New Technologies in Aquaculture: Improving Production Efficiency, Quality and Environmental Management (Woodhead Publishing Series in Food Science, Technology and Nutrition)

New technologies in aquaculture Related titles: Improving farmed fish quality and safety (ISBN 978-1-84569-299-5) Fis...

Author: Gavin Burnell | Geoff Allan

153 downloads 2297 Views 10MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form

DOWNLOAD PDF

New technologies in aquaculture

Related titles: Improving farmed fish quality and safety (ISBN 978-1-84569-299-5)

Fish farming enables greater control of product quality, but there have been concerns about the levels of contaminants found in farmed products. Their sensory and nutritional quality can also not equal that of wild-caught fish. This important collection reviews potential negative safety and quality issues in farmed fish and presents methods to improve product characteristics. The first part of the book discusses contaminants, such as persistent organic pollutants and veterinary drug residues and methods for their reduction and control. The second part addresses important quality issues, such as genetic control of flesh characteristics and the effects of feed on product nutritional and sensory quality. Improving seafood products for the consumer (ISBN 978-1-84569-019-9)

Consumer health and well-being may potentially be improved by consumption of health promoting, safe seafood products of high eating quality. This book provides a convenient review of significant findings in key areas of seafood research, with chapters authored by experts in the field. Consumer attitude to seafood products is first discussed, followed by chapters analysing important advances in the area of the health benefits of seafood, for example the relationship between omega-3 fatty acids and heart disease. Subsequent parts of the book discuss key topics in seafood safety, advances in processing technologies and methods to improve the quality of farmed fish. Shellfish safety and quality (ISBN 978-1-84569-152-3)

Shellfish are a very popular and nutritious food source worldwide and their consumption has risen dramatically. Because of their unique nature as compared to beef and poultry, shellfish have their own distinct aspects of harvest, processing and handling. Edited by leading authorities in the field, this collection reviews issues of current interest and outlines steps that can be taken by the shellfish industry to improve shellfish safety and eating quality. Opening chapters consider microbial, biotoxin, metal and organic contaminants of shellfish. Techniques to reduce contamination are then discussed, such as mitigation of the effects of harmful algal blooms. Chapters also address approaches to managing disease and other methods to improve quality, such as improved packaging methods and reduction of biofouling. Details of these books and a complete list of Woodhead’s titles can be obtained by: • visiting our web site at www.woodheadpublishing.com • contacting Customer Services (e-mail: [email protected]; fax: +44 (0) 1223 893694; tel.: +44 (0) 1223 891358 ext.130; address: Woodhead Publishing Limited, Abington Hall, Granta Park, Great Abington, Cambridge CB21 6AH, UK)

New technologies in aquaculture Improving production efficiency, quality and environmental management Edited by Gavin Burnell and Geoff Allan

Oxford

Cambridge

New Delhi

Published by Woodhead Publishing Limited, Abington Hall, Granta Park, Great Abington, Cambridge CB21 6AH, UK www.woodheadpublishing.com Woodhead Publishing India Private Limited, G-2, Vardaan House, 7/28 Ansari Road, Daryaganj, New Delhi – 110002, India Published in North America by CRC Press LLC, 6000 Broken Sound Parkway, NW, Suite 300, Boca Raton, FL 33487, USA First published 2009, Woodhead Publishing Limited and CRC Press LLC © Woodhead Publishing Limited, 2009, except Chapters 26 and 27 which are © The State of Queensland (through the Department of Primary Industries and Fisheries), 2009 The authors have asserted their moral rights. This book contains information obtained from authentic and highly regarded sources. Reprinted material is quoted with permission, and sources are indicated. Reasonable efforts have been made to publish reliable data and information, but the authors and the publishers cannot assume responsibility for the validity of all materials. Neither the authors nor the publishers, nor anyone else associated with this publication, shall be liable for any loss, damage or liability directly or indirectly caused or alleged to be caused by this book. Neither this book nor any part may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, microfilming and recording, or by any information storage or retrieval system, without permission in writing from Woodhead Publishing Limited. The consent of Woodhead Publishing Limited does not extend to copying for general distribution, for promotion, for creating new works, or for resale. Specific permission must be obtained in writing from Woodhead Publishing Limited for such copying. Trademark notice: Product or corporate names may be trademarks or registered trademarks, and are used only for identification and explanation, without intent to infringe. British Library Cataloguing in Publication Data A catalogue record for this book is available from the British Library. Library of Congress Cataloging in Publication Data A catalog record for this book is available from the Library of Congress. Woodhead Publishing ISBN 978-1-84569-384-8 (book) Woodhead Publishing ISBN 978-1-84569-647-4 (e-book) CRC Press ISBN 978-1-4398-0109-3 CRC Press order number: N10010 The publishers’ policy is to use permanent paper from mills that operate a sustainable forestry policy, and which has been manufactured from pulp which is processed using acid-free and elemental chlorine-free practices. Furthermore, the publishers ensure that the text paper and cover board used have met acceptable environmental accreditation standards. Typeset by SNP Best-set Typesetter Ltd., Hong Kong Printed by TJ International Limited, Padstow, Cornwall, UK

Contents

Contributor contact details......................................................................... xix Preface.......................................................................................................... xxix

Part I 1

2

Genetic improvement and reproduction ...................................

Genome-based technologies useful for aquaculture research and genetic improvement of aquaculture species .................................. Z. Liu, Auburn University, USA 1.1 Introduction.............................................................................. 1.2 DNA marker technologies ..................................................... 1.3 DNA sequencing technologies .............................................. 1.4 Gene discovery technologies ................................................. 1.5 Genome mapping technologies ............................................. 1.6 Genome expression analysis technologies ........................... 1.7 Acknowledgements ................................................................. 1.8 References ................................................................................ Genetic improvement of finfish ........................................................ G. Hulata, Agricultural Research Organization, Israel, and B. Ron, Israel Oceanographic & Limnological Research Ltd, Israel 2.1 Introduction: current status of aquaculture genetics ......... 2.2 Key drivers for genetic improvement of finfish .................. 2.3 Case studies – risks associated with selective breeding programs ...................................................................................

1

3 3 4 18 26 28 35 41 41 55

55 56 69

vi

Contents 2.4 2.5 2.6 2.7

3

4

5

6

Future trends ............................................................................ Sources of further information and advice .......................... Acknowledgement................................................................... References ................................................................................

Genetic variation and selective breeding in hatchery-propagated molluscan shellfish ........................................ P. Boudry, Ifremer, France 3.1 Introduction.............................................................................. 3.2 Monitoring genetic diversity and risks related to inbreeding ................................................................................. 3.3 Inheritance of traits important for aquaculture .................. 3.4 Current status of established molluscan shellfish breeding programs................................................................... 3.5 Present needs and future trends: use of marker assisted selection and genomics ........................................................... 3.6 References ................................................................................ Controlling fish reproduction in aquaculture ................................. C. Mylonas, Hellenic Center for Marine Research, Greece, and Y. Zohar, University of Maryland Biotechnology Institute, USA 4.1 Introduction.............................................................................. 4.2 The fish reproductive cycle and its control .......................... 4.3 Reproductive strategies and dysfunctions in captivity ....... 4.4 Hormonal therapies for the control of reproduction ......... 4.5 Induction of oocyte maturation and ovulation ................... 4.6 Induction of spermiation ........................................................ 4.7 Spontaneous spawning versus artificial insemination ........ 4.8 Future trends ............................................................................ 4.9 Sources of further information and advice .......................... 4.10 References ................................................................................ Producing sterile and single-sex populations of fish for aquaculture .......................................................................................... T. Benfey, University of New Brunswick, Canada 5.1 Introduction.............................................................................. 5.2 Sterile populations................................................................... 5.3 Single-sex populations ............................................................ 5.4 Future trends and further reading ........................................ 5.5 References ................................................................................ Chromosome set manipulation in shellfish ..................................... X. Guo, Y. Wang, Z. Xu, Rutgers University, USA, and H. Yang, Louisiana State University Agriculture Center, USA 6.1 Introduction..............................................................................

71 72 72 72 87 87 88 90 92 97 100 109

110 110 116 118 122 126 127 128 130 130 143 143 144 154 157 159 165

165

Contents 6.2 6.3 6.4 6.5 6.6 6.7 6.8

Part II 7

8

9

vii

Principles and methods of chromosome set manipulation ............................................................................ Triploid shellfish....................................................................... Tetraploid shellfish .................................................................. Gynogensis, androgenesis and aneuploids ........................... Summary and perspectives ..................................................... Acknowledgements ................................................................. References ................................................................................

166 174 183 187 187 188 188

Health ...........................................................................................

195

Advances in disease diagnosis, vaccine development and other emerging methods to control pathogens in aquaculture .......................................................................................... A. Adams, University of Stirling, UK 7.1 Introduction.............................................................................. 7.2 Key drivers to improve disease diagnosis and vaccine development ............................................................................. 7.3 Limitations of current diagnostic methods .......................... 7.4 Advances in methods of disease diagnosis (mainly for bacterial diseases) ............................................................. 7.5 Advances in vaccine development ........................................ 7.6 Other emerging methods to control pathogens .................. 7.7 Future trends ............................................................................ 7.8 Sources of further information and advice .......................... 7.9 References ................................................................................ Controlling parasitic diseases in aquaculture: new developments .............................................................................. C. Sommerville, University of Stirling, UK 8.1 Introduction.............................................................................. 8.2 Effects of parasitic disease in aquaculture........................... 8.3 Advances in the understanding of parasite biology and host–parasite interactions ............................................... 8.4 Advances in methods of identifying parasites..................... 8.5 Advances in methods of controlling parasites .................... 8.6 Future trends ............................................................................ 8.7 References ................................................................................ Controlling viral diseases in aquaculture: new developments...... T. Renault, Ifremer, France 9.1 Introduction.............................................................................. 9.2 Overview of viral diseases in aquaculture ........................... 9.3 Limitation of current management techniques ...................

197 197 198 198 199 203 207 208 209 211

215 215 216 218 220 221 237 237 244 244 245 248

viii

Contents 9.4 9.5 9.6

10

Diet and husbandry techniques to improve disease resistance: new technologies and prospects .................................... F. J. Gatesoupe, INRA-Ifremer, France 10.1 Introduction.............................................................................. 10.2 Fighting the pathogens............................................................ 10.3 Improving welfare ................................................................... 10.4 Improving feed......................................................................... 10.5 Concluding remarks ................................................................ 10.6 Sources of further information and advice .......................... 10.7 References ................................................................................

Part III 11

12

Advances in understanding of immunity of aquacultured species to viral diseases .................................. New methods to control viral diseases in aquaculture and future trends ..................................................................... References ................................................................................

249 254 259

267 267 268 273 276 289 290 291

Diet and husbandry ..................................................................

313

Fish larvae nutrition and diet: new developments ......................... S. Kolkovski, Dept of Fisheries, Australia, J. Lazo, Fish Nutrition Laboratory, Mexico, D. Leclercq, ACUI-T, France, and M. Izquierdo, Grupo de Investigación en Acuicultura, Spain 11.1 Introduction.............................................................................. 11.2 Determination of nutritional requirements of larvae ........ 11.3 Nutritional requirements of fish larvae ................................ 11.4 Feed identification and ingestion .......................................... 11.5 Ontogeny of digestive capacity in marine fish larvae .................................................................................. 11.6 Digestive system capacity ....................................................... 11.7 Diet manufacturing methods ................................................. 11.8 Microdiet characteristics......................................................... 11.9 Feeding system ......................................................................... 11.10 Dosage system ......................................................................... 11.11 Future directions ..................................................................... 11.12 References ................................................................................

315

Aquaculture feeds and ingredients: an overview ........................... R. Hardy, University of Idaho, USA 12.1 Introduction.............................................................................. 12.2 Sustainability of feed ingredients .......................................... 12.3 Safety of farmed fish products from harmful residues and pollutants...........................................................................

315 319 322 332 336 343 346 349 354 355 359 360 370 370 371 374

Contents 12.4

12.5 12.6 12.7 12.8

13

14

15

Categories of environmental pollutants and residues comprising risks to the safety of farmed fish products .................................................................................... Alternate protein and lipid sources ...................................... Future trends ............................................................................ Sources of further information and advice .......................... References ................................................................................

Ingredient evaluation in aquaculture: digestibility, utilisation and other key nutritional parameters ........................... B. Glencross, CSIRO Marine and Atmospheric Research, Australia 13.1 Introduction.............................................................................. 13.2 Characterisation and preparation of ingredients ................ 13.3 Defining ingredient digestibility ............................................ 13.4 Ingredient palatability............................................................. 13.5 Defining effects on growth and utilisation........................... 13.6 Ingredient functionality and feed technical qualities ......... 13.7 Frontier technologies for ingredient evaluation.................. 13.8 References ................................................................................

Quantifying nutritional requirements in aquaculture: the factorial approach ........................................................................ I. Lupatsch, Swansea University, UK 14.1 Introduction.............................................................................. 14.2 Quantification of nutritional requirements .......................... 14.3 Feed ingredient evaluation..................................................... 14.4 Feed formulation and feeding strategies .............................. 14.5 Future trends ............................................................................ 14.6 References ................................................................................

Advances in aquaculture nutrition: catfish, tilapia and carp nutrition ...................................................................................... D. Davis, Auburn University, USA, T. Nguyen, Nong Lam University, Vietnam, M. Li, National Warmwater Aquaculture Center, USA, D. M. Gatilin III, Department of Wildlife and Fisheries Sciences, USA, and T. O’Keefe, Aqua-Food Technologies, Inc., USA 15.1 Introduction.............................................................................. 15.2 Nutrient requirements ............................................................ 15.3 Sources of further information and advice .......................... 15.4 References ................................................................................

ix

375 378 383 383 384

387

388 390 393 399 402 408 408 410

417 417 419 431 433 437 438

440

440 443 456 456

x 16

17

18

19

Contents Advances in aquaculture feeds and feeding: basses and breams .... M. Booth, New South Wales Department of Primary Industries, Australia 16.1 Introduction.............................................................................. 16.2 Asian seabass ........................................................................... 16.3 Red sea bream and gilthead sea bream ............................... 16.4 Grouper .................................................................................... 16.5 Future trends ............................................................................ 16.6 References ................................................................................

459

Advances in aquaculture feeds and feeding: salmonids ................ S. Refstie, Nofima Marin and Aquaculture Protein Centre (APC), Norway, and T. Åsgård, Nofima Marin, Norway 17.1 Introduction.............................................................................. 17.2 Feed technology and formulation ......................................... 17.3 Digestive physiology ............................................................... 17.4 Nutritional requirements ........................................................ 17.5 Nutrition and health................................................................ 17.6 Dietary additives ..................................................................... 17.7 Species differences .................................................................. 17.8 Practical formulations ............................................................. 17.9 Feeding and feeding systems ................................................. 17.10 Future trends ............................................................................ 17.11 References ................................................................................

498

Monitoring viral contamination in shellfish growing areas ...................................................................................... F. S. Le Guyader and M. Pommepuy, Ifremer, France, and R. L. Atmar, Baylor College of Medicine, USA 18.1 Introduction.............................................................................. 18.2 Source of pollution .................................................................. 18.3 Methods .................................................................................... 18.4 Input and flux ........................................................................... 18.5 Strategies for reducing contamination ................................. 18.6 Other issues .............................................................................. 18.7 Future trends ............................................................................ 18.8 References ................................................................................ Impacts of harmful algal bloom on shellfisheries aquaculture .......................................................................................... Y. Matsuyama, National Research Institute of Fisheries and Environment of Inland Sea, Japan, and S. Shumway, University of Connecticut, USA 19.1 Introduction.............................................................................. 19.2 Global increase of harmful algal blooms (HAB) ...............

459 461 466 476 483 484

498 500 501 506 507 511 514 515 517 518 522

542

542 544 550 553 562 565 568 569

580

580 581

Contents 19.3 19.4 19.5 19.6 19.7 20

Advances in microalgal culture for aquaculture feed and other uses ............................................................................................. M. R. Tredici, N. Biondi, E. Ponis, L. Rodolfi, Università degli Studi di Firenze, Italy, and G. Chini Zittelli, Istituto per lo Studio degli Ecosistemi, Italy 20.1 Introduction.............................................................................. 20.2 Current status and new techniques for microalgae culture ....................................................................................... 20.3 Microalgae for aquaculture feed ........................................... 20.4 Microalgae as dietary supplements, animal feed and nutraceuticals ........................................................................... 20.5 Microalgae as source of pharmaceuticals and probiotics .................................................................................. 20.6 Wastewater reclamation and biofuel production by algae–bacteria consortia ......................................................... 20.7 Future trends ............................................................................ 20.8 Sources of further information and advice .......................... 20.9 References ................................................................................

Part IV 21

Impact of harmful algal bloom species on shellfisheries industries ........................................................... Prevention of harmful algal bloom threats .......................... Conclusions .............................................................................. Acknowledgements ................................................................. References ................................................................................

Environmental issues ................................................................

Predicting and assessing the environmental impact of aquaculture .......................................................................................... C. Crawford and C. MacLeod, University of Tasmania, Australia 21.1 Introduction.............................................................................. 21.2 Interactions between aquaculture and the environment ............................................................................. 21.3 Site selection and carrying capacity ...................................... 21.4 Considerations in developing an environmental monitoring and assessment program .................................... 21.5 Monitoring and assessment techniques ................................ 21.6 Recent technological advances and future trends .............. 21.7 Sources of further information and advice .......................... 21.8 References ................................................................................

xi

587 595 601 601 602

610

610 611 621 635 643 653 657 658 659

677

679

679 681 684 686 690 696 699 700

xii

Contents

22

Spatial decision support in aquaculture: the role of geographical information systems and remote sensing ................. L. G. Ross, N. Handisyde, D.-C. Nimmo, University of Stirling, Scotland 22.1 The spatial planning context .................................................. 22.2 Database construction and project methodology ............... 22.3 Decision support systems and tools ...................................... 22.4 Selected applications and examples of geographical information systems in aquaculture............... 22.5 Case study: climate change .................................................... 22.6 Case study: multi-site coastal zone planning ....................... 22.7 Summary and future trends ................................................... 22.8 Acknowledgements ................................................................. 22.9 References ................................................................................

23

Zooremediation of contaminated aquatic systems through aquaculture initiatives ........................................................................ S. Gifford, G. R. MacFarlane, C. E. Koller, R. H. Dunstan, The University of Newcastle, Australia, and W. O’Connor, NSW Department of Primary Industries, Australia 23.1 Introduction.............................................................................. 23.2 Zooremediation of pollutants ................................................ 23.3 Zooremediation and pearl aquaculture: a case study .............................................................................. 23.4 Future trends ............................................................................ 23.5 Sources of further information and advice .......................... 23.6 References ................................................................................

Part V 24

Farming new species ...................................................................

Farming cod and halibut: biological and technological advances in two emerging cold-water marine finfish aquaculture species ............................................................................ V. Puvanendran and A. Mortensen, Nofima Marin, Norway 24.1 Introduction.............................................................................. 24.2 Atlantic cod .............................................................................. 24.3 Atlantic halibut ........................................................................ 24.4 Future trends ............................................................................ 24.5 Sources of further information and advice .......................... 24.6 Acknowledgements ................................................................. 24.7 References ................................................................................

707

707 711 718 720 726 739 745 746 747

750

750 751 758 761 764 764

769

771 772 774 789 794 797 798 798

25

26

27

28

Contents

xiii

Cobia cultivation................................................................................. E. McLean, Ministry of Fisheries Wealth, Sultanate of Oman, G. Salze, Virginia-Maryland Regional College of Veterinary Medicine, USA, M. H. Schwarz, Virginia Seafood AREC, USA, and S. R. Craig, Virginia Cobia Farms LLC, USA 25.1 Introduction.............................................................................. 25.2 Broodstock and spawning ...................................................... 25.3 Larval rearing........................................................................... 25.4 Juveniles and on-growing ....................................................... 25.5 Emerging issues and future trends........................................ 25.6 References ................................................................................

804

804 805 807 812 816 818

Advances in the culture of lobsters ................................................. C. M. Jones, Northern Fisheries Centre, Australia 26.1 Introduction.............................................................................. 26.2 Current situation and constraints .......................................... 26.3 Advances in culture ................................................................ 26.4 Production systems .................................................................. 26.5 Product issues: markets........................................................... 26.6 Future trends ............................................................................ 26.7 Sources of further information and advice .......................... 26.8 References ................................................................................

822

Advances in the culture of crabs ...................................................... B. D. Paterson, Queensland Department of Primary Industries and Fisheries, Australia 27.1 Introduction.............................................................................. 27.2 Current situation ..................................................................... 27.3 Product issues........................................................................... 27.4 Production systems .................................................................. 27.5 Future trends ............................................................................ 27.6 Sources of further information and advice .......................... 27.7 References ................................................................................

845

Aquaculture and the production of pharmaceuticals and nutraceuticals ...................................................................................... K. Benkendorff, Flinders University of South Australia, Australia 28.1 Introduction.............................................................................. 28.2 Marine pharmaceuticals ......................................................... 28.3 Marine nutraceuticals ............................................................. 28.4 Diversifying the aquaculture industry .................................. 28.5 Current case studies ................................................................

822 823 827 832 835 835 836 836

845 848 848 851 859 860 860

866

866 870 872 874 875

xiv

Contents 28.6 28.7 28.8 28.9

Steps towards commercialisation .......................................... Future trends ............................................................................ Acknowledgements ................................................................. References ................................................................................

884 886 887 887

Part VI Aquaculture systems design .....................................................

893

29

895

30

31

Opportunities and challenges for off-shore farming ..................... R. Langan, University of New Hampshire, USA 29.1 The context for off-shore farming ......................................... 29.2 Characterization and selection of off-shore sites ................ 29.3 Finfish species cultivated in off-shore cages ........................ 29.4 Off-shore mollusc culture ....................................................... 29.5 Environmental concerns ......................................................... 29.6 Future trends ............................................................................ 29.7 References ................................................................................ Advances in technology for off-shore and open ocean aquaculture .......................................................................................... A. Fredheim, SINTEF Fisheries and Aquaculture, Norway, and R. Langan, University of New Hampshire, USA 30.1 Introduction: historical development of fish farming technology ................................................................................ 30.2 Floating fish farm design ........................................................ 30.3 Current status and technical limitations............................... 30.4 Novel fish farm systems .......................................................... 30.5 Supporting technologies for off-shore and open ocean fish farming ............................................................................... 30.6 Sources of further information and advice .......................... 30.7 References ................................................................................ Advances in technology and practice for land-based aquaculture systems: tank-based recirculating systems for finfish production ................................................................................ T. Losordo, D. DeLong and T. Guerdat, North Carolina State University, USA 31.1 Introduction.............................................................................. 31.2 Components in recirculating systems design ....................... 31.3 Types of particulate waste solids ........................................... 31.4 Tank, water input manifolds, and drain design.................... 31.5 Settleable solids capture components................................... 31.6 Suspended solids capture components ................................. 31.7 Biological filtration .................................................................. 31.8 Oxygenation components and processes .............................

895 897 899 901 904 909 910

914

914 918 924 930 941 942 942

945

945 947 948 948 955 957 962 970

Contents 31.9 Sterilization components and processes ............................... 31.10 Comparing freshwater and marine systems design ............ 31.11 An example of a modern approach to a complete systems design .......................................................................... 31.12 References ................................................................................ 32

33

34

Advances in technology and practice for land-based aquaculture systems: ponds for finfish production......................... C. E. Boyd, Auburn University, USA, and S. Chainark, Phuket Rajabhat University, Thailand 32.1 Introduction.............................................................................. 32.2 Hydrologic types of ponds ..................................................... 32.3 Production methodology ........................................................ 32.4 Liming and fertilization .......................................................... 32.5 Feeds and feed management ................................................. 32.6 Dissolved oxygen management ............................................. 32.7 Pond amendments ................................................................... 32.8 Pond bottom treatments ......................................................... 32.9 Water quality monitoring ....................................................... 32.10 Pond effluents........................................................................... 32.11 Future trends ............................................................................ 32.12 References ................................................................................ Superintensive bio-floc production technologies for marine shrimp Litopenaeus vannamei: technical challenges and opportunities ............................................................ C. L. Browdy, J. A. Venero, A. D. Stokes and J. Leffler, Marine Resources Research Institute, USA 33.1 Introduction.............................................................................. 33.2 Superintensive bio-floc-based shrimp production systems .... 33.3 Components of superintensive bio-floc-based shrimp production systems .................................................................. 33.4 Current research priorities ..................................................... 33.5 Conclusions .............................................................................. 33.6 Acknowledgements ................................................................. 33.7 References ................................................................................ Traditional Asian aquaculture .......................................................... P. Edwards, Asian Institute of Technology, Thailand 34.1 Introduction.............................................................................. 34.2 Definitions and principles ...................................................... 34.3 Traditional aquaculture systems ............................................ 34.4 Recent changes to traditional practice ................................. 34.5 Research and development for improved traditional practice ......................................................................................

xv 973 975 977 979

984

984 985 988 989 992 994 997 1002 1003 1004 1006 1006

1010

1010 1011 1013 1017 1024 1025 1026 1029 1029 1030 1034 1037 1041

xvi

Contents 34.6 34.7 34.8 34.9 34.10

35

36

37

Recent development of semi-intensive aquaculture........... Bridging traditional and modern practice............................ Future trends ............................................................................ Sources of further information and advice .......................... References ................................................................................

1047 1050 1054 1056 1056

Use of information technology in aquaculture .............................. J. Bostock, University of Stirling, UK 35.1 Introduction.............................................................................. 35.2 Information and communications technology (ICT) for productivity and effectiveness ......................................... 35.3 ICT for quality and customer service ................................... 35.4 ICT in aquaculture innovation and learning ....................... 35.5 Conclusions .............................................................................. 35.6 Acknowledgements ................................................................. 35.7 Sources of further information and advice .......................... 35.8 References ................................................................................

1064

Inland saline aquaculture .................................................................. G. L. Allan and D. S. Fielder, New South Wales Department of Primary Industries, Australia, K. M. Fitzsimmons, University of Arizona, USA, S. L. Applebaum, Jacob Blaustein Institute for Desert Research BGU, Israel, and S. Raizada, Central Institute of Fisheries Education Rohtak Centre (ICAR), India 36.1 Introduction.............................................................................. 36.2 Saline groundwater from interception schemes to protect agriculture ................................................................... 36.3 Coal bed methane waste water ............................................. 36.4 Chemistry and remediation.................................................... 36.5 Case studies .............................................................................. 36.6 Future trends ............................................................................ 36.7 References ................................................................................

1119

Urban aquaculture: using New York as a model ........................... M. P. Schreibman and C. Zarnoch, City University of New York, USA 37.1 Introduction.............................................................................. 37.2 Goals ......................................................................................... 37.3 Technology................................................................................ 37.4 Potential urban aquaculture programs ................................. 37.5 The economics: siting, processing, and marketing for economic success ............................................................... 37.6 Marketing and competition.................................................... 37.7 The role of the university .......................................................

1148

1064 1067 1088 1098 1104 1105 1105 1116

1119 1121 1123 1126 1128 1144 1145

1148 1151 1152 1153 1157 1158 1159

Contents

xvii

37.8 Future trends ............................................................................ 1159 37.9 Acknowledgements ................................................................. 1161 37.10 References ................................................................................ 1161

Index ............................................................................................................. 1163

Contributor contact details

(* = main contact)

Chapter 1

Editors

Zhanjiang Liu The Fish Molecular Genetics and Biotechnology Laboratory Department of Fisheries and Allied Aquacultures and Program of Cell and Molecular Biosciences Aquatic Genomics Unit Auburn University Auburn AL 36849 USA

Gavin Burnell Director Aquaculture and Fisheries Development Centre University College Cork Cork Ireland E-mail: [email protected] Geoff L. Allan Port Stephens Fisheries Institute New South Wales Department of Primary Industries Locked Bag 1 Nelson Bay NSW 2315 Australia E-mail: [email protected]. gov.au

E-mail: [email protected]

Chapter 2 Gideon Hulata* Head, Institute of Animal Science Agricultural Research Organization The Volcani Center PO Box 6, Bet Dagan 50250 Israel E-mail: [email protected]

xx


Tetsuzan (Benny) Ron Aquaculture Program Coordinator Office of the Vice Chancellor for Research and Graduate Education University of Hawaii at Manoa 1960 East-West Road Biomed T-701A Honolulu HI 96822 Hawaii

Chapter 5


Chapter 6

Chapter 3 Pierre Boudry Ifremer – UMR M100 Physiologie et Ecophysiologie des Mollusques Marins 29280 Plouzané France E-mail: [email protected]

Tillmann J. Benfey Department of Biology University of New Brunswick PO Box 4400 Fredericton New Brunswick E3B 5A3 Canada E-mail: [email protected]

Ximing Guo,* Yongping Wang, Zhe Xu Haskin Shellfish Research Laboratory Institute of Marine and Coastal Sciences Rutgers University 6959 Miller Avenue Port Norris NJ 08349 USA

Chapter 4


Constantinos C. Mylonas* Institute of Aquaculture Hellenic Center for Marine Research PO Box 2214 Heraklion 71003 Crete Greece

Huiping Yang Aquaculture Research Station Louisiana State University Agriculture Center 2410 Ben Hur Road Baton Rouge LA 70820 USA

E-mail: [email protected] Yonathan Zohar Center of Marine Biotechnology University of Maryland Biotechnology Institute 701 E. Pratt Baltimore MD 21202 USA E-mail: [email protected]

Chapter 7 Alexandra Adams Institute of Aquaculture University of Stirling Stirling FK9 4LA Scotland UK E-mail: [email protected]


Chapter 8 Christina Sommerville Institute of Aquaculture University of Stirling Stirling FK9 4LA Scotland UK E-mail: [email protected]

Juan Pablo Lazo Fish Nutrition Laboratory Centro de Investigación Científica y de Educación Superior de Ensenada BC Organismo Descentralizado de Interés Público Km. 107 Carr. Tijuana-Ensenada Mexico

Chapter 9


T. Renault Ifremer Laboratoire de Génétique et Pathologie 17390 La Tremblade France

Didier Leclercq ACUI-T 129 Bd St Aignan 44100 Nantes France


Chapter 10 F. J. Gatesoupe INRA-Ifremer UMR1067 Nutrition Aquaculture et Génomique BP 70 F-29280 Plouzané France

E-mail: [email protected] Marisol Izquierdo Grupo de Investigación en Acuicultura ULPGC & ICCM PO Box 56 35200 Telde Las Palmas de Gran Canaria Spain E-mail: [email protected]


Chapter 12 Chapter 11 Sagiv Kolkovski* Department of Fisheries Western Australia PO Box 20 North Beach WA 6920 Australia E-mail: [email protected]. gov.au

xxi

Ronald W. Hardy Director Aquaculture Research Institute University of Idaho 3059F National Fish Hatchery Road Hagerman ID 83332 USA E-mail: [email protected]

xxii


Chapter 13 Brett D. Glencross CSIRO Marine and Atmospheric Research PO Box 120 Cleveland QLD 4163 Australia E-mail: [email protected]

Chapter 14 Ingrid Lupatsch Centre for Sustainable Aquaculture Research Swansea University Singleton Park Swansea SA2 8PP UK E-mail: [email protected]

Chapter 15 Donald Allen Davis* Department of Fisheries and Allied Aquacultures Auburn University 203 Swingle Hall Auburn AL 36849-5419 USA E-mail: [email protected] Tri N. Nguyen Faculty of Fisheries Nong Lam University Thu Duc District Ho Chi Minh City Vietnam E-mail: [email protected]

Menghe Li National Warmwater Aquaculture Center 127 Experiment Station Road PO Box 197 Stoneville MS 38776-0197 USA E-mail: [email protected] Delbert M. Gatlin III Department of Wildlife and Fisheries Sciences 216 Heep Laboratory Building 2258 TAMUS College Station TX 77843-2258 USA E-mail: [email protected] Tim O’Keefe Aqua-Food Technologies, Inc. 3192 Matecumbe Key Road Punta Gorda FL 33955 USA

Chapter 16 Mark Booth New South Wales Department of Primary Industries Port Stephens Fisheries Institute Taylors Beach NSW 2316 Australia E-mail: [email protected]. au


xxiii

Chapter 17

Chapter 19

S. Refstie* and T. Åsgård Nofima Marin NO-6600 Sunndalsøra Norway

Yukihiko Matsuyama* Harmful Algal Bloom Division National Research Institute of Fisheries and Environment of Inland Sea Maruishi Hatsukaichi Hiroshima 7390452 Japan

S. Refstie Aquaculture Protein Centre (APC), CoE Norway E-mail: [email protected] [email protected]

Chapter 18 Françoise S. Le Guyader* Laboratoire de Microbiologie Ifremer BP 21105 44311 Nantes cedex 03 France

E-mail: [email protected] Sandra E. Shumway Department of Marine Sciences University of Connecticut 1080 Shennecossett Road Groton CT 06340 USA E-mail: sandra.shumway@uconn. edu

E-mail: [email protected] Monique Pommepuy Laboratoire de Microbiologie Ifremer BP 70 29280 Plouzané France E-mail: [email protected] Robert L. Atmar Departments of Medicine and Molecular Virology & Microbiology Baylor College of Medicine 1 Baylor Plaza MS BCM280 Houston TX 77030 USA E-mail: [email protected]

Chapter 20 Mario R. Tredici,* Natascia Biondi, Emanuele Ponis, Liliana Rodolfi Dipartimento di Biotecnologie Agrarie Università degli Studi di Firenze Piazzale delle Cascine 24 50144 Firenze Italy E-mail: [email protected] Graziella Chini Zittelli Istituto per lo Studio degli Ecosistemi CNR Via Madonna del Piano 10 50019 Sesto Fiorentino Firenze Italy

xxiv


Chapter 21 Christine Crawford* and Catriona MacLeod Tasmanian Aquaculture and Fisheries Institute University of Tasmania Nubeena Crescent Taroona Tasmania 7053 Australia E-mail: Christine.Crawford@utas. edu.au [email protected]

Chapter 22 Lindsay G Ross,* Neil Handisyde, Donna-Claire Nimmo Institute of Aquaculture University of Stirling Stirling FK9 4LA Scotland UK E-mail: [email protected]

Chapter 23 Scott Gifford, Geoff R. MacFarlane, Claudia E. Koller and R. Hugh Dunstan* School of Environmental and Life Sciences The University of Newcastle Callaghan NSW 2308 Australia E-mail: Hugh.Dunstan@newcastle. edu.au

Wayne O’Connor NSW Department of Primary Industries Port Stephens Fisheries Centre Private Bag 1 Nelson Bay NSW 2315 Australia E-mail: wayne.o’[email protected]. gov.au

Chapter 24 Velmurugu Puvanendran* and Atle Mortensen Nofima Marin Muninbakken 9-13 9291 Tromsø Norway E-mail: Velmurugu.puvanendran@ nofima.no [email protected]

Chapter 25 Ewen McLean* Ministry of Fisheries Wealth Marine Science and Fisheries Center PO Box 427 PC 100 Muscat Sultanate of Oman E-mail: [email protected] Guillaume Salze Virginia-Maryland Regional College of Veterinary Medicine Duck Pond Drive Blacksburg VA 24061-0442 USA

Contributor contact details Michael H. Schwarz Virginia Seafood AREC 102 S. King St Hampton VA 23669 USA Steven R. Craig Virginia Cobia Farms LLC 108 Battleground Road Saltville VA 24370 USA E-mail: [email protected]

Chapter 26 Clive M. Jones Department of Primary Industries and Fisheries Queensland Northern Fisheries Centre PO Box 5396 Cairns QLD 4870 Australia

xxv

Chapter 28 Kirsten Benkendorff School of Biological Sciences Flinders University of South Australia GPO Box 2100 Adelaide SA 5001 Australia E-mail: Kirsten.benkendorff@ flinders.edu.au

Chapter 29 Richard Langan Atlantic Marine Aquaculture Center University of New Hampshire Gregg Hall, Suite 130 35 Colovos Road Durham NH 03824 USA E-mail: [email protected]


Chapter 30 Chapter 27 Brian D. Paterson Bribie Island Aquaculture Research Centre Queensland Department of Primary Industries and Fisheries PO Box 2066 Woorim Bribie Island 4507 Australia E-mail: [email protected]. gov.au

Arne Fredheim* SINTEF Fisheries and Aquaculture Aquaculture Technology 7465 Trondheim Norway E-mail: [email protected]

xxvi


Richard Langan Atlantic Marine Aquaculture Center University of New Hampshire Gregg Hall, Suite 130 35 Colovos Road Durham NH 03824 USA E-mail: [email protected]

Chapter 31 Thomas M. Losordo, PhD,* Dennis P. DeLong, MSM, and Todd C. Guerdat, MS Department of Biological and Agricultural Engineering Campus Box 7625 North Carolina State University Raleigh NC 27695 USA

Chapter 33 Craig L. Browdy* Novus International 5 Tomotley Court Charleston South Carolina 29407 USA E-mail: craig.browdy@novusint. com Jesus A. Venero, Alvin D. Stokes and John W. Leffer Waddell Mariculture Center Marine Resources Research Institute South Carolina Department of Natural Resources 217 Ft Johnson Road Charleston South Carolina 29407 USA


Chapter 34

Chapter 32

Peter Edwards 593 Lat Prao Soi 64 Bangkok Thailand 10310

Claude E. Boyd* Department of Fisheries and Allied Aquacultures Auburn University AL 36849 USA E-mail: [email protected] Suwanit Chainark Phuket Rajabhat University Faculty of Fisheries Technology 21 Tepknasatree Road Amphor Muang Phuket Province 83000 Thailand E-mail: [email protected]


Chapter 35 John Bostock Senior Consultant Institute of Aquaculture University of Stirling Stirling FK9 4LA Scotland UK E-mail: [email protected]


Chapter 36 Geoff L. Allan* and D. Stewart Fielder Port Stephens Fisheries Institute New South Wales Department of Primary Industries Locked Bag 1 Nelson Bay NSW 2315 Australia E-mail: [email protected] Kevin M. Fitzsimmons Department of Soil, Water and Environmental Science University of Arizona 2601 E. Airport Drive Tucson AZ 85706 USA Samuel L. Applebaum Albert Katz Department of Dryland Biotechnologies The Bengis Center for Desert Aquaculture Jacob Blaustein Institute for Desert Research BGU Sede Boqer Campus Midreshet Ben-Gurion 84990 Israel

xxvii

Sudhir Raizada Central Institute of Fisheries Education Rohtak Centre (ICAR) Lahli Via Anwal Rohtak – 124 411 Haryana India

Chapter 37 M.P. Schreibman* Aquatic Research and Environmental Assessment Center (AREAC) Brooklyn College City University of New York 2900 Bedford Avenue Brooklyn New York NY 11210 USA E-mail: [email protected]. edu C.B. Zarnoch Baruch College City University of New York One Bernard Baruch Way Department of Natural Science 17 Lexington Avenue, Box A-0506 New York NY 10010 USA

Preface

Global aquaculture remains the fastest growing food industry with growth since 1970 of 8.8 % per annum.1 This growth compares with 1.2 % and 2.8 % for capture fisheries and terrestrial farmed meat production, respectively.1 Total global aquaculture production reached 59.4 million tonnes in 2004, worth an estimated US$ 70.3 billion, including 46 million tonnes of aquaculture product consumed for food. Global demand for seafood has continued to rise, fuelled by global population growth and an increase in per capita consumption due to increasing protein consumption in many developing countries and an increase in relative preference for seafood protein in many developed countries. Global population was estimated at 6.72 billion in November 2008 and, while growth has halved from the peak in around 1963, it is predicted to reach 9 billion by 2040.2 Seafood consumption has increased to 16.6 kg/person/y, the highest on record.1 To cater for global demands in 2020, an estimated 70 million tonnes of seafood will be required from aquaculture.1 Past production increases have come from new industries, new areas for production and intensification of production, mainly in developing countries. Since the early practice of capturing and holding animals, aquaculture has become much more sophisticated with most animals being bred in purpose-built hatcheries, cultured in ponds, cages or tanks, often with some control over the environment, harvested for a specific market and often processed to add value to the product. The massive production increase

1

FAO (2007) The State of World Fisheries and Aquaculture 2006, Rome, Food and Agriculture Organization of the United Nations. 2 http://www.census.gov/ipc/www/idb/worldpopinfo.html

xxx

Preface

(from approximately 1 million tonnes in the 1950s to 59.4 million tonnes in 2004) arose from increases in the area under culture and the number of species cultured and from a shift in the reliance on natural feeds to the greater use of formulated feeds that increasingly met the species’ nutritional requirements. Improvements in other aspects of husbandry, such as health management, and better technology, such as cage and tank systems, also contributed. New technology is now needed to boost production, protect fragile environments and supply the highest quality product. The easy gains in production increase have now mostly been made and that to increase production in the next decade and a half to 70 million tonnes or beyond will require a major new improvement in technology. This is the subject of this book, Aquaculture: New Technologies. We have divided the contents of this book into six parts and selected international experts to contribute individual chapters. The first four parts deal with developments in new technologies for genetic improvement and reproduction, health, diet and husbandry and aquaculture system design. Aquaculture has lagged behind agriculture in applying genetic improvement techniques, but this is a rapidly changing field. We present chapters that detail advances in genetic improvement for finfish, shrimp and molluscs, controlling reproduction and gender, and sterility and genomics. Stress and disease accompany intensive animal production for all species, and managing health is a fundamental requirement for all aquaculture producers. We are regularly discovering new diseases for aquatic animals but, fortunately, we are also developing new treatments and therapies. In the Health part, advances in diagnosis, vaccine development and new methods to control viruses, parasites and other pathogens are presented. The major operating cost for all aquaculture species that are fed is diets and feeding costs. In the Diet and Husbandry part of the book, we have selected chapters that document advances in larval marine fish nutrition, challenges and opportunities with selection of dietary ingredients, bioenergetic modelling to estimate nutritional requirements and specific advances in nutritional science for salmonids; catfish, carps and tilapia; and seabasses and breams. There is also a chapter on microalgal culture – used as a feed for molluscs and other organisms and as a product for human and animal nutrition, in cosmetics and pharmaceutics, and for environmental applications. This part also has a chapter on the impact of harmful algal blooms on shellfish aquaculture. In the fourth part of the book, chapters describing the latest technology for off-shore and open ocean aquaculture, tank-based recirculating systems, land-based finfish and shrimp pond culture systems are presented. Chapters on inland saline aquaculture, urban aquaculture and traditional Asian aquaculture are also included. To conclude this section of the book we have included a chapter on the use of information technology in aquaculture.

Preface

xxxi

The final two parts of the book look at environmental issues and new species for aquaculture. Sustainability can be interpreted in many ways but, whatever your definition, there is universal agreement that all human activities should have a minimal impact on the environment. Therefore in the environmental part of the book, chapters are included on prediction and assessments of environmental impacts, advances in effluent treatment, reducing the impacts of escapees, the role of geographical information systems (GIS) in aquaculture and aquaculture for zooremediation. The new species part examines the latest developments for high-value species including cod, halibut and wolfish; cobia; lobsters; and the aquaculture of pharmaceuticals and nutraceuticals. Several figures from the book have additionally been included as colour plates in an eight-page section which appears between pages 576 and 577. An analysis of past advances in aquaculture gives optimism for the future. While the challenges are great, the adoption of new technology will facilitate rapid future increases in production. The potential of genetic improvement is still largely untapped, new health management strategies will reduce production costs and, while there are considerable constraints with the supply of feed ingredients, advances in our understanding of nutritional requirements will improve feed efficiency. New production systems will also allow production to increase and take production closer to the market for high-value species. The world is facing increasing challenges with food security, and aquatic protein will continue to play a major role in both the developing and developed world. Aquaculture is critical for the future supply of seafood and other aquatic products. Gavin Burnell and Geoff Allan

1 Genome-based technologies useful for aquaculture research and genetic improvement of aquaculture species Z. Liu, Auburn University, USA

Abstract: In spite of the relatively late start of aquaculture genome research, significant progress has been made in aquaculture genomics. Many of the genomic resources, tools, and technology developed from genomics have wide applications for aquaculture research and genetic improvements of aquaculture species. The major genome technologies include DNA marker technologies, novel sequencing technologies, gene discovery technologies, genome mapping technologies, and technologies for analysis of genome expression. This chapter was written to provide basic information such as theories behind the technologies, principles of the technologies, and potential applications of each of these genome technologies relevant to aquaculture. In some cases, research and technology development trends are discussed such that the readers are aware of the direction of future research. For instance, single nucleotide polymorphisms (SNP) are clearly the markers of choice in the future even though microsatellites are currently the predominant type of markers in aquaculture research and applications; the next generation of sequencing technologies will not only play a dominant role in sequencing, but also may replace the traditional genome expression analysis technologies such as microarrays. Key words: genome, amplified fragment length polymorphism (AFLP), microsatellites, single nucleotide polymorphisms (SNP), marker, quantitative trait loci (QTL), expressed sequence tag (EST), next generation sequencing technology, microarray, linkage mapping, radiation hybrid, comparative mapping, sequence tag.

1.1 Introduction Aquaculture, like animal husbandry, has a long history dating back some 3000 years when the Chinese began culturing carp. However, whereas genetic selection of animal livestock has been conducted for thousands of years, until very recently, most cultured aquatic animals were essentially

4


wild. For thousands of years, aquaculture was limited to the harvesting of immature fish or shellfish and transferring them to an artificially created environment favorable to their growth. In spite of much earlier aquaculture practices in China, the documented artificial production of aquaculture seed was first introduced in 1733 when a German farmer successfully gathered fish eggs, fertilized them, and raised the fish that hatched. Initially this kind of aquaculture was limited to freshwater fish. In the 20th century, new techniques were developed to successfully breed saltwater species. Most brood stocks used in aquaculture were not genetically selected until the late 20th century. Since around the 1970s, major progress has been made in the genetic enhancement programs of many aquaculture species by using traditional selective breeding techniques, and it is only since the late 1990s that large-scale genome research of aquaculture species started to take off. Genomics, as a new field, has its own technologies and requires new sets of resources. To clarify the term used in the title of this chapter, genomebased technologies; this term is used to include technologies required to conduct genome research and technologies derived as a result of genome research for genetic improvement programs in aquaculture. As such, this chapter will include DNA marker technologies, sequencing technologies, genome mapping technologies, gene discovery technologies, and genome expression analysis technologies. This chapter will briefly introduce these technologies and discuss their applications in genome research and genetic improvements of aquaculture species. Readers with an interest in technical details of these technologies are referred to a recently published book, Aquaculture Genome Technologies (Liu, 2007a).

1.2 DNA marker technologies 1.2.1 Historical perspectives The genome compositions of each individual of the same species are similar but different at the level of DNA sequences and its encoding capacity, and thereby have different transcriptional activities, biological characteristics and performance. The entire task of DNA marker technologies is to provide the means to reveal such DNA level differences of genomes among individuals of the same species, as well as among various related taxa. Historically, these measurements relied on phenotypic or qualitative markers. Morphological differences such as body dimensions, size, and pigmentation are some examples of phenotypic markers. Genetic diversity measurements based on phenotypic markers are often indirect, and inferential through controlled breeding and performance studies (Parker et al., 1998; Okumus and Çifci, 2003). Because these markers are polygenically inherited and have low heritability, they may not represent the true genetic differences (Smith and Chesser, 1981). It is only when the genetic basis for these phenotypic markers is known, that some of them can be used to measure

Genome-based technologies useful for aquaculture research

5

genetic diversity. Molecular markers including protein markers and DNA markers were developed to overcome problems associated with phenotypic markers. Much before the discovery of DNA markers, allozyme markers were used to identify broodstocks in fish and other aquaculture species (Kucuktas and Liu, 2007). Allozymes are different allelic forms of the same enzymes encoded at the same locus (Hunter and Markert, 1957; Parker et al., 1998; May, 2003). Genetic variations detected in allozymes may be the result of point mutations, insertions or deletions (indels). Allozymes have had a wide range of applications in fisheries and aquaculture, including population analysis, mixed stock analysis, and hybrid identification (May, 2003). However, they are becoming a marker type of the past due to the limited number of loci that in turn prohibits genome-wide coverage for the analysis of complex traits (Kucuktas and Liu, 2007). In addition, mutation at the DNA level that causes a replacement of a similarly charged amino acid may not be detected by allozyme electrophoresis. Another drawback is that the most commonly used tissues in allozyme electrophoresis are the muscle, liver, eye, and heart, the collection of which is lethal. Two specific technological advances, the discovery and application of restriction enzymes in 1973 and the development of DNA hybridization techniques in 1975, set the foundation for the development of the first type of DNA markers, restriction fragment length polymorphism (RFLP – for a recent review, see Liu, 2007b). Restriction endonucleases cut DNA wherever their recognition sequences are encountered. Therefore, changes in the DNA sequence due to insertions/deletions (indels), base substitutions, or rearrangements involving the restriction sites can result in the gain, loss, or relocation of a restriction site. Digestion of DNA with restriction enzymes results in fragments whose number and size can vary among individuals, populations, and species. Two approaches are widely used for RFLP analysis. The first involves the use of Southern blot hybridization (Southern, 1975), while the second involves the use of polymer chain reaction (PCR). Traditionally, fragments were separated using Southern blot analysis, in which genomic DNA is digested, subjected to electrophoresis through an agarose gel, transferred to a solid support such as a piece of nylon membrane, and visualized by hybridization to specific probes. Most recent analysis replaces the tedious Southern blot analysis with techniques based on PCR. If flanking sequences are known for a locus, the segment containing the RFLP region is amplified via PCR. If the length polymorphism is caused by a deletion or insertion, gel electrophoresis of the PCR products should reveal the size difference. However, if the length polymorphism is caused by base substitution at a restriction site, PCR products must be digested with a restriction enzyme to reveal the RFLP. The major strength of RFLP markers is that they are codominant markers, i.e., both alleles in an individual are observed in the analysis. The major disadvantage of RFLP is the relatively low level of polymorphism.

6


In addition, either sequence information (for PCR analysis) or a molecular probe (for Southern blot analysis) is required, making it difficult and timeconsuming to develop markers in species lacking known molecular information. Due to these disadvantages, the application of RFLP markers in aquaculture and fisheries has been, and will be, limited. Mitochondrial genome evolves more rapidly than the nuclear genome. The rapid evolution of the mtDNA makes it highly polymorphic within a given species. The polymorphism is especially high in the control region (D-loop region), making the D-loop region highly useful in population genetic analysis. The analysis of mitochondrial markers is mostly RFLP analysis, or direct sequence analysis (Liu and Cordes, 2004). Due to the high levels of polymorphism and the ease of mitochondrial DNA analysis, mtDNA has been widely used as markers in aquaculture and fisheries settings. However, mtDNA is maternally inherited in most cases, and this non-Mendelian inheritance greatly limits the applications of mtDNA for genome research. In addition, most aquaculture-related traits are controlled by nuclear genes. For most aquaculture finfish species, their nuclear genome is at the level of a billion base pairs while their mitochondrial genomes are usually tens of thousands of times smaller than the nuclear genome. Clearly, in spite of their usefulness for the identification of aquaculture stocks, mitochondrial DNA markers will not be tremendously useful for aquaculture genome research and genetic improvement programs in aquaculture. However, some recent studies suggested that mitochondrial DNA could influence performance traits such as growth (Steele et al., 2008). When the Human Genome Project was launched in the mid-1980s, the capacity and capabilities of available DNA marker technologies seriously limited genome research. Such severe limits gave rise to pressure to develop more efficient marker systems for analysis of complex traits and genome organizations. At the end of the 1980s, the simple sequence repeats (SSR) or microsatellites were discovered; and they have since been used as one of the most preferred marker types because of their high levels of polymorphism, abundance, roughly even genome distribution, codominant inheritance, and small locus size that facilitate PCR-based genotyping (Tautz, 1989). Because of the importance of microsatellites for aquaculture genome research and genetic improvement programs, they will be discussed in more detail below. At the beginning of 1990s, efforts were also devoted to develop multiloci, PCR-based fingerprinting techniques. Such efforts resulted in the development of two marker types that were highly popular for a while: RAPD (random amplified polymorphic DNA, Welsh and McClelland 1990; Williams et al., 1990) and AFLP (amplified fragment length polymorphism, Vos et al., 1995). RAPD is a multi-locus DNA fingerprinting technique using PCR to randomly amplify anonymous segments of nuclear DNA with a single short


7

PCR primer (8–10 bp in length) (for a recent review, see Liu, 2007c). Because the primers are short, relatively low annealing temperatures (often 36–40 ºC) must be used. Once different bands are amplified from related species, population, or individuals, RAPD markers are produced. RAPD markers thus are differentially amplified bands using a short PCR primer from random genome sites. Genetic variation and divergence within and between the taxa of interest are assessed by the presence or absence of each product, which is dictated by changes in the DNA sequence at each locus. RAPD polymorphisms can occur due to base substitutions at the primer binding sites or to insertions or deletions (indels) in the regions between the two close primer binding sites. The potential power for detection of polymorphism is reasonably high as compared to RFLP, but much lower than microsatellites; typically, 5–20 bands can be produced using a given primer, and multiple sets of random primers can be used to scan the entire genome for differential RAPD bands. Because each band is considered a bi-allelic locus (presence or absence of an amplified product), polymorphic information content (PIC) values for RAPDs fall below those for microsatellites. The major advantages of RAPD markers are their applicability to all species regardless of known genetic, molecular or sequence information, relatively high level of polymorphic rates, simple procedure, and a minimal requirement for both equipment and technical skills. RAPD has been widely used in genetic analysis of aquaculture species, but its further application in genome studies is limited by its lack of high reproducibility and reliability. In addition, RAPD is inherited as dominant markers and transfer of information with dominant markers among laboratories and across species is difficult.

1.2.2 Amplified fragment length polymorphism (AFLP) Alternatives to RAPD that overcome the major problems such as its low reproducibility have been actively sought, and AFLP (Vos et al., 1995) was the outcome of such efforts. AFLP is based on the selective amplification of a subset of genomic restriction fragments using PCR (for a recent review, see Liu, 2007d). Genomic DNA is digested with restriction enzymes, and double-stranded DNA adaptors with known sequences are ligated to the ends of the DNA fragments to generate primer binding sites for amplification. The sequence of the adaptors and the adjacent restriction site serve as primer binding sites for subsequent amplification of the restriction fragments by PCR. Selective nucleotides extending into the restriction sites are added to the 3′ ends of the PCR primers such that only a subset of the restriction fragments is recognized. Only restriction fragments in which the nucleotides flanking the restriction site match the selective nucleotides will be amplified. The subset of amplified fragments is then analyzed by denaturing polyacrylamide gel electrophoresis to generate the fingerprints.

8


AFLP analysis is an advanced form of RFLP. Therefore, the molecular basis for RFLP and AFLP are similar. First, any deletions and/or insertions between the two restriction enzymes, e.g., between Eco RI and Mse I that are most often used in AFLP analysis, will cause shifts of fragment sizes. Second, base substitution at the restriction sites will lead to loss of restriction sites and thus a size change. However, only base substitutions in all Eco RI sites and roughly 1/8 of Mse I sites are detected by AFLP since only the Eco RI primer is labeled and AFLP is designed to analyze only the Eco RI–Mse I fragments. Third, base substitutions leading to new restriction sites may also produce AFLP. Once again, gaining Eco RI sites always leads to production of AFLP, gaining Mse I sites must be within the Eco RI–Mse I fragments to produce new AFLP. In addition to the common mechanisms involved in polymorphism of RFLP and AFLP, AFLP also scans for any base substitutions at the first three bases immediately after the two restriction sites. Considering large numbers of restriction sites for the two enzymes (250 000 Eco RI sites and 500 000 Mse I sites immediately next to Eco RI sites for a typical fish genome with one billion base pairs), a complete AFLP scan would also examine over two million bases immediately adjacent to the restriction sites. The potential power of AFLP in the study of genetic variation is enormous. In principle, any combination of a 6-bp cutter with a 4-bp cutter in the first step can be used to determine potential fragment length polymorphism. For each pair of restriction enzymes used in the analysis, e.g., Eco RI and Mse I, a total of approximately 500 000 Eco RI–Mse I fragments would exist for a genome with a size of 1 × 109 bp. Theoretically, 4096 primer combinations compose a complete genome-wide scan of the fragment length polymorphism using the two restriction enzymes if three bases are used for selective amplification. As hundreds of restriction endonucleases are commercially available, the total power of AFLP for analysis of genetic variation can not be exhausted. However, it is probably never necessary to perform such exhaustive analysis. Since over 100 loci can be analyzed by a single primer combination, a few primer combinations should display thousands of fingerprints. For genetic resource analysis, the number of primer combinations required for construction of phylogenetic trees/dendrograms depends on the level of polymorphism in the populations, but probably takes no more than five to ten primer combinations. AFLP combines the strengths of RFLP and RAPD. It is a PCR-based approach requiring only a small amount of starting DNA; it does not require any prior genetic information or probes; and it overcomes the problem of low reproducibility inherent to RAPD. AFLP is capable of producing far greater numbers of polymorphic bands than RAPD in a single analysis, significantly reducing costs and making possible the genetic analysis of closely-related populations. It is particularly well adapted for stock identification because of the robust nature of its analysis. The other


9

advantage of AFLP is its ability to reveal genetic conservation as well as genetic variation. In this regard, it is superior to microsatellites for applications in stock identification. Microsatellites often possess large numbers of alleles, too many to obtain a clear picture with small numbers of samples. Identification of stocks using microsatellites, therefore, would require large sample sizes. For instance, if ten fish are analyzed, each of the ten fish may exhibit distinct genotypes at a few microsatellite loci, making it difficult to determine relatedness without any commonly conserved genotypes. In closely related populations, AFLP can readily reveal commonly shared bands which define the common roots in a phylogenetic tree, and polymorphic bands that define branches in the phylogenetic tree. The major weakness of AFLP markers is their dominant nature of inheritance. Genetic information is limited with dominant markers because essentially only one allele is scored; and at the same time, since the true alternative allele is scored as a different locus, AFLP also inflates the number of loci under study. As dominant markers, information transfer across laboratories is difficult. In addition, AFLP is more technically demanding, requiring special equipment such as automated DNA sequencers for optimal operations. AFLP has been widely used in aquaculture in areas such as analysis of population structures, migration, hybrid identification, strain identification, parentage identification, genetic resource analysis, genetic diversity, reproduction contribution, and endangered species protection (Jorde et al., 1999; Seki et al., 1999; Sun et al., 1999; Cardoso et al., 2000; Chong et al., 2000; Kai et al., 2002; Mickett et al., 2003; Whitehead et al., 2003; Mock et al., 2004; Campbell and Bernatchez, 2004; Simmons et al., 2006). AFLP has also been widely used in genetic linkage analysis (Kocher et al., 1998; Liu et al., 1998, 1999; Griffiths and Orr, 1999; Agresti et al., 2000; Robison et al., 2001; Rogers et al., 2001; Liu et al., 2003; Li et al., 2003), and analysis of parental genetic contribution involving interspecific hybridization (Young et al., 2001) and meiogynogenesis (Felip et al., 2000). In a study of the black rockfish (Sebastes inermis), Kai et al. (2002) used AFLP to distinguish three color morphotypes, in which diagnostic AFLP loci were identified as well as loci with significant frequency differences. In such reproductive isolated populations, it is likely that ‘fixed markers’ of AFLP can be identified to serve as diagnostic markers. Fixed markers are associated most often with relatively less migratory, reproductive isolated populations (Kucuktas et al., 2002). With highly migratory fish species, fixed markers may not be available. However, distinct populations are readily differentiated by difference in allele frequencies. For instance, Chong et al. (2000) used AFLP for the analysis of five geographical populations of Malaysian river catfish (Mystus nemurus) and found that AFLP was more efficient for the differentiation of sub-populations and for the identification of genotypes within the populations than RAPD although similar clusters of the populations were concluded with either analysis.

10


In spite of its popularity, AFLP has two fundamental flaws that prohibit its wider applications in the future: the dominance inheritance and lack of information to link it to genome sequence information. In some cases, AFLP can be used as a rapid screening tool, and useful markers can then be converted to SCAR (sequence characterized amplified region) markers. However, genome scale applications of SCAR markers are unlikely.

1.2.3 Microsatellites Microsatellites are simple sequence repeats (SSRs) of 1–6 base pairs. The advantages of microsatellites as molecular markers include their abundance in genomes, even distribution, small locus size facilitating PCR-based genotyping, codominant nature of Mendelian inheritance, and high levels of polymorphism (for a recent review, see Liu, 2007e). Microsatellites are highly abundant in various eukaryotic genomes including all aquaculture species studied to date. In most of the vertebrate genomes, microsatellites make up a few percent of the genome in terms of the involved base pairs, depending on the compactness of the genomes. Generally speaking, more compact genomes tend to contain smaller proportion of repeats including simple sequence repeats, but this generality is not always true. For example, the highly compact genome of Japanese pufferfish contains 1.29 % of microsatellites, but its closely related Tetraodon nigroviridis genome contains 3.21 % of microsatellites (Crollius et al., 2000). During a genomic sequencing survey of channel catfish, microsatellites were found to represent 2.58 % of the catfish genome (Xu et al., 2006; Liu, 2007g). In fugu, one microsatellite was found for every 1.87 kb of DNA. For comparison, in the human genome, one microsatellite was found for every 6 kb of DNA (Beckmann and Weber, 1992). It is reasonable to predict that in most aquaculture fish species, one microsatellite should exist every 10 kb or less of the genomic sequences, on average. Dinucleotide repeats are the most abundant forms of microsatellites. For instance, in channel catfish, 67.9 % of all microsatellites are present in the form of dinucleotide repeats; 18.5 % are present as trinucleotide repeats; and 13.5 % as tetranucleotide repeats, excluding mononucleotide repeats which are not nearly as useful for molecular markers. Generally speaking, dinucleotide microsatellites are the most abundant, followed by tri-, or tetranucleotide repeats but, in some cases, tetranucleotide repeats can be more frequent than the trinucleotide repeats. Of the dinucleotide repeat types, (CA)n is the most common dinucleotide repeat type, followed by (AT)n, and then (CT)n (Toth et al., 2000; Xu et al., 2006). (CG)n type of repeat is relatively rare in the vertebrate genomes, partially because the vertebrate genomes are often A/T-rich. Of the trinucleotide repeats and tetranucleotide repeats, relatively A/T-rich repeat types are generally more abundant than G/C-rich repeat types. Microsatellites longer than tetranucleotide repeats (penta- and hexanucluotides) are much less abundant and


11

therefore, are less important as molecular markers (Toth et al., 2000). It is important to point out that the definition of microsatellites limiting to repeats of six bases long is quite arbitrary. Technically speaking, repeats with seven bases or longer sequences are also microsatellites but, because they become rarer as the repeats are longer, they are less relevant as molecular markers. Microsatellites are distributed in the genome on all chromosomes and all regions of the chromosome. They have been found inside gene coding regions (e.g. Liu et al., 2001), introns, and in the non-gene sequences (Toth et al., 2000). The best known examples of microsatellites within coding regions are those causing genetic diseases in humans, such as the CAG repeats that encode the polyglutamine tract, resulting in mental retardation. In spite of their wide distribution in genes, microsatellites are predominantly located in non-coding regions (Metzgar et al., 2000). Only about 10–15 % of microsatellites reside within coding regions (Moran, 1993; van Lith and van Zutphen, 1996; Edwards et al., 1998; Serapion et al., 2004). This distribution should be explained by negative selection against frameshift mutations in the translated sequences (Metzgar et al., 2000; Li et al., 2004). Because the majority of microsatellites exist in the form of dinucleotide repeats, any mutation by expansion or shrinking would cause frameshift of the protein encoding open frames if they reside within the coding region. This also explains why the majority of microsatellites residing within coding regions have been found to be trinucleotide repeats, though the presence of dinucleotide repeats and their mutations within the coding regions do occur. Most microsatellite loci are relatively small, ranging from a few to a few hundred repeats. The relatively small size of microsatellite loci is important for PCR-facilitated genotyping. Generally speaking, within a certain range, microsatellites containing a larger number of repeats tend to be more polymorphic, though polymorphism has been observed in microsatellites with as few as five repeats (Karsi et al., 2002). For practical applications, microsatellite loci must be amplified using PCR. For best separations of related alleles that often differ from one another by as little as one repeat unit, it is desirable to have small PCR amplicons, most often within 200 bp. However, due to the repetitive nature of microsatellites, their flanking sequences can be quite a simple sequence as well, prohibiting the design of PCR primers for the amplification of microsatellite loci within a small size limit. Microsatellites are highly polymorphic as a result of their hypermutability and thereby the accumulation of various forms in the population of a given species. Microsatellite polymorphism is based on size differences due to varying numbers of repeat units contained by alleles at a given locus. Microsatellite mutation rates have been reported as high as 10−2 per generation (Weber and Wong, 1993; Crawford and Cuthbertson, 1996; Ellegren, 2000), which are several orders of magnitude greater than that of

12


non-repetitive DNA (10−9; Li, 1997). In several fish species, the mutation rates of microsatellites were reported to be at the level of 10−3 per locus per generation: 1.3 × 10−3 in common carp (Zhang et al., 2008), 2 × 10−3 in pipefish (Jones et al., 1999), 3.9–8.5 × 10−3 in salmon (Steinberg et al., 2002) and 2 × 10−3 in dollar sunfish (MacKiewicz et al., 2002). Microsatellites are inherited in a Mendelian fashion as codominant markers. This is one of the strengths of microsatellite markers in addition to their abundance, even genomic distribution, small locus size, and high polymorphism. Genotyping of microsatellite markers is usually straightforward. However, due to the presence of null alleles (alleles that can not be amplified using the primers designed), complications do exist. As a result, caution should be exercised to ensure that the patterns of microsatellite genotypes fit the genetic model under application. The disadvantages of microsatellites as markers include the requirement for existing molecular genetic information, a large amount of upfront work for microsatellite development, and the tedious and labor-intensive nature of microsatellite primer design, testing, and optimization of PCR conditions. Each microsatellite locus has to be identified and its flanking region sequenced for the design of PCR primers. Technically, the simplest way to identify and characterize a large number of microsatellites is through the construction of microsatellite-enriched small-insert genomic libraries (Ostrander et al., 1992; Lyall et al., 1993; Kijas et al., 1994; Zane et al., 2002). In spite of the variation in techniques for the construction of microsatelliteenriched libraries, the enrichment techniques usually include selective hybridization of fragmented genomic DNA with a tandem repeat-containing oligonucleotide probe and further PCR amplification of the hybridization products. In spite of the simplicity in the construction of microsatelliteenriched libraries and thereby the identification and characterization of microsatellite markers, for a large genome project, direct microsatellite marker development may not be the wisest approach. Recent progress in sequencing technologies with the next generation of sequencers will allow large numbers of genomic sequence tags to be generated that would include numerous microsatellites. Microsatellites can be identified and sequenced directly from genome sequence surveys such as bacterial artificial chromosome (BAC) end sequencing (Xu et al., 2006; Somridhivej et al., 2008), and from expressed sequence tag (EST) analysis from which many microsatellites can be developed into type I markers (Liu et al., 1999; Serapion et al., 2004). Caution has to be exercised, however, on microsatellites developed from ESTs. First, due to the presence of introns, one has to be careful not to design primers at the exon–intron boundaries. Second, the presence of introns would make allele sizes unpredictable. Finally, many microsatellites exist at the 5′- or 3′-untranstated region (UTR), making flanking sequences insufficient for the design of PCR primers. While introns are not a problem for microsatellites derived from BAC end sequencing, sequencing reactions often terminate immediately after the microsatellite


13

repeats, which also makes flanking sequences insufficient for the design of PCR primers. Microsatellites have recently become an extremely popular marker type in a wide variety of genetic investigations, as evidenced by the launch of the journal Molecular Ecology Notes, dedicated almost entirely to publishing primer and allele frequency data for newly-characterized microsatellite loci in a wide range of species. Since the late 1990s, microsatellite markers have been used extensively in fisheries research including studies of genome mapping, parentage, kinships, and stock structure. The major application of microsatellite markers is for the construction of genetic linkage and quantitative trait loci (QTL) maps. This is because of the high polymorphic rate of microsatellite markers. When a resource family is produced, the male and female fish parents are likely to be heterozygous in most microsatellite loci. The high polymorphism of microsatellites makes it possible to map many markers using a minimal number of resource families. There are other reasons for the popularity of microsatellites, one of which is that microsatellites are sequence-tagged markers that allow them to be used as probes for the integration of different maps including genetic linkage and physical maps. Communication using microsatellite markers across laboratories is easy, and the use of microsatellite across species borders is sometimes possible if the flanking sequences are conserved (FitzSimmons et al., 1995; Rico et al., 1996; Cairney et al., 2000; Leclerc et al., 2000). As a result, microsatellites can be also used for comparative genome analysis. If microsatellites can be tagged to gene sequences, their potential for use in comparative mapping is greatly enhanced. In spite of the popularity and great utilization of microsatellites, recent advances in molecular markers will have a major impact on the choice of DNA markers. In particular, the rapid progress in SNP, including its rapid identification and automation in genotyping, makes SNP the far more preferred marker system for genome studies as detailed below.

1.2.4 Single nucleotide polymorphism (SNP) SNP describes polymorphisms caused by point mutations that give rise to different alleles containing alternative bases at a given nucleotide position within a locus (for a recent review, see Liu, 2007f). Such sequence differences due to base substitutions have been well characterized since the beginning of DNA sequencing in 1977, but genotyping SNPs for large numbers of samples was not possible until several major technological advances in the late 1990s. SNPs are again becoming a focal point of molecular markers since they are the most abundant polymorphism in any organism, adaptable to automation, and reveal hidden polymorphism not detected with other markers and methods. SNP markers have been regarded by many as the markers of choice in the future.

14


Theoretically, a SNP within a locus can produce as many as four alleles, each containing one of four bases at the SNP site: A, T, C, and G. Practically, however, most SNPs are usually restricted to one of two alleles (quite often either the two pyrimidines C/T or the two purines A/G) and have been regarded as bi-allelic. They are inherited as codominant markers in a Mendelian fashion. In spite of its increasing popularity as the choice of markers for the future, SNP discovery is a daunting task. As defined by its definition, SNP discovery depends on sequencing. Several approaches have been used for the discovery of SNPs in humans and animals. Earlier efforts used approaches such as single-strand conformation polymorphism (SSCP) analysis (Gonen et al., 1999), heteroduplex analysis (Sorrentino et al., 1992), and direct DNA sequencing. However, several recently developed approaches provide greater efficiencies, two of which are described here in detail. The first and the simplest one is to conduct deep sequencing of reduced representation libraries (Altshuler et al., 2000; Van Tassel et al., 2008). In this method, genomic DNA from multiple individuals is mixed and digested with restriction endonuclease and subjected to electrophoresis through an agarose gel. The idea is that the allelic fragments from these individuals (with potential SNPs) should all migrate to the same gel location. The gel slice is cut and the DNA extracted for the construction of the reduced representation library. The reduced representation library is deeply sequenced to generate coverage of 20–30X using next generation DNA sequencers. The generated sequences can then be assembled for the identification of SNPs. Solexa sequencing can be used for species in which a draft genome sequence exists where assembly of the short sequence tags can be achieved. Longer sequences would be needed if a draft genome sequence is not yet available. In most aquaculture species, draft genome sequences are not yet available, and therefore 454 sequencing should be considered. The second strategy involves data mining from EST projects, if EST libraries were constructed using multiple individuals (each individual contains two sets of chromosomes so it is possible also to use just one individual, but a greater level of polymorphism is provided by multiple individuals). This approach is realistic because EST resources already exist, or are to be developed for the majority of important aquaculture species. In addition, EST-derived SNPs are coming from genes and therefore are type I markers. Mapping of gene-associate SNPs would allow analysis of association of SNPs with traits for the discovery of the ‘causing SNPs’ for the traits (Bader, 2001; Marnellos, 2003; Halldorsson et al., 2004; Stram, 2004). However, this approach has major limitations. Because of evolutionary restraint on mutations in coding regions, SNP rates are generally much lower in coding regions than in non-coding regions. The major problem of EST-derived SNPs could be related high sequence errors in EST sequenc-


15

ing resulting in pseudo-SNPs (Wang et al., 2008b). In order to avoid pseudoSNPs, two factors appeared to be crucial: the contig sizes and the lower sequence allele frequency. Contigs larger than four sequences with the minor sequence being represented at least twice seem to provide a high level of SNP validation rates (Wang et al., 2008). SNP genotyping requires special equipment. Many methods have been developed through the years to differentiate the alleles of SNPs. A lot of the earlier methods, in spite of being adaptable to individual laboratory situations, are not suitable for large-scale genome-wide applications. These include direct sequencing, single base sequencing (reviewed by Cotton, 1993), allele-specific oligonucleotide (ASO, Malmgren et al., 1996), heteroduplex analysis, denaturing gradient gel electrophoresis (DGGE, Cariello et al., 1988), single strand conformational polymorphism assays (SSCP, Suzuki et al., 1990), and ligation chain reaction (LCR, Kalin et al., 1992). Large-scale analysis of SNP markers, however, depends on the availability of expensive, cutting-edge equipment. Several options are available for efficient genotyping using the state of the art equipment. Particularly popular are methods involving MALDI– TOF (Matrix-assisted laser desorption ionization – time of flight) mass spectrometry (Ross et al., 1998; Storm et al., 2003), and the BeadArray technology developed by Illumina. The latter, as it can be adapted for largescale genome studies, is becoming the most popular SNP genotyping method. The BeadArray technology is based on 3-micron silica beads that self assemble in microwells on either of two substrates: fiber optic bundles or planar silica slides. When randomly assembled on one of these two substrates, the beads have a uniform spacing of ∼5.7 microns. Each bead is covered with hundreds of thousands of copies of a specific oligonucleotide that act as the capture sequences in one of Illumina’s assays (Fig. 1.1). The manufacturing process includes a sequential hybridization of every single array element (bead with oligos). This process, called decoding, allows validation of every feature of every array to ensure that each array element is present and functional. The allele discrimination at each SNP locus is achieved by using three oligos (P1, P2, and P3, Fig. 1.2), of which P1 and P2 are allele-specific and are Cy3- and Cy5-labeled. P3 is locus-specific designed several bases downstream from the SNP site. Upon allele-specific extension and ligation, the artificial, allele-specific template is created for PCR using universal primers. If the template DNA is homozygous, either P1 or P2 will be extended to meet P3; if the template is heterozygous, both P1 and P2 will be extended to meet P3, allowing ligation to happen (Fig. 1.2). P3 contains a unique address sequence that targets a particular bead type with complementary sequence to the address sequence. After downstream-processing, the single-stranded, dye-labeled DNAs are hybridized to their complement bead type through their unique address sequences. After hybridization, the BeadArray Reader is used to analyze fluorescence signal on the beadchip,

16

New technologies in aquaculture Optical fiber bundle Bead library each with a distinct oligonucleotide capture probe

cataaatattctggcaagga

cactatgaccttctggata cggcatcagtggactgggct atacaaaggcttgtactttt gaagggacttgcactgttgc tgcacaggtgaccaataccc

Fig. 1.1 Schematic illustration of the BeadArray technology.

which is in turn analyzed using software for automated genotype clustering and calling (http://www.illumina.com/). The Illumina platform is highly cost-effective and has been widely used for large-scale SNP analysis in the Human Genome Project. Among all the factors, the relatively low cost of the Illumina genotyping platform is the key for selection of an SNP genotyping platform. Currently, Illumina offers two platforms for the BeadArray technology: the GoldenGate® Platform for up to 7600 SNPs, and the iSelect® platform for 7600–60 000 SNPs. On the basis of cost per sample, the iSelect® platform is the most efficient with a cost of several cents per sample. In spite of its current low levels of application in aquaculture genome research, SNP markers should gain in popularity as more and more sequence information becomes available in aquaculture species. Equally important, once the genetic linkage maps are well constructed, genome scans for QTLs are expected to follow to study traits important to aquaculture, which then depends on the use of well-defined association analysis. As SNP markers are great markers for the analysis of trait–genotype associations, their application to aquaculture will become essential. It is clear that SNPs will


17

A/G P1 P2 P1 P2

T C

Address P3

P3

Allele-specific extension and ligation PCR with P1, P2, and P3

Homozygous A/A Homozygous G/G Heterozygous A/G

Fig. 1.2 Allele discrimination using BeadArray technology. The allele discrimination at each SNP locus is achieved by using three oligos (P1, P2, and P3, of which P1 and P2 are allele-specific and are Cy3- and Cy5-labeled. P3 is locus-specific designed several bases downstream from the SNP site. Upon allele-specific extension and ligation, the artificial, allele-specific template is created for PCR using universal primers. If the template DNA is homozygous, either P1 or P2 will be extended to meet P3; if the template is heterozygous, both P1 and P2 will be extended to meet P3, allowing ligation to happen, generating templates for successful PCR. By measurements of red, green, or yellow of the fluorescence, the genotypes can be readily called.

become the major markers of choice for genome research and genetic improvement programs in aquaculture.

1.2.5 Trends in DNA marker technologies DNA marker technologies have become essential for aquaculture genetics research and the genetic improvement of aquaculture species. As a matter of fact, DNA markers, both the quality and quantity, have always been a limiting factor for in-depth genome research. Throughout the years, aquaculture geneticists have used various markers including allozyme markers, mitochondrial markers, RFLP markers, RAPD, AFLP, microsatellites, and SNPs. The overall trend, however, has been driven by: (i) the need for large numbers of markers for high-density coverage of the genomes, and (ii) the need for sequence-tagged markers for comparative genome analysis. Such demands have driven aquaculture genetic research away from using systems that do not offer a great number of markers such as RFLP and allozyme markers, and away from anonymous dominant markers such as RAPD and AFLP. Microsatellites, being codominant and sequence-tagged, have recently become very popular. However, with the draft genome sequence

18


very soon becoming available for major aquaculture species, microsatellites are not without limitations. Their genotyping can be multiplexed, but the extent of multiplexing is limited. Automation of microsatellite genotyping is limited, thus prohibiting large-scale genome-wide applications. Mapping of thousands of microsatellites to the genome involves a lot of work, and analysis using tens or hundreds of thousands of microsatellites would be a daunting task, if not technically impossible for repeated analysis. This only leaves the SNP marker system to be viable. SNPs are the most abundant markers in genomes when compared to any other types of markers; SNPs are sequence-tagged and therefore would allow comparative mapping analysis; SNP genotyping is highly automated and therefore is adaptable to large-scale genome-wide analysis. Therefore, it is clear that SNP markers are the choice marker of the future. In spite of the current lack of draft whole genome sequences for aquaculture species, it is anticipated that they will soon become available for major aquaculture species. In addition, the availability of next generation sequencing technologies (see below) makes it unnecessary to have the whole genome draft sequences in order to develop a large number of SNP markers.

1.3 DNA sequencing technologies Two independent DNA sequencing technologies were originally invented in 1977, and they have been referred to as Sanger’s enzymatic method and Maxam-Gilbert chemical method (Maxam and Gilbert, 1977; Sanger et al., 1977). Since the 1980s, most DNA has been sequenced by the enzymatic method as the chemical method never gained popularity because of its use of toxic chemicals in the reactions. However, the Sanger’s method, once the golden standard, is rapidly losing ground as the next generation DNA sequencers are now emerging. As the principles and applications of original DNA sequencing technologies, especially those of the Sanger’s DNA sequencing technology, were well documented and most readers are familiar with them, this section will focus on the next generation of DNA sequencing technologies. Readers who are interested in the basic principles of the traditional Sanger’s sequencing are referred to a chapter in Aquaculture Genome Technologies (Liu, 2007i,j). Several major new sequencing platforms have been adopted recently, and they are collectively referred to as the next generation DNA sequencers. A common feature among the new generation of sequencing procedures is the elimination of the need to clone DNA fragments and the subsequent amplification and purification of DNA templates prior to sequencing. Instead, sequence templates are handled in bulk, and massively parallel sequencing allows the generation of numerous sequences simultaneously. Readers need to know that many sequencing platforms are being developed, and this field is one of the most active areas in technology


19

Table 1.1 Comparison of three next generation sequencing platforms Platform

SOLiD

454

Solexa

Vendor Sequence tags per run Bases per run Potential applications

Applied Biosystems 240 million

454 Life Sciences 500 000

Illumina >20 million

6 × 109 bp Resequencing, gene expression analysis, microRNA discovery, chromatin immune-precipitation (ChIP)

1.2 × 108 bp Resequencing, gene expression analysis, microRNA discovery, ChIP, whole genome de novo sequencing

1 × 109 bp Resequencing, gene expression analysis, microRNA discovery, ChIP

development. The next section will focus only on the principles of three sequencing platforms: the SOLiDTM sequencing platform, and the Solexa sequencing platform, and the 454 sequencing platform (Table 1.1).

1.3.1 The SOLiD sequencing platform The SOLiD (Sequencing by Oligonucleotide Ligation and Detection) method utilizes ligation of fluorescently labeled 8-mer primers containing random bases at six of its eight positions and specific dinucleotides at the remaining two positions (the earliest version was the fourth and the fifth, but it can be the first and second, and that will be used for explanation here). The primers are fluorescently labeled with four specific dyes with each dye corresponding to four specific dinucleotides. Note that at each DNA base position, there are four base possibilities: A, C, G, or T. For dinucleotide at two consecutive base positions, a total of 16 dinucleotides (AA, AC, AG, AT, CA, CC, CG, CT, GA, GC, GG, GT, TA, TC, TG, and TT) should cover all possibilities. In order to make each of the four fluorescent dyes uniquely represent one specific nucleotide, a two-step decoding process is required. A random primer is ligated to the template only when the first and second nucleotides on the primer are complementary to those on the template. After visualizing the color, the fluorescent tag is removed by cleaving the primer between the fifth and sixth positions, removing bases 6, 7, and 8. The process is repeated; and in the second round of ligation, a new primer is ligated, with the new first and second nucleotides on the primer being complementary to those on the template, counting from the end of the previously ligated primer after cleavage (base 6 and 7 of the previous primer). Repeat this process and every first and second position is recorded. Next, the system is reset to generate the recording for every n − 1, n − 2, n − 3, and n − 4 position (Kate Marusina, http://www.

20


genengnews.com/articles/chitem.aspx?aid=1946) such that each base included in the dinucleotide is ‘sequenced’ twice to allow base calling. For example, the base at position 4 is sequenced in the dinucleotide base 3 and base 4, and it is sequenced again in the dinucleotide base 4 and base 5. As with all next generation sequencing platforms, the SOLiD sequencing does not require cloning of genomic DNA. It starts with the creation of a ‘library’ by ligation of two adaptors to sheared genomic DNA (Fig. 1.3). Once the adapters are ligated to the library, emulsion PCR is conducted using the common primers to generate ‘bead clones’ in which each contains a single nucleic acid species. Each bead is then attached to the surface of a flow cell (microscope slide) via 3′ modifications to the DNA strands (Fig. 1.4). Each microbead can be considered a separate sequencing reaction which is monitored simultaneously via sequential digital imaging.

Shear DNA

Ligate adaptors, P1 and P2

Fig. 1.3

Making ‘libraries’ of sheared segments by ligating to two adaptors as the first step of SOLiD sequencing.

+

P1 P2

+

Polymerase

Clonal PCR

+ P1 coated beads

Fig. 1.4 Clonal amplification of genomic DNA in SOLiD sequencing. Each genomic DNA segment with adaptors is absorbed to beads and amplified by using the adaptor primers to generate numerous clones ready for sequencing.


21

SOLiD sequencing chemistry depends on specific ligation of a random primer to the existing primer only when the random primer harbors the specific dinucleotide that is complementary to the template DNA being sequenced. The actual base detection is no longer done by the polymerasedriven incorporation of labeled dideoxy terminators. Instead, SOLiD uses a mixture of labeled oligonucleotides and queries the input strand with ligase. In the early version, each oligo has degenerate nucleotide at positions 1–3 (N′s at 3′ first three bases), one of 16 specific dinucleotide at positions 4–5, and degenerate nucleotide at positions 6–8 that are fluorescently labeled (demonstrated in Fig. 1.3 with the first and second nucleotide being specific, and the remaining bases being degenerate). The sequencing reaction involves: (i) hybridization and ligation of a specific oligo whose 4th and 5th bases match that of the template; (ii) detection of the specific fluor associated with the specific dinucleotide; (iii) cleavage of bases 6–8; (iv) repeat, this time querying the 9th and 10th bases. Seven cycles of ligation would allow putative nucleotide identities at positions 4 and 5, 9 and 10, 14 and 15, 19 and 20, 24 and 25, 29 and 30, and 34 and 35 to be recorded. After seven cycles of this, a ‘reset’ is performed in which the initial primer and all ligated portions are melted from the template and discarded. Next a new initial primer is used that is N−1 in length. Repeating the initial cycling (steps 1–4) now generates an overlapping data set. In this manner, ligations using primer N generate sequences for bases 4 and 5, 9 and 10, 14 and 15, 19 and 20, 24 and 25, 29 and 30, and 34 and 35; ligations using primer N−1 generate sequences for bases 3 and 4, 8 and 9, 13 and 14, 18 and 19, 23 and 24, 28 and 29, and 33 and 34, and so on. After use of primers N, N−1, N−2, N−3, and N−4, every base is ‘sequenced’ twice using two primers (Table 1.2). Base calling is dependent on a two-step encoding procedure with known nucleotides in every fourth and fifth position of the primer (Fig. 1.5). For example, the dinucleotides CA, AC, TG, and GT are all encoded by the green dye. Because each base is queried twice, it is possible, using the two colors, to determine which bases were at which positions. For instance, if the sequence is TCGAACGTA . . . blue label is detected for the first ligation reaction using primer N that determines base composition at Table 1.2 Schematic illustration of the base positions sequenced by each ligation and using various primers. Each black bar represents the two bases sequenced by each ligation, and the numbers above the bars indicate the base positions to be sequenced. The primers N, N−1, N−2, N−3, and N−4 are indicated in the first column 0 1 2 3 4 5 6 7 8 9 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 3 3 3 3 3 3 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 N –1 –2 –3 –4

22

New technologies in aquaculture n–1

3′ A-T-n-n-n-z-z-z

1st base

2nd base A C G T

A-A-n-n-n-z-z-z

A

Ligase 3′

C G T

3′ Bead …… 5′

3′ 7x Ligation

Use n–1, n–2, n–3, and n–4 primers

3′

Primer

p5′

A-C-n-n-n-z-z-z

Adapter sequence

3′

A-G-n-n-n-z-z-z

Template sequence Record fluorescence

Primer A-C-n-n-n-z-z-z

Bead …… 5′

TG Adapter sequence Cleavage

3′

Primer

Template sequence

z-z-z

A-C-n-n-n p5′ Bead …… 5′

TG Adapter sequence

Template sequence

Fig. 1.5 Chemistry of SOLiD sequencing platform. The SOLiD sequencing utilizes ligation of fluorescently labeled 8-mer primers containing random bases at six of its eight positions. Shown here the first two bases are specific dinucleotide that are specifically labeled as displayed by the dotted circles, e.g., AA: blue, AC: green, AG: yellow, and AT: red. A random primer is ligated to the template only when the first and second nucleotides on the primer are complementary to those on the template. After visualizing the color, the fluorescent tag is removed by cleaving the primer between the fifth and sixth positions, removing bases 6, 7, and 8. The process is repeated; and in the second round of ligation, a new primer is ligated with the new first and second nucleotides on the primer being complementary to those on the template, counting from the end of the previously ligated primer after clevage (base 6 and 7 of the previous primer). Next, the system is reset to generate the recording for every n−1, n−2, n−3, and n−4 positions by using N−1, N−2, N−3, and N−4 primers.

base 4 and 5. There are still four possibilities with blue label: AA, CC, GG, and TT. However, in the first ligation reaction of primer N−1, yellow label is detected, which effectively calls the base at position 4 to be ‘A’. Similarly, with the second ligation reaction using N−4 primer (that determines base compositions at base 5 and 6), green should be detected that effectively calls the base at position 5 to be ‘A’ as well. Repeating this decoding process to include ‘sequencing’ of each base with two primers will provide unambiguous base callings.


23

As with any other type of technology, SOLiD sequencing technology is making rapid improvements allowing greater throughput and more applications. Several areas are under intense scrutiny to increase the efficiency and accuracy of the technology including: increasing the bead density, read lengths, and ability of multiplexing. Currently, SOLiD read length is around 35 bases, and it is anticipated to be 50 bases in 2009. The SOLiD sequencing technology has wide applications including, but not limited to, targeted resequencing, gene expression analysis by digital counting of sequence tags (e.g., Cloonan et al., 2008), microRNA discovery, chromatin immune-precipitation (ChIP), and whole genome sequencing. Due to its short read length, it is anticipated that its application to whole genome sequencing will be mostly applicable to whole genome resequencing. However, it is less amenable to de novo whole genome sequencing projects because the assembly of whole genome based on short sequence tags has proven to be a great challenge. Because the technology is quite new, there are no publications covering the use of the SOLiD sequencing platform in aquaculture species, to the author’s best knowledge.

1.3.2 The Solexa sequencing platform The Solexa sequencing platform depends on two of its core technologies: the Clonal Single Molecule ArrayTM technology that allows simultaneous analysis of hundreds of millions of individual molecules, and the reversible terminator technology that allows specific base calling based on sequencing by synthesis. Solexa sequencing starts with sheering of genomic DNA to small segments to which different adaptor sequences are ligated to either end. Upon binding single-stranded template DNA fragments with adaptors randomly to the inside surface of the flow cell channels, template DNA is amplified clonally through bridge PCR. DNA is sequenced by detection of fluorescently labeled dideoxynucleotide terminators. These specially created nucleotides, which also possess a reversible termination property, allow each cycle of the sequencing reaction to occur simultaneously in the presence of all four nucleotides (ddA, ddC, ddT, ddG). In the presence of all four nucleotides, the polymerase is able to select the correct base to incorporate, with the natural competition between all four alternatives leading to higher accuracy than methods where only one nucleotide is present in the reaction mix at a time (which require the enzyme to reject an incorrect nucleotide). Sequences where a particular base is repeated one after another (‘homopolymer repeats’) are dealt with as for any other sequence and with high accuracy; this avoids the problems of measuring intensity and deducing how many bases were present in the repeat that are the cause of uncertainty seen with ‘one base per reaction’ methods, as described with the 454 sequencing platform. Solexa sequencing technology achieves an unparalleled data density with highly accurate results. A typical Solexa sequencing run generates millions

24


of sequence tags with the capability to generate over a billion bases of DNA sequence per run. Currently, the read length is limited to about 35 bp. Like the SOLiD sequencing technology, the Solexa sequencing technology has wide applications including, but not limited to, gene expression analysis by digital counting of sequence tags, microRNA discovery, epigenetic studies, ChIP, and whole genome sequencing (Bentley, 2006; Butler et al., 2008; Chen et al., 2008; Cokus et al., 2008; Dolan and Denver, 2008; Glazov et al., 2008; Hillier et al., 2008). However, due to its short read length, it is anticipated that its application to whole genome sequencing will be mostly applicable to whole genome re-sequencing. As Solexa technology is also quite new, its application in aquaculture species is still limited, but the potential is tremendous. One of the earliest applications of the Solexa technology was actually conducted in oysters. Dennis Hedgecock’s group used the Solexa technology for the study of genes involved in heterosis of pacific oysters (Hedgecock et al., 2007).

1.3.3 The 454 sequencing platform 454 sequencing is based on pyrosequencing. During DNA synthesis, a pyrophosphate (PPi) is released when each base is incorporated. The released pyrophosphate can be converted to adenosine triphosphate (ATP) that generates a fluorescent signal upon the actions of luciferase in the presence of its substrates. Measurement of the light signal after sequential injection of A, C, G, and T would allow the determination of the base composition. After each base addition, the whole sequencing reaction system is reset by cleaning out all existing ATP and nucleotides with apyrase. When mononucleotide repeats are encountered in the sequence, the pyrosequencing reaction continuously incorporates the repeated nucleotide until it reaches a different nucleotide. The light signal produced is proportional to the number of mononucleotides incorporated–up to eight bases. Mononucleotide repeats greater than 8 bp cannot be accurately sequenced by pyrosequencing. The 454 sequencing platform uses microfabricated high-density picolitre reactors (Margulies et al., 2005). No cloning is necessary for 454 sequencing. The clonal DNA used for sequencing is obtained by clonal PCR amplification of a single molecule in emulsified water-in-oil microreactors. Preparation of the DNA library consists of a few simple steps. Genomic DNA is fractionated into smaller fragments (300–500 bp) that are subsequently filled in to polished ends (blunted), allowing ligation of adaptors to the genomic DNA for PCR amplification. In order to prevent intermolecular ligation of the genomic DNA fragments, the DNA fragments are dephosphorylated. Short adaptors (A and B) are then ligated onto the ends of the fragments. After ligation, the gap needs to be repaired, presumably using a DNA ligase. The adaptors provide priming sequences for both amplification and sequencing of the sample-library fragments. The two adaptors are


25

different. Adaptor B contains a 5′-biotin tag that enables immobilization of one strand of the library onto streptavidin coated beads. The nonbiotinylated strand is released and used as a single-stranded template DNA library. The single-stranded template DNA library is immobilized onto beads carrying short primers complementary to the adaptor A sequences by base pairing. The key element here is attaining the correct proportion of beads to DNA molecules such that only one molecule is captured by each bead. The beads containing a single molecule of the single-stranded template are emulsified with the amplification reagents in a water-in-oil mixture. Each bead is captured within its own microreactor where PCR amplification occurs. This results in bead-immobilized, clonally amplified DNA fragments. The single strand template DNA library beads are added to the DNA bead incubation mix (containing DNA polymerase) and are layered with enzyme beads (containing sulfurylase and luciferase) onto the PicoTiterPlate device. The device is centrifuged to deposit the beads into the wells. The layer of enzyme beads ensures that the DNA beads remain positioned in the wells during the sequencing reaction. Due to the size of the wells in relation to the beads, only one bead containing a specific clonally amplified genomic DNA segment should be placed into each well of the PicoTiterPlate device. The loaded PicoTiterPlate device is placed into the ‘454 sequencer’, the Genome Sequencer 20 Instrument or the FLX generation systems, which performs pyrosequencing-like reactions. Unlike a traditional pyrosequencing reaction, hundreds of thousands of beads, each with millions of copies of clonally amplified DNA, are sequenced in parallel. Each well of the PicoTiterPlate device is a separate pyrosequencing reaction. If a nucleotide complementary to the template strand is flowed into a well, the polymerase extends the existing DNA strand by adding a nucleotide(s). Addition of one (or more) nucleotide(s) results in a reaction that generates a light signal that is recorded by the CCD camera in the instrument. The signal strength is proportional to the number of nucleotides incorporated in a single nucleotide flow. Typically, over 200 000 reads can be achieved in a single run. Assuming generation of 250 bp by a single reaction, each run should generate 50 million bp or more of sequence in several hours using a single instrument. This is approximately a 10X coverage of a bacterial genome! The 454 sequencing platform holds much potential for its great applications such as gene expression profiling, epigenetic analysis, and whole genome sequencing (Patrick, 2007; Bekal et al., 2008; Hafner et al., 2008; Vera et al., 2008). The 454 sequencing platform is probably the most promising technology for de novo whole genome sequencing among the next generation sequencers as it produces sequences of approximately 250 bp, that is significantly shorter than the traditional Sanger sequencing (800– 1000 bp), but much longer those generated by SOLiD or Solexa sequencing

26


platforms. The current major problems prohibiting its application for the sequencing of complex genomes are its relatively short sequencing reads and difficulties in accurate determination of homopolymeric runs in the DNA. The short reads complicate genome sequence assembly, while the inability to determine the number of bases within a long homopolymeric run prohibits accurate sequencing of genomes. These problems are more significant for complex genomes with high levels of repeat structure. However, the technologies’ high throughput and low costs are very attractive, especially for aquaculture species. As the technology is perfected to minimize these drawbacks, the 454 sequencing platform will show even greater promise.

1.4 Gene discovery technologies Performance and production traits are controlled by genes, environments, and gene–environment interactions. In order to gain detailed understanding of performance and production traits, understanding the genes in aquaculture genomes become essential. Sequencing of ESTs has been the primary approach for the discovery of genes in aquaculture species, although several other approaches are also available such as serial analysis of gene expression (SAGE). Recently, however, the adoption of several novel sequencing platforms using next generation sequencers has allowed generation of expressed sequence tags through de novo sequencing of whole transcriptomes.

1.4.1 Expressed sequence tags and gene discovery ESTs are single pass sequences of random cDNA clones. They are partial cDNA sequences corresponding to mRNAs generated from randomly selected cDNA library clones (for recent reviews, see Liu, 2006, 2007h). EST analysis has traditionally been conducted by sequencing random cDNA clones from cDNA libraries. Such an approach is efficient at initial stages of gene discovery, but has proven to be inefficient in the gene discovery of rarely expressed genes. The rate of gene discovery usually drops precipitously soon after reaching a level of several thousand ESTs. By using regular cDNA libraries, the most abundantly expressed genes would have been sequenced many times before the most rarely expressed genes are sequenced just once. Clearly, EST sequencing from non-normalized libraries is inefficient for gene discoveries of rarely expressed genes. Normalization decreases the prevalence of clones representing abundant transcripts and dramatically increases the efficiency of random sequencing and rare gene discovery. Normalized cDNA libraries are cDNA libraries that have been equalized in representation to reduce the representation of abundantly expressed


27

genes and to increase the representation of rarely expressed genes. While the details of how the subtraction is conducted may differ greatly, the basic principles behind normalization are the same, i.e. they all depend on the faster hybridization kinetics of abundantly expressed genes to form doublestranded complexes that can be removed by various means, whereas it takes a long time for the rarely expressed genes to reassociate. Several strategies have been developed for the normalization of cDNA libraries, but the fundamental principles behind all the normalization procedures are the same. We have used a strategy utilizing the Evrogen Trimmer-Direct Kit (http://www.evrogen.com/p3_2.shtml). This system is specially developed to normalize cDNA enriched with full length sequences (Zhulidov et al., 2004). The method involves denaturation–reassociation of cDNA, degradation of ds-fraction formed by abundant transcripts, and PCR amplification of the equalized ss-DNA fraction. The key element of this method is degradation of ds-fraction formed during reassociation of cDNA using duplex-specific nuclease (DSN) enzyme (Shagin et al., 2002). A number of specific features of DSN make it ideal for removing ds-DNA from complex mixtures of nucleic acids. DSN displays a strong preference for cleaving ds-DNA in both DNA–DNA and DNA–RNA hybrids, compared to ss-DNA and RNA, irrespective of the sequence length. Moreover, the enzyme remains stable over a wide range of temperatures and displays optimal activity at 55–65 ºC. Consequently, degradation of the ds-DNAcontaining fraction by this enzyme occurs at elevated temperatures, thereby decreasing loss of transcripts due to the formation of secondary structures and non-specific hybridization involving adapter sequences. EST analysis is one of the most rapid approaches for gene discovery. A small collection of ESTs in a species without any genome information can result in the rapid identification of a large number of genes. Gene discovery and identification is, therefore, the primary function of EST analysis. Because of the exceptionally high gene discovery rate of the EST approach, EST analysis has been extremely popular. The EST database dbEST has been one of the fastest growing databases at NCBI. As of May 30, 2008, there are 52 858 766 entries in the NCBI’s public EST database dbEST (dbEST release 053008, http://www.ncbi.nlm.nih.gov/dbEST/dbEST_ summary.html). Large EST resources are available for several major aquaculture species including Atlantic salmon, rainbow trout, catfish, oysters, and shrimps. ESTs provide the information and material basis for the development of microarrays for the analysis of genome expression as discussed below.

1.4.2 de novo sequencing of whole transcriptomes and gene discovery As detailed under sequencing technologies, all next generation sequencing platforms have the ability to generate hundreds of thousands (the 454 platform) to millions of expressed sequence tags (SOLiD and Solexa

28


sequencing platforms) using RNA as the starting material. Clearly, such sequencing projects not only allow many genes to be identified, but, importantly, also allow expression profiling through digital counting of sequence tags, as will be further discussed in Section 1.6. As compared to traditional EST analysis, the next generation sequencing technologies can rapidly produce a large number of expressed sequence tags. They probably provide a much greater power in terms of expression profiling, as accurate estimation can be made based on the number of sequenced tags. In addition, relatively accurate counting of tags from various exons may also provide information concerning alternative splicing and alternative polyadenylation. However, it may be more difficult for the identification of short sequence tags for less conserved genes as no draft genome sequences are yet available from aquaculture species. This problem will soon be alleviated when the draft genome sequences become available. In comparison, the 454 sequencing platform perhaps provides a greater power for sequence identification because of its longer sequence reads, but at the expense of the number of sequence tags to be generated that would otherwise offer greater accuracy for expression profiling based on tag counting.

1.5 Genome mapping technologies Genome mapping and sequencing is the core of structural genomics. While no whole genome draft sequences are yet available for aquaculture species, genomes of many aquaculture species have been subjected to mapping. Genome mapping can be classified into several categories based on resource needs, technology requirement, and principles used in mapping, i.e., genetic linkage mapping, QTL mapping, physical mapping, cytogenetic mapping, radiation hybrid mapping, and comparative mapping (Liu, 2007a). While cytogenetic mapping is highly useful for the identification of chromosomes and physical mapping of genes to chromosomes, its resolution is low for large-scale genome-wide mapping analysis (this is covered in Chapter 2). Limited work has been conducted in comparative mapping of aquaculture species. A recent chapter in Aquaculture Genome Technologies provided excellent coverage on comparative mapping and positional cloning (Lee and Kocher, 2007). Interested readers are referred to the chapter for details on comparative mapping.

1.5.1 Genetic linkage mapping Genetic linkage mapping is an old technology. It is purely based on cosegregation of markers within a well-defined segregating population that is often referred to as the reference family or mapping population. Genetic mapping requires two major resources: the segregating population, and the molecular markers. The segregating population can be F2 population, back-


29

cross progenies, or higher generation of intercrosses. In some cases, F1 can be used and treated as a pseudo-backcross because heterozygous markers are segregating in F1 population. However, for best results, three generation pedigrees are needed to provide non-ambiguous linkage phases. The number of individuals used for mapping analysis depends on the desired resolution. A population of 100 individuals can resolve markers that are 1 cM away (1 out of 100 are recombinant). If higher resolution is needed to detect rare recombinants, larger numbers of the mapping population can be used. Any molecular markers that are polymorphic and segregating in the mapping population in a Mendelian fashion can be used for linkage mapping. However, sequence tagged markers provide codominance and transferability across laboratories and possibly also across species borders allowing comparative mapping analysis (see below). The most often used marker type for linkage mapping is microsatellite, although SNP markers may soon dominate on linkage maps. As the advantages and disadvantages of various types of markers are detailed above, we will not repeat them here. Genetic linkage maps can be constructed upon analysis of marker segregation data within the mapping population. This is achieved by use of various software packages. Linkage maps have been constructed in over 30 major aquaculture species (Table 1.3). A recent review by Danzmann and Gharbi provided excellent details on linkage mapping, and summarized recent progress of linkage mapping in aquaculture species (Danzmann and Gharbi, 2007). It is clear, however, that the marker densities on the genetic linkage maps of aquaculture species are too low currently to provide sufficient coverage for efficient QTL analysis. The use of more markers, in particular the SNPs to be developed, should very soon change the situation.

1.5.2 Quantitative trait loci (QTL) mapping Most performance and production traits are controlled by multiple genes, and simple Mendelian genetic analysis is not therefore sufficient to provide answers as to how many genes are controlling the traits, and how they function. The multigene controlled traits are defined as quantitative traits and the loci controlling the traits are defined as QTL. QTLs can be mapped genetically by correlation of segregating markers with the traits, and such a process is referred to as QTL mapping. QTL mapping starts with creation of a population in which the traits and the markers are segregating. For instance, fish resistant to a particular disease can be crossed with susceptible fish to produce F1 fish. F2 fish can be produced from the F1 fish in which the disease trait is segregating. In a sense, QTL mapping is not any different from genetic linkage mapping except that the proper mapping population is needed in which the trait of interest is segregating along with DNA markers. QTL mapping is the core

Inter-population hybrids Interspecific haploids Interspecific hybrids Outcross

Walking catfish Japanese flounder European sea bass

Ayu Common carp Yellowtails Black tiger shrimp

Channel catfish

Brown trout Arctic charr Tilapia

AFLP, SSR SSR, genes SSR, genes SSR, AFLP, genes AFLP, SSR AFLP, SSR SSR, genes SSR, genes AFLP AFLP AFLP, SSR SSR, genes microsatellites AFLP, SSR SSR, genes, RAPD SSR AFLP

SSR, AFLP, genes

Inter-strain backcross

Outcross Inter-strain backcross Inter-strain backcross Inter-strain backcross Haploids Interspecific 3-way cross Interspecific F2 intercross Outcross Interspecific backcross Haploids Inter-strain hybrids Outcross

Atlantic salmon

AFLP, SSR, genes

Marker type(s)

Double haploids

Mapping panel(s)

Current status of linkage maps in aquaculture species

Rainbow trout

Table 1.3

527 64 302 327 174 292 552 293 506 146 463 174 369 195 272 200 673

1439

1359

Markers

Young et al., 1998 Nichols et al., 2003 Sakamoto et al., 2000 Danzmann et al., 2005 Moen et al., 2004 Gilbey et al., 2004 Gharbi et al., 2006 Woram et al., 2004 Kocher et al., 1998 Agresti et al., 2000 Lee et al., 2005 Waldbieser et al., 2001 Liu et al., 2003 Poompuang and Na-Nakorn, 2004 Coimbra et al., 2003 Chistiakov et al., 2005 Volckaert et al., 2007 Watanabe et al., 2004 Sun and Liang, 2004 Ohara et al., 2005 Wilson et al., 2002

Reference

Outcross Outcross Outcross Inter-population hybrids Outcross Inter-line double hybrids Inter-strain backcross Inter-population hybrids Inter-population hybrids Inter-population hybrids Interspecific hybrids

AFLP AFLP AFLP AFLP AFLP, SSR, genes SSR AFLP AFLP AFLP AFLP, RAPD, SSR AFLP AFLP, SSR AFLP, SSR SSR AFLP SSR

246 401 394 231–241 133–158 102 349 545 503 384 324–339 293 375 204 350 150

Moore et al., 1999 Li et al., 2003 Pérez et al., 2004 Li et al., 2006 Yu and Guo, 2003 Hubert and Hedgecock, 2004 Li and Guo, 2004 Li et al., 2005 Wang et al., 2005 Liu et al., 2006 Zhou et al., 2006 Shen et al., 2007 Ning et al., 2007 Bargelloni et al., 2007 Reith et al., 2007 Morishima et al., 2007

AFLP = amplified fragment length polymorphism, RAPD = random amplified polymorphic DNA, SSR = simple sequence repeats. Source: modified and amended from Danzmann and Gharbi, 2007.

Pacific abalone Sea urchin Guppy Yellow croaker Gilthead sea bream Atlantic halibut Loach

Zhikong scallop

White shrimp Chinese shrimp Eastern oyster Pacific oyster

Kuruma prawn

32


of aquaculture genomics as the ultimate practical goal of aquaculture genomic research is to provide tools for genetic improvements. Much progress has been made in QTL mapping in aquaculture species. A recent review by Korol et al. (2007) covered many of the examples of QTL mapping studies in aquaculture species, and interested readers are referred to this review. As a whole, QTL mapping in aquaculture species has fallen behind, and greater efforts should be devoted to this area. The practical application of QTL mapping is marker-assisted selection. There are only few examples of marker-assisted selection in aquaculture species (e.g., Fuji et al., 2007). Before the wider applications of markerassisted selection are developed, the trend is that selection will soon become whole genome-based (Meuwissen et al., 2001), as has already occurred in terrestrial livestock species. With whole genome selection, selection is performed on estimates of associations of phenotype with largest possible markers across the genome. This contrasts with the traditional markerassisted selection which is based on a small number of significant markers, thus limiting overall effectiveness. The application of whole genome selection involves using ‘training data’ to estimate ‘breeding values’ of SNP haplotypes or alleles.

1.5.3 Radiation hybrid mapping The concept of radiation hybrid mapping was initially derived from somatic cell hybrids. Back in the 1970s, technology was developed to fuse different types of cells to form hybrid cell lines. In 1990, Cox et al., resurrected the technology by fusing X-ray radiated cells (donor cells) with normal cells (recipient cells) (Cox et al., 1990). As the chromosomes of the X-ray radiated cells were broken, the cells cannot survive by themselves. However, upon fusion with a recipient cell, broken chromosomal segments from the donor cells can be fused into the recipient cells. In order to have a selection marker for the hybrid cells, a drug-resistant gene (e.g., neo) can be first inserted into the donor cell’s genome. Upon fusion of the cells, the selection drug G418 can be applied to select for hybrid cells as the recipient cells do not have the drug resistance and should be killed by the antibiotic. Fusion cells containing the neo gene would be selected for growth. Clonal expansion of such fused hybrid cells would create a panel of radiation hybrid cell lines with each containing a different segment of the broken chromosomes, along with the chromosomal segments containing the neo gene. Because radiation causes random chromosomal breakage, various chromosomal segments contained within the panel of radiated cell lines would collectively cover the entire genome, with some portions of the chromosomal segments overlapping one another. Such radiation panels are used to map the genome through radiation hybrid (RH) mapping.


33

RH mapping is based on co-retention of markers. A recent chapter in Aquaculture Genome Technologies written by Dr Caird Rexroad provides an excellent explanation for RH mapping (Rexroad, 2007), in which he wrote: ‘RH mapping strategies are based on the concept that markers which are close together on chromosomes will frequently be co-retained in the same hybrids – the probability that irradiation will induce a chromosome break between two markers decreases as the physical distance between the two markers decreases’. To provide adequate statistical support for mapping, marker retention frequencies – the percentage of times a marker is scored positive in a RH panel – is critical. Optimal retention is 20–50 % (Walter and Goodfellow, 1993). RH mapping is calculated based on the co-retention of markers in fragments across the panel. The estimated frequency of breakage between two markers is θ, which ranges from 0 to 1 and is analogous to recombination frequencies (r) used in genetic mapping. A θ value of 0 means two markers are always co-retained, a value of 1 means they are co-retained at random. This raw value is then included in multipoint analyses and transformed into centiRays (cR) – the RH map unit – using map functions similar to those of Haldane or Kosambi which are used in genetic map construction. Hence, observation of chromosome breaks between two markers in RH mapping is analogous to observing recombination between two markers in genetic mapping. In fact, the term ‘linkage’ is often used in RH mapping. The frequency of chromosome breaks between two markers is not only due to their physical distance, but also to the intensity of the radiation used to create the panel. Siden and colleagues conducted experiments to observe the effects of different dosages of radiation on a segment of the human X chromosome (Siden et al., 1992). At 5000 rad 10 % of the clones retained the entire chromosome arm, 40 % had fragments of 3–30 MB, and 50 % had fragments less than 3 MB. At 25 000 rad only 6 % had fragments larger than 3 Mb. Therefore the radiation hybrid map–distance unit is annotated with a subscript stating the dosage used to create the panel in rads, i.e. cR3000. Retention of multiple fragments from a single chromosome in a hybrid cell line complicates analyses; therefore 100–300 cell lines must be scored for a panel to construct statistically significant maps. RH mapping was initially created to map the non-polymorphic markers. Back in the mid-1990s, polymorphic markers were limiting in most species. By fusing cells of the interest species to a rodent cell line, the background genes are usually not amplified by using PCR primers designed from the genes of the species of interest. Thus ESTs were mapped to the genome maps. Later, however, it was found that RH maps were critically important for guiding the whole genome assembly as they are essentially physical linkage maps. RH mapping was mostly applied to mammalian genome mapping, but less so in aquatic species. However, it has been used for the zebrafish, an

34


aquatic model organism used to study the genetics of development, growth, reproduction, and disease resistance (Kwok et al., 1999; Geisler et al., 1999; Hukriede et al., 1999). To date, the only aquaculture species in which RH maps have been constructed is the gilthead sea bream (Senger et al., 2006; Sarropoulou et al., 2007). One reason is that higher resolution can be achieved by BAC-based physical maps. In addition, the need to map nonpolymorphic markers is drastically reduced as many polymorphic markers have now become available, especially the SNP markers. Therefore, the application of RH mapping in aquaculture species is limited.

1.5.4 Bacterial artificial chromosome (BAC)-based physical mapping BAC-based physical maps are important for the understanding of genome structure and organization, and for position-based cloning of economically important genes. A well characterized physical map can often be an important foundation for whole genome sequencing. A BAC-based physical map would also allow exploitation of existing genomic information from maprich species using comparative mapping, thus accelerating genome research in the species of interest. The first step of BAC-based physical mapping is the construction of large-insert BAC libraries. BAC libraries are large-insert genomic libraries. A recent chapter in Aquaculture Genome Technologies (He et al., 2007) provided excellent technical details on construction and characterization of BAC libraries, and related chapters by Davidson (2007) and Xu et al. (2007a) had a great coverage on details of physical mapping. Interested readers are referred to these chapters. Briefly, large inserts contained in a BAC library were derived from multiple copies of the genome broken randomly by partial restriction enzyme digest. Therefore, the BAC library can be viewed as multiple genome copies broken randomly into segments that are overlapping one another. Because the genomic segments originally from the same genome locations harbor the same restriction sites, overlapping genome segments can be aligned by the presence of the same sets of restriction fragments. A set of overlapping genome segments aligned by overlapping restriction fingerprints are then defined as a contig [a contig (from contiguous) is a set of overlapping DNA segments derived from a single genetic source], and many contigs make up the entire genome, possibly with gaps (or short overlapping segments, not supporting statistical overlapping status). The efforts to make BAC contig-based physical maps in aquaculture species are a recent event. As a result, physical maps have been only constructed in Atlantic salmon (Ng et al., 2005), tilapia (Katagiri et al., 2005), and channel catfish (Quiniou et al., 2007; Xu et al., 2007b), and a physical map is under construction in rainbow trout (Yniv Palti, USDA ARS, personal communication). It is expected that physical maps will soon be constructed in many of the important aquaculture species.


35

1.6 Genome expression analysis technologies The development of high throughput technologies for global or genomewide measurements of gene expression requires the availability of genome resources. Most often, such genome resources come in the form of whole gene sequencing or the availability of a large resource of expressed sequence tags such that the major fraction of the transcriptome is represented. Once the sequences representing all the genes of an organism or the vast majority of the genes of the organism are known, global or genome-wide measurements of gene expression can be made using either microarray technologies or sequence tag-based technologies.

1.6.1 Microarray technology While microarrays utilize several recent technological innovations, they are, at their core, simply a high-density dot blot. There are two primary approaches to microarrays, differing both in their construction and their sample labeling. Spotted arrays are constructed by spotting long oligos or cDNAs using a printing robot, whereas in situ arrays are constructed by synthesizing short oligos directly onto the slide by photolithography (for a detailed review, see Peatman and Liu, 2007). Spotted array technology encapsulates the printing of either PCR products or long oligos (60–70 mers). Traditionally referred to as cDNA arrays, spotted arrays are today just as likely to be long oligos, as the cost of synthesizing oligos continues to decline, and because the parallel PCR required to prepare for cDNA arrays is labor-intensive, costly, and requires having clones on hand. While these cDNA-associated difficulties can be overcome through hard work and collaboration among members of a species group, the printing of long oligos offers advantages in startup time, the purity of commercial oligo synthesis, easier clone tracking, and the ability to utilize all available sequences in public genetic databases for array construction. Readers are referred to Whitfield et al.’s (2002) EST sequencing and microarray research on honey bee using spotted cDNAs; Rise et al., (2004a) and von Schalburg et al. (2005) describe considerations taken in construction of salmonid spotted cDNA arrays; and Zhao et al. (2005) report validation of a porcine spotted oligo array. Operon Biotechnologies (http://www.operon.com/) is a leading provider of sets of synthetic oligos for microarray spotting, and their website provides an excellent resource for criteria used in gene selection and long oligo design. Additionally, The Institute for Genomic Research (TIGR), well known for its EST indices, provides 70-mer oligo predictions for genes in each of its indices that have been utilized by some groups (Zhao et al., 2005). Researchers should also decide in the design phase their array layout, feature duplication, and the controls to be spotted on the slide (Whitfield et al., 2002; Smyth et al., 2005).

36


A variety of microarray slides are available for printing, most are polyL-lysine and amino silane-coated (see Hessner et al., 2004 for surfacechemistry comparisons). Telechem (http://www.arrayit.com/Products/ Substrates/) and Erie Scientific (http://www.eriemicroarray.com/index. aspx) are leading providers of microarray slides. The actual robotic printing of microarrays is increasingly being outsourced to large university core labs or private companies which now have years of experience in the field. For groups that anticipate printing multiple array designs and batches and want increased printing flexibility, purchasing a spotting robot may be a good choice. Perkin Elmer (http://las.perkinelmer.com/) and Genomic Solutions (http://www.genomicsolutions.com) offer popular printing systems. In situ array technology relies on photolithography for microarray construction (Lipshutz et al., 1999), a technique often used in computer chip fabrication. In contrast to spotting nucleotide products on the slide surface, oligonucleotides are synthesized directly on the surface of the array, one base at a time. To achieve sufficient feature densities, unique physical lithographic masks are created for each array design, to either block or allow light to reach the slide. In the places the mask does not cover, light deprotects, or converts, a special protective group to a hydroxyl group. This allows the binding of a single oligo at that specific site by its phosphate group. This oligo also bears a protective group that must be deprotected before an additional oligo can be coupled to it. Through repeated cycles of deprotection and coupling, 25-mer oligos are synthesized directly on the slide at densities currently as high as 1.3 million features per array. Affymetrix (http://www.affymetrix.com/) is recognized as the developer and industry leader for in situ arrays. While their technology made genome-wide arrays a reality for model species and continues to expand the horizons of microarray research in biomedical fields, the technology has been prohibitively expensive for the smaller species groups including aquaculture species. Nimblegen Systems (http://www.nimblegen.com) has recently developed a ‘maskless’ version of the Affymetrix technology that uses digital mirrors to achieve the same effect (Nuwaysir et al., 2002) at a significantly lower startup cost, now making in situ arrays a feasible choice for aquaculture genomic research. The majority of array design considerations for in situ arrays overlap with those of spotted arrays. EST analysis, clustering, quality control, and probe selection are still necessary steps to arrive at the set of genes that will be synthesized on the array. The higher feature density allowed with in situ arrays means that more genes, duplicates, and/or controls may be included on the array, if desired. Because the per array cost is significantly higher for in situ arrays and project flexibility considerably less than for spotted arrays, researchers usually attempt to maximize the information that can be gained from each slide. Usually, desired sequences for the array are sent electronically to the company, which then carries out oligo probe selection (23–25 mers) and designs the array layout. Both Affymetrix and


37

Nimblegen use a perfect match (PM) and mismatch (MM) system that accounts for the majority of the features on in situ arrays. Mismatch probes, as their name suggests, contain one or more mismatched nucleotides in the PM probe sequence and are used to detect and screen out false background fluorescence resulting from non-specific cross-hybridization. Commonly, 10 PM and 10 MM probes are synthesized for each gene included on the array, and are believed to significantly increase the accuracy and sensitivity of gene expression detection (see Irizarry et al., 2003; Han et al., 2004; Chen et al., 2005 for more information on PM and MM probe theory). Spotted and in situ microarrays differ not only in their array construction but also in the procedures used to label and hybridize experimental samples (probes in the traditional sense) to them. Both array platforms require that you start with RNA sources. The RNA is extracted from the samples of interest. Each RNA sample is reverse transcribed to cDNA, after quantification and quality-checking by spectrophotometer measurement and agarose gel electrophoresis. From this step, differences in the procedure arise between the two microarray platforms. The cDNA samples for spotted arrays are labeled with two different fluorescent dyes, Cy3 and Cy5, which fluoresce ‘green’ and ‘red’, respectively, under two different wavelengths of light (633 nm and 543 nm). The control sample is labeled with one dye and the treatment sample with the other. Dye assignments should be swapped in replicates to avoid dyeassociated bias of hybridization (Churchill, 2002). Dye labeling is most commonly done either directly or through indirect aminoallyl labeling (see Manduchi et al., 2002; Badiee et al., 2003 for a comparison of labeling methods). The two labeled samples are hybridized simultaneously in equal amounts to the same array for 16–20 h. The hybridized array, after washing to remove unhybridized probes, is scanned under a laser scanner (e.g. Molecular Devices/Axon Instruments’ Axon 4000B) at both fluorescent wavelengths (or channels) for the two dyes. A digital image is acquired for both channels and, by overlaying the two images, a fluorescent signal ratio for each array feature is obtained. This fluorescent signal ratio indicates gene expression levels. Using the Cy3/Cy5 labeling system, yellow spots indicate approximately equal levels of mRNA from both the control and treatment samples (equal signals from the green Cy3 and the red Cy5). Features that appear red or green have hybridized a majority of mRNA from only one sample. Fluorescent intensity data for each feature are recorded, and the scanned image and data can be linked back to gene feature identities through programs such as Molecular Devices/Axon Instruments’ GenePix ProTM software. Background subtraction and normalization is customarily carried out at this point, followed by microarray analysis and validation of genes determined to be significantly differentially expressed after treatment. For in situ arrays, the RNA samples are reverse transcribed using a T7 promoter oligo-dT primer. The resulting cDNA is converted to a

38


double-stranded template by a second strand synthesis reaction. After purification, these double-stranded cDNA samples (again control and treatment) are converted by in vitro transcription to biotin-labeled cRNA using a T7 RNA polymerase. The cRNA from each sample is fragmented and hybridized to its own slide (note: no mixing of samples). Streptavidinphycoerithryn is added as the fluorescent dye for both the control and treatment samples. To clarify, each biological sample for in situ arrays is hybridized to a different slide and labeled with a single dye. Differential expression is measured by comparing the fluorescent intensity measurement of a given gene on the control slide with a separate measurement for the same gene from the treatment slide. Labeling reactions and hybridizations of in situ arrays are commonly carried out by the array provider or core lab. Several groups have experimentally compared the precision and accuracy of the two platforms using the same biological samples. Their studies may prove helpful to those considering which system to implement in their own research (see Woo et al., 2004; Yauk et al., 2004; Meijer et al., 2005). Microarray research has advanced dramatically in recent years in aquaculture or aquatic species (summarized in Table 1.4). However, the field is still in its infancy and distribution of resources remains uneven. A number of microarrays have been developed from a variety of aquaculture species that has led to the publication of a special issue in the Journal of Fish Biology devoted entirely to the description of microarrays in aquatic species (Table 1.4). Interested readers are referred to this special issue (Journal of Fish Biology, Volume 72, issue 9, 2008). To date, most published microarray studies have used PCR-amplified spotted cDNA clones to fabricate the array. However, as microarray research typically takes several years from its inception to reach publication, the recent trends toward spotted oligos and in situ microarrays may not be reflected in the aquaculture literature for several years. A welldesigned microarray can be a valuable asset to an aquaculture species group, especially if the cost per slide can be minimized to the extent that researchers can integrate transcriptomic approaches into their already established research. Microarray studies are most successful when they are just one of several approaches used to answer biological questions. For example, salmonid researchers have implemented array technology in their study of reproductive development, toxicology, physiology, and repeat structures (Rise et al., 2004b; Ewart et al., 2005; Krasnov et al., 2005; Tilton et al., 2005; Vornanen et al., 2005; Martin et al., 2006; von Schalburg et al., 2006; Roberge et al., 2007; Eichner et al., 2008; Gahr et al., 2008; Jørgensen et al., 2008; Schiøtz et al., 2008; Wynne et al., 2008; Vanya et al., 2008; Young et al., 2008). In a similar effort, microarrays have been used to identify defense related genes in enteric septicemia of catfish (ESC)resistant blue catfish and ESC-susceptible channel catfish (Peatman et al., 2007, 2008).


39

Table 1.4 Current status of microarray development in various aquaculture and aquatic species Species

Microarray platform

Reference

Salmonids

GRASP 3.5K cDNA GRASP 16K cDNA INRA 9K cDNA cGRASP 32K cDNA cGRASP 22K oligo (70) 16 950 cDNA 660 cDNA nylon 19K in situ oligo 28K in situ oligo

Rise et al., 2004a von Schalburg et al., 2005 Bonnet et al., 2007 Koop, in progress Koop, in progress Taggart et al., 2008 Ju et al., 2002 Li et al., 2006 Peatman et al., 2007, 2008; Liu et al., 2008 Jenny et al., 2007 Gracey et al., 2004 Williams et al., 2008 Douglas et al., 2008 Salem et al., 2008 Olohan et al., 2008 Geoghegan et al., 2008 Klaper et al., 2008; Kane et al., 2008 Villeneuve et al., 2008 Gracey, 2008 Diab et al., 2008 Garcia-Reyero et al., 2008 Sarropoulou et al., 2005 de la Vega et al., 2008; Robalino et al., 2007 Wang et al., 2006

Catfish

Oysters Carp Atlantic halibut Rainbow trout Three-spined stickleback Fathead minnow Goby European flounder Largemouth bass Sea bream Shrimps

5K cDNA 13.4K cDNA 13K–26K cDNA 9277 50mer oligo 37K oligo 21 500 oligo 9692 cDNA 15 000 oligo 4105 oligo 2000 oligo 12 661 cDNA 3336 cDNA 15 950 oligo 10K cDNA 3853 cDNA 2469 cDNA 3136

Due to low funding levels and a relatively small research community, aquaculture genomics stands today where the model species did almost ten years ago in the 1990s. In the same way, microarray research in aquaculture species is only in its infancy. Like researchers of humans and mice ten years ago, we are currently using microarrays to accelerate gene expression analysis under varied experimental conditions, to reveal novel functions in genes, and to discover possible gene interactions and networking through cluster analysis. To find future directions for microarray research in aquaculture species, we need only to observe microarray studies in model species today. The future looks especially promising for using microarrays for SNP analysis and QTL mapping to make tangible progress towards widespread marker-assisted selection (MAS) in aquaculture. In particular, merging positional candidate genes with expression candidate genes from microarray information may reveal QTL genes responsible for important performance traits (see Drake et al., 2006). Microarrays have, furthermore, evolved to allow studies of metabolomics and proteomics that will be

40


important in development of fish vaccines (Cretich et al., 2006). A Veterinary Immune Reagent Network has already been established in the USA toward development of a set of antibodies for use in agricultural research including aquaculture (http://www.avma.org/onlnews/javma/jun06/060615b. asp). Microarrays are also being utilized in livestock disease diagnostics, a use easily adapted for detection of outbreaks of aquaculture pathogens (Schmitt and Henderson, 2005; Baxi et al., 2006). Much of the groundwork for practical microarray research has already been laid. It is up to the aquaculture community to exploit and adapt these advances for the advantage of their respective species. In spite of the bright outlook of microarray research, emerging next generation sequencing technologies may soon replace, at least in part, the capacity of microarrays. This is because sequence-based gene expression profiling can provide not only gene identities without any ambiguity, but also more accurate assessment of genome expression based on sequence tag counting.

1.6.2 Sequence tag-based technology Tag profiling is a revolutionary approach to gene expression analysis that generates expression profiles for any transcript from any organism. Using Solexa or SOLiD sequencing technologies, millions of expressed sequence tags can be generated from a single run allowing gene expression profiles to be accurately characterized based on sequence tag counting. The major advantage of tag profiling is its high ability to identify, quantify, and annotate expressed genes on the level of the whole genome without prior sequence knowledge. Because sequence tag-based genome expression analysis does not require any existing genome resources, it is much more adaptable to aquaculture species where whole genome sequences are lacking.

1.6.3

Comparison of the microarray technology with tag- or sequence-based technology In microarray experiments, hybridization signal intensities are used to generate abundance measurements that correspond to the amount of target mRNA that has hybridized to a specific probe; and relative measurements are determined by a comparison of two samples. Tag-based technologies measure the expression level of a gene by counting the abundance of a specific transcript in a sample. This count provides an abundance measure of each gene’s expression level within the sample. Recently, some studies have compared microarray and massively parallel signature sequencing (MPSS) technology. Their results suggested a moderate correlation between the two platforms. However, one platform often detects expression for some genes that are not measured by the other platform (Coughlan et al., 2004; Oudes et al., 2005; Liu et al., 2007), suggesting that using a combina-


41

tion of transcription profiling technologies would provide more complete coverage of gene expression measurements. It is likely that different technology platforms will provide significant differences in the measurements of gene expression. Chen et al. (2007) recently found that RNA samples exhibited higher correlations within the technology platform used to measure RNA abundance rather than expected similarities due to the biological nature of the samples. In particular, the tag- or sequence-based platforms may be more variable in measuring RNA abundance than Affymetrix or Agilent microarray platforms. Therefore, comparison of RNA abundance across technology platforms requires exercise of caution. However, when relative expression between samples with different biological treatment is at issue, which most often is the most important question for aquaculture research settings, the samples were more closely clustered according to their biological nature than the technology platform (Chen et al., 2007).

1.7 Acknowledgements Research in my laboratory is supported by grants from USDA NRI Animal Genome and Genetic Mechanisms Program, USDA NRI Basic Genome Reagents and Tools Program, Mississippi-Alabama Sea Grant Consortium, Alabama Department of Conservation, USAID, National Science Foundation, and BARD. The author would like to thank Dr Huseyin Kucuktas for helping with drawings of the figures, and to thank Dr Hong Liu for her assistance with the references.

1.8 References agresti j j, seki s, cnaani a, poompuang s, hallerman e m, umiel n, hulata g, gall g a e and may b (2000) Breeding new strains of tilapia: development of an artificial center of origin and linkage map based on AFLP and microsatellite loci, Aquaculture, 185, 43–56. altshuler d, pollara v j, cowles c r, van etten w j, baldwin j, linton l and lander e s (2000) An SNP map of the human genome generated by reduced representation shotgun sequencing, Nature, 407, 513–16. bader j s (2001) The relative power of SNPs and haplotype as genetic markers for association tests, Pharmacogenomics, 2, 11–24. badiee a, eiken h g, steen v m and lovlie r (2003) Evaluation of five different cDNA labeling methods for microarrays using spike controls, BMC Biotechnol, 3, 23. bargelloni l, franch r, patarnello t, tsalavouta m, sarropoulou e, magoulas a, kotoulas g, chatziplis d, georgoudis a, louro b and power d m (2007) A genetic linkage map of the hermaphrodite teleost fish Sparus aurata L. Aquaculture, 272, Supplement 1, 243. baxi m k, baxi s, clavijo a, burton k m and deregt d (2006) Microarray-based detection and typing of foot-and-mouth disease virus, Vet J, 172, 473–81.

42


beckman j s and weber j l (1992) Survey of human and rat microsatellites, Genomics, 12, 627–31. bekal s, craig j p, hudson m e, niblack t l, domier l l and lambert k n (2008) Genomic DNA sequence comparison between two inbred soybean cyst nematode biotypes facilitated by massively parallel 454 micro-bead sequencing, Mol Genet Genomics, 279, 535–43. bentley d r (2006) Whole-genome re-sequencing, Curr Opin Genet Dev, 16, 545–52. bonnet e, fostier a and bobe j (2007) Microarray-based analysis of fish egg quality after natural or controlled ovulation, BMC Genomics, 8, 55. butler j, maccallum i, kleber m, shlyakhter i a, belmonte m k, lander e s, nusbaum c and jaffe d b (2008) ALLPATHS: de novo assembly of wholegenome shotgun microreads, Genome Res, 18, 810–20. cairney m, taggart j b and hoyheim b (2000) Characterization of microsatellite and minisatellite loci in Atlantic salmon (Salmo salar L.) and cross-species amplification in other salmonids, Mol Ecol, 9, 2175–8. campbell d and bernatchez l (2004) Generic scan using AFLP markers as a means to assess the role of directional selection in the divergence of sympatric whitefish ecotypes, Mol Biol Evol, 21, 945–56. cardoso s r, eloy n b, provan j, cardoso m a and ferreira p c (2000) Genetic differentiation of Euterpe edulis Mart. populations estimated by AFLP analysis, Mol Ecol, 9, 1753–60. cariello n f, scott j k, kat a g, thilly w g and keohavong p (1988) Resolution of a missense mutant in human genomic DNA by denaturing gradient gel electrophoresis and direct sequencing using in vitro DNA amplification: HPRT Munich, Am J Hum Genet, 42, 726–34. chen d t, chen j j and soong s j (2005) Probe rank approaches for gene selection in oligonucleotide arrays with a small number of replicates, Bioinformatics, 21, 2861–6. chen j, agrawal v, rattray m, west m a, st clair d a, michelmore r w, coughlan s j and meyers b c (2007) A comparison of microarray and MPSS technology platforms for expression analysis of Arabidopsis, BMC Genomics, 8, 414–26. chen w, kalscheuer v, tzschach a, menzel c, ullmann r, schulz m h, erdogan f, li n, kijas z, arkesteijn g, pajares i l, goetz-sothmann m, heinrich u, rost i, dufke a, grasshoff u, glaeser b, vingron m and ropers h h (2008) Mapping translocation breakpoints by next-generation sequencing, Genome Res, 18, 1143–9. chistiakov d a, hellemans b, haley c s, law a s, tsigenopoulos c s, kotoulas g, bertotto d, libertini a and volckaert f a (2005) A microsatellite linkage map of the European sea bass Dicentrarchus labrax L, Genetics, 170, 1821–6. chong l k, tan s g, yusoff k and siraj s s (2000) Identification and characterization of Malaysian river catfish, Mystus nemurus (C&V): RAPD and AFLP analysis, Biochem Genet, 38, 63–76. churchill g a (2002) Fundamentals of experimental design for cDNA microarrays, Nat Genet, 32 Supplement, 490–95. cloonan n, forrest a r, kolle g, gardiner b b, faulkner g j, brown m k, taylor d f, steptoe a l, wani s, bethel g, robertson a j, perkins a c, bruce s j, lee c c, ranade s s, peckham h e, manning j m, mckernan k j and grimmond s m (2008) Stem cell transcriptome profiling via massive-scale mRNA sequencing, Nat Methods, 5, 613–19. coimbra m r m, kobayashi k, koretsugu s, hasegawa o, ohara e, ozaki a, sakamoto t, naruse k and okamoto n (2003) A genetic linkage map of the Japanese flounder, Paralichthys olivaceus, Aquaculture, 220, 203–18. cokus s j, feng s, zhang x, chen z, merriman b, haudenschild c d, pradhan s, nelson s f, pellegrini m and jacobsen s e (2008) Shotgun bisulphite sequencing


43

of the Arabidopsis genome reveals DNA methylation patterning, Nature, 452, 215–19. cotton r g (1993) Current methods of mutation detection, Mutat Res, 285, 125–44. coughlan s j, agrawal v and meyers b (2004) A comparison of global gene expression measurement technologies in Arabidopsis thaliana, Comp Funct Genomics, 5, 245–52. cox d r, burmeister m, price e r, kim s and myers r m (1990) Radiation hybrid mapping: a somatic cell genetic method for constructing high-resolution maps of mammalian chromosomes, Science, 250, 245–50. crawford a m and cuthbertson r p (1996) Mutations in sheep microsatellites, Genome Res, 6, 876–9. cretich m, damin f, pirri g and chiari m (2006) Protein and peptide arrays: recent trends and new directions, Biomol Eng, 23, 77–88. crollius r h, jaillon o, dasilva c, ozouf-costaz c, fizames c, fischer c, bouneau l, billault a, quetier f, saurin w, bernot a and weissenbach j (2000) Characterization and repeat analysis of the compact genome of the freshwater pufferfish Tetraodon nigroviridis, Genome Res, 10, 939–49. danzmann r g and gharbi k (2007) Linkage mapping in aquaculture species, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 139–67. danzmann r g, cairney m, davidson w s, ferguson m m, gharbi k, guyomard r, holm l e, leder e, okamoto n, ozaki a, rexroad c e, 3rd, sakamoto t, taggart j b and woram r a (2005) A comparative analysis of the rainbow trout genome with 2 other species of fish (Arctic charr and Atlantic salmon) within the tetraploid derivative Salmonidae family (subfamily: Salmoninae), Genome, 48, 1037–51. davidson w s (2007) Bacterial artificial chromosome libraries and BAC-based physical mapping of aquaculture genomes, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 245–59. de la vega e, o’leary n a, shockey j e, robalino j, payne c, browdy c l, warr g w and gross p s (2008) Anti-lipopolysaccharide factor in Litopenaeus vannamei (LvALF): a broad spectrum antimicrobial peptide essential for shrimp immunity against bacterial and fungal infection, Mol Immunol, 45(7), 1916–25. diab a m, williams t d, sabine v s, chipman j k and george s g (2008) The GENIPOL European flounder Platichthys flesus L. toxicogenomics microarray: application for investigation of the response to furunculosis vaccination, J Fish Biol, 72, 2154–69. dolan p c and denver d r (2008) TileQC: a system for tile-based quality control of Solexa data, BMC Bioinformatics, 9, 250. douglas s e, knickle l c, williams j, flight r m and reith m e (2008) A first generation Atlantic halibut Hippoglossus hippoglossus (L.) microarray: application to developmental studies, J Fish Biol, 72, 2391–406. drake t a, schadt e e and lusis a j (2006) Integrating genetic and gene expression data: application to cardiovascular and metabolic traits in mice, Mamm Genome, 17, 466–79. edwards y j, elgar g, clark m s and bishop m j (1998) The identification and characterization of microsatellites in the compact genome of the Japanese pufferfish, Fugu rubripes: perspectives in functional and comparative genomic analyses, J Mol Biol, 278, 843–54. eichner c, frost p, dysvik b, jonassen i, kristiansen b and nilsen f (2008) Salmon louse (Lepeophtheirus salmonis) transcriptomes during post molting maturation and egg production, revealed using EST-sequencing and microarray analysis, BMC Genomics, 9, 126. ellegren h (2000) Microsatellite mutations in the germline: implications for evolutionary inference, Trends Genet, 16, 551–8.

44


ewart k v, belanger j c, williams j, karakach t, penny s, tsoi s c, richards r c and douglas s e (2005) Identification of genes differentially expressed in Atlantic salmon (Salmo salar) in response to infection by Aeromonas salmonicida using cDNA microarray technology, Dev Comp Immunol, 29, 333–47. felip a, martinez-rodriguez g, piferrer f, carrillo m and zanuy s (2000) AFLP analysis confirms exclusive maternal genomic contribution of meiogynogenetic sea bass (Dicentrarchus labrax L.), Mar Biotechnol (NY), 2, 301–6. fitzsimmons n n, moritz c and moore s s (1995) Conservation and dynamics of microsatellite loci over 300 million years of marine turtle evolution, Mol Biol Evol, 12, 432–40. fuji k, hasegawa o, honda k, kumasaka k, sakamoto t and okamoto n (2007) Marker-assisted breeding of a lymphocystis disease-resistant Japanese flounder (Paralichthys olivaceus), Aquaculture, 272, 291–5. gahr s a, vallejo r l, weber g m, shepherd b s, silverstein j t and rexroad c e, 3rd (2008) Effects of short-term growth hormone treatment on liver and muscle transcriptomes in rainbow trout (Oncorhynchus mykiss), Physiol Genomics, 32, 380–92. garcia-reyero n, griffitt r j, liu l, kroll k j, farmerie w g, barber d s and denslow n d (2008) Construction of a robust microarray from a non-model species largemouth bass, Micropterus salmoides (Lacêpede), using pyrosequencing technology, J Fish Biol, 72, 2354–76. geisler r, rauch g j, baier h, van bebber f, bross l, dekens m p, finger k, fricke c, gates m a, geiger h, geiger-rudolph s, gilmour d, glaser s, gnugge l, habeck h, hingst k, holley s, keenan j, kirn a, knaut h, lashkari d, maderspacher f, martyn u, neuhauss s, neumann c, nicolson t, pelegri f, ray r, rick j m, roehl h, roeser t, schauerte h e, schier a f, schonberger u, schonthaler h b, schulte-merker s, seydler c, talbot w s, weiler c, nusslein-volhard c and haffter p (1999) A radiation hybrid map of the zebrafish genome, Nat Genet, 23, 86–9. geoghegan f, katsiadaki i, williams t d and chipman j k (2008) A cDNA microarray for the three-spined stickleback, Gasterosteus aculeatus L., and analysis of the interactive effects of oestradiol and dibenzanthracene exposures, J Fish Biol, 72, 2133–53. gharbi k, gautier a, danzmann r g, gharbi s, sakamoto t, hoyheim b, taggart j b, cairney m, powell r, krieg f, okamoto n, ferguson m m, holm l e and guyomard r (2006) A linkage map for brown trout (Salmo trutta): chromosome homeologies and comparative genome organization with other salmonid fish, Genetics, 172, 2405–19. gilbey j, verspoor e, mclay a and houlihan d (2004) A microsatellite linkage map for Atlantic salmon (Salmo salar), Anim Genet, 35, 98–105. glazov e a, cottee p a, barris w c, moore r j, dalrymple b p and tizard m l (2008) A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach, Genome Res, 18, 957–64. gonen d, veenstra-vanderweele j, yang z, leventhal b and cook e h, jr (1999) High throughput fluorescent CE-SSCP SNP genotyping, Mol Psychiatry, 4, 339–43. gracey a y (2008) The Gillichthys mirabilis Cooper array: a platform to investigate the molecular basis of phenotypic plasticity, J Fish Biol, 72, 2118–32. gracey a y, fraser e j, li w, fang y, taylor r r, rogers j, brass a and cossins a r (2004) Coping with cold: An integrative, multitissue analysis of the transcriptome of a poikilothermic vertebrate, Proc Natl Acad Sci U S A, 101, 16970–75. griffiths r and orr k (1999) The use of amplified fragment length polymorphism (AFLP) in the isolation of sex-specific markers, Mol Ecol, 8, 671–4.


45

hafner m, landgraf p, ludwig j, rice a, ojo t, lin c, holoch d, lim c and tuschl t (2008) Identification of microRNAs and other small regulatory RNAs using cDNA library sequencing, Methods, 44, 3–12. halldorsson b v, istrail s and de la vega f m (2004) Optimal selection of SNP markers for disease association studies, Hum Hered, 58, 190–202. han e s, wu y, mccarter r, nelson j f, richardson a and hilsenbeck s g (2004) Reproducibility, sources of variability, pooling, and sample size: important considerations for the design of high-density oligonucleotide array experiments, J Gerontol A Biol Sci Med Sci, 59, 306–15. he l, du c, li y, scheuring c and zhang h b (2007) Construction of large-insert bacterial clone libraries and their applications, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 215–44. hedgecock d, lin j z, decola s, haudenschild c d, meyer e, manahan d t and bowen b (2007) Transcriptomic analysis of growth heterosis in larval Pacific oysters (Crassostrea gigas), Proc Natl Acad Sci U S A, 104, 2313–18. hessner m j, meyer l, tackes j, muheisen s and wang x (2004) Immobilized probe and glass surface chemistry as variables in microarray fabrication, BMC Genomics, 5, 53. hillier l w, marth g t, quinlan a r, dooling d, fewell g, barnett d, fox p, glasscock j i, hickenbotham m, huang w, magrini v j, richt r j, sander s n, stewart d a, stromberg m, tsung e f, wylie t, schedl t, wilson r k and mardis e r (2008) Whole-genome sequencing and variant discovery in C. elegans, Nat Methods, 5, 183–8. hubert s and hedgecock d (2004) Lingkage maps of microsatellite DNA markers for the Pacific oyster Crassostrea gigas, Genetics, 168, 351–62. hukriede n a, joly l, tsang m, miles j, tellis p, epstein j a, barbazuk w b, li f n, paw b, postlethwait j h, hudson t j, zon l i, mcpherson j d, chevrette m, dawid i b, johnson s l and ekker m (1999) Radiation hybrid mapping of the zebrafish genome, Proc Natl Acad Sci U S A, 96, 9745–50. hunter r l and markert c l (1957) Histochemical demonstration of enzymes separated by zone electrophoresis in starch gels, Science, 125, 1294–5. irizarry r a, hobbs b, collin f, beazer-barclay y d, antonellis k j, scherf u and speed t p (2003) Exploration, normalization, and summaries of high density oligonucleotide array probe level data, Biostatistics, 4, 249–64. jenny m j, chapman r w, mancia a, chen y a, mckillen d j, trent h, lang p, escoubas j m, bachere e, boulo v, liu z j, gross p s, cunningham c, cupit p m, tanguy a, guo x, moraga d, boutet i, huvet a, de guise s, almeida j s and warr g w (2007) A cDNA microarray for Crassostrea virginica and C. gigas, Mar Biotechnol (NY), 9, 577–91. jones a g, rosenqvist g, berglund a and avise j c (1999) Clustered microsatellite mutations in the pipefish Syngnathus typhle, Genetics, 152, 1057–63. jorde p e, palm s and ryman n (1999) Estimating genetic drift and effective population size from temporal shifts in dominant gene marker frequencies, Mol Ecol, 8, 1171–8. jørgensen sm, afanasyev s, krasnov a (2008) Gene expression analyses in Atlantic salmon challenged with infectious salmon anemia virus reveal differences between individuals with early, intermediate and late mortality, BMC Genomics, 9, 179. ju z, dunham r and liu z j (2002) Differential gene expression in the brain of channel catfish (Ictalurus punctatus) in response to cold acclimation, Mol Genet Genomics, 268, 87–95. kai y, nakayama k and nakabo t (2002) Genetic differences among three colour morphotypes of the black rockfish, Sebastes inermis, inferred from mtDNA and AFLP analyses, Mol Ecol, 11, 2591–8.

46


kalin i, shephard s and candrian u (1992) Evaluation of the ligase chain reaction (LCR) for the detection of point mutations, Mutat Res, 283, 119–23. kane m d, sringer j a, iannotti n v, gough e, johns s m, schlueter s d and sepulveda m s (2008) Identification of development and tissue-specific gene expression in the fathead minnow Pimephales promelas, Rafinesque using computational and DNA microarray methods, J Fish Biol, 72, 2341–53. karsi a, cao d, li p, patterson a, kocabas a, feng j, ju z, mickett k d and liu z (2002) Transcriptome analysis of channel catfish (Ictalurus punctatus): initial analysis of gene expression and microsatellite-containing cDNAs in the skin, Gene, 285, 157–68. katagiri t, kidd c, tomasino e, davis j t, wishon c, stern j e, carleton k l, howe a e and kocher t d (2005) A BAC-based physical map of the Nile tilapia genome, BMC Genomics, 6, 89. kijas j m, fowler j c, garbett c a and thomas m r (1994) Enrichment of microsatellites from the citrus genome using biotinylated oligonucleotide sequences bound to streptavidin-coated magnetic particles, Biotechniques, 16, 656–60, 662. klaper r, carter b j, richter c a, drevnick p e, sandheinrich m b and tillitt d e (2008) Use of a 15 k gene microarray to determine gene expression changes in response to acute and chronic methylmercury exposure in the fathead minnow Pimephales promelas Rafinesque, J Fish Biol, 72, 2207–80. kocher t d, lee w j, sobolewska h, penman d and mcandrew b (1998) A genetic linkage map of a cichlid fish, the tilapia (Oreochromis niloticus), Genetics, 148, 1225–32. korol a, shirak a, cnaani a and hallerman e (2007) Detection and analysis of quantitative trait loci (QTLs) for economic traits in aquatic species, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 169–97. krasnov a, koskinen h, afanasyev s and molsa h (2005) Transcribed Tc1-like transposons in salmonid fish, BMC Genomics, 6, 107. kucuktas h and liu z (2007) Allozyme and mitochondrial markers, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 73–85. kucuktas h, wagner b k, shopen r, gibson m, dunham, r a and liu z j (2002) Genetic analysis of Ozark Hellbenders (Cryptobranchus alleganiensis bishopi) utilizing RAPD markers, Proc Ann Conf SEAFWA 55, 126–37. kwok c, critcher r and schmitt k (1999) Construction and characterization of zebrafish whole genome radiation hybrids, Methods Cell Biol, 60, 287–302. leclerc d, wirth t and bernatchez l (2000) Isolation and characterization of microsatellite loci in the yellow perch (Perca flavescens), and cross-species amplification within the family Percidae, Mol Ecol, 9, 995–7. lee b-y and kocher t (2007) Comparative genomics and positional cloning, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 323–35. lee b y, lee w j, streelman j t, carleton k l, howe a e, hulata g, slettan a, stern j e, terai y and kocher t d (2005) A second-generation genetic linkage map of tilapia (Oreochromis spp.), Genetics, 170, 237–44. li l and guo x (2004) AFLP-based genetic linkage maps of the pacific oyster Crassostrea gigas Thunberg, Mar Biotechnol (NY), 6, 26–36. li b, kadura i, fu d j and watson d e (2004) Genotyping with TaqMAMA, Genomics, 83, 311–20. li y, byrne k, miggiano e, whan v, moore s, keys s, crocos p, preston n and lehnert s (2003) Genetic mapping of the kuruma prawn Penaeus japonicus using AFLP markers, Aquaculture, 219, 143–56. li l, xiang j, liu x, zhang y, dong b and zhang x (2005) Construction of AFLPbased genetic linkage map for Zhikong scallop, Chlamys farreri Jones et Preston and mapping of sex-linked markers, Aquaculture, 245, 63–73.


47

li z, li j, wang q, he y and liu p (2006) AFLP-based genetic linkage map of marine shrimp Penaeus (Fenneropenaeus) chinensis, Aquaculture, 261(2), 463–72. lipshutz r j, fodor s p, gingeras t r and lockhart d j (1999) High density synthetic oligonucleotide arrays, Nat Genet, 21, 20–24. liu z j (2006) Transcriptome characterization through the generation and analysis of expressed sequence tags: Factors to consider for a successful EST project, Israel Journal of Aquaculture-Bamidgeh, 58, 328–41. liu z j (2007a) Aquaculture Genome Technologies, Blackwell, Ames, IA. liu z j (2007b) Marking the genome: Restriction fragment length polymorphism (RFLP), in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 11–20. liu z j (2007c) Random amplified polymorphic DNA (RAPD), in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 21–28. liu z j (2007d) Amplified fragment length polymorphism (AFLP), in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 29–42. liu z j (2007e) Microsatellite markers and assessment of marker utility, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 43–58. liu z j (2007f) Single nucleotide polymorphism (SNP), in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 59–72. liu z j (2007g) Genomescape: characterizing the repeat structure of the genome, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 277–90. liu z j (2007h) Transcriptome characterization through the analysis of expressed sequence tags, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 301–56. liu z j (2007i) DNA sequencing technologies, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 465–76. liu z j (2007j) Sequencing the genome, in Liu (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 477–90. liu z j and cordes j f (2004) DNA marker technologies and their applications in aquaculture genetics, Aquaculture, 238, 1–37. liu z, nichols a, li p and dunham r a (1998) Inheritance and usefulness of AFLP markers in channel catfish (Ictalurus punctatus), blue catfish (I. furcatus), and their F1, F2, and backcross hybrids, Mol Gen Genet, 258, 260–68. liu z, li p, kucuktas h, nichols a, tan g, zheng x, argue b j and dunham r a (1999) Development of amplified fragment length polymorphism (AFLP) markers suitable for genetic linkage mapping of catfish, Trans Am Fish Soc, 128, 317–27. liu z, li p, kocabas a, karsi a and ju z (2001) Microsatellite-containing genes from the channel catfish brain: evidence of trinucleotide repeat expansion in the coding region of nucleotide excision repair gene RAD23B, Biochem Biophys Res Commun, 289, 317–24. liu z, karsi a, li p, cao d and dunham r (2003) An AFLP-based genetic linkage map of channel catfish (Ictalurus punctatus) constructed by using an interspecific hybrid resource family, Genetics, 165, 687–94. liu x, liu x, guo x, gao q, zhao h and zhang g (2006) A preliminary genetic linkage map of the Pacific abalone Haliotis discus hannai Ino, Mar Biotechnol (NY), 8, 386–97. liu f, jenssen t k, trimarchi j, punzo c, cepko c l, ohno-machado l, hovig e and kuo w p (2007) Comparison of hybridization-based and sequencing-based gene expression technologies on biological replicates, BMC Genomics, 8, 153. liu z, li r w and waldbieser g c (2008) Utilization of microarray technology for functional genomics in ictalurid catfish, J Fish Biol, 72, 2377–90. lyall j e, brown g m, furlong r a, ferguson-smith m a and affara n a (1993) A method for creating chromosome-specific plasmid libraries enriched in clones

48


containing [CA]n microsatellite repeat sequences directly from flow-sorted chromosomes, Nucleic Acids Res, 21, 4641–2. mackiewicz m, fletcher d e, wilkins s d, dewoody j a and avise j c (2002) A genetic assessment of parentage in a natural population of dollar sunfish (Lepomis marginatus) based on microsatellite markers, Mol Ecol, 11, 1877–83. malmgren h, gustavsson j, tuvemo t and dahl n (1996) Rapid detection of a mutation hot-spot in the human androgen receptor, Clin Genet, 50, 202–5. manduchi e, scearce l m, brestelli j e, grant g r, kaestner k h and stoeckert c j, jr. (2002) Comparison of different labeling methods for two-channel highdensity microarray experiments, Physiol Genomics, 10, 169–79. margulies m, egholm m, altman w e, attiya s, bader j s, bemben l a, berka j, braverman m s, chen y j, chen z, dewell s b, du l, fierro j m, gomes x v, godwin b c, he w, helgesen s, ho c h, irzyk g p, jando s c, alenquer m l, jarvie t p, jirage k b, kim j b, knight j r, lanza j r, leamon j h, lefkowitz s m, lei m, li j, lohman k l, lu h, makhijani v b, mcdade k e, mckenna m p, myers e w, nickerson e, nobile j r, plant r, puc b p, ronan m t, roth g t, sarkis g j, simons j f, simpson j w, srinivasan m, tartaro k r, tomasz a, vogt k a, volkmer g a, wang s h, wang y, weiner m p, yu p, begley r f and rothberg j m (2005) Genome sequencing in microfabricated high-density picolitre reactors, Nature, 437, 376–80. marnellos g (2003) High-throughput SNP analysis for genetic association studies, Curr Opin Drug Discov Devel, 6, 317–21. martin s a, blaney s c, houlihan d f and secombes c j (2006) Transcriptome response following administration of a live bacterial vaccine in Atlantic salmon (Salmo salar), Mol Immunol, 43, 1900–911. maxam a m and gilbert w (1977) A new method for sequencing DNA, Proc Natl Acad Sci U S A, 74, 560–64. may b (2003) Allozyme variation, in Hallerman E M (ed.), Population Genetics: Principles and Applications for Fisheries Scientists, American Fisheries Society, Bethesda, MD, 23–36. meijer a h, verbeek f j, salas-vidal e, corredor-adamez m, bussman j, van der sar a m, otto g w, geisler r and spaink h p (2005) Transcriptome profiling of adult zebrafish at the late stage of chronic tuberculosis due to Mycobacterium marinum infection, Mol Immunol, 42, 1185–203. meuwissen t h e, hayes b j and goddard m e (2001) Prediction of total genetic value using genome-wide dense marker maps, Genetics, 157, 1819–29. metzgar d, bytof j and wills c (2000) Selection against frameshift mutations limits microsatellite expansion in coding DNA, Genome Res, 10, 72–80. mickett k, morton c, feng j, li p, simmons m, cao d, dunham r a and liu z (2003) Assessing genetic diversity of domestic populations of channel catfish (Ictalurus punctatus) in Alabama using AFLP markers, Aquaculture, 228, 91–105. mock k e, brim-box j c, miller m p, downing m e and hoeh w r (2004) Genetic diversity and divergence among freshwater mussel (Anodonta) populations in the Bonneville Basin of Utah, Mol Ecol, 13, 1085–98. moen t, hoyheim b, munck h and gomez-raya l (2004) A linkage map of Atlantic salmon (Salmo salar) reveals an uncommonly large difference in recombination rate between the sexes, Anim Genet, 35, 81–92. moore s s, whan v, davis g p, byrne k, hetzel d j s and preston n (1999) The development and application of genetic markers for the Kuruma prawn Penaeus japonicus, Aquaculture, 173, 19–32. moran c (1993) Microsatellite repeats in pig (Sus domestica) and chicken (Gallus domesticus) genomes, J Hered, 84, 274–80. morishima k, arias-rodriguez l, nakayama i and arai k (2007) A genetic linkage map of the loach Misgurnus anguillicaudatus (Teleostei: Cobitidae), Aquaculture, 272, Supplement 1, 291.


49

ng s h, artieri c g, bosdet i e, chiu r, danzmann r g, davidson w s, ferguson m m, fjell c d, hoyheim b, jones s j, de jong p j, koop b f, krzywinski m i, lubieniecki k, marra m a, mitchell l a, mathewson c, osoegawa k, parisotto s e, phillips r b, rise m l, von schalburg k r, schein j e, shin h, siddiqui a, thorsen j, wye n, yang g and zhu b (2005) A physical map of the genome of Atlantic salmon, Salmo salar, Genomics, 86, 396–404. nichols k m, young w p, danzmann r g, robison b d, rexroad c, noakes m, phillips r b, bentzen p, spies i, knudsen k, allendorf f w, cunningham b m, brunelli j, zhang h, ristow s, drew r, brown k h, wheeler p a and thorgaard g h (2003) A consolidated linkage map for rainbow trout (Oncorhynchus mykiss), Anim Genet, 34, 102–15. ning y, liu x, wang z y, guo w, li y and xie f (2007) A genetic map of large yellow croaker Pseudosciaena crocea, Aquaculture, 264, 16–26. nuwaysir e f, huang w, albert t j, singh j, nuwaysir k, pitas a, richmond t, gorski t, berg j p, ballin j, mccormick m, norton j, pollock t, sumwalt t, butcher l, porter d, molla m, hall c, blattner f, sussman m r, wallace r l, cerrina f and green r d (2002) Gene expression analysis using oligonucleotide arrays produced by maskless photolithography, Genome Res, 12, 1749–55. ohara e, nishimura t, nagakura y, sakamoto t, mushiake k, okamoto n (2005) Genetic linkage maps of two yellowtails (Seriola quinqueradiata and Seriola lalandi), Aquaculture, 244, 41–8. okumus¸ i and çiftci y (2003) Fish population genetics and molecular markers: II. Molecular markers and their applications in fisheries and aquaculture, Turkish J Fish Aquat Sci, 3, 51–79. olohan l a, li w, wulff t, jarmer h, gracey a y and cossins a r (2008) Detection of anoxia-responsive genes in cultured cells of the rainbow trout Oncorhynchus mykiss (Walbaum), using an optimized, genome-wide oligoarray, J Fish Biol, 72, 2170–86. ostrander e a, jong p m, rine j and duyk g (1992) Construction of small-insert genomic DNA libraries highly enriched for microsatellite repeat sequences, Proc Natl Acad Sci U S A, 89, 3419–23. oudes a j, roach j c, walashek l s, eichner l j, true l d, vessella r l and liu a y (2005) Application of affymetrix array and massively parallel signature sequencing for identification of genes involved in prostate cancer progression, BMC Cancer, 5, 86. parker p g, snow a a, schug m d, booton g c and fuerst p a (1998) What molecules can tell us about populations: choosing and using a molecular marker, Ecology, 79, 361–82. patrick k (2007) 454 life sciences: illuminating the future of genome sequencing and personalized medicine, Yale J Biol Med, 80, 191–4. peatman e and liu z j (2007) Microarray fundamentals: Basic principles and application in aquaculture, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 357–70. peatman e, baoprasertkul p, terhune j, xu p, nandi s, kucuktas h, li p, wang s, somridhivej b, dunham r and liu z j (2007) Expression analysis of the acute phase response in channel catfish (Ictalurus punctatus) after infection with a Gramnegative bacterium, Dev Comp Immunol, 31, 1183–96. peatman e, terhune j, baoprasertkul p, xu p, nandi s, wang s, somridhivej b, kucuktas h, li p, dunham r, liu z j (2008) Microarray analysis of gene expression in the blue catfish liver reveals early activation of the MHC class I pathway after infection with Edwardsiella ictaluri, Mol Immunol, 45, 553–66. pérez f, erazo c, zhinaula m, volckaert f and calderón j (2004) A sex-specific linkage map of the white shrimp Penaeus (Litopenaeus) vannamei based on AFLP markers, Aquaculture, 242, 105–18.

50


poompuang s and na-nakorn u (2004) A preliminary genetic map of walking catfish (Clarias macrocephalus), Aquaculture, 232, 195–203. quiniou s m, waldbieser g c and duke m v (2007) A first generation BAC-based physical map of the channel catfish genome, BMC Genomics, 8, 40. reith m, reid d, smith c, blanchard b and martin-robichaud d (2007) A genetic linkage map for Atlantic halibut (Hippoglossus hippoglossus), Aquaculture, 272, Supplement 1, 304. rexroad iii c e (2007) Radiation hybrid mapping in aquatic species, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 313–22. rico c, rico i and hewitt g (1996) 470 million years of conservation of microsatellite loci among fish species, Proc R Soc Lond B Biol Sci, 263, 549–57. rise m l, von schalburg k r, brown g d, mawer m a, devlin r h, kuipers n, busby m, beetz-sargent m, alberto r, gibbs a r, hunt p, shukin r, zeznik j a, nelson c, jones s r, smailus d e, jones s j, schein j e, marra m a, butterfield y s, stott j m, ng s h, davidson w s and koop b f (2004a) Development and application of a salmonid EST database and cDNA microarray: data mining and interspecific hybridization characteristics, Genome Res, 14, 478–90. rise m l, jones s r, brown g d, von schalburg k r, davidson w s and koop b f (2004b) Microarray analyses identify molecular biomarkers of Atlantic salmon macrophage and hematopoietic kidney response to Piscirickettsia salmonis infection, Physiol Genomics, 20, 21–35. robalino j, almeida j s, mckillen d, colglazier j, trent h f, 3rd, chen y a, peck m e, browdy c l, chapman r w, warr g w and gross p s (2007) Insights into the immune transcriptome of the shrimp Litopenaeus vannamei: tissue-specific expression profiles and transcriptomic responses to immune challenge, Physiol Genomics, 29, 44–56. roberge c, paez d j, rossignol o, guderley h, dodson j and bernatchez l (2007) Genome-wide survey of the gene expression response to saprolegniasis in Atlantic salmon, Mol Immunol, 44, 1374–83. robison b d, wheeler p a, sundin k, sikka p and thorgaard g h (2001) Composite interval mapping reveals a major locus influencing embryonic development rate in rainbow trout (Oncorhynchus mykiss), J Hered, 92, 16–22. rogers s m, campbell d, baird s j, danzmann r g and bernatchez l (2001) Combining the analyses of introgressive hybridisation and linkage mapping to investigate the genetic architecture of population divergence in the lake whitefish (Coregonus clupeaformis, Mitchill), Genetica, 111, 25–41. ross p, hall l, smirnov i and haff l (1998) High level multiplex genotyping by MALDI-TOF mass spectrometry, Nat Biotechnol, 16, 1347–51. sakamoto t, danzmann r g, gharbi k, howard p, ozaki a, khoo s k, woram r a, okamoto n, ferguson m m, holm l e, guyomard r and hoyheim b (2000) A microsatellite linkage map of rainbow trout (Oncorhynchus mykiss) characterized by large sex-specific differences in recombination rates, Genetics, 155, 1331–45. salem m, kenney p b, rexroad c e and yao j (2008) Development of a 37 k highdensity oligonucleotide microarray: a new tool for functional genome research in rainbow trout, J Fish Biol, 72, 2187–206. sanger f, nicklen s and coulson a r (1977) DNA sequencing with chain-terminating inhibitors, Proc Natl Acad Sci U S A, 74, 5463–7. sarropoulou e, kotoulas g, power d m and geisler r (2005) Gene expression profiling of gilthead sea bream during early development and detection of stress-related genes by the application of cDNA microarray technology, Physiol Genomics, 23, 182–91. sarropoulou e, franch r, louro b, power d m, bargelloni l, magoulas a, senger f, tsalavouta m, patarnello t, galibert f, kotoulas g and geisler r (2007) A


51

gene-based radiation hybrid map of the gilthead sea bream Sparus aurata refines and exploits conserved synteny with Tetraodon nigroviridis, BMC Genomics, 8, 44. schiøtz bl, jørgensen sm, rexroad c, gjøen t, krasnov a (2008) Transcriptomic analysis of responses to infectious salmon anemia virus infection in macrophagelike cells, Virus Res, 36, 65–74. schmitt b and henderson l (2005) Diagnostic tools for animal diseases, Rev Sci Tech, 24, 243–50. seki s, agresti j j, gall gae, taniguchi n and may b (1999) AFLP analysis of genetic diversity in three populations of ayu Plecoglossus altivelis, Fish Sci, 65, 888–92. senger f, priat c, hitte c, sarropoulou e, franch r, geisler r, bargelloni l, power d and galibert f (2006) The first radiation hybrid map of a perch-like fish: the gilthead seabream (Sparus aurata L), Genomics, 87, 793–800. serapion j, kucuktas h, feng j and liu z (2004) Bioinformatic mining of type I microsatellites from expressed sequence tags of channel catfish (Ictalurus punctatus), Mar Biotechnol (NY), 6, 364–77. shagin d a, rebrikov d v, kozhemyako v b, altshuler i m, shcheglov a s, zhulidov p a, bogdanova e a, staroverov d b, rasskazov v a and lukyanov s (2002) A novel method for SNP detection using a new duplex-specific nuclease from crab hepatopancreas, Genome Res, 12, 1935–42. shen x, yang g, liu y, liao m, wang x, zhu m, song w, zou g, wei q, wang d and chen d (2007) Construction of genetic linkage maps of guppy (Poecilia reticulata) based on AFLP and microsatellite DNA markers, Aquaculture, 271, 178–87. siden t s, kumlien j, schwartz c e and rohme d (1992) Radiation fusion hybrids for human chromosomes 3 and X generated at various irradiation doses, Somat Cell Mol Genet, 18, 33–44. simmons m, mickett k, kucuktas h, li p, dunham r and liu z j (2006) Comparison of domestic and wild catfish populations provide no evidence for genetic impact, Aquaculture, 252, 133–46. smith m h and chesser r k (1981) Rationale for conserving genetic variation of fish gene pools, in Ryman N (ed.), Fish Gene Pools, Ecological Bulletin, Stockholm, 34, 13–20. smyth g k, michaud j and scott h s (2005) Use of within-array replicate spots for assessing differential expression in microarray experiments, Bioinformatics, 21, 2067–75. somridhivej b, wang s, sha z, liu h, quilang j, xu p, li p and liu z j (2008) Characterization, polymorphism assessment, and database construction for microsatellites from BAC end sequences of catfish: a resource for integration of linkage and physical maps, Aquaculture, 275, 76–80. sorrentino r, potolicchio i, ferrara g b and tosi r (1992) A new approach to HLA-DPB1 typing combining DNA heteroduplex analysis with allele-specific amplification and enzyme restriction, Immunogenetics, 36, 248–54. southern e m (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis, J Mol Biol, 98, 503–17. steele c a , wheeler p a and thorgaard g h (2008) Mitochondrial and maternal effects on growth in clonal rainbow, Plant and Animal Genomes XVI Conference, 12–16 January, San Diego, CA, abstract, http://www.intl-pag.org/16/ abstracts/PAG16_P05p_619.html, accessed December 2008. steinberg e k, lindner k r, gallea j, maxwell a, meng j and allendorf f w (2002) Rates and patterns of microsatellite mutations in pink salmon, Mol Biol Evol, 19, 1198–202. storm n, darnhofer-patel b, van den boom d and rodi c p (2003) MALDI-TOF mass spectrometry-based SNP genotyping, Methods Mol Biol, 212, 241–62.

52


stram d o (2004) Tag SNP selection for association studies, Genet Epidemiol, 27, 365–74. sun x w and liang l q (2004) A genetic linkage map of common carp (Cyprinus carpio L.) And mapping of a locus associated with cold tolerance, Aquaculture, 238, 165–72. sun y, song w, zhong y, zhang r, abatzopoulos t j and chen r (1999) Diversity and genetic differentiation in Artemia species and populations detected by AFLP markers, Int J Salt Lake Res, 8, 341–50. suzuki y, orita m, shiraishi m, hayashi k and sekiya t (1990) Detection of ras gene mutations in human lung cancers by single-strand conformation polymorphism analysis of polymerase chain reaction products, Oncogene, 5, 1037–43. taggart j b, bron j e, martin s a m, seear p j, hoyheim b, talbot r, carmichael s n, villeneuve l a n, sweeney g e, houlihan d f, secombes c j, tocher d r and teale a j (2008) A description of the origins, design and performance of the TRAITS-SGP Atlantic salmon Salmo salar L. cDNA microarray, J Fish Biol, 72, 2071–94. tautz d (1989) Hypervariability of simple sequences as a general source for polymorphic DNA markers, Nucleic Acids Res, 17, 6463–71. tilton s c, gerwick l g, hendricks j d, rosato c s, corley-smith g, givan s a, bailey g s, bayne c j and williams d e (2005) Use of a rainbow trout oligonucleotide microarray to determine transcriptional patterns in aflatoxin B1-induced hepatocellular carcinoma compared to adjacent liver, Toxicol Sci, 88, 319–30. toth g, gaspari z and jurka j (2000) Microsatellites in different eukaryotic genomes: survey and analysis, Genome Res, 10, 967–81. van lith h a and van zutphen l f (1996) Characterization of rabbit DNA microsatellites extracted from the EMBL nucleotide sequence database, Anim Genet, 27, 387–95. van tassell c p, smith t p l, matukumalli l k, taylor j f, schnabel r d, lawley c t, haudenschild c d, moore s s, warren w c and sonstegard t s (2008) SNP discovery and allele frequency estimation by deep sequencing of reduced representation libraries, Nat Meth, 5, 247–52. vanya ewart k, williams j, richards r c, gallant j w, melville k and douglas s e (2008) The early response of Atlantic salmon (Salmo salar) macrophages exposed in vitro to Aeromonas salmonicida cultured in broth and in fish, Dev Comp Immunol, 32, 380–90. vera j c, wheat c w, fescemyer h w, frilander m j, crawford d l, hanski i and marden j h (2008) Rapid transcriptome characterization for a nonmodel organism using 454 pyrosequencing, Mol Ecol, 17, 1636–47. villeneuve d l, knoebl i, larkin p, miracle a l, carter b j, denslow n d and ankley g t (2008) Altered gene expression in the brain and liver of female fathead minnows Pimephales promelas Rafinesque exposed to fadrozole, J Fish Biol, 72, 2281–340. volckaert f a m j, batargias c, chatziplis d, chistiakov d, guo y, haley c s, hellemans b, kotoulas g, law a, libertini a, mcandrew b j, tsigenopoulos c and whitaker h a (2007) A second generation linkage map of European sea bass, Aquaculture, 272, Supplement 1, 316. von schalburg k r, rise m l, cooper g a, brown g d, gibbs a r, nelson c c, davidson w s and koop b f (2005) Fish and chips: various methodologies demonstrate utility of a 16 006-gene salmonid microarray, BMC Genomics, 6, 126. von schalburg k r, mccarthy s p, rise m l, hutson j c, davidson w s and koop b f (2006) Expression of morphogenic genes in mature ovarian and testicular tissues: potential stem-cell niche markers and patterning factors, Mol Reprod Dev, 73, 142–52.


53

vornanen m, hassinen m, koskinen h and krasnov a (2005) Steady-state effects of temperature acclimation on the transcriptome of the rainbow trout heart, Am J Physiol Regul Integr Comp Physiol, 289, R1177–84. vos p, hogers r, bleeker m, reijans m, van de lee t, hornes m, frijters a, pot j, peleman j, kuiper m et al. (1995) AFLP: a new technique for DNA fingerprinting, Nucleic Acids Res, 23, 4407–14. waldbieser g c, bosworth b g, nonneman d j and wolters w r (2001) A microsatellite-based genetic linkage map for channel catfish, Ictalurus punctatus, Genetics, 158, 727–34. walter m a and goodfellow p n (1993) Radiation hybrids: irradiation and fusion gene transfer, Trends Genet, 9, 352–6. wang l l, song l s, chang y q, xu w, ni d j and guo x m (2005) A preliminary genetic map of Zhikong scallop (Chlamys farreri Jones et Preston 1904), Aquaculture Res, 36, 643–53. wang b, li f, dong b, zhang x, zhang c and xiang j (2006) Discovery of the genes in response to white spot syndrome virus (WSSV) infection in Fenneropenaeus chinensis through cDNA microarray, Mar Biotechnol, 8, 491–500. wang b, li f, luan w, xie y, zhang c, luo z, gui l, yan h and xiang j (2008a) Comparison of gene expression profiles of Fenneropenaeus chinensis challenged with WSSV and Vibrio, Mar Biotechnol (NY), 10, 644–75. wang s, sha z, sonstegard t s, liu h, xu p, somridhivej b, peatman e, kucuktas h and liu z j (2008b) Quality assessment parameters for EST-derived SNPs from catfish, BMC Genomics, 9, 450. watanabe t, fujita h, yamasaki k, seki s and taniguchi n (2004) Preliminary study on linkage mapping based on microsatellite DNA and AFLP markers using homozygous clonal fish in ayu (Plecoglossus altivelis), Mar Biotechnol (NY), 6, 327–34. weber j l and wong c (1993) Mutation of human short tandem repeats, Hum Mol Genet, 2, 1123–8. welsh j and mcclelland m (1990) Fingerprinting genomes using PCR with arbitrary primers, Nucleic Acids Res, 18, 7213–18. whitehead a, anderson s l, kuivila k m, roach j l and may b (2003) Genetic variation among interconnected populations of Catostomus occidentalis: implications for distinguishing impacts of contaminants from biogeographical structuring, Mol Ecol, 12, 2817–33. whitfield c w, band m r, bonaldo m f, kumar c g, liu l, pardinas j r, robertson h m, soares m b and robinson g e (2002) Annotated expressed sequence tags and cDNA microarrays for studies of brain and behavior in the honey bee, Genome Res, 12, 555–66. williams j g, kubelik a r, livak k j, rafalski j a and tingey s v (1990) DNA polymorphisms amplified by arbitrary primers are useful as genetic markers, Nucleic Acids Res, 18, 6531–5. williams d r, li w, hughes m a, gonzalez s f, vernon c, vidal m c, jeney z, jeney g, dixon p, mcandrew b, bartfai r, orban l, trudeau v, rogers j, matthews l, fraser e j, gracey a y and cossins a r (2008) Genomic resources and microarrays for the common carp Cyprinus carpio L, J Fish Biol, 72, 2095–117. wilson k, li y, whan v, lehnert s, byrne k, moore s, pongsomboon s, tassanakajon a, rosenberg g, ballment e, fayazi z, swan j, kenway m and benzie j (2002) Genetic mapping of the black tiger shrimp Penaeus monodon with amplified fragment length polymorphism, Aquaculture, 204, 297–309. woo y, affourtit j, daigle s, viale a, johnson k, naggert j and churchill g (2004) A comparison of cDNA, oligonucleotide, and Affymetrix GeneChip gene expression microarray platforms, J Biomol Tech, 15, 276–84.

54


woram r a, mcgowan c, stout j a, gharbi k, ferguson m m, hoyheim b, davidson e a, davidson w s, rexroad c and danzmann r g (2004) A genetic linkage map for Arctic char (Salvelinus alpinus): evidence for higher recombination rates and segregation distortion in hybrid versus pure strain mapping parents, Genome, 47, 304–15. wynne j w, o’sullivan m g, cook m t, stone g, nowak b f, lovell d r and elliott n g (2008) Transcriptome analyses of amoebic gill disease-affected Atlantic salmon (Salmo salar) tissues reveal localized host gene suppression, Mar Biotechnol (NY), 10, 388–403. xu p, wang s, liu l, peatman e, somridhivej b, thimmapuram j, gong g and liu z (2006) Channel catfish BAC-end sequences for marker development and assessment of syntenic conservation with other fish species, Anim Genet, 37, 321–6. xu p, wang s and liu z (2007a) Physical characterization of aquaculture genomes through BAC end sequencing, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 261–74. xu p, wang s, liu l, thorsen j, kucuktas h and liu z (2007b) A BAC-based physical map of the channel catfish genome, Genomics, 90, 380–88. yauk c l, berndt m l, williams a and douglas g r (2004) Comprehensive comparison of six microarray technologies, Nucleic Acids Res, 32, e124. young w p, wheeler p a, coryell v h, keim p and thorgaard g h (1998) A detailed linkage map of rainbow trout produced using doubled haploids, Genetics, 148, 839–50. young w p, ostberg c o, keim p and thorgaard g h (2001) Genetic characterization of hybridization and introgression between anadromous rainbow trout (Oncorhynchus mykiss irideus) and coastal cutthroat trout (O. clarki clarki), Mol Ecol, 10, 921–30. young n d, cooper g a, nowak b f, koop b f and morrison r n (2008) Coordinated down-regulation of the antigen processing machinery in the gills of amoebic gill disease-affected Atlantic salmon (Salmo salar L.), Mol Immunol, 45, 2581–97. yu z and guo x (2003) Genetic linkage map of the eastern oyster Crassostrea virginica Gmelin, Biol Bull, 204, 327–38. zane l, bargelloni l and patarnello t (2002) Strategies for microsatellite isolation: a review, Mol Ecol, 11, 1–16. zhao s h, recknor j, lunney j k, nettleton d, kuhar d, orley s and tuggle c k (2005) Validation of a first-generation long-oligonucleotide microarray for transcriptional profiling in the pig, Genomics, 86, 618–25. zhang y, liang l, jiang p, li d, lu c and sun x (2008) Genome evolution trend of common carp (Cyprinus carpio L.) as revealed by the analysis of microsatellite loci in a gynogentic family, J Genet Genomics, 35, 97–103. zhou z, bao z, dong y, wang s, he c, liu w, wang l and zhu f (2006) AFLP lingkage map of sea urchin constructed using an interspecific cross between Strongylocentrous nudus (Venus) and S. intermedius (Mars), Aquaculture, 259, 56–65. zhulidov p a, bogdanova e a, shcheglov a s, vagner l l, khaspekov g l, kozhemyako v b, matz m v, meleshkevitch e, moroz l l, lukyanov s a and shagin d a (2004) Simple cDNA normalization using kamchatka crab duplexspecific nuclease, Nucleic Acids Res, 32, e37.

2 Genetic improvement of finfish G. Hulata, Agricultural Research Organization, Israel, and B. Ron, Israel Oceanographic & Limnological Research Ltd, Israel

Abstract: This chapter focuses on the major genetic approaches, technologies and methodologies that have shaped the aquaculture industry in recent years. Classic selective breeding programs (cross-breeding and hybridization) are the mainstream of finfish genetic improvement, and will continue to be the main engine driving the global finfish aquaculture industry forward. Breeding programs have been expanded, their design optimized and many new ones initiated since the late 1990s. Advances in application of biotechnology to fishes have provided tools that can be used to genetically change (improve) cultured populations using non-selective breeding methods through manipulations of genes and chromosomes (mainly triploidy). Cytological methodologies are useful tools helping with chromosomal gene mapping and with validation of aquacultured finfish species and hybrids. Modern technology has brought new types of molecular markers into play, and their application has allowed rapid progress into many aquaculture investigations. These include quantification of genetic variability and inbreeding, parentage assignments, species and strain identification, construction of high-resolution genetic linkage maps for aquaculture species and the detection of quantitative trait loci. They also offer the opportunity to include genomic information in breeding programmes (marker assisted selection; MAS). Advances have been made in developing genomic and bioinformatic tools. Although gene transfer technology has yielded promising products, their future is questionable due to severe controversies over public health and environmental issues. Use of embryonic stem (ES) cell lines is being investigated and may prove to be an alternative approach for gene transfer. Key words: Breeding programs, biotechnology, manipulations of genes and chromosomes, cytogenetics, quantitative trait loci (QTL), marker assisted selection (MAS), genomic and bioinformatic tools, gene transfer, embryonic stem cells.

2.1 Introduction: current status of aquaculture genetics The status and prospects of aquaculture genetics have been repeatedly reviewed during the last decade for specific groups of fish or for the industry in general (e.g., Gjedrem, 2000, 2002; Knibb, 2000; Lymbery et al., 2000;

56


Dunham et al., 2001; Hulata, 2001; Myers et al., 2001; Fjalestad et al., 2003; Okamoto, 2005; Hershberger, 2006; Mair, 2007). A few relevant books, each covering a specific aspect of the field, have also been published (Hallerman, 2003; Dunham, 2004; Gjedrem, 2005; Liu, 2007a). Although classic selective breeding methods as well as emerging technologies are available and contribute to the progress of the industry, their application is not yet evenly spread over globally cultured species and culture areas (Hulata, 2001). How much of the nearly 48 million tonnes cultured globally (2005 estimate; FAO, 2007) stems from genetically improved stocks is hard to tell. Some five years ago, Gjedrem (2002) estimated that genetically improved stocks accounted for no more than 10 % of aquaculture production. ‘This figure is undoubtedly rising in developed countries, as the benefits of genetic improvement become apparent, but it is almost certainly much lower in most developing countries’ (Mair, 2007). With major producers such as China and other south-eastern Asian countries (FAO, 2007) lagging behind in application of genetic technologies in their aquaculture industries, it is unlikely to be more than 20 % at present. It is not our intention to duplicate the above-mentioned reviews, but rather to focus on the new approaches, technologies and methodologies that have shaped the field in recent years.

2.2 2.2.1

Key drivers for genetic improvement of finfish

Improving growth rate, disease resistance and other quality traits by selective breeding and other methods Classical breeding programs (selective breeding, cross-breeding and hybridization) are the mainstream of finfish genetic improvement (Bartley et al., 2001; Gjedrem, 2005). The impact of selective breeding programs on the aquaculture industry can be exemplified by the wide global distribution of the Donaldson strain of rainbow trout (Parsons, 1998), the success of the Norwegian Atlantic salmon breeding program (Gjedrem, 2000) and the progressing dissemination of the selectively bred Nile tilapia, known as genetically improved farmed tilapia – GIFT (Pullin, 2007). Breeding programs have been expanded, and many new ones initiated during the last decade – see examples in Table 2.1. The breeding goal in most of these programs was improving growth rate. Whereas in the past improving growth rate was the most common breeding goal, new traits have been incorporated more recently in breeding programs (Table 2.2). As fish welfare is becoming a crucial issue for the aquaculture industry (Ashley, 2007), attention has also been given recently to selection for sustainability and animal welfare-related traits (Olesen et al., 2000, 2003; Bentsen and Olesen, 2002). Attention is also given to the possible effects of selection on the social behaviour and growth pattern of the fish (Brännäs

Genetic improvement of finfish

57

Table 2.1 Examples of recent breeding programmes Species

Reference

Atlantic cod (Gadus morhua) Atlantic salmon (Salmo salar) Common carp (Cyprinus carpio) Gilthead seabream (Sparus aurata) Hybrid striped bass (Morone chrysops × M. saxatilis) Lake Malawi tilapia (Oreochromis shiranus) Mediterranean sea bass (Dicentrarchus labrax L.) Nile tilapia (O. niloticus) Red sea bream (Pagrus major) Rohu carp (Labeo rohita)

Gjerde et al., 2004 Quinton et al., 2005; Kolstad et al., 2006 Vandeputte, 2003; Kocour et al., 2007 Gorshkov et al., 2004 Garber and Sullivan, 2006 Maluwa and Gjerde, 2006a,b, 2007; Maluwa et al., 2006 Saillant et al., 2006 Ponzoni et al., 2005; Li et al., 2006 Murata et al., 1996 Gjerde et al., 2002; Reddy et al., 2002

Table 2.2 Examples of production- and consumer-related breeding-goal traits in recent breeding programmes Trait Production-related Age at maturity Eliminating vertebral deformity Feed efficiency Reproductive traits Stress, disease and parasite resistance

Consumer-related Appearance Body composition Carcass quality

Species

Reference

Rainbow trout (On. mykiss) Atlantic salmon (S. salar) Atlantic cod (Gadus morhua) Atlantic salmon (S. salar) Coho salmon (On. kisutch) Rainbow trout (On. mykiss) Atlantic salmon (S. salar)

Kause et al., 2003a

Rainbow trout (On. mykiss) Rainbow trout (On. mykiss) Coho salmon (On. kisutch)

Kause et al., 2003b, 2004

Gjerde et al., 2005 Kolstad et al., 2006 Kolstad et al., 2004, 2005b; Kause et al., 2006b; Quinton et al., 2007 Gall and Neira, 2004; Gallardo et al., 2004a Pottinger and Carrick, 1999; Henryon et al., 2005 Kolstad et al., 2005a; Ødegård et al., 2006, 2007a,b

Tobin et al., 2006; Kause et al., 2007; Quillet et al., 2007 Neira et al., 2004

et al., 2005). Improvements have also been made in breeding programs through the introduction of new methodology for measuring complex traits, such as flesh color or feed efficiency [in rainbow trout (On. mykiss) – Helge Stien et al., 2006; Kause et al., 2006a].

58


Advances in designing breeding programs in aquaculture Because broodstocks are limited in size, inbreeding is an inherent problem in many breeding programs (Gjedrem, 2005). Efforts have been made recently to optimize mating designs for reducing effects of inbreeding in breeding programs (Gjerde et al., 1996; Villanueva et al., 1996; Sonesson and Meuwissen, 2000, 2002; Sonesson et al., 2003; Gallardo et al., 2004b; Dupont-Nivet et al., 2006; Holtsmark et al., 2006, 2008; D’Agaro et al., 2007), and in improving the experimental designs and statistical models to enhance genetic gains (Sonesson et al., 2005; Hinrichs et al., 2006; Martinez et al., 2006a,b). In addition, emerging technologies based on molecular markers and genomic approaches are progressively rising in importance, and efforts are being made to involve molecular approaches in breeding programs (Fjalestad et al., 2003; Silverstein et al., 2006). A step further towards improving the design of breeding program was taken by Hayes et al. (2006) in their comparison of different strategies for using molecular marker information in order to maximize genetic diversity in the base population. Combining available phenotypic information for the traits of interest with marker data, they propose, would ‘ensure that as much genetic variance as possible, for as many traits as possible, is captured in the base population’.

2.2.2

Improving performance and other traits by non-selective breeding methods Advances in application of biotechnology to fishes (reviewed by Melamed et al., 2002) have provided tools that can be used to genetically change (improve) cultured populations using non-selective breeding methods through manipulations of genes and chromosomes (Rasmussen and Morrissey, 2007). The different approaches will be discussed in more detail below. Chromosome set manipulations (gynogenesis, androgenesis and polyploidy) Although chromosome-set manipulations, which have been heavily investigated since the 1970s, have not resulted in many commercial applications to advance the aquaculture industry (Khan et al., 2000; Hulata, 2001), these manipulations still attract interest (Arai, 2001; Felip et al., 2001a; Gomelsky, 2003; Komen and Thorgaard, 2007), and research has expanded to more species with emphasis on newly-cultured species (Table 2.3). The physiological effects of polyploidy are also being investigated (e.g., Peruzzi et al., 2005; Taylor et al., 2007; Maxime, 2008). The most common applications of these procedures are production of triploids to prevent reproduction and improve growth rate (reviewed by Tiwary et al., 2004), and cloning through gynogenesis and androgenesis (reviewed by Pandian and Kirankumar, 2003; Komen and Thorgaard, 2007). Triploidy is also used


59

Table 2.3 Examples of chromosome manipulations in newly culture species Species

Reference

European sea bass (Dicentrarchus labrax) Sunshine bass (M. chrysops × M. saxatilis) Largemouth bass (Micropterus salmoides) Turbot (Scophthalmus maximus)

Felip et al., 2001a,b, 2002; Peruzzi et al., 2004; Bertotto et al., 2005 Kerby et al., 2002

Barfin flounder (Verasper moseri) Sturgeon (Acipenser sp.) Atlantic halibut (Hippoglossus hippoglossus)

Gomelsky et al., 2004; Neal et al., 2004 Piferrer et al., 2000, 2003, 2004; Cal et al., 2006 Mori et al., 2006 Flynn et al., 2006; Grunina et al., 2005, 2006 Tvedt et al., 2006

for genetic mapping (Nomura et al., 2006). Although resulting in high degree of sterility, triploidy does not always confer significant improvement of growth (e.g., Mori et al., 2006). Production of triploids would be more efficient by mating induced tetraploids with normal diploids; this has so far been restricted to rainbow trout, since in no other commercial finfish species have viable and fertile tetraploids been obtained (Arai, 2001; Babiak et al., 2002a,b). For other species, triploids are produced as all-female populations by using spermatozoa of artificially sex-reversed (often gynogenetic) males, so as to assure their complete sterility (e.g., Arai, 2000; Rothbard et al., 2000; Rothbard, 2006 and Fig. 2.1). This is because triploid males sometimes show gonadal development and often are not completely sterile (e.g., Pandian and Koteeswaran, 1998; Arai, 2000, 2001; Felip et al., 2001a; Oshima et al., 2005; Sousa-Santos et al., 2007). Commercial production and culture of (all-female) triploid fish is so far limited to brown trout, rainbow trout, Atlantic and Chinook salmon and European sea bass. Additionally, commercial production of triploid grass carp is carried out for stocking native bodies of water to control vegetation. Cytogenetics During the 1990s, the number of cytogenetic studies of marine fishes has increased. Its main application, however, has been in solving systematic and taxonomy issues rather than genetic improvement. Cytogenetic studies can help in predicting the success of inter-specific hybridization between species; successful hybridization occurs predominantly between closely-related species having identical chromosome structure and numbers, or at least identical number of chromosome arms (e.g., Kim et al., 1995). Resulting F1 are often reproductively viable, although in some cases they are sterile (in most cases due to being triploids).

60

New technologies in aquaculture ♂ Albino grass carp (XY)

♀ Wild-type grass carp (XX)

♀ Albino grass carp (XX)

♂ Common carp (XY)

Sperm (X & Y)

UV-irradiated eggs

Eggs (X)

UV-irradiated sperm

Fertilization

Fertilization

Shock Lateshock

♀♀ XX Female monosex (2nd Task)

♂♂ ♀♀ (YY) (XX) Homozygous progeny

MT sexinversion ♂♂ XX Gynogenetic males

Fertilization

Sperm bank

Sperm bank

Early-shock

♂♂ XY Male monosex (1st Task)

♀♀ XXX Female triploids (3rd Task)

Lateshock

♀♀ XXXX 4N-females (4th Task) 2N gametes Fertilization

♀♀ XXX Female triploids (5th Task)

Fig. 2.1 Schematic presentation of ploidy manipulations on grass carp to produce XXX female triploids (reproduced with permission from Rothbard, 2006).


61

Another area where cytogenetics has played an important role is studies of sex determination (reviewed by Ezaz et al., 2006). Knowledge on sex determination may contribute to efficient production of monosex populations, which in turn may contribute to improved production efficiency in various cultured species (e.g., tilapias). Cytogenetics is also playing an important role in the verification of chromosome-set manipulations as well as for gene mapping (Gorshkova, 2006). Study of sex chromosomes: Ten sex-determination systems are known among fishes. The unusual cytology and exceptional evolution of sex chromosomes lead to numerous basic questions related to why and how sex chromosomes evolved. This was the source of a century-long debate from the time when H.J. Muller suggested that sex chromosome pairs evolved eventually from a pair of autosomes (Muller, 1914). With regard to cytological examination of sex chromosome evolution, fishes are the most fascinating of vertebrate groups. Fishes represent the largest vertebrate group which displays the widest diversity of sex determination and sex chromosomal systems, including gonochorism (separate sexes), hermaphroditism (individuals displaying both sexes) and unisexuality (all female-species). Using cytogenetic methodologies, among others, it was revealed that in gonochoristic fishes, the gender may be determined genetically – ranging from a single-allele determination to chromosomal sex determination. In addition, it was shown that polygenic sex determination and sex determination by genotype–environment interaction take place in fishes (see reviews by Devlin and Nagahama, 2002 and Ezaz et al., 2006). Cytogenetic studies play an important role in the identification of the various sturgeon species and hybrids. Inter-specific hybridization is well known in Acipenseriformes and can be advantageous in aquaculture (Steffens et al., 1990; Gorshkova et al., 1996; Fontana, 2002; Gorshkova, 2006). Lately, Fopp-Bayat et al. (2007) performed cytogenetic analysis by preparing chromosomes from the gill epithelium of Acipenser baeri × (Huso huso × Acipenser ruthenus) hybrids in both diploid and triploid states. Karyological inspection of Russian imported sturgeons, reared at the Kibbutz Dan fish farm, Israel, were conducted on hybrids of Russian sturgeon (Acipenser guldenstadti) and great (beluga) sturgeon (Huso huso). Results showed that the consistent mode of 2N was 181–190 and the karyotype consisted of 78 metacentric and submetacentric, 16 acrocentric, and about 88 micro-chromosomes. The intermediate origin of the imported sturgeon hybrid confirmation, based on different number of chromosomes, points at the polyploidy origin of the Acipenseridae, and allowed the geneticists to formulate recommendations concerning conservation and genetic management of cultured sturgeon stocks in Israel (Gorshkova et al., 1996; Gorshkova, 2006). During 1992–1995, Groshkova and co-workers conducted chromosome set manipulation research using the economically important marine finfish, gilthead seabream (Gorshkova et al., 1995; Knibb et al., 1998a, b). These

62


studies led to the establishment of a protocol that provided gilthead sea bream gynogenetic and triploid progenies. In addition, these researchers achieved the production of meiotic gynogenetic sea bass progeny using heat shocks to eggs fertilized with UV-irradiated sperm (Gorshkova et al., 1995; Knibb et al., 1998a, b). As a result, a direct karyological confirmation concerning the hybrid nature and triploid origin of the offspring were described using karyotypes of chromosomally-manipulated forms with ‘marker’ chromosomes (Gorshkov et al., 1998). Another study was done during 1999, when Gorshkova and co-workers commenced cytogenetic inspection of white grouper (E. aeneus) early embryonic development (Gorshkova et al., 2002b). Although one of the most valuable fishes in the Mediterranean basin, white grouper has a severe limitation in commercial culture as a result of the unpredictable and often low quality of spawned eggs, embryos with low survival rates and escalating larvae mortality. The percentage of cytogenetically abnormal embryos carrying diverse types of chromosomal aberrations varied significantly amongst spawnings and ranged from 35.5–79 %. Continuous examination of subsequent spawning of different parental fishes using cytogenetic monitoring of the early embryonic stages would be of immediate interest for future genetic broodstock management of the white grouper (Gorshkova et al., 2002a). Aid in gene mapping: Cytological methodologies have been employed in chromosomal gene mapping of some aquacultured finfish species. This technique has been used mainly as a complementary approach to identify particular chromosomes (Phillips and Reed, 1996; Cnaani et al., 2007a, b; Phillips et al., 2006). Using fluorescence in situ hybridization (FISH) and linkage mapping, Cnaani and co-workers showed that in tilapia the sox2 and sox14 genes are on separate chromosomes. The rainbow trout (On. mykiss) genetic linkage groups have been assigned to specific chromosomes in the OSU (2N = 60) strain using FISH with bacterial artificial chromosomes (BAC) probes containing genes mapped to each linkage group. The set of BACs compiled for this research will be especially useful in construction of genome maps and identification of quantitative trait locus/loci (QTL) for important traits in other salmonid fishes (Phillips et al., 2006; see further discussion below). Molecular markers Since the 1960s, electrophoretic studies of proteins (allozymes, or allelic forms of isozymes) have provided the primary tool for studying genetic diversity in fisheries and aquacultured stocks (Liu and Cordes, 2004; Verspoor et al., 2005; Kucuktas and Liu, 2007). The main uses of allozyme electrophoresis have been for stock identification and management (in the wild as well as aquaculture), analysis of population genetics processes such as inbreeding and genetic drift, molecular tagging and parentage analysis and, to a much lesser extent, for genetic mapping (Liu and Cordes, 2004).


63

The major drawbacks of allozymes, apart from the need for fresh or frozen samples of relatively large quantities, are the limited variability and poor coverage of the genome. Nevertheless, allozyme analysis has made a significant contribution to our understanding of the genetic diversity and the structure of wild genetic resources in many species, and especially the Atlantic salmon (Verspoor et al., 2005). Since the mid-1980s, DNA-based analyses (e.g., Artamonova, 2007) that are characterized by higher genetic variation and polymorphism, as well as higher genome coverage, have gradually substituted for allozymes. Modern biotechnology has introduced into play new types of molecular markers, as well as other techniques that will be discussed below (see Chapter 1 in this volume for a detailed account). The new platform technologies have opened up vast possibilities to the aquacultural biotechnologist (Melamed et al., 2002).The various types of DNA markers – mitochondrial DNA, restriction fragment length polymorphism (RFLP), random amplified polymorphic DNA (RAPD), amplified fragment length polymorphism (AFLP), microsatellite, single nucleotide polymorphisms (SNP) and expressed sequence tag (EST) markers – have been described in detail by Liu and Cordes (2004) and in Chapters 2–8 in Liu (2007a). The application of DNA markers has allowed rapid progress in aquaculture investigations of genetic variability and inbreeding, parentage assignments, species and strain identification and construction of high-resolution genetic linkage maps for aquaculture species (Liu and Cordes, 2004), as well as detection of QTL and enabling the use of genomic information in breeding programs (viz MAS). Chistiakov et al. (2006) state that in aquaculture research, microsatellites are the ‘workhorse markers’ and review the genomic distribution, function, evolution and practical applications of microsatellites to fish genetics and aquaculture. Gradually, SNPs are becoming the future markers of choice (Liu, 2007b), mainly because of the need for very high densities of genetic markers (SNPs by far exceed microsatellites in this respect), and the recent progress in genotyping techniques and detection of polymorphism. Genomic resources continue to be developed (e.g., Hayes et al., 2007; Somridhivej et al., 2008). These and the other new marker types paved the way for various applications that are re-shaping aquaculture breeding programs. Parental assignment and molecular pedigrees: DNA markers, notably microsatellites, have solved one of the major obstacles in breeding programs, namely the ability to individually mark small fish. In order to utilize maximum information available on relatives, and increase the accuracy of selection, fish should be marked individually so that pedigrees can be tracked across generations (Villanueva et al., 2002). Since newborn fish are too small to be physically tagged, families must be reared separately until the fish reach the size at which they can be safely tagged individually (Doyle and Herbinger, 1994; Herbinger et al., 1995). Apart from limiting the

64


number of families that can be used, and the extra expenses incurred by rearing each family separately, this also introduces common-environment correlations that reduce the accuracy of selection. Furthermore, it allows applying family selection to fish species that are not easily reproduced by single-pair matings (e.g., gilthead sea bream; Knibb, 2000). The development of DNA markers has enabled solution of this problem, when it was shown that by using a series of polymorphic markers, each individual in a mix of several or many families can be uniquely assigned to its parents with nearly complete accuracy (e.g., Herbinger et al., 1995, 1999; Estoup et al., 1998; O’Reilly et al., 1998; Perez-Enriquez et al., 1999; Norris et al., 2000). The pioneering study by Herbinger et al. (1995) was designed to ‘assess the feasibility of establishing pedigrees in mixed aquaculture populations and of selection programs for commercial aquaculture operations based on genetic profiling data from microsatellite markers’, and in fact paved the way for the application of DNA markers in breeding programs. The Herbinger et al. (1995) study ‘showed that the pedigree of a mixed rainbow trout population could be satisfactorily determined using as few as four microsatellite markers even though the fish could have originated from 100 possible pairs (ten sires × ten dams). The ability to establish the pedigree of completely mixed fish from their single locus DNA profile means that this pilot study was able to take place in a production farm with practically no interference with the normal routine’. Using this approach, families produced separately can be mixed and reared communally from hatching, or pools of males and females can be bred in the same pond or tank and their progeny reared together, until a posteriori parentage assignment at a later stage, even just before selection of breeding candidates. Villanueva et al. (2002) attempted to answer the key questions related to this application – the number of loci and the level of information (i.e., the numbers of alleles per loci and their relative frequency) required for accurate assignment. Application to breeding programs is already under way, e.g., in the estimation of heritability with a microsatellite parentage assignment-based pedigree in common carp cultured under traditional pond conditions as demonstrated by Kocour et al. (2007). Another application of DNA markers that is becoming of major importance is for tracing live fish or fish products at any stage along the production chain. Hayes et al. (2005) compare and discuss three alternate traceability schemes using DNA markers. Linkage maps: Since the late 1990s, linkage maps have been developed for most commercially important finfish species (Table 2.4; see also Table 10.2 in Danzmann and Gharbi, 2007). Work is also underway to develop the necessary genomic resources to develop maps of barramundi (Lates calcarifer – Zhu et al., 2006) and striped bass (Morone saxatilis – Rexroad et al., 2006). Some maps are quite preliminary, although for a few species more advanced maps have already been


65

Table 2.4 Examples of linkage maps for commercially important species. Those already listed in Danzmann and Gharbi (2007) are marked in bold face Species

Reference

American catfish (Ictalurus punctatus ¥ I. furcatus) Arctic char (S. alpinus) Atlantic salmon (S. salar) Ayu (Plecoglosus altivelis) Baramundi (Lates calcarifer) Bighead carp (Aristichthys nobilis) Brown trout (S. trutta) Common carp (C. carpio) European sea bass (Dicentrarchus labrax) Gilthead sea bream (Sparus aurata)

Liu et al., 2003

Japanese flounder (Paralichthys olivaceus) Rainbow trout (On. mykiss) Silver carp (Hypophthalmichthys molitrix) Thai catfish (Clarias macrocephalus) Tilapia (O. niloticus ¥ O. aureus; F2) Yellowtail (Seriola spp.)

Woram et al., 2004 Moen et al., 2004 Watanabe et al., 2004 Wang et al., 2007 Liao et al., 2007 Gharbi et al., 2006 Sun and Liang, 2004 Chistiakov et al., 2005 Franch et al., 2006; Senger et al., 2006; Sarropoulou et al., 2007a,b; 2008 Coimbra et al., 2003 Nichols et al., 2003; Danzmann et al., 2005 Liao et al., 2007 Poompuang and Na-Nakorn, 2004 Lee et al., 2005 Ohara et al., 2005

obtained. The number of markers mapped range from 146 (C. Macrocephalus – Poompuang and Na-Nakorn, 2004) to over 1400 (On. mykiss – Danzmann et al., 2005) in the more advanced maps, and some contain genes as well (those of rainbow trout, brown trout, Atlantic salmon, Arctic charr, channel catfish, European sea bass, common carp and tilapia – for details see Table 10.2 in Danzmann and Gharbi, 2007). Apart from the Danzmann et al. (2005) map of rainbow trout and the preliminary map of common carp (Sun and Liang, 2004), all other maps have either more or less linkage groups (LG) than the haploid number of chromosomes (N) in the species. As long as no commercially important species has its genome fully sequenced, linkage maps constitute the basic prerequisite for detection of QTL (Korol et al., 2007) and fine mapping of genes through comparative mapping to sequenced genomes of model species, and for positional cloning (Lee and Kocher, 2007; Sarropoulou et al., 2008). QTL detection: A QTL is a segment of a chromosome with a significant effect on the expression (phenotype) of a trait of interest; this issue was recently reviewed by Korol et al. (2007). The chapter presents an overview of QTL detection, lists the four steps in the detection of QTL, and outlines their application in MAS; see below) – marker development; development

66


of a linkage map of at least moderate density; mapping of QTL using genetic markers placed on the map, with development of a model for inheritance and expression of the trait; and finally, use of the identified association between marker(s) and QTL in practical breeding program (i.e., MAS). It then discusses recent advances in detection of QTL, and presents a list of traits for which QTL have been detected in various aquacultured species. Among the traits are growth rate and body shape traits, resistance to stress, pathogens and diseases, coloration, sex determination. These have been detected in Atlantic salmon, rainbow trout, coho salmon, Arctic char, tilapias and common carp (see references in Korol et al., 2007 and Sonesson, 2007a). Most recently, a QTL for early maturation was identified in rainbow trout (Haidle et al., 2008). Moen et al. (2004) present a testing strategy for detection of QTL affecting disease resistance in Atlantic salmon. Sonesson (2007a) reviewed the efforts to detect QTL in aquaculture species. Such studies yield knowledge of marker–QTL linkages and estimates of the effects of QTL alleles on the trait in the population. Komen and Thorgaard (2007) discuss the advantage of using double haploids for QTL mapping and present case studies for rainbow trout, but also mention the obstacles to implementation of this approach (related to yield, survival, fertility, quality control and sustained commitment of resources). They conclude that the biggest challenge is the extremely low yields of doubled haploids in experiments with a variety of fish species. MAS: The development of large numbers of genetic markers and genetic maps for many aquacultured species (as mentioned above), which enables detection of QTL, has further led to search for genes associated with commercial traits. Opportunities that were proposed about 25 years ago (Soller and Beckmann, 1982; Beckmann and Soller, 1983), namely the use of genetic markers for selection, are finally becoming a reality. And yet, ‘only a handful of cases demonstrating practical usefulness of MAS’ have been reported in livestock (Rothschild and Ruvinsky, 2007) and even fewer in aquacultured species. The most remarkable application so far is the breeding of a lymphocystis disease-resistant Japanese flounder (Paralichthys olivaceus) (Fuji et al., 2006, 2007; Sakamoto et al., 2006), although this is not a real selective breeding program. They identified a major locus that is mapped to LG15 of the Japanese flounder linkage map, which is highly associated with resistance to the lymphocyctis disease (LD). Specifically, one allele of this marker is tightly linked to LD resistance. LD resistance and the marker are inherited in a Mendelian fashion, with LD resistance behaving as a dominant trait. This inference enabled selection of resistant parents for establishing an LD-resistant stock. With the many projects of marker development, QTL and linkage mapping in progress (see for examples Liu, 2007a; Martinez, 2007), it is anticipated that the industry will adopt the MAS strategy in the near future (Rothschild and Ruvinsky, 2007). Sonesson (2007a) and Martinez (2007) reviewed the current status of aqua-


67

culture breeding schemes and evaluated the possibilities for applying MAS. So far, MAS schemes have been mostly developed for livestock. Sonesson (2007b) is developing and optimizing models for combining MAS with the classical aquaculture breeding schemes using the best linear unbiased prediction (BLUP) model. Genomics Wenne et al. (2007) reviewed the current development of genomic technologies and their potential applications and implications for fisheries management and aquaculture. Full genome sequences are so far available only for a few model fish species such as zebrafish Danio rerio (http://www.sanger.ac.uk/ Projects/D_rerio/), fugu Takifigu rubripes (http://www.fugu-sg.org/), puffer fish Tetraodon nigroviridis (http://www.genome.gov/11008305), medaka Oryzias latipes (http://dolphin.lab.nig.ac.jp/medaka/index.php) and stickleback Gasterosteus aculeatus (http://www.genome.gov/12512292). A Tilapia Genome Sequencing Project is currently underway at the Broad Institute [a research collaboration involving the Massachusetts Institute of Technology (MIT) and Harvard University], and the release of a first high-coverage genome is expected before the end of 2009 (TD Kocher, University of Maryland, USA, pers comm). Sequenced genomes of the model species have been well exploited so far with bioinformatics analyses and molecular biology techniques. It is anticipated that integration of more traditional disciplines such as biochemistry and physiology and expanding the study to additional species such as carp, catfish, salmon, trout or tilapia will further exploit the potential of fish genomics. This will be accompanied by applications to environmental biology and aquaculture (Crollius and Weissenbach, 2007). Various aspects of fish genomics have recently been reviewed in great detail in a book edited by Liu (2007a). Therein, Davidson (2007) and Xu et al. (2007) discuss the importance and utility of BAC libraries as the key genomic resource required for building genetic maps and integrating them with the respective physical maps. Guo et al. (2007) reviewed the utility of FISH as a tool in genome mapping. Many FISH studies have been published, but the full potential of this tool for gene and genomic mapping as well as for comparative genomic analysis in aquacultured species has not yet been realized. Rexroad (2007) reviewed the construction of radiation hybrids (RH) and discuss the perspective of RH mapping for aquaculture species. Apart from zebrafish, the only RH map reported so far for an aquacultured species is for the gilthead sea bream (Senger et al., 2006; Sarropoulou et al., 2008). Lee and Kocher (2007) presented an example of how comparative mapping and positional cloning were employed in an attempt to identify the gene(s) underlying a QTL for sex determination identified on LG1 of Nile tilapia. Their conclusion is that ‘conservation of gene order among fish at scales of several Mbs allows the use of the relatively complete sequences of model fish species to accelerate gene discovery and positional cloning of these genes’.

68


Bioinformatic tools already available and those that will be further developed enable prediction of genes in important aquaculture species using the genome sequences of the model fishes. The sequencing of the genome of Nile tilapia, expected to be completed during 2009 (TD Kocher, University of Maryland, USA, pers comm), will further boost the use of comparative mapping of aquacultured species. Chapters 20–24 in Liu (2007a) review and discuss the status and perspective of analyzing genome expression and gene function in fish using expressed sequence tags (EST) and microarrays. More details on the status of genome mapping and genomics in salmonids, cyprinids, catfish, tilapias, European sea bass and Japanese flounder can be found in the recently published book Genome Mapping and Genomics in Fishes and Aquatic Animals (Kocher and Kole, 2008). Transgenesis Gene transfer technology leading to the production of genetically modified organisms (GMOs) is probably the most controversial issue dealt with in this chapter. On one hand, its successful application in several aquaculture species has produced stocks with improved traits, such as enhanced growth rate. The most notable of these are in salmonids, e.g., Devlin et al. (2004) and Fletcher et al. (2004), mud loach, e.g., Nam et al. (2001, 2002, 2004), and tilapia, e.g., Martínez et al. (2000), Maclean et al. (2002) and Caelers et al. (2005). Another case is increased cold tolerance through expression of an antifreeze polypeptide that might potentially expand culture range of salmon (Devlin et al., 2004). Gene transfer also has the potential to contribute to disease resistance [e.g., enhanced bacterial disease resistance of cecropin-transgenic channel catfish (Ictalurus punctatus) – Dunham et al. (2002) – and resistance to Aeromonas hydrophila infection in human lactoferrin-transgenic grass carp (Ctenopharyngodon idellus) – Mao et al. (2004)] and other traits. On the other hand, GMOs pose environmental threats and have raised public concerns that, so far, prevent their commercial use by the aquaculture industry (e.g., Kapuscinski and Hallerman, 1990; Levy et al., 2000; NRC, 2002; Pew, 2003; Myhr and Dalmo, 2005; Rasmussen and Morrissey, 2007). Galli (2002) presented a quite comprehensive overview of the current status of modern biotechnology research in aquaculture. Directed to policy and decision makers, it highlights issues relevant to research and the potential for commercialization of genetically modified (GM) aquacultured organisms. Teufel et al. (2002) reviewed the research on transgenic trout and salmon, their potential and the constraints for implementation. The issues of public concerns and implications to the aquaculture industry have been further discussed by several scientists, e.g., Aerni (2004), Maclean (2003) and Millar and Tomkins (2007). A special volume (Kapuscinski et al., 2007) published recently has focused on the potential environmental risks (threats to biodiversity and natural ecosystems) and


69

benefits of uses of aquacultured GMOs. It covers all aspects from the development of transgenic fish, through assessment of environmental risks from their use, to suggestions for risk management of transgenic fish. The main conclusion and message of the book is that the risks ‘must be honestly and accurately analysed and understood by society’ in order to allow the potential benefits of transgenic aquaculture research to be realized. It further suggests that ‘using this book’s chapters for guidance, countries can begin to approach the task of creating effective, scientifically sound and socially responsible biosafety policies for transgenic fish and other aquatic organisms’. Commercialization of transgenic fish, however, poses not only ecological, food safety and regulatory issues, but also animal welfare concerns. Hallerman et al. (2007) reviewed the effects of growth hormone transgenes on the welfare and behavior of four species: Atlantic salmon, coho salmon, tilapia and common carp. Various morphological, physiological and behavioral alternations occur in GH-transgenics that seem to negatively affect, among other traits, swimming ability and reproductive behavior. Possible means for reducing the welfare issues that arise are discussed, such as the use of weaker promoters in expression vectors and selection of transgenic lines with physiologically appropriate levels of GH expression. Furthermore, since GH-transgenic animals have higher energy demands than non-transgenic fish, optimizing their formulated diets may improve production potential of transgenic animals and help maintain their welfare. The production of transgenics in itself has met with various difficulties, one of which is lack of control over integration of a single copy of a transgene and its proper expression. In recent years, use of embryonic stem (ES) cell lines has been investigated as an alternative approach for gene transfer. Hong et al. (2000) have reviewed the status and perspectives of using ES for transgenesis in fish. Since then, more studies have focused on the model fishes medaka (Bubenshchikova et al., 2005) and zebrafish (e.g., Ma et al., 2001; Fan et al., 2004; Hong and Schartl, 2006; Alvarez et al., 2007; Chen et al., 2007), and in recent years, a few attempts have also been made in aquacultured species (Holen and Hamre, 2003; Parameswaran et al., 2007).

2.3 Case studies – risks associated with selective breeding programs Species or strains of many fish species have been translocated from their place of origin, or from places to which they have been introduced, and deliberately released for stocking or escaped from culture facilities, thereby affecting wild stocks (Cross, 2000). A few outstanding examples will be discussed.

70


The farming of Atlantic salmon (Salmo salar), which has greatly expanded in the last 50–60 years, resulted in large numbers of escaped farm salmon invading native salmon populations throughout the North Atlantic (e.g., Fleming et al., 2000; Gilbey et al., 2005; Carr and Whoriskey, 2006; Hindar et al., 2006; O’Reilly et al., 2006). The nature of this interaction has been investigated by McGinnity et al. (2003, 2004), Weir et al. (2004, 2005) and others. Naylor et al. (2005) presented a thorough analysis of the problem in their assessment of the risks of escaped salmon from net-pen aquaculture, and listed various potential biological consequences of farm salmon escapes: risk of feral stock establishment; risks of competition with wild fish for mates, space and prey; risk of pathogen transmission; and, most relevant to this review, risks associated with genetic interactions with wild stocks. These were further discussed in the framework of the EU GENIMPACT project: Evaluation of genetic impact of aquaculture activities on native populations (Verspoor et al., 2006). Moreover, the culture of Atlantic salmon has been shown to genetically affect wild populations of other salmonids as well, e.g., sea trout (Salmo trutta) (Coughlan et al., 2006). Of even greater concern are the risks associated with the Atlantic salmon selective breeding programs. Since the 1980s, a series of corporate merger and spin-off through purchase and sale of Atlantic salmon breeding and/or growing companies has resulted in translocations of stocks among countries in Europe as well as North America and Chile. For example, the origin of Donegal Silver Irish salmon lies in the MOWI Norwegian broodstock, eggs from which were introduced at Fanad Fisheries in 1982. Marine Harvest, one of the largest salmon companies in the world resulting from these mergers, with branches in Ireland, Norway, Scotland, Canada and Chile, has moved stocks within Europe as well as from Europe to North and South America (A. Norris, Marine Harvest, pers comm; http://www. marineharvest.com/). The effects of cultured species on their respective wild populations is visible in the last two or three decades also with the Mediterranean gilthead sea bream (Sparus aurata) and sea bass (Dicentrarchus labrax). These effects include interaction and competition for resources by accidentally escaping fish (whose numbers are increasing according to the records) and contribution of escaped fish to reproduction in the wild. Data suggest that the contribution of escaped spawners ‘is not negligible’ and that a decrease in mean size of fish caught in the longline fishery in Greek coastal lagoons has already been detected (Dimitriou et al., 2007). Naylor et al. (2005) predict that the rising production of two new marine species – cod and halibut – may lead to similar processes. Escaped hybrid catfish (female Thai walking catfish, Clarias macrocephalus × male African catfish, C. gariepinus) from farms in central Thailand may interbreed with C. macrocephalus individuals in the wild. Senanan et al. (2004) assessed genetic introgression of C. gariepinus genes into four wild and two broodstock populations of C. macrocephalus.


71

Tilapias are a group of fish that have been widely spread around the world since the 1950s (Pullin et al., 1997). More recently, stocks of Nile tilapia (O. niloticus) were introduced from various regions in Africa into the Philippines and mixed with cultured (earlier – introduced) strains to form the base population for the GIFT breeding program carried out by the WorldFish Center (formerly ICLARM) and collaborators (Eknath et al., 1993, 2007; Eknath, 1995). Improved descendants from this program were disseminated to several countries in Southeast Asia for evaluation against local stocks, eventually leading to commercial culture of this introduced strain, which showed superior growth rate and survival relative to that of other strains used by farmers (De Silva, 2003). Since no native wild populations of tilapia existed in those countries, escapement did not result in any damage to wild populations. Upon termination of the GIFT research program, sub-samples were transferred to several countries in the region and served as founders for separate, parallel, further breeding programs (Gupta and Acosta, 2004). According to Ponzoni (2007, WorldFish Center, pers comm), the WorldFish policy has been not to transfer GIFT to Africa because of biodiversity considerations, namely, due to concerns that the fish could escape and cross with wild populations in Africa, thus contaminating their gene pool. Consequently, countries from which wild fish were sampled to initiate the breeding program (Egypt, Ghana, Kenya and Senegal) did not benefit from the genetic gain made, and have received nothing in return for their collaboration. The issue has been raised by some African representatives and it has re-kindled the debate on the matter. This has resulted in a recommendation to allow controlled introduction followed by a properly designed comparison of GIFT with relevant local strains to ascertain that there is a productivity advantage exhibited by GIFT. At present, WorldFish is finalizing the policy document that will define the circumstances under which the introduction of GIFT to an African country will be authorized. ‘Given a favorable outcome for GIFT from the above comparison, multiplication and dissemination of GIFT will be authorized. The multiplication and dissemination programs will be accompanied by a package of measures attempting to minimize the risk of escapes and to mitigate the impact in case these should occur’ (Ponzoni, 2007, WorldFish Center, pers comm).

2.4 Future trends Conventional breeding programs will continue to be the main engine driving the global finfish aquaculture industry forward. Efforts will persist to increase efficiency and optimize the design of breeding programs by maximising the use of pedigree information while using both established and cutting-edge technologies mentioned above. However, since these methods are less suitable for economically important traits that are

72


difficult to measure on candidates for selection (such as carcass and disease traits), alternative approaches will have to be further developed and optimized. Here is where incorporation of recent biotechnological tools may come into play. The potential for accelerating breeding programs expected from applying these tools has yet to be realized in the aquaculture industry. Nevertheless, MAS and gene-assisted selection (GAS) methodologies, when mature, may eventually become practical in efforts towards identifying genes that underlie economically-important traits and towards combining quantitative and molecular data in breeding programs. A potential alternative breakthrough may arise from solving containment problems currently limiting the use of GM aquacultured organisms; once the public prefers education to regulation, antagonism to the use of GM may fade out.

2.5 Sources of further information and advice Several books devoted to various aspects and methodologies discussed in this chapter were published in recent years. These will obviously serve as the main sources for further information for the near future. Among them are Fingerman and Nagabhushanam’s (2000) Recent Advances in Marine Biotechnology: Aquaculture – Fishes, Beaumont and Hoare’s (2003) Biotechnology and Genetics in Fisheries and Aquaculture; Hallerman’s (2003) Population Genetics: Principles and Applications for Fisheries Scientists; Dunham’s (2004) Aquaculture and Fisheries Biotechnology: Genetic Approaches; Gjedrem’s (2005) Selection and Breeding Programs in Aquaculture; Liu’s (2007a) Aquaculture Genome Technologies; and Kocher and Kole’s (2008) Genome Mapping and Genomics in Fishes and Aquatic Animals.

2.6 Acknowledgement The authors would like to thank Eric Hallerman for his valuable comments and suggestions that helped shape the view-point expressed in the paper and improved its prose. This paper is contribution No. 526/08 from the ARO, The Volcani Center, Bet Dagan, Israel.

2.7 References aerni p (2004) Risk, regulation and innovation: the case of aquaculture and transgenic fish, Aquat Sci, 66, 327–41. alvarez m c, béjar j, chen s and hong y (2007) Fish ES cells and applications to biotechnology, Mar Biotechnol, 9(2), 117–27.


73

arai k (2000) Chromosome manipulation in aquaculture: recent progress and perspective, Suisanzoshoku, 48, 295–303. arai k (2001) Genetic improvement of aquaculture finfish species by chromosome manipulation techniques in Japan, Aquaculture, 197(1–4), 205–28. artamonova v s (2007) Genetic markers in population studies of Atlantic salmon Salmo salar L.: analysis of DNA sequences, Russ J Genet, 43(4), 341–53. ashley p j (2007) Fish welfare: current issues in aquaculture, Appl Anim Behav Sci, 104, 199–235. babiak i, dobosz s, goryczko k, kuzminski h, brzuzan p and ciesielski s (2002a) Androgenesis in rainbow trout using cryopreserved spermatozoa: the effect of processing and biological factors, Theriogenology, 57(4), 1229–49. babiak i, dobosz s, kuzminski h, goryczko k, ciesielski s, brzuzan p, urbányi b, horváth a, lahnsteiner f and piironen j (2002b) Failure of interspecies androgenesis in salmonids, J Fish Biol, 61(2), 432–47. bartley d m, rana k and immink a j (2001) The use of inter-specific hybrids in aquaculture and fisheries, Rev Fish Biol Fish, 10, 325–37. beaumont a r and hoare k (eds) (2003) Biotechnology and Genetics in Fisheries and Aquaculture, Oxford, Blackwell. beckmann j s and soller m (1983) Restriction fragment length polymorphisms in genetic improvement: methodologies, mapping and costs, Theor Appl Genet, 67(1), 35–43. bentsen h b and olesen i (2002) Designing aquaculture mass selection programs to avoid high inbreeding rates, Aquaculture, 204(3–4), 349–59. bertotto d, cepollaro f, libertini a, barbaro a, francescon a, belvedere p, barbaro j and colombo l (2005) Production of clonal founders in the European sea bass, Dicentrarchus labrax L., by mitotic gynogenesis, Aquaculture, 246(1–4), 115–24. brännäs e, chaix t, nilsson j and eriksson l o (2005) Has a 4-generation selection programme affected the social behaviour and growth pattern of Arctic charr (Salvelinus alpinus)?, Appl Anim Behav Sci, 94, 165–78. bubenshchikova e, ju b, pristyazhnyuk i, niwa k, kaftanovskaya e, kinoshita m, ozato k and wakamatsu y (2005) Generation of fertile and diploid fish, medaka (Oryzias latipes), from nuclear transplantation of blastula and four-somite-stage embryonic cells into nonenucleated unfertilized eggs, Clon Stem Cells, 7(4), 255–64. caelers a, maclean n, hwang g, eppler e and reinecke m (2005) Expression of endogenous and exogenous growth hormone (GH) messenger (m) RNA in a GH-transgenic tilapia (Oreochromis niloticus), Transgenic Res, 14, 95–104. cal r m, vidal s, gómez c, álvarez-blázquez b, martínez p and piferrer f (2006) Growth and gonadal development in diploid and triploid turbot (Scophthalmus maximus), Aquaculture, 251(1), 99–108. carr j w and whoriskey f g (2006) The escape of juvenile farmed Atlantic salmon from hatcheries into freshwater streams in New Brunswick, Canada, ICES J Mar Sci, 63(7), 1263–8. chen s-l, sha z-x, ye h-q, liu y, tian y-s, hong y and tang q-s (2007) Pluripotency and chimera competence of an embryonic stem cell line from the sea perch (Lateolabrax japonicus), 9(1), 82–91. chistiakov d a, hellemans b, haley c s, law a s, tsigenopoulos c s, kotoulas g, bertotto d, libertini a and volckaert f a m (2005) A microsatellite linkage map of the European sea bass Dicentrarchus labrax L., Genetics, 170(4), 1821–6. chistiakov d a, hellemans b and volckaert f a m (2006) Microsatellites and their genomic distribution, evolution, function and applications: a review with special reference to fish genetics, Aquaculture, 255(1–4), 1–29.

74


cnaani a, lee b-y, ozouf-costaz c, bonillo c, baroiller j-f, d’cotta h and kocher t d (2007a) Mapping of sox2 and sox14 in tilapia (Oreochromis spp.), Sex Dev, 1, 207–10. cnaani a, lee b-y, zilberman n, ozouf-costaz c, hulata g, ron m, d’hont a, baroiller j-f, d’cotta h, penman d j, tomasino e, coutanceau j-p, pepey e, shirak a and kocher t d (2007b) Genetics of sex determination in tilapiine species, Sex Dev, 2, 43–54. coimbra m r m, kobayashi k, koretsugu s, hasegawa o, ohara e, ozaki a, sakamoto t, naruse k and okamoto n (2003) A genetic linkage map of the Japanese flounder, Paralichthys Olivaceus Aquacuture, 220, 203–18. coughlan j, mcginnity p, o’farrell b, dillane e, diserud o, de eyto e, farrell k, whelan k, stet r j m and cross t f (2006) Temporal variation in an immune response gene (MHC I) in anadromous Salmo trutta in an Irish river before and during aquaculture activities, ICES J Mar Sci, 63, 1248–55. crollius h r and weissenbach j (2005) Fish genomics and biology, Genome Res, 15(12), 1675–82. cross t f (2000) Genetic implications of translocation and stocking of fish species, with particular reference to Western Australia, Aquac Res, 31(1), 83–94. d’agaro e, woolliams j a, haley c s and lanari d (2007) Optimizing mating schemes in fish breeding. Ital J Anim Sci, 6(Suppl. 1), 795–6. danzmann r g and gharbi k (2007) Linkage mapping in aquaculture species, in Liu Z (ed.), Aquaculture Genome Technologies, Ames, IA, Blackwell, 139–67. danzmann r g, cairney m, davidson w s, ferguson m m, gharbi k, guyomard r, holm l-e, leder e, okamoto n, ozaki a, rexroad iii c e, sakamoto t, taggart j b and woram r a (2005) A comparative analysis of the rainbow trout genome with 2 other species of fish (Arctic charr and Atlantic salmon within the tetraploid derivative Salmonidae family (subfamily: Salmoninae), Genome, 48, 1037–51. davidson w s (2007) Bacterial artificial chromosome libraries and BAC-based physical mapping of aquaculture genomes, in Liu Z (ed.), Aquaculture Genome Technologies, Ames, IA, Blackwell, 245–59. de silva s s (2003) Tilapias as Exotics in the Asia-Pacific: a Review. FAO Fisheries Technical Paper, No. 450, Rome, Food and Agriculture Organization of the United Nations. devlin r h, nagahama y (2002) Sex determination and sex differentiation in fish: an overview of genetic, physiological, and environmental influences, Aquaculture, 208, 191–364. devlin r h, biagi c a and yesaki t y (2004) Growth, viability and genetic characteristics of GH transgenic coho salmon strains, Aquaculture, 236(1–4), 607–32. dimitriou e, katselis g, moutopoulos d k, akovitiotis c and koutsikopoulos c (2007) Possible influence of reared gilthead sea bream (Sparus aurata, L.) on wild stocks in the area of the Messolonghi lagoon (Ionian Sea, Greece), Aquac Res, 38(4), 398–408. doyle r w and herbinger c (1995) The use of DNA fingerprinting for high-intensity, within-family selection in fish breeding, Proceedings of the Fifth World Congress on Genetic Applications to Livestock Production, University of Guelph, Guelph, ONT, 19, 364–70. dunham r a (ed.) (2004) Aquaculture and Fisheries Biotechnology: Genetic Approaches, Oxford, CABI. dunham r a, majumdar k, hallerman e, bartley d, mair g, hulata g, liu z, pongthana n, bakos j, penman d, gupta m, rothlisberg p and hoerstgenschwark g (2001) Review of the status of aquaculture genetics, in Subasinghe R P, Bueno P, Phillips M J, Hough C, McGladdery S E and Arthur J R (eds), Aquaculture in the Third Millenium, Technical Proceedings of the Conference on


75

Aquaculture in the Third Millenium, 20–25 February 2000, Bangkok, Bangkok NACA and Rome, FAO, 129–57. dunham r a, warr g w, nichols a, duncan p l, argue b, middleton d and kucuktas h (2002) Enhanced bacterial disease resistance of transgenic channel catfish Ictalurus punctatus possessing cecropin genes, Mar Biotechnol, 4(3), 338–44. dupont-nivet m, vandeputte m, haffray p and chevassus b (2006) Effect of different mating designs on inbreeding, genetic variance and response to selection when applying individual selection in fish breeding programs, Aquaculture, 252(2–4), 161–70. eknath a e (1995) Managing aquatic genetic resources. Management Example 4: The Nile tilapia, in Thorpe J (ed.), Conservation of Fish and Shellfish Resources: Managing Diversity, London, Academic Press, 176–94. eknath a e, tayamen m m, palada-de vera m s, danting j c, reyes r a, dionisio e e, capili j b, bolivar h l, abella t a, circa a v, bensten h b, gjerde b, gjedrem t and pullin r s v (1993) Genetic improvement of farmed tilapias: the growth performance of eight strains of Oreochromis niloticus tested in different farm environments, Aquaculture, 111, 171–88. eknath a e, bentsen h b, ponzoni r w, rye m, nguyen n h, thodesen j and gjerde b (2007) Genetic improvement of farmed tilapias: composition and genetic parameters of a synthetic base population of Oreochromis niloticus for selective breeding, Aquaculture, 273, 1–14. estoup a, gharbi k, sancristobal m, chevalet c, haffray p and guyomard r (1998) Parentage assignment using microsatellites in turbot (Scophthalmus maximus) and rainbow trout (Oncorhynchus mykiss) hatchery populations, Can J Fish Aquat Sci, 55, 715–25. ezaz t, stiglec r, veyrunes f and marshall graves j a (2006) Relationships between vertebrate ZW and XY sex chromosome systems – review, Curr Biol, 16, R736–R743. fan l, crodian j and collodi p (2004) Production of zebrafish germline chimeras by using cultured embryonic stem (ES) cells, Meth Cell Biol, 77, 113–19. fao (2007) The State of World Fisheries and Aquaculture 2006, Rome, Food and Agriculture Organization of the United Nations. felip a, piferrer f, carrillo m and zanuy s (2002) Growth, gonadal development and sex ratios of meiogynogenetic diploid sea bass, J Fish Biol, 61(2), 347–59. felip a, zanuy s, carrillo m and piferrer f (2001a) Induction of triploidy and gynogenesis in teleost fish with emphasis on marine species, Genetica, 111(1–3), 175–95. felip a, piferrer f, zanuy s and carrillo m (2001a) Comparative growth performance of diploid and triploid European sea bass over the first four spawning seasons, J Fish Biol, 58, 76–88. fingerman m and nagabhushanam r (2000) Recent Advances in Marine Biotechnology, Volume 4 Aquaculture, Part B Fishes, Enfield, Science Publishers. fjalestad k t, moen t and gomez-raya l (2003) Prospects for genetic technology in salmon breeding programmes, Aquac Res, 34(5), 397–406. fleming i a, hindar k, mjolnerod i b, jonsson b, balstad t and lamberg a (2000) Lifetime success and interactions of farm salmon invading a native population, Proc Royal Soc – Biol Sci (Ser B), 267(1452), 1517–23. fletcher g l, shears m a, yaskowiak e s, king m j and goddard s v (2004) Gene transfer: Potential to enhance the genome of Atlantic salmon for aquaculture, Aust J Exp Agric, 44(11), 1095–100. flynn s r, matsuoka m, reith m, martin-robichaud d j and benfey t j (2006) Gynogenesis and sex determination in shortnose sturgeon, Acipenser brevirostrum Lesuere, Aquaculture, 253(1–4), 721–7.

76


fontana f (2002) A cytogenetic approach to the study of taxonomy and evolution in sturgeons, J Appl Ichthyol, 18(4–6), 226–33. fopp-bayat d, jankun m, woznicki p and kolman r (2007) Viability of diploid and triploid larvae of Siberian sturgeon and bester hybrids, Aquac Res, 38, 1301–4. franch r, louro b, tsalavouta m, chatziplis d, tsigenopoulos c s, sarropoulou e, antonello j, magoulas a, mylonas c c, babbucci m, patarnello t, power d m, kotoulas g and bargelloni l (2006) A genetic linkage map of the hermaphrodite teleost fish Sparus aurata L., Genetics, 174(2), 851–61. fuji k, kobayashi k, hasegawa o, coimbra m r m, sakamoto t and okamoto n (2006) Identification of a single major genetic locus controlling the resistance to lymphocystis disease in Japanese flounder (Paralichthys olivaceus), Aquaculture, 254(1–4), 203–10. fuji k, hasegawa o, honda k, kumasaka k, sakamoto t and okamoto n (2007) Marker-assisted breeding of a lymphocystis disease-resistant Japanese flounder (Paralichthys olivaceus), Aquaculture, 272(1–4), 291–5. gall g a e and neira r (2004) Genetic analysis of female reproduction traits of farmed coho salmon (Oncorhyncus kisutch), Aquaculture, 234(1–4), 143–54. gallardo j a, garcía x, lhorente j p and neira r (2004a) Inbreeding and inbreeding depression of female reproductive traits in two populations of coho salmon selected using BLUP predictors of breeding values, Aquaculture, 234(1–4), 111–22. gallardo j a, lhorente j p, garcía x and neira r (2004b) Effects of nonrandom mating schemes to delay the inbreeding accumulation in cultured populations of coho salmon (Oncorhynchus kisutch), Can J Fish Aquat Sci, 61(4), 547–53. galli l (2002) Genetic Modification in Aquaculture – A Review of Potential Benefits and Risks, Canberra, Bureau of Rural Sciences. garber a f and sullivan c v (2006) Selective breeding for the hybrid striped bass (Morone chrysops, Rafinesque × M. saxatilis, Walbaum) industry: status and perspectives, Aquac Res, 37(4), 319–38. garbey k, gautier a, danzmann r g, gharbi s, sakamoto t, høyheim b, taggart j b, cairney m, powell r, krieg f, okamoto n, ferguson m m, holm l-e and guyomard r (2006) A linkage map for brown trout (Salmo trutta): chromosome homeologies and comparative genome organization with other salmonid fish, Genetics, 172, 2405–19. gilbey j, knox d, o’sullivan m and verspoor e (2005) Novel DNA markers for rapid, accurate, and cost-effective discrimination of the continental origin of Atlantic salmon (Salmo salar L.), ICES J Mar Sci, 62(8), 1609–16. gjedrem t (2000) Genetic improvement of cold-water fish species, Aquac Res, 31(1), 25–33. gjedrem t (2002) Selective breeding – essential for further productivity, sustainability in aquaculture, Global Aquac Advocate, Feb., 46–7. gjedrem t (2005) Selection and Breeding Programs in Aquaculture, Dordrecht, Springer. gjerde b, gjøen h m and villanueva b (1996) Optimum designs for fish breeding programmes with constrained inbreeding mass selection for a normally distributed trait, Livest Prod Sci, 47(1), 59–72. gjerde b, reddy p v g k, mahapatra k d, saha j n, jana r k, meher p k, sahoo m, lenka s, govindassamy p and rye m (2002) Growth and survival in two complete diallele crosses with five stocks of rohu carp (Labeo rohita), Aquaculture, 209(1– 4), 103–15. gjerde b, terjesen b f, barr y, lein i and thorland i (2004) Genetic variation for juvenile growth and survival in Atlantic cod (Gadus morhua), Aquaculture, 236(1–4), 167–77.


77

gjerde b, pante m j r and baeverfjord g (2005) Genetic variation for a vertebral deformity in Atlantic salmon (Salmo salar), Aquaculture, 244(1–4), 77–87. gomelsky b (2003) Chromosome set manipulation and sex control in common carp: a review, Aquat Living Resour, 16(5), 408–15. gomelsky b, dabrowski k, garcia-abiado m a, stilwell w, tidwell j h and coyle s d (2004) Ploidy of backcross hybrids of largemouth bass and smallmouth bass, N Amer J Aquac, 66(2), 133–6. gorshkova g (2006) Practical use of cytogenetics in fish biology and aquaculture, Isr J Aquac – Bamidgeh, 58(4), 280–5. gorshkova g, gorshkov s, hadani a, gordin h and knibb w (1995) Chromosome set manipulations in marine fish, Aquaculture, 137, 157–8. gorshkova g, gorshov s, gordin h and knibb w (1996) Karyological studies in hybrids of beluga Huso huso (L.) and the Russian sturgeon Acipenser guldenstaedti Brant, Isr J Aquac – Bamidgeh, 48, 35–9. gorshkov s, gorshkova g, hadani a, gordin h and knibb w (1998) Chromosome set manipulations and hybridization experiments in gilthead seabream (Sparus aurata). I. Induced gynogenesis and intergeneric hybridization using males of the red seabream (Pagrus major), Isr J Aquac – Bamidgeh, 50(3), 99–110. gorshkova g, gorshkov s and golani d (2002a) Karyotypes of Barbus canis and Capoeta damascina (Pisces, Cyprinidae) from the Middle East, Ital J Zool, 69, 191–4. gorshkova g, protas y, ben-atia s and gorshkov s (2002b) Cytogenetic examination of early embryonic development in the white grouper, Epinephelus aeneus (Pisces, Serranidae), J Appl Ichthyol, 18, 29–34. gorshkov s, gorshkova g, meiri i and gordin h (2004) Culture performance of different strains and crosses of the European sea bass (Dicentrarchus labrax) reared under controlled conditions in Eilat, Israel, J Appl Ichthyol, 20, 194–203. grunina a s and recoubratsky a v (2005) Induced androgenesis in fish: obtaining viable nucleocytoplasmic hybrids, Russ J Dev Biol, 36(4), 208–17. grunina a s, recoubratsky a v, tsvetkova l i and barmintsev v a (2006) Investigation on dispermic androgenesis in sturgeon fish: The first successful production of androgenetic sturgeons with cryopreserved sperm, Int J Refrig, 29(3), 379–86. guo x, wang y and xu z (2007) Genomic analyses using fluorescence in situ hybridization, in Liu Z (ed.), Aquaculture Genome Technologies, Ames, IA, Blackwell, 289–311. gupta m v and acosta b o (2004) From drawing board to dining table: the success story of the GIFT project, NAGA, 27(3&4), 4–14. haidle l, janssen j e, gharbi k, moghadam h k, ferguson m m and danzmann r g (2008) Determination of quantitative trait loci (QTL) for early maturation in rainbow trout (Oncorhynchus mykiss), Mar Biotechnol, 10, 579–92. hallerman e m (2003) Population Genetics: Principles and Application for Fisheries Scientists, American Fisheries Society, Bethesda, MD. hallerman e m, mclean e and fleming i a (2007) Effects of growth hormone transgenes on the behavior and welfare of aquacultured fishes: a review identifying research needs, Appl Anim Behav Sci, 104(3–4), 265–94. hayes b, sonesson a k and gjerde b (2005) Evaluation of three strategies using DNA markers for traceability in aquaculture species, Aquaculture, 250(1–2), 70–81. hayes b, he j, moen t and bennewitz j (2006) Use of molecular markers to maximise diversity of founder populations for aquaculture breeding programs, Aquaculture, 255(1–4), 573–8. hayes b, laerdahl j k, lien s, moen t, berg p, hindar k, davidson w s, koop b f, adzhubei a and hoyheim b (2007) An extensive resource of single nucleotide

78


polymorphism markers associated with Atlantic salmon (Salmo salar) expressed sequences, Aquaculture, 265, 82–90. helge stien l, manne f, ruohonene k, kause a, rungruangsak-torrissen k and kiessling a (2006) Automated image analysis as a tool to quantify the colour and composition of rainbow trout (Oncorhynchus mykiss W.) cutlets, Aquaculture, 261(2), 695–705. henryon m, berg p, olesen n j, kjær t e, slierendrecht w j, jokumsen a and lund i (2005) Selective breeding provides an approach to increase resistance of rainbow trout (Onchorhynchus mykiss) to the diseases, enteric redmouth disease, rainbow trout fry syndrome, and viral haemorrhagic septicaemia, Aquaculture, 250(3–4), 621–36. herbinger c m, doyle r w, pitman e r, paquet d, mesa k a, morris d b, wright j m and cook d (1995) DNA fingerprint based analysis of paternal and maternal effects on offspring growth and survival in communally reared rainbow trout, Aquaculture, 137, 245–56. herbinger c m, o’reilly p t, doyle r w, wright j m and o’flynn b (1999) Early growth performance of Atlantic salmon full-sib families reared in single family tanks versus in mixed family tanks, Aquaculture, 173(1–4), 105–16. hershberger w k (2006) What can history tell us about the future of aquaculture genetics?, Isr J Aquac – Bamidgeh, 58(4), 223–9. hindar k, fleming i a, mcginnity p and diserud o (2006) Genetic and ecological effects of salmon farming on wild salmon: modelling from experimental results, ICES J Mar Sci, 63(7), 1234–47. hinrichs d, wetten m and meuwissen t h e (2006) An algorithm to compute optimal genetic contributions in selection programs with large numbers of candidates, J Anim Sci, 84(12), 3212–18. holen e and hamre k (2003) Towards obtaining long term embryonic stem cell like cultures from a marine flatfish, Scophtalmus maximus, Fish Physiol Biochem, 29(3), 245–52. holtsmark m, sonesson a k, gjerde b and klemetsdal g (2006) Number of contributing subpopulations and mating design in the base population when establishing a selective breeding program for fish, Aquaculture, 258(1–4), 241–9. holtsmark m, klemetsdal g, sonesson a k and woolliams j a (2008) Establishing a base population for a breeding program in aquaculture, from multiple subpopulations, differentiated by genetic drift: I. Effects of the number of subpopulations, heritability and mating strategies using optimum contribution selection, Aquaculture, 274(2–4), 232–40. hong y and schartl m (2006) Isolation and differentiation of medaka embryonic stem cells, Meth Molec Biol, 329, 3–16. hong y, chen s and schartl m (2000) Embryonic stem cells in fish: current status and perspectives, Fish Physiol Biochem, 22(2), 165–70. hulata g (2001) Genetic manipulations in aquaculture: a review of stock improvement by classical and modern technologies, Genetica, 111, 155–73. kapuscinski a r and hallerman e m (1990) Transgenic fish and public policy. Anticipating environmental impacts of transgenic fish, Fisheries 15(1), 2–11. kapuscinski a r, hayes k r, li s, dana g, hallerman em and schei p (2007) Environmental Risk Assessment of Genetically Modified Organisms, Volume 3. Methodologies for Transgenic Fish, Oxford CABI. kause a, ritola o and paananen t (2004) Breeding for improved appearance of large rainbow trout in two production environments, Aquac Res, 35(10), 924–30. kause a, ritola o, paananen t, mäntysaari e and eskelinen u (2003a) Selection against early maturity in large rainbow trout Oncorhynchus mykiss: the quantitative genetics of sexual dimorphism and genotype-by-environment interactions, Aquaculture, 228(1–4), 53–68.


79

kause a, ritola o, paananen t, eskelinen u and mäntysaari e (2003b) Big and beautiful? Quantitative genetic parameters for appearance of large rainbow trout, J Fish Biol, 62(3), 610–22. kause a, tobin d, dobly a, houlihan d, martin s, mäntysaari e a, ritola o and ruohonen k (2006a) Recording strategies and selection potential of feed intake measured using the X-ray method in rainbow trout, Genet Sel Evol, 38(4), 389–409. kause a, tobin d, houlihan d f, martin s a m, mäntysaari e a, ritola o and ruohonen k (2006b) Feed efficiency of rainbow trout can be improved through selection: Different genetic potential on alternative diets, J Anim Sci, 84(4), 807–17. kause a, tobin d, mäntysaari e a, martin s a m, houlihan d f, kiessling a, rungruangsak-torrissen k, ritola o and ruohonen k (2007) Genetic potential for simultaneous selection of growth and body composition in rainbow trout (Oncorhynchus mykiss) depends on the dietary protein and lipid content: phenotypic and genetic correlations on two diets, Aquaculture, 271(1–4), 162–72. kerby j h, everson j m, harrell r m, geiger j g, starling c c and revels h (2002) Performance comparisons between diploid and triploid sunshine bass in fresh water ponds, Aquaculture, 211(1–4), 91–108. khan t a, bhise m p and lakra w s (2000) Chromosome manipulation in fish – a review, Ind J Anim Sci, 70(2), 213–21. kim d s, nam y k and park i-s (1995) Survival and karological analysis of reciprocal diploid and triploid hybrids between mud loach (Misgurnus mizolepis) and cyprinid loach (Misgurnus anguillicaudatus) Aquaculture, 135, 257–65. knibb w (2000) Genetic improvement of marine fish – which method for industry?, Aquac Res, 31(1), 11–23. knibb w, gorshkova g and gorshkova s (1998a) Genetic improvement of cultured marine finfish: case studies, in De Silva S S (ed.), Tropical Mariculture, London, Academic Press, 111–49. knibb w, gorshkova g and gorshkova s (1998b) Selection and crossbreeding in Mediterranean cultured marine fish, in Bartley D and Basurco B (eds), Genetics and Breeding of Mediterranean Aquaculture Species, Zaragoza, CIHEAM, 47–60. kocher t d and kole c (2008) Genome Mapping and Genomics in Fishes and Aquatic Animals, Springer, Berlin/Heidelberg. kocour m, mauger s, rodina m, gela d, linhart o and vandeputte m (2007) Heritability estimates for processing and quality traits in common carp (Cyprinus carpio L.) using a molecular pedigree, Aquaculture, 270, 43–50. kolstad k, grisdale-helland b and gjerde b (2004) Family differences in feed efficiency in Atlantic salmon (Salmo salar), Aquaculture, 241(1–4), 169–77. kolstad k, heuch p a, gjerde b, gjedrem t and salte r (2005a) Genetic variation in resistance of Atlantic salmon (Salmo salar) to the salmon louse Lepeophtheirus salmonis, Aquaculture, 247(1–4), 145–51. kolstad k, meuwissen t h e and gjerde b (2005b) Efficient design for doing genetic studies of feed efficiency in Atlantic salmon (Salmo salar), Aquaculture, 247(1–4), 153–8. kolstad k, thorland i, refstie t and gjerde b (2006) Genetic variation and genotype by location interaction in body weight, spinal deformity and sexual maturity in Atlantic cod (Gadus morhua) reared at different locations off Norway, Aquaculture, 259(1–4), 66–73. komen h and thorgaard g h (2007) Androgenesis, gynogenesis and the production of clones in fishes: a review, Aquaculture, 269(1–4), 150–73. korol a, shirak a, cnaani a and hallerman e m (2007) Detection and analysis of quantitative trait loci (QTL) for economic traits in aquatic species, in Liu Z (ed.), Aquaculture Genome Technologies, Ames, IA, Blackwell, 169–97.

80


kucuktas h and liu z (2007) Allozyme and mitochondrial DNA markers, in Liu Z (ed.), Aquaculture Genome Technologies, Oxford, Blackwell, 73–85. lee b-y and kocher t d (2007) Comparative genomics and positional cloning, in Liu Z (ed.), Aquaculture Genome Technologies, Ames, IA, Blackwell, 323–35. lee b-y, lee w-j, streelman j t, carleton k l, howe a e, hulata g, slettan a, stern j e, terai y and kocher t d (2005) A second-generation genetic linkage map of tilapia (Oreochromis spp.), Genetics, 170, 237–44. levy j a, marins l f and sanchez a (2000) Gene transfer technology in aquaculture, Hydrobiologia, 420, 91–4. li s-f, he x-j, hu g-c, cai w-q, deng x-w and zhou p-y (2006) Improving growth performance and caudal fin stripe pattern in selected F6–F8 generations of GIFT Nile tilapia (Oreochromis niloticus L.) using mass selection, Aquac Res, 37(12), 1165–71. liao m, zhang l, yang g, zhu m, wang d, wei q, zou g and chen d (2007) Development of silver carp (Hypophthalmichthys molitrix) and bighead carp (Aristichthys nobilis) genetic maps using microsatellite and AFLP markers and a pseudotestcross strategy, Anim Genet, 38(4), 364–70. liu z (2007a) Aquaculture Genome Technologies, Ames, IA, Blackwell. liu z (2007b) Single nucleotide polymorphism (SNP), in Liu Z (ed.), Aquaculture Genome Technologies, Ames, IA, Blackwell, 59–72. liu z j and cordes j f (2004) DNA marker technologies and their applications in aquaculture genetics, Aquaculture, 238(1–4), 1–37. liu z, karsi a, li p, cao d and dunham r (2003) An AFLP-based genetic linkage manp of channel catfish (lctalurus punctatus) constructed by using an interspecific hybrid resourse family, Genetics, 165, 687–94. lymbery a j, doupé r g, jenkins g and thorne t (2000) Genetics in the aquaculture industry, Aquac Res, 31(1), 1–2. ma c, fan l, ganassin r, bols n and collodi p (2001) Production of zebrafish germline chimeras from embryo cell cultures, Proc Nat Acad Sci USA, 98(5), 2461–6. maclean n (2003) Genetically modified fish and their effects on food quality and human health and nutrition, Trends Food Sci Technol, 14, 242–52. maclean n, rahman m a, sohm f, hwang g, iyengar a, ayad h, smith a and farahmand h (2002) Transgenic tilapia and the tilapia genome, Gene, 295(2), 265–77. mair g c (2007) Genetics and breeding in seed supply for inland aquaculture, in Bondad-Reantaso M G (ed.), Assessment of Freshwater Fish Seed Resources for Sustainable Aquaculture, FAO Fisheries Technical Paper, No. 501, Rome, Food and Agriculture Organization of the United Nations, 519–47. maluwa a o, gjerde b (2006a) Genetic evaluation of four strains of Oreochromis shiranus for harvest body weight in a diallel cross, Aquaculture, 259(1–4), 28–37. maluwa a o, gjerde b (2006b) Estimates of the strain additive, maternal and heterosis genetic effects for harvest body weight of an F2 generation of Oreochromis shiranus, Aquaculture, 259(1–4), 38–46. maluwa a o and gjerde b (2007) Response to selection for harvest body weight of Oreochromis shiranus, Aquaculture, 273, 33–41. maluwa a o, gjerde b and ponzoni r w (2006) Genetic parameters and genotype by environment interaction for body weight of Oreochromis shiranus, Aquaculture, 259(1–4), 47–55. mao w, wang y, wang w, wu b, feng j and zhu z (2004) Enhanced resistance to Aeromonas hydrophila infection and enhanced phagocytic activities in human lactoferrin-transgenic grass carp (Ctenopharyngodon idellus), Aquaculture, 242(1–4), 93–103.


81

martínez r, juncal j, zaldívar c, arenal a, guillén i, morera v, carrillo o, estrada m, morales a and estrada m p (2000) Growth efficiency in transgenic tilapia (Oreochromis sp.) carrying a single copy of an homologous cDNA growth hormone, Biochem Biophys Res Comm, 267, 466–72. martinez v (2007) Marker-assisted selection in fish and shellfish breeding schemes, in Guimarães E, Ruane J, Scherf B, Sonnino A and Dargie J (eds), MarkerAssisted Selection, Current Status and Future Perspectives in Crops, Livestock, Forestry and Fish, Rome, Food and Agriculture Organization of the United Nations, 309–28. martinez v, kause a, mäntysaari e and mäki-tanila a (2006a) The use of alternative breeding schemes to enhance genetic improvement in rainbow trout (Oncorhynchus mykiss): I. One-stage selection, Aquaculture, 254(1–4), 182–94. martinez v, kause a, mäntysaari e and mäki-tanila a (2006b) The use of alternative breeding schemes to enhance genetic improvement in rainbow trout: II. Two-stage selection, Aquaculture, 254(1–4), 195–202. maxime v (2008) The physiology of triploid fish: current knowledge and comparisons with diploid fish, Fish Fish, 9, 67–78. mcginnity p, prodöhl p, ferguson a, hynes r, maoiléidigh n o, baker n, cotter d, o’hea b, cooke d, rogan g, taggart j and cross t (2003) Fitness reduction and potential extinction of wild populations of Atlantic salmon, Salmo salar, as a result of interactions with escaped farm salmon, Proc Royal Soc London – Biol Sci, 270(1532), 2443–50. mcginnity p, prodöhl p, maoiléidigh n o, hynes r, cotter d, baker n, o’hea b and ferguson a (2004) Differential lifetime success and performance of native and non-native Atlantic salmon examined under communal natural conditions, J Fish Biol, 65(Suppl. A), 173–87. melamed p, gong z, fletcher g and hew c l (2002) The potential impact of modern biotechnology on fish aquaculture, Aquaculture, 204(3–4), 255–69. millar k and tomkins s (2007) Ethical analysis of the use of GM fish: emerging issues for aquaculture development, J Agric Environ Ethics, 20(5), 437–53. moen t, fjalestad k t, munck h and gomez-raya l (2004) A multistage testing strategy for detection of quantitative trait loci affecting disease resistance in Atlantic salmon, Genetics, 167(2), 851–8. mori t, saito s, kishioka c and arai k (2006) Aquaculture performance of triploid barfin flounder Verasper Moseri, Fish Sci, 72, 270–77. muller h j (1914) A gene for the fourth chromosome of Drosophila, J Exp Zool, 17, 325–36. murata o, harada t, miyashita s, izumi k, maeda s, kato k and kumai h (1996) Selective breeding for growth in red sea bream, Fish Sci, 62(6), 845–9. myers j m, heggelund p o, hudson g and iwamoto r n (2001) Genetics and broodstock management of coho salmon, Aquaculture, 197, 43–62. myhr a i and dalmo r a (2005) Introduction of genetic engineering in aquaculture: ecological and ethical implications for science and governance, Aquaculture, 250(3–4), 542–54. nam y k, noh j k, cho y s, cho h j, cho k-n, kim c g and kim d s (2001) Dramatically accelerated growth and extraordinary gigantism of transgenic mud loach Misgurnus mizolepis, Transgenic Res, 10, 353–62. nam y k, cho y s, cho h j and kim d s (2002) Accelerated growth performance and stable germ-line transmission in androgenetically derived homozygous transgenic mud loach, Misgurnus mizolepis, Aquaculture, 209(1–4), 257–70. nam y k, park i-s and kim d s (2004) Triploid hybridization of fast-growing transgenic mud loach Misgurnus mizolepis male to cyprinid loach Misgurnus anguillicaudatus female: the first performance study on growth and reproduction of transgenic polyploid hybrid fish, Aquaculture, 231(1–4), 559–72.

82


nrc (2002) Animal Biotechnology: Science-Based Concerns, Washington, DC, National Academy Press. naylor r, hindar k, fleming i a, goldburg r, williams s, volpe j, whoriskey f, eagle j, kelso d and mangel m (2005) Fugitive salmon: assessing the risks of escaped fish from net-pen aquaculture, BioScience, 55(5), 427–37. neal j w, neal d m, noble r l and mcgee m v (2004) Artificial propagation and induction of triploidy in largemouth bass Micropterus salmoides and ploidy discrimination using erythrocyte length, J World Aquac Soc, 35(1), 46–54. neira r, lhorente j p, araneda c, díaz n, bustos e and alert a (2004) Studies on carcass quality traits in two populations of coho salmon (Oncorhynchus kisutch): phenotypic and genetic parameters, Aquaculture, 241(1–4), 117–31. nicols k m, young w p, danzmann r g, robinson b d, rexroad c, noakes m, phillips r b, bentzen p, spies i, knudsen k, allendorf f w, cunningham b m, brunelli j, zhang h, ristow s, drew r, brown k h, wheeler p a and thorgaard g h (2003) A consolidated linkage map for rainbow trout (Oncorhynchus mykiss), Anim Genet, 34, 102–15. nomura k, morishima k, tanaka h, unuma t, okuzawa k, ohta h and arai k (2006) Microsatellite-centromere mapping in the Japanese eel (Anguilla japonica) by half-tetrad analysis using induced triploid families, Aquaculture, 257, 53–67. norris a t, bradley d g and cunningham e p (2000) Parentage and relatedness determination in farmed Atlantic salmon (Salmo salar) using microsatellite markers, Aquaculture, 182(1–2), 73–83. ødegård j, olesen i, gjerde b and klemetsdal g (2006) Evaluation of statistical models for genetic analysis of challenge test data on furunculosis resistance in Atlantic salmon (Salmo salar): prediction of field survival, Aquaculture, 259(1–4), 116–23. ødegård j, olesen i, gjerde b and klemetsdal g (2007a) Evaluation of statistical models for genetic analysis of challenge-test data on ISA resistance in Atlantic salmon (Salmo salar): prediction of progeny survival, Aquaculture, 266(1–4), 70–76. ødegård j, olesen i, gjerde b and klemetsdal g (2007b) Positive genetic correlation between resistance to bacterial (furunculosis) and viral (infectious salmon anaemia) diseases in farmed Atlantic salmon (Salmo salar), Aquaculture, 271(1– 4), 173–7. ohara e, nishimura t, nagakura y, sakamoto t, mushiake k and okamoto n (2005) Genetic linkage maps of two yellow tails (seriola quinqueradiala) and (Seriola lalande), Aquaculture, 244, 41–8. okamoto n (2005) Recent progress in molecular genetic and breeding of fish and shellfish for aquaculture, Bull Japan Soc Sci Fish, 71(3), 286–9. olesen i, groen a f and gjerde b (2000) Definition of animal breeding goals for sustainable production systems, J Anim Sci, 78(3), 570–82. olesen i, gjedrem t, bentsen h b, gjerde b and rye m (2003) Breeding programs for sustainable aquaculture, J Appl Aquac, 13(3–4), 179–204. o’reilly p, herbinger c and wright j (1998) Analysis of parentage determination in Atlantic salmon (Salmo salar) using microsatellites, Anim Genet, 29, 363–70. o’reilly p t, carr j w, whoriskey f g and verspoor e (2006) Detection of European ancestry in escaped farmed Atlantic salmon, Salmo salar L., in the Magaguadavic River and Chamcook Stream, New Brunswick, Canada, ICES J Mar Sci, 63(7), 1256–62. oshima k, morishima k, yamaha e and arai k (2005) Reproductive capacity of triploid loaches obtained from Hokkaido island, Japan, Ichthyol Res, 52, 1–8. pandian t j and kirankumar s (2003) Androgenesis and conservation of fishes, Curr Sci, 85(7), 917–31.


83

pandian t j and koteeswaran r (1998) Ploidy induction and sex control in fish, Hydrobiologia, 384, 167–243. parameswaran v, shukla r, bhonde r and hameed a s s (2007) Development of a pluripotent ES-like cell line from Asian sea bass (Lates calcarifer) – an oviparous stem cell line mimicking viviparous ES cells, Mar Biotech, 9(6), 766–75. parsons j (1998) Status of genetic improvement in commercially reared stocks of rainbow trout, World Aquac, 29, 44–7. perez-enriquez r, takagi m and taniguchi n (1999) Genetic variability and pedigree tracing of a hatchery-reared stock of red sea bream (Pagrus major) used for stock enhancement, based on microsatellite DNA markers, Aquaculture, 173(1– 4), 413–23. peruzzi s, chatain b, saillant e, haffray p, menu b and falguière j-c (2004) Production of meiotic gynogenetic and triploid sea bass, Dicentrarchus labrax L.: 1. Performances, maturation and carcass quality, Aquaculture, 230(1–4), 41–64. peruzzi s, varsamos s, chatain b, fauvel c, menu b, falguière j-c, sévère a and flik g (2005) Haematological and physiological characteristics of diploid and triploid sea bass, Dicentrarchus labrax L., Aquaculture, 244(1–4), 359–67. pew initiative on food and biotechnology (2003) Future Fish? Issues in Science and Regulation of Transgenic Fish, Cambridge, MA, The Pew Charitable Trusts, www.pewtrust.org/our_work_report_detail.aspx?id=33350, accessed February 2009. phillips r b and reed k m (1996) Application of fluorescence in situ hybridization (FISH) techniques to fish genetics: a review, Aquaculture, 140(3), 197–216. phillips r b, nichols k m, dekoning j j, morasch m r, keatley k a, rexroad iii c, gahr s a, danzmann r g, drew r e and thorgaard g h (2006) Assignment of rainbow trout linkage groups to specific chromosomes, Genetics, 174, 1661–70. piferrer f, cal r m a, álvarez-blázquez b, sánchez l and martínez p (2000) Induction of triploidy in the turbot (Scophthalmus maximus). I. Ploidy determination and the effects of cold shocks, Aquaculture, 188(1–2), 79–90. piferrer f, cal r m, gómez c, bouza c and martínez p (2003) Induction of triploidy in the turbot (Scophthalmus maximus): II. Effects of cold shock timing and induction of triploidy in a large volume of eggs, Aquaculture, 220(1–4), 821–31. piferrer f, cal r m, gómez c, álvarez-blázquez b, castro j and martínez p (2004) Induction of gynogenesis in the turbot (Scophthalmus maximus): effects of UV irradiation on sperm motility, the Hertwig effect and viability during the first 6 months of age, Aquaculture, 238(1–4), 403–19. ponzoni r w, hamzah a, tan s and kamaruzzaman n (2005) Genetic parameters and response to selection for live weight in the GIFT strain of Nile tilapia (Oreochromis niloticus), Aquaculture, 247(1–4), 203–10. poompuang s and na-nakorn u (2004) A preliminary genetic map of walking catfish (Clarias macrocephalus), Aquaculture, 232(1–4), 195–203. pottinger t g and carrick t r (1999) Modification of the plasma cortisol response to stress in rainbow trout by selective breeding, Gen Comp Endocrinol, 116, 122–32. pullin r s v (2007) Genetic resources for aquaculture: status and trends, in Bartley D M, Harvey B J and Pullin R S V (eds), Workshop on Status and Trends in Aquatic Genetic Resources: a Basis for International Policy, FAO Fisheries Proceedings, No. 5, Rome, Food and Agriculture Organization of the United Nations, 109–43. pullin r s v, palomares m, casal c, dey m and pauly d (1997) Environmental impacts of Tilapia, in Fitzsimmons K (ed.), Tilapia Aquaculture: Proceedings of the Fourth International Symposium on Tilapia in Aquaculture, Publication No.

84


NRAES-106, Ithaca, NY, Northeast Regional Aquacultural Engineering Services, 554–70. quillet e, leguillou s, aubin j, labbé l, fauconneau b and médale f (2007) Response of a lean muscle and a fat muscle rainbow trout (Oncorhynchus mykiss) line on growth, nutrient utilization, body composition and carcass traits when fed two different diets, Aquaculture, 269(1–4), 220–31. quinton c d, mcmillan i and glebe b d (2005) Development of an Atlantic salmon (Salmo salar) genetic improvement program: genetic parameters of harvest body weight and carcass quality traits estimated with animal models, Aquaculture, 247(1–4), 211–17. quinton c d, kause a, koskela j and ritola o (2007) Breeding salmonids for feed efficiency in current fishmeal and future plant-based diet environments, Genet Sel Evol, 39(4), 431–46. rasmussen r s and morrissey m t (2007) Biotechnology in aquaculture: transgenics and polyploidy, Comp Rev Food Sci Food Safe, 6(1), 2–16. reddy p v g k, gjerde b, tripathi s d, jana r k, mahapatra k d, gupta s d, saha j n, sahoo m, lenka s, govindassamy p, rye m and gjedrem t (2002) Growth and survival of six stocks of rohu (Labeo rohita, Hamilton) in mono and polyculture production systems, Aquaculture, 203(3–4), 239–50. rexroad c e iii (2007) Radiation hybrid mapping in aquatic species, in Liu Z (ed.), Aquaculture Genome Technologies, Ames, IA, Blackwell, 313–22. rexroad c, vallejo r, coulibaly i, couch c, garber a, westerman m and sullivan c (2006) Identification and characterization of microsatellites for striped bass from repeat-enriched libraries, Cons Genet, 7(6), 971–82. rothbard s (2006) A review of ploidy manipulations in aquaculture: the Israeli experience, Isr J Aquac – Bamidgeh, 58(4), 266–79. rothbard s, shelton w l, rubinshtein i, hinits y and david l (2000) Induction of all-female triploids in grass carp (Ctenopharyngodon idella) by integration of hormonal sex inversion and ploidy manipulation, Isr J Aquac – Bamidgeh, 52(4), 133–50. rothschild m f and ruvinsky a (2007) Marker-assisted selection for aquaculture species, in Liu Z (ed.), Aquaculture Genome Technologies, Ames, IA, Blackwell, 199–213. saillant e, dupont-nivet m, haffray p and chatain b (2006) Estimates of heritability and genotype-environment interactions for body weight in sea bass (Dicentrarchus labrax L.) raised under communal rearing conditions, Aquaculture, 254(1–4), 139–47. sakamoto t, fuji k, kobayashi k, hasegawa o, ozaki a and okamoto n (2006) Marker-assisted breeding for viral disease resistance in Japanese flounder (Paralichthys olivaceus), Isr J Aquac – Bamidgeh, 58(4), 384–6. sarropoulou e, kotoulas g, bargelloni l, power d m, franch r, louro b, magoulas a, patarnello t, senger f, galibert f and geisler r (2007a) A gene-based radiation hybrid map of the gilthead sea bream Sparus aurata, Aquaculture, 272(Suppl. 1), S308. sarropoulou e, franch r, louro b, power d m, bargelloni l, magoulas a, senger f, tsalavouta m, patarnello t, galibert f, kotoulas g and geisler r (2007b) A gene-based radiation hybrid map of the gilthead sea bream Sparus aurata refines and exploits conserved synteny with Tetraodon nigroviridis, BMC Genom, 8, 44–58. sarropoulou e, nousdili d, magoulas a and kotoulas k (2008) Linking the genomes of nonmodel teleosts through comparative genomics, Mar Biotechnol, 10(3), 227–33. sausa-santos c, collares-pereira m j and almada v (2007) Fertile triploid males – an uncommon case among hybrid vertebrates, J Exp Zool, 307A, 220–25.


85

senanan w, kapuscinski a r, na-nakorn u, miller l m (2004) Genetic impacts of hybrid catfish farming (Clarias macrocephalus × C. gariepinus) on native catfish populations in central Thailand, Aquaculture, 235, 167–84. senger f, priat c, hitte c, sarropoulou e, franch r, geisler r, bargelloni l, power d and galibert f (2006) The first radiation hybrid map of a perch-like fish: the gilthead seabream (Sparus aurata L), Genomics, 87(6), 793–800. silverstein j t, weber g m, rexroad iii c e and vallejo r l (2006) Genetics and genomics – integration of molecular genetics into a breeding program for rainbow trout, Isr J Aquac – Bamidgeh, 58(4), 231–7. soller m and beckmann j s (1982) Restriction fragment length polymorphisms and genetic improvement, Proc. 2nd World Congress Genetics Applied to Livestock Production, VI, Madrid, Editorial Garsi, 396–404. somridhivej b, wang s, sha z, liu h, quilang j, xu p, li p, hu z and liu z (2008) Characterization, polymorphism assessment, and database construction for microsatellites from BAC end sequences of catfish: a resource for integration of linkage and physical maps, Aquaculture, 275, 76–80. sonesson a k (2007a) Possibilities for marker-assisted selection in aquaculture breeding schemes, in Guimarães E, Ruane J, Scherf B, Sonnino A and Dargie J (eds), Marker-Assisted Selection, Current Status and Future Perspectives in Crops, Livestock, Forestry and Fish, Rome, Food and Agriculture Organization of the United Nations, 309–28. sonesson a k (2007b) Within-family marker-assisted selection for aquaculture species, Genet Sel Evol, 39(3), 301–17. sonesson a k and meuwissen t h e (2000) Mating schemes for optimum contribution selection with constrained rates of inbreeding, Genet Sel Evol, 32(3), 231–48. sonesson a k and meuwissen t h e (2002) Non-random mating for selection with restricted rates of inbreeding and overlapping generations, Genet Sel Evol, 34(1), 23–39. sonesson a k, janss l l g and meuwissen t h e (2003) Selection against genetic defects in conservation schemes while controlling inbreeding, Genet Sel Evol, 35(4), 353–68. sonesson a k, gjerde b and meuwissen t h e (2005) Truncation selection for BLUPEBV and phenotypic values in fish breeding schemes, Aquaculture, 243(1–4), 61–8. steffens w, jähnichen h and fredrich f (1990) Possibilities of sturgeon culture in Central Europe, Aquaculture, 89, 101–22. sun x w and liang l q (2004) A genetic linkage map of common carp (Cyprinus carpio L.) and mapping of a locus associated with cold tolerance, Aquaculture, 238, 169–72. taylor j f, needham m p, north b p, morgan a, thompson k and migaud h (2007) The influence of ploidy on saltwater adaptation, acute stress response and immune function following seawater transfer in non-smolting rainbow trout, Gen Comp Endocrinol, 152(2–3), 314–25. teufel j, pätzold f and potthof c (2002) Scientific Research on Transgenic Fish With Special Focus on the Biology of Trout and Salmon, Berlin, Federal Environmental Agency. tiwary b k, kirubagaran r and ray a k (2004) The biology of triploid fish, Rev Fish Biol Fish, 14(4), 391–402. tobin d, kause a, mäntysaari e a, martin s a m, houlihan d f, dobly a, kiessling a, rungruangsak-torrissen k, ritola o and ruohonen k (2006) Fat or lean? The quantitative genetic basis for selection strategies of muscle and body composition traits in breeding schemes of rainbow trout (Oncorhynchus mykiss), Aquaculture, 261(2), 510–21.

86


tvedt h b, benfey t j, martin-robichaud d j, mcgowan c and reith m (2006) Gynogenesis and sex determination in Atlantic halibut (Hippoglossus hippoglossus), Aquaculture, 252(2–4), 573–83. vandeputte m (2003) Selective breeding of quantitative traits in the common carp (Cyprinus carpio): a review, Aquat Liv Res, 16(5), 399–407. verspoor e, beardmore j a, consuegra s, garcía de leániz c, hindar k, jordan w c, koljonen m-l, mahkrov a a, paaver t, sánchez j a, skaala ø, titov s and cross t f (2005) Population structure in the Atlantic salmon: Insights from 40 years of research into genetic protein variation, J Fish Biol, 67(Suppl. 1), 3–54. verspoor e, olesen i, bentsen h b, glover k, mcginnity p and norris a (2006) Atlantic salmon – Salmo salar, in Crosetti D, Lapègue S, Olesen I and Svaasand T (eds), Genetic Effects of Domestication, Culture and Breeding of Fish and Shellfish, and Their Impacts on Wild Populations, GENIMPACT project: evaluation of genetic impact of aquaculture activities on native populations, A European network WP1 workshop, Viterbo, Italy, 12–17th June. villanueva b, woolliams j a and gjerde b (1996) Optimum designs for breeding programmes under mass selection with an application in fish breeding, Anim Sci, 63(3), 563–76. villanueva b, verspoor e and visscher p m (2002) Parental assignment in fish using microsatellite genetic markers with finite numbers of parents and offspring, Anim Genet, 33(1), 33–41. wang c m, zhu z y, lo l c, feng f, lin g, yang w t, li j and yue g h (2007) A microsatellite linkage map of barramundi, Lates calcarifer, Genetics, 175, 907–15. watanabe t, fujita h, yamasaki k, seki s and taniguchi n (2004) Preliminary study on linkage mapping based on microsatellite DNA and AFLP markers using homozygous clonal fish in ayu (Plecoglossus altivelis), Mar Biotechnol, 6(4), 327–34. weir l k, hutchings j a, fleming i a and einum s (2004) Dominance relationships and behavioural correlates of individual spawning success in farmed and wild male Atlantic salmon, Salmo salar, J Anim Ecol, 73(6), 1069–79. weir l k, hutchings j a, fleming i a and einum s (2005) Spawning behaviour and success of mature male Atlantic salmon (Salmo salar) parr of farmed and wild origin, Can J Fish Aquat Sci, 62(5), 1153–60. wenne r, boudry p, hemmer-hansen j, lubieniecki k p, was a and kause a (2007) What role for genomics in fisheries management and aquaculture?, Aquat Living Resour, 20, 241–55. woram r a, mcgowan c, stout j a, gharbi k, ferguson m m, hoyheim b, davidson e a, davidson w s, rexroad c and danzmam r g (2004) A genetic map for Arctic char (Salvelinus alpinus): evidence for higher recombination rates and segregation distortion in hybrid versus pure strain mapping parents, Genome, 47, 304–15. xu p, wang s and liu z (2007) Physical characterization of genomes through BAC end sequencing, in Liu Z (ed.), Aquaculture Genome Technologies, Ames, IA, Blackwell, 261–74. zhu z y, wang c m, lo l c, feng f, lin g and yue g h (2006) Isolation, characterization, and linkage analyses of 74 novel microsatellites in barramundi (Lates calcarifer), Genome, 49(8), 969–76.

3 Genetic variation and selective breeding in hatchery-propagated molluscan shellfish P. Boudry, Ifremer, France

Abstract: This chapter presents the current status of molluscan shellfish domestication and research made to plan and implement efficient breeding programs for the improvement of characters of aquaculture interest, notably yield-related and disease resistance traits. It presents the features of molluscan reproduction and hatchery rearing that have a bearing on the genetic composition of artificially bred and non-native populations, showing how they may hinder improvement but also offer possibilities for selection. The major mollusc breeding programs are reviewed with the methods they employ and progress achieved. Finally, recent developments in genomics and marker assisted selection are presented with their potential applications in the future improvement of molluscan shellfish. Key words: selective breeding, oysters, aquaculture, bivalves, genetics.

3.1 Introduction Despite the high proportion of world aquaculture production that molluscan shellfish represent, this group has benefited little from genetic improvement methods compared with other types of farmed species (Hulata, 2001). Unlike most finfish and shrimp production, molluscan shellfish aquaculture is largely based on the on-growing of wild seed. This is probably the main reason why there have only been small advances made in the development and adoption of genetically superior broodstock. Hatchery production is limited overall and relatively little investment has been made in genetics as a result. Among molluscan shellfish, oysters are the group of species where the most progress has been made so far in this respect (Sheridan, 1997). The first genetic improvements were initiated in countries where collection

88


of wild seed is limited by environmental factors (e.g. Pacific oyster on the west coast of North America), or over-harvesting and subsequent low recruitment (e.g. abalone in New Zealand). It is easy to see how the demand for seed motivated the development of hatchery technology, offering in turn the possibility of controlled reproduction and planned breeding. Disease-related production constraints also strongly encourage work towards genetic improvement for disease resistance. The main genetic improvement made so far in marine molluscs has been based on polyploidy and, more specifically, the production of triploids (Chapter 6). Considering the results of quantitative genetics studies published since the mid-1990s, one might be led to think that selective breeding could vastly improve molluscan shellfish production in the near future. Several selective breeding programs for oysters have been initiated in recent years and have started to benefit the industry, notably in USA, Australia and New-Zealand (a review of these is made below). Selective breeding is indeed a slower way to genetically improve molluscan shellfish than the single-step improvement achieved with triploidy. It should, however, be seen as a logical long-term complement rather than as an alternative option, especially as it can target traits that cannot be modified by triploidisation. When selective breeding programs are correctly planned and well managed genetic gain is cumulative over successive generations, while triploidy is a single-step improvement. Triploidy presents the advantage of a relatively rapid return on investment but might limit or slow down further progress. Selective breeding of tetraploid broodstocks, commonly used in oysters to produce triploids by crossing with diploid parents (Guo et al., 1996), is known to be slower and more complex than for diploids because of the larger number and order of genetic interactions, as illustrated in many autotetraploid crop species (Gallais, 1981). Combining selective breeding and triploidy would therefore be a promising but challenging direction for genetic improvement (McCombie et al., 2005).

3.2 Monitoring genetic diversity and risks related to inbreeding One of the main characteristics of molluscan shellfish is their very high fecundity, highlighted by Williams in his ‘Elm-Oyster Model’ of reproductive strategy in evolution (Williams, 1975). An adult female Pacific oyster commonly produces more than 50 million eggs (Kang et al., 2003). As a result, a very small number of genitors can potentially produce huge numbers of offspring. However, populations based on small numbers of parents will have low effective sizes and inbreeding will occur in subsequent generations. Such loss of genetic diversity can be estimated from the decrease in mean number of alleles per locus, decrease in heterozygosity and/or genetic differentiation between populations (i.e. Fst estimates) (Li

Genetic variation and selective breeding in molluscan shellfish

89

et al., 2004). More interestingly, effective population size (N(e)) can be estimated from temporal changes in the frequencies of selectively neutral alleles in isolated populations (Waples, 1989). This approach also makes it possible to obtain accurate estimates of present genetic effective population size in the wild for abundant species such as prawns (Ovenden et al., 2007) and oysters (Hedgecock et al., 2007a). Loss of genetic diversity due to genetic drift is a well known phenomenon in non-native species introduced into new geographic areas. Such introductions have frequently been made for the production of new species of molluscan shellfish. Several cases of inbreeding depression have been documented following introductions, especially for scallop species (for review see Beaumont, 2000). The bay scallop (Argopecten irradians) was introduced from USA to China in 1982. Only 26 individuals survived transportation and led to a commercial production of 200 000 metric tonnes in 1990 (Guo et al., 1999). The genetic effect of this bottleneck was documented using mitochondrial restriction fragment length polymorphism (RFLP) (Blake et al., 1997), allozyme (Xue et al., 1999) and microsatellite markers (Wang et al., 2007). Despite several recent introductions of new stocks aimed at expanding the gene pool, the genetic diversity remains limited, and clear effects of inbreeding depression have been demonstrated (Zhang et al., 2005). The Japanese scallop (Patinopecten yessoensis) was also introduced to China from Japan in 1982. Using six microsatellite loci, Li et al. (2007) showed that after about two decades of hatchery propagation, effective population sizes ranged from 26 to 70. Contrastingly, in several cases of unintentional introduction of non-native oyster species, little or no reduction of genetic variability was noted. This is the case for the Pacific oyster (Crassostrea gigas) following its introduction from Japan into Australia (English et al., 2000; Appleyard and Ward, 2006), New Zealand (Smith et al., 1986) and France (Huvet et al., 2004a). The same was observed for the Portuguese oyster thought to have been introduced from Taiwan into Portugal and then France (Huvet et al., 2001, 2004a). Similarly, feral populations of the Manila clam (Ruditapes philippinarum), introduced from Asia into Europe during the 1970s show similar levels of genetic variability to native clam species (Borsa and Thiriot-Quievreux, 1990; Moraga, 1986). Hatchery propagation can be a major cause of reduction in effective population size, mainly due to the practice of using a small number of parents to make crosses. Many shellfish broodstocks have been shown to have small effective size (i.e. low genetic variation due to random genetic drift), using either allozymes (Hedgecock et al., 1992) or microsatellite markers (Launey et al., 2001). Although the use of limited numbers of highly fecund genitors is the major reason for reduced effective size in hatchery-propagated molluscan shellfish, additional reasons have been identified. Gametic incompatibility (Gaffney et al., 1993) and differential survival during larval stage (Boudry et al., 2002; Taris et al., 2006) also

90


contribute significantly to increasing variance in reproductive success between genitors. Reduction of effective population size leads to inbreeding in such isolated populations, resulting in a limited response to selection. In molluscan shellfish, inbreeding depression is much better documented than lack of genetic variance (Zheng et al., 2006). This is mainly due to the ease of comparing inbred progenies with outbred ones and the limited number of multi-generation selective breeding studies that have been made (see below). Inbreeding depression is due to unmasking of recessive deleterious alleles (i.e. genetic load). Very high levels of genetic load, revealed by high and frequent distortion of marker segregation ratios, have been reported in oysters (Bierne et al., 1998; Launey and Hedgecock, 2001). Culling, a common practice in shellfish hatcheries and nurseries, may contribute to masking inbreeding by selecting the fast-growing, more heterozygous genotypes (Taris et al. 2007). As a result, the development of homozygous lines, by making crosses between relatives, will be slower than in species with lower genetic load (homozygote disadvantage), as the most heterozygous individuals survive and grow better.

3.3 Inheritance of traits important for aquaculture With the increased interest in the potential for selective breeding in molluscs, much work has been focused on a variety of traits in these animals. The extent of the genetic basis of traits such as growth or disease resistance provides a direct indication of the potential for their improvement by selection. Such evaluations need to be considered in the context of environmental variation, so as to assess the extent of genotype × environment interaction and thus indicate what value a selected group could have under differing rearing environments of varied geographical areas. Selective breeding requires that observed phenotypic variation be partly due to genetic components, and the demonstration of this genetic basis is a prerequisite for any breeding program. Heritability estimates, genetic correlations between traits and genotype × environment interactions are commonly listed as essential information needed to set up a breeding program (Falconer and Mackey, 1996). There are, however, numerous examples of farmed molluscan shellfish species in which these key elements are still unknown, although some genetic information may be available. On one hand, some studies based on comparison between progenies reared in a common environment suggest local population adaptation (e.g. Ibarra et al., 1997; Soletchnik et al., 2002) or different levels of genetic variability (Zheng et al., 2004). Many published studies are based on a small number of families over just one or a limited number of generations (e.g. Ernande et al., 2003), limiting the validity of the genetic parameters estimated. On the other hand, a large number of studies report very encouraging results,


91

showing that significant improvement could be obtained by selective breeding, even though these fail to provide heritability estimates, e.g. Bonamia ostreae resistance in the European flat oyster, Ostrea edulis (Naciri-Graven et al., 1998; Culloty et al., 2004), and resistance to Haplosporidium nelsoni (‘MSX’) (Ford and Haskin, 1987; Ford et al., 1990), Perkinsus marinus (‘Dermo’) (Encomio, et al., 2005) and Roseovarius crassostreae (Juvenile Oyster Disease) (Barber et al., 1998) in the American oyster, Crassostrea virginica (Farley et al., 1998). In these cases, resistant ‘lines’ or ‘strains’ have been produced, but the benefit for shellfish production has been lower than initially expected, either due to technical difficulties at the hatchery and/or nursery stages, or because the shellfish industry itself has not become involved. Among the numerous papers reporting heritability estimates for traits of aquacultural interest in farmed molluscan shellfish, two main types appear: (i) studies based on response to individual selection over one (e.g. Ibarra et al., 1999) or several generations (e.g. Zheng et al., 2006), and (ii) studies based on families using nested or diallel crossing designs. A few papers also report response to family selection (Langdon et al., 2003) and midparent–offspring regressions (Evans and Langdon, 2006a). The magnitude of interactions have been examined in several studies (Evans and Langdon, 2006b; Swan et al., 2007) and were limited in most cases. However, high plasticity of genetic correlations between reproductive effort and both survival and growth have been reported, underlining the influence of environmental conditions on genetic correlation estimations (Ernande et al., 2004). Heritability estimates of larval traits, such as growth or size at particular ages, have been made for mussel (Mallet and Haley, 1984; Toro and Paredes, 1996; Toro et al., 2004), oyster (Losee, 1978; Ernande et al., 2003) and scallop (Jones et al., 1996). Although such studies are relatively easy to perform due to the short time required to record these traits, they are often of limited aquacultural interest, and genetic correlations between larval and postlarval traits are usually low (Ernande et al., 2003). Additionally, heritability estimates often increase with age, e.g. in abalone (Jonasson et al., 1999), although it is not always the case as reported in mussel by Alcapan et al. (2007). Most molluscan on-growing is performed under extensive aquacultural conditions (relative to most finfish or agricultural species) along tidal or shallow coastal areas. As a result, artificial rearing conditions at early stages in the hatchery and nursery (where food availability and water temperature are controlled) might act as efficient domestication forces. The potential of strong (intentional or unintentional) selection at these early stages is therefore important in highly fecund molluscan species (Taris et al., 2007). Further research is needed to determine genetic correlations between traits recorded at spat size and in market size shellfish, which would allow us to gain a deeper understanding of what such approaches could offer (see Hedgecock and Davis, 2007).

92


One of the most extensive heritability studies that has been conducted was made by Ward et al. (2005) on Pacific oyster. Based on a partially hierarchical crossing design (31 males by 31 females to produce 62 families), results provided estimates of heritabilities and genetic correlations for several traits: growth (total, shell, fresh and dry flesh weights), ornamentation and shell colour (from photographs), shell morphology (height, length and depth) and shape (flat, convex, concave or undulating, and presence/ absence of a hook). Estimates of genetic parameters showed a medium to high additive genetic basis for the studied traits and no dominance. In contrast, Hedgecock and Davis (2007) found strong evidence of heterosis for yield (i.e. growth, as the mortality component of yield was negligible in their experiments). To conclude, it is likely that most traits show significant additive but also non-additive variance in the Pacific oyster and many other molluscan shellfish. Special attention has been given to the heritability of resistance to summer mortality in oysters (Samain and McCombie, 2008). Following studies conducted in the USA in the early 1980s (Beattie et al., 1980; Hershberger et al., 1984), high heritability estimates of 0.83 ± 0.40 (Dégremont et al., 2007) were confirmed by the response of this trait to divergent selection (Boudry et al., 2008). Interestingly, broad-sense (Evans and Langdon, 2006b) and narrow-sense (Dégremont et al., 2007) heritability estimates for growth in C. gigas are lower than those for survival (see also Ernande et al., 2004).

3.4 Current status of established molluscan shellfish breeding programs Main work on genetic improvement has so far focussed on oyster species and green-lipped mussel. Although a number of breeding programs that have now been initiated for other molluscan shellfish, e.g. for the scallop Argopecten purpuratus in Chile and for the abalone Haliotis laevigata in Australia (Kube et al., 2007), these are not sufficiently established and/or documented to be described here. The breeding programs that are well described in the literature, and which have already led to significant transfer to industry, provide examples of methods followed and resources required. These selection schemes concern the Pacific oyster C. gigas in the USA, Australia and New Zealand, the Sydney rock oyster Saccostrea glomerata in Australia and the green-lipped mussel Perna canaliculus in New Zealand (Table 3.1). Common points between these programs are the collaboration of industry (farmers and/or hatcheries) and government (institutions, organising structures and funding), and the need for financial support to sustain the programs, at least though their early stages that may span several years.

CSIRO followed by ASI / Thoroughbred oysters New South Wales Department of Primary Industries, Select Oyster Company

Growth

Growth and quality

Growth and quality Resistance to diseases, growth

Pacific oyster

Pacific oyster, green lipped mussel Pacific oyster

Sydney rock oyster

Cawthron Institute

Yield

Pacific oyster

Molluscan Broodstock Program Taylor Shellfish Farms

Main targeted traits

Name of the organisation and/or operating company

New South Wales

Tasmania

New Zealand

West coast of USA West coast of USA

Location

Major selective breeding programs of molluscan shellfish

Species

Table 3.1

1990

1996

1998

1996

Starting year

http://www.oysterssa.com.au/ media/files/734.pdf http://www.dpi.nsw.gov.au/ research/updates/issues/ june-2006/ disease-resistant-oysters

http://www.cawthron.org.nz/ aquaculture/selective-breeding. html

http://hmsc.oregonstate.edu/ projects/mbp/index.htm http://www.fish.washington.edu/ wrac/pdfs/crossbreed_ completion.pdf

Dedicated website or information available on internet

Ward et al., 2005 Nell and Perkins, 2006

Langdon et al., 2003 Hedgecock and Davis, 2007 King et al., 2004

Main reference

94


3.4.1 Selection of C. gigas in the USA Two major C. gigas breeding programs are in operation on the west coast of the USA. The Molluscan Broodstock Program (MBP) was initiated in 1996 (Hedgecock et al., 1996a). This is a collaborative program between Hatfield Marine Science Center, Newport (University of Oregon and USDA) and several commercial companies. Cohorts of 50–60 full-sib families are produced in Newport and evaluated at intertidal and subtidal commercial sites along the west coast. The main initial objective of the MBP was to improve yield (i.e. the combination of survival and growth) by selecting the heaviest 30 % of oysters in the 10 % of families with the best yield. Such a high among-family selective pressure scheme obviously requires a large number of families to be produced per generation (in this case 200–240 families corresponding to four cohorts), and hence the infrastructure necessary to achieve this. The first results published from the MBP concerned gain in yield, and showed an improvement of ≈10 % after one generation of selection (Langdon et al., 2003). More recently genotype × environment was studied in greater depth (Evans and Langdon, 2006b): separating survival and growth, and estimating their coheritability (Evans and Langdon, 2006a). High heritability estimates of mantle and shell pigmentation were also reported (Brake et al., 2004). The USDA Western Regional Aquaculture Center (WRAC) project is examining the potential of hybrid vigour (i.e. heterosis) for yield improvement, by cross-breeding inbred lines. A large genetic load (Launey and Hedgecock, 2001) both explains the frequently observed distortions of Mendelian ratios in inheritance studies (Bierne et al., 1998) and supports the dominance theory of heterosis in oysters (Hedgecock et al., 1996b). Inbred lines (with inbreeding coefficients ranging from f = 0.375 to 0.5) are obtained by mating within full-sib families produced by the MBP or from wild stocks. The oyster lines are reared and maintained by Taylor Resources, Inc., and field performance monitored by Taylor Shellfish Farms and Baywater, Inc. Diallel mating experiments allowed general and specific combining abilities (GCA, SCA) of the tested lines to be estimated (Hedgecock and Davis, 2007). Such an approach requires the production and testing of numerous inbred lines, a time- and labour-intensive process. Recent physiological (Pace et al., 2006) and transcriptomic (Hedgecock et al., 2007b) approaches could ease the selection of elite inbred lines for commercial seed production in the future. Although heterosis is now clearly demonstrated in C. gigas, the potential of cross-breeding relative to other breeding strategies based on additive genetic variance still remains to be explored in depth (see Ryan et al., 2006).

3.4.2 The Australian oyster selection programs Selection is performed on two different cupped oyster species in Australia: the native Sydney rock oyster (Saccostrea glomerata) and the non-native


95

Pacific oyster (C. gigas). Research on C. gigas was initiated in 1993, with an initial phase aiming to estimate heritability and the magnitude of genotype × environment interactions for a number of traits. The value of different selection methods was also evaluated. An individual selection method with mass spawning and 20 % selection pressure, assisted by genetic fingerprinting, was compared with a family selection method based on the production of 40 families per generation using one male × two females. This research work was carried out at the TAFI (Tasmanian Aquaculture and Fisheries Institute) at the University of Tasmania and CSIRO (Commonwealth Scientific and Industrial Research Organization), in partnership with farmers in Tasmania and South Australia. In the second phase of this research (2000), the South Australian Oyster Growers’ Association (SAOGA), the Tasmanian Oyster Research Council and South Australian Oyster Research Council (SAORC), created the Australian Seafood Industry (ASI), a non-profit-making organisation to continue selection and rearing. In 2004, 20 % of Australian production benefited from this program. The first four generations (1996–2000) of individual selection for growth led to a gain of 60 % in live weight and a 50 % reduction in its heterogeneity (Ward and Thompson, 2005; Ward et al., 2005). These changes were accompanied by a 41 % decrease in allelic diversity at eight microsatellite markers, but none at 10 enzymatic loci studied nor in the observed heterozygocity (Appleyard and Ward, 2006). Family selection was initiated in 1997 (40–60 families per generation using one male × two females). Among the numerous results from this study (see Ward et al., 2005a), genotype × environment interactions were generally found to be low, with low genetic correlations between farms. The different selective breeding strategies were analysed, and it was concluded that the combination of moderate interfamily and strong intrafamily selection should maximise genetic gains. The native Sydney rock oyster (S. glomerata) commonly shows slower growth than introduced C. gigas, and its production is strongly affected by mortalities caused by two parasites Mikrocytos roughleyi (winter mortality) and, since 1994, Martelia sydneyi (QX disease). With the aim of improving this situation, researchers at the New South Wales (NSW) Department of Primary Industries initiated two breeding programs, selecting to improve growth and resistance to parasites in the Sydney rock oyster (Nell et al., 2000). These breeding programs started in 1990, formed part of the strategic plan for oyster farming development established through cooperation between the NSW Oyster Farmer’s Association and the Oyster Research Advisory Committee (ORAC). Australian oyster farmers reared the first selected S. glomerata in 2004. The first selection program, initiated in 1990 in Port Stephens, NSW, Australia, aimed to improve growth rate by individual selection of four independent lines. For each generation, each line was reproduced with a mass spawning of about 350 genitors. An overall pressure of 7 % was

96


applied on each generation, and response to selection was estimated after each generation (Nell et al., 1996, 1999; Nell and Perkins, 2005). In 2001, after four generations of selection, the four lines were compared with two control lines at three sites. A mean weight gain of 40 % was observed by the fourth generation (i.e. +10 % per generation). No line × site interaction was observed either for growth (weight and length) or mortality (23 % on average over the whole cycle). The increase in growth rate allowed the rearing time to harvest to be reduced from 41 to about 29 months. The combined effect of selection for growth and triploidisation by cytochalasin B treatment was evaluated after two generations of selection (Hand et al., 2004). The results showed that growth improvements from selective breeding and triploidy were ‘at least additive’, as a positive interaction was observed between triploidy and improvement by selection. A parallel set of breeding lines was also established in 1990 at Georges River, NSW, to select for resistance to Mikrocytos roughleyi. This programme was reorganised and expanded following the outbreak of QX disease in 1994 (Nell et al., 2000; Nell and Hand, 2003). The evaluation of the third generation of selection at three sites (Nell and Perkins, 2006) showed that the three selected lines, which had been subjected to different disease pressures, had improved performances, but that genetic coheritability between resistances to the two diseases was low. Estimates of genetic correlation between resistance to parasites and growth are now needed to establish whether these traits can be improved together by individual selection or if a more complex breeding program is needed.

3.4.3

Selective breeding of Pacific oyster and green-lipped mussel in New Zealand In 1998, a prospective study concluded that it would be beneficial to the shellfish industry in New Zealand to develop selective breeding programs for its major commercial species. The Cawthron Institute undertook this task and is presently the sole hatchery in New Zealand, supplying the entire industry with hatchery seed. As in the MBP in the USA, the Cawthron Institute produces families of oysters (C. gigas), which are then reared on commercial farms and evaluated for their growth performances and quality (i.e. shell shape and uniformity). Following an initial cohort of nine families in 1999 (Janke et al., 2004), 60-family cohorts were then produced every two years from 2001 onwards (King et al., 2004). High within-family selective pressures were applied (20 oysters selected out of 1000), although results remain to be published. Using a similar strategy, cohorts of green-lipped mussel, Perna canaliculus (55–75 full-sib families) have been produced since 2002. The improvement objective in this species is to produce more uniform mussels with better growth rates for a number of different markets (whole live, ½ shell,


97

fresh, frozen or processed). Because of the high influence that mussel density has on growth performance, a mixed family approach is being used, with external identity tags glued to the shells of the mussels from the age of nine months. As these tags are frequently lost during growth and harvest, genetic identification using microsatellite marker is now being considered (McAvoy et al., 2008).

3.5 3.5.1

Present needs and future trends: use of marker-assisted selection and genomics

Mixed-family approaches: the use of DNA fingerprinting for parentage assignment Practical limitations, including space constraints and the management demands of maintaining large numbers of rearing vessels at one time, increase the cost of breeding large numbers of families and represent major drawbacks to family-based selective breeding of molluscan shellfish. Highdensity flow-through larval rearing systems can, however, facilitate the development of such breeding programs (Janke et al., 2004). A mixedfamily approach, using physical tags or genetic markers and sorting, represents an alternative more practical strategy. Physical tagging is impossible at early stages in aquatic species and highly polymorphic polymer chain reaction (PCR)-based markers provide a suitable alternative for species where they are available. Typically, 10–20 variable genetic markers are needed to assign >95 % of individuals to single pairs of parents (e.g. Vandeputte et al., 2006). The very high levels of polymorphism observed at microsatellite markers in bivalves should theoretically make parentage assignment easier. However, high frequencies of null alleles are also commonly observed (Hedgecock et al., 2004), which can lead to difficulties in such analyses. Microsatellites are currently the type of marker most commonly used for parentage assignment (e.g. Herbinger et al., 1995; Fishback et al., 2002; Vandeputte et al., 2004), but amplified fragment length polymorphisms (AFLPs) have also been considered (Gerber et al., 2000). Single nucleotide polymorphisms (SNPs) are considered as a powerful tool for parentage inference that will potentially become important in the near future (Anderson and Garza, 2006), but which can be expensive to analyse and will therefore require the development of cost-efficient high-throughput genotyping methods (Hayes et al., 2005). As mean SNP density is very high in oysters (Curole and Hedgecock, 2005; Sauvage et al., 2007), and likely to be of a similar level in many other marine bivalves, the number of potential SNP markers is extremely high. Parentage assignment studies have been made using microsatellite markers in several mollusc species on an experimental level involving

98


a limited number of genitors (Boudry et al., 2002; Li and Kijima, 2006; Taris et al., 2006; McAvoy et al., 2008). Microsatellites are also used on a routine basis to confirm parentage and pedigree of oyster broodstock (e.g. Hedgecock and Davis, 2007). However, the suitability of such approaches for mixed-family breeding programs remains to be demonstrated, despite the large number of markers already available (Li et al., 2003a). Other potential applications are walk-back selection (Li et al., 2003b; Sonesson, 2005) and pedigree-assisted selection methods (such as animal model-based methods (Lynch and Walch, 1998)). Walk-back selection is especially promising in species for which resources are limited (because the amount of genotyping is considerably lower than for the animal model-based breeding schemes), or for species were controlled reproduction is not optimised (i.e. species for which maturation techniques and/or strip-spawning are not yet well developed).

3.5.2 Quantitative trait loci mapping Mapping chromosome regions that influence phenotypic traits (i.e. quantitative trait loci; QTL) requires linkage maps of medium to high density. Maps are already available for some molluscan shellfish (Table 3.2), but to date only a few published papers report the identification of QTLs in these species. Yu and Guo (2006) identified QTLs for resistance to Perkinsus marinus in the American oyster C. virginica by comparing AFLP genotype frequency before and after mortality in two full-sib families. This method does not, however, evaluate the proportion of phenotypic variance associated with the identified QTLs. The other study described QTLs for shell, muscle, gonad, digestive gland and gill weight in Pacific abalone Haliotis discus hannai (Liu et al., 2007). In addition to these two published studies, positive results have recently been obtained in European Flat oyster Ostrea edulis for Bonamia ostreaea resistance (Lallias et al., 2009), and in the Pacific oyster C. gigas for summer mortality resistance (Sauvage, 2008) and heterosis for growth (Hedgecock et al., 2004b). Several other studies are currently in progress. This work will contribute to an improved understanding of genetic architecture of the studied traits and provide a basis for marker-assisted selection (MAS) programs (Sonesson, 2007; Wenne et al., 2007).

3.5.3 Candidate genes, genomics and marker-assisted selection The availability of molluscan shellfish selected for traits of aquacultural importance provides the opportunity to search for markers and/or assays indicative of different desirable traits. Such markers represent complementary or alternative phenotying tools and could subsequently be used in gene-assisted selection (GAS). For example, phenoloxidase assays have shown that oysters bred for QX resistance have significantly higher activi-


99

Table 3.2 Published linkage maps for molluscan shellfish

Species

Number of linkage groups (LG), Number of markers, Total length (L), Mean distance between markers (D) Male

Crassostrea 10 LG 96 markers gigas L = 758 cM (n = 10) D = 9 cM 10 LG 88 markers L = 616 cM D = 8 cM Crassostrea 12 LG virginica 114 markers L = 647 cM (n = 10) D = 6 cM 9 LG Ostrea 104 markers edulis1 L = 471 cM (n = 10) D = 5 cM 14 LG Mytilus 116 markers edulis L = 825 cM, (n = 14) D = 8 cM 23 LG 166 markers L = 2468 cM D = 15 cM 20 LG Chlamys 197 markers farreri L = 1631 cM (n = 19) D = 9 cM 18 LG Haliotis 167 markers discus L = 702 cM hannai D = 5 cM (n = 18)

Type and number of markers scored (male / female)

Experimental Reference design

349 AFLP

2 F1 families

Female 11 LG 119 markers L = 1031 cM D = 9 cM 10 LG 86 markers L = 770 cM D = 10 cM 12 LG 84 markers L = 904 cM D = 13 cM 10 LG 117 markers L = 450 cM D = 4 cM 14 LG 121 markers L = 862.8 cM D = 8 cM 25 LG 198 markers L = 3130 cM D = 15 cM 19 LG 166 markers L = 1504 cM D = 10 cM 19 LG 160 markers L = 888 cM D = 6 cM

Li and Guo, 2004

115 microsatellites 3 F2 families

Hubert and Hedgecock, 2004

153 / 129 AFLP 3 microsatellites 1 / 2 EST

1 F1 family

Yu and Guo, 2003

235 AFLP 16 microsatellites

1 F2 family

Lallias et al., 2007a

791 AFLP

1 F1 family

Lallias et al., 2007b

603 AFLP

1 F1 family

Wang et al., 2005

667 AFLP

1 F1 family

Li et al., 2005

180 microsatellites 3 F1 families

Sekino and Hara, 2007

1

male and female parents could not be determined in the cross. AFLP = amplified fragment length polymorphism, EST = expressed sequence tag.

ties than the non-selected population, indicating that phenoloxidase may represent a specific QX disease resistance factor (Newton et al., 2004). Direct association between gene polymorphism and phenotypic variation in certain traits has recently been reported in oysters. (Prudence et al., 2006) showed that oyster genotypes with different alleles at the two Amylase

100


gene loci had significant differences in growth. Physiological causes of such differences have also been investigated in relationship with feeding-related traits and specific amylase activity (Huvet et al., 2008). Differential mortality of genotypes at candidate genes have revealed an association between specific alleles of both glutamine synthetase (amino-acid metabolism) and delta-9 desaturase (lipid metabolism) genes with resistance to summer mortality (David et al., 2007). In addition to these a priori approaches, differential gene expression studies can provide new ‘candidate genes’. Differential gene expression between oysters selected to be resistant or sensitive to summer mortality (Huvet et al., 2004b) or exposure to pollutants (Boutet et al., 2004; Tanguy et al., 2005) has led to the identification of large numbers of candidate expressed sequence tags (ESTs). Until now, suppression subtractive hybridisation (SSH) has been the method most frequently used to identify genes differentially expressed between contrasting individuals. However, novel high-throughput transcriptome analysis methods such as microarrays (Jenny et al., 2007), massively parallel signature sequencing (MPSS) (Hedgecock et al., 2007b) or serial analysis of gene expression (SAGE) (Bachère, pers. comm.) are likely to increasingly contribute to the identification of genes of interest in the near future. The non-neutrality of allozyme markers has been strongly debated in bivalves, in relation to heterozygote deficiencies frequently observed in wild populations using these tools (Raymond et al., 1997) and the relationship between heterozygosity and fitness-related traits (Bierne et al., 2000). Evidence of departure from neutrality has been specifically shown for certain markers, both indirectly in a study examining patterns of isolation by distance (Launey et al., 2002) and more directly by measurements of specific activity of given enzymes (Pogson, 1991). However, contrasting results were found by Gardner and Lobkov (2005) and Wood and Gardner (2006). Although cross-breeding is currently proposed as an efficient method of commercial improvement in diploid oysters (Hedgecock and Davis, 2007) and higher multi-locus heterozygocity is associated with better performance in meiosis I triploids when compared with meiosis II (Magoulas et al., 2000), I am not aware of any selective breeding program targeting specific enzyme heterozygocity in any bivalve molluscs. The co-localisation of QTLs and candidate genes should be a mutual reinforcement of both approaches (Carlborg et al., 2005) that would benefit the ultimate progression of molluscan shellfish improvement programs based on such knowledge.

3.6 References alcapan a c, nespolo r f and toro j e (2007) Heritability of body size in the Chilean blue mussel (Mytilus chilensis Hupe 1854): effects of environment and ageing, Aquac Res, 38, 313–20.


101

anderson e c and garza j c (2006) The power of single-nucleotide polymorphisms for large-scale parentage inference, Genetics, 172, 2567–82. appleyard s a and ward r d (2006) Genetic diversity and effective population size in mass selection lines of Pacific oyster (Crassostrea gigas), Aquaculture, 254, 148–59. barber b j, davis c v and crosby m a (1998) Cultured oysters, Crassostrea virginica, genetically selected for fast growth in the Damariscotta River, Maine, are resistant to mortality caused by Juvenile Oyster Disease (JOD), J Shellfish Res, 17, 1171–5. beattie j h, chew k k and hershberger w k (1980) Differential survival of selected strains of Pacific oysters (Crassostrea gigas) during summer mortality, Proc Natl Shellfish Ass, 70, 184–9. beaumont a (2000) Genetic considerations in transfers and introductions of scallops, Aquac Int, 8, 493–512. bierne n, launey s, naciri-graven y and bonhomme f (1998) Early effect of inbreeding as revealed by microsatellite analyses on Ostrea edulis larvae, Genetics, 148, 1893–906. bierne n, tsitrone a and david p (2000) An inbreeding model of associative overdominance during a population bottleneck, Genetics, 155, 1981–90. blake s g, blake n j, oesterling m j and graves j e (1997) Genetic divergence and loss of diversity in two cultured populations of the bay scallop, Argopecten irradians (Lamarck, 1819), J Shellfish Res, 16, 55–8. borsa p and thiriot-quievreux c (1990) Karyological and allozymic characterization of Ruditapes philippinarum, R aureus and R decussatus (Bivalvia, Veneridae), Aquaculture, 90, 209–27. boudry p, collet b, cornette f, hervouet v and bonhomme f (2002) High variance in reproductive success of the Pacific oyster (Crassostrea gigas, Thunberg) revealed by microsatellite-based parentage analysis of multifactorial crosses, Aquaculture, 204, 283–96. boudry p, dégremont l and haffray p (2008) The genetic basis of summer mortality in Pacific oyster spat and potential for improving survival by selective breeding in France, in Summer mortality of Pacific oyster Crassostrea gigas. The Morest Project, Quae Editions, Versailles, 153–96. boutet i, tanguy a and moraga d (2004) Response of the Pacific oyster Crassostrea gigas to hydrocarbon contamination under experimental conditions, Gene, 329, 147–57. brake j, evans f and langdon c (2004) Evidence for genetic control of pigmentation of shell and mantle edge in selected families of Pacific oysters, Crassostrea gigas, Aquaculture, 229, 89–98. carlborg o, de koning d j, manly k f, chesler e, williams r w and haley c s (2005) Methodological aspects of the genetic dissection of gene expression, Bioinformatics 21(10), 2383–93. culloty s c, cronin m a and mulcahy m f (2004) Potential resistance of a number of populations of the oyster Ostrea edulis to the parasite Bonamia ostreae, Aquaculture, 237, 41–58. curole j p and hedgecock d (2005) High frequency of SNPs in the Pacific oyster genome Plant and Animal Genomes XIII Conference, January 15–19, San Diego, CA, http://intl-pag.org/13/abstracts/PAG13_W026.html, accessed January 2009. david e, boudry p, dégremont l, tanguy a, quere n, samain j f and moraga d (2007) Genetic polymorphism of glutamine synthetase and delta-9 desaturase in families of Pacific oyster Crassostrea gigas and susceptibility to summer mortality, J Exp Mar Biol Ecol, 349, 272–83.

102


dégremont l, ernande b, bedier e and boudry p (2007) Summer mortality of hatchery-produced Pacific oyster spat (Crassostrea gigas). I. Estimation of genetic parameters for survival and growth, Aquaculture, 262, 41–53. encomio v g, stickler s m, allen s k jr, and chu f-l (2005) Performance of ‘natural dermo-resistant’ oyster stocks-survival, disease, growth, condition and energy reserves, J Shellfish Res, 24, 143–55. english l j, maguire g b and ward r d (2000) Genetic variation of wild and hatchery populations of the Pacific oyster, Crassostrea gigas (Thunberg) in Australia, Aquaculture, 187, 283–98. ernande b, clobert j, mccombie h and boudry p (2003) Genetic polymorphism and trade-offs in the early life-history strategy of the Pacific oyster, Crassostrea gigas (Thunberg, 1795): a quantitative genetic study, J Evol Biol, 16, 399–414. ernande b, boudry p, clobert j and haure j (2004) Plasticity in resource allocation based life history traits in the Pacific oyster, Crassostrea gigas. I. Spatial variation in food abundance, J Evol Biol, 17, 342–56. evans s and langdon c (2006a) Direct and indirect responses to selection on individual body weight in the Pacific oyster (Crassostrea gigas), Aquaculture, 261, 546–55. evans s and langdon c (2006b) Effects of genotype x environment interactions on the selection of broadly adapted Pacific oysters (Crassostrea gigas), Aquaculture, 261, 522–34. falconer d s and mackay t f c (1996) Introduction to Quantitative Genetics, Longman, Harlow. farley c a, lewis e j, relyea d, zahtila j and rivara g (1998) Resistance studies for juvenile oyster disease (JOD) 1997: Some early insights into genetic aspects, J Shellfish Res, 17, 352–3. fishback a g, danzmann r g, ferguson m m and gibson j p (2002) Estimates of genetic parameters and genotype by environment interactions for growth traits of rainbow trout (Oncorhynchus mykiss) as inferred using molecular pedigrees, Aquaculture, 206, 137–50. ford s e and haskin h h (1987) Infection and mortality patterns in strains of oysters Crassostrea virginica selected for resistance to the parasite Haplosporidium nelsoni (MSX), J Parasitol, 73, 368–76. ford s e, figueras a j and haskin h h (1990) Influence of selective breeding, geographic origin, and disease on gametogenesis and sex-ratios of oysters, Crassostrea virginica, exposed to the parasite Haplosporidium nelsoni (MSX), Aquaculture, 88, 285–301. gaffney p m, bernat c m and allen s k (1993) Gametic incompatibility in wild and cultured populations of the eastern oyster, Crassostrea virginica (Gmelin), Aquaculture, 115, 273–84. gallais a (1981) Quantitative genetics and breeding theory of autoploid plants, Eucarpia Proc Quant Genetics and Breeding Methods, 189–216. gardner j p a and lobkov l (2005) A test for overdominance at the phosphoglucomutase-2 locus in Pacific oysters (Crassostrea gigas) from New Zealand, Aquaculture, 244, 29–39. gerber s, mariette s, streiff r, bodenes c and kremer a (2000) Comparison of microsatellites and amplified fragment length polymorphism markers for parentage analysis, Mol Ecol, 9, 1037–48. guo x m, debrosse g a and allen s k (1996) All-triploid pacific oysters (Crassostrea gigas Thunberg) produced by mating tetraploids and diploids, Aquaculture, 142, 149–61. guo x, ford s e and zhang f (1999) Molluscan aquaculture in China, J Shellfish Res, 18, 19–31.


103

hand r e, nell j a and thompson p a (2004) Studies on triploid oysters in Australia XIII. Performance of diploid and triploid Sydney rock oyster, Saccostrea glomerata (Gould, 1850), progeny from a third generation breeding line, Aquaculture, 233, 93–107. hayes b, sonesson a k and gjerde b (2005) Evaluation of three strategies using DNA markers for traceability in aquaculture species, Aquaculture, 250, 70–81. hedgecock d and davis j (2007) Heterosis for yield and crossbreeding of the Pacific oyster Crassostrea gigas, Aquaculture, 272, S17–S29. hedgecock d, chow v and waples r s (1992) Effective population numbers of shellfish broodstocks estimated from temporal variance in allelic frequencies, Aquaculture, 108, 215–32. hedgecock d, langdon c, blouin m and allen s (1996a) Genetic improvement of cultured oysters by selection, Coastal Marine Experiment Station Annual Report, Agricultural Experimental Station, Oregon State University, Corvallis, OR. hedgecock d, mcgoldrick d j, manahan d t, vavra j, appelmans n and bayne b l (1996b) Quantitative and molecular-genetic analyses of heterosis in bivalve mollusks, J Exp Mar Biol Ecol, 203, 49–59. hedgecock d, li g, hubert s, bucklin k and ribes v (2004a) Widespread null alleles and poor cross-species amplification of microsatellite DNA loci cloned from the Pacific oyster, Crassostrea gigas, J Shellfish Res, 23, 379–85. hedgecock d, li g m-l and voigt m l (2004b) Mapping heterosis QTL in the Pacific oyster Crassostrea gigas, Plant and Animal Genomes II Conference, January 10–14, San Diego, CA, http://www.intl-pag.org/12/abstracts/W06_ PAG12_19.html, accessed January 2009. hedgecock d, launey s, pudovkin a i, naciri y, lapegue s and bonhomme f (2007a) Small effective number of parents (N-b) inferred for a naturally spawned cohort of juvenile European flat oysters Ostrea edulis, Mar Biol, 150, 1173–82. hedgecock d, lin j z, decola s, haudenschild c d, meyer e, manahan d t and bowen b (2007b) Transcriptomic analysis of growth heterosis in larval Pacific oysters (Crassostrea gigas), Proc Natl Acad Sci USA, 104, 2313–18. herbinger c m, doyle r w, pitman e r, paquet d, mesa k a, morris d b, wright j m and cook d (1995) DNA fingerprint based analysis of paternal and maternal effects on offspring growth and survival in communally reared rainbow trout, Aquaculture, 137, 245–56. hershberger w k, perdue j a and beattie j h (1984) Genetic selection and systematic breeding in Pacific oyster culture, Aquaculture, 39, 237–45. hubert s and hedgecock d (2004) Linkage maps of microsatellite DNA markers for the Pacific oyster Crassostrea gigas, Genetics, 168, 351–62. hulata g (2001) Genetic manipulations in aquaculture: a review of stock improvement by classical and modern technologies, Aquaculture, 111, 155–73. huvet a, lapegue s, magoulas a and boudry p (2001) Mitochondrial and nuclear DNA phylogeography of Crassostrea angulata, the Portuguese oyster endangered in Europe, Mar Biotechnol, 1, 251–62. huvet a, fabioux c, mccombie h, lapegue s and boudry p (2004a) Natural hybridization between genetically differentiated populations of Crassostrea gigas and C. angulata highlighted by sequence variation in flanking regions of a microsatellite locus, Mar Ecol – Prog Ser, 272, 141–52. huvet a, herpin a, degremont l, labreuche y, samain j f and cunningham c (2004b) The identification of genes from the oyster Crassostrea gigas that are differentially expressed in progeny exhibiting opposed susceptibility to summer mortality, Gene, 343, 211–20. huvet a, jeffroy f, fabioux c, daniel j y, quillien v, van wormhoudt a, moal j, samain j f, boudry p and pouvreau s (2008) Association among growth, food

104


consumption-related traits and amylase gene polymorphism in the Pacific oyster Crassostrea gigas, Anim Genet, 39, 662–5. ibarra a m, ramirez j l and garcia g a (1997) Stocking density effects on larval growth and survival of two Catarina scallop, Argopecten ventricosus (equals circularis) (Sowerby II, 1842), populations, Aquac Res, 28, 443–51. ibarra a m, ramirez j l, ruiz c a, cruz p and avila s (1999) Realized heritabilities and genetic correlation after dual selection for total weight and shell width in catarina scallop (Argopecten ventricosus), Aquaculture, 175, 227–41. janke a, king n, roberts r and kaspar h (2004) Selective breeding of the Pacific oyster Crassostrea gigas in New Zealand, Aquaculture 2004, Book of Abstracts, 311. jenny m j, chapman r w, mancia a, chen y a, mckillen d j, trent h, lang p, escoubas j m, bachere e, boulo v, liu z j, gross p s, cunningham c, cupit p m, tanguy a, guo x, moraga d, boutet i, huvet a, de guise s, almeida j s and warr g w (2007) A cDNA Microarray for Crassostrea virginica and C. gigas, Mar Biotechnol, 9, 577–91. jonasson j, stefansson s e, gudnason a and steinarsson a (1999) Genetic variation for survival and shell length of cultured red abalone (Haliotis rufescens) in Iceland, J Shellfish Res, 18, 621–5. jones r, bates j a, innes d j and thompson r j (1996) Quantitative genetic analysis of growth in larval scallops (Placopecten magellanicus), Mar Biol, 124, 671–7. kang s g, choi k s, bulgakov a a, kim y and kim s y (2003) Enzyme-linked immunosorbent assay (ELISA) used in quantification of reproductive output in the pacific oyster, Crassostrea gigas, in Korea, J Exp Mar Biol Ecol, 282, 1–21. king n, janke a, roberts r and kaspar h (2004) New Zealand oyster-breeding program seeks genetic improvements, Global Aquac Advocate, 7(3), 59–60. kube p d, appleyard s a and elliot n g (2007) Selective breeding greenlip abalone (Haliotis laevigata): Preliminary results and issues, J Shellfish Res, 26, 821–4. lallias d, beaumont a r, haley c s, boudry p, heurtebise s and lapègue s (2007a) A first-generation genetic linkage map of the European flat oyster Ostrea edulis (L.) based on AFLP and microsatellite markers. Anim Genet, 38, 560–8. lallias d, lapegue s, hecquet c, boudry p and beaumont a r (2007b) AFLP-based genetic linkage maps of the blue mussel (Mytilus edulis), Anim Genet, 38, 340–9. lallias d, gomez-raya l, haley c s, arzul i, heurtebise s, beaumont a r, boudry p and lapègue s (2009) Combining two-stage testing and interval mapping strategies to detect QTL for resistance to bonamiosis in the European flat oyster Ostrea edulis, Mar Biotechnol (in press). langdon c, evans f, jacobson d and blouin m (2003) Yields of cultured Pacific oysters Crassostrea gigas Thunberg improved after one generation of selection, Aquaculture, 220, 227–44. launey s and hedgecock d (2001) High genetic load in the Pacific oyster Crassostrea gigas, Genetics, 159, 255–65. launey s, barre m, gerard a and naciri-graven y (2001) Population bottleneck and effective size in Bonamia ostreae-resistant populations of Ostrea edulis as inferred by microsatellite markers, Genet Res, 78, 259–70. launey s, ledu c, boudry p, bonhomme f and naciri-graven y (2002) Geographic structure in the European flat oyster (Ostrea edulis L.) as revealed by microsatellite polymorphism, J Hered, 93, 331–8. li l and guo x m (2004) AFLP-based genetic linkage maps of the Pacific oyster Crassostrea gigas Thunberg, Mar Biotechnol, 6, 26–36. li q and kijima a (2006) Microsatellite analysis of gynogenetic families in the Pacific oyster, Crassostrea gigas, J Exp Mar Biol Ecol, 331, 1–8.


105

li g, hubert s, bucklin k, ribes v and hedgecock d (2003a) Characterization of 79 microsatellite DNA markers in the Pacific oyster Crassostrea gigas, Mol Ecol Notes, 3, 228–32. li x, field c and doyle r (2003b) Estimation of additive genetic variance components in aquaculture populations selectively pedigreed by DNA fingerprinting, Biom J, 45, 61–72. li q, park c, endo t and kijima a (2004) Loss of genetic variation at microsatellite loci in hatchery strains of the Pacific abalone (Haliotis discus hannai), Aquaculture, 235, 207–22. li l, xiang j h, liu x, zhang y, dong b and zhang x j (2005) Construction of AFLPbased genetic linkage map for Zhikong scallop, Chlamys farreri Jones et Preston and mapping of sex-linked markers, Aquaculture, 245, 63–73. li q, xu k f and yu r h (2007) Genetic variation in Chinese hatchery populations of the Japanese scallop (Patinopecten yessoensis) inferred from microsatellite data, Aquaculture, 269, 211–19. liu x d, liu x and zhang g f (2007) Identification of quantitative trait loci for growth-related traits in the Pacific abalone Haliotis discus hannai Ino, Aquac Res, 38, 789–97. losee e (1978) Influence of Heredity on Larval and Spat Growth in Crassostrea virginica, Atlanta, GA, Louisiana State University Division of Continuing Education, Baton Rouge, LA. lynch m and walch b (1998) Genetics and Analysis of Quantitative Traits, Sunderland, MA, Sinauer Associates Inc. magoulas a, kotoulas g, gerard a, naciri-graven y, dermitzakis e, hawkins a j s and ll a (2000) Comparison of genetic variability and parentage in different ploidy classes of the Japanese oyster Crassostrea gigas, Genet Res, 76, 261–72. mallet a l and haley l e (1984) General and specific combining abilities of larval and juvenile growth and viability estimated from natural oyster populations, Mar Biol, 81, 53–9. mcavoy e s, wood a r and gardeur j n (2008) Development and evaluation of microsatellite markers for identification of individual GreenshellTM mussels (Perna canaliculus) in a selective breeding programme, Aquaculture, 274, 41–8. mccombie h, ledu c, phelipot p, lapegue s, boudry p and gerard a (2005) A complementary method for production of tetraploid Crassostrea gigas using crosses between diploids and tetraploids with cytochalasin B treatments, Mar Biotechnol, 7, 318–30. moraga d (1986) Genetic-polymorphism of cultivated populations of the Manila clam, Tapes philippinarum, Comptes Rendus Acad Sci Ser III-Sci Vie-Life Sci, 302, 621–4. naciri-graven y, martin a g, baud j p, renault t and gerard a (1998) Selecting the flat oyster Ostrea edulis (L) for survival when infected with the parasite Bonamia ostreae, J Exp Mar Biol Ecol, 224, 91–107. nell j a and hand r e (2003) Evaluation of the progeny of second-generation Sydney rock oyster Saccostrea glomerata (Gould, 1850) breeding lines for resistance to QX disease Marteilia sydneyi, Aquaculture, 228, 27–35. nell j a and perkins b (2005) Evaluation of progeny of fourth generation Sydney rock oyster Saccostrea glomerata (Gould, 1850) breeding lines, Aquac Res, 36, 753–7. nell j a and perkins b (2006) Evaluation of the progeny of third-generation Sydney rock oyster Saccostrea glomerata (Gould, 1850) breeding lines for resistance to QX disease Marteilia sydneyi and winter mortality Bonamia roughleyi, Aquac Res, 37, 693–700.

106


nell j a, sheridan a k and smith i r (1996) Progress in a Sydney rock oyster, Saccostrea commercialis (Iredale and Roughley), breeding program, Aquaculture, 144, 295–302. nell j a, smith i r and mcphee c c (2000) The Sydney rock oyster Saccostrea glomerata (Gould 1850) breeding programme: progress and goals, Aquac Res, 31, 45–9. nell j a, smith i r and sheridan a k (1999) Third generation evaluation of Sydney rock oyster Saccostrea commercialis (Iredale and Roughley) breeding lines, Aquaculture, 170, 195–203. newton k, peters r and raftos d (2004) Phenoloxidase and QX disease resistance in Sydney rock oysters (Saccostrea glomerata), Dev Comp Immunol, 28, 565–9. ovenden j r, peel d, street r, courtney a j, hoyle s d, peel s l and podlich h (2007) The genetic effective and adult census size of an Australian population of tiger prawns (Penaeus esculentus), Mol Ecol, 16, 127–38. pace d a, marsh a g, leong p k, green a j, hedgecock d and manahan d t (2006) Physiological bases of genetically determined variation in growth of marine invertebrate larvae: A study of growth heterosis in the bivalve Crassostrea gigas, J Exp Mar Biol Ecol, 335, 188–209. pogson g h (1991) Expression of overdominance for specific activity at the phosphoglucomutase-2 locus in the pacific oyster, Crassostrea gigas, Genetics, 128, 133–41. prudence m, moal j, boudry p, daniel j y, quere c, jeffroy f, mingant c, ropert m, bedier e, van wormhoudt a, samain j f and huvet a (2006) An amylase gene polymorphism is associated with growth differences in the Pacific cupped oyster Crassostrea gigas, Anim Genet, 37, 348–51. raymond m, vaanto r l, thomas f, rousset f, demeeus t and renaud f (1997) Heterozygote deficiency in the mussel Mytilus edulis species complex revisited, Mar Ecol – Prog Ser, 156, 225–37. ryan f b, kube p b, parkinson s a, li x and nell j a (2006) Selection of Genetic Strategies in Pacific Oysters to Maximise Commercial Benefit, Australian Seafood Industries, Howrah, TAS. samain j f and mccombie h (2008) Summer Mortality in Pacific Oyster Crassostrea gigas, The Morest Project, Versailles, Editions Quae. sauvage c (2008) Développement de marqueurs moléculaires liés à la résistance à la mortalité estivale chez l’huître creuse Crassostrea gigas – approche QTL, Thèse de Doctorat de l’Université de La Rochelle. sauvage c, bierne n, lapegue s and boudry p (2007) Single nucleotide polymorphisms and their relationship to codon usage bias in the Pacific oyster Crassostrea gigas, Gene, 406, 13–22. sekino m and hara m (2007) Linkage maps for the Pacific abalone (genus Haliotis) based on microsatellite DNA markers, Genetics, 175, 945–58. sheridan a k (1997) Genetic improvement of oyster production-a critique, Aquaculture, 153, 165–79. smith p j, ozaki h and fujio y (1986) No evidence for reduced genetic-variation in the accidentally introduced oyster Crassostrea gigas in New Zealand, New Zea J Mar Fresh Res, 20, 569–74. soletchnik p, huvet a, le moine o, razet d, geairon p, faury n, goulletquer p and boudry p (2002) A comparative field study of growth, survival and reproduction of Crassostrea gigas, C-angulata and their hybrids, Aquat Living Resour, 15, 243–50. sonesson a k (2005) A combination of walk-back and optimum contribution selection in fish: a simulation study, Genet Sel Evol, 37, 587–99. sonesson a k (2007) Within-family marker-assisted selection for aquaculture species, Genet Sel Evol, 39, 301–17.


107

swan a a, thompson p a and ward r d (2007) Genotype x environment interactions for weight in Pacific oysters (Crassostrea gigas) on five Australian farms, Aquaculture, 265, 91–101. tanguy a, boutet i, laroche j and moraga d (2005) Molecular identification and expression study of differentially regulated genes in the Pacific oyster Crassostrea gigas in response to pesticide exposure, Febs J, 272, 390–403. taris n, ernande b, mccombie h and boudry p (2006) Phenotypic and genetic consequences of size selection at the larval stage in the Pacific oyster (Crassostrea gigas), J Exp Mar Biol Ecol, 333, 147–58. taris n, batista f m and boudry p (2007) Evidence of response to unintentional selection for faster development and inbreeding depression in Crassostrea gigas larvae, Aquaculture, 272(supp 1), S69–S79. toro j e and paredes l i (1996) Heritability estimates of larval shell length in the Chilean blue mussel Mytilus chilensis, under different food densities, Aquat Living Resour, 9, 347–50. toro j e, alcapan a c, vergara a m and ojeda j a (2004) Heritability estimates of larval and spat shell height in the Chilean blue mussel (Mytilus chilensis Hupe 1854) produced under controlled laboratory conditions, Aquac Res, 35, 56–61. vandeputte m, kocour m, mauger s, dupont-nivet m, de guerry d, rodina m, gela d, vallod d, chevassus b and linhart o (2004) Heritability estimates for growthrelated traits using microsatellite parentage assignment in juvenile common carp (Cyprinus carpio L.), Aquaculture, 235, 223–36. vandeputte m, mauger s and dupont-nivet m (2006) An evaluation of allowing for mismatches as a way to manage genotyping errors in parentage assignment by exclusion, Mol Ecol Notes, 6, 265–7. wang l l, song l s, chang y q, xu w, ni d j and guo x m (2005) A preliminary genetic map of Zhikong scallop (Chlamys farreri Jones et Preston 1904), Aquac Res 36, 643–53. wang l l, zhang h, song l and guo x (2007) Loss of allele diversity in introduced populations of the hermaphroditic bay scallop Argopecten irradians, Aquaculture, 271, 252–9. waples r s (1989) A generalized approach for estimating effective population size from temporal changes in allele frequency, Genetics, 121, 379–91. ward r d and thompson p a (2005) Progress in a genetic improvement program for Pacific oysters (Crassostrea gigas) in Australia, Aquaculture, 247, 32–3. ward r d, thompson p a, appleyard s a, swan a a and kube p d (2005) Sustainable genetic improvement of Pacific oysters in Tasmania and South Australia, Final Report FRDC Project 2000/2006, Hobart (Tasmania), CSIRO Marine and Atmospheric Research and Fisheries Research and Development Corporation, Hobart, TAS. wenne r, boudry p, hemmer-hansen j, lubieniecki k p, was a and kause a (2007) What role for genomics in fisheries management and aquaculture? Aquat Living Resour, 20, 241–55. williams g c (1975) Sex and Evolution, Princeton, NJ, Princeton University Press. wood a r and gardner j p a (2006) No evidence for overdominance at the phosphoglucomutase-2 locus in Pacific oysters (Crassostrea gigas) from New Zealand, Aquaculture, 259, 74–80. xue q, sheila s, zhang f and xiang j (1999) Population genetic structure at allozymes phosphoglucomutase (PGM) locus and its related in different populations of bay scallop, Argopecten irradians, Oceanol Limnol Sin, 30, 381–90. yu z n and guo x m (2003) Genetic linkage map of the eastern oyster Crassostrea virginica Gmelin, Biol Bull, 204, 327–38. yu z n and guo x m (2006) Identification and mapping of disease-resistance QTLs in the eastern oyster, Crassostrea virginica Gmelin, Aquaculture, 254, 160–70.

108


zhang h b, liu x, zhang g f and zhang g z (2005) Effects of effective population size (Ne) on the F2 growth and survival of bay scallop Argopecten irradians irradians (Lamarck). Acta Oceanol Sin, 24, 114–20. zheng h p, zhang g f, liu x, zhang f s and guo x m (2004) Different responses to selection in two stocks of the bay scallop, Argopecten irradians irradians Lamarck (1819), J Exp Mar Biol Ecol, 313, 213–23. zheng h p, zhang g f, liu x a and guo x m (2006) Sustained response to selection in an introduced population of the hermaphroditic bay scallop Argopecten irradians irradians Lamarck (1819), Aquaculture, 255, 579–85.

4 Controlling fish reproduction in aquaculture C. Mylonas, Hellenic Center for Marine Research, Greece, and Y. Zohar, University of Maryland Biotechnology Institute, USA

Abstract: Industrial aquaculture is a new activity to most parts of the world and is looking for ways to establish a reliable and controlled system for the provision of seed stock for grow-out operations. Control of reproductive function can be achieved, in many fish species, by manipulating photoperiod, water temperature and spawning substrate. The reproductive cycle is separated in two phases – i.e., growth and maturation – which may be controlled by different reproductive hormones at the level of the pituitary and gonad. Although the first phase of reproductive development is concluded in captivity, the second stage of the reproductive cycle – i.e., oocyte maturation (OM) and ovulation in females, and spermiation in males – may require the employment of exogenous hormonal therapies. In some species, these hormonal manipulations are used only as a management tool to enhance the efficiency of egg production and facilitate hatchery operations, but in other fishes exogenous hormones are the only way to produce fertilized eggs at an industrial level. The reproductive cycle is controlled by the interactions of the hormones of the brain–pituitary– gonad axis. From the brain, gonadotropin releasing hormones (GnRHs) travel along neural axons and stimulate the gonadotroph cells of the pituitary to produce and secrete the two gonadotropins (GtH) follicle stimulating hormone (FSH) and luteinizing hormone (LH), which, in turn, act at the level of the gonad to induce steroidogenesis and the production of the androgens, estrogens and progestagens, which are the final effectors of reproductive function. Hormonal manipulations of reproductive function in cultured fishes have focused on the use of either exogenous LH preparations that act directly at the level of the gonad, or synthetic GnRH agonists (GnRHa) that act at the level of the pituitary to induce release of the endogenous LH stores, which, in turn act at the level of the gonad to induce steroidogenesis and the process of OM and spermiation. Key words: reproduction, induced spawning, final oocyte maturation, spermiation.

110


4.1 Introduction As an industrial agricultural activity, aquaculture is quite new to most parts of the world, with the exception of the extensive carp culture (family Cyprinidae) in Asia and the more recent intensification of salmonid production (Oncorhynchus and Salmo spp) in Europe and North America. In essence, it is only since the 1970s that a truly worldwide industry has developed, lately focusing on marine fishes (Kirk, 1987), and this industry is looking for ways to establish a reliable and controlled system for the provision of seed stock for grow-out operations. Control of reproductive function can be achieved, in many fish species, by manipulating photoperiod, water temperature and spawning substrate. However, the conclusion of the final stage of the reproductive cycle – i.e., oocyte maturation and ovulation in females, and spermiation in males – may require the employment of exogenous hormonal therapies. In some species, these hormonal manipulations are used only as a management tool to enhance the efficiency of egg production and facilitate hatchery operations, but in other fishes exogenous hormones are the only way to produce fertilized eggs at an industrial level. This chapter provides a brief description of the reproductive biology of fishes, followed by a description of the major problems encountered in culture, and the hormonal methods developed in the last few decades to address these dysfunctions. Some consideration is also given to future trends in the spawning induction technologies.

4.2 The fish reproductive cycle and its control The reproductive cycle is separated in two phases – i.e., growth and maturation – which may be controlled by different reproductive hormones at the level of the pituitary and gonad (Fig. 4.1). In females, the first phase includes the growth of the primary oocytes and the accumulation of the yolk precursor, vitellogenin (vtg), in their cytoplasm (Fig. 4.2). At the completion of this phase, which is also referred to as vitellogenesis, the process of oocyte maturation (OM) includes both cytoplasmic and nuclear events that prepare the oocyte for its expulsion from the ovarian follicle (ovulation), its release to the environment during spawning and its fertilization by a single spermatozoon. In males, the growth phase is referred to as spermatogenesis and includes the mitotic proliferation of the spermatogonia into primary spermatocytes, their meiotic division into secondary spermatocytes and their differentiation to spermatids and flagellated spermatozoa. The process of maturation, better known as spermiation, includes the increase in seminal fluid production and the capacitation of the spermatozoa, which are now able to undergo forward motility once released in the water during spawning. The reproductive cycle is controlled by the interactions of the hormones of the brain–pituitary–gonad axis (Fig. 4.1). From the brain, gonadotropin releasing hormones (GnRHs) produced in specific neuroendocrine cells

Controlling fish reproduction in aquaculture

The reproductive axis in fish Environment (photoperiod, lunar cycle, temperature, rainfall)

Spermatogenesis & vitellogenesis

Follicle stimulating hormone (FSH)

Androgens Estrogens

Fully grown gametes

Brain GnRH +

Pituitary

Gonad

111

♀♂

Final maturation DA Luteinizing hormone (LH)

17,20bdihydroxy Progesterone Fertile gametes

Fig. 4.1 Schematic representation of the reproductive axis in fish, its major components and phases, and its environmental and endocrine control.

(Gothilf et al., 1996, 1997; Holland et al., 2001) travel along neural axons and are released immediately at synapses with the gonadotropic cells of the pituitary gland (Yaron et al., 2003). The synthesis and release of the GnRHs is controlled by environmental and nutritional parameters in such a way that reproduction takes place under optimal conditions (Yu et al., 1997). In response to GnRH stimulation, the gonadotrophs produce and secrete the two gonadotropins (GtH) follicle stimulating hormone (FSH) and luteinizing hormone (LH), which, in turn, act at the level of the gonad to induce steroidogenesis (Rosenfeld et al., 2007) and the production of the androgens, estrogens and progestagens, which are the final effectors of reproductive function. In addition to the primary GnRH stimulatory system, neurons secreting dopamine (DA) exert an inhibitory action on both the brain (GnRH synthesis and release) and pituitary (down-regulation of GnRH-R and interference with the GnRH signal-transduction pathways) (Peter et al., 1993; Peter and Yu, 1997; Yaron et al., 2003; Dufour et al., 2005; Levavi-Sivan et al., 2004). As a result, DA inhibits both basal LH secretion and GnRHstimulated LH secretion from the pituitary. Although a dopaminergic inhibition on LH release has been demonstrated in all vertebrates, its intensity and temporal action may differ greatly among fishes. A strong dopaminergic inhibition of reproduction has been demonstrated in salmonids, cyprinids, silurids, tilapia (Oreochromis spp.), freshwater eel (Anguilla anguilla) and grey mullet (Mugil cephalus) (Saligaut et al., 1999; Silverstein et al.,

112


A

B gv gv po y

po y l C

D

ca

y

E y ca

l gv

gv

y l

H

G

F

y y

l

gv

gv

y

l l ca

Fig. 4.2 Microphotographs of histological sections from ovaries. (A) Primary oocytes (po) of striped bass, having a centrally located germinal vesicle (gv) and peripheral nucleoli. (B) Oocytes at various stages of vitellogenesis from Atlantic bluefin tuna. Vitellogenic oocytes have various amounts of lipid droplets (l) and yolk vesicles (y). (C) Vitellogenic oocyte of white bass containing small numbers of lipid droplets. (D) Vitellogenic oocyte of striped bass with a very large percentage of lipid droplets. The periphery is occupied by cortical alveoli (ca). (E) Vitellogenic oocyte of American shad (Alosa sapidissima) showing no lipid droplets. (F) Oocyte of striped bass undergoing GV migration and lipid coalescence. (G) Oocyte of striped bass at the GV breakdown stage. (H) Ovulated egg from striped bass. Photographs are not at the same scale.


113

1999; Yaron et al., 2003; Vidal et al., 2004). In contrast, a DA inhibitory system seems to be very weak or absent in most marine fishes (Copeland and Thomas, 1989; Zohar et al., 1995; Kumakura et al., 2003a; Prat et al., 2001).

4.2.1 Vitellogenesis, oocyte maturation and ovulation At the onset of vitellogenesis, the ovigerous lamellae of the ovary contain nests of primary oocytes (Fig. 4.2a), which are arrested at prophase I (Guraya, 1986; Wallace and Selman, 1990; Selman et al., 1993). After a period referred to as primary growth, or previtellogenesis, during which the appearance of the ovarian follicle (i.e., the granulosa and theca layers) takes place, vitellogenesis, or the secondary growth, begins (Fig. 4.2b). Vitellogenesis is a hormone-dependant process and its immediate effector is the estrogen 17β-estradiol (E2), produced from the androgen testosterone (T) by the ovarian follicle in a two-cell process involving both the theca and granulosa cell layers (Nagahama, 1994). Regulation of steroidogenesis and E2 production at this time is controlled by the pituitary GtH, in some species by FSH and in others by LH (Rosenfeld et al., 2007). As the name implies, the major characteristic of vitellogenesis is the production of vitellogenin (vtg), which takes place in the liver, and its sequestration in a pinocytosis-mediated process into the developing oocyte (Mommsen and Walsh, 1988; Tyler and Sumpter, 1996). At the start of vitellogenesis, the oocytes may be 150–250 μm in diameter (Fig. 4.2b) and, depending on fish species, at the end of the process the post-vitellogenic oocytes may have a diameter of 550 μm, as in shi drum (Umbrina cirrosa) (Mylonas et al., 2004a), 850 μm, as in striped bass (Morone saxatilis) (Mylonas et al., 1997e), 1400 μm, as in wreckfish (Polyprion americanus) (Fauvel et al., 2007), or up to 4 mm, as in Salmo and Oncorhynchus species (Bromage et al., 1992). Once sequestered into the oocytes, vtg is stored in the yolk globules (or granules), until the process of OM. Another type of nutrients accumulating into the growing vitellogenic oocytes are the lipids. Depending on the species of fish, lipids may be present in the form of triglycerides, phospholipids or wax esters (Lund et al., 2000), and the amount and type of lipid class dominating the cytoplasm determines the presence (Fig. 4.2b, c and d) or absence (Fig. 4.2e), and size and number of lipid droplets (Fig. 4.2c and d) (Mylonas et al., 1997e, 2004a; Corriero et al., 2007). Thus, at the end of vitellogenesis the oocyte has a large cytoplasm filled completely with yolk globules and, in most cases, lipid droplets, a centrally located nucleus (named germinal vesicle, GV), and thick zona radiata (the future chorion) and follicular layers (Fig. 4.2c and d). Oocyte maturation is the second phase of the gametogenic cycle in females, and it is regulated by an LH surge from the pituitary and the production of the maturation inducing hormone (MIH) by the ovarian follicle (Nagahama et al., 1994; Suwa and Yamashita, 2007). The MIH is a

114


progestagen, and in most fishes it is 17α,20β-dihydroxy-progesterone (DHP), whereas in others it is 17α,20β,21-trihydroxy-progesterone (20β-S). Oocyte maturation begins with the resumption of meiosis, which has been arrested in prophase I, and the migration of the GV to the animal pole of the oocyte (Fig. 4.2f), underneath the micropyle (Mylonas et al., 1997b). At the same time, and depending on fish species, coalescence of the lipid droplets takes place, resulting in the production of a single lipid droplet (Fig. 4.2g) (Mylonas et al., 1997e). As OM progresses, the GV membrane dissolves (germinal vesicle breakdown, GVBD), chromosomes condense and the first polar body is expulsed from the oocyte. During this time, there is a chemical modification of the yolk, with the proteolysis of the vtg and the production of its major components, lipovitellin, phosvitin and β-component, and free amino acids (FAA) (Cerdá et al., 2007), which is apparent in the coalescence of the yolk globules and the change in staining properties of the yolk (Fig. 4.2g and h) (Mylonas et al., 1997e). Depending on whether the eggs produced are pelagic or bethic (i.e., positively or negatively buoyant), the extent of this proteolysis varies and results in the increase in the osmotic pressure of the oocyte, which drives a drastic uptake of water (Cerdá et al., 2007) with a many-fold increase in size. After hydration, the follicular wall ruptures and the oocyte is ovulated (Fig. 4.2h) into the ovarian cavity, in most fishes, or in the abdominal in others (e.g., Salmonidae and Acipenseridae).

4.2.2 Spermatogenesis and spermiation Spermatogenesis is the process of mitotic proliferation of the spermatogonia, their meiotic division into haploid spermatocytes, and their transformation into flagellated spermatozoa (Schulz and Miura, 2002). During mitotic proliferation, each spermatogonium goes through a species-specific number of divisions, which ranges between 5 and 15. During these divisions all daughter cells maintain direct cytoplasmic bridges between them; they are all contained within an individual spermatocyst, and undergo simultaneous development and maturation from spermatogonia to spermatocytes I and II, spermatids and finally flagellated spermatozoa (Fig. 4.3). Once spermatogenesis is completed, the Sertoli cells that surround each spermatocyst rupture and the spermatozoa are released into the testicular lumen. The presence and relative abundance of spermatocysts with the above maturation stage gametes are used as an indication of the degree of testicular development in fish. With the rupture of the spermatocyst starts the period of spermiation, during which the spermatozoa undergo maturation (capacitation) as they move along the tubular lumen of the testes and are gathered in the efferent ducts. Capacitation is the process by which the spermatozoa acquire the capacity for motility once released in the water, and thus the ability to fertilize the eggs (Billard et al., 1995; Miura and Miura, 2003). At the same


115 B

A st sc

sg

sc

sz

E sg C

D sz sz sz

sc

Fig. 4.3 Microphotographs of histological sections from testes of European sea bass at various stages of maturation. (A) Before the onset of the reproductive season, containing only spermatogonia (sg). (B) At the early stage of spermatogenesis in November, containing spermatocyst with spermatocytes I and II (sc) and spermatids (st), including some spermatozoa (sz). (C) In December when spermiation begins, showing the extensive rupture of the mature spermatocysts and the aggregation of spermatozoa in the tubules. (D) In January at the onset of the females spawning season, with the tubules containing almost exclusively spermatozoa. (E) Spent testes at the end of the season, showing residual spermatozoa, new spermatogonia and hypertrophied somatic cells. Photographs are not in the same scale.

time, the testes produce large volumes of seminal fluid, in which the spermatozoa are transported and released to the environment during spawning. During the period of spermiation, gentle abdominal pressure can result in the release of milt (seminal fluid with spermatozoa) in most fishes, and the quality of the milt (density, percentage motility and survival) can be evaluated (Suquet et al., 1994; Billard et al., 1995; Fauvel et al., 1999). The general view of the involvement of pituitary GtHs in the male reproductive cycle, as with the female, is that FSH controls mainly the early stages of gametogenesis (Ohta et al., 2007), while LH regulates the process of spermiation (Schulz and Miura, 2002). Again, the final effectors of the GtHs on reproductive function are the gonadal steroids. Estrogens seem to induce the mitotic proliferation of the spermatogonia prior to the onset of

116


gametogenesis (Miura and Miura, 2003). Then androgens (T and 11-keto T, 11-KT) regulate the whole process of spermatogenesis, to the production of flagellated spermatozoa (Miura et al., 1991b; Schulz and Miura, 2002). The maturation of the spermatozoa and the acquisition of motility capacity are controlled by DHP, the same progestagen that acts as an MIH in the female. This action involves the spermatozoa themselves, in a receptormediated process that results in an increase in seminal plasma pH (Miura and Miura, 2003). 4.2.3 Spawning Spawning is the release of the mature gametes (eggs and capacitated spermatozoa) to the external environment (in the vast majority of fishes), in order to produce the zygote. As spermatozoa lose their motility within seconds or minutes after release from the testes and contact with the water (Billard et al., 1995) and eggs absorb water resulting in the closure of the micropyle (Cerdá et al., 2007), spawning must be extremely synchronous in order to result in fertilized eggs. Therefore, fish employ both breeding rituals and pheromones in order to signal to the other sex their readiness for spawning (Liley, 1983; Stacey, 1984; Stacey et al., 1994; Zabala et al., 1997; Kobayashi et al., 2002). Spawning may take place in pairs (e.g., flounder, catfish), single females with a group of males (e.g., Salmonidae, Moronidae), or large groups of males and females (e.g., Sparidae, Thunnidae). Also, the eggs produced may be pelagic, demersal or may stick to each other and various substrates, such as rocks and vegetation. All these characteristics must be known for each fish of interest and be evaluated by the aquaculturist, in order to achieve the optimum results in terms of egg fecundity and fertilization success.

4.3

Reproductive strategies and dysfunctions in captivity

Being the largest vertebrate class with more that 27 000 species and a very long evolutionary history (Nelson, 2006), fishes exhibit an amazing diversity in reproductive biology and strategies. For the purpose of broodstock management and hormonal manipulations for the induction of OM, ovulation and spawning in aquaculture operations, female fish may be separated into two classifications: sychronous spawners (synchronous and single-batch group-synchronous) and asynchronous spawners (multiple-batch groupsynchronous and asynchronous) (Tyler and Sumpter, 1996). Synchronous spawners reproduce once in their lifetime or once during an annual reproductive season, and their ovary contains a single, uniform population of developing oocytes during the reproductive season (Fig. 4.4a). On the other hand, asynchronous spawners reproduce multiple times during every reproductive period. These spawns may be numerous and regular, e.g., daily or every other day for a period of 3–4 months; or can be few and irregular in

Controlling fish reproduction in aquaculture A

117

B

Fig. 4.4 Microphotographs of histological sections from ovaries of striped bass, a synchronous fish (A), and of bluefin tuna, an asynchronous fish (B). Photographs are not in the same scale.

their timing, e.g. 3–7 spawns with an inter-spawn period of between 3 and 10 d. The ovaries of these species contain oocytes at all stages of development during the reproductive season (Fig. 4.4b), and different batches of oocytes mature during each OM, ovulation and spawning event. In terms of the males, the situation is somewhat simpler. Spermatogenesis and spermiation may be temporally separated, with spermiation occurring after the conclusion of spermatogenesis, and during the spawning season the testes may contain exclusively spermatozoa (Billard, 1986; Malison et al., 1994). In the majority of species, however, there is significant overlap between the two processes, with both spermatogenesis and spermiation taking place during the spawning season (Jackson and Sullivan, 1995; Mylonas et al., 2003; Rainis et al., 2003). Therefore, management of male reproduction in captivity and induction of spermiation utilizes very similar methods. Reproductive dysfunctions of captive fishes are often restricted to the females, since males do undergo complete maturation in captivity, albeit at times possibly producing a reduced amount of milt and of lower quality (Mylonas and Zohar, 2001a, 2007; Zohar and Mylonas, 2001b; Mañanos et al., 2008). The simplest reproductive problem in females is observed in salmonids (Onchorhynchus and Salmo spp.), which do undergo vitellogenesis, OM and ovulation, but fail to spawn their eggs when reared in captivity (Bromage and Cumaranatunga, 1988; Zohar, 1989), probably due to the

118


lack of the appropriate spawning substrate to place their eggs. The most common reproductive dysfunction in captivity is the failure of OM upon completion of vitellogenesis. As a result there is no ovulation and no spawning of eggs (Berlinsky et al., 1996, 1997; Larsson et al., 1997; Mugnier et al., 2000; Mylonas and Zohar, 2001b; Barbaro et al., 2002; Duncan et al., 2003; Marino et al., 2003; Ibarra-Castro et al., 2004; Mylonas et al., 2004a; Yang and Chen, 2004; Chen, 2005; Agulleiro et al., 2006; Fauvel et al., 2007; Mylonas et al., 2007). The failure of captive females to undergo OM is due to dysfunctional release of LH from the pituitary. In striped bass, for example, the levels of various reproductive hormones were compared between cultured fish that fail to undergo OM during the spawning season and wild fish captured on their spawning grounds (Mylonas et al., 1997d, 1998b; Steven et al., 2000; Mylonas and Zohar, 2001b). In wild females, a plasma LH surge was observed during OM and ovulation, but in females reared in captivity plasma LH levels remained low at the end of vitellogenesis. However, LH was synthesized and stored in the pituitary during vitellogenesis, since levels of LH and its mRNA in the pituitary did not differ between wild and captive females, demonstrating that the problem is one of lack of release and not synthesis in captivity. In addition, mRNA levels of the pituitary receptor for the GnRH most relevant to pituitary LH synthesis were similar between wild and captive females. This suggests that the disruption in LH release from the pituitaries of captive fish is not due to a dysfunction in pituitary responsiveness, but may be related to the control of pituitary function by the reproductive brain. In fact, differences were observed between wild and captive females undergoing OM, when comparing the pituitary content of the endogenous GnRHs. The GnRH mRNA levels within the brain, however, were similar between the two groups, indicating that the altered pituitary content of GnRH in captive fish may be a result of altered release from the hypothalamus, rather than deficient synthesis (Steven, 2000; Steven et al., 2000). Similarly in males, lower plasma levels of LH during the spermiation period have been suggested as the cause of the reduced amount of milt produced by some fishes (Mylonas and Zohar, 2001b; Mañanos et al., 2002). As with females, the amount of LH in the pituitary or the ability of the pituitary to synthesize LH in response to treatment with exogenous GnRHa is not affected in these fishes, suggesting that again the reproductive dysfunction in the males may be identified in the brain control of GtH synthesis and/or release.

4.4 Hormonal therapies for the control of reproduction Based on the accumulating evidence that the failure of fishes to undergo OM and full spermiation in captivity is the result of diminished LH release


119

♀♂

Hormonal induction of oocyte maturation & spermiation Brain

GnRH GnRHa

LH

Pituitary

LH

Gonads

Sex steroids

Oocyte maturation-spermiation

Fig. 4.5 Schematic representation of the dysfunction in the reproductive axis of cultured fishes, and the exogenous hormonal interventions for the induction of oocyte maturation and spermiation.

from the pituitary, manipulations of reproductive function in cultured fishes have focused on the use of either exogenous LH preparations that act directly at the level of the gonad, or GnRHa that acts at the level of the pituitary to induce release of the endogenous LH stores (Fig. 4.5). Endogenous LH, in turn, acts at the level of the gonad to induce steroidogenesis and the process of OM and spermiation.

4.4.1 Gonadotropin preparations Gonadotropin preparations include pituitary homogenates and pituitary extracts (PE) that contain LH (as well as other pituitary hormones), purified piscine LH or purified human chorionic gonadotropin (hCG), which has very strong LH activity (Lam, 1982; Donaldson and Hunter, 1983; Zohar, 1989; Zohar and Mylonas, 2001b). The main advantage of GtH preparations is that they act directly at the level of the gonad. Pituitary homogenates were the first type of exogenous hormonal treatments used by aquaculturists for the induction of maturation and spawning (Houssay, 1930; Von Ihering, 1937; Fontenele, 1955). Today, preparations of carp pituitary extract (CPE) and purified salmon GtH are available commercially and are used worldwide. These purified PE are more effective than the earlier pituitary homogenates, since they are purified to various extents and their activity is usually calibrated using bioassays (Yaron, 1995; Donaldson, 1973). Nevertheless, they still maintain the disadvantages of risking pathogen transmissions, as well as a high degree of species

120


specificity, due to the significant differences in the primary structure of fish GtH (Rosenfeld et al., 2007). Treatments with pituitary homogenates and PE are usually split into a smaller priming dose (10–20 % of total) and a larger resolving dose given 12–24 h apart (Thalathiah et al., 1988; Parauka et al., 1991; Kucharczyk et al., 1997; Chen, 2005). Human CG has also been used extensively in hormonal manipulation of reproduction in fishes, as it has been available throughout the world for some time now, and it is purified and of clinical grade and standardized bioactivity. Unlike GtH preparations of piscine origin, hCG is most often effective in a single dose (100 and 4000 IU Kg−1), presumably due to its long residence time in circulation (Ohta and Tanaka, 1997). This is unrelated to its heterologous nature in fish, since it has been shown to have a significantly longer halflife compared to the pituitary GtHs both in fish (Fontaine et al., 1984) and humans (Ludwig et al., 2002). Recently, an hCG preparation has been approved for commercial utilization in commercial aquaculture (CHORULONTM, Intervet International bv, The Netherlands).

4.4.2 Gonadotropin-releasing hormone agonists The use of GnRHas for spawning induction therapies has important advantages over the use of GtH preparations. Firstly, being of synthetic nature, GnRHas do not pose a disease transmission threat, as pituitary homogenates or extracts may do. Secondly, GnRHa treatments are less speciesspecific than GtH ones, due to the high structural similarity of native GnRHs among fishes (Lethimonier et al., 2004). Thirdly, and perhaps most importantly, GnRHas stimulate the release of the endogenous GtHs and other necessary pituitary hormones (Le Gac et al., 1993; Weber et al., 1995; Cyr and Eales, 1996; Negatu et al., 1998), and thus they provide for a better integration of reproductive processes by acting at a higher level of the brain–pituitary–gonad axis. Although hundreds of different GnRHas are available, the only approved GnRHa for use in commercial aquaculture is Azagly-nafarelin (GONAZONTM, Intervet International bv, The Netherlands), which has so far been shown to be efficacious only in salmonids (Haffray et al., 2005). As mentioned earlier, in some fishes there is a strong inhibition of basal and GnRH-stimulated release of LH by DA. Therefore, administration of DA antagonists prior to the treatment with GnRHa removes the inhibition on the gonadotrophs and enhances the stimulatory effect of GnRHa on LH release. Currently, hormonal manipulations of reproduction using a combined GnRHa/DA antagonist treatment are used mostly in cyprinids (Yaron, 1995; Mikolajczyk et al., 2003, 2004; Kaminski et al., 2004), catfishes (Silverstein et al., 1999; Brzuska, 2001; Wen and Lin, 2004) and mullets (Glubokov et al., 1994; Arabaci and Sari, 2004; Aizen et al., 2005). There are several DA antagonists available in the market that


121

proved to be useful for hormone treatments in aquaculture (i.e., domperidone, pimozide, reserpine and metoclopramide); these are usually administered as a liquid solution injected prior to, or at the same time as the GnRHa treatment.

4.4.3 Sustained-release delivery systems It was recognized almost from the first spawning induction experiment (Fontenele, 1955), that sustained administration of the hormone would result in improved efficacy. This is because the processes of OM and spermiation often require a prolonged treatment with exogenous hormones, given in multiple injections (Mylonas et al., 1992; Dabrowski et al., 1994; Slater et al., 1994, Carrillo et al., 1995, Pankhurst et al., 1996). Such repetitive handling of broodstock requires substantial labor, time and monitoring, and in situations where the broodfish are very large (groupers, amberjacks or tunas) or kept outdoors – in ponds or cages – it is very time-consuming and labor-intensive to crowd, capture, anaesthetize and inject the fish with hormones. Since the 1980s, a variety of hormone-delivery systems, almost exclusively for GnRHa, have been developed for use in a variety of fishes. The first such delivery system was prepared using cholesterol and was tested in Atlantic salmon (Salmo salar) (Weil and Crim, 1983). Cholesterol implants are prepared as solid, cylindrical pellets (3 mm in diameter) and are implanted intramuscularly using an implanter. The next type of GnRHadelivery system was fabricated in the form of microspheres (5–200 μm in diameter), using copolymers of lactic acid and glycolic acid (LGA) (Okada et al., 1994) or a copolymer of fatty acid dimer and sebasic acid (Fad-sa) (Mylonas et al., 1995). For treatment, the microspheres are suspended in a viscous vehicle and are injected into the muscle (Zohar, 1988; Breton et al., 1990; Chang et al., 1995; Mylonas et al., 1997c; Mylonas and Zohar, 2001b; Barbaro et al., 2002). The greatest advantage of biodegradable, microspheric delivery systems is that the same preparation can be used to treat fish with large variations in size. Also, since over time the microspheres degrade to their monomer constituents, which are all natural products – e.g., lactic acid, glycolic acid or sebasic acid – broodstock retired from production can be consumed for food without any concerns over harmful residual chemicals. Another type of GnRHa-delivery system used for spawning induction is prepared in the form of a solid implant, using a non-degradable co-polymer of ethylene and vinyl acetate (EVAc) (Zohar, 1996). In this delivery system, the GnRHa is mixed with an inert bulking agent, and the mixture is entrapped by the EVAc matrix. Upon application, the inert matrix dissolves, carrying with it the GnRHa. The EVAc implants are fabricated as disks 2 or 3 mm in diameter and are administered intramuscularly using an implanter (Mylonas et al., 2007), releasing GnRHa

122


for periods from 2–5 weeks (Zohar, 1996; Mylonas et al., 1998b; Mañanos et al., 2002).

4.5 Induction of oocyte maturation and ovulation As mentioned earlier, for the purpose of broodstock management and hormonal manipulation of OM and spawning, fish are separated into two classifications: synchronous spawners (single-time and single-batch group-synchronous) and asynchronous spawners (multiple-batch groupsynchronous and asynchronous) (Tyler and Sumpter, 1996). These differences in reproductive strategies may necessitate the employment of different approaches in terms of hormonal therapy and egg acquisition. For example, single or double injections of GnRHa in liquid form may be effective in synchronous fish (Mylonas et al., 1992), which have all their oocytes developed at the same stage of maturation, but may not be the best approach to achieve maximum fecundity in asynchronous species with a long reproductive season (Zohar et al., 1995). Also, if required, strip spawning and artificial insemination is a good alternative to tank spawning in synchronous fishes, but will result in very poor fecundity in asynchronous species, since the fish ovulate only part of their total season production of vitellogenic oocytes, and the stripping process may damage the remaining oocytes. The use of GtH preparations in inducing OM, ovulation and spawning in synchronous fishes has been summarized well in previous reviews, which report also more extensive information on doses and treatment protocols (Donaldson, 1973; Lam, 1982; Donaldson and Hunter, 1983; Zohar and Mylonas, 2001a; Mañanos et al., 2008). Some more recent examples include the European catfish (Silurus glanis), which was successfully induced to ovulate using 4 mg Kg−1 CPE, though in a smaller percentage of females compared to a combined GnRHa/DA antagonist treatment (Brzuska, 2001). In the Japanese catfish (Silurus asotus), a single injection of 10 000 IU Kg−1 hCG induced OM and ovulation from June to September (Kumakura et al., 2003b). In the Brazilian catfish ‘cachara’ (Pseudoplatystoma fasciatum), both CPE and hCG were effective in inducing ovulation (Leonardo et al., 2004). Also, hCG at 1000 or 2000 IU Kg−1 was effective as a single injection in inducing ovulation in the Korean spotted sea bass (Lateolabrax maculatus) (Lee and Yang, 2002). Finally, in wild-caught ocellated puffer (Takifugu ocellatus), both single- and double-injections of 6 mg Kg−1 PE or 2500 IU Kg−1 hCG were very effective in inducing OM and ovulation (Chen, 2005), and in pikeperch (Sander lucioperca), either single or multiple injections of 200 IU Kg−1 hCG were effective in inducing ovulation (Zakes and Szczepkowski, 2004). The continued interest in the control of reproduction of the European eel has resulted in improved knowledge on the dysfunctions of this species


123

in culture and has identified some blocks in the endocrine axis. The European eel undergoes gametogenesis during its long migration from European rivers to the Sargasso sea, off the coast of North America (Tesch, 2003). In captivity, the absence of this migration results in the complete absence of both oogenesis and spermatogenesis. Recent research has identified DA as the brain hormone responsible for the blocking of the reproductive axis and the absence of pubertal development (Vidal et al., 2004). Still, however, the only available practical method for the induction of gametogenesis in the freshwater eel is the weekly administration of fish gonadotropin extracts in the female (Ohta et al., 1997; Sato et al., 1997; Pedersen, 2003; Palstra et al., 2005) and one or two injections of the same gonadotropin or of hCG in the male (Miura et al., 1991a; Ohta et al., 1996; Ohta and Tanaka, 1997). Oocyte maturation is induced by the administration of the MIH, eggs and sperm are collected by stripping, and fertilization is accomplished artificially (Pedersen, 2004). A very promising new way to induce gametogenesis in the European eel is currently undergoing development (Guido van den Thillart and Herman Spaink, unpublished data), and employs genetically engineered zebrafish cell lines expressing the genes of zebrafish LH and FSH, controlled by a constitutive promoter. Once implanted subcutaneously to silver migrating eels, such cells are shown to produce continuously the two zf-GtHs, thus stimulating gonadogenesis. The development of this method will alleviate the need for multiple injections of heterologous hormones and will probably increase the effectiveness of maturation induction approaches in the freshwater eels. The synchronization of ovulation in salmonids was one of the very first applications of GnRHa in aquaculture (Donaldson et al., 1981; Crim and Glebe, 1984; Breton et al., 1990). The treatment is usually given in the form of two injections (10–100 μg Kg−1) spaced 3 d apart or a single application of a GnRHa-delivery system (10–50 μg Kg−1), given around two weeks before the onset of natural maturation of the broodstock. The two-injection (Van Der Kraak et al., 1985; Sullivan et al., 1989; Mylonas et al., 1992) and GnRHa-delivery system protocols (Crim et al., 1983; Crim and Glebe, 1984; Breton et al., 1990; Goren et al., 1995) induce ovulation in 100 % of the stock within two weeks after treatment. Single or multiple injections of GnRHa have also been used extensively in other synchronous fishes. When a two-injection protocol is used, GnRHa is given in a priming (5–10 %) and resolving dose (95–90 %), and if a DA antagonist is also used it is given with the priming dose. For example, in the ocellated puffer both single and double injections of 50 μg Kg−1 GnRHa were effective in inducing OM (Chen, 2005), while similar results were obtained using 2–4 injections of GnRHa in the bullseye puffer (Spoeroides annulatus) (Duncan et al., 2003). In the grey mullet, two injections of 30 μg Kg−1 GnRHa together with 15 mg Kg−1 metoclopramide were very effective in inducing spawning within 24 h (Aizen et al., 2005). Similarly, two injections of

124


20 μg Kg−1 GnRHa with 5 mg Kg−1 pimozide induced ovulation in 95 % of treated common carp (Cyprinus carpio) (Mikolajczyk et al., 2004). Two injections of GnRHa in combination with a DA antagonist have been used successfully also in the koi carp (Cyprinus carpio) (Arabaci et al., 2004), lake mullet (Chalcalburnus tarichi) (Arabaci and Sari, 2004) and wild catfish (Silurus asorus) (Wen and Lin, 2004). Finally, a single injection of 20 μg Kg−1 GnRHa induced ovulation in tench (Tinca tinca) (Rodríguez et al., 2004). Sturgeon (Acipenser spp.) aquaculture for meat and caviar relies exclusively on the use of hormonal spawning induction methods and the artificial fertilization of the obtained eggs. Sturgeon females are evaluated for the completion of vitellogenesis and the extent of the migration of the nucleus (polarization index, PI) by laparoscopic (Hurvitz et al., 2007) or surgical removal of oocytes from the ovary and their in vitro processing (Williot et al., 1991; Conte et al., 1988). The selected mature females may be given sturgeon pituitary extract, carp pituitary extract or, more recently, GnRHa (Webb et al., 1999; Chebanov and Billard, 2001; Williot et al., 2001, 2002; Burtsev et al., 2002; Zhuang et al., 2002), usually in priming and resolving injections spaced 10–24 h apart, and ovulation is accomplished 24–50 h afterwards. Single treatments with carp pituitary homogenate have also been reported to be effective (Williot et al., 2005). Acquisition of eggs is done using caesarian surgery or, more recently, by inserting a scalpel into the abdominal pore and making a small incision at the basal part of the oviducts (Chebanov and Billard, 2001). Sperm can be used fresh or cryopreserved (Billard et al., 2004) and the amount of sperm produced may also be enhanced using GnRHa-based hormonal therapies (Williot et al., 2002). The greater efficacy of GnRHa-delivery systems in inducing OM in synchronous fishes has been demonstrated well since the mid-1990s (Mylonas and Zohar, 2001a, 2007). A GnRHa-delivery system was the only hormonal preparation able to induce spawning in the yaqui catfish (Ictalurus pricei), whereas combined sGnRHa/DA antagonist or catfish PE treatments were ineffective (Mylonas and Zohar, 2001a). In the tiger puffer (Takifugu rubripes), GnRHa-delivery systems (400 μg Kg−1) induced ovulation in 18 and 10 d in fish with mean oocyte diameter of 800–900 μm and 900–1000 μm, respectively (Matsuyama et al., 1997). Other examples of applications in synchronous fishes include the bullseye puffer (Duncan et al., 2003), cobia (Rachycentron canadum) (Kilduff et al., 2002), devil stinger (Inimicus japonicus) (Takushima et al., 2003) and common carp (Brzuska and Bialowas, 2002). GnRHa-delivery systems have been used in preference to liquid injections in a variety of asynchronous fishes. For example, GnRHa-delivery systems induced two consecutive spawns within 3 d in white bass (M. chrysops) (Mylonas et al., 1997b) and greater amberjack (Seriola dumenili)


125

(Mylonas et al., 2004c), five spawns within 7 d in the barramundi (Lates calcarifer) (Almendras et al., 1988), five ovulations within two weeks in striped trumpeter (Latris lineate) (Morehead et al., 1998), one to four ovulations within 7 d in the black sea bass (Centropristis striata) (Watanabe et al., 2003) and seven ovulations within 10 d in the dusky grouper (E. marginatus) (Marino et al., 2003). The greatest potential, however, of sustained-release GnRHa-delivery systems is in the induction of OM in asynchronous fishes with a daily or almost daily ovulation/spawning frequency. For example, the red porgy (Pagrus pagrus), red seabream (P. major) and gilthead seabream (Sparus aurata) have an asynchronous mode of ovarian development and are capable of undergoing OM and spawning on a 24 h cycle for periods up to four months (Watanabe and Kiron, 1995; Zohar et al., 1995; Mylonas et al., 2004b). A single GnRHa injection in the gilthead seabream induced daily spawning in only 20 % of the stock, while a GnRHadelivery system induced daily spawning in >70 % of treated females. Similar results have been obtained with the other two sparids (Matsuyama et al., 1995; Zohar and Mylonas, 2001a). Thus, GnRHa-delivery systems result in significant increases in fecundity, by increasing the number of broodfish undergoing OM, and the number of ovulations per spawning season (Barbaro et al., 2002). The latest success of the GnRHa-delivery systems has been in the induction of OM, ovulation and spawning in cage-cultured Atlantic bluefin tuna (Thunnus thynnus) (Mylonas et al., 2007) and tankcultured Southern bluefin tuna (T. maccoyii) (M. Deichmann, Clean Seas Tuna Ltd, personal communication), which resulted in the production of fertilized eggs and viable larvae. Due to the inability of anaesthetizing bluefin tunas and the great difficulties in handling such large (60–120 Kg) and fast swimming pelagic fishes, GnRHa administration was done underwater in free swimming fish (Mylonas et al., 2007). It is expected that this method will continue to be used as the standard for the induction of spawning in captive-reared Atlantic bluefin tuna, until such time as land-based facilities are build or appropriate sea-cage sites are identified, which can reproduce the optimal environmental conditions necessary for reproductive maturation and spawning (e.g., temperature-photoperiod combination, water quality, etc.). Recently, the use of these GnRHa-delivery systems has induced spawning for four consecutive days in a captive-reared stock at Vibo Valentia, Italy, producing many millions of fertilized eggs, allowing the first larval rearing of Atlantic bluefin tuna in the Mediterranean Sea (G. Demetrio, unpublished data). Finally, GnRHa-delivery systems have been employed with great success in inducing multiple spawnings, often of improved quality compared to the few naturally spawning females, in various flatfishes. For example, GnRHadelivery systems induced daily ovulations in the greenback flounder (Rhombosolea tapirina) (Poortenaar and Pankhurst, 2000), and in wild-caught summer flounder (Paralichthys dentatus) GnRHa implants induced daily

126


ovulations for 8 d (Berlinsky et al., 1997), whereas in fish maintained for more than a year in captivity the same treatment induced not only ovulation but also tank spawning (Watanabe et al., 1998). Similarly in turbot (Scophthalmus maximus), treatment with a GnRHa-delivery system induced multiple ovulations in 100 % of treated fish compared to 50 % of controls (Mugnier et al., 2000). Also, in the yellowtail flounder (Pleuronectes ferrugineus) different GnRHa-delivery systems induced an average of eight consecutive ovulations, compared to three in control fish, resulting in the production of twice as many eggs and of higher fertilization and hatching percentage than control females (Larsson et al., 1997). The same two GnRHa-delivery systems have also induced daily spawnings for up to two weeks in the Senegal sole (Solea senegalensis), though with very limited fertilization success (Agulleiro et al., 2006; Guzmán et al., 2008).

4.6 Induction of spermiation As mentioned earlier, the dysfunction observed in cultured male fishes is not the absence of any stage of testicular development, but rather a reduction in the spermiation process and the production of expressible milt. Due to the long-term nature of the process of spermatogenesis and spermiation – as opposed to OM in females – long-term hormonal therapies with GnRHa-delivery systems have proven more effective in enhancing milt production compared to acute treatments with either GtH preparations or GnRHas. For example, in the rabbitfish (Siganus guttatus) milt production increased significantly 24 h after GnRHa injection, but returned to pretreatment levels 48 h later (Garcia, 1991). Sustained elevation of sperm production was maintained for 5 d in carp by daily injections of GnRHa, but 3 d after the treatment was interrupted, milt volume decreased below pre-treatment levels (Takashima et al., 1984). In the winter flounder (Pleuronectes americanus) a single injection did not increase milt production, whereas two injections given 24 h apart induced a significant increase in total expressible milt (Harmin and Crim, 1993). Finally, in the European sea bass (Dicentrarchus labrax) a single injection of GnRHa at the end of the spawning season was effective in maintaining milt volume of stripped males for only 3 d, compared to 17 d of GnRHa implants (Rainis et al., 2003). These results underline the need for a long-term hormonal therapy, in order to induce sustained increases in milt production. Another disadvantage of single hormone injections is that they usually induce only a short-lived elevation of seminal plasma production, with a much smaller increase in spermatozoa production (Clemens and Grant, 1965; Garcia, 1991) and the increase in milt volume is accompanied with significant reductions in sperm density (Takashima et al., 1984; Garcia, 1991). In white bass, treatment with an hCG injection may restore milt


127

release in males stripped completely of their milt, but the milt is extremely thin and contains mostly seminal fluid (Bayless, 1972). On the contrary, GnRHa-delivery systems increase milt production significantly, without any decrease in sperm density, motility or fertilizing ability of the spermatozoa (Mylonas et al., 1997a). Many different GnRHa-delivery systems have been used to enhance spermiation in cultured fishes and beginning with salmonid species such as Atlantic salmon (Zohar, 1996; Weil and Crim, 1983), rainbow trout (Oncorhynchus mykiss) (Breton et al., 1990), chinook salmon (O. tshawystcha) (Solar et al., 1995), coho salmon (O. kisutch) (Goren et al., 1995). GnRHa-delivery systems have also been very effective in basses of the Moronidae family. For example, in the European seabass at the peak of the spawning season, a single injection of GnRHa induced increases in milt production for 7 d only, whereas treatment with GnRHa-delivery systems resulted in increased milt production for 28–35 d (Mañanos et al., 2002). Also in the striped bass, GnRHa-delivery systems induced long-term increases in milt production, lasting for 14–20 d (Mylonas et al., 1997c; Mylonas et al., 1998a). GnRHa implants have also been used in Atlantic halibut (Hippoglossus hippoglossus) to enhance the quality of the sperm (Vermeirssen et al., 2003), in starry flounder (Platichthys stellatus) to increase milt volume and sperm density (Moon et al., 2003) and in greenback flounder to increase sperm volume (Lim et al., 2004). Still, in some species simple injections of GnRHa of GtH preparations have been employed for the successful enhancement of spermiation, such as the Siberian sturgeon (A. baerii) (Williot et al., 2002), the sterlet (Acipenser ruthenus) (Rzemieniecki et al., 2004), the precocious European sea bass (Schiavone et al., 2006) and the minnow (Rhynchocypris oxycephalus) (Park et al., 2002).

4.7 Spontaneous spawning versus artificial insemination Hormonal induction of OM and spermiation does not ensure spawning of the fish – i.e., release of their gametes – in a timely and synchronous way so that fertilized eggs are produced. This may be due to inappropriate tank size, lack of bottom substrate for the preparation of a nest or plant substrate for the adhesion of the eggs, and possibly other reasons that are not yet known. Therefore, for some species it is also necessary to employ artificial gamete collection and fertilization, using strip spawning. Such species include all salmonids, sturgeons and various carps, groupers and flatfishes. In these situations, it is important to establish with varying degrees of accuracy the time of ovulation after the hormonal treatment. This is because once the eggs are ovulated into the ovarian or abdominal cavity, they begin to lose their viability in a species- and temperaturedependent process that may last from minutes (e.g., Moronidae) to days

128


(Salmonidae). Failure to strip the eggs within the appropriate time interval after hormonal stimulation will result in greatly reduced fertilization success. The same is not true for sperm collection, which can be done at any time after hormonal stimulation. In addition, sperm from most fishes can be kept viable without the use of cryopreservation or extenders from many hours (Rainis et al., 2003) to many days (Mylonas et al., 2003; Papadaki et al., 2008). Therefore, a typical artificial insemination protocol should plan for (i) collection and storage of sperm a few hours before the expected time of ovulation and (ii) stripping of the eggs at the appropriate time after hormonal therapy. This procedure will ensure optimal results in fertilization success.

4.8 Future trends Basic studies of fish reproductive physiology and endocrinology, in combination with functional genomics and modern tools of biotechnology, will lead to more precise and efficient control of reproduction in farmed fish and to better supplies of optimal quality seed. It is clear from the present review that GnRHs are of considerable importance to normal and induced gametogenesis in farmed fish. Understanding the environmental and endocrine regulation of GnRH gene expression is key to developing strategies for overcoming the GnRH failure that results in the lack of OM, ovulation and spawning in captive fish. More studies on the functional significance of GnRH multiplicity will lead to better tailored GnRH-based spawning induction technologies that will administer or manipulate the relevant, physiological combination of GnRH forms. In addition, the discovery and understanding of factors that control the early establishment of the GnRH system can be used to develop new approaches to induce sterility or precocious puberty in farmed fish. The introduction of zebrafish as a model for the study of the GnRH system (Steven et al., 2003; Palevitch et al., 2007) and the recent development of transgenic zebrafish expressing a green fluorescent protein (GFP) reporter gene under control of the GnRH promoter (Abraham et al., 2008) provide very powerful tools for improving our understanding of how the GnRH system is regulated in fish. Using these tools, simple manipulations of GnRH neuronal development and GnRH synthesis and release may be developed in the future to control the onset of puberty and induce oocyte maturation, ovulation and spawning. To be successful, exogenous application of GnRHa and other hormonal preparations in spawning induction therapies must be precisely synchronized with the acquisition of follicular maturational and ovulatory competence. Fish that are treated too early or too late will either not spawn or spawn unfertilizable or poor quality eggs. In most cases, prediction of


129

‘readiness’ of the female for spawning induction is determined based on ovarian biopsy and measurement of oocyte diameter and/or microscopic observation of morphological characteristics of the oocytes, such as GV migration or occurrence of atresia. Although it has been standard practice for decades, the ovarian biopsy method is not ideal, as it is stressful to the fish, impossible to conduct on small (such as ornamental fishes) or very large (such as bluefin tuna) species, and not very accurate. The field of spawning induction needs non-invasive and more precise methods to determine the readiness of the female, as well as to predict and optimize the success of the spawning induction treatment. Many hormones and other factors are involved in the process of acquiring ovarian maturational competence, and these may be used as precise indicators of its progress (Patiño et al., 2001). Determining which factors are relevant and best suited as indicators will be greatly facilitated using genomics and proteomics information, and several recent studies have used this approach (Bobe et al., 2004; Aegerter et al., 2005; von Schalburg et al., 2005; Bonnet et al., 2007). More work needs to be done in order to fully exploit this approach in fish and develop DNA or molecule microarrays in order to efficiently and comprehensively assess spawning readiness in aquacultured species. In addition, significant effort has been devoted to developing methodologies that measure reproductive indicators, such as steroids and vtg, using mucous or muscle samples (Bridges et al., 2003; Susca et al., 2001). Application of novel and non-invasive sampling modalities, together with the development of fish ‘gene chips’ for reproductive factors, will undoubtedly lead to the future use of such approaches to optimize the timing and enhance the success of spawning manipulation in farmed fish. Finally, recent research has established a new paradigm for fish reproductive endocrinology. The simplistic partitional view of the brain– pituitary–gonadal axis has been replaced by a more complex and integrated web of endocrine interactions. The multiple brain GnRHs and their receptors were shown to be expressed locally in the pituitary (Mohamed et al., 2005) and gonads (Lin and Peter, 1996; Gray et al., 2002; Uzbekova et al., 2002; Soverchia et al., 2007). In both the ovary and testis of fish, GnRH has been demonstrated to directly affect gamete development and maturation (Habibi et al., 1988; Gazourian et al., 1997; Pati and Habibi, 2000; Soverchia et al., 2007). Likewise, the pituitary gonadotropins were shown to be expressed locally in the gonads, and this expression is regulated by GnRH (Wong et al., 2004). The occurrence of a complete GnRH–GtH–steroid axis within the fish gonads should be considered when hormonally manipulating reproduction and inducing spawning, as its balanced expression may be critical to the production of highest quality gametes and embryos. Thus, a more complete understanding of how the entire endocrine–reproductive axis is coordinated in fish is expected to lead to better application of

130


spawning manipulation protocols and optimization of seed production in aquaculture.

4.9 Sources of further information and advice Further information in this subject can be obtained in recent reviews (Schulz and Miura, 2002; Miura and Miura, 2003; Mylonas and Zohar, 2007; Mañanos et al., 2008). Information on fish reproduction in general can also be obtained from the website REPROFISH (www.reprofish.eu), a website established currently in Europe, with the objective of acting as a portal for students, scientists and professionals interested in fish reproduction and its control. Through the site, the interested professional can access scientific articles and protocols related to the control of reproduction in fish under culture conditions. Also, articles related to fish reproduction and its control are published in the proceedings of the International Symposium on Fish Reproductive Physiology and the International Symposium on Fish Endocrinology, which take place once every four years. Journals such as Aquaculture, Aquaculture Research, Fish Physiology and Biochemistry, General and Comparative Endocrinology and Biology of Reproduction publish many articles related to fish reproduction.

4.10 References abraham, e, palevitch o, ijiri s, du s-j, gothilf y and zohar y (2008) Early development of gonadotrophin-releasing hormone-I neurones and the role of GnRH-I as an autocrine migration factor, J Neuroendocrinol, 20, 394–405. aegerter, s, jalabert b and bobe j (2005) Large scale-real-time PCR analysis of mRNA abundance in rainbow trout eggs in relationship with egg quality and post-ovulatory ageing, Mol Reprod Dev, 2, 377–85. agulleiro, m j, anguis v, cañavate j p, martínez-rodríguez g, mylonas c c and cerdá j (2006) Induction of spawning of captive-reared Senegal sole (Solea senegalensis) using different administration methods for gonadotropin-releasing hormone agonist, Aquaculture, 257, 511–24. aizen, j, meiri i, tzchori i, levavi-sivan b and rosenfeld h (2005) Enhancing spawning in the grey mullet (Mugil cephalus) by removal of dopaminergic inhibition, Gen Comp Endocrinol, 142, 212–21. almendras, j m, duenas c, nacario j, sherwood n m and crim l w (1988) Sustained hormone release. III. Use of gonadotropin releasing hormone analogues to induce multiple spawnings in sea bass, Lates calcarifer, Aquaculture, 74, 97–111. arabaci, m and sari m (2004) Induction of ovulation in endemic pearl mullet (Chalcalburnus tarichi), living in the highly alkaline Lake Van, using GnRHa ([d-Ser(tBu)6, Pro9-NEt]-GnRH) combined with haloperidol, Aquaculture, 238, 529–35.


131

arabaci, m, cagirgan h and sari m (2004) Induction of ovulation in ornamental common carp (Koi, Cyprinus carpio L.) using LHRHa ([d-Ser(tBu)6, Pro9-NEt]LHRH) combined with haloperidol and carp pituitary extract, Aquac Res, 35, 10–14. barbaro, a, franceson a, bertotto d, bozzato g, di maria i, patarnello p, furlan f and colombo l (2002) More effective induction of spawning with long-acting GnRH agonist in the shi drum, Umbrina cirrosa L. (Sciaenidae, Teleostei), a valuable candidate for Mediterranean mariculture, J Appl Ichthyol, 18, 192–9. bayless, j d (1972) Artificial Propagation and Hybridization of Striped bass, Morone saxatilis (Walbaum), Columbia, SC, South Carolina Wildlife and Marine Resources Department. berlinsky, d l, king w v, smith t i j, hamilton r d, ii, holloway j, jr and sullivan c v (1996) Induced ovulation of Southern flounder Paralichthys lethostigma using gonadotropin releasing hormone analogue implants, J World Aquac Soc, 27, 143–52. berlinsky, d l, william k, hodson r g and sullivan c v (1997) Hormone induced spawning of summer flounder Paralichthys dentatus, J World Aquac Soc, 28, 79–86. billard, r (1986) Spermatogenesis and spermatology of some teleost fish species, Reprod Nutr Develop, 26, 877–920. billard, r, cosson j, crim l w and suquet m (1995) Sperm physiology and quality, in Bromage N R and Roberts R J (eds), Broodstock Management and Egg and Larval Quality, Oxford, Blackwell Science, 25–52. billard, r, cosson j, noveiri s b and pourkazemi m (2004) Cryopreservation and short-term storage of sturgeon sperm, a review, Aquaculture, 236, 1–9. bobe, j, nguyen t and jalabert b (2004) Targeted gene expression profiling in the rainbow trout (Oncorhynchus mykiss) ovary during maturational competence acquisition and oocyte maturation, Biol Reprod, 71, 73–82. breton, b, weil c, sambroni e and zohar y (1990) Effects of acute versus sustained administration of GnRHa on GtH release and ovulation in the rainbow trout, Oncorhyncus mykiss, Aquaculture, 91, 371–83. bonnet, e, fostier a and bobe j (2007) Microarray-based analysis of fish egg quality after natural or controlled ovulation, BMC Genomics, 8, 55. bridges c r, susca v, eicker j, corriero a, de metrio g, megalofonou p, de la serna j-m and kime d (2003) Fishy business in the Mediterranean – tuna, tonnara and testosterone, in Bridges C R, Gordin H and Garcia A (eds), Cahiers Options Méditerranéennes, Vol. 60: Domestication of the bluefin tuna Thunnus thynnus thynnus, CIHEAM, Zaragoza, 33–5. bromage, n r and cumaranatunga r (1988) Egg production in the rainbow trout, in Muir J F and Roberts R J (eds), Recent Advances in Aquaculture, London, Croom Helm/Timber Press Inc., 63–138. bromage, n, jones j, randall c, thrush m, springate j, duston j and barker g (1992) Broodstock management, fecundity, egg quality and the timing of egg production in the rainbow trout (Oncorhynchus mykiss), Aquaculture, 100, 141–66. brzuska, e (2001) Artificial spawning of European catfish Silurus glanis L.: differences between propagation results after stimulation of ovulation with carp pituitary and Ovopel, Aquac Int, 32, 11–19. brzuska, e and bialowas h (2002) Artificial spawning of carp, Cyprinus carpio (L.), Aqua Res, 33, 753–65. burtsev, i a, nikolaev a i, maltsev s a and igumnova l v (2002) Formation of domesticated broodstocks as a guarantee of sustainable hatchery reproduction of sturgeon for sea ranching, J Appl Ichthyol, 18, 655–8.

132


carrillo, m, zanuy s, prat f, cerda j, ramos j, mañanos e and bromage n (1995) Sea bass (Dicentrarchus labrax), in Bromage N R and Roberts R J (eds), Broodstock Management and Egg and Larval Quality, Oxford, Blackwell Science, 138–68. cerdá, j, fabra m and raldúa d (2007) Physiological and molecular basis of fish oocyte hydration, in Babin P J, Cerdá J and Lubzens E (eds), The Fish Oocyte: from Basic Studies to Biotechnological Application, Dordrecht, Kluwer Academic, 349–96. chang, c f, yueh w s, lee m f and schally a v (1995) A microencapsulated analog of LH-RH accelerates maturation but without stimulating sex reversal in the protandrous black porgy, Acanthopagrus schlegeli, Reprod Nutr Develop, 35, 339–49. chebanov, m and billard r (2001) The culture of sturgeons in Russia: production of juveniles for stocking and meat for human consumption, Aquat Living Resour, 14, 375–81. chen, y f (2005) Induced ovulation and embryonic development of ocellated puffer, Takifugu ocellatus, J Appl Ichthyol, 21, 136–40. clemens, h p and grant f b (1965) The seminal thinning response in carp (Cyprinus carpio) and rainbow trout (Salmo gairdneri) after injections of pituitary extracts, Copeia, 1965, 174–7. conte, f s, doroshov s i, lutes p b and strange e m (1988) Hatchery manual for the white sturgeon (Acipenser transmontanus Richardson) with application to other North American Acipenseridae, Cooperative Extension University of California, Division of Agriculture and Natural Resources. copeland, p a and thomas p (1989) Control of gonadotropin release in the Atlantic croaker (Micropogonias undulatus): evidence for lack of dopaminergic inhibition, Gen Comp Endocrinol, 74, 474–83. corriero, a, medina a, mylonas c c, abascal f j, deflorio m, aragón l, bridges c r, santamaria c a, heinisch g, vassallo-agius r, belmonte a, fauvel c, garcia a, gordin h and de metrio g (2007) Histological study of the effects of treatment with gonadotropin-releasing hormone agonist (GnRHa) on the reproductive maturation of captive-reared Atlantic bluefin tuna (Thunnus thynnus L.), Aquaculture, 272, 675–86. crim, l w and glebe b d (1984) Advancement and synchrony of ovulation in Atlantic salmon with pelleted LHRH analog, Aquaculture, 43, 47–56. crim, l w, evans d m and vickery b h (1983) Manipulation of the seasonal reproductive cycle of the landlocked Atlantic salmon (Salmo salar) by LHRH analogues administered at various stages of gonadal development, Can J Aquat Fish Sci, 40, 61–7. cyr, d g and eales j g (1996) Interrelationships between thyroidal and reproductive endocrine systems in fish, Rev Fish Biol Fish, 6, 165–200. dabrowski, k, ciereszko a, ramseyer l, culver d and kestemont p (1994) Effects of hormonal treatment on induced spermiation and ovulation in the yellow perch (Perca flavescens), Aquaculture, 120, 171–80. donaldson, e m (1973) Reproductive endocrinology of fishes, Amer Zool, 13, 909–27. donaldson, e m and hunter g a (1983) Induced final maturation, ovulation and spermiation in cultured fishes, in Hoar W S, Randall D J and Donaldson E M (eds), Fish Physiology, Orlando, FL, Academic Press, 351–403. donaldson, e m, hunter g a and dye h m (1981) Induced ovulation in coho salmon (Oncorhynchus kisutch). II. Preliminary study of the use of LH-RH and two high potency LH-RH analogues, Aquaculture, 26, 129–41. dufour, s, weltzien f, m.e. s, le belle n, vidal b, vernier p and pasqualini c (2005) Dopaminergic inhibition of reproduction in teleost fishes, Annals of the New York Academy of Science, 1040, 9–21.


133

duncan, n j, rodriguez m. de o. g a, alok d and zohar y (2003) Effects of controlled delivery and acute injections of LHRHa on bullseye puffer fish (Sphoeroides annulatus) spawning, Aquaculture, 218, 625–35. fauvel, c, savoye o, dreanno c, cosson j and suquet m (1999) Characteristics of sperm of captive seabass in relation to its fertilization potential, J Fish Biol, 54, 356–69. fauvel, c, suquet m, sévère a, mylonas c c and papandroulakis n (2007) Slowrelease GnRHa therapy prevented atresia during vitellogenesis and induced ovulation of captive wreckfish (Polyprion americanus), Cybium, 32, 191. fontaine, y a, dufour s, tanguy g, khan i a, cedard l and leloup-hatey j (1984) Clairances metaboliques de la gonadotropine chorionique humaine (hCG) et de la gonadotropin de carpe (cGtH) chez un poisson teleosteen, l’anguille, Colloque Physiologie des Poissons, INRA and IFREMER. fontenele, o (1955) Injecting pituitary (hypophyseal) hormones into fish to induce spawning, Prog Fish-Cult, 18, 71–5. garcia, l m b (1991) Spermiation response of mature rabbitfish, Siganus guttatus Bloch, to luteinizing hormone-releasing hormone analogue (LHRHa) injection, Aquaculture, 97, 291–9. gazourian, l, deragon k l, chase c f, pati d, habibi h r and sower s a (1997) Characteristics of GnRH binding in the gonads and effects of lamprey GnRH-I and -III on reproduction in the adult sea lamprey, Gen Comp Endocrinol, 108, 327–39. glubokov, a i, kouril j, mikodina e v and barth t (1994) Effects of synthetic GnRH analogues and dopamine antagonists on the maturation of Pacific mullet, Mugil so-iuy Bas, Aquac Fish Man, 25, 419–25. goren, a, gustafson h and doering d (1995) Field trials demonstrate the efficacy and commercial benefit of a GnRHa implant to control ovulation and spermiation in salmonids, in Goetz F W and Thomas P (eds), Reproductive Physiology of Fish, Austin, TX, Fish Symposium 95, 99–101. gothilf, y, muñoz-cueto j a, sagrillo c a, selmanoff m, chen t t, kah o, elizur a and zohar y (1996) Three forms of gonadotropin-releasing hormone in a perciform fish (Sparus aurata): complementary deoxyribonucleic acid characterization and brain localization, Biol Reprod, 55, 636–45. gothilf, y, meiri i, elizur a and zohar y (1997) Preovulatory changes in the levels of three gonadotropin-releasing hormone-encoding messenger ribonucleic acids (mRNAs), gonadotropin ß-subunit mRNAs, plasma gonadotropin, and steroids in the female gilthead seabream, Sparus aurata, Biol Reprod, 57, 1145–54. gray, s l, adams b a, warby c m, von schalburg k r and sherwood n m (2002) Transcription and translation of the salmon gonadotropin-releasing hormone genes in brain and gonads of sexually maturing rainbow trout (Oncorhynchus mykiss), Biol Reprod, 67, 1621–7. guraya, s s (1986) The cell and molecular biology of fish oogenesis, in Sauer H W (ed.), Monographs in Developmental Biology, Basel, Karger, 1–223. guzmán, j m, norberg b, ramos j, mylonas c c and mañanos e (2008) Vitellogenin, steroid plasma levels and spawning performance of cultured Senegalese sole (Solea senegalensis), Gen Comp Endocrinol, 156, 285–97. habibi, h r, van der kraak g, bulanski e and peter r e (1988) Effect of GnRH on reinitiation of oocyte meiosis in goldfish, in vitro, Am J Physiol, 255, R268–R273. haffray, p, enright w j, driancourt m a, mikolajczyk t, rault p and breton b (2005) Optimization of breeding of salmonids: GonazonTM, the first officially approved inducer of ovulation in the EU, Aquaculture Magazine, March, 52–6. harmin, s a and crim l w (1993) Influence of gonadotropin hormone-releasing hormone analog (GnRH-A) on plasma sex steroid profiles and milt production

134


in male winter flounder, Pseudopleuronectes americanus (Walbaum), Fish Physiol Biochem, 10, 399–407. holland, m c, hassin s and zohar y (2001) Seasonal fluctuations in pituitary levels of the three forms of gonadotropin-releasing hormone in striped bass, Morone saxatilis (Teleostei), during juvenile and pubertal development, J Endocrinol, 169, 527–38. houssay, b a (1930) Accion sexual de la hipofisis en los peces y reptiles, Rev Soc Arg Biol, 106, 686–8. hurvitz, a, jackson k, degani g and levavi-sivan b (2007) Use of endoscopy for gender and ovarian stage determinations in Russian sturgeon (Acipenser gueldestaedtii) grown in aquauculture, Aquaculture, 270, 158–66. ibarra-castro, l, dumas s and duncan n (2004) Gonad development and LHRHa induced spawning in female rosey spotted snapper Lutjanus gutattus, 5th International Symposium on Fish Endocrinology, 5–9 September Castellon. jackson, l f and sullivan c v (1995) Reproduction of white perch: the annual gametogenic cycle, Trans Am Fish Soc, 124, 563–77. kaminski, r, kusznierz j, myszkowski l and wolnicki j (2004) The first attempt to artificially reproduce the endangered cyprinid lake minnow Eupallasella perenurus (Pallas), Aquac Int, 12, 3–10. kilduff, p, dupaul w, oesterling m, olney j, jr and tellock j (2002) Induced spawning of cobia, Rachycentron canadum, and early larval husbandry, World Aquac, 33, 35–8. kirk, r (1987) A History of Marine Fish Culture in Europe and North America, Farnham, Fishing News Books Ltd. kobayashi, m, sorensen p w and stacey n (2002) Hormonal and pheromonal control of spawning behavior in the goldfish, Fish Physiol Biochem, 26, 71–84. kucharczyk, d, kujawa r, luczynski m, glogowski j, babiak i and wyszomirska e (1997) Induced spawning in bream, Abramis brama (L.), using carp and bream pituitary extract and hCG, Aquac Res, 28, 139–44. kumakura, n, okuzawa k, gen k and kagawa h (2003a) Effects of gonadotropinreleasing hormone agonist and dopamine antagonist on hypothalamus-pituitarygonadal axis of pre-pubertal female red seabream (Pagrus major), Gen Comp Endocrinol, 131, 264–73. kumakura, n, sakai k and takashima f (2003b) Reproductive cycle and human chorionic gonadotropin-induced ovulation in hatchery reared Japanese catfish Silurus asotus, Fish Sci, 69, 495–504. lam, t j (1982) Applications of endocrinology to fish culture, Can J Aquat Fish Sci, 39, 11–137. larsson, d g j, mylonas c c, zohar y and crim l w (1997) Gonadotropin releasing hormone-analogue (GnRH-A) advances ovulation and improves the reproductive performance of a cold-water batch-spawning teleost, the yellowtail flounder (Pleuronectes ferrugineus), Can J Aquat Fish Sci, 54, 1957–64. le gac, f, blaise o, fostier a, le bail p y, loir m, mourot b and weil c (1993) Growth hormone (GH) and reproduction: a review, Fish Physiol Biochem, 11, 219–32. lee, w-k and yang s-w (2002) Relationship between ovarian development and serum levels of gonadal steroid hormones, and induction of oocyte maturation and ovulation in the cultured female Korean spotted sea bass Lateolabrax maculatus (Jeom-nong-eo), Aquaculture, 207, 169–83. leonardo, a f g, romagosa e, borella m i and batlouni s r (2004) Induced spawning of hatchery-raised Brazilian catfish, cachara Pseudoplatystoma fasciatum (Linnaeus, 1766), Aquaculture, 240, 451–61.


135

lethimonier, c, madigou t, munoz-cueto j-a, lareyre j-j and kah o (2004) Evolutionary aspects of GnRHa, GnRH neuronal systems and GnRH receptors in teleost fish, Gen Comp Endocrinol, 135, 1–16. levavi-sivan, b, safarian h, rosenfeld h, elizur a and avitan a (2004) Regulation of gonadotropin-releasing hormone (GnRH)-receptor gene expression in tilapia: effect of GnRH and dopamine, Biol Reprod, 70, 1545–51. liley, n r (1983) Hormones and reproductive behaviour in fishes, in Hoar W S, Randall D J and Donaldson E (eds), Fish Physiology, New York, Academic Press. lim, h k, pankhurst n w and fitzgibbon q p (2004) Effects of slow release gonadotropin releasing hormone analog on milt characteristics and plasma levels of gonadal steroids in greenback flounder, Rhombosolea tapirina, Aquaculture, 240, 505–16. lin x-w and peter r e (1996) Expression of salmon gonadotropin-releasing hormone (GnRH) and chicken GnRH-II precursor messenger ribonucleic acids int he brain and ovary of goldfish, Gen Comp Endocrinol, 101, 282–96. ludwig, m, felberbaum r e, diedrich k and lunefeld b (2002) Ovarian stimulation: from basic science to clinical application, Reprod Biomed, Online, 5, 73–86. lund, e d, sullivan c v and place a r (2000) Annual cycle of plasma lipids in captive reared striped bass: effects of environmental conditions and reproductive cycle, Fish Physiol Biochem, 22, 263–75. malison, j a, procarione l s, barry t p, kapuscinski a r and kayes t b (1994) Endocrine and gonadal changes during the annual reproductive cycle of the freshwater teleost, Stizostedion vitreum, Fish Physiol Biochem, 13, 473–84. mañanos, e, carrillo m, sorbera l s, mylonas c c, asturiano j f, bayarri m j, zohar y and zanuy s (2002) Luteinizing hormone and sexual steroid plasma levels after treatment of European sea bass with sustained-release delivery systems for gonadotropin-releasing hormone analogue, J Fish Biol, 60, 328–39. mañanos, e, duncan n and mylonas c c (2008) Reproduction and control of ovulation, spermation and spawning in cultured fish, in Cabrita E, Robles V and Herráez M P, Methods in Reproductive Aquaculture: Marine and Freshwater Species, Taylor and Francis Group LLC, Boca Raton, FL, CRC Press, 1–40. marino, g, panini e, longobardi a, mandich a, finoia m g, zohar y and mylonas c c (2003) Induction of ovulation in captive-reared dusky grouper, Epinephelus marginatus (Lowe, 1834) with a sustained-release GnRHa implant, Aquaculture, 219, 841–58. matsuyama, m, takeuchi h, kashiwagi m, hirose k and kagawa h (1995) Induced gonadal development and spawning of immature red sea bream Pagrus major with LHRH-a administration in different ways during winter season, Fish Sci, 61, 472–7. matsuyama, m, chuda h, ikeda y, tanaka h and matsuura s (1997) Induction of ovarian maturation and ovulation in the cultured tiger puffer Takifugu rubripes by different hormonal treatments, Suisanzoshoku, 45, 67–73. mikolajczyk, t, chyb j, sokolowska-mikolajczyk m, enright w j, epler p, filipiak m and breton b (2003) Attempts to induce an LH surge and ovulation in common carp (Cyprinus carpio L.) by differential application of a potent GnRH analogue, azagly-nafarelin, under laboratory, commercial hatchery, and natural conditions, Aquaculture, 223, 141–57. mikolajczyk, t, chyb j, szczerbik p, sokolowska-mikolajczyk m, epler p, enright w j, filipiak m and breton b (2004) Evaluation of the potency of azagly-nafarelin (GnRH analogue), administered in combination with different formulations of pimozide, on LH secretion, ovulation and egg quality in common carp (Cyprinus

136


carpio L.) under laboratory, commercial and natural conditions, Aquaculture, 234, 447–60. miura, t and miura c i (2003) Molecular control mechanisms of fish spermatogenesis, Fish Physiol Biochem, 28, 181–6. miura, T, yamauchi K, nagahama Y and takahashi H (1991a) Induction of spermatogenesis in male Japanese eel, Anguilla japonica, by a single injection of human chorionic gonadotropin, Zool Sci, 8, 63–73. miura, t, yamauchi k, takahashi h and nagahama y (1991b) Hormonal induction of all stages of spermatogenesis in vitro in the male Japanese eel (Anguilla japonica), Proc Natl Acad Sci USA, 88, 5774–8. mohamed j s, thomas p and khan i a (2005) Isolation, cloning, and expression of three prepro-GnRH mRNAs in Atlantic croaker brain and pituitary, J Comp Neurol, 488(4), 384–95. mommsen, t p and walsh p j (1988) Vitellogenesis and oocyte assembly, in Hoar W S and Randall D J (eds), Fish Physiology, San Diego, CA, Academic Press, 348–406. moon, s h, lim h k, kwon j y, lee j k and chang y j (2003) Increased plasma 17-hydroxyprogesterone and milt production in response to gonadotropinreleasing hormone analogue in captive male starry flounder, Platichthys stellatus, Aquaculture, 218, 703–16. morehead, d t, pankhurst n w and ritar a j (1998) Effect of treatment with LHRH analogue on oocyte maturation, plasma sex steroid levels and egg production in female striped trumpeter Latris lineata (Latrididae), Aquaculture, 169, 315–31. mugnier, c, gaignon j l, lebegue e, fostier a and breton b (2000) Induction and synchronisation of spawning in cultivated turbot (Scophthalmus maximus L.) broodstock by implantation of sustained-release GnRH-a pellet, Aquaculture, 181, 241–55. mylonas, c c and zohar y (2001a) Use of GnRHa-delivery systems for the control of reproduction in fish, Rev Fish Biol Fish, 10, 463–91. mylonas, c c and zohar y (2001b) Endocrine regulation and artificial induction of oocyte maturation and spermiation in basses of the genus Morone, Aquaculture, 202, 205–20. mylonas, c c and zohar y (2007) Promoting oocyte maturation, ovulation and spawning in farmed fish, in Babin P J, Cerdá J and Lubzens E (eds), The Fish Oocyte: from Basic Studies to Biotechnological Applications, Dordrecht, Kluwer Academic, 433–70. mylonas, c c, hinshaw j m and sullivan c v (1992) GnRHa-induced ovulation of brown trout (Salmo trutta) and its effects on egg quality, Aquaculture, 106, 379–92. mylonas, c c, tabata y, langer r and zohar y (1995) Preparation and evaluation of polyanhydride microspheres containing gonadotropin-releasing hormone (GnRH), for inducing ovulation and spermiation in fish, J Control Release, 35, 23–34. mylonas, c c, gissis a, magnus y and zohar y (1997a) Hormonal changes in male white bass (Morone chrysops) and evaluation of milt quality after treatment with a sustained-release GnRHa-delivery system, Aquaculture, 153, 301–13. mylonas, c c, magnus y, gissis a, klebanov y and zohar y (1997b) Reproductive biology and endocrine regulation of final oocyte maturation of captive white bass, J Fish Biol, 51, 234–50. mylonas, c c, scott a p, vermeirssen e l m and zohar y (1997c) Changes in plasma gonadotropin II and sex steroid hormones, and sperm production of striped bass after treatment with controlled-release gonadotropin-releasing hormone agonistdelivery systems, Biol Reprod, 57, 669–75.


137

mylonas, c c, scott a p and zohar y (1997d) Plasma gonadotropin II, sex steroids, and thyroid hormones in wild striped bass (Morone saxatilis) during spermiation and final oocyte maturation, Gen Comp Endocrinol, 108, 223–36. mylonas, c c, woods l c, iii and zohar y (1997e) Cyto-histological examination of post-vitellogenesis and final oocyte maturation in captive-reared striped bass, J Fish Biol, 50, 34–49. mylonas, c c, woods l c, iii, thomas p, schulz r w and zohar y (1998a) Hormone profiles of captive striped bass (Morone saxatilis) during spermiation, and longterm enhancement of milt production, J World Aquac Soc, 29, 379–92. mylonas, c c, woods l c, iii, thomas p and zohar y (1998b) Endocrine profiles of female striped bass (Morone saxatilis) in captivity, during post-vitellogenesis and induction of final oocyte maturation via controlled-release GnRHa-delivery systems, Gen Comp Endocrinol, 110, 276–89. mylonas, c c, papadaki m and divanach p (2003) Seasonal changes in sperm production and quality in the red porgy Pagrus pagrus (L.), Aquac Res, 34, 1161–70. mylonas, c c, kyriakou g, sigelaki i, georgiou g, stephanou d and divanach p (2004a) Reproductive biology of the shi drum (Umbrina cirrosa) in captivity and induction of spawning using GnRHa, Isr J Aquac-Bamidgeh, 56, 75–92. mylonas, c c, papadaki m, pavlidis m and divanach p (2004b) Evaluation of egg production and quality in the Mediterranean red porgy (Pagrus pagrus) during two consecutive spawning seasons, Aquaculture, 232, 637–49. mylonas, c c, papandroulakis n, smboukis a, papadaki m and divanach p (2004c) Induction of spawning of cultured greater amberjack (Seriola dumerili) using GnRHa implants, Aquaculture, 237, 141–54. mylonas, c c, bridges c r, gordin h, belmonte ríos a, garcía a, de la gándara f, fauvel c, suquet m, medina a, papadaki m, heinisch g, de metrio g, corriero a, vassallo-agius r, guzmán j m, mañanos e and zohar y (2007) Preparation and administration of gonadotropin-releasing hormone agonist (GnRHa) implants for the artificial control of reproductive maturation in captive-reared Atlantic bluefin tuna (Thunnus thynnus thynnus), Rev Fish Sci, 15, 183–210. nagahama, y (1994) Endocrine regulation of gametogenesis in fish, Int J Dev Biol, 38, 217–29. nagahama, y, yoshikuni m, yamashita m and tanaka m (1994) Regulation of oocyte maturation in fish, in Sherwood N M and Hew C L (eds), Fish Physiology, San Diego, CA, Academic Press, 393–439. negatu, z, hsiao s m and wallace r a (1998) Effects of insulin-like growth factor-I on final oocyte maturation and steroid production in Fundulus heteroclitus, Fish Physiol Biochem, 19, 13–21. nelson, r j (2006), Fishes of the World, 4th ed, New York, Wiley. ohta, h and tanaka h (1997) Relationship between serum levels of human chorionic gonadotropin (hCG) and 11-ketotestosterone after a single injection of hCG and induced maturity in the male Japanes eel, Anguilla japonica, Aquaculture, 153, 123–34. ohta, h, kagawa h, tanaka h, okuzawa k and hirose k (1996) Milt production in the Japanese eel Anguilla japonica induced by repeated injections of human chorionic gonadotropin, Fish Sci, 62, 44–9. ohta, h, kagawa h, tanaka h, okuzawa k, iimura n and hirose k (1997) Artificial induction of maturation and fertilization in the Japanese eel, Anguilla japonica, Fish Physiol Biochem, 17, 163–9. ohta, h, miyake h, miura c i, kamei h, aida k and miura t (2007) Follicle-stimulating hormone induces spermatogenesis mediated by androgen production in Japanese eel, Anguilla japonica, Biol Reprod, 77, 970–7.

138


okada, h, doken y, ogawa y and toguchi h (1994) Sustained suppression of the pituitary-gonadal axis by leuprorelin three-month depot microspheres in rats and dogs, Pharmaceut Res, 11, 1199–203. palevitch o, abraham e, kight k e and zohar y (2007) Ontogeny of the GnRH system in zebrafish brain: in situ hybridization and promoter-reporter expression analyses in intact animals, Cell Tissue Res, 327, 313–22. palstra, a p, cohen e g h, niemantsverdriet p r w, van ginneken v j t and van den thillart g e e j m (2005) Artificial maturation and reproduction of European silver eel: development of oocytes during final maturation, Aquaculture, 249, 533–47. pankhurst, n w, purser g j, van der kraak g, thomas p m and forteath g n r (1996) Effect of holding temperature on ovulation, egg fertility, plasma levels of reproductive hormones and in vitro ovarian steroidogenesis in the rainbow trout Oncorhynchus mykiss, Aquaculture, 146, 277–90. papadaki, m, papadopoulou m, sigelaki i and mylonas c c (2008) Egg and sperm production and quality of sharpsnout sea bream (Diplodus puntazzo) in captivity, Aquaculture, 276, 187–97. parauka, f m, troxel w j, chapman f a and mcbay l g (1991) Hormone-induced ovulation and artificial spawning of Gulf of Mexico sturgeon (Acipenser oxyrhynchus desotoi), Prog Fish-Cult, 53, 113–17. park, i s, choi g c, nam y k and kim d s (2002) The effect of exogenous hormone treatment on spermiation in Rhynchocypris oxycephalus (Sauvage and Dabry), J World Aquac Soc, 33, 494–500. pati d and habibi h r (2000) Direct action of GnRH variants on goldfish oocyte meiosis and follicular steroidogenesis, Gen Comp Endocrinol, 160, 75–88. patiño, r, yoshizaki g, thomas p and kagawa h (2001) Gonadotropic control of ovarian follicle maturation: the two-stage concept and its mechanisms, Comp Biochem Physiol, B129, 427–39. pedersen, b h (2003) Induced sexual maturation of the European eel Anguilla anguilla and fertilization of the eggs, Aquaculture, 224, 323–38. pedersen, b h (2004) Fertilization of eggs, rate of embryonic development and hatching following induced maturation of the European eel Anguilla anguilla, Aquaculture, 237, 461–73. peter, r e and yu k l (1997) Neuroendocrine regulation of ovulation in fishes: basic and applied aspects, Rev Fish Biol Fish, 7, 173–97. peter, r e, lin h r, van der kraak g and little m (1993) Releasing hormones, dopamine antagonists and induced spawning, in Muir J F and Roberts R J (eds), Recent Advances in Aquaculture, Oxford, Blackwell Scientific, 25–30. poortenaar, c w and pankhurst n w (2000) Effect of luteinising hormone-releasing hormone analogue and human chorionic gonadotropin on ovulation, plasma and ovarian levels of gonadal steroids in greenback flounder Rhombosolea tapirina, J World Aquac Soc, 31, 175–85. prat, f, zanuy s and carrillo m (2001) Effect of gonadotropin-releasing hormone analogue (GnRHa) and pimozide on plasma levels of sex steroids and ovarian development in sea bass (Dicentrarchus labrax L.), Aquaculture, 198, 325–38. rainis, s, mylonas c c, kyriakou y and divanach p (2003) Enhancement of spermiation in European sea bass (Dicentrarchus labrax) at the end of the reproductive season using GnRHa implants, Aquaculture, 219, 873–90. rodríguez, r, celada j d, saez-royuela m, carral j m, aquilera a and melendre p m (2004) Artificial reproduction in 1-year-old tench (Tinca tinca L.), J Appl Ichthyol, 20, 542–4. rosenfeld, h, meiri i and elizur a (2007) Gonadotropin regulation of oocyte development, in Babin P J, Cerdá J and Lubzens E (eds), The Fish Oocyte: from


139

Basic Studies to Biotechnological Applications, Dordrecht, Kluwer Academic, 171–98. rzemieniecki, a, domagala j, glogowski j, ciereszko a, trzebiatowski r, kouril j, hamackova j and babiak i (2004) Induced spermiation in 3-year-old sterlet, Acipenser ruthenus L, Aquac Res, 35, 144–51. saligaut, c, linard b, breton b, anglade i, bailhache t, kah o and jego p (1999) Brain aminergic system in salmonids and other teleosts in relation to steroid feedback and gonadotropin release, Aquaculture, 177, 13–20. sato, n, kawazoe i, suzuki y and aida k (1997) Development of an emulsion prepared with the lipophilized gelatin and its application for hormone administration in the Japanese eel Anguilla japonica, Fish Physiol Biochem, 17, 171–8. schiavone, r, zilli l, vilella s and fauvel c (2006) Human chorionic gonadotropin induces spermatogenesis and spermiation in 1-year-old European sea bass (Dicentrarchus labrax): assessment of sperm quality, Aquaculture, 255, 522–31. schulz, r w and miura t (2002) Spermatogenesis and its endocrinology, Fish Physiol Biochem, 26, 43–56. selman, k, wallace r a, sarka a and qi x (1993) Stages of oocyte development in the zebrafish, Brachydanio rerio, J Morphol, 218, 203–24. silverstein, j t, bosworth b g and wolters w r (1999) Evaluation of dual injection of LHRHa and the dopamine receptor antagonist pimozide in cage spawning of channel catfish Ictalurus punctatus, J World Aquac Soc, 30, 263–8. slater, c, schreck c b and swanson p (1994) Plasma profiles of the sex steroids and gonadotropins in maturing female spring chinook salmon (Oncorhynchus tshawytscha), Comp Biochem Physiol, 109A, 167–75. solar, i i, smith j, dye h m, mackinlay d d, zohar y and donaldson e m (1995) Induced ovulation of chinook salmon using a GnRHa implant: effect on spawning, egg viability and hormone levels, in Goetz F W and Thomas P (eds), Reproductive Physiology of Fish, Austin, TX, Fish Symposium 95, 144. soverchia l, carotti m, andreu-vieyra c, mosconi g, cannella n, habibi h g and polzonetti-magni a (2007) Role of gonadotropin-releasing hormone (GnRH) in the regulation of gonadal differentiation inthe gilthead seabream (Sparus aurata), Mol Reprod Dev, 74, 57–67. stacey, n e (1984) Control of timing of ovulation by exogenous and endogenous factors, in Potts G W and Wooton R J (eds), Fish Reproduction: Strategies and Tactics, London, Academic Press, 207–22. stacey, n e, cardwell j r, liley n r, scott a p and sorenson p w (1994) Hormones as sex pheromones in fish, in Davey K G, Peter R E and Tobe S S (eds), Perspectives in Comparative Endocrinology, Ottawa, ONT, National Research Council of Canada, 438–48. steven, c (2000) Studies on the GnRH-GtH system of female striped bass (Morone saxatilis): effects of GnRH agonist therapy and comparison of reproductive endocrine parameters between wild and captive fish, Marine Estuarine and Environmental Sciences, College Park, MD, University of Maryland. steven, c, gothilf y, holland m c h, stubblefield j, mylonas c c and zohar y (2000) Differential expression of the three GnRH genes in wild and captive striped bass, Morone saxatilis, in response to natural and hormonally induced maturation, in Norberg B, Kjesbu O S, Taranger G L, Andersson E and Stefansson S O (eds), Reproductive Physiology of Fish, Bergen, University of Bergen, 66. sullivan, c v, bernard m g, hara a and dickhoff w w (1989) Thyroid hormones in trout reproduction: enhancement of GnRHa and partially purified salmon GtH-induced ovarian maturation in vivo and in vitro, J Exp Zool, 250, 188–95.

140


suquet, m, billard r, cosson j, dorange g, chauvaud l, mugnier c and fauvel c (1994) Sperm features in turbot (Scophthalmus maximus): a comparison with other freshwater and marine fish species, Aquat Living Resour, 7, 283–94. susca v, corriero a, bridges c r and demetrio g (2001) Study of the sexual maturity of female bluefin tuna: purification and partial characterization of vitellogenin and its use in an enzyme-linked immunosorbent assay, J Fish Biol, 58(3), 815. suwa, k and yamashita m (2007) Regulatory mechanisms of oocyte maturation and ovulation, in Babin P J, Cerdá J and Lubzens E, The Fish Oocyte: from Basic Studies to Biotechnological Applications, Dordrecht, Kluwer Academic, 323–47. takashima, f, weil c, billard r, crim l w and fostier a (1984) Stimulation of spermiation by LHRH analogue in carp, Bull Jap Soc Sci Fish, 50, 1323–9. Takushima, M, Nozaki R, Kadomura K, Yasumoto S and Soyano K (2003) Induced ovulation using LHRHa and artificial fertilization in devil stinger, Inimicus japonicus, Fish Physiol Biochem, 28, 521–2. tesch, f-w (ed.) (2003) The eel, Oxford, Blackwell Science. thalathiah, s, ahmad a o and zaini m s (1988) Induced spawning techniques practised at Batu Berendam, Melaka, Malaysia, Aquaculture, 74, 23–33. tyler, j r and sumpter j p (1996) Oocyte growth and development in teleosts, Rev Fish Biol Fish, 6, 287–318. uzbekova s, lareyre, j-j, madigou t, davai b, jalabert b and breton b (2002) Expression of prepro-GnRH and GnRH receptor messengers in rainbow trout ovary depends on the stage of ovarian follicular development, Mol Reprod Dev, 62, 47–56. van der kraak, g, dye h m, donaldson e m and hunter g a (1985) Plasma gonadotropin, 17β-estradiol, and 17a,20β-dihydroxy-4-pregnen-3-one levels during luteinizing hormone-releasing hormone analogue and gonadotropin induced ovulation in coho salmon (Oncorhynchus kisutch), Can J Zool, 63, 824–33. vermeirssen, e l m, mazorra de quero c, shields r j, norberg b, kime d e and scott a p (2003) Fertility and motility of sperm from Atlantic halibut (Hippoglossus hippoglossus) in relation to dose and timing of gonadotropin-releasing hormone agonist implant, Aquaculture, 230, 547–67. vidal, b, pasqualini c, le belle n, holland m c h, sbaihi m, vernier p, zohar y and dufour s (2004) Dopamine inhibits luteinizing hormone synthesis and release in the juvenile European eel: a neuroendocrine lock of the onset of puberty, Biol Reprod, 71, 1491–500. von ihering, r (1937) A method for inducing spawning in fish, Prog Fish-Cult, 34, 15–16. von schalburg k r, rise m l, brown g d, davidson w s and koop b f (2005) A comprehensive survey of the genes involved in maturation and development of the rainbow trout ovary, Biol Reprod, 72, 687–99. wallace, r a and selman k (1990) Ultrastructural aspects of oogenesis and oocyte growth in fish and amphibians, J Electron Microsc Tech, 16, 175–201. watanabe, t and kiron v (1995) Red sea bream (Pagrus major), in Bromage N R and Roberts R J (eds), Broodstock Management and Egg and Larval Quality, Oxford, Blackwell Science, 398–413. watanabe, w o, ellis e p, ellis s c and feeley m w (1998) Progress in controlled maturation and spawning of summer flounder (Paralichthys dentatus) broodstock, J World Aquac Soc, 29, 393–404. watanabe, w o, smith t i j, berlinsky d l, woolridge c a, stuart k r, copeland k a and denson m r (2003) Volitional spawning of black sea bass Centropristis striata induced with pelleted luteinizing hormone releasing hormone-analogue, J World Aquac Soc, 34, 319–31.


141

webb, m a h, van eenennaam j p, doroshov s i and moberg g p (1999) Preliminary observations on the effects of holding temperature on reproductive performance of female white sturgeon, Acipenser transmontanus Richardson, Aquaculture, 176, 315–29. weber, g m, borski r j, powell j f f, sherwood n m and grau e g (1995) In vivo and in vitro effects of gonadotropin-releasing hormone on prolactin in the tilapia Oreochromis mossambicus, Am Zool (Abstract), 34, 121A. weil, c and crim l w (1983) Administration of LHRH analogues in various ways: effect on the advancement of spermiation in prespawning landlocked salmon, Salmo salar, Aquaculture, 35, 103–15. wen, h s and lin h r (2004) Effects of exogenous neurohormone, gonadotropin (GtH) and dopaminergic drugs on the serum GtH content and ovulatory responsiveness of wild catfish, Silurus asorus (Linnaeus, 1758), Aquac Res, 35, 204–12. williot, p, brun r, rouault t and rooryck o (1991) Management of female breeders of the Siberia sturgeon, Acipenser baeri Brandt: first results, in Williot P (ed.), Acipenser, France, Cemagref Publications, 365–79. williot, p, sabeau l, gessner j, arlati g, bronzi p, gulyas t and berni p (2001) Sturgeon farming in Western Europe: recent developments and perspectives, Aquat Living Resour, 14, 367–74. williot, p, gulyas t and ceapa c (2002) An analogue of GnRH is effective for induction of ovulation and spermiation in farmed Siberian sturgeon Acipenser baerii Brandt, Aquac Res, 33, 735–7. williot, p, brun r, rouault t, pelard m, mercier d and ludwig a (2005) Artificial spawning in cultured sterlet sturgeon, Acipenser ruthenus L., with special emphasis on hermaphrodites, Aquaculture, 246, 263–73. wong, t t, gothilf y, zmora n, kight k e, meiri i, elizur a and zohar y (2004) Developmental expression of three forms of gonadotropin-releasing hormone and ontogeny of the hypothalamic-pituitary-gonadal axis in gilthead seabream (Sparus aurata), Biol Reprod, 71, 1026–35. yang, z and chen y-f (2004) Induced ovulation in obscure puffer Takifugu obscurus by injections of LHRH-a, Aquac Int, 12, 215–23. yaron, z (1995) Endocrine control of gametogenesis and spawning induction in the carp, Aquaculture, 129, 49–73. yaron, z, gur g, melamed p, rosenfeld h, elizur a and levavi-sivan b (2003) Regulation of fish gonadotropins, Int Rev Cytol, 225, 131–85. yu, k l, lin x w, da cunha bastos j and peter r e (1997) Neural regulation of GnRH in teleost fishes, in Parhar I S and Sakuma Y (eds), GnRH Neurons: Gene to Behavior, Tokyo, Brain Shuppan, 277–312. zabala, m, garcia-rubies a, louisy p and sala e (1997) Spawning behaviour of the Mediterranean dusky grouper Epinephelus marginatus (Lowe, 1834) (Pisces, Serranidae) in the Medes Islands Marine Reserve (NW Mediterranean, Spain), Sci Mar, 61, 65–77. zakes, z and szczepkowski m (2004) Induction of out-of-season spawning of pikeperch, Sander lucioperca (L.), Aquac Int, 12, 11–18. zhuang, p, kynard b, zhang l, zhang t, zhang z and li d (2002) Overview of biology and aquaculture of Amur sturgeon (Acipenser schrenckii) in China, J Appl Ichthyol, 18, 659–64. zohar, y (1988) Gonadotropin releasing hormone in spawning induction in teleosts: basic and applied considerations, in Zohar Y and Breton B (eds), Reproduction in Fish: Basic and Applied Aspects in Endocrinology and Genetics, Paris, INRA Press, 47–62. zohar, y (1989) Fish reproduction: its physiology and artificial manipulation, in Shilo M and Sarig S (eds), Fish Culture in Warm Water Systems: Problems and Trends, Boca Raton, FL, CRC, 65–119.

142


zohar, y, harel m, hassin s and tandler a (1995) Gilthead sea bream (Sparus aurata), in Bromage N R and Roberts R J (eds), Broodstock Management and Egg and Larval Quality, Oxford, Blackwell Science, 94–117. zohar, y (1996) New approaches for the manipulation of ovulation and spawning in farmed fish, Bull Natl Res Inst Aquac, Suppl, 2, 43–8. zohar, y and mylonas c c (2001a) Endocrine manipulations of spawning in cultured fish: from hormones to genes, Aquaculture, 197, 99–136. zohar, y and mylonas c c (2001b) Endocrine manipulations of spawning in cultured fish: from hormones to genes, in Donaldson E M and Lee C S (eds), Reproductive Biotechnology in Finfish Aquaculture, Amsterdam, Elsevier, 99–136.

5 Producing sterile and single-sex populations of fish for aquaculture T. J. Benfey, University of New Brunswick, Canada

Abstract: Unlike terrestrial livestock, fish are highly amenable to manipulations leading to the production of single-sex and sterile populations, allowing producers to maximize output based on sex-specific characteristics of economic value while also addressing concerns about environmental impacts of fish which may escape from their farms. Induced triploidy is currently the only method available to produce commercial-scale numbers of sterile fish, and it is particularly useful when combined with all-female production. This approach, and the use of endocrine manipulations to generate broodstock capable of yielding all-female diploid offspring, are the most commonly applied manipulations for sex control used in commercial aquaculture. This chapter describes the methodology and rationale for using single-sex and sterile populations in aquaculture. Key words: androgenesis, gynogenesis, monosex, sex reversal, sterilization, triploidy.

5.1 Introduction This chapter addresses the approaches, rationale and limitations for using sterile and single-sex (i.e., all-female or all-male) populations of fish for aquaculture. Unlike traditional terrestrial livestock species, fish are remarkably amenable to such manipulations. The methods used are often very simple and, in some cases, mimic naturally-occurring exceptions to the typical vertebrate pattern of dioecious diploidy (Purdom, 1984; Devlin and Nagahama, 2002). As a result, some of the manipulations described in this chapter are already used in commercial aquaculture. There are three basic aquaculture applications for sterile populations: to prevent feral spawning of escaped farmed fish, to eliminate production losses associated with early sexual maturation and to protect investments made in developing novel genotypes. Single-sex populations can also be

144


used to address concerns with the establishment of feral populations if the farmed species is not endemic to the culture location and cannot hybridize with native species. However, they are generally used to take advantage of sex-specific differences in production traits of economic value. For example, research has targeted the production of female populations of halibut (Hippoglossus hippoglossus) because of their faster growth as juveniles (Hendry et al., 2003), anguillid eels (Anguilla spp.) because of their larger ultimate size (Davey and Jellyman, 2005), and sturgeon (Acipenser spp.) and lumpfish (Cyclopterus lumpus) for the production of high-value caviar or cheaper equivalents (Flynn and Benfey, 2007, Martin-Robichaud et al., 1994, respectively).

5.2 Sterile populations The principal driving force currently behind using sterile fish in aquaculture is the mitigation of risks to wild populations associated with the escape of farmed fish. These risks can be divided into direct effects of the escaped individuals themselves (predation, displacement, disease transfer, etc.) as well as indirect effects of interbreeding between wild and farmed fish and/ or the establishment of feral populations of farmed fish. Sterilization addresses only these indirect effects, serving as a method of ‘genetic containment’ of any fish which escape from farms. Clearly, physical containment is the preferred option, both from the farmer’s standpoint and for the sake of protecting wild populations. Thus, sterilization serves as a back-up to effective physical containment. If physical containment could be assured, then there would be no need for sterile fish to address this issue. However, current aquaculture practices rarely allow for complete containment of farmed fish populations. A second important reason for using sterile fish in aquaculture is to prevent pre-harvest sexual maturation. Early maturation of farmed fish raises numerous production concerns for fish farmers because of the considerable energy invested by the fish in gamete production and spawning morphology/behaviour. Maturing fish lose flesh quality as muscle energy reserves are withdrawn for the production of gametes, especially in females. Maturing fish are also chronically stressed and, as a result, have reduced immunocompetence and are more susceptible to disease. Mature males also often show aggressive behaviour. Sterilization can effectively eliminate these problems for the fish farmer. However, they can also often be addressed through selection, as age at maturity is a heritable trait. A number of recent studies have also demonstrated photoperiod manipulation to be an effective method for delaying or suppressing maturation in a variety of fishes including salmonids (Peterson and Harmon, 2005; Unwin et al., 2005), sea bass (Dicentrarchus labrax) (Rodriguez et al., 2005; Felip et al., 2008),

Producing sterile and single-sex populations of fish for aquaculture

145

flatfish (Imsland and Jonassen, 2005; Garcia-Lopez et al., 2006) and gadoids (Davie et al., 2007a, b). Similar results have been achieved in salmonids through periodic reductions in feeding (Silverstein and Shimma, 1994; Duston and Saunders, 1999). Although such environmental manipulations do not render the fish sterile, they are likely more appealing to farmers and consumers as alternatives to the methods outlined below for permanent sterilization. A third reason for using sterile fish is to protect advances made through selection programs and ‘genetic engineering’ (by transgenesis), both of which are long-term, expensive approaches used for genetic improvement. The former is of critical importance to any type of farming, including aquaculture, whereas the latter has yet to be embraced by the fish-farming industry. In either case, having made such long-term investments in producing unique genotypes, there is clearly an interest in ensuring that producers cannot establish independent breeding programs from them. This is a classic problem in agriculture, and can be addressed through licensing agreements that establish breeding rights. However, sterilization can serve as insurance should such agreements not be possible. The fact that alternatives to sterilization exist to address problems associated with escapees, early maturation and the protection of breeding rights explains, at least to some extent, why sterile fish have not found greater use in aquaculture. However, these alternatives are not always adequate, and so there remains considerable interest in the development and use of effective sterilization techniques. Although there are a number of ways in which to sterilize fish, the use of female triploid populations is currently the only accepted method for achieving this on a commercial scale (Dunham, 2004; NRC Committee on Biological Confinement of Genetically Engineered Organisms, 2004; Johnstone, 2005; Devlin et al., 2006a).

5.2.1 Triploidy by direct induction Triploidy induction refers to the creation of individuals with three complete chromosome sets when the norm for that species would be some other number, this generally being two (i.e., diploid). Most vertebrates are diploid, with individuals inheriting one set of chromosomes from their mother and the other from their father. Individuals with an odd number of chromosome sets, such as triploids, are generally sterile, whereas those with an even number, such as diploids and tetraploids, are generally fertile. Triploidy is generally induced by interference with the completion of the second meiotic division, thereby yielding individuals with two sets of maternal chromosomes and one set of paternal chromosomes

146


(Pandian and Koteeswaran, 1998). Germ cells (spermatogonia and oogonia) are the only cells which undergo meiotic division, a process necessary for reducing a cell’s chromosome complement by half (typically from diploid to haploid) so that the correct chromosome number (typically diploid) results from fertilization. Meiosis comprises two cellular divisions, and these are completed by the time of spermiation in males, yielding four haploid post-meiotic spermatozoa from each initial diploid premeiotic spermatogonium. The process is somewhat different in oocytes, which eliminate chromosomes through the production of ‘polar bodies’ that are shed as the oocytes develop, ultimately resulting in the production of a single egg from each diploid oogonium. The first meiotic division and polar body production occur early in ovarian development, but the second polar body, containing a single (haploid) set of chromosomes, is retained until after oocytes are fertilized. It is the physical penetration of the oocyte by the fertilizing spermatozoon that stimulates the oocyte’s second meiotic division to go to completion with release of the second polar body. Preventing this from happening results in triploidy (see Fig. 5.1). Thermal and pressure-induced retention of the second polar body has been used extensively for the production of triploid fish (Benfey, 1989; Pandian and Koteeswaran, 1998; Felip et al., 2001). Thermal treatments are relatively easy to apply with inexpensive equipment, but are less easily controlled, i.e., it is difficult to ensure that all eggs within a treatment batch are heated/cooled at the same rate and to the same temperature. The actual treatment temperature used is also dependent on pre-treatment incubation temperature, making it difficult to come up with a consistent, standardized treatment in the absence of adequate control of incubation temperature. These problems are avoided through the use of hydrostatic pressure treatment, which involves treating eggs within a sealed pressure vessel such that all eggs within a treatment batch are exposed to the identical treatment. Furthermore, the optimum pressure treatment is independent of incubation temperature. Systems for the hydrostatic pressure treatment of large numbers of eggs are commercially available and are used routinely by both commercial and government hatcheries for the production of triploids for aquaculture and fisheries management applications (e.g., Abiado et al., 2007). Triploidy induction by hydrostatic pressure treatment is considered to be highly reliable (Johnstone, 1993, 2005; Benfey, 2001). For instance, in an assessment of the aquaculture characteristics of triploid Atlantic salmon (Salmo salar), O’Flynn et al. (1997) applied a standard treatment of 5 minutes exposure to 65 500 kPa, beginning at 300 ºC minutes after fertilization, for triploidy induction in 86 families representing four different research strains of Atlantic salmon spawned over 5 consecutive years, as well as in 3 commercial runs over 2 consecutive years at an industry hatchery. Triploidy induction success was based on screening ten


~~~~

1

147

M

P M

~~~~

2

M

P M

X3n 3

PM M

4

PMM PMM

PM

PM PM X4n

5

PM M

PM M 3n

PM PM

PM

PM

2n PPMM PPMM

6

7

PM PM

PM PM 4n

Fig. 5 1 Production of diploid (2n), triploid (3n) and tetraploid (4n) embryos. When ovulated, fish eggs are arrested at meiosis II, with one haploid maternal chromosome set (M) destined to become the egg pronucleus and another destined to become the second polar body (Step 1). The fertilizing spermatozoon carries one haploid paternal chromosome set (P). Its entry into the egg results in the completion of meiosis II with extrusion of the haploid second polar body (Step 2). This process is blocked for triploidy induction (X3n). The nuclear membrane then encloses either two (2n zygote) or three (3n zygote) chromosome sets (Step 3). The first cell division is preceded by mitotic duplication of all chromosomes within the zygote (Step 4). Cell division then occurs, giving the 2-cell embryo (Step 5). This process is blocked for tetraploidy induction (X4n). The subsequent mitotic cell division begins with a further duplication of all chromosomes (Step 6) and results in a 4n 2-cell embryo (Step 7).

148


randomly selected fish from each family, and in all cases the tested fish were confirmed to be triploid. Although the number of fish tested per family was small, the uniform result across families, strains and year classes speaks to the reliability of this method. Similarly, Devlin et al. (2006b) found that triploidy induction success by hydrostatic pressure treatment in coho salmon (Oncorhynchus kisutch) can routinely exceed 99 %. The principal limitation of thermal/pressure-induced triploidy induction is that treatments are applied directly to the eggs destined to become triploid. This means that there is always the possibility for lower triploidy induction success based on inexperience and/or inadequate control over the key induction variables of pre-treatment duration (which is temperature dependent) and the duration and magnitude of the thermal/pressure treatment itself. Thus, although there is abundant evidence that triploidy induction can work with a high (effectively 100 %) rate of success, there is a need for standard operating procedures and quality assurance programs to ensure routine triploidy induction success. This is especially important for inexperienced users of this technology. Chemical inhibitors of microtubular formation, such as colchicine and cytochalasin B, have been used extensively to produce polyploid plants and bivalves, respectively. However, experiments with these chemicals have never yielded appreciable numbers of polyploid fish (Refstie et al., 1977; Allen and Stanley, 1979; Smith and Lemoine, 1979; Refstie, 1981; Bolla and Refstie, 1985). Exposure to hyperbaric nitrous oxide has shown more promise, with up to 100 % triploidy induction success in both rainbow trout (Oncorhynchus mykiss) (Shelton et al., 1986), and Atlantic salmon (Johnstone et al., 1989), but with reduced survival. This approach has not been further pursued, given the higher triploid yield obtained through hydrostatic pressure treatment (Johnstone et al., 1989). Chemical-induced triploidy suffers the same limitation as thermal and pressure-induced triploidy: treatments are applied directly to the eggs destined to become triploid, thus introducing the possibility of reduced efficacy due to inexperience and/or failure to ensure correct treatment. An additional limitation of this approach is that treating fish with chemicals known to interfere with cell division may affect consumer acceptance of the final product. The direct induction of triploidy is also possible through dispermic fertilization, whereby two spermatozoa enter a single egg to yield triploids with two sets of paternal chromosomes and one set of maternal chromosomes (Pandian and Koteeswaran, 1998). This method of triploidy induction has received far less attention than that described above for polar body retention. Polyethylene glycol and high pH/calcium solutions have been used to fuse spermatozoa prior to fertilization in rainbow trout, resulting


149

in up to 33 % triploidy induction success (Ueda et al., 1986, 1988). The remaining eggs were fertilized with single (unfused) spermatozoa, yielding normal diploid offspring. The principal limitation of triploidy induction by dispermic fertilization is the high failure rate of spermatozoan fusion. These treatments have been shown to cause extensive fusion of spermatoan tails (in addition to heads), thereby affecting motility and reducing fertilization success (Araki et al., 1995). With further research it may be possible to develop a more reliable protocol to match the success rate of thermal/ pressure-induced triploidy, although this will be hampered by speciesspecific differences in optimum treatments (Araki et al., 1995). In any case, the same issues of inexperience and/or inadequate treatment control will apply.

5.2.2 Triploidy by tetraploid–diploid crosses As an alternative to the direct induction of triploidy, it is also possible to create triploids indirectly by crossing tetraploid individuals of one sex with diploids of the other (Pandian and Koteeswaran, 1998). Depending on which parent is the tetraploid, the offspring will either have two sets of maternal and one set of paternal chromosomes (tetraploid mother; similar outcome as direct induction of triploidy through retention of the second polar body) or one set of maternal and two sets of paternal chromosomes (tetraploid father; similar outcome as direct induction of triploidy through dispermic fertilization). In either case, this approach requires the direct induction of tetraploidy – rather than triploidy – and the subsequent incorporation of tetraploid broodstock into regular breeding programs. Tetraploidy is induced using the same thermal or hydrostatic pressure treatments employed for triploidy induction, but applied somewhat later after fertilization in order to block the first mitotic cell division of the zygote. Mitosis is a simpler form of cell division than meiosis, involving the duplication of all chromosomes followed by their separation into two chromosome complements of equal number, after which cell division occurs to leave the two resultant cells with one set of chromosomes each. Thus, prior to the first mitotic cell division in a normal diploid zygote, all the chromosomes have been duplicated to give it a tetraploid chromosome number for a short time. This is subsequently reduced to diploid with cell division to yield the twocell diploid embryo. Treatments that block this first mitotic cell division after chromosome duplication has occurred are effective for inducing tetraploidy (see Fig. 5.1). Although tetraploidy has been induced in numerous fish species (Solar et al., 1992; Pandian and Koteeswaran, 1998), their survival is generally very low – much lower than that of induced triploids. This has generally been related to difficulties with getting the treatment timing right to minimize mortality (e.g., Chourrout et al., 1986; Zhang et al., 2005), but there also

150


appear to be inherent physiological problems with tetraploids that significantly reduce their viability (Sakao et al., 2003, 2006). However, several studies have demonstrated that it is feasible to create triploid populations of rainbow trout by crossing tetraploids with diploids (Chourrout et al., 1986; Blanc et al., 1987; Chourrout and Nakayama, 1987; Myers and Hershberger, 1991). There are a number of limitations with the use of tetraploid–diploid crosses as an approach for the production of all-triploid populations. Firstly, and critically, they do not generally yield all-triploid populations as predicted. For instance, although crosses between tetraploid male and diploid female rainbow give mostly triploid progeny, they also often yield small numbers of diploids and aneuploids (Chourrout et al., 1986). Similarly, rainbow trout crosses between tetraploid females and diploid males also yield mostly triploid offspring, but with the occasional haploids, diploids and mosaics (Chourrout and Nakayama, 1987). Similar observations have been made with mud loach (Misgurnus mizolepis) (Nam and Kim, 2004) and blunt snout bream (Megalobrama amblycephala) (Zou et al., 2004). There is some evidence from these studies that individual variation exists among tetraploids in their ability to produce triploid offspring, suggesting that careful tetraploid broodstock selection may ensure all-triploid progeny (e.g., Nam and Kim, 2004). However, based on the current level of experience with tetraploids it would be necessary to screen all the offspring from individual crosses to confirm their triploid status. Given this limitation to an otherwise theoretically ideal process for producing triploid populations, it is likely easier to use direct induction of triploidy for which treatment protocols are better defined. A second limitation of using tetraploid crosses with diploids, at least in rainbow trout, is that tetraploid females have delayed maturation (Chourrout et al., 1986) and tetraploid males have reduced fertility (Chourrout et al., 1986; Blanc et al., 1987, 1993; Myers and Hershberger, 1991). This latter effect is apparently because their relatively large spermatozoa – a consequence of increased chromosome number – have difficulty penetrating the micropyle of the egg (Chourrout et al., 1986). The micropyle is a small opening through which spermatozoa must pass to fertilize the egg in teleost fishes, and micropyle diameter is so closely matched to spermatozoan head diameter within a species that it cannot easily accommodate the 30 % increase in head width of spermatozoa from tetraploid males compared to those from diploids (Chourrout et al., 1986). A third limitation of this approach to producing triploids is that presumptive tetraploids may in fact be diploid-tetraploid mosaics. Such mosaics have been observed in several species following treatments designed to block the first mitotic division, including amago salmon (Oncorhynchus masou ishikawai) (Yamaki et al., 1999), rainbow trout


151

(Zhang and Onozato, 2004a) and their hybrid (Zhang and Onozato, 2004b). Diploid–tetraploid mosaics have the potential to yield large numbers of diploid offspring (up to 100 %) when crossed to normal diploids (Yamaki et al., 1999; Yamaki and Arai, 2000; Zhang and Onozato, 2004b), and their occurrence in presumptive all-tetraploid populations may account for earlier observations of diploids and aneuploids arising from crosses between tetraploids and diploids (as described above: Chourrout et al., 1986; Chourrout and Nakayama, 1987; Nam and Kim, 2004; Zou et al., 2004). It is likely possible to overcome this limitation through refinement of tetraploidy induction protocols (e.g., Zhang and Onozato, 2004a) and screening of presumptive tetraploid broodstock before their use. However, this screening process would need to go beyond ploidy determination of presumptive tetraploid broodstock by standard techniques such as karyotyping or flow cytometric measurement of DNA content from blood cells because they may miss the existence of a mosaic genotype in the germ line. Rather, it would be necessary to screen the progeny resulting from tetraploid–diploid crosses between individual parents to confirm their all-triploid nature.

5.2.3 Genomic stability of triploids Ensuring the genomic stability of triploid individuals is critical when using induced triploidy as a means of achieving reproductive sterility. The specific concern with this is that triploid individuals do not reduce their chromosome number to diploid, either at the whole animal level or within populations of cells. Reversion to diploidy in the germ cells, whether limited to these cells alone or because of diploid reversion at the whole animal level, circumvents the reproductive sterilization aimed for through triploidy induction. Even if an animal remained triploid in all its somatic tissues, if any of the pre-meiotic germ cells (oogonia or spermatogonia) reverted to diploid they would yield viable haploid gametes as expected from a fertile diploid animal. When considering the possibility of triploid reversion to diploid, it is important to make a distinction between actual reversion from the triploid state to some other chromosomal configuration, as opposed to not having had true triploids in the first place. This latter possibility arises from the various limitations of triploidy induction protocols, and comes down to two possibilities: the direct triploidy induction process is not fully successful and results in a mix of triploid and diploid individuals, or the tetraploidy induction process is not fully successful and leads to the production of some mosaic individuals with the potential to produce diploid offspring. These limitations have been addressed above. The reversion of a truly triploid individual to the diploid state in some or all of its tissues could be envisaged to occur slowly, by the loss of one or a few chromosomes at a time, or quickly, by the loss of an entire

152


haploid chromosome set at one time. The former would initially lead to aneuploidy (i.e., any chromosome number other than an exact multiple of haploid), but could ultimately lead to a reduction in chromosome number to a lower euploid state (i.e., an exact multiple of haploid – specifically diploid in this case). At the whole animal level, this would then lead to mosaic individuals, as would be the case if an entire haploid chromosome set was lost outright from individual cells. Such a scenario, which requires errors in, or modifications to, the typical processes of mitotic chromosome separation and cell division, has never been described in artificially produced triploid fish. However, concerns are frequently raised over just such a scenario, apparently based on its repeated observation in the Pacific oyster (Crassostrea gigas), where is has been seen not just in triploids (Allen et al., 1996, 1999), but also in tetraploids (McCombie et al., 2005) and even in diploids (Thiriot-Quiévreux et al., 1992; Zouros et al., 1996; Leitão et al., 2001a, b; Bouilly et al., 2005). Aneuploidy has also been observed in the pearl oyster (Pinctada martensii) (He et al., 2001, 2004). Unlike fish, oysters appear to be highly tolerant of aneuploidy and mosaicism (Wang et al., 1999; He et al., 2004). Given the greater number and longer history of publications on triploid fish compared to shellfish and the fact that reversion to diploidy has never been reported in triploid fish, it appears that it either does not happen or is lethal. Indeed, recent research by Poss et al. (2004) has demonstrated in zebrafish (Danio rerio) that vertebrate cells – and in particular germ cells – are highly sensitive to errors in chromosome separation and cell division that might lead to aneuploidy, with the result that such cells are unable to divide. Although not ‘reversion’ per se, another issue to consider is the fate of any post-meiotic germ cells that might develop in artificiallyproduced triploids. It is important to recognize that (i) artificiallyproduced triploid fish are capable of producing small numbers of post-meiotic gametes (reviewed by Benfey, 1999) and (ii) there are naturally occurring triploid ‘species’ (actually hybrids) which regularly do so because they have evolved atypical meiotic processes that allow them to circumvent triploid sterility and thereby maintain self-sustaining, reproductively viable populations (Purdom, 1984; Devlin and Nagahama, 2002). The production of gametes in artificially-produced triploids is more commonly reported in males than in females, likely for two related reasons (Benfey, 1999). Firstly, male fish typically produce far more gametes than females because spermatozoa are so much smaller than oocytes and gonads of a given size will therefore have far more pre-meiotic spermatogonia than oogonia. Thus, if a certain percentage of pre-meiotic cells are destined to complete meiosis in triploids – as appears to be the case (Benfey, 1999) – firstly, this will translate into much larger numbers of post-meiotic sperma-


153

tozoa in males than post-meiotic oocytes in females. Secondly, triploid females do not produce sufficient levels of the ovarian steroid 17β-estradiol that stimulates the synthesis and uptake of yolk proteins by developing oocytes, resulting in slowed or arrested growth of those few oocytes that do progress through meiosis in triploid females (Benfey et al., 1989; Schafhauser-Smith and Benfey, 2001, 2003a, b). Although there have been occasional reports of ovulated eggs from triploid female salmonids, in no case have they yielded viable offspring (Johnstone et al., 1991; Benfey, 1996). The production of sperm (milt) by triploid males is more common (Benfey, 1999) but, as clearly demonstrated in rainbow trout, it comprises aneuploid spermatozoa with a modal DNA content halfway between haploid and diploid (Benfey et al., 1986). When used to fertilize eggs from normal diploid females, the offspring are aneuploid and do not survive (Lincoln and Scott, 1984; Ueda et al., 1987). This confirms the sterile nature of triploid fish, in the true sense of the word: an inability to produce viable offspring. Naturally occurring triploids that maintain self-sustaining populations all involve hybrids between two or more closely related species, and are called ‘allotriploids’ to distinguish them from the within-species artificial triploids (‘autotriploids’) that are the focus of this paper. Hybrid allotriploids invariably exist as all-female populations and rely on males of one of their progenitor species to provide sperm for the activation of development in their eggs (Vrijenhoek, 1994; Devlin and Nagahama, 2002). Maintaining reproductively viable populations of allotriploids is only possible through the evolution of atypical patterns of meiosis and fertilization that have never been observed in autotriploids.

5.2.4 Alternatives to triploidy for sterilization Detailed descriptions of the variety of alternatives to triploidy for producing sterile fish can be found elsewhere (e.g., Devlin and Donaldson, 1992; Maclean and Laight, 2000; Wong and Van Eenennaam, 2008), and are therefore only reviewed briefly. Surgical castration is probably the earliest technique to have been developed for sterilizing fish. It can be highly effective if no gonadal tissue remains after surgery. However, ensuring the complete removal of the gonads is difficult, especially when working with smaller fish. In any case, it is inconceivable that surgical castration can applied on a commercial scale because of the amount of time and handling involved in the procedure. High energy radiation (gamma- and X-ray) is well documented to have sterilizing effects on a wide range of organisms, including fish. However, permanent sterilization is difficult to achieve. Furthermore, the equipment used is heavy and cumbersome, and is therefore not amenable to transport

154


to farm sites. Operator and environmental safety are clear concerns when using high energy radiation sources, and consumer acceptability of the final product is questionable. This technique is therefore not seen as suitable for commercial aquaculture. The use of chemicals, immunological manipulations or transgenic techniques to act upon the hypothalamic–pituitary–gonadal axis are approaches more likely to work on a commercial scale than surgical castration or high energy radiation, but as yet no effective treatments for permanent sterilization have been developed along these lines for any aquaculture species. Any approach which interferes with the production or release of gonadotropin releasing hormone (hypothalamus) or gonadotropins (pituitary) is potentially effective for ensuring sterilization. Unlike triploidy and most other sterilization approaches, one could envisage this approach as being reversible, allowing the breeding of top performing sterile fish by supplementation of the missing hormone(s) as a form of replacement therapy. This is a field of research worthy of pursuit for developing novel techniques for sterilizing fish. Lastly, androgen administration, through immersion or feeding, is well documented to be an inexpensive and effective method for the permanent sterilization of fish. It is easily applied on a commercial scale, although care must be taken to protect farm employees and the environment from exposure to high steroid doses. The steroid treatments are typically completed one or more years prior to fish reaching market size, by which time residual steroid levels have become non-detectable (Pandian and Kirankumar, 2003). The only apparent reason that this technique is not used for commercial production is because of concerns about consumer acceptance of a steroid-treated product, and this limitation is not likely to change.

5.3 Single-sex populations From a strictly production standpoint, there are often clear advantages of one sex over the other for commercial aquaculture. For most species of fish it is impossible to separate males and females as juveniles, and in many species this is even impossible as sexually mature adults. However, there are a number of different approaches that can be used to generate singlesex populations through simple genetic, endocrine or environmental manipulations.

5.3.1 Uniparental inheritance The activation of embryonic development with no contribution of the paternal genome (gynogenesis) or the maternal genome (androgenesis) is


155

a simple genetic manipulation that can be used for the production of singlesex populations (Pandian and Koteeswaran, 1998; Felip et al., 2001; Komen and Thorgaard, 2007). Gynogenesis is usually accomplished by modifying or destroying the spermatozoan genome without affecting the motility of the spermatozoa and hence their ability to penetrate the egg and activate embryonic development. This is generally done using UV-irradiation, but is also possible with high energy radiation or certain chemicals. In some cases, the use of sperm from a different species has the same effect. Penetration of the treated spermatozoon into the egg stimulates the resumption of meiosis, which ends with extrusion of the haploid second polar body. The result is a haploid zygote with its genomic DNA derived solely from the egg’s pronucleus. Diploidy can be restored by using thermal or hydrostatic pressure treatments to either block extrusion of the second polar body itself, or by allowing this to occur but then blocking the first mitotic cell division after the chromosome complement has been duplicated. These treatments are identical to those used to induce triploidy or tetraploidy, respectively, after fertilization with intact spermatozoa. In this case, however, the resulting zygote has a normal diploid chromosome number but with all chromosomes inherited from the mother. Androgenesis works in the same way as gynogenesis, but requires irradiation of the eggs rather than the sperm, followed by fertilization with intact spermatozoa. Ordinarily this would yield androgenetic haploids, but again if the first mitotic cell division is blocked after pre-mitotic duplication of the paternal genome, then the result is androgenetic diploids. Considerably more research has been conducted on gynogenesis than on androgenesis in fish, principally because it is easier to effectively irradiate sperm than eggs. Gynogenesis can be used to create all-female populations but cannot yield all-male populations. For instance, in species having female homogamety, equivalent to the mammalian XX-female/XY-male system, exclusion of the paternal genome and duplication of the maternal genome through gynogenesis should result in all-female populations. This is well established for salmonid fishes (Ihssen et al., 1990) and has also been demonstrated for Atlantic halibut (Tvedt et al., 2006). In species with female heterogamety, equivalent to the avian WZ-female/ZZ-male system, gynogenesis yields populations comprising mostly normal males and ‘super-females’ (WW genotype), with the possibility of smaller number of normal females. Sex ratios recently obtained from gynogenetic populations of shortnose sturgeon (Acipenser brevirostrum) suggest that this species has male homogamety (Flynn et al., 2006). The creation of all-female populations in such cases requires the mating of normal males with super-females. Conversely, androgenesis results in all-male populations in species with male homogamety (WZ/ZZ-system) but cannot be used to make all-female populations in such species. For species

156


having male heterogamety (XX/XY-system), androgenesis yields populations comprising mostly normal females and ‘super-males’ (YY genotype), with the possibility of smaller numbers of normal males. All-male populations can then be obtained by crossing normal females with super-males. Perpetuating all-female and all-male lines using such genetic manipulations is facilitated by endocrine manipulations. In species with female homogamety, functional sex reversal of gynogenetic females yields phenotypic males capable of generating all-female offspring when crossed with normal females. Similarly, in species with male homogamety, functional sex reversal of gynogenetic males yields phenotypic females capable of generating all-male offspring when crossed with normal males. Further details on the methodology for endocrine sex reversal are provided in Section 5.3.2. Uniparental inheritance results in reduced heterozygosity, an important consideration when designing breeding programs that incorporate gynogenetic or androgenetic fish. The pathways described above also assume simple (single locus) genetic control of sex determination, for which many exceptions exist among fishes (Devlin and Nagahama, 2002). Furthermore, because most fish lack discrete sex chromosomes or even much in the way of distinct sex-specific genes, the predicted sex ratio outcomes are not always realized due to segregation of recessive mutations affecting sex determination (Komen and Thorgaard, 2007). Thus, although uniparental inheritance is useful for determining the genetic basis to sex determination (e.g., Flynn et al., 2006; Tvedt et al., 2006; Komen and Thorgaard, 2007), it is not generally used for the direct production of single-sex populations of fish.

5.3.2 Endocrine sex reversal Although sex is ultimately under genetic control and is often determined – and fixed – at fertilization, the phenotypic expression of sex (i.e., gonadal differentiation into ovaries or testes) is mediated by sex steroids. Thus, estrogens and androgens have feminizing and masculinizing effects, respectively. These hormones are the natural ‘sex inducers’ in vertebrates, and their exogenous administration during gonadal differentiation can be used to change sex in fish (Devlin and Nagahama, 2002). Successful endocrine sex reversal therefore requires knowledge of the timing of gonadal differentiation. In some species this occurs prior to yolk absorption, requiring the immersion of embryos in steroid solutions. In species where gonadal differentiation occurs later in life, these steroids can be administered through the food, either via live prey such as steroid-enriched Artemia (e.g., lumpfish; Martin-Robichaud et al., 1994) or in prepared feeds (e.g., Atlantic halibut; Hendry et al., 2003).


157

Despite the fact that it is possible to achieve ‘direct’ feminization or masculinization in this way, the marketability of such fish for human consumption is affected by their exposure to steroids (Pandian and Kirankumar, 2003). The preferred method for aquaculture applications is therefore ‘indirect’ feminization or masculinization. For instance, the appropriate administration of androgens to salmonid fishes results in all-male populations. If the sex-reversed genotypic females (‘neo-males’) within such populations are subsequently mated to normal females, all the resulting offspring are female but have not themselves been exposed to steroids. This method for the production of all-female populations for aquaculture is currently used for salmonid species such as rainbow trout and chinook salmon (Oncorhyncus tshawytscha) (Devlin and Nagahama, 2002), as well as for Atlantic halibut (Scotian Halibut Ltd, Nova Scotia, Canada, unpublished).

5.3.3 Environmental manipulation of sex ratio All steroid hormones are derived from cholesterol, with their biosynthesis controlled by specific steroidogenic enzymes. Chemical inhibition of such enzymes has been used to create single-sex populations of fish (Piferrer, 2001). Given that enzyme activity is sensitive to physical (e.g., temperature) and chemical (e.g., pH) conditions, it should also be possible to manipulate sex ratios in fish by manipulating the expression and/or activity of steroidogenic enzymes (Baroiller et al., 1999). The best candidate for such environmental manipulations is temperature, given the well documented effects of egg incubation temperature on sex ratios in reptiles and some species of fish. Such a protocol has obvious attractiveness for aquaculture because it represents a more consumer-friendly approach, given the absence of genetic manipulation or use of steroid hormones. Sex ratios have been altered by simple temperature manipulations in numerous aquaculture species, including Nile tilapia (Oreochromis niloticus) (Tessema et al., 2006), goldfish (Carassius auratus) (Goto-Kazeto et al., 2006) and several flatfish species (Goto et al., 1999, 2000; Yamamoto, 1999; Luckenbach et al., 2003), although not Atlantic halibut (Hughes et al., 2008). The number of fish species demonstrating temperature-sensitive sexual differentiation under experimental conditions is growing rapidly, and this may become a common approach to producing sex-biased populations for aquaculture.

5.4 Future trends and further reading As aquaculture continues to grow in importance as a source of high-quality food, there will be a greater focus on developing technologies to improve

158


production efficiencies. Although aquaculture is rightly seen as an aquatic extension of terrestrial agriculture, there are some unique attributes of the animals farmed in aquaculture compared to more familiar terrestrial livestock because the latter focuses on mammals and birds, whereas in aquaculture the focus is on fish and invertebrates. The terrestrial paradigm of what is possible with respect to sex control does not apply to these aquaculture species. Given the ease with which single-sex and sterile populations of fish can be produced using simple manipulations that are not likely to be criticized by consumers, and in fact have added benefits to mitigating aquaculture impacts on the environment, it is likely that there will be widespread use of such populations in the future. The key is to not have one’s imagination constrained by what is (and is not) possible to do when farming mammals and birds. Given the fundamental differences between triploids and diploids with respect to genome size, gene dosage, cell size, etc. (Benfey, 1999), it is not surprising that triploid performance in aquaculture is not necessarily the same as for diploids. Triploid growth is, at best, generally no better than that of diploids (Benfey, 1999; Maxime, 2008), and they are less tolerant of chronic exposure to high temperature (Ojolick et al., 1995; Hyndman et al., 2003). Current research focuses on determining the limitations and best culture conditions for triploids, with respect to providing the optimum environment for letting them realize their potential (e.g., Atkins and Benfey, 2008). Through such research it should become possible to increase greatly the use of triploids in commercial aquaculture without affecting production efficiencies. At the same time, it is important to continue searching for effective alternatives to triploidy for providing sterile populations. Relevant advances made in other fields should be pursued for their applicability to aquaculture. For instance, the recent discovery of the key role of kisspeptin and its receptor (GPR54) in controlling puberty through the regulation of gonadotropin releasing hormone secretion in mammals (Dungan et al., 2006) should be investigated as a likely site for intervention for the control of gonadal development in fishes. With respect to the production of single-sex populations, the rapid increase in the number of species demonstrated to have thermal-labile sex determination – at least under culture conditions if not in nature – opens the door for widespread use of simple temperature manipulation at key stages of the life cycle as a way of altering sex ratio to the benefit of fish farmers. Advances in molecular biology will facilitate the integration of such manipulations into traditional breeding programs. For further reading on the topics covered in this chapter, the reader is recommended the comprehensive reviews by Pandian and Koteeswaran (1998), Benfey (1999), Felip et al., (2001), Devlin and Nagahama (2002), Koman and Thorgaard (2007) and Maxime (2008).


159

5.5 References abiado m a g, penn m, dabrowski k, stafford j (2007) Evaluation of two commercially available pressure chambers to induce triploidy in saugeyes, N Am J Aquac, 69, 197–201. allen jr s k, stanley j g (1979) Polyploid mosaics induced by cytochalasin B in landlocked Atlantic salmon Salmo salar, Trans Am Fish Soc, 108, 462–6. allen jr s k, guo x, burreson g, mann r (1996) Heteroploid mosaics and reversion among triploid oysters, Crassostrea gigas. Fact or artifact, J Shellfish Res, 15, 514 (abstract). allen jr s k, howe a, gallivan t, guo x, debrosse g (1999) Genotype and environmental variation in reversion of triploid Crassostrea gigas to the heteroploid mosaics state, J Shellfish Res, 18, 293 (abstract). araki k, shinma h, nagoya h, nakayama i, onozato, h (1995) Androgenetic diploids of rainbow trout (Oncorhynchus mykiss) produced by fused sperm, Can J Fish Aquat Sci, 52, 892–6. atkins m e, benfey t j (2008) Effect of temperature on routine metabolic rate in triploid salmonids, Comp Biochem Physiol, 149A, 157–61. baroiller j-f, guiguen y, fostier a (1999) Endocrine and environmental aspects of sex differentiation in fish, Cell Mol Life Sci, 55, 910–31. benfey t j (1989) A bibliography of triploid fish, 1943 to 1988, Can Tech Rep Fish Aquat Sci, 1682, 1–33. benfey t j (1996) Ovarian development in triploid brook trout (Salvelinus fontinalis), in Goetz F W and Thomas P (eds), Proceedings of the 5th International Symposium on the Reproductive Physiology of Fish, Austin, TX, Fish Symposium, 95, 357. benfey t j (1999) The physiology and behavior of triploid fishes, Rev Fish Sci, 7, 39–67. benfey t j (2001) Use of sterile triploid Atlantic salmon (Salmo salar L.) for aquaculture in New Brunswick, Canada, ICES J Mar Sci, 58, 525–9. benfey t j, solar i i, de jong g, donaldson e m (1986) Flow-cytometric confirmation of aneuploidy in sperm from triploid rainbow trout, Trans Am Fish Soc, 115, 838–40. benfey t j, dye h m, solar i i, donaldson e m (1989) The growth and reproductive endocrinology of adult triploid Pacific salmonids, Fish Physiol Biochem, 6, 113–20. blanc j-m, chourrout d, kreig f (1987) Evaluation of juvenile rainbow trout survival and growth in half-sib families from diploid and tetraploid sires, Aquaculture, 65, 215–20. blanc j-m, poisson h, escaffre a m, aguirre p, vallée f (1993) Inheritance of fertilizing ability in male tetraploid rainbow trout (Oncorhynchus mykiss), Aquaculture, 110, 61–70. bolla s, refstie t (1985) Effect of cytochalasin B on eggs of Atlantic salmon and rainbow trout, Acta Zool (Stockholm), 66, 181–8. bouilly k, leitão a, chaves r, guedes-pinto h, boudry p, lapègue s (2005) Endonuclease banding reveals that atrazine induced aneuploidy resembles spontaneous chromosome loss in Crassostrea gigas, Genome, 48, 177–80. chourrout d, nakayama i (1987) Chromosome studies of progenies of tetraploid female rainbow trout, Theor Appl Genet, 74, 687–92. chourrout d, chevassus b, krieg f, happe a, burger g, renard p (1986) Production of second generation triploid and tetraploid rainbow trout by mating tetraploid males and diploid females – potential of tetraploid fish, Theor Appl Genet, 72, 193–206.

160


davey ajh, jellyman d j (2005) Sex determination in freshwater eels and management options for manipulation of sex, Rev Fish Biol Fish, 15, 37–52. davie a, mazorra de quero c, bromage n, treasurer j, migaud h (2007a) Inhibition of sexual maturation in tank reared haddock (Melanogrammus aeglefinus) through the use of constant light photoperiods, Aquaculture, 270, 379–89. davie a, porter mjr, bromage n r, migaud h (2007b) The role of seasonally altering photoperiod in regulating physiology in Atlantic cod (Gadus morhua). Part I. Sexual maturation, Can J Fish Aquat Sci, 64, 84–97. devlin r h, donaldson, e m (1992) Containment of genetically altered fish with emphasis on salmonids, in Hew C L and Fletcher G L (eds), Transgenic Fish, Singapore, World Scientific, 229–66. devlin r h, nagahama y (2002) Sex determination and sex differentiation in fish: an overview of genetic, physiological, and environmental influences, Aquaculture, 208, 191–364. devlin r h, sundström l f, muir w m (2006a) Interface of biotechnology and ecology for environmental risk assessments of transenic fish, Trends Biotech, 24, 89–97. devlin r h, biagi c a, sakhrani d, eom k-w (2006b) Assessment of pressure-shock induced triploidy for containment of transgenic salmon, in MacKinlay C and Busby C (eds), Book of Abstracts, 7th International Congress on the Biology of Fish, St. John’s, Newfoundland, Bethesda, MD, American Fisheries Society, 47. dungan h m, clifton d k, steiner r a (2006) Kisspeptin neurons as central processors in the regulation of gonadotropin-releasing hormone secretion, Endocrinol, 147, 1154–8. dunham r a (2004) Aquaculture and Fisheries Biotechnology: Genetic Approaches, Cambridge, MA, CABI. duston j, saunders r l (1999) Effect of winter food deprivation on growth and sexual maturity of Atlantic salmon (Salmo salar) in sea water, Can J Aquat Sci, 56, 201–7. felip a, zanuy s, piferrer f (2001) Induction of triploidy and gynogenesis in teleost fish with emphasis on marine species, Genetica, 111, 175–95. felip a, zanuy s, muriach b, cerda-reverter j m, carrillo m (2008) Reduction of sexual maturation in male Dicentrarchus labrax by continuous light both before and during gametogenesis, Aquaculture, 275, 347–55. flynn s r, benfey t j (2007) Sex differentiation and aspects of gametogenesis in shortnose sturgeon, Acipenser brevirostrum, Lesuere, J Fish Biol, 70, 1027–44. flynn s r, matsuoka m, reith m, martin-robichaud d j, benfey t j (2006) Gynogenesis and sex determination in shortnose sturgeon, Acipenser brevirostrum, LeSuere, Aquaculture, 253, 721–7. garcia-lopez a, pascual e, sarasquete c, martinez-rodriguez g (2006) Disruption of gonadal maturation in cultured Senegalese sole Solea senegalensis Kaup by continuous light and/or constant temperature regimes, Aquaculture, 261, 789–98. goto r, mori t, kawamata k, matsubara t, mizuno s, adachi s, yamauchi k (1999) Effects of temperature on gonadal sex determination in barfin flounder Verasper moseri, Fish Sci, 65, 884–7. goto r, kayaba t, adachi s, yamauchi k (2000) Effects of temperature on sex determination in marbled sole Limanda yokohamae, Fish Sci, 66, 400–2. goto-kazeto r, abe y, masai k, yamaha e, goto-kazeto r, abe y, masai k, yamaha e, adachi s, yamauchi k (2006) Temperature-dependent sex differentiation in


161

goldfish: Establishing the temperature-sensitive period and effect of constant and fluctuating water temperatures, Aquaculture, 254, 617–24. he m, lin y, shen q, hu j, jiang w (2001) Production of aneuploid Pinctada martensii Dunker in tetraploid, Mar Sci Bull, 3, 63–8. he m, jiang w, huang l (2004) Studies on aneuploid pearl oyster (Pinctada martensii Dunker) produced by crossing triploid females and a diploid male following the inhibition of PB1, Aquaculture, 230, 117–24. hendry c i, martin-robichaud d j, benfey t j (2003) Hormonal sex reversal of Atlantic halibut (Hippoglossus hippoglossus), Aquaculture, 219, 769– 81. hughes v, benfey t j, martin-robichaud d j (2008) Effect of rearing temperature on sex ratio in juvenile Atlantic halibut, Hippoglossus hippoglossus, Env Biol Fish, 81, 415–19. hyndman c a, kieffer j d, benfey t j (2003) Physiology and survival of triploid brook trout following exhaustive exercise in warm water, Aquaculture, 221, 629–43. ihssen p e, mckay l r, mcmillan i, phillips r b (1990) Ploidy manipulation and gynogenesis in fishes: cytogenetic and fisheries applications, Trans Am Fish Soc, 119, 698–717. imsland a k, jonassen t m (2005) The relation between age at first maturity and growth in Atlantic halibut (Hippoglossus hippoglossus) reared at four different light regimes, Aquac Res, 36, 1–7. johnstone r (1993) Maturity control in Atlantic salmon, in Muir J F and Roberts R J (eds), Recent Advances in Aquaculture IV, Oxford, Blackwell Scientific, 99–105. johnstone r (2005) An overview of methods of control of maturation in salmonids, in Wild and Farmed Salmon – Working Together, Edinburgh, North Atlantic Salmon Conservation Organization, 32–6. johnstone r, knott r m, macdonald a g, walsingham m v (1989) Triploidy induction in recently fertilized Atlantic salmon ova using anaesthetics, Aquaculture, 78, 229–36. johnstone r, mclay h a, walsingham m v (1991) Production and performance of triploid Atlantic salmon in Scotland, Can Tech Rep Fish Aquat Sci, 1789, 15–36. komen h, thorgaard g h (2007) Androgenesis, gynogenesis and the production of clones in fishes: A review, Aquaculture, 269, 150–73. leitão a, boudry p, mccombie h, gérard a, thiriot-quiévreux c (2001a), Experimental evidence for a genetic basis to differences in aneuploidy in the Pacific oyster (Crassostrea gigas), Aquat Living Resour, 14, 233–7. leitão a, boudry p, thiriot-quiévreux c (2001b) Evidence of differential chromosome loss in aneuploid karyotypes of the Pacific oyster, Crassostrea gigas, Genome, 44, 735–7. lincoln r f, scott a p (1984) Sexual maturation in triploid rainbow trout, Salmo gairdneri Richardson, J Fish Biol, 25, 385–92. luckenbach j a, godwin j, daniels h v, borski r j (2003) Gonadal differentiation and effects of temperature on sex determination in southern flounder (Paralichthys lethostigma), Aquaculture, 216, 315–27. maclean n, laight r j (2000) Transgenic fish: An evaluation of benefits and risks, Fish Fish, 1, 146–72. martin-robichaud d j, peterson r h, benfey t j, crim l w (1994) Direct feminization of lumpfish (Cyclopterus lumpus L.) using 17ß-oestradiol-enriched Artemia as food, Aquaculture, 123, 137–51. maxime v (2008) The physiology of triploid fish: current knowledge and comparisons with diploid fish, Fish Fish, 9, 67–78.

162


mccombie h, lapègue s, cornette f, ledu c, boudry p (2005) Chromosome loss in bi-parental progenies of tetraploid Pacific oyster Crassostrea gigas, Aquaculture, 247, 97–105. myers j m, hershberger w k (1991) Early growth and survival of heat-shocked and tetraploid-derived triploid rainbow trout (Oncorhynchus mykiss), Aquaculture, 96, 97–107. nam y k, kim d s (2004) Ploidy status of progeny from the crosses between tetraploid males and diploid females in mud loach (Misgurnus mizolepis), Aquaculture, 236, 575–82. nrc committee on biological confinement of genetically engineered organisms (2004), Biological Confinement of Genetically Engineered Organisms, Washington, DC, National Academies Press. o’flynn f m, mcgeachy s a, friars g w, benfey t j, bailey j k (1997) Comparisons of cultured triploid and diploid Atlantic salmon (Salmo salar L.), ICES J Mar Sci, 54, 1160–5. ojolick e j, cusack r, benfey t j, kerr s r (1995) Survival and growth of all-female diploid and triploid rainbow trout (Oncorhynchus mykiss) reared at chronic high temperature, Aquaculture, 131, 177–87. pandian t j, kirankumar s (2003) Recent advances in hormonal induction of sexreversal in fish, J Appl Aquac, 13, 205–30. pandian t j, koteeswaran r (1998) Ploidy induction and sex control in fish, Hydrobiologia, 384, 167–243. peterson r h, harmon p r (2005) Changes in condition factor and gonadosomatic index in maturing and non-maturing Atlantic salmon (Salmo salar L.) in Bay of Fundy sea cages, and the effectiveness of photoperiod manipulation in reducing early maturation, Aquact Res, 36, 882–9. piferrer f (2001) Endocrine sex control strategies for the feminisation of teleost fish, Aquaculture, 197, 229–81. poss k d, nechiporuk a, stringer k f, lee c, keating m t (2004) Germ cell aneuploidy in zebrafish with mutations in the mitotic checkpoint gene mps1, Genes Develop, 18, 1527–32. purdom c e (1984) Atypical modes of reproduction in fish, in Clarke J R (ed.), Oxford Reviews of Reproductive Biology, Oxford, Oxford University Press, 303–40. refstie t (1981) Tetraploid rainbow trout produced by cytochalasin B, Aquaculture, 25, 51–8. refstie t, vassvik v, gjedrem t (1977) Induction of polyploidy in salmonids by cytochalasin B, Aquaculture, 10, 65–74. rodriguez l, begtashi i, zanuy s, carrillo m (2005) Long-term exposure to continuous light inhibits precocity in European male sea bass (Dicentrarchus labrax L.): hormonal aspects, Gen Comp Endocrinol, 140, 116–25. sakao s, fujimoto t, tanaka m, yamaha e, arai k (2003) Aberrant and arrested embryos from masu salmon eggs treated for tetraploidization by inhibition of the first cleavage, Nipp Suis Gakk, 69, 738–48. sakao s, fujimoto t, kimura s, yamaha e, arai k (2006) Drastic mortality in tetraploid induction results from the elevation of ploidy in masu salmon, Oncorhynchus masou, Aquaculture, 252, 147–60. schafhauser-smith d, benfey t j (2001) The reproductive physiology of three age classes of adult female diploid and triploid brook trout (Salvelinus fontinalis), Fish Physiol Biochem, 25, 319–33. schafhauser-smith d, benfey t j (2003a) In vitro steroid production by triploid ovarian follicles, Gen Comp Endocrinol, 133, 279–86.


163

schafhauser-smith d, benfey t j (2003b) The effects of long-term estradiol-17β treatment on the growth and physiology of triploid brook trout (Salvelinus fontinalis), Gen Comp Endocrinol, 131, 9–20. shelton c j, macdonald a g, johnstone r (1986) Induction of triploidy in rainbow trout using nitrous oxide, Aquaculture, 58, 155–9. silverstein j t, shimma h (1994) Effect of restricted feeding on early maturation in female and male amago salmon, Oncorhynchus masou ishikawae, J Fish Biol, 45, 1133–5. smith l t, lemoine h l (1979) Colchicine-induced polyploidy in brook trout, Prog Fish-Cult, 41, 86–8. solar i i, hajen w e, donaldson e m (1992) A bibliography of tetraploidy in fish (1964–1991), Can Tech Rep Fish Aquat Sci, 1901, 1–22. tessema m, muller-belecke a, horstgen-schwark g (2006) Effect of rearing temperatures on the sex ratios of Oreochromis niloticus populations, Aquaculture, 258, 270–7. thiriot-quiévreux c, pogson g h, zouros e (1992) Genetics of growth rate variation in bivalves: aneuploidy and heterozygosity effects in a Crassostrea gigas family, Genome, 35, 39–45. tvedt h b, benfey t j, martin-robichaud d j, mcgowan c, reith m (2006) Gynogenesis and sex determination in Atlantic halibut (Hippoglossus hippoglossus), Aquaculture, 252, 573–83. ueda t, kobayashi m, sato r (1986) Triploid rainbow trouts induced by polyethylene glycol, Proc Jap Acad Ser B, 62, 161–4. ueda t, sawada m, kobayashi j (1987) Cytogenetical characteristics of the embryos between diploid female and triploid male in rainbow trout, Jap J Genet, 62, 461–5. ueda t, sato r, kobayashi j (1988) Triploid rainbow trout induced by high-pH-highcalcium, Nipp Suis Gakk, 54, 2045. unwin m j, rowe d k, poortenaar c w, boustead n c (2005) Suppression of maturation in 2-year-old Chinook salmon (Oncorhynchus tshawytscha) reared under continuous photoperiod, Aquaculture, 246, 239–50. vrijenhoek r c (1994) Unisexual fish: model systems for studying ecology and evolution, Ann Rev Ecol Syst, 25, 71–96. wang z, guo x, allen jr s k, wang r (1999) Aneuploid Pacific oyster (Crassostrea gigas Thunberg) as incidentals from triploid production, Aquaculture, 173, 347–57. wong a c, van eenennaam a l (2008) Transgenic approaches for the reproductive containment of genetically engineered fish, Aquaculture, 275, 1–12. yamaki m, arai k (2000) Ploidies of gametes produced by putative tetraploid amago salmon induced by inhibition of the first cleavage, Bull Fac Fish Hokkaido Univ, 51(3), 135–52. yamaki m, satou h, taniura k, arai k (1999) Progeny of the diploid-tetraploid mosaic amago salmon, Nipp Suis Gakk, 65, 1084–9. yamamoto e (1999) Studies on sex-manipulation and production of cloned populations in hirame, Paralichthys olivaceus (Temminck et Schlegel), Aquaculture, 173, 235–46. zhang x, onozato h (2004a) Hydrostatic pressure treatment during the first mitosis does not suppress the first cleavage but the second one, Aquaculture, 240, 101–13. zhang x, onozato h (2004b) Allo-eudiploidy of the diploid cells in diploid-tetraploid mosaic hybrids between female rainbow trout Oncorhynchus mykiss and male amago salmon O. rhodurus, Fish Sci, 70, 924–6.

164


zhang x, mutsukawa k, onozato h (2005) Correlation between delay in the earlier cleavage stage and the tetraploidization rate in rainbow trout Oncorhynchus mykiss embryos treated with heat or hydrostatic pressure shock during the first cell cycle, Fish Sci, 71, 239–41. zou s, li s, cai w, zhao j, yang h (2004) Establishment of fertile tetraploid population of blunt snout bream (Megalobrama amblycephala), Aquaculture, 238, 155–64. zouros e, thiriot-quiévreux c, kotoulas g (1996) The negative correlation between somatic aneuploidy and growth in the oyster Crassostrea gigas and implications for the effects of induced polyploidization, Gen Res, 68, 109–16.

6 Chromosome set manipulation in shellfish X. Guo, Y. Wang, Z. Xu, Rutgers University, USA, and H. Yang, Louisiana State University Agriculture Center, USA

Abstract: Chromosome set manipulation may produce phenotypic changes that are useful in aquaculture. Chromosome set manipulation in shellfish has led to the production of polyploid, gynogenetic and aneuploid animals. While studies on gynogenetic and aneuploid shellfish have been largely academic, research on polyploids has made significant contributions to shellfish aquaculture. Triploids have been produced and evaluated in many species. Triploid shellfish grow significantly faster than diploids in most species studied so far. Their sterility often results in improved meat quality and provides biological containment of cultured stocks. Triploids have become an important part of the oyster farming industry and may have similar potential in other shellfish. Tetraploids have been successfully produced and used for triploid production in oysters. Tetraploid induction in other species remains a major challenge that hinders commercial production of triploids. Key words: triploidy, tetraploidy, gynogenesis, sterility, shellfish, genome adaptation.

6.1 Introduction Shellfish are major aquaculture species. Shellfish species account for more than one third of the world total aquaculture production (FAO, 2007). Common aquaculture species include oysters, clams, scallops, mussels, abalone, shrimp, crawfish and crabs. They support major aquaculture industries in many countries. Various efforts have been made to genetically improve the performance of cultured shellfish. Selective breeding has been used to produce superior strains (see Chapter 3). Increasingly, biotechnical approaches are being applied to the genetic improvement of shellfish stocks (Guo, 2004).

166


Chromosome set manipulation can be used to create new chromosome constructs that are potentially useful for aquaculture. Most animals including shellfish possess two sets of chromosomes with one set from the mother and the other from the father, a condition known as diploidy. We can alter the normal process of chromosome inheritance and create a range of variations in chromosome number and composition. Variations in chromosome number may involve partial or complete sets of chromosomes. The condition where a cell or organism has incomplete sets of chromosomes is referred to as aneuploidy, and the condition of having complete sets of chromosomes is called euploidy. Euploid conditions include normal diploidy with two sets of chromosomes, as well as haploidy with one and polyploidy with three or more sets of chromosomes. Triploidy and tetraploidy are common polyploid conditions with three and four sets of chromosomes, respectively. In addition to changes in chromosome number, the parental origin of chromosomes can also be changed. Uniparental inheritance can be obtained by excluding chromosomes from one of the parents. Uniparental inheritance based on maternal and paternal chromosomes is referred to as gynogenesis and androgenesis, respectively. The diploid chromosome complement of an organism represents rigid genome organization derived from millions of years of evolution and adaptation. Chromosome number within species or genera is usually conserved. For example, all oysters have a diploid number of 20 chromosomes, and most clams and scallops have a diploid number of 38 (Thiriot-Quiévreux, 2002; Wang and Guo, 2004; Wang et al., 2004). Changes in chromosome number are serious mutations that may have profound consequences. Chromosome mutations can be lethal or result in significant changes in phenotype, but some changes in phenotype can be beneficial for aquaculture. Triploid shellfish, for example, may be sterile and grow faster than normal diploids (Nell, 2002; Guo, 2004). Gynogenesis and androgenesis can potentially be used for the rapid production of inbred lines and for sex control. Because of these and other potential benefits, chromosome set manipulation has been investigated in many shellfish species. This chapter introduces basic principles and methods of chromosome set manipulation, examines available data and provides perspectives for future research and development.

6.2 Principles and methods of chromosome set manipulation 6.2.1 Reproduction in shellfish Most shellfish species are dioecious and reproduce sexually. Sexual dimorphism is evident in most crustaceans and some molluscs. In crustaceans and gastropods, sexual dimorphism is often expressed as differences in sexual

Chromosome set manipulation in shellfish

167

organs and body size (Landau, 1992). In bivalve molluscs such as scallops and clams, female and male gonads may exhibit different colours. In the Chinese scallop Chlamys farreri, Japanese scallop Patinopecten yessoensis, Atlantic sea scallop Placopecten magellanicus, and dwarf surfclam Mulinia lateralis, female gonads are usually orange to red, while male gonads are milky white, and this ability to identify sex is advantageous in chromosome set manipulation because early and accurate separation of sexes can reduce the chance of uncontrolled fertilization or contamination. Most shellfish have exceptionally high fecundity. A two-year old female Pacific oyster Crassostrea gigas may produce 20–50 million eggs. Spawning in molluscan shellfish can be induced by thermal stimulation, feeding, ultraviolet (UV)-treated seawater and serotonin (Landau, 1992; Guo et al., 1999). During spawning, female and male shellfish release their gametes into surrounding water and fertilization takes place outside the body cavity, although there are some exceptions. Most crustaceans go through copulation, and males deposit spermatophores into females (Landau, 1992) and in this case fertilization occurs when the females release their eggs. Some molluscs such as Argopecten scallops and Ostrea oysters are hermaphrodites, although they may avoid self-fertilization by releasing sperm and eggs at different times. When released, eggs of most shellfish are resting at the prophase or metaphase of meiosis I (Gilbert, 1988). Fertilization triggers the resumption of meiosis I and II, which release polar body I (PB1) and II (PB2), respectively. Fertilized eggs go through rapid development and, depending on the temperature, develop into swimming larvae within 10–24 h. Most shellfish have a long planktonic larval stage (several weeks), during which larvae can disperse over long distances. Shellfish larvae usually go through some form of metamorphosis at the end of the larval period. High fecundity, external fertilization and free-living larvae make most shellfish good candidates for chromosome set manipulation, although some species such as crabs, freshwater shrimp and Ostrea oysters brood their eggs, making chromosome set manipulation more challenging.

6.2.2 Principles and approaches The objective of chromosome set manipulation is to create new chromosome combinations by altering the normal process of fertilization, meiosis, mitosis and zygote formation. Many types of manipulation are possible in shellfish. Unlike fish eggs that usually complete meiosis I before maturation, shellfish eggs rest at the metaphase of meiosis I (Gilbert, 1988), making both meiosis I and II accessible to manipulation. Meiosis I, II or both can be inhibited, causing the retention of polar bodies and therefore extra chromosome sets. The first mitosis of the zygote can be blocked, which may result in chromosome doubling, and gamete chromosomes from one of the sexes can be inactivated to produce uniparental inheritance which is called

168


gynogenesis or androgenesis. The many types of manipulation and their combinations can produce a variety of new chromosome variants, although not all of them are viable or useful for aquaculture. Haploids, for example, can be easily created by gynogenesis, but they are not viable and of no practical benefit. Haploid embryos, however, are useful for certain genetic analysis. For shellfish genetics and breeding, the most relevant chromosome constructs are triploids, tetraploids, gynogenetic diploids and aneuploids. We will examine how these variants are created. The principles of chromosome set manipulation are illustrated in Fig. 6.1. Triploidy is produced by blocking meiosis II in normally fertilized zygotes. Blocking meiosis II retains PB2 which contains one set of chromosomes. During normal development, PB2 is released, leaving the egg with one set of maternal chromosomes. The maternal set of chromosomes unites with the paternal set from the sperm and forms a diploid zygote (Fig. 6.1). The retention of PB2 adds an extra set of maternal chromosomes to the diploid zygote, producing triploidy. Meiosis II blocking is widely used for the production of triploids in fish and shellfish species (Thorgaard, 1983; Beaumont and Fairbrother, 1991). The same process that produces triploids in normally fertilized eggs produces meiotic gynodiploids in gynogenetically activated eggs when sperm chromosomes are inactivated (Fig. 6.1). Inhibition of mitosis I leads to the doubling of chromosomes and formation of tetraploids in normally fertilized eggs or mitotic gynodiploids in gynogenetically activated eggs (Fig. 6.1). Mitotic gynodiploids, also known as double-haploids, are completely homozygous at all loci and particularly useful for the creation of inbred lines and genetic mapping (Thorgaard, 1983; Young et al., 1998). Tetraploids can also be created by blocking meiosis I and II in gynogenetically activated eggs (Fig. 6.1). Blocking meiosis I and II in normally fertilized eggs produces pentaploids (Fig. 6.1), which die before reaching D-stage (Cooper and Guo, 1989). While it is easy to understand that blocking meiosis II in normal zygotes produces triploidy (Fig. 6.1), blocking meiosis I is more complex. Blocking meiosis I was initially considered as a method for triploid induction. In the eastern oyster Crassostrea virginica, blocking meiosis I produced triploids as detected at adult stages (Stanley et al., 1981, 1984). In the Pacific oyster, however, meiosis I blocking resulted in predominantly tetraploids as detected at early embryonic stages by flow cytometry (Stephens, 1989). Chromosome counting of resultant embryos, however, revealed that blocking meiosis I produced not only triploids and tetraploids, but also high percentages of aneuploids (Guo et al., 1992a). Segregation analysis showed that blocking meiosis I significantly altered chromosome segregation during meiosis II (Guo et al., 1992b). It led to abnormal tripolar segregations in the majority of treated eggs and the formation of aneuploids (Fig. 6.2). Some studies have reported high percentages of triploids from meiosis I blocking as detected at adult stages (Stanley et al., 1984; Yang and Guo, 2006a), probably because most aneuploids are not viable and only triploids

Chromosome set manipulation in shellfish Normal fertilization

10

Gynogenesis

10

M1

M1

10

UV treated sperm

10 10

10 10 10

Blocking M1&2

PB1 M2 10

Blocking M1&2

Blocking M1 only

10

20

PB1

Abnormal segregation Aneuploids

20

10 M2

10

20 20

20 20

10 10 10

10

10 10

Blocking M2

Blocking M2 PB1

PB2

PB1

PB2

10 10

40

10

10

10

50

20

10 40

10

40

10

50

Pentaploid

20

30

40

20

Diploid

Tetraploid

Triploid

10

10

20

Blocking mitosis

Blocking mitosis

50

169

30

30

Triploid

Aneuploid

40

40

Tetraploid

10

10

Haploid

20

20

20

Meiotic Mitotic gynodiploid gynodiploid 100 % inbred Sex control

Fig. 6.1 Schematic presentation of chromosome set manipulation in shellfish. Left: in normal zygotes, blocking meiosis I (M1) and II (M2) produces pentaploids, blocking M2 produces triploids, blocking mitosis I produces tetraploids, and blocking M1 produces abnormal segregation and aneuploids. Right: in gynogenetically activated eggs, blocking M1 and M2 produces tetraploids, blocking M2 produces meiotic gynodiploids, and blocking mitosis I produces mitotic gynodiploids. Bottom: crossing diploids and tetraploids produces triploids, and crossing diploids and triploids produces aneuploids.

can survive. Because of the production of aneuploids and reduced survival, blocking meiosis I is no longer considered a good approach for triploid production. On the other hand, triploids produced from meiosis I blocking may grow faster than meiosis II triploids (Stanley et al., 1984; Beaumont and Kelly, 1989; Hawkins et al., 1994), and blocking meiosis I may produce some tetraploids (Yang et al., 2000b), which are desired for triploid production.

170


10

MI

10 Blocking polar body I with cytochalasin B A

B 10 10

10 10

10

10

D

10

E

10 10 10

10 10

5

10 10

C

10 10

10 10

10

10

PB1 MII

7

20

7 10

10

10 10

20 20

10

10

= 20

PB2 10

10

5

6

10

10

10

2n Normal segregation

3n United bipolar

100 %

7%

10

13

13

14 13

15 15

10 10 10 10

10

10

10

= 13 14 13 10

= 10 15 15 10

3.7n/2.4n Randomized tripolar 68 %

4n/2.5n Unmixed tripolar

= 10/20 10/0 15 15 10

4n/3n/2n Separated bipolar 12 %

Fig. 6.2 Blocking meiosis I produces abnormal tripolar segregations of chromosomes during meiosis II and a wide range of aneuploids (from Guo et al., 1992b).

Once produced, tetraploids can be crossed with normal diploids to produce 100 % triploids, and triploids can be crossed with diploids to create aneuploids (Fig. 6.1). Gynogenetic diploids may be used to create inbred lines and monosex populations.

6.2.3 Methods for inhibiting meiosis and mitosis Meiotic and mitotic divisions can be blocked by a number of chemical and physical treatments. Cell division depends on the assembly of microtubules


171

and microfilaments, and any agent that affects their synthesis and function can potentially block cytokinesis. In general, inhibiting meiosis is easier than blocking the first mitotic division, because the latter involves the complete cleavage of eggs. Several treatments have been tested for meiosis and mitosis inhibition in shellfish, showing varying degrees of effectiveness. These include heat shock, cold shock, pressure shock, cytochalasin B (CB), 6-dimethylaminopurine (6DMAP), caffeine, colchicine and nocodazole (Beaumont and Fairbrother, 1991; Guo, 1991; Guo et al., 1994; Scarpa et al., 1994; Dunstan et al., 2007). Among physical treatments, heat shock appears to be the most effective. In blue mussel Mytilus edulis, for example, a 10 min heat shock of 32 ºC applied at 20 min post-fertilization produced 97.4 % triploids (Yamamoto and Sugawara, 1988). In the dwarf surfclam Mulinia lateralis, a 35 ºC heat shock targeting meiosis I produced 82.5–98.5 % triploids at juvenile stages (Yang and Guo, 2006a). Heat shock is also effective in shrimp. Up to 100 % triploidy has been induced using heat shock in the Chinese shrimp Penaeus chinensis (Li et al., 2003b; Xiang et al., 2006). Cold shock and pressure shock have been tested in several shellfish species (Arai et al., 1986; Yamamoto and Sugawara, 1988; Guo, 1991; Liang et al., 1994; Yang and Guo, 2006b), but they are not as effective as heat shock. Among chemical treatments, CB and 6DMAP are clearly more effective than others. CB is a specific and reversible inhibitor of microfilaments, which are required for the formation of division furrow during cytokinesis. CB does not affect chromosome movement which is controlled by microtubules (Longo, 1972; Guo et al., 1992b). CB is probably the most frequently tested and used chemical for chromosome set manipulation in molluscan shellfish. It is highly effective in blocking meioses but less so in blocking mitosis I. CB can produce 70–100 % triploids by blocking meiosis II if treatments are applied correctly (Downing and Allen, 1987; Guo and Allen, 1994b). The effective dosage for CB ranges from 0.1 to 1.0 mg/l and, since CB is not water soluble, the stock solution is made by dissolving it in dimethylsulfoxide (DMSO) at 1 mg/ml. For triploid induction, the success rate depends on how synchronized the egg development is and how precisely the treatment is applied to target meiosis II. Typically, a 10–20 min treatment with 0.5 mg/l CB, applied when 60 % of the eggs release PB1 or as soon as PB2 is observed, gives good results. While CB works well in molluscs, it is not very effective in crustaceans and finfish, probably because eggs of crustaceans and finfish have a chitinous shell, which cannot be easily penetrated by CB. While CB is effective, it is also highly toxic and poses health risks for people who handle it. Double nitrile gloves should be used when working with CB. In the USA, the FDA has banned the use of CB in commercial shellfish hatcheries. Alternatively, 6DMAP can be used for triploid induction (Desrosiers et al., 1993) as it is water soluble and less toxic than CB. It is a kinase inhibitor, probably targeting enzymes required for cytokinesis.

172


High percentages (>80 %) of triploids have been produced using 6DMAP in several species including Mytilus edulis (Brake et al., 2004), Haliotis rubra (Liu et al., 2004), Haliotis laevigata (Dunstan et al., 2007) and Penaeus japonicas (Sellars et al., 2006b; Coman et al., 2008). The effective dosage of 6DMAP ranges from 75–400 μM. A direct comparison finds that CB treatment results in higher percentages of triploids and lower mortality than 6DMAP (Nell et al., 1996). In another study, heat shock was highly effective in blocking mitosis I and producing tetraploidy (up to 98 %), while 6DMAP failed (Sellars et al., 2006a). It appears that 6DMAP is almost as effective as CB in blocking meiosis II, but not in inhibiting meiosis I and mitosis I. The results for caffeine are variable. In Mytilus galloprovincialis, caffeine treatments targeting meiosis II produced only 4.7–7.5 % triploids (Scarpa et al., 1993), while in Haliotis discus hannai it produced 91–100 % triploids by blocking meiosis I (Okumura et al., 2007). It is unknown if caffeine affects meiosis I and II differently, or whether the discrepancy is due to inherent inconsistence of the treatment. Further evaluation is needed.

6.2.4 Inactivation of gamete chromosomes Gynogenesis and androgenesis require the inactivation of gamete chromosomes. Gamete chromosomes can be inactivated with several methods including UV irradiation, X-ray, γ-ray and chemicals such as toluidine blue (Thorgaard, 1983; Guo, 1991). UV irradiation is an effective and popular method for inactivating sperm chromosomes. UV light has weak penetrating power, and sperm samples should be treated in a thin layer (1 mm). The dosage of UV varies greatly among studies and may be influenced by the age of the lamp, temperature and sperm concentration. It should be empirically determined for each species and experiment. As examples, sperm chromosomes have been successfully inactivated by a 5–6 min treatment at 1080 μW/cm2/s in C. gigas (Guo et al., 1993), 2 min treatment at 620 μW/cm2/s in Mytilus galloprovincialis (Scarpa et al., 1994) and 1.5 min treatment at 1400 μW/cm2/s in Mulinia lateralis (Guo and Allen, 1994b). Toluidine blue (5 μM for 29 min) can also inactivate sperm chromosomes of C. gigas, but the treatment is sensitive to light and often produces inconsistent results (Guo, 1991). In fish, X-ray or γ-ray is commonly used for the inactivation of egg chromosomes (Thorgaard, 1983) but, because shellfish eggs are small, their chromosomes can be inactivated with UV irradiation (Li et al., 2004).

6.2.5 Identification of polyploids and uniparental inheritance A key component of chromosome set manipulation is the identification or confirmation of new chromosome variants. Positive identification is


173

essential for evaluating induction success and the performance of induced polyploids and aneuploids. Polyploids can be identified by chromosome counting, nucleus size and flow cytometry (FCM) analysis of DNA content. Chromosome counting is direct, accurate, but also labour intensive (Guo et al., 1992a). Nucleus size has also been used to identify polyploids in a few studies (Komaru et al., 1988; Utting and Child, 1994). FCM is probably the fastest and most reliable method for the identification of polyploids (Allen, 1983; Guo et al., 1996). It can accurately identify hundreds of samples in a day. However, FCM cannot detect small variations in DNA content or identify aneuploids. The identification of aneuploids requires chromosome counting. The success of inhibiting meiosis I or II can be verified with fluorescence staining of polar bodies and nuclei (Scarpa et al., 1994). Briefly, eggs are fixed in ethanol or formalin. Drops of embryos are placed on a slide and stained for 3–10 min with a fluorescence dye such as 4,6-diamidine-2phenylindole (DAPI). A coverglass is applied to the slide and gently pressed to flatten the eggs and remove excess stain. Segregation patterns and the presence of polar bodies can then be observed under an epifluorescence microscope. A fluorescence-stained egg is shown in Fig. 6.3A. Chromosome counting is easier with early embryos than with adults. Embryonic cells are actively dividing and provide abundant metaphases for analysis. With embryos, metaphases can be prepared using the squashing and orcein-staining method (Guo et al., 1992b). Since the orcein-staining method does not break cells, metaphases can be counted with confidence. More than one metaphase can be counted in most embryos (Fig. 6.3B). For adult shellfish, gill or gonad is often used for chromosome preparation. Animals are treated with colchicine (0.005 % for 4–8 h) to stop cells at metaphase (Guo et al., 2007). Tissues are dissected and treated with a hypotonic solution (0.075 M KCl) for 10–20 min before fixation in Carnoy’s fixative (3 : 1 of methanol : acetic acid). Metaphase spreads are made by airdrying and stained with Leishman’s stain. The air-drying and Leishmanstaining method produces high-quality metaphases with no or little background (Fig. 6.3C). However, the air-drying method may disrupt metaphases and create artificial chromosome loss. Care should be taken during screening, and only metaphases showing no obvious signs of chromosome loss are counted. For FCM, fresh tissue gives the best results. Fresh tissues can be frozen in the staining buffer that contains 10 % DMSO (Allen, 1983; Guo et al., 1996). When working with fresh samples is not possible, tissues can be fixed in ethanol (Yang et al., 2000a). Because FCM measures relative DNA content and fluorescence signals can vary considerably, it is important that diploids are always used as reference (Fig. 6.3D), and reference samples should be prepared in the same way as test samples. Success in gynogenesis and androgenesis must be genetically verified. Cross-contamination of experimental groups by normal gametes or larvae

174


A

C

B

1200 count

D

2

1000 800 600 1

400 200

3 0 0

50

100

150

200

250

300

Fig. 6.3 Cytogenetic techniques used for the verification of chromosome set manipulation in shellfish: A, a fluorescence-stained egg of C. gigas showing only polar body I after treatment; B, a triploid embryo of C. virginica showing two triploid metaphases (3n = 30) and PB1 only; C, two metaphases of C. virginica showing trisomy (2n + 1) with 21 chromosomes; and D, flow cytometry analysis of a triploid oyster (peak 2) using a diploid as reference (peak 1).

is common, especially when the survival of gynogenetic or androgenetic animals is low. Uniparental inheritance can be confirmed with the use of multiple codominant markers such as allozymes or microsatellites (Guo and Gaffney, 1993).

6.3 Triploid shellfish Triploid shellfish were first reported in the eastern oyster by Stanley et al. (1981). Since then, triploids have been induced in dozens of shellfish species. However, many studies are limited to reporting induction success and larval survival, and adult performance of triploid shellfish is not well documented in most species. Triploid shellfish can be produced with three methods: inhibiting meiosis II, inhibiting meiosis I and crossing diploids and tetraploids, and the three


175

types of triploids may differ considerably in performance. So far, most of the performance data have been collected from triploids produced by inhibiting meiosis but, as we will see, natural triploids produced from tetraploids greatly out-perform induced triploids. Therefore, data from induced triploids may grossly underestimate the full potential of triploid shellfish.

6.3.1 Larval performance It is well documented that triploid induction reduces larval survival. Treated larvae often experience heavy mortality. For example, in Mulinia lateralis, the relative survival (with diploids as 100 %) of treated larvae to day 8 is 55.3 % (Guo and Allen, 1994b) and in C. gigas, the relative survival of treated larvae to day 2 ranges from 16.8–57.8 % depending on treatment temperature (Downing and Allen, 1987). In another study on the same species, the relative survival of the treated larvae to day 1 is 5.3 % (Guo et al., 1996), while that of natural triploids is 79.1 %. The difference in survival between natural triploids and diploids is not significant. Clearly, the reduced survival is not an inherent problem of triploidy, but is caused by induction treatments or genetic defects associated with induced triploids. Retention of PB2 may be deleterious because of homozygosity or imprinting. The larval growth of induced triploids is either faster or about the same as diploids (Downing and Allen, 1987; Guo et al., 1996). Larval growth is sensitive to culture density. As induced triploids experience high mortality, they may enjoy low culture density compared with diploid controls. Therefore, larval growth of induced triploids should be viewed with caution, unless equal densities are strictly maintained. There is no question, however, that in C. gigas, larvae of natural triploids grow significantly faster than normal diploids from day 1 (Guo et al., 1996). When reaching the eyedstage, diploid larvae are usually 250–260 μm in size, while natural triploid larvae are about 280–300 μm (Guo, unpublished).

6.3.2 Growth Post-larval growth of triploids has been evaluated in over 20 shellfish species and, in most of the species studied so far, triploids grow significantly faster than diploid controls (Table 6.1). The superior growth of triploids is most pronounced in oysters and, in fact, triploid oysters have shown superior growth in all species and studies reported to date. In early studies where triploids were produced by inhibiting meiosis I or II, triploids typically grew 10–40 % faster than diploids (Stanley et al., 1984; Allen and Downing, 1986; Barber and Mann, 1991; Maguire et al., 1995). In Saccostrea glomerata, triploids’ advantage in growth is remarkable and consistent, with four studies reporting 36–74 % growth increases in triploids, averaging 53 % (Nell et al., 1994; Hand et al., 1999, 2004; Troup et al., 2005). In C. virginica and Ostrea edulis, meiosis I triploids grow significantly faster than diploids, while

Scallop Argopecten irradians Argopecten ventricosus Chlamys farreri

Crassostrea madrasensis Crassostrea talienwhanensis Ostrea edulis Saccostrea glomerata

Crassostrea gigas

Oyster Crassostrea virginica

Species

CB, 0.05–0.10 mg/L CB, 0.5 mg/L CB, 0.5–0.9 mg/L

CB, 0.5 mg/L CB, 0.5 mg/L CB, 1.0 mg/L 4n 4n CB, 1.0 mg/L CB or 6DMAP CB, 0.5 mg/L CB, 1.0 mg/L CB, 0.5 mg/L; 4n 4n 4n 6DMAP, 100 μM Cold: 2–8 ºC CB, 1.0 mg/L CB, 0.5 mg/L CB, 1.25 mg/L CB, 1.0 mg/L CB, 1.25 mg/L

Method1

66–94 8–58 18

61–72 96 85 100 100 71–96 86 76 84 82–100 100 99–100 na 43–70 na 85 73–93 75–79 na

%3N

36, 73 (muscle) 55, 161 (muscle)3 5, 44 (muscle)

12–41 30 67 82–192 91–109 28 40 20–23 80–150 14; 26 25–51 159 128–2603 52 (length) 61 (PB1); −8 (PB2) 41 36–57 74 49

% increase2

1 1 1.2

3 2 1.4 1.3 1.5 1.5 0.8 2.3–3.2 1.5–2 1 0.8 1 1 1 1.25 2.5 2 1.3 3.2

Age (y)

Tabarini, 1984 Ruiz-Verdugo et al., 2000 Yang et al., 2000b

Stanley et al., 1984 Barber and Mann, 1991 Matthiessen and Davis, 1992 Guo et al., 2008 Allen, pers comm Allen and Downing, 1986 Garnier-Gere et al., 2002 Maguire et al., 1995 Akashige and Fushimi, 1992 Wang et al., 2002 Guo et al., 1996 Nell and Perkins, 2005 Mallia et al., 2006 Liang et al., 1994 Hawkins et al., 1994 Nell et al., 1994 Hand et al., 1999 Hand et al., 2004 Troup et al., 2005

Source

Table 6.1 Induction and post-larval growth of triploid shellfish, with growth measured as percent increase in body size (whole body weight unless otherwise noted) of triploids over diploid controls

Shrimp Fenneropenaeus chinensis Penaeus japonicus

3

2

43–100 73–93

28 Smaller

13–34 30 (tissue) −17 (length)

18–44

23–30 30–54 83 92

34, 63 (tissue) Larger (PB1)

8 0 72 −15 0 (length) 0 0 0

18, 42 (muscle) 40, 67 (muscle) −11, 13 (muscle)

83 26–67

30 62–100 21–100 44 56–85 35 50–80 70–77

75 44–90 48–95

0.5 0.5–1

0.33 3 0.5

2

1.9 0.1

4 1.5 0.3 1 0.06 1 1–3 0.25

1.2 1 1.8

Induction method: CB = cytochalasin B; 6DMAP = 6-dimethyaminopurine; 4n, tetraploid crossing with diploid. Percent increase: PB1 = blocking the release of polar body I; PB2 = blocking the release of PB2. Triploids are not verified.

Heat: 29–32 ºC 6DMAP, 150 μM

Abalone Haliotis discus hannai Haliotis laevigata Haliotis rubra

1

6DMAP, 75–150 μM 6DMAP, 100 μM CB, 0.5 mg/L

Pinctada martensii

CB, 1.0 mg/L CB, 1.0 mg/L CB, 0.5 mg/L CB, 1.0 mg/L CB, 1.0 mg/L CB, 0.5 mg/L CB CB, 0.5 mg/L

CB, 0.5 mg/L CB, 0.5 mg/L CB, 0.5–1 mg/L

6DMAP, 400 μM CB, 0.1, 0.5, 1 mg/L Heat: 25, 30 ºC CB, 0.75–1.0 mg/L

Mussel Mytilus edulis

Mulinia lateralis Mya arenaria Tapes dorsatus Tapes philippinarum

Clam Mercenaria mercenaria

Nodipecten subnodosus

Chlamys nobilis

Xiang et al., 2006 Coman et al., 2008

Zhang et al., 1998 Dunstan et al., 2007 Liu et al., 2004

Jiang et al., 1993

Brake et al., 2004 Beaumont and Kelly, 1989

Eversole et al., 1996 Yang and Guo, unpubl. Guo and Allen, 1994b Mason et al., 1988 Nell et al., 1995 Shpigel and Spencer, 1996 Ekaratne and Davenport, 1993 Utting and Child, 1994

Komaru and Wada, 1989 Lin et al., 1995 Maldonado-Amparo et al., 2004

178


meiosis II triploids do not (Stanley et al., 1984; Hawkins et al., 1994). For natural triploids produced from diploid × tetraploid crosses, the increase in growth is even more impressive. Natural triploids grow up to 159 % faster than diploids in C. gigas (Nell and Perkins, 2005) and up to 190 % faster in C. virginica (Guo et al., 2008). The superior growth of natural triploids is remarkable even at three months of age (Fig. 6.4). It is also worth noting that in C. virginica natural triploids have shown significant improvements with successive generations of breeding of their tetraploid parents. Triploids produced from the first generation tetraploids grow 34 % faster

2n

3n

2n

3n

Fig. 6.4 Triploid (3n) C. virginica produced from tetraploids compares with their diploid (2n) controls at 3 (top) and 15 (bottom) months of age.


179

than diploid (Wang et al., 2005), while triploids produced from the second generation tetraploids grow 88–190 % faster than diploids (Guo et al., 2008). Superior growth has also been demonstrated for triploid scallops (Tabarini, 1984; Komaru and Wada, 1989; Lin et al., 1995; Ruiz-Verdugo et al., 2000; Yang et al., 2000b). Triploid scallops show 5 %, 18 %, 36 %, 40 % and 55 % increases in whole body weight in five separate studies (Table 6.1). In these same studies, triploids show even greater increases in adductor muscle weight, by 44 %, 42 %, 73 %, 67 % and 161 %, respectively. In Nodipecten subnodosus, triploids are 11 % smaller than diploids in whole body weight, but still 13 % bigger than diploids in adductor muscle weight (Maldonado-Amparo et al., 2004). These observations point to an interesting phenomenon that triploid scallops have greatly enlarged adductor muscles. Since adductor muscle is the marketed product for most scallops, any increases in adductor muscle mean not only higher yield, but also higher per unit price. Therefore, triploid scallops may have tremendous potential in aquaculture. Triploid mussels, abalone and shrimp have also shown increased body size or growth (Zhang et al., 1998; Brake et al., 2004; Xiang et al., 2006), although the magnitude is not as impressive as in oysters. In mussels, the highest increase is 44 % in whole body weight observed in Pinctada martensii, a pearl oyster but closely related to mussels (Jiang et al., 1993), and 63 % in tissue weight in Mytilus edulis (Brake et al., 2004). Data from clams are interesting albeit less encouraging for aquaculture. In all but one study, triploid clams are either smaller or about the same size as diploids (Table 6.1). Mulinia lateralis is an exception, where triploids are 72 % bigger than diploids and show nearly normal gonadal development (Guo and Allen, 1994b). Overall, it seems that, for some unknown reasons, triploid clams do not grow faster than diploids. This observation is interesting and deserves further investigation. The growth of triploids is strongly influenced by environmental conditions. It has been shown in several species that triploids from the same cohort may perform very differently at different locations. In general, the triploid advantage in growth is highest at warmer and more productive sites (Davis, 1989; Brake et al., 2004). This finding is not surprising, as in nutrientlimiting environments triploids may not grow faster than diploids even if they have greater potential. This may explain why triploids do not show superior growth in some of the studies. Despite the poor showing of triploids in a few clams, it is clear that triploids grow significantly faster than diploids in most shellfish species, and the cause of their increased growth or body size has been the subject of much discussion. Three hypotheses have been proposed, attributing the increased body size of triploids to increased heterozygosity, sterility or enlarged cell size (Guo and Allen, 1994b; Wang et al., 2002). The heterozygosity hypothesis suggests that the extra set of chromosomes in triploids increases heterozygosity (Stanley et al., 1984), which is often positively

180


correlated with growth in diploids. Supporting the heterozygosity hypothesis, triploids produced by blocking meiosis I, which may have higher levels of heterozygosity, grow faster than triploids produced by blocking meiosis II (Stanley et al., 1984; Hawkins et al., 1994). In addition, natural triploids produced from tetraploids are more heterozygous and also grow faster than induced triploids (Wang et al., 2002, 2005). A positive correlation between heterozygosity and growth is observed among diploids and two types of triploids (Fig. 6.5). There are also observations arguing against the heterozygosity hypothesis. First, meiosis I triploids do not show superior growth in some species including Mytilus edulis (Beaumont et al., 1995) and Pinctada martensii (Jiang et al., 1993). In the latter species, meiosis II triploids are slightly larger than meiosis I triploids. Secondly, although existing at the group level, the correlation between body size and multilocus heterozygosity is absent at the individual level within groups (Jiang et al., 1993; Beaumont et al., 1995; Garnier-Gere et al., 2002; Wang et al., 2002). In the absence of a highly positive and significant correlation at the individual level, the heterozygosity hypothesis has to be viewed with caution. The sterility hypothesis argues that triploids, because of their sterility, may allocate more energy to somatic growth rather than gonad development. Normal diploids spawn in summer and expend a considerable amount of energy on reproduction, while triploids do not. The sterility hypothesis is supported by studies in which triploids grow faster than diploids only after sexual maturation (Allen and Downing, 1986; Brake et al., 2004). However, energy relocation cannot explain the observation that in many cases triploids are significantly larger than diploids long before sexual maturation (Guo and Allen, 1994b; Guo et al., 1996). In C. gigas, triploid larvae are significantly larger than diploids on day 1, and triploid juveniles are 51 % larger than diploids at eight months of age or 3–4 months prior to sexual maturation (Guo et al., 1996). In C. virginica, natural triploids are 1.6

0.6

1.4 0.4 1.2

0.3 0.2

1

Meat weight (g)

Heterozygosity

0.5

0.1 0.8

0 2n

3nCB

Heterozygosity

3nDT Meat weight (g)

Fig. 6.5 A positive correlation between meat weight and multilocus heterozygosity in diploids (2n), triploids produced by inhibiting meiosis II (3nCB) and triploids produced from tetraploids (3nDT) in the Pacific oyster (based on Wang et al., 2002).


181

165–180 % larger than diploids at 3 months of age or 8 months prior to their first reproductive season (Wang et al., 2006). In Mulinia lateralis, triploids are 72 % larger than diploids without showing signs of reduced gonadal development (Guo and Allen, 1994b). These data strongly suggest that sterility or energy relocation is not the major cause for the increased body size in triploids. Finally, the cell size hypothesis proposes that triploid cells are larger than diploids and automatically lead to increases in organ and body size (Guo and Allen, 1994b). Development in molluscs is mosaic, where increases in cell size are not compensated by a reduction in number (Gilbert, 1988). Supporting the cell size hypothesis, eggs from triploid C. gigas are about 54 % larger (Guo and Allen, 1994c), and adductor muscle cells of triploid Chlamys farreri are about 50 % larger (Yang and Guo, unpublished). The observation that natural triploids grow faster than induced triploids, seemingly against the cell size hypothesis, can be explained with potential genetic defects associated with meiosis inhibition. The cell size hypothesis also has its limitations as it cannot explain cases where triploids are more than 50 % bigger than diploids (Table 6.1), because the cell size increase in triploids should be proportional to the increase in DNA or about 50 %. Although all three hypotheses can explain some of the data, none of them can account for all the observations so a new synthesis is necessary. We propose here a unifying genome adaptation hypothesis to explain the greatly increased body size of natural triploids observed in oysters (Nell and Perkins, 2005; Guo et al., 2008). The genome adaptation hypothesis accepts that increased cell size and heterozygosity are primary and independent causes for the increased body size of triploids, and sterility contributes additional but secondary increases. Further, the hypothesis argues that newly established polyploid genomes are dynamic and have a greater potential to change and adapt. The great increase in body size of natural triploid eastern oysters (by 109–190 %, Guo et al., 2008) is the result of rapid genome adaptation, after two generations of selection on their tetraploid father. The rapid adaptation is possible because of the tremendous genetic variation created by the polyploid genome per se and possibly through non-Mendelian changes such as chromosome deletion, duplication and rearrangements due to multivalent formation (Guo and Allen, 1997) and unequal crossovers during meiosis. The genome adaptation hypothesis assumes no limits on body size increase and can explain the fact that natural triploids are larger than induced triploids, and become even larger when produced from the second generation tetraploids. In other words, natural triploid grow faster, because their tetraploid father has survived at least two generations of polyploidy (including their triploid grandmother), subjected to severe selection for growth and survival (relative to massive genetic variation in the polyploid genome), and become adapted to the polyploid condition. The genome adaptation hypothesis suggests that tetraploids can also be rapidly improved during the first few generations before reaching a new equilibrium for tetraploidy.

182


6.3.3 Meat quality Because of their sterility, triploid molluscs may have improved meat quality during the spawning season (Allen and Downing, 1986). Most molluscs allocate a large portion (30–60 %) of their body to gonad production, and sexual maturation and reproduction often lead to a reduction in meat quality in normal diploids. For the half-shell oyster industry, animals with excessive gonadal material are considered as low-quality and oyster farms may have to stop or reduce production during the summer season. Because triploids have greatly reduced gonad development and are largely sterile, their meat quality is not affected by maturation and spawning during the reproductive season. Triploid molluscs therefore provide a high-quality product that can be sold year round, and it was the improved summer meat quality, not superior growth, that initially led to commercial production of triploids in the Pacific oyster (C. gigas) (Allen et al., 1989). On the negative side, triploid Pacific oyster cultured in warmer climates may develop brown spots in gonadal areas, but this phenomenon appears to be environment-specific (Nell, 2002; Davis, pers comm). Triploid Sydney rock oysters may also show brown coloration on the surface of their gonad (Hand and Nell, 1999); this coloration may be a response to aborted gametogenesis and high water temperature and it may disappear over time (Nell, 2002). We have not seen any brown coloration in triploid Pacific and eastern oysters cultured in New Jersey.

6.3.4 Survival The survival of adult triploids is variable. Triploid shellfish may have improved health or disease-resistance during reproductive seasons, and it has been shown that triploid oysters are less susceptible to summer mortalities caused by stress and energy depletion (Allen and Downing, 1986; G. Zhang, personal communication). However, there are also observations that triploids suffer from heavier mortality than diploids in summer at some locations (B. Eudeline, personal communication). Barber and Mann (1991) have shown that triploid and diploid eastern oysters are equally susceptible to Dermo, a parasitic disease caused by Perkinsus marinus. Another study has shown that triploid eastern oysters are less susceptible to MSX diseases (caused by Haplosporidium nelsoni) than diploids (Matthiessen and Davis, 1992). Similarly, in the Sydney rock oyster, mortality of triploids is two times lower than that of normal diploids under infection by the parasite, Mikrocytos roughleyi (Hand et al., 1998a,b). In the eastern oyster, triploids show better survival against ROD (Roseovarius oyster disease, caused by the bacterium Roseovarius crassostreae) than diploids (Guo et al., 2008). This improved survival is probably not due to specific resistance to Roseovarius crassostreae. ROD is a juvenile disease and primarily affects oysters smaller than 2.5 cm and, because triploids grow significantly faster, they may reach the refuge size earlier.


183

6.3.5 Sterility and genome stability Triploids have three sets of chromosomes, and theoretically they cannot go through meiosis and produce viable gametes. This is true in most fish and some shellfish where triploid females do not produce mature eggs (Thorgaard, 1983; Allen et al., 1986; Li et al., 2003a). So the use of sterile triploids in aquaculture helps to reduce the concern that cultured stocks (often selectively bred) may escape and interbreed with wild populations. If sterile, triploids can provide effective biological containment, which is especially important for culturing non-native species. Unfortunately, in most molluscs, the triploids are not completely sterile. Triploids have greatly reduced gonadal development, but they do produce some mature and viable gametes. In the Pacific oyster, the fecundity of triploid females is about 2 % of normal diploids (Guo and Allen, 1994a). The survival of triploid × triploid crosses is about 0.04 126 % of diploid × diploid crosses. The reproductive potential of triploids, assuming unlimited sperm, is therefore 0.000 008 (2 % × 0.04 126 %) or 1 in 125 000. If we consider that only 7 % of the triploid × triploid progeny are diploids (Guo and Allen, 1994a), the relative chance of triploids producing diploid offspring becomes 0.000 008 × 0.07 = 0.00 000 056 or 1 in 1.8 million. If we assume that sperm are also limiting and triploid males produce 2 % of what diploids produce, then the reproductive potential becomes 0.000 000 011 or 1 in 89 000 000. It means that when diploids produce 89 million fertile diploids, triploids would produce one, which is extremely low. This calculation is based on only one study and can be influenced by many variables. For example, another study puts the relative fecundity of triploid C. gigas at 13.4 % (Gong et al., 2004). Further, the calculation assumes that the culture population is 100 % triploids, which is not always possible (see Section 7.4). Any residual diploids can greatly change the calculation, because the survival of triploid × diploid cross is much higher than triploid × triploid crosses (Guo and Allen, 1994a; Gong et al., 2004). Even if 100 % triploids can be produced, the stability of the triploid genome presents another concern. It has been shown that some triploids may revert to mosaics, which contain some diploid cells, although it appears that reversion occurs in a small fraction (5–15 %) of triploids and is primarily restricted to somatic tissues (Allen et al., 1999). Reversion of tetraploids is more frequent (Guo, unpublished), suggesting increased genome instability of tetraploidy. Reversion is not well understood at this time and further research is needed.

6.4 Tetraploid shellfish 6.4.1 Induction of tetraploids Although triploid shellfish can be readily produced by blocking meiosis II, direct induction of triploids has several disadvantages: (i) most induction

184


treatments are toxic and detrimental to larval survival; (ii) the induction is rarely 100 % effective, which complicates hatchery management; and (iii) the retention of PB2 may have deleterious effects on the survival and growth of induced triploids (Chourrout et al., 1986; Guo et al., 1990). These problems can be eliminated by producing triploids from diploid × tetraploid mating (Guo et al., 1996). Tetraploidy is typically induced by inhibiting the first mitosis in fertilized eggs (Fig. 6.1). Viable tetraploids have been produced with mitosis I inhibition in fish (Chourrout, 1982; Myers et al., 1986) and amphibians (Fischberg, 1958; Reindschmidt et al., 1979). In shellfish, we have more ways to make tetraploids because meiosis I and II are both accessible. Tetraploid shellfish can be produced with at least the following approaches: inhibition of mitosis I, inhibition of meiosis I, inhibition of meiosis I and II in gynogenetically activated eggs, fusion of two diploid cells, and inhibition of meiosis I in eggs from triploids fertilized by normal sperm. All these approaches have been tested in shellfish with variable results (Table 6.2). Mitosis I inhibition has produced high percentages of tetraploid embryos, up to 80–90 %, in several species, but no tetraploids survived beyond metamorphosis in any of those studies, despite the diverse treatments used (Table 6.2). In C. gigas, blocking meiosis I and II in gynogenetically activated eggs produced 94.6 % tetraploids, none of which survived beyond larval stages (Guo, 1991), and neither zygote nor blastomere fusion produced viable tetraploids (Guo et al., 1994). Viable tetraploids were produced by meiosis I inhibition in several species, although the number of tetraploids that survived to juvenile stage was small (3–5) and no tetraploid lines were established (Scarpa et al., 1993; Allen et al., 1994; Yang et al., 2000b; Peruzzi and Guo, 2002; Yang and Guo, 2004). The poor survival of tetraploid shellfish may be caused by many factors. In many molluscs, the first cleavage is characterized by the formation of a polar lobe. The polar lobe contains morphogenic determinants that need to be precisely distributed (Gilbert, 1988). Therefore, inhibiting mitosis I may disrupt the distribution of morphogenic determinants and normal development. In fish and amphibians where viable tetraploids were produced by mitosis I blocking (Fischberg, 1958; Reinschmidt et al., 1979; Chourrout, 1982; Myers et al., 1986), the first cleavage is an equal division, and the development is regulative. The disruption of polar lobe formation cannot explain why tetraploid produced by blocking meiosis I and II in gynogenetically activated eggs are not viable, as the process does not affect the polar lobe. Guo (1991) hypothesizes that the poor viability of the induced tetraploids is caused by a cellnumber deficiency, and this deficiency arises from the cleavage of a normal egg by a large, tetraploid nucleus and the maintenance of a given nucleus/ cytoplasm ratio. In ‘mosaic’ development, a cell’s fate is programmed by the number of divisions and distribution of morphogenic determinants (Gilbert, 1988). A reduction in cell number at the end of cleavage may stop


185

Table 6.2 Tetraploid (4n) induction in shellfish: approaches and treatments used, percent 4n embryos produced and number of viable 4n obtained after metamorphosis Approach/Species Mitosis I inhibition Crassostrea gigas

Treatment1

% 4n embryos

No. of viable 4n

Reference

Heat, 35–40 ºC Colchicine, 0.125 mM Nocodazole, 0.026 μM Heat, 35, 38 ºC Cold, 4, 7 ºC Nocodozle, 0.02–1.6 mg/L 6-DMAP CB KCI Heat, 33–34 ºC

45 5 10 63–86 23–31 0

0 0 0 0 0 0

Guo et al., 1994 Guo, 1991

50 55 80 22–90

0 0 0 0

Cui et al., 2004

Heat, 35–36 ºC Cold, 5 ºC 6-DMAP, 150 μM

33–67 15 0

0 0 0

Sellars et al., 2006a

CB, 1 mg/L

94.6

0

Guo, 1991

PEG, zygote fusion PEG, blastomere fusion PEG, sperm fusion

2.2 30

0 0

Guo et al., 1994

0

0

Meiosis I inhibition Crassostrea gigas Chlamys farreri Haliotis discus hannai Ostrea edulis

CB, 1 mg/L CB, 0.5 mg/L 6DMAP, 175–225 μM CB, 0.8 mg/L CB, 1 mg/L

28 26 20–23 25–33 40–53

0 5 0 0 0

Mulinia lateralis

CB, 0.75 mg/L

na

4

CB, 0.67 mg/L Heat, 35 ºC CB, 1 mg/L

40–90 0 18

3 0 5

Gendreau and Grizel, 1990 Perruzzi and Guo, 2002 Yang and Guo, 2004 Yang and Guo 2006a Scarpa et al., 1993

CB, 0.5 mg/L

na

3

Allen et al., 1994

Mercenaria mercenaria Eriocheir sinensis Fenneropenaeus chinensis Marsupenaeus japonicus Gynogenesis Crassostrea gigas Cell fusion Crassostrea gigas

Mytilus galloprovincialis Tapes philippinarum

Meiosis inhibition in 3n female × 2n male cross CB, 0.5 mg/L Crassostrea gigas CB, 0.5 mg/L Crassostrea gigas Crassostrea virginica CB, 1 mg/L CB, 0.25 mg/L Crassostrea ariakensis na Argopecten ventricosus CB, 0.5 mg/L Pinctada martensii 1

67 30–84 40–100 0–90

1970 – 4000 3120

Yang and Guo, 2006b

Li et al., 2003b

Guo, 1991 Yang et al., 2000b Zhang et al., 2000

Guo and Allen, 1994c Eudeline et al., 2000 Guo et al., 2002 Allen et al., 2005

na

5

Maldonado et al., 2003

17

2

He et al., 2000

CB = cytochalasin B, na = not available, PEG = polyethylene glycol, 6-DMAP = 6-dimethylaminopurine.

186


development by retaining different morphogenic determinants in one cell, or by a lack of sufficient number of cells needed for further morphogenesis. The cell-number deficiency can be corrected by an increase in the egg volume. The eggs from triploids are significantly larger than that from normal diploids (Guo and Allen, 1994a). By blocking meiosis I in eggs from triploids fertilized with sperm from diploids, Guo and Allen (1994c) were able to produce a large number of viable tetraploids in C. gigas, a result that supports the cell-number deficiency hypothesis. Using the same method, viable tetraploids have been obtained in five bivalve molluscs and in three Crassostrea oysters, large numbers of tetraploids are produced and tetraploid lines established (Table 6.2). It has been shown recently that tetraploids produced by inhibiting meiosis II in eggs from diploids fertilized with sperm from tetraploids are viable (McCombie et al., 2005). This finding argues against the cell-number deficiency hypothesis, although the relative survival of tetraploids is not reported. The survival of a few tetraploids does not change the fact that the majority of tetraploids produced from eggs of diploids cannot survive. The cell-number hypothesis provides one explanation. The genome adaptation hypothesis (see Section 6.3.2) can also explain the improved survival of tetraploids derived from triploid females (Guo and Allen, 2004c) and tetraploid males (McCombie et al., 2005). By having survived at least one round of polyploidization, the triploid or tetraploid parents may have eliminated genes or gene complexes that are incompatible with polyploidy, giving their progeny an enhanced ability to survive tetraploidy.

6.4.2 Performance of tetraploids At present, large numbers of tetraploids and second generation tetraploids are only available in C. gigas (Guo and Allen, 1994c), C. virginica (Guo et al., 2002) and C. ariakensis (Allen et al., 2003). The first generation tetraploid C. gigas are larger than the diploids and triploids from the same treatment group (Guo and Allen, 1994c), but the diploids and triploids appear to be exceptionally small and possibly aneuploid. In C. virginica, the first generation tetraploids are also smaller than diploids and triploids (Guo et al., 2002). The first two to three generations of tetraploid C. virginica suffered heavy mortalities that appeared to be unique to tetraploids (Guo, unpublished data). Mortality occurred primarily in early spring when oysters are going through gonadal development. By the fourth generation, tetraploids were much healthier than in early generations and significantly larger than diploids (Guo et al., unpublished). This observation is in agreement with the genome adaptation hypothesis that tetraploids can go through rapid adaptation during the first few generations. Tetraploid oysters are fertile and have apparently normal development of gonads. The fecundity of tetraploid C. gigas is comparable to that of normal diploids (Guo and Allen, 1997), differing from the greatly reduced


187

fecundity of triploids. Tetraploids have an approximately 1 : 1 sex-ratio at one year of age. In contrast to the abnormally high frequency of hermaphrodites among triploids, tetraploids have about the same level of hermaphrodites as normal diploids. During meiosis, all chromosomes are engaged in multivalent formation (Guo and Allen, 1997). In spite of massive multivalent formation, tetraploids produce primarily diploid sperm with some aneuploids (Guo and Allen, 1997; Wang et al., 1999). All-triploid populations have been produced in all three oyster species by mating diploid females with tetraploid males. Natural triploids produced from tetraploid are practically 100 % pure, with percentages typically between 99 and 100 % (Guo et al., 1996; Wang et al., 2006). The rare diploids found among natural triploids may be gynogenetic, androgenetic (Wang et al., 1999), or due to imperfect meiosis in tetraploids. It can also be the result of contamination by a diploid group.

6.5 Gynogenesis, androgenesis and aneuploids Gynogenesis has been successfully produced in several shellfish species including Haliotis discus hannai (Arai et al., 1984; Fujino et al., 1990), Mytilus edulis (Fairbrother, 1994), Mytilus galloprovincialis (Scarpa et al., 1994), C. gigas (Guo et al., 1993; Li et al., 2000), and Mulinia lateralis (Guo and Allen, 1994b). In Mulinia lateralis, all gynodiploids are females, providing evidence for XX-female and XY-male determination of sex (Guo and Allen, 1994b). In C. gigas, meiotic gynodiploids have been used for genecentromere mapping of allozyme loci (Guo and Gaffney, 1993). The mean recombination frequency over seven loci is 0.74, which is high but not unusual. Mitotic gynodiploids are extremely valuable for genetic analysis and breeding because they are completely homozygous at all loci. However, mitotic gynodiploids have not been reported in shellfish. Haploid androgenesis has been achieved in C. gigas (Li et al., 2004). Aneuploids can be created by crossing triploids with diploids with or without inhibition of meiosis (Guo and Allen, 1994a,c). The following chromosome numbers have been observed in adult oysters, demonstrating that they are viable. They include 2n − 1, 2n + 1, 2n + 2, 2n + 3, 3n − 2, 3n − 1, 3n, 3n + 1, 3n + 2, 3n + 3, 4n − 2, 4n − 1, 4n and 4n + 1 (Guo and Allen, 1994c; Wang et al., 1999; Gong et al., 2004). Preliminary data show that most aneuploid conditions negatively affect growth including trisomy, a condition of a diploid genome having one extra chromosome (2n + 1). Trisomic families have been produced in the Pacific oyster (Guo et al., 2000), which are potentially useful in gene mapping and other genetic analyses.

6.6 Summary and perspectives Chromosome set manipulation has made significant contributions to shellfish aquaculture through the development of triploid and tetraploid oysters (Nell,

188


2002). Because of their superior growth, improved meat quality and sterility, triploids have become a desired product for oyster farming, and triploid oysters are now being used for commercial production in many countries including the USA, Australia, France, Chile, China and Korea. In the USA, about one third of the Pacific oyster production is from triploids. Triploid eastern oysters are also commercially cultured in the USA. Triploid C. ariakensis have been deployed for large-scale field trials in the USA, which would not be possible for a non-native species without the use of triploids. C. ariakensis is an Asian oyster that resists two devastating diseases (MSX and Dermo) of the eastern oyster. While the introduction of diploid C. ariakensis to US waters is controversial, triploids are being evaluated and considered as an alternative species for aquaculture. Tetraploids have played a critical role in the successful use of triploids in all three oyster species. On the other hand, the full potential of chromosome set manipulation has not yet been realized in shellfish. Research on uniparental inheritance and aneuploids remains largely academic, and triploids have not entered commercial production in most shellfish. Induced triploids have already demonstrated improved performance in scallops, mussels, abalone and shrimp, and natural triploids in the future should offer even greater improvements as has been shown in oysters. However, tetraploids which are needed for the production of natural triploids are only available in three species of oysters so the development of tetraploids in other major shellfish species should be a priority for the research community. Finally, chromosome set manipulation in shellfish is not only useful for aquaculture, but also important for our understanding of shellfish genomes. The creation of various chromosome variants provides unique opportunities to study some of the basic questions in genome biology. Research in shellfish has raised some interesting questions such as why triploids grow faster, why aneuploids grow slower, and why tetraploids have limited viability. Hypotheses have been advanced, and future studies may greatly improve our understanding of shellfish genomes.

6.7 Acknowledgements We thank Alison Guo for helping with graphics. This work is partly supported by grants from NOAA Sea Grant Oyster Disease Research Program. This is publication IMCS-2009-60 and NJSG-09-900.

6.8 References akashige, s and fushimi, t (1992) Growth, survival, and glycogen-content of triploid Pacific oyster Crassostrea gigas in the waters of Hiroshima, Japan, Nippon Suisan Gakkaishi, 58, 1063–71.


189

allen, s k, jr (1983) Flow cytometry: assaying experimental polyploid fish and shellfish, Aquaculture, 33, 317–28. allen, s k, jr and downing, s l (1986) Performance of triploid Pacific oysters, Crassostrea gigas (Thunberg). I. Survival, growth, glycogen content, and sexual maturation in yearlings, J Exp Mar Biol Ecol, 102, 197–208. allen, s k, jr, hidu, h and stanley, j g (1986) Abnormal gametogenesis and sex ratio in triploid soft-shell clam Mya arenaria, Biol Bull, 170, 198–210. allen, s k, jr, downing, s l and chew, k k (1989) Hatchery Manual for Producing Triploid Oysters, Seattle, WA, University of Washington Press. allen, s k, jr, shpigel, m s, utting, s and spencer, b (1994) Incidental production of tetraploid Manila clams, Tapes philippinarum (Adams and Reeve), Aquaculture, 128, 13–19. allen, s k, jr, howe, a, gallivan, t, guo, x and debrosse, g (1999) Genotype and environmental variation in reversion of triploid Crassostrea gigas to the heteroploid mosaic state, J Shellfish Res, 18, 293. allen, s k, jr, erskine, a j, walker, e and zebal, r (2003) Production of tetraploid Suminoe oysters C. ariakensis, J Shellfish Res, 22, 317. allen, s k, jr, erskine, a j, walker, e j and debrosse, g a (2005) Production of tetraploid suminoe oysters, Crassostrea ariakensis, Aquaculture, 247, 3. arai, k f, naito, f, sasaki, h and fujino, k (1984) Gynogenesis with ultraviolet ray irradiated sperm in the Pacific abalone, Bull Jap Soc Sci Fish, 50, 2019–23. arai, k f, naito, f and fujino, k (1986) Triploidization of the Pacific abalone with temperature and pressure treatments, Bull Jap Soc Sci Fish, 52, 417–22. barber, b j and mann, r (1991) Sterile triploid Crassostrea virginica (Gmelin, 1791) grow faster than diploids but are equally susceptible to Perkinsus marinus, J Shellfish Res, 10, 445–50. beaumont, a r and fairbrother, j e (1991) Ploidy manipulation in molluscan shellfish: a review, J Shellfish Res, 10, 1–18. beaumont, a r and kelly, k s (1989) Production and growth of triploid Mytilus edulis larvae, J Exp Mar Biol Ecol, 132, 69–84. beaumont, a r, fairbrother, j e and hoare, k (1995) Multilocus heterozygosity and size: A test of hypotheses using triploid Mytilus edulis, Heredity, 75, 256–66. brake, j, davidson, j and davis, j (2004) Field observations on growth, gametogenesis, and sex ratio of triploid and diploid Mytilus edulis, Aquaculture, 236, 179–91. chourrout, d (1982) Tetraploidy induced by heat shocks in the rainbow trout (Salmo gairdneri R.), Reprod Nutr Dev, 20, 727–37. chourrout, d, chevassus, b, krieg, f, happe, a, burger, g and renard, p (1986) Production of second generation triploid and tetraploid rainbow trout by mating tetraploid males and diploid females–potential of tetraploid fish, Theor Appl Genet, 72, 193–206. coman, f e, sellars, m j, norris, b j, coman, g j and preston, n p (2008) The effects of triploidy on Penaeus (Marsupenaeus) japonicus (Bate) survival, growth and gender when compared to diploid siblings, Aquaculture, 276, 50–59. cooper, k and guo, x (1989) Polyploid Pacific oyster produced by blocking polar body I and II with cytochalasin B, J Shellfish Res, 8, 412. cui, z x, xiang, j h, zhou, l h, cai, n n and song, l s (2004) Improvement of polyploidy induction in Eriocheir sinensis, Acta Oceanol Sinica, 23, 725–32. davis, j p (1989) Growth rate of sibling diploid and triploid oysters, Crassostrea gigas, J Shellfish Res, 8, 319 (abstract). desrosiers, r r, gerard, a, peignon, j m, naciri, y, dufresne, l, morasse, j, ledu, c, phelipot, p, guerrier, p and dube, f (1993) A novel method to produce triploids in bivalve mollusks by the use of 6-dimethylaminopurine, J Exp Mar Biol Ecol, 170, 29–43.

190


downing, s l and allen, s k, jr (1987) Induced triploidy in the Pacific oyster, Crassostrea gigas: Optimal treatments with cytochalasin B depend on temperature, Aquaculture, 61, 1–15. dunstan, g a, elliott, n g, appleyard, s a, holmes, b h, conod, n, grubert, m a and cozens, m a (2007) Culture of triploid greenlip abalone (Haliotis laevigata Donovan) to market size: Commercial implications, Aquaculture, 271, 130–41. ekaratne, s u k and davenport, j (1993) The relationships between the gametogenetic status of triploids or diploids of manila clams, Tapes philippinarum, and their oxygen-uptake and gill particle-transport, Aquaculture, 117, 335–49. eudeline, b, allen, s k, jr and guo, x (2000) Optimization of tetraploid induction in the Pacific oysters, Crassostrea gigas, using the first polar body as a natural indicator, Aquaculture, 187, 73–84. eversole, a g, kempton, c j, hadley, n h and buzzi, w r (1996) Comparison of growth, survival, and reproductive success of diploid and triploid Mercenaria mercenaria, J Shellfish Res, 15, 689–94. fairbrother, j e (1994) Viable gynogenetic diploid Mytilus edulis (L.) larvae produced by ultraviolet light irradiation and cytochalasin B shock, Aquaculture, 126, 25–34. fao (2007) The State of World Fisheries and Aquaculture 2006, Rome, Food and Agriculture Organization of the United Nations. fischberg, m (1958) Experimental tetraploidy in newts, J Embryol Exp Morphol, 6, 393–402. fujino, k, arai, k, iwadare, k, yoshida, t and nakajima, s (1990) Induction of gynogenetic diploid by inhibiting second meiosis in the Pacific abalone, Nippon Suisan Gakkaishi, 56, 1755–63. garnier-gere, p h, naciri-graven, y, bougrier, s, magoulas, a, heral, m, kotoulas, g, hawkins, a and gerard, a (2002) Influences of triploidy, parentage and genetic diversity on growth of the Pacific oyster Crassostrea gigas reared in contrasting natural environments, Mol Ecol, 11, 1499–514. gendreau, s and grizel, h (1990) Induced triploidy and tetraploidy in the European flat oyster, Ostrea edulis L, Aquaculture, 90, 229–38. gilbert, s f (1988) Developmental Biology, 2nd Edn, Sunderland, MA, Sinauer Associates Inc. gong, n, yang, h, zhang, g, landau, b j and guo, x (2004) Chromosome inheritance in triploid Pacific oyster Crassostrea gigas Thunberg, Heredity, 93, 408–15. guo, x (1991) Studies on Tetraploid Induction in the Pacific Oyster, Crassostrea gigas (Thunberg), Seattle, WA, University of Washington. guo, x (2004) Oyster breeding and the use of biotechnology, Bull Aquac Assoc Canada, 104(2), 26–33. guo, x and allen, s k, jr (1994a) Reproductive potential and genetics of triploid Pacific oyster, Crassostrea gigas (Thunberg), Biol Bull, 187, 309–18. guo, x and allen, s k, jr (1994b) Sex determination and polyploid gigantism in the dwarf surfclam (Mulinia lateralis Say), Genetics, 138, 1199–206. guo, x and allen, s k, jr (1994c) Viable tetraploids in the Pacific oyster (Crassostrea gigas Thunberg) produced by inhibiting polar body 1 in eggs from triploids, Mol Mar Biol Biotechnol, 3, 42–50. guo, x and allen, s k, jr (1997) Sex and meiosis in autotetraploid Pacific oyster, Crassostrea gigas (Thunberg), Genome, 40, 397–405. guo, x and gaffney, p m (1993) Artificial gynogenesis in the Pacific oyster, Crassostrea gigas: II. Allozyme inheritance and early growth, J Hered, 84, 311–15. guo, x, hershberger, w k and myers, j (1990) Growth and survival of intrastrain and interstrain triploids of rainbow trout, Oncorhynchus mykiss, J World Aquac Soc, 21, 250–56.


191

guo, x, cooper, k, hershberger, w k and chew, k k (1992a) Genetic consequences of blocking polar body I with cytochalasin B in fertilized eggs of the Pacific oyster, Crassostrea gigas: I. Ploidy of resultant embryos, Biol Bull, 183, 381–6. guo, x, hershberger, w k, cooper, k and chew, k k (1992b) Genetic consequences of blocking polar body I with cytochalasin B in fertilized eggs of the Pacific oyster, Crassostrea gigas: II. Segregation of chromosome, Biol Bull, 183, 387–93. guo, x, hershberger, w k, cooper, k and chew, k k (1993) Artificial gynogenesis with ultraviolet irradiated sperm in the Pacific oyster, Crassostrea gigas: I. Induction and survival, Aquaculture, 113, 201–14. guo, x, hershberger, w k, cooper, k and chew, k k (1994) Tetraploid induction with mitosis-I inhibition and cell-fusion in the Pacific oyster (Crassostrea gigas Thunberg), J Shellfish Res, 13, 193–8. guo, x, debrosse, g and allen, s k, jr (1996) All-triploid Pacific oysters (Crassostrea gigas Thunberg) produced by mating tetraploids and diploids, Aquaculture, 142, 149–61. guo, x, ford, s and zhang, f (1999) Molluscan aquaculture in China, J Shellfish Res, 18, 19–31. guo, x, zhang, g, landau, b j, english, l and wang, y (2000) Aneuploidy in the Pacific oyster, Crassostrea gigas Thunberg and its effects on growth, J Shellfish Res, 19, 614. guo, x, wang, j, landau, b j, li, l, debrosse, g a and krista, k d (2002) The successful production of tetraploid eastern oyster, Crassostrea virginica Gmelin, J Shellfish Res, 21, 380–81. guo, x, wang, y and xu, z (2007) Genomic analyses by fluorescent in situ hybridization, in Liu, Z J (ed.), Aquaculture Genome Technologies, Ames, IA, Blackwell, 289–311. guo, x, wang, y, debrosse, g a, bushek, d and ford, s e (2008) Building a superior oyster for aquaculture, Jersey Shoreline, 25, 7–9. hand, r e and nell, j a (1999) Studies on triploid oysters in Australia XII. Gonad discolouration and meat condition of diploid and triploid Sydney rock oysters Saccostrea commercialis in five estuaries in New South Wales, Australia, Aquaculture, 171, 181–94. hand, r e, nell, j a and maguire, g b (1998a) Studies on triploid oysters in Australia. X. Growth and mortality of diploid and triploid Sydney rock oysters Saccostrea commercialis (Iredale and Roughley), J Shellfish Res, 17, 1115–27. hand, r e, nell, j a, smith, i r and maguire, g b (1998b) Studies on triploid oysters in Australia. XI. Survival of diploid and triploid Sydney rock oysters Saccostrea commercialis (Iredale and Roughley) through outbreaks of winter mortality caused by Mikrocytos roughleyi infection, J Shellfish Res, 17, 1129–35. hand, r e, nell, j a, reid, d d, smith, i r and maguire, g b (1999) Studies on triploid oysters in Australia: Effect of initial size on growth of diploid and triploid Sydney rock oysters, Saccostrea commercialis (Iredale & Roughley), Aquac Res, 30, 35–42. hand, r e, nell, j a and thompson, p a (2004) Studies on triploid oysters in Australia: XIII. Performance of diploid and triploid Sydney rock oyster, Saccostrea glomerata (Gould, 1850), progeny from a third generation breeding line, Aquaculture, 233, 93–107. hawkins, a j s, day, a j, gerard, a, naciri, y, ledu, c, bayne, b l and heral, m (1994) A genetic and metabolic basis for faster growth among triploids induced by blocking meiosis I but not meiosis II in the larviparous European flat oyster, Ostrea edulis L, J Exp Mar Biol Ecol, 184, 21–40. he, m, lin, y, shen, q, hu, j and jiang, w (2000) Production of tetraploid pearl oyster (Pinctada martensii Dunker) by inhibiting the first polar body in eggs from triploids. J Shellfish Res, 19, 147–51.

192


jiang, w, li, g, xu, g, lin, y and qing, n (1993) Growth of the induced triploid pearl oyster, Pinctada martensii (D.), Aquaculture, 111, 245–53. komaru, a and wada, k t (1989) Gametogenesis and growth of induced triploid scallops Chlamys nobilis, Nippon Suisan Gakkaishi, 55, 447–52 (in Japanese with English abstract). komaru, a, uchimura, y, ievama, h and wada, k t (1988) Detection of induced triploid scallop, Chlamys nobilis, by DNA microfluorometry with DAPI staining, Aquaculture, 69, 201–10. landau, m (1992) Introduction to Aquaculture, New York, Wiley. li, q, osada, m, kashihara, m, hirohashi, k and kijima, a (2000) Induction of gynogenetic diploids and cytological studies in the Pacific oyster, Crassostrea gigas, Suisanzoshoku, 48, 185–91. li, f, xiang, j, zhang, x, zhou, l, zhang, c and wu, c (2003a) Gonad development characteristics and sex ratio in triploid Chinese shrimp (Fenneropenaeus chinensis), Mar Biotechnol, 5, 528–35. li, f, xiang, j, zhou, l, wu, c and zhang, x (2003b) Optimization of triploid induction by heat shock in Chinese shrimp Fenneropenaeus chinensis, Aquaculture, 219, 221–31. li, q, hisatsune, t and kijima, a (2004) Induction of haploid androgenesis in Pacific oyster by UV irradiation, Mar Biotechnol, 6, 291–7. liang, y, wang, r, tian, c, yu, r and qu, x (1994) A preliminary study on the triploid oyster Crassostrea talienwhanensis, J Fish China, 18, 237–40 (in Chinese with English abstract). lin, y, he, m, qing, n and jiang, w (1995) Triploid induction in the scallop, Chlamys nobilis and growth comparisons, Tropi Oceanol, 14, 84–9 (in Chinese with English abstract). liu, w, heasman, m and simpson, r (2004) Induction and evaluation of triploidy in the Australian blacklip abalone, Haliotis rubra: a preliminary study, Aquaculture, 233, 79–92. longo, f j (1972) The effects of cytochalasin B on the events of fertilization in the surf clam, Spisula solidissima. I. Polar body formation, J Exp Zool, 182, 321–44. maguire, g b, gardner, n c, nell, j a, kent, g n and kent, a s (1995) Studies on triploid oysters in Australia. 2. Growth, condition index gonad area, and glycogen content of triploid and diploid Pacific oysters, Crassostrea gigas, from oyster leases in Tasmania, Australia, Aquaculture, 137, 355–8. maldonado, r, ibarra, a m and ramirez, j l (2003) Induction to tetraploidy in catarina scallop, Argopecten ventricosus (Sowerby II, 1842), Cienc Mar, 29, 229–38. maldonado-amparo, r, ramirez, j l, avila, s and ibarra, a m (2004) Triploid lionpaw scallop (Nodipecten subnodosus Sowerby); Growth, gametogenesis, and gametic cell frequencies when grown at a high food availability site, Aquaculture, 235, 185–205. mallia, j v, muthiah, p and thomas, p c (2006) Growth of triploid oyster, Crassostrea madrasensis (Preston), Aquac Res, 37, 718–24. mason, k m, shumway, s e, allen, s k jr and hidu, h (1988) Induced triploidy in the soft-shell clam Mya arenaria: energetic implications, Mar Biol, 98, 519–28. matthiessen, g c and davis, j p (1992) Observations on growth rate and resistance to MSX (Haplosporidium nelsoni) among diploid and triploid eastern oyster [Crassostrea virginica (Gmelin, 1791)] in New England, J Shellfish Res, 11, 449–54. mccombie, h, ledu, c and phelipot, p (2005) A complementary method for production of tetraploid Crassostrea gigas using crosses between diploids and tetraploids with cytochalasin B treatments, Mar Biotechnol, 7, 318–30. myers, j m, iwamoto, r n and hershberger, w k (1986) Tetraploid induction in salmonids, J World Aquac Soc, 17, 1–7.


193

nell, j a (2002) Farming triploid oysters, Aquaculture, 210, 69–88. nell, j a and perkins, b (2005) Studies on triploid oysters in Australia: farming potential of all-triploid Pacific oysters, Crassostrea gigas (Thunberg), in Port Stephens, New South Wales, Australia, Aquac Res, 36, 530–6. nell, j a, cox, e, smith, i r and maguire, g b (1994) Studies on triploid oyster in Australia. I. The farming potential of triploid Sydney rock oyster, Saccostrea commercialis (Iredale and Roughley), Aquaculture, 126, 243–55. nell, j a, o’connor, w a, hand, r e and mcadam, s p (1995) Hatchery production of diploid and triploid clams, Tapes dursatus (Lamark 1818): a potential new species for aquaculture, Aquaculture, 130, 389–94. nell, j a, hand, r e, goard, l j and mcadam, s p (1996) Studies on triploid oyster in Australia. Evaluation of cytochalasin B and 6-dimethylaminopurine for triploidy induction in Sydney rock oysters Saccostrea commercialis (Iredale and Roughley), Aquac Res, 126, 689–98. okumura, s i, arai, k, harigaya, y, eguchi, h, sakai, m, senobkuya, h, furukawa, s and yamamor, k (2007) Highly efficient induction of triploid Pacific abalone Haliotis discus hannai by caffeine treatment, Fish Sci, 73, 237–43. peruzzi, s and guo, x (2002) Tetraploid induction by meiosis inhibition with cytochalasin B in the dwarf surfclam, Mulinia lateralis Say: effects of temperature, J Shellfish Res, 21, 677–84. reindschmidt, d c, simon, s j, volpe, e p and tompkins, r (1979) Production of tetraploid and homozygous diploid amphibians by suppression of first cleavage, J Exp Zool, 210, 137–43. ruiz-verdugo, c a, ramirez, j l, allen, s k jr and ibarra, a m (2000) Triploid catarina scallop (Argopecten ventricosus Sowerby II, 1842): growth, gametogenesis, and suppression of functional hermaphroditism, Aquaculture, 198, 13–23. scarpa, j, wada, k t and komaru, a (1993) Induction of tetraploid mussel by suppression of polar body formation, Nippon Suisan Gakkaishi, 59, 2017–23. scarpa, j, toro, j e and wada, k t (1994) Direct comparison of six methods to induce triploidy in bivalves, Aquaculture, 119, 119–33. sellars, m j, coman, f e, degnan, b m and preston, n p (2006a) The effectiveness of heat, cold and 6-dimethylaminopurine shocks for inducing tetraploidy in the Kuruma shrimp, Marsupenaeus japonicus (Bate), J Shellfish Res, 25, 631–7. sellars, m j, degnan, b m and preston, n p (2006b) Production of triploid Kuruma shrimp, Marsupenaeus (Penaeus) japonicus (Bate) nauplii through inhibition of polar body I, or polar body I and II extrusion using 6-dimethylaminopurine, Aquaculture, 256, 337–45. shpigel, m and spencer, b (1996) Performance of diploid and triploid Manila clams (Tapes philippinarum, Adams and Reeve) at various levels of tidal exposure in the UK and in water from fish ponds at Eilat, Israel, Aquaculture, 141, 159–71. stanley, j g, allen, s k, jr and hidu, h (1981) Polyploidy induced in the American oyster, Crassostrea virginica, with cytochalasin B, Aquaculture, 23, 1–10. stanley, j g, hidu, h and allen, s k, jr (1984) Growth of American oysters increased by polyploidy induced by blocking meiosis I but not meiosis II, Aquaculture, 37, 147–55. stephens, l b (1989) Inhibition of the First Polar Body Formation in Crassostrea gigas Produces Tetraploids, Not Meiotic I Triploids, Seattle, WA, University of Washington. tabarini, c l (1984) Induced triploidy in the bay scallop, Argopecten irradians, and its effect on growth and gametogenesis, Aquaculture, 42, 151–60. thiriot-quiévreux, c (2002) Review of the literature on bivalve cytogenetics in the last ten years, Cah Biol Mar, 43, 17–26.

194


thorgaard, g h (1983) Chromosome set manipulation and sex control in fish, in Hoar, W S, Randall, D J and Donaldson, E M (Eds), Fish Physiology, London, Academic Press. troup, a j, cairns, s c and simpson, r d (2005) Growth and mortality of sibling triploid and diploid Sydney rock oysters, Saccostrea glomerata (Gould), in the Camden Haven River, Aquac Res, 36, 1093–103. utting, s d and child, r d (1994) Genetic manipulation of the Manila clam Tapes philippinarum using cytochalasin B to induce triploid, Aquaculture, 120, 271–82. wang, y and guo, x (2004) Chromosomal rearrangement in Pectinidae revealed by rRNA loci and implications in bivalve evolution, Biol Bull, 207, 247–56. wang, z, guo, x, allen, s k, jr and wang, r (1999) Aneuploid Pacific oyster (Crassostrea gigas Thunberg), Aquaculture, 173, 347–57. wang, z, guo, x, allen, s k, jr and wang, r (2002) Heterozygosity and body size in triploid Pacific oysters, Crassostrea gigas Thunberg, produced from meiosis II inhibition and tetraploids, Aquaculture, 204, 337–48. wang, y, xu, z and guo, x (2004) Differences in the rDNA-bearing chromosome divide the Asian-Pacific and Atlantic species of Crassostrea (Bivalvia, Mollusca), Biol Bull, 206, 46–54. wang, y, guo, x, debrosse, g a and ford, s e (2005) Growth in natural triploid eastern oyster produced by diploid × tetraploid crosses, J Shellfish Res, 24, 1274. wang, y, guo, x, debrosse, g, karney, r, bagnall, p, blake, j, ford, s e and bushek, d (2006) Superior growth of triploid eastern oyster depends on culture environment, J Shellfish Res, 25, 675–6. xiang, j, li, f, zhang, c, zhang, x, yu, k, zhou, l, and wu, c (2006) Evaluation of induced triploid shrimp Penaeus (Fenneropenaeus) chinensis cultured under laboratory conditions, Aquaculture, 259, 108–15. yamamoto, s and sugawara, y (1988) Induced triploidy in the mussel, Mytilus edulis, by temperature shock, Aquaculture, 72, 21–9. yang, h, gallivan, t, guo, x and allen, s k, jr (2000a) A method for preserving oyster tissue samples for flow cytometry, J Shellfish Res, 19, 835–9. yang, h, zhang, f and guo, x (2000b) Triploid and tetraploid zhikong scallop, Chlamys farreri Jones et Preston, produced by inhibiting polar body I, Mar Biotechnol, 2, 466–75. yang, h and guo, x (2004) Tetraploid induction by meiosis inhibition in the dwarf surfclam Mulinia lateralis (Say 1822): effects of cytochalasin B duration, Aquac Res, 35, 1187–94. yang, h and guo, x (2006a) Polyploid induction by heat shock-induced meiosis and mitosis inhibition in the dwarf surfclam, Mulinia lateralis Say, Aquaculture, 252, 171–82. yang, h and guo, x (2006b) Tetraploid induction by inhibiting mitosis I with heat shock, cold shock, and nocodazole in the hard clam Mercenaria mercenaria (Linnaeus, 1758), Mar Biotechnol, 8, 501–10. young, w p, wheeler, p a, coryell, v h, keim, p and thorgaard, g h (1998) A detailed linkage map of rainbow trout produced using doubled haploids, Genetics, 148, 839–50. zhang, g, wang, z, chang, y, song, j, ding, j, wang, y and wang, r (1998) Triploid induction in Pacific abalone Haliotis discus hannai Ino by 6-dimethylaminopurine and the performance of triploid juveniles, J Shellfish Res, 17, 783–8. zhang, g, wang, z, chang, y, song, j, ding, j, zhao, s and guo, x (2000) Tetraploid induction in the Pacific abalone Haliotis discus hannai Ino with 6-DMAP and CB, J Shellfish Res, 19, 540–41.

7 Advances in disease diagnosis, vaccine development and other emerging methods to control pathogens in aquaculture A. Adams, University of Stirling, UK

Abstract: Disease is still regarded as a major constraint to aquaculture production globally. Rapid disease diagnosis and vaccination play a huge part in the control of bacterial diseases, and there has been significant progress in both of these areas. This chapter considers the limitations of existing methods and reviews recent advances made in pathogen detection technologies and vaccine development methodologies. Future directions are discussed, including nanotechnology and reversed vaccinology. Key words: fish disease, fish health, disease diagnosis, vaccine development, pathogen detection technologies.

7.1 Introduction Disease is still regarded as a major constraint to aquaculture production globally (Adams et al., 2005). As the industry continues to expand and diversify, the risk of new diseases emerging and old ones spreading to other geographical regions is a reality. The movement of eggs and fry between fish farms presents ideal circumstances for pathogens to adapt with their hosts and environment. Control of pathogens is complex and relies heavily on a combination of pathogen detection, disease diagnosis, treatment, prevention and general health management. Rapid disease diagnosis and vaccination play a huge part in this, and there has been significant progress in both of these areas since the 1980s. In the years since 2000 the pace has increased even more as methods developed for clinical and veterinary medicine are rapidly adapted and optimised for use in

198


aquaculture. Novel diagnostic methods are published frequently and the success of vaccination in reducing the use of antibiotics has been realised, at least in some countries. Innovative alternative methods for the control of fish diseases are also being researched and applied. This chapter aims to provide a review of the recent advances made in disease diagnosis, vaccine development and other emerging methods to control pathogens in aquaculture.

7.2 Key drivers to improve disease diagnosis and vaccine development The main key driver to improve disease diagnosis and vaccine development is the continued significant losses to the industry caused by pathogens. Bacterial diseases cause a substantial economic burden to the aquaculture industry and, although antibiotics and chemotherapeutants are extensively used to control disease outbreaks, there is increasing concern about their use because of drug residues in food, the development of antimicrobial drug resistance and the detrimental effect on the aquatic microbial ecosystems and populations (Thompson and Adams, 2004). There is a concerted effort to move away from the use of antibiotics wherever possible. This was highlighted in September 2008 in Korea with the announcement that from next year the Korea Food and Drug Administration will ban the use of seven types of antibiotics in feed for livestock and fish raised in fish farms. In the UK, Norway and Japan there has already been a significant reduction in the use of antibiotics since the 1990s (Adams et al., 2005; Markestad and Grave, 1997). There is a real need to increase production of fish globally through aquaculture and therefore health and welfare must be given a high priority if targets set are to be reached. Some vaccines, in particular multivalent vaccines, have led to welfare concerns in the past few years due to the presence of adhesions on internal organs, thought to result from oil-based adjuvants in the vaccines (Berg et al., 2007). Farming of new species will play a significant role in increasing production. Persistent disease problems in cod (Vibriosis in particular) have played a large part in this new industry stagnating in Scotland. As cobia farming increases globally, and with the first farms being licensed in Brazil (Eric Routledge, Special Secretariat for Aquaculture and Fisheries, SEAP, Brazil; pers comm), there will be a need for farmers to be one step ahead of potential disease threats.

7.3 Limitations of current diagnostic methods Many of the current techniques for the detection of pathogens and diagnosis of diseases are actually very good. On the other hand, identification of

Advances in disease diagnosis and vaccine development

199

certain pathogens is difficult to achieve and some of the methods developed may be too complicated to apply or interpret. Conventional pathogen isolation and characterisation techniques, alongside pathology, still remain the methods of choice for the diagnosis of many diseases. However, these traditional methods tend to be costly, labour-intensive, and slow, and might not always lead to a definitive diagnosis being made. The rapid progress made in biotechnology since the 1990s has enabled the development and improvement of a wide range of immunodiagnostic and molecular techniques (Cunningham, 2004; Adams and Thompson, 2006, 2008), and reagents and commercial kits have become more widely available. These rapid methods both complement and enhance the traditional methods of disease diagnosis. The Manual of Diagnostic Tests for Aquatic Animals (World Organisation for Animal Health, 2006) includes a variety of standardised methods (including traditional, immunological and molecular methods) for the identification of selected pathogens (causing notifiable diseases), and these will expand as new methods are developed and validated (Adams and Thompson, 2008). Most of these are, however, for viral diseases, and Renibacteriun salmoninarum and Piscirickettsia salmonis, the causative agents of bacterial kidney disease (BKD) and ricketsiosis, respectively, are the only bacterial pathogens included. The diseases caused by these pathogens do not meet the listing criteria, but they are included because reporting requirements for non-listed diseases apply in regard to significant epidemiological events. For those diseases not included in the Animal Health Code there are no set standards. It is important that reagents and methods used for detecting bacterial pathogens are standardised and rigorously tested for specificity and sensitivity. Commercial reagents and kit development (Adams and Thompson, 2008) have gone some of the way to achieving this, but there still is not a full range of reagents or kits available for use in aquaculture. The cost, speed, specificity and sensitivity of assays are all extremely important to end-users. The highest cost is often time, although labour costs do vary considerably between countries. Many of the new technologies require specialised equipment and highly skilled staff and few of the existing methodologies are suited to field testing, or use in rudimentary laboratories.

7.4 Advances in methods of disease diagnosis (mainly for bacterial diseases) Disease diagnosis is currently made using a variety of methods, as reviewed by Adams and Thompson (2008). Traditional bacteriology, whereby the pathogen is isolated and identified biochemically (e.g. using API® strips), and observation of histological sections from diseased fish are widely used. Rapid methods that specifically identify the pathogen using antibodies

200


(immunodiagnostics) or by amplifying specific sequences of DNA or RNA using polymerase chain reaction (PCR) (i.e. molecular diagnostics) are also regularly used in many laboratories. In some instances molecular diagnostics has completely taken over from other methodologies. For many of the rapid methods live and dead pathogens cannot be distinguished; therefore, the inclusion of enrichment methods and the use of live/dead kits are useful supplementary methods (Vatsos et al., 2002). Interpretation of results using rapid methods of pathogen detection should be carefully considered with all the other clinical evidence, including histology and attempted culture of the pathogen. Immunodiagnostic methods such as immunohistochemistry (IHC), the fluorescence antibody test (FAT) and indirect fluorescence antibody test (IFAT) enable rapid specific detection of pathogens in tissue samples without the need to first isolate the pathogen. The IHC method is a simple extension of histology allowing specific identification of pathogens in formalin tissue fixed sections (Adams and Marin de Mateo, 1994; Steiropoulos et al., 2002), while FAT/IFAT is extremely rapid and sensitive as well as being specific but requires a fluorescent microscope to read the results (Adams et al., 1995; Miles et al., 2003; Klesius et al., 2006). Both IHC and FAT/IFAT are technically easy to perform, and examples of the results obtained using these methods are shown in Fig. 7.1. (p. 201, see also colour section.) A variety of other antibody-based methods have also been developed for use in aquaculture. Some are very simple to use, but usually require pathogen isolation prior to use and lack in sensitivity (e.g. agglutination), while others are more complex, but with the added advantage of pathogen quantification (e.g. enzyme-linked immunosorbent assay, ELISA), or detection and characterisation of specific pathogen antigens to their molecular weight, e.g. Western blot (Rose et al., 1989; Adams and Thompson 1990; Adams, 1992, 2004). The ELISA also has the advantage of high throughput and automated equipment is available. The ELISA can also be used for serology (detecting antibodies to specific pathogens). Although serology is an essential screening tool in clinical medicine and in most control programmes for the significant diseases of domestic animals (Palmer-Densmore et al., 1998; Yuce et al., 2001; Fournier and Raoult, 2003) it has not yet been validated for any bacterial diseases in fish. Serology is used effectively for detecting exposure to fish viruses, such as koi herpesvirus (KHV) (Adkinson et al., 2005; Adams and Thompson, 2008), but bacterial pathogens pose a much more complex picture with cross reactivities likely unless specific known proteins are used to coat the ELISA plates rather than whole pathogens. The use of molecular technologies for the detection of fish bacterial pathogens is rapidly increasing and a vast array of methods has already been developed (Karunasagar et al., 1997; Cunningham, 2004; Adams and Thompson 2006, 2008; Wilson and Carson, 2003). Molecular methods

Advances in disease diagnosis and vaccine development (a)

(b)

(c)

(d)

201

Fig. 7.1 (See also Plate I) Examples of immunodiagnostic methods to detect fish pathogens in fish tissue. Detection of Renibacterium salmoninarum using indirect fluorescent antibody test, IFAT (a). Detection of Renibacterium salmoninarum using True Blue as substrate (b), Photobacterium damselae subspecies piscicida using 3,3′-diaminobenzidine (DAB) as substrate (c) and Streptococcus iniae using Fast Red as substrate (d) by immunohistochemistry, IHC. (Photographs (a)–(c) and (d) courtesy of Dr K D Thompson and Dr P Klesius, respectively)

generally have the highest sensitivity and are therefore particularly useful for detecting microorganisms that are present in low numbers or for those that are difficult to culture. In addition, molecular methods can be used for the identification of pathogens to species level (Puttinaowarat et al., 2000; Pourahmed, 2008) and in epidemiology for the identification of individual strains and differentiating closely related strains (Cowley et al., 1999). The PCR is the best known method, although there are many useful variations, including nested PCR, random amplification of polymorphic DNA (RAPD), reverse transcriptase-PCR (RT-PCR), reverse cross blot PCR (rcb-PCR) and RT-PCR enzyme hybridisation assay (Puttinaowarat et al., 2000; Wilson and Carson, 2003; Cunningham, 2004). Colony hybridisation has also been used successfully for the rapid identification of Vibrio anguillarum in fish (Aoki et al., 1989) and has the advantage of detecting both pathogenic and environmental strains (Powell and Loutit, 2004). Real-time PCR (also known as qPCR) offers quantification and high sample throughput. Real-

202


time PCR methods have recently been developed for a variety of significant fish bacterial pathogens, such as Aeromonas salmonicida (Balcázar et al., 2007), Piscirickettsia salmonis (Karatas et al., 2008) Renibacterium salmoninarum (Jansson et al., 2008) and Edwardsiella ictaluri (US Patent 6951726), and it is likely that this range will expand rapidly. Polygenic sequencing following PCR of specific genes is being recommended for the identification of some pathogens where differentiation of closely related species is difficult. For example, Pourahmed (2008) found that sequencing of three different genes was necessary to classify certain mycobacteria species from fish. A variety of novel rapid diagnostic methods are currently being developed that have potential for future application in the diagnosis of aquatic animal health. These were recently reviewed by Adams and Thompson (2008), and comparisons were made between these methods and existing technologies with regard to their advantages and disadvantages. Loop-mediated isothermal amplification (LAMP) is an emerging technology with potential for detection of fish and shellfish pathogens, and research tests to detect Edwardsiella tarda, E. ictaluri, Nocardia seriolae, and Flavobacterium psychrophilum (bacterial pathogens that cause edwardsiellois, enteric septicemia of catfish and nocardiosis, respectively), Tetracapsuloides bryosalmonae (the parasite that causes proliferative kidney disease, PKD) and infectious haematopoitic necrosis virus (IHNV) in fish and white spot syndrome virus (WWSV) in shrimp have already been developed (Savan et al., 2005; Manji, 2008). A commercial LAMP test kit is available for WSSV. The LAMP is a relatively new method for amplifying DNA which relies on autocycling strand displacement DNA synthesis and, since it is carried out under isothermal conditions, it can be performed without the use of a thermocycler. The method uses Bst DNA polymerase and a set of four specially designed primers (two inner and two outer primers) to recognise a total of six distinct sequences on the template DNA (Notomi et al., 2000). The main advantages of the method are the speed with which it can be performed, its sensitivity, and the fact that the results are read by eye, and, although the test requires the use of pipettes and an incubator, it does not require any other specialised equipment. Figure 7.2 (p. 203, see also colour section) shows the results of a LAMP test carried out to identify Flavobacterium psychrophilum, where a simple colour change in the tube from orange to green indicates a positive. Simple rapid field tests using lateral flow technology are also in development, and rapid kits are currently commercially available to detect infectious salmon anaemia virus (ISAV) and WSSV in shrimp. Although there are none yet for bacterial pathogens in fish, this type of technology has been successfully developed for clinical (Gatta et al., 2004) and veterinary use (Bautista et al., 2002) and offers simple field test capabilities.


203

Fig. 7.2 (See also Plate II) Example of a loop-mediated isothermal amplification (LAMP) test carried out using purified Flavobacterium psychrophilum DNA. Positive samples turn green and negative ones remain orange. LAMP is highly sensitive and specific, and is performed under isothermal conditions, needing minimal instrumentation. (Photograph courtesy of F. Manji)

There is also interest in the development of multiplex tests to simultaneously detect different pathogens in a single sample. Multiplex technologies such as the Luminex xMAPTM (a bead array) and microarray both have huge potential in this area, but these are currently expensive and labourintensive as assays are still being developed and optimised (Adams and Thompson, 2008). The xMap system theoretically offers simultaneous quantitative analysis of up to 100 different analytes from a single drop of sample in an integrated, 96-well formatted system (Dunbar, 2006). This is complex technology with huge potential as it can be used for vaccine development, through epitope mapping (Costa et al., 2007), as well as pathogen detection. This is flexible technology as antibodies, protein or DNA can be bound to the bead array. A number of research groups are also currently developing DNA and oligo microarray technology for diagnostics and these also will offer simultaneous detection of pathogens for the future (González et al., 2004; Matsuyama et al., 2006).

7.5 Advances in vaccine development A wide range of commercial vaccines is available against bacterial pathogens, with most targeting salmon and trout, with additional vaccines available for channel catfish, European seabass and seabream, Japanese

204


amberjack and yellowtail, tilapia and Atlantic cod (Thompson and Adams, 2004; Adams et al., 2005; Sommerset et al., 2005). The salmonid market presently uses heptavalent vaccines containing Listonella (Vibrio) anguillarum serotypes O1 and O2, V. salmonicida, Moritella viscosa, Aeromonas salmonicida, the causative agents of vibriosis, Hitra disease, winter ulcer disease, furunculosis and infectious pancreatic necrosis, respectively, and infectious pancreatic necrosis virus (IPNV). Due to environmental and control concerns in most countries only two bacterial vaccines (Edwardsiella ictaluri and Flavobacterium columnarae, causing Columnarus, for Channel catfish in the USA) and one viral vaccine (KHV for Carp in Israel) are presently commercially available as ‘live attenuated’ vaccines (Adams et al., 2005). Most of the commercial vaccines are based on inactivated bacterial pathogens, with fewer available for viral vaccines and none against parasites yet. The major producers of fish vaccines are now Intervet-Schering Plough Animal Health (The Netherlands), Novartis Animal Health (Switzerland), Pharmaq (Norway) and Microtek International Inc. (Canada). There are a number of smaller companies producing vaccines locally (e.g. autogenous vaccines), in different countries. Vaccines used in Japan are mostly developed and distributed by Japanese companies. Many new vaccines are in development (Thompson and Adams, 2004; Adams et al., 2005). The primary considerations for vaccines for aquaculture are cost-effectiveness and safety. Vaccines need to provide long-term protection against diseases on commercial fish farms. All the serotypic variants of the disease agent need to be considered, the time/age when the animal is most susceptible to disease, the route of administration and the method of vaccine preparation (i.e. inactivated whole cell, attenuated, subunit, recombinant). In order to develop an effective vaccine the protective antigens need to be identified and their protective response confirmed in the host species. The latter may be antibody mediated, cell mediated or both depending on the vaccine components. A practical method of administration and an inexpensive method of vaccine production also need to be established. It is important in vaccine development to work with the antigens that are expressed during infection rather than antigens expressed in the laboratory. Many salmon vaccines from the past are based on inactivated (whole cell) cultures of the pathogenic organism (usually inactivated in formalin) grown in vitro. In these cases the vaccines gave good protection (e.g. Vibrio vaccine); however, many pathogens appear to switch off important protective antigens when cultured in vitro. In such cases alternative methods of culture (e.g. the inclusion of an iron-chelating agent) are required so that expression of the important ‘protective’ antigens is induced (Neelam et al., 1993). This can be achieved by modifying the culture medium of the pathogen in vitro, as shown by Bakopoulos et al., (2003) and Jung et al., (2007) for Photobacterium damselae subsp. piscicida,

Advances in disease diagnosis and vaccine development kDa 201 116 80

205

kDa 201 116 80

42 33

42 33

18 7

18 7 1

(a)

2

3

4

5

6

7

8

1

2

3

4

5

6

7

8

(b)

Fig. 7.3 Western blot analysis of Photobacterium damselae subspecies piscicida after culture of the bacterium in different media (1–8), showing that different proteins are expressed under different culture conditions. Blot (a) used rabbit serum while blot (b) was performed with fish serum where many fewer antigens were recognised. (Photographs courtesy of Dr V Bakopoulos)

the pathogen that causes pasteurellosis. The effects of altering the constituents of the media for culturing P. damselae subsp. piscicida in the laboratory on antigen expression are illustrated in Fig. 7.3, where differences are observed in the antigens expressed/recognised by fish sera between media 1, 7 and 8, for example (Fig. 7.3a, b). Some antigens appear to be up-regulated whilst others are down-regulated. This also serves to highlight the difference between mammalian and fish immune systems, as fish (Fig. 7.3b) recognise many fewer antigens than rabbits (Fig. 7.3a). An alternative approach is to place the pathogen of interest inside the peritoneal cavity of fish, enclosed in sealed chambers (that permit the exchange of small molecules only), so that antigen expression in vivo can be determined (Bakopoulos et al., 2004; Poobalane, 2007; Jung et al., 2008). Figure 7.4 shows how R. salmoninarum alters the expression of surface molecules when the bacterium is cultured in vivo or in vitro. Bacterial cells appears smooth and rounded when cultured in vitro in contrast to those cultured inside the host fish. Application of sera from fish (that have been infected with the disease of interest and then recovered) in Western blot analysis on one- or two-dimensional gels (immunoprotomics) can then pinpoint potential vaccine candidates that can then be identified and vaccines produced (e.g. a recombinant vaccine against Aeromonas hydrophila, Poobalane, 2007). Of course these antigens may be expressed and the fish may respond by producing antibodies to them, but they may or may not be protective. Thus, challenge of vaccinated and nonvaccinated fish is then performed to establish if the vaccine is actually protective.

206

(a)


(b)

Fig. 7.4 Electron micrographs (EM) of Renibacterium salmoninarum cultured in vitro and in vivo, illustrating the differential expression of bacterial surface molecules when bacteria are cultured in the laboratory or inside fish. (Photographs courtesy of Dr K D Thompson)

Fish vaccines have become much more sophisticated since the mid1990s. Technologies such as recombinant and DNA vaccines are powerful tools for vaccine development (Leong et al., 1997; Smith, 2000) as these enable the isolation of potential protective antigens from suppressive ones. These are being developed because the simpler approach of using inactivated whole cell vaccines did not succeed for many of the important diseases, and attempts at attenuated vaccines in general have not been encouraged from a safety point of view (Benmansour and de Kinkelin, 1997). An IPNV vaccine based on a recombinant expressed viral protein has been developed (Frost and Ness, 1997) and has been on the market for several years for use in salmon in Norway, but the licensing of other recombinant vaccines has been slow. DNA vaccines for fish have been shown to be effective when based on DNA-sequences encoding for rhabdovirus glycoproteins (Lorenzen and La Patra, 2005) and the first DNA vaccine has been licensed in Canada against IHNV. Vaccines for fish can be administered by a variety of different methods, i.e. injection (intramuscular or intra-peritoneally), immersion (bath or dipvaccination) or orally. There is much interest in developing oral vaccines as this is the most practical method of administration. In the absence of natural exposure, booster vaccination is needed to maintain immunity. Oral vaccine boosters have been used successfully and are marketed commercially. For example, oral vaccines are available against enteric red mouth (ERM) and vibriosis in rainbow trout, and against furunculosis and IPNV in salmon (Meeusen et al., 2007). These vaccines employ an antigen protection vehicle to protect vaccines from the acid environment of the fish


207

stomach, and improved delivery systems are currently being researched for a variety of vaccines.

7.6 Other emerging methods to control pathogens Close monitoring of stocks to ensure early detection of pathogens causing disease problems (and effective treatment) and vaccination to prevent infections are clearly not the only methods of disease control. Farmers can take a number of measures to manage the impact on healthy stocks, including improved nutrition/diet, and maintaining stocking densities at levels that optimise growth and avoid over-crowding that reduces the ability for the animal to resist infections. Immunostimmulants (e.g. glucans) added to diets have been reported to enhance the immune system of the fish in the short term, when applied either on their own or in vaccines as adjuvants, and are reported to be very affective at stimulating the nonspecific defense mechanisms of the animal (Thompson and Adams, 2004; Peddie and Secombes, 2005). Other dietary additives are also being used, sometimes to target specific diseases, e.g. addition of vitamin E to target salmon pancreas disease (SPD). A wide range of modified diets and immunostimulants is available commercially and many new products are being researched (Bricknell and Dalmo, 2005; Peddie and Secombes, 2005). In addition, probiotics are widely used in some countries (Birkbeck, 2004). Reducing the risk of exposure to, or impact on, healthy populations is also an effective alternative approach to pathogen control. Molecular methods (e.g. PCR) are ideal technologies to use for screening fish broodstock and eggs for the presence of pathogens, and as long as large enough sample sizes are tested (e.g. for eggs) this may prove to be an effective method of reducing the reservoir of specific pathogens on fish farms. Recently, Manji (2008) reported that, although the prevalence of Flavobacterium psychrophilum in rainbow trout eggs was very low (1–2.4 %) this still led to spread of disease (rainbow trout fry syndrome, RTFS) and mortalities when these eggs were grown on. In this study it was necessary to test at least 300 eggs per batch in the screening process. The long-term approach to disease control is through the selection of disease-resistant strains or families of fish, and much research is currently focused on fish genotype and disease susceptibility (Biacchesi et al., 2007). Selective breeding programs have been shown to have large beneficial effects on production and quality traits in cold-water fish species, but only a small percentage of aquaculture production is based on genetically improved fish and shellfish (Gjedrem, 2000). Resistance is a complex quantitative trait that is likely to be affected by many genes (Gjedrem

208


et al., 1991; Grimholt et al., 2003). To select for disease resistance it is necessary to challenge a large number of animals and measure each family’s overall performance for the trait. Genes associated with disease and stress resistance are now being identified and their characteristics will be used as identifiers (markers) for selective breeding of disease- and/or stress-resistant individuals (Moen et al., 2004). This approach should continue to be pursued, bearing in mind that increased resistance to one pathogen can result in decreased resistance to other pathogens. As more nucleotide sequences become available for fish bacterial pathogens, this will provide opportunities to develop innovative alternative disease control methods. Recently, following the sequencing of R. salmoninarum, Sudheesh et al. (2007) described the identification of a new class of drug (phenyl vinyl sulfone) which inhibits the activity of a very important enzyme (sortase) in R. salmoninarum. Inhibition of this enzyme appears to dramatically reduce the virulence of the bacterium by interfering with the ability of the bacterium to adhere and colonise fish cells. This drug could offer a promising alternative to antibiotics to control bacterial kidney disease in fish, and this type of approach holds potential for future control of bacterial disease in general for fish.

7.7 Future trends Technologies to assist with disease control are moving at a rapid pace. Careful consideration must be given to selecting which methods to take forward and apply in aquaculture. Vaccines need to be cost-effective and safe, and pathogen detection methods should be robust yet sensitive. There are many innovative technologies that may fulfil these criteria and provide new vaccines and useful diagnostics tools. It is important, however, that the diagnostics methods already developed are standardised and fully validated, if they are considered useful, and that new technologies do not supersede these just because they are novel methods. They need to have clear advantages over the existing methods for use in aquaculture. Nanotechnology is an area being explored for the detection of pathogens in food (Kim et al., 2007) and in clinical and veterinary diagnostics, and this may prove extremely useful for application in diagnostics for aquatic animals. Nanotechnology is generally used when referring to materials of 0.1–100 nanometres; however, it is also inherent that these materials should display different properties from bulk (or micrometric and larger) materials as a result of their size. These differences include physical strength, chemical reactivity, electrical conductance, magnetism and optical effects. Such technology offers the ability to detect extremely low


209

levels of pathogens very quickly, and progress has already been made for the identification of foodborne pathogens (Joseph and Morrison, 2006). Recently, the focus is on different types of sensors to detect pathogens and immunomagnetic reduction (IMR) technology has been reported for the detection of low levels of the H5N1 virus that causes bird flu (Yang et al., 2008). In this method magnetic nanoparticles were coated with antibody and a high-transition-temperature superconductive quantum interference device was used to sense the immunomagnetic reduction of the reagents. Nanotechnology is also being used in conjunction with proteomics (Marko et al., 2007) and may be a useful technology to identify markers of disease and vaccine antigens. Immunoprotomics, as discussed in Section 7.5, is also known as ‘reversed vaccinology’ and has recently been successfully used for the development of a recombinant vaccine against A. hydrophila for carp (Poobalane, 2007). Other technologies with the same approach are knockout technologies, which indicate whether specific antigens are essential or important for survival of the pathogen in the host. These methods have great potential for the future and include RNA interference where expression of certain genes is blocked by antisense RNA (Melamed et al., 2002), in vivo expression technologies, IVET (Rainey and Preston, 2000), and signature tagged mutagenesis (Saenz and Dehio, 2005). The information obtained from a variety of these techniques is combined with data from existing literature to identify potential vaccine candidate antigens for cloning and for recombinant expression (Adams et al., 2005). Delivery of DNA vaccines using bacteriophages has been reported to be successful in a number of animals including fish (Skurnik and Strauch, 2006). The phage particles used are non-infectious and only grow on specialised laboratory strains of bacteria; the phage coat protects the vaccine from degradation and allows the host’s immune system to process it more efficiently (March et al., 2004; Clark and March, 2006). This technology may be extremely useful for oral delivery of DNA vaccines for fish. Gene sequencing underpins many of the new technologies being developed both for diagnostics and vaccine development and, as gene sequences become available for both pathogens and the host fish species, microarrays can be developed. These will enable very rapid progress to be made in fish health control for the future.

7.8 Sources of further information and advice In addition to the references cited there are numerous websites that provide useful information and advice. These are summarised in Table 7.1.

210


Table 7.1

Sources of further information and advice

Name of organisation or project

Website address

AquaFirst AquaNet CEFAS (Centre for Environment. Fisheries and Aquaculture Science) DipNet (An EU funded project investigating disease interaction and pathogen exchange between farmed and wild aquatic animal populations) EAFP (European Association of Fish Pathologists) EPIZONE – Network of Excellence for Epizootic Disease Diagnosis and Control EUROCARP FAO (Food and Agriculture Organisation of the United Nations) FAO oneFish Community Directory Project (aquaculture/diseases) FEAP (Federation of European Aquaculture Producers) FishEggTrade (An EU funded project appraising of the zoosanitary risks associated with trade and transfer of fish eggs and sperm) Fish Health Section of the American Fisheries Society Fish Health Section of the Asian Fisheries Society Fisheries Research Services IAAAM (International Association for Aquatic Animal Medicine) IMAQUANIM (EU funded project: Improved immunity of aquaculture animals) International Database for Aquatic Animal Diseases ISAAE (International Society of Aquatic Animal Epidemiology) NACA (Network of Aquaculture Centres in Asia-Pacific) OIE Aquatic Animal Health Standards Commission OIE Designated Experts and Reference Laboratories for Aquatic Animal Diseases PANDA (Permanent Advisory Network for Diseases in Aquaculture) WAS (World Aquaculture Society)

http://aquafirst.vitamib.com http://www.aquanet.ca http://www.cefas.co.uk http://www.dipnet.info

http://www.eafp.org http://www.epizone-eu.net http://eurocarp.haki.hu http://www.fao.org http://www.onefish.org/id/10752 http://www.feap.info/feap http://cordis.europa.eu/life/src/ control/qlk2-ct-2002-01546.htm http://www.fisheries.org/units/fhs/ http://afs-fhs.seafdec.org.ph/ http://www.marlab.ac.uk/ http://www.iaaam.org http://imaquanim.dfvf.dk/info/ http://www.collabcen.net http://www.isaaepi.org/modules/news/ http://www.enaca.org http://www.oie.int/aac/eng/en_fdc.htm http://www.oie.int/fdc/eng/Diseases/ en_reflabslist.htm http://www.europanda.net http://www.was.org


211

7.9 References adams a (1992) Sandwich enzyme linked immunosorbent assay (ELISA) to detect and quantify bacterial pathogens in fish tissue, in Stolen J S, Fletcher T C, Kaattari S L and Rowley A F (eds), Techniques in Fish Immunology, Vol. 2, SOS Publications, Fair Haven, NJ, 177–84. adams a (2004) Immunodiagnostics in aquaculture, Bull Eur Assoc Fish Pathol, 24, 33–7. adams a and marin de mateo m (1994) Immunohistochemical detection of fish pathogens, in Stolen J S, Fletcher T C, Kaattari S L and Rowley A F (eds), Techniques in Fish Immunology, Vol. 3, SOS Publications, Fair Haven, NJ, 133–44. adams a and thompson k d (1990) Development of an ELISA for the detection of Aeromonas salmonicida in fish tissue, J Aquat Animal Health, 2, 281–8. adams a and thompson k d (2006) Biotechnology offers revolution to fish health management, Trends Biotechnol, 24, 201–5. adams a and thompson k d (2008) Recent applications of biotechnology to novel diagnostics for aquatic animals, Rev Sci Tech Off Int Epiz, 27, 197–209. adams a, thompson k d, morris d, farias c and chen s c (1995) Development and use of monoclonal antibody probes for immunohistochemistry, ELISA and IFAT to detect bacterial and parasitic fish pathogens, Fish Shellfish Immunol, 5, 537–47. adams a, aoki t, berthe f c j, grisez l and karunasagar i (2005) Recent technological advancements on aquatic animal health and their contributions towards reducing disease risks – a review, in Bondad-Reantaso M G, Mohan C N, Crumlish M and Subasinghe R P (eds), Disease in Asian Aquaculture VI, Proceedings of the sixth symposium on diseases in Asian aquaculture, Fish Health Section, Asian Fisheries Society, Manila, 71–88. adkison m a, gilad o and hedrick r p (2005) An enzyme linked immunosorbent assay (ELISA) for detection of antibodies to the koi herpesvirus (KHV) in the serum of koi Cyprinus carpio, Fish Pathol, 40(2), 53–62. aoki t, hirono i, de castro t and kitao t (1989) Rapid identification of Vibrio anguillarum by colony hybridization, J Appl Ichthyol, 5, 67–73. bakopoulos v, pearson m, volpatti d, gousmani l, adams a, galeotti m, richards r h and dimitriadis g j (2003) Investigation of media formulations promoting differential antigen expression by Photobacterium damsela ssp. piscicida and recognition by sea bass, Dicentrarchus labrax (L.), immune sera, J Fish Dis, 26, 1–13. bakopoulos v, hanif a, poulos k, galeotti m, adams a and dimitriadis g j (2004) The effect of in vivo growth on the cellular and extracellular components of the marine bacterial pathogen Photobacterium damsela subsp. piscicida, J Fish Dis, 27, 1–13. balcázar j l, vendrell d, de blas i, ruiz-zarzuela i, gironés o and múzquiz j l (2007) Quantitative detection of Aeromonas salmonicida in fish tissue by realtime PCR using self-quenched, fluorogenic primers, J Med Microbiol, 56, 323–8. bautista d a, elankumaran s, arking j a and heckert r a (2002) Evaluation of an immunochromatography strip assay for the detection of Salmonella sp. from poultry, J Vet Diagn Invest, 14, 427–30. benmansour a and de kinkelin p (1997) Live fish vaccines: history and perspectives, in Gudding R, Lillehaug A, Midtlyng P J and Brown F (eds), Fish Vaccinology Developments in Biological Standardization, Karger, Basel, 279–89. berg a, rødseth o m and hansen t (2007) Fish size at vaccination influence the development of side-effects in Atlantic salmon (Salmo Salar L.), Aquaculture, 265, 9–15.

212


biacchesi s, le berre m , le guillou s, benmansour a, brémont m, quillet e and boudinot p (2007) Fish genotype significantly influences susceptibility of juvenile rainbow trout, Oncorhynchus mykiss (Walbaum), to waterborne infection with infectious salmon anaemia virus, J Fish Dis, 30, 631–6. birkbeck t h (2004) Role of probiotics in fish disease prevention, in Leung K A (ed.), Current Trends in the Study of Bacterial and Viral Fish and Shrimp Diseases. Molecular Aspects of Fish and Marine Biology, Vol. 3, World Scientific, Singapore, 390–416. bricknell i and dalmo r a (2005) The use of immunostimulants in fish larval aquaculture, Fish Shellfish Immunol, 19, 457–72. clark j r and march j b (2006) Bacteriophages and biotechnology: vaccines, gene therapy and antibacterials, Trends Biotechnol, 24, 212–18. costa j z, adams a, bron j e, thompson k d, starkey w g and richards r h (2007) Identification of B-cell epitopes on the betanodavirus capsid protein, J Fish Dis, 30, 419–26. cowley j a, dimmock c m, wongteerasupaya c, boonsaeng v, panyim s and walker p j (1999) Yellow head virus from Thailand and gill-associated virus from Australia are closely related but distinct prawn viruses, Dis Aquatic Org, 36, 153–7. cunningham c o (2004) Use of molecular diagnostic tests in disease control: making the leap from laboratory to field application, in Leung K-Y (ed.) Current Trends in the Study of Bacterial and Viral Fish and Shrimp Diseases, Molecular Aspects of Fish and Marine Biology, Vol. 3, World Scientific, Singapore, 292–312. dunbar s a (2006) Applications of Luminex® xMAPTM technology for rapid, highthroughput multiplexed nucleic acid detection, Clin Chim acta, 363, 71–82. fournier p e and raoult d (2003) Comparison of PCR and serology assays for early diagnosis of acute Q fever, J Clin Micro, 41, 5094–98. frost p and ness a (1997) Vaccination of Atlantic salmon with recombinant VP2 of infectious pancreatic necrosis virus (IPNV), added to a multivalent vaccine, suppresses viral replication following IPNV challenge, Fish Shellfish Immunol, 7, 609–19. gatta l, perna f, ricci c, osborn j f, tampieri a, bernabucci v, miglioli m and vaira d (2004) A rapid immunochromatographic assay for Helicobacter pylori in stool before and after treatment, Alim Pharmacol Therapeut, 20, 469–74. gjedrem t (2000) Genetic improvement of cold-water fish species, Aquac Res, 31, 25–33. gjedrem t, salte r and gjoen h m (1991) Genetic-variation in susceptibility of Atlantic salmon to furunculosis, Aquaculture, 97, 1–6. gonzález s f, krug m j, nielsen m e, santos y and call d r (2004) Simultaneous detection of marine fish pathogens by using multiplex PCR and a DNA microarray, J Clin Microbiol, 1414–19. grimholt u, larsen s, nordmo r, midtlyng p, kjoeglum s, storset a, saebo s and ste r j (2003) MHC polymorphism and disease resistance in Atlantic salmon (Salmo salar); facing pathogens with single expressed major histocompatibility class I and class II loci, Immunogenetics, 55, 210–19. jansson e, lindberg l, säker e and aspán a (2008) Diagnosis of bacterial kidney disease by detection of Renibacterium salmoninarum by real-time PCR, J Fish Dis, 31, 755–63. jung t s, thompson k d, volpatti d, galeotti m and adams a (2007) Variation in the molecular weight of Photobacterium damselae subsp. piscicida antigens when cultured under different conditions in vitro, J Vet Sci, 8, 255–61. jung t s, thompson k d, volpatti d, galeotti m and adams a (2008) In vivo morphological and antigenic chracateristics of Photobacterium damselae subsp. piscicida, J Vet Sci, 9, 169–75.


213

karunasagar i, nayak b b and karunasagar i (1997) Rapid detection of Vibrio parahaemolyticus from fish by polymerase chain reaction, in Flegel T W and MacRae L H (eds), Diseases in Asian Aquaculture III, Asian Fisheries Society, Manila, 119–22. karatas s, mikalsen j, steinum t m, taksdal t, bordevik m and colquhoun d j (2008) Real time PCR detection of Piscirickettsia salmonis from formalin-fixed paraffin-embedded tissues, J Fish Dis, 31, 747–53. kim g, om a s and mun j h (2007) Nano-particle enhanced impedimetric biosensor for detedtion of foodborne pathogens, J Phys: Conf Ser, 61, 555–9. klesius p, evans j, shoemaker c, yeh h, goodwin a e, adams a and thompson k d (2006) Rapid detection and identification of Streptococcus iniae using a monoclonal antibody-based indirect fluorescent antibody technique, Aquaculture, 258, 180–6. leong j c, anderson e, bootland l m, chiou p w, johnson m, kim c, mourich d and trobridge g (1997) Fish vaccine antigens produced or delivered by recombinant DNA technologies, in Gudding R, Lillehaug A, Midtlyng O J and Brown F (eds), Fish Vaccinology. Developments in Biological Standardization, Karger, Basel, 267–77. lorenzen n and la patra s e (2005) DNA vaccines for aquacultured fish, Rev Sci Tech Off Int Epiz, 24, 201–13. manji f (2008) Development of methods to determine prevalence of Flavobacterium psychrophillum in farm systems, PhD Thesis, University of Stirling, UK. march j b, clark j r and jepson c d (2004) Genetic immunisation against hepatitis B using whole bacteriophage lambda particles, Vaccine, 22, 1666–71. markestad a and grave k (1997) Reduction of antibacterial drug use in Norwegian fish farming due to vaccination, in Gudding R, Lillehaug A, Midtlyng O J and Brown F (eds), Fish Vaccinology. Developments in Biological Standardization, Karger, Basel, 365–9. marko n f, weil r j and toms s a (2007) Nanotechnology in proteomics, Expert Rev Proteomics, 4, 617–26. matsuyama t, kamaish t and oseko n (2006) Rapid discrimination of fish pathogenic Vibrio and Photobacterium species by oligonucleotide DNA array, Fish Pathol, 41, 105–12. meeusen e n t, walker j, peters a, pastoret p-p and jungersen g (2007) Current status of veterinary vaccines, Clinical Microbiology Reviews, 20, 489–510. melamed p, gong z, fletcher g and hew c l (2002) The potential impact of modern biotechnology on fish aquaculture, Aquaculture, 204, 255–69. miles d j c, thompson k d, lilley j h and adams a (2003) Immunofluorescence of the epizootic ulcerative syndrome pathogen, Aphanomyces invadans, using monoclonal antibodies, Dis Aquat Org, 55(1), 77–84. moen t, fjalestad k t, munck h and gomez-raya l (2004) A multistage testing strategy for detection of quantitative trait loci affecting disease resistance in Atlantic salmon, Genetics, 167, 851–8. neelam b, robinson r a, price n c and stevens l (1993) The effect of iron limitation on the growth of Aeromonas salmonicida, Microbios, 74, 59–67. notomi t, okayama h, masubuchi h, yonekawa t, watanabe k, amino n and hase t (2000) Loop-mediated isothermal amplification of DNA, Nucleic Acids Res, 28(12), 63. palmer-densmore m l, johnson a f and sabara m i (1998) Development and evaluation of an ELISA to measure antibody responses to both the nucleocapsid and spike proteins of canine coronavirus, J Immunoassay, 19, 1–22. peddie s and secombes c j (2005) An overview of fish immunostimulant research, Fish Vet J, 8, 1–31.

214


poobalane s (2007) Aeromonas hydrophila vaccine development using immunoproteomics, PhD Thesis, University of Stirling, UK. pourahmed f (2008) Molecular detection and identification of aquatic mycobacteria, PhD Thesis, University of Stirling, UK. powell j l and loutit m w (2004) Development of a DNA probe using differential hybridization to detect the fish pathogen Vibrio anguillarum, Microb Ecol, 28, 365–73. puttinaowarat s, thompson k d and adams a (2000) Mycobacteriosis: detection and identification of aquatic Mycobacterium species, Fish Vet J, 5, 6–21. rainey p b and preston g m (2000) In vivo expression technology strategies: valuable tools for biotechnology, in Curr Opin Biotechnol, 11, 440–4. rose a s, ellis a e and adams a (1989) An assessment of routine Aeromonas salmonicida carrier detection by ELISA, Bull Eur Assoc Fish Pathol, 9, 65–7. savan r, kono t, itami t and sakai m (2005) Loop-mediated isothermal amplification: an emerging technology for detection of fish and shellfish pathogens, J Fish Dis, 28, 573–81. saenz h l and dehio c (2005) Signature-tagged mutagenesis: technical advances in a negative selection method for virulence gene identification, Curr Opin Microbiol, 8, 612–19. skurnik m and strauch s (2006) Phage therapy: facts and fiction, Int J Med Microbiol, 296, 5–14. smith p d (2000) Vaccines and vaccination – a widening choice, Fish Farmer, 23(6), 45–53. sommerset i, krossoy b, biering e and frost p (2005) Vaccines for fish in aquaculture, Future Drugs, Expert Review of Vaccines, 4, 89–101. steiropoulos n a, yuksel s a, thompson k d, adams a and ferguson h w (2002) Detection of Rickettsia-like organisms (RLOs) in European sea bass (Dicentrarchus labrax, L.) by immunohistochemistry, using rabbit anti-Piscirickettsia salmonis serum, Bull Eur Assoc Fish Pathol, 22(5), 428–32. sudheesh p s, crane s, cain k d and strom m s (2007) Sortase inhibitor phenyl vinyl sulfone inhibits Renibacterum salmoninarum adherence and invasion of host cells, Dis Aquat Org, 78, 115–27. thompson k d and adams a (2004) Current trends in immunotherapy and vaccine development for bacterial diseases of fish, in Leung K-Y (ed.), Current Trends in the Study of Bacterial and Viral Fish and Shrimp Diseases. Molecular Aspects of Fish and Marine Biology, Vol. 3, World Scientific, Singapore, 313–62. vatsos i n, thompson k d and adams a (2002) Development of an immunofluorescent antibody technique (IFAT) and in situ hybridisation to detect Flavobacterium psychrophilum in water samples, Aquac Rese, 33, 1087–90. wilson t and carson j (2003) Development of sensitive, high-throughput one-tube RT-PCR-enzyme hybridisation assay to detect selected bacterial fish pathogens, Dis Aquatic Org, 54, 127–34. yang s y, chieh j j, wang w c, yu c y, lan c b, chen j h, horng h e, hong c y, yang h c and huang w (2008) Ultra-highly sensitive and wash-free bio-detection of H5N1 virus by immunomagnetic reduction assays, J Virol Meth, 153, 250–2. yuce a, yucesoy m, genc s, sayan m and ucan e s (2001) Serodiagnosis of tuberculosis by enzyme immunoassay using A60 antigen, Clin Microbiol Infect, 7, 372–6. world organisation for animal health (2006) Manual of Diagnostic Tests for Aquatic Animals, 5th edn, OIE, Paris.

8 Controlling parasitic diseases in aquaculture: new developments C. Sommerville, University of Stirling, UK

Abstract: The expanding global aquaculture industry is urgently in need of more effective methods for the control of parasitic diseases. Advances in our understanding of parasite biology, host parasite interactions and improved diagnostic methods using new technologies which contribute to better management and control are highlighted in this chapter. There is an increasing volume of research pointing to effective control without the use of chemical interventions. The processes leading to increasing regulation and cost of drugs and chemicals are described. Their integration into a more sustainable pest management strategy is discussed and the imperative for the inclusion of resistance management principles in any strategy is emphasised. Key words: aquaculture, parasites, disease control, new developments, integrated pest management.

8.1 Introduction Aquatic parasites attracted little attention until the large-scale development of intensive aquaculture in the early 1970s created a surge of interest in parasitic diseases, resulting in an increase in our knowledge and understanding of parasites of aquatic organisms generally. The high fish density associated with culture intensification leads to increased chances of parasite/host encounters which inevitably results in a higher parasite prevalence and intensity. Parasitic diseases can impact on aquaculture systems in a number of ways which will determine their economic cost (Sommerville, 1998). Mortality has evident costs determined by the size and age of the fish but, more often, parasite infection causes morbidity and loss of appetite with a resultant waste of food, reduced food conversion efficiency and specific growth rate which, over a grow-out period in a population of fish, may account for a noteworthy proportion of the profits. In some cases

216


parasite infections may be zoonotic, or reduce the market value owing to their large size or unaesthetic appearance, and this has been known to cause rejection of entire stocks of fish even where there was no discernible impact on the welfare of the fish; other parasitic infections may affect broodstock quality. The scarcity of taxonomists with expertise in aquatic parasites has always been a problem. It was, and is still, common to encounter undescribed parasites in fish and new methods are needed to aid non-specialists. It is necessary to underpin research into parasite control in aquaculture systems with studies on parasite biology and the host–parasite interactions for several reasons. In the first place, it is important to establish whether it is necessary to intervene as some parasites have no impact on the growth performance or wellbeing of the culture species and, secondly, what threshold level of infection is sustainable without treatment. Understanding the host–parasite interactions can lead to targets for drugs or other nonchemical treatments and knowledge of the life cycle of the parasite is key to making appropriate intervention at the right time. Many parasites have complex life cycles and knowledge of the location of transmission stages and vectors is essential for prevention of infection and management of the disease without the use of drugs or chemicals. However, commonly, the method of choice for the control of parasitic problems in fish has been chemotherapy, despite the availability of a range of non-invasive methods. The following discussion will illustrate how the potential of new methodologies to study the issues noted above may lead to more effective control.

8.2 Effects of parasitic disease in aquaculture In today’s aquaculture industry, parasite epizootics continue to have major economic consequences, and there is an urgent need to find more effective methods of control. The magnitude of the economic losses has increased as a result of the size of the operations, as in the salmon mariculture industry, and the greater part of the economic costs are currently due to only a small number of parasite pathogens. For example, the estimated cost to the industry of sea lice infections can be as high as 5 % of annual costs in growth alone (Rae, 2002). Drugs and chemical treatments have become an increasingly significant component of the production costs of aquaculture since the 1980s. Most of the early, cheaper, treatments are no longer available and the new treatments have been specifically tailored to aquaculture requirements and therefore are at higher cost. As a result of the widespread outbreaks of disease, attempts are now being made to regulate the aquaculture industry at governmental level, although this varies from country to country (Scarfe et al., 2006). The primary objective is to control the movements of fish across boundaries in a manner which minimises the risk of the spread of disease. A further major

Controlling parasitic diseases in aquaculture: new developments

217

objective is the regulation of the use of drugs and chemicals which are used to treat disease with a view to developing good practices which will protect the consumer and the environment without compromising the welfare of the fish (see below). There is now a greater awareness of biosecurity in aquaculture on a global scale (Subasinghe and Bondad-Reantaso, 2006). Legislation is now becoming widespread and is coupled with better techniques for detection of low levels of chemical/drug contamination of food products (Reimschuessel, 2008). The impact of exotic parasites on native fauna has been recognised since the spread of rainbow trout, common carps, tilapias and eels around the globe. Indigenous species often have little defence against ‘foreign’ parasites and, without the benefits from evolution, may succumb rapidly. Unfortunately little control was exercised and efforts to contain further spread have often been too little, too late; many cosmopolitan pathogenic parasites have been recognised, e.g. the ciliate Ichthyophthirius multifiliis originated in the tropics of Asia and now extends into the sub-arctic regions (Valtonen and Keränen, 1981). Plans for quarantine systems to contain parasitic diseases have been identified since the early 1980s and taken up by governments and major agencies, e.g. FAO (Arthur, 1996; Subasinghe and Arthur, 1997; Subasinghe, 2004), but implementation at country or regional level for the most part seems to have been half-hearted. Thus, the transfaunation of fish parasite pathogens across global boundaries has been largely avoidable but has been facilitated through misjudgement, often founded on lack of knowledge of the parasite pathobiology. There has, to date, not been sufficient expertise available in vulnerable countries at a high enough level to understand the need for, and to implement effectively, preventative practices into the regulatory process. Expertise has been growing rapidly since the 1970s and most countries for which fish culture is a significant source of income and/or protein now have some diagnostic and advisory personnel who make recommendations on how to treat parasite problems (Scarfe et al., 2006). Organisations responsible for protection of wild stocks have been drawn into debates on the potential introduction and spread of parasite pathogens through aquaculture activities. These can be highly controversial, as in the case of sea lice. Concentration of research efforts on these problems has been ultimately beneficial to the aquaculture industry. For example, there has been widespread concern that mariculturalists do not effectively control sea lice infections and that these are the source of lice seen on wild salmonids, currently a major issue in Canada, see for example Krkosˇek et al. (2005). This has been hotly debated and is the cause of deep political division. Some have gone so far as to blame the decline in salmon and sea trout populations on sea lice infection from the farming activities to the extent that Canada, Norway and Scotland have invested considerable research effort in trying to demonstrate conclusively whether this is the case and it is very publicly debated in these countries (McVicar, 2004; Heuch et al.,

218


2005; Krkosˇek et al., 2005, 2006, 2007; Boxaspen, 2006; Hilborn, 2006; Hume, 2008; Penston et al., 2008). A benefit of this controversy is the allocation of funding to try to find new and sustainable methods of control, some of which are now the subject of legislation. Similarly, the research associated with the protection of wild salmon parr from the monogenean Gyrodactylus salaris has contributed to our understanding of host–parasite interactions, parasite virulence, epidemiology and phylogeny of this genus, many species of which are common in culture systems worldwide (Bakke et al., 2007). G. salaris is a non-virulent parasite of Baltic salmon which, when introduced into Norwegian rivers, has been associated with mass decline of Atlantic salmon stocks on which it becomes more virulent. Research in non-endemic countries has also led governments to develop risk analyses and containment policies.

8.3 Advances in the understanding of parasite biology and host–parasite interactions Knowledge of the pathogenic processes of many aquatic parasites is now well established, as is the greater impact on a host of an exotic parasite with which it has not evolved, for example, whirling disease in rainbow trout (Hedrick et al., 1999; Rose et al., 2000; Gilbert and Granath, 2003), Anguillicola crassus in European eels (Kennedy and Fitch, 1990; Würtz et al., 1998) and Myxidium leei in Mediterranean mariculture (Diamant, 1998). Perhaps less well recognised and researched are the influences and relationships a parasite has with other pathogens within the same host and their combined impact on the host. The modulated susceptibility of a host in the presence of one or more pathogens has been studied for higher animals and rates more attention in fish (Booth et al., 2008). Describing the parasite population dynamics in wild fish allows for the assessment of the influence of environmental factors which are commonly associated with temperature and season but, in cultured fish, parasite populations are also affected by husbandry factors such as stocking time, size, age and reproductive state of the host, grading, transportation events, etc. and these, in turn, affect the parasite management strategy; an intervention at the inappropriate time is costly without having any benefit. Monitoring, informed by the population dynamics, allows intervention at an early stage when prevalence (percent of fish infected) and mean intensity are low. The life cycles of parasites are influenced by many aspects of the environment. During its life the parasite may have to contend with several potentially hostile environments, i.e. one or more hosts, which may constitute unrelated taxa, as well as the external aquatic environment during free-living stages. Climatic influences, host reproductive cycles and behaviour will be superimposed on these factors and determine when the parasite reproduces, leaves the host, becomes dormant, etc. Such epidemiological infor-


219

mation is necessary both to prevent infection and to target any intervention (Giorgiadis et al., 2001). Mathematical models incorporating such data are increasingly being researched in order to analyse the risk of epidemics through the spread of pathogens across boundaries and to develop strategies for treatment and control, e.g. the risk of introducing Gyrodactylus salaris (Peeler and Thrush, 2004; Peeler et al., 2004). Most importantly, understanding the parasite biology and epidemiology has led to management solutions to a parasite problem without chemical intervention, for example, fallowing (Bron et al., 1993). Taylor et al. (2006) studied the complex interactions contributing to problem Argulus infections in stillwater trout fisheries in England and used risk analysis to identify contributing factors. A subsequent analysis of the risk factors pointed to low water clarity, slow stock turnover and high temperature influencing the abundance of Argulus, information which led to management of the infection without the use of chemicals. Knowledge of the biology and life cycle of a parasite pathogen is necessary for the efficient application of chemotherapeutants to the target stage. The need for targeted interventions is well exemplified with the use of various products which are useful against parasitic crustaceans. Crustacean parasites have a complex life history with numerous stages separated by moults. These stages are differentially susceptible (depending on the species) to the organophosphates (pre-adults) and the insect growth regulators (juveniles), while hydrogen peroxide, pyrethroids and emamectin benzoate have some activity against all stages. Excessive, ineffective use of pesticides with no economic benefit is harmful to the environment, the fish and the image projected by the industry to the public and the regulators, as well as contributing to the development of resistance (Jones et al., 1992). Mathematical models can help target effective control programmes, such as the life cycle model constructed by Tucker et al. (2002) to predict the outcomes of targeting treatments against different life stages of L. salmonis. Revie et al. (2005) used retrospective data on infection levels in Scottish fish farms with a view to advising the industry on a treatment strategy and Fenton et al. (2006) produced a population model of Argulus coregoni in Finnish trout ponds which pointed to variable egg hatching reducing the effectiveness of chemical control strategies in the field. Molecular epidemiology is applied to fish parasitic diseases but is not yet widespread. However, with the increase in genomics data and epidemiological studies, this is a promising area for future research in fish which has been successfully employed for the study of sea lice populations for example (Banks et al., 2000; Todd et al., 1997, 2004). A range of biochemical and immunohistochemical techniques have been important in elucidating host–parasite interactions. An exciting area for research which will ultimately result in new control strategies is the interplay between the immune responses of the fish to the parasite and the parasite’s immunomodulatory capability/activity. Whilst it reveals intrinsi-

220


cally interesting host–parasite interactions, at the same time it may reveal targets for vaccine developments. For example, Bell et al. (2000) mapped the secretory glands of L. salmonis and demonstrated peroxidase secreting glands in the oral region. Butler et al. (2000) developed immunoassays to evaluate the immunosuppressive activity of secretory products produced in vitro by L. salmonis copepodids in an artificial skin model. Progress has been made on identifying some of the products of the interaction (see Firth et al., 2000; Ross et al., 2000; Johnson et al., 2002; Fast et al., 2003, 2004). Future research using proteomics and microarrays to study gene expression together with RT-PCR and real-time PCR for L. salmonis will form a model for future studies of many such parasite–host systems. The application of DNA probes to histological sections using in situ hybridisation is not yet widespread but helped elucidate the life cycle in the fish of the pathogenic myxosporeans, PKX (Tetracapsuloides bryosalmonae) and Sphaerospora trutta, which were unknown and would have remained so without the use of this technique to detect the parasite in blood and other organs where it was otherwise not visible (Morris et al., 1999; Holzer et al., 2003).

8.4 Advances in methods of identifying parasites Early diagnosticians of parasitic diseases often had to be content with identification to the generic or even family level. With the greater number of experts researching aquatic pathobiology and new methodologies, the situation has improved considerably. Unfortunately, there are still few taxonomists, but there are more keys and more helpful techniques. Morphology-based techniques are still largely used such as SEM and TEM (scanning and transmission electron microscopy) and are essential for determining protozoa and other small histozoic stages of parasites. Basic morphology is supported by specific staining techniques, e.g. chaetotaxy (Shinn et al., 1998), and newer technologies such as confocal microscopy (McGurk et al., 2005; Arafa et al., 2007) and image analysis. Developments in image analysis have made it possible to analyse digitally shapes to extract the key features. Such data can then be subjected to a statistical classifier (Shinn et al., 2000). This has been most advanced in the automation of the discrimination of Gyrodactylus salaris from other salmonid species of the genus (Shinn et al., 2000). The key characteristics of species of the gyrodactylids are the size, shape, number, etc. of the hard parts, the sclerites, and these lend themselves readily to digital image analysis. Recent developments have shown that these can be semi-automated, thereby relieving the need for specialist taxonomists (Kay et al., 1999; Harris et al., 2008). This is especially helpful where pathogen monitoring systems are dependent on non-specialists and where introduction of only a single specimen of a species is risky, as is the case of Gyrodactylus salaris.


221

Parallel to these developments, and now having much wider potential, are PCR and DNA sequence analysis. The most common targets are the small sub-unit ribosomal RNA genes and the internal transcribed regions of rDNA loci. This technology has greatly increased our understanding of some groups such as the myxozoans which has made remarkable progress as a result. Prior to the molecular investigations of these parasites, this little-known group was thought to be protistan. However, they are now known to be highly specialised bilaterians close to the nematodes based on DNA sequences and ultrastructure. Further, it was demonstrated conclusively that a little-known group of sporozoan parasites of oligochaetes, the Actinosporea, are the alternate stages in the life cycle of the Myxosporea of teleosts, thus throwing the systematics into confusion. It is unlikely that these investigations would have been carried out if it wasn’t for the important myxozoan diseases in aquacultured fish, ‘Whirling Disease’, caused by Myxobolus cerebralis and ‘Proliferative kidney disease’ (PKD) caused by an unknown organism referred to as PKX. Subsequent studies on the Myxosporea have been able to link actinospore stages to myxospore stages, consequently elucidating the life cycles and reassigning them taxonomically using molecular phylogenetics. Molecular techniques are now so widely disseminated worldwide that descriptions of new parasite species are commonly accompanied by sequence data and there is a considerable gene bank resource to draw on. Molecular systematics is having a major effect on some taxa and it will be interesting to see how they overlay traditional taxonomy (Kent et al., 2001; Fiala, 2006; Holzer et al., 2007). Molecular techniques for the most part are more useful for parasitology than the immunodiagnostic techniques, e.g. IFAT and mAB probes, for reasons of simplicity, sensitivity and accuracy.

8.5 Advances in methods of controlling parasites 8.5.1 Non-chemical methods Aquaculturists have tended to use non-chemical methods only when chemotherapeutants were either inadequate or unavailable. Some nonchemical methods remain the most effective, such as manual removal of lymnaeid snails to control eye fluke and the introduction of a substrate to remove eggs of Argulus and leeches from ponds and lakes, although the modern adaptation of this two millennia-old Chinese method is to suspend plastic boards below the surface (Gault et al., 2002). Traditional horticultural methods, such as fallowing, were not introduced into salmon cage culture until the early 1990s (Bron et al., 1993). This, and single year class stocking, was shown to delay the build-up of sea lice populations until the fish are larger and less vulnerable to infection and, although it is largely a practice in maricultured salmon to minimise the effect of sea lice, it has benefits in relation to other diseases such as Furunculosis, as well as

222


environmental benefits allowing some recovery of the sea bed below cages. The length of the fallow period was determined from knowledge gained from research into sea lice life cycles coupled with economic factors. Biological control has always been a popular concept, but its success has never lived up to the expectation. A common application which probably arose from some of the attempts to control schistosomiasis, but which did not successfully translate into fish culture ponds, was the stocking of mollusc-eating fish to control problematic digenea such as eye flukes and zoonotic heterophyids (Ben-Ami and Heller, 2001). Perhaps the most successful biological control application for fish parasites is the use of wrasse for control of sea lice (Sayer et al., 1996). Members of the wrasse family (Labridae) feed from surfaces such as rocks but will remove lice from the surface of salmon when confined in cages along with the salmon. This method was widespread in Norway and Scotland in the 1990s but has largely declined as there are a number of disadvantages with wrasse which are costly to surmount. In the main, these are associated with the lack of domestication of the species. There is potential for improvement, but little development of the use of wrasse has taken place since the mid-1990s. The best use of wrasse is in conjunction with a range of other methods, targeted to assist juvenile and newly stocked fish for the first few months at sea and fits in well with a coherent integrated pest management (IPM) strategy for sea lice. Biopesticides are based on pathogenic microorganisms, bacteria, fungi, viruses, protozoa, nematodes, etc. and are specific to a target pest. They have a high potential for being more ecologically sound but are still at an early stage of research. Preliminary studies of potential biopesticides have already been carried out for L. salmonis (Sommerville and Harper, unpublished). The natural pathogens have been identified (Freeman, 2002; Treasurer and James, 2002; Freeman et al., 2003) and studies on viral and bacterial pathogens advanced. Biological control, whilst highly favoured by conservationists and organic culture agencies, e.g. Soil Association in the UK, has not been taken up enthusiastically by the industry apart from wrasse. However, with further research it is easy to envision the development of a biopesticide. Although none so far have been developed for an aquatic production system, the problems to be overcome are similar to those for terrestrial ones such as specificity, large-scale production, stabilisation, storage, product application registration, etc. The use of semiochemicals has been explored for the control of L. salmonis. Semiochemicals are species specific odours (kairomones) which aid in host location. These have been studied for L. salmonis and shown to affect behaviour of motile stages. It is suggested that these chemicals, once identified, could form the basis for control of the parasite, e.g. by use of lures, but its practicability has yet to be established (Ingvarsdóttir et al., 2002). Early recognition of a strong positive phototaxis exhibited by L. salmonis free-living copepodids led to the invention of a light lure by a Scottish company in 1996. This rather complex and expensive piece of


223

equipment was shown to be totally ineffective when suspended from sea cages (Gravil, 1996), illustrating the folly of imagining that what appears to be a relatively simple organism is responding to a single stimulus in its natural habitat. Understanding parasite biology is a very fertile field in the search for non-chemical controls. Ideally, these methods would be combined with an effective vaccination programme; however, the development of any commercial parasite vaccine has been elusive. Studies on fish immune responses to parasites abound and, from the early 1970s, were able to demonstrate humoral factors in response to parasite infection, although most studies failed to demonstrate protection. However, it is only with the greater understanding of the immune system in fish that more realistic approaches to parasite vaccine development have come about, such as those by Canadian workers, Ross et al. (2008), who have taken out a US patent for a recombinant vaccine against caligids (sea lice). Vaccine development has been most advanced for three parasite pathogens, namely Cryptobia salmositica, Ichthyophthirius multifiliis and Lepeophtheirus salmonis, through different approaches. Woo and colleagues developed a successful experimental live vaccine to an attenuated strain of Cryptobia salmositica and subsequently developed a recombinant DNA vaccine based on a 200 kDa metalloprotease (Tan et al., 2008). There is a substantial body of work describing the developments, summarised by Woo (2006). No useful attenuated strains of I. multifiliis have been described although controlled low dose administration of the parasite was shown to give protection as long ago as 1974 (Hines and Spira, 1974). Vaccine development has concentrated on immobilising antigens known as i-antigens which react specifically with ciliary membrane proteins. A number of IgG Class mAbs were identified which conferred protection (Dickerson and Clark, 1998) and are thought to be produced locally in the fish skin. Using molecular techniques, a substantial body of knowledge of the host parasite interactions has now been accrued which will ultimately lead to a vaccine. The development of a commercial vaccine has been delayed partly owing to the difficulty of axenic culture of the parasite in vitro on a commercial scale. Immobilisation antigens have been shown to produce protective immunity in channel catfish (Wang and Dickerson, 2002; Wang et al., 2002), and the cloned genes are expressed using a non-parasitic ciliate Tetrahymena thermophyla using plasmid vectors. A large amount of recombinant protein is produced which has been shown to produce protective immunity in channel catfish. The research associated with these developments is summarised by Dickerson (2006). Early attempts at vaccines against L. salmonis ranged from crude polyclonal antigens to recombinants (Raynard et al., 2002). Grayson et al. (1995) used a partially purified extract with limited success and Raynard et al. (1994) used recombinant louse proteins, although problems of funding halted progress of the research despite their identification of a B-galactoside

224


fusion protein which reduced fecundity in the parasite. The more recent studies such as those outlined by Johnson and Fast (2004) are designed to avoid dependence on concealed gut antigens, and the way forward would be to block immunosuppressive products secreted by the louse. Husbandry There is commercial activity in the production of specific pathogen-resistant stocks which involves the selection of families with natural resistance. Most research activity has been against viruses although some progress has been made with stocks showing resistance to sea lice, for example, research into the heritability of resistance to sea lice infection (Mustafa and MacKinnon, 1999; Glover et al., 2005). Commercial research is underway following promising lab-based selection of families with high resistance and field trials are planned. Similar work is being carried out with amoebic gill disease. These are necessarily long-term studies; however, if genetic linkages are identified, selection for resistance can be facilitated by means of marker assisted selection (MAS) and should accelerate the process (see Jones et al. (2002) for review of different approaches). Glover et al. (2007) investigated polymorphism in MHC genes to resistance to lice and found a link between susceptibility and MHC Class II. Should transgenics become acceptable in food fish, there may be a role for disease-resistant fish, but parasite-resistant transgenic farm animals are, at present, at the early experimental stage of development. Transgenic strategies to confer resistance to specific diseases include the transfer of major histocompatibility – complex genes, T-cell receptor genes, immunoglobulin genes, genes that affect lymphokines – as well as specific disease resistance genes (Niemann et al., 2005). Transgenic crops such as Bt crops which incorporate a gene encoding for the Bacillus thuringiensis (Bt) toxin which is poisonous to insect pests, have become accepted in the USA, and this technology may have potential for fish. However, the claim that there is a reduction in pesticide use is only clear so far with Bt cotton. This technology is highly controversial but is considered to be a useful, environmentally friendly control by the US Environmental Protection Agency, and insect-resistant management plans are mandatory with their use (for useful information see Insecticide Resistance Action Committee (IRAC) http://www.irac-online.org). Interestingly, surveillance data shows that a significant proportion of farmers break the rules. There is potential for the engineering of culture systems to minimise outbreaks of disease, e.g. eliminating pathogens through filtration of incoming water is becoming more widespread and economic. Land-based marine systems have avoided sea-lice infection and net-pens could be designed to avoid deformations due to crowding, which alter fish density and dose determination. The advanced design of recirculation systems offers the potential for greater control of pathogens generally, and offshore cages would be expected to include a high degree of environmental control but poorer disease monitoring.


225

Despite chemotherapy being the favoured control method by the aquaculture industry, improved husbandry to produce healthier, less stressed fish, improved diets and environmental conditions have contributed in a major way to disease control. Some diets are now available containing supplements which act as immunomodulators, improving the natural ability of the host to resist pathogens (Bricknell and Dalmo, 2005). Several in-feed immunomodulators, e.g. B-glucans, nucleotides, vitamins and yeast derivatives etc., have been tested in fish with parasite infection and apparently shown to have beneficial effects, e.g. sea lice (Burrells et al., 2001), Loma salmonae (Guselle et al., 2006 ). However, there are few fully scientific studies and data on the method of action are lacking. The results of research into light levels have also contributed to reduced stress.

8.5.2 Chemotherapy The search for a ‘quick fix’ has always been an industry goal. The ‘Medicine chest’ available in the beginnings of the current rapid expansion of intensive aquaculture was extremely limited in useful chemicals and dependent largely on extensive carp culture from the Middle and Far East and the ornamental fish trade. Some are still used in the ornamental trade and some, such as the highly toxic organochlorine insecticides, were banned from use in the 1970s and 1980s although may still be available and used in some parts of the world. Research efforts to find suitable treatment compounds were stepped up as new diseases emerged from the intensification process. Some 400 substances (including synonyms) are listed by Hoffman and Meyer (1974) of the Bureau of Sport Fisheries and Wildlife in the USA, accompanied by the minimum of advice and any available reference to their use. Almost all of these have fallen by the wayside since medicines have become heavily regulated for use in food fish in many countries, including the EU, the USA, Japan and Canada. The use of chemotherapy to control parasites in fish populations should take into consideration, as well as the treatment of the disease in the fish, the toxicity to the consumer and the impact on the environment. Unfortunately, there is no single agency which deals with all these aspects of products found useful for fish. The major controlling agencies are those which cover veterinary medicines which have produced a significant body of legislation based on quality, efficacy and safety. There has been a general trend for developed countries to continue to increase regulation of drugs and, as a result, farmers in these countries find they have access to a very limited number and range of products. Some of the most useful compounds have been banned for use in aquaculture, e.g. dimetranidazole (DMZ) for use against the ciliate protozoan Ichthyophthirius multifiliis and the flagellate Spironucleus spp., and have not been replaced. Malachite Green was a very useful chemical, well known for years to the ornamental fish trade but very effective against I. multifiliis in culture

226


ponds and raceways when combined with formalin. On the other hand, many other countries have no licensing of drugs and are only concerned when there is a need to export to a highly regulated country. New drugs are rarely presented for aquaculture use as the pharmaceutical companies regard the market as too small and it has only really been worth their while to develop treatments for sea lice in salmonid culture, although the same products are useful against other crustacean ectoparasites, e.g. pyrethroids are used for isopod infection in Mediterranean mariculture and Argulus in freshwater. The data required for the authorisation of new products is voluminous and complex (Woodward, 1996). Schnick (1991) outlined the processes required for five continents (Africa, Asia, Australia, Europe and North America) and lists the approved drugs at the time. Most authorised products are derived from active compounds already used in mammalian or veterinary medicine. There are no new molecules designed to control fish parasites. For a marketing authorisation to be issued there are usually three factors to be taken into account. These are safety, efficacy and quality, although these are organised in different ways through a range of governmental organisations, depending on the country in question, see Schnick et al. (2005). Animal safety is determined through tolerance studies for adverse effects of single or repeat doses and all adverse reactions should be reported. There may be a change in the perception of an adverse reaction with the current increased awareness of animal welfare; this would also be informed by the current better understanding of stress in fish (Huntingford et al., 2006). With new information or unacceptable reactions, previously licensed products may be revoked. Consumer safety is effected through the establishment of maximum residue levels (MRLs) which are required to be set for a market authorization (MA). The details of how these are set in the EU are well outlined in Woodward (1996) and there are guidelines for how the studies should be carried out for registration purposes. Depending on the status, a drug may be placed in one of four annexes, and Annex IV includes substances which cannot be used on public health grounds and are effectively prohibited for use in food animals owing to the risk to the consumer. This categorisation is unlikely to be changed but may become accepted globally and incorporated into legislation worldwide. On the whole, the pattern over recent years has been to place compounds previously found to be useful into the Annex IV category, thereby reducing the number of available parasiticides to a mere handful. Data required for an MRL are extensive (Woodward, 1996) and extrapolation from mammalian levels is impossible because of the difference in metabolism of a poikilotherm; a complicating factor being the changes due to environmental temperature and salinity which must also be taken into account. There are some concessions which have been helpful to aquaculture, such as the now widely accepted Joint FAO/WHO Committee on Food Additives (JECFA) and the Centre for Veterinary


227

Medicine Products (CVMP) old drug policy which allows substances such as formalin which have a long history of use, to be fast tracked by allowing safety experience to be taken into account (JECFA, 1993). It seems likely that this situation will only exist until data from new studies establish an acceptable risk. The MRL forms the basis for the determination of the withdrawal period which is determined by the pharmacokinetics and is mostly defined in terms of degree days. The MRL is also the yardstick used for surveillance, where surveillance is carried out, e.g. in the EU and USA. Policing the regulations in the interests of the consumer and the environment can feed the media with exposé stories. The ‘backlash’ in the finding of regulatory transgressions is very damaging to the aquaculture industry and can have serious adverse effects on the markets and consequently the economics, e.g. farmed salmon was added to the UK statutory residue surveillance programme in 2001 after the Food Standards Agency (FSA) of the UK forwarded anecdotal evidence it had received that the banned Malachite Green was being used in fish farming. There is now statutory surveillance for Malachite Green and the avermectin, Ivermectin©, at one time used to control sea lice. The result of the adverse publicity has been the tightening up of safety processes at grow-out sites and markets, and it can be said, therefore, to have had some beneficial effects. It is likely that surveillance will increase and include more molecules. This also has an indirect effect on overseas producers, for example, increasingly those from Asia who wish to import into the UK and other countries with effective surveillance. An alternative approach permits veterinarians to treat a condition in an animal by prescribing a product which does not have a specific MA for that species, provided only a small number of animals are involved, certain information is recorded and a standard withdrawal period of 500 degree days is used (Woodward, 1996). This facility, commonly referred to as ‘the cascade’ or ‘Off label’ system, is an important consideration for animal welfare which is increasingly recognised. Guidelines for fish welfare in aquaculture are currently being developed by a number of organisations including, for example, the European Food Standards Agency (2008), which are likely to form the basis of an EU Directive in this case and applied by regulatory authorities within the EU. Greater concerns are also shown for operator safety than previously in some regions, i.e. the EU, USA, Canada, etc., and this is now incorporated into the authorisation package; the hazards and how to deal with them are displayed on the packaging, and proper adherence to these directions may be monitored and subject to other legislation, e.g. Health and Safety. There are considerable extra costs involved in the form of lockable safety stores on site, equipment, such as respiratory masks, and protective clothing. Additional antidote kits and monitoring for acetyl cholinesterase is required in the case of organophosphates, which are expensive and have a relatively short life requiring constant updating.

228


Environmental safety is now one of the most influential factors in chemotherapy in fish, especially in the marine environment. The public response to usage of chemicals in inshore waters, largely for the treatment of sea lice on salmon, has influenced the legislative controls almost as much as the scientific data, resulting in severe restrictions for use, particularly in Scotland, Norway and Canada. Ecotoxicological studies of the fate of treatments for sea lice, some of which are prolonged, have been retrospective, and therefore the precautionary principle has been applied and, indeed, demanded by conservation bodies. New technological developments in assessment of environmental impacts will eventually provide the rationale for regulation. Regulation and monitoring guidelines on procedure deal with a number of parasiticides (most being sea lice treatments) from which environmental quality standards (EQS) are set. Bath treatments result in the release of the product, after a fixed period, into the environment and, in some countries, such discharges require permission; this is one way by which treatments may be regulated, i.e. by controlling discharge consents. A further way in which regulations may be implemented is through a programme of monitoring. This seems to be a means favoured by regulators in Scotland, Ireland and Norway, and a monitoring programme goes hand in hand with authorisation. The implementation of threshold levels for sea lice would appear to be to satisfy the aquaculture critics whose concern is for wild fish populations, but this risks increasing the amount of pesticide used, with consequent resistance and environmental effects. It is likely that the environmental constraints on administration of bath treatments will increase, and make in-feed/oral treatments more favourable for development. Although in-feeds are still likely to be highly regulated, the impact is likely to be less, especially since mechanisms to minimise the amount of uneaten food are being developed as well as the collection of eliminated solid faecal waste in the interests of environmental quality. Validated spatial models are now in use to predict environmental impact and these may be used with geographic information systems (GIS) to great effect (Pérez et al., 2002). As has been indicated above, legislation abounds on drug regulation, largely arising from those (usually developed countries countries) with major aquacultural interests. It has been recognised that there is a need for harmonisation of the regulations, and some attempts have been made in this direction (Schnick, 2001). One example is the trilateral programme ‘International Co-operation on Harmonization of Technical Requirements for Regulation of Veterinary Medicinal Products (VICH)’, the parties to which are the EU, USA and Japan with Australia and New Zealand as observers. This has become a global issue. It is anticipated that the VICH recommendations should replace corresponding legal requirements. A major benefit will be that a common data package can be used for authorisation throughout the world. What is certain is that regulation will increase and controls


229

and monitoring will tighten, further discouraging the pharmaceutical companies from processing products for authorisation. Already, the cost is such that it is only feasible to pursue products for high value species where the market size is large enough and the value of the product sufficiently high for the farmer to treat rather than destroy the stock or harvest early. This explains why most of the authorised products for fish parasites are those developed to treat sea lice on salmonids. During recent years new product licences have been issued or given appropriate governmental permits (see Table 8.1). Some of these have been withdrawn subsequently, e.g. Nuvan® 500EC (Ciba-Geigy Agrochemicals) (dichlorvos), and others have not found favour with the end-user, and market sales have declined. The use of hydrogen peroxide was highly favoured because it was a familiar compound used in the food industry and a search for other such compounds is highly desirable. The expansion of organic fish production is, at least partly, constrained by the lack of acceptable treatments for parasitic disease and the search for natural products which can be used is a very fruitful area for research. As can be seen from Table 8.1 there are now a number of oral parasiticides authorised for sea lice treatment. It is also evident from the table that the range of treatments available provide for different modes of action, and it should have been possible to avoid the development of resistance in sea lice with the appropriate rotation of use. However, even in the light of this knowledge, fish farmers have tended to persist in the use of single chemical treatments which has resulted in the development of resistance to some of the most effective compounds (Jones et al., 1992; Treasurer et al., 2000), the most recent one being emamectin benzoate which is under investigation (Lees et al., 2008). Furthermore, there is ample anecdotal evidence of cost cutting which has accelerated the development of resistance, e.g. use of less than the recommended dose. This was known in some cases to have been carried out through ignorance of the formulation concentration – a case of not reading the label carefully – but in many cases, it was under economic pressure. The costs of these therapeutants are very high due to high development costs which are passed on to the farmers. Fortunately, a few of the large pharmaceutical companies are continuing to search for new sea lice treatments. The ideal product would have all the characteristics shown in Table 8.2, and the further development of products with novel modes of action would be advantageous. Resistance to dichlorvos in sea lice populations was first reported in 1992 by Jones et al. (1992). Resistance development and its mechanisms have been recognised and largely understood since 1947 – when resistance to DDT in houseflies was detected within a few years of the introduction of synthetic organic insecticides – and are now being studied in sea lice (e.g. Fallang et al., 2004, 2005). With every new pesticide developed, resistance has appeared within 2–20 years after their introduction, leading to a

Organophosphate Organophosphate Organophosphate Organophosphate Oxidant Oxidant Synthetic pyrethroid Synthetic pyrethroid Avermectin Avermectin

Benzylphenylurea Benzylphenylurea

Nuvan® 500 EC Aquaguard®* Neguvon® Salmosan®* Paramove®* Salartect®* Excis®* Alphamax®* Ivomec® Slice®*

Calicide®* Lepsidon® Teflubenzuron Diflubenzuron

Dichlorvos Dichlorvos Trichlorfon Azamethophos Hydrogen peroxide Hydrogen peroxide Cypermethrin Deltamethrin Ivermectin Emamectin benzoate

Active ingredient

* Products having a marketing authorisation in the UK. Note: The dichlorvos products are no longer available.

Product type

Chemotherapeutants used against sea lice

Product name

Table 8.1

AChEase inhibitor in cholinergic nervous systems AChEase inhibitor AChEase inhibitor AChEase inhibitor Not established possibly mechanical Not established possibly mechanical Interferes with sodium channels in axon membranes Interferes with sodium channels in axon membranes Interferes with sodium channels in axon membranes Interferes with GABA recepters in the peripheral nervous system Chitin synthesis inhibitor Chitin synthesis inhibitor

Mode of action

Oral/in feed Oral/in feed

Bath Bath Bath Bath Bath Bath Bath Bath Oral/in feed Oral/in feed

Application method


231

Table 8.2 The ideal chemotherapeutant For fish: • Low dose efficacy • Prolonged duration of efficacy • Single dose application • No effect on appetite • Wide toxicity margin • Effective against all stages of the parasite For humans: • Completely safe to handle in concentrated form • Rapidly metabolised in fish flesh to undetectable levels • Preferably used in the food industry and therefore acceptable to the public For the environment: • Specific toxicity to target species • Excreted metabolites in harmless form and rapid decomposition in the water • By-products which are already components of the natural environment and non-fouling For the product: • Cheap • Oral/in-feed administration • Prolonged shelf life • No evidence of cross-resistance

treadmill effect. Parasite pathogens in aquaculture are now firmly on that treadmill. The pattern is familiar as the selection pressure on the heritable resistance traits is accelerated by more frequent and intensive use of the pesticide applied by desperate aquaculturists. The rotation of pesticides with different modes of action interrupts this sequence and prolongs the active use of each pesticide. The speed of development is also influenced by the rate of reproduction of the parasite, the immigration and host range of the parasite, the proximity to resistant populations, the persistence of the product, its concentration and specificity and the rate, timing and number of applications made (see http://www. irac-online.org). More than 500 species of arthropods have already shown resistance to at least one class of insecticide. The resistance of sea lice to dichlorvos may have been delayed by the influx of unexposed populations of sea lice from wild salmonids into sites, which was possible owing to the distance between culture sites in the young industry and the growth and stocking cycles of the salmon; however, with multi-year class stocking and closer proximity of cage sites as the industry expanded, it became inevitable. For this reason, an untreated reservoir of the parasite is always desirable. The development of sea lice resistance has resulted in cycles of complacency during which there is widespread use of a single effective

232


product, followed by pressure to seek new products when early stage resistance is recognised. With no new licensed products available, this is followed by crisis during which farmers are forced to seek out and use nonchemical methods of control. Since it is clear that parasites will always be present and there will always be a need for control, it is wise to take the long-term view and avoid the short-termism which leads farmers to reach for the current most effective product every time and hope to eliminate the parasite from the site. This will mean that farmers have to introduce an IPM strategy incorporating resistance management principles either voluntarily or by government mandate; the latter making it compulsory and coordinated on a regional or national basis. Resistance management principles are clear (Table 8.3, see also http://www.irac-online.org). The concept of an IPM strategy for sea lice control, incorporating resistance management principles, was put forward to the Scottish industry as long ago as 1995 (Sommerville, 1995) at a time when seven products were at either the licensing stage or advanced in their development with four different modes of action and a number of useful management/husbandry methods. The concept has slowly been taken up, but there is as yet little evidence of commitment to it by the aquaculture industry, save for a few enthusiasts. In some countries, small inroads have been made into an IPM for sea lice control, for example, in 1998 the Scottish industry introduced a scheme of area management agreements (AMA) as part of a National Treatment Strategy (Rae, 1999) which focused treatment events in the late winter, and obtained agreements to coordinate simultaneous treatments within a bay or at least with proximal sites. This is particularly important to avoid local dispersion of the treatment compound following release of tarpaulin enclosures around cages into

Table 8.3 • • • • • • • • • •

Resistance management principles

Always include husbandry and biological control methods. Do not rely on a single pesticide class; frequent use of the same pesticide will lead quickly to resistance. Rotate products from different classes based on modes of action i.e. use different classes of pesticide in alternation. Time the application against the most susceptible life stages but based on population size thresholds. Use only at the recommended rate and treatment interval. Do ensure the effective dose rate is achieved; for a bath treatment this means use enclosures. Always test efficacy post treatment. If treatment fails due to resistance, do not retreat with a pesticide of the same class. Do not treat floating cages piecemeal, treat a whole site. Synchronise treatments with adjacent sites.


233

neighbouring sites. The persistent low dose into adjacent sites in such cases is thought to have accelerated the development of resistance to the organophosphate Aquagard®. Heuch et al. (2005) reviewed the Norwegian National Action Plan and outlined its shortcomings. However, this and other strategies have always fallen short of the full IPM by not incorporating rotation of chemicals, the main method by which resistance development can be avoided or delayed. Thus crisis management prevails. Government policy has favoured supervised control based on threshold levels of lice and expensive monitoring programmes have been put in place. However, action thresholds are difficult to design and use. In the case of sea lice there are seven stages of the life cycle living on the fish, the adult stage represented by both male and female. Since the adults and pre-adults are the most damaging to the fish, threshold levels have concentrated on numbers of these stages, together with a ‘zero gravids’ strategy. Not sufficient is known about the infra-population structure under different conditions to determine if this is reasonable or not. Additionally, the sampling method recognises only 40–50 % accuracy (Treasurer and Pope, 2000). The decision regarding the threshold level is arbitrary as the risk depends on a number of other factors and has not been clearly defined. With reliance on threshold levels, there is a danger of over-use of pesticides which, in the absence of any enforced rotation, is dangerous. In Scotland the Environment Agency retains the ability to control the number of treatment episodes in a given time period, but this will not necessarily engage farmers in rotation. Learning to live with parasites whilst minimising economic losses and guided by fish welfare issues is a much more sustainable way of satisfying all stakeholders. This is achievable by the development of epidemiological models and is the way forward for research into parasite control in order to develop non-chemical methods and interventions which will contribute to an IPM for any pathogen/host system in aquaculture. Whatever new methods of control are developed for parasites in aquaculture, these will only be sustainable if used within an IPM which incorporates resistance management principles.

8.5.3 Integrated pest management A good IPM will involve biological, cultural/husbandry, preventative, prophylactic as well as chemotherapy elements, all underpinned by monitoring, i.e. concerted multiple tactics based on knowledge. It would meet the goals of all the stakeholders, including farmers, consumers and government agencies, with the ultimate goal of reducing losses due to parasite pathogens at the same time as safeguarding against risks of environmental pollution, hazards to human health and reduced sustainability of the aquaculture industry. Thus it requires a multidisciplinary approach as political, social and economic perspectives have to be accommodated as well as husbandry,

234


ecological and technical aspects. Importantly, the IPM in aquaculture will depend on knowledge of the parasite pathogens, life cycles, transmission route, etc. which, for some pathogens, is very scanty. Knowledge of the host species’ physiology, genetics, behaviour and interaction with the parasite is important and, again, in-depth knowledge is only known for a small handful of the major culture species. This information is taken into the context of the husbandry system and local management practices. A suggested IPM scheme, generalised for management and control of most parasite pathogens, is as follows and is illustrated in Fig. 8.1. Control of parasites starts with fish stock control. Many fish species are now progeny of home-grown broodstocks, and fish stocks available in the future will be specific pathogen-resistant, achieved either by selective breeding or by transgenics. They will be obtained from an approved source together with a health certificate which guarantees they are specific pathogen free. They will already be multi-vaccinated. The fish will be stocked into a licensed site which has been checked hydrographically to ensure appropriate environmental conditions are met, including depth, flushing action, etc. The site will not be too close to adjacent sites utilised for fish culture, and the wild fish migration paths in the vicinity will be known together with their seasonality so as to predict when there is likely to be an influx of parasite transmission stages. The site will have been fallowed for as long as possible and only a single year class will be stocked into it throughout the growth cycle. Much of this will be subject to regulatory

Yr 1 Fish stock • certified • resistant? • multivaccinate

Site • fallowed • single year class • hydrography • wild fish • proximity

R e g u l a t o r y

r e q u i r e m e n t s

Yr 2

Growth cycle

Screen Improve general health status

Stocking • max size • handling • lower density

Other infections • reject • treat • quarantine • prophylaxis

Improve transport conditions to minimise stress

H A R V E S T

Minimisation management • Hygiene: net • Stress reduction cleaning

monitoring

monitoring

TREAT? • Parasite population structure? • Treatment history? • Health status? • Temperature? • Cost-effectiveness? • Logistics? • Coordination possible?

• Environmental control monitoring

Biological/biopesticide

CHEMICAL/DRUG? Bath • Logistics? • Health status? • Site sensitivity? • Season/climate? • Temperature? • Site history? • Treatment history?

Fig. 8.1 Generalised IPM scheme for parasite control.

Oral

R O T A T I O N


235

requirements. Fish would be screened prior to stocking by a reputable laboratory with skilled, expert staff equipped with appropriate molecular technology, and would be rejected if uncontrollable pathogens were found to be present or treated if appropriate treatment was available. Ideally these fish would then be quarantined and, where appropriate, given a prophylactic treatment. They would be tested post-treatment to ensure the parasite has been eradicated prior to stocking, and subjected to a risk analysis also prior to stocking. A knowledge of the ontogeny of the immune system of the particular species cultured is necessary both for this and for vaccination purposes, and to ensure that the size of the fish stocked gives the best opportunity to resist disease, etc. The transport conditions are crucial to the success of stocking new fish, and, by minimising stress and preventing multiplication of the parasites which reproduce rapidly under such conditions, e.g. flagellates and ciliates, the survival rate can be improved. There is ample room for improvement through technology if there was more investment in innovative engineering; for example, with the use of well-boats, mortality can be markedly reduced. Minimising handling stresses and using low stocking densities improves the quality of the new stock in the first few weeks in the new site. Constant monitoring of fish throughout the grow-out period will pay dividends, but this is often done in an ad hoc manner by taking bulk weights and giving a cursory glance to identify any clinical conditions. Using appropriate, statistically-based sampling techniques provides the opportunity to test muscle/fat levels, identify pathogens, etc. During the growth cycle, management aims are to reduce stress through environmental control, handling and hygiene which influence pathogen levels and may have welfare implications. It is likely that maintenance of fish welfare according to a benchmark set of recognised indices may become statutory in the near future in the EU. The grow-out period is continually at risk of disease outbreaks and, in the event of the appearance of a parasite pathogen, revealed in the routine samples, it is necessary to decide whether there is a need to intervene. This could be either chemical or biological, and would depend on a wide range of conditions. First choice would be a non-chemical control where these are available; often these are best used in concert if there is more than one. If the choice was chemical, rather than use threshold levels which are universally applied, a full assessment of the situation needs to be made, including bioassays to assess levels of chemical/drug resistance. Such a decision could readily be supported by appropriate software incorporating current knowledge. The technology for such software has been developed, and packages of variable usefulness are available. Such software would be frequently updated with local knowledge and with the results of experience as it became available. Important information would relate to the health status of the fish, environmental information such as temperature and salinity (which affects dose rate), the population structure of the parasite, its chemical sensitivity in a bioassay, the cost-effectiveness (would it

236


be better to harvest, destroy, etc?). The logistics would be assessed, e.g. climatic conditions, ability to coordinate treatment with adjacent/regional sites, etc. The treatment history of the site would also be a significant factor. If the decision was that it was necessary to treat, the nature of treatment would need to be considered. In the event of a chemical treatment being the choice, the key questions depend on the availability of more than one product with different applications and modes of action. Only for sea lice is there currently such a choice. The current choices of an oral or a bath treatment may well be supplemented with a slow release drug implant in the near future. It may be also be that, as with emamectin benzoate, which has a prolonged activity time, these will be administered prior to stocking, e.g. to salmonids in freshwater before transfer to sea cages, thereby providing protection through the most vulnerable growing stages. The choice of whether to employ a bath or an oral treatment may depend on a number of factors such as the health status of the fish. Where the infection has already damaged gills, bath treatments themselves increase mortality. Early stages of disease are often first signalled by a reduced appetite, then there would be difficulties in achieving the correct dose level for an in-feed treatment and a bath treatment would be more appropriate. The season and climate would also have a considerable influence as this would affect both appetite and withdrawal times in temperate zones. The treatment will also be influenced by the salinity of a site, the flushing rate of a bath treatment, and, indeed, the feasibility of enclosures where fast tides or high winds may change the volume of the cage and prevent accurate dosing. The logistics may be such that a whole site cannot be treated at one time or that the size of the fish and the handling would, in themselves, increase mortality. Frequently it is simply a question of labour availability at the appropriate time or the stock may be too close to market, making a prescribed long withdrawal period uneconomic. The method for application of bath treatments is very basic and could be considerably improved by investment in some innovative engineering. Unfortunately the industry is not sufficiently profitable to engage entrepreneurs to take this on. Treatment tanks and swim-throughs have been tried which enable detoxification of chemical product prior to release but have so far proved to be too expensive. A key element of chemotherapy is post-treatment testing of efficacy, something which is often overlooked or forgotten. Following consideration of the pros and cons of different drugs and chemicals currently available, overriding all other considerations should be treatment history and the absolute requirement to rotate the treatments. Any treatment will be applied according to resistance management principles (Table 8.3) and may best be applied by mandate through regulatory processes in the future. The general principle should prevail that treatment with drugs or chemicals is a last resort rather than the method of choice as it is currently.


237

8.6 Future trends The production of healthy fish is the best mechanism to assist fish in resisting disease, and this may be supported by transgenics and/or dietary immunostimulants in the future. It seems that there will always be a place for pharmaceuticals and, with the increased value of the global aquaculture industry, it is hoped that more investment in fish parasiticides with different modes of action will ensue. New applications are being sought for parasiticides; exciting possibilities for the near future are slow-release implants for antiparasitic drugs. However, a major constraint on the development of new and more effective parasiticides is the time (up to 10 years) to obtain a marketing authorisation for a new product. Pharmaceutical companies do not find this cost-effective given the size of the market and the lack of control over the patents exhibited in the Far East. The effect of this may, though, have benefits in persuading the farmers of the importance of pursuing non-chemical control methods. The current molecular tools available to find target molecules are very expensive; however, the benefits would be great. The more advanced studies of the major parasite pathogens such as those which use microarrays for L. salmonis can lead the way to find target molecules for both vaccines and chemotherapeutants. Vaccine research for C. salmositica, L. salmonis and for I. multifiliis is at the leading edge of parasite vaccine research, although they may be utilising different approaches. There is, as yet, little interest in investing in new biocontrol methods, but biopesticides, albeit slow to become of interest for control of fish disease, are gradually being accepted as part of the armoury in horticulture and elsewhere. The growth in predictive epidemiological modelling, and risk analysis to point to management and husbandry controls, will probably bring dividends more rapidly than any other approach by identifying and targeting the most effective interventions. Increased legislation and greater regulation can be expected, particularly on food safety, fish welfare and environmental issues. However, none of the measures will single-handedly control any specific pathogen, and it is clear that future sustainability can only be achieved through collaborative integrated management strategies.

8.7 References arafa sz, el-naggar mm, el-abbassy sa, stewart mt and halton dw (2007) Neuromusculature of Gyrodactylus rysavyi, a monogenean gill and skin parasite of the catfish Clarias gariepinus, Parasitology International, 56(4), 297–307. arthur jr (1996) Fish and shellfish quarantine: the reality for Asia-Pacific, in Subasinghe RP, Arthur JR and Shariff M (eds), Health Management in Asian Aquaculture, Proceedings of the Regional Expert Consultation on Aquaculture

238


Health Management in Asia and the Pacific, FAO Fisheries Technical Paper No. 360, FAO, Rome, 11–28. bakke ta, cable j and harris pd (2007) The biology of gyrodactylid monogeneans: The ‘Russian-doll killers’, Advances in Parasitology, 64, 161–376. banks ba, taggart jb, shinn ap and sommerville c (2000) Microsatellite analysis of Scottish sea lice population, Acta Parasitologica, 45(3), 266. bell s, bron je and sommerville c (2000) Distribution of exocrine glands in Lepeophtheirus salmonis (Krøyer 1837) and Caligus elongatus Nordmann, 1832. (Copepoda: Caligidae), Contributions to Zoology, 69(1/2), 9–12. ben-ami f and heller j (2001) Biological control of aquatic pest snails by the black carp Mylopharyngodon piceu., Biological Control, 22(2), 131–8. booth m, graham a and viney m (eds) (2008) Parasitic co-infections: challenges and solutions, Preface, Parasitology, 13, 749. boxaspen k (2006) A review of the biology and genetics of sea lice, ICES Journal of Marine Science, 63(7), 1304–16. bricknell i and dalmo ra (2005) The use of immunostimulants in fish larval aquaculture, Fish Shellfish Immunology, 19, 457–72. bron je, sommerville c, wootten r and rae gh (1993) Fallowing of marine Atlantic salmon, Salmo salar L., farms as a method for the control of sea lice Lepeophtheirus salmonis (Krøyer, 1837), Journal of Fish Diseases, 16, 487–93. burrells c, williams pd and forno pf (2001) Dietary nucleotides: a novel supplement in fish feeds −1. Effects on resistance to disease in salmonids, Aquaculture, 199, 159–69. butler r, bowden tj, bron je, bricknell jr and sommerville c (2000) The use of an in vitro model to investigate suppression of Atlantic salmon cellular immune responses during infection of Lepeophtheirus salmonis, Acta Parasitologica, 45, 271, Abstract. diamant a (1998) Red drum Sciaenops ocellatus (Sciaenidae), a recent introduction to Mediterranean mariculture, is susceptible to Myxidium leei (Myxosporea). Aquaculture, 62(1/2), 33–9. dickerson hw (2006) Ichthyophthirius multifiliis and Cryptocaryon irritans, in Woo PTK (ed.) Fish ‘Diseases and Disorders’ Volume 1: Protozoan and Metazoan Infections, 2nd edn, CABI, Oxford, 116–53. dickerson hw and clark tg (1998) Ichthyophthirius multifiliis: a model of cutaneous infection and immunity in fishes, Immunogical Review, 166, 377–84. efsa (2008) Fish Welfare, Parma, European Food Standards Agency, http://www. efsa.europa.eu/EFSA/efsa_locale-1178620753812_1211902131969.htm, accessed January 2009. fallang a, denholm i, horsberg te and williamson ms (2005) Novel point mutation in the sodium channel gene of pyrethroid-resistant sea lice Lepeophtheirus salmonis (Crustacea: Copepoda), Diseases of Aquatic Organisms, 65, 129–36. fallang a, ramsay jm, sevatdal s, burka jf, jewess p, hammell kl and horsberg te (2004) Evidence for occurrence of an organophosphate-resistant type of acetylcholinesterase in strains of sea lice (Lepeophtheirus salmonis Krøyer), Pest Management Science, 60, 1163–70. fast md, burka jf, johnson sc and ross nw (2003) Enzymes released from Lepeophtheirus salmonis in response to mucus from different salmonids, Journal of Parasitology, 89, 7–13. fast md, ross nw, craft ca, locke sj and mackinnon sl and johnson sc (2004) Lepeophtheirus salmonis: characterization of prostaglandin E-2 in secretory products of the salmon louse by Rp-Hplc and mass spectrometry, Experimental Parasitology, 107, 5–13.


239

fenton a, hakalahti t, bandilla m and valtonen et (2006) The impact of variable hatching rates on parasite control: a model of an aquatic ectoparasite in a Finnish fish farm, Journal of Applied Ecology, 43(4), 660–80. fiala i (2006) The phylogeny of Myxosporea (Myxozoa) based on small subunit ribosomal RNA gene analysis, International Journal for Parasitology, 36(14), 1521–34. firth k, johnson s and ross n (2000) Characterization of proteases in the skin mucus of Atlantic salmon (Salmo salar) infected with the salmon louse (Lepeophtheirus salmonis) and in whole-body louse homogenate, Journal of Parasitology, 86, 1199–205. freeman ma (2002) Potential biological control agents for the salmon louse Lepeophtheirus salmonis (Krøyer 1837), PhD Thesis, University of Stirling, UK. freeman ma, bell as and sommerville c (2003) A hyperparasitic microsporidian infecting the salmon louse Lepeophtheirus salmonis: An rDNA-based molecular phylogenetic study, Journal of Fish Diseases, 26(11–12), 667–76. gault nfs, kilpatrick dj and stewart mt (2002) Biological control of the fish louse in a rainbow trout fishery, Journal of Fish Biology, 60, 226–37. gilbert ma and granath wo (2003) Whirling disease of salmonid fish: life cycle, biology, and disease, Journal of Parasitology, 89(4), 658–67. giorgiadis mp, gardner ia and hedrick rp (2001) The role of epidemiology in the prevention, diagnosis and control of infectious diseases of fish, Preventive Veterinary Medicine, 1(48), 287–302. glover ka, aasmundstad t, nilsen f, storset a and skaala ø (2005) Variation of Atlantic salmon families (Salmo salar L.) in susceptibility to the sea lice Lepeophtheirus salmonis and Caligus elongatus, Aquaculture, 245, 19–30. glover ka, grimholt u, bakke hg, nilsen f, storset a and skaala ø (2007) Major histocompatibility complex (MHC) variation and susceptibility to the sea louse Lepeophtheirus salmonis in Atlantic salmon Salmo salar, Diseases of Aquatic Organisms, 76(1), 57–65. grayson th, john rj, wadsworth s, greaves k, cox d, roper j, wrathmell ab, gilpin ml and harris je (1995) Immunization of Atlantic salmon against the salmon louse: identification of antigens and effects on louse fecundity, Journal of Fish Biology, 47, 85–94. gravil hr (1996) Studies of the biology and ecology of the free swimming larval stages of Lepeophtheirus salmonis (Krøyer, 1838) and Caligus elongatus Nordmann, 1832 (Copepoda: Caligidae), PhD thesis, University of Stirling, UK. guselle nj, markham rjf and speare dj (2006) Intraperitoneal administration of β-1,3/1,6-glucan to rainbow trout, Oncorhynchus mykiss (Walbaum), protects against Loma salmonae, Journal of Fish Diseases, 29, 375–81. harris pd, shinn ap, cable j, bakke ta and bron je (2008) GyroDb: gyrodactylid monogeneans on the web, Trends in Parasitology, 24, 109–11. hedrick rp, mcdowell ts, mukkatira k, georgiadis mp and macconnell e (1999) Susceptibility of selected inland salmonids to experimentally induced infections with Myxobolus cerebralis, the causative agent of Whirling Disease, Journal of Aquatic Animal Health, 11(4), 330–39. heuch pa, bjørn pa, finstad b, holst jc, asplen l and nilsen f (2005) A review of the Norwegian ‘National Action Plan Against Salmon Lice on Salmonids’: The effect on wild salmonids, Aquaculture, 246, 79–92. hilborn r (2006) Salmon-farming impacts on wild salmon, Proceedings of the National Academy of Sciences USA, 103(42), 15277. hines rs and spira dt (1974) Ichthyophthiriasis in the mirror carp Cyprinus carpio L. V. Acquired immunity, Journal of Fish Biology, 6, 373–8.

240


hoffman gl and meyer fp (1974) Parasites of Freshwater Fish, TFH Publications, Neptune City, NJ. holzer as, sommerville c and wootten r (2003) Tracing the route of Sphaerospora truttae from the entry locus to the target organ of the host, Salmo salar L., using an optimized and specific in situ hybrdization technique, Journal of Fish Diseases, 26, 647–55. holzer as, wootten r and sommerville c (2007) The secondary structure of the unusually long 18S ribosomal RNA of the myxozoan Sphaerospora truttae and structural evolutionary trends in the Myxozoa, International Journal for Parasitology, 37(11), 1173–296. hume s (2008) Sea lice dispute escalates into an Ivory Towers punch-up, Vancouver Sun, April 30, http://www.canada.com/vancouversun/news/editorial/story. html?id=01c89ab2-5609-4185-b9fa-84f6ef270a17, accessed January 2009. huntingford fa, adams c, braithwaite va, kadri s, pottinger tg, sandoe p and turnbull jf (2006) Review paper: current issues in fish welfare, Journal of Fish Biology, 68(2), 332–72. ingvarsdóttir a, birkett ma, duce i, genna rl, mordue w, pickett ja, wadhams lj and mordue luntz aj (2002) Semiochemical strategies for sea louse control: host location cues, Pest Management Science, 58(6), 537–45. jecfa (joint fao/who expert committee on food additives) (1993) Evaluation of certain veterinary residues in food, Fortieth report of the Joint FAO/WHO expert committee on food additives, FAO/WHO, Rome/Geneva. johnson sc and fast md (2004) Interactions between sea lice and their hosts, in Wiegertjes GF and Flik G (eds), Host-parasite Interactions, Abingdon/New York, Garland Science/BIOS Scientific, 131–59. johnson s, ewart k, osborne j, delage d, ross n and murray h (2002) Molecular cloning of trypsin cDNAs and trypsin gene expression in the salmon louse Lepeophtheirus salmonis (Copepoda: Caligidae), Parasitology Research, 88, 789–96. jones cs, lockyer ae, verspoor e, secombes cj and noble lr (2002) Towards selective breeding of Atlantic salmon for sea louse resistance: approaches to identify trait markers, Pest Management Science, 58, 559–68. jones mw, sommerville c and wootten r (1992) Reduced sensitivity of the salmon louse Lepeophtheirus salmonis to the organophosphate Dichlorvos, Journal of Fish Diseases, 15, 303–10. kay jw, shinn ap and sommerville c (1999) Towards an automated system for the identification of notifiable pathogens, Parasitology Today, 15(5), 201–6. kennedy cr and fitch dj (1990) Colonization, larval survival and epidemiology of the nematode Anguillicola crassus, parasitic in the eel, Anguilla anguilla, in Britain, Journal of Fish Biology, 36, 117–31. kent ml, andree kb, bartholomew jl, el-matbouli m, desser ss, devlin rh, feist sw, hedrick rp, hoffmann rw, khattra j, hallett sl, lester rjg, longshaw m, palenzeula o, siddall me and xiao c (2001) Recent advances in our knowledge of the Myxozoa, Journal of Eukaryotic Microbiology, 48, 395–413. krkosˇ ek m, lewis ma and volpe jp (2005) Transmission dynamics of parasitic sea lice from farm to wild salmon, Proceedings of the Royal Society of London, Series B, 272, 689–96. krkosˇ ek m, lewis ma, morton a, frazer ln and volpe jp (2006) Epizootics of wild fish induced by farm fish, Proceedings of the National Academy of Sciences, 103(42), 15506–10. krkosˇ ek m, ford js, morton a, lele s, myers ra and lewis ma (2007) Declining wild salmon populations in relation to parasites from farm salmon, Science, 318, 1772–5.


241

lees f, baillie m, gettinby g and revie cw (2008) The efficacy of emamectin benzoate against infestations of Lepeophtheirus salmonis on farmed Atlantic salmon (Salmo salar L) in Scotland, 2002–2006, PLoS ONE, 3(2), e1549. mcgurk c, morris dj, bron je and adams a (2005) The morphology of Tetracapsuloides bryosalmonae (Myxozoa: Malacosporea) spores released from Fredericella sultana (Bryozoa: Phylactolaemata), Journal of Fish Diseases, 28, 307–12. mcvicar ah (2004) Management actions in relation to the controversy about salmon lice infections in fish farms as a hazard to wild salmonid populations, Aquaculture Research, 35(8), 751–8. morris dj, adams a and richards rh (1999) In situ hybridization of DNA probes to PKX, the causative organism of proliferative kidney disease (PKD), Journal of Fish Diseases, 22(2), 161–3. mustafa a and mackinnon bm (1999) Genetic variation in susceptibility of Atlantic salmon to the sea louse Caligus elongatus Nordmann, 1832, Canadian Journal of Zoology, 77, 1332–5. niemann h, kues w and carnwath jw (2005) Transgenic farm animals: Present and future, Revue Scientifique et Technique–Office International des Épizooties, 24(1), 285–98. peeler ej and thrush ma (2004) Qualitative analysis of the risk of introducing Gyrodactylus salaris into the United Kingdom, Diseases of Aquatic Organisms, 62, 103–13. peeler ej, gardiner r and thrush ma (2004) Qualitative risk assessment of routes of transmission of the exotic fish parasite Gyrodactylus salaris between river catchments in England and Wales, Preventive Veterinary Medicine, 64(2/4), 175–89. penston mj, millar cp, zuur a and davies im (2008) Spatial and temporal distribution of Lepeophtheirus salmonis (Krøyer) larvae in a sea loch containing Atlantic salmon, Salmo salar L., farms on the north-west coast of Scotland, Journal of Fish Diseases, 31(5), 361–71. pérez om, telfer tc, beveridge mcm and ross lg (2002) Geographical information systems (GIS) as a simple tool to aid modelling of particulate waste distribution at marine fish cage sites, Estuarine, Coastal and Shelf Science, 54(4), 761–8. rae gh (1999) Sea lice, medicines and a national treatment for control, Fish Veterinary Journal, 3, 46–51. rae gh (2002) Sea louse control in Scotland, past and present, Pest Management Science, 58(6), 515–20. raynard rs, munro als, king j, ellis ae, bruno dw, bricknell ir, vahanakki p, wootten r, sommerville c, petrie a, vivers b, andrade-salas o, melvin w, amezega t, labus mb, coull jj, relly p, mulcahy mf, o’donoghue m and o’connell j (1994) Development of a vaccine for the control of sea lice (Lepeophtheirus salmonis and Caligus elongatus) in Atlantic salmon (Salmo salar L), F:17, International Council for Exploration of the Sea, Copenhagen. raynard rs, bricknell ir, billingsley pf, nisbet aj, vigneau a and sommerville c (2002) Development of vaccines against sea lice, Pest Management Science, 58, 569–75. reimschuessel r (2008) Assessing the human health implications of new veterinary drugs used in fish farming, in Lie Ø (ed.), Improving Farmed Fish Quality and Safety, Woodhead, Cambridge, 128–56. revie cw, robbins c, gettinby g, kelly l and treasurer jwa (2005) A mathematical model of the growth of sea lice, Lepeophtheirus salmonis, populations on farmed Atlantic salmon, Salmo salar L., in Scotland and its use in the assessment of treatment strategies, Journal of Fish Diseases, 28(10), 603–13.

242


rose jd, marrs gs, lewis c and schisler g (2000) Whirling disease behaviour and its relation to pathology of brain stem and spinal cord in rainbow trout, Journal of Aquatic Animal Health, 12(2), 107–18. ross nw, firth kj, wang a, burka jf and johnson sc (2000) Changes in hydrolytic enzyme activities of naïve Atlantic salmon Salmo salar skin mucus due to infection with the salmon louse Lepeophtheirus salmonis and cortisol implantation, Diseases of Aquatic Organisms, 41(1), 43–51. ross nw, johnson sc, fast md and ewart kv (2008) Recombinant Vaccines Against Caligid Copepods (Sea Lice) and Antigen Sequences Thereof, United States Patent Application 20080003233, http://www.freepatentsonline.com/ y2008/0003233.html, accessed February 2009. sayer md, treasurer jw and costello mj (1996) Wrasse biology and aquaculture applications: commentary and conclusions, in Sayer MDJ, Treasurer JW and Costello MJ (eds), Wrasse: Biology and Use in Aquaculture, Fishing News Books, Oxford, 240–46. scarfe ad, lee cs and o’bryen pj (eds) (2006) Aquaculture Biosecurity: Prevention, Control, and Eradication of Aquatic Animal Disease, Blackwell, Ames, IA. schnick ra (1991) Chemicals for world-wide aquaculture, in Fish Health Management in Asia-Pacific, Report on a Regional Study and Workshop on Fish Disease and Fish Health Management, Asian Development Bank and Network of Aquaculture Centres in Asia, Bangkok, 441–66. schnick ra (2001) International harmonization of antimicrobial sensitivity determination for aquaculture drugs, Aquaculture, 196(3–4), 277–88. schnick ra, alderman dj, armstrong r, gouvello r, le ishihara s, lacierda ec, percival s and roth m (2005) Worldwide Aquaculture Drug and Vaccine Registration Progress, Aqua KE Government Documents (2005): 8010190, Joint Subcommittee on Aquaculture, http://govdocs.aquake.org/cgi/reprint/2005/801/8010190. pdf, accessed February 2009. shinn ap, kay jw and sommerville c (2000) The use of statistical classifiers for the discrimination of species of the genus Gyrodactylus (Monogenea) parasitising salmonids, Parasitology, 120, 1–9. shinn ap, sommerville c and gibson di (1998) The application of chaetotaxy in the discrimination of Gyrodactylus salaris Malmberg, 1957 (Gyrodactylidae: Monogenea) from species of the genus parasitising British salmonids, International Journal of Parasitology, 28, 805–14. sommerville c (1995) Latest weapons in the war on lice, FISH FARMER, March/ April, 53–5. sommerville c (1998) Parasitic diseases of fish, in Black K and Pickering A (eds), The Biology of Farmed Fish, Sheffield Biological Sciences, Vol. 1, Sheffield Academic Press, Sheffield, 146–79. subasinghe r (2004) Quarantine procedures and their implementation, In Gupta MV, Bartley DM and Acosta BO (eds), Use of Genetically Improved and Alien Species for Aquaculture and Conservation of Aquatic Biodiversity in Africa, Worldfish Center, Penang, 66–76. subasinghe r and arthur jr (1997) Introducing AAPQIS: the FAO’s Aquatic Animal Pathogen and Quarantine Information System (English), In FAO Aquaculture Newsletter (FAO) (no. 16) 3–6. subasinghe rp and bondad-reantaso mg (2006) Biosecurity in aquaculture: International agreements and instruments, their compliance, prospects and challenges for developing countries, in Scarfe AD, Lee CS and O’Bryen PJ (eds), Aquaculture Biosecurity: Prevention, Control, and Eradication of Aquatic Animal Disease. Blackwell, Ames, IA, 9–16.


243

tan cw, jesudhasan rrr and woo ptk (2008) Towards a metalloprotease-DNA vaccine against piscine cryptobiosis caused by Cryptobia salmositica, Parasitology Research, 102, 265–75. taylor ngh, sommerville c and wootten r (2006) The epidemiology of Argulus spp. (Crustacea: Branchiura) infections in stillwater trout fisheries, Journal of Fish Diseases, 29, 193–200. todd cd, walker am, wolff k, northcott sj, walker af, ritchie mg, hoskins r, abbott rj and hazon n (1997) Genetic differentiation of populations of the copepod sea louse Lepeophtheirus salmonis (Krøyer) ectoparasitic on wild and farmed salmonids around the coasts of Scotland: Evidence from RAPD markers, Journal of Experimental Marine Biology and Ecology, 210(2), 251–74. todd cd, walker am, ritchie mg, graves ja and walker af (2004) Population genetic differentiation of sea lice (Lepeophtheirus salmonis) parasitic on Atlantic and Pacific salmonids: analyses of microsatellite DNA variation among wild and farmed host, Canadian Journal of Fisheries and Aquatic Science, 61(7), 1176–90. treasurer jw and james w (2002) A review of potential pathogens of sea lice and the application of cleaner fish in biological control, Pest Management Science, 58(6), 546–58. treasurer jw and pope ja (2000) Selection of host sample number and design of a monitoring programme for ectoparasitic sea lice (Copepoda: Caligidae) on farmed Atlantic salmon, Aquaculture, 187, 247–60. treasurer jw, wadsworth s and grant a (2000) Resistance of sea lice, Lepeophtheirus salmonis (Krøyer), to hydrogen peroxide on farmed Atlantic salmon, Salmo salar L, Aquaculture Research, 31, 855–60. tucker cs, norman r, shinn ap, bron je, sommerville c and wootten r (2002) A single cohort, time delay model of the life cycle of the salmon louse (Lepeophtheirus salmonis) on Atlantic salmon Salmo salar, Fish Pathology, 37, 107–18. valtonen et and keränen al (1981) Ichthyophthiriasis of Atlantic salmon, Salmo salar L., at the Montta hatchery in northern Finland in 1978–79, Journal of Fish Diseases, 4, 405–11. wang x and dickerson hw (2002) Surface immobilization antigen of the parasitic ciliate Ichthyophthirius multifiliis elicits protective immunity in channel catfish (Ictalurus punctatus), Clinical Diagnostic Laboratory Immunology, 9, 176–81. wang x, clark tg, noe j and dickerson hw (2002) Immunisation of channel catfish, Ictalurus punctatus, with Ichthyophthirius multifiliis immobilisation antigens elicits serotype-specific protection, Fish and Shellfish Immunology, 13, 337–50. woo ptk (ed.) (2006) Fish Diseases and Disorders Volume 1: Protozoan and Metazoan Infections, 2nd edn, CABI, Oxford. woodward kn (1996) The regulation of fish medicines – UK and European Union aspects, Aquaculture Research, 27(10), 25–34. würtz j, knopf k and tarachewski h (1998) Distribution and prevalence of Anguillicola crassus (Nematoda) in eels Anguilla anguilla of the rivers Rhine and Naab, Germany, Diseases of Aquatic Organisms, 32, 137–43.

9 Controlling viral diseases in aquaculture: new developments T. Renault, Ifremer, France

Abstract: Looking at the level of aquaculture species production, viral disease control remains an important challenge. However, relatively little is known about what farmers can do to prevent and treat viral infections and how fish and shellfish fight viral diseases. Difficulties for control of viral infections in aquaculture mainly come from the lack of commercial vaccines and from the absence of specific therapeutic agents. Prevention and control first pass through control of fish and shellfish movements. Understanding complex interactions between animal, environment and pathogen also appears as a necessary avenue. In the long term, alternative treatments using antiviral drugs may be developed, but the most effective way for sustainable aquaculture production may certainly rely on the production of selected animals for disease resistance. Key words: viral diseases, aquaculture, disease control, immunity, vaccination, selection, transfer regulation.

9.1 Introduction World aquaculture has grown at an average annual rate of almost 8.8 % from 1950 to 2004 compared with 3 % for livestock meat and 1.6 % for capture fisheries production (FAO, 2006). Aquatic production (including plants) has steadily increased since the early 1950s (a million tonnes). By 1996, the total production of cultured finfish, shellfish and aquatic plants was 34.1 million tonnes which was valued at US$46.5 billion. Total world aquaculture production reached 59.4 million tonnes for a value of US$70.3 billion by 2004 (FAO, 2006). In this context, aquaculture is perceived as having the greatest potential to meet the growing demand for aquatic food, at time when the production from capture fisheries has reached a plateau, and most of the main fisheries are fully exploited.

Controlling viral diseases in aquaculture: new developments

245

Aquaculture, however, has its own problems to contend with. From time to time populations of cultivated animals may suffer from severe mortality outbreaks. Among the possible causes there is the occurrence of infectious diseases due to an extended variety of pathogens. Resulting diseases arise partly from the high stocking density in production systems in conjunction with stress induced by environmental fluctuations and management practices. Viruses are among the most destructive pathogens encountered in aquaculture and are a limiting factor to the success of many aquaculture farms through (i) direct losses of fish and shellfish, (ii) indirect costs from reduced productivity and costs of disease management and (iii) loss of export markets related to imposition of trade restrictions. Although their management must be an integral part of farm husbandry, identification of viruses and investigation of viral diseases is highly specialized and requires special training and equipment. Despite the impact that viral diseases have on aquatic organisms, relatively little is known about what farmers can do to prevent and treat viral infections and how fish and shellfish fight viral diseases. Difficulties encountered in the control of viral infections in aquaculture mainly come from the lack of commercial vaccines and from the absence of specific therapeutic agents. Consequently, farmers are left with few resources other than the use of preventive measures. In the long term, alternative treatments such as antiviral drugs may be developed and the most effective way for sustainable aquaculture production will certainly rely on the production of selected animals for disease resistance. In a holistic overview of aquaculture species production, viral disease control remains an important challenge. The prevention and control of viral diseases ranges from the control of mollusc movements to understanding complex interactions between animal, environment and pathogens to the genetic selection for disease resistance.

9.2 Overview of viral diseases in aquaculture 9.2.1 Fish viruses As husbandry practices have improved in the past decades and bacterial diseases have been partially managed, viral diseases have emerged as continuing problems to the fish aquaculture industry (NASCO, 1993; Stephen and Iwama, 1997). Several major viral diseases such as infectious pancreatic necrosis (IPN), infectious haematopietic necrosis (IHN), viral haemorrhagic septicaemia (VHS) and infectious salmon anaemia (ISA) cause severe losses in fish farming (Table 9.1). Moreover, all the fish diseases notifiable to Office International des Epizooties (OIE, World Organisation of Animal Health) are viral infections indicating the importance of fish viruses worldwide (Table 9.2).

246


Table 9.1 Main fish viral diseases Diseases

Type of virus

Fish species affected

References

Enzootic haematopoietic necrosis (EHN)

Iridovirus

Infectious haematopoietic necrosis (IHN) Spring viraemia if carp (SVC) Viral haemorrhagic septicaemia (VHS)

Rhabdovirus

Redfin perch, Perca fluviatilis, and rainbow trout, Oncorhynchus mykiss Salmonids

Langdon and Humphrey, 1987; Langdon et al., 1988 Bootland and Leong, 1999

Rhabdovirus

Cypriid fish

Fijan, 1999

Rhabdovirus

Rainbow trout, Oncorhynchus mikiss Trout and salmon

Wolf, 1988

Atlantic salmon, Salmo salar A wide range of species

Thorud and Djupvk, 1988 Frerichs et al., 1996

Channel catfish, Ictalutus punctatus Koi carps

Wolf, 1988

Infectious pancreatic necrosis (IPN) Infectious salmon anaemia (ISA) Viral encephalopathy and retinopathy (VER) or Viral nervous necrosis (VNN) Channel catfish virus disease (CCVD) Koi herpes disease (KHVD)

Table 9.2

Nodavirus

Herpes virus Herpes virus

Notifiable fish diseases

Notifiable viral diseases Enzootic haematopoietic necrosis (EHN) Infectious haematopoietic necrosis (IHN) Spring viraemia of carp (SVC) Viral haemorrhagic septicaemia (VHS) Infectious salmon anaemia (ISA) Red sea bream iridovirla disease Koi herpes disease (KHVD)

OIE, Health Code, 2007

Directive 2006/88/EC

X X X X X X X

X1 X2 X2* X2 X2 X2

1 Exotic disease in the Directive 2006/88/EU. 2 Non-exotic disease in the Directive 2006/88/ EU. 2* SVC removed from the Annex IV (Directive 2006/88/EU), Directive 2008/53/EU. Source: OIE, 2007; EC, 2006.


247

9.2.2 Crustacean viruses Viruses are the most diverse and numerous of the infectious microbial agents described for crustaceans. Over 30 viruses have been reported from aquatic crustaceans (Bonami, 1976; Couch, 1981; Johnson, 1984; Sparks, 1985; Mari and Bonami, 1986), and in marine shrimp aquaculture, viruses cause the most economically significant biotic diseases. Management of viral diseases is particularly important to the success of semi-intensive shrimp farming. For example, in Taiwan, the production of Penaeus monodon decreased from about 90 000 tons in 1987 to 20 000 in 1989 and has still not recovered because of baculovirus infections. Since shrimp farming currently relies primarily on wild-caught stock, shrimp viral pathogens are repeatedly introduced into cultured systems. Additionally, these pathogens continue to be disseminated over wide geographical areas with movement of shrimp stocks for aquaculture purposes (Lightner et al., 1983; Colorni et al., 1987; Brock et al., 1993). The viruses affecting penaeid shrimp include DNA viruses and RNA viruses (Tables 9.3 and 9.4).

9.2.3 Mollusc viruses The discovery of viruses in marine bivalves is a fairly recent event. Although several viruses are only detectable in molluscs that are suffering from another disease or from environmental stress such as pollution, several massive mortality outbreaks have been correlated to viral infections. Mass mortalities of Portuguese oysters, Crassostrea angulata, among French

Table 9.3 Main crustacean viral diseases Crustacean species affected

Reference

Parvoviridae

Penaeus stylirostris

Lightner et al., 1983

Dicistroiridae

Penaeus vannamei Shrimp and other crustacean species Penaeus monodon Penaeid shrimp

Hasson et al., 1995 Lightner and Redman, 1998

Diseases

Type of virus

Infectious hypodermal and hematopoietic necrosis (IHHN) Taura syndrome (TSV) White spot syndrome disease (WSSV)

Nimaviridae

Yellowhead disease (YHD) Tetrahedral baculovirosis (Baculovirus penaei) Sperical baculovirosis (Penaeus monodontype baculovirus)

Roniviridae (Okavirus) Baculoviridae Baculoviridae

Penaeus monodon

Cowley et al., 2000 Lightner et al., 1983 Lightner et al., 1983

248


Table 9.4

Notifiable crustacean diseases

Notifiable viral diseases Taura syndrome (TSV) White spot syndrome disease (WSSV) Yellowhead disease (YHD) Tetrahedral baculovirosis (Baculovirus penaei) Sperical baculovirosis (Penaeus monodon-type baculovirus) Infectious hypodermal and haematopoietic necrosis (IHHN)

OIE, Health Code, 2007

Directive 2006/88/EC

X X X X X

X1 X2 X1

X

1 Exotic disease in the Directive 2006/88/EU. 2 Non-exotic disease in the Directive 2006/88/ EU. Source: OIE, 2007; EC, 2006.

stocks between 1967 and 1973 were associated with irido-like virus infections (Comps and Duthoit, 1976, 1979; Comps and Bonami, 1977). Herpeslike virus and herpes virus infections have been identified in various marine mollusc species in different countries (Farley et al., 1972; Hine et al., 1992; Nicolas et al., 1992; Hine and Thorne, 1997; Renault et al., 2000, 2001; Arzul et al., 2001; Renault and Arzul, 2001; Vásquez-Yeomans et al., 2004; Chang et al., 2005; Friedman et al., 2005; Hooper et al., 2007). Other viruses described in bivalves are identified as members of the Papovaviridae, Togaviridae, Retroviridae, Reoviridae, Birnaviridae and Picornaviridae (Farley, 1976, 1978; Oprandry et al., 1981; Ramussen, 1986; Bower, 2001).

9.3 Limitation of current management techniques There are many transfers of aquatic species between the countries culturing them and many introductions of non-native species (alien species) in order to develop new farming activities (Goulletquer and Heral, 1997; Calvo et al., 2001; Anderson et al., 2004). Air transport and increased global trade facilitate transfers and introductions of live animals. However, although these movements and transfers have had a positive impact on the development of aquaculture, they are also identified as a threat to biodiversity and a major source of pathogens. Finally the aquatic environment makes it difficult to confine stock for the purpose of preventing disease spread and dissemination. Currently the available chemotherapy is highly restricted in aquaculture in order to control risks to consumer safety and to avoid the development of resistant pathogen strains. In this context, regulations on the use of


249

antimicrobials, veterinary drugs and chemicals in aquaculture have been developed and implemented in many countries worldwide. Moreover, animals are often reared in open waters which strongly limits the use of drugs in relation to the quantity to be used and their impact on surounding ecosystems. Nevertheless, animals are continuously at risk of exposure to pathogens present in their environment. Chemotherapy may, however, be successfully applied in confined and controlled facilities such as hatcheries and nurseries. Although vaccination is used routinely to prevent viral diseases in veterinary medicine, it is not widely used in fish. At present, commercial vaccines have been developed for protection of fish from bacterial agents. Early prototype vaccines containing inactivated viruses developed for administration by immersion all resulted in insufficient protection. The use of attenuated or avirulent forms of viruses is regarded as unacceptable due to the residual virulence in targeted species and virulence in non-target species. In this context, DNA vaccines appear as promising tools for immunization of fish, and extended research has been developed for a number of viral fish diseases including rhabdovirus infections. DNA vaccination is based on the administration of the gene encoding the vaccine antigen. The host immune system is triggered by subsequent expression of the antigen after vaccination. Despite intensive research efforts since the late 1990s, there is only one DNA vaccine on the market targeting a fish viral disease. It encodes the glycoprotein G of IHNV (Apex-IHN®, Vical) and is used in salmon aquaculture in Canada (Hensley, 2005). Although promising results have also been reported for the vaccines against VHS, there are no commercial vaccines available to control VHS (Lorenzen et al., 2001; Utke et al., 2008). The mechanism through which resistance is conferred by these vaccines is unknown. However, non-specific protection is conferred by the vaccines at early stages post-infections suggesting that innate immunity in fish plays a key role in resistance to viral infections. Crustaceans and molluscs, like other invertebrates, lack an adaptative immune system and an immunological memory. They do not possess lymphocytes and do not produce antibodies. Hence, vaccination cannot be used to protect them against pathogens, and indirect diagnosis tests including serology are not available. The direct detection of infectious agents remains the only possible approach.

9.4 Advances in understanding of immunity of aquacultured species to viral diseases The vertebrate immune system displays both specific and non-specific (innate) mechanisms while invertebrates have only non-specific defence mechanisms. The innate system is the more ancient. This system relies on cells (i.e. phagocytes) and blood-borne molecules (i.e. complement). The

250


fact that invertebrates make up greater than 90 % of all species on earth attests to the efficiency of their ‘primitive’ host defence systems, at least at the population level. Since the 1990s, it has become more and more evident that some of these innate mechanisms are conserved in invertebrates (e.g. Drosophila) and mammals, suggesting that discoveries are applicable to a wide range of phyla (Medzhitov et al., 1997; Means et al., 2000). In addition, it has been shown that the non-specific response is required to initiate the specific immune response in mammals. Thus, nonspecific immunity is increasingly perceived as being of fundamental importance. Various strategies are employed by invertebrates and vertebrates to kill invasive or opportunistic microorganisms, including phagocytosismediated killing, agglutination, encapsulation, release of microbicidal molecules and apoptosis. Antiviral innate immunity is important because it constitutes the first line of defence in vertebrates, and the only one in invertebrates. Host cells are stimulated to change their transcriptional profile, to produce antiviral molecules and immune mediators or to die in order to protect other cells. Therefore, innate immunity in fish, molluscs and crustaceans has been actively investigated in recent years in order to determine which innate defence mechanisms are triggered in viral infections. Several approaches including mRNA differential display, suppressive subtractive hybridization (SSH) (He et al., 2005), expressed sequence tag (EST) libraries (Jenny et al., 2002; Song et al., 2006) and gene arrays (microarray) (Dhar et al., 2003; Wang et al., 2006) have been developed in order to study differentially expressed genes after a viral infection in fish and shellfish. Through such studies, conserved mechanisms and pathways of the innate immunity have been identified. Characterization of innate immune responses has been carried out using different viral disease models including fish, crustacean and mollusc diseases. This permits interchange of knowledge and methodological progress in the field of non-specific immunity. Moreover, studies have been performed at the biochemical and genomic levels. Taken together, both approaches may lead to the characterization of antiviral molecules and mechanisms in invertebrates and lower vertebrates. This, in turn, is of benefit to the design of more potent vaccines in fish and antiviral therapeutic agents, and to the identification of new targets for preventive actions in different cultured aquatic species. Genomic and proteomic approaches may provide good opportunity to identify and exploit conserved pathways in different invertebrate phyla (molluscs and crustaceans) and vertebrates and to provide new insight into the evolution and flexibility of defence systems. The innate immune responses of fish, molluscs and crustaceans remains a vast domain to be explored and is very likely to present potential applications: (i) by the use of defined molecules as therapeutic agents, (ii) by the use of encoding genes as selection markers for improving resistance to infections and (iii) by the development of new vaccines in fish.


251

9.4.1 Virus-induced genes Induction of host cell genes in response to viral infections constitutes a major step in the initiation of the host defence system. Viruses induce the up-regulation of various host genes (O’Shea, 1997; Welsh and Sen, 1997), some of which have antiviral activity. The interferon and interferon-induced genes are probably the best studied in mammalian models, but few data are available on fish and invertebrates. New virus-induced genes in nonclassical models such as fish and shellfish are of interest in studying the virus–host relationship in lower vertebrates and in invertebrates and in obtaining insights into the mechanisms involved in immune responses to viral stimuli. It is important to note that function characterization of conserved virus-induced genes may also add to discoveries in mammals. This is consistent with the current comparative approach to functional genomics and postgenomics, from bacteria to human. Some genes involved in the interferon-dependent response have been cloned in fish (Trobridge and Leong, 1997; Trobridge et al., 1997) and new fish genes (Vig-1 and Vig-2) induced by VHSV have been reported in rainbow trout, Oncorhynchus mykiss, cells (Boudinot et al., 1999, 2000). Vig-1 is homologous to a recently described human cytomegalovirusinduced gene (Zhu et al., 1997). The mouse homolog is very similar to the trout gene, and is also induced by viruses and lipopolysaccharides (LPS), showing that genes of this family are implicated in the non-specific response throughout the vertebrates (Boudinot et al., 2001). Vig-1 may be involved in the non-specific virus-induced synthesis of enzymatic cofactors of the nitric oxide (NO) pathway (Vasquez-vivar et al., 1998). This is significant because NO is an important compound of the innate immune response to viruses (Karupiah et al., 1993; Komatsu et al., 1996; Reiss and Komatsu, 1998; Zaragosa et al., 1998). An increased transcription of several immune related genes including interleukin 1β (Il-1β), transforming growth factor β (TGF-β) and IL-8 genes has also been reported in the rainbow trout after VHSV infection suggesting a role for these molecules in antiviral defence (Tafalla et al., 2005). Knowledge about antiviral defence at the molecular level has developed rapidly in recent years. Such approaches have been employed to identify differentially expressed genes and to find immune-relevant factors responsible for virus resistance in shrimp. For exmple, in WSSV-infected shrimp, Penaeus stylirostris, immune-related genes including the genes encoding lipopolysaccharide and β-1,3 glucan binding protein (LGBP), serine protease, C-type lectin, macrophage mannose receptor and low-density lipoprotein receptor were over-expressed in comparison to non-infected animals (Dhar et al., 2003). In a more recent study, genes encoding an interferon-like protein and a (2′-5′) oligo(A) synthetase-like protein, respectively, have been identified in WSSV-resistant shrimp, P. japonicus (He et al., 2005). These two proteins are key components of the interferon system in vertebrates. Wang et al. (2006) also demonstrated a differential

252


profile of immune-related gene expression in response to WSSV infection in the Chinese shrimp, Fenneropenaeus chinensis. Although genes induced by viral infections and genes whose expression is related to the ability of shrimp to survive viral outbreaks have been identified, no significant insight into the antiviral mechanism in shrimp has been gained. A major concern in mollusc immunity is the fragmentary knowledge on effector proteins, regulatory pathways and related genes. However, various molecular technologies have been applied since the late 1990s in order to identify immunity conferring genes. These include genes encoding heat shock proteins, antimicrobial peptides, toll-like receptors and tumor necrosis factor (TNF) receptor associated proteins that have so far been identified in bivalves using EST libraries (Jenny et al., 2002; Guegen et al., 2003, 2006; Peatman et al., 2004; Tanguy et al., 2004; Song et al., 2006). Although such data may provide the basis for understanding the role of the innate immune system in molluscs, very little information is available on antiviral responses. During the course of an EU funded project (Avinsi, QLK2-CT2002-01691) SSH libraries have been constructed in order to study the antiviral response of adult Pacific oyster, Crassostrea gigas, to ostreid herpes virus 1 (OsHV-1) by identifying and studying virus-induced genes. Among the sequences that matched with the product of known genes, 9 % were related to putative immune functions (e.g. laccase, macrophage-expressed protein, molluscan defence protein, IK cytokine, myeloid differenciation factor 88, . . .) and the related oyster genes were totally sequenced by rapid amplification of cDNA ends polymer chain reaction (RACE PCR) (pers obs.). These immune-relevant genes have been used to construct a genetic map on the basis of a quantitative trait locus (QTL) approach during the course of another EU funded project (Aquafirst, Contract nº 513692) and have provided the basis for studying the role of the innate immune system in the immediate response to pathogens, especially viruses.

9.4.2 Antiviral molecules Biochemical characterization of antiviral molecules using tissue extracts from aquatic species has previously been reported. Several groups have carried out studies on induced proteins involved in the non-specific host defence response in invertebrates and have characterized a number of them including a large number of antimicrobial peptides (Gotz and Boman, 1985; Cociancich et al., 1994; Destoumieux et al., 1997; Bulet et al., 1999; Mitta et al., 1999; Relf et al., 1999). Although these molecules are characterized by a broad activity spectrum, affecting the growth of bacteria, fungi and yeast (Charlet et al., 1996; Mitta et al., 2000), antiviral effects have rarely been reported. However, many reports have been published about in vitro antiviral effects of extracts from aquatic species (algae, bacteria and plants) (Hasui et al., 1995; Garcia et al., 1999; Bergé et al., 1999; Matsuda et al.,


253

1999; Yasin et al., 2000). These studies are based on the inhibition of the in vitro replication of different viruses. In recent years, some studies have been developed on antiviral drugs focusing on the regulation of the innate defence system (Falco et al., 2007, 2008).

9.4.3 Apoptosis During viral infections of multicellular organisms, induction of apoptosis is often observed and can be regarded as a primitive antiviral mechanism (O’Brien, 1998; Everett and McFadden, 1999; Koyama et al., 2000). After viral infection, cells that die by apoptosis limit the ability of the virus to replicate and spread. The detection of apoptosis in lower vertebrates and invertebrates indicates that programmed cell death may be a key defence against viral infections. There is, consequently, a selective advantage for viruses that subvert apoptotic processes. Several viruses carry genes that interfere with the host’s apoptotic machinery, and such genes have been found in mammalian herpes viruses (Henderson et al., 1993; Zhu et al., 1995) and insect baculoviruses (Huang et al., 2000). Indeed, many viruses have developed strategies to inhibit or delay apoptosis in target cells and to activate apoptosis in immune cells, thereby lowering the immune response (Roulston et al., 1999). Studies have shown that apoptosis is induced in fish by VHSV and IPNV (Bjorklund et al., 1997; Hong et al., 1998, 1999a,b; Eléouët et al., 2001). An increased transcription of two genes (ubiquitin conjugating enzyme 7 interacting protein and interferon induced with helicase C domain protein 1, which may be involved in apotosis and IFN regulation) has been reported in viral encephalopathy and retinopathy (VER) infected sea bream, Sparus aurata (Dios et al., 2007). Herpes viruses infecting oysters and clams have also been associated with apoptosis (Renault et al., 2000, 2001). Genes encoding proteins significantly related to the inhibiton of apoptosis proteins (IAPs) in mammalian and insect cells have been described in OsHV-1, a herpes virus infecting Crassostrea gigas oyster larvae (Arzul et al., 2001; Davison et al., 2005). Moreover, it has been suggested that apoptosis may be the cause of death in shrimp with lethal viral infections and that it may be an integral part of a process for adaptive tolerance to viruses in crustaceans (Flegel, 1997; Pasharawipas et al., 1997; Flegel and Pasharawipas, 1998; Flegel, 2007). DNA fragmentation of the type considered as a hallmark of apoptsis has been reported in cultured black tiger shrimp, Penaeus monodon, infected with white spot syndrome virus (Sahout et al., 2001). A BIR-like motif (baculovirus IAP repeats) was also recently found in TSV genome (Mari et al., 2002). A recent study focusing on gene expression profiles in the hepatopancreas of the WSSV-resistant and susceptible Pacific white shrimp, Litopenaeus vannamei, demonstrated that genes encoding apoptotic-related proteins were expressed at a higher level in the virusresistant shrimp (Zhao et al., 2007).

254


9.4.4 RNA interference Double-stranded RNA (dsRNA), a virus-associated molecular pattern, is a potent inducer of antiviral responses. Specific RNA interference (RNAi) reponse, a phenomenon triggered by intracellular dsRNA, serves antiviral functions in vertebratres and invertebrates. RNAi relies on a series of gene silencing mechanisms; all of them are based on the processing of long dsRNA precursors into small interfering RNAs (siRNAs). The final effect is targeted degradation or translational repression of mRNAs that share sequence similiraty with the dsRNA inducer. In other words, RNAi is a sequence-specific, post-transcriptional process of mRNA degradation. RNAi has been reported as an effective mechanism to suppress viral infections or replication of many viruses. An effective RNAi machinery has been reported in fish and shrimp (Schyth et al., 2006; Robalino et al., 2007) and it may provide an efficient tool to fight viral diseases in aquaculture. Recently, it has been reported that exogenously synthetic long dsRNAs and siRNAs can inhibit viruses from different aquatic animals (Robalino et al., 2004; Tirasophon et al., 2005; Li et al., 2007; Wu et al., 2007, Xu et al., 2007). As an example, injection of sequence-dependent siRNA induces antiWSSV activity in Litopenaeus vannamei shrimp (Wu et al., 2007). Moreover, a sequence-specific dsRNA targeting shrimp β-integrin efficiently inhibits WSSV replication in experimentally infected shrimp P. japonicus (Li et al., 2007). The shrimp β-integrin has been demonstrated to act as a WSSV receptor (Li et al., 2007). Double strand (ds) RNA may also trigger innate antiviral immunity in fish and crustaceans (Dodd et al., 2004; Westenberg et al., 2005; Robalino et al., 2007). In fish, double-stranded DNA may induce a complex antiviral program mediated in part by interferons (IFN). Schyth et al. (2006) showed that VHSV glycoprotein siRNA efficiently inhibits VHSV multiplication. However, inhibition of SVCV, a heterologous rhabdovirus, has also been reported and an up-regulation of the interferon induced Mx gene observed. These results suggest that siRNAs induced a non-target specific antiviral effect. In the marine crustacean Litopenaeus vannamei, injection of dsRNA of diverse base composition is able to protect animals from mortality induced by two unrelated viruses, TSV and WSSV (Robalino et al., 2004). Shrimp immune system is able to recognize dsRNA as a virus-associated molecular pattern, resulting in the activation of an innate antiviral response.

9.5 New methods to control viral diseases in aquaculture and future trends 9.5.1 Control of animal movements Transfer regulations have been developed in order to avoid the introduction of animals from an enzootic area to a pathogen-free area. Specific viruses are included in lists of notifiable pathogens by the EU legislation


255

(2006/88/EC, Annex IV) (Tables 1 and 2) and by the OIE (Manual of Diagnostic Tests for Aquatic Animals, 2006 and the Aquatic Animal Health Code, 2007) (Tables II and IV). Targeted viruses and related viral diseases are listed based on the fact that they (i) resist or respond poorly to therapy, (ii) have a restricted geographical range, (iii) induce major economic losses, and affect species that are traded internationally. Although most of the notifiable diseases are viral diseases in fish and crustaceans, no viral disease is listed at present for molluscs. In this context, defining the health status (free from infection or infected) of fish and shellfish stocks from a production site, a geographical zone or an entire country through health surveillance programmes is an essential prerequiste to allow or not allow animal movements and transfers. Hatcheries who supply seeds to growers as an alternative to wild-caught sources demonstrate a rapid and constant expansion. They may contribute to the development of a substantial international trade in gametes, larvae and juveniles, and the distribution of stocks improved through selective breeding. As an example, mollusc hatchery development significantly contributes to production worldwide and hatcheries therefore have an increased contribution to movements, transfers and introduction of live animals. In Europe, the global hatchery production of oyster larvae is up to three billion individuals, and a large part (around 30 %) of this production is exported outside the country of production. Animal transfers are currently recognized as a major cause underlying outbreaks of mortality, epidemics and spread of diseases. With this in mind, hatcheries should be recognized as a risky segment of the aquaculture sector. At the same time, hatcheries have closed facilities that enhance disease control capabilities and may produce certified pathogen free progeny, and so help to reduce the circulation of infected stocks. Moreover, they may have a pivotal role in the development and implementation of health management strategies based on improved resistance to infectious diseases. The involvement of hatcheries in the control of viral diseases using commercial diagnosis kits would offer producers the possibility to contribute proactively in the early detection of possible adverse conditions for aquacultured species growth and survival before a major problem occurs, contributing to the minimization of the effects of disease outbreaks on their business and subsequently to the enhancement of their competitiveness. Adequate control of larvae and juveniles from hatcheries in case of intensive rearing in controlled facilities may avoid costly epizootics. Moreover, the availability of efficient tests for detection of specific viruses may facilitate screening of broodstock, juveniles and larvae before commercial transactions and therefore constitute a guarantee of product quality for fish and shellfish producers. As another example, production of specific pathogen free (SPF) shrimp in hatcheries will assure the farmer in the grow-out ponds that the larvae that he is buying will not infect his pond or farm with a disease.

256


It is also important to keep in mind that over-regulation could place unnecessary restrictions on free trade. Finally, at the administrative levels the impact of infectious diseases, especially non-notifiable diseases, is generally misunderstood or seriously underestimated, and it is not uncommon to find a lack of interest in their assessement. As an example, in mollusc hatcheries/nurseries, herpes virus infections have been frequently reported in larvae and juveniles and are involved in mortality outbreaks (Renault et al., 1994). The disease is not currently a notifiable disease subjected to specific control measures under EU or OIE legislation. However, the virus associated with these mortalities generates important economic losses and may jeopardize the sustainable development of this important socioeconomic activity in coastal regions.

9.5.2 Genetic improvment for disease resistance Enhancing fish and shellfish defense ability through their immunity is one of the important approaches to preventing and controlling infectious diseases. Studies were recently developed in order to provide valuable information for further understanding of the defense mechanisms in aquatic species and to define genetic markers of interest. In this context, selective breeding of aquacultured stocks appears as one of the most promising approaches for aquaculture development. Although there have been several fish breeding programs targeting the production of resistant animals to a particular viral disease worldwide since the 1990s, recent work has focused on positive correlation between resistance to several pathogens including bacteria and viruses. Odegard et al. (2007) assumed that efficient selection for improved resistance to both furonculosis, a bacterial disease, and ISA, a viral one, may be performed in Atlantic salmon (Salmo Salar). In shrimp, by serial cultivation of five successive generations of surviving P. stylirostris in captivity, an ‘IHHNVtolerant’ variety as been developed at the Ifremer center in Tahiti (French Polynesia) (Flegel, 2007). Taura syndrome virus (TSV)-tolerant shrimp stocks were also developed by serial selection of survivors from TSV challenges over several generations (Moss et al., 2005). However, TSV-tolerant families appeared to be not tolerant to WSSV, suggesting specific antiviral mechanisms (Moss et al., 2005). Based on recent data, research is iniated for developing Pacific oyster strains resistant or tolerant to OsHV-1 in France (T. Renault, pers. comm.). Data recently generated by genomic approaches may help in developing breeding programs by identification of genes of interest which can be used as genetic markers. Innate antiviral immunity and the RNAi pathways in fish and shrimp offer the possibility of genetic selection based on the identificaton of genes involved in these mechanisms. This information can be used to assist selection for antiviral resistance. Genetic engineering (gene transfer) can be a way to improve viral disease resistance in fish and shell-


257

fish. However, this approach must be evaluated against the demands of society for environmentally responsible practices in agriculture and food safety.

9.5.3 Vaccination Although major advances in antiviral vaccine research in fish were promised by recombinant DNA technology, these vaccines are not easy to use in the field and cause security concerns. Long-term safety issues related to the environment and the consumer remain to be fully addressed. Other innovative technical approaches may also be developed. Liu et al. (2006) have recently reported the use of virus-like particles (VLPs) to protect grouper Epinephelus lanceolatus against grouper nervous necrosis virus (GNNV), a piscine nodavirus. Recombinant viral proteins produced in yeast also appear as promising tools for induction of a protective immune response in fish by delivery in feeds (Allnutt et al., 2007). This may be a feasible approach since yeast is already a componant of feeds and, moreover, its production is low cost and easily engineered.

9.5.4 Alternative methods of prevention and treatment The preventive or therapeutical use of chemotherapeutants is highly restricted since fish and shellfish farming is mostly carried out in the natural aquatic environment. No efficient therapeutic agents against fish and shellfish viruses have yet been developed and so alternative methods are urgently needed. Work with acute viral infections in shrimp has shown that administration of dsRNA based on the genomes of RNA and DNA viruses is protective (Robalino et al., 2005; Yodmuang et al., 2006). RNAi-based gene therapies in viral diseases appear clearly as a promising approach to silence viral gene expression and to inhibit viral replication in aquatic animals. Moreover, host genes such as genes encoding virus receptors may be also targeted (Li et al., 2007). However, the very short half-life of synthetic dsRNA after injection is a major concern: si RNAs may not stay long enough for complete protection. In this context, high expression vectors and better transfection techniques are needed. Moreover, it is important to keep in mind that some viruses have evolved strategies to inhibit gene silencing mechanisms. Antiviral factors including antimicrobial peptides (AMPs) produced early after a first encounter with a virus also appear promising tools to control viral infections in aquaculture. Falco et al. (2007) reported that synthetic human α-defensin-1 (HNP1) exhibits anti-VHSV activity. HNP1 inactivates virus particles and induces antiviral response in host cells (Falco et al., 2007). Morever, the same research team showed that a β-defensin-like peptide identified in the rainbow trout, O. mykiss, induces production of

258


an antiviral activity and up-regulation of Mx, suggesting a type I IFNmediated antiviral mechanism (Falco et al., 2008).

9.5.5

Understanding complex interactions between animal, environment and pathogen for risk assessment Aquatic species are particularly challenged by their environment. They are frequently reared in environments subjected to fluctuations (temperature, salinity and pollution). Demonstration of the relationship between pollution and increase of susceptibility to infectious diseases has been carried out in aquatic species including bivalves. Chou et al. (1998) reported higher mortality rates in Meretrix lusoria contaminated with heavy metals and experimentally exposed to a birnavirus than in animals only contaminated or only infected. Summer seed mortality reported in Tomales Bay, California has been associated with extreme temperature, phytoplankton blooms and a herpesvirus (Burge et al., 2007). Reducing the impact of pathogens is likely to rely on knowledge of their biology.

9.5.6 Biosecurity Biosecurity appears as the favoured adopted approach. An efficient management of the sanitary status of fish and shellfish production relies on a significant involvement of the farmers who can be key players in disease control. Biosecurity has two main goals: to protect the facility and to protect the surrounding environment from the introduction of novel pathogens. Inherent to any biosecurity program is a record of the health history/status of all new animals entering a facility, control over movement of people and equipment, the ability to control water quality, a health monitoring program and standard operating procedures (SOPs) and current biosecurity measures at this facility. Measures must include: • • • •

health status of incoming animals; quarantine of brood animals; staff training; SOPs for all aspects of animal handling (e.g. daily checks, mortality reporting and response, handling of samples for disease diagnosis, etc.); • control measures: foot baths and footware of personnel; • handling of animals used in the development of their family lines. Moreover, a routine health sampling is needed to complement current protocols that examine animals only in response to problems. The utility of collecting samples for multiple analyses (such as histology and molecular analyses) appears as an important component of health monitoring for the facility particularly in light of the viral epidemic. The promotion of an integrated biosecurity approach and the development of rapid, reliable and sensitive diagnosis tools that meet the time


259

constraints experienced under hatching conditions are of the utmost importance for efficient control of diseases in hatcheries.

9.6 References allnutt f c t, bowers r m, rowe c g, vakharia v n, lapatra s e and dhar a k (2007) Antigenicity of infectious pancreatic necrosis virus VP2 subvirla particles expressed in yeast, Vaccine, 25, 4880–8. anderson j, hedgecock d, berrigan m, criddle k r, dewey w, ford s, gouletquer p, hildreth r, paolisso m, targett n and whitlach r (2004) Non-native Oysters in the Chesapeake Bay, National Research Council, National Academy Press, Washington, DC. arzul i, nicolas j-l, davison a j and renault t (2001) French scallops: a new host for ostreid herpesvirus 1, Virology, 290, 342–9. bergé j p, bourgougnon n, alban s, pojer f, chermann j c, billaudel s, robert j m, durand p and franz g (1999) Antiviral and anticoagulant activities of a water soluble compound extracted from the marine diatom Haslea ostrearia, Planta Med, 65, 604–9. bjorklund h v, johansson t r and rinne a (1997) Rhabdovirus-induced apoptosis in a fish cell line is inhibited by a human endogenous acid cysteine proteinase inhibitor, J Virol, 71(7), 5658–62. bonami j r (1976) Viruses from crustaceans and annelids: Our state of knowledge, Proc Int Colloq Invertebr Pathol, 1, 20–3. bootland l m and leong j c (1999) Infectious hematopoietic necrosis virus, in Woo P K T and Bruno D W (eds), Fish Diseases and Disorders, volume 3, Viral, Bacterial and Fungal infections, CABI, Oxford, 57–121. boudinot p, massin p, blanco m, riffault s and benmansour a (1999) Vig-1, a new fish gene induced by the rhabdovirus glycoprotein, has a virus-induced homologue in humans and shares conserved motifs with the MoaA family, J Virol, 73, 1846–52. boudinot p, riffault s, salhi s, carrat c, sedlik c, mahmoudi n, charley b and benmansour a (2000) Vesicular stomatitis virus and pseudorabies virus induce a vig1/cig5 homologue in mouse dendritic cells via different pathways, J Gen Virol, 81, 2675–82. boudinot p, sahli s, blanco m and benmansour a (2001) Viral haemorrhagic septicaemia virus induces vig-2, a new interferon responsive gene of rainbow trout, Fish Shellfish Immunol, 11, 383–97. bower s m (2001) Synopsis of infectious diseases and parasites of commercially exploited shellfish: Assorted viruses detected in oysters and of unknown significance, Fisheries and Oceans Canada, Vancouver, BC, http://www.pac.dfo-mpo. gc.ca/sci/shelldis/pages/assortvirusoy_e.htm, accessed January 2009. brock j a, lightner d v and bell t a (1993) A review of four virus (BP, MBV, BMN and IHHN) diseases of penaeid shrimp with particular references to clinical significance, diagnosis and control in shrimp aquaculture, Proceedings of the 71st International Council for the Exploration of the Sea, C.M. 1983/Gen:10/1–18. bulet p, hetru c, dimarcq j l and hoffman j (1999) Antimicrobial peptides in insects: structure and function, Dev Comp Immunol, 23, 329–44. burge c a, judah l r, conquest l l, griffin f j, cheney d, suhrbier a, vadopalas b, olin p g, renault t and friedman c s (2007) Summer seed mortalities of the Pacific oyster, Crassostrea gigas Thunberg, grown in Tomales Bay, California, USA: the influence of oyster stock, planting time, pathogens and environmental stressors, J Shellfish Res, 26(1), 163–72.

260


calvo g w, luckenbach m w, allen s k and burreson e m (2001) A comparative field study of Crassostrea ariakensis (Fujita 1913) and Crassostrea virginica (Gmelin1791) in relation to salinity in Virginia, J Shellfish Res, 20, 221–9. chang p h, kuo s t, lai s h, yang h s, ting y y, hsu c l and chen h c (2005) Herpeslike virus infection causing mortality of cultured abalone Haliotis diversicolor supertexta in Taiwan, Dis Aquat Org, 65, 23–7. charlet m, chernysh s, philippe h, hetru c, hoffman j and bulet p (1996) Isolation of several cysteine-rich antimicrobial peptides from the blood of a mollusc, Mytilus edulis, J Biol Chem, 271(6), 21808–13. chou h y, chang s j, lee h y and chiou y c (1998) Preliminary evidence for the effect of heavy metal cations on the susceptibility of Hard Clam (Meretrix lusoria) to clam birnavirus infection, Fish Pathol, 33, 213–19. cociancich s, bulet p, hetru c and hoffman j a (1994) Insect immunity and antibacterial proteins, Parasitol Today, 10, 132–9. colorni a, samocha t and colorni b (1987) Pathogenic viruses introduced into Israeli mariculture systems by imported penaeid shrimp, Bamidgeh, 39, 21–8. comps m and bonami j r (1977) Viral infection associated with mortality in the oyster Crassostrea gigas Thunberg, C R Acad Sci Hebd Seances Acad Sci D, 285, 1139–40. comps m and duthoit j l (1976) Infection virale associée à la maladie des branchies de l’huître portugaise (Crassostrea angulata lmk), C R Acad Sci Hebd Seances Acad Sci D, 282, 1991–3. comps m and duthoit j l (1979) Infections virales ches les huîtres Crassostrea angulata Lmk et Crassostrea gigas Th, Haliotis, 8, 301–7. couch j a (1981) Viral diseases of invertebrates other than insects, in Davidson E W (ed.), Pathogenesis of Invertebrates Microbial Diseases, Allanheld Osmun, Totowa, NJ, 127–60. cowley j a, dimmock c m, spann k m and walker p j (2000) Gill-associated virus of Penaeus monodon prawns: an invertebrate virus with ORF1a and ORF1b genes related to arteri- and coronaviruses, J Gen Virol, 81, 1473–84. davison a j, trus b l, cheng n, steven a c, watson m s, cunningham c, le deuff r m and renault t (2005) A novel class of herpesvirus with bivalve hosts, J Gen Virol, 86, 41–3. destoumieux d, bulet p, loew d, van dorsselaer a, rodriguez j and bachère e (1997) Penaeidins: A new family of antimicrobial peptides in the shrimp Penaeus vannnamei (Decapoda), J Biol Chem, 272(45), 28398–406. dhar a k, dettori a, roux m m, klimpel k r and read b (2003) Identification of differentially expressed genes in shrimp (Penaeus stylirostris) infected with White spot syndrom virus by cDNA microarrays, Arch Virol, 148, 2381–96. dios s, poisa-beiro l, figueras a and novoa b (2007) Suppression subtraction hybridization (SSH) and macroarray techniques reveal differential gene expression profiles in brain of sea bream infected with nodavirus, Molec Immunol, 44, 2195–204. dodd a, chambers s p and love d r (2004) Short interfering RNA-mediated gene trageting in the zebrafish, FEBS Lett, 561, 89–93. ec (2006) Council Directive 2006/88/EC of 24 October 2006 on animal health requirements for aquaculture animals and products thereof, and on the prevention and control of certain diseases in aquatic animals, Official Journal of the European Union, L328, 24 November, 14–56. eléouët j f, druesne n, chimlonczyk s, monge d, dorson m and delmas b (2001) Comparative study of In situ cell death induced by the viruses of Viral Heamorrhagic Septicemia (VHS) and Infectious Pancreatic Necrosis (IPN) in rainbow trout, J Comp Path, 124, 300–307.


261

everett h and mcfadden g (1999) Apoptosis: an innate immune response to virus infection, Trends Microbiol, 7(4), 160–5. falco a, mas v, tafalla c, perez l, coll j m and estepa a (2007) Dual antiviral activity of human alpha-defensin-1 against viral haemorrhagic septicaemia rhabdovirus (VHSV): inactivation of virus particles and infection of a type I interferon-related response, Antivir Res, 76, 11–123. falco a, chico v, marroqui l, perez l, coll j m and estepa a (2008) Expression and antiviral activity of a β-defensin-like peptide identified in the rainbow trout (Oncorhynchus mykiss) EST sequences, Molec Immunol, 45(3), 757–65. fao (2006) State of World Aquaculture 2006, FAO Fisheries Technical Paper Nº 500, Rome, Food and Agriculture Organization of the United Nations. farley c a (1976) Ultrastructural observations on epizootic neoplasia and lytic virus infection in bivalve molluscs, Prog Exp Tumor Res, 20, 283–94. farley c a (1978) Viruses and virus-like lesions in marine molluscs, Mar Fish Rev, 40, 18–20. farley c a, banfield w g, kasnic j r g and foster w s (1972) Oyster herpes-type virus, Science, 178, 759–60. fijan n (1999) Spring viraemia of carp and other virla disease agents of warm water fish, in Woo P T K and Bruno D W (eds), Fish Diseases and Disorders, volume 3, Viral, Bacterial and Fungal infections, CABI, Oxford, 177–244. flegel t w (1997) Special topic review: major viral diseases of the black tiger prawn (Penaeus monodon) in Thailand, World J Microbiol Biotechnol, 13, 433–42. flegel t w (2007) Update on virla accomodation, a model for host-viral interaction in shrimp and other arthropods, Develop Comp Immunol, 31, 217–31. flegel t w and pasharawipas t (1998) Viral accomodation: a new concepts for crustacean response to viral pathogens, in Flegel T W, Menasveta P and Paisarnat S (eds), Shrimp Biotechnology in Thailand, National Center for Genetic Engineering and Biotechnology, Bangkok, 245–50. frerichs g n, rodger h d and peric z (1996) Cell culture isolation of piscine neuropathy nodavirus from juvenile sea bass, Dicentrarchus labrax, J Gen Virol, 162, 2067–71. friedman c s, estes r s, stokes n a, burge c a, hargove j s, barber b j, elston r a, burreson e m and reece k s (2005) Herpes virus in juvenile Pacific oysters Crassostrea gigas from Tomales Bay, California, coincides with summer mortality episodes, Dis Aquat Org, 63(1), 33–41. garcia g, cavallaro l, broussalis a, ferraro g and martino r (1999) Biological and chemical characterization of the fraction with antiherpetic activity from Achyrocline flaccida, Planta Med, 65(4), 343–6. gotz p and boman h (1985) Insect immunity, in Kerkut G and Gilbert L (eds), Comprehensive Insect Physiology, Biochemistry and Pharmacology, Vol 3, Pergamon Press, Oxford, 453–85. goulletquer p and heral m (1997) Marine Molluscan production trends in France: from fisheries to aquaculture, NOAA Technical Report NMFS 129, National Oceanic and Atmospheric Administration, Washington, DC, 137–64. gueguen y, cadoret j p, flament d, barreau-roumiguière c, girardot a l, garnier j, hoareau a, bachère e and escoubas j m (2003) Immune gene discovery by expressed sequence tags generated from hemocytes of the bacteria-challenged oyster, Crassostrea gigas, Gene, 303, 139–45. gueguen y, herpin a, aumelas a, garnier j, fievet j, escoubas j m, bulet p, gonzalez m, lelong c, favrel p and bachère e (2006) Characterization of a defensin from the oyster Crassostrea gigas: recombinant production, folding, solution structure, antimicrobial activities and gene expression, J Biol Chem, 281, 313–23.

262


hasui m, matsuda m, okutani k and shigeta s (1995) In vitro antiviral activities of sulfated plysaccharides from a marine microalga (Cochlodinium polyrikoides) against human immunodeficiency virus and other enveloped viruses, Int J biol Macromol, 17, 293–7. hasson k w, lightner d v, poulos b t, redman r m, white b l, brock j a and bonami j r (1995) Taura syndrom in Penaeus vannamei: demonsration of a viral etiology, Dis Aquat Org, 23, 115–26. he n, qin q and xu x (2005) Differential profile of gene expressed in hemocytes of White Spot Syndrom Virus-resistant shrimp (Penaeus japonicus) by combining suppression subtractive hybridization and differential hybridizaton, Antiviral Res, 66, 39–45. henderson s, huen d, rowe m, dawson c, johnson g and rickinson a (1993) Epstein-Barr virus-coded BHRF1 protein, a viral homologue of Bcl-2, protects human B from programmed cell death, Proc Natl Acad Sci USA, 90(18), 8479–83. hensley s (2005) Vaccines that keep salmon safe to eat may help humans, Wall Street J, 23 September. hine p m and thorne t (1997) Replication of herpes-like viruses in haemocytes of adult flat oysters Ostrea angasi: an ultrastructural study, Dis Aquat Org, 29, 197–204. hine p m, wesney b and hay b e (1992) Herpesvirus associated with mortalities among hatchery-reared larval Pacific oysters, Crassostrea gigas, Dis Aquat Org, 12(2), 135–42. hong j r, lin t l, hsu y l and wu j l (1998) Apoptosis precedes necrosis of fish cell line with infectious pancreatic necrosis virus infection, Virology, 250(1), 76–84. hong j r, hsu y l and wu j l (1999a) Infectious pancreatic necrosis virus induces apoptosis due to down-regulation of survival MCL-1 protein expression in a fish cell, Virus Res, 63(1–2), 75–83. hong j r, lin t l, yang j y, hsu y l and wu j l (1999b) Dynamics of nontypical apoptotic morphological changes visualized by green fluorescent proteinin living cells with infectious pancreatic necrosis virus infection, J Virol, 73(6), 5056–63. hooper c, hardy-smith p and handlinger j (2007) Ganglioneuritis causing high mortalities in farmed Australian abalone (Haliotis laevigata and Haliotis rubra), Australian Vet J, 85(5), 188–93. huang q, deveraux q l, maeda s, salvesen g s, stennicke h r, hammock b d and reed j c (2000) Evolutionary conservation of apoptosis mechanisms: lepidopteran and baculoviral inhibitor of apoptosis proteins are inhibitors of mammalian caspase-9, Proc Natl Acad Sci USA, 97(4), 1427–32. jenny m j, ringwood a h, lacy e r, lewitus a j, kempton j w, gross p s, warr g w and chapman r w (2002) Potential indicators of stress response identified by expressed sequence tag analysis of hemocytes and embryos from the American oyster, Crassostrea virginica, Mar Biotechnol, 4, 81–93. johnson p t (1984) Viral diseases of marine invertebrates, Helgoländer Meeresunters, 37, 65–98. karupiah g, xie q w, buller r m, nathan c, duarte c and macmicking j d (1993) Inhibition of viral replication by interferon-gamma-induced nitric oxide synthase, Science, 261, 1445–8. komatsu t, bi z and reiss c s (1996) Interferon-gamma induced type 1 nitric oxid synthase activity inhibits viral replication in neurons, J Neuroiummunol, 68, 101–8. koyama a h, fukumori t, fujita m, irie h and adachi a (2000) Physiological significance of apoptosis in animal virus infections, Microbes Infect, 2(9), 1111–17.


263

langdon j s and humphrey j d (1987) Epizootic Hematopoietic Necrosis a new viral disease in redfin perch Perca fluviatilis L. in Australia, J Fish Dis, 11, 93–6. langdon j s, humphrey j d and williams l m (1988), Outbreaks of an EHNV-like iridovirus in cultured rainbow trout, Salmo gairdenri Richardson, in Australia, J Fish Dis, 10, 289–98. li d f, zhang m c, yang h j, zhu y b and xu x (2007) β-integrin mediates WSSV infection, Virology, 10, 1016–27. lightner d v and redman r m (1998) Shrimp diseases and current diagnostic methods, Aquaculture, 164, 201–20. lightner d v, redman r m and bell t a (1983) Infectious hypodermal and hematopoietic necrosis, a newly recognised virus disease of penaeid shrimp, J Invertebr Pathol, 42, 62–70. liu w, hsu c h, chang c y, chen h h and lin c s (2006) Immune response against grouper nervous necrosis virus by vaccination of virus-like particles, Vaccine, 24, 6282–7. lorenzen n, lorenzen e and einer-jensen k (2001) Immunity to viral haemorrhagic septicemia (VHS) following DNA vaccination of rainbow trout at an early life-stage, Fish Shellfish Immunol, 11(7), 585–91. mari j and bonami j r (1986) Les infections virales du crabe Carcinus mediterraneus Czerniavski, 1884, in Vivarès C P, Bonami J R and Jaspers E (eds), Pathology in Marine Aquaculture, Special publication No. 9, European Aquaculture Society, Bredene, 283–93. mari j, poulos b t, lightner d v and bonami j r (2002) Shrimp Taura Syndrome virus: genomic chracaterization and similitarity with members of the genus Cricket paralysis-like viruese: full nucleotide sequence, J Gen Virol, 83, 915–26. moss s m, doyle r w and lightner d v (2005) Breeding shrimp for disease resistance: challenge and opportunities for improvement, in Walker P J, Lester R G and Bondad-Reantaso M G (eds), Diseases in Asian aquaculture V. Proceedings of the fifth symposium on diseases in Asian aquaculture, Manila, Asian Fisheries Society, 379–93. matsuda m, shigeta s and okutani k (1999) Antiviral activities of marine Pseudomonas polysaccharides and their oversulfated derivates, Mar Biotechnol, 1, 68–73. medzhitov r, preston-hurlburt p and janeway c a (1997) A human homologue of the Drosophila Toll protein signals activation of adaptative immunity, Nature, 338, 394–7. means t k, golenbock t and fenton m j (2000) The biology of Toll-like receptors, Cytokins Growth Factor Reviews, 11, 219–32. mitta g, hubert f, nöel t and roch p (1999) Myticin, a novel cysteine-rich antimicrobial peptide isolated from haemocytes and plasma of the mussel Mytilus galloprovincialis, Eur J Biochem, 264, 1–9. mitta g, vandenbulcke f, hubert f, salzet m and roch p (2000) Involvement of mytilins in mussels antimicrobial defence, J Biol Chem, 275, 12954–62. nasco (1993) Impacts of Salmon Aquaculture, Edinburgh, North Atlantic Salmon Conservation Organization. nicolas j l, comps m and cochennec n (1992) Herpes-like virus infecting Pacific oyster larvae, Crassostrea gigas, Bull Eur Ass Fish Pathol, 12(1), 11–13. o’brien v (1998) Viruses and apoptosis, J Gen Virol, 79, 1833–45. odegard j, olesen i, gjerde b and klemetsdal g (2007) Positive genetic correlation between resistance to bacterial (furonculosis) and viral (infectious salmon anaemia) diseases in farmed Atlantic salmon (Salmo salar), Aquaculture, 271, 173–7.

264


oie (2007) Aquatic Animal Health Code, World Organisation for Animal Health, Paris. oprandry j j, chang p w, pronovost a d, cooper k r, brown c w and yates v j (1981) Isolation of a viral agent causing hematopoietic neoplasia in the soft-shell clam, Mya arenaria, J Invertebr Pathol, 38, 45–51. o’shea j j (1997) Jaks, STATs, Cytokine signals and immunoregulation: are we there yet?, Immunity, 7, 1–11. pasharawipas t, flegel t w, sriurairatana s and morrison d j (1997) Latent yellow-head infections in Penaeus monodon and implication regarding disease tolerance or resistance, in Flegel T W, Menasveta P and Paisarnat S (eds), Shrimp Biotechnology in Thailand, National Center for Genetic Engineering and Biotechnology, Bangkok, 45–53. peatman e j, wei x, feng j, liu l, kucuktas h, li p, he c, rouse d, wallace r, dunham r and liu z (2004) Development of expressed sequence tags from Eastern oyster (Crassostrea virginica): lessons learned from previous efforts, Mar Biotechnol, 6, 491–6. ramussen l p d (1986) Occurrence, prevalence and seasonality of neoplasia in the marine mussel Mytilus edulis from three sites in Denmark, Mar Biol, 92, 59–64. reiss c s and komatsu t (1998) Does nitric oxid play a critical role in viral infections?, J Virol, 72, 4547–51. relf j m, chisholm j r s, kemp g d and smith v j (1999) Purification and characterization of a cysteine-rich 11.5 kDA antibacterial protein from the granular haemocytes of the shore crab, Carcinus maenas, Eur J Biochem, 264, 350–7. renault t and arzul i (2001) Herpes-like virus infections in hatchery-reared bivalve larvae in Europe: specific viral DNA detection by PCR, J Fish Dis, 24, 161–7. renault t, le deuff r m, chollet b, cochennec n and gérard a (2000) Concomitant herpes-like virus infections in hatchery-reared larvae and nursery-cultured spat Crassostrea gigas and Ostrea edulis, Dis Aquat Org, 42(3), 173–83. renault t, lipart c and arzul i (2001) A herpes-like virus infects a non-ostreid bivalve species: virus replicaton in Ruditapes philippinarum larvae, Dis Aquat Org, 45, 1–7. robalino j, browdy c l, prior s, metz a, parnell p, gross p and warr g (2004) Induction of antiviral immunity by double-stranded RNA in a marine invertebrate, J Virol, 78, 10442–8. robalino j, barlett t, shepard e, prior s, jaramillo g, scura e, chaman r w, gross p s, browdy c j and warr g w (2005) Double-stranded RNA induces sequencespecific antiviral silencing in addition to non-specific immunity in a marine shrimp: convergence of RNA interference and innate immunity in the invertebrate antiviral response? J Virol, 79, 13561–71. robalino j, barlett t, chapman r w, gross p s, browdy c l and warr g w (2007) Double-stranded RNA and antiviral immunity in marine shrimp: Inducible hot mechanisms and evidence for evolution of viral counter-responses, Dev Comp Immunol, 31, 539–47. roulston a, marcellus r c and branton p e (1999) Viruses and apoptosis, Annu Rev Microbiol, 53, 577–628. sahout a h, hassan m d and shariff m (2001) DNA fragmentation, an indicator of apoptosis, in cultured black tiger shrimp Penaeus monodon infected with white spot syndrome virus (WSSV), Dis Aquat Org, 44, 155–9. schyth b d, lorenzen n and pedersen f s (2006) Antiviral activity of small interfering RNAs: Specificity testing using heterologous virus reveals interferonrelated effects overlooked by conventional mismatch controls, Virology, 349, 134–41.


265

song l, xu w, li c, li h, wu l, xiang j and guo x (2006) Development of expressed sequence tags from the Bay scallop Argopecten irradians irradians, Mar Biotechnol, 8, 161–9. sparks a k (1985) Synopsis of Invertebrate Pathology Exclusive of Insects, New York, Elsevier. stephen c and iwama g (1997) Fish Health Discussion Paper. Salmon Aquaculture Review, BC Environmental Assessment Office, Victoria, BC. tafalla c, coll j and secombes c j (2005) Expression of genes related to the early immune response inrainbow trout (Onchorhynchus mykiss) after viral haemorrhagic septicemia (VHS) infection, Dev Comp Immunol, 29, 615– 26. tanguy a, guo x and ford s e (2004) Discovery of genes expressed in response to Perkinsus marinus challenge in Eastern (Crassostrea virginica) and Pacific (C. gigas) oysters, Gene, 338, 121–31. tirasophon w, roshorm y and panyim s (2005) Silencing of yellow head virus replication in penaeid shrimp cells by dsRNA, Biochem Biophys Res Commun, 334, 102–7. thorud k e and djupvk h o (1988) Infectious salmon anaemia in Atlantic salmon, Salmo salar L., Bull Eur Assoc Fish Pathol, 8, 109–11. trobridge g d, chiou p p and leong j a (1997) Cloning of the rainbow trout (Oncorhynchus mykiss) Mx2 and Mx3 cDNAs and characterization of trout Mx protein expression in salmon cells, J Virol, 71, 5304–11. trobridge g d and leong j a (1997) Characterization of the rainbow trout Mx gene, J Interferon Cytokine Res, 15, 691–702. utke k, kock h, schuetze h, bergman s m, lorenzen n, einer-jensen k, köllner b, dalmo r a, vesely t, ototake m and fischer u (2008) Cell-mediated immune responses in rainbow trout after Dann immunization against the virual hemorrhagic specticemia virus, Dev Comp Immunol, 32, 239–52. vasquez-vivar j, kalyanaraman b, martazek p, hogg n, masters bss, karoui h, tordo p and pitchard p (1998) Superoxide generation by endothelial nitric oxid synthase: the influence of cofactors, Proc Natl Acad Sci USA, 95, 9220–5. vásquez-yeomans r, cáceres-martínez j and huerta a f (2004) Herpes-like virus associated with eroded gills of the Pacific oyster Crassostrea gigas in Mexico, J Shellfish Res, 23, 417–19. wang b, li f, dong b, zhang x, zhang c and xiang j (2006) Discovery of the genes in response to White Spot Syndrome Virus (WSSV) infection in Fenneropenaeus chinensis through cDNA microarray, Mar Biotechnol, 8, 491–500. welsh r m and sen g c (1997) Nonspecific host response to viral infections, in Nathanson N (ed.), Viral Pathogenesis, Lippincott-Raven, Philadelphia, PA, 109–41. westenberg m, heinhuis b, zuidema d and vlak j m (2005) SiRNA injection induces sequence-independent protection in Penaeus monodon against white spot syndrom virus, Virus Res, 114, 133–9. wolf k (1988) Infectious hematopoietic necrosis, in Wolf K (ed.), Fish Viruses and Fish Viral Diseases, Cornell University Press, Ithaca, NY, 83–114. wu y, lu l, yang l s, weng s p, chan s m and he j g (2007) Inhibition of white spot syndrom virus in Litopenaeus vannamei shrimp by sequence-specific si RNA, Aquaculture, 217, 21–30. xu j y, han f and zhang x b (2007) Silencing shrimp white spot syndrom virus (WSSV) genes by si RNA, Antivir Res, 73, 126–31. yasin b, pang m, turner j s, cho y, dinh n n, waring a j, lehrer r i and wagar e a (2000) Evaluation of the inactivation of infectious Herpes simplex virus by host-defense peptides, Eur J Clin Microbiol Infect Dis, 19(3), 187–94.

266


yodmuang s, tirasophon w, roshorm y, chinnirunvong w and panyim s (2006) YHV-protease dsRNA inhibits YHV replication in Penaeus monodon and prevents mortality, Biochem Biophys Res Comm, 341, 351–6. zaragoza c, ocampo c j, saura m, leppo m, wei x q, quick r, moncada s, liew f y and lowenstein c j (1998) The role of nitric oxide synthase in the host response to coxsackievirus myocarditis, Proc Natl Acad Sci USA, 95, 2469–74. zhao z y, yin z x, weng s p, guan h j, li s d, xing k, chan s m and he j g (2007) Profiling of differentially expressed genes in hepatopancreas of white spot sydrome virus-resistant shrimp (Litopenaeus vannamei) by suppression subtractive hydridisation, Fish Shellfish Immunol, 22, 520–34. zhu h, cong j p and shenk t (1997) Use of differential display analysis to assess the effect of human cytomegalovirus infection on the accumulation of cellular RNAs: induction of interferon-responsive RNAs, Proc Natl Acad Sci USA, 94, 13985–90. zhu h, shen y and shenk t (1995) Human cytomegalovirus IE1 and IE2 proteins block apoptosis, J Virol, 69, 7960–70.

10 Diet and husbandry techniques to improve disease resistance: new technologies and prospects F. J. Gatesoupe, INRA-Ifremer, France

Abstract: This chapter examines the emergence of new products and methods that have been aimed at improving disease resistance in aquaculture, and the implications for health of other technologies developed for fish and shellfish husbandry and feeding. The first section deals with the direct inhibition of pathogens, and the second with ways of improving welfare in order to reduce stress. The third part is devoted to feed additives that can stimulate the defenses, and to dietary side effects important for fish and shellfish health. Key words: microbial management, biocontrol agents, neuroendocrine immune axis, feed additives, feed hazards.

10.1 Introduction Health is of concern for everybody. The geneticist can select resistant animals, the veterinarian can vaccinate, diagnose diseases and prescribe remedies, but their efforts would be ineffective without the constant awareness of the farmer, whose husbandry know-how is essential to preserve animal health. Before this, the nutritionist should have paved the way by designing healthy feeds and additives. Increasing knowledge allows the emergence of new products and methods, which can cope with sanitary issues within the framework of sustainable development. This section will examine such innovation, but also the implications for health of other technologies developed for fish and shellfish husbandry and feeding. For instance, intensive rearing and closed circuit systems may be stressful, and hence threaten health. Another challenge is to replace fish meal and oil with alternative sources of protein and lipids while still meeting nutritional

268

New technologies in aquaculture Feed Nutrients

Pathogens

Immunostimulants Probiotics Prebiotics

Stress

Microbiota

Physical barrier innate Immune system

adaptive (finfish)

Fig. 10.1 External factors affecting health and the immune response: interactions between pathogens, stress factors, feed, microbiota and the immune response. Hygiene maintenance is the first weapon against pathogens (Section 10.2). Welfare improvement should limit the causes of stress, which degrade the immune defenses (Section 10.3). Diet should be aimed at stimulating innate immunity and the balance of the gut microbiota which bar the way to infection and which ‘educate’ the immune system. The diet should also reduce the adverse effects of stress, while avoiding nutrient excess that could benefit pathogens (Section 10.4).

requirements, and stimulating the immune system. Furthermore, the role of intestinal microbiota in fish health and nutrition has been recently shown, and it is worth reconsidering the complex interactions between pathogens, stress factors, feed, microbiota and the immune response of the animal (Fig. 10.1). Two main strategies will be addressed to fish farmers, describing (i) how they can fight the pathogens directly, by adjusting hygiene practice, and the future trends in pathogen inhibition, then (ii) how they can improve welfare to reduce stress. The third part will be devoted to formulating the feed to optimize the defenses of fish and shellfish.

10.2 Fighting the pathogens The previous Chapters (7–9) described the means available to avoid infection with various pathogens. The maintenance of strict hygiene conditions is fundamental, but that does not signify that a completely sterile environment would be desirable. The association of gut microbiota with aquatic organisms has been recently requalified from commensalism to mutualism, inferring the importance of preserving this ecosystem as far as possible.

Diet and husbandry techniques to improve disease resistance

269

That may be difficult in mollusc and shrimp hatcheries, where antibiotics are currently used to avoid mortality crashes, but alternative solutions are emerging (Riquelme et al., 2001; Garcia and Massam, 2005).

10.2.1

Understanding the importance of preserving intestinal microbiota The methods of gnotobiology have elucidated the roles of microbiota associated with aquatic animals (reviewed by Marques et al., 2006). Although bivalve larvae are certainly among the most sensitive organisms to bacterial diseases, Douillet (1989) noted poor growth and survival of bacteria-free oyster larvae (Crassostrea gigas) fed axenic algae. In aseptic conditions, most bacterial strains were harmful (Douillet and Langdon, 1993), but Douillet (1989) found three strains that improved survival and, among them, strain CA2 which also improved growth. In a similar experiment, Besse and Nicolas (1989) concluded that bacteria provide essential nutrients for bivalve larval growth. This was further confirmed by Douillet (1993), who demonstrated that oyster larvae digested and assimilated bacterial carbon from strain CA2. Antibiotic treatments may be also detrimental to water quality, as experienced by Andersen et al. (2000), who noted a build-up of ammonia in batches of great scallop larvae treated with chloramphenicol, hypothetically due to an alteration in microbial activity. In the absence of gnotobiological data, the role of microbiota has not been proved in penaeid larvae. However, Thompson et al. (1999) showed that São Paulo Shrimp (Penaeus paulensis) larvae fed bacteria in xenic conditions could survive longer than the starved control. Mohamed (1996) showed that relatively good results for development and survival of giant tiger prawn (Penaeus monodon) could be obtained with the partial substitution of dietary microalgae by bacterial biomass. The efficiency of bacteria as feed for brine shrimp (Artemia) was further studied in gnotobiotic conditions (Gorospe et al., 1996; Marques et al., 2006). The essential role of microbiota in fish gut ontogeny was demonstrated by Rawls et al. (2004, 2006), who compared the responses of axenic zebrafish (Danio rerio) larvae to those of germ-free fish inoculated post-hatch with bacterial strains or complex microbiota. These authors showed the role of gut bacteria in intestinal cell proliferation, immune response and nutrient metabolism, by quantifying the differential expression of marker genes. Microbiota originating from conventionally reared zebrafish were much more efficient than any of the isolates, especially in stimulating cell proliferation. The effect of microbiota on gut maturation in zebrafish was further evidenced by Bates et al. (2006), who observed in germ-free larvae several signs of poor differentiation of the intestinal epithelium, e.g. no detection of phosphatase activity in the brush border membrane, and lack of protein uptake by endocytosis.

270


10.2.2 Improving hygiene Strict hygiene rules should accompany the preservation of intestinal microbiota, to avoid infection (Section 10.6). Every person, live organism and material entering the rearing area may introduce pathogens. Thus there is a need for appropriate precautions, which include the quarantine of animals of non-certified origin, and all the disinfection treatments that are reasonably feasible. Water disinfection is particularly important, and there are several methods available. The most common one is based on physical treatment by UV irradiation. Summerfelt (2003) preferred this method, which is less expensive and simpler than ozonation, but which cannot work in the case of turbid water. Mitigated results were obtained by the combination of sand filtration and UV sterilization in mollusc hatcheries (Ford et al., 2001; SainzHernández and Maeda-Martínez, 2005), and some negative effects were reported by Matson et al. (2006). The chemical methods of disinfection – for instance with ozone or chlorine – may generate toxic by-products. However, there is a growing interest in ozonation, which not only disinfects the water, but also improves its quality for recirculation systems (Tango and Gagnon, 2003). After initial disinfection, the microbial settlement is generally left to chance in the rearing system, based on the recurrence of ‘endemic bacteria’ (Van Rijn, 1996). This is made reliable by a biofilter that creates narrow niche specialization, with high stability in microbial function, but diversity of the competent strains (Skjermo et al., 1997; Cytryn et al., 2005; Tal et al., 2006). However, the introduction of ‘starter bacterial population’, and other bioremediation and biocontrol agents, may be a safe precaution (Gross et al., 2006; Sections 10.2.5, 10.3.2). During the course of rearing, the wastes should be properly treated, and animal health should be constantly surveyed. Compartmentalizing the rearing units is essential to reduce the risk of disease spread, as well as fallowing at the end of each production cycle.

10.2.3 New antimicrobial preparations and compounds Many extracts from plant and animal origin have been documented for their antibacterial activity against fish pathogens (Gatesoupe, 2008a). Herbal medicines seem particularly promising as alternatives to antibiotics, not only for fish but also for shrimps (Direkbusarakom, 2004), including the post-larval stages (Citarasu et al., 2003a,b). Inhibitory effects were noted against fish and shrimp pathogenic viruses (Direkbusarakom, 2004; Balasubramanian et al., 2007) and fungi (Xu et al., 1994; Harikrishnan and Balasundaram, 2005). These medicines may also have immunostimulatory effects on fish (Section 10.4.4), shrimps (Citarasu et al., 2006) and abalone (Xue et al., 2008). Such effects on the host could account for the broad spectrum of diseases that might be treated, including infestation with


271

parasites (Auro de Ocampo and Jimenez, 1993; Direkbusarakom, 2004). However, the preventive or curative doses should be investigated carefully before application to a particular species, due to the risk of toxicity of some extracts, like that of neem (Azadirachta indica) for Indian carps (Das et al., 2002). This author has found no instances of plant extracts being used to treat bivalve larvae, which seem particularly susceptible to xenobiotics. It may be difficult to avoid the use of antibiotics in the case of great scallop (Pecten maximus) (Torkildsen et al., 2002). Smith (1994) suggested selecting microalgae with antimicrobial activity as shellfish food. That was effective for crustacean larvae – e.g. to control Vibrio spp. in shrimp hatcheries (Regunathan and Wesley, 2004) – but likely to be insufficient for molluscs, which require other sustainable treatments. Sun and Oliver (1994) suggested using diacetyl as antimicrobial agent to decrease the risk of human infection with Vibrio vulnificus from eating raw oysters, but the treatment was found effective only after shucking (Birkenhauer and Oliver, 2003). A solution applicable to larviculture was proposed by Takahashi et al. (2000a), who showed the inhibitory activity of ovoglobulins from hen eggs against Vibrio tubiashii, in experimental challenges of Pacific oyster (Crassostrea gigas) larvae. Other products from animal origin may have antimicrobial activity, and such antagonistic properties may be mainly expected from components of the innate immune system. Besides the natural defenses, some of these compounds extracted from other animals could be used, e.g. heterologous antimicrobial peptides. Ho et al. (2002) tested in vitro the antagonism of cecropins against shrimp pathogens. These peptides are unlikely to be suitable to treat marine shrimps, due to the minimum bactericidal concentration which was particularly high in seawater, close to the toxic dose for shrimp haemocytes. Jia et al. (2000) showed the need for a constant intraperitoneal supply of antimicrobial peptides to protect coho salmon (Oncorhynchus kisutch) against Vibrio anguillarum infection. The practical application of heterologous antimicrobial peptides would require finding the appropriate mode of introduction, such as transgenesis (Morvan et al., 1997; Cheng et al., 2001), or recombination in yeast (Dorrington, 2006). Among other animal products with antimicrobial activity, one could cite chitosan (Anas et al., 2005), and an extract from a marine sponge (Dendrilla nigra) (Selvin et al., 2004a), possibly due to symbiotic Streptomyces sp. (Selvin et al., 2004b). The use of inhibitors of bacterial quorum sensing has been also proposed by Defoirdt et al. (2004), with some practical applications to shrimps (Manefield et al., 2000; Defoirdt et al., 2006; Bai et al., 2008) and fish (Rasch et al., 2004, 2007). These inhibitors should be further tested, but caution should be exercised due their risk of toxicity for the host and microbiota. Moreover, slight changes in the biochemical structure may turn antagonistic molecules into agonists of quorum sensing (Geske et al., 2007). Another

272


innovative treatment was proposed by Defoirdt et al. (2007), who showed the inhibitory effect of poly-β-hydroxybutyrate against Vibrio campbellii in a challenge test with Artemia franciscana. The compound is produced and accumulated by bacterial strains, which may be used as convenient vectors for aquaculture purposes (Halet et al., 2007).

10.2.4 New biocidal compounds The use and environmental impact of classical disinfectants were reviewed by the joint Group of Experts on the Scientific Aspects of Marine Environmental Protection (GESAMP, 1997), including chloramine T, formalin, hypochlorite, iodophores and quaternary ammonium compounds. There is a growing interest in bronopol (2-bromo-2-nitro-1,3 propanediol, Pycese®) to protect fish and eggs against pathogenic fungi (Pottinger and Day, 1999) and bacteria (Treasurer et al., 2005; Birkbeck et al., 2006). Bronopol seemed less efficient against parasitosis, like ‘white spot’ on rainbow trout (Oncorhychus mykiss) (Shinn et al., 2005). The compound was not suitable in preventing mortality in scallop larvae (Torkildsen et al., 2002).

10.2.5 Biocontrol agents Many microbes are antagonistic to other microbes, and some are specific pathogens of infectious agents encountered in aquaculture. These properties can be exploited for biological control, but the potential for several cross-relations between probiotics and pathogens has been under-explored, to my knowledge (Table 10.1). This approach should not be confused with the indirect action of microbes used to stimulate the immune response of the host, which will be considered in Section 10.4.6. The control of viral infection by recombinant virus was noted there, notwithstanding its indirect mode of action by killing specifically infected Table 10.1 Some examples of potential biocontrol agents in aquaculture; many cross relations are, to my knowledge, still unexplored Biocontrol agent Pathogen Virus

Bacterium

Fungus

Reviewed by Maeda, 2004

Unexplored

Reviewed by Gram and Ringø, 2005

Fungus

‘Virus against virus’ technology, unexplored Bacteriophage therapy (reviewed by Nakai and Park, 2002) Unexplored

Parasite

Unexplored

Suggested by Leaño et al., 2005 ‘Killer yeast’ (Wang et al., 2007) Unexplored

Virus Bacterium

Saprolegnosis control (Lategan et al., 2004) Unexplored


273

cells of the host. First proposed by Schnell et al. (1997) against HIV, this promising technology for human medicine is unlikely to bring applications to aquaculture in the short term, but one could have the same opinion about bacteriophage therapy, which was successfully tested in fish (Nakai and Park, 2002) and shrimp (Vinod et al., 2006; Karunasagar et al., 2007). Other viruses are specific to pathogenic fungi and parasites, and they could be considered as possible biocontrol agents. For example, fungal hypoviruses were used against the chestnut blight fungus (Milgroom and Cortesi, 2004). The high specificity of viruses is a limiting factor in developing such approaches in connection with aquaculture. However, at least those targeting major diseases devoid of sustainable treatments should be worth investigating. The search for biocontrol of parasitism in aquaculture seems to be still lying fallow. There are few documented cases of applications of fungi, despite their great potential as anti-infective agents (Bhadury et al., 2006). Wang et al. (2007, 2008a) proposed to exploit a toxin produced by Pichia anomala against Metschnikowia bicuspidata, which was pathogenic in a Portunid crab (Portunis trituberculatus). Leaño et al. (2005) characterized fungi associated with shrimp culture in ‘green water’, and they suggested a possible involvement in the control of luminous Vibrio. The most documented candidates for biocontrol are certainly bacteria. Many strains have been proposed as probiotics, and some are commercially exploited in shrimp and fish farming. Specific antagonisms of probiotic bacteria have been listed in many reviews (e.g. Gram and Ringø, 2005; Gatesoupe, 2008a). Some bacteria may be used as antiviral agents (Maeda, 2004), while others are active against fungi. For example, Gil-Turnes et al. (1989) described the protection of shrimp embryos against pathogenic Lagenidium callinectes, due to the production of antifungal metabolite by symbiotic Alteromonas sp. Lategan et al. (2004) proposed to prevent saprolegniosis in eels by adding Aeromonas media cultures to tank water. However, even though these are attractive prospects, such treatments should be evaluated cautiously. Secord (2003) stressed the risk of attempting biocontrol in the aquatic environment, in view of the paucity of literature and experience, and Wang et al. (2000) raised a first warning on aquacultural application, by attributing the emergence of a new bacterial syndrome in Penaeus monodon to regular use of probiotic Bacillus subtilis.

10.3 Improving welfare Ashley (2007) identified health as a fundamental measure of fish welfare. The neurochemical response to stress interacts with the immune system, and deep distress may have a long-lasting effect on health (Huntingford et al., 2006). After a brief reminder of the knowledge of neuroimmunology

274


in fish and shellfish, this section will introduce the main environmental and husbandry factors involved in stimulating the animal’s response.

10.3.1

Interactions between neuroendocrine and immune functions in fish and shellfish The turn of the 20th century has brought new understanding of the evolution of innate and adaptive immunity (Flajnik and Du Pasquier, 2004). The frontier between adaptive defenses – supposedly specific to vertebrates – and innate response has been mitigated with new findings. Arala-Chaves and Sequeira (2000) observed some secondary response in haemocyte proliferation of kuruma prawns (Penaeus japonicus), after stimulation with fungal antigens, and then Kurtz and Franz (2003) showed the reduction of infectivity of parasitic tapeworm in the copepod Macrocyclops albidus, after primary infection. Such responses – possibly mediated by adhesion molecules from the immunoglobulin superfamily – remain quite limited in comparison with those of vertebrates. Still speculative is the idea that the adaptive immune system could be an evolutionary offshoot of the vertebrate nervous system (Bayne, 2003), but there is growing evidence that both systems can communicate with cytokines and neuropeptides, in a similar way in vertebrates and invertebrates (Salzet, 2001; Engelsma et al., 2002; Fig. 10.2). Cortisol can depress some adaptive responses of the immune system in fish, while the activity of innate components is enhanced (Weyts et al., 1999). Many other hormones can modulate the immune response in fish, e.g. growth hormone, prolactin, reproductive hormones and melanotropins (Schreck, 1996; Harris and Bird, 2000; Yada, 2007). Acute stress increased the plasmatic concentrations of cortisol, adrenaline and lysozyme in rainbow trout, while chronic stress may reduce the efficacy the immune response (Demers and Bayne, 1997). Similar effects have been observed in invertebrates, for instance immunodepression in shrimps with dopamine (Cheng et al., 2005a; Li et al., 2005; Chang et al., 2007) and noradrenaline (Cheng et al., 2006). The stress response of Pacific oyster is also under adrenergic control (Lacoste et al., 2001a,b).

10.3.2 Improving water quality and bioremediation Among external signals that can elicit stress, many parameters of water quality have been identified in fish, like temperature, salinity, hardness, pH, nitrogenous compounds, dissolved oxygen and CO2 (Ellis et al., 2002; Håstein et al., 2005; Portz et al., 2006). Many immunoassays can be used to estimate the impact of environmental factors on fish immunity (Anderson, 1996). The effects of environmental factors on shrimp immunity have also been evaluated, mainly based on haemocyte counts and phenoloxydase activity (Le Moullac and Haffner, 2000). Smith et al. (2000) proposed to


275

Stress Mollusca, Crustacea

Teleostei Hypothalamus CRH

DA

TRH Pituitary

ACTH CAs

α-MSH β-E

Cortisol Head kidney Cytokines

Immunocyte

Antibody formation

Encephalins

Fig. 10.2 Known similarities of mediators that interact between the neuroendocrine and immune systems in fish and shellfish, a tentative scheme after several sources (Ottaviani et al., 1998, 2004; Weyts et al., 1999; Salzet, 2001; Stefano et al., 2002). The grey zone indicates which hormones, or closely resembling molecules, have been identified both in invertebrates and vertebrates: CRH, corticotropin-releasing hormone; DA, dopamine; TRH, thyrotropinreleasing hormone; ACTH, adenocorticotropic hormone; α-MSH, α-melanocytestimulating hormone; β-E, β-endorphin; CAs, catecholamines.

measure nitric oxide in blue mussel (Mytilus edulis) as indicator of the immune status after environmental stress. For healthy stock, it is essential to monitor water quality and to avoid severe fluctuations. Physical processes can ensure water quality, but it may be worth considering the introduction of competent microorganisms, such as phytoplankters or other microbes. In pond aquaculture, the chemical equilibrium is dependent on microbial activities (Abraham et al., 2004), and bioremediation has been successfully applied to shrimp culture (Devaraja et al., 2002; Wang et al., 2005). Water treatment by live bacterial preparations seemed less efficient with fish in pond culture, but Taoka et al. (2006a) noted that the introduction of complex microbial mixture into closed recirculating system was more effective than oral administration to Japanese flounder (Paralichthys olivaceus). Fish growth indeed was only improved

276


by water treatment, among other beneficial effects observed in both cases. Some Bacillus spp. strains also improved water quality in aquaria with common carp (Cyprinus carpio) (Lalloo et al., 2007).

10.3.3 Improving rearing conditions There is a general trend to maximize stocking density, for economical reasons. Such a practice may exert adverse effects on health, depending on the innate behavioural responses of each species and on the ability of the producer to maintain water quality. For example, Li et al. (2006) demonstrated the interacting effects of dissolved oxygen and stocking density on the immune status of Chinese shrimp (Fenneropenaeus chinensis). Subhash and Lipton (2007) observed that bacterial load increased with increasing stocking density of pearl oyster larvae (Pinctada margaritifera), while survival decreased. The response is not only species-specific, but sex ratio was also shown to interfere in Mozambique tilapia (Oreochromis mossambicus) exposed to chronic confinement (Binuramesh et al., 2005). Many other parameters in husbandry conditions can affect health, like photoperiod, possibly mediated by melatonin secretion from the pineal gland of fish during the dark phase (Ángeles Esteban et al., 2006; Cuesta et al., 2008). Stressful human interventions – like transportation, handling or netting – should be kept to a minimum. Acute stress, often experimentally reproduced by netting, increased the activity of cortisol, adrenaline and lysozyme in rainbow trout plasma (Demers and Bayne, 1997). Many other immunological indicators may be altered, including those related to adaptive immunity and complement pathways in gilthead sea bream (Sparus aurata) (Sunyer et al., 1995). Both environmental and husbandry factors may generate oxidative stress (Livingstone, 2001, 2003), which will be considered in the next section, since it can be prevented by adequate feed supply.

10.4 Improving feed The diet is mainly aimed at meeting the nutritional requirements of the animal, which will be considered in detail in the next Chapters (11–17). This section will deal first with the requirements to optimize the immune defenses, but the diet also has side effects important for fish health. In particular, pathogens could benefit from some nutrients brought in excess, whereas the gastrointestinal microbiota – the first defense line against pathogens – are also influenced by substrates available from feed. The dietary supply of specific products like probiotics and prebiotics may be a good precaution against health hazards due to microbial variability.


277

10.4.1 Fatty acids and antioxidants The dietary fatty acid supply is particularly important for health, especially in terms of ratios between the n-3 and n-6 series, and between the highly unsaturated fatty acids (HUFA). The fatty acids requirements for growth are different between aquatic species. Warm freshwater species require both n-3 and n-6 series, unlike salmonids and marine fish that require mainly n-3 fatty acids, depending on bioconversion capabilities, which are generally greater in freshwater fish and salmonids than in marine species (Takeuchi, 1997). When considering the effects on disease resistance instead of growth, these trends should be moderated (Table 10.2). Dietary supplementation with vegetable oil rich in linoleic acid seems beneficial to the immune defense of many species, even when they do not require n-6 fatty acids for growth, while an excess of n-3 HUFA supply may be detrimental to the immune response. These requirements may result from several different biochemical pathways. 1. Dietary fatty acids can modulate the composition the phospholipid bilayer of the cell membrane, thus influencing membrane fluidity and toll-like receptors (Koch and Heller, 2005), which are involved in the immune response of both vertebrates and invertebrates (Beschin et al., 2001). 2. Dietary fatty acids also affect the production of eicosanoids by the cyclooxygenase pathway (Yaqoob, 2004). Several eicosanoids derived from arachidonic acid have been shown to modulate immunity in fish (Rowley et al., 1995; Van Anholt et al., 2004). Exogenous leukotriene B4 – extracted from blood leukocytes of European turbot (ScophthalTable 10.2 Comparisons of essential fatty acids requirement between fishes, considering either growth or disease resistance Fatty acids requirement for optimal Species Growth

Immune response

Cyprinus carpio Epinephelus malabricus

n − 3HUFA > LNA > LA (reviewed by Takeuchi, 1997) DHA > EPA (Wu et al., 2002)

Ictalurus punctatus Oncorhynchus mykiss Salvelinus alpinus

n − 3HUFA > LNA > LA (reviewed by Takeuchi, 1997) 1 %LNA or 0.5 %n − 3HUFA (reviewed by Takeuchi, 1997) LA + LNA? (Yang and Dick, 1994)

Improvement with n − 3HUFA (Pilarczyk, 1995) DHA > EPA (Wu et al., 2003) LA + n − 3HUFA > n − 3HUFA > LA (Lin and Shiau, 2007) Excess of n − 3HUFA detrimental (Li et al., 1994) 1 %n − 3HUFA detrimental (Kiron et al., 1995b) LA > LNA > n − 3HUFA (Lødemel et al., 2001)

n − 6 series: LA = linoleic acid. n − 3 series: LNA = linolenic acid; HUFA = highly unsaturated fatty acids; EPA = eicosapentaenoic acid; DHA = docosahexaenoic acid.

278


mus maximus) – inhibited the viral replication in rainbow trout cells infected with the virus causing hemorrhagic septicaemia (Tafalla et al., 2002). Prostaglandin E2 (PGE2) inhibited ulceration in gastric mucosa isolated from European eel (Anguilla anguilla) (Faggio et al., 2000). The parasitic copepod Lepeophtheirus salmonis secreted PGE2, likely inhibiting the immune response of its host, Atlantic salmon (Salmo salar) (Fast et al., 2004). The modulatory effect of PGE2 on cyclooxygenase 2 (COX-2) was found to be dose-dependent in macrophage-like cells from Atlantic salmon (Fast et al., 2005). Arachidonic acid and/or eicosanoid derivative(s) also stimulated the immune defenses of Pacific oyster (Delaporte et al., 2006). 3. Proinflammatory cytokines stimulate COX-2, and also the inducible nitric oxide synthase of fish macrophages (Secombes et al., 2001; Lindenstrøm et al., 2004; Buonocore et al., 2005). These two oxidative pathways are thus interacting to regulate macrophage respiratory burst (Novoa et al., 1996). Nitric oxide is important for normal physiological functions, and for the elimination of pathogens, but it can also contribute to oxidative stress by reacting with superoxide to form peroxynitrite, a powerful oxidant causing cellular damage (Beckman and Koppenol, 1996; Roch, 1999). 4. Animals activate NADPH-oxidase pathways in response to infective attack or to xenobiotic contaminants. They produce highly reactive oxygen species (ROS), such as superoxide and hydroxyl radicals, and hydrogen peroxide, which can kill the pathogen or detoxify the xenobiotic, but also generate oxidative stress, and damage host cells. This may occur especially when HUFA are supplied in excess, due to lipid peroxidation with ROS (Kelly et al., 1998; Roch, 1999; Zhang et al., 2007). Several minerals can catalyze these reactions, mainly iron (Sutton et al., 2006) and copper (Berntssen et al., 2000). These intricate relationships between oxidative pathways make it essential to counterbalance pro-oxidant activities by bringing sufficient amounts of antioxidant compounds into the diet, mainly vitamins C and E. Both these vitamins act in synergy, and they can be added at dietary doses that grossly exceed nutritional requirements. The effects of megadoses of vitamin C seem variable, depending on species and experimental conditions (e.g. Waagbø et al., 1993; Sealey and Gatlin, 2002; López et al., 2003; Wang et al., 2006; Gatesoupe, 2008a). Vitamin A also has antioxidant properties, but excess supply may be harmful, especially during larval stages (Ørnsrud et al., 2002; Fu et al., 2006). 10.4.2 Other nutrients important for health Besides fatty acid requirements, and the maintenance of the equilibrium between pro- and antioxidants in the organism, there are many other ways by which the diet can influence health and the immune system.


279

The antioxidant vitamins have other physiological roles, like vitamin C, which acts as coenzyme for pro-collagen hydroxylation into collagen, and which is essential for tissue damage repairs and wound healing (Wahli et al., 2003). Other coenzyme vitamins have been documented to modulate the immune response of aquatic animals. For instance: pyridoxine – a key cofactor for amino acid metabolism – stimulates an immune response in disk abalone (Haliotis discus hannai) (Chen et al., 2005); folic acid – transformed to tetrahydrofolate, a coenzyme involved in the metabolism of amino acids and nucleic acids – seemed important for the resistance of channel catfish (Ictalurus punctatus) to Edwardsiella ictaluri infection (Duncan and Lovell, 1994). Metal ions, as common cofactors of many enzymatic reactions, are essential for the immune response. However, the dose needs to be adjusted cautiously (Lee and Shiau, 2002), to avoid excess that could increase the risk of peroxidation (Section 10.4.1), or benefit pathogens (Section 10.4.3). The organic forms of dietary metal supply are generally more efficient than inorganic minerals (Wang et al., 1997; Gatta et al., 2001). Li and Gatlin (2006) recently reviewed the effects of dietary nucleotides on fish immunity. Though nucleotides are not considered essential nutrients, de novo synthesis is costly, and it was not surprising to find many beneficial effects of their dietary supply on gene expression and enzymatic reactions involved in the immune and stress responses, not only in fish but also in shrimps (Fegan, 2004; Choudhury et al., 2005). However, the efficacy of dietary nucleotide supplementation remains to be demonstrated under fish farming conditions, where shrimps probably obtain a sufficient supply of nucleotides from the microbes that they ingest in large amounts (Li et al., 2007b). The same remark should also apply to bivalve molluscs, although genomic bacterial DNA was recently proposed as an immunostimulant for a mussel, Hyriopsis cumingii (Hong et al., 2006). Protein supply is also important for immunity. A protein-deficient diet reduced lysozyme activity and C-reactive protein response in rainbow trout (Kiron et al., 1995a), and sub-optimal dietary protein levels were detrimental to the immune status of whiteleg shrimp (Litopenaeus vannamei) (Pascual et al., 2004). The form of protein supply may have side effects, especially when fish meal is replaced by alternative protein sources, which may contain antigenic proteins and enzymatic inhibitors (Section 10.4.7). Gildberg et al. (1996) isolated peptidic fractions from Atlantic cod (Gadus morhua) stomach hydrolysate, which stimulated oxidative burst activity in Atlantic salmon leucocytes in vitro. These authors suggested applications of such protein hydrolysates as vaccine adjuvant and feed immunostimulants. The intraperitoneal injection of cod muscle hydrolysate confirmed that it was possible to stimulate respiratory burst in vivo (Bøgwald et al., 1996), but its use as a feed additive was inefficient (Gildberg et al., 1995;

280


Gildberg and Mikkelsen, 1998). However, a dietary supply of 10–15 % of fish protein hydolysate stimulated humoral immunity in large yellow croaker (Pseudosciaena crocea) (Tang et al., 2008). Histones from cod milt seemed efficient as a feed additive to protect Atlantic cod challenged with V. anguilllarum, but it was not possible to elucidate the mechanism of action. Presumably, it either stimulated superoxide production in macrophages – as observed after peritoneal injection (Pedersen et al., 2003) – or directly inhibited the pathogen, due to antibacterial properties (Pedersen et al., 2004).

10.4.3

Nutritional competition between pathogens, gut microbiota and the host: iron as a key issue Although crucial for health, the competition for nutrients between host and microbes has seldom been studied. Before absorption, most nutrients remain freely available to the microbes present in the gastrointestinal tract. The pathogens that successfully invade can acquire all the nutrients they need from the host except iron, which is strongly bound (Ratledge and Dover, 2000). Natural iron chelators play a fundamental role in competition among prokaryotes and eukaryotes, especially in the iron-limited marine environment (Hutchins et al., 1999). The competition for iron is probably involved in the biocontrol of some fish pathogens by bacteria (Smith and Davey, 1993; Gram et al., 1999), and such chelators may be useful in inhibiting pathogens, like the oyster parasite Perkinsus marinus (Gauthier and Vasta, 2004) or in increasing disease resistance, like in European turbot challenged with pathogenic Vibrio (Gatesoupe, 1997). Kakuta and Murachi (1993) observed a sharp decrease in iron content of most tissues of Anguilla japonica (Japanese eel) infected with Aeromonas salmonicida, except at the infection site. Dietary iron supply must be sufficient to avoid anemia in channel catfish (ca. 30 mg kg−1, Lim and Klesius, 1997), but without excess, since a purified diet supplemented with 180 mg kg−1 inorganic iron caused increased susceptibility to Edwardsiella ictaluri (Sealey et al., 1997). The requirement for iron is conditioned by synergistic effects with vitamin C (Waagbø et al., 1993) and n-3 HUFA (Rørvik et al., 2003). Welker et al. (2007) demonstrated that the protective effect of dietary bovine lactoferrin on Nile tilapia (Oreochromis niloticus) challenged with Streptococcus iniae was related to a decrease in plasmatic iron, due to the iron-binding protein. The dietary supply of lactoferrin had variable effects, depending on species, rearing conditions and the immune parameters studied. It also reduced stress in common carp (Kakuta, 1998) and increased non-specific defenses and disease resistance in rainbow trout, Asian catfish (Clarias Batrachus) and the giant freshwater prawn (Macrobrachium rosenbergii) (Sakai et al., 1993; Kumari et al., 2003; Chand et al., 2006), but not in an experiment with Atlantic salmon (Lygren et al., 1999).


281

10.4.4 Non-nutritive immunostimulants Several authors have reviewed the use of immunostimulants in fish farming. For instance, Sakai (1999) stressed that injection was the most effective mode of administration, though difficult to apply in practice, except as a vaccine adjuvant (Anderson, 1992). The efficacy of oral and immersion methods decreases with long-term administration (Sakai, 1999), but their use as a diet additive is more convenient for large-scale production applications (Gannam and Schrock, 1999). Dietary immunostimulants have various compositions, and there is no official classification. Their diversity is illustrated by some examples in Table 10.3, which deals with feed additives other than nutrients and living probiotics, since both of these categories are considered elsewhere (Section 10.4.1–3 and Section 10.4.6). Polysaccharides – the most important class of immunostimulants – will be described in Section 10.4.5. The most recently developed synthetic compound is levamisole, classified as a T cell stimulator by Anderson (1992). This compound was particularly efficient in stimulating immunoglobulin M (IgM) production in gilthead sea bream (Cuesta et al., 2004), but it also stimulated non-specific

Table 10.3 Some examples of immunostimulants used as feed additives for fish and shrimps Application to shrimp

Type

Product

Application to fish

Synthetic

Levamisole

Cuesta et al., 2004

β-glucans

Yeast glucan, laminaran, etc. Bacterin Peptydoglycan Lipopolysaccharides

Kumari and Sahoo, 2006 Sakai et al., 1995 Itami et al., 1996 O’Donnell et al., 1994

Whole cells

Ortuño et al., 2002

Mannan oligosaccharide Spray-dried

Staykov et al., 2007

Baruah and Prasad, 2001 Suphantharika et al., 2003 Azad et al., 2005 Itami et al., 1998 Takahashi et al., 2000b Sajeevan et al., 2006 Genc et al., 2007

Watanuki et al., 2006

Lee et al., 2003

Water-soluble extracts Alginate

Castro et al., 2006

Fu et al., 2007

Fujiki et al., 1994

Plant extracts

Medicinal herbs

Dügenci et al., 2003

Animal extracts

Chitin and chitosan

Gopalakannan and Arul, 2006

Cheng et al., 2005b Citarasu et al., 2006 Wang and Chen, 2005

Bacterial derivatives Yeast products

Spirulina platensis Seaweed derivatives

282


immunity in fish (Anderson, 1992), as well as in shrimp (Baruah and Prasad, 2001). Among the natural immunostimulants, β-glucans are by far the most documented ones for aquaculture purposes, probably due to the limited risk of their having an impact on flesh quality and the aquatic environment (Gannam and Schrock, 1999; Section 10.4.5). As with most dietary immunostimulants, β-glucans tend to provoke mainly innate responses in fish (Kumari and Sahoo, 2006), and similar efficacy has been observed in shrimps (Suphantharika et al., 2003). These glucans can be obtained from various source organisms such as bacteria, fungi, and seaweeds. For example, the main cell wall component of yeast is (1,3/1,6)-β-D-glucan, and whole yeast cells are used as immunostimulants (Ortuño et al., 2002; Sajeevan et al., 2006). Besides bacterial preparations like bacterin, which are used as vaccine, other inactivated bacterial cells can be administered as simple immunostimulants, e.g. air-killed Clostridium butyricum, which increased the resistance of rainbow trout to Vibrio anguillarum (Sakai et al., 1995). Some authors spoke of ‘vaccination’ to describe the stimulation of the immune response observed in shrimps with formalin-killed Vibrio. Alabi et al. (1999) observed a protective effect of immersing larval Indian white prawn (Penaeus indicus) in a suspension of dead cells of Vibrio harveyi before challenge experiments, while the protection was not conferred by incorporating the lyophilized inactive pathogen into compound diet. However, Bohnel et al. (1999) obtained positive results with the oral route by using Artemia as ‘vaccine’ vehicle for post-larval Penaeus monodon. More recently, Azad et al. (2005) confirmed that heat-killed V. anguillarum could be efficiently administered via the feed of P. monodon post-larvae. Bacterial cell wall components were also used in fish and shrimps, for instance peptidoglycan from Bifidobacterium thermophilum (Itami et al., 1996, 1998) and lipopolysaccharides (Dalmo et al., 1998; Takahashi et al., 2000b), although Huttenhuis et al. (2006) warned about pathogen-derived lipopolysaccharides, which were suspected to cause immunotolerance. In addition, many other extracts from various materials have been put forward as potential immunostimulants, like alginate from seaweeds (Section 10.4.5). Many herbal medicines have been tested for their immunodulating properties in fish. Some may act as enzyme inhibitors, with possible side effects as antinutritional factors (Section 10.4.7). Among the other active preparations, one can cite for example: ginger extract (Dügenci et al., 2003); glycyrrhizin, the active ingredient of licorice root (Jang et al., 1995); aloe leaves (Kim et al., 2002); garlic bulbs (Sahu et al., 2007). Among animal products, chitin and its deacylated derivative, chitosan, seem particularly interesting in stimulating immunity. Chitosan was found more efficient than chitin in a challenge experiment of common carp with Aeromonas hydrophila (Gopalakannan and Arul, 2006), but the product may depress fish growth (Kono et al., 1987).


283

10.4.5 Non-starch polysaccharides and oligosaccharides Among non-nutrient feed components, non-starch polysaccharides (NSP) are of particular importance. 1.

2.

3.

Polysaccharides may constitute a bulk in the intestine, especially with plant-derived diets, thus affecting transit and the physical properties of digesta. Transit duration can affect health due to nutrient availability and microbial activity. The incorporation of guar gum, a watersoluble galactomannan, in the diet of Nile tilapia and African catfish (Clarias gariepinus) increased digesta viscosity and reduced nutrients digestibility (Amirkolaie et al., 2005; Leenhouwers et al., 2006). Conversely, insoluble bulk agents like cellulose did not affect viscosity and digestibility, but increased faecal ejection time and recovery (Dias et al., 1998; Amirkolaie et al., 2005). Dietary NSP can directly stimulate the immune system of the animal. Several toll-like receptors seemed able to initiate the immune response to dietary carbohydrate molecules. In gilthead sea bream blood leucocytes, yeast whole cell phagocytosis was elicited by glucan receptors but not by mannose receptors (Esteban et al., 2004). However, another derivative from yeast cell wall, mannan oligosaccharide, seemed effective in various species (Sweetman and Davies, 2006; Genc et al., 2007; Staykov et al., 2007). The efficacy of alginates as immunostimulants may be related to their composition rather than the molecular weight of their constituents. For example, the proportion of β-1,4-D-mannuronate (M) to α-L-guluronate (G) residues was suspected to play a role (Fujiki et al., 1994; Vollstad et al., 2006). However, results are ambiguous since Fujiki et al. (1994) obtained good results on common carp with low-M alginates, unlike with high-M alginate from Lessonia nigrescens, whereas a high-M alginate from Durvillea antartica was preferred in Norwegian studies (Skjermo et al., 2006; Vollstad et al., 2006). Gastrointestinal microbiota of fishes have been documented for the fermentation of carbohydrates, resulting in the production of volatile fatty acids (VFA), and probable metabolic benefits accruing to the host (Clements, 1997). Kihara and Sakata (2001) observed in vitro the fermentation of different substrates by intestinal content extracted from rainbow trout fed a standard diet. Branched VFA were probably produced from nitrogenous compounds. The fermentation was significantly stimulated by chitin, and weakly by lactosucrose, while alginate tended to inhibit gas production. Soybean oligosaccharides and raffinose were fermented more intensively than other oligosaccharides in intestinal content from common carp fed a standard diet (Kihara and Sakata, 2002). The effects of feeding fish with different carbohydrates were studied in other experiments. When Siberian sturgeon (Acipenser baerii) were fed inulin – mostly linear β-2,1 linked fructans – their intestinal content

284

4.

New technologies in aquaculture produced in vitro a larger gas volume than when the fish were fed cellulose, but the highest gas production was observed with fish fed inulinderived fructooligosaccharides (FOS; Mahious et al., 2006a). Whether the fish were fed inulin or FOS, the production of VFA by their intestinal contents was slightly different, but significantly higher than the production from fish fed cellulose. When tilapia were fed α-starch, their intestinal content produced in vitro higher levels of VFA in comparison with fish fed NSP (Kihara and Sakata, 1997). That may explain why almost the same fermentation pattern was observed in the intestine of African catfish fed diets based on various cereal grains, which were more varied by their NSP than by their starch supply (Leenhouwers et al., 2007). Acetate, and probably other VFA, are actively absorbed through the intestinal epithelium of Oreochromis mossambicus (Titus and Ahearn, 1991). This might result in the reinforcement of the intestinal structure, with an increased thickness of the muscle layer in red sea bream fed lactosucrose and in Nile tilapia fed α-starch (Kihara et al., 1995; Kihara and Sakata, 1997). Refstie et al. (2006) also observed in Atlantic salmon fed inulin a higher intestinal mass than when the fish were fed a standard diet, whether or not the diet contained oxytetracycline. Consequently, the authors hypothesized a mechanical effect of dietary inulin, which acted as fibre that increased intestinal filling and peristaltic activity. Such interpretation could not account for the effect of dietary lactosucrose observed by Kihara et al. (1995). The water content of digesta was affected neither by lactosucrose in red sea bream (Pagrus major) nor by α-starch in Nile tilapia (Kihara and Sakata, 1997). Amirkolaie et al. (2006) confirmed this absence of physical influence of gelatinized starch (α-starch) on digesta, but these authors noted a decrease in hindgut fermentation due to gelatinization, in comparison with tilapia fed native starch. In summary, if some dietary carbohydrates can stimulate intestinal growth, the cause still remains uncertain, with opinion divided between a purely mechanistic phenomenon and the possible mediation of VFA. NSP, and especially their hydrolytic derivatives, may be used as prebiotics, which are food ingredients that beneficially affect the host by selectively stimulating the growth of and/or activating the metabolism of one or a limited number of health-promoting bacteria in the intestinal tract. The potential for applying this to fish intestinal microbiota were sketched out by Burr et al. (2005), but the practical results are still very limited. Presumptively beneficial microbes like Carnobacterium sp. and Bacillus sp. can use inulin and FOS, respectively (Ringø and Holzapfel, 2000; Mahious et al., 2006b). However, a high dose of inulin – incorporated as 15 % of the dry diet – damaged the ultrastructure of hindgut epithelial cells in Arctic charr (Salvelinus alpinus) reared in freshwater (Olsen et al., 2001). The number of bacterial cells


285

adherent to the hindgut was reduced in Arctic charr fed inulin in comparison with those fed dextrin, and the species of Carnobacterium seemed different in each group (Ringø et al., 2006). In Atlantic salmon reared in seawater, the supply of inulin at 7.5 % of the dry diet did not damage the intestine, and a possible prebiotic effect was considered (Refstie et al., 2006). Inulin tended to decrease microbial diversity in Atlantic salmon (Bakke-McKellep et al., 2007), contrary to what was observed in piglets with several prebiotics, including inulin (Konstantinov et al., 2003; 2004). The incorporation of 2 % FOS in the diet for weaning turbot larvae improved growth, in comparison with a diet containing 2 % cellulose, inulin or lactosucrose (Mahious et al., 2006b). The dose of dietary prebiotics may be important, and the lowest level of FOS tested (0.4 %) was sufficient to obtain the best growth improvement in Litopenaeus vannamei (Zhou et al., 2007). A complex preparation of partially autolyzed yeast, dairy ingredients and fermentation products seemed to have a greater effect than that of FOS on VFA production and gut microbiota isolated from red drum (Burr et al., 2008). NSP purified from soy also affected intestinal microbiota in Atlantic salmon (Ringø et al., 2008).

10.4.6 Dietary probiotics Many probiotics have been experimentally introduced into aqua feeds, and a number of reviews on this subject are available (Ringø and Gatesoupe, 1998; Gatesoupe, 1999, 2005, 2007, 2008b; Gomez-Gil et al., 2000; Hansen, 2000; Verschuere et al., 2000; Irianto and Austin, 2002; Abidi, 2003; Maeda, 2004; Burr et al., 2005; Gram and Ringø, 2005; Ringø et al., 2005; Balcázar et al., 2006; Vine et al., 2006; Gómez and Balcázar, 2008; Kesarcodi-Watson et al., 2008; Tinh et al., 2008; Wang et al., 2008b). Bivalve larvae are highly sensitive to bacterial environment and water quality, and the most suitable means of introduction is to cultivate microalgal feed in association with the probiotic strain (Nicolas et al., 2007). Growth improvement was observed in pearl oyster (Pinctada fucata) spat fed with Lactobacillus acidophilius in addition to microalgae (Subhash et al., 2007). Macey and Coyne (2005, 2006) introduced into the compound diet for midas ear abalone (Haliotis midae) a microbial preparation composed of three strains isolated from the gut of the abalone: Vibrio midae, Cryptococcus sp. and Debaryomyces hansenii. The microbial consortium exerted several beneficial effects on the abalone, including increased resistance to Vibrio anguillarum. This correlated with increased phagocytic activity of haemocytes against the pathogen, and the maintenance of the number of circulating haemocytes after challenge, whereas it dropped in the control group. These probiotics also stimulated protease and amylase activity in the gastrointestinal tract, thus contributing to improving the health of abalone in different ways.

286


An interesting feature of probiotics is their ability to combine several modes of action, from a direct antagonism to pathogens (Section 10.2.5) to more or less indirect effects on the immune and digestive functions of the host. This was also observed in shrimps (e.g. Li et al., 2007a; Wang, 2007; Castex et al., 2008) and in fish (e.g. Nikoskelainen et al., 2003; Frouël et al., 2008). The stimulation of the innate immune system by dietary probiotics may provide some protection against cutaneous and branchial parasites (Pieters et al., 2008; Reyes-Becerril et al., 2008). In most cases, the presence of living material did not seem essential for the probiotics to stimulate the immune and the digestive systems of fish (Villamil et al., 2002; Irianto and Austin, 2003; Díaz-Rosales et al., 2006; Salinas et al., 2006; Frouël et al., 2008). This point is important for practical application as feed additives in aquaculture because of the authorization for market release, which may be more easily obtained with dead microbial cells than with living probiotics. Nevertheless, the impact of germ viability on fish health should be investigated carefully since, for instance, the inactivation of a commercial probiotic consortium annihilated its protective effect against edwarsiellosis in Nile tilapia (Taoka et al., 2006b).

10.4.7

Alternative protein sources and feed hazards: antinutritional factors, mycotoxins The need to replace fish meal with alternative protein sources has brought new concerns about the health of aquatic animals. By-product feedstuffs from poultry or other land animals could constitute up to 40–50 % of the dietary protein supply without significant degradation of the immune status of Atlantic salmon (Bransden et al., 2001) and oriental river prawn (Macrobrachium nipponense) (Yang et al., 2004). It remains the case that the use of potentially contaminated animal by-products has been viewed negatively in the aquafeed industry (Amaya et al., 2007). The main effort is aimed at replacing fish meal by vegetable protein sources (Gatlin et al., 2007). For example, good results were obtained by Amaya et al. (2007) by feeding Litopenaeus vannamei a plant-based diet with 1 % squid meal as the only animal protein source. Although there was no negative effect on growth, it would be worth investigating whether there were any effects on health. Plant-based feeds may contain many antinutritional factors, whose effects on fish have been reviewed by Francis et al. (2001) Guillaume and Métailler (2001) and Gatlin et al. (2007). Information is seldom available for shrimps, which seem more resistant than fish to some compounds. For example, saponins are used to eradicate predatory fish from shrimp ponds (Nagesh et al., 1999). Soybean meals and soy protein concentrate should be introduced cautiously in salmonid feeds. High levels of incorporation caused a decline in macrophage activity and the disruption of epithelial integrity in the distal intestine of rainbow trout (Burrells et al., 1999; Ostaszewska et al., 2005).


287

The resistance against Aeromonas salmonicida was also reduced (Neji et al., 1993). Soybean molasses, increased lysozyme activity and IgM production in Atlantic salmon, but decreased survival in challenge with A. salmonicida (Krogdahl et al., 2000). The main concern is enteritis provoked by dietary soybean products in Atlantic salmon (Bakke-McKellep et al., 2000, 2007). If the antinutritional or toxic factors can be identified, then adequate feed processing may solve the problem. The syndrome seemed to be caused by saponins – possibly in combination with disruption of the intestinal microbial balance, and with other factors like allergenic proteins (Knudsen et al., 2007). Soybean lectins may thus contribute to the toxic effect of soybean meal to salmonids (Buttle et al., 2001; Francis et al., 2001). Channel catfish can tolerate much higher levels of dietary soybean meal than salmonids (Peres et al., 2003). Raw soybean meal may contain a trypsin inhibitor, which can be destroyed with heat treatment, and Peres et al. (2003) improved feed efficiency and growth in channel catfish by autoclaving this feed ingredient for 40 mins. Adversely, the heat-treated meal decreased the disease resistance of the catfish challenged with Edwardsiella ictaluri. This example illustrates why it is important not to rely only on growth performances in assessing the dietary value of feedstuffs. SitjáBobadilla et al. (2005) observed a remarkable increase of complement alternative pathway activity in gilthead sea bream fed a half-and-half fish meal and plant protein mixture, but this immune response was depleted with higher rates of fish meal replacement. Some compounds classified as antinutritional factors may also have medicinal applications, when they are properly administered (Table 10.4). For example, saponins are known to increase permeability of the intestinal mucosa. This could account not only for their suspected role in enteritis of salmon fed soy products, but also for the interest in Quillaja saponin as an oral vaccine adjuvant to prevent edwardsiellosis in the Japanese flounder (Ashida et al., 1999), or to stimulate chemotaxis of yellowtail (Seriola quinqueradiata) leucocytes (Ninomiya et al., 1995). Lectins are sugar-binding proteins that may impair gut epithelial functions, but they can also antagonize fish parasites, as shown in vitro by Xu et al. (2001). These authors dissected fins from channel catfish, and they observed that the infection by Ichthyophthirius multifiliis was hindered when the parasite was immobilized by pre-incubation with plant lectins. Polyphenols, like tannins and gossypol, are toxic to fish and shrimps, but they may be exploited as antibacterial and immunostimulants in some cases, probably because of their antioxidant properties. Sodium phytate seemed a suitable source of phosphorous for Penaeus japonicus, but it depressed growth in Penaeus vannamei, as was observed in fish (Civera and Guillaume, 1989; Francis et al., 2001). In case of depletion of dietary calcium supply, phytic acid seemed detrimental even to P. japonicus (Civera Cercedo, 1994). The successful substitution of fish meal is, however, dependent on the selection of plant protein sources – possibly pre-treated – to minimize antinutritional factors and toxins.

288


Table 10.4 Examples of antinutritional factors in plant protein sources; some of these factors could be used to improve the health of fish and shrimps Antinutritional factor Glucosidic factors Saponin

Glucosinolates

Effects on fish and shrimps Source

Quillaja saponaria

Brassica spp.

Proteinaceous factors Trypsin inhibitor Soya

Detrimental

Beneficial

High dose depresses salmonid growth, with abnormal intestinal morphology (Bureau et al., 1998) Thyroid hyperplasia in carp (Hossain and Jauncey, 1988)

Low dose increases carp growth (Francis et al., 2002); immunostimulant (Ninomiya et al., 1995; Ashida et al., 1999) –

May decrease dietary value (Peres et al., 2003) Soybean agglutinin binds to intestinal epithelium of salmonids, possibly causing damage (Buttle et al., 2001)

–

Lectins (agglutinins)

Ubiquitous

Polyphenols Tannic acid

Seeds

Toxic for tilapia and carp (Saha and Kaviraj, 1996; Becker and Makkar, 1999)

Gossypol

Cottonseed

Depresses growth in channel catfish (Yildirim et al., 2003)

Phytates

Seeds

Reduce protein digestibility and zinc availability in fish (Gatlin et al., 2007); unsuitable as phosphorous source in Penaeus vannamei (Civera and Guillaume, 1989)

Plant lectins bind to fish parasite Ichthyophthirius (Xu et al., 2001); wheat germ agglutinin proposed as immunostimulant for Penaeus orientalis (Xu et al., 1992); Antagonistic to fishpathogenic bacteria (Chung et al., 1995; Zhao et al., 1997); stimulates immune response in Labeo rohita (Prusty et al., 2007) Immunostimulant and antibacterial (Yildirim-Aksoy et al., 2004a,b) Suitable phosphorous source in Penaeus japonicus (Civera and Guillaume, 1989)


289

Plant-based feed ingredients increase the risk of introducing mycotoxins (Spring, 2005), though such risk may be also encountered with fish meal (Encarnação, 2006). Even molluscs can be contaminated via fungi growing in sediments, and blue mussel stored gliotoxin in ‘meat’ (i.e. all tissues, except digestive gland; Grovel et al., 2003). Because mycotoxins are very stable, they may cause health risk for farmed animals, as well as for seafood consumers. For example, aflatoxin B1 is a potent hepatocarcinogen, which can cause damage in fish liver and shrimp hepatopancreas. It is also immunodepressing, and Ottinger and Kaattari (1998) showed that in winter – a period of decreased immune reactivity – rainbow trout leucocytes were 1000-fold more sensitive to the toxin than murine leucocytes. However, warm-water fish like channel catfish and tilapia seemed less sensitive (Spring, 2005; Encarnação, 2006). Generally, early life stages are more sensitive than adults, and the exposure of rainbow trout embryos to aflatoxin B1 resulted in more than two years of immune dysfunction in ongrowing stages (Ottinger and Kaattari, 2000). Other mycotoxins are also immunodepressive, like trichothecene T-2 (Smith et al., 1999a,b; Prearo et al., 2000) and fumonisin (Lumlertdacha and Lovell, 1995). Spring (2005) summarized the prevention strategies for the production of feed ingredients, e.g. by selecting fungal-resistant strains, to storage in dry conditions.

10.5 Concluding remarks Most of the husbandry practices in hatcheries and farms may affect health, more or less directly, and it was not possible to draw an exhaustive overview of all the methods that have been or that could be developed to improve disease resistance in aquaculture. The important thing is to keep in mind the complex mechanisms that coordinate homeostasis in animals and microbiota and, in this way, try to anticipate how each new technical change could interfere in the animal’s physiology. This is not an easy task, and innovation should be tested prudently before moving on to full-scale application. Among the new trends covered in this chapter, some are still highly experimental. Economical and regulatory constraints can cause long delays before novel commercial products are approved. This may often discourage R and D departments from designing special preparations when the potential market size is uncertain, which is generally the case in aquaculture. ‘A concerted approach to species or system-oriented health programmes is needed, particularly given the difficulties in achieving licenses for existing and new therapeutic products’, wrote Hough (2007) in a background document for the EATP (European Aquaculture Technology Platform) first stakeholders’ meeting. International and interprofessional organizations such as these need to play a vital role in turning scientific findings into practice.

290


10.6 Sources of further information and advice 10.6.1 Hygiene rules Concerning hygiene and water treatment, the World Organisation for Animal Health (OIE) has inventoried the ‘methods for disinfection of aquaculture establishments’ (Manual of Diagnostic Tests for Aquatic Animals, 2006, Chapter 1.1.5., http://www.oie.int/eng/normes/fmanual/ A_00014.htm). 10.6.2 European directives It may be useful to refer to the European directive ‘on animal health requirements for aquaculture animals and products thereof, and on the prevention and control of certain diseases in aquatic animals’ (EC, 2006): The Panel on Animal Health and Welfare, created by the European Food Authority (EFSA), delivers opinions on current issues, in support of official directives (e.g. ‘possible vector species and live stages of susceptible species not transmitting disease as regards certain fish diseases’ (EFSA, 2007)). The European regulation for chemicals used in aquaculture has been reviewed by Costello et al. (2001), and Mortensen et al. (2006) have commented on the directive dealing with health risks caused by the movement of aquatic animals for farming purposes (EU, 1991). 10.6.3 Evaluation of safety of chemicals used in aquaculture The Food and Agriculture Organization (FAO) has promoted responsible practices ‘towards safe and effective use of chemicals in coastal aquaculture’ in the report by GESAMP (1997). More recently, the World Health Organization held an expert consultation on the risk of spreading antimicrobial resistance generated by aquaculture (Alday et al., 2006; FAO/OIE/ WHO, 2006). 10.6.4 Fish and shellfish diseases Specific information about fish and shrimp diseases is available with the national aquaculture program of the US Department of Agriculture’s Animal and Plant Health Inspection Service (APHIS; http://www.aphis. usda.gov/animal_health/animal_dis_spec/aquaculture/). A website has been dedicated to aquatic animal health with the support of the Fish Health Section of the American Fisheries Society (http://www.fisheries.org/units/ fhs/). There is also a virtual mollusc health laboratory moderated by Franck Berthe (http://vre.upei.ca/mhl/). 10.6.5 Dietary additives The dietary solutions to improve health can be documented from databases like that of ‘Level 1 Diet, the anti-inflammation health program’, which


291

offers a search engine on more than one million health studies (http://www. level1diet.com/). Articles from Feed Mix dealing with aquafeeds and health can be browsed at http://www.allaboutfeed.net/article-database/ aquaculture/health.html.

10.7 References abidi r (2003) Use of probiotics in larval rearing of new candidate species, Aquac Asia, 8(2), 15–16. abraham t j, ghosh s, nagesh t s and sasmal d (2004) Distribution of bacteria involved in nitrogen and sulphur cycles in shrimp culture systems of West Bengal, India, Aquaculture, 239(1–4), 275–88. alday v, guichard b, smith p and uhland c (2006) Towards a risk analysis of antimicrobial use in aquaculture, joint FAO/WHO/OIE expert consultation on antimicrobial use in aquaculture and antimicrobial resistance, Seoul, June 13–16, http://www.nuigalway.ie/microbiology/documents/alday_et_al_.pdf, accessed January, 2009. alabi a o, jones d a and latchford j w (1999) The efficacy of immersion as opposed to oral vaccination of Penaeus indicus larvae against Vibrio harveyi, Aquaculture, 178(1–2), 1–11. amaya e, davis d a and rouse d b (2007) Alternative diets for the Pacific white shrimp Litopenaeus vannamei, Aquaculture, 262(2–4), 419–25, http:// www.ag.auburn.edu/~davisda/publications/publication_files/p60_aqua_2007_ amaya_0502_tanks.pdf, accessed January, 2009. amirkolaie a k, leenhouwers j i, verreth j a j and schrama j w (2005) Type of dietary fibre (soluble versus insoluble) influences digestion, faeces characteristics and faecal waste production in Nile tilapia (Oreochromis niloticus L.), Aquac Res, 36(12), 1157–66. amirkolaie a k, verreth j a j and schrama j w (2006) Effect of gelatinization degree and inclusion level of dietary starch on the characteristics of digesta and faeces in Nile tilapia (Oreochromis niloticus (L.)), Aquaculture, 260(1–4), 194–205. anas a, paul s, jayaprakash n s, philip r and singh i s b (2005) Antimicrobial activity of chitosan against vibrios from freshwater prawn Macrobrachium rosenbergii larval rearing systems, Dis Aquat Org, 67(1–2), 177–9. anderson d p (1992) Immunostimulants, adjuvants, and vaccine carriers in fish: Applications to aquaculture, Annu Rev Fish Dis, 2, 281–307. anderson d p (1996) Environmental factors in fish health: immunological aspects, in Iwama G and Nakanishi T (eds), The Fish Immune System, San Diego, CA, Academic Press, 289–310. andersen s, burnell g and bergh ø (2000) Flow-through systems for culturing great scallop larvae, Aquacult Int, 8(2), 249–57, http://www.imr.no/__data/page/3939/ Andersen%20et%20al%202000.pdf, accessed January 2009. ángeles esteban m, cuesta a, rodríguez a and meseguer j (2006) Effect of photoperiod on the fish innate immune system: a link between fish pineal gland and the immune system, J Pineal Res, 41(3), 261–6. arala-chaves m and sequeira t (2000) Is there any kind of adaptive immunity in invertebrates?, Aquaculture, 191(1–3), 247–58. ashida t, okimasu e, ui m, heguri m, oyama y and amemura a (1999) Protection of Japanese flounder Paralichthys olivaceus against experimental edwardsiellosis by formalin-killed Edwardsiella tarda in combination with oral administration of immunostimulants, Fish Sci, 65(4), 527–30.

292


ashley p j (2007) Fish welfare: Current issues in aquaculture, Appl Anim Behav Sci, 104(3–4), 199–235, http://www.flinders.edu.au/shadomx/apps/fms/ fmsdownload.cfm?file_uuid=E4987CB0-AF7A-A083-321E-5EBF36F96C45& siteName=flinders, accessed January 2009. auro de ocampo a and jimenez e m (1993) Herbal medicines in the treatment of fish diseases in Mexico, Veterinaria Mex, 24(4), 291–5. azad i s, panigrahi a, gopal c, paulpandi s, mahima c and ravichandran p (2005) Routes of immunostimulation vis-à-vis survival and growth of Penaeus monodon postlarvae, Aquaculture, 248(1–4), 227–34. bai f f, han y, chen j x and zhang x h (2008) Disruption of quorum sensing in Vibrio harveyi by the AiiA protein of Bacillus thuringiensis, Aquaculture, 274(1), 36–40. bakke-mckellep a m, press c mcl, baeverfjord g, krogdahl å and landsverk t (2000) Changes in immune and enzyme histochemical phenotypes of cells in the intestinal mucosa of Atlantic salmon, Salmo salar L., with soybean meal-induced enteritis, J Fish Dis, 23(2), 115–27. bakke mckellep a m, penn m h, salas p m, refstie s, sperstad s, landsverk t, ringø e and krogdahl å (2007) Effects of dietary soyabean meal, inulin and oxytetracycline on intestinal microbiota and epithelial cell stress, apoptosis and proliferation in the teleost Atlantic salmon (Salmo salar L.), Brit J Nutr, 97(4), 699–713. balasubramanian g, sarathi m, rajesh kumar s and sahul hameed a s (2007) Screening the antiviral activity of Indian medicinal plants against white spot syndrome virus in shrimp, Aquaculture, 263(1–4), 15–19. balcázar j l, de blas i, ruiz zarzuela i, cunningham d, vendrell d and múzquiz j l (2006) The role of probiotics in aquaculture, Vet Microbiol, 114(3–4), 173–86. baruah n d and prasad k p (2001) Efficacy of levamisole as an immunostimulant in Macrobrachium rosenbergii (de Man), J Aquac Trop, 16(2), 149–58. bates j m, mittge e, kuhlman j, baden k n, cheesman s e and guillemin k (2006) Distinct signals from the microbiota promote different aspects of zebrafish gut differentiation, Dev Biol, 297(2), 374–86. bayne c j (2003) Origins and evolutionary relationships between the innate and adaptive arms of immune systems, Integr Comp Biol, 43(2), 293–9. becker k and makkar h p s (1999) Effects of dietary tannic acid and quebracho tannin on growth performance and metabolic rates of common carp (Cyprinus carpio L.), Aquaculture, 175(3–4), 327–35. beckman j s and koppenol w h (1996) Nitric oxide, superoxide, and peroxynitrite: the good, the bad, and ugly, Am J Physiol – Cell Physiol, 271(5), C1424–37. berntssen m h g, lundebye a k and hamre k (2000) Tissue lipid peroxidative responses in Atlantic salmon (Salmo salar L.) parr fed high levels of dietary copper and cadmium, Fish Physiol Biochem, 23(1), 35–48. beschin a, bilej m, torreele e and de baetselier p (2001) On the existence of cytokines in invertebrates, Cell Mol Life Sci, 58(5–6), 801–14. besse b and nicolas j l (1989) Axenic larvae of bivalve: Nutritional role of bacteria, in Billard R and De Pauw N (eds), Aquaculture Europe ’89 (Short Communications and abstracts of presentations at the International Aquaculture Conference held in Bordeaux, France, in October 1989), Special Publication No.10, European Aquaculture Society, Oostende, 31–2. bhadury p, mohammad b t and wright p c (2006) The current status of natural products from marine fungi and their potential as anti-infective agents, J Ind Microbiol Biotechnol, 33(5), 325–37. binuramesh c, prabakaran m, steinhagen d and michael r d (2005) Effect of chronic confinement stress on the immune responses in different sex ratio groups of Oreochromis mossambicus (Peters), Aquaculture, 250(1–2), 47–59.


293

birkbeck t h, reid h i, darde b and grant a n (2006) Activity of bronopol (Pyceze®) against bacteria cultured from eggs of halibut, Hippoglossus hippoglossus and cod, Gadus morhua, Aquaculture, 254(1–4), 125–8. birkenhauer j m and oliver j d (2003) Use of diacetyl to reduce the load of Vibrio vulnificus in the Eastern oyster, Crassostrea virginica‚ J Food Prot, 66(1), 38–43. bøgwald j, dalmo r a, mcqueen leifson r, stenberg e and gildberg a (1996) The stimulatory effect of a muscle protein hydrolysate from Atlantic cod, Gadus morhua L, on Atlantic salmon, Salmo salar L, head kidney leucocytes, Fish Shellfish Immunol, 6(1), 3–16. bohnel h, lohavanijaya p, rungin s, schnug c and seifert h s h (1999) Active immunisation of Black Tiger Prawn (Penaeus monodon) against vibriosis in Thailand, Berl Munch Tierarztl Wochenschr, 112(8), 289–95. bransden m p, carter c g and nowak b n (2001) Effects of dietary protein source on growth, immune function, blood chemistry and disease resistance of Atlantic salmon (Salmo salar L.) parr, Anim Sci, 73(1), 105–13. buonocore f, randelli e, casani d, mazzini m, cappuccio i, secombes c j and scapigliati g (2005) cDNA cloning and expression analysis of a cyclooxygenase-2 from sea bass (Dicentrarchus labrax L.) after vaccination, Aquaculture, 245(1–4), 301–10. bureau d p, harris a m and cho c y (1998) The effects of purified alcohol extracts from soy products on feed intake and growth of chinook salmon (Oncorhynchus tshawytscha) and rainbow trout (Oncorhynchus mykiss), Aquaculture, 161(1–4), 27–43, http://fishnutrition.uoguelph.ca/Publications/Bureau_etal_1998_ soyasaponin.pdf, accessed January 2009. burr g d, gatlin iii d and ricke s (2005) Microbial ecology of the gastrointestinal tract of fish and the potential application of prebiotics and probiotics in finfish aquaculture, J World Aquac Soc, 36(4), 425–36. burr g, hume m, ricke s, nisbet d and gatlin iii d (2008) A preliminary in vitro assessment of GroBiotic®-A, brewer’s yeast and fructooligosaccharide as prebiotics for the red drum Sciaenops ocellatus, Environ Sci Health B, 43(3), 253–60. burrells c, williams p d, southgate p j and crampton v o (1999) Immunological, physiological and pathological responses of rainbow trout (Oncorhynchus mykiss) to increasing dietary concentrations of soybean proteins, Vet Immunol Immunopathol, 72(3–4), 277–88. buttle l g, burrells a c, good j e, williams p d, southgate p j and burrells c (2001) The binding of soybean agglutinin (SBA) to the intestinal epithelium of Atlantic salmon, Salmo salar and Rainbow trout, Oncorhynchus mykiss, fed high levels of soybean meal, Vet Immunol Immunopathol, 80(3–4), 237–44. castex m, chim l, pham d, lemaire p, wabete n, nicolas j l, schmidely p and mariojouls c (2008) Probiotic P. acidilactici application in shrimp Litopenaeus stylirostris culture subject to vibriosis in New Caledonia, Aquaculture, 275(1–4), 182–93, http://www.ifremer.fr/docelec/doc/2008/publication-4079.pdf, accessed January 2009. castro r, piazzon m c, zarra i, leiro j, noya m and lamas j (2006) Stimulation of turbot phagocytes by Ulva rigida C. Agardh polysaccharides, Aquaculture, 254(1–4), 9–20. chand r k, sahoo p k, kumari j, pillai b r and mishra b k (2006) Dietary administration of bovine lactoferrin influences the immune ability of the giant freshwater prawn Macrobrachium rosenbergii (de Man) and its resistance against Aeromonas hydrophila infection and nitrite stress, Fish Shellfish Immunol, 21(2), 119–29. chang c c, wu z r, kuo c m and cheng w (2007) Dopamine depresses immunity in the tiger shrimp Penaeus monodon, Fish Shellfish Immunol, 23(1), 24–33.

294


chen h, mai k, zhang w, liufu z, xu w and tan b (2005) Effects of dietary pyridoxine on immune responses in abalone, Haliotis discus hannai Ino, Fish Shellfish Immunol, 19(3), 241–52. cheng t c, lapeyre j l, bucannon j t, tiersch t r and cooper r k (2001) The effects of heterologous anti-microbial peptide gene transfer on the immunity of the eastern oyster Crassostrea virginica, 6th Asian Fisheries Forum: Book of Abstracts, Manila, Asian Fisheries Society, 59. cheng w, chieu h t, tsai c h and chen j c (2005a) Effects of dopamine on the immunity of white shrimp Litopenaeus vannamei, Fish Shellfish Immunol, 19(4), 375–85. cheng w t, liu c h, kuo c m and chen j c (2005b) Dietary administration of sodium alginate enhances the immune ability of white shrimp Litopenaeus vannamei and its resistance against Vibrio alginolyticus, Fish Shellfish Immunol, 18(1), 1–12. cheng w, chieu h t, ho m c and chen j c (2006) Noradrenaline modulates the immunity of white shrimp Litopenaeus vannamei, Fish Shellfish Immunol, 21(1), 11–19. choudhury d, pal a k, sahu n p, kumar s, das s s and mukherjee s c (2005) Dietary yeast RNA supplementation reduces mortality by Aeromonas hydrophila in rohu (Labeo rohita L.) juveniles, Fish Shellfish Immunol, 19(3), 281–91. chung k t, zhao g, stevens e jr, simco b a and wei c i (1995) Growth inhibition of selected aquatic bacteria by tannic acid and related compounds, J Aquat Anim Health, 7(1), 46–9. citarasu t, rajajeyasekar r, venkatramalingam k, dhandapani p s and marian m p (2003a) Effect of wood apple Aegle marmelos, Correa (Dicotyledons, Sapindales, Rutaceae) extract as an antibacterial agent on pathogens infecting prawn (Penaeus indicus) larviculture, Indian J Mar Sci, 32(2), 156–61. citarasu t, venkatramalingam k, babu m m, sekar r r j and petermarian m (2003b) Influence of the antibacterial herbs, Solanum trilobatum, Andrographis paniculata and Psoralea corylifolia on the survival, growth and bacterial load of Penaeus monodon post larvae, Aquac Int, 11(6), 583–95. citarasu t, sivaram v, immanuel g, rout n and murugan v (2006) Influence of selected Indian immunostimulant herbs against white spot syndrome virus (WSSV) infection in black tiger shrimp, Penaeus monodon with reference to haematological, biochemical and immunological changes, Fish Shellfish Immunol, 21(4), 372–84. civera r and guillaume j (1989) Effect of sodium phytate on growth and tissue mineralization of Penaeus japonicus and Penaeus vannamei juveniles, Aquaculture, 77(2–3), 145–56. civera cerecedo r (1994) Growth of Penaeus japonicus juveniles fed with different levels of calcium and phosphorus, Rev Invest Cient Univ Auton Baja Calif Sur, Ser Cienc Mar, 1, 1–5. clements k d (1997) Fermentation and gastrointestinal microorganisms in fishes, in Mackie R I and White B A (eds), Gastrointestinal Microbiology, Vol 1, Gastrointestinal Ecosystems and Fermentations, New York, Chapman & Hall, 156–98. costello m j, grant a, davies i m, cecchini s, papoutsoglou s, quigley d and saroglia m (2001) The control of chemicals used in aquaculture in Europe, J App Ichthyol, 17(4), 173–80, http://ec.europa.eu/fisheries/cfp/ governance/consultations/contributions100507/2001_chemicals_aquaculture.pdf, accessed January 2009. cuesta a, meseguer j and esteban m a (2004) Total serum immunoglobulin M levels are affected by immunomodulators in seabream (Sparus aurata L.), Vet Immunol Immunopathol, 101(3–4), 203–10.


295

cuesta a, cerezuela r, esteban m a and meseguer j (2008) In vivo actions of melatonin on the innate immune parameters in the teleost fish gilthead seabream, J Pineal Res, 45(1), 70–8. cytryn e, van rijn j, schramm a, gieseke a, de beer d and minz d (2005) Identification of bacteria potentially responsible for oxic and anoxic sulfide oxidation in biofilters of a recirculating mariculture system, Appl Environ Microbiol, 71(10), 6134–41, http://aem.asm.org/cgi/reprint/71/10/6134, accessed January 2009. dalmo r a, seternes t, arnesen s m, jørgensen t ò and bøgwald j (1998) Tissue distribution and cellular uptake of Aeromonas salmonicida lipopolysaccharide (LPS) in some marine fish species, J Fish Dis, 21(5), 321–34. das b, mukherjee s c and murjani g (2002) Acute toxicity of neem Azadirachta indica in Indian major carps, J Aquac Trop, 17(1), 23–33. defoirdt t, boon n, bossier p and verstraete w (2004) Disruption of bacterial quorum sensing: an unexplored strategy to fight infections in aquaculture, Aquaculture, 240(1–4), 69–88. defoirdt t, crab r, wood t k, sorgeloos p, verstraete w and bossier p (2006) Quorum sensing-disrupting brominated furanones protect the gnotobiotic brine shrimp Artemia franciscana from pathogenic Vibrio harveyi, Vibrio campbellii, and Vibrio parahaemolyticus isolates, Appl Environ Microbiol, 72(9), 6419–23. http://aem.asm.org/cgi/reprint/72/9/6419?maxtoshow=&HITS=10&hits=10&RES ULTFORMAT=&fulltext=defoirdt&searchid=1&FIRSTINDEX=0&volume=7 2&issue=9&resourcetype=HWCIT, accessed January 2009. defoirdt t, halet d, vervaeren h, boon n, de wiele t v, sorgeloos p, bossier p and verstraete w (2007) The bacterial storage compound poly-βhydroxybutyrate protects Artemia franciscana from pathogenic Vibrio campbellii, Environ Microbiol, 9(2), 445–52. delaporte m, soudant p, moal j, giudicelli e, lambert c, séguineau c and samain j f (2006) Impact of 20:4n-6 supplementation on the fatty acid composition and hemocyte parameters of the Pacific Oyster Crassostrea gigas, Lipids, 41(6), 567–76, http://www.ifremer.fr/docelec/doc/2006/publication-1876.pdf, accessed January 2009. demers n e and bayne c j (1997) The immediate effects of stress on hormones and plasma lysozyme in rainbow trout, Dev Comp Immunol, 21(4), 363–73, http://itech.fgcu.edu/faculty/ndemers/DCI%2097%20article.pdf, accessed January 2009. devaraja t n, yusoff f m and shariff m (2002) Changes in bacterial populations and shrimp production in ponds treated with commercial microbial products, Aquaculture, 206(3–4), 245–56. dias j, huelvan c, dinis m t and métailler r (1998) Influence of dietary bulk agents (silica, cellulose and a natural zeolite) on protein digestibility, growth, feed intake and feed transit time in European seabass (Dicentrarchus labrax) juveniles, Aquat Living Resour, 11(4), 219–26, http://www.ifremer.fr/docelec/doc/1998/ publication-870.pdf, accessed January 2009. díaz-rosales p, salinas i, rodríguez a, cuesta a, chabrillón m, balebona m c, moriñigo m á, esteban m á and meseguer j (2006) Gilthead seabream (Sparus aurata L.) innate immune response after dietary administration of heat-inactivated potential probiotics, Fish Shellfish Immunol, 20(4), 482–92. direkbusarakom s (2004) Application of medicinal herbs to aquaculture in Asia, Walailak J Sci & Tech, 1(1), 7–14. dorrington t (2006) Recombinant antimicrobials for feed based delivery in aquaculture, Diss Abst Int Pt B – Sci & Eng, 66(9), 4548. douillet p (1989) Effect of bacteria on the culture of larvae of the Pacific oyster Crassostrea gigas (Thunberg), J Shellfish Res, 8(2), 412.

296


douillet p (1993) Bacterivory in Pacific oyster Crassostrea gigas larvae, Mar Biol Prog Ser, 98(1–2), 123–34. douillet p and langdon c (1993) Effects of marine bacteria on the culture of axenic oyster Crassostrea gigas (Thunberg) larvae, Biol Bull, 184(1), 36–51. dügenci s k, arda n and candan a (2003) Some medicinal plants as immunostimulant for fish, J Ethnopharmacol, 88(1), 99–106. duncan p l and lovell r t (1994) Influence of vitamin C on the folate requirement of channel catfish, Ictalurus punctatus, for growth, hematopoiesis, and resistance to Edwardsiella ictaluri infection, Aquaculture, 127(2–3), 233–44. ec (2006) Council Directive of the European Union 2006/88/EC of 24 October 2006 on animal health requirements for aquaculture animals and products thereof, and on the prevention and control of certain diseases in aquatic animals, Official Journal of the European Communities, L328, 24 November, 14, http://eur-lex. europa.eu/LexUriServ/site/en/oj/2006/l_328/l_32820061124en00140056.pdf. ellis t, north b, scott a p, bromage n r, porter m and gadd d (2002) The relationships between stocking density and welfare in farmed rainbow trout, J Fish Biol, 61(3), 493–531. encarnação p (2006) The consequences of mycotoxins in aquaculture, Feed Mix, 14(5), 30–2. http://www.allaboutfeed.net/article-database/the-consequences-ofmycotoxins-in-aquaculture-id33.html. engelsma m y, huising m o, van muiswinkel w b, flik g, kwang j, savelkoul h f j and verburg-van kemenade b m l (2002) Neuroendocrine–immune interactions in fish: a role for interleukin-1, Vet Immunol Immunopathol, 87(3–4), 467–79. esteban m a, rodríguez a and meseguer j (2004) Glucan receptor but not mannose receptor is involved in the phagocytosis of Saccharomyces cerevisiae by seabream (Sparus aurata L.) blood leucocytes, Fish Shellfish Immunol, 16(3), 447–51. eu (1991) Council Directive of of the European Union 91/67/EEC of 28 January 1991 concerning the animal health conditions governing the placing on the market of aquaculture animals and products, Official Journal of the European Communities, L46, 19 February, 1. Directive as last amended by Regulation (EC) No 806/2003 (OJ, L122, 16.5.2003, 1). efsa (2007) European Food Safety Authority, Summary of opinion on possible vector species and live stages of susceptible species not transmitting disease as regards certain fish diseases, Scientific Opinion of the Panel on Animal Health and Welfare (Question No EFSA-Q-2007-044), The EFSA Journal, 584, 2–2, http://www.efsa.europa.eu/EFSA/Scientific_Opinion/ahaw_op_ ej584_fishdiseasevectors_summary_en.pdf. faggio c, denaro m g, lionetto m g and trischitta f (2000) Protective effects of prostaglandins in the isolated gastric mucosa of the eel, Anguilla anguilla, J Comp Physiol, 170B(5–6), 357–63. fao/oie/who (2006) Report of a joint FAO/OIE/WHO Expert Consultation on Antimicrobial Use in Aquaculture and Antimicrobial Resistance, Seoul, Republic of Korea, 13–16 June 2006, Geneva, WHO, http://www.who.int/topics/foodborne_ diseases/aquaculture_rep_13_16june2006%20.pdf, accessed January 2009. fast m d, ross n w, craft c a, locke s j, mackinnon s l and johnson s c (2004) Lepeophtheirus salmonis: characterization of prostaglandin E2 in secretory products of the salmon louse by RP-HPLC and mass spectrometry, Exp Parasitol, 107(1–2), 5–13. fast m d, ross n w and johnson s c (2005) Prostaglandin E2 modulation of gene expression in an Atlantic salmon (Salmo salar) macrophage-like cell line (SHK1), Dev Comp Immunol, 29(11), 951–63. fegan d (2004) Nucleotides, Aqua Feeds: Formulation & Beyond, 1(4), 10–12. flajnik m f and du pasquier l (2004) Evolution of innate and adaptive immunity: can we draw a line?, Trends Immunol, 25(12), 640–4.


297

ford s e, xu z and debrosse g (2001) Use of particle filtration and UV irradiation to prevent infection by Haplosporidium nelsoni (MSX) and Perkinsus marinus (Dermo) in hatchery-reared larval and juvenile oysters, Aquaculture, 194(1–2), 37–49. francis g, makkar h p s and becker k (2001) Antinutritional factors present in plant-derived alternate fish feed ingredients and their effects in fish, Aquaculture, 199(3–4), 197–227. francis g, makkar h p s and becker k (2002) Dietary supplementation with a Quillaja saponin mixture improves growth performance and metabolic efficiency in common carp (Cyprinus carpio L.), Aquaculture, 203(3–4), 311–20. frouël s, le bihan e, serpentini a, lebel j m, koueta n and nicolas j l (2008) Preliminary study of the effects of commercial lactobacilli preparations on digestive metabolism of juvenile sea bass (Dicentrarchus labrax), J Mol Microbiol Biotechnol, 14(1–3), 100–6. fu j, zhang w, mai k, feng x, xu w, liufu z and tan b (2006) Effects of dietary vitamin A on antioxidant responses of abalone Haliotis discus hannai Ino, Acta Oceanol Sin, 25(5), 141–50. fu y w, hou w y, yeh s t, li c h and chen j c (2007) The immunostimulatory effects of hot-water extract of Gelidium amansii via immersion, injection and dietary administrations on white shrimp Litopenaeus vannamei and its resistance against Vibrio alginolyticus, Fish Shellfish Immunol, 22(6), 673–85. fujiki k, matsuyama h and yano t (1994) Protective effect of sodium alginates against bacterial infection in common carp, Cyprinus carpio L., J Fish Dis, 17(4), 349–55. gannam a l and schrock r m (1999) Immunostimulants in fish diets, J Appl Aquac, 9(4), 53–89. garcia a f and massam j p (2005) Elimination of antibiotics in hatcheries while improving production levels by use of probiotics, World Aquac, 36(1), 57–60. gatesoupe f j (1997) Siderophore production and probiotic effect of Vibrio sp. associated with turbot larvae, Scophthalmus maximus, Aquat Living Resour, 10(4), 239–46. gatesoupe f j (1999) The use of probiotics in aquaculture, Aquaculture 180(1–2), 147–65. gatesoupe f j (2005) Probiotics and prebiotics for fish culture, at the parting of the ways, Aqua Feeds: Formulation & Beyond, 2(3), 3–5. gatesoupe f j (2007) Live yeasts in the gut: Natural occurrence, dietary introduction, and their effects on fish health and development, Aquaculture, 267(1–4), 20–30, http://www.ifremer.fr/docelec/doc/2007/publication-2144.pdf, accessed January 2009. gatesoupe f j (2008a) Different methods to reduce antibiotic use in farmed fish, in Lie Ø (ed.), Improving Farmed Fish for the Consumer, Cambridge, Woodhead, 199–237. gatesoupe f j (2008b) Updating the importance of lactic acid bacteria in fish farming: natural occurrence and probiotic treatments, J Mol Microbiol Biotechnol, 14 (1–3), 107–14, http://www.ifremer.fr/docelec/doc/2007/publication-2589.pdf, accessed January 2009. gatlin iii d m, barrows f t, brown p, dabrowski k, gaylord t g, hardy r w, herman e, hu g, krogdahl å, nelson r, overturf k, rust m, sealey w, skonberg d, souza e j, stone d, wilson r and wurtele e (2007) Expanding the utilization of sustainable plant products in aquafeeds: a review, Aquac Res, 38(6), 551–79. gatta p p, thompson k d, smullen r, piva a, testi s and adams a (2001) Dietary organic chromium supplementation and its effect on the immune response of rainbow trout (Oncorhynchus mykiss), Fish Shellfish Immunol, 11(5), 371–82.

298


gauthier j d and vasta g r (1994) Inhibition of in vitro replication of the oyster parasite Perkinsus marinus by the natural iron chelators transferrin, lactoferrin, and desferrioxamine, Dev Comp Immunol, 18(4), 277–86. genc m a, aktas m, genc e and yilmaz e (2007) Effects of dietary mannan oligosaccharide on growth, body composition and hepatopancreas histology of Penaeus semisulcatus (de Haan 1844), Aquac Nutr, 13(2), 156–61. gesamp (1997) GESAMP (IMO/FAO/UNESCO-IOC/WMO/WHO/IAEA/UN/ UNEP Joint Group of Experts on the Scientific Aspects of Marine Environmental Protection), Towards safe and effective use of chemicals in coastal aquaculture, GESAMP Reports and Studies, No. 65, Rome, Food and Agriculture Organization of the United Nations. http://www.fao.org/docrep/meeting/003/w6435e.htm, accessed January 2009. geske g d, o’neill j c and blackwell h e (2007) N-phenylacetanoyl-L-homoserine lactones can strongly antagonize or superagonize quorum sensing in Vibrio fischeri, ACS Chem Biol, 2(5), 315–20. gil-turnes m s, hay m e and fenical w (1989) Symbiotic marine bacteria chemically defend crustacean embryos from a pathogenic fungus, Science, 246(4926), 116–18. gildberg a and mikkelsen h (1998) Effects of supplementing the feed to Atlantic cod (Gadus morhua) fry with lactic acid bacteria and immuno-stimulating peptides during a challenge trial with Vibrio anguillarum, Aquaculture, 167(1–2), 103–13. gildberg a, johansen a and bøgwald j (1995) Growth and survival of Atlantic salmon (Salmo salar) fry given diets supplemented with fish protein hydrolysate and lactic acid bacteria during a challenge trial with Aeromonas salmonicida, Aquaculture, 138(1–4), 23–34. gildberg a, bøgwald, johansen a and stenberg e (1996) Isolation of acid peptide fractions from a fish protein hydrolysate with strong stimulatory effect on Atlantic salmon (Salmo salar) head kidney leucocytes, Comp Biochem Physiol, 114B(1), 97–101. gómez g d and balcázar j l (2008) A review on the interactions between gut microbiota and innate immunity of fish, FEMS Immunol Med Microbiol, 52(2), 145–54. gomez-gil b, roque a and turnbull j f (2000) The use and selection of probiotic bacteria for use in the culture of larval aquatic organisms, Aquaculture, 191(1–3), 259–70. gopalakannan a and arul v (2006) Immunomodulatory effects of dietary intake of chitin, chitosan and levamisole on the immune system of Cyprinus carpio and control of Aeromonas hydrophila infection in ponds, Aquaculture, 255(1–4), 179–87. gorospe j n, nakamura k, abe m and higashi s (1996) Nutritional contribution of Pseudomonas sp. in Artemia culture, Fish Sci, 62(6), 914–18. gram l and ringø e (2005) Prospects of fish probiotics, in Holzapfel W and Naughton P (eds), Microbial Ecology in Growing Animals, Edinburgh, Elsevier, 379–417. gram l, melchiorsen j, spanggaard b, huber i and nielsen t f (1999) Inhibition of Vibrio anguillarum by Pseudomonas fluorescens AH2, a possible probiotic treatment of fish, Appl Environ Microbiol, 65(3), 969–73, http://aem.asm.org/cgi/ reprint/65/3/969, accessed January 2009. gross a, nemirovsky a, zilberg d and nejidat a (2006) Soil nitrifying enrichments for enhancement of biofiltration systems in intensive recirculating saline water aquaculture, World Aquac, 37(2), 12–15. grovel o, pouchus y f and verbist j f (2003) Accumulation of gliotoxin, a cytotoxic mycotoxin from Aspergillus fumigatus, in blue mussel (Mytilus edulis), Toxicon, 42(3), 297–300.


299

guillaume j and métailler r (2001) Antinutritional factors, in Guillaume J, Kaushik S, Bergot P and Métailler R (eds), Nutrition and Feeding of Fish and Crustaceans, Chichester, Praxis, 297–307. halet d, defoirdt t, van damme p, vervaeren h, forrez i, van de wiele t, boon n, sorgeloos p, bossier p and verstraete w (2007) Poly-β-hydroxybutyrateaccumulating bacteria protect gnotobiotic Artemia franciscana from pathogenic Vibrio campbellii, FEMS Microbiol Ecol, 60(3), 363–9. hansen g h (2000) Use of probiotics in marine aquaculture, Feed Mix, 8(4), 32–4. harikrishnan r and balasundaram c (2005) Modern trends in Aeromonas hydrophila disease management with fish, Rev Fish Sci, 13(4), 281–320. harris j and bird d j (2000) Modulation of the fish immune system by hormones, Vet Immunol Immunopathol, 77(3–4), 163–76. håstein t, scarfe a d and lund v l (2005) Science-based assessment of welfare: aquatic Animals, Rev sci tech Off int Epiz, 24(2), 529–47, http://www.oie.int/ boutique/extrait/hastein529547.pdf?PHPSESSID=6ffc9aef653e939cf22fe7464f3b dd8e, accessed January 2009. ho s h, lin c z, chen y c and song y l (2002) Effects of cecropin peptides on aquatic animal pathogens and shrimp hemocytes, Fish Pathol, 37(1), 7–12. hong x t, xiang l x and shao j z (2006) The immunostimulating effect of bacterial genomic DNA on the innate immune responses of bivalve mussel, Hyriopsis cumingii Lea, Fish Shellfish Immunol, 21(4), 357–64. hossain m a, jauncey k (1988) Toxic effects of glucosinolate (allyl isothiocyanate) (synthetic and from mustard oilcake) on growth and food utilization in common carp, Indian J Fish, 35(3), 186–96. hough, c (2007) EATP Proposal – Framework for Vision, a background document on the need, role and impact of a European Aquaculture Technology Platform, in EATP First Stakeholders Meeting, Boncelles, FEAP Secretariat, http://www. eatpnet.eu/doc/EATP%20Proposal%20-%20Framework%20for%20Vision.pdf, accessed January 2009. huntingford f a, adams c, braithwaite v a, kadri s, pottinger t g, sandøe p and turnbull j f (2006) Current issues in fish welfare, J Fish Biol, 68(2), 332–72. hutchins d a, witter a e, butler a and luther iii g w (1999) Competition among marine phytoplankton for different chelated iron species, Nature, 400(6747), 858–61. huttenhuis h b t, ribeiro a s p, bowden t j, van bavel c, taverne-thiele a j and rombout j h w m (2006) The effect of oral immuno-stimulation in juvenile carp (Cyprinus carpio L.), Fish Shellfish Immunol, 21(3), 261–71. irianto a and austin b (2002) Probiotics in aquaculture, J Fish Dis, 25(11), 633–42. irianto a and austin b (2003) Use of dead probiotic cells to control furunculosis in rainbow trout, Oncorhynchus mykiss (Walbaum), J Fish Dis, 26(1), 59–62. itami t, kondo , uozu m, suganuma a, abe t, nakagawa a, suzuki n and takahashi y (1996) Enhancement of resistance against Enterococcus seriolicida infection in yellowtail, Seriola quinqueradiata (Temminck & Schlegel), by oral administration of peptidoglycan derived from Bifidobacterium thermophilum, J Fish Dis, 19(2), 185–7. itami t, asano m, tokushige k, kubono k, nakagawa a, takeno n, nishimura h, maeda m, kondo m and takahashi y (1998) Enhancement of disease resistance of kuruma shrimp, Penaeus japonicus, after oral administration of peptidoglycan derived from Bifidobacterium thermophilum, Aquaculture, 164(1–4), 277–88. jang s i, marsden m j, kim y g, choi m s and secombes c j (1995) The effect of glycyrrhizin on rainbow trout, Oncorhynchus mykiss (Walbaum), leucocyte responses, J Fish Dis, 18(4), 307–15.

300


jia x, patrzykat a, devlin r h, ackerman p a, iwama g k and hancock r e w (2000) Antimicrobial peptides protect coho salmon from Vibrio anguillarum infections, Appl Environ Microbiol, 66(5), 1928–32. kakuta i (1998) Reduction of stress response in carp, Cyprinus carpio L., held under deteriorating environmental conditions, by oral administration of bovine lactoferrin, J Fish Dis, 21(3), 161–7. kakuta i and murachi s (1993) Changes of iron content in eels (Anguilla japonica) infected with atypical Aeromonas salmonicida, Comp Biochem Physiol, 105C(2), 275–8. karunasagar i, shivu m m, girisha s k, krohne g and karunasagar i (2007) Biocontrol of pathogens in shrimp hatcheries using bacteriophages, Aquaculture, 268(1–4), 288–92. kelly s a, havrilla c m, brady t c, abramo k h and levin e d (1998) Oxidative stress in toxicology: established mammalian and emerging piscine model systems, Environ Health Perspect, 106(7), 375–84, http://www.ehponline.org/members/ 1998/106p375-384kelly/kelly-full.html, accessed January 2009. kesarcodi-watson a, kaspar h, lategan m j and gibson l (2008) Probiotics in aquaculture: The need, principles and mechanisms of action and screening processes, Aquaculture 274(1), 1–14. kihara m and sakata t (1997) Fermentation of dietary carbohydrates to short-chain fatty acids by gut microbes and its influence on intestinal morphology of a detritivorous teleost tilapia (Oreochromis niloticus), Comp Biochem Physiol, 118A(4), 1201–7. kihara m and sakata t (2001) Influences of incubation temperature and various saccharides on the production of organic acids and gases by gut microbes of rainbow trout Oncorhynchus mykiss in a micro-scale batch culture, J Comp Physiol, 171B(6), 441–7. kihara m and sakata t (2002) Production of short-chain fatty acids and gas from various oligosaccharides by gut microbes of carp (Cyprinus carpio L.) in microscale batch culture, Comp Biochem Physiol, 132A(2), 333–40. kihara m, ohba k and sakata t (1995) Trophic effect of dietary lactosucrose on intestinal tunica muscularis and utilization of this sugar by gut microbes in red seabream Pagrus major, a marine carnivorous teleost, under artificial rearing, Comp Biochem Physiol, 112A(3–4), 629–34. kim k h, hwang y j, kim k w, bai s c and kim d s (2002) Effects of dietary aloe on chemiluminescent responses of peripheral blood phagocytes and resistance against Edwardsiella tarda Ewing and McWhorter 1965 in the cultured olive flounder, Paralichthys olivaceus (Temminck et Schlegel), Aquac Res, 33(2), 147–50. kiron v, watanabe t, fukuda h, okamoto n and takeuchi t (1995a) Protein nutrition and defence mechanisms in rainbow trout Oncorhynchus mykiss, Comp Biochem Physiol, 111A(3), 351–9. kiron v, fukuda h, takeuchi t and watanabe t (1995b) Essential fatty acid nutrition and defence mechanisms in rainbow trout Oncorhynchus mykiss, Comp Biochem Physiol, 111A(3), 361–7. knudsen d, urán p, arnous a, koppe w and frøkiær h (2007) Saponin-containing subfractions of soybean molasses induce enteritis in the distal intestine of Atlantic salmon, J Agric Food Chem, 55(6), 2261–7. koch t and heller a r (2005) Benefits of ω-3 fatty acids in parenteral nutrition, Clin Nutr Suppl, 1(3), 17–24. kono m, matsui t and shimizu c (1987) Effect of chitin, chitosan, and cellulose as diet supplements on the growth of cultured fish, Bull Jap Soc Sci Fish, 53(1), 125–9.


301

konstantinov s r, zhu w y, williams b a, tamminga s, de vos w m and akkermans a d l (2003) Effect of fermentable carbohydrates on piglet faecal bacterial communities as revealed by denaturing gradient gel electrophoresis analysis of 16S ribosomal DNA, FEMS Microbiol Ecol, 43(2), 225–35. konstantinov s r, awati a, smidt h, williams b a, akkermans a d l and de vos w m (2004) Specific response of a novel and abundant Lactobacillus amylovoruslike phylotype to dietary prebiotics in the guts of weaning piglets, Appl Environ Microbiol, 70(7), 3821–30, http://aem.asm.org/cgi/reprint/70/7/3821, accessed January 2009. krogdahl å, bakke-mckellep a m, røed k h and baeverfjord g (2000) Feeding Atlantic salmon Salmo salar L. soybean products: effects on disease resistance (furunculosis), and lysozyme and IgM levels in the intestinal mucosa, Aquac Nutr, 6(2), 77–84. kumari j and sahoo p k (2006) Dietary β-1,3 glucan potentiates innate immunity and disease resistance of Asian catfish, Clarias batrachus (L.), J Fish Dis, 29(2), 95–101. kumari j, swain t and sahoo p k (2003) Dietary bovine lactoferrin induces changes in immunity level and disease resistance in Asian catfish Clarias batrachus, Vet Immunol Immunopathol, 94(1–2), 1–9. kurtz j and franz k (2003) Innate defence: Evidence for memory in invertebrate immunity, Nature, 425(6953), 37–8. lacoste a, malham s k, cueff a, jalabert f, gélébart f and poulet s a (2001a) Evidence for a form of adrenergic response to stress in the oyster Crassostrea gigas, J Exp Biol, 204(7), 1247–55. lacoste a, jalabert f, malham s k, cueff a and poulet s a (2001b) Stress and stress-induced neuroendocrine changes increase the susceptibility of juvenile oysters (Crassostrea gigas) to Vibrio splendidus, Appl Environ Microbiol, 67(5), 2304–9, http://aem.asm.org/cgi/reprint/67/5/2304, accessed January 2009. lalloo r, ramchuran s, ramduth d, görgens j and gardiner n (2007) Isolation and selection of Bacillus spp. as potential biological agents for enhancement of water quality in culture of ornamental fish, J Appl Microbiol, 103(5), 1471–9. lategan m j, torpy f r and gibson l f (2004) Control of saprolegniosis in the eel Anguilla australis Richardson, by Aeromonas media strain A199, Aquaculture, 240(1–4), 19–27. leaño e m, lio-po g d, nadong l a, tirado a c, sadaba r b and guanzon n g jr (2005) Mycoflora of the ‘green water’ culture system of tiger shrimp Penaeus monodon Fabricius, Aquac Res, 36(16), 1581–7. lee m and shiau s (2002) Dietary copper requirement of juvenile grass shrimp, Penaeus monodon, and effects on non-specific immune responses, Fish Shellfish Immunol, 13(4), 259–70. lee y k, chew p f, soh b s, tham l y (2003) Enhancing phagocytic activity of hemocytes and disease resistance in the prawn Penaeus merguiensis by feeding Spirulina platensis, J Appl Phycol, 15(4), 279–87. leenhouwers j i, adjei-boateng d, verreth j a j and schrama j w (2006) Digesta viscosity, nutrient digestibility and organ weights in African catfish (Clarias gariepinus) fed diets supplemented with different levels of a soluble non-starch polysaccharide, Aquac Nutr, 12(2), 111–16. leenhouwers j i, ter veld m, verreth j a j and schrama j w (2007) Digesta characteristiscs and performance of African catfish (Clarias gariepinus) fed cereal grains that differ in viscosity, Aquaculture, 264(1–4), 330–41. le moullac g and haffner p (2000) Environmental factors affecting immune responses in Crustacea, Aquaculture, 191(1–3), 121–31.

302


li p and gatlin iii d m (2006) Nucleotide nutrition in fish: Current knowledge and future applications, Aquaculture, 251(2–4), 141–52. li m h, wise d j, johnson m r and robinson e h (1994) Dietary menhaden oil reduced resistance of channel catfish (Ictalurus punctatus) to Edwardsiella ictaluri, Aquaculture, 128(3–4), 335–44. li j t, lee p p, chen o c, cheng w and kuo c m (2005) Dopamine depresses the immune ability and increases susceptibility to Lactococcus garvieae in the freshwater giant prawn, Macrobrachium rosenbergii, Fish Shellfish Immunol, 19(3), 269–80. li y, li j and wang q (2006) The effects of dissolved oxygen concentration and stocking density on growth and non-specific immunity factors in Chinese shrimp, Fenneropenaeus chinensis, Aquaculture, 256(1–4), 608–16. li k, zheng t, tian y, xi f, yuan j, zhang g and hong h (2007a) Beneficial effects of Bacillus licheniformis on the intestinal microflora and immunity of the white shrimp, Litopenaeus vannamei, Biotechnol Lett, 29(4), 525–30. li p, lawrence a l, castille f l and gatlin iii d m (2007b) Preliminary evaluation of a purified nucleotide mixture as a dietary supplement for Pacific white shrimp Litopenaeus vannamei (Boone), Aquac Res, 38(8), 887–90. lim c and klesius p h (1997) Responses of channel catfish (Ictaluris punctatus) fed iron-deficient and replete diets to Edwardsiella ictaluri challenge, Aquaculture, 157(1–2), 83–93. lin y h and shiau s y (2007) Effects of dietary blend of fish oil with corn oil on growth and non-specific immune responses of grouper, Epinephelus malabaricus, Aquac Nutr, 13(2), 137–44. lindenstrøm t, secombes c j and buchmann k (2004) Expression of immune response genes in rainbow trout skin induced by Gyrodactylus derjavini infections, Vet Immunol Immunopathol, 97(3–4), 137–48. livingstone d r (2001) Contaminant-stimulated reactive oxygen species production and oxidative damage in aquatic organisms, Mar Pollut Bull, 42(8), 656–66. livingstone d r (2003) Oxidative stress in aquatic organisms in relation to pollution and aquaculture, Revue Méd Vét, 154(6), 427–30, http://www.revmedvet.com/2003/ RMV154_427_430.pdf, accessed January 2009. lødemel j b, mayhew t m, myklebust r, olsen r e, espelid s and ringø e (2001) Effect of three dietary oils on disease susceptibility in Arctic charr (Salvelinus alpinus L.) during cohabitant challenge with Aeromonas salmonicida ssp. Salmonicida, Aquac Res, 31(12), 935–45. lópez n, cuzon g, gaxiola g, taboada g, valenzuela m, pascual c, sanchez a and rosas c (2003) Physiological, nutritional, and immunological role of dietary β 1–3 glucan and ascorbic acid 2-monophosphate in Litopenaeus vannamei juveniles, Aquaculture, 224(1–4), 223–43. lumlertdacha s and lovell r t (1995) Fumonisin-contaminated dietary corn reduced survival and antibody production by channel catfish challenged with Edwardsiella ictaluri, J Aquat Anim Health, 7(1), 1–8. lygren b, sveier h, hjeltnes b and waagbø r (1999) Examination of the immunomodulatory properties and the effect on disease resistance of dietary bovine lactoferrin and vitamin C fed to Atlantic salmon (Salmo salar) for a short-term period, Fish Shellfish Immunol, 9(2), 95–107. macey b m and coyne v e (2005) Improved growth rate and disease resistance in farmed Haliotis midae through probiotic treatment, Aquaculture, 245(1–4), 249–61. macey b m and coyne v e (2006) Colonization of the gastrointestinal tract of the farmed South African abalone Haliotis midae by the probionts Vibrio midae SY9, Cryptococcus sp. SS1, and Debaryomyces hansenii AY1, Mar Biotechnol, 8(3), 246–59.


303

maeda m (2004) Interactions of microorganims and their use as biocontrol agents in aquaculture, La Mer, 42(1), 1–19. mahious a s, van loo j and ollevier f (2006a) Impact of the prebiotics, inulin and oligofructose on microbial fermentation in the spiral valve of Siberian sturgeon Acipenser baerii, Aqua 2006, Florence, 9–13 May, Baton Rouge, LA, World Aquaculture Society, https://www.was.org/meetings/AbstractData.asp? AbstractId=10997, accessed January 2009. mahious a s, gatesoupe f j, hervi m, métailler r and ollevier f (2006b) Effect of dietary inulin and oligosaccharides as prebiotics for weaning turbot, Psetta maxima (Linnaeus, C. 1758), Aquac Int, 14(3), 219–29, http://www.ifremer.fr/ docelec/doc/2006/publication-1721.pdf, accessed January 2009. manefield m, harris l, rice s a, de nys r and kjelleberg s (2000) Inhibition of luminescence and virulence in the black tiger prawn (Penaeus monodon) pathogen Vibrio harveyi by intercellular signal antagonists, Appl Environ Microbiol, 66(5), 2079–84, http://aem.asm.org/cgi/reprint/66/5/2079, accessed January 2009. marques a, ollevier f, verstraete w, sorgeloos p and bossier p (2006) Gnotobiotically grown aquatic animals: opportunities to investigate host–microbe interactions, J Appl Microbiol, 100(5), 903–18, http://www.ncaref.org/Media/ Marques_A%202006.pdf, accessed January 2009. matson s e, langdon c j and evans s (2006) Specific pathogen free culture of the Pacific oyster (Crassostrea gigas) in a breeding research program: Effect of water treatment on growth and survival, Aquaculture, 253(1–4), 475–84. milgroom m g and cortesi p (2004) Biological control of chestnut blight with hypovirulence: A critical analysis, Annu Rev Phytopathol, 42, 311–38. mohamed k s (1996) Heterotrophic marine bacteria as supplementary feed for larval Penaeus monodon, Naga, 19(1), 23–6. mortensen s, korsnes k and bergh ø (2006) ‘Eyes wide shut’ – A critical view of aquaculture health management and risk factors in the ‘real world’, Bull Eur Ass Fish Pathol, 26(1), 2–6, http://www.imr.no/__data/page/6453/Eyes_wide_shut.pdf, accessed January 2009. morvan, a, iwanaga s, comps m and bachère e (1997) In vitro activity of the limulus antimicrobial peptide tachyplesin I on marine bivalve pathogens, J Invertebr Pathol, 69(2), 177–82. nagesh t s, jayabalan n, mohan c v, annappaswamy t s and anil t m (1999) Survival and histological alterations in juvenile tiger shrimp exposed to saponin, Aquac Int, 7(3), 159–67. nakai t and park s c (2002) Bacteriophage therapy of infectious diseases in aquaculture, Res Microbiol, 153(1), 13–18. neji h, naimi n, lallier r and de la noüe j (1993) Relationships between feeding, hypoxia, digestibility and experimentally induced furunculosis in rainbow trout, in Kaushik S J and Luquet P (eds), Fish Nutrition in Practice, Paris, Institut National de la Recherche Agronomique, 187–97. nicolas j l, gatesoupe f j, frouel s, bachère e, gueguen y (2007) Quelles stratégies alternatives aux antibiotiques en aquaculture? INRA Prod Anim, 20(3), 253–8. nikoskelainen s, ouwehand a c, bylund g, salminen s and lilius e m (2003) Immune enhancement in rainbow trout (Oncorhynchus mykiss) by potential probiotic bacteria (Lactobacillus rhamnosus), Fish Shellfish Immunol, 15(5), 443–52. ninomiya m, hatta h, fujiki m, kim m, yamamoto t and kusuda r (1995) Enhancement of chemotactic activity of yellowtail (Seriola quinqueradiata) leucocytes by oral administration of quillaja saponin, Fish Shellfish Immunol, 5(4), 325–8. novoa b, figueras a, ashton i and secombes c j (1996) In vitro studies on the regulation of rainbow trout (Oncorhynchus mykiss) macrophage respiratory burst activity, Dev Comp Immunol, 20(3), 207–16.

304


o’donnell g b, smith p r, kilmartin j j and moran a p (1994) Uptake and fate of orally administered bacterial lipopolysaccharide in brown trout (Salmo trutta), Fish Shellfish Immunol, 4(4), 285–99. olsen r e, myklebust r, kryvi h, mayhew t m and ringø e (2001) Damaging effect of dietary inulin on intestinal enterocytes in Arctic charr (Salvelinus alpinus L.), Aquac Res, 32(11), 931–4. ørnsrud r, graff i e, høie s, totland g k and hemre g (2002) Hypervitaminosis A in first-feeding fry of the Atlantic salmon (Salmo salar L.), Aquac Nutr, 8(1), 7–13. ortuño j, cuesta a, rodríguez a, esteban m a and meseguer j (2002) Oral administration of yeast, Saccharomyces cerevisiae, enhances the cellular innate immune response of gilthead seabream (Sparus aurata L.), Vet Immunol Immunopathol, 85(1–2), 41–50. ostaszewska t, dabrowski k, palacios m e, olejniczak m and wieczorek m (2005) Growth and morphological changes in the digestive tract of rainbow trout (Oncorhynchus mykiss) and pacu (Piaractus mesopotamicus) due to casein replacement with soybean proteins, Aquaculture, 245(1–4), 273–86. ottaviani e (2004) The mollusc as a suitable model for mammalian immuneneuroendocrine investigations, Invertebrate Survival J, 1(1), 2–4. http://www.isj. unimo.it/articoli/ISJ001.pdf, accessed January 2009. ottaviani e, franchini a and franceschi c (1998) Presence of immunoreactive corticotropin-releasing hormone and cortisol molecules in invertebrate haemocytes and lower and higher vertebrate thymus, Histochem J, 30(2), 61–7. ottinger c a and kaattari s l (1998) Sensitivity of rainbow trout leucocytes to aflatoxin B1, Fish Shellfish Immunol, 8(7), 515–30. ottinger c a and kaattari s l (2000) Long-term immune dysfunction in rainbow trout (Oncorhynchus mykiss) exposed as embryos to aflatoxin B1, Fish Shellfish Immunol, 10(1), 101–6. pascual c, zenteno e, cuzon g, suárez j, sánchez a, gaxiola g, taboada g, maldonado t and rosas c (2004) Litopenaeus vannamei juveniles energetic balance and immunological response to dietary proteins, Aquaculture, 239(1–4), 375–95. pedersen g m, gildberg a, steiro k and olsen r l (2003) Histone-like proteins from Atlantic cod milt: stimulatory effect on Atlantic salmon leucocytes in vivo and in vitro, Comp Biochem Physiol, 134B(3), 407–16. pedersen g m, gildberg a and olsen r l (2004) Effects of including cationic proteins from cod milt in the feed to Atlantic cod (Gadus morhua) fry during a challenge trial with Vibrio anguillarum, Aquaculture, 233(1–4), 31–43. peres h, lim c and klesius p h (2003) Nutritional value of heat-treated soybean meal for channel catfish (Ictalurus punctatus), Aquaculture, 225(1–4), 67–82. pieters n, brunt j, austin b and lyndon a r (2008) Efficacy of in-feed probiotics against Aeromonas bestiarum and Ichthyophthirius multifiliis skin infections in rainbow trout (Oncorhynchus mykiss, Walbaum), J Appl Microbiol, 105(3), 723–32. pilarczyk a (1995) Changes in specific carp immune reaction caused by addition of fish oil to pellets, Aquaculture, 129(1–4), 425–9. portz d e, woodley c m and cech j j (2006) Stress-associated impacts of short-term holding on fishes, Rev Fish Biol Fish, 16(2), 125–70. pottinger t g and day j g (1999) A Saprolegnia parasitica challenge system for rainbow trout: Assessment of Pyceze as an anti-fungal agent for both fish and ova, Dis Aquat Org, 36(2), 129–41. prearo m, minervini f, pavoletti e, pascale m, visconti a and ghittino c (2000) Symptomatological, anatomopathological and histological features in rainbow trout fed with a deoxynivalenol (vomitoxin) contaminated diet, Boll Soc Ital Patol Ittica, 12(29), 33–43.


305

prusty a k, sahu n p, pal a k, reddy a k and kumar s (2007) Effect of dietary tannin on growth and haemato-immunological parameters of Labeo rohita (Hamilton) fingerlings, Anim Feed Sci Technol, 136(1–2), 96–108. rasch m, buch c, austin, b, slierendrecht w j, ekmann k s, larsen j l, johansen c, riedel k, eberl l, givskov m and gram l (2004) An inhibitor of bacterial quorum sensing reduces mortalities caused by vibriosis in rainbow trout (Oncorhynchus mykiss, Walbaum), Syst Appl Microbiol, 27(3), 350–9, http://www.cmbb. hw.ac.uk/research/Austin1.pdf, accessed January 2009. rasch m, kastbjerg v g, bruhn j b, dalsgaard i, givskov m and gram l (2007) Quorum sensing signals are produced by Aeromonas salmonicida and quorum sensing inhibitors can reduce production of a potential virulence factor, Dis Aquat Org, 78(2), 105–13. ratledge c and dover l g (2000) Iron metabolism in pathogenic bacteria, Annu Rev Microbiol, 54, 881–941. rawls j f, samuel b s and gordon j i (2004) Gnotobiotic zebrafish reveal evolutionarily conserved responses to the gut microbiota, Proc Natl Acad Sci U S A, 101 (13), 4596–601, http://gordonlab.wustl.edu/PublicationPDFs/336_RawlsPNAS04. pdf, accessed January 2009. rawls j f, mahowald m a, ley r e and gordon j i (2006) Reciprocal gut microbiota transplants from zebrafish and mice to germ-free recipients reveal host habitat selection, Cell, 127(2), 423–33, http://gordonlab.wustl.edu/PublicationPDFs/364_ RawlsCell06.pdf, accessed January 2009. refstie s, bakke-mckellep a m, penn m h, sundby a, shearer k d and krogdahl å (2006) Capacity for digestive hydrolysis and amino acid absorption in Atlantic salmon (Salmo salar) fed diets with soybean meal or inulin with or without addition of antibiotics, Aquaculture, 261(1), 392–406. regunathan c and wesley s g (2004) Control of Vibrio spp. in shrimp hatcheries using the green algae Tetraselmis suecica, Asian Fish Sci, 17(2), 147–58. http:// www.asianfisheriessociety.org/modules/library/singlefile.php?cid=127&lid=194, accessed January 2009. reyes-becerril m, tovar-ramírez d, ascencio-valle f, civera-cerecedo r, gracialópez v and barbosa-solomieu v (2008) Effects of dietary live yeast Debaryomyces hansenii on the immune and antioxidant system in juvenile leopard grouper Mycteroperca rosacea exposed to stress, Aquaculture, 280(1–4), 39–44. ringø e and gatesoupe f j (1998) Lactic acid bacteria in fish: a review, Aquaculture, 160(3–4), 177–203. ringø e and holzapfel w (2000) Identification and characterization of carnobacteria associated with the gills of Atlantic salmon (Salmo salar L.), Syst Appl Microbiol, 23(4), 523–7. ringø e, schillinger u and holzapfel w (2005) Antimicrobial activity of lactic acid bacteria isolated from aquatic animals and the use of lactic acid bacteria in aquaculture in Holzapfel W and Naughton P (eds), Microbial Ecology in Growing Animals, Edinburgh, Elsevier, 418–53. ringø e, sperstad s, myklebust r, mayhew t m and olsen r e (2006) The effect of dietary inulin on aerobic bacteria associated with hindgut of Arctic charr (Salvelinus alpinus L.), Aquac Res, 37(9), 891–7. ringø e, sperstad s, kraugerud o f and krogdahl å (2008) Use of 16S rRNA gene sequencing analysis to characterize culturable intestinal bacteria in Atlantic salmon (Salmo salar) fed diets with cellulose or non-starch polysaccharides from soy, Aquac Res, 39(10), 1087–100. riquelme c e, jorquera m a, rojas a i, avendano r e and reyes n (2001) Addition of inhibitor-producing bacteria to mass cultures of Argopecten purpuratus larvae (Lamarck, 1819), Aquaculture, 192(2–4), 111–19.

306


roch p (1999) Defense mechanisms and disease prevention in farmed marine invertebrates, Aquaculture, 172(1–2), 125–45. rørvik k a, dehli a, thomassen m, ruyter b, steien s h and salte r (2003) Synergistic effects of dietary iron and omega-3 fatty acid levels on survival of farmed Atlantic salmon, Salmo salar L., during natural outbreaks of furunculosis and cold water vibriosis, J Fish Dis, 26(8), 477–85. rowley a f, knight j, lloyd-evans p, holland j w and vickers p j (1995) Eicosanoids and their role in immune modulation in fish – a brief overview, Fish Shellfish Immunol, 5(8), 549–67. saha n c and kaviraj a (1996) Acute and chronic toxicity of tannic acid and spent bark of cinchona to tilapia Oreochromis mossambicus, Aquaculture, 145(1–4), 119–27. sahu s, das b k, mishra b k, pradhan j and sarangi n (2007) Effect of Allium sativum on the immunity and survival of Labeo rohita infected with Aeromonas hydrophila, J Appl Ichthyol, 23(1), 80–86. sainz-hernández j c and maeda-martínez a n (2005) Sources of Vibrio bacteria in mollusc hatcheries and control methods: a case study, Aquac Res, 36(16), 1611–18. sajeevan t p, philip r and bright singh i s (2006) Immunostimulatory effect of a marine yeast Candida sake S165 in Fenneropenaeus indicus, Aquaculture, 257(1–4), 150–5. sakai m (1999) Current research status of fish immunostimulants, Aquaculture, 172(1–2), 63–92. sakai m, otubo t, atsuta s and kobayashi m (1993) Enhancement of resistance to bacterial infection in rainbow trout, Oncorhynchus mykiss (Walbaum), by oral administration of bovine lactoferrin, J Fish Dis, 16(3), 239–47. sakai m, yoshida t, atsuta s and kobayashi m (1995) Enhancement of resistance to vibriosis in rainbow trout, Oncorhynchus mykiss (Walbaum), by oral administration of Clostridium butyricum bacterin, J Fish Dis, 18(2), 187–90. salinas i, díaz rosales p, cuesta a, meseguer j, chabrillón m, moriñigo m a and esteban m a (2006) Effect of heat-inactivated fish and non-fish derived probiotics on the innate immune parameters of a teleost fish (Sparus aurata L.), Vet Immunol Immunopathol, 111(3–4), 279–86. salzet m (2001) Neuroimmunology of opioids from invertebrates to human’, Neuroendocrinol Lett, 22(6), 467–74, http://www.nel.edu/22_6/NEL220601R05_ Salzet_.pdf, accessed January 2009. schnell m j, johnson j e, buonocore l, rose j k (1997) Construction of a novel virus that targets HIV-1-infected cells and controls HIV-1 infection, Cell, 90(5), 849–57. schreck c b (1996) Immunomodulation: endogenous factors, in Iwama G and Nakanishi T (eds), The Fish Immune System, San Diego, CA, Academic Press, 311–37. sealey w m and gatlin iii d m (2002) Dietary supplementation of vitamin C and/or vitamin E before or after experimental infection with Streptococcus iniae has limited effects on survival of hybrid striped bass, J Aquat Anim Health, 14(3), 165–75. sealey w m, lim c and klesius p h (1997) Influence of the dietary level of iron from iron methionine and iron sulfate on immune response and resistance of channel catfish to Edwardsiella ictaluri, J World Aquac Soc, 28(2), 142–9. secombes c j, wang t, hong s, peddie s, crampe m, laing k j, cunningham c and zou j (2001) Cytokines and innate immunity of fish, Dev Comp Immunol, 25(8–9), 713–23. secord d (2003) Biological control of marine invasive species: cautionary tales and land-based lessons, Biol Invasions, 5(1–2), 117–31.


307

selvin j, huxley a j and lipton a p (2004a) Immunomodulatory potential of marine secondary metabolites against bacterial diseases of shrimp, Aquaculture, 230 (1–4), 241–8. selvin j, joseph s, asha k r t, manjusha w a, sangeetha v s, jayaseema d m, antony m c, and denslin vinitha a j (2004b) Antibacterial potential of antagonistic Streptomyces sp. isolated from marine sponge Dendrilla nigra, FEMS Microbiol Ecol, 50(2), 117–22. shinn a, wootten r and sommerville c (2005) Alternative compounds for the treatment of Ichthyophthirius multifiliis infecting rainbow trout, Trout News, 35, 38–41, http://www.cefas.co.uk/news-and-events/finfish-news/trout-news/troutnews---issue-no-35-january-2003.aspx, accessed January 2009. sitjá-bobadilla a, peña-llopis s, gómez-requeni p, médale f, kaushik s and pérezsánchez j (2005) Effect of fish meal replacement by plant protein sources on non-specific defence mechanisms and oxidative stress in gilthead sea bream (Sparus aurata), Aquaculture, 249 (1–4), 387–400, http://www.ifremer.fr/docelec/ doc/2005/publication-3595.pdf, accessed January 2009. skjermo j, salvesen i, øie g, olsen y and vadstein o (1997) Microbially matured water: A technique for selection of a non-opportunistic bacterial flora in water that may improve performance of marine larvae, Aquac Int, 5(1), 13–28. skjermo j, størseth t r, hansen k, handå a and øie g (2006) Evaluation of β-(1 → 3, 1 → 6)-glucans and high-M alginate used as immunostimulatory dietary supplement during first feeding and weaning of Atlantic cod (Gadus morhua L.), Aquaculture, 261(3), 1088–101. smith b c (1994) Investigating allelopathy between the marine microalgae: some species familiar to aquaculture, J Shellfish Res, 13(1), 319–20. smith p and davey s (1993) Evidence for the competitive exclusion of Aeromonas salmonicida from fish with stress-inducible furunculosis by a fluorescent pseudomonad, J Fish Dis, 16(5), 521–4. smith d a, schurig g g, smith s a and holladay s d (1999a) Tilapia (Oreochromis niloticus) and rodents exhibit similar patterns of inhibited antibody production following exposure to immunotoxic chemicals, Vet Hum Toxicol, 41(6), 368–73. smith d a, schurig g g, smith s a and holladay s d (1999b) Inhibited cytotoxic leukocyte activity in tilapia (Oreochromis niloticus) following exposure to immunotoxic chemicals, Int J Toxicol, 18(3), 167–72. smith k l, galloway t s and depledge m h (2000) Neuro-endocrine biomarkers of pollution-induced stress in marine invertebrates, Sci Total Environ, 262(1–2), 185–90. spring p (2005) Mycotoxins – a rising threat to aquaculture, Feed Mix, 13(5), 26–9, http://aquafeed.com/docs/ns/Spring&Fegan.pdf, accessed January 2009. staykov y, spring p, denev s and sweetman j (2007) Effect of a mannan oligosaccharide on the growth performance and immune status of rainbow trout (Oncorhynchus mykiss), Aquac Int, 15(2), 153–61. stefano g b, cadet p, zhu w, rialas c m, mantione k, benz d, fuentes r, casares f, fricchione g l, fulop z and slingsby b (2002) The blueprint for stress can be found in invertebrates, Neuroendocrinol Lett, 23(2), 85–93, http://www.nel.edu/ pdf_w/23_2/NEL230202R02_Stefano_rw.pdf, accessed January 2009. subhash s k and lipton a p (2007) Effects of a probiotic bacterium, Lactobacillus acidophilus, on the growth and survival of pearl oyster (Pinctada margaritifera) spat, Isr J Aquac 59(4), 201–5. subhash s k, lipton a p and raj r p (2007) Stocking density dependent bacterial load and its influence on the production of pearl oyster Pinctada fucata (Gould) seed, Indian J Anim Sci, 77(5), 420–3. summerfelt s t (2003) Ozonation and UV irradiation – an introduction and examples of current applications, Aquac Eng, 28(1–2), 21–36, http://www.w-m-t.

308


com/library/pdf/Summerfelt_paper_Ozone_UV_design_examples.pdf, accessed January 2009. sun y and oliver j d (1994) Effects of GRAS compounds on natural Vibrio vulnificus populations in oysters, J Food Prot, 57(10), 921–3. sunyer j o, gómez e, navarro v, quesada j and tort l (1995) Physiological responses and depression of humoral components of the immune system in gilthead sea bream (Sparus aurata) following daily acute stress, Can J Fish Aquat Sci, 52(11), 2339–46. suphantharika m, khunrae p, thanardkit p and verduyn c (2003) Preparation of spent brewer’s yeast β-glucans with a potential application as an immunostimulant for black tiger shrimp, Penaeus monodon, Bioresour Technol, 88(1), 55–60. sutton j, balfry s, higgs d, huang c h and skura b (2006) Impact of iron-catalyzed dietary lipid peroxidation on growth performance, general health and flesh proximate and fatty acid composition of Atlantic salmon (Salmo salar L.) reared in seawater, Aquaculture, 257(1–4), 534–57. sweetman j and davies s (2006) Improving growth performance and health status of aquaculture stocks in Europe through the use of Bio-Mos®, in Lyons T, Jacques K and Hower J (eds), Proceedings Alltech’s 22nd Ann Symposium Nutritional Biotechnology in the Feed and Food Industries, Nottingham, Nottingham University Press, 445–52, http://www.aquafeed.com/docs/papers/Sweetman.pdf, accessed January 2009. tafalla c, figueras a and novoa b (2002) Possible role of LTB4 in the antiviral activity of turbot (Scophthalmus maximus) leukocyte-derived supernatants against viral hemorrhagic septicemia virus (VHSV), Dev Comp Immunol, 26(3), 283–93. takahashi k g, nakamura a and mori k (2000a) Inhibitory effects of ovoglobulins on bacillary necrosis in larvae of the Pacific oyster, Crassostrea gigas, J Invertebr Pathol, 75(3), 212–17. takahashi y, kondo m, itami t, honda t, inagawa h, nishizawa t, soma g and yokomizo y (2000b) Enhancement of disease resistance against penaeid acute viraemia and induction of virus-inactivating activity in haemolymph of kuruma shrimp, Penaeus japonicus, by oral administration of Pantoea agglomerans lipopolysaccharide (LPS), Fish Shellfish Immunol, 10(6), 555–8. takeuchi t (1997) Essential fatty acid requirements of aquatic animals with emphasis on fish larvae and fingerlings, Rev Fish Sci, 5(1), 1–25. tal y, watts j e m and schreier h j (2006) Anaerobic ammonium-oxidizing (anammox) bacteria and associated activity in fixed-film biofilters of a marine recirculating aquaculture system, Appl Environ Microbiol, 72(4), 2896–904, http://aem.asm.org/cgi/reprint/72/4/2896, accessed January 2009. tang h g, wu t x, zhao z y and pan x d (2008) Effects of fish protein hydrolysate on growth performance and humoral immune response in large yellow croaker (Pseudosciaena crocea R.), J Zhejiang Univ Sci B, 9(9), 684–90. tango m s and gagnon g a (2003) Impact of ozonation on water quality in marine recirculation systems, Aquac Eng, 29(3–4), 125–37. taoka y, maeda h, jo j y, jeon m j, bai s c, lee w j, yuge k and koshio s (2006a) Growth, stress tolerance and non-specific immune response of Japanese flounder Paralichthys olivaceus to probiotics in a closed recirculating system, Fish Sci, 72(2), 310–21. taoka y, maeda h, jo j y, kim s m, park s i, yoshikawa t, sakata t (2006b) Use of live and dead probiotic cells in tilapia Oreochromis niloticus, Fish Sci, 72(4), 755–66. thompson f l, abreu p c and cavalli r (1999) The use of microorganisms as food source for Penaeus paulensis larvae, Aquaculture, 174(1–2), 139–53.


309

tinh n t n, dierckens k, sorgeloos p and bossier p. (2008) A review of the functionality of probiotics in the larviculture food chain, Mar Biotechnol, 10(1), 1–12. titus e and ahearn g a (1991) Transintestinal acetate transport in a herbivorous teleost: anion exchange at the basolateral membrane, J Exp Biol, 156(1), 41–61. torkildsen l, coyne r, samuelsen o b, magnesen t and bergh ø (2002), Treatment of the early life stages of scallop (Pecten maximus) with antimicrobial agents; searching for an alternative to chloramphenicol, Aquact Int, 10(5), 399–409. treasurer j w, cochrane e and grant a (2005) Surface disinfection of cod Gadus morhua and haddock Melanogrammus aeglefinus eggs with bronopol, Aquaculture, 250(1–2), 27–35. van anholt r d, spanings f a t, koven w m, nixon o and wendelaar bonga s e (2004) Arachidonic acid reduces the stress response of gilthead seabream Sparus aurata L., J Exp Biol, 207(19), 3419–30. van rijn j (1996) The potential for integrated biological treatment systems in recirculating fish culture: a review, Aquaculture, 139(3–4), 181–201. verschuere l, rombaut g, sorgeloos p and verstraete w (2000) Probiotic bacteria as biological control agents in aquaculture, Microbiol Mol Biol Rev, 64(4), 655–71, http://mmbr.asm.org/cgi/reprint/64/4/655.pdf, accessed January 2009. villamil l, tafalla c, figueras a and novoa b (2002) Evaluation of immunomodulatory effects of lactic acid bacteria in turbot (Scophthalmus maximus), Clin Diagn Lab Immunol, 9(6), 1318–23, http://cdli.asm.org/cgi/reprint/9/6/1318, accessed January 2009. vine n g, leukes w d, and kaiser h (2006) Probiotics in marine larviculture FEMS Microbiol Rev, 30(3), 404–27. vinod m g, shivu m m, umesha k r, rajeeva b c, krohne g, karunasagar i and karunasagar i (2006) Isolation of Vibrio harveyi bacteriophage with a potential for biocontrol of luminous vibriosis in hatchery environments, Aquaculture, 255(1–4), 117–24. vollstad d, bøgwald j, gåserød o and dalmo r a (2006) Influence of high-M alginate on the growth and survival of Atlantic cod (Gadus morhua L.) and spotted wolffish (Anarhichas minor Olafsen) fry, Fish Shellfish Immunol, 20(4), 548–61. waagbø r, glette j, raa-nilsen e and sandnes k (1993) Dietary vitamin C, immunity and disease resistance in Atlantic salmon (Salmo salar), Fish Physiol Biochem, 12(1), 61–73. wahli t, verlhac v, girling p, gabaudan j and aebischer c (2003) Influence of dietary vitamin C on the wound healing process in rainbow trout (Oncorhynchus mykiss), Aquaculture, 225(1–4), 371–86. wang y b (2007) Effect of probiotics on growth performance and digestive enzyme activity of the shirmp Penaeus vannamei, Aquaculture, 269(1–4), 259–64. wang s h and chen j c (2005) The protective effect of chitin and chitosan against Vibrio alginolyticus in white shrimp Litopenaeus vannamei, Fish Shellfish Immunol, 19(3), 191–204. wang c l, lovell r t, and klesius p h (1997) Response to Edwardsiella ictaluri challenge by channel catfish fed organic and inorganic sources of selenium, J Aquat Anim Health, 9(3), 172–9. wang y g, lee k l, najiah m, shariff m and hassan m d (2000) A new bacterial white spot syndrome (BWSS) in cultured tiger shrimp Penaeus monodon and its comparison with white spot syndrome (WSS) caused by virus, Dis Aquat Org, 41(1), 9–18. wang y b, xu z r and xia m s (2005) The effectiveness of commercial probiotics in northern white shrimp Penaeus vannamei ponds, Fish Sci, 71(5), 1036–41.

310


wang w n, wang y and wang a l (2006) Effect of supplemental l-ascorbyl-2polyphosphate (APP) in enriched live food on the immune response of Penaeus vannamei exposed to ammonia-N, Aquaculture, 256(1–4), 552–7. wang x h, chi z m, yue l x, li j, li m j and wu l f (2007) A marine killer yeast against the pathogenic yeast strain in crab (Portunus trituberculatus) and an optimization of the toxin production, Microbiol Res, 162(1), 77–85. wang l, yue l x, chi z m and wang x h (2008a) Marine killer yeasts active against a yeast strain pathogenic to crab Portunus trituberculatus, Dis Aquat Org, 80(3), 211–18. wang y b, li j r and lin j (2008b) Probiotics in aquaculture: challenges and outlook, Aquaculture, 281(1–4), 1–4. watanuki h, ota k, tassakka a c m a r, kato t and sakai m (2006) Immunostimulant effects of dietary Spirulina platensis on carp, Cyprinus carpio, Aquaculture, 258(1–4), 157–63. welker t l, lim c, yildirim-aksoy m and klesius p h (2007) Growth, immune function, and disease and stress resistance of juvenile Nile tilapia (Oreochromis niloticus) fed graded levels of bovine lactoferrin, Aquaculture, 262(1), 156–62. weyts f a a, cohen n, flik g and verburg-van kemenade b m l (1999) Interactions between the immune system and the hypothalamo-pituitary-interrenal axis in fish, Fish Shellfish Immunol, 9(1), 1–20. wu f c, ting y y and chen h y (2002) Docosahexaenoic acid is superior to eicosapentaenoic acid as the essential fatty acid for growth of grouper, Epinephelus malabaricus, J Nutr, 132(1), 72–9. wu f c, ting y y and chen h y (2003) Dietary docosahexaenoic acid is more optimal than eicosapentaenoic acid affecting the level of cellular defence responses of the juvenile grouper Epinephelus malabaricus, Fish Shellfish Immunol, 14(3), 223–38. xu b, ji w, xu h and shi j (1992) The immunologic competence of wheat germ agglutinin in Penaeus orientalis, J Ocean Univ Qingdao, 22(4), 29–34. xu b, xu h, chen q and shi j (1994) Growth conditions for Fusarium oxysporum, Trans Oceanol Limnol (Qingdao), 1, 30–36. xu d h, klesius p h and shoemaker c a (2001) Effect of lectins on the invasion of Ichthyophthirius theront to channel catfish tissue, Dis Aquat Org, 45(2), 115–20. xue j p, xu y p, jin l j, liu g, sun y x, li s y and zhang j c (2008) Effects of traditional Chinese medicine on immune responses in abalone, Haliotis discus hannai Ino, Fish Shellfish Immunol, 24(6), 752–8. yada t (2007) Growth hormone and fish immune system, Gen Comp Endocr, 152(2–3), 353–8. yang x and dick t a (1994) Arctic char (Salvelinus alpinus) and rainbow trout (Oncorhynchus mykiss) differ in their growth and lipid metabolism in response to dietary polyunsaturated fatty acids, Can J Fish Aquat Sci, 51(6), 1391–400. yang y, xie s, lei w, zhu x and yang y (2004) Effect of replacement of fish meal by meat and bone meal and poultry by-product meal in diets on the growth and immune response of Macrobrachium nipponense, Fish Shellfish Immunol, 17(2), 105–14. yaqoob p (2004) Fatty acids and the immune system: from basic science to clinical applications, Proc Nutr Soc, 63(1), 89–104. yildirim m, lim c, wan p j and klesius p h (2003) Growth performance and immune response of channel catfish (Ictalurus puctatus) fed diets containing graded levels of gossypol-acetic acid, Aquaculture, 219(1–4), 751–68. yildirim-aksoy m, lim c, wan p and klesius p h (2004a) Effect of natural free gossypol and gossypol-acetic acid on growth performance and resistance of channel catfish (Ictalurus punctatus) to Edwardsiella ictaluri challenge, Aquac Nutr, 10(3), 153–65.


311

yildirim-aksoy m, lim c, dowd m k, wan p, klesius p h and shoemaker c (2004b) In vitro inhibitory effect of gossypol from gossypol-acetic acid, and (+)- and (−)isomers of gossypol on the growth of Edwardsiella ictaluri, J Appl Microbiol, 97(1), 87–92. zhang q, li f, wang b, zhang j, liu y, zhou q and xiang j (2007) The mitochondrial manganese superoxide dismutase gene in Chinese shrimp Fenneropenaeus chinensis: cloning, distribution and expression, Dev Comp Immunol, 31(5), 429–40. zhao g, chung k t, milow k, wang w and stevens s e jr (1997) Antibacterial properties of tannic acid and related compounds against the fish pathogen Cytophaga columnaris, J Aquat Anim Health, 9(4), 309–13. zhou z, ding z and huiyuan l v (2007) Effects of dietary short-chain fructooligosaccharides on intestinal microflora, survival, and growth performance of juvenile white shrimp, Litopenaeus vannamei, J World Aquac Soc, 38(2), 296–301.

11 Fish larvae nutrition and diet: new developments S. Kolkovski, Dept of Fisheries, Australia, J. Lazo, Fish Nutrition Laboratory, Mexico, D. Leclercq, ACUI-T, France, and M. Izquierdo, Grupo de Investigación en Acuicultura, Spain

Abstract: Marine fish larvae fed microdiets have not, at this stage, matched the growth and survival performances demonstrated by larvae fed live feeds such as rotifers and Artemia. This chapter discusses the issues related to the use of microdiets as a sole or partial feed for marine fish larvae. The techniques and methods of manufacturing microdiet particles, chemical and physical properties and the relationship to the ingestion and digestion are described. The chapter also looks at the physiological development and the nutritional requirements of larvae. Advances in feeding regimes such as co-feeding and feeding systems are also reviewed. Key words: marine fish larvae, digestive enzymes, nutrition, feeding systems, microdiets.

11.1 Introduction During the past three decades, enormous efforts have been made to develop microdiets1 to replace live feed, both rotifers and Artemia, as complete or partial replacements for marine fish larvae (Koven et al., 2001; Kolkovski, 2004). While there have been substantial achievements in reducing the reliance on live feeds and weaning the larvae earlier onto microdiets, microdiets still cannot completely replace live feeds for most species. Although weaning the larvae from Artemia onto a microdiet can be achieved at metamorphosis in many species (Foscarini, 1988; Hardy, 1989; Koven et al., 2001; Curnow et al., 2006a,b), the early introduction of pre1

Microdiet is also referred to in the literature as formulated, inert, dry or weaning diet. It usually refers to first prepared (dry) diet fed to larvae. Usually particle sizes range between 150 μm and 800 μm.

316


pared diets as the sole replacement for live food has met with limited success (Adron et al., 1974; Barnabe, 1976; Appelbaum and Van Damme, 1988; Kanazawa et al., 1989; Walford et al., 1991; Fernández-Díaz and Yúfera, 1997; Rosenlund et al., 1997). A clear example of the superiority of live food over commercial microdiets was demonstrated by Curnow et al. (2006a, Fig. 11.1). Barramundi (Lates calcarifer) larvae development was affected by rearing protocols, with co-feeding rotifers and commercial diet allowing complete replacement of Artemia. However, by including Artemia in the protocol with one of the commercial microdiets, survival was significantly improved. Furthermore, feeding protocols with earlier weaning from rotifers resulted in significantly reduced growth and survival (Curnow et al., 2006a). The efficiency of the utilization of feed particles (either live or inert) by marine larvae is affected by many external and internal factors (Kolkovski, 2001, 2004; Koven et al., 2001, Fig. 11.2). Primarily, the searching, identification and ingestion processes are influenced by physical and chemical factors including color, shape, size, movement and olfactory stimuli at a molecular level. Substances secreted by live food organisms that act to stimulate a feeding response belong to a group of chemicals known as ‘feed attractants’, and some have been specifically identified for larvae (Kolkovski et al., 1997b, 2001). Moreover, these physical and chemical factors affect the palate and influence the ingestion process, which is the precursor to the digestion process. Digestion involves secretion of enzymes, peristaltic movements and, after larvae metamorphosis, acid and bile salt secretions. The assimilation and absorption process begins after the food particle is digested and broken down into more simple molecules that can pass across the gut lining. This is further facilitated by the development of brush border and microvilli as well as protein transporters and other transport mechanisms (Zambonino-Infante and Cahu, 2001, 2007). Unsuccessful microdiet development is partially related to the limited knowledge of larval nutrition. Appropriated knowledge of the nutritional requirements of the larvae is necessary in order to design effective microdiets. However, the modulation of the biochemical composition of live preys is very limited, and this restricts research on larval nutrition. The lipidic component of live preys is more variable, easier to control and has a marked effect on larval performance. Hence more attention has been paid to lipids and the essential fatty acid requirements of fish larvae (Izquierdo et al., 2000). More recent, studies have focused on fat-soluble vitamins requirements and also the deleterious effect of their excess or inadequate molecular forms. Indeed, fat-soluble vitamin contents of microalgae and live prey vary greatly with culture conditions, frequently causing ‘hypo’ and ‘hypervitaminosis’. The development of experimental microdiets co-fed with very small quantities of live prey have allowed more precise studies of both fat- and water-soluble nutrients. Most reported water-soluble

Fish larvae nutrition and diet: new developments

317

(a)

(b)

(c)

(d)

(e)

(f)

Fig. 11.1 Barramundi Lates calcarifer growth using different feeding protocols (Curnow et al., 2006). (a) 11 days rotifers, 9 days Artemia co-fed with Proton (INVE); (b) 11 days rotifers, 9 days Artemia co-fed with Micro-Gemma/Gemma (Skretting); (c) 11 days rotifers, Micro-Gemma/Gemma; (d) 7 days rotifers, Micro-Gemma/Gemma; (e) 3 days rotifers, Micro-Gemma/Gemma; (f) Micro Gemma/Gemma.

318


Chemical factors feed attractants FAA, ammonium salts, etc. ‘smell’

Visual factors color shape size movement

Capsule proteins ingredients moisture

Ingestion size taste shape movement

Digestion digestive enzymes peristaltic movements digestive tract development acid secretion, bile salts

Assimilation/absorption brush borders microvilii transporters proteins

Fig. 11.2 Factors affecting food particle utilization.

vitamin requirements are much higher for larvae than for juveniles of the same species, although this may be related not only to the higher metabolic demand in the former, but also to the high ratio surface/volume in larval diets which makes nutrients more prone to oxidation and leaching (Yúfera et al., 2003). Very recently, it has been shown that live prey are also deficient in critical minerals. Modern encapsulation technology is allowing the development of new enrichment products including water-soluble nutrients such as vitamins and minerals, which in turn are improving our knowledge of the requirements of these nutrients for the developing larvae. Studies have also determined the effect of protein and amino acid requirements, frequently involving tube feeding trials (Rønnestad et al., 2000). Fast-growing fish larvae have a high demand for protein and require more elevated dietary contents than juveniles and adults. Requirements for all these nutrients and their utilization by the larvae will depend on a series of morphological and physiological changes which occur with larval development through complete metamorphosis. Moreover, interrelation among certain nutrients has also been shown to affect their optimum dietary levels. Very little attention was given to the feeding process of microdiets (Kolkovski, 2004), including feeding systems, specific design to deal with very small particles such as microdiet particles, dispersion of particles in the water column, feeding strategies (continuous vs. periodic), water hydrodynamics and the particle-larval interaction in the rearing tank. In many commercial hatcheries, manual feeding is still very common. A diet that supplies all the larva’s nutritional requirements will not achieve the best growth if the feeding frequencies, amounts and particle disposal are not optimized.


319

This chapter reviews the aspects related to the utilization of microdiet by fish larvae from the feeding process, ingestion, digestion and nutritional requirements. It also reviews the chemical and physical properties of microdiet particles related to the particle behavior in the water and the interaction particle – larvae. Current production methods and feeding systems and protocols are also discussed.

11.2 Determination of nutritional requirements for larvae Despite the importance of clearly defining the specific nutritional requirements of fish larvae in order to formulate appropriate larval feeds, determination of larval requirements is one of the most complicated aspects of fish nutrition. Fish larval nutritional reserves are very limited at first feeding, and hence their survival dramatically depends on exogenous high-quality feeds that contain all the necessary nutrients to match larval requirements. Moreover, during larval development the fish will undertake several morphological and physiological changes, which in nature are simultaneous with changes in behavior and even habitat and type of prey that are not provided under culture conditions. All these changes affect nutrient availability and feed use by the larvae, in turn affecting their nutritional requirements. The requirement for a particular nutrient can be defined from a physiological point of view as the nutrient intake needed to fulfil a physiological role while the diet specification refers to nutrient content in the diet to supply the physiological requirements. Under the requirement for maintenance is the minimum amount of a nutrient or energy needed to keep the fish alive. For instance, we can consider the energy for maintenance as the energy needed to maintain the basal metabolism, plus the energy for involuntary activity, such as movement for body balance and buoyancy, and muscular activity. In larvae, the requirement for maximal growth or survival is utilized more frequently since both parameters are critical for mass fry production. Here, the relationships among larvae and larval diet and feeding have important effects in the determination of the quantitative needs. For instance, factors such as nutrient leaching or availability, diet production technology, feed stability or type of feeding will markedly affect the requirements. Least cost diet formulation, despite being broadly utilized for fish fry, has scarcely been studied in larval nutrition where feeds are generally expensive and feed production is relatively small. In juveniles, requirements for maximal growth are always higher than the requirements for least cost production. From a practical point of view, requirements in larvae have been also determined as requirement for health or stress resistance since, even though nutrient levels can be high enough in the diet to cover maintenance and growth requirements, they may be insufficient to promote maximum disease and stress resistance in

320


larvae. Moreover, the requirements determined for these nutrients under optimal culture conditions increase when fish are exposed to unfavorable environmental conditions (poor water quality, stress, pathogens). Thus, for example, the definition of the requirement for vitamin E to improve immunological defenses is related to the production conditions applied. Finally, more recently, in larvae the requirements for highest fry quality are being considered in relation to the need of a nutrient to improve pigmentation and reduce bone deformities. Studies on determination of the nutritional requirements of larvae are not only scarce but their results and recommendations are difficult to generalize and apply in practice; this is due to the differences in the methodological approaches used and inexperienced in larval culture. Therefore, in order to further improve our knowledge on larval nutrition in a more effective way, studies aimed to determine the requirements for a given nutrient must fulfill a series of demands: • They should apply a practical point of view. • If optimal culture conditions for the tested species have been established, the requirements should be assayed in such conditions. If not, conditions should be established in relation to a review of what is known of this species in its natural conditions. • As far as possible, experimental conditions similar to those used at commercial scale should be used (feed preparation technique, water quality, photoperiod and larval stocking density, among others). • Due to the large interference between different nutrients, to establish the requirements for a particular nutrient only that nutrient should be varied in the diets, trying to avoid changes in the type of nutrient source. • At least triplicate or quadruplicate tanks of larvae should be used per dietary treatment, as one tank of fish represents a single block observation. • To determine quantitative requirements, it is important to consider different factors related to the species (e.g., larval size and developmental stage, broodstock origin and feeding), related to the culture medium (e.g., temperature, salinity, larval density, type of culture: extensive/ intensive, presence or absence of green water), related to the feeding strategy and feeding regime and related to the feed (e.g., type of inert feed or live preys, feed density, dietary energy content, nutrient availability in the ingredient source and interactions with other dietary nutrients or ingredients). • Complete feed ingredient descriptions should be provided, including international feed number (IFN), chemical composition and particle size, when reporting dietary formulations and the results of nutritional feeding trials. If a commercially prepared diet is used, the trade name and manufacturer should be indicated.


321

• A standard diet or live prey protocol should be used as a control in addition to any local diet also designed as a control. In most cases the use of different control diets or live prey protocols complicates comparison of results among different authors. • A minimum of six dietary nutrient levels or treatments is recommended for nutrient requirement studies. • Larval body composition should be carried out at the beginning and at the end of the experiment, particularly for the nutrient tested. • An appropriate statistical analysis is always necessary. The most direct method to evaluate nutrient requirements for larvae is to feed them diets or live prey varying only in their content of a particular nutrient. For this purpose we must feed the larvae with enriched live prey or directly on microdiets containing different levels of the nutrient to be tested. However, this is not easy to achieve when live prey are used. Although it is possible to control the content of some nutrients such as fatty acids, the precise amount of certain nutrients such as total proteins, individual amino acids, vitamins and minerals is difficult to manipulate in live prey, whose own metabolism modifies the nutrients provided through the enrichments. In this sense, microdiets are a preferred method to determine nutritional requirements of larvae. Once several levels of the nutrient are provided through the diet, their effects on various parameters are studied: (i) growth rate, which is easily affected by some nutrients but not by others; (ii) survival rate, which is a very sensitive parameter to certain nutrients; (iii) resistance to stress (while resistance to stress is difficult to determine individually due to the small size of larvae, molecular markers of stress have recently been developed and should allow a more precise determination of the effects of certain nutrients); (iv) biochemical composition of the fish larvae. However, in the development of new species for aquaculture it is not always possible to conduct a dose–effect trial, and hence information about nutritional requirements of the larvae has been obtained by other methods such as: • Study of the biochemical composition of the eggs. Since marine fish eggs should contain all the nutrients that are essential for the embryo and the larvae development up to the stage of yolk-sac absorption, their biochemical composition should give us some information about which nutrients are required at this stage of development (Izquierdo et al., 1989; González et al., 1995). • Study of the evolution of a nutrient along the embryo and larval development. The depletion/deposition of a given nutrient during embryo and larval development, its utilization as energy yield or its incorporation into larval tissues can provide information about the relative importance of the nutrient for the growing larvae (Rodríguez et al., 1994a–c, 1998).

322


• Study of enzyme activity and gene expression of molecules related with the metabolism of a particular nutrient or the physiological mechanisms in which this nutrient is implied (Izquierdo et al., 2000). • Behavior studies, related to the fast development of the central neural system and sensorial organs which occur in the larvae, can provide information about the importance of nutrients implied in this development, such as essential fatty acids, vitamin E, and amino acids (Benítez et al., 2007) . • Tube feeding combined with radio labeling studies, which provide accurate information about digestible and energetic utilization and deposition of dietary nutrients (Rønnestad et al., 2001). Thus, many authors have applied some of these methods to research on larval nutrition and have determined the requirements of a limited number of nutrients for certain species along larval development which will be reviewed in Section 11.3.

11.3 Nutritional requirements of fish larvae 11.3.1 Requirements for essential fatty acids (EFA) Essential fatty acids, particularly highly unsaturated fatty acids (HUFA) with 20 or more carbon atoms of the linolenic family (n−3 HUFA) including docosahexaenoic acid (DHA, 22:6n−3) and eicosapentaenoic acid (EPA, 20:5n−3), have long been recognized as an important nutritional factor affecting larval rearing success (Watanabe et al., 1983). Indeed both DHA and EPA, together with arachidonic acid (ARA, 20:4n−6) have a variety of very important functions in fish species, particularly in larvae. Despite the fact that freshwater fish seem to have sufficient Δ5 and Δ6 desaturases and elongases activities to produce ARA, EPA and DHA if their precursors linoleic (18:2n−6) and linolenic (18:3n−3) acids are present in the diet, such enzymatic activity is very restricted in marine fish larvae and, as a consequence DHA, EPA and ARA have to be included in the diet and are considered essential. Thus, although it was thought that Δ5 and Δ6 activity was lacking in marine fish, a Δ6 desaturase-like gene was finally isolated in larval gilthead sebaream (Sparus aurata) (Seiliez et al., 2003). More recently, it has been shown that the expression of this gene is affected by the larval diet (Izquierdo et al., 2008). For instance, substitution of fish oil by vegetable oils in enrichment emulsions for rotifers produced a six-fold higher relative expression of the Δ6 desaturase-like gene in gilthead seabream larvae, denoting the nutritional regulation of desaturase activity through its gene expression. Moreover, products of Δ6–Δ5 desaturases such as 18:2n−9, 18:3n−6, 20:3n−6 and 20:4n−6 significantly increased in tissues of larvae fed rotifers enriched with vegetable oils (Izquierdo et al., 2008). In fact, it is possible that the Δ6 desaturase present in seabream


323

also has Δ5 activity as has been shown in zebrafish (Danio rierio) (Hastings et al., 2001). In practice, these findings imply a higher possibility of substitution of fish oils in first feeding diets and prey for marine fish larvae, if precursor fatty acids such as 18:3n−3 and 18:2n−6 are present. However, if dietary levels of these precursor fatty acids are too high it may significantly reduce the expression of desaturase gene (Izquierdo et al., 2008). Interestingly, expression of desaturases can be also affected by salinity. For instance, larvae of the eurihaline species Galaxias maculatus have been found to be higher in EPA, DHA and ARA acids when they were obtained from marine environments in comparison with those from freshwater (Dantagnan et al., 2005, 2007), denoting the important role of some of these fatty acids in osmotic regulation. Moreover, before first feeding, synthesis of those EFA was activated in larvae from the freshwater environment but not in those obtained in the estuary, suggesting the influence of environment salinity on activation of elongation and desaturation enzymes. Inadequate content of those EFA in live prey or microdiets gives rise to several biological symptoms in larvae such as reduced feeding, growth and swimming activities, and increasing mortality, fatty livers, hydrops, deficient swim bladder inflation, abnormal pigmentation and disaggregation of gill epithelia (Izquierdo, 1996, 2005). EFA requirement for gilthead seabream was very close to 1.5 % n−3 HUFA in dry matter when larvae were fed either live prey (Rodríguez et al., 1998) or microdiets (Salhi et al., 1999), regardless of dietary lipid level (Salhi et al., 1994). However, as in the other life stages, provided other nutrients such as antioxidants are also balanced, elevation of dietary n−3 HUFA up to 8 %, keeping balanced ratios among the different EFA further improves larval growth and survival (Liu et al., 2002). High n−3 HUFA requirements have been also estimated for red porgy (Pagrus pagrus) (3.39 %, Hernández-Cruz et al., 1999) and Dentex dentex (Mourente et al., 1999) despite the fact that in the latter the high EPA content in Artemia may have caused an over-estimation of the requirements as observed in gilthead seabream (Rodríguez et al., 1997). In contrast, carp larvae seem to require as little as 0.05 % n−3 fatty acids from cod liver oil (Radunz-Neto et al., 1994) to cover the essential fatty acid requirements during larval development.

11.3.2 Requirements for docosahexaenoic acid (DHA) The particular structure of DHA, with an extremely long chain and the highest number of double bonds, provides this fatty acid with special characteristics that allow it to carry out many important functions in fish metabolism. Its incorporation into cell membranes regulates membrane integrity and function, and it is an important component of phosphoglycerides, particularly phosphatidyl ethanolamine and phosphatidyl choline. It may be a substrate for some lypoxigenases, and several studies have shown that it has a greater potential as an EFA for marine fish larvae than EPA

324


(Watanabe et al., 1989), its requirement being more limiting for growth and survival than those for other n−s HUFA (Izquierdo, 1996). Moreover, as for other fatty acids, DHA has been found to play an important role in gene expression regulation, affecting a variety of physiological functions in fish. It is specifically retained in starved or low-EFA fed larvae, possibly due to lower cell oxidation rates than other fatty acids (Madsen et al., 1999). DHA is predominantly important for neural tissue and sensorial organs, being accumulated in rod and cone photoreceptors in herring (Bell and Dick, 1993) and in the central nervous system and eyes in gilthead seabream (Benítez et al., 2004). Moreover, DHA has been found to increase eye diameter and density of photoreceptors in gilthead seabream larvae (Izquierdo et al., 2000) and, in agreement, visual capacity was found to be reduced in yellowtail (Seriola quinqueradiata) fed DHA-deficient diets (Masuda et al., 1999). Feeding gilthead seabream larvae with DHA-deficient rotifers has been found to delay for about 10 days the appearance of reaction after visual stimulus, in agreement with the minor DHA content in eyes and brains of these larvae, and suggesting a delay in the functional development of brain and vision (Benítez et al., 2007). DHA is necessary for growth, survival, disease prevention and flat fish pigmentation and metamorphosis (Izquierdo, 2005; Hamre and Harboe, 2008). DHA also appears to be important for bone development, and it has been found to reduce the incidence of opercular deformities in milkfish (Gapasin and Duray, 2001) and of cranial deformities, lordosis and vertebrae fusion in red porgy (Roo et al., 2009). In general, DHA requirements along larval development vary with reports of 0.5 % for Acanthochromys poliacanthus (Southgate and Kavanagh, 1999), 2.5 % for Atlantic halibut (Hippoglossus hippoglossus) (Hamre and Harboe, 2008) and 0.8 % for gilthead seabream larvae (Rodríguez et al., 1998; Salhi et al., 1999, Fig. 11.3).

24

% Survival

22 20 R2 = 0.7322

18 16 14 12 0

1

2

3 4 % DHA in microdiet

5

6

7

Fig. 11.3 Effect of dietary docosahexaenoic acid (DHA) on survival of gilthead seabream larvae (Izquierdo unpublished, 2007).


325

In seabream larvae, high levels (5 % in dry basis) of dietary DHA in microdiets for gilthead seabream did not cause any excess problem, but further promoted growth and larval survival (Liu et al., 2002). However, under certain conditions a high level of dietary DHA may exert negative effects in the larvae. For instance, a higher incidence of cephalic and vertebral column deformities has been reported in European sea bass fed high levels of DHA and EPA adversely affecting fish growth and survival (Cahu et al., 2003). However, this negative effect of high dietary DHA content could be related to an insufficient presence of dietary antioxidants such as vitamin E. Thus, in the same species, increase in dietary DHA caused degeneration and breakage of the muscular fibre as well as an infiltration of mononuclear cells in the myosepta of sea bass larvae (Betancor et al., 2009), which could be related to the proliferation of free radicals derived from DHA, since the elevation of dietary vitamin E markedly reduced the incidence of these pathological signs.

11.3.3 Requirements for eicosapentaenoic acid (EPA) EPA also plays several general and particular roles in fish metabolism. It is a main component of polar lipids in larvae and it regulates membrane integrity and function, its incorporation into phosphoacylglycerides enhances fluidity of cell membranes to a degree higher than ARA (Hagve et al., 1998) but lower than DHA (Hashimoto et al., 1999). Moderate dietary levels of this fatty acid enhance DHA incorporation into larval phospholipids (PL) (Izquierdo et al., 2000, 2001), causing a sparing effect on such an important fatty acid. EPA is an important precursor of prostaglandins (PG) in marine fish and has a predominant role in immune regulation in certain marine fish species (Ganga et al., 2005). Indeed, in gilthead seabream, PGE3 derived from EPA is the major prostaglandin found in fish plasma (Ganga et al., 2005), and it is strongly correlated with plasma polar lipid concentrations of EPA. Nevertheless, PG production markedly differs among tissues of the same species. Moreover, EPA is also a main substrate for some lypoxigenases, being the main precursor for leukotriene synthesis in some species. Its competition with ARA for these two types of enzymes enables it to be an important regulator of eicosanoid synthesis. Dietary EPA is important for larval growth and survival (Watanabe et al., 1989). For instance, best growth and survival have been obtained in larval gilthead seabream with EPA dietary levels of 0.7–0.8 % on a dry weight basis (Rodríguez et al., 1998; Salhi et al., 1999; Fig. 11.4). However, increasing dietary EPA up to 1.8 % reduced growth when ARA levels are as high as 1.8 % and DHA/EPA about 1.3, denoting how the EFA value of EPA is dependent on the dietary levels of DHA and ARA as discussed later (Izquierdo et al., 2000). EPA also plays an important role in stress regulation in fish larvae. For instance, in gilthead seabream larvae, an increase of EPA up to 2.9 % on a dry weight basis significantly improved

326

New technologies in aquaculture 30 28 26 % Survival

24 R2 = 0.8362

22 20 18 16 14 12 10 0

1

2 3 % EPA in microdiet

4

5

Fig. 11.4 Effect of dietary eicosapentaenoic acid (EPA) on survival of gilthead seabream larvae (Izquierdo unpublished, 2007).

resistance to both handling and temperature shock stresses (Liu et al., 2002). Indeed, EPA has been found to regulate the production of cortisol, the essential hormone in fish stress regulation, in ACTH-stimulated interrenal cells, together with ARA (Ganga et al., 2006). In general, EPA requirements described in the literature range from 0.7 % for gilthead seabream (Rodríguez et al., 1998; Salhi et al., 1999) to 1.3 % for Centropomus parallelus and 1.6 % for Dentex dentex (Mourente et al., 1999).

11.3.4 Requirements for arachidonic acid (ARA) ARA is a main component of a minor but very important polar lipid class, phosphatidyl inositol (PI). In vitro, ARA has been described as a preferred substrate for most cycloxigenases, being the main precursor for PG synthesis, whereas in vivo, at least in marine fish, EPA seems to be the main substrate, although this could be related to its high presence in the diet. ARA also constitutes a good substrate for several lypoxigenases, its derivative hydroxy-fatty acids having important physiological functions in marine fish. Its content in the PI of cell membranes regulates eicosanoid synthesis. In gilthead seabream larvae, an increase of ARA up to 1 % enhances survival and growth when DHA and EPA dietary contents are 1.3 and 0.7, respectively (Izquierdo, 1996; Bessonart et al., 1999; Fig. 11.6). Increase in ARA content in the rotifers also prevents post-stress mortality (Koven et al., 2001). Indeed, ARA has been found to regulate not only cortisol production in fish (Ganga et al., 2006) but also expression of stress-related genes such as HSP70 gene in gilthead seabream larvae (Negrín et al., 2009) (Fig. 11.5). ARA also seems to play important role in production of turbot juveniles (Castell et al., 1994) and in flatfish pigmentation (Estévez et al.,


Cycloxigenase products Tissue fatty acids Lipoxygenase products

327

cAMPC

Stress-related genes expression

Fig. 11.5 Some mechanisms implicated in stress regulation by fatty acids (Izquierdo unpublished, 2007). 7.2 7

TL

6.8 6.6 6.4 6.2 6 5.8 0

0.05

0.1 ARA/EPA

0.15

0.2

Fig. 11.6 Effect of ARA/EPA on gilthead seabream larval growth (Izquierdo unpublished, 2007).

1997). Excess levels of ARA in live preys have been found to correlate with impaired pigmentation in turbot (Estévez et al., 1999), Japanese flounder (Estévez et al., 2001) and sole (Solea solea) (Lund et al., 2008). ARA requirements for fish larvae range from 0.6 % for gilthead seabream (Besonart et al., 1999) to 2.5 % for a freshwater fish larvae, the guppie (Poecilia reticulate) (Khozin-Goldberg et al., 2006).

11.3.5 Importance of balanced EFA ratios EFA requirements estimated in the literature are high, with EPA dietary contents being two or three times higher than those of DHA (Rodríguez et al., 1994, 1997). This is due to the very high incorporation of EPA into the larval polar lipids and the displacement of DHA from certain polar lipids (Izquierdo et al., 2000). Similarly, unbalanced EPA/ARA ratios seem

328

New technologies in aquaculture 7.5

TL

7

6.5

6

5.5 0

20

40 60 80 100 120 140 160 180 200 (EPA + DHA + ARA)*(DHA/EPA)/ARA

Fig. 11.7 Gilthead seabream larval growth in relation to dietary DHA + EPA + ARA)/DHA/EPA/ARA (Izquierdo unpublished, 2007).

to be detrimental for flatfish (McEvoy et al., 1998). Evidence of competition among two or more of these EFAs has been suggested for digestive enzymes, fatty acid binding proteins, phosphoacylglicerides synthetases, lypoxigenases and cyclooxigenases and, probably, in beta-oxidation as occurs in rats (Izquierdo, 2005). Not only absolute dietary values for each of these EFAs but also optimum dietary ratios among them must be defined since both will affect at least their incorporation into the tissue lipids and hence membrane fluidity and function, the energy values obtained from their betaoxidation and the production of metabolically active compounds. Thus, optimum DHA/EPA ratios seem to be around 1.5 for sparids (Rodríguez et al., 1997) and around 2 for flatfish (Reitan et al., 1994); whereas optimum EPA/ARA ratios seem to be around 5 for flatfish (Bell et al., 2003) and about 8 for sparids. Considering both the sum of the three EFAs and the ratios among them, a plot of the dietary value of the ratio (DHA + EPA + ARA)*DHA/EPA/ARA against growth in some recent studies (Fig. 11.7), yields a significant correlation. Application of the same equation to dietary fatty acids in other gilthead seabream studies (Rodríguez et al., 1994, 1998; Fernández et al., 1995; Salhi et al., 1999; Koven et al., 2001; Liu et al., 2002 and others), demonstrated that for ARA values higher than 0.5 % when the value of the equation (DHA + EPA + ARA)*DHA/EPA/ARA became closer to 50 growth performance was better.

11.3.6 Phospholipids (PL) Feeding larvae low dietary PL reduces growth and lipid transport from larval enterocytes to hepatocytes (Kanazawa, 1993; Izquierdo et al., 2000). For instance, feeding larval gilthead seabream diets without lecithin supplementation produces accumulation of lipidic vacuoles in the basal zone of the enterocyte and esteatosis in the hepatic tissue, both of them being


329

markedly reduced by a 2 % addition of soybean lecithin, denoting an enhancement in the lipid transport activity in gut and liver (Liu et al., 2002). This reduction in lipid transport could be related to a limited capacity for ‘de novo’ synthesis of phospholipids in the larvae. Reacilation of phospholipids in the enterocyte is known to occur through the glycerol-3-phosphate pathway in both the rough and the smooth endoplasmic reticulum (Izquierdo et al., 2000). However, since marine fish larvae fed microdiets show enterocytes with a poor development of the endoplasmic reticulum and Golgi system, reacilation capacity may be limited in these larvae. Indeed, inappropriate dietary lipids have been found to markedly affect re-esterification pathways in seabream gut (Caballero et al., 2006a), modifying the type of lipoprotein formed (Caballero et al., 2006b) and hence lipid transport. In contrast, when gilthead seabream larvae were fed triglycerides (TG) of marine origin, rich in n−3 HUFA, an accumulation of lipid vacuoles in the basal zone of the enterocyte and hepatic steatosis was observed. This indicated good absorption of dietary TG but also a reduced lipid transport to peripheral tissues. Conversely, feeding with marine PL markedly reduced lipid accumulation in both type of tissues (Salhi et al., 1999). These results agree well with the higher incorporation into larval polar lipids of fatty acids from dietary polar lipids than from dietary triglycerides (Izquierdo et al., 2001). In studies with labeled fatty acids, dietary n−3 HUFA PL significantly improved the incorporation of free EPA, but not of free oleic acid, into larval polar lipids in comparison to n−3 HUFA-rich TG (Izquierdo et al., 2001). This specific tissue incorporation of EPA when dietary polar lipids are rich in n−3 HUFA could be related to the enhancement of lipid transport, mobilization and deposition in the peripheral tissues by n−3 HUFA rich dietary phospholipids. As a consequence, growth of larval gilthead seabream was improved when they were fed microdiets containing marine PL instead of marine TG despite the slightly lower dietary n−3 HUFA levels of the former (1.5 % versus 1.8 %, respectively) (Salhi et al., 1999). Incorporation of dietary free fatty acids seems to be even lower than that of TG. Thus, labeled oleic acid was better incorporated into both polar or neutral lipids of seabream larvae when it was provided in the diet esterified in a triglyceride than as a free fatty acid, suggesting again a limited capacity of reacilation or transport for dietary long-chain free fatty acids or its preferential utilization as an energy source in the enterocyte (Izquierdo et al., 2001). Enzymatic, histological and biochemical evidence suggests that marine fish larvae are able to digest and absorb n−3 HUFA-rich TG more efficiently than free fatty acids, but feeding with PL, particularly if they are rich in n−3 HUFA, will enhance PL digestion and especially lipid transport, allowing a better n−3 HUFA incorporation into larval membrane lipids and promoting fish growth. This confirms former studies which suggest that, in

330


addition to the dietary level of essential fatty acids, the molecular form in which they are present in the diet is also important for good growth and survival of marine fish larvae (Izquierdo, 1996; Izquierdo et al., 1989a,b). Accumulation of lipidic vacuoles in the basal zone of the enterocyte caused by feeding diets without lecithin supplementation in gilthead seabream disappeared when 0.1 % PC was added regardless of its (squid or soybean) origin (Izquierdo et al., 2000). However, squid PC was more efficient in reducing hepatic steatosis than soybean PC, suggesting a combined effect of dietary PC and n−3 HUFA to further enhance hepatic lipid utilization. Indeed both types of molecules have been found to promote lipoprotein synthesis. Finally, increased PL concentration, particularly PI, reduced skeletal deformities in seabass (Cahu et al., 2003), and has been suggested to be related to an up-regulation in bone morphogenic genes.

11.3.7 Vitamins and minerals The content of water-soluble vitamins in most hatchery microalgae and live prey seems to match the requirements of water-soluble vitamins for fish larvae, except for the low levels of pyridoxine in enriched rotifers and thiamin in enriched Artemia (González, 1997). Both vitamins play essential roles in fish metabolism. Pyridoxine is necessary in several levels of amino acid metabolism, being also very important for immune regulation, whereas thiamin acts as a coenzyme cocarboxilase, being essential for the oxidative decarboxylation of alfa-keto acids and hence for obtaining energy from amino acids, sugars and lipids. Vitamin C also plays a very important role during larval development, particularly preventing opercular deformities as has been seen in milkfish. In microdiets, it is very important to determine optimum vitamin contents to match the larval requirements. In addition, most water-soluble vitamin requirements described for larvae are higher than for juveniles of the same species, and this could be related not only to the higher metabolic demand in the former, but also to the high ratio surface/volume in larval diets making the diets more prone to oxidation and leaching. Thus, whereas in juveniles vitamin premix accounts for about 2–3 % of the diet, in larval microdiets they may reach up to 6–8 % of the diet. In contrast, fat-soluble vitamin contents of microalgae and live prey vary greatly among sample batches and with culture conditions, frequently leading to hypo or hypervitaminosis. For instance, vitamin E decreases in seabream from fertilization to the onset of exogenous feeding and continues dropping down during enriched rotifer feeding until Artemia is introduced in the culture system. Increasing vitamin E content in microdiets for gilthead seabream or seabass from 300 up to 1500 or 3000 mg/kg markedly improves growth and stress resistance (Betancor et al., 2009). However, vitamin E efficacy is closely related to dietary vitamin C. For instance, the progressive elevation of dietary α-tocopherol acetate levels up to


331

1500 mg/kg in larval seabream diets containing ascorbic acid in its free form significantly reduced larval survival, whereas the same increase in α-tocopherol when vitamin C was supplemented as ascorbic acid polyphosphate caused a significant improvement in larval growth without affecting survival, suggesting a pro-oxidative effect of α-tocopherol over vitamin C in the former. More attention has been recently paid to vitamin A requirements in fish larvae. In gilthead seabream total retinol contents in the larvae increase during rotifer feeding, whereas they are slightly reduced after feeding a non-retinol containing Artemia. Indeed, the carotenoid content in Artemia seems to be enough to cover halibut vitamin A requirements (Moren et al., 2004). Despite the fact that adequate levels of vitamin A are required for normal pigmentation of flatfish, enrichment of Artemia with all-trans retinoic acid increases retinol palmitate inducing a higher incidence of bone deformities and hyperpigmentation of the blind side in Japanese flounder larvae. Vitamin D has been also shown to be important for normal development of fish larvae but in much smaller quantities, since its accumulation can easily cause hypervitaminosis inducing bone deformities and malpigmentation in Japanese flounder. Minerals have been much less studied in fish larvae, despite recent studies showing the importance of P, and particularly I and Se for cod larval growth (Hamre, pers comm) and Zn and Mn for bone development (Sato, pers comm), encouraging its study in other species.

11.3.8 Protein and amino acid requirements Fast-growing fish larvae have a high demand for protein and require more than juveniles and adults, so microdiets designed for larvae contain between 50 and 70 % protein. From the 20 most common amino acids (AA), 10 have been found to be essential (EAA) or indispensable for all studied fish and are required for optimum growth: leucine, isoleucine, valine, threonine, phenylalanine, methionine, tryptophan, arginine, histidine and lysine. Another two amino acids, tyrosine and cystine, are only nonessential if phenylaline and methionine, respectively, are present in the diet. At least all those amino acids should also be supplied to marine fish larvae. The importance of other minor amino acids such as taurine, an important enhancer of growth and survival in several sparids larvae, should not be neglected. Methods to determine quantitative requirements of each of those AA in fish larvae include feeding microdiets with graded levels of one amino acid at a time in a test diet containing either all crystalline amino acids, a mixture of casein, gelatin and crystalline amino acids, or a semi-purified diet using an imbalanced protein (zein, corn gluten) formulated so that the amino acid profile is identical to the test protein except for the amino acid being tested. As studied by Kanazawa

332


and co-workers for fish larvae of several species, diets are designed to contain protein levels at or slightly below the optimum protein requirement for that species to assure a maximum use of the limiting amino acid. Hence, quantitative requirements of several AA have been determined for red sea bream and Japanese flounder larvae (López-Alvarado, 1995). Relationships among AA, such as competition or common synthesis pathways, also need to be considered. AA leaching in microdiets that stay in the water for a relatively long time causes difficulties in accurately determining physiological requirements. Hence other methods previously utilized in juveniles have been applied to fish larvae. For instance, from the early 1980s it has been shown that there is no difference between the relative proportions of individual essential AA required in the diet and the relative proportions of the same 10 AA present in fish carcass. Since the essential AA profile of fish muscle protein does not differ greatly between individual fish species, the pattern of requirement for individual species should also be similar. Thus, analysis of the larval AA composition has frequently been used to predict its essential AA requirements (Watanabe and Kiron, 1994; Conceiçao et al., 1997). Comparison of live prey and fish larvae AA profiles would allow us to predict if such feed would cover the larval AA requirements. For instance, when turbot larvae and live food EAA profiles are compared, the profile of the latter seems to be deficient in some EAA such as leucine, arginine, threonine or methionine (Conceiçao et al., 1997), depending on the larval age and type of prey, whereas rotifers seem to be deficient in threonine and leucine for larval seabream. Other methods utilized in juveniles consider that when an EAA is deficient in a diet the major proportion will be used for protein synthesis and only a small fraction will be oxidized to carbon dioxide to obtain energy whereas, if that AA is supplied in the diet in excess, plasma levels will increase and it will be more available for oxidation. A force feeding method including labeled EAA has been recently developed for fish larvae (Conceiçao et al., 2003), denoting a high retention of labeled doses of EAA in the body (>60 %), and low catabolism as measured by liberated 14 CO2 (40 %).

11.4 Food identification and ingestion The first interaction between food particle (live or inert) and larvae occurs in the water column. Following this interaction, the particle can be accepted or rejected. Therefore, it is essential that this interaction (i.e the feeding process) is maximized and optimized. There are many factors affecting this process including particle/organisms concentration, chemical and physical cues and many others.


333

d

c b a

Fig. 11.8 The feeding process (modified from Mackie and Mitchell, 1985). (a) general and non specific reaction, initiation of search movement – chemical and electrical stimuli; (b) identification of the food particle location – chemical stimuli; (c) close identification of the food particle – chemical and visual stimuli; (d) tasting and/or actual feeding – chemical stimuli (taste buds).

The feeding process includes several steps in the larval process of finding and ingesting food particles (Fig. 11.8, modified from Mackie and Mitchell, 1985): 1. general and non-specific reaction, initiation of search movements involving chemical and electrical stimuli; 2. identification of the food particle location involving chemical stimuli; 3. close identification of the food particle, involving chemical and visual stimuli; 4. tasting and/or actual feeding requiring chemical stimuli (taste buds). Various substances, such as free amino acids, nucleotides, nucleosides and ammonium bases, are released from organisms that are prey for fish larvae and are potent inducers of feeding behavior in marine (Knutsen, 1992; Doving and Knutsen, 1993) and freshwater fish larvae. Generally planktonic organisms concentrate in ‘patches’ that attract the fish larvae. Kolkovski et al. (1997a, b) identified some of the active substances in Artemia rearing water and added these substances to the larvae-rearing tank. The authors then analyzed the effect that individual substances had on ingestion rates by eliminating one substance at a time and observing the differences in feeding activity. When microdiet ingestion rates dropped, the missing substance was regarded as being an active feed attractant. The

334


authors found four amino acids which induced increased feeding activity; glycine, alanine, arginine and ammonium salt – betaine. Furthermore, a synergistic relationship was reported between the amino acids and betaine, which when combined produced a stronger effect than the sum of the individuals. These and other amino acids as well as other substances were also found to be active with other marine species (Table 11.1).

Table 11.1 Amino acids as feed attractant in marine organisms Rainbow trout (Salmo gairdineri) Atlantic salmon (Salmo salar) Sea bass (Dicentrarchus labrax) Pig fish (Orthopristis chrysopterus) Red sea bream (Chrysophrys major) Gilthead sea bream (Sparus aurata) Turbot (Scophthalmus maximus) Dover sole (Solea solea) Puffer (Fugu pardalis) Japanese eel (Anguilla japonica) Cod (Gadus morhua) Herring (Clupea harengus) Glass eel (Anguilla anguilla) Lobster (Homarus americanus) Western Atlantic ghost crab (Ocypode quadrata) Freshwater prawn (Macrobrachium rosenbergii) Abalone (Haliotis discus) Source: Kolkovski, 2001.

Mixture of L-amino acids Glycine Mixture of L-amino acids Glycine, betaine Glycine, betaine Glycine, alanine, lysine Valine, glutamic acid and arginine Glycine, betaine, alanine, arginine Inosine and IMP Glycine, betaine Glycine, inosine, betaine Glycine, betaine Glycine, arginine, alanine, proline Arginine Glycine, proline

Adron and Mackie, 1978 Hughes, 1990 Mackie and Mitchell, 1982 Carr et al., 1977, 1978 Goh and Tamura, 1980 Fuke et al., 1981 Ina and Matsui, 1980 Kolkovski et al., 1997 Mackie and Adron, 1978 Mackie et al., 1980 Metaillet et al., 1983 Ohsugi et al., 1978 Yoshii et al., 1979 Doving et al., 1994 Damsey, 1984

Glycine, arginine, alanine, proline Alanine, glycine, histidine, proline Glutamate, betaine, taurine, ammonium chloride Butanoic acid, carboxylic acid, trehalose, carbohydrates, homarine, asparagine Taurine, glycine, trimethylamine, betaine

Mackie and Mitchell, 1983 Kamstra and Heinsbroek, 1991 Corotto et al., 1992

Mixture of L-amino acid and lecithin

Harada et al., 1987

Trott and Robertson, 1984 Harpaz et al., 1987


335

A practical way to increase the ingestion rates of microdiets would be to incorporate these substances as extracts or hydrolysates into the diet. Kolkovski et al. (2000) tested the effect of krill hydrolysate as a feed attractant on yellow perch (Perca flavescens) and lake whitefish (Coregonus clupeaformis), by coating commercial starter diet with 5 % krill hydrolysate. Fish fed the coated diet experienced similar growth to fish fed live Artemia and significantly higher growth than fish fed the control diet (Fig. 11.9) Furthermore, a recent experiment was conducted to determine whether the method of hydrolysate incorporation in microdiets affected growth of yellowtail kingfish (Seriola lalandi) larvae. Krill hydrolysate was compared coated or incorporated into the diet (Kolkovski, 2006a). Growth rates of larvae fed coated-diet were significantly higher than larvae fed krill hydrolysate incorporated diet. Both diets (incorporated and coated) preformed significantly better than the control diet with no hydrolysate (Fig. 11.10). Other hydrolystaes such as squid hydrolysate have also been found to be effective in increasing both ingestion and growth (Kolkovski et al., 1997a, 2009; Kolkovski and Tandler, 2000; Lian and Lee, 2003; Lian et al., 2008). It is assumed that inclusion of hydrolysates as partial protein replacement benefits the larvae in two ways: (i) higher ingestion rates (due to the hydrolysates feed-attractability properties) and (ii) higher assimilation due to the influx of free amino acid and short peptides. Currently, several commercial microdiets include different hydrolysates such as krill, fish and squid hydrolysates in their formulation. Due to the fact that hydrolysates are, in fact, a mixture of amino acids and peptides (as well as many other nutrients), it has been suggested that a mixture of known amino acids could be a better

Intake (μg diet larvae–1 60 min)

60 a 50 40

Smell

Smell and taste

30

a

a

20

a b

10 0

a

b

Starter

Starter + 5 % krill

Liquid krill

*Artemia

*Artemia dry weight calculated as 2 mg/nauplii

Fig. 11.9 Effect of krill hydrolysate on ingestion rates of yellow perch and whitefish (Kolkovski et al., 2000). Grey bars – yellow perch (average wet weight – 424 mg), white bars – whitefish (average wet weight – 13.52 mg).

336

New technologies in aquaculture 8000 7000 Wet weight (g)

6000 5000 4000 3000 2000 1000 0 Control

Krill incorporated

Krill coated

Treatments

Fig. 11.10 Effect of krill hydrolysate inclusion method on growth of yellowtail kingfish: incorporated krill – krill hydrolysate was mixed at 3 % (DW) with other ingredients; krill coated – krill hydrolystae was coated with MD particles.

solution (Kolkovski, 2001). Table 11.2 presents the pros and cons of each alternative.

11.4.1 Presentation of feed attractants to fish larvae There are several ways to introduce the attractants to the larvae. These include the following: • The addition of attractants directly into the water uses large amounts of these substances, but maintains a constant concentration. • Coating the diet particle results in unknown leaching rates, but can contribute to higher palatability and more specifically identifies particles as food. • Incorporation into the diet as part of the protein source also results in an unknown leaching rate (depending on the microdiet type); however, only a low amount of attractants is needed, part of the protein source in the diet is replaced and digestion and assimilation are improved.

11.5

Ontogeny of digestive capacity in marine fish larvae

The development of adequate compound microdiets to replace live foods in the culture of marine fish larvae requires a thorough understanding of the digestion processes occurring during ontogeny (Cahu and Zambonino Infante, 1997; Lazo et al., 2000a). This knowledge is required for overcoming the necessary use of live feeds in the rearing of marine fish larvae. The


337

Table 11.2 The use of marine organisms hydrolysates and free amino acids as feed attractants

Content

Nutritional value Formulation Activity

Concentrations

Synergism

Hydrolysate

Free amino acids

Digested protein (usually from marine organisms) components such as free amino acids and short peptides Can be used as partial protein replacement

Pure amino acids

Unknown and uncontrolled values of AA and peptides as well as other nutrients Krill, squid, fish and several crustaceans and molluscs hydrolysates found to be strong attractants. As a ‘general rule’, protein fraction weight between 1000 and 10 000 Dalton is found to have a positive effect on feeding Concentrations of extracts and/or hydrolysates made from aquatic animals are harder to quantify than amino acids. However, concentrations that are found to have a positive effect on feeding range from 10−2 to 10−10 g/l (when added to the water). In most cases, when incorporated into the diet, the concentration of hydrolysates and extracts released into the water was not determined No data available

Can be adjusted and balanced to the AA requirements Known amounts of AA Only the L-isomers have been found to be active as feed attractants

Increasing the concentration of amino acids (when added to the water) was found to have positive effects on feeding, range from 10−8–10−2 M

Synergistic effects were associated with many combinations of amino acids and other substances such as ammonium salts

AA = amino acids. Source: Kolkovski, 2006a.

lack of success in completely replacing live foods with compound microdiets since the onset of first feeding has been historically attributed to the presence of an undeveloped digestive system at the time of hatching and consequent low digestive capacity (Lauf and Hoffer, 1984; Munilla-Moran et al., 1990; Holt, 1993). Although most research to date indicates marine fish larvae have a very defined and specific digestive physiology that merits the development of specific diets and weaning protocols, studies also indicate that many marine fish larvae possess a differentiated and effective

338


digestive system early in development (Sarasquete et al., 1995; Ribeiro et al., 1999; Lazo et al., 2000a; Zambonino-Infante and Cahu, 2001). The conventional approach used for assessing digestive capacity in marine fish larvae has typically involved characterizing the morphological development of the digestive system and associated organs while also quantifying digestive enzyme activities using biochemical, histochemical and molecular techniques (for an excellent review see Zambonino-Infante and Cahu, 2001). The morphological and functional development of the digestive system of fish larvae was first reviewed by Tanaka (1973) and Govoni et al. (1986) and more recently by Zambonino-Infante and Cahu (2001) and Hoehne-Reitan and Kjorsvik (2004). Briefly, at hatching, the stomach is typically undifferentiated and non-functional. Acid digestion and pepsin expression are lacking, and the proton pump used to secrete hydrochloric acid into the stomach lumen is not functional (Gawlicka et al., 2001; Rønnestad et al., 2001; Rust et al., 2002; Morais et al., 2005). Most species also lack functional mouth and jaws. Early larvae typically posses a simple tube-like alimentary canal that is closed at both ends and that is lined with columnar epithelium. The alimentary canal undergoes rapid transformations during the transition to exogenous feeding. By the onset of first feeding, the alimentary canal has already developed into its different functional regions, but it is still less elaborated than in juveniles. However, the liver, pancreas and gallbladder are usually present and functional (HoehneReitan and Kjorsvik, 2004). Digestion occurs in the midgut and hindgut, and nutrient absorption takes place through the apical region of the epithelium of each region, which is characterized by columnar cells named enterocytes. Alkaline proteases play a major role in protein digestion during the first days of feeding, while acid proteases became increasingly important toward the end of the larval period, concomitant with the appearance of a functional stomach (Lauf and Hoffer, 1984; Lazo et al., 2007). As the developmental process progresses, oxynticopeptic cells in the gastric glands become functional, as suggested by the production of hydrochloric acid through a functional proton pump, the expression of pepsinogen and it activation to pepsin (Gawlicka et al., 2001). From the perspective of the digestion system, the transformation to the juvenile stage is complete once the stomach is fully differentiated (Fig. 11.11). A high specific activity of digestive enzymes has been observed before the initiation of exogenous feeding in most species studied to date (Zambonino-Infante and Cahu, 2001). This suggests the process of enzyme production is initiated by underlying genetic mechanisms (Buddington and Diamond, 1989) rather than by the diet (Cahu et al., 1994; Lazo et al., 2000a). While it appears that during the early stages of development digestive enzyme activities are controlled by gene expression rather than by feeding activity, a diet’s composition can influence the maturation of the digestive system by triggering an onset or increase in the activity of some digestive enzymes (Zambonino-Infante and Cahu, 2001). Feeding nutri-

Fish larvae nutrition and diet: new developments MO

PA

YR

339

FS Lates calcarifer

MO

PA

PA

YR

FS

MO YR

PA

FS

MO

PA

0

FS Scophtalmus maximus 18 °C

1

2

3

4

FS

MO

5

6

Morone saxatilis 22 °C FS

7

17

Sparus aurata 19 °C

25

Dicentrarchus labrax 19 °C

40

Fig. 11.11 Comparison of developmental stages in the digestive tract of several marine fish species: PA – protease activity; MO – mouth opening; YR – yolk resorption; FS – functional stomach (from Moyano et al., 1996).

tionally unbalanced microdiets to marine fish larvae can disrupt the normal maturation process; the earlier the weaning onto unbalanced microdiets, the more negative the observed effect on maturation (Cahu and Zambonino, 1994; Lazo et al., 2000a). In contrast, some nutrients, such as polyamines, can enhance the maturation and differentiation of the enterocytes involved in nutrient absorption. For example, seabass larvae fed a diet containing 0.33 % dry weight of the polyamine spermine displayed a faster maturation of the enterocytes relative to those fed a similar diet lacking in the polyamine (Péres et al., 1997). Likewise, Tovar et al. (2002) included the polyamine-producing yeast (Debaryomyces hansenii HF1) in the diet of seabass larvae and observed an increase in digestive enzyme secretion and earlier maturation of the enterocytes that were mediated by spermine and spermidine. While most species can be effectively weaned onto microdiets before completion of metamorphosis, successful weaning during the early larval stages has proven more challenging (Kolkovski et al., 2001). Only a handful of species can be reared on microdiets from the time of mouth opening (i.e., red drum, Scieaenops ocellatus; Lazo et al., 2000b and seabass; Cahu and Zambonino-Infante, 2001). Most species cultured to date require the use of rotifers or Artemia at some point during development. As previously mentioned, early research suggested the problems associated with early weaning were attributed to low digestive enzyme activity or to the importance of live prey for aiding or triggering the digestive

340


process (Kolkovski, 2001). In contrast, recent studies indicate that enzymatic activity is high in early larvae, and that the potential contribution of digestive enzymes from the prey is negligible. Typically, enzymes for the luminal digestion of proteins (trypsin, chymotrypsin and elastase, among others), lipids (lipases and phospholipases) and carbohydrates (amylases and maltases) are present in larvae before exogenous feeding commences or shortly thereafter. Their activity tends to increase with age, length and type of feed (Alliot et al., 1980; Baragi and Lovell, 1986; Cousin et al., 1987; Moyano et al., 1996; Baglole et al., 1998; Izquierdo et al., 2000; ZamboninoInfante and Cahu, 2001; Lazo et al., 2007). Intracellular enterocyte digestive enzymes such as tri- and dipeptidases exhibit high levels of activity during the early larval stage and decrease as development progresses (Cahu and Zambonino-Infante, 1995; Lazo et al., 2007). In contrast, the activity of intestinal brush border membrane enzymes such as aminopeptidases and alkaline phosphatases are lowest at first feeding and subsequently increase with age. A decrease in intracellular peptidase activity concurrent to an increase in brush border peptidase activity is indicative of the full intestinal maturity of marine fish larvae (Cahu and Zambonino-Infante, 1994). The ratio between intestinal brush border membrane enzyme activity (i.e., leucine amino peptidase or alkaline phosphatese) and intracelular peptidase activity (i.e., leucine-alanine peptidase) is a good indicator of the normal maturation of the enterocytes in marine fish larvae, the higher the ratio the higher the degree of maturation. This ratio can be used to evaluate the effect of diet on digestive system maturation (Fig. 11.12). Thus, although not as complex as the juvenile digestive system, marine fish larvae posses a wide range of digestive enzymes that support the efficient digestion of

12.0 10.0

Ratio

8.0 Adequate diet Inadequate diet

6.0 4.0 2.0 0.0 0

10 20 30 40 Days after hatching

50

Fig. 11.12 Relationship between intestinal brush border enzyme activity and intracellular peptidase activity. Data were estimated from results of enzyme activities of seabass larvae fed nutritionally balanced and unbalanced diets reported by Cahu and Zambonino (1995).


341

nutrients if adequate feeds are provided (i.e., larvae can achieve very high growth rates in the wild and under culture conditions). It has been proposed that exogenous enzymes from live prey could directly aid in larval digestion or activate the zymogens present in larval gut, thus increasing digestion and growth rates (Dabrowski, 1979; Lauf and Hoffer, 1984; Kolkovski et al., 1993). The mechanisms through which exogenous enzymes could aid or stimulate the digestive process are not clearly understood. Moreover, the addition of exogenous enzymes to compound microdiets in the rearing of marine fish larvae has been shown to be beneficial for some species (such as sea bass and sea bream) while its benefits have not been conclusively demonstrated for other species (Kolkovski, 2001). Moreover, several authors have reported a lack of significant differences in levels of pancreatic and intestinal enzymes in fish larvae reared with live prey or microdiets (Baragi and Lovell, 1986; Cahu et al., 1995; Lazo et al., 2000a), which indicates that the ingestion of live prey does not stimulate enzyme production or secretion into the gut lumen. Kurokawa et al. (1998) estimated the relative contribution of exogenous enzymes to digestion in Japanese sardine (Sardinops melanotictus) larvae and determined that it was only 0.60 % of the total protease activity in the intestine, and therefore concluded that the contribution of the prey’s enzymes to digestion was minimal. Similarly, Diaz et al. (1997) using substrate-SDSpage to estimate protease activity in larval sea bream and their live prey (rotifers) failed to detect proteases from the prey within the digestive tract. They suggested that the contribution of exogenous enzymes was limited to an autolytic process of the prey in the larval gut. Based on this data, it appears that the contribution of exogenous digestive enzymes to the total digestive capacity of the larvae is negligible in most species. The lack of early weaning success cannot be attributed solely to the absence of a functional stomach and lower digestive enzyme production, so other factors have been conjectured to explain the lower performance of larvae fed on microdiets. These include low ingestion rates of the microdiets (Lazo et al., 2002) or the failure of microdiets to effectively stimulate digestive enzyme secretion (Kolkovski et al., 1997a, b; Cahu and Zambonino-Infante, 2001). The latter would lead to low levels of enzymes in the lumen to digest feed particles. In combination with the relatively fast gut transit time typical of marine fish larvae (Govoni et al., 1986), this would effectively reduce the ability of the larvae to absorb the dietary nutrients necessary for meeting the requirements for normal growth. Recent research has begun to shape a more comprehensive understanding of the development of the digestive system by focusing on the study of the hormonal mechanisms controlling the expression and secretion of digestive enzymes and their modulation through dietary nutrients (Rønnestad et al., 2007). For example, many compounds present in live feeds have the potential for influencing digestive enzyme activity in fish larvae. Polyamides, algal growth regulators which play multiple roles in

342


stabilizing the intracellular conformation of nucleic acids and membranes (Mathews and Van Holde, 1990; García-Jiménez et al., 1998), have been shown to stimulate gut hormone, cholecystokinin (CCK) release in rats, which in turn mediates the release of pancreatic enzymes (Fioramonti et al., 1994). Most formulated diets designed for marine fish larvae contain large amounts of fish meal, which is naturally low in the polyamide spermine (Bardocz, 1993). The addition of spermine to microdiets fed to sea bass larvae has been shown to increase pancreatic enzyme secretion and induce earlier intestinal maturation (Peres et al., 1997). In addition, amino acids may increase the secretion of certain hormones, such as somatostatin and bombasin, which also stimulate the secretion of pancreatic enzymes (Chey, 1993; Kolkovski et al., 1997a, b). Live feeds contain large amounts of free amino acids, which may stimulate the secretion of trypsin (Dortch, 1987; Fyhn et al., 1993). Cahu and Zambonino-Infante (1995) reported increased trypsin secretion in sea bass larvae fed a mixture of free amino acids in their diets. Both neural and hormonal processes are involved in regulating the secretion of pancreatic enzymes (Fange and Grove, 1979). The sight, smell or presence of food triggers a nervous control mediated by the vagus nerve that results in the induction of pancreatic secretion. Hjelmeland et al. (1988) induced secretion of trypsinogen from pancreatic tissue into the intestine of herring (Clupea harengus) larvae by feeding polystyrene spheres with no nutritional value. Similarly, Pedersen and Andersen (1992) were able to enhance the secretion of pancreatic enzymes by increasing the size of the inert particles fed to herring larvae. Additionally, gastrointestinal hormones, such as CCK, play an important role not only in the stimulation of pancreatic enzyme secretion, but also in gallbladder contraction, intestinal peristalsis and gut transit time in fish larvae (Rønnestad et al., 2007), all of which are important factors regulating the digestion process. In first feeding larvae, CCK production seems to be genetically hardwired, but in older larvae it can also be regulated by dietary factors such as protein levels and chain length (Cahu and Zambonino Infante, 2001). However, distension of the gut wall is not a factor that triggers CCK production (Koven et al., 2002). This indicates that the secretion of pancreatic enzymes is regulated by mechanisms in addition to CCK production and requires further research. Kolkovski et al. (1997b) found a ten-fold increase in bombasine activity when larvae were fed live food (Artemia) compared to microdiet, suggesting that live food activated the digestive system significantly more than microdiet resulting in better digestion and assimilation. As we continue to move away from the paradigm of low digestive capacity as the main reason for the unsuccessful rearing of marine fish larvae on microdiets, researchers have begun to study the step following digestion in feed utilization, namely, the absorption and transport of ingested or digested nutrients. Recent research has shown that marine fish larvae have an


343

adequate but limited capacity to absorb and transport some of the digested nutrients. For example, Morais et al. (2004) fed 14C radio labeled Artemia to Senegalense sole (Solea senegalensis) larvae of different ages (12, 22 and 35 DPH) and found no significant differences (77–83 %) in Artemia utilization among ages. Surprisingly, the younger larvae were more efficient in retaining protein assimilated from the feed. Apparently, younger larvae have the ability to compensate for a moderate digestive capacity and a lower gut residence time by increasing the efficiency of retaining absorbed amino acids. The mechanism through which the larvae are capable of achieving an increased efficiency in the absorption of amino acids has yet to be established and warrants further research. Morais et al. (2007) investigated the effect of lipid level and fatty acid composition on ingestion, digestive enzyme activity and absorption and transport of digested nutrients using several species of marine fish larvae. The authors concluded that lipid transport after absorption may be more of a limiting factor than digestion of dietary lipids. Phospholipids were more easily digested than neutral lipids and their presence in the diet markedly improving lipid absorption and transport (Liu et al., 2002). Thus, large lipid droplets accumulate in the enterocytes of larvae fed a high-lipid diet in the absence of adequate phospholipids, which in turn may reduce the absorption of digested nutrients (including amino acids and free fatty acids) from the lumen (Morais et al., 2005). Collectively, the results of studies performed to date indicate the need for examining the inclusion of feed attractants and stimulants of the secretion of pancreatic enzymes in microdiets. In addition it is important to include an adequate balance of free amino acids, peptides and intact proteins, phospholipids, neutral lipid sources and free fatty acids in diets so as to develop an adequate replacement of live feeds from first feeding during the rearing of marine fish larvae.

11.6 Digestive system capacity Recent research evaluating the effect of specific nutrients on larval digestive physiology and characterizing the metabolic pathways of the assimilated nutrients has revealed an important role of the type (protein vs peptides and amino acids or triglycerides vs phospholipids), quantities (protein or lipid levels), ratios (DHA : EPA :ARA; or essential fatty acids vs other fatty acids for metabolic energy) and availability of a dietary nutrients (Morais et al., 2007; Rønnestad et al., 2007). Given the complexity the metabolic pathways involved, a more comprehensive approach is needed to further our understanding of the digestive process and nutrient requirements of developing marine fish larvae (Zambonino-Infante and Cahu, 2007). Similarly, more molecular research is needed to characterize nutrient transporters in the gut lumen throughout ontogeny,

344


so as to more thoroughly establish the assimilation capacity of developing larvae. To date, no routine assay has been developed to measure dietary protein digestibility in marine larval fishes. Although some interesting methods have been recently proposed (Alarcón, 1997; Lazo et al., 2002; Rønnestad et al., 2007; Muscato et al., 2009), a standard method applied among research laboratories has yet to be established. Results obtained through the characterization of digestive enzymes, such as the determination of protease activity and inhibition, optimum temperature and pH should be utilized to develop in vitro and in vivo assays to measure protein digestibility throughout the larval stage. In vitro tests can be used to evaluate digestibility of different proteins sources and ingredient-mediated enzyme inhibition. Enzyme extracts from larval guts, purified enzymes or readily-available commercial enzymes can be utilized for these assays (although the former enzymes are preferred). The effect of feed processing (i.e. temperature and drying) and ingredient pretreatment (i.e. enzyme hydrolysis) on digestibility of the protein sources can also be evaluated using in vitro assays (Alarcón et al., 1997; Lazo and Holt, 2001). Thus far, few studies have considered the changes in digestive capacity occurring within a specific stage of development such as the larval period (i.e., early, mid and late larvae or early juvenile). Information of changes in enzyme type and relative activity can be utilized to develop reliable in vitro digestibility assays that allow for the screening of potential dietary ingredients and formulated feeds, without the need for long, expensive and labor-intensive feeding trials. Recently, Lazo and Martinez (2007) evaluated the in vitro protein digestibility of potential dietary ingredients throughout ontogeny of digestive system in larvae of California halibut (Paralichthys californicus) using the pH-STAT technique to identify adequate protein sources for each stage of development. Highly significant differences (p < 0.001) in protein digestibility were found for some ingredients among the developmental stages evaluated (Fig. 11.13). Meals elaborated with typical live feeds for the rearing of marine fish larvae (rotifers and Artemia) showed the highest protein digestibility with a tendency to decrease as larval development progressed. Soybean meals were poorly digested, and this could be attributed to presence of antinutritional factors and/or differences in protein quality due to processing. Results from this type of studies warrant the importance of evaluating the digestibility of protein sources through larval development in order to formulate successful weaning diets for marine fish larvae (i.e., stage-specific diets). Information on the ontogeny of digestive enzymes will aid in the selection of more adequate ingredients for the successful design of adequate diets specific to each developmental stage. Although in vitro assays are simple, rapid and inexpensive techniques, the more accurate and comprehensive approach to assess nutrient digestibility is to evaluate digestibility using in vivo methods. Recently,

Fish larvae nutrition and diet: new developments 2.5

9 DPH 39 DPH

15 DPH 51 DPH

345

a

26 DPH ab ab

a

2.0

a

DH (%)

1.5

ab

a

a

bc

a a

a ab a

1.0

bb

b

0.5

bb

ab

ab

a

ab b

b b

a

a c

a abab

c bc

abc

c aa

b

bc

bc

b

b

bc c 0.0

Casein

Fish meal 1 Fish meal 2

Krill meal

Squid meal

Rotifers

Artemia

Soy meal Wheat gluten

Ingredients

Fig. 11.13 Changes in degree of hydrolysis (DH) of several ingredients through ontogeny of the digestive system in California halibut larvae: DAH – days post hatching (adapted from Martinez-Montaño et al., 2006).

Rønnestad et al. (2001) developed an improved in vivo method of the controlled tube feeding of radiolabeled nutrients originally conceived by Rust et al., 1993). In the improved technique, correct discrimination was made between unabsorbed labeled nutrients from gut evacuation and labeled nutrients from metabolism of the absorbed nutrients. With this technique, it is possible to quantify gut absorption, oxidation and retention of dietary nutrients and thus assess part of the functionality of the digestive system in marine fish larvae. Nevertheless, full digestion capacity is probably not realistically quantified since nutrients are ‘forced’ fed into the digestive system and many hormonal processes that may naturally occur in a feeding trial may not be taking place. How easily other laboratories will adopt this highly innovative method is yet to be seen since it requires sophisticated apparatus and uses radiolabeled compounds. A more simple approach was recently developed by Muscato et al. (2009), to determine in vivo protein digestion of microdiets in marine fish larvae. The new method uses FluoSpheres®, fluorescent microspheres, as an indirect marker to estimate protein digestibility. Additionally, the fluorescent microspheres can be used to quantify feed ingestion. The formulation and manufacture of adequate microdiets using new information will permit more nutritional studies to further our knowledge and understanding of the nutritional requirements of marine fish larvae and finally overcome the necessity of using live feeds in the rearing of marine fish larvae.

346


11.7 Diet manufacturing methods Several microdiet manufacturing methods are currently being used: • • • •

microbound diets (MBD) (Fig. 11.14a), microcoated diets (MCD) and micro-encapsulated diets (MED) (Fig. 11.14b) and, marumerization (MEM) (Fig. 11.14c).

(a)

(c) A

B

C

D

(b)

Fig. 11.14 Microdiets manufactured by different techniques: (a) MBD; (b) MED (photo Manuel Yúfera, CICS, Cediz, Spain); (c) MEM (photo Bernard Devresse, BernAqua, Belgium).


347

All have been used extensively in nutritional studies with finfish larvae and are commercially manufactured. 11.7.1 MBD Currently, the manufacturing process of MBDs is the simplest and most commonly used method of preparation. It consists of dietary components held within a gelled matrix or binder. They do not have a capsule, and it is suggested that this facilitates greater digestibility and increased attraction through greater nutrient leaching (Kolkovski, 2001; Yúfera et al., 2003; Kolkovski, 2006a,b). Some commercial microdiets are manufactured using extrusion and then crushed and sieved to the required particle sizes. All the ingredients are ground, mixed with a binder such as gelatine, alginate, zein, carrgeenan and carboxymethyl-cellulose, activated by temperature or chemically (López-Alvarado et al., 1994; Koven et al., 2001; Kolkovski, 2004, 2006b) and then dried (drum drying or spray drying), ground and sieved to the required size.

11.7.2 MCD The MCD method is based on coating or binding small MBD particles to reduce leaching (López-Alvarado et al., 1994; Baskerville-Bridges and Kling, 2000; Onal and Langdon, 2004). The coating layer is usually lipids or lipoproteins. This method is not often used in commercial processes.

11.7.3 MED MED particles are made using several different techniques. The particle usually has a membrane or capsule wall, which separates dietary materials from the surrounding medium (Fig. 11.14b,c). The capsule wall helps maintain the integrity of the food particle until it is consumed preventing leaching and degradation of the nutritional ingredients in the water. However, this attribute may restrict leaching of water-soluble dietary components and therefore reduce the larvae’s attraction to the food particles (Yúfera et al., 2003; Kvåle et al., 2006). The capsule wall is also thought to impair digestion of the food particle (Yúfera et al., 1998; Kolkovski, 2006a,b) (Fig. 11.14b). There are several methods for micro-encapsulation. These include chemical processes and mechanical processes. In chemical processes, the capsules are made within a liquid, usually stirred or agitated. The capsules are formed by (i) spraying droplets of coating material on core ingredients, (ii) capsulating liquid droplets containing the nutritional ingredients by spraying into gas phase, (iii) creating gel capsules by spraying droplets, containing the nutritional ingredients and a binder, into liquid solution that activate the binder or by polymerization reaction at a solid/gas or (iv) liquid interfaces. Protein cross-link (Yúfera et al., 1998, 2000) involves several stages of mixing and washing with organic solvents resulting in a very expensive diet

348

New technologies in aquaculture Arg Lys Glu His Asp

Pro Tyr Ser Gly Thr

Ala Cys Met

Leu Val lle

120 100

% Leaching

80 60 40 20 0 –6 Hydrophilic

–4

–2

0

2

4

6 Hydrophobic

Hydropathy index MB – microbound diet MC – microencapsulated diet MC-L – microencapsulated diet with lysine supplementation

Fig. 11.15 Percentage of FAA leached after 60 min of immersion in water in relation to the hydropathy index (Yúfera et al., 2002).

process, that is potentially toxic. These methods have never resulted in good growth rates due to the inability of larvae to digest and assimilate the particles as well as the high ratio of non-nutritional ingredients mainly the capsule, to the essential nutrients (Yúfera et al., 2005). Another method, complex coacervation, involves mixing and activating, using electrical charges, two liquid phases differing in their viscosity resulting in very small capsules. These capsules then bind to create a larger capsule containing hundreds or thousands of microcapsules (Thies, 2007) (Fig. 11.15c).

11.7.4 MEM Mechanical encapsulation involves processes such as spray drying, fluidized bed drying, cold micro-extrusion marumerization (MEM) and particleassisted rotational agglomeration. The last two techniques have gained attention in the past few years with commercially available diets produced using these methods. Initially developed for pharmaceutical processes, these methods involve purpose-built machines. MEM is a two-step process of cold extrusion followed by marumerization (spheronization). The process has the capability of producing particles from 500–1000 μm and greater. Particle-assisted rotational agglomeration (PARA), which is a single-step


349

process capable of producing particles from 50–500 μm that are lower in density than particles produced by the MEM method due to the fact that the extrusion step is avoided. The method is based on a spinning disk (marumerizer). A wet mash of the ingredients is put into the marumerizer with or without inert beads. The rotation movement of the disk breaks down the mash into smaller spherical particles. The diameter of the particles depends on several factors including the disk rotation speed, the inert beads and the raw ingredients (Barrows and Lellis, 1996, 2006).

11.8 Microdiet characteristics Although they have a very strong role in microdiet utilization, very little attention and research efforts have been donated to the identification of the chemical and physical properties of diet particles. There are only a handful of scientific works on leaching properties and even fewer on the buoyancy and behavior of the particles in the water column.

11.8.1 Leaching As mentioned above, one of the problems of MBD particles and most of the microdiet-type particles is the high leaching rate of amino acids. Kvåle et al. (2006) reported leaching of protein molecules (9–18 kD) after 5 min immersion in water (3 % NaCl, 12 ºC) at a rate of 80–98 %, 43–54 % and 4–6 % for agglomerated, heat coagulated and protein encapsulated microdiet. Yúfera et al. (2003) determined the rate of different amino acids leaching from both MBD and MED. The authors found contrary patterns between the two diet types. While hydrophilic amino acids leached the most from MBD, hydrophobic amino acids were found to leach from MED particles at a higher rate (Fig. 11.15). The leaching rates of the two diets were also significantly different. For instance, 70 % of free lysine leached from MBD particles after less than 5 min, while less than 7 % leached from MED particles after 60 min (Fig. 11.16). López-Alvarado et al. (1994) tested the leaching rates from several different microdiets made with different techniques and found similar results (Table 11.3). Heinen (1981) assessed water stability of formulated diets made from 11 different binders; MBD made from agar and alginate were amongst the most stable in terms of integrity, while carrageenan was amongst the poorest. A diet particle needs to achieve a fine balance between leaching amino acids and other nutrients to act as feed attractant and digestibility of the particle to suit the undeveloped larvae digestive system. A particle that will be hard and leach-resistant will also present a challenge to the larvae digestive system, whilst, a particle that will digest easily in the gut will also disintegrate relatively quickly in the water (Yúfera et al., 2000; Kolkovski, 2006a).

350

New technologies in aquaculture 120 a

100

(%) Leaching

80

a

a a

a

60

MC-L MC MB

20

10 c

0

a b ab b 0 10

d

c

c b

b 20

30 40 Time (min)

50

b 60

MB – microbound diet MC – microencapsulated diet MC-L – microencapsulated diet with lysine supplementation

Fig. 11.16 Leaching pattern of lysine during 60 min of immersion in water (Yúfera et al., 2002). Table 11.3 Leaching rates from different MD manufactured by different techniques MD type and binder type MBD, carrageenan MBD, alginate MBD, zein Protein MED Protein MED/lipid MCD Lipid walled (tripalmitin + triolein) Lipid walled (tripalmitin)

Leaching (%) 85 81 91 59 39 47 4

± ± ± ± ± ± ±

7 2 2 1 2 9 2

MBD = microbound diets, MCD = microcoated diets, MED = microencapsulate diet. Source: Lopez-Alvarado et al., 1994.

11.8.2 Buoyancy One of the most significant problems with microdiet particles is their negatively buoyant inert state. However, very few scientific studies have investigated this issue. In addition, MBD particles do not move like live zooplankton. This specific movement act as a visual stimulus for increased feeding activity (Kolkovski et al., 1997a,b). Furthermore, the particles sink to the bottom of the tank where they are no longer available to the larvae and accumulate there, leading to bacterial proliferation and deterioration of water quality. This further creates the need to effectively wean the larvae onto the MBD, in order to both modify their digestive capacity and their


351

Accumulative diet return (%)

MicroGemma 150 MicroGemma 300

100

Kinko 0

80

Proton 2

60

Gemma 0.3

Proton 3 Kinko 1

40

Grow Best L3 20

Proton 4 NRD 4/6 2

4

6 8 Time (min)

10

12

14

NRD 5/8 Diet size

Fig. 11.17 Sinking patterns of commercial diets (Jackson and Nimmo, 2005).

feeding behavior. A change in behavior is illustrated by the larvae’s ability to recognize the inert particles as food and to more actively hunt for them during a relatively smaller window of opportunity, as the particles pass down through the water column. Figure 11.17 illustrates the sinking rates of several commercial microdiets (Jackson and Nimmo, 2005). Different attempts have been made to increase the amount of time the microdiet particle spends in the water column including increasing buoyancy by adjusting and modifying oil levels, manufacturing methods and also using rearing systems with up-welling currents (Kolkovski et al., 2004; Teshima et al., 2004). Knowledge of sinking and leaching rates of microdiets can and should be used to optimize feeding time in the larvae tank. The faster the diet particle sinks the shorter the feeding intervals should be coupled with smaller quantities of diet, in short, feeding less more often.

11.8.3 Weaning and co-feeding methods An important factor influencing the larvae’s acceptance of a microdiet, which affects both their growth and survival, is the weaning process. In the past, early weaning has led to poor growth and inferior quality larvae with an increased risk of skeletal deformities (Cahu and Zambonino Infante, 2001). Recent advances in microdiet formulation have considerably reduced the pre-weaning period, allowing the introduction of specific larval diets to marine finfish culture as early as mouth opening (Cahu and Zambonino Infante, 2001). ‘Co-feeding’ weaning protocols, simultaneously using inert and live diets, allow an earlier and more efficient changeover period onto microdiet from live feeds (Hart and Purser, 1996; Daniels and Hodson, 1999; Koven et al., 2001; Curnow et al., 2006,a,b; Rosenlund and Halldorsson, 2007). Co-feeding provides higher growth and survival than

352


feeding solely live feeds or microdiets (Kolkovski et al., 1995). Early cofeeding of an appropriate microdiet will improve larval nutrition and can condition the larvae to accept microdiet more readily, thus preventing an adverse effect on subsequent growth following weaning (Rosenlund et al., 1997; Canavate and Fernandez-Diaz, 1999; Cahu and Zambonino Infante, 2001; Kolkovski, 2001, Saenz de Rodriganez et al., 2005). However, in spite of newer diet manufacture technique, better understanding of the digestive system ontogeny, complete live feed replacement has still not been achieved. In the past several years many experiments have been conducted looking at this problem and trying to wean larvae of different species at different ages to different microdiets with limited success. Curnow et al. (2006b) demonstrated the effect of different weaning and co-feeding treatments on growth and survival of barramundi larvae (Fig. 11.18). The authors found that early weaning before the larvae fully developed, as well as diet type and quality, influenced not only growth and survival but also the occurrence of cannibalism. They concluded that co-feeding barramundi larvae on microdiet should be started no earlier than three days prior to stomach differentiation and be continued post metamorphosis. Co-feeding improves growth by 25–30 % over the previous standard method (shorter and earlier weaning), and mortality during weaning was reduced from 5 % to 1 % (Bosmans et al., 2005). Similar results were found with many fresh water and marine species (Table 11.4). It is now clear that complete replacement of live food is still far from reality. Although replacement of Artemia has 25.00

Length (mm)

20.00

15.00

10.00

5.00

0.00 2

6

10

14

18

22

26

28

Larvae age in days post hatch G

G3

G7

G12

G12A

P12A

Fig. 11.18 Effect of various feeding protocols on barramundi larvae length average length, mm ± SE) (Curnow et al., 2006a). Treatments are denoted according to Table 11.5.


353

Table 11.4 References to weaning protocols of different fish larvae species Fish species

Weaning protocol

Pikeperch (Sander lucioperca) (freshwater)

Weaning at hatch, 12 or 19 DPH

Senegaleresole (Solea senegalese)

Weaning protocols

Sea bass (Dicentrarchus labrax) Atlantic cod (Gadhus morhua)

Weaning period, 15, 20 and 25 DPH Weaning protocols, 0 %, 50 % and 100 % Artemia replacement with microdiet Larvae rearing protocols (review)

Atlantic cod (Gadhus morhua) Fat snook (Centropomus parallelus) Common sole (Solea sloea)

Weaning period

Tongue sole (Cynoglossus semilaevis) Dourado (Salminus brasiliensis)

Weaning protocols

Pacu (Piaractus mesopotamicus)

Weaning protocols

Sturgeon (Acipenser sturio) Barramundi (Lates calcarifer)

Weaning periods

Dover sole (Solea solea)

DPH = days post hatch.

Weaning diets comparison

Weaning time

Weaning protocols

Diet type and weaning time

Findings

Authors

Best growth, survival and lowest deformities, but high cannibalism at post-hatch weaning Artemia-fed larvae grew threefold less then fish fed an inert diet. Sudden weaning and co-feeding resulted in larger fish than late weaning Lowest growth and survival rates when weaned at 15 DPH, highest at 25 DPH Highest survival and growth achieved in treatments with Artemia (100 % and 50 %)iu

Kestemont et al., 2007

Weaning achieved at 22 with reduced growth, but higher growth achieved with late weaning (30 DPH) Successfully weaned at 35 DPH, but higher growth achieved at 40 DPH weaning Weaning at 30 DPH, one diet achieved comparable survival to Artemia treatment and better growth Co-feeding regimes preformed similar or better than Artemia regime Early weaning (3, 5 DPH) resulted in lower survival although length and weight was not affected Artemia-fed larvae showed the higest growth compared to diet-fed larvae Long weaning (21 days) resulted in better growth and survival then short weaning (3 days) Complete replacement of Artemia was achieved. However, better survival achieved when small amount of Artemia was added Early weaning (42 DPH) resulted at higher survival, but late weaning resulted at higher growth

Engrola et al., 2007

Suzer et al., 2007 Fletcher et al., 2007

Rosenlund and Halldorsson, 2007 Alves et al., 2005 Palazzi et al., 2006 Chang et al., 2006 Vega-Orellana et al., 2006 Tesser et al., 2005 Williot et al., 2005 Curnow et al., 2006a,b

Rueda-Jasso et al., 2005

354


Table 11.5 Weaning protocols according to Curnow et al., 2006a Skretting Australia Diets Treatments

INVE Diets

G

Gemma Micro

G3

Gemma Micro

0.6

0.8

1.0

1.6

2.0

0.4

0.6

0.8

1.0

1.6

2.0

0.8

1.0

1.6

2.0

0.8

1.0

1.6

2.0

1.0

1.6

2.0

0.5

Gemma Micro

5 10 15 10

5

Gemma Micro 5 10 15

Rotifers G12A

0.4

5 10 15

Rotifers G12

15 10 5 0.6

Gemma Micro 5 10 15

Rotifers

0.8 15 10 5 2

Artemia P12A

0.6

Proton

0.8

10

6

1.0

2

Artemia 0

6

2 1.6

2.0

15 10 5

5 10 15

Rotifers

DPH

Gemma 0.3

Proton 3/5

Proton 2/3

Proton 1

Rotifers G7

Gemma Micro 300

Gemma Micro 150

5

10

6

10

15

6

2

20

25

30

DPH = days post hatch.

been achieved for some species such as red drum and European sea bass, replacing the Artemia is not yet considered to be realistic for most species. Replacement of rotifers is even more difficult. Weaning protocols are almost standard in terms of the weaning steps, i.e. rotifers, Artemia (nauplii and then enriched Artemia), Artemia– microdiet co-feeding and complete weaning. However, these protocols are varied according to the fish species, temperature, microdiet type, rearing system, feeding system and intervals. Even in fish species whose nutritional requirements are considered to be similar, such as gilthead sea bream and European sea bass, weaning protocols are different. While sea bass is one of the only marine fish species for which complete replacement of Artemia was achieved (Chau and Zambonino, 2001), sea bream protocol is still reliant on Artemia.

11.9 Feeding system The digestibility and nutritional qualities of the commercially available microdiets are now becoming much better due to continuous research and development, as mentioned above. However, none of these commercial


355

microdiets is used solely without Artemia (not to mention without rotifers). Part of the reason is the microdiet distribution or the manner of delivery to the larvae. The best dry diet is as good as the method with which it is dispensed into the larvae tank. Compared to feeding systems and methods for on-growing fish, larvae feeding systems were not given much attention from both the scientific and commercial sectors. Only a handful of automated microdiet feeding systems exist and almost no scientific papers have been published (Papandroulakis et al., 2002). Hand feeding is the simplest and still the most widely used method. Hand feeding is usually undertaken using small devices (spoons, salt-boxes) with relatively long periods between feeding events (30–60 min). Covering long photoperiods is difficult due to labor and logistics involving long feeding periods, sometimes over 24 h. Due to the high larval metabolic rates and the demand for continuous feeding, the result is insufficient benefits from a relatively expensive product. It has been recognized that European hatcheries (and, in fact, any modern intensive hatcheries) have a strong need for automation in all the production processes. Not only would this generate labor savings, but it will also secure the production protocols and bring more repeatability to every step of the processes (Leclercq, 2004). With this in mind, plans were made to develop automatic dispensers of microparticles that would be precise in their distribution and easy to use in hatcheries.

11.10 Dosage system The first requirement from a mechanical microdiet dispenser concerns its capacity to deliver one stable quantity per feeding event. Well-known belt feeders (FIAP Aquaculture, Denmark), driven by a motor or by a clock, are not capable of splitting a daily ration in equal aliquots of feed. They are handy and cheap but not actually built for microdiet particles, resulting in the microparticle sticking to the belt, especially in humid conditions. Horizontal drums have also been developed (Arvotec, Finland). The small cavities on the drum external area can be loaded with, relatively, consistent quantities when the microparticle remains dry and not sticky. However, often, a thin layer of product accumulates between the rotating drum and its housing. This quickly becomes a contamination source, as well as a factor generating inconsistency in the distribution. Vertical hoppers with a rotating disk are also available commercially (Sterner, Norway). However, the self-compaction of the microparticles in the hopper coupled with a great deal of difficulty in cleaning the equipment limits its applicability. A different feeding mechanism was developed in Australia (‘AMD’ [Automatic Microdiet Dispenser], Department of Fisheries, Western

356

(a)


(b)

Fig. 11.19 Automatic microdiet dispenser (AMD, Department of Fisheries, Western Australia): (a) side view; (b) bottom view, static plate secured with bolts while the moving plate above it is held by the solenoid piston.

Australia, Fig. 11.19a,b) with the dosage system based on the opening of a sluice-valve quickly moved by means of a simple solenoid allowing for a constant quantity of feed to be delivered at each feeding event. Cleaning the feeder is a very simple and quick process. The feeder uses air from the hatchery supply to supply a built-in spreader.

11.10.1 Delivery to the rearing tank Once a reliable dose is established, its repetition over the tank surface or in the tank volume is necessary to increase the larvae–particle interaction (i.e. before it sinks to the bottom of the tanks and become unavailable to the larvae). The dose delivery can take place directly above the water surface. However, there is a risk of aggregation of particles into small packs, sticking together and immediately sinking to the tank bottom. To avoid this, Raunes, a cod hatchery in Norway, has developed an intermediate vessel where the microdiet is mixed with water and further distributed into the water column at different points of the tank. These are commonly referred to as ‘spiders’. The vessel volume is only a few liters and the applied flow (part of the tank water intake) allows for 2–3 min of residence time in the vessel. In this vessel, the dose is delivered into the flow of water by any dispenser and the microparticles are separated and


357

dispersed by the strong water movements into the vessel. The suspended particles are then pushed into the tanks through the ‘spider legs’, these being made from a number (6–12) of small rigid plastic (2–3 mm internal diameter) pipes. The lower end of each of these is set into the water column (2–3 cm below the tank surface). This means of dispersing the microparticles is very efficient, especially in large tanks (4–10 m3 or more). It avoids trapping the microparticles in the surface skimmers, which are often used to capture the oil-film at the surface of the tanks. This way of dispersing the microdiet particles is most efficient; however, due to the strong water movement, it may also cause very strong leaching of the nutrients. The extent of this problem is yet to be determined. Another way of spreading the microdiet over the surface is by air. An air-blade is formed under the dosage point (where the microdiet dose is delivered by the dispenser) and blows the light particles over an area that can reach 30–90 cm. Once separated from each other by the air current, the particles do not tend to clump and conglomerate over the surface. This is simpler than the ‘spider’ device described above, but requires tanks without skimmers (only for 5 days, will minimise variability in faeces composition and improve reliability of results (Wybourne and Carter, 1999), although arguably this can also be resolved by using a larger number of fish from which to collect faecal samples during a single collection period. Reduction in variance, however, has the potential to improve substantially the experimental power of digestibility studies and increase the capacity to detect significant effects and, irrespective of collection method, ingredient inclusion level or collection period duration, adequate replication is probably a far more important consideration (Searcy-Bernal, 1995).

13.3.3

Experiment management issues in ingredient digestibility assessment Experimental conditions can also have important effects on the determination of diet digestibility and need to be managed accordingly. Key considerations include environmental conditions, fish size and feeding ration structure. Water temperature has minor effects on digestibility. Windell et al. (1978) noted some influence of water temperature (7 ºC, 11 ºC and 15 ºC) on dry matter, protein, lipid, carbohydrate or energy digestibility of a diet fed to rainbow trout of three size classes (19 g, 207 g and 585 g), most notably at the lowest temperature and with the smallest fish. The ration size fed to the fish has also been shown to influence digestibility assessment, but only at the highest feeding rates. The study by Windell et al. (1978) also examined the effect of varying ration size on diet digestibility with rainbow trout. In this study the fish fed the highest feed ration produced significantly lower digestibility values for dry matter, carbohydrate and energy, but not for protein or lipid. Variability in the digestibilities of diets during the period when fish are first fed a new diet has also been noted (Wybourne and Carter, 1999). Because of this, a period of adaptation to new diets it has been suggested as necessary prior to faecal sample collection (Allan et al., 1999; Burel et al., 2000). The length of this period varies among researchers, although the data from Wybourne and Carter (1999) suggests that, as there was sufficient reduction in variability of digestibility assessments of most diets after four

Ingredient evaluation in aquaculture

397

days, collection could be commenced from day five. Most researchers use a minimum of seven days as an acclimation period (Allan et al., 1999; Glencross et al., 2005).

13.3.4 Calculating diet and ingredient digestibilities The calculation of digestibilities (either diet or ingredient) allows the determination of the apparent digestibility, based on the ratio of marker in the diet and faeces. The apparent digestibility coefficient (ADCdiet) of a specific nutritional variable is based on the following formula (Eq. 13.1): ⎛ Marketdiet × Nutrient faeces ⎞ ADCdiet = 1 − ⎜ ⎝ Market faeces × Nutrient diet ⎟⎠

[13.1]

In this equation the terms Markerdiet and Markerfaeces represent the marker content of the diet and faeces respectively, and Nutrientdiet and Nutrientfaeces represent the nutritional parameter of concern (e.g. protein or energy) in the diet and faeces respectively. With this formula, values would typically range from 0 to 1. Values greater than 1 or less than 0 are indications of errors. To achieve a percent apparent digestibility the equation should be multiplied by 100. To calculate the digestibility of a test ingredient, as might be done with the IRM ingredient digestibility method, the following equation is used (Eq. 13.2): Nutr. ADingredient =

[ ADtest × Nutrtest − ( ADbasal × Nutrbasal × 70%)] 30% × Nutringredient

[13.2]

In Eq. 13.2, the Nutr.ADingredient is the digestibility of a defined nutrient from the test ingredient when included in the test diet at 30 %. The ADtest is the apparent digestibility of the test diet. The ADbasal is the apparent digestibility of the basal diet, which in this example makes up 70 % of the test diet. In Eq. 13.2 the NutrIngredient , Nutrtest and Nutrbasal are the level of the nutrient of interest in the ingredient, test diet and basal diet, respectively. This equation was published in the aquaculture nutrition literature by two separate authors around the same time, and, although the specific mathematics used by each author to express this equation was slightly different, they in essence presented the same concept (Sugiura et al., 1998; Forster, 1999). One of the assumptions with the calculation of ingredient digestibility coefficients is that they will fall between 0 and 100 %. This is not always the case, but, unlike for diet digestibilities, it is not necessarily indicative of errors, although analytical errors for markers or nutrients, poor mixing of the marker in the diet or ‘non-representative’ samples of diet or faeces or can be real sources of error. Another possibility is the interaction between ingredients (more specifically dietary nutrients) to produce non-additive effects. It is suggested that when these values are determined that they be reported as calculated, but for calculating the

398


digestible energy or nutrient basis they should be rounded to 0 if negative or to 100 if greater than 100. There are several other assumptions used in the digestibility assessment process. As discussed earlier, it is assumed that digestible coefficients are additive, which means that if you sum the proportional digestibility values for each ingredient in a diet, then it should equal the measured digestibility of the diet. This assumption relies on there being no interactions among ingredients that differentially affect digestibility, and that changing the inclusion content of a particular ingredient does not change its digestibility either. However, neither of these assumptions holds true all the time. There have been several studies using a range of different ingredients where the assumption of additivity has been questioned (Wilson and Poe, 1985; Watanabe et al., 1996). While ingredients that are rich in ash, protein and/ or lipid usually produce results that are additive, the presence of carbohydrates (including different starch and fibre classes) adds a degree of complexity and potential departure from additivity (Glencross et al., 2007a). There is an increasing body of evidence that shows that certain fibre types can influence the digestibility process (Glencross et al., 2003a, 2008a). The inertness of the marker used to calculate apparent digestibility, being able to pass through the digestible tract without influencing digestion and at approximately the same rate as the rest of the digesta is another assumption. Chromic oxide has traditionally been the most commonly used marker. It has been claimed that its inclusion affects both carbohydrate and lipid digestibility (Ringo, 1995; Shiau and Liang, 1995); however, the effect was not consistent with all species as no affect on carbohydrate digestibility with gilthead sea bream was reported in a similar study by Fernandez et al. (1999). As a quality control mechanism the use of a standard reference ingredient in digestibility experiments is recommended. This also provides a useful way to standardise and assist in the assessment of the temporal and interlaboratory variance. Ingredients such as vitamin-free casein, enzymaticallyhydrolysed casein, wheat gluten and lupin kernel meals have previously been used for this purpose (Glencross et al., 2005, 2008a). Glencross et al. (2008a) demonstrated that use of such a reference ingredient and also reference diets was a good way to standardise digestibility assessments over time and managed to produce data with a coefficient of variation of 7.4 % and 4.2 % (for protein and energy digestibility, respectively) from seven experiments over a three-year period for a reference lupin kernel meal, while reference diet digestibility variance over the same experiments had even lower coefficients of variation of 1.3 % and 1.4 % (for protein and energy digestibility, respectively).

13.3.5 Species effects on the digestibility assessment process The comparability of digestibility data across species has shown contrasting results. A study comparing the diet and ingredient digestibility of a series


399

of diets and ingredients fed to rainbow trout and Atlantic salmon found a high degree of correlation between energy digestibilities (Fig. 13.1), but somewhat less correlation between protein digestibilities (Glencross et al., 2004b). It was argued that the poorer correlation between the protein digestibilities was attributable to the low variability among protein digestibilities in either species. It was suggested that the diet and ingredient digestibilities of a species such as rainbow trout could be reasonably applied to other carnivorous species like Atlantic salmon. However, how broadly this could be applied to other fish species (including other carnivores or even omnivores), or even the same species but comparing fresh and salt water, remains to be tested. In contrast to the results between rainbow trout and Atlantic salmon, a comparison of the ingredient digestibilities between rainbow trout and black tiger shrimp (Penaeus monodon) showed poor correlation (Glencross et al., 2008b). Diet digestibilities in this case were not examined because different formulations were used for either species, but the same test ingredients were used in each series of diets (Fig. 13.2). This poorer correlation could be attributed to a wide range of factors including, but not limited to, species, diet formulation and faecal collection method differences.

13.4 Ingredient palatability If the ingredient has a negative effect on feed intake then, irrespective of how digestible the nutrients and energy from a particular ingredient might be, it is of limited use in a feed formulation. Although there may be strateDiet Atlantic salmon ADC

Atlantic salmon ADC

1.000 0.950 0.900 0.850 0.800 0.750 0.700 0.800 0.850 0.900 0.950 1.000 (a)

Rainbow trout ADC

(b)

Ingredient 1.400 1.300 1.200 1.100 1.000 0.900 0.800 0.700 0.600 0.600 0.700 0.800 0.900 1.000 1.100 Rainbow trout ADC

Fig. 13.1 Correlations among diet (a) and ingredient (b) digestibilities of the same diets when fed to either Atlantic salmon at 14 ºC or rainbow trout at 15 ºC. Shown are the nitrogen (•), energy ( ) digestibilities. Equations for regression functions are: diet nitrogen digestibilities: y = 0.7619x + 0.1996, R2 = 0.1406; energy digestibilities: y = 1.354x − 0.3263, R2 = 0.9845. Ingredient nitrogen digestibilities y = −2.0838x + 3.1163, R2 = 0.2931, energy digestibilities: y = 1.5431x − 0.3528, R2 = 0.8131. Data reproduced from Glencross et al. (2004b).

400

New technologies in aquaculture 1.000

Shrimp ADC

0.900

0.800

0.700

0.600 0.500

0.600

0.700

0.800

0.900

1.000

1.100

Rainbow trout ADC

Fig. 13.2 Correlations among protein digestibilities of the same lupin kernel meals when fed to either black tiger shrimp or rainbow trout. Equations for regression function are: energy digestibility, y = 0.3191x + 0.5548, R2 = 0.6746; nitrogen digestibility, y = 0.0242x + 0.9155, R2 = 0.106. Data reproduced from Glencross et al. (2008b).

gies to avert or resolve palatability problems with certain feed ingredients using ingredient processing or feeding stimulants, clearly it is better if these problems can be avoided outright. For nutritional research to carry any credibility it has to be based on the actual ingestion of nutrients by an organism; therefore one of the key assessment criteria in research should be some demonstration or assessment of food intake by the animal (Jobling et al., 1995). Based on such an assessment it then becomes valid to base a measurement of a response by the animal relative to that feed intake. However, assessing feed intake, particularly for aquatic animals, is not necessarily straightforward or a simple parameter to measure. For an animal to demonstrate variability in feed intake to a diet, it must be given the opportunity to refuse feed. Therefore ensuring that the ration fed is above apparent satiety is important. Feed preference studies are one way of assessing affects on intake. A simple method published by Helland et al. (1996) provides an easy way of determining feed intakes in tanks of fish. By feeding to excess and simply collecting the uneaten feed and using compensation factors to account for solubilisation losses, a reasonable estimate of feed intake can be achieved. This method has strengths over fixed ration feeding regimes in that it allows for an element of self-discrimination of the feeds by the fish. A more advanced method, the use of self-feeding through computer-managed feedback response mechanisms, is another option that has been frequently used to allow discrimination of feeds by fish and certainly assists in removing human error from the feed intake assessment process (Juell, 1991; Boujard and Le Gouvello, 1997). In exam-


401

45 40 35 30 25 20 15 10 5 0

60 50 40 30 20 0 1

2

0.5 % 3

4

5 Day

(a)

10

1.0 % 6

7

8

9

0 0.0 0.5 1.0 Inclusion of sodium sulfamerazine (%) (b)

Cumulative feed intake (g/fish/28d)

Feed intake (g/tank)

ining the feed intake response of fish to a novel diet, the use of appropriate control treatments, such as those with palatability inhibitors such as sulfamerazine sodium (Boujard and Le Gouvello, 1997; Glencross et al., 2006), provides an extra degree of confidence in the ability to discern feed intake variability (Fig. 13.3). Many experiments specifically designed to examine serial inclusion of a particular ingredient end up with no significant effects on either growth or feed intake. While this is often used to argue that the ingredient is palatable to the test animal up to the inclusion level studied, it can be difficult to determine the degree of confidence in such results when the experiments are run without controls designed to demonstrate a specific effect, such as a decrease in feed palatability. Feed intake variability over time can also be an important issue to consider (Fig. 13.3). It was noticed that adaptation to some diets occurred slower than others, and it was suggested that this was primarily a sensory discrimination by the animal against certain feeds until it had become accustomed to them (Glencross et al., 2006). To enable such an examination in feed intake variability an assessment of the daily feed intake of individual replicate tanks is advantageous. Ingredient inclusion studies are the simplest way to examine effects on feed intake. In this strategy an ingredient is included into a series of test diets at increasing inclusion levels and then the reference and test diets are fed to apparent satiety to replicate groups of fish for a period of time. Differences in feed intake between the reference and test diet, it can then be argued, are reflective of the apparent palatability due to the test ingredient. However, the issue of how much of a test ingredient should be included in test diets is somewhat subjective. Ideally a range of inclusion levels that cover what would be the practical inclusion levels should be used as this

Fig. 13.3 Daily feed intake (a) by tanks (n = 3) of rainbow trout (n = 20/tank) fed diets with either 0 %, 0.5 % or 1.0 % sodium sulfamerizine in the diet and the same dietary treatments represented as cumulative feed intake (b) per fish over a 28 day period. Data derived from Glencross et al. (2006).

402


also allows examination of critical palatability levels or break-points in a practical context (Shearer, 2000).

13.5 Defining effects on growth and utilisation A third important issue to resolve for ingredient evaluation is in determining the capacity of the animal to use the digested nutrients for growth. However, there are many elements to be considered in defining growth. At its simplest this constitutes the gain in weight by an animal; it can also be extrapolated to other features such as protein and energy retention, feed use efficiencies and even molecular factors such as gene and/or specific protein expression.

13.5.1 Measuring growth The initial weight and size variability of the animals used in the study has an important bearing on the capacity of a study to determine significant effects. As a means of improving experimental power it is important to limit variance where possible. Front-end variance control can be managed by ensuring all fish weighed into a replicate (and across replicates) are from within one standard deviation of the mean. In addition to variance management controls, use of adequate replication or designs to provide significant experimental power to be able to discern effects being studied is another critical consideration (Searcy-Bernal, 1995). Generally, a minimum of three replicates should be considered mandatory for growth studies; however, if a regression relationship is being sought, then it may sometimes be more prudent to reduce the replicates to enable a greater number of treatments to be included. This is because in regression studies the power is derived from the range of treatments employed, not only the confidence of the assessment within each treatment (Shearer, 2000). Growth in nutritional experiments is generally defined as the difference between initial and final live-weights. More specifically this should be defined as live-weight gain. Live-weight gain is also often reported as percentage gain, which is usually expressed as a percentage of the final weight divided by the initial weight. For such measures as this, it is imperative that the specific initial weights of each replicate are used in any statistical analysis such as a covariance analysis. For a measure of growth to be considered a ‘growth rate’ it has to be time specific. The three most routinely used growth rate assessments are daily gain (DG), daily growth coefficient (DGC) and specific growth rate (SGR). Daily gain is the simplest of the three rates and is a measure of the live-weight gain over time. Daily growth coefficient in contrast is calculated based on a percentage of the one third root transformation of the final (Wf) and initial (Wi) live-weights over time (t) (Eq. 13.3) (Kaushik, 1998):


DGC = [(Wf1 3 − Wi1 3 ) t ] × 100

403 [13.3]

Thermal growth coefficient (TGC) is another growth rate parameter which is derived from the DGC, but the time component is expanded to be considered on a temperature basis. In this regard, the time component of the TGC is multiplied by the average temperature (ºC) over the period of the study (t) (Cho and Bureau, 1998) (Eq. 13.4): TGC = [(Wf1 3 − Wi1 3 ) ( t × °C )] × 100

[13.4]

A limitation to this descriptor is that it is only valid if used in the temperature range of the animal where its response to temperature is linear. As temperature approaches the animal’s optimum for growth, any further increases in temperature will not correspond to an actual increase in growth rate of the animal but should if based on a TGC. Because of this the temperature limits of TGC need to be recognised. Specific growth rate is another weight transformation often used to describe growth and is calculated based on a percentage of the natural logarithm transformation of the final and initial live-weights over time (Kaushik, 1998). However, the point of using a growth rate descriptor is to attempt to standardise the assessment and potentially allow for some comparability of performance across experiments. To achieve this, the growth rate assessment needs to provide some independence from fish size. Kaushik (1998) compared both DGC and SGR for a range of fish sizes and noted that SGR did not provide as good a transformation of growth rates when compared to that provided by using DGC. It was concluded that if such a growth rate descriptor is required, then DGC is more appropriate than SGR. However, if the initial weights of the animals are provided, then actual weight accrual as gain per day (DG) is perhaps just as, if not more, practical.

13.5.2 Survival Animal losses that occur during an experiment are usually expressed as a percentage survival. This survival is determined based on the number of individuals surviving at the end of a study relative to the number included in the study at the beginning. Unless the percentage is divided by the time of the experiment, survival should not be reported as a rate.

13.5.3 Feed conversion efficiency For an assessment to be made on the nutritional utilisation of a diet and, by referral, of an ingredient, there is a clear need to measure feed intake. Feed intake by fish is often reported as both an amount (g/fish) and rate (g/fish/d). However, truly accurate assessment of feed intake by fish is one of the more difficult aspects of aquaculture research to achieve. The

404


efficiency of food use by fish is usually reported as either feed conversion efficiency (FCE: Eq. 13.6) or food conversion ratio (FCR: Eq. 13.7). These assessments are usually made on a dry weight of food and live-weight of fish basis. Because these variables rely on both live-weight gain and feed intake assessment they assume the errors of both assessments. FCE = (Weight gain) ( Feed consumed)

[13.5]

FCR = ( Feed consumed) (Weight gain)

[13.6]

Energy gain (kJ / kg0.8/ d)

13.5.4 Nutrient retention To determine the efficiency by which nutrients and energy are retained from feeds, an assessment of the nutrient and energy composition of both the feed and fish is required, and this is needed on an as-fed and live-weight basis respectively. However, efficiency data can be strongly influenced by animal size, with smaller animals typically being far more efficient at retaining both nutrients and energy than larger fish of the same species (Glencross, 2008). An advancement on this is the determination of the partial efficiencies of protein and/or energy utilisation. This examines the relationship between digestible nutrient/energy intake and somatic accretion of that nutrient/energy, the coefficient of that relationship equating the partial utilisation efficiencies (Fig. 13.4). Typically, this parameter has 200

R

150

H S

100 50 0 0

100

200

300

–50 –100 Digestible energy intake (kJ/ kg0.8/ d)

Fig. 13.4 Energy retention by rainbow trout with varying levels of digestible energy intake from diets with 300 g/kg inclusion levels of a lupin protein concentrate dried using either heat (H) or spray-drying (S) relative to a diet with fish meal (R) as the only protein source. Each data point is based on data derived from the mean of four replicates for each diet ration level. Data derived from Glencross et al. (2007b). Energy partial utilisation efficiencies above 100 kJ/ kg0.8/d intake for the R and S diets were estimated at 69.3 %. Energy partial utilisation efficiencies above 100 kJ/kg0.8/d intake for the H diet was estimated at 61.5 %.


405

been determined to underpin bioenergetic models of fish growth and feed utilisation (Glencross, 2008). However, variants on this design have been used to examine the effect of ingredients on diet partial utilisation efficiencies (Glencross et al., 2007b). The forecast benefit of this is that it will better enable diet formulations with those ingredients to be used in models of nutrient and energy accumulation by fish. The apparent biological value (ABV) is a parameter derived from nutrient and energy retention values based on digestible nutrient and energy intake (Morales et al., 1994). Typically, ABV provides some assessment of the proportion of the nutrients or energy absorbed from the diet that is actually used for tissue growth. Clearly for this parameter to be estimated an assessment of the diet nutrient and energy digestibilities is required.

13.5.5

Factors likely to affect nutrient and energy utilisation of ingredients There are a range of factors that have the potential to affect nutrient and energy utilisation of ingredients. Among these are ANF, protein damage and amino acid limitations. ANF have the potential to cause significant problems to nutrient and energy utilisation by fish by interfering with digestion, palatability or even cellular function (Francis et al., 2001). In defining the effects of ANF on fish there have been a variety of experimental strategies examined, and these vary primarily based on the mode of action of the ANF being studied (Krogdhal et al., 1994; Refstie et al., 1998; Burel et al., 2001). For a detailed review on the variety and effects of ANF read Francis et al. (2001). The effect of protein damage on a range of lupin protein concentrates (LPC) dried using different techniques was examined by Glencross et al. (2007b). When excessive heat was used to dry an LPC it was shown that the ability of the fish to convert the digestible energy to retained energy was reduced compared to that from an LPC produced using less aggressive drying methods such as spray-drying (Fig. 13.4). The heat-damaged LPC was presumed to have had reduced nutritional value because of Mailliard reaction products, where carbohydrates condense with the free amino groups of lysine residues on the protein and render those amino acids unavailable for utilisation (Oste and Sjodin, 1984). Techniques can be developed to measure the degree of Mailliard products through a measuring the relative amounts of available lysine (Rutherfurd et al., 1997; McCafferty and Dods, 2008) (Fig. 13.5). Amino acid limitations can also limit the potential protein and energy utilisation by affecting the animal’s capacity to sustain growth potential. Specific ratios are required between the essential (indispensible) amino acids in the diet to allow protein synthesis to occur to its maximum potential (Kaushik, 1998). Typically, these ratios are referenced against the amount of dietary lysine, which is usually regarded as the first limiting amino acid

406


4 Homoarginine (available lysine)

5 4 3

Lysine (unavailable lysine, freed by hydrolysis)

2 1 0 0

2

4

6

8

10

12

14

Time (min)

Fig. 13.5 Chromatogram from a reactive lysine assay showing the homoarginine (available lysine content) and the lysine (unavailable lysine content) from a lupin protein concentrate sample. Data reproduced from McCafferty and Dods (2008).

in most practical diets. If an ingredient is included in a diet such that any one of the ten essential amino acids falls below the specific ratio required, then this amino acid becomes the limitation in protein synthesis and therefore growth. Concise experimental effects of such limitations due to an ingredient inclusion are rare, but have been demonstrated (Glencross et al., 2003b).

13.5.6 Gene and protein expression A modern aspect to the evaluation of nutritional effects on fish performance has been through the advent of nutrigenomics (Panserat et al., 2001, 2007). This aspect of nutritional evaluation has also had some application to the assessment of ingredients in fish diets, by allowing an examination of changes occurring at the molecular level (Kolditz et al., 2007; Lilleeng et al., 2007; Panserat et al., 2008). The two main streams of molecular science applied to ingredient assessment in fish diets have been genomics and proteomics, where gene and protein expression, respectively, are examined as a consequence of dietary treatments. Arguably proteomics has more direct relevance to animal function because it explores the actual functional changes occurring in protein expression within the cell (Vilhelmsson et al., 2004; Kolditz et al., 2008). In contrast, genomics explores the expression of genes through transcriptional processes, which still has to rely on transla-


407

tional processes to allow its effects to be mediated upon the animal (Panserat et al., 2008). This branch of science also offers some interesting capabilities to the examination of the extent of the influence of microbial populations in the gut of fish as a function of ingredient choice (Pond et al., 2006; Ringo et al., 2006; Lilleeng et al., 2007).

13.5.7

Biochemical, histological and sensory factors in ingredient evaluation One of the primary biochemical evaluations undertaken in ingredient evaluation studies is the systematic comparison of the effects of dietary treatments on whole somatic or organ specific composition (Shearer, 1994; Booth and Allan, 2003). Notably, whole somatic composition analysis is required for the examination of nutrient/energy utilisation efficiency and/or apparent biological value assessments. In addition to this more standard biochemical assessment, other biochemical parameters such as changes in blood glucose levels or thyroid hormone levels (triiodothyronine and thyroxine) or enzyme activities have also been used to provide an indication of disruption to the metabolic function and nutrient utilisation by fish (Burel et al., 2001). There is a range of other hormone assays that can be examined, including hormones such as somatatropin and insulin-like growth factor 1, which have been used as a correlates of synthetic activity in fish (Dyer et al., 2004; Bakke-McKellup et al., 2007). An evaluation of immune responses and parameters associated with an immune challenge has also been effectively used in recent times to examine nutritional treatments, and further expansion in this area would add value (Krogdhal et al., 2000; Bakke-McKellup et al., 2007; Olsen et al., 2007; Stone et al., 2008). Assessment of tissue histology has also provided useful insights into examining some of the more long-term and chronic effects of ingredient and ANF inclusion in fish diets (Krogdhal et al., 2000; Bakke-McKellup et al., 2007; Uran et al., 2007). Some specific parameters, such as gastrointestinal enteritis problems associated with use of soybean meals, are a particular case in example (Krogdhal et al., 2000; Uran et al., 2007). Typically, studies use an arbitrary scoring system to rate degrees of cellular change, and this scoring system is then used to compare different dietary treatments. Sensory or organoleptic properties, while not a common assessment parameter in nutritional research on ingredients, have been used to evaluate the potential impact of novel ingredients on product quality aspects. Such assessments have been more prevalent with studies on fish oil replacement than for fish meal replacement, but some reports on influences of products such as rendered meat meals do exist (Thomassen and Rosjo, 1989; Williams et al., 2003b).

408


13.6 Ingredient functionality and feed technical qualities Functionality of feed ingredients relates to their effects on the physical properties of the processed feed (Thomas and van der Poel, 2001; Hawkins et al., 2008). Irrespective of how good the nutritional value of an ingredient may be, if it cannot functionally be incorporated into a feed, or reduces the physical qualities of the feed, then its value as an ingredient is diminished. Key attributes sought are those where pellets produced from the formulation result in a product with properties that provide advantages for feeding aquatic species. These properties include aspects such as sinking rates, pellet durability, degree of starch gelatinisation and oil absorption capacity. Experimental extrusion processing is the most practical way to evaluate ingredient functionality, as the results have direct implications for a final product. In these studies, a hypothetical formulation including a test ingredient is run through an extruder and the properties of the pellets produced are compared against either a reference formulation or a series of target specifications (e.g. Fig. 13.6).

13.7 Frontier technologies for ingredient evaluation

Crush force (g)

As increasing pressure on fishery resources occurs there will be a shift towards the consistent use of alternative ingredients in most aquaculture feeds. Already there is substantial scope for the use of many plant and

9000

Soybean

8000

L. angustifolius

7000

L. luteus

6000 5000 4000 3000 2000 1000 0 0

100

200

300

400

Ingredient inclusion level (g/kg)

Fig. 13.6 Pellet hardness (g force to crush) from extruded diets with increasing levels of soybean or kernel meals from Lupinus angustifolius and Lupinus luteus lupin varieties. Pellet hardness is one of several physical properties of benefit to extruded fish feeds. The data show that different ingredients when included in diets at similar inclusion levels can have dramatically different effects on the physical properties of feed pellets. Data derived from Hawkins et al. (2008).


409

animal meals and oils as alternatives (Gatlin et al., 2007). This increasing use of alternatives will also introduce a greater array of challenges, the foremost being the reliable, accurate and rapid assessment of the nutritional value of each alternative nutrient source prior to its inclusion in a formulation. The use of rapid analysis techniques for ingredient composition, such as near-infrared spectroscopy (NIRS), has considerable potential to improve the basis for diet formulation from variable batches of raw ingredients. Although NIRS has gained almost routine use in many feed companies for the evaluation of crude protein, moisture and fat composition of ingredients and products, it has also begun to be used for the assessment of digestible nutrients and energy from ingredients and diets (Aufrere et al., 1996). Despite some good attempts at in vitro assessment of ingredient quality, routine assays using such technology are still to be adopted (Anderson et al., 1993; Carter et al., 1999). While such in vitro techniques do not offer the same potential turnaround as NIRS they are still significantly quicker and cheaper than in vivo studies. Accordingly further work on this area remains a priority. The use of nutritional modelling techniques to understand interactions among different compounds is another frontier to be explored. While recent studies have shown that specific interactions among compositional features of some plant ingredients affect their nutritional value, this is by no means the only source of variation in nutritional quality (Fairbairn et al., 1999; Glencross et al., 2008a). Furthermore it is likely that the causes of this variability in nutritional quality may vary between different ingredients and that, in many cases, there are also likely to be more than just two single factors that affect such nutritional qualities and therefore using modelling methods not only to identify them but also to describe them will be a significant advance forward in understanding ingredient limitations (Fig. 13.7). There are numerous other issues that also remain to be resolved. Improving our understanding of amino acid utilisation from different ingredients will improve the ability to formulate diets on an available amino acid basis (El-Haroun and Bureau, 2007). Further documentation on the critical threshold and biological effects of the various ANF is still required for many species (Francis et al., 2001). Similarly, the development of rapid assessment methods for the influence of ingredients on animal health is another need, and the use of molecular and biochemical techniques has much to offer in this regard (Aslaksen et al., 2007; Lilleeng et al., 2007). Improving our understanding of the nutritive values of ingredients will not only consolidate our confidence in using a broader range of ingredients, but also provide a more robust way of estimating the economic value on specific ingredients for inclusion in aquaculture feeds.

410


50 45–50

45

40–45

40 Lupin meal digestible protein (%)

35–40

35

30–35

30

25–30

25

20–25

20

15–20

15

10–15

10

5–10

5

0–5

0 0.1

0.4

0.7

Lupin meal lignin (%)

1.0

1.3

1.6

1.9 30

33

36

39

42

45

48

Lupin meal crude protein (%)

Fig. 13.7 The modelled relationship between lupin kernel meal protein content and lignin content as it affects the digestible protein content of lupin kernel meals. Figure reproduced from Glencross et al. (2008a).

13.8 References aksnes a, hjertnes t and opstvedt j (1996) Comparison of two assay methods for determination of nutrient and energy digestibility in fish, Aquaculture, 140, 343–59. allan gl, parkinson s, booth ma, stone daj, rowland sj, frances j and warnersmith r (2000) Replacement of fish meal in diets for Australian silver perch Bidyanus bidyanus: I. Digestibility of alternative ingredients, Aquaculture, 186, 293–310. anderson jsl, anderson dm and mcniven ma (1993) Evaluation of protein quality in fish meals by chemical and biological assays, Aquaculture, 115, 305–23. aoac (2005) Official Methods of Analysis of the Association of Official Analytical Chemists 18th edn, Association of Official Analytical Chemists, Washington, DC. aslaksen ma, kraugerud of, penn m, svihus b, denstadli v, jorgensen hy, hillestad m, krogdahl a and storebakken t (2007) Screening of nutrient digestibilities and intestinal pathologies in Atlantic salmon, Salmo salar, fed diets with legumes, oilseeds, or cereals, Aquaculture, 272, 541–55. aufrere j, graviou d, demarquilly c, perewz jm and andrieu j (1996) Near infrared reflectance spectroscopy to predict energy value of compound feeds for swine and ruminants, Animal Feed Science and Technology, 62, 77–90. austreng e (1978) Digestibility determination in fish using chromic oxide marking and analysis of different segments of the gastrointestinal tract, Aquaculture, 13, 265–72. austreng e, storebakken t, thomassen ms, refstie s and thomassen y (2000) Evaluation of selected trivalent metal oxides as inert markers used to estimate apparent digestibility in salmonids, Aquaculture, 188, 65–78.


411

bakke-mckellup am, koppang eo, gunnes g, sanden m, hemre g-i, landsverk t and krogdahl a (2007) Histological, digestive, metabolic, hormonal and some immune factor responses in Atlantic salmon, Salmo salar L., fed genetically modified soybeans, Journal of Fish Diseases, 30, 5–79. booth ma and allan gl (2003) Utilization of digestible nitrogen and energy from four agricultural ingredients by juvenile silver perch Bidyanus bidyanus, Aquaculture Nutrition, 9, 317–26. booth ma, allan gl, frances j and parkinson s (2001) Replacement of fishmeal in diets of silver perch: VI. Effects of dehulling and protein concentration on the digestibility of four Australian grain legumes in diets for silver perch (Bidyanus bidyanus), Aquaculture, 196, 67–85. boujard t and le gouvello r (1997) Voluntary feed intake and discrimination of diets containing a novel fluoroquinone in self-fed rainbow trout, Aquatic Living Resources, 10, 343–50. bureau dp, harris am and cho cy (1999) Apparent digestibility of rendered animal protein ingredients for rainbow trout (Oncorhynchus mykiss), Aquaculture, 180, 345–58. bureau dp, harris am and cho cy (2000) Feather meals and bone meals from different origins as protein sources in rainbow trout (Oncorhynchus mykiss), Aquaculture, 181, 281–91. burel c, boujard t, corraze g, kaushik sj, boeuf g, mol ka, van der geyten s and kuhn er (1998) Incorporation of high levels of extruded lupin in diets for rainbow trout (Oncorhynchus mykiss): nutritional value and effect on thyroid status, Aquaculture, 163, 325–45. burel c, boujard t, tulli f and kaushik s (2000) Digestibility of extruded peas, extruded lupin, and rapeseed meal in rainbow trout (Oncorhynchus mykiss) and turbot (Psetta maxima), Aquaculture, 188, 285–98. burel c, boujard t, kaushik sj, boeuf g, mol ka, van der geyten s, darras vm, kuhn er, pradet-balade b, querat b, quinsac a, krouti m and ribaillier d (2001) Effects of rapeseed meal glucosinolates on thyroid metabolism and feed utilisation in rainbow trout, General and Comparative Endocrinology, 124, 343–58. carter cg, bransden mb, van barneveld rj and clarke sm (1999) Alternative methods for nutrition research on the southern bluefin tuna, Thunnus maccoyii: In vitro digestibility, Aquaculture, 179, 57–70. cho cy and bureau dp (1998) Development of bioenergetic models and the FishPrFEQ software to estimate production, feeding ration and waste output in aquaculture, Aquatic Living Resources, 11, 199–210. cho cy and kaushik sj (1990) Nutritional energetics in fish: Energy and protein utilisation in rainbow trout (Salmo gairdnerii), World Reviews of Nutrition and Dietetics, 61, 132–72. cho cy and slinger sj (1979) Apparent digestibility measurement in feedstuff for rainbow trout, in Halver JE and Tiews K (eds), Finfish Nutrition and Fishfood Technology, Vol. 2, Heenemann GmbH, Berlin, 239–47. choubert g, de la noue j and luquet p (1982) Digestibility in fish: improved device for the automatic collection of feces, Aquaculture, 29, 185–9. dyer ar, barlow cg, bransden mp, carter cg, glencross bd, richardson n, thomas pm, williams kc and carragher jf (2004) Correlation of plasma IGF-I concentrations and growth rate in aquacultured finfish: A tool for assessing the potential of new diets, Aquaculture, 236, 583–92. el-haroun er and bureau dp (2007) Comparison of the bioavailability of lysine in blood meals of various origins to that of L-lysine HCl for rainbow trout (Oncorhynchus mykiss), Aquaculture, 262, 402–9. fairbairn sl, patience jf, classen hl and zijlstra rt (1999) The energy content of barley fed to growing pigs: Characterising the nature of its variability and

412


developing predictive equations for its estimation, Journal of Animal Science, 77, 1502–12. fernandez f, miquel ag, martinez r, serra e, guinea j, narbaiza fj, caseras a and baanante iv (1999). Dietary chromic oxide does not affect the utilization of organic compounds but can alter the utilization of mineral salts in gilthead sea bream Sparus aurata, Journal of Nutrition, 129, 1053–9. forster i (1999) A note on the method of calculating digestibility coefficients of nutrients provided by single ingredients to feeds of aquatic animals, Aquaculture Nutrition, 5, 143–5. francis g, makkar hps and becker k (2001) Anti-nutritional factors present in plantderived alternate fish feed ingredients and their effect in fish, Aquaculture, 199, 197–227. gatlin dm, barrows ft, brown p, dabrowski k, gaylord tg, hardy rw, herman e, hu g, krogdahl a, nelson r, overturf k, rust m, sealy w, skonberg d, souza ej, stone d, wilson r and wurtele e (2007) Expanding the utilisation of sustainable plant products in aquafeeds: a review, Aquaculture Research, 38, 551–79. glencross bd (2008) A factorial growth and feed utilisation model for barramundi, Lates calcarifer based on Australian production conditions, Aquaculture Nutrition, 14, 36–73. glencross bd, boujard tb and kaushik sj (2003a) Evaluation of the influence of oligosaccharides on the nutritional value of lupin meals when fed to rainbow trout, Oncorhynchus mykiss, Aquaculture, 219, 703–13. glencross bd, curnow jg, hawkins we, kissil gwm and petterson ds (2003b) Evaluation of the feed value of a transgenic strain of the narrow-leaf lupin (Lupinus angustifolius) in the diet of the marine fish Pagrus auratus, Aquaculture Nutrition, 9, 197–206. glencross bd, hawkins we and curnow jg (2004a). Nutritional assessment of Australian canola meals. I. Evaluation of canola oil extraction method, enzyme supplementation and meal processing on the digestible value of canola meals fed to the red seabream (Pagrus auratus, Paulin), Aquaculture Research, 35, 15–24. glencross bd, carter cg, duijster n, evans de, dods k, mccafferty p, hawkins we, maas r and sipsas s (2004b) A comparison of the digestive capacity of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss) when fed a range of plant protein products, Aquaculture, 237, 333–46. glencross bd, hawkins we, evans d, mccafferty p, dods k, maas r and sipsas s (2005) Evaluation of the digestible value of lupin and soybean protein concentrates and isolates when fed to rainbow trout, Oncorhynchus mykiss, using either stripping or settlement faecal collection methods, Aquaculture, 245, 211–20. glencross bd, hawkins we, evans d, mccafferty p, dods k, jones jb, sweetingham m, morton l, harris d and sipsas s (2006) Evaluation of the influence of the lupin alkaloid, gramine when fed to rainbow trout (Oncorhynchus mykiss), Aquaculture, 253, 512–22. glencross bd, booth m and allan gl (2007a). A feed is only as good as its ingredients – A review of ingredient evaluation for aquaculture feeds, Aquaculture Nutrition, 13, 17–34. glencross bd, hawkins we, evans d, mccafferty p, dods k, and sipsas s (2007b) Heat damage during some drying techniques affects nutrient utilisation, but not digestibility of lupin protein concentrates fed to rainbow trout (Oncorhynchus mykiss), Aquaculture, 265, 218–29. glencross bd, hawkins we, vietch c, dods k, mccafferty p and hauler rc (2007c) Assessing the effect of dehulling efficiency of lupin (Lupinus angustifolius) meals


413

on their digestible nutrient and energy value when fed to rainbow trout (Oncorhynchus mykiss), Aquaculture Nutrition, 13, 462–70. glencross bd, hawkins we, evans d, rutherford n, mccafferty p, dods k, karopoulos m, veitch c, sipsas s and buirchell b (2008a) Variability in the composition of lupin (Lupinus angustifolius) meals influences their digestible nutrient and energy value when fed to rainbow trout (Oncorhynchus mykiss), Aquaculture, 277, 220–30. glencross bd, smith dm, carter cg (2008b) A comparison of the digestibility of lupin kernel meals when fed to rainbow trout (Oncorhynchus mykiss), Atlantic salmon (Salmo salar) and Black tiger shrimp (Penaeus monodon), in Glencross B (ed.), Aquaculture Feed Grains Program – Final Report, Department of Fisheries, Hillarys, WA, 453–70. gomes ef, rema p, kaushik sj (1995) Replacement of fish meal by plant proteins in the diet of Rainbow Trout (Oncorhynchus mykiss): digestibility and growth performance, Aquaculture, 130, 177–86. hawkins we, glencross bd, maas r, karopoulos m and hauler r (2008) Effect of lupin kernel meal inclusion on extruded salmonid pellet characteristics, in Glencross B (ed.), Aquaculture Feed Grains Program – Final Report, Department of Fisheries, Hillarys, WA, 471–95. helland s, grisdale-helland b and nerland s (1996) A simple method for the measurement of daily feed intake of groups of fish in tanks, Aquaculture, 139, 156–63. higgs da, mcbride jr, markert jr, dosanjh bs, plotnikoff md and clarke wc (1982) Evaluation of Tower and Candle rapeseed protein concentrate as protein supplements in practical dry diets for juvenile chinook salmon (Oncorhynchus tshawytscha), Aquaculture, 29, 1–31. ishikawa m, teshima s, kanazawa a and koshio s (1996) Evacuation of inert markers in digestibility determination, 5α-cholestane and chromic oxide, in the prawn Penaeus japonicus, Fisheries Science, 62, 229–34. jiang z (2001) Ingredient variation: Its impact and management, in van der Poel AFB, Vahl JL and Kwakkel RP (eds.), Advances in Nutritional Technology 2001. Proceedings of the 1st World Feed Conference, 7–8 November, Utrecht, Wageningen Academic, Wageningen, 47–56. jobling m, arnesen am, baardvik bm, christiansen js and jorgensen eh (1995) Monitoring feeding behaviour and food intake: methods and applications, Aquaculture Nutrition, 1, 131–43. juell je (1991) Hydroacoustic detection of food waste – a method to estimate maximum food intake of fish populations in sea cages, Aquacultural engineering, 10, 207–17. kaushik sj (1998) Nutritional bioenergetics and estimation of waste production in non-salmonids, Aquatic Living Resources, 11, 311–18. kaushik sj, cravedi jp, lalles jp, sumpter j, fauconneau b and laroche m (1995) Partial or total replacement of fish meal by soybean protein on growth, protein utilization, potential estrogenic or antigenic effects, cholesterolemia and flesh quality in rainbow trout, Oncorhynchus mykiss, Aquaculture, 133, 257–74. kolditz c, lefevre f, borthaire m and medale f (2007) Transcriptome and proteome analysis of changes induced in trout liver by suppression of dietary fish oil, FASEB J, 21(6), A1402-d-1403. kolditz c, borthaire m, richard n, corraze g, panserat s, vachot c, lefevre f, medale f (2008) Liver and muscle metabolic changes induced by dietary energy content and genetic selection in rainbow trout (Oncorhynchus mykiss), American Journal of Physiological Regulation and Integrated Comparative Physiology, 294, 1154–64.

414


krogdhal å, lea tb and olli jj (1994) Soybean proteinase inhibitors affect intestinal trypsin activities and amino acid digestibilities in rainbow trout (Oncorhynchus mykiss), Comparative Biochemistry and Physiology, 107A, 215–19. krogdhal å, bakke-mckellep am, roed kh and baeverfjord g (2000) Feeding Atlantic salmon Salmo salar L. soybean products: effects on disease resistance (furunculosis), and lysozyme and IgM levels in intestinal mucosa, Aquaculture Nutrition, 6, 77–84. lilleeng e, froystad mk, vekterud k, valen ec and krogdahl å (2007) Comparison of intestinal gene expression in Atlantic cod (Gadus morhua) fed standard fish meal or soybean meal by means of suppression subtractive hybridisation and real-time PCR, Aquaculture, 267, 269–83. maynard la and loosli jk (1969) Animal Nutrition, 6th edn. New York, McGraw-Hill. mccafferty p and dods k (2008) Developing an in-vitro assessment method for heat damage of proteins and feed quality determination, in Glencross B (ed.), Aquaculture Feed Grains Program – Final Report, Department of Fisheries, Hillarys, WA, 290–6. morales ae, cardenete g, de la higuera m and sanz a (1994) Effects of dietary protein source on growth, feed conversion and energy utilisation in rainbow trout, Oncorhynchus mykiss, Aquaculture, 124, 117–26. morales ae, cardenete g, sanz a and de la higuera m (1999) Re-evaluation of crude fibre and acid-insoluble-ash as inert markers, alternative to chromic oxide, in digestibility studies with rainbow trout, Oncorhynchus mykiss, Aquaculture, 179, 71–9. mwachireya sa, beames rm, higgs da and dosanjh bs (1999) Digestibility of canola protein products derived from the physical, enzymatic and chemical processing of commercial canola meal in rainbow trout, Oncorhynchus mykiss (Walbaum) held in freshwater, Aquaculture Nutrition, 5, 73–82. nengas i, alexis mn and davies sj (1999) High inclusion levels of poultry meals and related by-products in diets for gilthead seabream Sparus aurata L, Aquaculture, 179, 13–23. nrc (national research council) (1993) Nutrient Requirements of Fish, National Academy Press, Washington, DC. nir i and ptichi i (2001) Feed particle size and hardness: Influence on performance, nutritional, behavioural and metabolic aspects, in van der Poel AFB, Vahl JL and Kwakkel RP (eds.), Advances in Nutritional Technology 2001. Proceedings of the 1st World Feed Conference, Utrecht, November 7–8. Wageningen, 157–86. olsen re, hansen ac, rosenlund g, hemre gi, mayhew tm, knudsen dl, eroldogan ot, myklebust r and karlsen o (2007) Total replacement of fish meal with plant proteins in diets for Atlantic cod (Gadus morhua L.) II – Health aspects, Aquaculture, 272, 612–24. oste re and sjodin p (1984) Effect of Maillard reaction products on protein digestion. In vivo studies in rats, Journal of Nutrition, 114, 2228–34. panserat s, plagnes-juanm e and kaushik s (2001) Nutritional regulation and tissue specificity of gene expression for proteins involved in hepatic glucose metabolism rainbow trout (Oncorhynchus mykiss), The Journal of Experimental Biology, 204, 2351–60. panserat s, kirchener s and kaushik s (2007) Nutrigenomics, in Nakagawa H, Sato M and Gatlin D III (eds), Dietary Supplements for the Health and Quality of Cultured Fish, CABI, Reading, 210–29. panserat sp, kolditz c, richard ng, plagnes-juan e, piumi f, esquerré d, médale f, corraze g and kaushik s (2008) Hepatic gene expression profiles in juvenile rainbow trout (Oncorhynchus mykiss) fed fishmeal or fish oil-free diets, British Journal of Nutrition, 100, 953–67.


415

petterson ds, harris dj, rayner cj, blakeney ab and choct m (1999) Methods for the analysis of premium livestock grains, Australian Journal of Agricultural Research, 50, 775–87. pond mj, stone dm and alderman dj (2006) Comparison of conventional and molecular techniques to investigate the intestinal microflora of rainbow trout (Oncorhynchus mykiss), Aquaculture, 261, 194–203. refstie s, storebakken t and roem aj (1998) Feed consumption and conversion in Atlantic salmon (Salmo salar) fed diets with fish meal, extracted soybean meal or soybean meal with reduced content of oligosaccharides, trypsin inhibitors, lectins and soya antigens, Aquaculture, 162, 301–12. refstie s, glencross b, landsverk t, sørensen m, lilleeng e, hawkins w and krogdahl å (2006) Digestive function and intestinal integrity in Atlantic salmon (Salmo salar) fed kernel meals and protein concentrates made from yellow or narrow-leafed lupins, Aquaculture, 261, 1382–95. reverter m, lundh t, and lindberg je (1999) Ileal amino acid digestibilities in pigs of barley-based diets with inclusion of lucerne (Medicago sativa), white clover (Trifolium repens), red clover (Trifolium pratense) or perennial ryegrass (Lolium perenne), British Journal of Nutrition, 82, 139–47. ringø e (1995) Does chromic oxide (Cr2O3) affect faecal lipid and intestinal bacterial flora in Arctic charr, Salvelinus alpinus (L.)?, Aquaculture and Fisheries Management, 24, 767–76. ringø e, sperstad s, myklebust r, refstie s and krogdahl å (2006) Characterisation of the microbiota associated with intestine of Atlantic cod (Gadus Morhua L.): The effect of fish meal, standard soybean meal and a bioprocessed soybean meal, Aquaculture, 261, 829–41. rutherfurd sm, moughan pj and van osch l (1997) Digestible reactive lysine in processed feedstuffs: application of a new bioassay, Journal of Agricultural Food Chemistry, 45, 1189–94. searcy-bernal r (1995) Statistical power and aquacultural research, Aquaculture, 127, 371–88. shearer kd (1994). Factors affecting the proximate composition of cultured fishes with. emphasis on salmonids, Aquaculture, 119, 63–88. shearer kd (2000) Experimental design, statistical analysis and modelling of dietary nutrient requirement studies for fish: a critical review, Aquaculture Nutrition, 6, 91–102. shiau sy and liang hs (1995) Carbohydrate utilization and digestibility by tilapia Oreochromis niloticus x O. aureus, are affected by chromic oxide inclusion in the diet, Journal of Nutrition, 125, 976–82. smith dm and tabrett sj (2004) Accurate measurement of in vivo digestibility of shrimp feeds, Aquaculture, 232, 563–80. stone daj, allan gl, parkinson s and rowland sj (2000) Replacement of fish meal in diets for Australian silver perch, Bidyanus bidyanus. III. Digestibility and growth using meat meal products, Aquaculture, 186, 311–26. stone daj, gaylord tg, johansen ka, overturf k, sealey wm and hardy rw (2008) Evaluation of the effects of repeated fecal collection by manual stripping on the plasma cortisol leels, TNF-a gene expression, and digestibility and availability of nutrients from hydrolysed poultry and egg meal by rainbow trout, Oncorhynchus mykiss (Walbaum), Aquaculture, 275, 250–9. sugiura sh, dong fm, rathbone ck and hardy rw (1998) Apparent protein digestibility and mineral availabilities in various feed ingredients for salmonid feeds, Aquaculture, 159, 177–202. sugiura sh, babbit jk, dong fm and hardy rw (2000) Utilization of fish and animal by-product meals in low-pollution feeds for rainbow trout Oncorhynchus mykiss (Walbaum), Aquaculture Research, 31, 585–93.

416


thomas j and van der poel afb (2001) Functional properties of diet ingredients: Manufacturing and Nutritional Implications, in van der Poel AFB, Vahl JL and Kwakkel RP (eds), Advances in Nutritional Technology 2001. Proceedings of the 1st World Feed Conference, Utrecht, November 7–8, Wageningen, 109–22. thomassen ms and rosjo c (1989) Different fats in feed for salmon: influence on sensory parameters, growth rate and fatty acids in muscle and heart, Aquaculture, 79, 129–35. uran pa schrama jw, rombout jhwm, obach a, jensen l, koppe w and verreth jaj (2007) Soybean meal-induced enteritis in Atlantic salmon (Salmo salar L.) at different temperatures, Aquaculture Nutrition, 13, 1–7. vandenberg gw and de la noue j (2001) Apparent digestibility comparison in rainbow trout (Oncorhynchus mykiss) assessed using three methods of faeces collection and three digestibility markers, Aquaculture Nutrition, 7, 237–45. vilhelmsson ot, martin sam, medale f, kaushik sj and houlihan df (2004) Dietary plant-protein substitution affects hepatic metabolism in rainbow trout (Oncorhynchus mykiss), British Journal of Nutrition, 92, 71–80. watanabe t, takeuchi t, satoh s and kiron v (1996). Digestible energy: methodological influences and mode of calculation, Fish Science, 62, 288–92. williams kc, barlow cg, rodgers lj and ruscoe i (2003a) Potential of meat meal to replace fish meal in extruded dry diets for barramundi, Lates calcarifer (Bloch). I. Growth performance, Aquaculture Research, 34, 23–32. williams kc, patterson bd, barlow cg, ford a and roberts r (2003b) Potential of meat meal to replace fish meal in extruded dry diets for barramundi, Lates calcarifer (Bloch). II. Organoleptic characteristics and fatty acid composition, Aquaculture Research, 34, 33–42. wilson rp and poe we (1985) Apparent digestible protein and energy coefficients of common feed ingredients for channel catfish, The Progressive Fish Culturalist, 47, 154. windell jt, foltz jw and sarokan ja (1978) Effect of body size, temperature and ration size on the digestibility of a dry pelleted diet by rainbow trout, Transactions of the American Fisheries Society, 107, 613–16. wybourne ba and carter cg (1999) The effect of plant meal inclusion on feed intake and nutritional adaptation by Atlantic salmon, Salmo salar L, in Fishmeal Replacement in Aquaculture Feeds for Atlantic Salmon, Project 93/120, Fisheries Research and Development Corporation, Deakin, ACT 100–26.

14 Quantifying nutritional requirements in aquaculture: the factorial approach I. Lupatsch, Swansea University, UK

Abstract: Growth and the feed required to sustain this growth is of major importance in aquaculture. To improve productivity and profitability within this industry we must provide feeds that supply adequate levels of energy and protein in order to sustain efficient growth. In view of the diversification of fish farming a general approach is needed to define energy and protein requirements so that each fish species can realize its full growth and economic potential. Growth is usually defined as deposition of new body components, which in fish is predominately protein and lipid. In addition to the maintenance requirement the feed must supply the precursors for new tissue production, as well as the energy necessary for synthesis of both protein and lipid. Thus, the quantification of energy and protein requirement in the growing fish is the sum of the needs for maintenance and growth. The significance of this approach is that energy and protein needs are quantified in terms of absolute requirements per unit of body weight and weight gain and only subsequently expressed as a percentage of the diet. As energy and protein intake is a function of feed consumption and its composition, it is necessary to foresee the amount of feed the fish is physically able to consume in order to adjust the energy and protein content of a potential feed. From the comparison of several fish species it can be concluded, that utilization of energy and protein for deposition of weight gain do not appear to be very different across the species examined. Differences are found, however, in the magnitude and the composition of the weight gain, which ultimately determines the amount of energy and protein required. Key words: factorial modelling, energy utilization, protein efficiency, bioenergetics.

14.1 Introduction To improve productivity and profitability of aquaculture we have to provide feeds that supply adequate levels of energy and protein to sustain optimal

418


growth. Proper feed management is also crucial with regard to the aquatic environment, since feed that is neither consumed nor available to the fish will be lost to the effluent surroundings and will result in nutrient enrichment of the water body. Due to the shortage of fish meal and fish oil, alternative ingredients have to be chosen, but in order to utilize them appropriately the requirements of the fish have to be known. This can only be done by quantifying the key nutrient requirements of fish and evaluating the nutritional characteristics of the feed ingredients (composition, digestibility, limiting factors), so that least-cost formulations can optimize the balance between nutrient requirements and the cost of feeds. Nutrient requirements in fish are often quantified by dose–response relationships, where diets containing graded levels of a nutrient are fed and the resulting growth is measured. The quantitative requirement for the nutrient is then considered at the level below which the growth will be depressed or above which it will not increase (Zeitoun et al., 1976; Mercer, 1982). These methods, however, are time-consuming and limited in their broad application as the conditions under which the requirements were determined may not permit extrapolation (Baker, 1986). This fact is emphasized particularly in regards to effects of dietary protein and energy supply on performance in fish. Despite a vast body of information, results concerning the optimal protein requirement even for the same species are often not in agreement. Energy and protein requirements are very complex as they are closely linked. Without protein there is no growth, but neither is there growth without energy. Since protein can function as an energy source in addition to its essential role for growth, the optimal balance between the supply of dietary non-protein energy and protein should be determined. Considerable progress has been made in recent years in the study of the dietary nutrient requirements of fishes, mainly salmonids. Feeding charts for trout based on nutritional bioenergetics have been introduced by Cho and Kaushik (1990), Cho (1992) and Cho and Bureau (1998); however, information concerning the prediction of growth and energy and especially protein needs is still lacking for a number of fish species. Compared to terrestrial domesticated husbandry, which relies on a few selected species, aquaculture is utilizing an increasing variety of fish that show distinct differences with respect to feed requirements and conversion efficiencies. In addition, target species for aquaculture range in their feeding preferences from carnivorous, omnivorous to herbivorous. Thus, it is not always clear if differences in feed efficiencies that are reported for various species are due to true biological differences or the different conditions used in the various studies. One of the recurring questions in aquaculture is whether the farming of carnivorous species is sustainable. Carnivores are thought to require 45–50 % dietary protein while most omnivores and herbivores require only 24–32 % protein in their feeds. This gives the impression that herbivorous species are more efficient converters of protein into growth. However,

Quantifying nutritional requirements in aquaculture

419

protein requirements expressed solely on the basis of dietary inclusion levels are incomplete if feed intake is not considered. Protein intake is the product of the protein content of the feed and the total amount of feed consumed. As such, the protein demand per kg of fish produced will give a clearer picture of the overall efficiency of the species in question. The following is an attempt to quantify the nutritional requirements of fish that are very different in their natural feeding habitat, ranging from carnivorous to omnivorous, marine and freshwater. It focuses on species that are already well established in aquaculture like the gilthead sea bream (Sparus aurata), the European sea bass (Dicentrarchus labrax) and tilapia (Oreochromis sp.), and farmed all over the world in addition to new candidates like the white grouper (Epinephelus aeneus), the Asian sea bass (Lates calcarifer), also known as Barramundi, as well as the grey mullet (Mugil cephalus) (Lupatsch et al., 2001, 2003a,b; Lupatsch and Kissil, 2005). The factorial approach, which had been used in classical animal nutrition for decades to quantify requirements, is applied to assist in a better understanding of the underlying principles involved, and to point out not only the differences but also the common ground among fish species.

14.2 Quantification of nutritional requirements 14.2.1 Methodology Nutrient requirements are generally described for animals of a given age and for specific physiological functions, such as maintenance, reproduction or growth. In fish farming growth of fish flesh is one of the major goals of production. Growth itself is typically defined as deposition of new body components, which in fish consists mainly of protein, lipid and water. In addition to the requirement for maintenance, the feed must supply the precursors for synthesis of new tissue, and also the energy needed to deposit both protein and lipid. The following outlines the principles of the factorial approach for evaluating the energy and protein efficiencies for growth in fish. According to this, the energy and protein requirements are considered the sum for maintenance plus growth. The requirement for maintenance is mainly a function of the size of the fish and water temperature, and is proportional to the metabolic body weight in the form of a × BW(kg)b, where a is a constant, characteristic of a certain fish species at a set temperature and b is the exponent of the metabolic body weight. The requirement for growth is dependent on the amount and the composition of the weight gain, including the cost of energy to deposit the new growth. The actual requirement for dietary gross energy and protein must take into account the partial efficiency of utilisation of these nutrients for maintenance and for growth. The significance of this approach is that protein and energy needs are expressed primarily in terms of absolute

420


demand per fish body mass and anticipated weight gain. As energy and protein consumption is the product of feed intake and feed composition the voluntary maximum feed intake as well as the composition of the feed have to be considered. Feeds can then be formulated and feeding tables established which are based on daily requirements for energy and protein dependent on anticipated growth. The following equation specifies the formal approach to those calculations: requirement = a × BW ( kg ) + c × gain b

( kg )b: Metabolic body weight where a is the constant for given conditions (activity, temperature) expressed in kJ per unit of metabolic weight and characteristic of a fish species, b is the exponent of the metabolic body weight and converts absolute weight to metabolic weight correcting for the decrease in metabolic rate per unit of body weight as fish grow and c is the cost in units of energy or protein to deposit new growth. The parameters to obtain for quantifying the requirements in fish are thus the following: • growth data – to describe daily potential weight gain along the growth cycle at different temperatures; • feed intake – a prediction of the maximum voluntary feed intake; • change in body composition along the growth cycle; • maintenance requirements for energy and protein at different temperatures; • efficiency of utilization of dietary energy and protein to deposit energy and protein as growth.

14.2.2 Growth and feed intake We might assume that different fish have a genetically determined asymptotic body size and that they are capable of adjusting their feed or energy intake to realize their genetic potential. Thus, a prerequisite for estimating feed requirements of a newly cultured fish species is to define its maximal potential for growth. This modelling requires growth data from trials, where feed supply in terms of energy and nutrients is not limiting and optimal growing conditions are met. Therefore, one of the first steps to determine energy and protein demand should be to establish a simple growth model described for various water temperatures. As an example, the growth potential of tilapia is illustrated in Fig. 14.1 and as expected daily weight gain is strongly dependent upon increasing water temperatures. The equation defining this relationship between daily weight gain, fish size as well as temperature appears later in this section [Eq. 14.1].


421

Daily weight gain (g fish–1 day–1)

4.5 4.0 3.5 3.0 2.5 2.0 1.5

Temp 29 °C

1.0

Temp 26 °C Temp 24 °C Temp 22 °C

0.5 0.0 0

50

100

150 200 250 300 Fish weight (g)

350

400

450

Fig. 14.1 Daily weight gain (g) in relation to increasing body weights in tilapia fed to apparent satiation at increasing temperatures.

In contrast to terrestrial animals, fish seem to grow continuously. Growth does not cease and reaches an asymptote, which in aquaculture, however, might never be attained. Growth rates in aquaculture have been in the past typically described using the specific growth rate (SGR) or as absolute growth in g per day. As growth is affected by temperature like in all poikilotherms, it increases with increase in temperature up to an optimum above which growth decreases, until the upper lethal temperature is reached. Although SGR and absolute weight gain are dependent upon feed intake and water temperature, their main dependence is on the size of the fish, and as a result they cannot be compared among groups of fish having different weights. In studies with various fish species (Lupatsch et al., 2003a) growth along the growing cycle could be best described by using allometric equations relating the daily weight gain (y) dependent upon fish weight (x) with water temperature (T) as the additional variable. The voluntary feed intake in fish is expressed in a similar manner:

y = a × BW ( g ) × ec ×T b

This equation can be integrated as shown below and the weight BWt after t days can be predicted starting from BW0: BWt = [ BW0c 1 + c2 ⋅ ec 3⋅T ⋅ days]

c4

with c1 = (1 − b) c2 = (1 − b) ⋅ a

422

New technologies in aquaculture c3 = temperature coefficient c4 = 1 (1 − b)

To describe the growth especially for salmonids the thermal-unit growth coefficient (TGC) as suggested by Cho (1992) and based on the model proposed by Iwama and Tautz (1981) has gained relatively wide acceptance in fish nutrition research by using the following equation: Wt = [W00.333 + ∑ (TGC ⋅T ⋅ days)]

3

This equation in its general form is equivalent to the formulae for fish used in the present study (eqs 14.1–14.7), which of course is not too surprising as biological principles of fish growth should be the same. Nonetheless, the main difference is that weight exponents other than 1 − b = 0.333 are used in the growth models described here in contrast to the TGC model, thus they should result in a better description of the growth pattern observed across the life cycle of a fish species. The growth potential itself (and therefore the coefficients of the equation) would of course be typical for different fish species, and even different genetic strains, as described in eqs 14.1–14.7. As energy and protein intake is a function of feed intake as well as content of feed, it is necessary to predict the amount of feed that the fish is physically able to consume; this is needed to adjust the energy and protein content of a potential feed. Feeds can then be formulated and feeding tables established which are based on daily requirements for energy and protein dependent on anticipated growth. Figure 14.2 depicts the relationship between daily weight gain (g), feed intake (g) and the body weight (g) of gilthead sea bream. The lines describe the relationships at an average water temperature of 23 °C for both feed intake and weight gain. As can be seen, absolute weight gain as well as the amount of food eaten increases with increasing weight, while feed intake increases at a higher rate than weight gain. Examples of the growth potential of several species are summarized in the equations below together with an estimation of voluntary feed intake (eqs 14.1–14.8). In those studies fish were fed to satiation in a controlled system and the feed intake, depending on size and water temperature, determined (Lupatsch, 2003a,b; Lupatsch, 2008). Tilapia Weight gain = 0.0113 × BW ( g )

0.547

× e0.090 ×T

[14.1]

or Wt = ( W00.453 + 0.00512 × e0.090 ×T × days]2.207 Feed intake = 0.0156 × BW ( g )

0.600

× e0.085×T

[14.2]

Weight gain and feed intake (g fish–1 day–1)


423

5.0 Feed intake

4.5

Weight gain

4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0.0 0

50

100 150 200 250 300 350 400 450 500 Fish weight (g)

Fig. 14.2 Daily weight gain (g) and feed intake (g) in relation to increasing body weight in gilthead sea bream fed to satiation.

Gilthead sea bream Weight gain = 0.024 × BW ( g )

0.514

× e0.060 ×T

[14.3]

or Wt = ( W00.486 + 0.01166 × e0.060 ×T × days]2.060 Feed intake = 0.017 × BW( g )

0.652

× e0.064 ×T

[14.4]

× e0.030 ×T

[14.5]

White grouper Weight gain = 0.062 × BW ( g )

0.558

or Wt = (W00.442 + 0.0274 × e0.030 ×T × days]2.262 Feed intake = 0.058 × BW ( g )

0.600

× e0.027 ×T

[14.6]

Asian sea bass Weight gain = 0.0051 × BW ( g )

0.508

× e0.135×T

[14.7]

or Wt = (W00.492 + 0.0025 × e0.135×T × days]2.033 Feed intake = 0.0057 × BW ( g )

0.576

× e0.121×T

[14.8]

424


14.2.3 Composition of weight gain As a large proportion of the energy and protein consumed by the fish is retained as growth, the composition of the gain is an additional factor determining the subsequent energy and protein requirement. When measuring whole body composition of fish at increasing sizes, each unit weight gain is assumed to equal the body composition at a certain size. As pictured in Fig. 14.3 for gilthead sea bream, moisture content and energy concentrations change with increasing fish weights. The protein content on the other hand is quite constant regardless of fish size and is on average 175 mg g−1. The fact that protein content remains quite stable and energy content is increasing with increasing fish size is typical for most fish (see Fig. 14.4). Therefore, in estimating requirements for tissue deposition and growth, wide variations between species in terms of energy needs are expected based on the differing tissue composition. For example, relatively energy dense gilthead sea bream require more dietary energy per unit of weight gain than leaner fish such as tilapia and grouper. It is noteworthy, however, that the demand for dietary protein per unit of weight gain remains similar irrespective of fish species (eqs 14.9–14.12). Gilthead sea bream Energy content of carcass ( kJ g −1 ) = 4.66 × BW ( g ) Protein content ( mg g −1 )

0.139

[14.9]

0.055

[14.10]

= 175

Tilapia Energy content of carcass ( kJ g −1 ) = 5.53 × BW ( g ) Protein content ( mg g −1 )

Moisture

700

Energy

Protein

16 14

600

12

500

10

400

8

300

6

200

4

100

2

0 0

Energy content (kJ g–1 fish)

18

800 Protein content (mg g–1 fish)

= 160

0 50 100 150 200 250 300 350 400 450 500 Fish weight (g)

Fig. 14.3 Proximate body composition (per g wet weight) of gilthead sea bream at increasing sizes and fed a standard diet to satiation.


425

13

Energy content (kJ g–1 fish)

12 11 10 9 8 7 6 5 4

Gilthead seabream

3

Asian sea bass

Tilapia White grouper

2 0

50

100 150 200 250 300 350 400 450 500 Fish weight (g)

Fig. 14.4 Comparison of energy contents (kJ per g wet weight) of several species relative to fish size.

White grouper Energy content of carcass ( kJ g −1 ) = 5.01 × BW ( g ) Protein content ( mg g −1 )

0.056

[14.11]

0.104

[14.12]

= 169

Asian sea bass Energy content of carcass ( kJ g −1 ) = 4.51 × BW ( g ) Protein content ( mg g −1 )

= 170

14.2.4 Metabolic body weight Metabolic rate in fish is related to body weight and to temperature. Fish require energy for maintaining normal processes of life such as blood circulation, osmoregulation, excretion and movement, regardless of whether or not feed is consumed. Depending on the activity, several metabolic levels can be distinguished: standard, routine and active metabolism. Metabolic rate, at all levels of activity, depends largely on the size of the fish, and is proportional to the metabolic body weight in the form of a × BW(kg)b. Two major methods have been used to determine energy requirements in animals: direct and indirect calorimetry; however, most researchers have used indirect calorimetry in fish. The latter method estimates the energy demand of fish indirectly through measurements of oxygen consumption, but it can also include comparative carcass analysis.

426


The comparative carcass analysis was employed in the present examples to measure the caloric value of the tissues utilized during starvation for fish of increasing sizes. This method was chosen as the most feasible and applicable. Fish could be kept in groups in a tank, move freely and the duration of each testing period was sufficiently long. The daily loss of energy as well as protein can be thus calculated in relation to body weight. The relationships between daily energy and protein loss and fish weight are not linear and results were fitted to ln–ln functions as have traditionally been used by animal nutritionists to express metabolic body weight (MBW). The antilog of these functions describes the allometric relationship common in biological measurements. The relationship between energy loss (kJ fish−1 day−1), protein loss (g fish−1 day−1) and fish weight (g) for gilthead sea bream are depicted in Fig. 14.5. For several fish species the daily loss of energy and protein respectively can be determined as follows: Gilthead sea bream Energy loss (kJ fish −1 day −1 ) = 41.5 × BW ( kg ) Protein loss ( g fish −1 day −1 ) = 0.40 × BW ( kg )

0.82

[14.13]

0.70

[14.14]

European sea bass Energy loss (kJ fish −1 day −1 ) = 34.6 × BW ( kg ) Protein loss ( g fish day −1

−1

) = 0.39 × BW ( kg)

0.79

[14.15]

0.69

[14.16]

White grouper Energy loss (kJ fish −1 day −1 ) = 26.3 × BW ( kg ) Protein loss ( g fish day

−1

) = 0.34 × BW ( kg)

[14.17]

0.70

[14.18] 0.00

0 –2 –4 –6 –8 –10 –12 –14 –16 –18 –20 –22

–0.05 –0.10 –0.15 –0.20 –0.25 –0.30 Energy Protein

–0.35 –0.40

Protein loss (g fish–1 day–1)

Energy loss (kJ fish–1 day–1)

−1

0.80

–0.45 0

50 100 150 200 250 300 350 400 450 Fish weight (g)

Fig. 14.5 Daily energy (kJ) and protein loss (g) in gilthead sea bream in relation to body size.


427

Asian sea bass Energy loss (kJ fish −1 day −1 ) = 23.4 × BW ( kg ) Protein loss ( g fish day −1

−1

) = 0.24 × BW ( kg)

0.82

0.69

[14.19] [14.20]

The expressions of (kg)0.82, (kg)0.79, (kg)0.80 and (kg)0.82 can thus be described as the metabolic weights for gilthead sea bream, European sea bass, white grouper and Asian sea bass, respectively. No significant differences could be found among the fish species concerning the exponent b of the metabolic body weight (kg)b for energy, which was on average 0.80, giving a strong indication that this might be a common value for fish, as has been suggested already by Brett and Groves (1979). This also means that the rate of increase in energy metabolism with weight is higher in fish than in birds and mammals. The relationship between a fish’s protein metabolism and its body weight conforms also to the allometric equation: a × BW(kg)b. The exponent of the metabolic weight for protein metabolism in fish was shown to be on average b = 0.70. Data correlating protein metabolism to different fish weights are sparse, and most authors have assumed a common exponent for the relationship between energy or protein loss and body weight. However, the best fit between protein loss and body weight in fish was reached using a metabolic body weight with an exponent of b = 0.70. The similarities of these coefficients in various species indicate that protein and energy metabolic rate cannot be described by the same metabolic body weight. 14.2.5 Efficiency for energy and protein utilization Loss at starvation as described in eqs 14.13–14.20 is only an approximation of maintenance energy requirements. To quantify the maintenance requirements (zero energy and protein balance) and to define the efficiency of energy utilization for growth, fish are fed increasing amounts of known digestible energy and protein from zero feed up to maximum intake as described in detail by Lupatsch et al. 2001, 2003a,b and Lupatsch and Kissil, 2005. Figure 14.6 shows an example of growth trials with gilthead sea bream that were performed at three different temperature regimes using fish of various sizes. The experimental diets were based mainly on fish meal, fish oil and cornstarch and digestibility was determined beforehand. Fish meal was chosen as the primary protein source because of its balanced amino acid profile. To examine the relationship between dietary energy consumed and energy gained for different sized fish both DE intake (x) and energy retained (y) were expressed per metabolic body weight (MBW) of kg0.80. For the three trials performed at different temperatures, the following linear regressions were obtained (Fig. 14.6): Temp 20 °C

y = −30.2 + 0.69 x

[14.21]

428


Energy gain (kJ kg–0.80 day–1)

150 125

Temp 20.5 °C

100

Temp 24 °C

75

Temp 27 °C

50 25 0 –25 –50 0

50

100

150

200

250

300

Digestible energy fed (kJ kg–0.80 day–1)

Fig. 14.6 Daily energy retention per unit metabolic body weight of kg0.80 in gilthead sea bream fed increasing levels of digestible energy at different temperatures. Corresponding eqs 14.21–14.23 are presented in the text.

Temp 24 °C

y = −38.1 + 0.67 x

[14.22]

Temp 27 °C

y = −47.1 + 0.66 x

[14.23]

For the sea bream at zero energy retention (y = 0) the required intake of digestible energy (DE) can then be calculated as the daily maintenance requirement DEmaint at increasing temperatures: a = 43.7 kJ at 20.5 °C, 56.9 kJ at 24 °C and 71.4 kJ at 27 °C each describing the value a in the expression a × BW(kg)0.80. The efficiency of DE for growth is defined by the slope of the lines and is nearly identical at the different temperatures with an average value of 0.67. The reciprocal 1/0.67 = 1.49 describes the cost of DE (kJ) per unit of energy deposited (kJ). The relationship between dietary DP intake and protein retained, both referring to a MBW of (kg)0.70, shows a similar linear response in sea bream and the relationships can be described by the following equations: Temp 20 °C

y = −0.25 + 0.46 x

[14.24]

Temp 24 °C

y = −0.30 + 0.46 x

[14.25]

Temp 27 °C

y = −0.39 + 0.48 x

[14.26]

In the case of protein, the efficiency of utilization can again be defined by the slope of the lines and amounts to an average value of 0.47 at the three temperatures. Corresponding to the protein efficiency the reciprocal of 1/0.47 = 2.13 describes the cost of DP (g) per unit of protein deposited (g). It must be pointed out, however, that this value is only appropriate for


429

a dietary protein with a balanced amino acid profile like fish meal as used in the present studies. In practical diets, which might be limiting in one or two amino acids, the protein efficiency will be reduced. Maintenance requirement for protein is dependent on temperature as well and can be determined as DPmaint = 0.54 g at 20 °C, 0.66 g at 24 °C and 0.81 g at 27 °C, each presenting the value a in the expression a × BW(kg)0.70 day−1. The maintenance requirement for energy increases at higher temperatures in sea bream as expected and shows a linear response from 43.7 kJ to up to 71.4 kJ × BW (kg)0.80 in the range between 20 and 27 °C (Fig. 14.7). The same can be said for the protein maintenance requirement and temperature; thus maintenance requirements in relation to temperature in gilthead sea bream can be well described by the following equations (only between 20 to 27 °C): Maintenance requirement for energy in kJ fish−1 day−1: DEmaint = ( 4.38 × T (°C ) − 45.65) × ( kg )

0.80

[14.27]

Maintenance requirement for protein in g fish−1 day−1: DPmaint = ( 0.045 × T (°C ) − 0.42) × ( kg )

0.70

[14.28]

90

1.10 Energy Protein

80

1.00

70

0.90

60

0.80

50

0.70

40

0.60

30

0.50 0.40

20 19

20

21

22

23

24

25

26

27

28

29

Constant ‘a’ in DPmaint = a × (kg)0.70 day–1

Constant ‘a’ in DEmaint = a × (kg)0.80 day–1

In growth studies with several fish species using the same methodology, the relationships between daily DE intake (x) and energy retained ( y) both expressed per unit of metabolic weight (kg)0.80 were obtained and are depicted in Fig. 14.8. The linear relationships between daily DE intake (x) and energy retained (y) both expressed per unit of metabolic weight (kg)0.80 as presented in Fig. 14.8 are shown below (at 27 °C):

Temperature (° C)

Fig. 14.7 Relationship between maintenance requirement expressed as a × BW(kg)b versus water temperature in gilthead sea bream.

430


Energy gained (kJ kg–0.80 day–1)

200 Gilthead sea bream Tilapia White grouper

150 100

Asian sea bass

50 0 –50 0

50

100

150

200

250

300

350

Digestible energy fed (kJ kg–0.80 day–1)

Fig. 14.8 Daily energy retention per unit metabolic body weight of kg0.80 in various fish species fed increasing levels of digestible energy at a temperature of 27 °C.

Gilthead sea bream y = −47.1 + 0.66 x

[14.29]

y = −37.2 + 0.64 x

[14.30]

Tilapia

White grouper y = −34.0 + 0.68 x

[14.31]

Asian sea bass y = −28.3 + 0.67 x

[14.32]

The efficiency of energy utilization (i.e. the slope of energy gain as a function of DE intake) is remarkably similar, ranging between 0.64 and 0.68 for the fish species, but differences are observed for maintenance requirements as depicted in Fig. 14.8. It supports the concept that the energy efficiency for growth is constant and independent of fish weight, feeding level and species, but maintenance requirement expressed per metabolic body weight is species specific. The similarities of energy efficiencies involving salmonids have been also demonstrated in rainbow trout where the utilization of DE for gain was 0.61 regardless of feeding level or temperature (Azevedo et al., 1998). This value is very close to the 0.68 of another study with rainbow trout (Rodehutscord and Pfeffer, 1999). Quantification of energy and protein requirements for maintenance and efficiency of growth for various fish species can thus be described according to the common equation:


431

Requirements ( fish −1 day −1 ) = a × ( kg ) + c × gain b

and in detail for each specie: Gilthead sea bream DE ( kJ) = ( 4.38 × T − 45.65) × ( kg ) DP ( g ) = ( 0.045 × T − 0.42) × ( kg )

0.80

+ 1.49 × energy gain ( kJ )

[14.33]

0.70

+ 2.13 × protein gain ( g )

[14.34]

+ 1.61 × energy gain ( kJ )

[14.35]

Tilapia DE ( kJ) = ( 3.28 × T − 30.0) × ( kg )

0.80

DP ( g ) = ( 0.048 × T − 0.65) × ( kg )

+ 2.17 × protein gain (g )

[14.36]

0.80

+ 1.49 × energy gain (kJ )

[14.37]

0.70


[14.38]

+ 1.48 × energy gain (kJ )

[14.39]

0.70

White grouper DE ( kJ) = ( 3.86 × T − 53.54) × ( kg ) DP ( g ) = ( 0.066 × T − 1.19) × ( kg ) Asian sea bass DE ( kJ) = ( 3.16 × T − 44.4) × ( kg ) DP ( g ) = 0.45 × ( kg )

0.70

0.80


[14.40]

14.3 Feed ingredient evaluation Feed is the principal operating cost in the production of fish, and for aquatic feeds the main protein and energy source has traditionally been fish meal. However, there are limits to the continued expansion of aquaculture based upon feeds using fish meal and fish oils, which are costly and limited in supply. The production of successful fish feed formulae relying less on fish meal requires therefore accurate information on the nutritive value of more economical protein sources. In addition to quantifying energy and protein demands, one of the requirements for formulating practical feeds is determination of the digestibility of various feed ingredients. Ideally the nutrient requirements of fish and the nutrient concentration of a foodstuff should be expressed in units of digestible energy and protein so that least-cost formulations can optimize the balance between nutrient requirements and the cost of feeds. The nutritive value of compound diets will depend on the digestibility of the individual ingredients, and nutrient digestibility has been shown to be additive at least for energy, lipid and protein (Lupatsch et al., 1997). Apparent digestibilities of crude protein are on average high regardless of the origin of the protein. There seems to be more variation in protein digestibility of animal meal and their by-products than from plant proteins, possibly due to processing procedures. Some of the differences arise due to treatments such as heating, drum drying or spray drying. Based on digest-

432


ibility studies with several fish species it can be concluded, that the digestibility coefficients of protein and lipids are generally around 86 % and 92 %, respectively, regardless of fish species, while those for carbohydrates are more variable reflecting the quality or source of carbohydrates in the diets (Lupatsch et al., 1997; Sklan et al., 2004). Carbohydrate availability in trout and salmon has been shown to depend on the level of inclusion in the diet; however, omnivorous fish like, for instance, tilapia should be capable of digesting and absorbing relatively large amounts of carbohydrates. In general, it can be said that differences in digestibility data are mainly due (besides errors in the experimental design) to the ingredient itself, to processing procedures, mechanical or otherwise or, in regards to plant products, to the fibre content. There is less variation among various fish species in regard to protein digestibility of an ingredient than there is among different ingredients. In short, we can assume that protein digestibility is more a characteristic of a particular ingredient, less so of the fish species. For species with similar feeding habits (i.e. omnivores or carnivores), digestible energy values are also similar. Therefore, where there is a lack of actual data, digestibility values obtained from fish that consume similar feed items in nature can be safely adopted to describe the nutritional value of common feed ingredients. Table 14.1 provides average values of the DE and DP content of raw ingredients that are commonly used in practical feed formulations as determined in gilthead sea bream.

Table 14.1 Typical composition of practical feed ingredients (kg−1 on as fed basis)

Fish meal Meat meal Poultry meal Feather meal Fish oil Soybean meal Soya protein Full fat soya Corn gluten Canola protein Wheat gluten Lupin seed Pea seed meal Corn meal Wheat meal Corn starch

Digestible protein (g)

Dry matter

Crude protein (g)

910 930 930 920

637 595 627 828

560 446 502 521

910 910 900 920 920 930 930 940 900 910 910

445 630 351 630 590 778 396 247 110 123 –

394 570 289 567 543 746 356 173 82 98 –

Gross energy (MJ)

Digestible energy (MJ)

19.38 19.44 20.27 22.82 38.50 17.56 18.75 20.78 21.30 21.24 21.20 17.35 16.60 17.24 17.29 15.89

17.24 14.77 15.20 14.83 36.5 11.50 14.21 12.88 16.16 16.78 19.29 9.30 7.30 10.20 11.24 12.71


433

14.4 Feed formulation and feeding strategies The results of the above mentioned allow calculation of the daily recommended intake for growing fish. By defining the fish’s demands for maintenance and growth a comprehensive energy and protein budget can be derived that essentially quantifies the energy and protein the fish needs to consume to achieve its anticipated growth at any specific temperature and part of its growth cycle as demonstrated for Asian sea bass in Table 14.2. Table 14.2 Calculations of daily energy and protein requirements in growing Asian sea bass (at 27 °C) Body weight, per fish

50 g

250 g

500 g

1.42

3.23

4.59

Energy requirement, kJ fish day Metabolic BW, kg0.80 DEmaint2 Energy gain3 DEgrowth4 DEmaint+growth5 Maintenance as % of total DE

0.091 3.72 9.65 14.28 18.01 20.7

0.330 13.50 25.84 38.24 51.74 26.1

0.574 23.50 39.49 58.45 81.95 28.7

Protein requirement, g fish−1 day−1 Metabolic BW, kg0.70 DPmaint6 Protein gain7 DPgrowth8 DPmaint+growth9 Maintenance as % of total DP

0.123 0.055 0.242 0.475 0.530 10.4

0.379 0.171 0.548 1.075 1.246 13.7

0.616 0.277 0.780 1.529 1.806 15.3

Weight gain1, g day−1 −1

Feed formulation DE content of feed, MJ kg−1 Required feed10, g fish−1 day−1 Feed conversion ratio DP content in feed11, g kg−1 DP DE−1 ratio, g MJ−1 1

−1

15 1.20 0.84 441 29.4

15 3.45 1.07 361 24.1

15 5.46 1.19 331 22.0

Predicted weight gain for Asian sea bass at 27 °C (eq. 14.7). Digestible energy required for maintenance – (3.16 × T − 44.4) × BW(kg)0.80. Expected energy gain = weight gain × energy content of gain (eq. 14.12). 4 Digestible energy required for growth = expected energy gain × 1.48 (cost in units of DE to deposit one unit of energy as growth). 5 Total DE required for maintenance and growth. 6 Digestible protein required for maintenance = 0.45 × BW(kg)0.70. 7 Expected protein gain = weight gain × protein content of gain (170 mg g−1). 8 Digestible protein required for growth = expected protein gain × 1.96 (cost in units of DP to deposit one unit of protein as growth). 9 Total DP required for maintenance and growth. 10 Required feed intake to meet daily requirements while using feeds containing 15 MJ kg−1 DE. 11 Required DP inclusion in feed to meet daily requirements of digestible protein. BW = body weight, DE = digestible energy, DP = digestible protein. 2 3

434


The significance of the above mentioned approach is, that protein and energy needs are expressed primarily in terms of absolute demand per fish body mass and anticipated weight gain and only secondarily as a percentage or inclusion of feed. Due to the fact that protein and energy demands are constantly changing, different diets would have to be formulated for growing fish. However, on a practical basis it is unreasonable to expect that a large number of diets would be used to support production of any fish species. It is obvious from Table 14.2, that the proportion of total DE which is required for maintenance will increase with increasing body weight and with decreasing growth rate, thus influencing the feed conversion ratio (FCR). Also, the DP/DE ratio will decrease with increasing fish size and decreasing growth potential due to the changing ratio of energy to protein of the gain and the increasing proportion of energy used for maintenance with increasing fish size. Faster growing fish will usually display a better FCR, as do juveniles of any species. In addition, higher temperatures might have a positive effect on feed efficiency as demonstrated for tilapia in Table 14.3, where at 27 °C the potential for growth is much greater than at 22 °C and the FCR slightly improved. Even though maintenance requirements for energy increase with temperature, this increase is still minor compared to the advantage of higher weight gain, at least for the range of temperatures that are considered optimal for a certain fish species. Differences in nutrient requirements are largely due to the growth potential and the composition of the growth as demonstrated in Table 14.4 for grouper and mullet. On a daily basis grey mullet require more energy than grouper due to the high energy content of the weight gain and greater maintenance requirement. On the other hand, the daily protein requirement of grouper is greater due to the superior growth. The amount of energy and protein supplied to the fish is a function of the amount of feed consumed and the density of energy and protein in that feed. As shown in Table 14.4, it is possible for a formulator to come up with a series of feed formulations to meet the energy and protein requirements of a fish species. The absolute daily protein requirement of a fish is dependent on size and anticipated weight gain regardless of DE content. Therefore, as demonstrated in Table 14.4 the protein level expressed as a percentage of the feed will change according to the selected digestible energy content of 13 or 16 MJ kg−1 feed. However, it is important for the formulator to recognize that the fish has to be physically able to consume all the feed to acquire the energy and protein needed for maximum growth. For instance, a 300 g grey mullet that would grow 2 g day−1 would be able to consume 5.16 g feed on average (Table 14.4). White grouper, on the other hand, would be able to grow 3.36 g per day, but feed intake is just 3.68 g. As the energy requirement of grouper is relatively low and consequently the feed intake, the protein content has to be sufficiently high to satisfy the demand. Fish on a lower trophic level, like mullet or tilapia, could


435

Table 14.3 Recommendations of DE and DP supply for tilapia grown at two water temperatures (22 °C and 27 °C) Body weight, per fish

50 g

300 g

Temperature Weight gain1, g day−1

22 °C 0.70

27 °C 1.09

22 °C 1.85

27 °C 2.91

Energy requirement, kJ fish−1 day−1 DEmaint2 Energy gain3 DEgrowth4 DEmaint+growth5 Maintenance as % of total DE

3.84 4.77 7.68 11.52 33.3

5.33 7.48 12.04 17.37 30.7

16.09 14.03 22.58 38.67 41.6

22.35 22.00 35.42 57.77 38.7

Protein requirement, g fish−1 day−1 DPmaint6 Protein gain7 DPgrowth8 DPmaint+growth9 Maintenance as % of total DP

0.050 0.111 0.241 0.291 17.1

0.079 0.175 0.379 0.458 17.3

0.175 0.297 0.643 0.818 21.4

0.278 0.465 1.009 1.287 21.6

Feed formulation DE content of feed, MJ kg−1 Required feed10, g fish−1 day−1 Feed conversion ratio DP content in feed11, g kg−1 DP DE−1 ratio, g MJ−1

13 0.89 1.27 329 25.3

13 1.34 1.23 343 26.4

13 2.97 1.61 275 21.2

13 4.44 1.53 290 22.3

1

Predicted weight gain for tilapia at 22 °C and 27 °C (eq. 14.1). Digestible energy required for maintenance – (3.28 × T − 30.0) × BW(kg)0.80. 3 Expected energy gain = weight gain × energy content of gain (eq. 14.10). 4 Digestible energy required for growth = expected energy gain × 1.61 (cost in units of DE to deposit one unit of energy as growth). 5 Total DE required for maintenance and growth. 6 Digestible protein required for maintenance = (0.048 × T − 0.65) × BW(kg)0.70. 7 Expected protein gain = weight gain × protein content of gain (160 mg g−1). 8 Digestible protein required for growth = expected protein gain × 2.17 (cost in units of DP to deposit one unit of protein as growth). 9 Total DP required for maintenance and growth. 10 Required feed intake to meet daily requirements while using feeds containing 13 MJ kg−1 DE. 11 Required DP inclusion in feed to meet daily requirements of digestible protein. DE = digestible energy, DP = digestible protein. 2

be fed low energy and protein diets because they are able to consume high amounts of feeds. When comparing energy and protein requirements per unit of fish produced, as shown in Table 14.5, white grouper and Asian sea bass prove to be the more efficient species compared to gilthead sea bream and even tilapia. To produce 1 kg of fish the need for crude protein is about 613 g for sea bream and only about 456 g for grouper. The energy required to produce 1 kg of grouper is as low as 20 MJ compared to 34 MJ for the sea bream.

Table 14.4 Predicted energy and protein requirement for grouper and mullet at 27 °C and proposed feed formulation while deciding on 13.0 or 16.0 DE MJ kg−1 feed

Body weight, per fish Weight gain, g day−1 Feed intake – voluntary, g day−1 Energy requirement, kJ fish−1 day−1 DEmaint Energy gain DEgrowth DEmaint+growth Protein requirement, g fish−1 day−1 DPmaint Protein gain DPgrowth DPmaint+growth Feed formulation DE content of feed, MJ kg−1 Required feed, g fish−1 day−1 DP content in feed, g kg−1 Feed conversion ratio DP DE−1 ratio, g MJ−1

White grouper

Grey mullet

300 g 3.36 3.68

300 g 2.00 5.16

19.34 23.17 34.53 53.87

27.84 20.78 36.37 64.21

0.255 0.568 1.051 1.306

0.319 0.321 0.713 1.033

13.0 4.14 315 1.23 24.2

16.0 3.37 388 1.00 24.2

13.0 4.94 209 2.47 16.1

16.0 4.01 257 2.01 16.1

Specifications for white grouper can be found in equations in text. Specifications for grey mullet (Lupatsch, unpublished). Weight gain (g day−1) = 0.0019 × BW(g)0.557 × e0.140×T Feed intake (g day−1) = 0.0026 × BW(g)0.659 × e0.142×T Energy content of carcass (kJ g−1) = 5.56 × BW(g)0.110 Protein content (mg g−1) = 161 Requirements: DE(kJ) = (5.3 × T − 70.2) × (kg)0.80 + 1.75 × energy gain (kJ) DP(g) = (0.086 × T − 1.58) × (kg)0.70 + 2.22 × protein gain (g) DE = digestible energy, DP = digestible protein.

Table 14.5 Comparison of energy and protein requirements for the production of 1 kg of fish of 300 g weight (forecast for gilthead sea bream and European sea bass at 23 °C, all others at 27 °C) Requirement (per kg fish produced) Energy Protein (g) (MJ) Gilthead sea bream European sea bass White grouper Asian sea bass Tilapia Grey mullet

Feed formulation CP1 GE1 content content (MJ kg−1 (g kg−1 feed) feed)

Production efficiency Feed conversion ratio (feed gain−1)

613

33.9

22.0

398

1.54

573

30.1

22.0

418

1.37

456 456 522 609

19.9 20.6 24.8 40.2

19.0 19.0 17.0 17.0

434 422 358 258

1.05 1.08 1.46 2.36

1 Requirements are based on gross energy (GE) and crude protein (CP) values assuming a digestibility of 85 % and 80 % for protein and energy, respectively.


437

14.5 Future trends The challenges nutritionists are facing is to continually reduce feed costs, improve conversion efficiency and minimize environmental impact. One of the approaches is to accurately quantify nutrient requirements of the fish and choose feed ingredients according to least cost principles. Combining the protein and energy needs with digestibility data on available feed ingredients would then allow the formulation of feeds and establishment of proper feeding tables for each fish species. Once an optimal feeding strategy is in place, it can be used for predictions of fish production, feed demand, FCR and solid and soluble waste production and forecast of profitability. Regardless of whether fish are raised in cages, ponds or recirculation systems, a nutrient budget can be established by using the following mass balance: total food input = retention (growth) + faeces (solid waste) + excretion (dissolved waste). Table 14.6 provides an example of the total nutrient budget for gilthead sea bream and grouper based on daily requirements for energy and protein. The total nutrient input to produce one ton of fish is much lower for grouper, especially regarding carbon, but also concerning nitrogen, even although the protein content of the feed is 45 % for grouper and only 40 % protein for seabream. In accordance to the higher feed efficiency of grouper, the total waste production is considerably less compared to sea bream. By establishing a feeding regime based on nutritional bioenergetics of any fish species, a long-term forecast of production and nutrient flow can be made according to expected growth and production efficiencies. In conclusion, energy and protein requirements of fish are dependent on growth potential, composition of weight gain and demand for maintenance, regardless of whether they are carnivorous or herbivorous, marine or freshTable 14.6 Nutrient release for fish of 300 g (in kg ton−1 of fish produced) Gilthead sea bream

White grouper

Input Feed Carbon Nitrogen Phosphorus

1540 727.0 98.1 15.4

1050 431 72.9 12.6

Retention Carbon Nitrogen Phosphorus

262.3 28.0 7.2

161.5 27.0 7.5

Waste Carbon Nitrogen Phosphorus

Solid 145.1 14.7 5.4

Dissolved 319.8 55.3 2.8

Solid 89.0 10.9 4.4

Dissolved 180.9 35.0 0.70

438


water fish. Additional differences between fish are mainly due to stomach capacity and the amount of feed that can be consumed. Hence, energy and protein requirements for each fish species can be calculated and feeds adapted to changing conditions for the duration of a growth period. Thus it is necessary to formulate a specific feed in combination with a suitable feeding regime. Using this approach to quantify energy and protein demands in various fish species, it is possible to estimate the biological and economical efficiency of different feeds and culture systems.

14.6 References azevedo p a, cho c y, leeson s and bureau d p (1998) Effects of feeding level and water temperature on growth, nutrient and energy utilisation and waste outputs of rainbow trout Oncorhynchus mykiss, Aquat Living Resour, 11, 227–38. baker d h (1986) Problems and pitfalls in animal experiments designed to establish dietary requirements for essential nutrients, Review J Nutr, 116, 2339–49. brett j r and groves t d d (1979) Physiological Energetics, in Hoar W S, Randall D J and Brett J R (eds), Fish Physiology, Vol. VIII, Academic Press, New York, San Francisco, CA, London, 279–352. cho c y (1992) Feeding systems for rainbow trout and other salmonids with reference to current estimates of energy and protein requirements, Aquaculture, 100, 107–23. cho c y and bureau d p (1998) Development of bioenergetic models and the fishPrFEQ software to estimate production, feeding ratio and waste output in aquaculture, Aquat Living Resour, 11, 199–210. cho c y and kaushik s j (1990) Nutritional energetics in fish: energy and protein utilisation in rainbow trout, World Rev Nutr Diets, 61, 132–72. iwama g k and tautz a f (1981) A simple growth model for salmonids in hatcheries, Can J Fish Aquat Sci, 38, 649–56. lupatsch i (2003a) Feeding regimes for Asian sea bass grown at high temperatures, Global Aquac Advocate, 6, 62–3. lupatsch i (2003b) Effect of water temperature on energy and protein requirements for maintenance and growth of Asian sea bass Lates calcarifer, International Conference of the World Aquaculture Society, Salvador, Bahia. lupatsch i (2008) Predicting growth, feed intake and waste production of intensively reared tilapia based on nutritional bioenergetics, Proceedings of the Seventh International Conference on Recirculating Aquaculture, 25–27 July, Roanoke, VA. lupatsch i and kissil g wm (2005) Feed formulations based on energy and protein demands in white grouper Epinephelus aeneus, Aquaculture, 248, 83–95. lupatsch i, kissil g wm, sklan d and pfeffer e (1997) Apparent digestibility coefficients of feed ingredients and their predictability in compound diets for gilthead seabream, Sparus aurata, Aquac Nutr, 3, 81–9. lupatsch i, kissil g wm and sklan d (2001) Optimization of feeding regimes for European sea bass Dicentrarchus labrax: a factorial approach, Aquaculture, 202, 289–302. lupatsch i, kissil g wm and sklan d (2003a) Comparison of energy and protein efficiency among three fish species: gilthead seabream (Sparus aurata), European seabass (Dicentrarchus labrax) and white grouper (Epinephelus aeneus): energy expenditure for protein and lipid deposition, Aquaculture, 225, 175–89.


439

lupatsch i, kissil g wm and sklan d (2003b) Defining energy and protein requirements of gilthead seabream (Sparus aurata) to optimize feeds and feeding regimes, Isr J Aquac – Bamidgeh, 55, 243–57. mercer l p (1982) The quantitative nutrient-response relationship, J Nutr, 112, 560–6. rodehutscord m and pfeffer e (1999) Maintenance requirement for digestible energy and efficiency of utilisation of digestible energy for retention in rainbow trout, Oncorhynchus mykiss, Aquaculture, 179, 95–107. sklan d, prag t and lupatsch i (2004) Apparent digestibility coefficients of feed ingredients and their prediction in diets for tilapia Oreochromis niloticus × Oreochromis aureus, Aquac Res, 35, 358–64. zeitoun i h, ullrey d e, magee w t, gill j l and bergen w g (1976) Quantifying nutrient requirements of fish, J Fish Res Board Can, 33, 167–72.

15 Advances in aquaculture nutrition: catfish, tilapia and carp nutrition D. Davis, Auburn University, USA, T. Nguyen, Nong Lam University, Vietnam, M. Li, National Warmwater Aquaculture Center, USA, D. M. Gatlin III, Department of Wildlife and Fisheries Sciences, USA, and T. O’Keefe, Aqua-Food Technologies, Inc., USA

Abstract: Freshwater fish species account for almost 50 % of the world’s aquaculture production, with tilapia, carp and catfish representing the primary culture species. These species are cultured in numerous countries as they have adaptable feeding habits, respond well to a wide variety of culture technologies and are well accepted by consumers. All three species can be easily reared on commercially produced floating feeds. Feeds not only represent one of the primary production costs and source of nutrients but they are also the primary source of pollutants that contribute to poor water quality and disease occurrences. Understanding the nutrient requirements, optimizing commercial feed formulations and managing feed inputs are all critical to the continued success of the industry. This chapter will review current concepts on nutrient requirements, pre- and probiotics, the options of using incomplete feeds as well as current trends in feed manufacturing. Key words: catfish, tilapia, carp, nutrition, feed formulation.

15.1 Introduction Tilapia (Oreochromis and Tilapia sp.), carp (Cyprinid sp.) and catfish (Ictalurus, Clarias and Pangasius sp.) are freshwater fish which account for a considerable portion of the world production of cultured species (see Table 15.1 for a list of common species). Based on data from the Food and Agriculture Organization of the United Nations, Fisheries and Aquaculture Information and Statistics Service, freshwater aquaculture produced about 44 % of aquaculture products or around 27 757 935 tons of freshwater fish valued at 35.3 billion US dollars in 2005. As a percentage of freshwater production, carp, catfish and tilapia represent approximately 57.9, 4.5 and

Advances in aquaculture nutrition: catfish, tilapia and carp nutrition

441

Table 15.1 Examples of commercially produced species of tilapia, carp, and catfish Family

Genus species

Cichlidae

Oreochromis mossambicus O. urolepis hornorum O. niloticus O. aureus Sarotherodon galilaeus S. melanotheron

Clariidae

Clarias gariepinus, C. macrocephalus (often hybridized with C. gariepinus)

Cyprinidae

Cyprinus carpio C. carassius Ctenopharyngodon idella Hypophthalmichthys molitrix H. nobilis Mylopharyngodon piceus Catla catla Labeo rohita Cirrhinus mrigala

Ictaluridae

Ictalurus punctatus I. furcatus

Pangasiidae

Pangasius hypophthalmus Pangasius bocourti

7.1 % of the production, respectively. These species are not necessarily high valued species; however, they are major contributors to world aquaculture production and are a critical source of high-quality protein in many countries. Hence, they can be viewed as staples of the food supply for many countries. Because these fish are sold more as commodities than as luxury food items, it is critical that production systems are cost-effective and efficient. Due to cost structures, modern production systems for these species have a number of similarities to that of terrestrial chicken production systems, albeit, somewhat less advanced. Because of their fast growth, adaptability to a wide range of environmental conditions, disease resistance, high-quality flesh which has a wide market appeal, ability to grow and reproduce in captivity and feed on relatively low trophic levels, these species could be considered ‘aquatic chickens’. All three groups of fish can be cultured in traditional extensive culture systems. As aquaculture has matured into a commercial industry, extensive production systems are generally not cost-effective and are being replaced by more modern intensive systems. The shift from extensive systems is most apparent in Asia where traditional carp polyculture systems based on organic fertilization and supplemental nutrient sources are being replaced by polyculture systems using complete feeds. The same trend has occurred

442


with tilapia culture in every country that has a commercial industry. In semi-intensive farming systems, supplemental feeds that consist of locally available, low-cost single feedstuffs such as rice bran, copra meal, coffee pulp, brewery by-products and/or various combinations have been used as supplements to natural food (Lim, 1989). These systems are characterized by lower financial inputs but also poor returns on the investment. As stocking rate increases, the contribution of natural food decreases and nutritionally complete feeds are required. This increases the cost of production; however, it also improves the return on the investment, producing better profit margins for a commercial industry. Of course this is the catch. In intensive culture systems such as in ponds, raceways, cages and tanks, feed is the most expensive item, often accounting for 30–60 % of the total variable expenses (Lim and Webster, 2006a) as well as other variable costs. Therefore, the development of cost-effective feeds using high-quality, inexpensive and preferably locally available ingredients is critical to modern commercial aquaculture and to the continued sustainability of the industry. With improving cost effectiveness of the feed in mind, the industry has considerable challenges, especially as agriculture and food production systems adjust to new production models driven by increased world populations combined with higher per capita consumption of protein. This, combined with increased industrial uses of agriculture products as partial replacements for industrial products such as crude oil (e.g. carbohydrate sources for ethanol and oil seeds for biodiesel), has resulted in increases in prices and limited supplies. On the other hand, this industrial use of raw agriculture products has or will increase the availability of industrial byproducts such as distillers’ grains and oil seed meals that may be suitable for inclusion in animal feeds. In response to shifts in the availability of feed stuffs, the industry has invested considerable time and efforts in determining dietary requirements, optimizing the use of cost-effective ingredients and evaluating the potential of feed supplements that may enhance production through a variety of mechanisms. The biggest challenges to the feed industry are the redefining of agriculture as it shifts towards vertically integrated models and an increased use of by-products as cost-effective replacements for traditional ingredients. Once we have adjusted to new price structures and the availability of basic ingredients, research will continue to refine nutrient requirements and biological availability of nutrient from various ingredients. However, there will more likely be increased effort to tie economic and nutritional models together as production systems become more industrialized. Also, with the increasing use of molecular biology, including gene chips and progress in defining the genome of key culture species, we are likely to see genetic improvements for specific traits, whether it is for chain elongation for the production of essential fatty acids or a better utilization of specific ingredients.


443

15.2 Nutrient requirements Nutrient requirement data are well published and there are numerous books and review papers that summarize data for these species. Examples of published resources include books such as NRC (1993), Webster and Lim (2002), Kelly and Silverstein (2005), Lim and Webster (2006a) and El-Sayed (2006). As with all animals, these species of fish require a well balanced diet containing protein, energy, lipids, vitamins and minerals. General requirement data have been summarized in a variety of sources; hence this chapter will primarily concentrate on more recent information and trends in research.

15.2.1 Protein requirements Protein (or amino acids) is the principal organic constituent of animal tissue and is the most expensive component in fish feeds. Providing a costeffective and suitably balanced protein source designed to promote efficient and cost-effective daily growth is critical. Considerable research efforts have been expended to determine essential amino acid requirements and dietary protein levels necessary to achieve optimum fish performance under various culture conditions. Optimum dietary protein levels vary depending on several factors including growth rate of the fish (which in turn is dependent on fish size and temperature), feed intake, amount of non-protein energy in the diet, protein quality (amino acid balance and digestibility), presence of natural foods and management practices. Grow-out diets for these species are often formulated with lower levels of protein as compared to other species. This is due to several reasons, including a moderate growth rate, the ability to consume relatively large quantities of feed as well as a reasonable use of carbohydrates as an energy source to spare protein. With suitable feed intake and protein sparing, the daily requirement of protein intake can be met from a variety of dietary protein levels. For example, the grow-out diets for channel catfish production are typically formulated to contain 28–32 % crude protein. However, researchers have examined a wide range of dietary protein levels (from 10 % to 40 %) in various studies and found no differences in weight gain in fish fed diets containing as low as 24 % protein when fish were fed to apparent satiation (Robinson and Li, 2007). In addition, fish fed 16–20 % dietary protein gain about 80–90 % of that of fish fed a 32 %-protein diet. However, as dietary protein decreases, the digestible energy/crude protein ratio increases beyond the optimum range (8.5–9.5 kcal digestible energy/g protein [36–40 kJ digestible energy/g protein]) resulting in an increase in body fat. This effect is quite dramatic in diets containing very low levels of protein. Fish fed a 16 %-protein diet contain about twice as much fillet fat as similar size fish raised on a 32 %-protein diet. It is clear that fish can be produced using a wide range of dietary protein levels.

444


Even though a wide range of protein levels can be utilized to produce fish, one has to consider that commercially produced fish are sold for human consumption at a price that will provide an adequate return on investment to maintain the viability of the operation. Hence, the dress out (percentage of edible product) as well as the quality of the product is critical in determining market prices. The optimal protein level used by commercial operations is that which produces the best economic return based on feed inputs and final product quality. Hence it is critical that commercial operations match both feed intake and dietary protein levels. We often talk in terms of dietary protein levels, but we are really talking about a well balanced mixture of non-essential and essential amino acids (EAA). The essential amino acid requirements, expressed as % diet, % protein or % daily energy intake have been reasonably well established for carp, tilapia and catfish species. Albeit well studied, there are contradictory reports in the literature and quite often the terminology referring to the total sulfur amino acid and methionine requirements is not clearly distinguished. This is mainly because cystine can replace part of the methionine requirement. For example, the reported total sulfur amino acid requirement is 2.88 % of protein for Indian carp (Murthy and Varghese, 1998), 2.34 % of protein for channel catfish (Harding et al., 1977) and 3.21 % of protein for Nile tilapia (Santiago and Lovell, 1988). Schwarz et al. (1998) reported a methionine requirement of 2.13 % for common carp; however, the diet also contained 1.04 % cystine. In fact one of the advantages of these species is that they have relatively low requirements for methionine which makes formulating with alternative ingredients simpler than for other species. Albeit there is considerable information with regards to essential amino acid requirements there is limited data on the digestibility of essential amino acids from various feed ingredients. This is due to both the cost and difficulty of obtaining realistic values. As the industry moves towards increased cost efficiencies, feed formulations must become more precise, thus making the need for digestibility values even more critical. Unfortunately, as we reduce the cost of the feeds we also quite often move towards lower cost ingredients which may also have reduced digestibility. Hence, digestibility information is critical in terms of estimating cost effectiveness as well as providing critical information on the nutritional quality of an ingredient. When formulating feeds for fish, there is often a question as to whether it is better to use synthetic amino acids to balance the amino acid profile or to utilize intact protein sources. This is a debate that still goes on even in the poultry industry in terms of which is the more cost-effective method. When dealing with aquatic animals, there are additional complications such as leaching of water-soluble components. Consequently, the use of watersoluble pure amino acids is discouraged in larval, fry and early fingerling feeds where leaching is an issue. However, in grow-out diets the use of


445

amino acid supplements is acceptable. The efficacy of crystalline and protein-bound amino acids has been evaluated (e.g. Williams et al., 2001). Unfortunately, the cost based on biological values is quite hard to determine; hence the cost effectiveness will always be debated.

15.2.2 Alternative protein sources The development of commercial feeds for aquaculture has been traditionally based on the use of fish meal as the main protein source (Gatlin et al., 2007). This is due to its high protein content and balanced EAA profile. Fish meal is also an excellent source of essential fatty acids, digestible energy, minerals and vitamins, making it an excellent ingredient. Because of its nutritive value, it is no surprise that fish meal is the most expensive protein source in animal feeds (Tacon, 1993). There is no question that marine feedstuffs such as fish meal, are exceptionally good sources of protein (EAA) and other essential nutrients. Supply and price considerations make the use of high levels of marine ingredients economically unjustified in grow-out diets for carp, tilapia or catfish. Due to nutritional and palatability requirements of fry and fingerling fish it often justified to use these ingredients in diet for early development stages. Practical grow-out diets designed for these species vary depending on local availability of ingredients but, in general, the most cost-effective formulations are based primarily on soybean meal in combination with other plant-based proteins and/or low levels of animal proteins to provide the desired level of protein with a balanced amino acid profile (Gatlin, 2003). As a group, these fish constitute one of the largest sectors of cultured fish and a major user of solvent extracted soybean meal. For example, it is not uncommon for commercial grow-out diets for these species to have 40–50 % soybean meal. Research has demonstrated that these protein sources may be replaced by other less expensive feedstuffs. For example, cottonseed meal is generally price competitive (on a protein basis) with soybean meal, so it is often used as a replacement. However, it does contain gossypol (a compound that can be toxic to fish), and has lower levels of lysine as well as processing problems that limit inclusion levels in practical diets. With regards to catfish, research has shown that about 50 % of soybean meal can be replaced with cottonseed meal (27 % of the diet) plus supplemental lysine in catfish diets without negatively affecting fish performance (Li and Robinson, 2006; Robinson and Li, 2008). There is considerable information with regards to alternative dietary protein sources for these species. For example, in a review presented by El-Sayed (1999) he noted that alternative sources of protein for the tilapia include fishery by-products, terrestrial animal by-products, oilseed plants, aquatic plants, single-cell proteins, grain legumes, plant protein concentrates and cereal by-products. Based on a wide variety of studies, there are advantages to retaining a low level of fish meal in fry and fingerling feeds;

446


however, in production diets there are minimal difference in biological performance of well-balanced diets with or without fish meal. As noted by El-Sayed (1999) even in cases where biological performance is reduced, cost and profit indices of alternative protein sources were better than for fish meal-based feeds.

15.2.3 Energy Energy is often considered one of the most important components of the diet because protein, lipids and carbohydrates will all be degraded to meet energy demands prior to their use for growth. Furthermore, excesses of energy can reduce feed intake (limiting the intake of other nutrients) and produce fish that have higher levels of fat that may not be desired by the processor and/or consumer. As noted by Robinson et al. (2001), the most notable differences in the nutrition of fish as compared with other livestock concerns energy requirements. For example, less energy is required for protein synthesis in fish than other warm-blooded animals. The protein gain per megacalorie (Mcal) of metabolizable energy (ME) consumed is 47, 23, 9 and 6 g (= 197, 96, 38, 25 MJ) for catfish (ME estimated), broiler chickens, swine and beef cattle, respectively (Robinson et al., 2001). This means that the daily requirement for energy is relatively low and, with the exception of fry feeds, practical grow-out diets for these species are not likely to be limiting in energy. In fact most diets made with high-quality ingredients have an excess of energy, which results in an inefficient use of energy and fish with higher levels of fat than would be found in wild fish. Estimates of the dietary requirement for energy have generally been determined by measuring weight gain or protein gain of fish fed diets containing a known amount of energy. Energy requirements expressed as a ratio of digestible energy (DE) to crude protein (DE/P) range for the carp (9.7–11.6 kcal/g [= 40.6–48.6 kJ/g], Takeuchi et al., 1979), channel catfish (7.4–12 kcal/g [= 31.0–50.2 kJ/g], Robinson et al., 2001) and tilapia (8.13– 9.7 kcal/g [= 34.0–40.6 kJ/g], Lim and Webster, 2006b). Albeit energy requirements have been well studied, we have primarily approached dietary energy levels based on the need to spare protein and maximize growth rates. Current grow-out diets for these species have relatively low levels of protein, minimal levels of lipids (to keep energy levels down) and high levels of carbohydrates which result in relatively high energy to protein levels. High energy to protein ratios, poor inventory control and near satiation feeding using a floating feed all contribute to an inefficient energy conversion. Hence, one can only conclude that feeds and feeding practices are not optimized for cost efficiencies relative to dietary energy. This is a minor point today but, as our culture practices become more precise for these species, we will need to optimize costs relative to energy. Currently, there is basic information with regards to DE values for typical ingredients used in practical diet formulations (see Wilson, 1994 and


447

Stone, 2003 for reviews). As with other species, lipids and protein are highly digestible whereas carbohydrates in general have lower digestibility values. Clearly the source of the carbohydrate, physical state and level of inclusion influence digestibility (Gray, 1992; Stone, 2003). Because carbohydrates are the least expensive source of energy we must expand the available information with regards to the influence of dietary inclusion level, processing conditions as well as ratios of specific types of carbohydrates or classes (soluble and insoluble) in order to better understand the cost benefits of using various ingredient processing combinations. Future research is needed to look at the cost effectiveness of various dietary energy levels in combination with feeding practices. In cases where the fish are fed to near satiation, it may be more cost-effective to allow the insoluble carbohydrate fraction to increase, thus reducing the level of available energy and providing a better energy to protein ratio in the diet. However, such concepts must be approached based on overall economics of the culture system as this will increase carbon loading on the culture system, possibly increasing overall costs of production. In cases where intake is controlled and energy from carbohydrates may be limited there are a variety of physical and chemical processes that may be used to enhance nutrient availability. The animal industry is often encouraged to utilize sub-optimal ingredients due to price considerations. Hence, improving nutrient availability could significantly improve performance. Poorly utilized ingredients can often be improved through processing conditions and/or enzyme supplementation. Both the pig and poultry industry have found that exogenous enzymes can be used to enhance starch utilization and improve the negative effects of the soluble fractions of the dietary non-starch polysaccharides associated with various plant ingredients. For example, work with chickens has also indicated that extrusion or enzyme treatment of barley improved performance (Vranjes and Wenk, 1995; Lazaro et al., 2003). There are limited examples of the use of enzyme supplements for a number of fish species. Data with fish are quite limited, although the same concept does seem to apply. For example, in work with lupin meal offered to rainbow trout it was demonstrated that removal of the oligosaccharides through enzyme degradation or alcohol extraction increased the nutritive values of the lupin meal (Glencross et al., 2003).

15.2.4 Lipids Dietary lipids are an important source of highly digestible energy and are the only source of essential fatty acids needed by the fish for normal growth, development and reproduction (Lim and Webster, 2006a). In terms of total lipids, fry feeds contain 8–12 % lipid to enhance the energy density of highprotein diets, whereas production diets typically have relatively low levels of protein and high levels of digestible carbohydrates and low (4–8 % diet)

448


levels of lipids. In addition to a source of energy, they serve as a carrier for other fat-soluble nutrients, contribute to the palatability of the feed and provide lubrication to the feed manufacturing process as well as to help reduce feed dust by spraying oil in the finished extruded feed pellets. Dietary lipid levels are primarily adjusted to meet energy requirements and to facilitate processing. Dietary fatty acid content is often adjusted to meet the essential fatty acid requirements of the fish and, more recently, to improve the fatty acid profile of the fish tissue with respect to human nutrition. All three fish species discussed in this chapter have the ability to chain elongate and desaturate 18 : 2 n-6 and 18 : 3 n-3 to longer chain fatty acids of their respective families (Webster and Lim, 2002). As long as minimal levels of these fatty acids are provided essential fatty acid deficiencies are not likely to occur. These fish species are capable of producing arachidonic acid (ArA), eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) from precursors. Although the lipid content of the fillet of these species is relatively low, they are a source for these essential fatty acids for the human consumer. Seafood is not only a major source of protein but it is also one of the best sources of essential fatty acids. Because of human health benefits, the fatty acid content of fish has come into play when marketing a number of products including fish. In the past fish oils were considered industrial products and sold on the market at very low costs. These oils were extensively used in aquaculture diets producing a final product high in essential fatty acids. However, supplies of marine fish oils are limited and the price of these oils has steadily increased making the use of alternative oils more common. A number of plant oils (e.g. soybean oil, linseed oil, rapeseed oil, sunflower oil and palm oil) have been shown to be partial or total replacements for fish oil (Ng et al., 2003; Bahurmiz and Ng, 2007). Although this has helped reduce feed costs, one also has to consider the implications to the final product. Hence, to ensure that our products remain a healthy food item of choice, a great deal of future research will be required to determine the most cost-effective ways to produce a final product that meets marketing requirements for human consumers.

15.2.5 Vitamins Vitamins are a group of organic substances that are required in small quantities in the diet for metabolism, immune function, growth and reproduction. Vitamins and minerals are critical components of any complete feed, and improper supplementation can have devastating effects on production. The dietary requirements for vitamins and minerals have been well studied in a number of species. However, there is a clear difference between determining a dietary requirement and being able to make clear recommendations under practical conditions. Vitamin and mineral premixes are a significant cost to a formulation but they can also dramatically influence


449

production if proper supplementation is not achieved. In terms of vitamin requirements they have been well summarized by the NRC (1993) and more recently in books for each of the species. The practical application of dietary requirements for vitamins and minerals is often a complex issue for which there are no absolute solutions. Some fish are able to obtain certain vitamins to partially or completely meet their metabolic needs. For example, most fish species can synthesize enough inositol in the body to meet their requirement. Vitamin B12 can be synthesized by intestinal microorganisms in catfish, tilapia and carp to partially meet the requirement. Other vitamins such as choline are clearly required by the fish but have interactions with other nutrients. For example, choline has three major metabolic functions: as a component of phosphatidylcholine; as a precursor of neurotransmitter acetylcholine; and as a precursor of betaine, which acts as a source of labile methyl groups for methylation reactions (NRC, 1993). Consequently, the dietary methionine and betaine status as well as inherent levels in ingredients all influence the need for a choline supplement. Lecithin (a source of choline) is also often supplemented for a variety of nutritional and processing considerations, adding to the level of this vitamin. Additionally, vitamins can be destroyed during processing and storage; hence, the ‘required levels of dietary supplements’ become a complex issue for which it is often difficult to produce specific guidelines. In intensive systems where limited or no natural foods are available, feeds used for these species are typically supplemented with a vitamin premix that provides all essential vitamins in sufficient quantities to ensure optimum growth and health and to compensate for losses during feed manufacturing and storage. However, supplemental vitamins may not be necessary for tilapia stocked at moderate densities in fertilized ponds since natural foods can supply the vitamin needs of the fish (Shiau, 2002). There is also evidence that natural foods in channel catfish grow-out ponds supply some of the vitamin needs of the fish (Robinson et al., 1998). The extent to which natural food organisms contribute to the vitamin nutrition of intensively grown channel catfish is still unclear since the abundance of natural food organisms varies from pond to pond and from time to time. The concentrations of certain vitamins inherent in feedstuffs commonly used in fish feeds can be found in various feed ingredient tables, and can be used to estimate vitamin concentrations in formulated feeds. However, the actual concentration and the estimated value may vary considerably since tabular values are averages and the concentration of vitamins in a particular feed ingredient may vary from batch to batch. Also, since bioavailability for most vitamins present in feed ingredients is not known, this source of vitamins is usually not considered when formulating fish feeds, but it could be a significant source of vitamins for fish. Studies with channel catfish conducted in earthen ponds show that there were no differences in weight gain, feed consumption, feed conversion, survival or hematocrit values of fish regardless of whether or not the diet was supplemented with

450


a vitamin premix or a specific vitamin (Robinson et al., 1998). The results suggest that vitamin requirements of pond-raised channel catfish are somehow met by sources other than supplemental vitamins, possibly by a combination of vitamin sources, such as those present in feed ingredients and natural food organisms. Vitamins, as well as certain other nutrients, are needed for the proper function of the immune system. There has been much attention given to the role of vitamins in the health of fish, the most notable being the use of megadoses of vitamin C in the diet to improve disease resistance. For channel catfish, published data seem to agree that under laboratory conditions immune response of the fish is depressed if an ascorbic acid-free diet is fed. However, the results from studies in which megadoses of ascorbic acid were fed to channel catfish to improve disease resistance are contradictory. The effects of other vitamins on immune function or disease resistance of these fish have also been investigated. However, there has been no conclusive evidence that increasing the concentrations of supplemental vitamins above the requirement level is beneficial to these fish species.

15.2.6 Minerals Mineral requirements of fish are similar to terrestrial animals other than functions in osmoregulation and the ability to directly obtain minerals from the water through absorption across exposed membranes. As a number of minerals can either be absorbed from the water (e.g. calcium, Ca) or are present in adequate levels in most diet formulations (e.g. potassium, K), dietary supplementation is generally not required. Of the 23 minerals which have been demonstrated to be essential for one or more species, practical diet formulations for fish typically only require phosphorus (P), magnesium (Mg), copper (Cu), iron (Fe), zinc (Zn), manganese (Mn) and selenium (Se) as supplements. The dietary requirements for both macro and trace minerals have been reviewed by Davis and Gatlin (1996) and Watanabe et al. (1997). Systematic evaluations of dietary mineral requirements, physiological functions and biological value of all biologically important minerals do not exist. There is also limited information on the biological value of minerals from various sources as well as potential interactions that can occur between minerals. Many of the studies that have been conducted have been driven by both economic and environmental concerns. For example, there is a fair amount of information on the bioavailability of phosphorus from both organic and inorganic sources (Robinson et al., 2001). Considerable research has also been conducted on the use of various forms of phytase to enhance P bioavailability from plants containing significant levels of phytate phosphorus. Such studies are becoming even more important as we move from animal protein sources, which are rich sources of minerals, towards plantbased diets that often do not contain adequate levels of minerals.


451

As the aquaculture industry matures into a more cost-efficient industry and we shift feed formulations farther from animal-based ingredients, we will most likely need to re-evaluate mineral requirements, particularly for trace minerals. It is most likely that future research will be geared toward more cost-effective delivery mechanisms for minerals, whether through precise delivery of traditional inorganic sources or chelated minerals which can have higher biological availabilities but also have lower leaching rates from the feed once it is submersed in the water. Depending on consumer acceptance, we may even see trends for the enhancement of mineral in seafood products to ensure that they are excellent sources of minerals to meet human health concerns.

15.2.7 Prebiotics and probiotics If growth performance and feed efficiency are increased in commercial aquaculture, then the costs of production are likely to be reduced. Also if more fish are able to resist disease and survive until they are of marketable size, the subsequent cost of medication and overall production costs are reduced. There is a clear relation between nutritional status of an animal and their disease response (Lim and Webster, 2001). Additionally, there are numerous compounds that have the potential to enhance growth and survival through a variety of mechanisms. It has been documented in a number of food animals that their gastrointestinal microbiota play important roles in affecting the nutrition and health of the host organism. Thus, various means of altering the intestinal microbiota to achieve favorable effects such as enhancing growth, digestion, immunity and disease resistance of the host organism have been investigated in various terrestrial livestock as well as in humans. Dietary supplementation of prebiotics, which are classified as non-digestible food ingredients that beneficially affect the host by stimulating growth and/or activity of a limited number of health-promoting bacteria such as Lactobacillus and Bifidobacter spp. in the intestine, while limiting potentially pathogenic bacteria such as Salmonella, Listeria and Escherichia coli, have been reported to favorably affect various terrestrial species; however, such information is extremely limited to date for aquatic organisms. Based on a review by Burr et al. (2005), effects of probiotics, defined as live microbial feed supplements, on gastrointestinal microbiota have been studied in some fishes, but the primary application of microbial manipulations in aquaculture has been to alter the composition of the aquatic medium. In general, the gastrointestinal microbiota of fishes, including those produced in aquaculture, have been poorly characterized, especially the anaerobic microbiota. Therefore, more detailed studies of the microbial community of cultured fish are needed to potentially enhance the effectiveness of prebiotic and probiotic supplementation.

452


15.2.8 Complete versus supplemental feeds It has been well established that using appropriate pond culture techniques in combination with a quality commercial feed with appropriate feed inputs results in the best overall performance and return on the investment. A wide variety of examples can be found at the Soy in Aquaculture website which presents results of various feeding trials in Asia (www.soyaqua.org). Another excellent example is the publication by Green et al. (1994) which presents economic results from using various levels of nutrient inputs that affect production, costs and returns. One advantage of carps, tilapia and, to a lesser extent, catfishes is that they are amenable to culture using sub-optimal feeds as they are capable of utilizing natural productivity. In terms of standing crop, production is increased as one moves from natural feeds enhanced with fertilization to single ingredients like rice bran in combination with inorganic fertilization, then to farm-made feeds and finally commercially produced feed. If one does a complete enterprise budget, in which all inputs, labor (including opportunity cost for sourcing and preparing materials), infrastructure (e.g. land and pond construction cost which are often neglected in budgets for subsistence farming) are taken into account, sub-optimal feed produces a negative net return. Furthermore, if performance and economic returns are compared for farm-made feed (for which all costs are accounted) as compared to a high-quality locally produced commercial feed, the high-quality commercial feed will out perform the on-farm feed in terms of return on investment. Importing a production diet can be cost-effective in some situations but, in general, in-country feed production using a combination of locally produced and imported ingredients is more cost-effective and the best solution. The exception to this rule is for hatchery diets which are often cost-effective to import. An interest in sub-optimal feeds comes about for a variety of reasons. Quite often the land was obtained at no cost, there is a lack of quality commercially produced feeds and/or inadequate financial resources to purchase feeds. This situation is often accompanied by a poor understanding of appropriate culture technologies, financial management and credit sources which further complicate the issues. In cases where only poor-quality feeds are available, the industry will benefit the most from improving feed technologies through the introduction of quality control standards, proper processing technologies and the production of floating feeds. This is best exemplified by the development of commercial aquaculture in Asia where a traditional fertilizer-based industry has shifted to high-quality commercially produced feeds. One can find numerous examples of the comparison of traditional culture technologies to modern feed technologies at the soy in aquaculture website (www.soyaqua.com). In the case where a commercial industry has not developed or in the case where the farmer does not have the financial resources to purchase feed he can graduate from one technology to the next if he is capable of goal-


453

oriented financial management and has the proper training. If appropriate culture techniques are not developed simultaneously with improved feeding then no one will benefit from the advances. In such cases, the farmer who is utilizing high-nitrogen locally available ingredients (on-farm grasses, manures, etc.) would invest his money in the purchase of inorganic fertilizers to increase production and revenues. As his production is increased, he can then move to using simple mixes of ground cereal grains by-products (e.g. rice bran, wheat bran, corn bran, etc.) in combination with inorganic fertilizers. Again, as revenues increase, they can then graduate to locally produced feed using a simple mix of cereal grains and their by-products, vegetable and animal proteins that are then ground and mixed with a vitamin premix. Boiling water can then be blended into the dry ingredients to produce a moist dough which can be formed and dried. Unfortunately, in countries where commercially produced feeds are not available there is also a shortage of high-protein ingredients and vitamin premixes. The next advancement would be small-scale commercial production of feeds which are often pelleted and of poor quality due to a poor understanding of quality control and appropriate milling standards. As the industry develops, the final stage would be a commercial mill producing a high-quality feed with suitable quality control standards. To facilitate feed management this should be an extruded floating feed. As noted before, if one does a complete enterprise budget for operations using the lower levels of technology, these operations only make sense if infrastructure costs are free and there are no other options. In all cases, farmers must be educated in terms of appropriate culture technologies (stocking densities, water management, feeding protocols, etc.), financial management, record keeping, analysis and quite often marketing.

15.2.9 Complete feeds The commercial manufacturing of fish feeds has developed rapidly and represents one of the fastest growing components of feed manufacturing. With regards to grow-out diets for these species the production of a floating feed is the technology of choice. Given current market constraints the most costeffective diets are often plant-based with limited quantities of animal protein. Examples of plant-based juvenile and production diets are presented in Table 15.2, with feed specifications presented in Tables 15.3–15.6. Such feeds contain vitamin and mineral premixes to provide a complete diet. Floating feeds are most efficiently produced using a wet extruder designed for the production of expanded products. The ability to control the density of a pellet to produce a floating feed is clearly a major advantage for management. Extrusion processing is more expensive than the pelleting process but produces a feed that is more economical to use because of the benefits of using a floating feeds as a management tool. In cases where inventory control is very precise and feeding based on observation of the fish at the

454


Table 15.2

Examples of generic production diets for carp, tilapia, and catfish

Ingredient (as is basis) Soybean meal 46 % protein Wheat flour 13.2 % protein Fish meal 64 % protein DDGS1 28.5 % protein Rice bran 13 % protein Corn gluten meal 60.7 % protein Fish oil, anchovy Blood meal 90 % protein Ca Phosphate Mono 21 % P Soy oil Vit PMX F-2 Min PMX F-1 Mold inhibitor Choline chloride 60 % Stay C 35 % active C Ethoxyquin 1

36/7 Fingerling

32/6 Grower

34.00 19.80 13.50 10.00 8.00 7.00 2.70 2.00 1.30 0.50 0.50 0.25 0.30 0.10 0.03 0.02

50.00 25.00 14.00 3.0 1.5 1.5 2.20 1.7 0.50 0.25 0.30 0.10 0.03 0.02

DDGS = distiller’s dried grains with solubles.

Table 15.3 General nutrient specifications for formulation of practical diets for tilapia, carp, and catfish Nutrient

Fry

Juvenile

Adult

Protein (%) DE/DP1 Fat (%) n3 (%) Fiber (%) Ash (%) Moisture (%)

45–41 9–8 12–11 1 min 2 max 9–7 11–10

40–36 9–8 10–7 0.7 min 2.5 max 6–8 11–10

35–30 9.5–8 6–5 0.5 min 3.5 max 5–8 11–10

1 DE, digestible energy in kcal/100 g of feed (9 kcal = 37.7 kJ); DP, digestible protein in g/100 g of feed.

surface is not critical, a properly pelleted feed is also quite adequate. Current trends in feed manufacturing include fine grinding and the production of very small pellets (1–2 mm). Such pellets are technically more difficult to produce but have numerous advantages over crumbled feeds. Another shift in mill management is that more attention is being paid to the reduction of energy costs. Quite often energy costs can be reduced by improving air assist systems, ensuring hammers on hammer mills are in good shape, as well as making a compromise between very fine grinding and the most energyefficient grind (which is typically larger). Additional savings can be made by


455

Table 15.4 Recommended minimum amino acid levels in diets for tilapia, carp, and channel catfish Amino acid (available)

Tilapia

Carp

Arginine Histidine Isoleucine Leucine Lysine Methionine & cystine1 Phenylalanine and tyrosine Threonine Tryptophan Valine

4.2 1.7 3.1 3.4 5.1 3.2–3.0 5.7 3.7 1.0 2.8

4.3 2.1 2.5 3.3 5.7 3.1 6.5 3.9 0.8 3.6

Channel catfish 4.3 1.5 3.1 3.4 5.1 2.3 5.0 2.0 0.5 3.0

1

Minimum methionine level is generally considered to be 60 % (wt/wt) of the total Met + Cys value.

Table 15.5 Recommended vitamin fortification levels for warm water fish (adapted from Roche supplementation guidelines for optimum vitamin nutrition) Amount Vitamin A D E K Thiamine (B1) Riboflavin (B2) Pyridoxine (B6) Vitamin B12 Niacin Pantothenate Folic acid Biotin Vitamin C1 Choline

Units / kg of feed IU IU IU mg mg mg mg mg mg mg mg mg mg mg

Minimum

Optimum

4000 1000 100 3–5 10 15 8 0.02 80 40 4 0.5 50 0

8000 2000 300 10 20 20 12 0.05 120 50 7 1 300 600

1

Vitamin activity in the finished diet – amount depends on stability of the source. Only stabilized sources are recommended.

reducing the variability in drying to make more precise endpoints and optimizing pre-conditioning to facilitate starch gelatinization and reduce energy required to extrude the product. One clear trend in both pelleting and extrusion processing is the replacement of pre-conditioners with newer models that allow for longer retention times for better pre-cooking of the product.

456

New technologies in aquaculture Table 15.6 Supplemental mineral levels recommended for practical diets Element

Units

Amount

Cobalt Copper Iodine Iron Manganese Selenium Zinc

mg/kg mg/kg mg/kg mg/kg mg/kg mg/kg mg/kg

0.025 10.0 3.5 25.0 25.0 0.3 100.0

15.3 Sources of further information and advice • American Feed Industry Association (2005) Feed Manufacturing Technology V, American Feed Industry Association, Arlington, VA. • Hertrampf J W and Piedad-Pascual F (2000) Handbook of Ingredients for Aquaculture Feeds, Kluwer Academic, Dordrecht. • Lim C E and Webster C D (eds) (2006) Tilapia: Biology, Culture and Nutrition, Food Products Press, New York. • Lim C E and Webster C D (2006b) Nutrient requirements, in Lim C E and Webster C D (eds), Tilapia: Biology, Culture and Nutrition, Food Products Press, New York. • NRC (National Research Council) (1993) Nutrient Requirements of Fish, National Academy Press, Washington, DC.

15.4 References bahurmiz o m and ng w k (2007) Effects of dietary palm oil source on growth, tissue fatty acid composition and nutrient digestibility of red hybrid tilapia, Oreochromis sp., raised from stocking to marketable size, Aquaculture, 262, 383–92. burr g, gatlin d m iii and ricke s (2005) Microbial ecology of the gastrointestinal tract of fish and the potential application of prebiotics and probiotics in finfish aquaculture, Journal of World Aquaculture Society, 36, 425–36. davis d a and gatlin d m iii (1996) Dietary mineral requirements of fish and marine crustaceans, Reviews in Fisheries Science, 4(1), 75–99. el-sayed a-f m (2006) Tilapia Culture, CABI Publishing, Cambridge, MA. el-sayed a-f m (1999) Alternative dietary protein sources for farmed tilapia, Oreochromis spp., Aquaculture, 179, 149–68. gatlin d m iii (2003) Use of Soybean Meal in the Diets of Omnivorous Freshwater Fish, United Soybean Board American Soybean Association, Chesterfield, MO/ Washington DC, 1–12. gatlin d m iii, barrows r t, brown p, dabrowski k, gaylord t g, hardy r w, herman e, hu g, krogdahl å, nelson r, overturf k, rust m, sealey w, skonberg d, souza e, stone d, wilson r and wurtele e (2007) Expanding the utilization of sustainable plant products in aquafeeds: a review, Aquaculture Research, 38, 551–79.


457

glencross b d, boujard t and kaushik s j (2003) Influence of oligosacharides on the digestibility of lupin meals when fed to rainbow trout, Oncorbynchus mykiss, Aquaculture, 219, 703–13. gray g m (1992) Starch digestion and absorption in nonruminants, Journal Nutrition, 122, 172–7. green b w, teichert-coddington d t and hanson t r (1994) Summary of Freshwater Aquacultural Research Conducted from 1983 to 1992, International Center for Aquaculture and Aquatic Environments, Research and Development Series No. 39, Auburn University, Auburn, Al. harding d e, allen o w and wilson r p (1977) Sulfur amino acid requirement of channel catfish: L-methionine and L-cystine, Journal of Nutrition, 107, 2031–5. kelly a and silverstein j (eds) (2005) Aquaculture in the 21st Century, American Fisheries Society, Bethesda, Md. lazaro r m, garcia m j, aranibar and mateos g g (2003) Effect of enzyme addition to wheat-, barley- and rye-based diets on nutrient digestibility and performance of lying hens, British Poultry Science, 44, 256–65. li m h and robinson e h (2006) Use of cottonseed meal in diets of aquatic animals: a review, North American Journal of Aquaculture, 68, 14–22. lim c e (1989) Practical feeding – tilapias, in Lovell T. (ed.), Nutrition and Feeding of Fish, Van Nostrand Reinhold, New York, 163–83. lim c e and webster c d (eds) (2001) Nutrition and Fish Health, Food Products Press, New York. lim c e and webster c d (eds) (2006a) Tilapia: Biology, Culture and Nutrition, Food Products Press, New York. lim c e and webster c d (2006b) Nutrient requirements, in Lim C E and Webster C D (eds), Tilapia: Biology, Culture and Nutrition, Food Products Press, New York, 469–501. murthy h s and varghese t j (1998) Total sulphur amino acid requirement of the Indian major carp, Labeo rohita (Hamilton), Aquaculture Nutrition, 4, 61–5. ng w k, lim p k and boey p l (2003) Dietary lipid and palm oil source affects growth, fatty acid composition and muscle a-tocopherol concentration of African catfish, Clarias gariepinus, Aquaculture, 215, 229–43. nrc (national research council) (1993) Nutrient Requirements of Fish, National Academy Press, Washington, DC. robinson e h and li m h (2007) Catfish Protein Nutrition: revised, Bulletin No. 1159. Mississippi Agriculture and Forestry Experiment Station, Mississippi State University, MS. robinson e h, li m h and oberle d (1998) Catfish Vitamin Nutrition, Bulletin No. 1078, Mississippi Agricultural and Forestry Experiment Station, Mississippi State University, MS. robinson e h and li m h (2008) Replacement of soybean meal in channel catfish, Ictalurus punctatus, diets with cottonseed meal and distillers dried grains with solubles, Journal of the World Aquaculture Society, 39, 521–7. robinson e h, li m h and manning b b (2001) A Practical Guide to Nutrition, Feeds, and Feeding (second revision), Bulletin No. 1113, Mississippi Agriculture and Forestry Experiment Station, Mississippi State University, MS. stone d a j (2003) Dietary carbohydrate utilization by fish, Reviews in Fisheries Science, 11, 337–69. santiago c b and lovell r t (1988) Amino acid requirements for growth of Nile tilapia, Journal of Nutrition, 118, 1540–46. schwarz f j, kirchgessner m and deuringer u (1998) Studies on the methionine requirement of carp (Cyprinus carpio L.), Aquaculture, 161, 121–9. shiau s y (2002) Tilapia, Oreochromis spp., in Webster C D and Lim C (eds), Nutrient Requirements and Feeding of Finfish for Aquaculture, CABI, New York.

458


tacon a g j (1993) Feed Ingredients for Warmwater Fish: Fish Meal and Other Processed Feedstuffs, FAO Fisheries Circular No. 856, Food and Agriculture Organization of the United Nations, Rome. takeuchi t, watanabe t and ogino c (1979) Optimum ratio of dietary energy to protein for carp, Nippon Suisan Gakkaishi, 45, 983–7. vranjes m v and wenk c (1995) The influence of extruded vs. untreated barley in the feed, with and without dietary enzyme supplement on broiler performance, Animal Feed Science and Technology, 54, 21–32. watanabe t, kiron v and satoh s (1997) Trace minerals in fish nutrition, Aquaculture, 151, 185–207. webster c d and lim c e (eds) (2002) Nutrient Requirements and Feeding of Finfish for Aquaculture, CABI, New York. wilson r p (1994) Utilization of dietary carbohydrate by fish, Aquaculture, 124, 67–80. williams k, barlow c and rodgers l (2001) Efficacy of cystalline and protein-bound amino acids for amino acid enrichment of diets for barramundi/Asian seabass (Lates calcarifer Bloch), Aquaculture Research, 32(1), 415–29.

16 Advances in aquaculture feeds and feeding: basses and breams M. Booth, New South Wales Department of Primary Industries, Australia

Abstract: The aquaculture species of bass and bream belong to the order Perciformes and come from five major family groups; Latidae, Sparidae, Serranidae, Moronidae and Lutjanidae. Well-known species include Asian seabass Lates calcarifer (Latidae), the common sea breams or porgies such as Pagrus pagrus, Pagrus major (= Pagrus auratus), gilthead sea bream Sparus aurata and common dentex Dentex dentex (all from the Sparidae), European sea bass Dicentrachus labrax, striped bass Morone saxatilus, white bass Morone chrysops and hybrid striped bass (Morone saxatilus × M. chrysops) (Moronidae) and the groupers Epinephalus sp. (Serranidae). All sea basses and sea breams are euryhaline and carnivorous and they generally command high market prices. Much of the research on basses and sea breams is dominated by basic nutrition and feeding research that aims to improve production efficiencies. To reflect recent advances in understanding nutrient requirements, use of alternative feed ingredients and feeding strategies for these species, new information is presented here for Asian seabass, red sea bream, gilthead sea bream and grouper. Future nutrition research with these species will continue to investigate increased use of alternative feed ingredients and reductions in the use of declining stocks of fish meal and fish oil. The impact of new ingredients and new diet specifications on extrusion and processing technology will need to be considered. The increase in demand for high-value species will demand research that improves our understanding of basic nutrient requirements for protein, amino acids, lipids or carbohydrates and a better understanding of the impacts of these factors, in conjunction with culture environmental conditions, on nutritional status, fish metabolism, health, and total farm productivity. Key words: Latidae, Asian seabass, barramundi, Lates calcarifer, Sparidae, red sea bream, Pagrus major, Pagrus auratus, gilthead sea bream Sparus aurata, Serranidae, grouper, Epinephalus, digestibility, requirements, replacement studies, feeding studies, alternative ingredients.

16.1 Introduction Important aquaculture species of bass and bream belong to the order Perciformes and come from five major family groups; Latidae, Sparidae,

460


Serranidae, Moronidae and Lutjanidae. Within each of theses families is a diverse range of species and many have aquaculture potential. The best known representative from the Latidae is the Asian seabass Lates calcarifer, while the Sparids are represented by the common sea breams or porgies such as the red porgie Pagrus pagrus, Japanese red sea bream Pagrus major, also known as Pagrus auratus in Australia (Paulin, 1990), gilthead sea bream Sparus aurata and common dentex Dentex dentex (Pillay, 1993). Several emerging sparids include the sheepshead Archosargus probatocephalus (Tucker, 2008) and red banded seabream Pagrus auriga (Cardenas, 2008). The Moronidae are represented by European sea bass Dicentrachus labrax, striped bass Morone saxatilus, white bass Morone chrysops and hybrid striped bass (Morone saxatilus × M. chrysops). The Serranidae are probably best represented by the groupers (Epinephalus sp.) while the Lutjanidae include species such as red snapper Lutjanus campperchanus, mangrove red snapper Lutjanus argentimaculatus and mutton snapper Lutjanus analis. According to recent FAO data, Taiwan (15 000 t) and Thailand (6660 t) are the major producers of Asian seabass, but production in Malaysia (5550 t), Indonesia (2183 t) and Australia (2075 t) is increasing (Rimmer, 2003) and the species is even farmed in intensive recirculating systems in the USA and Europe. In Australia, the value of Asian seabass production has climbed to approximately $US15 million (ABARE, 2007). Japan produces nearly 71 000 t of red sea bream annually while Greece, Turkey, Spain and Italy produce about 43 900, 28 460 and 16 500 t of gilthead seabream, respectively (FAO Fisheries Statistics 1950–2006). Greece (34 000 t) and Spain (8300 t) are the major producers of European sea bass while the majority of mangrove red snapper are produced in Malaysia (4500 t). China was by far the major producer of grouper sp. (48 000 t valued at $US54 million), but production continues to escalate in Taiwan (9500 t), Indonesia (3100 t) and Thailand (3000 t) (FAO Fisheries Statistics 1950–2006). Common to all sea basses and sea breams are their euryhaline and carnivorous habits and the fact that they generally command high market prices (Pillay, 1993). Early publications on red sea bream (Foscarini, 1988) gilthead sea bream (Kissil, 1991), Asian seabass (Boonyaratpalin, 1991; Pillay, 1993), striped or hybrid bass (Brandt, 1991) and European sea bass (Landau, 1992) give some historical background on each species and describe their potential for aquaculture. More recently, reviews have been published on the basic nutritional requirements and feeding practices of Asian seabass (Boonyaratpalin and Williams, 2002), European sea bass (Kaushik, 2002), red sea bream (Koshio, 2002), gilthead sea bream (Koven, 2002) and hybrid striped bass (Webster, 2002). Review, discussion and evaluation of the development and constraints to aquaculture of sea bass, sea bream (Gasca-Leyva et al., 2002; Rad, 2007) and grouper (Pomeroy, 2007) have also contributed to the broader economic understanding of these species.

Advances in aquaculture feeds and feeding: basses and breams

461

Cited literature in the aforementioned nutritional reviews covered research up to about 2000. Henceforth there has been interest in new areas of research such as genetic and genomic (Wang et al., 2007) studies in fish nutrition. However, much of the research on basses and sea breams, like many aquaculture species, is dominated by basic nutrition and feeding research that aims to improve production efficiencies. This is the case whether industries are new (e.g. grouper) or mature (e.g. salmon). Recent advances in understanding nutrient requirements, use of alternative feed ingredients and feeding strategies are presented here for Asian seabass, red sea bream, gilthead sea bream and grouper. These species were selected for review because they are representative of the diverse range of basses and breams currently under culture and because nutritional research undertaken on these four species is similar to research undertaken on most of the other species related to their specific family groups.

16.2 Asian seabass Asian seabass are also known as giant sea bass or barramundi. They are widely distributed in the tropical and sub-tropical areas of Asia (Pillay, 1993). Their natural life cycle is considered biphasic, with the juvenile stages of growth occurring in freshwater followed by migration to sea for sexual maturation and spawning (Boonyaratpalin and Williams, 2002). They are amenable to culture in a variety of fresh or saltwater systems (cages, ponds or tanks) and are tolerant of turbidity and high stocking densities. Traditionally, Asian seabass were fed a ration of chopped low-value fish during the grow-out period, and this was often blended and extended with broken rice or rice bran (Pillay, 1993). This feeding strategy is still used in many Asian countries where this species is produced despite the emergence of highquality feeds manufactured using extrusion technology that dominate production in Australia, the USA, Europe and Taiwan.

16.2.1 Requirements Hitherto little was known about the quantitative protein or amino acid requirements of Asian seabass according to the recent review of Boonyaratpalin and Williams (2002). Like most carnivorous species, protein requirements were estimated to be between 40 and 50 % of the diet (NRC, 1993; Catacutan and Coloso, 1995). Early studies had elucidated the digestible energy demands of this species at different temperatures using a bioenergetic approach (Lupatsch, 2003) while recommended levels of dietary carbohydrate were given as 20 % in diets containing lipid levels ranging from 6 to 18 % (Catacutan and Coloso, 1997). Recently, Glencross (2006) has published a comprehensive review on the nutritional management of Asian seabass which covers nutritional advances on this species in some

462


detail. The extensive nature of this document precludes repetition in this chapter and readers seeking an inclusive list of references, information on growth, dietary requirements, digestibility and feeding strategies are urged to consult this work. Glencross (2008) has also presented new and refined data on nutrient requirements, feed utilization and iterative diet formulation for Asian seabass determined from bio-energetic studies, partial validation of bio-energetic models for large fish (Glencross et al., 2008) and a wide ranging report on the cage culture of this species which includes information on growth performance, flesh quality, purging techniques and sensory analysis (Glencross et al., 2007). The potential of increasing dietary lipid in order to spare protein for growth of juvenile (80 g) or sub-adult (230 g) barramundi reared in freshwater was investigated by Williams et al. (2003a). In one factorial experiment, test diets contained 38–53 % crude protein with lipid concentrations of 7.0, 12.8 or 18.3 % and in another test diets varied in protein from 44–65 % with lipid concentrations of 13, 18 or 23 %. Regardless of fish size, feed conversion ratio (FCR) and growth rate improved linearly with increasing dietary crude protein content and improved step-wise with increasing dietary lipid content (Fig. 16.1). A small protein sparing effect was observed, but this was more pronounced in the smaller rather than the larger animals. Interestingly, an increase in dietary crude protein did not overly affect efficiency of nitrogen retention, but retention of dietary gross energy improved as dietary lipid increased; fat deposition was the major component of the retained energy. Their results showed that productivity can be markedly improved by increasing dietary protein and lipid concentrations, but that Asian seabass only has a limited capacity to use lipid as a 5.5 5.0

ADG

4.5 4.0 3.5 7.0 % lipid

3.0

12.8 % lipid 2.5

18.3 % lipid

2.0 35

38

40

43

45

48

50

53

55

58

Crude protein content of diet (%)

Fig. 16.1 Effect of dietary protein (air-dry) on average daily weight gain (ADG) of plate size Asian seabass fed diets that contained 7.0 %, 12.8 % or 18.3 % total lipid (air-dry). Data reproduced from Williams et al. (2003a).


463

primary energy source. An earlier study found that for iso-nitrogenous diets, increases in dietary gross energy from 18 to 21 MJ kg−1 supplied as a mix of different lipid: carbohydrate ratios improved overall productive performance, a result indicative of protein sparing. However, there was little evidence that lipid (fish oil) or carbohydrate (autoclaved starch) was preferred as a protein sparing energy source at either of the dietary energy densities (Nankervis et al., 2000). Requirements for trypotophan, methionine, lysine and arginine were given as 0.5 %, 2.24 %, 4.5–5.2 % and 3.8 % of dietary protein, respectively (several authors cited in Boonyaratpalin and Williams, 2002). Based on growth response, the total sulphur amino acid demand of small fish (2.5 g) fed increasing levels of methionine (in the presence of cystine) was estimated to be 2.9 % of dietary protein which was similar to previous estimates (Coloso et al., 1999). New work has confirmed the tryptophan requirements of juvenile fish (5.3 g) to be 0.41 % of dietary protein (Coloso et al., 2004). Williams et al. (2001) conducted research into the efficacy of crystalline amino acids in diets for Asian seabass reared in freshwater by comparing their performance to that of fish fed protein bound amino acids (casein). They found that the efficacy of amino acid enrichment was dose dependent. At low dietary supplementation rates (i.e. 30 % moisture), but the majority of work since then has been based on dry feeds (Koshio, 2002). Much of the diet research in Japan has been sponsored by private feed companies and, as such, feed formulations and production results are held in confidence. Publication of specific nutritional research on this species in the past was often limited or unavailable, but more manuscripts are now being published in readily accessible journals. General dietary requirements for red sea bream are estimated at 40–55 % crude protein, 10–15 % lipid, 10–15 % carbohydrate and 15–21 % ash (Foscarini, 1988; Koshio, 2002) and approximate requirements for other sparids such as the gilthead sea bream (Kaushik, 1997). The scale and success of the Japanese red sea bream industry, particularly once it had converted to using dry extruded feeds, prompted interest in the sea cage aquaculture of the same species in Australia (i.e. P. auratus). This led to significant advances in brood-stock management, larval rearing (Bell et al., 1991; Battaglene and Talbot, 1992; Battaglene and Allan, 1994; Fielder et al., 2002, 2005, 2008) and preliminary research on diet development (Quartararo et al., 1998a,b) for this species under Australian conditions. Henceforth, P. auratus is referred to as red sea bream (Paulin, 1990). Aquaculture of gilthead sea bream is more recent than that of red sea bream, and most of the research effort on this species occurred after 1980 (Kissil, 1991). Many of the early advances in the nutrition of gilthead were based on research conducted with red sea bream. As indicated earlier, Koven (2002) has recently presented a comprehensive review of the nutrient requirements and feeding practices for larval, broodstock and grow-out fish determined from studies up till 2001. His review also touches on alternative feed ingredients such as soy and rape seed protein concentrates, lupin meal, corn gluten meal, meat and poultry meal. Koven (2002) opined that, although the lipid and fatty acid requirements of larval fish were well

468


studied, the lack of specialized microdiets for larval fish was restricting detailed investigation of other nutrient requirements. His review also indicated that there appeared to be discrepancies in published research about the ability of gilthead sea bream to utilize dietary lipid to spare protein.

Protein deposition (g kgBW–0.7 d–1)

16.3.1 Requirements Many of the basic requirements for protein, EAA, lipids, vitamins, minerals and energy during the juvenile or grow-out phase of growth have been previously elucidated for red sea bream (Takeuchi et al., 1991; Forster and Ogata, 1998; Koshio, 2002) and gilthead sea bream (Koven, 2002). Many requirements were determined using animals of one size fed diets in which the dietary crude protein, lipid or energy content was varied over a suitable range; changes in response criteria such as weight gain or protein retention were then measured. More recently, these types of studies have progressed to determine requirements on a digestible protein (DP) and DE basis. For example, Booth et al. (2007), using predetermined digestibility coefficients of dietary ingredients coupled with a summit/diluent approach, demonstrated that growth and protein retention in juvenile (30–90 g) red sea bream was closely linked to the DP : DE ratio of the diet. According to their results, diets for juvenile red sea bream should contain approximately 23 g DP MJ DE−1 to promote optimal weight gain and protein deposition (Fig. 16.2). This corresponded to practical diets containing dietary DP (g kg−1) and DE (MJ kg−1) contents of 460 : 20, 420 : 18 or 350 : 15, respectively.

1.50 1.25 1.00 0.75 High-energy series Mid-energy series Low-energy series

0.50 0.25 0.00 10

13

15

18

20

23

25

28

30

DP:DE ratio (g DP MJ DE–1)

Fig. 16.2 Effect of dietary digestible protein (DP) and digestible energy (DE) ratio on relative protein deposition in juvenile red sea bream (P. auratus). Data reproduced from Booth et al. (2007).


469

Current practice has moved away from simple dose–response experiments to the use of bio-energetic or multivariate approaches (Shearer, 1995; Azevedo et al., 2005) to predict growth relationships or the DP and DE requirements of growing fish. This approach has been used to estimate the protein and energy requirements of gilthead sea bream (Lupatsch et al., 1998, 2001a, 2003b; Libralato and Solidoro, 2008; Lupatsch, 2008) and European sea bass (Lupatsch et al., 2001b) and to examine differences in energy utilization by sparids and grouper (Lupatsch et al., 2003a). However, no such work has been published on red sea bream. Similarly, extension of bio-energetic models to determine amino acid or other essential nutrient requirements is rare and warrants increased attention in the future. Amino acid requirements for lysine were extrapolated (A/E ratio) to determine the EAA for red sea bream in earlier work (Forster and Ogata, 1998). A recent experiment has elucidated the ideal amino acid pattern for juvenile red sea bream (1.6 g) by feeding a series of semi-purified diets containing 20 % crystalline amino acids to simulate the amino acid pattern of red sea bream egg protein, red sea bream larvae protein, red sea bream juvenile whole body protein or brown fish meal (Alam et al., 2005). The results suggest that red sea bream juveniles are able to utilize large amounts of crystalline amino acids in coated form and demonstrated that the highest weight gain was observed in fish fed the diet simulating the amino acid pattern of juvenile red sea bream. Takagi et al. (2001) found that supplementation of diets containing high levels of soy protein concentrate with crystalline lysine or methionine added alone or in combination improved growth in red sea bream juveniles (12 g) above that of fish fed a control diet having no added crystalline amino acids. However, the growth response of yearling red sea bream (180 g) fed similar diets was more equivocal leading these authors to suggest that the amino acid requirement of red sea bream might change according to growth rate or age. The essential amino acid pattern of juvenile gilthead sea bream (5 g) was recently updated using the amino acid dilution method. The levels, expressed as A/E ratios relative to lysine (= 100) were estimated as arginine, 108.3; threonine, 58.1; histidine, 36.8; isolouecine, 49.7; leucine, 92.7; methionine, 50.8; phenyalanine, 44.2; valine, 62.6; tryptophan, 14.6 (Oliva-Teles and Peres, 2008). As for red sea bream, these authors found the EAA requirement of gilthead sea bream correlated well with the EAA composition of fish tissue. Recently, many experiments have been conducted to investigate the efficacy of dietary taurine in ameliorating the effects of ‘green liver syndrome’ in red sea bream. This symptom is thought to be related to increases in dietary content of alternative feed ingredients such as soybean meal at the expense of fish meal content (Takagi et al., 2006). Early work hypothesized that taurine might in fact be an essential nutrient for larval and juvenile fish (Takeuchi et al., 2001), playing an important role in lipid metabolism (Matsunari et al., 2008b). Supplementing low fish meal diets with taurine has been shown to improve performance and reduce ‘green liver

470


syndrome’ in yearling red sea bream. Red sea bream fed diets without taurine supplementation exhibited inferior feed performance, alteration of erythrocytes and significant reductions in hepato-pancreatic taurine concentration and elevations in hepato-pancreatic biliverdin concentration (Takagi et al., 2006). Recommended dietary inclusion levels of taurine have been suggested as 0.5 % (Matsunari et al., 2008a) and 0.52 % in terms of optimizing growth and 0.48 % in terms of optimizing feed efficiency (Matsunari et al., 2008b). Moderate elevation of dietary lipid is generally thought to enhance protein retention in gilthead sea bream, supporting a protein sparing effect in this species. However, the level of dietary protein, feeding regimes or activity level employed in different studies all appear to impact on the magnitude of this effect (Forster and Ogata, 1996; Vergara et al., 1996, 1999; Caballero et al., 1999; Company et al., 1999a,b; Santinha et al., 1999). Other research has found little evidence of protein sparing in sparids. For example, Schuchardt et al. (2008) recently reported that increases in the lipid content of iso-proteic diets from 10 % to 15 % did not induce a protein sparing effect in red porgy while lipid levels above 15 % negatively affected performance. In addition, Bonaldo et al. (2008a) found that although increasing the energy density of diets (i.e. from 16 % to 32 % crude fat) increased feed intake, it elevated FCR and did not improve weight gain of gilthead sea bream fed to apparent satiety. A similar outcome was reported by Velazquez et al. (2006a). Like lipid, carbohydrates are potential sources of dietary energy for marine fish despite the fact that fish have no requirement for carbohydrate per se. Recent research in this area is dominated by metabolic investigations on enzymes important to carbohydrate metabolism (Panserat et al., 2000, 2002; Caseras et al., 2002; Fernandez et al., 2007; Couto et al., 2008; Enes et al., 2008b) as well as simple studies on glucose regulation (Booth et al., 2006). Evidence of protein sparing is limited; however, Wu et al. (2007) found that protein productive value was improved by incorporating 20 % raw starch (corn starch, tapioca starch or potato starch) into the diets of juvenile yellowfin sea bream Sparus latus. Several studies have recommended including no more than 20–30 % carbohydrate in the diets of bass and sea breams (Booth et al., 2006; Fernandez et al., 2007; Wu et al., 2007; Rawles et al., 2008). Requirements for vitamin A have been recently estimated for small red sea bream (1.2 g) by feeding increasing dietary contents of retinol palmitate (i.e. 0, 300, 600, 1500, 3000, 4500, 6000, 15 000 or 30 000 retinol equivalent kg−1 diet). Specific growth rate tended to plateau around 6000 retinol equivalent kg−1 diet, beyond which a slight decrease in specific growth rate was observed. Besides a growth reduction in red sea bream fed diets with low levels of vitamin A, no other signs of deficiency were noted. Likewise, there were no signs of toxicity in fish fed the highest levels of vitamin A. Based on specific growth rate and liver retinol concentration the requirement of


471

dietary vitamin A for juvenile red sea bream was estimated to be between 1500 and 6000 retinol equivalents kg−1 (Hernandez et al., 2004).

16.3.2 Digestibility Apparent digestibility coefficients for a diverse range of ingredients have been published for red sea bream (Yamamoto et al., 1998; Glencross and Hawkins, 2004; Glencross et al., 2004a; Booth et al., 2005, 2006) and gilthead sea bream (Nengas et al., 1995; Lupatsch et al., 1997). As for most carnivorous species, the digestibility of marine proteins and oils is high (Yamamoto et al., 1998; Booth et al., 2005). Newer studies have tended to focus on measuring digestibility of rendered animal by-product meals and plant products with higher levels of crude protein (Drew et al., 2007), such as improved varieties of lupin (Glencross et al., 2003a; Glencross and Hawkins, 2004) or differently processed canola meals (Glencross et al., 2004a). In the past it was common to measure the digestibility of alternative ingredients at one inclusion level (usually 30 %). However, concerns about the additivity of certain ingredients, especially carbohydrate sources, has driven research to investigate the effects of dietary inclusion content on digestibility. For example, red sea bream are highly efficient at digesting the protein from grains such as extruded wheat, but organic matter and gross energy digestibility decrease linearly as inclusion levels of wheat (Booth et al., 2005) or pregelatinized starch (Fig. 16.3) increase (Booth et al., 2006). In contrast, inclusion level had no affect on the protein and energy digestibility

Gross energy ADC (%)

105 95 85 75 65 55 45 150

250

350

450

Gelatinized wheat starch inclusion level (g kg–1 diet)

Fig. 16.3 Effect of increasing dietary inclusion content (g kg−1 diet) on percent apparent energy digestibility coefficients (ADC) of gelatinized wheat starch by juvenile red sea bream (P. auratus). Data reproduced from Booth et al. (2006).

472


of meat meal and poultry meal by red sea bream (Booth et al., 2005) or soybean meal (Venou et al., 2006). Other researchers have reported similar issues with the additivity of carbohydrate apparent digestibility coefficients (ADCs) for gilthead seabream (Lupatsch et al., 1997). Alternate studies have confirmed that sparids are reasonably efficient at digesting the energy from wheat, provided inclusion levels are not excessive (Georgopoulos and Conides, 1999; Venou et al., 2003); however, there is some indication that the level of dietary fat can negatively affect starch and protein digestibility by interfering with the activity of alpha-amylase and protease in the digestive tract (Fountoulaki et al., 2005). It is clear that carbohydrate sources, excluding non-starch polysaccharides (NSP) have potential for use in sparid diets, but this potential will ultimately be governed by the protein and lipid requirements of individual species which in turn dictates the ‘formulation space’ remaining for carbohydrate inclusion. The aforementioned variability in carbohydrate digestibility underscores the need to determine the ADCs of carbohydrate sources over a wide range of inclusion levels in order to accurately formulate either research or commercial feeds. A list of apparent digestibility coefficients for different feed ingredients fed to red sea bream (P. auratus) is presented in Table 16.3.

16.3.3 Replacement studies There is a great deal of published research targeting the replacement of fish meal or fish oil in aquafeeds for sparids. Studies on the use of oilseeds, legumes and plant proteins in either their raw or processed forms dominate the literature (Takagi et al., 2000a; Pereira and Oliva-Teles, 2002, 2004; Venou et al., 2003, 2006; Glencross et al., 2004b; Kissil and Lupatsch, 2004; Biswas et al., 2007; Lozano et al., 2007; Martinez-Llorens et al., 2007a,b; Enes et al., 2008a). Many of these studies are aimed at understanding or overcoming the negative impacts of feeding plant proteins (e.g. low digestibility, antinutrients, palatability, HUFA profile, gut histology) on the nutritional or immune status of the fish (Sitja-Bobadilla et al., 2005) or implications for the consumer (Robles et al., 2008). By comparison, there are relatively few recent studies investigating the replacement of fish meal with animal by-product meals such as meat or poultry meals, blood meals or feather meals in aquafeeds for sparids (e.g. Martinez-Llorens et al., 2008), despite previous evidence that animal byproduct meals are suitable alternatives to fish meal (Quartararo et al., 1998a,b; Nengas et al., 1999; Takagi et al., 2000b). This may be related to the European ban on including some rendered animal by-product meals in animal diets, prompting more effort on use of plant proteins (MartinezLlorens et al., 2008). Australia is known to be free of BSE and no such legislative constraints are in place to preclude the use of rendered animal by-product meals in aqua-feeds. Booth et al. (2008a) found that the diets for juvenile red sea bream that are formulated on a digestible protein and


473

Table 16.3 Percent apparent digestibility coefficients (ADC) for protein and energy of Australian ingredients fed to red sea bream Ingredient Fish meal1 Wheat gluten1 Lupin seed meal (Gungarru)1 Canola meal (solvent-extracted)2 Canola meal (expeller-extracted)2 Canola protein concentrate2 Solvent-extracted soybean meal2 Fish meal3 Fish oil3 Fish oil3 Extruded wheat3 Extruded wheat3 Extruded wheat3 Meat meal3 Meat meal3 Poultry meal3 Poultry meal3 Blood meal3 Haemoglobin powder meal3 Solvent-extracted soybean meal3 Expeller-extracted soybean meal3 Pregelatinized wheat starch4 Pregelatinized wheat starch4 Pregelatinized wheat starch4 Pregelatinized wheat starch4

Inclusion level (%) 42 na 30 30 30 30 30 50 15 25 20 30 40 30 50 30 50 15 15 30 30 15 25 35 45

Protein ADC (%) 87.5 102.0 98.7 83.2 93.6 52.6 79.2 94.3 na na 100.6 105.4 100.1 62.2 65.3 84.9 86.9 81.6 95.1 87.2 90.7 na na na na

Energy ADC (%) 87.8 84.3 56.3 43.9 61.6 73.7 58.3 99.2 100.5 98.3 80.5 76.9 74.4 72.0 70.5 91.4 91.4 81.3 79.5 66.8 64.3 89.2 73.9 70.2 55.2

1

Data from Glencross et al., 2003a. Data from Glencross et al., 2004a. Data from Booth et al., 2005. 4 Data from Booth et al., 2006. na = not applicable. 2 3

energy basis (25 g DP MJ DE−1) can contain as much as 36 % poultry meal, 35 % meat meal or 42 % solvent extracted soybean meal before weight gain and feed efficiency decline. In addition, commercially extruded diets that contained a blend of these feed ingredients were able to replace all but 16 % of the fish meal in similarly treated control diets. Various studies have found that gilthead sea bream will tolerate diets containing about 20 % carbohydrate (native or waxy maize starch, pregelatinized starch) before growth performance is reduced (Couto et al., 2008; Enes et al., 2008a). These tolerance levels are slightly lower than those cited for juvenile red sea bream (Booth et al., 2006). To date, replacement studies evaluating soybean meal have received the most attention. Soybean meal is known to impair growth and protein utili-

474


zation and cause distinct morphological alterations to the intestine of Atlantic salmon and rainbow trout. However, its use, even at very high dietary levels (up to 30 %), does not appear to affect growth, feed intake, protein efficiency ratio or FCR in gilthead sea bream. Notwithstanding these results, at high inclusion levels it appears to induce subtle changes in the morphology of the distal intestine (i.e. presence of cellular infiltration of the submucosa and lamina propria) (Bonaldo et al., 2008b). Longer term studies have shown that suitable blends of plant proteins such as corn, wheat gluten, extruded peas, wheat and rapeseed meal can satisfactorily replace up to 75 % of fish meal in diets for gilthead sea bream without affecting growth, but fillet yield and n-3 fatty acid composition of fish fed plant protein-based diets was lower than fish fed a fish meal control diet (De Francesco et al., 2007). These studies have been extended to investigate the concurrent replacement of fish meal with plant proteins and fish oil with different types of vegetable oil (i.e. rapeseed: linseed: palm oils) with promising results (Benedito-Palos et al., 2007). Much attention is being focused on the use of plant oils in diets for cultured marine finfish, firstly because of their abundance in the face of decreasing stocks of fish oil (Bell and Tocher, 2008) and secondly because marine fish lack the ability to convert polyunsaturated fatty acids (PUFA) like LOA and linolenic acid (LNA) in vegetable oils to the essential fatty acids EPA, DHA or ArA. This issue becomes extremely important where dietary fish meal content is also significantly reduced (a good source of essential fatty acids), particularly when it is replaced with plant proteins (a poor source of EFA). Glencross et al. (2003b) has demonstrated that crude or refined canola oil and refined soybean oil can partially replace significant levels of fish oil in the diets of red sea bream before growth and FCR are negatively affected. However, they found a strong correlation between the level of fish oil substitution and the fatty acid composition of tissues, particularly an increase in the level of PUFA (especially LNA and LOA). Sensory assessment of fish fed these diets also indicated a preference for red sea bream fed refined canola oil > refined soybean oil > fish oil. These findings were supported in a later study that demonstrated that canola oil could replace up to 70 % of pollock oil in the diet of red sea bream without compromising growth performance (Huang et al., 2007). Generally, the judicious substitution of fish oils by plant oils has been shown to have dramatic impacts on lipid composition but relatively little impact on the production performance of sparids. Consequently, research has started to focus on the use of ‘finishing diets’ to restore or ameliorate the fatty acid composition of edible fish, particularly the n-3 HUFA. Such an approach was explored by Glencross et al. (2003c) who fed red sea bream for three months on canola or soybean oil diets before switching them back to diets containing fish oil. Moderate decreases in PUFA (18:2n-6, 18:3n-3) and increases in long-chain PUFA (20:5n-3, 22:6n-3) were recorded in tissue samples after one month, demonstrating the potential of this approach.


475

These results were echoed in the study of Izquierdo et al. (2005) who found reductions in the muscle content of DHA, ArA and EPA of gilthead sea bream reared on diets containing rapeseed, linseed or soybean oil. Refeeding a fish oil-based diet for 60 days restored muscle contents of DHA and ArA, but contents of EPA were not recovered even after 90 days (Izquierdo et al., 2005). Although growth of marine fish fed vegetable oils, particularly blends of different oils, generally approximates that of fish fed fish oil, the use of these oils has implications for their immunological status and resistance to different stressors. Thus, increasing effort is being directed at understanding the impact of vegetable oils on the stress (Ganga et al., 2008) and immune response of gilthead sea bream, specifically the interferon system (Montero et al., 2008a,b). Readers are encouraged to consult the following publications for background on lipid research and replacement studies with red and gilthead seabream: Glencross et al. (2003c), Izquierdo et al. (2003) and Izquierdo et al. (2005).

16.3.4 Feeding studies Recent reviews have presented feeding tables for larvae, juvenile and adult red sea bream (Koshio, 2002), but at that time less information was available for gilthead sea bream (Koven et al., 2001). New work has recommended feeding rates of 2.3 % and 0.6 % BW day−1 as optimum and maintenance rations, respectively, for very small (3 g) gilthead sea bream (Mihelakakis et al., 2002), and numerous studies are now available that estimate the daily feed intake of gilthead sea bream based on the total energy or protein demands of growing fish (Lupatsch et al., 1998, 2003b; Lupatsch, 2004, 2008). Although bio-energetic models estimate total feed demand, much research on gilthead sea bream is still dedicated to exploring different feeding regimes and if these regimes can enhance feed intake and weight gain (Paspatis et al., 2000; Mihelakakis et al., 2002; Ibarz et al., 2003; SánchezMuros et al., 2003; Sitja-Bobadilla et al., 2003; Velazquez et al., 2006b). In comparison, there are far fewer feeding studies reported for red sea bream. Recent publications include a study on the interactive effects of photoperiod and feeding interval which demonstrated that weight gain of newly weaned red sea bream (0.14–1.80 g) could be maximized by rearing them under an 18L:6D photoperiod and feeding them at least 10 % of their body weight eight times per day (Tucker et al., 2006). This study was followed by an investigation of larger juveniles (5 vs 20 g) fed one of nine feeding regimes to apparent satiation: 1 feed early, 1 feed late, 2 feeds early, 2 feeds late, 4 feeds, 4 feeds early, 4 feeds late, 6 feeds or 8 feeds per day. The results indicated that optimum to maximum weight gain and FCR in juvenile red sea bream could be achieved by feeding fish to apparent satiation twice per day. In addition, the gastric evacuation rate of a single meal fed to small or large snapper proved to be similar (relative feed content = 2.733 ± 0.195 × exp(−0.139±0.013)), with approximately half the meal passed within 5 h and the

476


whole meal cleared from the stomach within 16–20 h (Booth et al., 2008b). As for gilthead sea bream (Gines et al., 2004; Eroldogan et al., 2006a,b, 2008), there is renewed interest in evaluating the potential for compensatory growth in red sea bream (Oh et al., 2007) and the beneficial effects of extended photoperiod on feed intake (Biswas et al., 2005, 2006, 2008).

16.3.5 Miscellaneous studies The unnatural dark skin pigmentation (i.e. melanism) of cultured red sea bream, gilthead sea bream and red porgy has continued to affect the profitability of the sparid industry and a great deal of research effort has focused on developing practical nutritional or physical solutions to ameliorate this problem. Approaches have included the addition of natural or synthetic carotenoids to diets (Gomes et al., 2002; Gouveia et al., 2002; Booth et al., 2004; Kalinowski et al., 2007), alteration of the culture environment to reduce natural light intensity, background colour or alter certain wavelengths (Rotllant et al., 2003; Doolan et al., 2007, 2008a,b,c) and post-harvest treatment of fish with chemicals such as potassium or sodium chloride (Lin et al., 1998; Doolan et al., 2008a). Doolan et al. (2008b) recommended that red sea bream P. auratus should be held in white cages and fed diets containing 30 mg astaxanthin kg−1 for 50 days to increase skin lightness and red pigmentation. Pavlidis et al. (2008) have indicated the skin lightness of red porgy P. pagrus can be significantly improved by providing low light intensity, blue spectra, a water temperature of 19 °C and a white background. This suggests the problem is multifactorial in nature and indicates that for each species, a specific solution may be required for each particular culture situation.

16.4 Grouper Groupers are a diverse group of predatory reef fish comprising more than 90 species within five main genera of the family Serranidae (Williams, 2005). They are widely distributed in the tropical and subtropical seas of the world and are highly prized in the fish markets of Hong Kong and Singapore (Rimmer et al., 2004; Williams, 2005). Well known species include the orange spot grouper Epinephelus coioides, humpback grouper Cromileptes altivelis and coral trout Plectropomus spp. The preferred harvest size for groupers tends to be between 0.6 and 1.2 kg depending on the market, with species such as the orange spot grouper taking between 6 and 12 months to reach this weight under typical farm conditions. One of the greatest impediments to the aquaculture development of groupers, especially the higher value species (e.g. coral trout and humpback grouper), is the limited production of fry and fingerlings. This bottleneck is being addressed through advances in hatchery technology (Rimmer et al., 2004; Sim et al., 2005). Until recently,


477

low-value fish was the preferred feed for the grow-out of groupers, especially in South East Asia. This practice has tended to place increased pressure on stocks of low-value fish (Shapawi et al., 2007) and can act as a potential vector for the introduction of diseases to farms. As issues surrounding hatchery bottlenecks for grouper have improved, grow-out production has escalated. This expansion can only continue if it is based on a move away from feeding low-value fish to feeding cost-effective, low polluting manufactured feeds. An excellent monograph listing advances in larval and grow-out technologies for grouper, including many papers on nutrition, has recently become available (Rimmer et al., 2004).

16.4.1 Requirements The gross nutrient requirements of farmed grouper appear to be quite similar (Williams, 2005), with fingerlings requiring a diet with high crude or digestible protein content (i.e. >44 % DP) (Luo et al., 2004; Williams et al., 2004; Tuan and Williams, 2007), medium levels of lipid (i.e. 7–16 %) (Lin and Shiau, 2003; Williams et al., 2004, 2006a; Tuan and Williams, 2007) and no more than 20 % cereal grains to promote good growth and feed conversion (Williams, 2005). A longer term feeding study with larger humpback grouper (150–400 g) found no interaction between increasing levels of dietary protein and lipid content and suggested diets for this slower growing species should contain a digestible protein content approaching 51 %, 10–12 % lipid and a DP : DE ratio of 31–32 g MJ−1 to promote optimal growth (Usman et al., 2005). Many studies have shown that growth rates of grouper continue to increase in response to increases in dietary protein while concomitant increases in lipid content have little impact apart from increasing adiposity (Cheng et al., 2006; Tuan and Williams, 2007), indicating that grouper rely heavily on dietary proteins as a source of metabolic energy (Williams et al., 2004). Further evidence for the use of dietary protein as an energy source for grouper can be found in the bio-energetic study of Lupatsch and Kissil (2005) who showed that white grouper (Epinephelus aeneus) has a relatively low feed intake coupled with a low energy requirement and thus the opportunity to spare dietary protein is limited. Lupatsch and Kissil (2005) presented iterative feed formulations for white grouper over the entire grow-out range which indicated that the DP : DE of aquafeeds for this species will decline from about 33 to 21 g DP MJ DE−1 as fish grow from 5 g to 750 g. Little is known of about the quantitative amino acid requirements of grouper. Recent work using diets containing graded levels of crystalline amino acids has determined the dietary lysine requirement of juvenile orange spot grouper to be 28.3 g kg−1 diet (e.g. 55.6 g kg−1 protein) (Luo et al., 2006b) and the dietary methionine requirement (in the presence of cystine) to be 13.1 g kg−1 diet (e.g. 27.3 g kg−1 dietary protein) (Luo et al., 2005). A similar study with the same species determined the dietary arginine

478


requirement as 27 g kg−1 diet (e.g. 55 g kg−1 protein) (Luo et al., 2007). Other work which simulated the amino acid composition of different protein sources using a mix of intact proteins (i.e. fish meal and soybean meal) and crystalline amino acids suggests that diets with an amino acid pattern similar to white fish meal or juvenile grouper protein (E. coioides) are closer to the overall amino acid pattern required by this species than the amino acid pattern of proteins such as brown fish meal, red sea bream protein or hen egg protein (Luo et al., 2008). The type of fat appears to have an impact on its protein sparing capacity in grouper. For example, the addition of long-chain fatty acids (LCFA) in the form of olive oil was shown to induce a protein sparing effect (i.e. improved protein retention) when test feeds contained 15 % but not 30 % olive oil. No such sparing effect was apparent when medium-chain fatty acids (MCFA) in the form of coconut oil were included at 15 % of the diet while severe reductions in protein and energy retention were recorded in fish fed diets containing 30 % coconut oil (Williams et al., 2006a). High lipid levels (i.e. 30 %), regardless of the type of lipid, tended to reduce feed intake, but grouper fed diets containing high lipid-MCFA diets exhibited major reductions in feed intake. A concurrent radio labelling study by Smith et al. (2005) found that MCFA were more rapidly oxidized than LCFA and caused a general increase in respiration rate of grouper. These authors suggested that while MCFA appear to be a more utilizable form of energy than LCFA, the rapid oxidation of MCFA appears to trigger acidosis or ketogenic like responses that reduce appetite. Requirements for n-3 HUFA of juvenile grouper appear to be quite different for juveniles of different species with a minimum dietary content of 1 % suggested for humpback grouper and up to at least 2.5 % of diet for tiger grouper (Suwirya et al., 2005). Wu et al. (2002, 2003) have demonstrated that DHA is more important than EPA in promoting growth and elevating the immune response in E. malabaricus. The carbohydrate requirements of groupers have received little attention to date and much more research is needed in this area. Much of the work is equivocal. For example, Shiau and Lin (2001) demonstrated that starch and glucose were equally well utilized (i.e. weight gain, feed efficiency and protein efficiency ratio) at a high water temperature (29 °C), but that starch was better utilized than glucose at a lower water temperature (23 °C). More recent work has investigated the utilization and digestibility of diets containing 20 % glucose, sucrose, dextrin or starch in high protein (54 %), low lipid (11 %) diets of juvenile humpback grouper (8.0 g) and indicates that protein and energy retention was superior in fish fed glucose > dextrin > starch > sucrose (Usman et al., 2004). Not surprisingly, preliminary glucose tolerance tests also show that glucose is more rapidly absorbed into the plasma compartment; peaking approximately 3 h after feeding compared to 6 h for sucrose, dextrin or starch (Usman et al., 2004). No improvement in weight gain or feed efficiency was recorded in humpback


479

grouper (8 g) fed isonitrogenous / isocaloric diets containing >14 % dextrin (Suwiyra et al., 2004). Requirements for vitamin C have been determined for E. malabaricus using diets containing graded levels of L-ascorbyl-2-monophosphate-Mg (C2MP-Mg) or L-ascorbyl-2-monophosphate-Na (C2MP-Na) esters. Percentage weight gain was maximized by feeding diets containing about 51 mg or 17 mg of C2MP-Mg or C2MP-Na ascorbic acid equivalent, respectively (Lin and Shiau, 2004). Requirements for other vitamin C derivatives such as L-ascorbyl-2-sulphate (C2S) or L-ascorbyl-2-polyphosphate (C2PP) are approximately 55 mg and 31 mg ascorbic acid equivalent, respectively (Lin and Shiau, 2005a). Vitamin A requirements for the greasy grouper E. tauvina have been reported as as 3101 IU vitamin A (as retinyl acetate) kg−1 diet (Mohamed et al., 2003) while the requirement for vitamin E (DL-atocopheryl acetate) appears to be between 50–100 mg kg−1 diet (Lin and Shiau, 2005b). A total dietary phosphorous requirement of 8.6 g kg−1 is recommended for juvenile orange spot grouper growing in floating cages (Zhou et al., 2004). New work on E. coioides has considered the complementary effects of dietary phosphorous (NaH2PO4 · 2H2O) and calcium (Ca-lactate) and indicates that adequate dietary phosphorous (about 11 g kg−1 diet) is essential for promoting weight gain and supporting mineralization of bone and scales in grouper; however, the beneficial effects of added dietary calcium were less evident and addition of this mineral reduced feed intake (Ye et al., 2006). Requirement for selenium (selenomethionine) E. malabaricus is about 0.8 mg kg−1 diet (Lin and Shiau, 2005c).

16.4.2 Digestibility Like many carnivorous species, grouper digest ingredients of animal origin better than those of plant origin. Protein digestibility of marine and terrestrial ingredients is generally high (>75 %) but is more variable for plant ingredients, being high for lupin and corn gluten for example but particularly low for ingredients high in fibre such as rice bran (Williams, 2005). A growing list of ADCs is now available for a diverse range of ingredients fed to grouper species. To date the majority of these data have been determined using indirect settlement techniques and selected values for humpback grouper (Laining et al., 2003) and orange spot grouper (Eusebio et al., 2004a; Lin et al., 2004) are reproduced in Table 16.4. Lin et al. (2004) found that the amino and fatty acid availability of test ingredients closely approximated values for protein and lipid digestibility, respectively, and that generally, fatty acid availability decreased as fatty acid chain length increased. There is some indication that apparent digestibility in grouper is negatively correlated with feed rations, possibly due to the increased passage rate of larger meals; however, reductions in ADCs were minor and more work is required to elucidate the effects of ration size on digestibility (Luo et al., 2006a).

480


Table 16.4 Percent apparent digestibility coefficients (ADC) for dry matter, crude protein (CP) and energy for selected South East Asian ingredients fed to grouper Digestibility (%)1 Feed ingredient Dry matter

Crude protein (CP)

Marine product Acetes shrimp meal (72 % CP) Fish meal (Chilean, 65 % CP) Fish meal (local, 45 % CP) Fish meal (sardine, 65 % CP) Fish meal (tuna, 50 % CP) Fish meal (white, 69 % CP) Shrimp head meal (50 % CP) Squid meal (71 % CP)

76.0 ± 4.00 83.6 ± 3.09 59.1 ± 1.23 87.2 ± 2.53 75.4 ± 3.61 89.2 ± 1.69 58.5 ± 3.33 99.4 ± 0.95

95.0 ± 0.72 98.0 ± 0.07 82.4 ± 1.99 92.5 ± 1.40 76.2 ± 1.92 98.6 ± 0.31 78.0 ± 1.32 94.2 ± 0.21

Terrestrial animal product Blood meal (ring-dried, 84 % CP) Blood meal (oven-dried, 84 % CP) Blood meal (formic, 87 % CP)2 Blood meal (propionic, 84 % CP)2 Meat meal (Australian, 44 % CP) Meat meal (Philippine, 45 % CP) Meat solubles (Danish, 74 % CP) Poultry feather meal (67 % CP)

36.9 ± 0.98 48.1 ± 0.85 67.9 ± 1.63 61.7 ± 2.60 60.8 ± 0.80 77.7 ± 0.09 99.3 ± 0.45 74.3 ± 3.06

15.5 ± 2.01 55.2 ± 1.35 87.5 ± 0.55 84.2 ± 0.69 98.9 ± 1.32 83.8 ± 1.66 97.6 ± 0.08 81.8 ± 2.58

85.2 ± 2.81 94.0 ± 2.03 74.2 ± 3.14 56.0 ± 0.04 54.1 ± 1.24 45.3 ± 2.37 22.2 ± 1.52 68.5 ± 7.02 54.8 ± 2.72 75.7 ± 1.98

82.9 ± 4.71 99.5 ± 0.65 93.5 ± 1.22 78.8 ± 2.64 97.5 ± 3.65 80.5 ± 1.30 59.5 ± 1.41 42.7 ± 5.38 67.2 ± 1.29 96.0 ± 0.13

72.8 ± 0.85

96.0 ± 0.13

Terrestrial plant product Corn meal (8 % CP) Corn gluten meal (56 % CP) Cowpea meal (white, 24 % CP) Lucaena (ipil-ipil) meal (19 % CP) Lupin albus meal (26 % CP) Palm oil cake meal (11 % CP) Rice bran (11 % CP) Rice bran (14 % CP) Soybean meal (full-fat, 41 % CP) Soybean meal (solvent-extracted, 50–54 % CP) Wheat flour (9 % CP)

Energy

77.2 ± 1.91 85.2 ± 0.90 63.6 ± 0.89

40.4 ± 3.74 44.3 ± 0.97 51.1 ± 0.89

Mean ± SD. Oven-dried blood meal fermented using either formic or propionic acids. Source: data reproduced from Williams, 2005. 1 2

16.4.3 Replacement studies An increasing number of studies are beginning to evaluate alternative feed ingredients for use in farm-made and commercial feeds for grouper species; however, much of the work has used very small fish and further investigations with larger animals are warranted. Recent work includes a robust investigation of terrestrial proteins using predetermined ADCs of test and


481

supplementary ingredients to formulate diets with a similar digestible protein content prior to evaluation (Eusebio et al., 2004b). Although this study used very small fish (3 g), it demonstrated that diets for E. coioides can include up to 20 % cowpea meal, 16–19 % meat and bone meal when fish meal is replaced on a digestible protein basis. Other ingredients such as corn gluten meal and soy protein concentrate also appear to be very promising (Eusebio et al., 2004b); however, no more than 10 % shrimp head meal is recommended in diets for humpback grouper (Rachmansyah et al., 2004). Millamena (2002) demonstrated that a 4 : 1 mix of processed meat meal and blood meal (both of Australian origin) could replace as much as 80 % of dietary fish meal (isonitrogenous basis) in a control diet without affecting the growth rate and feed conversion of E. coioides. Total replacement of fish meal with this mixed protein source resulted in significantly poorer growth rates and feed conversion, probably due to the declining content and availability of dietary essential amino acids such as lysine and methionine (Millamena and Golez, 2001; Luo et al., 2005, 2006b). In a similar study with E. coioides, highly digestible meat solubles (72 % crude protein; minced, pressed, sterilized and spray dried) were able to replace up to 40 % of fish meal protein without growth and performance being affected (Millamena and Golez, 2001). In contrast, Wang et al. (2008) found that performance of humpback grouper declined if more than 40 % of fish meal protein was replaced on an isonitrogenous/isocaloric basis with a blend of 50 : 20 : 20 : 10 poultry by-product meal:meat and bone meal:blood meal : fish meal. Based on weight gain alone, good quality sources of poultry by-product meal were able to replace more than 75 % of fish meal (sole protein source) in control diets for humpback grouper when formulated on an isoproteic/isolipidic basis (Shapawi et al., 2007). Caution should be exercized when reviewing replacement studies that do not account for the digestibility or availability of nutrients in ingredients a priori. This is especially so for animal by-product meals which often vary markedly in nutrient content and availability due to differences in the type and severity of the rendering process. Although the intensive culture of grouper is relatively recent, attention has already turned to investigating alternatives to fish oil. Shapawi et al. (2008) measured no difference in the performance of humpback grouper fed isolipidic test diets (10 %) containing 5 % crude or refined palm oil, refined soybean oil or canola oil compared to fish fed a diet containing the same level of cod liver oil. However, replacement of the marine oil with the vegetable oils significantly affected the fatty acid content and composition of tissue and liver; replacement of fish oil with vegetable oils resulted in reduced levels of total n-3 PUFA and an increased level of total n-6 PUFA in both muscle and liver tissues (Shapawi et al., 2008). Other research has found that E. malabaricus fed a 3 : 1 or 1 : 1 ratio of fish oil : corn oil (4 % total lipid) matched the weight gain and performance of fish fed a control diet containing a similar level of fish oil (Lin and Shiau, 2007). Like the

482


previous study, tissue fatty acid composition was indicative of the fatty acid profile of the test diets. In addition, the authors of this study linked elevations in the leukocyte superoxide production ratio, plasma lysozyme and alternative complement (ACH50) activities of grouper (e.g. indicators of enhanced non-specific immune response) to test diets containing the blends of fish oil and corn oil. More clarification of these effects is warranted.

16.4.4 Feeding studies A very early study centred on feeding a mixture of low-value fish to wildcaught E. tauvina (60 g) held in floating cages. Tested feeding frequencies ranged from once every fifth, fourth, third or second day to once, twice or three times daily. Optimal growth and good FCR corresponded with a feeding frequency of once every two days and apparent feed intake was highly dependent on gastric evacuation time (Thia-Eng and Seng-Keh, 1978). Very small red spotted grouper E. akaara exhibited superior weight gain and feed conversion efficiency when feed dry pellets (52 % crude protein, 13 % lipid) between four and six times a day (Kayano et al., 1993), which is in line with more recent recommendations (Sim et al., 2005). Luo et al. (2006a) quantified the optimal and maintenance ration of juvenile E. coioides (10 g) fed a dry pellet (52 % crude protein, 9 % lipid, 18.8 MJ kg−1) as 2.5 % and 0.5 % BW day−1, respectively. Feed conversion ratio for these fish was optimized when the ration was nearer to 2.0 % BW day−1. Similarly, weight gain and feeding efficiency in juvenile (5 g) yellow grouper Epinephelus awoara continued to increase in a linear fashion as feeding rate was increased from 0.5 % BW day−1 to apparent satiation (2.5 % BW day−1) (Sun et al., 2007). The latter study incorporated useful information on faecal production and the fate of ingested nitrogen in order to develop an energy budget for juveniles of this species (i.e. 100C = 2F + 4U + 75R + 19G where C is food energy, F is faecal energy, U is excretory energy, R is metabolism energy and G is growth energy).

16.4.5 Miscellaneous studies As the production of grouper has intensified in South East Asia so too have problems caused by parasitic organisms and bacterial or viral diseases (Cheng et al., 2008). This has led to a push to improve the innate immunity of grouper species by feeding immunostimulants such as ascorbic acid (Lin and Shiau, 2004, 2005a). Several experiments have recently investigated the use of seaweed extracts such as sodium alginate to boost the non-specific immune response of grouper, with elevations in serum indicators such as alternative complement activity (ACH50), respiratory burst or phagocytic activity used as evidence of an increased immune response. For example, E.coioides recorded elevations in the aforementioned indicators after injection with 20 mg sodium alginate kg BW−1. In addition, the survival of


483

injected fish subjected to a challenge with Vibrio alginolyticus was significantly higher than controls (Cheng et al., 2007). Similar improvements in the innate cellular and humoral response of brown marbled grouper (E. fuscoguttatus) was detected in fish fed diets containing 10 g sodium alginate kg−1 or 5 g carrageenan kg−1 for eight weeks. Fish fed these diets were also more resistant to a challenge with V. alginolyticus, recording significantly higher survival than controls after 168 h (Cheng et al., 2008). Lower dietary inclusion of sodium alginate (1–2 g kg−1 diet) also improved the non-specific immune response of juvenile E. fuscoguttatus and E. coioides and their resistance to infection with a pathogenic strain of Streptococcus sp. and a grouper iridovirus (Chiu et al., 2008; Yeh et al., 2008). At present the mechanisms underlying these improvements are not well understood; however, it is believed that seaweed polysaccharides such as sodium alginate and carrageenan upregulate phagocytic activity in much the same way as other immunostimulants such as glucans (Cheng et al., 2008; Chiu et al., 2008).

16.5 Future trends In the broadest sense research will continue to investigate increased use of alternative feed ingredients and reductions in the use of declining stocks of fish meal and fish oil (Allen Davis et al., 2005; Moriss, 2005). As such, the determination of digestibility coefficients for individual species should be the first step in any research strategy and will remain a priority well into the future as greater physical, economic and legislative demands are placed on traditional feed ingredients. Fundamental research that develops or improves our understanding of basic nutrient requirements for protein, amino acids, lipids or carbohydrates (Davies and Gouveia, 2004) will continue as will the need to develop or improve feeding strategies that maximize feed intake and reduce waste. Valuable marine species such as basses and breams are often cultured in areas where seasonal fluctuations in water temperature, salinity or photoperiod have dramatic impacts on feed intake, growth rates, organ function and immune status (e.g. winter syndrome in gilthead sea bream; Gallardo et al., 2003; Luzzana et al., 2003, 2005; Tort et al., 2004; Ibarz et al., 2005). The impacts of these factors on nutritional status, metabolism and health and how these factors affect farm productivity or management strategies is not well understood and will be the focus of future research in many species. Increased attention will also be directed at gaining greater understanding of the effects of using different types and blends of vegetable oils in diets for marine fish and how these lipid sources affect carcass composition. This in turn will generate further research on the judicious use of finishing diets aimed at returning the fatty acid composition of fish to levels that are acceptable to the consumer. For new species such as grouper, emphasis will focus on the development of cost-effective, readily available extruded feeds that reduce reliance on low-value fishery products.

484


16.6 References abare (2007) Australian Bureau of Agricultural and Resource Economics, Australian Fisheries Statistics June 2006, Fisheries Research and Development Corporation, Deakin West, ACT. alam m s, teshima s, yaniharto d, sumule o, ishikawa m and koshio s (2005) Assessment of reference dietary amino acid pattern for juvenile red sea bream, Pagrus major, Aquaculture International, 13, 369–79. allen davis d, samocha t m and bullis r a (2005) Working towards the removal of marine ingredients in aquafeeds, International AquaFeed, 8(1), 8–11. azevedo p a, van milgen j, leeson s and bureau d p (2005) Comparing efficiency of metabolizable energy utilization by rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar) using factorial and multivariate approaches, Journal of Animal Science, 83, 842–51. battaglene s c and allan g l (1994) Development of hatchery techniques for snapper, Pagrus auratus, in Australia, in Chou L M, Munro A D, Lam T J, Chen T W, Cheong L K K, Ding J K, Hooi K K, Khoo H W, Phang V P E, Shim K F and Tan C H (eds), Third Asian Fisheries Forum, Manila, Asian Fisheries Society. battaglene s c and talbot r b (1992) Induced spawning and larval rearing of snapper, Pagrus auratus (Pisces: Sparidae) from Australian waters, New Zealand Journal of Marine and Freshwater Research, 26, 179–83. bell j g and tocher d r (2008) Dietary oil sources: current position and future challenges, XIII International Symposium on Fish Nutrition and Feeding, June 2008 – Florianopolis, 12. bell j d, quartararo n and henry g w (1991) Growth of snapper, Pagrus auratus, from south-eastern Australia in captivity, New Zealand Journal of Marine and Freshwater Research, 25, 117–21. benedito-palos l, saera-vila a, calduch-giner j a, kaushik s and perez-sanchez j (2007) Combined replacement of fish meal and oil in practical diets for fast growing juveniles of gilthead sea bream (Sparus aurata L.): Networking of systemic and local components of GH/IGF axis, Aquaculture, 267, 199–212. biswas a k, seoka m, inoue y, takii k and kumai h (2005) Photoperiod influences the growth, food intake, feed efficiency and digestibility of red sea bream (Pagrus major), Aquaculture, 250, 666–73. biswas a k, seoka m, tanaka y, takii k and kumai h (2006) Effect of photoperiod manipulation on the growth performance and stress response of juvenile red sea bream (Pagrus major), Aquaculture, 258, 350–6. biswas a k, kaku h, ji s c, seoka m and takii k (2007) Use of soybean meal and phytase for partial replacement of fish meal in the diet of red sea bream, Pagrus major, Aquaculture, 267, 284–91. biswas a k, seoka m, ueno k, takii k and kumai h (2008) Stimulation of growth performance without causing stress response in young red sea bream, Pagrus major (Temminck & Schlegel), by photoperiod manipulation, Aquaculture Research, 39, 457–63. bonaldo a, fontanillas r, koppe w, fagioli p, mariani l, parma l and gatta p p (2008a) Effect of dietary energy level and ration on growth and feed utilisation of gilthead seabream (Sparus aurata): preliminary findings, XIII International Symposium on Fish Nutrition and Feeding, June, Florianopolis, 124. bonaldo a, roem a j, fagioli p, pecchini a, cipollini i and gatta p p (2008b) Influence of dietary levels of soybean meal on the performance and gut histology of gilthead sea bream (Sparus aurata L.) and European sea bass (Dicentrarchus labrax L.), Aquaculture Research, 39, 970–8. boonyaratpalin m (1991) Asian seabass, Lates calcarifer, in Wilson R P (ed.), Handbook of Nutrient Requirements of Finfish, Boca Raton, FL, CRC, 5–11.


485

boonyaratpalin m and williams k (2002) Asian Sea Bass, Lates calcarifer, in Webster C D and Lim C E (eds), Nutrient Requirements and Feeding of Finfish for Aquaculture, New York, CABI, 40–50. boonyaratpalin m, suraneiranat p and tunpibal t (1998) Replacement of fish meal with various types of soybean products in diets for the Asian seabass, Lates calcarifer, Aquaculture, 161, 67–78. booth m a, warner-smith r j, allan g l and glencross b d (2004) Effects of dietary astaxanthin source and light manipulation on the skin colour of Australian snapper Pagrus auratus (Bloch & Schneider, 1801), Aquaculture Research, 35, 458–64. booth m a, allan g l and anderson a j (2005) Investigation of the nutritional requirements of Australian snapper Pagrus auratus (Bloch & Schneider, 1801): apparent digestibility of protein and energy sources, Aquaculture Research, 36, 378–90. booth m a, anderson a j and allan g l (2006) Investigation of the nutritional requirements of Australian snapper Pagrus auratus (Bloch & Schneider, 1801): digestibility of gelatinized wheat starch and clearance of an intra-peritoneal injection of d-glucose, Aquaculture Research, 37, 975–85. booth m a, allan g l and anderson a j (2007) Investigation of the nutritional requirements of Australian snapper Pagrus auratus (Bloch & Schneider, 1801): effects of digestible energy content on utilization of digestible protein, Aquaculture Research, 38, 429–40. booth m a, allan g l and anderson a j (2008a) Investigation of the nutritional requirements of Australian snapper Pagrus auratus (Bloch & Schneider, 1801): influence of poultry offal, meat or soybean meal inclusion level on weight gain and performance, in Booth M A, Allan G L, Fielder D S and Anderson A J (eds), Increasing the profitability of snapper farming by improving hatchery practices and diets; diet development, Aquafin CRC Project 1B3 & FRDC Project No. 2001/208, Final Report, Volume 1, Deakin, ACT, Fisheries Research and Development Corporation. booth m a, tucker b j, allan g l and fielder d s (2008b) Effect of feeding regime and fish size on weight gain, feed intake and gastric evacuation in juvenile Australian snapper Pagrus auratus, Aquaculture, 282, 104–10. brandt t m (1991) Temperate basses, Morone spp., and black basses, Micropterus spp., in Wilson R P (ed.), Handbook of Nutrient Requirements of Finfish, Boca Raton, FL, CRC, 161–8. caballero m j, lopez-calero g, socorro j, roo f j, izquierdo m s and fernandez a j (1999) Combined effect of lipid level and fish meal quality on liver histology of gilthead seabream (Sparus aurata), Aquaculture, 179, 277–90. cardenas s (2008) Perspectives for red banded seabream culture, Global Aquaculture Advocate, 11(3), 56–8. caseras a, meton i, vives c, egea m, fernandez f and baanante i v (2002) Nutritional regulation of glucose-6-phosphatase gene expression in liver of the gilthead sea bream (Sparus aurata), British Journal of Nutrition, 88, 607–14. catacutan m r and coloso r m (1995) Effect of dietary-protein to energy ratios on growth, survival and body composition of juvenile Asian seabass Lates calcarifer, Aquaculture, 131, 125–33. catacutan m r and coloso r m (1997) Growth of juvenile Asian seabass, Lates calcarifer, fed varying carbohydrate and lipid levels, Aquaculture, 149, 137–44. cheng a c, chen c y, liou c h and chang c f (2006) Effects of dietary protein and lipids on blood parameters and superoxide anion production in the grouper, Epinephelus coioides (Serranidae: Epinephelinae), Zoological Studies, 45, 492–502.

486


cheng a c, tu c w, chen y y, nan f h and chen j c (2007) The immunostimulatory effects of sodium alginate and iota-carrageenan on orange-spotted grouper Epinephelus coicoides and its resistance against Vibrio alginolyticus, Fish & Shellfish Immunology, 22, 197–205. cheng a c, chen y y and chen j c (2008) Dietary administration of sodium alginate and kappa-carrageenan enhances the innate immune response of brown-marbled grouper Epinephelus fuscoguttatus and its resistance against Vibrio alginolyticus, Veterinary Immunology and Immunopathology, 121, 206–15. chiu s t, tsai r t, hsu j p, liu c h and cheng w (2008) Dietary sodium alginate administration to enhance the non-specific immune responses, and disease resistance of the juvenile grouper Epinephelus fuscoguttatus, Aquaculture, 277, 66–72. coloso r m, murillo-gurrea d p, borlongan i g and catacutan m r (1999) Sulphur amino acid requirement of juvenile Asian sea bass Lates calcarifer, Journal of Applied Ichthyology–Zeitschrift Fur Angewandte Ichthyologie, 15, 54–8. coloso r m, murillo-gurrea d p, borlongan i g and catacutan m r (2004) Tryptophan requirement of juvenile Asian sea bass Lates calcarifer, Journal of Applied Ichthyology, 20, 43–7. company r, calduch-giner j a, kaushik s and perez-sanchez j (1999a) Growth performance and adiposity in gilthead sea bream (Sparus aurata): risks and benefits of high energy diets, Aquaculture, 171, 279–92. company r, calduch-giner j a, perez-sanchez j and kaushik s j (1999b) Protein sparing effect of dietary lipids in common dentex (Dentex dentex): a comparative study with sea bream (Sparus aurata) and sea bass (Dicentrarchus labrax), Aquatic Living Resources, 12, 23–30. couto a, enes p, peres h and oliva-teles a (2008) Effect of water temperature and dietary starch on growth and metabolic utilization of diets in gilthead sea bream (Sparus aurata) juveniles, Comparative Biochemistry and Physiology – Part A: Molecular & Integrative Physiology, 151, 45–50. davies s j and gouveia a (2004) Cereal processing & improved carbohydrate digestibility in over-wintering diets for juvenile gilthead sea bream, International AquaFeed, 8(2), 18–23. de francesco m, parisi g, perez-sanchez j, gomez-requeni p, medale f, kaushik s j, mecatti m and poli b m (2007) Effect of high-level fish meal replacement by plant proteins in gilthead sea bream (Sparus aurata) on growth and body/fillet quality traits, Aquaculture Nutrition, 13, 361–72. doolan b j, booth m a, jones p l and allan g l (2007) Effect of cage colour and light environment on the skin colour of Australian snapper Pagrus auratus (Bloch & Schneider, 1801), Aquaculture Research, 38, 1395–403. doolan b j, allan g l, booth m a and jones p l (2008a) Cage colour and postharvest K+ concentration affect skin colour of Australian snapper Pagrus auratus (Bloch & Schneider, 1801), Aquaculture Research, 39, 919–27. doolan b j, allan g l, booth m a and jones p l (2008b) Effect of carotenoids and background colour on the skin pigmentation of Australian snapper Pagrus auratus (Bloch & Schneider, 1801), Aquaculture Research, 39, 1423–33. doolan b j, allan g l, booth m a and jones p l (2008c) Effects of cage netting colour and density on the skin pigmentation and stress response of Australian snapper Pagrus auratus (Bloch & Schneider, 1801), Aquaculture Research, 39, 1360–8. drew m d, borgeson t l and thiessen d l (2007) A review of processing of feed ingredients to enhance diet digestibility in finfish, Animal Feed Science and Technology, 138, 118–36.


487

enes p, panserat s, kaushik s and oliva-teles a (2008a) Growth performance and metabolic utilization of diets with native and waxy maize starch by gilthead sea bream (Sparus aurata) juveniles, Aquaculture, 274, 101–8. enes p, panserat s, kaushik s and oliva-teles a (2008b) Hepatic glucokinase and glucose-6-phosphatase responses to dietary glucose and starch in gilthead sea bream (Sparus aurata) juveniles reared at two temperatures, Comparative Biochemistry and Physiology a–Molecular & Integrative Physiology, 149, 80–6. eroldogan o t, kumlu m, kiris g a and sezer b (2006a) Compensatory growth response of Sparus aurata following different starvation and refeeding protocols, Aquaculture Nutrition, 12, 203–10. eroldogan o t, kumlu m and sezer b (2006b) Effects of starvation and realimentation periods on growth performance and hyperphagic response of Sparus aurata, Aquaculture Research, 37, 535–7. eroldogan o t, tasbozan o and tabakoglu s (2008) Effects of restricted feeding regimes on growth and feed utilization of juvenile gilthead sea bream, Sparus aurata, Journal of the World Aquaculture Society, 39, 267–74. eusebio p s, coloso r m and mamauag r e p (2004a) Apparent digestibility of selected ingredients in diets for juvenile grouper, Epinephelus coioides (Hamilton), Aquaculture Research, 35, 1261–9. eusebio p s, coloso r m and mamauag r e p (2004b) Evaluation of some terrestrial proteins in complete diets for grouper (Epinephelus coioides) juveniles, in Rimmer M A, McBride S and Williams K C (eds), Advances in Grouper Culture ACIAR Monograph 110, Canberra, Australian Centre for International Agricultural Research, 79–84. fernandez f, miquel a g, cordoba m, varas m, meton i, caseras a and baanante i v (2007) Effects of diets with distinct protein-to-carbohydrate ratios on nutrient digestibility, growth performance, body composition and liver intermediary enzyme activities in gilthead sea bream (Sparus aurata L.) fingerlings, Journal of Experimental Marine Biology and Ecology, 343, 1–10. fielder d s, bardsley w j, allan g l and pankhurst p m (2002) Effect of photoperiod on growth and survival of snapper Pagrus auratus larvae, Aquaculture, 211, 135–50. fielder d s, bardsley w j, allan g l and pankhurst p m (2005) The effects of salinity and temperature on growth and survival of Australian snapper, Pagrus auratus larvae, Aquaculture, 250, 201–14. fielder d s, allan g l and pankhurst p m (2008) Comparison of two environmental regimes for culture of Australian snapper, Pagrus auratus, larvae in commercialscale tanks, Journal of the World Aquaculture Society, 39, 364–74. forster i p and ogata h (1996) Growth and whole-body lipid content of juvenile red sea bream reared under different conditions of exercise training and dietary lipid, Fisheries Science, 62, 404–9. forster i and ogata h y (1998) Lysine requirement of juvenile Japanese flounder Paralichthys olivaceus and juvenile red sea bream Pagrus major, Aquaculture, 161, 131–42. foscarini r (1988) A review: Intensive farming procedure for red sea bream (Pagrus major) in Japan, Aquaculture, 72, 191–246. fountoulaki e, alexis m n, nengas i and venou b (2005) Effect of diet composition on nutrient digestibility and digestive enzyme levels of gilthead sea bream (Sparus aurata L.), Aquaculture Research, 36, 1243–51. gallardo m a, sala-rabanal m, ibarz a, padros f, blasco j, fernandez-borras j and sanchez j (2003) Functional alterations associated with ‘winter syndrome’ in gilthead sea bream (Sparus aurata), Aquaculture, 223, 15–27.

488


ganga r, montero d, vaquero a, tort l and izquierdo m s (2008) Effect of feeding vegetable oils on growth and ACTH-induced cortisol release by interrenal tissue from gilthead seabream Pagris aurata, XIII International Symposium on Fish Nutrition and Feeding, June, Florianopolis, 51. gasca-leyva e, leon c j, hernandez j m and vergara j m (2002) Bioeconomic analysis of production location of sea bream (Sparus aurata) cultivation, Aquaculture, 213, 219–32. georgopoulos g b and conides a j (1999) Study on the effects of dietary starch on growth, food conversion and digestibility of adult gilthead sea bream (Sparus aurata L. 1758), Journal of Aquaculture in the Tropics, 14, 143–52. gines r, afonso j m, arguello a, zamorano m j and lopez j l (2004) The effects of long-day photoperiod on growth, body composition and skin colour in immature gilthead sea bream (Sparus aurata L.), Aquaculture Research, 35, 1207–12. glencross b (2006) The nutritional management of barramundi, Lates calcarifer – a review, Aquaculture Nutrition, 12, 291–309. glencross b d (2008) A factorial growth and feed utilization model for barramundi, Lates calcarifer based on Australian production conditions, Aquaculture Nutrition, 14, 360–73. glencross b d and felsing m (2006) Influence of fish size and water temperature on the metabolic demand for oxygen by barramundi, Lates calcarifer (Bloch), in freshwater, Aquaculture Research, 37, 1055–62. glencross b and hawkins w (2004) A comparison of the digestibility of lupin (Lupinus sp.) kernel meals as dietary protein resources when fed to either, rainbow trout, Oncorhynchus mykiss or red seabream, Pagrus auratus, Aquaculture Nutrition, 10, 65–73. glencross b, curnow j, hawkins w, kissil g w m and peterson d (2003a) Evaluation of the feed value of a transgenic strain of the narrow-leaf lupin (Lupinus angustifolius) in the diet of the marine fish, Pagrus auratus, Aquaculture Nutrition, 9, 197–206. glencross b, hawkins w and curnow j (2003b) Evaluation of canola oils as alternative lipid resources in diets for juvenile red seabream, Pagrus auratus, Aquaculture Nutrition, 9, 305–15. glencross b d, hawkins w e and curnow j g (2003c) Restoration of the fatty acid composition of red seabream (Pagrus auratus) using a fish oil finishing diet after grow-out on plant oil based diets, Aquaculture Nutrition, 9, 409–18. glencross b, hawkins w and curnow j (2004a) Nutritional assessment of Australian canola meals. I. Evaluation of canola oil extraction method and meal processing conditions on the digestible value of canola meals fed to the red seabream (Pagrus auratus, Paulin), Aquaculture Research, 35, 15–24. glencross b, hawkins w and curnow j (2004b) Nutritional assessment of Australian canola meals. II. Evaluation of the influence of the canola oil extraction method on the protein value of canola meals fed to the red seabream (Pagrus auratus, Paulin), Aquaculture Research, 35, 25–34. glencross b, percival s, jones b and hughes j (2007) Sustainable development of barramundi cage aquaculture at Lake Argyle, FRDC Final Report, KSRP Report – Project 2003/026 – Fisheries Research, Department of Fisheries, Hillarys, WA. glencross b, michael r, austen k and hauler r (2008) Productivity, carcass composition, waste output and sensory characteristics of large barramundi Lates calcarifer fed high-nutrient density diets, Aquaculture, 284, 167–73. gomes e, dias j, silva p, valente l, empis j, gouveia l, bowen j and young a (2002) Utilization of natural and synthetic sources of carotenoids in the skin pigmentation of gilthead seabream (Sparus aurata), European Food Research Technology, 214, 287–93.


489

gouveia l, choubert g, pereira n, santinha j, empis j and gomes e (2002) Pigmentation of gilthead seabream, Sparus aurata (L. 1875), using Chlorella vulgaris (Chlorophyta, Volvocales) microalga, Aquaculture Research, 33, 987–93. harpaz s, hakim y, barki a, karplus i, slosman t and tufan eroldogan o (2005) Effects of different feeding levels during day and/or night on growth and brushborder enzyme activity in juvenile Lates calcarifer reared in freshwater recirculating tanks, Aquaculture, 248, 325–35. hernandez l h h, teshima s, ishikawa m, koshio s and tanaka y (2004) Effects of dietary vitamin a on juvenile red sea bream Chrysophrys major, Journal of the World Aquaculture Society, 35, 436–44. huang s s y, oo a n, higgs d a, brauner c j and satoh s (2007) Effect of dietary canola oil level on the growth performance and fatty acid composition of juvenile red sea bream, Pagrus major, Aquaculture, 271, 420–31. ibarz a, fernandez-borras j, blasco j, gallardo m a and sanchez j (2003) Oxygen consumption and feeding rates of gilthead sea bream (Sparus aurata) reveal lack of acclimation to cold, Fish Physiology and Biochemistry, 29, 313–21. ibarz a, blasco j, beltran m, gallardo m a, sanchez j, sala r and fernandezborras j (2005) Cold-induced alterations on proximate composition and fatty acid profiles of several tissues in gilthead sea bream (Sparus aurata), Aquaculture, 249, 477–86. izquierdo m s, obach a, arantzamendi l, montero d, robaina l and rosenlund g (2003) Dietary lipid sources for seabream and seabass: growth performance, tissue composition and flesh quality, Aquaculture Nutrition, 9, 397–407. izquierdo m s, montero d, robaina l, caballero m j, rosenlund g and gines r (2005) Alterations in fillet fatty acid profile and flesh quality in gilthead seabream (Sparus aurata) fed vegetable oils for a long term period. Recovery of fatty acid profiles by fish oil feeding, Aquaculture, 250, 431–44. kalinowski c t, izquierdo m s, schuchardt d and robaina l e (2007) Dietary supplementation time with shrimp shell meal on red porgy (Pagrus pagrus) skin colour and carotenoid concentration, Aquaculture, 272, 451–7. katersky r s and carter c g (2005) Growth efficiency of juvenile barramundi, Lates calcarifer, at high temperatures, Aquaculture, 250, 775–80. kaushik s j (1997) Recent developments in the nutrition and feeding of marine finfish of interest to the Mediterranean. INVE Conference, ALIIA Tradeshow. Thessaloniki. kaushik s j (2002) European Sea Bass, Dicentrachus labrax, in Webster C D and Lim C E (eds), Nutrient Requirements and Feeding of Finfish for Aquaculture, New York, CABI, 28–39. kayano y, yao s, yamamoto s and nakagawa h (1993) Effects of feeding frequency on the growth and body constituents of young red-spotted grouper, Epinephelus akaara, Aquaculture, 110, 271–8. kissil g w (1991) Gilthead seabream, Sparus auratus, in Wilson R P (ed.), Handbook of Nutrient Requirements of Finfish, Boca Raton, FL, CRC, 83–8. kissil g w and lupatsch i (2004) Successful replacement of fishmeal by plant proteins in diets for the gilthead seabream, Sparus aurata L, Israeli Journal of Aquaculture-Bamidgeh, 56, 188–99. koshio s (2002) Red sea bream, Pagrus major, in Webster C D and Lim C E (eds), Nutrient Requirements and Feeding of Finfish for Aquaculture, New York, CABI, 51–63. koven w (2002) Gilt-head sea bream, Sparus aurata, in Webster C D and Lim C E (eds), Nutrient Requirements and Feeding of Finfish for Aquaculture, CABI, 64–78.

490


koven w, kolkovski s, hadas e, gamsiz k and tandler a (2001) Advances in the development of microdiets for gilthead seabream, Sparus aurata: a review, Aquaculture, 194, 107–21. laining a, rachmansyah ahmad t and williams k (2003) Apparent digestibility of selected feed ingredients for humpback grouper, Cromileptes altivelis, Aquaculture, 218, 529–38. landau m (1992) Introduction to Aquaculture, New York, Wiley. libralato s and solidoro c (2008) A bioenergetic growth model for comparing Sparus aurata’s feeding experiments, Ecological Modelling, 214, 325–37. lin y-h and shiau s-y (2003) Dietary lipid requirement of grouper, Epinephelus malabaricus, and effects on immune responses, Aquaculture, 225, 243–50. lin m f and shiau s y (2004) Requirements of vitamin C (L-ascorbyl-2-monophosphate-Mg and L-ascorbyl-2-monophosphate-Na) and its effects on immune responses of grouper, Epinephelus malabaricus, Aquaculture Nutrition, 10, 327–33. lin m f and shiau s y (2005a) Requirements of vitamin C (L-ascorbyl-2-sulphate and L-ascorbyl-2-polyphosphate) and its effects on non-specific immune responses of grouper, Epinephelus malabaricus, Aquaculture Nutrition, 11, 183–9. lin y-h and shiau s-y (2005b) Dietary vitamin E requirement of grouper, Epinephelus malabaricus, at two lipid levels, and their effects on immune responses, Aquaculture, 248, 235–44. lin y h and shiau s y (2005c) Dietary selenium requirements of juvenile grouper, Epinephelus malabaricus, Aquaculture, 250, 356–63. lin y h and shiau s y (2007) Effects of dietary blend of fish oil with corn oil on growth and non-specific immune responses of grouper, Epinephelus malabaricus, Aquaculture Nutrition, 13, 137–44. lin m q, ushio h, ohshima t, yamanaka h and koizumi c (1998) Skin color control of the red sea bream (Pagrus major), Food Science and Technology–LebensmittelWissenschaft & Technologie, 31, 27–32. lin h z, liu y j, tian l x, wang j t, zheng w h, huang j n and chen p (2004) Apparent digestibility coefficients of various feed ingredients for grouper Epinephelus coioides, Journal of the World Aquaculture Society, 35, 134–42. lozano n b, vidal a, martinez-llorens s, merida s, blanco j, lopez a, torres m and cerda m (2007) Growth and economic profit of gilthead sea bream (Sparus aurata L.) fed sunflower meal, Aquaculture, 272, 528–34. luo z, liu y j, mai k s, tian l x, liu d h and tan x y (2004) Optimal dietary protein requirement of grouper Epinephelus coioides juveniles fed isoenergetic diets in floating net cages, Aquaculture Nutrition, 10, 247–52. luo z, liu y-j, mai k-s, tian l-x, yang h-j, tan x-y and liu d-h (2005) Dietary l-methionine requirement of juvenile grouper Epinephelus coioides at a constant dietary cystine level, Aquaculture, 249, 409–18. luo z, liu y j, mai k s, tian l x, tan x y and shi j f (2006a) Effects of feeding levels on growth performance, feed utilization, body composition, and apparent digestibility coefficients of nutrients for grouper Epinephelus coioides juveniles, Journal of the World Aquaculture Society, 37, 32–40. luo z, liu y j, mai k s, tian l x, tan x y, yang h j, liang g y and liu d h (2006b) Quantitative L-lysine requirement of juvenile grouper Epinephelus coioides, Aquaculture Nutrition, 12, 165–72. luo z, liu y j, mai k s, tian l x, tan x y and yang h j (2007) Effects of dietary arginine levels on growth performance and body composition of juvenile grouper Epinephelus coioides, Journal of Applied Ichthyology, 23, 252–7. luo z, liu y j, mai k s, tian l x, tan x y, yang h j and liu d h (2008) Influence of dietary amino acid profiles on growth performance and body composition of


491

juvenile grouper Epinephelus coioides, Journal of Applied Ichthyology, 24, 208–12. lupatsch i (2003) Israeli study examines feeding regimes for Asian seabass grown at high temperatures, Global Aquaculture Advocate, 6, 62–3. lupatsch i (2004) Gilthead seabream, AquaFeeds: Formulation & Beyond, 1(1), 16–18. lupatsch i (2008) By the numbers: nutritional bioenergetics for optimal feeding, Global Aquaculture Advocate, 11(3), 64–6. lupatsch i and kissil g w (2005) Feed formulations based on energy and protein demands in white grouper (Epinephelus aeneus), Aquaculture, 248, 83–95. lupatsch i, kissil g w, sklan d and pfeffer e (1997) Apparent digestibility coefficients of feed ingredients and their predictability in compound diets for gilthead seabream, Sparus aurata L., Aquaculture Nutrition, 3, 81–9. lupatsch i, kissil g w, sklan d and pfeffer e (1998) Energy and protein requirements for maintenance and growth in gilthead seabream (Sparus aurata L.), Aquaculture Nutrition, 4, 165–73. lupatsch i, kissil g w, sklan d and pfeffer e (2001a) Effects of varying dietary protein and energy supply on growth, body composition and protein utilization in gilthead seabream (Sparus aurata L.), Aquaculture Nutrition, 7, 71–80. lupatsch i, kissil g w and sklan d (2001b) Optimistion of feeding regimes for European sea bass Dicentrarchus labrax: a factorial approach, Aquaculture, 202, 289–302. lupatsch i, kissil g w and sklan d (2003a) Comparison of energy and protein efficiency among three fish species gilthead sea bream (Sparus aurata), European sea bass (Dicentrarchus labrax) and white grouper (Epinephelus aeneus): energy expenditure for protein and lipid deposition, Aquaculture, 225, 175–89. lupatsch i, kissil g w and sklan d (2003b) Defining energy and protein requirements of gilthead seabream (Sparus aurata) to optimize feeds and feeding regimes, Israeli Journal of Aquaculture-Bamidgeh, 55, 243–57. luzzana u, coutteau p, bavevi l, olak s, franzolini e, di giancamillo a and domeneghini c (2003) Nutritional solutions to winter syndrome in Gilthead sea bream; verification at a cage farm in Croatia, International AquaFeed, 6(3), 14–18. luzzana u, coutteau p, bavevi l, olak s, franzolini e, burlini a m, di giancamillo a and domeneghini c (2005) Optimization of feeding protocols for winter diet, International AquaFeed, 8(2), 36–40. martinez-llorens s, monino a v, vidal a t, salvador v j m, torres m p and cerda m j (2007a) Soybean meal as a protein source in gilthead sea bream (Sparus aurata L.) diets: effects on growth and nutrient utilization, Aquaculture Research, 38, 82–90. martinez-llorens s, vidal a t, monino a v, torres m p and cerda m j (2007b) Effects of dietary soybean oil concentration on growth, nutrient utilization and muscle fatty acid composition of gilthead sea bream (Sparus aurata L.), Aquaculture Research, 38, 76–81. martinez-llorens s, vidal a t, monino a v, ader j g, torres m p and cerda m j (2008) Blood and haemoglobin meal as protein sources in diets for gilthead sea bream (Sparus aurata): effects on growth, nutritive efficiency and fillet sensory differences, Aquaculture Research, 39, 1028–37. matsunari h, furuita h, yamamoto t, kim s-k, sakakura y and takeuchi t (2008a) Effect of dietary taurine and cystine on growth performance of juvenile red sea bream Pagrus major, Aquaculture, 274, 142–7. matsunari h, yamamoto t, kim s-k, goto t and takeuchi t (2008b) Optimum dietary taurine level in casein-based diet for juvenile red sea bream Pagrus major, Fisheries Science, 74, 347–53.

492


mihelakakis a, tsolkas c and yoshimatsu t (2002) Optimization of feeding rate for hatchery-produced juvenile gilthead sea bream Sparus aurata, Journal of the World Aquaculture Society, 33, 169–75. millamena o m (2002) Replacement of fish meal by animal by-product meals in a practical diet for grow-out culture of grouper Epinephelus coioides, Aquaculture, 204, 75–84. millamena o m and golez n v (2001) Evaluation of processed meat solubles as replacement for fish meal in diet for juvenile grouper Epinephelus coioides (Hamilton), Aquaculture Research, 32, 281–7. mohamed j s, sivaram v, roy t s c, marian m p, murugadass s and hussain m r (2003) Dietary vitamin A requirement of juvenile greasy grouper (Epinephelus tauvina), Aquaculture, 219, 693–701. montero d, caballero m j, ganga r, mathlouthi f, tort l, robaina l and izquierdo m s (2008a) Replacing fish oil by vegetable oils in marine fish: an overview of the effects on fish health, XIII International Symposium on Fish Nutrition and Feeding, 2008, Florianopolis, 50. montero d, grasso v, izquierdo m s, ganga r, real f, tort l, caballero m j and acosta f (2008b) Total substitution of fish oil by vegetable oils in gilthead sea bream (Sparus aurata) diets: Effects on hepatic Mx expression and some immune parameters, Fish & Shellfish Immunology, 24, 147–55. moriss p (2005) The vegetarian trout: opportunities for replacing fishmeal and fish oil in feeds for rainbow trout, International AquaFeed, 8(1), 41–6. murillo-gurrea d p, coloso r m, borlongan i g and serrano a e (2001) Lysine and arginine requirements of juvenile Asian sea bass (Lates calcarifer), Journal of Applied Ichthyology, 17, 49–53. nankervis l, matthews s j and appleford p (2000) Effect of dietary non-protein energy source on growth, nutrient retention and circulating insulin-like growth factor I and triiodothyronine levels in juvenile barramundi, Lates calcarifer, Aquaculture, 191, 323–35. nengas i, alexis m n, davies s j and petichakis g (1995) Investigation to determine digestibility coefficients of various raw materials in diets for gilthead sea bream, Sparus auratus (L.), Aquaculture Research, 26, 185–94. nengas i, alexis m n and davies s j (1999) High inclusion levels of poultry meals and related byproducts in diets for gilthead seabream Sparus aurata L, Aquaculture, 179, 13–23. nrc (1993) National Research Council – Nutrient Requirements of Fish, Washington, National Academy Press. oh s y, noh c h and cho s h (2007) Effect of restricted feeding regimes on compensatory growth and body composition of red sea bream, Pagrus major, Journal of the World Aquaculture Society, 38, 443–9. oliva-teles a and peres h (2008) The optimum dietary essential amino acid pattern for gilthead seabream Sparus aurata, XIII International Symposium on Fish Nutrition and Feeding, 2008, Florianopolis, Brazil, 111. panserat s, medale f, blin c, breque j, vachot c, plagnes-juan e, gomes e, krishnamoorthy r and kaushik s (2000) Hepatic glucokinase is induced by dietary carbohydrates in rainbow trout, gilthead seabream, and common carp, American Journal of Physiology-Regulatory Integrative and Comparative Physiology, 278, R1164–R1170. panserat s, plagnes-juan e and kaushik s (2002) Gluconeogenic enzyme gene expression is decreased by dietary carbohydrates in common carp (Cyprinus carpio) and gilthead seabream (Sparus aurata), Biochimica Et Biophysica ActaGene Structure and Expression, 1579, 35–42.


493

partridge g j and creeper j (2004) Skeletal myopathy in juvenile barramundi, Lates calcarifer (Bloch), cultured in potassium-deficient saline groundwater, Journal of Fish Diseases, 27, 523–30. partridge g j and lymbery a j (2008) The effect of salinity on the requirement for potassium by barramundi (Lates calcarifer) in saline groundwater, Aquaculture, 278, 164–70. partridge g j, lymbery a j and bourke d k (2008) Larval rearing of barramundi (Lates calcarifer) in saline groundwater, Aquaculture, 278, 171–4. paspatis m, maragoudaki d and kentouri m (2000) Self-feeding activity patterns in gilthead sea bream (Sparus aurata), red porgy (Pagrus pagrus) and their reciprocal hybrids, Aquaculture, 190, 389–401. paulin c d (1990) Pagrus auratus, a new combination for the species known as ‘snapper’ in Australasian waters (Pisces : Sparidae), New Zealand Journal of Marine and Freshwater Research, 24, 259–65. pavlidis m, karkana m, fanouraki e and papandroulakis n (2008) Environmental control of skin colour in the red porgy, Pagrus pagrus, Aquaculture Research, 39, 837–49. pereira t g and oliva-teles a (2002) Preliminary evaluation of pea seed meal in diets for gilthead sea bream (Sparus aurata) juveniles, Aquaculture Research, 33, 1183–9. pereira t g and oliva-teles a (2004) Evaluation of micronized lupin seed meal as an alternative protein source in diets for gilthead sea bream Sparus aurata L. juveniles, Aquaculture Research, 35, 828–35. pillay t v r (1993) Aquaculture Principles and Practices, Oxford, London, Blackwell Scientific. pomeroy r (2007) Public policy for sustainable grouper aquaculture development in Southeast Asia, in Leung P, Lee C S and O’Bryen P J (eds), Species & System Selection For Sustainable Aquaculture, Oxford, Blackwell, 461–76. quartararo n, allan g l and bell j d (1998a) Replacement of fish meal in diets for Australian snapper, Pagrus auratus, Aquaculture, 166, 279–95. quartararo n, bell j d and allan g l (1998b) Substitution of fishmeal in a diet for the carnivorous marine fish Pagrus auratus (Bloch and Schneider) from Southeastern Australia, Asian Fisheries Science, 10, 269–79. rachmansyah laining a and ahmad t (2004) The use of shrimphead meal as a substitute to fish meal in diets for humpback grouper (Cromileptes altivelis), in Rimmer M A, McBride S and Williams K C (eds), Advances in Grouper Culture, ACIAR Monograph 110, Canberra, Australian Centre for International Agricultural Research, 113–14. rad f (2007) Evaluation of the sea bass and sea bream industry in the Mediterranean, with emphasis on Turkey, in Leung P, Lee C S and O’Bryen P J (eds), Species & System Selection For Sustainable Aquaculture, Oxford, Blackwell, 445–9. raso s and anderson t a (2003) Effects of dietary fish oil replacement on growth and carcass proximate composition of juvenile barramundi (Lates calcarifer), Aquaculture Research, 34, 813–9. rawles s d, smith s b and gatlin d m (2008) Hepatic glucose utilization and lipogenesis of hybrid striped bass in response to dietary carbohydrate level and complexity, Aquaculture Nutrition, 14, 40–50. rimmer m (2003) Barramundi, in Lucas J S and Southgate P C (eds), Aquaculture Farming Aquatic Animals and Plants, Oxford, Blackwell, 364–81. rimmer m a, mcbride s and williams k c (eds) (2004) Advances in Grouper Culture, ACIAR Monograph 110, Canberra, Australian Centre for International Agricultural Research.

494


robles r, ceulemans s, coutteau p and cremer m (2008) Soy products replace fishmeal, fish oil in gilthead seabream feed study, Global Aquaculture Advocate, 11, 69–70. rotllant j, tort l, montero d, pavlidis m, martinez m, bonga s e w and phm b (2003) Background colour influence on the stress response in cultured red porgy Pagrus pagrus, Aquaculture, 223, 129–39. salama a j (2008) Effects of different feeding frequency on the growth, survival and feed conversion ratio of the Asian sea bass Lates calcarifer juveniles reared under hypersaline seawater of the Red Sea, Aquaculture Research, 39, 561–7. sánchez-muros m j, corchete v, suárez m d, cardenete g, gómez-milán e and de la higuera m (2003) Effect of feeding method and protein source on Sparus aurata feeding patterns, Aquaculture, 224, 89–103. santinha p j m, medale f, corraze g and gomes e f s (1999) Effects of the dietary protein: lipid ratio on growth and nutrient utilization in gilthead seabream (Sparus aurata L.), Aquaculture Nutrition, 5, 147–56. schuchardt d, vergara j m, fernandez-palacios h, kalinowski c t, hernandez-cruz c m, izquierdo m s and robaina l (2008) Effects of different dietary protein and lipid levels on growth, feed utilization and body composition of red porgy (Pagrus pagrus) fingerlings, Aquaculture Nutrition, 14, 1–9. shapawi r, ng w k and mustafa s (2007) Replacement of fish meal with poultry by-product meal in diets formulated for the humpback grouper, Cromileptes altivelis, Aquaculture, 273, 118–26. shapawi r, mustafa s and ng w k (2008) Effects of dietary fish oil replacement with vegetable oils on growth and tissue fatty acid composition of humpback grouper, Cromileptes altivelis (Valenciennes), Aquaculture Research, 39, 315–23. shearer k (1995) The use of factorial modelling to determine the dietary requirements for essential elements in fishes, Aquaculture, 133, 57–72. shiau s y and lin y h (2001) Carbohydrate utilization and its protein-sparing effect in diets for grouper (Epinephelus malabaricus), Animal Science, 73, 299–304. sim s y, rimmer m a, williams k, toledo j d, sugama k, rumengan i and phillips m j (2005) A Practical Guide to Feeds and Feed Management for Cultured Groupers, Publication No. 2005-02 of the Asia-Pacific Marine Finfish Aquaculture Network. sitja-bobadilla a, mingarro m, pujalte m j, garay e, alvarez-pellitero p and perez-sanchez j (2003) Immunological and pathological status of gilthead sea bream (Sparus aurata L.) under different long-term feeding regimes, Aquaculture, 220, 707–24. sitja-bobadilla a, pena-llopis s, gomez-requeni p, medale f, kaushik s and perez-sanehez j (2005) Effect of fish meal replacement by plant protein sources on non-specific defence mechanisms and oxidative stress in gilthead sea bream (Sparus aurata), Aquaculture, 249, 387–400. smith d m, williams i h, williams k c, barclay m c and venables w n (2005) Oxidation of medium-chain and long-chain fatty acids by polka dot grouper Cromileptes altivelis, Aquaculture Nutrition, 11, 41–8. sun l h, chen h r and huang l m (2007) Growth, faecal production, nitrogenous excretion and energy budget of juvenile yellow grouper (Epinephelus awoara) relative to ration level, Aquaculture, 264, 228–35. suwiyra k, giri n a, marzuqi m and trijoko (2004) Utilisation of dietary dextrin by juvenile humpback grouper (Cromileptes altivelis), in Rimmer M A, McBride S and Williams K C (eds), Advances in Grouper Culture, ACIAR Monograph 110, Canberra, ACIAR, 107–9. suwirya k, giri n a and marzuqi m (2005) Effect of dietary n-3 HUFA on growth of humpback grouper (Cromileptes altivelis) and tiger grouper (Epinephe-


495

lus fuscogutatus) juveniles, in Rimmer M A, McBride S and Williams K C (eds), Advances in Grouper Culture, ACIAR Monograph 110, Canberra, ACIAR, 98–100. takagi s, hosokawa h, shimeno s and ukawa m (2000a) Utilization of corn gluten meal in a diet for red sea bream Pagrus major, Nippon Suisan Gakkaishi, 66, 417–27. takagi s, hosokawa h, shimeno s and ukawa m (2000b) Utilization of poultry byproduct meal in a diet for red sea bream Pagrus major, Nippon Suisan Gakkaishi, 66, 428–38. takagi s, shimeno s, hosokawa h and ukawa m (2001) Effect of lysine and methionine supplementation to a soy protein concentrate diet for red sea bream Pagrus major, Fisheries Science, 67, 1088–96. takagi s, murata h, goto t, ichiki t, endo m, hatate h, yoshida t, sakai t, yamashita h and ukawa m (2006) Efficacy of taurine supplementation for preventing green liver syndrome and improving growth performance in yearling red sea bream Pagrus major fed low-fishmeal diet, Fisheries Science, 72, 1191–9. takeuchi t, shiina y and watanabe t (1991) Suitable protein and lipid levels in diet for fingerlings of Red Sea Bream Pagrus major, Nippon Suisan Gakkaishi, 57, 293–9. takeuchi t, park g s, seikai t and yokoyama m (2001) Taurine content in Japanese flounder Paralichthys olivaceus T. & S. and red sea bream Pagrus major T. & S. during the period of seed production, Aquaculture Research, 32, 244–8. tantikitti c, sangpong w and chiavareesajja s (2005) Effects of defatted soybean protein levels on growth performance and nitrogen and phosphorus excretion in Asian seabass (Lates calcarifer), Aquaculture, 248, 41–50. thia-eng c and seng-keh t (1978) Effects of feeding frequency on the growth of young estuary grouper, Epinephelus tauvina (Forskål), cultured in floating netcages, Aquaculture, 14, 31–47. tian x l and qin r g (2004) Effects of previous ration restriction on compensatory growth in barramundi Lates calcarifer, Aquaculture, 235, 273–83. tort l, rotllant j, liarte c, acerete l, hernandez a, ceulemans s, coutteau p and padros f (2004) Effects of temperature decrease on feeding rates, immune indicators and histopathological changes of gilthead sea bream Sparus aurata fed with an experimental diet, Aquaculture, 229, 55–65. tuan l a and williams k c (2007) Optimum dietary protein and lipid specifications for juvenile malabar grouper (Epinephelus malabaricus), Aquaculture, 267, 129–38. tucker j w (2008) Sheepshead: American seabream shows culture potential, Global Aquaculture Advocate, 11(2), 51–2. tucker b j, booth m a, allan g l, booth d and fielder d s (2006) Effects of photoperiod and feeding frequency on performance of newly weaned Australian snapper Pagrus auratus, Aquaculture, 258, 514–20. usman palinggi n and giri n a (2004) Utilisation of different dietary carbohydrate sources by humpback grouper (Cromileptes altivelis), in Rimmer M A, McBride S and Williams K C (eds), Advances in Grouper Culture, ACIAR Monograph 110, Canberra, Australian Centre for International Agricultural Research, 104–6. usman rachmansyah laining a, ahmad t and williams k c (2005) Optimum dietary protein and lipid specifications for grow-out of humpback grouper Cromileptes altivelis (Valenciennes), Aquaculture Research, 36, 1285–92. velazquez m, zamora s and martinez f j (2006a) Effect of dietary energy content on gilthead sea bream (Sparus aurata) feeding behaviour and nutritional use of the diet, Aquaculture Nutrition, 12, 127–33.

496


velazquez m, zamora s and martinez f j (2006b) Effect of different feeding strategies on gilthead sea bream (Sparus aurata) demand-feeding behaviour and nutritional utilization of the diet, Aquaculture Nutrition, 12, 403–9. venou b, alexis m n, fountoulaki e, nengas i, apostolopoulou m and castritsicathariou i (2003) Effect of extrusion of wheat and corn on gilthead sea bream (Sparus aurata) growth, nutrient utilization efficiency, rates of gastric evacuation and digestive enzyme activities, Aquaculture, 225, 207–23. venou b, alexis m n, fountoulaki e and haralabous j (2006) Effects of extrusion and inclusion level of soybean meal on diet digestibility, performance and nutrient utilization of gilthead sea bream (Sparus aurata), Aquaculture, 261, 343–56. vergara j m, robaina l, izquierdo m and delahiguera m (1996) Protein sparing effect of lipids in diets for fingerlings of gilthead sea bream, Fisheries Science, 62, 624–8. vergara j m, lopez-calero g, robaina l, caballero m j, montero d, izquierdo m s and aksnes a (1999) Growth, feed utilization and body lipid content of gilthead seabream (Sparus aurata) fed increasing lipid levels and fish meals of different quality, Aquaculture, 179, 35–44. wang c m, zhu z y, lo l c, feng f, lin g, yang w t, li j and yue g h (2007) A microsatellite linkage map of Barramundi, Lates calcarifer, Genetics, 175, 907–15. wang y, li k, han h, zheng z-x and bureau d p (2008) Potential of using a blend of rendered animal protein ingredients to replace fish meal in practical diets for malabar grouper (Epinephelus malabricus), Aquaculture, 281, 113–17. watanabe t and vassallo-agius r (2003) Broodstock nutrition research on marine finfish in Japan, Aquaculture, 227, 35–61. webster c d (2002) Hybrid striped bass, in Webster C D and Lim C E (eds), Nutrient Requirements and Feeding of Finfish for Aquaculture, New York, CABI, 327–43. williams k c (2005) Groupers, Aqua Feeds: Formulation & Beyond, Miami, FL, Feedware LCC. williams k, barlow c and rodgers l (2001) Efficacy of crystalline and proteinbound amino acids for amino acid enrichment of diets for barramundi/Asian seabass (Lates calcarifer Bloch), Aquaculture Research, 32, 415–29. williams k c, barlow c g, rodgers l, hockings i, agcopra c and ruscoe i (2003a) Asian seabass Lates calcarifer perform well when fed pelleted diets high in protein and lipid, Aquaculture, 225, 191–206. williams k c, barlow c g, rodgers l j and ruscoe i (2003b) Potential of meat meal to replace fish meal in extruded dry diets for barramundi, Lates calcarifer (Bloch). 1. Growth performance, Aquaculture Research, 34, 23–32. williams k c, paterson b d, barlow c g, ford a and roberts r (2003c) Potential of meat meal to replace fish meal in extruded dry diets for barramundi, Lates calcarifer (Bloch). II. Organoleptic characteristics and fatty acid composition, Aquaculture Research, 34, 33–42. williams k c, irvin s and barclay m (2004) Polka dot grouper Cromileptes altivelis fingerlings require high protein and moderate lipid diets for optimal growth and nutrient retention, Aquaculture Nutrition, 10, 125–34. williams i, williams k c, smith d m and jones m (2006a) Polka-dot grouper, Cromileptes altivelis, can utilize dietary fat efficiently, Aquaculture Nutrition, 12, 379–87. williams k c, barlow c g, rodgers l and agcopra c (2006b) Dietary composition manipulation to enhance the performance of juvenile barramundi (Lates calcarifer Bloch) reared in cool water, Aquaculture Research, 37, 914–27. wu f c, ting y y and chen h y (2002) Docosahexaenoic acid is superior to eicosapentaenoic acid as the essential fatty acid for growth of grouper, Epinephelus malabancus, Journal of Nutrition, 132, 72–9.


497

wu f c, ting y y and chen h y (2003) Dietary docosahexaenoic acid is more optimal than eicosapentaenoic acid affecting the level of cellular defence responses of the juvenile grouper Epinephelus malabaricus, Fish & Shellfish Immunology, 14, 223–38. wu x y, liu y j, tian l x, mai k s and yang h j (2007) Utilization of different raw and pre-gelatinized starch sources by juvenile yellowfin seabream Sparus latus, Aquaculture Nutrition, 13, 389–96. yamamoto t, akimoto a, kishi s, unuma t and akiyama t (1998) Apparent and true availabilities of amino acids from several protein sources for fingerling Rainbow trout, Common carp, and Red sea bream, Fisheries Science, 64, 448–58. ye c-x, liu y-j, tian l-x, mai k-s, du z-y, yang h-j and niu j (2006) Effect of dietary calcium and phosphorus on growth, feed efficiency, mineral content and body composition of juvenile grouper, Epinephelus coioides, Aquaculture, 255, 263–71. yeh s p, chang c a, chang c y, liu c h and cheng w (2008) Dietary sodium alginate administration affects fingerling growth and resistance to Streptococcus sp and iridovirus, and juvenile non-specific immune responses of the orange-spotted grouper, Epinephelus coioides, Fish & Shellfish Immunology, 25, 19–27. yone y (1976) Nutritional studies of red sea bream, Proceedings of the First International Conference on Aquaculture Nutrition, October 14–15 (1975), Lewes/ Rehoboth, DE, 39–64. zhou q c, liu y j, mai k s and tian l x (2004) Effect of dietary phosphorus levels on growth, body composition, muscle and bone mineral concentrations for orange-spotted grouper Epinephelus coioides reared in floating cages, Journal of the World Aquaculture Society, 35, 427–35.

17 Advances in aquaculture feeds and feeding: salmonids S. Refstie, Nofima Marin and Aquaculture Protein Centre (APC), Norway, and T. Åsgård, Nofima Marin, Norway

Abstract: Salmonid aquaculture is highly mechanised, thus depending on efficient feed utilisation, rapid growth, and short production cycles to maximise output of extensive facilities. This chapter addresses recent history, advances, practices, and future trends in feed ingredient choice, formulation, feed processing and manufacture, and feeding to obtain these goals. Chosen strategies and solutions are largely based on in-depth research on salmonid metabolism and nutritional physiology, which is used to reassess nutritional requirements, evaluate feed ingredients, and elucidate how physical properties of feeds, dietary nutrients or natural bioactive components, feed additives or contaminants, and malnutrition affects fish performance, health, and nutrient composition. Key words: salmon, trout, feed, nutrition, health.

17.1 Introduction By 2006 salmonid aquaculture produced more than 1.4 million metric tons of salmon (FAO, 2007) and probably about 300 000 tons of rainbow trout, consuming 2.5 million tons of feed in the process. These fishes are grown in both freshwater and seawater. Freshwater farming of portion sized salmonids developed from hatchery propagation programs during the late 1800s to spread worldwide through the temperate climate zones during the early 1900s (Jensen, 1975; Herschberger, 1992). This industry mainly produces rainbow trout (Oncorhynchus mykiss), which are grown in earth ponds, concrete dams, or raceway systems that have often implemented thorough water control and recirculation systems to minimise water use and effluent discharges.

Advances in aquaculture feeds and feeding: salmonids

499

Successful sea farming of salmonids was first achieved in the late 1960s (reviewed by Jensen, 1975). This industry grows Atlantic salmon (Salmo salar) and Pacific salmonids of the Oncorhyncus genus up to 7 kg in pens with water volumes of up to 100 000 m3, holding up to 200 000 individual fish. Today the bulk of sea-farmed salmon and trout is produced in Norway and Chile, which have suitable climates and coastlines. This form of aquaculture depends on efficient feed utilisation, rapid growth, and short production cycles to maximise output of the extensive facilities. Current feeding systems are consequently highly mechanised and controlled. Moist or dry pelleted compound feeds were long the diets of choice for salmonids in freshwater. These were largely based on fish meal and oil, and were lean as a result of feed technological limitations. When attempts were made to farm salmonids in seawater they were initially fed moist diets made locally from scrap fish and animal by products (Åsgård and Austreng, 1985a, b, 1986, 1987). This was partly because it was difficult to feed dry feeds during cold winters, a problem that was solved when high-quality low-temperature (LT) dried fish meals (Pike and Hardy, 1997) were introduced. The 1980s saw the introduction of high-pressure moist extrusion technology, which paved the way for modern dry and durable highenergy salmon and trout diets containing up to 40 % lipid (Hillestad and Johnsen, 1994; Einen and Roem, 1997; Einen and Skrede, 1998; Hillestad et al., 1998; Hemre and Sandnes, 1999; Refstie et al., 2001). The period furthermore saw the introduction of synthetic carotenoid pigments in diets for sea-farmed salmonids (Foss et al., 1984; Choubert and Blanc, 1985; Storebakken et al., 1985, 1986, 1987), where pink flesh colour is a major quality criterion. This raised the share of the pigment costs to 20 % of the total raw material cost in commercial feeds. The 1990s then forced the aquaculture industries to look for alternative non-marine feedstuffs (Storebakken et al., 2000a; Francis et al., 2001; Bakke-McKellep et al., 2008), realising that further sustainable growth and stable ingredient supply depended on this. Thus, nutritional research in salmonids during the 2000s focused extensively on (i) defining raw materials that alone or in combination may legally and safely replace fish meal and oil in the diets without compromising fish health or productivity, (ii) defining pigment sources and means for more efficient flesh pigmentation, and (iii) avoiding producing less healthy foods when reducing the use of dietary fish oil. The in-depth focus and commitment of these efforts have significantly improved our understanding of salmonid nutrient requirements, digestive function, and metabolism, but also revealed nutritional knowledge gaps that need to be bridged by further research. Current status of salmonid nutrition may in many respects serve as a model for more recently domesticated fishes, pointing at risk factors that need to be investigated and controlled.

500

17.2


Feed technology and formulation

17.2.1 Preferred technology: benefits and restrictions on formulation Current salmonid diets are manufactured by high-pressure moist extrusion technology (Fig. 17.1). The extrusion process expands starch in the feed mixture to produce wear-resistant pellets that do not crack or crumble easily, thus allowing efficient mechanical feed distribution. Due to the expanded starch matrix in the pellets, extruded feeds furthermore have high capacity for soaking up and holding oil. To reach the lipid levels in high energy diets (≥40 %), oil is sprayed onto the pellets in a vacuum coater and then pressed into the pellets by letting in air. High temperature (100–150 °C), pressure, and shear force during the extrusion process may cause oxidation that reduces protein quality and damages feed additives such as vitamins and carotenoid pigments (Camire et al., 1990; Haaland et al., 1993). High moisture content during extrusion protects the ingredients (Sørensen et al., 2002), but as water works as a lubricant in the extruder, it can not exceed 25–30 % (Rokey, 1994). The extrusion process must, thus, be carefully optimised to avoid nutrient losses. It follows that heat-sensitive feed additives for extruded feeds must be stabilised in beadlet matrixes (Gadient and Fenster, 1994; Killeit, 1994; Anderson and Sunderland, 2002) and/or added post-extrusion together with the oil. Thermally processed feedstuffs receive a secondary heating during extrusion, and this must be considered when determining quality criteria for such ingredients. The restriction on moisture in the feed mash furthermore limits the use of feasible wet ingredients such as fish silage and

Dry ingredients Fish meal,vegetable protein ingredients, vitamins, minerals, and carbohydrates

Pre-conditioning

Extrusion

Drying Moist ingredients Water, steam, oil, and fish silage Vacuum coating

Cooling

Fig. 17.1

Main principles of high-pressure moist extrusion feed manufacture.


501

fermented vegetable feedstuffs, so extruded feeds are mainly made from dry meals.

17.2.2 Trends in feed formulation The salmon and trout feed industry has a strong focus on evaluating new feed ingredients to expand the base of safe ingredients. This is in part to reduce the dependency on marine feedstuffs derived from limited fisheries, thereby increasing the sustainability of the salmonid industry. Using a wide selection of feedstuffs also spreads risks related to batch variations in content of unwanted components in the feedstuffs, and ultimately allows true least cost formulation. Major feed companies optimise feeds based on digestible protein and energy content in the actual ingredient batches used, measured by near-infrared reflectance (NIR; Givens et al., 1997) or nuclear magnetic resonance (NMR; Makkar, 2008) spectroscopy. Thus, the feeds come with declared concentrations of digestible protein and energy as calculated by linear programming, while the chemical nutrient composition of the diets may vary.

17.3 Digestive physiology 17.3.1 Digestive physiology and regulation Salmonid fishes are strictly carnivorous species having short gastrointestinal tracts. These are functionally sectioned into a J-shaped muscular stomach, a pyloric intestine with 50–60 pyloric caeca, a mid-intestine of similar length and with similar morphology but without caeca, and a distinct distal intestine of similar length as the mid-intestine but with larger diameter and annular rings (Nordrum et al., 2000). The pyloric caeca substantially expand the absorptive surface of the intestine, contributing 70–80 % of the total absorptive capacity (Buddington et al., 1997). The bulk of nutrients are, thus, digested and absorbed in this intestinal section (Krogdahl et al., 1999; Denstadli et al., 2004; Refstie et al., 2006a). The entire length of the salmonid intestine is, however, capable of nutrient absorption, and the distal intestine also transports intact protein by endocytosis throughout the lifespan of the fish (Sire and Vernier, 1992; Buddington et al., 1997). Salmonids have a diffuse pancreas spread among and on the walls of the pyloric caeca. Endochrine, paracrine, and neural mechanisms are involved in regulating the enzyme secretion from this pancreatic tissue. Cholecystokinin (CCK) plays a major role, and products of nutrient hydrolysis are more potent stimulators than intact nutrients (Krogdahl and Sundby, 1999). Enzyme secretion and digestive capacity is regulated according to diet composition (Krogdahl and Sundby, 1999; Krogdahl et al., 2004; Santigosa et al., 2008; Bogevik et al., 2009), although the capacity to adapt secretion of α-amylase for starch hydrolysis is restricted (Spannhof and Plantikow, 1983; Krogdahl et al., 1999).

502


17.3.2 Role of the intestinal microflora In homoeothermic terrestrial animals the physiological role of the microflora is dynamic and complex, including colonisation resistance against pathogens, metabolic conversion of dietary and endogenous compounds, and interaction with the host immune system (Cummings and Macfarlane, 1997; Lhoste et al., 2003). It has been generally accepted that fish have a stable intestinal microflora with lower bacterial density and simpler bacterial diversity (Cahill, 1990; Ringø et al., 1995; Kim et al., 2007). Some of these bacteria are considered transient and pass through the gut with the intestinal contents, while others are adherent to and associated with the intestinal mucosa (Ringø and Birkbeck, 1999; Ringø, 2008). Absence or inactivation of pathogenic intestinal bacteria is very important for good health in salmonid fish (Irianto and Austin, 2002; Jutfelt et al., 2008; Ringø et al., 2008). The role of the intestinal microflora regarding digestive function in fish is more uncertain. However, both total count of cultivable intestinal bacteria and bacterial species diversity is significantly changed when replacing fish meal by soybean meal (Heikkinen et al., 2006; Bakke-McKellep et al., 2007b) or krill meal (Ringø et al., 2006a) in diets for rainbow trout and Atlantic salmon, particularly in the distal intestine. The microflora is also altered by dietary cellulose, soy non-starch polysaccharides, or inulin (Bakke-McKellep et al., 2007b; Ringø et al., 2008, 2006b). Thus, just as in terrestrial animals, the microflora in salmonids is dynamic and modulated by diet, and probably affects both digestive function and health.

17.3.3 Feed and feedstuff related digestive function alterations Oil belching and pellet durability Regurgitation (belching) of oil is a significant problem in sea-farmed rainbow trout and Coho salmon, which are pacific salmonids of the genus Oncorhynchus, and may occasionally be observed in Atlantic salmon as well. It is manifested by continuous surfacing of oil droplets in the sea pens and an oil slick on the pen surface. In pacific salmoids oil belching often coincides with gastric dilation air sacculitis (GDAS; Staurnes et al., 1990; Anderson, 2006; Forgan and Forster, 2007), commonly known as bloat, which is characterised by an enlarged stomach, reduced abdominal wall thickness, and sublethal osmoregulatory stress. The stomach also contains up to six times more material than normal, largely consisting of water and accumulated dietary oil. The etiology of this condition is complex. With regard to lipid accumulation in the stomach, however, it appears related to the physical water stability and durability of the feed particles, and more specifically to how particles disintegrate and release oil. Extruded grower feeds for salmonids have a very high oil content, and pellets that rapidly disintegrate and release the feed oil cause oil separation and accumulation in the stomach


503

(Baeverfjord et al., 2006a; Terjesen et al., 2008). Stressed fish will, thus, belch feed oil. It follows that optimal feeds for salmonids should not release feed oil while disintegrating. However, too durable feed is not feasible either. High pellet water stability and durability prolong gastric evacuation (Hilton et al., 1981), and too stable extruded diets depress appetite significantly (Terjesen et al., 2008). Thus, feed water stability, durability, and oil release are important quality criteria of salmonid diets that should be optimised carefully. Soybean meal-induced enteritis Salmoninds are intolerant to little refined soy products such as full-fat and extracted (de-oiled) soybean meals. The adverse effects are dose dependent (Krogdahl et al., 2003), and appetite and growth are significantly depressed at high dietary inclusion (>20 %; Olli and Krogdahl, 1994; Olli et al., 1994a, 1995; Krogdahl et al., 2003; Refstie et al., 2005). Consequently this restricts the use of this cost-efficient plant protein commodity in salmonid diets. With regard to appetite and growth depression, rainbow trout appears to have a higher tolerance for soybean meal than Atlantic salmon (Refstie et al., 2000). As repeatedly shown in both Atlantic salmon (van den Ingh et al., 1991, 1996; Baeverfjord and Krogdahl, 1996; Refstie et al., 2000, 2001, 2005, 2006a, b; Krogdahl et al., 2003; Sanden et al., 2005; Bakke-McKellep et al., 2007a, b, c; Knudsen et al., 2007, 2008; Urán et al., 2008) and rainbow trout (Rumsey et al., 1994; Burrells et al., 1999; Refstie et al., 2000; Ostaszewska et al., 2005; Heikkinen et al., 2006; Romarheim et al., 2006; Escaffre et al., 2007), the most severe digestive function alteration in response to dietary soybean meal is inflammation and histopathological changes in the distal intestine. Due to rapid regression following withdrawal of soybean meal from the diet, this condition is classified as a non-infectious and sub-acute enteritis (Baeverfjord and Krogdahl, 1996). It is characterised by infiltration of inflammatory cells in the basal membrane underlying the intestinal mucosa, shortening and clubbing of the mucosal folds, and loss of supranuclear vacuolisation of the enterocytes (Fig. 17.2; Baeverfjord and Krogdahl, 1996). The rate of cell renewal in the mucosa increases in response to losses of functional enterocytes (Bakke-McKellep et al., 2007b), probably resulting in an increasingly immature enterocyte population, as it corresponds with impaired digestive functionality and reduced relative weight of the distal intestine (Bakke-McKellep et al., 2000a, b, 2007b; Nordrum et al., 2000; Krogdahl et al., 2003; Refstie et al., 2006a, b). The condition also alters the local immune response in the intestine, resulting in increased susceptibility to bacterial infections entering the organism across the intestine (Krogdahl et al., 2000). The causative soy components are found in the alcohol extractable fraction of soybeans (van den Ingh et al., 1996; Knudsen et al., 2007; Yamamoto

504

(a)


(b)

Fig. 17.2 Cross-sections of the distal intestine of Atlantic salmon with normal and undamaged intestine (a) or suffering from serious soybean-meal induced enteritis (b); pictures by Grete Baeverfjord. Note the infiltration of inflammatory cells in the basal membrane underlying the intestinal mucosa, shortening and clubbing of the mucosal folds, and loss of supranuclear vacuolisation of the enterocytes.

et al., 2008). This fraction is among other things rich in saponins (Anderson and Wolf, 1995; Knudsen et al., 2007), which in themselves do not induce the inflammatory reaction, but do increase the epithelial permeability of the distal intestine, thereby apparently exposing the immune system to foreign antigens from dietary components or intestinal bacteria (Knudsen et al., 2008). Soybean meal-induced enteritis appears T-cell-mediated (Bakke-McKellep, 2007c), suggesting a hypersensitivity to some soy peptide. It is plausible that altered intestinal microflora in response to soy (Heikkinen et al., 2006; Bakke-McKellep et al., 2007b) and probably most plant meals plays a role. Soybean meal-induced enteritis appears specific to salmonids, as it is not found in other investigated fish species (Grisdale-Helland et al., 2002a; Catacutan and Pagador, 2004; Evans et al., 2005; Ostaszewska et al., 2005; Refstie et al., 2006c; Romarheim et al., 2008a). The hypersensitivity


505

furthermore appears specific to soy, as similar intolerance reactions are not observed when feeding legumes like lupin, field peas, and faba beans, oilseeds like sunflower and rapeseed, wheat and corn gluten, or cereal grains like wheat and oat to Atlantic salmon (Storebakken et al., 2000b; Refstie et al., 2006b; Aslaksen et al., 2007). Soybean meals for salmonids are upgraded by alcohol-washing to produce soy protein concentrates (Lusas and Riaz, 1995), which do not alter the distal intestine in these species (van den Ingh et al., 1991, 1996; Rumsey et al., 1994; Refstie et al., 2001; Escaffre et al., 2007). Impaired lipid digestion Inclusion of soybean meal in the diet reduces the digestibility of lipid in salmonids (Refstie et al., 1998, 2000, 2001, 2005). When comparing legumes, oilseeds, and cereal grains this effect also appears specific to soy (Refstie et al., 2006b; Aslaksen et al., 2007), and the causative agent(s) are found in the alcohol extractable soy fraction (Olli and Krogdahl, 1995; Yamamoto et al., 2008). This adverse response is associated with lower concentration of bile salts in the intestine (Refstie et al., 2006b; Romarheim et al., 2008b; Yamamoto et al., 2008), which is probably caused by altered cholesterol and bile acid metabolism and/or faecal drainage of bile acids in response to alcohol soluble soy component(s). It is neither a direct consequence of soybean meal-induced enteritis nor specific to salmonids, as dietary soybean meal significantly depresses the lipid digestibility in Atlantic cod without causing intestinal inflammation (Førde-Skjærvik et al., 2006; Refstie et al., 2006c). At low ambient temperature the digestibility of saturated fatty acids is reduced in Atlantic salmon and rainbow trout (Menoyo et al., 2003; Ng et al., 2003, 2004). This may potentially worsen the effects of soybean meal on lipid digestion. Dietary non-starch polysaccharides furthermore reduce digestibility of solid fat in e.g. poultry (Smulikowska and Mieczkowska, 1996; Langhout et al., 1997; Dänicke et al., 2000). Thus, the combination of fibre-rich plant meals with oils rich in saturated fatty acids may potentially impair lipid digestion in salmonids at low water temperature. Feed oils with low melting points should in general be avoided at low water temperature. High levels of plant oil (soy, rapeseed, linseed, and palm oil) in the diet may cause accumulation of oil droplets in the enetrocytes of salmonids (Olsen et al., 1999, 2000, 2003; Caballero et al., 2002). The lipid content in the mucosa is normalised by supplying palmetic acid (C16:0; Olsen et al., 2000), which stimulates synthesis of phospholipids, or by sypplying soy lecitin, which is the phospholipid fraction of soy oil (Olsen et al., 1999, 2003). The condition is, thus, interpreted as symptoms of phospholipid deficiency and insufficient capacity for synthesis of lipoproteins for lipid transport out of the intestinal mucosa.

506


17.4 Nutritional requirements 17.4.1 Micronutrients The requirements of individual vitamins and vitamin-like components like inositol and choline (Woodward, 1994; Halver, 2002) and essential mineral elements (Lall, 2002) have long been established in salmonids. Thus, these are not further discussed here. It is, however, imperative that dietary minerals are available for digestion and absorption.

17.4.2 Macronutrients Protein and amino acids Protein and amino acid requirements are extensively investigated in Atlantic salmon and rainbow trout (Wilson, 2002). The optimum dietary protein to energy ratio decreases with fish size until the fish undergoes sexual maturation (Austreng et al., 1988; Einen and Roem, 1997). This is caused by escalating fattening while the body protein concentration remains constant (Shearer, 1984; Shearer et al., 1994), and by slower metabolism as the weight of the fish increases, so that a higher proportion of the dietary energy is used for maintenance (Jobling, 1994). Requirement values for all ten essential amino acids are established by dose–response studies for rainbow trout, Chinook salmon, and Coho salmon (Wilson, 2002). However, the growth responses in these studies were far inferior to what is achieved in modern commercial salmonid aquaculture. Adding to this, these values were generally established by broken line regression and/or analysis of variance, which frequently underestimate the requirement (Shearer, 2000). For Atlantic salmon requirement values based on dose–response experiments are only determined for lysine (Anderson et al., 1993; Berge et al., 1998), arginine (Lall et al., 1994; Berge et al., 1997), metionine (Rollin et al., 1994), and threonine (Bodin et al., 2008). Requirements values for the other essential amino acids are alternatively estimated based on optimal balance among essential amino acids of an ‘ideal reference’ protein expressed relative to lysine (Rollin et al., 2003). This model assumes that responses to dietary essential amino acids are well described by broken line regression, and that all essential amino acids are utilised with similar efficiencies. Thus, much work remains to update and establish amino acid requirement values for fastgrowing salmonids. Salmonids appear to have limiting capacity for converting proline to hydroxiproline (Aksnes et al., 2008), and to synthesise taurine from methionine and cysteine (Gaylord et al., 2006, 2007). These amino acids are, thus, conditionally essential in salmonids, and should be considered when formulating diets low in animal protein. Dietary supplementation of histidine above the required level for growth furthermore prevents osmotic cataract in Atlantic salmon genetically disposed for this disorder and/or grown in


507

areas with variable salinity (Breck et al., 2003, 2005a; Bjerkås and Sveier, 2004). This is because N-acetyl-L-histidine and histidine containing derivates serve as molecular water pumps regulating hydration of lens tissue (Baslow, 1998; Breck et al., 2005b). Fatty acids Salmonids fishes require aracidonic acid (ArA; C20:4n-6), eicosapentaenoic acid (20:5n-3; EPA) (EPA; C20:5n-3), and docosahexaenoic acid (22:6n-3; DHA) (DHA; C22:6n-3) in the diet. The reason for this is limited Δ6 deasaturase activity for biosynthesis of C20 and C22 long-chained polyunsaturated fatty acids (PUFA) from C18 fatty acids (Storebakken et al., 2000a; Opsahl-Ferstad et al., 2003). The ArA requirement is low, and appears particularly important in broodstock to achieve reproductive success and good egg and fry quality (Bell and Sargent, 2003). Essential fatty acids are selectively retained in phospholipids by salmonids (Bell et al., 2001, 2003; Torstensen et al., 2004a, b), and requirement for EPA + DHA is about 1 % of dry feed (Sargent et al., 2002). The fatty acid profile of triglycerides in adipose tissue does, however, mirror the profile of the dietary oil. Carbohydrate As salmonid fishes have high capacity for synthesis of glucose by gluconeogenesis, they have no specific requirement for carbohydrate (Dabrowski and Guderley, 2002; Hemre et al., 2002). Growth is still promoted by low (∼5 %) dietary inclusion of starch (Hemre et al., 1995a). Due to limited capacity for starch digestion and glucose absorption, assimilation, and metabolism (Phillips et al., 1948; Spannhof and Plantikow, 1983; Wilson, 1994; Hidalgo et al., 1999; Krogdahl and Sundby, 1999; Krogdahl et al., 1999, 2004, 2005; Hemre et al., 1995a, b, 2002), use of starch in salmonid diets should be limited to what is necessary for feed technical purposes. For efficient digestion, this starch needs to be well gelatinised even in diets with moderate starch levels (Pfeffer et al., 1991). High glucose absorption leads to excessive glycogen deposition in the liver and ultimately liver dysfunction (Hilton and Dixon, 1982; Dixon and Hilton, 1985).

17.5 Nutrition and health 17.5.1 Unwanted dietary components and fish health Inherent bioactive components in protein feedstuffs The nutritional quality of fish meals is highly variable, depending on species composition, freshness of the raw materials, and processing conditions (Pike and Hardy, 1997). Spoiling of raw materials by microbial activity and autolysis starts immediately after catching, among other things facilitating oxidation of trimethylamineoxide (TMAO) to unpalatable TMA, and

508


decarboxylation of amino acids to form biogenic amines. This process also gives rise to still unknown component(s) that induce pathological changes in the liver and intestine of Atlantic salmon (Opstvedt et al., 2000). Histamine produced from histidine and/or gizzerosine resulting from histidine reacting with lysine during heating furthermore cause stomach distension in rainbow trout (Fairgrieve et al., 1994), possibly preceding development of ulceration. Thus, raw material freshness is an imperative quality criterion for fish meals used for salmonids. Plant feedstuffs often contain bioactive components deposited to protect the plant from being eaten. These are often referred to as antunutritional factors (ANFs), which may broadly be divided into heat-labile and heatstabile factors. Heat-labile ANFs are generally of protein nature, and the most potent of these are inhibitors of digestive enzymes (Liener, 1980) and lectins that may bind to glycoconjugates (e.g. receptors) on animal cell membranes to disturb intestinal function and, if endocytosed, metabolism (van Damme et al., 1998). Although found in most legumes, high concentrations make these components particularly problematic in raw soybeans, which exhibit trypsin inhibitor activity (TIA) as high as 30 mg trypsin inhibited per g meal (Anderson and Wolf, 1995). Salmonids tolerate TIA up to 5 mg/g before digestive disturbances depresses appetite (Olli et al., 1989, 1994b). However, standard thermal processing when extracting soy (Lusas and Riaz, 1995) reduces TIA (Anderson and Wolf, 1995) to levels acceptable by salmonids and, in parallel, inactivates most lectins (Maenz et al., 1999). Heat-stable ANFs comprise a variable group of which the best characterised are tannins, saponins, phytoestrogens, goitrogens (i.e. glucosinolates), and plant structural or storage components such as non-starch polysaccharides (NSP), α-galactocide ologosaccharides, and phytic acid (inositol-6-phosphate; I6P). This group also includes ‘unknown’ components such as factor(s) involved in the etiology of soybean meal-induced enteritis, as described in Section 17.3.3. Saponins have become a topic of interest in salmonids due to their involvement in this ANF complex (Knudsen et al., 2008). With regard to plant carbohydrates, α-galactocide ologosaccharides appear to be utilised by salmonid intestinal bacteria (Refstie et al., 2005), potentially inducing digestive disturbances (Glencross et al., 2003). NSP also alter the intestinal microflora (Ringø et al., 2008), but appear less of a problem. As opposed to poultry, salmonids respond to dietary NSP by increasing the water content in the intestine, thereby avoiding digestive problems related to digesta viscosity (Refstie et al., 1999; Kraugerud et al., 2007). Salmonids appear to tolerate between 5 and 10 g phytic acid per kg diet (Spinelli et al., 1983; Storebakken et al., 1998; Denstadli et al., 2006a; Helland et al., 2006), above which appetite is depressed and mineralisation is compromised, particularly with regard to divalent metal ions like zinc.


509

Isoflavonoid phytoestrogens do not affect growing salmonids (Milligan et al., 1998; Tollefsen et al., 2004; D’souza et al., 2005), but appear to alter reproductive performance in salmonid broodstock (Bennetau-Pelissero et al., 2001). Glucosinolates are found in cruciferous seeds like rapeseed and may induce severe goitre in salmonids, which are sensitive to these ANFs (Hilton and Slinger, 1986; Burel et al., 2000, 2001). An upper level of 1.4 mol/g diet is suggested (Tripathi and Mishra, 2007) but, as modern rapeseed varieties contain low levels of glucosinolates, this is normally unproblematic. Other heat-labile ANFs are not properly investigated with specific regard to salmonids. Contaminants in protein feedstuffs Due to the increased use of plant feedstuffs in feeds for salmonids, there is also a growing concern about mycotoxin in these species. Mycotoxins are toxins produced as secondary metabolites by fungi, and feed contamination results from fungal infection of crops. These components are a structurally diverse group, of which the most common are aflatoxins, fumonisins, and ochratoxins (Steyn, 1995; D’Mello and Macdonald, 1997; Binder et al., 2007). Mycotoxins have various acute and chronic adverse effects, and are highly carcinogenic (Hussein and Brasel, 2001; Speijers and Speijers, 2004; Santacroce et al., 2008). Rainbow trout appear highly responsive to mycotoxins, typically manifested by appetite depression, immuno suppression, liver cancer and dysfunction, and ultimately death (Bauer et al., 1969; Lee et al., 1971; Woodward et al., 1983; Rasmussen et al., 1986; Curtis et al., 1995; Ottinger and Kaattari, 1998, 2000; Carlson et al., 2001; Santacroce et al., 2008). Salmonella bacteria (Salmonella spp.) may contaminate feed and infect farmed animals, thereby infecting human consumers if the meats are not properly heated (Lax et al., 1995). Salmonella bacteria have been found in feed plants producing feeds for salmonids (Nesse et al., 2003, 2005a; Lunestad et al., 2007) and, despite extrusion processing, occasionally in ready-to-use salmonid feed (Lunestad et al., 2007). With a possible exception for Salmonella arizonale, salmonella bacteria are not fish pathogens (Kodama et al., 1987; Austin and McIntosh, 1991). Feedborne Salmonella bacteria may still penetrate the gut wall and infect internal organs of rainbow trout grown in freshwater (Hagen, 1966). This appears less of a problem in Atlantic salmon grown in saltwater (Nesse et al., 2005b), possibly due to different water environment and, thus, different modulation of the intestinal microflora. Contaminants in oils Lipid-soluble environmental toxins accumulate in the marine food web, and particularly Baltic and North Sea fish oils contain high levels of dioxin and polychlorinated biphenyls (PCBs). When feeding such oil, these components also accumulate in farmed salmonids. This problem is largely avoided

510


when substituting such fish oil by cleaner oils such as plant oils in the diet (Bell et al., 2005; Berntssen et al., 2005).

17.5.2 Malnutrition and fish health The use of high-fat energy-dense diets and lack of exercise in pen culture causes high lipid accumulation in salmonids, especially around the viscera (Hillestad and Johnsen, 1994; Einen and Roem, 1997; Einen and Skrede, 1998; Hillestad et al., 1998; Hemre and Sandnes, 1999; Refstie et al., 2001). This excessive lipid deposition strongly implies a situation corresponding to human obesity. Increased replacement of marine feedstuffs in salmonid diets furthermore leads to reduced health promoting effects of marine n-3 PUFA, which are important regulators of numerous cellular functions, including those related to inflammation and immunity. Together these factors may push the fish towards a state similar to metabolic syndrome in humans and the ‘lifestyle related disorders’ that follow (Eckel et al., 2005). Adding to this, obesity gives rise to increased oxidative stress in the body and lowered stress tolerance (Kyrou and Tsigos, 2007). Although these phenomena are not described in fish, high mortality in slaughter size Atlantic salmon due to handling stress and heart failure is a growing problem, indicating that they are indeed occurring. In Atlantic salmon there is a high and variable frequency of fish suffering from skeletal malformations (Vågsholm and Djupvik, 1998; Kvellestad et al., 2000). The causes for this appear complex, but mineral deficiency clearly plays a role. Even marginal phosphorus deficiency causes critical reductions in whole body and vertebral mineral content of fast-growing salmon (Helland et al., 2005). Long-term feeding with diets marginally deficient in phosphorus and/or zinc induces a range of skeletal deformities commonly observed in the industry, which are mineralised and persist if the salmon is given sufficient mineral supply (Baeverfjord et al., 2006b). As described in Section 17.4.2, high dietary levels of digestible starch or glucose leads to excessive glycogen deposition in the liver and ultimately liver dysfunction in salmonids.

17.5.3 Salmon feed history and human health Cardioprotective effects of long-chain n-3 PUFAs of marine origin are well recognised (Connor and Connor, 1997). Because the fatty acid profile of salmonid adipose tissues mirrors that of the diet fed (Torstensen et al., 2004b; Seierstad et al., 2005), salmonid meats high in EPA and DHA may be produced by feeding diets high in fish oil. Such tailor-made Atlantic salmon has proved beneficial for patients with coronary disease, imposing favourable biochemical changes and reducing vascular inflammation (Seierstad et al., 2005). It follows that concentration of long-chain marine n-3 PUFAs is an important quality criterion for salmonid products marketed as healthy food.


511

17.6 Dietary additives 17.6.1 Vitamins, minerals, and amino acids Premixes of stabilised vitamins are added to salmonid diets in accordance with long-established nutritional requirements (Woodward, 1994; Halver, 2002). As vitamins are destroyed during feed extrusion and storage, it is important to adjust and/or protect individual vitamins in the premix to account for this (Barrows et al., 2008a). With regard to mineral elements, premixes of iron, zinc, manganese, and copper salts are added to saltwater diets, and calcium, potassium, iodine, and selenium salts may furthermore be added to freshwater diets, in accordance with established requirements (Lall, 2002). Phosphorus (P) is added separately as readily available (Nordrum et al., 1997) calcium, sodium, or ammonium phosphates. Fish meals have high but variable content of P, typically ranging from 17–30 g P per kg depending on species composition and how much bone the meals contain (Sugiura et al., 1998). Bone-bound P and other mineral elements are, however, poorly available to salmonids (Nordrum et al., 1997; Sugiura et al., 1998; Vielma et al., 1999). Plant meals contain 5–10 g P per kg, but 30–60 % of this is bound as phytic acid (Lott et al., 2000), which is marginally digested by salmonids (Forster et al., 1999; Denstadli et al., 2006a) and furthermore binds essential divalent ions. Properly mineralised Atlantic salmon and rainbow trout contain 5 g P per kg during grow-out (Shearer, 1984; Shearer et al., 1994; Baeverfjord et al., 1998). Consequently, despite large P discharges from salmonid culture, there is still a need to fortify salmonid diets with digestible phosphate. Synthetic L-lysine x HCl, D,L-merhionine, and L-threonine are routinely used to optimise the amino acid profile in salmonid diets. 17.6.2 Carotenoids The unique pink flesh colour in salmonids is caused by deposition of carotenoids such as astaxanthin (3,3′-dihydroxy-β,β-carotene-4,4′-dione) and canthaxanthin (β,β-carotene-4,4′-dione) in the muscle protein fraction, associated with α-actinin (Matthews et al., 2006). Carotenoids are synthesised de novo by plants, algae, certain types of bacteria, and fungi, but all animals including fishes are unable to biosynthesise carotenoids and, thus, depend on dietary supply. Canthaxanthin and astaxanthin serve as vitamin A precursors in salmonids (Schiedt et al., 1985; Al-Khalifa and Simpson, 1988; Guillou et al., 1989; White et al., 2003), and also have beneficial effects on health, early growth, and fecundity, which is probably related to their effects as antioxidants and immunostimulants (Christiansen et al., 1994, 1995a, b; Torrissen and Christiansen, 1995; Christiansen and Torrissen, 1996; Palace et al., 1999; Stahl and Sies, 2003; Waagbø et al., 2003; Amar et al., 2004; Fraser and Bramley, 2004; Ahmadi et al., 2006). The share of the pigment is ∼10 % of the total raw material cost in commercial salmonid saltwater diets. Flesh colour is an imperative quality

512


criterion in salmonids grown in sea pens, and the need for dietary carotenoids during the seawater grow-out phase is defined by the need to obtain sufficient colouring of the flesh. EU has posed a maximum level of 25 mg canthaxanthin per kg diet, and astaxanthin is consequently the main carotenoid used, at least in Europe. The most common carotenoid feed additives are synthetically manufactured and beadlet matrix stabilised (Foss et al., 1984; Choubert and Blanc, 1985; Storebakken et al., 1985, 1986, 1987), but also red yeast (Xanthophyllomyces dendrorhous, anamorph Phaffia rhodozyma; Storebakken et al., 2004a, b; Aarseth et al., 2006; Bjerkeng et al., 2007), which is a natural source of astaxanthin, is in use, particularly in Chile. Although less efficiently utilised, oil derived from crustaceous macrozooplankton may also be used as natural carotenoid sources (Hynes et al., 2009), particularly for organic farming of salmonids. Dietary carotenoids are, however, poorly utilised by salmonids. Thus, extra gain in flesh pigmentation is minor when applying dietary concentrations higher than 50–60 mg per kg (Bjerkeng et al., 1990; Torrissen et al., 1995; Forsberg and Guttormsen, 2006a). The carotenoid concentration in the muscle increases slowly with fish size in a curve-linear fashion when the dietary concentration is kept constant (Storebakken et al., 1987; Bjerkeng et al., 1992; Torrissen et al., 1995; Forsberg and Guttormsen, 2006a). The deposition of carotenoids ceases when the fish become sexually mature, when there is a mobilisation of carotenoids from muscles to skin and reproductive organs (Bjerkeng et al., 1992; Schiedt, 1998). The reasons for this low carotenoid utilisation are at least two-fold. First, the metabolic turnover of carotenoids by the intestine and/or liver appears high. This is indicated by very strong positive correlation between plasma astaxanthin concentration and astaxanthin deposition in muscle when injecting astaxanthin into the abdominal cavity of Atlantic salmon (Ytrestøyl and Bjerkeng, 2007a) and rainbow trout (Ytrestøyl and Bjerkeng, 2007b), showing that neither plasma transport capacity nor muscle binding capacity are limiting factors for flesh pigmentation. Second, the apparent digestibility of carotenoids in salmonid fishes is generally low, typically between 40 and 60 % (Bjerkeng et al., 1997; Bjerkeng and Berge, 2000; Ytrestøyl et al., 2005, 2006). It is furthermore depressed by increasing dietary pigment concentration (Choubert and Storebakken, 1989; Bjerkeng et al., 1990; Torrissen et al., 1990, 1995), increasing feed intake (Ytrestøyl et al., 2006), and falling ambient water temperature (Ytrestøyl et al., 2005). Thus, carotenoid digestibility and retention may vary with season, explaining the ‘spring drop’ in muscle pigmentation that is often observed in northern waters (Mørkøre and Rørvik, 2001). Both high content of lipid in the diet (Choubert et al., 1991; Torrissen et al., 1990; Bjerkeng et al., 1997, 1999, 2000; Hamre et al., 2004) and high proportion of PUFA in the dietary lipid (Waagbø et al., 1993; Bjerkeng et al., 1999, 2000; Regost et al., 2004; Rørå et al., 2005) increase carotenoid bioavailability.


513

17.6.3 Feed enzymes Feed enzymes such as carbohydrases and phytases are routinely used as feed additives to improve nutrient utilisation and reduce phosphorus excretion in pigs and poultry. This practice is, however, practically difficult to apply to salmonids. First, feed enzymes are proteins most commonly of microbial origin, and are inactivated by high-pressure moist extrusion. Second, the salmonid gut is short and gastrointestinal transit rapid at high feed intake (Storebakken et al., 1999), giving limited time for added enzymes to work. Finally, salmonids are cold-blooded and cold-water fishes eat and grow at body temperatures far below the temperature optima of commercial feed enzymes. In line with this, addition of phytase post-extrusion to diets high in plant protein has shown little effect in Atlantic salmon and rainbow trout (Vielma et al., 2000; Denstadli et al., 2007). Pre-treatment of plant meals with phytase is, on the other hand, highly efficient in hydrolysing phytic acid to liberate essential divalent ions like zinc while rendering phytic acid-bound phosphorus available to salmonids (Storebakken et al., 1998; Vielma et al., 2002; Denstadli et al., 2006b, 2007). Thus, until extrudable enzyme products that work efficiently at low temperatures are developed, this appears the only feasible way to apply feed enzymes to salmonids.

17.6.4 Immunostimulants and pre-biotica Purified bakers’ yeast mixed link β-1.3/1.6-glucans and/or nucleotides are routinely used as dietary immunostimmulants when growing salmonids in seawater. Such diets are fed precautionary prior to stressful events such as handling, vaccination, saltwater transfer, anti-parasite treatments, and drastic environmental changes. Live yeasts are present and appear commensal in fish guts, possibly benefiting the immune and the digestive systems of the host (Gatesoupe, 2007). In line with this, dietary yeast β-glucans are shown to enhance nonspecific disease resistance (Robertsen et al., 1990; Robertsen, 1999; Sakai, 1999; Burrells et al., 2001a) and resistance to salmon lice (Ritchie, 2000) in Atlantic salmon. Dietary fortification of salmon diets with nucleotides give similar immunostimmulatory responses (Burrells et al., 2001a), and is furthermore reported to enhance growth and osmoregulatory capacity of Atlantic salmon following saltwater transfer, and to increase the mucosal surface area of the salmon gut (Burrells et al., 2001b). Mannan oligosaccharides (MOS) is another yeast cell wall derived feed additive. MOS are known to improve digestion and gut health in animals by binding to and blocking glycoprotein receptors on pathogens and/or function as a prebiotica, favouring growth of beneficial bacteria in the gut (Newman, 2001; Fernandez et al., 2002; Swanson et al., 2002). In line with this, dietary supplementation of purified MOS derived

514


from bakers’ yeast cell walls are shown to improve immune status, gut development, and growth in rainbow trout (Staykov et al., 2007; Yilmaz et al., 2007), and to increase feed efficiency and reduce oxidative radical production and serum lysozyme activity in Atlantic salmon (Grisdale-Helland et al., 2008).

17.7 Species differences Carbohydrate utilisation Rainbow trout has significantly higher capacity for starch digestion than Atlantic salmon (Krogdahl et al., 2004). This appears to result from lower α-amylase synthesis and secretion and/or lower substrate affinity by this enzyme in Atlantic salmon (Frøystad et al., 2006). In consequence, the digestibility of even gelatinised starch is reduced in Atlantic salmon when the dietary level exceeds ∼10 %, and undigested starch appears to disturb the digestion of other nutrients (Hemre et al., 1995a; Krogdahl et al., 1999, 2004). A ‘side effect’ of this is that Atlantic salmon is more protected from metabolic disturbances following excessive glucose absorption than rainbow trout at moderate (10–25 %) inclusion of starch in the diet (Hemre et al., 1995b; Krogdahl et al., 2004). Oil belching and bloat Pacific salmonids of the Oncorhynchus genus (rainbow trout, Coho, and Chinook salmon) are susceptible to oil belching and bloat (Staurnes et al., 1990; Rørvik et al., 2000; Anderson, 2006; Forgan and Forster, 2007). Bloat is triggered by osmoregulatory failure, which may explain why this syndrome only rarely occurs in Atlantic salmon. Rainbow trout reared in fullstrength seawater have higher drinking rate than Atlantic salmon (Potts et al., 1970), and also grow faster in fresh and brackish water than in seawater, while the opposite is seen in Atlantic salmon (McKay and Gjerde, 1985; Austreng et al., 1987). Thus, rainbow trout and possibly other pacific salmonids spend more energy on hydromineral regulation, and are more susceptible to osmoregulatory stress. Bloat often coincides with accumulation of feed oil in the stomach. Slowed gastric evacuation in response to nutrient-dense diets is supposedly a major trigger of the condition (Anderson, 2006; Forgan and Forster, 2007). However, as stated in Section 17.3.3, gastric oil accumulation is rather caused by oil release from feed particles with poor water stability (Baeverfjord et al., 2006a; Terjesen et al., 2008). Oil belching then appears to result when these fish are stressed. Thus, an alternative and plausible explanation is that bloat is triggered by osmoregulatory stressors like abrupt temperature and salinity changes (Rørvik et al., 2000), while gastric oil accumulation and belching occurs concomitantly if the fish is fed diets releasing oil while disintegrating.


515

Carotenoid utilisation Rainbow trout utilise dietary carotenoids more efficiently for muscle pigmentation than Atlantic salmon, taking colour faster and reaching higher muscle concentrations (Storebakken et al., 1986; March et al., 1990; March and MacMillan, 1996; Page and Davies, 2006). The mechanisms responsible for these differences are still unknown, but high correlation between plasma concentration and muscle deposition of astaxanthin (Ytrestøyl and Bjerkeng, 2007a, b) indicates differences in metabolic turnover of carotenoids by the intestine and/or liver.

17.8 Practical formulations 17.8.1 Choice of feedstuffs Proteins High-quality fish meals (Pike and Hardy, 1997) are still the protein raw materials of choice for salmonids when available at competitive prices. It has also proved difficult to successfully formulate fish-meal free salmonid feeds (Gomes et al., 1995; Espe et al., 2006), potentially due to insufficient knowledge about recognised nutrient requirements, ‘unknown’ essential nutrients in fish meals, and/or unwanted components in the alternative feedstuffs. Although there is, as described in Section 17.2.2, a drive towards fish meal replacement and use of multiple protein feedstuffs for salmonids, fish meals still constitute more than 15 % of salmonid commercial diets. From a nutritional point of view, animal by-products are obvious candidates for replacing fish meals in fish diets. However, EU and the European Economic Area have strong legislative restrictions on products of animal origin (Commission regulation (EC) No 1234/2003). Only hydrolysed nonruminant animal proteins with peptide sizes ≤10 kDa and non-ruminant blood products may be used in European fish feeds. In consequence, the European salmonid industries focus on dietary replacement of fish meals by plant protein sources. High use of plant protein is a challenging strategy, as plant protein sources are deficient in essential amino acids and, as described in Section 17.5.1, often contain ANFs (Storebakken et al., 2000a; Francis et al., 2001; Bakke-McKellep and Refstie, 2008). In Europe it is furthermore made difficult by legislative restrictions on use of DNA-containing feedstuffs originating from genetically modified (GM) crops, although GM plant feedstuffs may be authorised for use in feeds (EC No 1829/2003/EF). Thorough investigations have not been able to demonstrate negative responses (Sanden et al., 2004, 2005, 2006; Hemre et al., 2005, 2007; Bakke-McKellep et al., 2007a, 2008; Sagstad et al., 2007; FrøystadSaugen et al., 2008, 2009) or persistence of modified DNA (Sanden et al., 2004; Nielsen et al., 2005, 2006) in Atlantic salmon fed GM corn and soy. Despite this, European salmonid aquaculture is still reluctant to use GM feedstuffs out of fear of negative publicity and reduced consumer acceptance.

516


Outside Europe, and particularly in Chile, GM plant meals are commonly used, and animal by-products such as blood meals and poultry byproducts are increasingly taken into the feeds. Animal by-products often have well-balanced amino acid profiles for fish, and contain few if any ANFs. Thus, carefully processed animal by-products have high nutritional value for salmonids (Fowler, 1990; Pfeffer et al., 1994; Steffens, 1994; Bureau et al., 1999, 2000; Hertrampf and Piedad-Pascual, 2000). However, although animal by-products are available in relatively large quantities at competitive prices, these protein sources are little standardised and often of highly variable nutritional quality. Oils At competitive prices, fish oils are the lipid sources of choice for salmonids. The fatty acid composition varies considerably among fish oils of different origin (Frankel, 1993; Hertrampf and Piedad-Pascual, 2000). North Atlantic fish oil typically contains 15–20 % EPA + DHA, while South American fish oils may contain 30–40 % of these fatty acids. South American fish oils are, thus, the fish oils of choice to cover the EPA + DHA requirements in salmonids at high dietary inclusion of plant oils. Plant oils are devoid of ‘marine’ long-chained polyunsaturated n-3 fatty acids, which are essential in salmonids and considered healthy for humans (Storebakken et al., 2000a; Opsahl-Ferstad et al., 2003). The fatty acid profile in triglycerides of salmonid adipose tissues furthermore reflect that of the feed oil, giving a ‘vegetable’ profile of the fat in salmonids fed plant oils (Caballero et al., 2002; Grisdale-Helland et al., 2002b; Bell et al., 2001, 2003, 2005; Torstensen et al., 2004a, b; Berntssen et al., 2005). Rapeseed oil is the preferred plant oil, as it contains little saturated fatty acids, like fish oil it is rich in oleic acid (C18:1n-9), but contains little linoleic acid (C18:2n-6), which leaves a ‘vegetable’ fatty acid ‘print’ when accumulating in the fish. Palm oil is rich in palmetic acid (C16:0), which may be beneficial for lipid transport across the intestine (Olsen et al., 2000), but contains too much saturated fatty acids and, thus, has too low a melting point for practical use in winter diets. Soy oil contains little saturated fatty acids, but contains up to 60 % of linoleic acid. A ‘marine’ fatty acid profile of fish fed plant oils may largely be restored by choosing plant oils with low levels of linoleic acid and using high levels of EPA + DHA during the last part of the growth period (fish oil ‘wash out’; Bell et al., 2003, 2005; Torstensen et al., 2004b; Berntssen et al., 2005).

17.8.2 Lifespan diets Seasonal diets As described in Section 17.4.2, growing salmonids grow increasingly fatter while their body protein concentration remains constant (Shearer, 1984; Shearer et al., 1994). In climate zones with large seasonal variations in day


517

length and temperature, sea-farmed salmonids also show large cyclic variations in fattening, switching their metabolism to fat accumulation in the autumn to utilise this stored energy during the winter (Mørkøre and Rørvik, 2001; Roth et al., 2005). In response to this, commercial lifespan feed programs for sea-farmed salmonids are generally formulated with gradual increasing lipid and decreasing protein levels. Winter diets are furthermore formulated with more lipid and less protein than summer diets, but the time for recommended use of summer or winter diets varies at different latitudes. Within these restrictions typical commercial summer diets for sea-farmed rainbow trout and Atlantic salmon contain 32–40 % protein and 34–40 % lipid, while typical winter diets contain 30–37 % protein and 35–41 % lipid, depending on fish size and raw material use. Pigment strategies In sea-farmed Atlantic salmon the target carotenoid concentration is 6–7 mg per kg muscle, but may be higher in rainbow trout. To achieve this it is common practice to fortify seawater diets with 20–75 mg carotenoids per kg. Commercial feed companies have different models for flesh pigmenting and, thus, strategies for dietary carotenoid fortification, but in general smaller fish are given higher doses than larger fish. An example of such a mathematical programming model is given by Forsberg and Guttormsen (2006a). It predicts dietary astaxanthin concentrations giving adequately pigmented Atlantic salmon at minimum cost (Forsberg and Guttormsen, 2006b) as a function of fish size. Model simulations show that fish growing from seawater transfer to 2 kg should be fed 20–40 mg more pigment per kg diet than fish growing from 4–6 kg. Optimal strategy for dietary astaxanthin fortification depends on target muscle concentration, desired harvest size, and how fast the targeted muscle concentration should be reached. The model assumes that fish weight and dietary astaxanthin concentration are the only variables determining muscle pigmentation. In the light of Section 17.6.2, and knowing that physiological status and genetic disposition also affect the efficiency of carotenoid deposition (Torrissen et al., 1989; Storebakken and No, 1992), this assumption is obviously wrong. Still, such models have proved efficient tools for designing economically viable pigment strategies.

17.9 Feeding and feeding systems Salmonids are generally fed according to appetite, but meal frequencies in commercial operations vary with the feeding technology used. Stomach evacuation rate and, thus, optimal meal frequency varies with fish size and temperature (Handeland et al., 2008). In smaller operations and in landbased systems the fish may be fed continuously by automatic feeding

518


systems. In larger sea pens the fish are often fed meals distributed by feeding canons, and the meal frequency will vary from one meal per day for large fish at low temperature to four times a day in small fish at high temperature. Feeding systems used in sea pens deliver feeds by mechanic and/or pneumatic action. Thus, they have in common the need for high physical durability of the feed particles to allow efficient mechanic feed distribution. Appetite feeding in sea pens is challenging due to deep pens, large biomasses and thus it is difficult to monitor feed intake (Alver et al., 2004). This can be controlled by video or hydroacoustic devices detecting uneaten pellets sinking through the bottom of the pens, signalling to stop feeding (Juell et al., 1993; Ervika et al., 1994; Parsonage and Petrell, 2003). Alternatively, attempts can be made to collect and recycle uneaten feed during the feeding periods (Ervika et al., 1994). When integrated with automatic feeding systems, these monitoring systems automatically regulate feeding according to apparent appetite.

17.10 Future trends 17.10.1 Raw materials Protein sources The salmonid feed industry has a declared goal to reduce their dependency on fish meals. The ultimate goal is to treat fish meal as any other protein feedstuff in least cost formulation. Thus, new feedstuffs will continuously be evaluated and adapted for use in fish feeds. With regard to increased use of vegetable protein, this will require updated requirement values for essential amino acids, as well as a better understanding about conditional requirements of amino acids and other components not found in plants (Aksnes et al., 2006a, b, 2008; Gaylord et al., 2006, 2007). Understanding soy intolerance (Baeverfjord and Krogdahl, 1996) is a holy grail in salmonid nutrition. Considering the progress made in this field, it is expected that the causative components will be identified and proper means developed to reduce or totally avoid soybean meal-induced enteritis. This will allow higher use of standard soybean meals for salmonids. As soybean meal is the major protein commodity for animal feeds, it will increase the competitiveness of salmonid aquaculture. The biofuel industry offer new possibilities for developing feedstuffs from extraction or fermentation residues. One promising candidate is soybean meal resulting from in situ transesterification to produce biodiesel directly from soybeans (Barrows et al., 2008b). Residues from fermentation of corn or wheat to produce bioethanol are nutrientwise interesting, but high contamination with mycotoxins in crops going into these processes is currently challenging.


519

Increased harvesting of marine macrozooplankton like Antarctic krill (Euphausia superba) is offering new sources of marine protein. Marine crustacean macrozooplankton contain very high levels of fluoride (F; 1000– 6000 mg per kg). This is problematic for salmonids in freshwater, which absorb and deposit F in bones and scales (Yoshitomi et al., 2006). Dietary F is, however, not taken up by salmonids in seawater to any significant degree (Julshamn et al., 2004; Moren et al., 2007). The protective effect of water salinity indicates that ingested F like Cl is pumped out of the fish body across the gills by chloride cells. Thus, meals made from crustacean macrozooplanktoon have proved feasible feedstuffs for sea-farmed salmonids (Julshamn et al., 2004; Olsen et al., 2006; Suontama et al., 2007a, b). However, although the EU has accepted an upper level of 3000 g P per kg in krill, the upper level for complete diets is still 150 mg per kg (EU directive, 2005/87/EC). This is currently restricting the use of krill as a major protein source in European fish feeds. There is also a great potential for processing animal slaughter waste into by-products feasible for fish. This is a highly sustainable strategy, as it will allow recirculation of problematic wastes by converting them into healthy and high-quality seafood. However, due to the EU’s strong legislative restrictions on using products of animal origin as feedstuffs, this is currently difficult to achieve in Europe. Oils Fish and plant oils are already interchanged as energy substrates in salmonid feeds according to price fluctuations. As described in Section 17.8.1, a certain level of fish oil is still required in the diet to supply EPA and DHA. This may change when alternative sources of EPA and DHA become available. At the moment the most promising candidates are EPA- and DHA-rich plant oils originating from genetically modified (GM) oil seeds (Opsahl-Ferstad et al., 2003). Other sources may be GM yeast or bacteria. Harvesting of marine crustacean macrozooplankton also offers a new source of EPA- and DHA-rich marine oils. Although very rich in wax esters, such oils have proved feasible feed oils for Atlantic salmon (Olsen et al., 2004; Bogevik et al., 2008, 2009).

17.10.2 Feeds Functional feeds Functional feeds, i.e. feeds with added components stimulating specific physiological processes in the fish, are already used to some degree. Examples of such are feeds with immunostimulants used prior to stressful periods. As our understanding of fish physiology, immunology, and metabolism increases, new concepts will be developed. For example, increased awareness of the intestinal microflora in fish has spurred testing and development of prebiotica for salmonids (Refstie

520


et al., 2006a; Bakke-McKellep et al., 2007b; Staykov et al., 2007; Yilmaz et al., 2007; Grisdale-Helland et al., 2008). This development is expected to continue and accelerate. Increased knowledge about bioactive components in feedstuffs may furthermore lead to proactive use of raw materials and/or isolated components to stimulate beneficial physiological responses. Focus on lipid metabolism and obesity in salmonids has likewise led to testing of dietary components that increase fatty acid oxidation. Examples of such are high doses of EPA and DHA (Ruyter et al., 1999; Vegusdal et al., 2005), or metabolic modulators such as conjugated linoleic acid (CLA; Berge et al., 2004; Kennedy et al., 2006, 2007) and tetradecylthioacetic acid (TTA; Moya-Falcon et al., 2004; Gjøen et al., 2007; Kennedy et al., 2007; Rørvik et al., 2007). Too high doses of EPA and/or DHA do, however, induce oxidative stress and reduce mitochondrial function in Atlantic salmon (Kjær et al., 2008; Todorcˇevic´ et al., 2008), so this approach requires great caution. Metabolic modulators such as TTA must be subjected to thorough biological testing before being legalised and commercialised for feed purposes. Physical feed quality Hardness and wear resistance are carefully controlled by commercial farmers and are the ever more important quality criteria of extruded feeds used for salmonids in seawater. This is driven by gradual enlargement of the sea pens, as shear physical durability allows more efficient mechanic distribution of the feeds. However, it is becoming clear that durable and water-stable feeds slow stomach evacuation rate and depress feed intake and growth in rainbow trout (Hilton et al., 1981; Terjesen et al., 2008), and probably in salmonids in general. Feed pellets that ‘collapse’ in the stomach while releasing feed oil may furthermore cause oil belching if the fish is stressed (Baevefjord et al., 2006a; Terjesen et al., 2008). Thus, it is necessary to reassess physical quality criteria for salmonid feeds, and to optimise them with respect to feasible disintegration in the fish stomach. In the light of this, currently adopted nutritional values of feedstuffs replacing fish meal in salmonid diets may actually be wrong. Feedstuffs for salmonids are traditionally evaluated in fish meal replacement studies. However, factors like type of feedstuffs (Olsen et al., 2006; Refstie et al., 2006b), feedstuff components such as cellulose (Hansen and Storebakken, 2007), as well as different processing conditions along the feed manufacturing line (Sørensen et al., 2002, 2005; Aarseth et al., 2006) all significantly affect the physical quality of extruded feeds. Changing physical feed quality is seldom considered in replacement studies, although these variables may actually cause the main responses when comparing extruded feeds. Thus, it may prove necessary to re-evaluate the nutritional value of important feed ingredients for salmonids in experimental setups considering or standardising physical feed quality parameters.


521

17.10.3 Sustainability Sustainability in aquaculture is usually defined as low use of feedstuffs derived from limited and often threatened fisheries. As explained throughout this chapter, this is a major goal for several reasons in salmonid nutrition. Increased replacement of fish meals by other protein sources is part of the solution to achieve it. As shown in Fig. 17.3, the consumption of dietary fish protein will equal the production of farmed fish protein when reducing the dietary fish meal content to ∼25 %. At lower dietary fish meal inclusion salmonids will actually be net producers of fish protein. In this sustainability context, it is also problematic that valuable marine lipid resources are spent on producing visceral fat and visible muscular fat deposits which are lost as processing waste at slaughter and, thus, reduce

Spent marine protein 5,0

Produced marine protein

Tons

4,0 3,0 2,0 1,0 0,0 5 % FM (a)

10 % FM

20 % FM

35 % FM

Fish meal in the diet Spent wild-caught fish 5,0

Produced edible farmed salmon

Tons

4,0 3,0 2,0 1,0 0,0 5 % FM (b)

10 % FM 20 % FM Fish meal in the diet

35 % FM

Fig. 17.3 Consumption of wild-caught fish (processed into fish meal – FM) and production of farmed Atlantic salmon when using different levels of fish meal in the diet, calculated as ton protein (a) or ton edible fish (b). The results are based on unpublished experimental data. When calculating edible proportions of the fish, filet yields of 30 % and 60 % were assumed for wild-caught fish and Atlantic salmon, respectively.

522


harvest yields. Thus, preventing excessive lipid deposition in salmonids will have to be an important focus in future research. Part of the solution will be to regulate fattening of salmonids by dietary means. It is also becoming apparent that, like pigs, salmonids should be selectively bred for efficient but lean growth. When achieved, this will significantly spare lipid in salmonid aquaculture.

17.11 References aarseth k a, sørensen m and storebakken t (2006) ‘Effects of red yeast inclusions in diets for salmonids and extrusion temperature on pellet tensile strength: Weibull analysis, Anim Feed Sci Technol, 126, 75–91. ahmadi m r, bazyar a a, safi s, ytrestøyl t and bjerkeng b (2006) Effects of dietary astaxanthin supplementation on reproductive characteristics of rainbow trout (Oncorhynchus mykiss), J Appl Ichtyol, 22, 388–94. aksnes a, hope b, jonsson e, björnsson b t and albrektsen s (2006a) Sizefractionated fish hydrolysate as feed ingredient for rainbow trout (Oncorhynchus mykiss) fed high plant protein diets. I: Growth, growth regulation and feed utilization, Aquaculture, 261, 305–17. aksnes a, hope b and albrektsen s (2006b) Size-fractionated fish hydrolysate as feed ingredient for rainbow trout (Oncorhynchus mykiss) fed high plant protein diets. II: Flesh quality, absorption, retention and fillet levels of taurine and anserine, Aquaculture, 261, 318–26. aksnes a, mundheirn h, toppe j and albrektsen s (2008) The effect of dietary hydroxyproline supplementation on salmon (Salmo salar L.) fed high plant protein diets, Aquaculture, 275, 242–9. al-khalifa a r and simpson k l (1988) Metabolism of astaxanthin in the rainbow trout (Salmo gairdneri), Comp Biochem Physiol, 91B, 563–8. alver m o, alfredsen j o and sigholt t (2004) Dynamic modelling of pellet distribution in Atlantic salmon (Salmo salar L.) cages, Aquac Eng, 31, 51–72. amar e c, kiron v, satoh s and watanabe t (2004) Enhancement of innate immunity in rainbow trout (Oncorhynchys mykiss Walbaum) associated with dietary intake of carotenoids from natural products, Fish Shellfish Immunol, 16, 527–37. anderson c d (2006) A review of causal factors and controlling measures for bloat in farmed salmonids with a suggested mechanism for the development of the condition, J Fish Dis, 29, 445–53. anderson j s and sunderland r (2002) Effect of extruder moisture and dryer processing temperature on vitamin C and E and astaxanthin stability, Aquaculture, 207, 137–49. anderson r l and wolf w r (1995) Compositional changes in trypsin inhibitors, phytic acid, saponins and isoflavones related to soybean processing, J Nutr, 125, 581S–588S. anderson j s, lall s p, anderson d m and mcniven m (1993) Quantitative dietary lysine requirement of Atlantic salmon (Salmo salar) fingerlings, Can J Fish Aquat Sci, 50, 316–22. åsgård t and austreng t (1985a) Casein silage as feed for salmonids, Aquaculture, 48, 233–52. åsgård t and austreng t (1985b) Dogfish offal, ensiled or frozen, as feed for salmonids, Aquaculture, 49, 289–305. åsgård t and austreng t (1986) Blood, ensiled or frozen, as feed for salmonids, Aquaculture, 55, 263–84.


523

åsgård t and austreng t (1987) Squid as feed for salmonids, Aquaculture, 61, 259–73. aslaksen m a, kraugerud o f, penn m, svihus b, denstadli v, jørgensen h y, hillestad m, krogdahl å and storebakken t (2007) Screening of nutrient digestibilities and intestinal pathologies in Atlantic salmon, Salmo salar, fed diets with legumes, oilseeds, or cereals, Aquaculture, 272, 541–55. austin b and mcintosh d (1991) New bacterial fish pathogens and their implications for fish farming, Rev Med Microbiol, 2, 230–36. austreng e, storebakken t and åsgård t (1987) Growth rate estimates for cultured Atlantic salmon and rainbow trout, Aquaculture, 60, 157–60. austreng e, grisdale-helland b, helland s j and storebakken t (1988) Farmed Atlantic salmon and rainbow trout, Livest Prod Sci, 19, 369–74. baeverfjord g and krogdhal å (1996) Salmo salar distal intestine: a comparison with the intestine of fasted fish, J Fish Dis, 19, 375–87. baeverfjord g, åsgård t and shearer k d (1998) Development and regression of phosphorus deficiency in Atlantic salmon, Salmo salar L., parr and post-smolts, Aquac Nutr, 4, 1–11. baeverfjord g, refstie s, krogedal p and åsgård t (2006a) Low feed pellet water stability and fluctuating water salinity cause separation and accumulation of dietary oil in the stomach of rainbow trout (Oncorhynchus mykiss), Aquaculture, 261, 1335–45. baeverfjord g, helland s, refstie s, hjelde k and shearer k d (2006b) Skeletal deformities in response to restricted dietary mineral supply in Atlantic salmon (Salmo salar L.), Proc XII ISFNF, May 28–June 1, Biarritz. bakke-mckellep a m and refstie s (2008) Alternative protein sources and digestive function alterations in teleost fishes, in Cyrino J E P, Roubach R, Bureau D and Kapoor B G (eds), Feeding and Digestive Functions of Fishes, Science Publishers Inc., Plymouth, 440–72. bakke-mckellep a m, press c mcl, baeverfjord g, krogdahl å and landsverk t (2000a) Changes in immune and enzyme histochemical phenotypes of cells in the intestinal mucosa of Atlantic salmon, Salmo salar L., with soybean meal induced enteritis, J Fish Dis, 23, 115–27. bakke-mckellep a m, nordrum s, krogdahl å and buddington r k (2000b) Absorption of glucose, amino acids, and dipeptides by the intestine of Atlantic salmon (Salmo salar L.), Fish Physiol Biochem, 22, 33–44. bakke-mckellep a m, koppang e o, gunnes g, sanden m, hemre g-i, landsverk t and krogdahl å (2007a) Histological, digestive, metabolic, hormonal and some immune factor responses in Atlantic salmon, Salmo salar L., fed genetically modified soybeans, J Fish Dis, 30, 65–79. bakke-mckellep a m, penn m h, salas p m, refstie s, sperstad s, landsverk t, ringø e and krogdahl å (2007b) Effects of dietary soybean meal, inulin and oxytetracycline on intestinal microbiota and epithelial cell stress, apoptosis and proliferation in the teleost Atlantic salmon (Salmo salar L.), Brit J Nutr, 97, 669–713. bakke-mckellep a m, frøystad m, lilleeng e, dapra f, refstie s, krogdahl å and landsverk t (2007c) Response to soy: T-cell-like reactivity in the intestine of Atlantic salmon, Salmo salar L., J Fish Dis, 30, 13–25. bakke-mckellep a m, sanden m, danieli a, acierno r, hemre g-i, maffia m and krogdahl å (2008) Atlantic salmon (Salmo salar L.) parr fed genetically modified soybeans and maize: Histological, digestive, metabolic, and immunological investigations, Res Vet Sci, 84, 395–408. barrows f t, gaylord d, sealey w m, porter l and smith d e (2008a) The effect of vitamin premix in extruded plant-based and fish meal based diets on growth

524


efficiency and health of rainbow trout, Oncorhynchus mykiss, Aquaculture, 283, 148–55. barrows f t, gaylord d, sealey w m, haas m j and stroup r l (2008b) Processing soybean meal for biodiesel production; effect of a new processing method on growth performance of rainbow trout, Oncorhynchus mykiss, Aquaculture, 283, 141–7. baslow m h (1998) Function of the N-acetyl-L-histidine system in the vertebrate eye. Evidence in support of a role as a molecular water pump, J Mol Neurosci, 10, 193–208. bauer d h, lee d j and sinnhuber r o (1969) Acute toxicity of aflatoxins B1 and G1 in the rainbow trout (Salmo gairdneri), Toxicol Appl Pharmacol, 15, 415–19. bell j g and sargent j r (2003) Arachidonic acid in aquaculture feeds: current status and future opportunities, Aquaculture, 218, 491–9. bell j g, mcevoy j, tocher d r, mcghee f, campbell p j and sargent j r (2001) Replacement of fish oil with rapeseed oil in diets of Atlantic salmon (Salmo salar) affects tissue lipoprotein composition and hepatocyte faty acid metabolism, J Nutr, 131, 1535–43. bell j g, mcghee f, campbell p j and sargent j r (2003) Rapeseed oil as an alternative to marine fish oil in diets of post-smolt Atlantic salmon (Salmo salar): changes in flesh fatty acid composition and effectiveness of subsequent fish oil ‘wash out’, Aquaculture, 218, 515–28. bell j g, mcghee f, dick j r and tocher d r (2005) Dioxin and dioxin-like polychlorinated biphenyls (PCBs) in Scottish farmed salmon (Salmo salar): effects of replacement of dietary marine fish oil with vegetable oils, Aquaculture, 243, 305–14. bennetau-pelissero c, breton b, bennetau b, corraze g, le menn f, vail-cuisset b, helou c and kaushik s j (2001) Effect of genistein-enriched diets on the endocrine process of gametogenesis and on reproduction efficiency of the rainbow trout Oncorhynchus mykiss, Gen Comp Endocrinol, 121, 173–87. berge g e, lied e and sveier h (1997) Nutrition of Atlantic salmon (Salmo salar): The requirement and metabolism of arginine, Comp Biochem Physiol, 117A, 501–9. berge g e, sveier h and lied e (1998) Nutrition of Atlantic salmon (Salmo salar): The requirement and metabolic effect of lysine, Comp Biochem Physiol, 120A, 477–85. berge g m, ruyter b and åsgard t (2004) Conjugated linoleic acid in diets for juvenile Atlantic salmon (Salmo salar); effects on fish performance, proximate composition, fatty acid and mineral content, Aquaculture, 237, 365–80. berntssen m h g, lundebye a-k and torstensen b e (2005) Reducing the levels of dioxin and dioxin-like PCBs in farmed Atlantic salmon by substitution of fish oil with vegetable oil in the feed, Aquac Nutr, 11, 219–31. binder e m, tan l m, chin l j, handl j and richard j (2007) Worldwide occurrence of mycotoxins in commodities, feeds and feed ingredients, Anim Feed Sci Technol, 137, 265–82. bjerkås e and sveier h (2004) The influence of nutritional and environmental factors on osmoregulation and cataracts in Atlantic salmon (Salmo salar L.), Aquaculture, 235, 101–22. bjerkeng b and berge g m (2000) Apparent digestibility coefficients and accumulation of astaxanthin E/Z isomers in Atlantic salmon (Salmo salar L.) and Atlantic halibut (Hippoglossus hippoglossus L.), Comp Biochem Physiol, 127B, 423–32. bjerkeng b, storebakken t and liaaen-jensen s (1990) Response to carotenoids by rainbow trout in the sea: resorption and metabolism of dietary astaxanthin and canthaxanthin, Aquaculture, 91, 153–62.


525

bjerkeng b, storebakken t and liaaen-jensen s (1992) Pigmentation of rainbow trout from start feeding to sexual maturation, Aquaculture, 108, 333–46. bjerkeng b, følling m, lagocki s, storebakken t, olli j j and alsted a (1997) Bioavailability of all-E-astaxanthin and Z-isomers in rainbow trout (Oncorhynchus mykiss), Aquaculture, 157, 63–82. bjerkeng b, hatlen b and wathne e (1999) Deposition of astaxanthin in fillets of Atlantic salmon (Salmo salar) fed diets with herring, capelin, sandeel, or Peruvian high PUFA oils, Aquaculture, 180, 307–19. bjerkeng b, hatlen b and wathne e (2000) Corrigendum to ‘Deposition of astaxanthin in fillets of Atlantic salmon (Salmo salar) fed diets with herring, capelin, sandeel, or Peruvian high PUFA oils’, Aquaculture, 180, 307–19. Aquaculture, 189, 389–90. bjerkeng b, peisker m, von schwartzenberg k, ytrestøyl t and åsgård t (2007) Digestibility and muscle retention of astaxanthin in Atlantic salmon, Salmo salar, fed diets with the red yeast Phaffia rhodozyma in comparison with synthetic formulated astaxanthin, Aquaculture, 269, 476–89. bodin n, mambrini m, wauters j-b, abboudi t, ooghe w, le boulenge e, larondelle y and rollin x (2008) Threonine requirements for rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar) at the fry stage are similar, Aquaculture, 274, 353–65. bogevik a s, olsen r e and tocher d r (2008) Utilization and metabolism of palmityl and oleoyl fatty acids and alcohols in caecal enterocytes of Atlantic salmon (Salmo salar L.), Aquac Nutr, 14, 270–80. bogevik a s, tocher d r, langmyhr e, waagbø r and olsen r e (2009) Atlantic salmon (Salmo salar) postsmolts adapt lipid digestion according to elevated dietary wax esters from Calanus Finmarchicus, Aquac Nutr, 15, 94–103. breck o, bjerkas e, campbell p, arnesen p, haldorsen p and waagbø r (2003) Cataract preventative role of mammalian blood meal, histidine, iron and zinc in diets for Atlantic salmon (Salmo salar L.) of different strains, Aquac Nutr, 9, 341–50. breck o, bjerkas e, campbell p, rhodes j d, sanderson j and waagbø r (2005a) Histidine nutrition and genotype affect cataract development in Atlantic salmon, Salmo salar L., J Fish Dis, 28, 357–71. breck o, bjerkas e, sanderson j, waagbø r and campbell p (2005b) Dietary histidine affects lens protein turnover and synthesis of N-acetylhistidine in Atlantic salmon (Salmo salar L.) undergoing parr-smolt transformation, Aquac Nutr, 11, 321–32. buddington r k, krogdahl å and bakke-mckellep a m (1997) The intestines of carnivorous fish: structure and functions and the relation with diet, Acta Physiol Scand, 161, Suppl 638, 67–80. bureau d p, harris a m and cho c y (1999) Apparent digestibility of rendered animal protein ingredients for rainbow trout (Oncorhynchus mykiss), Aquaculture, 180, 345–58. bureau d p, harris a m, bevan d j, simmons l a, azevedo p a and cho c y (2000) Feather meals and meat and bone meals from different origins as protein sources in rainbow trout (Oncorhynchus mykiss) diets, Aquaculture, 181, 281–91. burel c, boujard t, escaffre a m, kaushik s j, boeuf g, mol k a, van der geyten s and kuhn e r (2000) Dietary low glucosinolate rapeseed meal affect thyroid status and nutrient utilization in rainbow trout (Oncorhynchus mykiss), Brit J Nutr, 83, 653–64. burel c, boujard t, kaushik s j, boeuf g, mol k a, van der geyten s, darras v m, kuhn e r, pradet-balade b, querat b, quinsac a, krouti m and ribaillier d (2001) Effects of rapeseed meal-glucosinolates on thyroid metabolism and feed utilization in rainbow trout, Gen Comp Endocrinol, 124, 343–58.

526


burrells c, williams p, southgate p and crampton v (1999) Immunological, physiological and pathological responses of rainbow trout Onchorhynchus mykiss to increasing dietary concentrations of soybean proteins, Vet Immunol Immunopath, 72, 277–88. burrells c, williams p d and forno p f (2001a) Dietary nucleotides: a novel supplement in fish feeds 1. Effects on resistance to disease in salmonids, Aquaculture, 199, 159–69. burrells c, williams p d, southgate p j and wadsworth s l (2001b) Dietary nucleotides: a novel supplement in fish feeds 2. Effects of vaccination, salt water transfer, growth rates and physiology of Atlantic salmon (Salmo salar L.), Aquaculture, 199, 171–84. caballero m j, obach a, rosenlund g, montero d, gisvold m and izquierdo m s (2002) Impact of different lipid sources on growth, lipid digestibility, tissue fatty acid composition and histology of rainbow trout, Oncorhynchus mykiss, Aquaculture, 214, 253–71. cahill m m (1990) Bacterial flora of fishes: a review, Microb Ecol, 19, 21–41. camire m e, camire a and krumhar k (1990) Chemical and nutritional changes in foods during extrusion, Crit Rev Food Sci Nutr, 29, 35–57. carlson d b, williams d e, spitsbergen j m, ross p f, bacon, c w, meredith f i and riley r t (2001) Fumonisin B1 promotes aflatoxin B1 and n-methyl-n′-nitronitrosoguanidine-initiated liver tumors in rainbow trout, Toxicol Appl Pharmacol, 172, 29–36. catacutan m r and pagador g e (2004) Partial replacement of fishmeal by defatted soybean meal in formulated diets for the mangrove red snapper, Lutjanus argentimaculatus (Forsskal 1775), Aquac Res, 35, 299–306. choubert g and blanc j-m (1985) Flesh colour of diploid and triploid rainbow trout (Salmo gairdneri Rich.) fed canthaxanthin, Aquaculture, 47, 299–304. choubert g and storebakken t (1989) Dose response to astaxanthin and canthaxanthin pigmentation of rainbow trout fed various dietary carotenoid concentrations, Aquaculture, 81, 69–77. choubert g, de la noüe j and blanc j-m (1991) Apparent digestibility of canthaxanthin in rainbow trout: effect of dietary fat level, antibiotics and number of pyloric caeca, Aquaculture, 99, 323–9. christiansen r and torrissen o j (1996) Growth and survival of Atlantic salmon, Salmo salar L., fed different dietary levels of astaxanthin. Juveniles, Aquac Nutr, 2, 55–62. christiansen r, lie ø and torrissen o j (1994) Effect of astaxanthin and vitamin A on growth and survival during the first feeding of Atlantic salmon, Salmo salar L., Aquac Fish Man, 25, 903–14. christiansen r, lie ø and torrissen o j, (1995a) Growth and survival of Atlantic salmon, Salmo salar L., fed different dietary levels of astaxanthin. First feeding fry, Aquac Nutr, 1, 189–98. christiansen r, glette j, lie ø, torrissen o j and waagbø r (1995b) Antioxidant status and immunity in Atlantic salmon, Salmo salar L., fed semi-purified diets with and without astaxanthin supplementation, J Fish Dis, 18, 317–28. connor s l and connor w e (1997) Are fish oils beneficial in the prevention and treatment of coronary artery disease?, Am J Clin Nutr, 66, S1020–S1031. cummings j h and macfarlane g t (1997) The role of intestinal bacteria in nutrient metabolism, J Parenter Enteral Nutr, 21, 357–65. curtis l r, zhang q, el-zahr c, carpenter h m, miranda c l, buhler d r, selivonchick d p, arbogast d n and hendricks j d (1995) Temperature-modulated incidence of aflatoxin B1-initiated liver cancer in rainbow trout, Fundam Appl Toxicol, 25, 146–53.


527

dabrowski k and guderley h (2002) Intermediary metabolism, in Halver J E and Hardy R W (eds), Fish Nutrition, Academic Press, San Diego, CA, 310–65. dänicke s, jeroch h, böttcher w and simon o (2000) Interactions between dietary fat type an enzyme supplementation in broiler diets with high pentosan contents: effects on precaecal and total tract digestibility of fatty acids, metabolizability of gross energy, digesta viscosity and weights of small intesinte, Anim Feed Sci Technol, 84, 279–94. denstadli v, vegusdal a, krogdahl å, bakke-mckellep a m, berge g m, holm h, hillestad m and ruyter b (2004) Lipid absorption in different segments of the gastrointestinal tract of Atlantic salmon (Salmo salar L.), Aquaculture, 240, 385–98. denstadli v, skrede a, krogdahl å, sahlstrøm s and storebakken t (2006a) Feed intake, growth, feed conversion, digestibility, enzyme activities and intestinal structure in Atlantic salmon (Salmo salar L.) fed graded levels of phytic acid, Aquaculture, 256, 365–76. denstadli v, vestre r, svihus b, skrede a and storebakken t (2006b) Phytate degradation in a mixture of ground wheat and defatted soybeans during feed processing: effects of temperature, moisture level, and retention time in small- and medium-scale incubation systems, J Agric Food Chem, 54, 5887–93. denstadli v, storebakken t, svihus b and skrede a (2007) A comparison of online phytase pre-treatment of vegetable feed ingredients and phytase coating in diets for Atlantic salmon (Salmo salar L.) reared in cold water, Aquaculture, 269, 414–26. dixon d g and hilton j w (1985) Effects of available carbohydrate and water temperature on the chronic toxicity of waterborne copper to rainbow trout (Salmo gairnderi), Can J Fish Aquat Sci, 42, 1007–13. d’mello j p f and macdonald a m c (1997) Mycotoxins, Anim Feed Sci Technol, 69, 155–66. d’souza n, skonberg d i, camire m e, guthrie k e, malison j and lima l (2005) Influence of dietary genistein levels on tissue genistein deposition and on the physical, chemical, and sensory quality of rainbow trout, Oncorhynchus mykiss, J Agric Food Chem, 53, 3631–6. eckel r h, grundy s m and zimmet p z (2005) The metabolic syndrome, Lancet, 365, 1415–28. einen o and roem a j (1997) Dietary protein/energy ratios for Atlantic salmon in relation to fish size: growth, feed utilization and slaughter quality, Aquac Nutr, 3, 115–26. einen o and skrede g (1998) Quality characteristics in raw and smoked fillets of Atlantic salmon, Salmo salar, fed high-energy diets, Aquac Nutr, 4, 99–108. ervika a, samuelsen o b, juell j e and sveier h (1994) Reduced environmentalimpact of antibacterial agents applied in fish farms using the liftup feed collector system or a hydroacoustic feed detector, Dis Aquat Org, 19, 101–4. escaffre e-m, kaushik s and mambrini m (2007) Morphometric evaluation of changes in the digestive tract of rainbow trout (Oncorhynchus mykiss) due to fish meal replacement with soy protein concentrate, Aquaculture, 273, 127–38. espe m, lemme a, petri a and el-mowafi a (2006) Can Atlantic salmon (Salmo salar) grow on diets devoid of fish meal?, Aquaculture, 255, 255–62. evans j j, pasnik d j, peres h, lim c and klesius p h (2005) No apparent differences in intestinal histology of channel catfish (Ictalurus punctatus) fed heat-treated and non-heat-treated raw soybean meal, Aquac Nutr, 11, 123–9. fairgrieve w t, myers m s, hardy r w and dong f m (1994) Gastric abnormalities in rainbow trout (Oncorhynchus mykiss) fed amine-supplemented diets or chicken gizzard-erosion-positive fish meal, Aquaculture, 127, 219–32.

528


fao (2007) The State of World Fisheries and Aquaculture, 2006, Food and Agriculture Organization of the United Nations, Rome. fernandez f, hinton m and van gils b (2002) Dietary mannan-oligosaccharides and their effect on chicken caecal microflora in relation to Salmonella enteritidis colonization, Avian Path, 31, 49–58. førde-skjærvik o, refstie s, aslaksen m a and skrede a (2006) Digestibility of diets containing different soybean meals in Atlantic cod (Gadus morhua); comparison of collection methods and mapping of digestibility in different sections of the gastrointestinal tract, Aquaculture, 261, 241–58. forgan l g and forster m e (2007) Development and physiology of gastric dilation air sacculitis in Chinook salmon, Oncorhyncus tshawytscha (Wallbaum), J Fish Dis, 30, 459–69. forsberg o i and guttormsen a g (2006a) A pigmentation modell for farmed Atlantic salmon: Nonlinear regression analysis of published experimental data, Aquaculture, 253, 415–20. forsberg o i and guttormsen a g (2006b) Modelling optimal dietary pigmentation strategies in farmed Atlantic salmon: Application of mixed-integer non-linear mathematical programming techniques, Aquaculture, 261, 118–24. forster i, higgs d a, dosanjh b s, rowshandeli m and parr j (1999) Potential for dietary phytase to improve the nutritive value of canola protein concentrate and decrease phosphorus output in rainbow trout (Oncorhynchus mykiss) held in 11 °C fresh water, Aquaculture, 179, 109–25. foss p, storebakken t, schiedt k, liaaen-jensen s, austreng e and streiff k (1984) I. Pigmentation of rainbow trout with the individual optical isomers of astaxanthin in comparison with canthaxanthin, Aquaculture, 41, 213–26. francis g, makkar h p s and becker k (2001) Antinutritional factors in plant-derived alternate fish ingredients and their effects in fish, Aquaculture, 199, 197–227. frankel e n (1993) Formation of headspace volatiles by thermal-decomposition of oxidized fish oils vs oxidized vegetable-oils, JAOCS, 70, 767–72. fraser p d and bramley p m (2004) The biosynthesis and nutritional uses of carotenoids, Prog Lipid Res, 43, 228–65. frøystad m k, lilleeng e, sundby a and krogdahl å (2006) Cloning and characterization of α-amylase from Atlantic salmon (Salmo salar L.), Comp Biochem Physiol, 145A, 479–92. frøystad-saugen m k, lilleeng e, bakke-mckellep a m, vekterud k, hemre g-i and krogdahl å (2008) Gene expression in distal intestine of Atlantic salmon (Salmo salar L.) fed genetically modified soybean meal, Aquac Nutr, 14, 204–14. frøystad-saugen m k, lilleeng e, bakke-mckellep a m, vekterud k, valen e c, hemre g-i and krogdahl å (2009) Distal intestinal gene expression in Atlantic salmon (Salmo salar L.) fed genetically modified maize, Aquac Nutr, 15, 104–15. fowler l g (1990) Feather meal as a dietary protein source during parr-smolt transformation in fall chinook salmon, Aquaculture, 89, 301–14. gadient m and fenster r (1994) Stability of ascorbic acid and other vitamins in extruded fish feeds, Aquaculture, 124, 207–11. gatesoupe f j (2007) Live yeast in the gut: natural occurrence, dietary introduction, and their effects on fish health and development, Aquaculture, 267, 20–30. gaylord t g, teague a m and barrows f t (2006) Taurine supplementation of all-plant protein diets for rainbow trout (Oncorhynchus mykiss), J WAS, 37, 509–17. gaylord t g, barrows f t, teague a m, johansen k a, overturf k e and shepherd b (2007) Supplementation of taurine and methionine to all-plant protein diets for rainbow trout (Oncorhynchus mykiss), Aquaculture, 269, 514–24.


529

givens d i, deboever j l and deaville e r (1997) The principles, practices and some future applications of near infrared spectroscopy for predicting the nutritive value of foods for animals and humans, Nutr Res Rev, 10, 83–114. gjøen t, kleveland e j, moya-falcn c, frøystad mk, vegusdal a, hvatturn e, berge r k and ruyter b (2007) Effects of dietary thia fatty acids on lipid composition, morphology and macrophage function of Atlantic salmon (Salmo salar L.) kidney, Comp Physiol Biochem, 148B, 103–11. glencross b d, boujard t and kaushik s j (2003) Influence of oligosaccharides on the digestibility of lupin meals when fed to rainbow trout, Oncorhynchus mykiss, Aquaculture, 219, 703–13. gomes e f, rema p and kaushik s j (1995) Replacement of fish meal by plant proteins in the diet of rainbow trout (Oncorhynchus mykiss): digestibility and growth performance, Aquaculture, 130, 177–86. grisdale-helland b, helland s j, baeverfjord g and berge g m (2002a) Full-fat soybean meal in diets for Atlantic halibut: growth, metabolism and intestinal histology, Aquac Nutr, 8, 265–70. grisdale-helland b, ruyter b, rosenlund g, obach a, helland s j, sandberg m g, standal h and røsjø c (2002b) Influence of high contents of dietary soybean oil on growth, feed utilization, tissue fatty acid composition, heart histology and standard oxygen consumption of Atlantic salmon (Salmo salar) rised at two temperatures, Aquaculture, 207, 311–29. grisdale-helland b, helland s j and gatlin iii d m (2008) The effects of dietary supplementation with mannanoligosaccharide, fructooligosaccharide or galactooligosaccharide on the growth and feed utilization of Atlantic salmon (Salmo salar), Aquaculture, 283, 163–7. guillou a, choubert g, storebakken t, de la noüet j and kaushik s (1989) Bioconversion pathway of astaxanthin into retinol2 in mature rainbow trout (Salmo gairdneri Rich.), Comp Biochem Physiol, 94B, 481–5. haaland h, ladstein k, rosenlund g and oliveira m a (1993) Stability of vitamins and pigment sin extruded fish feeds, in Reinertsen H, Dahle L A, Jørgensen L and Tvinnereim K (eds), Fish Farming Technology, Balkema, Rotterdam, 477–9. hagen o (1966) The occurrence of Salmonellas in rainbow trout in salmonella infected milieu, Nord Vet Med, 18, 513–16. halver j e (2002) The vitamins, in Halver J E and Hardy R W (eds), Fish Nutrition, Academic Press, San Diego, CA, 61–141. hamre k, christiansen r, waagbø r, maage a, torstensen b e, lygren b, lie ø, wathne e and albrektsen s (2004) Antioxidant vitamins, minerals and lipid levels in diets for Atlantic salmon (Salmo salar, L.): effects on growth performance and fillet quality, Aquac Nutr, 10, 113–23. handeland s o, imsland a k and stefansson s o (2008) The effect of temperature and fish size on growth, feed intake, food conversion efficiency and stomach evacuation rate of Atlantic salmon post-smolts, Aquaculture, 283, 36–42. hansen j ø and storebakken t (2007) Effects of dietary cellulose level on pellet quality and nutrient digestibilities in rainbow trout (Oncorhynchus mykiss), Aquaculture, 272, 458–65. heikkinen j, vielma j, kemiläinen o, tiirola m, eskelinen p, kiuru t, naviapaldanius d and von wright a (2006) Effects of soybean meal based diet on growth performance, gut histopathology and intestinal microbiota of juvenile rainbow trout (Oncorhynchus mykiss), Aquaculture, 261, 259–68. helland s, refstie s, espmark å, hjelde k and baeverfjord g (2005) Mineral balance and bone formation in fast-growing Atlantic salmon parr (Salmo salar) in response to dissolved metabolic carbon dioxide and restricted dietary phosphorus supply, Aquaculture, 250, 364–76.

530


helland s, denstadli v, witten p e, hjelde k, storebakken t, skrede a, åsgård t and baeverfjord g (2006) Hyper dense vertebrae andmineral content in Atlantic salmon (Salmo salar L.) fed diets with graded levels of phytic acid, Aquaculture, 261, 603–14. hemre g-i and sandnes k (1999) Effect of dietary lipid on the muscle composition in Atlantic salmon Salmo salar, Aquac Nutr, 5, 9–16. hemre g-i, sandnes k, lie ø, torrissen o and waagbø r (1995a) Carbohydrate nutrition in Atlantic salmon, Salmo salar L.: growth and feed utilisation, Aquac Res, 26, 149–54. hemre g-i, sandnes k, lie ø and waagbø r (1995b) Blood chemistry and organ nutrient composition in Atlantic salmon, Salmo salar L., fed graded amounts of wheat starch, Aquac Nutr, 1, 37–42. hemre g-i, mommsen t p and krogdahl (2002) Carbohydrate in fish nutrition: effects on growth, glucose metabolism and hepatic enzymes, Aquac Nutr, 8, 175–94. hemre g-i, sanden m, bakke-mckellep a m, sagstad a and krogdahl å (2005) Growth, feed utilization and health of Atlantic salmon Salmo salar L. fed genetically modified compared to non-modified commercial hybrid soybeans, Aquac Nutr, 11, 157–67. hemre g-i, sagstad a, bakke-mckellep a m, danieli a, acierno r, maffia m, frøystad m, krogdahl å and sanden m (2007) Nutritional, physiological, and histological responses in Atlantic salmon, Salmo salar L. fed diets with genetically modified maize, Aquac Nutr, 13, 186–99. herschberger w k (1992) Genetic variability in rainbow trout populations, Aquaculture, 100, 51–71. hertrampf j w and piedad-pascual f (2000) Handbook on Ingredients for Aquaculture Feeds, Kluwer Academic, Dordrecht. hidalgo m c, urea e and sanz a (1999) Comparative study of digestive enzymes in fish with different nutritional habits. Proteolytic and amylase activities, Aquaculture, 170, 267–83. hillestad m and johnsen f (1994) High-energy/low-protein diets for Atlantic salmon: effects on growth, nutrient retention and slaughter quality, Aquaculture, 124, 109–16. hillestad m, johnsen f, austreng e and åsgård t (1998) Long-term effects of dietary fat level and feeding rate on growth, feed utilization and carcass quality of Atlantic salmon, Aquac Nutr, 4, 89–97. hilton j w and dixon d g (1982) Effect of increased liver glycogen and liver weight on liver function in rainbow trout, Salmo gairdneri Richardson: recovery from anaesthesia and plasma 35S-sulphobromophthalein clearance, J Fish Dis, 5, 185–95. hilton j w and slinger s j (1986) Digestibility and utilisation of canola meal in practical-type diets for rainbow trout (Salmo gairdneri), Can J Fish Aquat Sci, 43, 1149–55. hilton j w, cho c y and slinger s j (1981) Effect of extrusion processing and steam pelleting diets on pellet durability, pellet water absorption, and the physiological response of rainbow trout (Salmo gairdneri R.), Aquaculture, 25, 185–94. hussein h s and brasel j m (2001) Toxicity, metabolism, and impact of mycotoxins on humans and animals, Toxicology, 167, 101–34. hynes n, egeland e s, koppe w, baardsen g and kiron v (2009) Calanus oil as a natural source for flesh pigmentation in Atlantic salmon (Salmo salar L.), Aquac Nutr, in press. irianto a and austin b (2002) Use of probiotics to control furunculosis in rainbow trout, Oncorhynchus mykiss (Walbaum), J Fish Dis, 25, 333–42.


531

jensen k w (1975) A short history of pond culture, in Amundsen A, Fiskeoppdrett, Landbruksforlaget, Oslo, 9–17 (in Norwegian). jobling m (1994) Fish Bioenergetics, Chapman & Hall, London. juell j e, furevik d m and bjordal a (1993) Demand feeding in salmon farming by hydroacoustic food detection, Aquac Eng, 12, 155–67. julshamn k, malde m k, bjorvatn k and krogedal p (2004) Fluoride retention of Atlantic salmon (Salmo salar) fed krill meal, Aquac Nutr, 10, 9–13. jutfelt f, sund h, glette j, mellander l, björnsson b t and sundell k (2008) The involvement of Aeromonas salmonicida virulence factors in bacterial translocation in the rainbow trout, Oncorhynchus mykiss (Walbaum), intestine, J Fish Dis, 31, 141–51. kennedy s r, campbell p j, porter a and tocher d r (2006) Influence of dietary conjugated linoleic acid (CLA) on lipid and fatty acid composition in liver and flesh of Atlantic salmon (Salmo salar), Comp Biochem Physiol, 141B, 168–78. kennedy s r, bickerdike r, berge r k, dick j r and tocher d r (2007) Influence of conjugated linoleic acid (CLA) or tetradecylthioacetic acid (TTA) on growth, lipid composition, fatty acid metabolism and lipid gene expression of rainbow trout (Oncorhynchus mykiss L.), Aquaculture, 272, 489–501. killeit u (1994) Vitamin retention in extrusion cooking, Food Chem, 49, 149–55. kim d-h, brunt j and austin b (2007) Microbial diversity of intestinal contents and mucus in rainbow trout (Oncorhynchus mykiss), J Appl Microbiol, 102, 1654–64. kjær m, todorcˇevic´ m, torstensen b e, vegusdal a and ruyter b (2008) Dietary n-3 HUFA affects mitochondrial fatty acid β-oxidation capacity and susceptibility to oxidative stress in Atlantic salmon, Lipids, 43, 813–27. knudsen d, uran p, arnous a, koppe w and frøkiær h (2007) Saponin-containing subfractions of soybean molasses induce enteritis in the distal intestine of Atlantic salmon, J Agric Food Chem, 55, 2261–7. knudsen d, jutfelt f, sundh h, sundell k, koppe w and frøkiær h (2008) Dietary soya saponins increase gut permeability and play a key role in the onset of soyabeaninduced enteritis in Atlantic salmon (Salmo salar L.), Br J Nutr, 100, 120–29. kodama h, nakanishi y, yamamoto f, mikami t, izawa h, imagawa t, hashimoto y and kudo n (1987) Salmonella-arizonae isolated from a Pirarucu, ArapaimaGigas Cuvier, with septicemia, J Fish Dis, 10, 509–12. kraugerud o f, penn m, storebakken t, refstie s, krogdahl å and svihus b (2007) Nutrient digestibilities and gut function in Atlantic salmon (Salmo salar) fed diets with cellulose or non-starch polysaccharides from soy, Aquaculture, 273, 96–107. krogdahl å and sundby a (1999) Characteristics of pancreatic function in fish, in Pierzynowski S G and Zabielski R (eds), Biology of the Pancreas in Growing Animals, Elsevier Science, Amsterdam, 437–58. krogdahl å, nordrum s, sørensen m, brudeseth l and røsjø c (1999) Effects of diet composition on apparent nutrient absorption along the intestinal tract and of subsequent fasting on mucosal disaccharidase activities and plasma nutrient concentration in Atlantic salmon Salmo salar L., Aquac Nutr, 5, 121–33. krogdahl å, bakke-mckellep a m, røed k h and baeverfjord g (2000) Feeding Atlantic salmon Salmo salar L. soybean products: effects on disease resistance (furunculosis), and lysozyme and IgM levels in the intestinal mucosa, Aquac Nutr, 6, 77–84. krogdahl å, mckellep a m b and baeverfjord g (2003) Effects of graded levels of standard soybean meal on intestinal structure, mucosal enzyme activities, and pancreatic response in Atlantic salmon (Salmo salar L.), Aquac Nutr, 9, 361–71. krogdahl å, sundby a and olli j j (2004) Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss) digest and metabolize nutrients differently. Effects of water salinity and dietary starch level, Aquaculture, 229, 335–60.

532


krogdahl å, hemre g-i and mommsen t p (2005) Carbohydrates in fish nutrition: digestion and absorption in postlarval stages, Aquac Nutr, 11, 103–22. kvellestad a, høie s, thorund k, tørund b and lyngøy a (2000) Platyspondyly and shortness of vertebral column in farmed Atlantic salmon Salmo salar in Norway – description and interpretation of pathological changes, Dis Aquat Org, 39, 97–108. kyrou i and tsigos c (2007) Stress mechanisms and-metabolic complications, Horm Metab Res, 39, 430–38. lall s p (2002) The minerals, in Halver J E and Hardy R W (eds), Fish Nutrition, Academic Press, San Diego, CA, 259–308. lall s p, kaushik s, le bail p y, keith r, anderson s j and plisetskaya e m (1994) Quantitative arginine requirement of Atlantic salmon (Salmo salar) reared in sea water, Aquaculture, 124, 13–25. langhout d j., schutte j b, geerse c, kies a k, de jong j and verstegen m w a (1997) Effects on chick performance and nutrient digestibility of an endo-xylanase added to a wheat- and rye-based diet in relation to fat source, Br Poult Sci, 38, 557–63. lax a j, barrow p a, jones p w and wallis t s (1995) Current perspectives in salmonellosis, Br Vet J, 151, 351–77. lee d j, wales j h and sinnhuver r o (1971) Promotion of aflatoxin-induced hepatoma growth in trout by methyl malavate and sterculate, Cancer Res, 31, 960–63. liener i (1980) Toxic constituents of plant foodstuffs, Academic Press, New York. lhoste e f, ouriet v, bruel s, flinois j p, brezillon c, magdalou j, cheze c and nugon-baudon l (2003) The human colonic microflora influences the alterations of xenobiotic-metabolizing enzymes by catechins in male F344 rats, Food Chem Toxicol, 41, 695–702. lott j n a, ockenden i, raboy v and batten g d (2000) Phytic acid and phosphorus in crop seeds and fruits: a global estimate, Seed Sci Res, 10, 11–33. lunestad b t, nesse l, lassen j, svihus b, nesbakken t, fossum k, rosnes j t, kruse h and yazdankhah s (2007) Salmonella in fish feed; occurrence and implications for fish and human health in Norway, Aquaculture, 265, 1–8. lusas e w and riaz m n (1995) Soy protein products: processing and use, J Nutr, 125, 573S–580S. maenz d d, irish g g and classen h l (1999) Carbohydrate-binding and agglutinating lectins in raw and processed soybean meals, Anim Feed Sci Technol, 76, 335–43. makkar h p s (2008) A review of the use of isotopic and nuclear techniques in animal production, Anim Feed Sci Technol, 140, 418–43. march b e and macmillan c (1996) Muscle pigmentation and plasma concentrations of astaxanthin in rainbow trout, chinook salmon, and Atlantic salmon in response to different dietary levels of astaxanthin, Prog Fish Cult, 58, 178–86. march b e, hajen w e, deacon g, macmillan c and walsh m g (1990) Intestinal absorption of astaxanthin, plasma astaxanthin concentration, body weight, and metabolic rate as determinants of flesh pigmentation in salmonid fish, Aquaculture, 90, 313–22. matthews s j, ross n w, lall s p and gill t a (2006) Astaxanthin binding protein in Atlantic salmon, Comp Biochem Physiol, 144B, 206–14. mckay l r and gjerde b (1985) The effect of salinity on growth of rainbow trout, Aquaculture, 49, 325–31. menoyo d, lopez-bote c j, bautista j m and obach a (2003) Growth, digestibility and fatty acid utilisation in large Atlantic salmon (Salmo salar) fed varying levels of n-3 and saturated fatty acids, Aquaculture, 225, 295–307. milligan s r, khan o and nash m (1998) Competitive binding of xenobiotic oestrogens to rat alpha-fetoprotein and to sex steroid binding proteins in human


533

and rainbow trout (Oncorhynchus mykiss) plasma, Gen Comp Endocrinol, 112, 89–95. moren m, malde m k, olsen r e, hemre g i, dahl l, karlsen o and julshamn k (2007) Fluorine accumulation in Atlantic salmon (Salmo salar), Atlantic cod (Gadus morhua), rainbow trout (Onchorhyncus mykiss) and Atlantic halibut (Hippoglossus hippoglossus) fed diets with krill or amphipod meals and fish meal based diets with sodium fluoride (NaF) inclusion, Aquaculture, 269, 525–31. mørkøre t and rørvik k-a (2001) Seasonal variations in growth, feed utilisation and product quality of farmed Atlantic salmon (Salmo salar) transferred to seawater as 0+ smolts or 1+ smolts, Aquaculture, 199, 145–57. moya-falcon c, hvattum e, dyrøy e, skorve j, stefansson s o, thomassen m s, jakobsen j v, berge r k and ruyter b (2004) Effects of 3-thia fatty acids on feed intake, growth, tissue fatty acid composition, beta-oxidation and Na+,K+-ATPase activity in Atlantic salmon, Comp Biochem Physiol, 139B, 657–68. nesse l l, nordby k, heir e, bergsjø b, vardund t, nygaard h and holstad g (2003) Molecular analyses of Salmonella enterica isolates from fish feed factories and fish feed ingredients, Appl Environ Microbiol, 69, 1075–81. nesse l l, refsum t, heir e, nordby k, vardund t and holstad g (2005a) Molecular epidemiology of Salmonella spp. isolates from gulls, fish-meal factories, feed factories, animals and humans in Norway based on pulsed-field gel electrophoresis, Epidemiol Infect, 133, 53–8. nesse l l, løvold t, bergsjø b, nordby k, wallace c and holstad g (2005b) Persistence of orally administered salmonella enterica Serovars Agona and Montevideo in Atlantic Salmon (Salmo salar L.), J Food Prot, 68, 1336–9. newman k e (2001) Effect of mannan oligosaccharide on the microflora and immunoglobulin status of sows and piglet performance, J Anim Sci, 79, 189. ng w-k, campbell p j, dick j r and bell j g (2003) Interactive effects of dietary palm oil concentration and water temperature on lipid digestibility in rainbow trout Oncorhynchus mykiss, Lipids, 38, 1031–8. ng w-k, sigholt t and bell j g (2004) The influence of environmental temperature on the apparent nutrient and fatty acid digestibility in Atlantic salmon (Salmo salar L.) fed finishing diets containing different blends of fish oil, rapeseed oil and palm oil, Aquac Res, 35, 1228–37. nielsen c r, berdal k g, bakke-mckellep a m and holst-jensen a (2005) Dietary DNA in blood and organs of Atlantic salmon (Salmo salar L.), Eur Food Res Technol, 221, 1–8. nielsen c r, holst-jensen a, løvseth a and berdal k g (2006) Persistence and distribution of intravenously injected DNA in blood and organs of Atlantic salmon (Salmo salar L.), Eur Food Res Technol, 222, 258–65. nordrum s, åsgård t, shearer k d and arnessen p (1997) Availability of phosphorus in fish bone meal and inorganic salts to Atlantic salmon (Salmo salar) as determined by retention, Aquaculture, 157, 51–61. nordrum s, bakke-mckellep a m, krogdahl å and buddington r k (2000) Effects of soybean meal and salinity on intestinal transport of nutrients in Atlantic salmon (Salmo salar L.) and rainbow trout (Oncorhynchus mykiss), Comp Biochem Physiol, 125B, 317–35. olli j j and krogdahl å (1994) Nutritive value of four soybean products in diets for rainbow trout (Oncorhynchus mykiss, Walbaum) reared in fresh water, Acta Agric Scand Sect A Sci, 44, 185–92. olli j j and krogdahl å (1995) Alcohol soluble components of soybeans seem to reduce fat digestibility in fish-meal based diets for Atlantic salmon, Salmo salar L., Aquac Res, 26, 831–5.

534


olli j, krogdahl å and berg-lea t (1989) Effects of soybean trypsin inhibitor activity on nutrient digestibility in salmonids fed practical diets containing various soybean meals, Proc III ISFNF, 28 August–September 1, Toba, 263–71. olli j j, krogdahl å, van den ingh t s g a m and brattås l e (1994a) Nutritive value of four soybean products in diets for Atlantic salmon (Salmo salar, L.), Acta Agric Scand Sect A Sci, 44, 50–60. olli j j, hjelmeland k and krogdahl å (1994b) Soybean trypsin inhibitors in diets for Atlantic salmon (Salmo salar, L): effects on nutrient digestibilities and trypsin in pyloric caeca homogenate and intestinal content, Comp Biochem Physiol, 109A, 923–8. olli j j, krogdahl å and våbenø a (1995) Dehulled solvent-extracted soybean meal as a protein source in diets for Atlantic salmon, Salmo salar L., Aquac Res, 26, 167–74. olsen r e, myklebust r, kaino t and ringø e (1999) Lipid digestibility and ultrastructural changes in the enterocytes of Arctic char (Salvelinus alpinus L.) fed linseed oil and soybean lecithin, Fish Physiol Biochem, 21, 35–44. olsen r e, myklebust r, ringø e and mayhew t m (2000) The influences of dietary linseed oil and saturated fatty acids on caecal enterocytes in Arctic char (Salvelinus alpinus L.): a quantitative ultrastructural study, Fish Physiol Biochem, 22, 207–16. olsen r e, dragnes b t, myklebust r and ringø e (2003) Effect of soybean oil and soybean lecithin on intestinal lipid composition and lipid droplet accumulation of rainbow trout, Oncorhynchus mykiss Walbaum, Fish Physiol Biochem, 29, 181–92. olsen r e, henderson r j, sountama j, hemre g, ringø e, melle w and tocher d r (2004) Atlantic salmon, Salmo salar, utilizes wax ester-rich oil from Calanus finmarchicus effectively, Aquaculture, 240, 433–49. olsen r e, suontama j, langmyhr e, mundheim h, ringø e, melle w, malde m k, hemre g-i (2006) The replacement of fish meal with Antarctic krill, Euphausia superba in diets for Atlantic salmon, Salmo salar, Aquac Nutr, 12, 280–90. opsahl-ferstad h-g, rudi h, ruyter b and refstie s (2003) Biotechnological approaches to modify rapeseed oil composition for applications in Aquaculture, Plant Sci, 165, 349–57. opstvedt j, mundheim h, nygård e, aase h and pike i h (2000) Reduced growth and feed consumption of Atlantic salon (Salmo salar) fed fish meal made from stale fish is not due to increased content of biogenic amines, Aquaculture, 188, 323–37. ostaszewska t, dabrowski k, palacios m e, olejniczak m and wieczorek m (2005) Growth and morphological changes in the digestive tract of rainbow trout (Oncorhynchus mykiss) and pacu (Piaractus mesopotamicus) due to casein replacement with soybean proteins, Aquaculture, 245, 273–86. ottinger c a and kaattari s l (1998) Sensitivity of rainbow trout leucocytes to aflatoxin B1, Fish Shellfish Immunol, 8, 515–30. ottinger c a and kaattari s l (2000) Long-term immune dysfunction in rainbow trout (Oncorhynchus mykiss) exposed as embryos to aflatoxin B1, Fish Shellfish Immunol, 10, 101–6. page g i and davies s j (2006) Tissue astaxanthin and canthaxanthin in rainbow trout (Oncorhunchus mykiss) and Atlantic salmon (Salmo salar), Comp Biochem Physiol, 143A, 125–32. palace v p, khaper n, qin q and singal p k (1999) Antioxidant potentials of vitamin A and carotenoids and their relevance to heart diseas, Free Radic Biol Med, 26, 746–61. parsonage k d and petrell r j (2003) Accuracy of a machine-vision pellet detection system, Aquac Eng, 29, 109–23.


535

pfeffer e, beckmann-toussaint j, henrichfreise b and jansen h d (1991) Effect of extrusion on efficiency of utilization of maize starch by rainbow trout (Oncorhynchus mykiss), Aquaculture, 96, 293–303. pfeffer e, wiesmann d and henrichfreise b (1994) Hydrolyzed feateh meal as feed component in diets for rainbow trout (Oncorhynchuss mykiss) and effects of dietary protein/energy ratio on the deficiency of utilization of digestible energy and protein, Arch Anim Nutr, 46, 111–19. phillips a m jr, tunison a v and brockway d r (1948) The utilization of carbohydrates by trout, Fish Res Bull, 11, 44. pike i h and hardy r w (1997) Standards for assessing quality of feed ingredients, in D’Abrami L R, Conclin D E and Akiyama D M (eds), Crustacean Nutrition, World Aquaculture Society, Baton Rouge, LA, 473–92. potts w t w, foster m a and stainer j w (1970) Salt and water balance in salmon smolt, J Exp Biol, 52, 553–64. rasmussen h b, larsen k, hald b, møller b and elling f (1986) Outbreak of livercell carcinoma among saltwater-reared rainbow trout Salmo gairdneri in Denmark, Dis Aquat Org, 1, 191–6. refstie s, storebakken t and roem a j (1998) Feed consumption and conversion in Atlantic salmon (Salmo salar) fed diets with fish meal, extracted soybean meal or soybean meal with reduced content of oligosaccharides, trypsin inhibitors, lectins and soya antigens, Aquaculture, 162, 301–12. refstie s, svihus b, shearer k d and storebakken t (1999) Nutrient digestibility in Atlantic salmon and broiler chickens related to viscosity and non-starch polysaccharide content in different soyabean products, Anim Feed Sci Technol, 79, 331–45. refstie s, korsøen ø j, storebakken t, baeverfjord g, lein i and roem a j (2000) Differing nutritional responses to dietary defatted soybean meal in rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar), Aquaculture, 190, 49–63. refstie s, storebakken t, baeverfjord g and roem a j (2001) Long-term protein and lipid growth of Atlantic salmon (Salmo salar) fed diets with partial replacement of fish meal by soy protein products at medium or high lipid level, Aquaculture, 193, 91–106. refstie s, sahlström s, bråthen e, baeverfjord g and krogedal p (2005) Lactic acid fermentation eliminates indigestible carbohydrates and antinutritional factors in soybean meal for Atlantic salmon (Salmo salar), Aquaculture, 246, 331–45. refstie s, bakke-mckellep a m, penn m h, sundby a, shearer k d and krogdahl å (2006a) Capacity for digestive hydrolysis and amino acid absorption in Atlantic salmon (Salmo salar) fed diets with soybean meal or inulin with or without addition of antibiotics, Aquaculture, 261, 392–406. refstie s, glencross b, landsverk t, sørensen m, lilleeng e, hawkins w and krogdahl å (2006b) Digestion and digestive physiology in Atlantic salmon (Salmo salar) fed kernel meals and protein concentrates made from yellow or narrow-leaf lupins, Aquaculture, 261, 1382–95. refstie s, landsverk t, bakke-mckellep a m, ringø e, sundby a, shearer k d and krogdahl å (2006c) Digestive capacity, intestinal morphology, and microflora of 1-year and 2-year old Atlantic cod (Gadus morhua) fed standard or bioprocessed soybean meal, Aquaculture, 261, 269–84. regost c, jakobsen j v and rørå a m b (2004) Flesh quality of raw and smoked fillets of Atlantic salmon as influenced by dietary oil sources and frozen storage, Food Res Int, 37, 259–71. ringø e (2008) The ability of carnobacteria isolated from fish intestine to inhibit growth of fish pathogenic bacteria: a screening study, Aquac Res, 39, 171–80.

536


ringø e and birkbeck t h (1999) Intestinal microflora of fish larvae and fry, Aquac Res, 30, 73–93. ringø e, strøm e and tabachek j-a (1995) Intestinal microflora of salmonids: a review, Aquac Res, 26, 773–89. ringø e, sperstad s, myklebust r, mayhew t m, mjelde a, melle w and olsen re (2006a) The effect of dietary krill supplementation on epithelium-associated bacteria in the hindgut of Atlantic salmon (Salmo salar L.): a microbial and electron microscopical study, Aquac Res, 37, 1644–53. ringø e., sperstad s., myklebust r., mayhew, t and olsen r e (2006b) The effect of dietary inulin on aerobic bacteria associated with hindgut of Arctic charr (Salvelinus alpinus L.), Aquac Res, 37, 891–7. ringø e, sperstad s, kraugerud o f and krogedahl å (2008) Use of 16S rRNA gene sequencing analysis to characterize culturable intestinal bacteria in Atlantic salmon (Salmo salar) fed diets with cellulose or non-starch polysaccharides from soy, Aquac Res, 39, 1087–100. ritchie g (2000) Respons: potential aid in fighting salmon lice, I dybden, 14, 224–7. robertsen b (1999) Modulation of the non-specific defence of fish by structurally conserved microbial polymers, Fish Shellfish Immunol, 9, 269–90. robertsen b, rørstad g, engstad r and raa j (1990) Enhancement of nonspecific disease resistance in Atlantic salmon, Salmo salar L, by a glucan from saccharomyces cerevisiae cell-walls, J Fish Dis, 13, 391–400. rokey g j (1994) Petfood and fishfood extrusion, in Frame N D (ed.), The Technology of Extrusion Cooking, Blackie Academic & Professional, London 144–89. rollin x, hidalgo m, teller e and vanbelle m (1994) Quantitative methioninie requirement of Atlantic salmon (Salmo salar) juveniles, Aquaculture, 124, 61. rollin x, mambrini m, abboudi t, larondelle y and kaushik s j (2003) The optimum dietary indispensible amino acid pattern for growing Atlantic salmon (Salmo salar L.) fry, Br J Nutr, 90, 865–76. romarheim o h, skrede a, gao y l, krogdahl å, denstadli v, lilleeng e and storebakken t (2006) Comparison of white flakes and toasted soybean meal partly replacing fish meal as protein source in extruded feed for rainbow trout (Oncorhynchus mykiss), Aquaculture, 256, 354–64. romarheim o h, zhang c, penn m, liu y j, tian l x, skrede a, krogdahl å and storebakken t (2008a) Growth and intestinal morphology in cobia (Rachycentron canadum) fed extruded diets with two types of soybean meal partly replacing fish meal, Aquac Nutr, 14, 174–80. romarheim o h, skrede a, penn m, mydland l t, krogdahl å and storebakken t (2008b) Lipid digestibility, bile drainage and development of morphological intestinal changes in rainbow trout (Oncorhynchus mykiss) fed diets containing defatted soybean meal, Aquaculture, 274, 329–38. rørå a m b, ruyter b, skorve j, berge r k and slinning k-e (2005) Influence of high content of dietary soybean oil quality of large fresh, smoked and frozen Atlantic salmon (Salmo salar), Aquac Int, 13, 217–31. rørvik k-a, skjervold p o, fjæra s o and steien s h (2000) Distended, water-filled stomach in seawater farmed rainbow trout, Oncorhynchus mykiss (Walbaum), provoked experimentally by osmoregulatory stress, J Fish Dis, 23, 15–18. rørvik k a, alne h, gaarder m, ruyter b, maseide n p, jakobsen j v, berge r, sigholt t and thomassen m s (2007) Does the capacity for energy utilization affect the survival of post-smolt Atlantic salmon, Salmo salar L., during natural outbreaks of infectious pancreatic necrosis?, J Fish Dis, 30, 399–409. roth b, johansen s j s, suontama j, kiessling a, leknes o, guldberg b and handeland s (2005) Seasonal variation in flesh quality, comparison between large and


537

small Atlantic salmon (Salmo salar) transferred into seawater as 0+ or 1+ smolts, Aquaculture, 250, 830–40. rumsey g l, endres j g, bowser p r, earnest-koons k a, anderson d p and siwicki a k (1994) Soy protein in diets of rainbow trout: Effects on growth, protein absorption, gastrointestinal histology, and nonspecific serologic and immune response, in Lim C E and Sessa D J (eds), Nutrition and Utilization Technology in Aquaculture, AOCS Press, Champaign, IL, 166–88. ruyter b, andersen o, dehli a, farrants a k o, gjøen t and thomassen m s (1999) Peroxisome proliferator activated receptors in Atlantic salmon (Salmo salar): effects on PPAR transcription and acyl-CoA oxidase activity in hepatocytes by peroxisome proliferators and fatty acids, Biochim Biophys Acta Lip Lip Metab, 1348, 331–8. sagstad a, sanden m, haugland ø, hansen a-c, olsvik p a and hemre g-i (2007) Evaluation of stress- and immune-response biomarkers in Atlantic salmon, Salmo salar L., fed different levels of genetically modified maize (Bt maize), compared with its near-isogenic parental line and a commercial suprex maize, J Fish Dis, 30, 201–12. sakai m (1999) Current research status of fish immunostimulants, Aquaculture, 172, 63–92. sanden m., bruce i j, rahman m a and hemre g-i (2004) The fate of transgenic sequences present in genetically modified plant products in fish feed, investigating the survival of GM soybean DNA fragments during feeding trials in Atlantic salmon, Salmo salar L., Aquaculture, 237, 391–405. sanden m, berntssen m h g, krogdahl å, hemre g-i and bakke-mckellep a m (2005) An examination of the intestinal tract of Atlantic salmon (Salmo salar L.) parr fed different varieties of soy and maize, J Fish Dis, 28, 317–30. sanden m, krogdahl å, bakke-mckellep a m, buddington r k and hemre g-i (2006) Growth performance and organ development in Atlantic salmon, Salmo salar L. parr fed genetically modified (GM) soybeans and maize, Aquac Nutr, 12, 1–14. santacroce m p, conversano m c, casalino e, lai o, zizzadoro c, centoducati g and crescenzo g (2008) Aflatoxins in aquatic species: metabolism, toxicity and prespectives, Rev Fish Biol Fish, 18, 99–130. santigosa e, sánchez j, médale f, kaushik s, pérez-sánchez j and gallardo m a (2008) Modifications of digestive enzymes in trout (Oncorhynchus mykiss) and sea bream (Sparus aurata) in response to dietary fish meal replacement by plant protein sources, Aquaculture, 282, 68–74. sargent j r, tocher d r and bell j g (2002) The lipids, in Halver J E and Hardy R W (eds), Fish Nutrition, Academic Press, San Diego, CA, 181–257. schiedt k (1998) Absorption and metabolism of carotenoids in birds, fish and crustaceans, in Carotenoids Vol. 3 Biosynthesis, Birkhäuser, Basel, 285–358. schiedt k, leuenberger f j, vecchi m and glinz e (1985) Absorption, retention, and metabolic transformations of carotenoids in rainbow trout, salmon and chicken, Pure Appl Chem, 57, 685–92. seierstad s l, seljeflot i, johansen o, hansen r, haugen m, rosenlund g, frøyland l and arnesen h (2005) Dietary intake of differently fed salmon; the influence on markers of human atherosclerosis, Eur J Clin Invest, 35, 52–9. shearer k d (1984) Changes in the elemental composition of hatchery reared rainbow trout (Salmo gairdneri) associated with growth and reproduction, Can J Fish Aquat Sci, 41, 1592–600. shearer k d (2000) Experimental design, statistical analysis and modelling of dietary nutrient requirement studies for fish: a critical review, Aquac Nutr, 6, 91–102.

538


shearer k d, åsgård t, andorsdóttir g and aas g h (1994) Whole body elemental and proximate composition of Atlantic salmon (Salmo salar) during the life cycle, J Fish Biol, 44, 785–97. sire m f and vernier j-m (1992) Intestinal absorption of protein in teleost fish, Comp Biochem Physiol, 103A, 771–81. smulikowska s and mieczkowska a (1996) Effect of rye level, fat source and enzyme supplementation on fat utilization, diet metabolizable energy, intestinal viscosity and performance of broiler chickens, J Anim Feed Sci, 5, 379–93. sørensen m, ljøkjel k, storebakken t, shearer k d and skrede a (2002) Apparent digestibility of protein, amino acids, and energy in rainbow trout (Oncorhynchus mykiss) fed a fish meal based diet extruded at different temperatures, Aquaculture, 211, 215–25. sørensen m, storebakken t and shearer k d (2005) Digestibility, growth and nutrient retention in rainbow trout (Oncorhynchus mykiss) fed diets extruded at two different temperatures, Aquac Nutr, 11, 251–6. spannhof l and plantikow h (1983) Studies on carbohydrate digestion in rainbow trout, Aquaculture, 30, 95–108. speijers g j a and speijers m h m (2004) Combined toxic effects of mycotoxins, Toxicol Lett, 153, 91–8. spinelli j, houle c r and wekell j c (1983) The effect of phytates on the growth of rainbow trout (Salmo gairdneri) fed purified diets containing varying quantities of calcium and magnesium, Aquaculture, 30, 71–83. stahl w and sies h (2003) Antioxidant activity of carotenoids, Mol Aspects Med, 24, 345–51. staurnes m, andorsdottir g and sundby a (1990) Distended, water-filled stomach in sea farmed rainbow trout, Aquaculture, 90, 333–43. staykov y, spring p, denev s and sweetman j (2007) Effect of mannan oligosaccharide on the growth performance and immune status of rainbow trout (Oncorhynchus mykiss), Aquac Int, 15, 153–61. steffens w (1994) Replacing fish meal with poultry by-product meal in diets for rainbow trout, Oncorhynchus mykiss, Aquaculture, 124, 27–34. steyn p s (1995) Mycotoxins, general view, chemistry and structure, Toxicol Lett, 82/83, 843–51. storebakken t and no h k (1992) Pigmentation of rainbow trout, Aquaculture, 100, 209–29. storebakken t, foss p, austreng e and liaaen-jensen s (1985) II. Epimerization studies with astaxanthin in Atlantic salmon, Aquaculture, 44, 259–69. storebakken t, foss p, huse i, wandsvik a and berg lea t (1986) III. Utilization of canthaxanthin from dry and wet diets by Atlantic salmon, rainbow trout and sea trout, Aquaculture, 51, 245–55. storebakken t, foss p, schiedt k, austreng e, liaen-jensen s and manz u (1987) Carotenoids in diets for salmonids IV. Pigmentation of Atlantic salmon with astaxanthin, astaxanthin dipalmitate and canthaxanthin, Aquaculture, 65, 279–92. storebakken t, shearer k d and roem a j (1998) Availability of protein, phosphorus and other elements in fish meal, soy-protein concentrate and phytase-treated soy-protein-concentrate-based diets to Atlantic salmon, Salmo salar, Aquaculture, 161, 365–79. storebakken t, kvien i s, shearer k d, grisdale-helland b and helland s j (1999) Estimation of gastrointestinal evacuation rate in Atlantic salmon (Salmo salar) using inert markers and collection of faeces by sieving: evacuation of diets with fish meal, soybean meal or bacterial meal, Aquaculture, 172, 291–9.


539

storebakken t, refstie s and ruyter b (2000a) Soy products as fat and protein sources in fish feeds for intensive aquaculture, in Drachley J (ed.), Soy in Animal Nutrition, Federation of Animal Sciences Society, Savoy, IL, 127–70. storebakken t, shearer k d, baeverfjord g, nielsen b g, åsgård t, scott t and de laporte a (2000b) Digestibility of macronutrients, energy and amino acids, absorption of elements and absence of intestinal enteritis in Atlantic salmon, Salmo salar, fed diets with wheat gluten, Aquaculture, 184, 115–32. storebakken t, sørensen m, bjerkeng b, harris j, monahan p and hiu s (2004a) Stability of astaxanthin from red yeast, Xanthophyllomyces dendrorhous, during feed processing: effects of enzymatic cell wall disruption and extrusion temperature, Aquaculture, 231, 489–500. storebakken t, sorensen m, bjerkeng b and hiu s (2004b) Utilization of astaxanthin from red yeast, Xanthophyllomyces dendrorhous, in rainbow trout, Oncorhynchus mykiss: effects of enzymatic cell wall disruption and feed extrusion temperature, Aquaculture, 236, 391–403. sugiura s h, dong f m, rathbone c k and hardy r w (1998) Apparent protein digestibility and mineral availabilities in various feed ingredients for salmonid feeds, Aquaculture, 159, 177–202. suontama j, kiessling a, melle w, waagbø r and olsen r e (2007a) Protein from Northern krill (Thysanoessa inermis), Antarctic krill (Euphausia superba) and the Arctic amphipod (Themisto libellula) can partially replace fish meal in diets to Atlantic salmon (Salmo salar) without affecting product quality, Aquac Nutr, 13, 50–58. suontama j, karlsen o, moren m, hemre g-i, melle w, langmyhr e, mundheim h, ringø e and olsen r e (2007b) Growth, feed conversion and chemical composition of Atlantic salmon (Salmo salar L.) and Atlantic halibut (Hippoglossus hippoglossus L.) fed diets supplemented with krill or amphipods, Aquac Nutr, 13, 241–55. swanson k s, grieshop c m, flickinger e a, healy h p, dawson k a, merchen n r and fahey jr g c (2002) Effects of supplemental fructooligosaccharides plus mannanoligosaccharides on immune function and ileal and fecal microbial populations in adult dogs, Arc Anim Nutr, 56, 309–18. terjesen b f, sigholt t, hillestad m, holm j, refstie s, baeverfjord g, aas t s, rørvik k-a and åsgård t (2008) The impact of physical pellet characteristics and environmental conditions on stomach content separation in rainbow trout, 7th International Conference on Recirculating Aquaculture Proceedings, 23–24 June, Roanoke, VA, 378–87. todorcˇ evic´ m, kjær m, djakovic´ n, vegusdal a, torstensen b e and ruyter b (2008) Effects of dietary n-3 fatty acids on fat deposition, mitochondrial function and oxidative stress in in Atlantic salmon visceral adipose tissue, Proc XIII ISFNF, June 1–5, 2006, Florianópolis, 53. tollefsen k e, øvrevik j and stenersen j (2004) Binding of xenoestrogens to the sex steroid-binding protein in plasma from Arctic charr (Salvelinus alpinus L.), Comp Biochem Physiol, 139C, 127–33. torrissen o j and christiansen r (1995) Requirements for carotenoids in fish diets, J Appl Ichthyol, 11, 225–30. torrissen o j, hardy r w and shearer k d (1989) Pigmentation of salmonidscarotenoid deposition and metabolism, CRC Crit Rev Aquat Sci, 1, 209–25. torrissen o j, hardy r w, shearer k d, scott t m and stone f e (1990) Effects of dietary canthaxanthin and lipid level on apparent digestibility coefficients for canthaxanthin in rainbow trout (Oncorhynchus mykiss), Aquaculture, 88, 351–62. torrissen o j, christiansen r, struksnæs g and estermann r (1995) Astaxanthin deposition in the flesh of Atlantic salmon, Salmo salar L., in relation to dietary astaxanthin concentration and feeding period, Aquac Nutr, 1, 77–84.

540


torstensen b e, frøyland l and lie ø (2004a) Replacing dietary fish oil with increasing levels of rapeseed oil and olive oil – effects on Atlantic salmon (Salmo salar L.) tissue and lipoprotein lipid composition and lipogenic enzyme activities, Aquac Nutr, 10, 175–92. torstensen b e, frøyland l, ørnsrud r and lie ø (2004b) Tailoring of a cardioprotective muscle fatty acid composition of Atlantic salmon (Salmo salar) fed vegetable oils, Food Chem, 87, 567–80. tripathi m k and mishra a s (2007) Glucosinolates in animal nutrition: a review, Anim Feed Sci Technol, 132, 1–27. urán p a, schrama j w, rombout j h w m, obach a, jensen l, koppe w and verreth j a j (2008) Soybean meal-induced enteritis in Atlantic salmon (Salmo salar L.) at different temperatures, Aquac Nutr, 14, 324–30. vågsholm i and djupvik h o (1998) Risk factors for spinal deformities in Atlantic salmon, Salmo salar L., J Fish Dis, 21, 47–53. van damme e j m, peumans w j, pusztai a and bardocz s (1998) Handbook of Plant Lectins: Properties and Biomedical Applications, Wiley, Chichester. van den ingh t s g a m, krogdahl å, olli j, hendricks h and koninkx j (1991) Effects of soybean containing diets on the proximal and distal intestine in Atlantic salmon Salmo salar: a morphological study, Aquaculture, 94, 296–305. van den ingh t s g a , olli j j and krogdahl å (1996) Alcohol-soluble components in soybeans cause morphological changes in the distal intestine of Atlantic salmon, Salmo salar L., J Fish Dis, 19, 47–53. vegusdal a, gjøen t, berge r k, thomassen m s and ruyter b (2005) Effect of 18 : 1n-9, 20 : 5n-3, and 22 : 6n-3 on lipid accumulation and secretion by Atlantic salmon hepatocytes, Lipids, 40, 477–86. vielma j, ruohonen k and lall s p (1999) Supplemental citric acid and particle size of fish bone-meal influence the availability of minerals in rainbow trout Oncorhynchus mykiss (Walbaum), Aquac Nutr, 5, 65–71. vielma j, mäkinen t, ekholm p and koskela j (2000) Influence of dietary soy and phytase levels on performance and body composition of large rainbow trout (Oncorhynchus mykiss) and algal availability of phosphorus load, Aquaculture, 183, 349–62. vielma j, ruohonen k and peisker m (2002) Dephytinization of two soy proteins increases phosphorus and protein utilization by rainbow trout, Oncorhynchus mykiss, Aquaculture, 204, 145–56. waagbø r, sandnes k, torrissen o j, sandvin a and lie ø (1993) Chemical and sensory evaluation of fillets from Atlantic salmon (Salmo salar) fed three levels of N-3 polyunsaturated fatty acids at two levels of vitamin E, Food Chem, 46, 361–6. waagbø r, hamre, k, bjerkås e, wathne e, lie ø and torstensen b (2003) Cataract formation in Atlantis salmon, Salmo salar L., smolt relative to dietary pro- and antioxidants and lipid level, J Fish Dis, 26, 213–29. white d a, ørnsrud r and davies s j (2003) Determination of carotenoid and vitamin A concentrations in everted salmonid intestine following exposure to solutions of carotenoid in vitro, Comp Biochem Physiol, 136, 683–92. wilson r p (1994) Utilization of dietary carbohydrate by fish, Aquaculture, 124, 67–80. wilson r p (2002) Amino acids and proteins, in Halver J E and Hardy R W (eds), Fish Nutrition, Academic Press, San Diego, CA, 143–79. woodward b (1994) Dietary vitamin requirements of cultured young fish, with emphasis on quantitative estimates for salmonids, Aquaculture, 124, 133–68. woodward b, young l g and lun a k (1983) Vomitoxin in diets for rainbow trout (Salmo gairdneri), Aquaculture, 35, 93–101.


541

yamamoto t, goto t, kine y, endo y, kitaoka y, sugita t, furuita h, iwashita y and suzuki n (2008) Effect of an alcohol extract from a defatted soybean meal supplemented with a casein-based semi-purified diet on the biliary bile status and intestinal conditions in rainbow trout Oncorhynchus mykiss (Walbaum), Aquac Res, 39, 986–94. yilmaz e, genc m a and genc e (2007) Effects of dietary mannan oligosaccharides on growth, body composition, and intestine and liver histology of rainbow trout, Oncorhynchus mykiss, Isr J Aquac, 59, 182–8. yoshitomi b, aoki m, oshima s and hata k (2006) Evaluation of krill (Euphausia superba) meal as a partial replacement in rainbow trout (Oncorhynchus mykiss) diets, Aquaculture, 261, 440–46. ytrestøyl t, struksnæs g, koppe w and bjerkeng b (2005) Effects of temperature and feed intake on astaxanthin digestibility and metabolism in Atlantic salmon, Salmo salar, Comp Biochem Physiol, 142B, 445–55. ytrestøyl t, struksnæs g, rørvik k-a, koppe w and bjerkeng b (2006) Astaxanthin digestibility as affected by ration levels for Atlantic salmon, Salmo salar, Aquaculture, 261, 215–24. ytrestøyt t and bjerkeng b (2007a) Dose response in uptake and deposition of intraperitoneally administered astaxanthin in Atlantic salmon (Salmo salar L.) and Atlantic cod (Gadus morhua L.), Aquaculture, 263, 179–91. ytrestøyl t and bjerkeng b (2007b) Intraperitoneal and dietary administration of astaxanthin in rainbow trout (Oncorhynchus mykiss) – plasma uptake and tissue distribution of geometrical E/Z isomers, Comp Biochem Physiol, 147B, 250–59.

18 Monitoring viral contamination in shellfish growing areas F. S. Le Guyader and M. Pommepuy, Ifremer, France, and R. L. Atmar, Baylor College of Medicine, USA

Abstract: Human and animal fecal wastes and urine contain a large number of different viruses that can enter the environment through the discharge of waste materials from infected individuals. Despite the high diversity of viruses that are introduced into the environment by human fecal pollution, only a few have been recognized to cause disease in association with consumption of contaminated shellfish. Viruses are present in shellfish in very low numbers. Nevertheless, they are still present in sufficient quantities to pose a health risk. This low level of contamination has made it necessary to develop highly sensitive viral extraction methods to ensure virus recovery from shellfish tissues. The most common route for accidental contamination is after heavy rainfall, leading to overflow and release of untreated sewage into the aquatic environment. To limit shellfish contamination the most desirable and effective option is to reduce the viral input. Key words: human enteric viruses, shellfish, sewage, persistence, flux.

18.1 Introduction Shellfish have been identified as a vector for human enteric pathogens for more than 150 years. Shellfish filter large volumes of water during their feeding, and in the process they concentrate small particles containing microalgae and microorganisms. The practice of consuming either raw or undercooked shellfish can lead to transmission of disease caused by human pathogens present in the shellfish. During the 1800s, outbreaks of typhoid fever and cholera were associated with shellfish consumption (Richards, 1985). Contamination of shellfish-growing waters with human sewage was recognized as a contributing cause of the outbreaks, leading to the development of bacteriologic criteria to assess the impact of sewage on shellfish and shellfish-growing waters.

Monitoring viral contamination in shellfish growing areas

543

Most countries have endorsed sanitary controls on live bivalve shellfish. In the EU, these are covered by Council Directive 91/492/EEC (EU, 1991) and in the USA, by interstate trading agreements set out in the Federal Drug Administration National Shellfish Sanitation Program Manual of Operations (FDA, 1993). These regulations cover similar ground on the requirements for harvesting area classification, depuration, relaying, analytical methods, and provisions for suspension of harvesting from classified areas following a pollution or public health emergency. The legislation also requires that third country imports into the EU and USA have to be produced under the same standard as domestic products. Exporting nations have therefore developed programs for compliance with the regulations of their target export markets. A major weakness of these controls is the use of traditional bacterial indicators of fecal contamination, such as the fecal coliforms or E. coli, to assess contamination and hence implement the appropriate control measures. Fecal indicators are either measured in the shellfish themselves (EU requirement) or in the shellfish-growing waters (US FDA requirement). Levels of E. coli are used to categorize harvesting areas and prescribe levels of treatment required before they can be sold to consumers. These controls led to a significant decrease in the number of shellfish-associated outbreaks of bacterial infection, but a new problem emerged. Outbreaks of nonbacterial gastroenteritis and infectious hepatitis were recognized to be associated with shellfish consumption (Richards, 1987). Several reports described a lack of correlation between bacterial indicator microorganisms and viruses, and pathogenic viruses may be detected in shellfish from areas classified as suitable for commercial exploitation using fecal coliform criteria (Abad et al., 1997; Bosch et al., 2001; Butt et al., 2004; Le Guyader et al., 2006a, 2008). A number of examples of transnational outbreaks have recently been reported following trade between EU member states (Le Guyader et al., 2006a) and importation of shellfish from third countries into the EU and the USA (Bosch et al., 2001; Butt et al., 2004). In addition, the practice of depuration, a process by which shellfish ‘purify’ themselves of enteric bacteria by filtering clean waters, failed to eliminate the risk of viral-mediated disease (Richards, 1988). Given the failure of the current arrangements to protect public health fully, there is a clear need to develop better approaches to controlling this problem. European shellfish trade totals 460 M per year, and increases by approximately 7 % each year. The European production represents more than a third of the worldwide shellfish production (i.e., in 1991, 180 000 tons of live weight: 72 % of farmed bivalves, 28 % wild – Eurostat data), and 8500 companies currently employ around 23 000 workers. This activity is one of the major sources of employment in coastal areas (Ireland, France, Spain, The Netherlands). The costs of outbreaks of shellfish-associated viral disease have not been clearly defined, but they are likely to be substantial. In the USA, foodborne diseases are a major cause of morbidity and

544


hospitalization, with about 325 000 hospitalizations and 5000 deaths per year (Butt et al., 2004). There are 76 million estimated cases of foodborne disease, 10–19 % of those for which a vehicle of transmission is identified seafood. Half of these are cases caused by viruses, and half of the illnesses are associated with shellfish consumption (Mead et al., 1999; Butt et al., 2004). In countries with higher seafood consumption, or where seafood is traditionally eaten raw, a larger percentage of foodborne illnesses are due to seafood consumption. For example, in Japan as much as 70 % of foodborne illness is associated with seafood consumption (Butt et al., 2004).

18.2 Source of pollution 18.2.1 Human enteric viruses Human and animal fecal wastes and urine contain a large number of different viruses that can enter the environment through the discharge of waste materials from infected individuals. These enteric viruses cause a wide spectrum of illnesses in humans including hepatitis, gastroenteritis, meningitis, fever, rash, and conjunctivitis. A brief description of the principal viruses that have been characterized either in outbreaks or in field studies is given below and their different characteristics are described Table 18.1. Hepatitis A virus (HAV) Infectious hepatitis, caused by the hepatitis A virus, is one of the most serious illnesses transmitted by shellfish. The hepatitis A virus belongs to the genus Hepatovirus of the family Picornaviridae, and is very stable in the environment, remaining viable for up to several weeks in water or on fomites (Abad et al., 1994; Arnal et al., 1998; Hollinger and Emerson, 2007). Hepatitis A virus infection has a long incubation period and is generally asymptomatic or associated with a mild illness in young children, while in older children and adults the illness is characterized by jaundice in more than 70 % of individuals (CDC, 2006). There is only a single serotype, and an effective vaccine is available for prevention of infection (CDC, 2006). Noroviruses (NoV) Noroviruses (NoV) are the most common infections currently associated with shellfish consumption. Norovirus is a genus in the family Caliciviridae, and the genus is divided into five genogroups (Zheng et al., 2006). Genogroups I, II and IV contain human strains, and the genogroups are further subdivided into genotypes based upon analyses of the amino acid sequence of the major capsid protein, VP1. Norovirus infection causes gastroenteritis characterized by the symptoms of vomiting and diarrhoea (Atmar and Estes, 2006). The prevalence of vomiting along with the short incubation period (1–2 days) and short clinical illness (1–3 days) has been used epidemiologically to identify probable outbreaks of NoV-associated

Adenovirus

70 nm Complex

dsDNA 35 900 bases Pair

3–10 days Gastroenteritis All year Young children

Size Capsid

Genome Size Genome

Incubation Illness Season Age

1–2 days Gastroenteritis All year Young adults

ssRNA 8251 bases

27–32 nm Icosahedral

Aichi virus

3–5 days Gastroenteritis Winter Children

ssRNA 6797 bases


Astrovirus

Characteristics of the the main enteric viruses

Name

Table 18.1

2–3 days Gastroenteritis Winter All ages

ssRNA 7642 bases


Norovirus

7–30 days Diverse Summer All ages

ssRNA 7200 bases


Enterovirus

70 nm Triple layer Icosahedral dsRNA 11 genes (3302 to 667 bp) 3 days Gastroenteritis Winter Young children

Rotavirus

Up to 6 weeks Hepatitis All year All ages

ssRNA 7478 bases


Hepatitis A virus

546


gastroenteritis (Kaplan et al., 1982; Turcios et al., 2006). The virus is stable in the environment, and the infectious dose is estimated to be less than 20 virions (Teunis et al., 2008). Noroviruses are the major cause of epidemic non-bacterial gastroenteritis worldwide and have been identified as the cause of 73 % to more than 95 % of outbreaks (Atmar and Estes, 2006). Mead and colleagues estimated that there are 23 million NoV infections per year in the USA, and these viruses constitute 60 % of the illness burden caused by known enteric pathogens (Mead et al., 1999). Although some studies provide a good indication of the substantial illness burden that results from NoV infection, the true extent of disease may still not be fully known (Patel et al., 2008). Rotavirus Rotaviruses are the main etiological agent of viral gastroenteritis in infants and young children. They constitute a genus in the Reoviridae family (Estes and Kapikian, 2007). In developing countries the burden of rotavirus disease in children under five years of age has been estimated to be over 125 million cases annually, of which 18 million are severe cases (nearly half a million deaths) (Oh et al., 2003; Parashar et al., 1998). In the developed world, rotaviruses remain an important cause of morbidity and of hospitalization in young children, and they are also increasingly recognized as a cause of infectious diarrhea in adults as well (Anderson and Weber, 2004). Astrovirus Astroviruses are classified in genus Mamastrovirus (human and animal strains) within the family Astroviridae (Mendez and Arias, 2007). In most species astrovirus are found in association with gastroenteritis, although other manifestations have been described in avian species (Mendez and Arias, 2007). Enterovirus (EV) Human enteroviruses belong to the genus Enterovirus in the Picornaviridae family. Poliovirus is a species within the Enterovirus genus and its three serotypes each can cause a devastating neurological disease for which, despite vaccination campaigns, the goal of global eradication has not yet been completed. Other enterovirus species and serotypes cause a variety of other clinical syndromes, including respiratory infections, haemorrhagic conjunctivitis, and myocarditis (Pallansch and Roos, 2007). Aichi virus Aichi virus belongs to the Kobuvirus genus in the Picornaviridae family. Aichi virus was identified in several other outbreaks in Japan as a cause of gastroenteritis associated with shellfish consumption (Yamashita et al., 2000) and was recently recognized in an oyster-related outbreak in Europe in 2006 (Le Guyader et al., 2008).


547

Adenovirus (ADV) Human adenoviruses belong to the genus Mastadenovirus in the Adenoviridae family (Wold and Horwitz, 2007). There are six species of human adenoviruses, and members of species F (formerly called subgroup F), consist of two serotypes, Ad40 and Ad41 causing diarrhoea and also referred to as enteric adenoviruses. Hepatitis E virus (HEV) Hepatitis E virus is a member of the Hepeviridae family. It is the primary cause of enterically transmitted non-A non-B hepatitis in tropical and subtropical developing countries, and it has an associated mortality rate of up to 20 % in pregnant women (Lu et al., 2006).

18.2.2 Animal viruses, potential zoonotic viruses A number of enteric viruses inducing gastroenteritis in humans have also been identified in animals. The predominant animals involved are porcine and bovine species. These observations raise the possibility that zoonotic transmission may occur. Such transmission has been best demonstrated to occur among rotaviruses. Bovine–human and porcine–human group A rotavirus reassortants have been identified in India, Italy, Slovenia, and Brazil, and a porcine group C rotavirus was identified in a child in Brazil (Estes and Kapikian, 2007; Gabbay et al., 2008; Martella et al., 2008; Steyer et al., 2008). There is also the potential for zoonotic transmission of noroviruses. Several porcine genogroup II norovirus strains have been characterized and, based upon the sequences of their major capsid protein (VP1), they have been classified in genotypes that are distinct from those of human strains (Wang et al., 2005; Zheng et al., 2006). Bovine strains are even less related to human strains and have been classified in a separate genogroup (genogroup III) (Oliver et al., 2003). However, the ability of human strains to replicate in pigs and cattle (Cheetham et al., 2006; Souza et al., 2008) has been demonstrated experimentally, and a recent study from Canada reported the presence of human-like GII.4 norovirus strains in pig feces and retail beef (Mattison et al., 2007). To date, no human infections with animal norovirus strains have been reported, but the simultaneous detection of human and animal enteric calciviruses in oysters samples collected from the markets suggests the potential for such infections to occur if humans can be infected with animal strains (Costantini et al., 2006; Symes et al., 2007). The significance of such an infection is the potential for the emergence of new strains through recombination events, as such events appear to be common among human strains (Bull et al., 2007). Enteroviruses are also important pathogens for cattle and swine, and high concentrations of these viruses may be detected in surface waters (Fong and Lipp, 2005). As for norovirus, shellfish contamination with

548


animal and human enterovirus strains was demonstrated in oyster samples collected in an area impacted with both human and bovine sewage (Dubois et al., 2004). The stringency of the host specificity among human and bovine strains suggests that they can be good indicators for identifying human and non-human sources of fecal contamination of natural waters (Fong and Lipp, 2005). Hepatitis E virus is a potential emerging pathogen, and evidence of its global spread as a cause of disease in humans is increasing. Clear demonstration of sequence homology between strains detected among swine or other domestic animals has now been made in several countries (Renou et al., 2007; Rutjes et al., 2007; Kaci et al., 2008; Ward et al., 2008). However, transmission seems to occur primarily through direct contact with infected animal or food consumption (e.g., pig liver) (Renou et al., 2007; Lewis et al., 2008). Shellfish consumption has been reported as a risk factor for hepatitis E virus infection, but additional studies are needed to establish this link (Cacopardo et al., 1997; Koizumi et al., 2004).

18.2.3

Examples of outbreaks with a special emphasis on the source of virus contamination Despite the high diversity of viruses that are introduced into the environment by human fecal pollution, only a few have been recognized to cause disease in association with consumption of contaminated shellfish. Potential explanations for this observation include a lack of susceptibility of the persons consuming the shellfish to these viruses (i.e., pre-existing immunity), a requirement for exposure to higher doses than are present in the shellfish to establish infection, and a lack of recognition of disease either through under-reporting or the unavailability of sensitive diagnostic assays. The instigation of regulations to specify acceptable levels of bacterial enteric pathogens in shellfish tissues or in shellfish growing waters in Europe (European regulation, 91/492/EC) and the USA (National Shellfish Sanitation Program) and improvements in sewage waste treatment procedures were followed by the virtual elimination of shellfish-associated outbreaks of typhoid fever and cholera in the USA (Richards, 1985; Rippey, 1994). However, as shellfish-associated bacterial infection declined, outbreaks of non-bacterial gastroenteritis and infectious hepatitis were described in association with shellfish consumption (Butt et al., 2004). In many instances, the shellfish and shellfish-growing waters met regulatory criteria for fecal bacterial levels, suggesting an accidental contamination event rather than exposure to a continuous sewage discharge. The most common route for accidental contamination is after heavy rainfall, leading to overflow and release of untreated sewage into the aquatic environment. As mentioned above, untreated sewage is likely to be heavily contaminated by enteric viruses. Frequently the source of accidental events for shellfish contamination cannot be traced, but a number of reports have


549

been able to elucidate the cause of human fecal pollution. For example, several clusters of gastroenteritis occurred in six states in the USA and were linked to oyster consumption. The oysters implicated in the outbreaks were all traced back to a single harvest area, and the epidemiological investigation showed that the outbreak resulted from disposal of human diarrheal stool from a single ill individual directly into the waters over the shellfish bed (Kohn et al., 1995). Another example was a large oyster-associated gastroenteritis outbreak that affected approximately 2000 persons during the summer of 1978 in Australia (Murphy et al., 1979). This outbreak was linked to sewage contamination of the oyster harvesting area near Sydney following a heavy rainfall. Runoff from heavy spring rains was also suspected to be responsible for 103 clusters of norovirus gastroenteritis involving more than 1000 persons after clam or oyster consumption in New York State in 1982 (Morse et al., 1986). In the south of France, heavy rainfall and sewage treatment plant failure were twice implicated as the cause of large gastroenteritis outbreaks due to consumption of oysters harvested from a single lagoon (Le Guyader et al., 2006a, 2008). The long incubation period of hepatitis A complicates linkage of this agent to particular food exposure incidents. However, linkage is still possible during large incidents. In 1988 in Shanghai, China, almost 300 000 hepatitis A cases were traced to the consumption of clams harvested from a sewage-polluted area (Halliday et al., 1991). A sizeable hepatitis A outbreak in the USA in 1973 was linked to Louisiana oysters. The harvesting areas were flooded by the Mississippi River, and there was evidence of sewage contamination based upon elevated fecal coliform levels that led to closure of the oyster beds. Subsequently, the oyster beds were re-opened to harvesting, but apparently the hepatitis A virus was retained in shellfish for at least six weeks following the contamination event. At the time of harvesting, oysters were fully compliant with the US sanitation program standard but still contaminated with the virus (Mackowiak et al., 1976). Many other hepatitis A outbreaks linked to bivalve shellfish have been reported, but the initiating fecal contamination event has been generally difficult to identify due to the protracted incubation period for this disease (Bosch et al., 2001). In summary, where a cause is ascribed, most contamination accidents are linked to failures or bypassing of treatment processes, often due to heavy rainfall (Fig. 18.1). The problem is that heavy rain causes the storage capacity of the sewage treatment plant to be exceeded. In combined sewer and rainfall systems this leads to storm spills. Such discharges result in the release of untreated effluent heavily contaminated with microorganisms. This may be particularly true during the ‘first flush’. Other causes are flooding of harvest areas with contaminated river water and disposal of feces from infected individuals on boats. It is interesting to note that although the efficiency of sewage treatment processes at fully removing viruses from effluents can be questioned, such effluents are not usually associated with

550


Waste water treatment plant

Catchment area agriculture and urban activities

Shellfish farm wastes Spreading liquid manures

Fig. 18.1 Possible sources of contamination for shellfish growing in coastal area. (Source: Ifremer, www.ifremer.fr/envlit/)

bivalve mollusc disease incidents. However, because most enteric viruses retain their viability in the environment, they can persist for a much longer time in the marine environment than bacterial indicators – up to weeks or months (Wait and Sobsey, 2001; Lipp et al., 2002; Griffin et al., 2003). In addition, viral particles have been noted to persist for months in shellfish tissues, either via ionic binding or specific attachment (Burkhardt and Calci, 2000; Loisy et al., 2005a, Le Guyader et al., 2006b).

18.3 Methods 18.3.1 Rapid review Viruses are present in shellfish in very low numbers. Nevertheless, they are present in sufficient quantities to pose a health risk as presented above. This low level of contamination has made it necessary to develop highly sensitive viral extraction methods to ensure virus recovery from shellfish tissues. The observation that viruses are concentrated in digestive diverticulum tissues led to the development of a method that represented a major step in the improvement of extraction methodologies (Metcalf et al., 1980; Atmar et al., 1995). This observation was subsequently confirmed by detection of HAV (Romalde et al., 1994) as well as through the tissue-specific quantification of infectious enteric adenoviruses and rotaviruses in mussels previously contaminated by bioaccumulation of such viruses and similarly of Norwalk


551

virus in oysters and clams (Abad et al., 1997; Schwab et al., 1998). Analysis of digestive tissues provides several advantages, including increased sensitivity, decreased processing time and decreased interference with reverse transcriptase-polymerase chain reaction (RT-PCR) by inhibitory substances (Atmar et al., 1995). Focusing the analysis of shellfish on the digestive tissues enhances assay performance by eliminating tissues (i.e. adductor muscle) that are rich in inhibitors (Atmar et al., 1995). The digestive tissues represent about one tenth of the total animal weight for oysters and mussels. With the exception of small species, such as clams or cockles, in which dissection may be technically difficult, most recent methods are based on dissected tissues and thus will be discussed here. Extraction of enteric viruses from shellfish is based on several steps: virus elution from shellfish tissues, recovery of viral particles, and then virus concentration. The weight analyzed generally ranges from 1.5–2 g of digestive tissues. Some recent methods propose larger weights for the first step but thereafter analyze only a fraction of the extracts (Boxman et al., 2006). Viruses are eluted from shellfish digestive tissues using various buffers (e.g. chloroform–butanol or glycine) before being concentrated either by polyethylene glycol precipitation or ultracentrifugation (Atmar et al., 1995; Nishida et al., 2003; Myrmel et al., 2004; Milne et al., 2007). Direct lysis of virus particles has also been used, including methods utilizing proteinase K or Trizol® to destroy shellfish tissues or Zirconia beads and a denaturing buffer for virus and/or nucleic acid elution (Jothikumar et al., 2005; LodderVerschoor et al., 2005; Kittigul et al., 2008; Lowther et al., 2008; Umesha et al., 2008). In addition to the in-house protocols that have been used for nucleic acids extraction and purification (Le Guyader and Atmar, 2007), a number of commercial kits can also be successfully applied to accomplish this task. Advantages of the commercial kits used for nucleic acid purification include their reliability, reproducibility and ease of use. Most of these kits are based on guanidium lysis followed by capture of nucleic acids on columns, beads or silica (Nishida et al., 2003; Lodder-Verschoor et al., 2005; Costafreda et al., 2006; de Roda-Husmann et al., 2007; Kingsley, 2007; Milne et al., 2007; Fukuda et al., 2008; Nenonen et al., 2008; Umesha et al., 2008). One of the goals of extraction methods is to remove inhibitors of the RT and PCR reactions sufficiently to allow detection of viral nucleic acids. Polysaccharides present in shellfish tissue are at least one substance that can inhibit the PCR reaction (Atmar et al., 1993). Elimination of inhibitors is difficult to evaluate and, depending on the time of the year and shellfish life, different compounds may be present (Di Girolamo et al., 1977; Burkhardt and Calci, 2000). Internal amplification control standards are used to detect the presence of significant sample inhibition, and the amount and frequency of sample inhibition has varied depending upon the shellfish tissue being analyzed (Atmar et al.,1995; Schwab et al., 1998; Le Guyader et al., 2000). Recent advances in food virology re-enforce the need for

552


harmonization of methods as well as addressing quality assurance and quality control (Pinto and Bosch, 2008). The addition of an external virus to a shellfish sample has been proposed as a control to evaluate the extraction efficiency of molecular virus detection methods (Costafreda et al., 2006; Nishida et al., 2007; Lowther et al., 2008). An ideal candidate would have the following properties: (i) it would be an encapsidated RNA virus with properties similar to the enteric viruses contaminating shellfish; (ii) it would normally not be present in field samples (thus RNA phages may be problematic); and (iii) it would be nonpathogenic. Based on these considerations, Costafreda et al. (2006) proposed to use a mengovirus strain MC0 as a control for extraction efficiency. Mengovirus, a Picornaviridae family member, was initially proposed as a control in validation studies of HAV removal in blood products manufacturing by several agencies such as the European Agency for the Evaluation of Medicinal products and the American Food and Drug Administration (Pinto and Bosch, 2008). Advantages of mengovirus are that it is unlikely to contaminate shellfish naturally, it is non-pathogenic for humans and it can be grown in cell culture. The use of a single extraction control for different enteric viruses that may be detected in shellfish or other types of food is also considered to be important for method standardization (European working group CEN/Tag4) and for comparisons between different laboratories. Since the most important shellfish-borne viral pathogens (enteric hepatitis viruses A and E and noroviruses) are either non-culturable or grow only poorly in cell culture, RT-PCR and real-time RT-PCR have become the methods of choice for their detection. In addition to the problems posed by the presence of inhibitory substances in samples, there are other difficulties encountered when molecular analyses are performed for the detection of viruses in shellfish samples. These include low virus concentrations in the sample and genomic diversity of the contaminating viruses. The extraction– concentration procedure is not virus-specific, allowing the nucleic acid of several viruses to be extracted simultaneously. RT-PCR must be performed under stringent conditions and confirmed by hybridization. A number of reviews on RT-PCR methods are now available that address issues related to these methods, including assay specificity and sensitivity (Le Guyader and Atmar, 2007; Wyn-Jones, 2007). Real-time PCR assays allow the combination of RT, PCR and confirmatory hybridization assays in a single well, and these assays are now being used to detect enteric viruses in shellfish (Nishida et al., 2003; Jothikumar et al., 2005; Loisy et al., 2005b; Costafreda et al., 2006; Lowther et al., 2008; Le Guyader et al., 2009). This technology significantly shortens the time needed for virus detection by removing the need for gel electrophoresis and the additional hybridization step. When extraction, RT and PCR efficiencies are measured, virus quantification in the sample can be estimated (Costafreda et al., 2006; Le Guyader et al., 2009). The efficiency of the virus nucleic acids extraction is evaluated through the use of a model virus (as described above)


553

while the efficiency of the RT-PCR reaction must be tracked by amplification of a RNA standard using the same combination of primers and probe used for virus detection (Pinto and Bosch, 2008). Such internal RNA controls have also been used for the detection of amplification inhibitors in qualitative assays (Schwab et al., 1998; Le Guyader et al., 2003).

18.3.2 Quantification The development of quantitative molecular assays for the analysis of shellfish has allowed estimates of the level of virus in naturally contaminated shellfish. However, relatively few data are currently available in this area. One report estimated the amount of HAV in coquina clams implicated in an outbreak to be between 7.5 × 103 to 7.9 × 105 genome copies per g of digestive tissues (Coastafreda et al., 2006). Another recent report used a semi-quantitative approach for norovirus detection to compare the levels of virus contamination between sites without describing the amount of shellfish analyzed (Lowther et al., 2008). Japanese investigators estimated the levels of norovirus contamination in oysters collected from two areas ranged from 1000 mg kg−1 Ni, Cu, Se, As and Al, or >10 000 mg kg−1 Zn and Mn. For ethical reasons this field would be likely limited to invertebrates.

to reduce nutrient pollution from waste salmon feed (Stirling and Okumus, 1995; Neori et al., 2004). Oysters have been found to reduce the levels of nitrogen and phosphorus in shrimp effluent by 72 % and 86 %, respectively (Jones et al., 2001), while oysters and clams reduce turbidity and chlorophyll a concentrations in fish farm effluent by 68 % and 79 %, respectively (Shpigel et al., 1997). Accordingly, the deployment and harvest of shellfish has been proposed in Sweden (Haamer, 1996) and America (Rice, 2001) to mitigate anthropogenic nutrient input to coastal waters. In general, these bivalves have been cultivated with human consumption in mind, although this need

Zooremediation of contaminated aquatic systems

753

not always be the case. At an estuary level, the cultivation and harvest of pearl oysters (Pinctada imbricata) could potentially balance the nitrogen input of a sewage treatment plant (Gifford et al., 2005) (see case study, Section 23.3). Recently, interest has arisen over the use of sponges for bioremediation of aquatic microorganism pollution (Milanese et al., 2003; Fu et al., 2006). Sponges have a renowned filtering capacity and, in large communities, filter the overlying water column in as little as 24 h (Reiswig, 1974), with high particle retention rates (Milanese et al., 2003) and potential for economic gains via bath sponge material (Stabili et al., 2006b) or novel metabolites (Hadas et al., 2005) (see Chapter 28). A recent European study demonstrated a successful trial of the marine sponge Chondrilla nucula as an environmental remediator of bacteria (Milanese et al., 2003). This study estimated that a 1 m2 patch of this sponge can retain up to 7 × 1010 E. coli cells and filter 14 L h−1 of water. A similar Chinese study investigated the potential of the marine sponge Hymeniacidon perleve to remediate E. coli and Vibrio anguillarum II, with the sponges filtering up to 8 × 107 E. coli cells h−1 per g fresh sponge (Fu et al., 2006). Polychaete culture is well established, providing fishing bait for anglers and feed used for fish and shrimp broodstocks in aquaculture (Oliver et al., 1991). Polychaetes have been suggested as environmental remediators of microbial pollution, with Sabella spallanzanii and Branchiomma luctuosum demonstrating retention efficiencies of 70 % and 98 % of Vibrio alginolyticus (Licciano et al., 2005). It was estimated that a standing stock of 250 000 worms (S. spallanzanii) could be used to remediate the waste suspended particulate matter from a 50 t y−1 fish farm, producing about 50 kg d.w. of worm material annually, suitable as bait or as the basis of fish feed (Giangrande et al., 2005). Food fish culture in wastewater has been widely practised for more than a century (Edwards and Pullin, 1990) but, more recently, several studies have investigated the feasibility of employing traditional practices for ornamental species to ameliorate wastewater. Referred to as integrated wastewater aquaculture (IWA), the viability of the culture of ornamentals such as rainbow fish (Melanotaenia fluviatilis; Kumar and Sierp, 2003) and goldfish (Carassius auratus; Gavine and Gooley, 2007) has been assessed. Kumar and Sierp (2003) found that rainbow fish can be cultured in wastewater and were more tolerant of higher nutrient levels (N) than some ‘food’ fish, e.g. silver perch (Bidyanus bidyanus). Gavine and Gooley (2007) suggested that the most suitable species among those studied for IWA is carp (Cyprinus carpio), due to greatest biomass increases, but free-range polyculture with goldfish is also feasible. Goldfish cultured in dams receiving wastewater inputs exhibited the fastest growth rates of all the species examined, but mortality was high. In the dams stocked with fish, numerous water quality parameters were improved compared with initial wastewater inputs. Most notably, significant decreases in coliforms, total phosphorus and total

754


nitrogen were observed. Results suggest a productive use of urban wastewater, improvement in water quality, with increase in fish biomass for human consumption or alternative uses such as fish supply for the aquaria trade.

23.2.2 Zoostabilisation/degradation of nutrients and microorganisms Many filter-feeding animals act as benthic–pelagic couplers, where they actively transfer energy and nutrients from the water column to the benthos. In one of the most high-profile examples, Newell (1988) proposed that large-scale ecological changes in Chesapeake Bay due to eutrophication could have arisen from over-harvesting of oyster biomass. Newell contrasted the filtration capacity of the 1880 standing stock of oysters with that of 1988 and concluded it would have taken 3.6 days and 228 days, respectively, to filter the entire water column of the bay. This finding has led to a concerted effort to re-establish oyster bars in many areas of the USA for ecological reasons (Coen and Luckenbach, 2000; Kirby and Miller, 2005), with the largest, the ‘Chesapeake 2000 Agreement’, committing various stakeholders to a ten-fold increase in native oysters in the Chesapeake Bay by 2010, at a cost of US$100 million (CBPFAC, 2002). Recently the potential for success of the existing oyster restoration efforts has been questioned. Mann and Powell (2007) have argued that the remaining options for the Chesapeake oyster resource lies with husbandry, and that it is the economic deliverables accompanying aquaculture that are required rather than self-sustaining ecological goals. Other examples of the potential for filter feeders to act as ‘ecological engineers’ include the zebra mussel (Dreissenia polymorpha) and the Asiatic clam (Corbicula fluminea). Following the introduction of the zebra mussel, turbidity in Lake Erie decreased markedly, chlorophyll a concentrations reduced by 43 %, and mean sechi disc transparencies (a measure of turbidity) increased by 1.24 m (Leach, 1993). Meanwhile, Phelps (1994) reported that following establishment of the Asiatic clam in the Potomac River estuary, water quality improved substantially, with submerged aquatic vegetation that had been absent for 50 years reappearing. Subsequent fish and bird surveys revealed large increases in their respective populations. Following reductions in clam biomass, water quality declined and fish, bird and aquatic vegetation populations contracted. Evidence such as this has supported recent calls for the deliberate introduction of exotic bivalve mollusc species to aquatic ecosystems (Gottlieb and Schweighofer, 1996). In order to avoid the problems associated with the introduction of an invasive species, the use of native species is generally preferable unless it is certain that any exotic candidate species are non-invasive (see Section 23.4). In this regard, some debate has also surrounded the introduction of sterile (e.g. triploid) exotic species, although clear aquaculture and/or zooremediative incentives are required for continued maintenance of an effective population size.


755

In addition to bivalve molluscs, zoostabilisation of nutrient and microorganism pollution is conceivable for polychaetes, sponges, and a variety of filter-feeding invertebrates. Here, maintenance or supplementation of wild populations of these organisms could be used to manage nutrient or microbial pollution in aquatic ecosystems. Recognition of the importance of these ecosystem services may aid in the conservation of these communities (Ostroumov, 2005). However, research in this area remains poorly developed in comparison to oyster reef conservation and would profit from increased endeavour.

23.2.3 Zooextraction of heavy metals While no definition has been suggested for an animal metal hyperaccumulator, we propose the use of plant definitions as a useful reference (Box 23.1). A recent review by Gifford et al. (2004), focusing on bivalve molluscs, identified species which satisfy the plant definition of a hyperaccumulator for Cu (Crassostrea virginica, 2013 mg kg−1 Cu), Pb (Mytilus edulis, 506 mg kg−1 Pb), Cd (Pinctada albina albina, 108 mg kg−1 Cd) and Al (Crassostrea rhizophorae, 2240 mg kg−1 Al) and approached this status for Zn (Crassostrea virginica, 9077 mg kg−1 Zn). This phenomenon of hyperaccumulation is well known, and many such animals are presently used in various large-scale environmental monitoring programs (O’Connor, 2002). Das and Jana (2003) investigated the potential for the freshwater bivalve Lamellidens marginalis as a biofilter of Cd pollution in India, demonstrating a bioconcentration factor (BCF, the ratio of concentration within the organism to the exposure concentration) for Cd of up to 347 and a dry weight Cd concentration exceeding 500 mg kg−1 (Jana and Das, 1997; Das and Jana, 2003). Some metal hyperaccumulating animals offer non-food economic returns. Gifford et al. (2005) demonstrated that each tonne of pearl oyster (Pinctada imbricata) harvested resulted in 703 g metals removed from an estuary on the east coast of Australia (see case study Section 23.3). In further work our research group investigated uptake of Pb and Zn by pearl oysters under controlled laboratory conditions. Pearl oysters exposed to 90 μg L−1 of each metal accumulated 601 mg kg−1 and 209 mg kg−1 Pb as well as 4421 mg kg−1 and 54 mg kg−1 Zn in the soft tissue and shell, respectively (Gifford et al., 2006). On-going work will assess the effects of selected pollutants on pearl quality, with the aim of developing a model that optimises environmental and economic outcomes. The sponges represent a diverse group of animals offering the potential for non-food economic returns that have yet to be explored as metal bioremediators. Sponges are exposed to many metal pollutants within aquatic ecosystems. Due to their renowned filtration capacity, they are known metal bioaccumulators (Bargagli et al., 1996; Cebrian et al., 2003), and have a history of use as reliable biomonitors of marine pollution (Hansen et al., 1995; Perez et al., 2005). Indeed, the little work carried out on sponges

756


indicates that they meet the definition of hyperaccumulators for Cd: Halichondria panicea, 271 mg kg−1 (Cd, Cebrian et al., 2003) and Tedania charcoti, 15 000 mg kg−1 Cd (Capon et al., 1993). These characteristics, combined with recent interest in sponges as a source of novel pharmaceuticals and bioactive compounds (Licciano et al., 2005; de Voogd, 2007), indicate the possibility for a self-financing remediation program. Conceivably, other animals such as bryozoans, polychaetes, and ascidians, which are known to accumulate vanadium (Kawakami et al., 2006), could be used as environmental remediators of metals, and may also offer the potential for farming of novel chemical compounds (Box 23.2).

Box 23.2

Self-financing zooremediation models

The cost of environmental remediation programs can often be prohibitive, thus the development of ‘profitable’ remediation programs would enhance their use. Specialised animals that could function as a remediation model while at the same time producing a valuable economic product include: Pearl oysters: The pearls produced by pearl oysters are an ideal economic offset against the costs of remediation. They are easily stored, are not food products and have a high market value. Pearl oysters have been demonstrated to be effective nutrient remediators; however, further work is necessary to determine the effects of metals and organic pollutants on pearl quality prior to deployment against these pollutants. Sponges: As with pearl oysters, sponges provide an ideal opportunity for profitable zooremediation. Many sponge metabolites are in high global demand and fetch strong prices. For certain sponge taxa, bath sponge material offers an alternative economic return for programs aimed at nutrient and microorganism pollution (the use of chemically exposed bath sponge material is unlikely to be accepted in the market). However, culture of sponges is not as advanced as mollusc culture, and further work is required to demonstrate whether any effects exist on the metabolites of economic interest following pollutant exposure. Sponges have been successfully deployed as zooremediators of microbial pollution. Edible molluscs: Edible molluscs are well established as zooremediators of nutrient pollution. However, as products of human consumption, great care needs to be maintained to either depurate them of pollutants prior to sale, or to culture the organisms in estuarine locations not impacted by other pollution sources such as micro-organisms or metals. Nonetheless, increasing mollusc culture in estuaries is an economically advantageous method of nutrient stabilisation/reduction in estuaries suffering eutrophication.


757

Fishes: ‘Integrated wastewater aquaculture systems’ or ‘integrated agriaquaculture systems’ have for some time made use of nutrient-rich wastewater sources such as sewage and animal wastes to produce fish as a food source. Systems involving species such as carp are common in Asia and areas of Europe where they significantly reduce nutrient loads and microorganisms in nutrient enriched ponds. In some cases contaminant concerns restrict this practice for food production; however, the potential for production of ornamental and aquarium fish is unaffected. Gastropod molluscs, bryozoans, ascidians: There is current interest within the bioprospecting field investigating the pharmaceutical value of novel gastropod secondary metabolites. It is possible that some of these economic molluscs may possess attributes amenable to concomitant bioremediation such as the ability to accumulate or break down pollutants.

As with phytoremediation, there is a need for adequate treatment of harvested metal-laden animal biomass. Fortunately, systems are presently in use for the recovery of Cd in waste scallop tissue (Ghimire et al., 2008). In scallops, only the muscle and the gonad are eaten, while the remainder of the organism preferentially accumulates natural sources of Cd from marine waters and this tissue is removed and discarded from the animal prior to sale. As such, there has been a need to develop systems to properly handle the estimated 400 000 t Cd contaminated scallop waste generated in Japan through scallop processing (Seki and Suzuki, 1997; Shiraishi et al., 2003). The Cd is harvested from the scallop waste prior to being reused in a nearby car battery plant, while the scallop tissue now free of Cd is used as fertiliser.

23.2.4 Zooextraction of organic pollutants While the deployment and harvest of animals that hyperaccumulate organic pollutants is yet to be trialed, the use of sponges and fish has potential. Spongia officinalis is known to concentrate many organic contaminants including PCBs to higher concentrations than bivalve molluscs (BCF of approximately 105) (Perez et al., 2003). Thus significant quantities of PCBs could potentially be removed from aquatic environments upon harvest of sponge tissue. Recently fish have been proposed for zooextraction of PCBs and DDT (MacKenzie et al., 2004). Here, the authors propose that by not discarding overboard fish waste such as cod liver, Baltic Sea fisheries could remove 31 kg y−1 PCBs from the Baltic ecosystem. This amount compares to an annual influx of some 260 kg of PCBs, and would remove more from

758


the ecosystem than any other budgetary component (such as degradation in the water column).

23.2.5 Zoostabilisation/degradation of organic pollutants Several examples exist in the literature of the use of animals to degrade organic contaminants to less toxic by-products. Gudimov (2002) reported that degradation of oil was accelerated 10–20 times in the presence of Mytilus edulis. Similarly, the sponge Spongia officinalis is able to degrade the surfactant 1-(p-Sulfophenyl)nonane to its main degradation products, 3-(p-sulfophenyl)propionic acid and p-sulfobenzoic acid, ten times more rapidly than other taxa such as marine bacteria (Perez et al., 2002), the first evidence of pollutant degradation by a sponge. In addition, there is some evidence that this sponge is able to degrade the PCB CB138 (International Union of Pure and Applied Chemistry, IUPAC) (Perez et al., 2003). It is likely that many sponges are able to break down organic pollutants, particularly given their ability to produce and safely store many halogenated biomolecules within the cell. Recent research by our group has suggested a role for oysters in the reduction of estrogenic compounds in estuarine waters arising from a range of anthropogenic sources (Andrew et al., 2008). The oyster Saccostrea glomerata was capable of rapidly metabolising 17α-ethynylestradiol, when exposed to concentrations as great as 50 ng L−1, equivalent to the maximum level reported in UK sewage effluent (Desbrow et al., 1998). In addition, the differential accumulation of organic pollutants observed in molluscs could be used for zoostabilisation. The gastropod Austrocochlea constricta accumulated short-chain aliphatic hydrocarbons (C14-C18) in the soft tissue, whereas longer-chain aliphatic hydrocarbons (C20-C30) tended to accumulate in the shell (Walsh et al., 1995). The authors proposed that longer-chain compounds were isolated from metabolically active tissue and stored in the shell of the organism. As such, it is conceivable that certain contaminants could be remediated via isolation from trophic transfer by harvest and shell burial.

23.3 Zooremediation and pearl aquaculture: a case study Although zoodegradation is conceivable, perhaps the most appropriate form of remediation possible for commercial aquaculture is zooextraction of contaminants. Furthermore, aquaculture initiatives yielding commercial products which are not impacted by accumulated contaminants would be most desirable. In this manner, zooextraction occurs as a concomitant byproduct of the aquaculture process. Metal bioremediation of coastal waters has historically included the culture and harvest of various filter-feeding bivalve molluscs (Haamer, 1996;


759

Soto and Mena, 1999; Rice, 2001; Landry, 2002). Pearl oysters have several advantages over other bivalve species that have led to our group proposing their use as an environmental remediation tool (Gifford et al., 2004). The cosmopolitan distribution of many species of pearl oyster, such as the Akoya Pearl oyster, Pinctada imbricata, Röding 1798 (Colgan and Ponder, 2002), allows the possibility of utilising an endemic species for remediation in many locales. The high protein content of P. imbricata (Suzuki, 1957; Seki, 1972) implies that a greater nitrogen yield per tonne oyster flesh is likely. The fact that the profit is obtained from the pearl, and the flesh is not necessarily bound for human consumption (unlike many cultured molluscs), allows deployment to potentially reduce nutrients, metals and other forms of recalcitrant pollution in waterways. Finally, the commercial return via pearling operations may be used to offset the costs of remediation (disposal or recycling of contaminated product). Our initial studies have assessed the nitrogen, phosphorus and metal content of pearl oyster tissue and shell harvested from a small commercial pearl farm and evaluated the potential to offset inputs to an estuary from a local sewage treatment plant (STP), in Port Stephens, Australia. In total, 7.5 kg N and 0.55 kg P was harvested per tonne of oyster material. As the total August harvest of 2003 was 9796 kg oyster material, the total amount of nutrients removed from the Port Stephens environment in the year 2003 via pearling operations was 73 kg N and 5.3 kg P. This harvest also removed approximately 1413 g of a suite of heavy metals from the estuary, including 539 g Zn and Al, 276 g Fe, 10 g As, and 6 g Cd in soft tissue. The yearly harvest removed approximately 5469 g metals from the waters of Port Stephens via pearl shell harvest, dominated by 4955 g of Sr within the shell matrix; however, some 257g Fe, 121 g Mn, 81 g Zn, and 42 g Al were also sequestered in the shell. In total 6882 g of selected metals were removed. As the 2003 oyster harvest was 9796 kg, this equates to approximately 0.7 kg metals per tonne oyster material harvested (Table 23.1). It is important to note that these removal rates do not indicate the maximum potential for pearl aquaculture as an environmental remediation technology, particularly in regard to metal loadings. The concentrations of metals in the oyster tissue recorded in this study represent site-specific loadings of the relatively uncontaminated Port Stephens environment. If oysters are deployed in metal impacted sites, tissue and shell loadings would be predicted to increase (Gifford et al., 2004). The oyster material could then be treated to recover the metals prior to further use or disposal, based on the scallop waste model mentioned previously (Section 23.2.3). Pearling operations could also assist in remediating the nitrogen inputs from the STP within Port Stephens. Given that the average nutrient inputs to the port from the STP for the years 1999–2000 to 2001–2002 were 3741 kg N and 2967 kg P (NSW EPA, 2000, 2001, 2002), the existing pearl farm harvesting 9.8 t y−1 oyster material would have to expand production approximately 51 times to 499 t y−1 to balance the nitrogen from the STP.

Shell (mg kg−1) 3900 ± 200 268 ± 18.4 0.01 ± 0.01 13.3 ± 1.92 42.25 ± 5.89 BDL BDL BDL BDL 0.86 ± 0.19 6.89 ± 2.32 814 ± 22.6 BDL 1.25 ± 0.15 19.9 ± 1.59 BDL

Tissue (mg kg−1)

98200 ± 700 7400 ± 500 1.08 ± 0.29 1076 ± 68.5 551 ± 33.9 BDL BDL 20.2 ± 1.19 11.9 ± 0.68 BDL 1076 ± 80.5 51.7 ± 6.02 BDL 1.36 ± 0.14 30.9 ± 2.72 1.15 ± 0.26 49 193 3707 0.63 539 276 BDL BDL 10.1 5.96 BDL 539 25.9 BDL 0.68 15.5 0.58 1413

Tissue remediation (g) 23 739 1631 0.06 80.9 257 BDL BDL BDL BDL 5.23 41.9 4955 BDL 7.61 121 BDL 5469

Shell remediation (g)

72 932 5338 0.69 620 533 BDL BDL 10.1 5.96 5.23 581 4981 BDL 8.29 137 0.58 6882

Gross remediation (g)

Note: Calculation for remediation is as follows: The wet tissue material is, on average, 37.8 % total weight of the animal. The dry weight of this material is 13.5 % (N = 20) of the mass of the wet weight. Therefore, every tonne of P. imbricata harvested will be composed of 622 kg of shell material and 378 kg of tissue. This 378 kg of tissue will have a dry mass of 51.19 kg. The 2003 harvest was approximately 9786 kg oyster material. BDL = below detection limit.

N P Cu Zn Fe Pb Ni As Cd Cr Al Sr U V Mn Se TOTAL (metals)

Pollutant

Table 23.1 Nitrogen, phosphorus and metal concentration of various dried tissues from Pinctada imbricata (N = 20) and the remediation resulting from 2003 oyster harvest


761

An increase of this size would result in 272 kg P being removed from the port’s waters. Since 2003, additional lease area has been granted and pearl densities have increased so that the potential harvest has increased almost five-fold. Indeed, if as proposed, existing unused edible oyster lease areas were used for production of pearl oysters to a size suitable for pearl production, harvest could increase ten-fold. However, this remains small and sparsely stocked in comparison to many other commercial bivalve operations and would still be small in comparison to the estimated 591 t of edible oysters produced in the port. The efficiency of pearl oyster remediation is variable as a function of oyster condition, as nutrient content varies over the season and the oysters in our study were harvested in the middle of winter when flesh condition was low (O’Connor and Lawler, 2003). It is therefore likely that nutrient yield would be substantially improved by harvesting the oysters at a time prior to the Southern hemisphere winter, such as May. Provided pearl quality is satisfactory, some manipulation of pearl harvest dates is possible due to the ease of pearl storage, when compared with the hygiene issues surrounding edible bivalve harvest and storage. Further information is required on the tolerance of P. imbricata to various contaminants and contaminant mixtures; accumulation, equilibration, and depuration rates for contaminants of interest; temporal variation in accumulation of contaminants balanced with seasonal growth and deployment times required to produce quality pearls; and the potential effect of contaminants on pearl quality arising. Further, investigations are required to assess potential impacts of pearl oyster aquaculture on benthos beneath leases due to biodeposition of faecal and pseudofaecal material, at the stocking densities required to effectively decrease contaminant load. While acknowledging these unknowns, initial findings suggest that pearl aquaculture could form part of an overall coastal management strategy, particularly one aimed at maintaining water quality of coastal ecosystems whilst encouraging sustainable aquaculture.

23.4 Future trends Animals may be employed to extract or stabilise nutrient, microbial, heavy metal, and organic pollution. This can be achieved via the harvesting of wild populations or culture of animals to extract pollutants and/or the supplementation or maintenance of wild populations to stabilise/degrade pollutants. However, many questions remain to be addressed before zooremediation can be reliably adopted. The successful harvest of wild animal taxa for zooextraction of pollutants requires a clear understanding of the population dynamics of candidate taxa to ensure a sustainable harvest. The successful supplementation of wild animal populations for zoostabilisation with introduced species requires an understanding of the risk of candidate taxa

762


perturbing local ecological communities. In addition, specific care must be exercised when contemplating the addition of exotic species in order to avoid the risk of introducing invasive species. A sound understanding of temporal accumulation dynamics (accumulation, equilibration, depuration) is paramount to optimising extraction efficiencies (Box 23.3). Furthermore, it is generally preferable to focus zooremediation initiatives on invertebrate taxa in order to minimise ethical concerns (Box 23.4). The use of animal taxa for zooremediation is likely to trigger significant community and governmental interest. To formulate sound decisions, quality scientific data must be available. A suitable model is the current debate surrounding the introduction of the non-native Asian oyster Crassostrea ariakensis to Chesapeake Bay, USA. Here, a whole of government approach and the commissioning of a report by the National Academy of Sciences (NRC, 2003) has recommended that too little is known about the biology of C. ariakensis to confidently assert that its introduction to US waters would be successful. Thus in reality, it is likely that the research

Box 23.3 Checklist for candidate zooremediation species Zoostabilisation

Zooextraction

Trait Accumulate pollutant Resistant to toxicity Non-invasive Rapid growth rate Relatively sedentary Ease of culture Population dynamics known Uptake dynamics known Knowledge of carrying capacity Disease risks understood

Nutrients

Metals

Organics

Nutrients

Metals

Organics

*

*

*

*

*

*

*

*

*

*

*

*

* *

* *

* *

* *

* *

* *

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

* Indicates that trait is required for sustainable zooremediation.


763

Box 23.4 The ethics of employing animals for zooremediation The employment of animals for bioremediation initiatives is likely to trigger greater ethical concern from the community and decision makers than the use of plants or microorganisms. In this context, it is important to recognise that any employment of animals for zooremediation initiatives must be based on sound ethical principles. In many jurisdictions, the term animal refers to ‘all live non-human vertebrates’, thus most guidelines do not relate to invertebrate species. It is likely that the use of invertebrate animal species such as polychaetes, sponges and molluscs will meet little resistance and satisfy community ethical standards. However, this does not preclude the use of vertebrate species such as fish if it can be demonstrated that the ethics of such zooremediation programs conform to current best practice animal husbandry guidelines.

burden of introducing non-native species for zoostabilisation programs will support the use of native animal taxa in this role. Various forms of aquaculture (pearl oysters, sponges, gastropod molluscs, bryozoans, ascidians, and even edible molluscs in certain scenarios (Box 23.2)) hold greatest promise for zooremediation (zooextraction) of contaminated aquatic systems. However, the introduction, culture, and harvest of animal taxa for zooremediation requires detailed knowledge on the biological requirements for successful husbandry practices. In addition, knowledge of factors governing optimal carrying capacity, disease and parasitic risks, and impacts on surrounding ecology are necessary in order to successfully establish zooextractive aquaculture operations (Box 23.3). Zooremediation (specifically zooextraction) is perhaps most appropriate for aquaculture initiatives where the profit-generating product and its marketability are not impacted by accumulated contaminants, especially where the economic return is sufficient to offset the significant costs of postharvest remediation technologies (disposal, degradation, or recycling of contaminants within product). Pearl aquaculture is one such initiative where this approach may be feasible in the future, as initial studies suggest. Before such practice gains acceptance, further research is required to establish tolerance, temporal accumulation dynamics for optimal extraction efficiency, possible negative effects on pearl quality, and consumer perception. Finally, it may be some time before aquaculture ventures are financially rewarded for the zooremediative outcomes, but increased understanding and broader acceptance of the potential ecological benefits of specific aquaculture ventures is required. Further, the encouragement of suitable

764


ventures could be more actively considered and incentives developed to include aquaculture as part of an overall pollutant remediative strategy.

23.5 Sources of further information and advice Aspects of this work were presented at the 3rd European Bioremediation Conference, 2005. This chapter is a modified version of earlier publications including Gifford et al. (2005) Marine Pollution Bulletin, 50, 417–22, and Gifford et al. (2007) Trends in Biotechnology, 25, 60–65. Reproduced with permission from Elsevier Press.

23.6 References andrew m n, dunstan r h, o’connor w a, van zwieten l and macfarlane g r (2008) Effects of 4-nonylphenol and 17α-ethynylestradiol exposure in the Sydney rock oyster, Saccostrea glomerata: Vitellogenin induction and gonadal development, Aquat Toxico, 88, 39–47. bargagli r, nelli l, ancora s and focardi s (1996) Elevated cadmium accumulation in marine organisms from Terra Nova Bay (Antarctica), Polar Biol, 16, 513–20. capon r j, elsbury k, butler m s, lu c c, hooper n a r, rostas j a p, o’brien k j, mudge l m and sim a t r (1993) Extraordinary levels of cadmium and zinc in a marine sponge, Tedania charcoti: inorganic chemical defense agents, Experientia, 49, 263–4. carmona r, kraemer g p and yarish c (2006) Exploring Northeast American and Asian species of Porphyra for use in an integrated finfish-algal aquaculture system, Aquaculture, 252, 54–65. cebrian e, marti r, uriz j m and turon x (2003) Sublethal effects of contamination on the Mediterranean sponge Crambe crambe: metal accumulation and biological responses, Mar Poll Bull, 46, 1273–84. cbpfac (2002) Recommendations on Suminoe oyster (Crassostrea ariakensis) aquaculture in Chesapeake Bay, Chesapeake Bay Program Federal Agencies Committee, Annapolis, MD. chung y h, kang c, yarish g, kraemer and lee j (2002) Application of seaweed cultivation to the bioremediation of nutrient-rich effluent, Algae, 17, 187–94. coen l d, and luckenbach m w (2000) Developing success criteria goals for evaluating oyster reef restoration: ecological function or resource exploitation, Ecol Eng, 15, 323–43. colgan d j and ponder w f (2002) Genetic discrimination of morphologically similar, sympatric species of pearl oysters (Mollusca: Bivalvia: Pinctada) in eastern Australia, Mar Freshw Res, 53, 697–709. das s and jana b (2003) In situ cadmium reclamation by freshwater bivalve Lamellidens marginalis from an industrial pollutant-fed river canal, Chemosphere, 52, 161–73. desbrow c, routledge e j, brighty g c, sumpter j p and waldock m (1998) Identification of estrogenic chemicals in STW effluent. 1. Chemical fractionation and in vitro biological screening, Environ Sci Technol, 32, 1549–58.


765

de voogd n j (2007) The mariculture potential of the Indonesian reef-dwelling sponge, Callyspongia biru: growth, survival and bioactive compounds, Aquaculture, 262, 54–64. edwards p and pullin r s v (1990) Wastewater-fed Aquaculture, Proceedings of the International Seminar on Wastewater Reclamation and Reuse for Aquaculture, 6–9 December, 1988, Calcutta, Environmental Sanitation Information Center, Asian Institute of Technology, Bangkok. fao (2005). FishStat Plus, Food and Agriculture Organization of the United Nations, Rome, http://www.fao.org/fi/statist/fisoft/fishplus.asp, accessed January 2009. fu w t, sun l, zhang x and zhang w (2006) Potential of the marine sponge Hymeniacidon perleve as a bioremediator of pathogenic bacteria in integrated aquaculture systems, Biotechnol Bioeng, 93, 1112–22. gavine f m and gooley g j (2007) Adding value to recycled water through aquaculture – opportunities for large-scale implementation in Australia, Ozwater Convention & Exhibition, 4–8 March Sydney. ghimire k n, huang k, inoue k, ohto k, kawakita h, harada h and morita m (2008) Heavy metal removal from contaminated scallop waste for feed, Biores Technol, 99, 2436–41. giangrande a a, cavallo a, licciano m, mola e, pierri c and trianni l (2005) Utilisation of the filter-feeder polychaete Sabella spallanzii Gmelin (Sabellidae) as bioremediator in aquaculture, Aquac Int, 13, 129–36. gifford s, dunstan r h, o’connor w, roberts t and toia r (2004) Pearl aquaculture: profitable environmental remediation? Sci Total Environ, 319, 27–37. gifford s, dunstan r h, o’connor w and macfarlane g r (2005) Quantification of in situ nutrient and heavy metal remediation by a small pearl oyster (Pinctada imbricata) farm at Port Stephens, Australia, Mar Poll Bull, 50, 417–22. gifford s p, macfarlane g r, o’connor w a and dunstan r h (2006) Effect of the pollutants lead, zinc, hexadecane and octocosane on total and shell growth in the Akoya Pearl Oyster, Pinctada imbricata, J Shellfish Res, 25, 159–65. gottlieb s j and schweighofer m e (1996) Oysters and the Chesapeake Bay ecosystem: a case for exotic species introduction? Estuaries, 19, 639–50. gudimov a v (2002) Zooremediation, a new biotechnology solution for shoreline protection and cleanup, In Proceedings of the 25th Arctic and Marine Oilspill Program, 401–12. haamer j (1996) Improving water quality in a eutrophied fjord system with mussel farming, Ambio, 25, 356–62. hadas e, shpigel m and ilan m (2005) Sea ranching of the marine sponge Negombata magnifica (Demospongiae, Latrunculiidae) as a first step for latrunculin B mass production, Aquaculture, 244, 159–69. hansen i v, weeks j m and depledge m h (1995) Accumulation of copper, zinc, cadmium and chromium by the marine sponge Halichondria panicea Pallas and the implications for biomonitoring, Mar Poll Bull 31, 133–8. jana b and das s (1997) Potential of freshwater mussel (Lamellidens marginalis) for cadmium clearance in a model system, Ecol Eng, 8, 179–93. jones a b, dennison w c n and preston p (2001) Integrated treatment of shrimp effluent by sedimentation, oyster filtration and macroalgal absorption: a laboratory scale study, Aquaculture, 193, 155–78. kawakami n, tatsuya ueki t, matsuo k, gekko k, and michibata h (2006) Selective metal binding by Vanabin2 from the vanadium rich ascidian, Ascidia sydneiensis samea, Biochim Biophys Acta, 1760, 1096–101. kirby m x and miller h m (2005) Response of a benthic suspension feeder (Crassostrea virginica Gmelin) to three centuries of anthropogenic eutrophication in Chesapeake Bay, Estuar Coast Shelf S, 62, 679–89.

766


kumar m s and sirep m (2003) Integrated Wastewater Treatment and Aquaculture Production, RIRDC Publication No 03/012 Project No MFR-16A, Rural Industries Research and Development Corporation, Barton, ACT. landry t (2002) The potential role of bivalve shellfish in mitigating negative impacts of land use on estuaries, in Cairns, D K (ed.), Effects of Land Use Practices on Fish, Shellfish, and their Habitats on Prince Edward Island, Canadian Technical Report of Fisheries and Aquatic Sciences, 2408, 155–7. leach j h (1993). Impacts of the zebra mussel (Dressena polymorpha) on water quality and fish spawning reefs in western Lake Erie, in, Nalepa T F and Schloesser D W (eds), Zebra mussels: biology, impacts, and control, Lewis, Boca Raton, FL, 381–97. licciano m, stabili l and giangrande a (2005) Clearance rates of Sabella spallanzii and Branchiomma luctuosum (Annelida: Polychaeta) on a pure culture of Vibrio alginolyticus, Water Res, 39, 4375–84. mackenzie b r, almesjo l and hansson s (2004) Fish, fishing, and pollutant reduction in the Baltic Sea, Environ Sci Technol, 38, 1970–76. mann r and powell e n (2007) Why oyster restoration goals in the Chesapeake Bay are not and probably cannot be achieved, J Shellfish Res, 26, 905–17. mcvey j p, stickney r, yarish c and chopin t (2002) Aquatic polyculture and balanced ecosystem management: new paradigms for seafood production, in Stickney R R and McVey J P (eds), Responsible Aquaculture, CABI, Oxford, 91–104. milanese m, chelossi e, manconi r, sara a, sidri m and pronzato r (2003) The marine sponge Chondrilla nucula Schmidt, 1862 as an elective candidate for bioremediation in integrated aquaculture, Biomol Eng, 20, 363–8. nrc (2003) Non-native oysters in the Chesapeake Bay, National Academies Press, Washington, DC. neori a, chopin t, troell m, bushmann a h, kraemer g p, halling c, shpigel m and yarish c (2004) Integrated aquaculture: rationale, evolution and state of the art emphasising seaweed biofiltration in modern mariculture, Aquaculture, 231, 361–91. newell r i e (1988) Ecological changes in Chesapeake Bay: Are they the result of overharvesting the American oyster, Crassostrea virginica?, in Lynch M P and Krome E C (eds), Understanding the Estuary: Advances in Chesapeake Bay Research, Chesapeake Research Consortium, Edgewater, MD, 536–46. nsw e p a (2000) Hunter water corporation environmental protection licence annual return Tanilba Bay wastewater treatment works, New South Wales Environmental Protection Agency, Sydney, NSW. nsw e p a (2001) Hunter water corporation environmental protection licence annual return Tanilba Bay wastewater treatment works, New South Wales Environmental Protection Agency, Sydney, NSW. nsw e p a (2002) Hunter water corporation environmental protection licence annual return Tanilba Bay wastewater treatment works, New South Wales Environmental Protection Agency, Sydney, NSW. o’connor t p (2002) National distribution of chemical concentrations in mussels and oysters in the USA, Mar Environ Res, 53, 117–43. o’connor w a and lawler n f (2003) Reproductive condition of the pearl oyster, Pinctada imbricata (Roding) in Port Stephens, NSW, Australia, Aquac Res, 35, 1–12. olguin e j (2003) Phycoremediation: key issues for cost-effective nutrient removal processes, Biotechnol Adv, 22, 81–91. oliver p j w, bury n, cowin p b d and smithard r r (1991) Commercial production of polychaetes for angling: implications for mainstream aquaculture, in De Pauw


767

N and Joyce J (comps), Aquaculture and the Environment, Special Publication no. 14, European Aquaculture Society, Oostende, 241–2. ostroumov s (2005) Some aspects of water filtering activity of filter feeders. Hydrobiologia, 542, 275–86. perez t, sarrazin l, rebouillon p and vacelet j (2002) First evidences of surfactant biodegradation by marine sponges (Porifera): an experimental study with linear alkylbenzenesulfonate, Hydrobiologia, 489, 225–33. perez t, wafo e, fourt m and vacelet j (2003) Marine sponges as biomonitor of polychlorobiphenyl contamination: Concentration and fate of 24 congeners, Environ Sci Technol, 37, 2152–8. perez t, longet d, schembri t, rebouillon p and vacelet j (2005) Effects of 12 years’ operation of a sewage treatment plant on trace metal occurrence within a Mediterranean commercial sponge (Spongia officinalis, Demospongiae), Mar Poll Bull, 50, 301–09. phelps h l (1994) The Asiatic clam (Corbicula fluminea) invasion and system-level ecological change in the Potomac River Estuary near Washington, D. C., Estuaries, 17, 614–21. reeves r d and baker a j m (2000) Metal-accumulating plants, in Raskin I and Ensley B D (eds), Phytoremediation of Toxic Metals: Using Plants to Clean up the Environment, Wiley, New York, 193–229. reiswig h m (1974) Water transport, respiration and energetics of three tropical marine sponges, J Exp Mar Biol Ecol, 14, 231–49. rice m a (2001) Environmental impacts of shellfish aquaculture: filter feeding to control eutrophication, in Tlusty M, Bengtson D, Halvorson H O, Oktay S, Pearce J and Rheault R B Jr (eds). Marine Aquaculture and the Environment: A Meeting of Stakeholders in the Northeast, Cape Cod Press, Falmouth, MA, 77–86, seki h and suzuki a (1997) A new method for the removal of toxic metal ions from acid-sensitive biomaterial, J Colloid Interf Sci, 190, 206–11. seki m (1972) Studies on environmental factors for the growth of the pearl oyster, Pinctada fucata, and the quality of its pearl under the culture condition, Bulletin of the Mie Prefectural Fisheries Experimental Stations, 32–143 (in Japanese with English summary and figures). shiraishi t, tamada m, saito k and sugo t (2003) Recovery of cadmium from waste of scallop processing with amidoxime adsorbent synthesised by graftpolymerisation, Radiat Phys Chem, 66, 43–7. shpigel m, gasith a and kimmel e (1997) A biomechanical filter for treating fish pond effluents, Aquaculture, 152, 103–17. soto d and mena g (1999) Filter feeding by the freshwater mussel, Diplodon chilensis, as a biocontrol of salmon farming eutrophication, Aquaculture, 171, 65–81. stabili l, licciano m, giangrande a, fanelli g and cavallo r a (2006a) Sabella spallanzii filter-feeding on a bacterial community: ecological implications and applications, Mar Environ Res, 61, 74–92. stabili l, licciano m, giangrande a, longo c, mercurio m, marzano c n and corriero g (2006b) Filtering activity of Spongia officinalis var adriatica (Schmidt) (Porifera, demospongiae) on bacterioplankton: implications for bioremediation of polluted seawater, Water Res, 40, 3083–90. stirling h p and okumus i (1995) Growth and production of mussels (Mytilus edulis L.) suspended at salmon marine cages and mussel farms in two sea lochs on the west coast of Scotland, Aquaculture, 134, 193–210. sursala s v, medina f and mccutcheon s c (2002) Phytoremediation: An ecological solution to organic chemical contamination, Ecol Eng, 18, 647–58. suzuki k (1957) Biochemical studies on the pearl oyster (Pinctada martensii) and its growing environments. I. The seasonal changes in the chemical components of

768


the pearl oyster, plankton and marine mud, Bulletin of the National Pearl Research Laboratories, 2, 57–62 (in Japanese with English summary). walsh k, dunstan r h and murdoch r n (1995) Differential bioaccumulation of heavy metals and organopollutants in the soft tissue and shell of the marine gastropod, Austrocochlea constricta, Arch Environ Contam Toxicol, 26, 367–73.

24 Farming cod and halibut: biological and technological advances in two emerging cold-water marine finfish aquaculture species V. Puvanendran and A. Mortensen, Nofima Marin, Norway

Abstract: Both Atlantic cod (Gadus morhua) and Atlantic halibut (Hippoglossus hippoglossus) have been considered new candidates for aquaculture in North Atlantic countries including Norway, Canada, the UK, Iceland, and the USA since the 1980s. Differences in cultivation methods existed between these two species mainly due to the differences in life stages and their requirements of nutrition, tank dynamics, and environmental conditions. Initially, extensive cultivation methods were employed for cod and halibut using wild zooplankton; however, decades of research on intensive culture methods using rotifer and Artemia resulted in development of improved hatchery protocols. Improvements have been made in recent years in broodstock management for both species, which resulted in improved egg quality. Year around production of eggs through photo-manipulation has been achieved for cod and halibut, which is a major boast for the industry. However, a bottleneck still exists regarding broodstock nutrition, which generally contributes to inconsistent quality of eggs and larvae. Breeding programs have already been initiated for cod in Norway, Canada, and Iceland, and Ireland will follow soon. No breeding programs are available for halibut; however, a genomics program has been initiated for halibut in Canada. Research activities in the early 1990s have resulted in improved egg and yolk sac larval survival and quality in halibut. Intensive larval rearing protocols are available for both species; however, consistent production of high-quality juveniles and survival are still elusive. Apart from poor broodstock management, dependence on cultured live feed, especially Artemia often contributed to poor larval and juvenile quality. However, attempts to replace live feed with formulated diets have been partly successful for cod, and currently most hatcheries in Norway are using only rotifers in their feed regime. Further improvements in feeds and feeding strategies are warranted to reduce the dependence on live feed further. Poor husbandry practices during larval stages could also result in major loss as the immune system of the larvae is underdeveloped. The on-growing phase of both species is more stable compared to the larval phase; however, disease outbreaks, both viral and bacterial, could provide major threats. More research should be conducted on developing vaccines for these disease problems. Escapes

772


of cod from grow-out systems have become a major problem and more research is needed on cage technology and fish behaviour to minimize these escapes. Research is also needed to produce all-female stocks and sterile fish to avoid fertilized eggs escaping to the wild. Early maturation has been recognized as the major bottleneck in cod culture and light administration appears to have limited effectiveness in preventing early maturation. Production of sterile fish would be a solution not only for minimizing fish escapees interacting with wild fish but also for minimizing early maturation. Market development need to be addressed with an emphasis on product quality and food safety. Key words: alternate species, cod, halibut, production technology, broodstock management, larviculture.

24.1 Introduction Globally, aquaculture remains the fastest growing animal food sector (FAO, 2007), and over the decades, commercial aquaculture in the Northern hemisphere has primarily relied on salmon aquaculture. The most recent decline in salmon prices from 2001–2003 highlights the importance of diversification through introducing new species for culture. From the mid-1990s on, the Northern hemisphere has focused on developing indigenous species for diversification, with research concentrating on candidate species that have positive biological and economic attributes, e.g. simpler life stages, better flesh quality, established and/or higher market value (Le François et al., 2002). Several marine finfish species, such as cod, halibut, flounders, haddock and wolfish, were evaluated for their potential as appropriate aquaculture species since the 1990s. Most species were dropped and research since year 2000 has focused successfully on cod and halibut, which have a high market demand. The difficulties of the complicated life cycle of halibut, characterized by a very long yolk-sac development phase and early first feeding, are compensated for by its high market value, whereas cod, also has poorly developed newly hatched larvae but a relatively short yolk-sac stage (Fig. 24.1). The iconic status of cod as the premium white fish in the European and North American markets and declines in worldwide catches of cod have created a demand for product, which has accelerated cod production rapidly since 2003. The annual production of cultured cod is expected to be 20–30 000 tons in 2008 while the production of halibut is expected to reach 7–10 000 tons. Research on cod and halibut has been designed to progress towards commercialization from the initial fundamental research and pilot-scale commercial production. To achieve this, efforts have been undertaken by the scientific community with the support of the industry and funding agencies to develop the basic rearing protocol of these species. These efforts

Farming cod and halibut: biological and technological advances

773

Adult cod

To table

~15 days 5–6 °C 2–3 years (2–3 kg)

Fertilized egg stage

Cod life cycle in captivity

On-growing stage

2–3 days 4–8 months (0.1–100 g)

Yolk sac larval stage 40–45 days

Weaning and nursery stage

Feeding larval stage

To table

Adult halibut

~15 days 5–6 °C

~3 years (3–4 kg) On-growing stage

Fertilized egg

Halibut life cycle in captivity

6–8 months (0.1–100 g)

30–45 days Yolk sac larval stage 200–280 days

Weaning and nursery stage

70–85 days

Feeding larval stage

Start feeding larval stage

Fig. 24.1 Life cycles of Atlantic cod and halibut in captivity. (Pictures of cod broodstock and eggs are provided by Lynn Lush of Department of Fisheries and Oceans, Canada and halibut pictures are provided by Brian Blanchard of Scotian Halibut Ltd., Canada)

774


resulted in developing the basic production protocols for these two species; however, problems still exist in achieving consistent high survival of goodquality juveniles. The focus was then shifted to other important issues such as culture techniques, nutrition, selective breeding, cage technology, product quality, and marketing. In this chapter, we will discuss progress made by the scientific community and industry since the 1990s, starting from basic research to current technology.

24.1.1 Current and past research activities A review on cod aquaculture research activities from the mid-1980s until 1990 was presented by Tilseth (1990) while a special issue on halibut culture published in Aquaculture Research in 1998 (van der Meeren (ed.), Volume 29, issue 12) reviewed the halibut culture research activities from the 1970s to 1998.

24.2 Atlantic cod The current supply of Atlantic cod from capture fisheries has declined to one million tonnes per year from its peak of four million tonnes in 1969. All the cod stocks in the North Atlantic are either over exploited or in decline and quotas have been reduced in all jurisdictions. The Northern Cod stock fishery off Newfoundland has been under moratorium since 1992, with the stock recently being listed as a threatened species by the Committee on the Status of Endangered Wildlife in Canada (COSWIC). Since the recovery of cod stocks does not look promising and demand for white fish is increasing, interest in cod aquaculture has gained momentum. With the scarcity of wild cod in the market, the market price for cod increased, making intensive culture of cod more feasible compared to earlier attempts using capture-based aquaculture. Research on aquaculture of Atlantic cod started in Norway in the early 1980s concomitant with sharp declines in cod quotas. The first symposium on cod aquaculture was held on 1983 in Arendal, Norway. Initial attempts at rearing cod in an intensive environment met with limited success due to poor understanding of broodstock biology, environmental requirements, and larval nutrition. Subsequently, interest in cod aquaculture was reduced as the stocks rebuilt and by the mid-1990s focused research on cod aquaculture was also severely reduced. However, basic research on juvenile production still continued. Other than Norway, Newfoundland was the other major jurisdiction where cod aquaculture research has been an on-going activity since 1984. Initially in Newfoundland capture-based cod aquaculture was popular among cod fishermen from 1985 until 1995; however, this practice ceased due to lack of access to stock for grow-out. Early research focused on


775

developing the economic parameters for successful cod aquaculture, including food and feeding, stocking density, disease management, vaccines, etc. With the decline in the fishery and the introduction of moratoria in the major areas where capture-based aquaculture was centred, the focus shifted to intensive aquaculture methods. Newfoundland researchers never experimented with either extensive or semi-intensive culture, believing that methods used in the Mediterranean for bass and bream would be easily adapted for use with cold-water species. The first commercial cod hatchery in Newfoundland was constructed in 1995 and produced 20 000 juveniles in 1996. Unfortunately this commercial activity ceased in 1997 when the hatchery was destroyed by fire. The success of intensive culture in Newfoundland spurred a significant investment in intensive cod aquaculture research in Norway, and subsequently significant investment in commercial production. Both Newfoundland and Scotland, the other major centre for cod aquaculture research, have fallen behind developments in Norway. Figure 24.2 shows the trend in cod juvenile production in Norway from 2002 to 2006 (Norwegian Fishery Directorate statistics 2007). The juvenile production, however, was expected to increase 5–6 fold in the next five years to 90 million juveniles (Rosenlund and Halldórsson, 2007). During this period of intensification, it became apparent that further research was needed in order to attain consistent production of cod fry in both numbers and quality. Although basic rearing protocols were developed, further research in broodstock, fine-tuning the existing production protocols, nutrition, disease management, product quality, on-growing, and market development are still needed.

16 14

# of juveniles produced (millions) Aquaculture harvest (× 1000 tons)

Production

12 10 8 6 4 2 0

Fig. 24.2

2002

2003

2004 Year

2005

2006

Cod aquaculture production in Norway from 2002 to 2006. (Source: Norwegian Fishery Directorate Statistics, 2007)

776


24.2.1 Broodstock Most of the initial cod research focused on ensuring the mass production of juveniles for successful commercialization of cod aquaculture. Focus on broodstock research has received little attention, as egg supply is not limited. A single adult cod can produce millions of eggs in a breeding season. Cod are batch spawners that are easily maintained in tanks under light and temperature control, and spawn spontaneously in captivity. Floating eggs are collected via a surface out-flow using an egg collector situated externally to the tank, or in some cases collected within the broodstock tank using a suction collector. Cod generally spawn in March to June. For successful commercial production, eggs should be available throughout the year. Recent studies have shown that year-round egg production can be easily achieved by photoperiod manipulation alone (Penney et al., 2006a; van der Meeren and Ivannikov, 2006). In this method, the natural photoperiod is shifted so that the fish’s spawning may be advanced or delayed according to hatchery or environmental requirements. The quality of the eggs and larvae are not affected by this photomanipulation (Fig. 24.3; Penney et al., 2006a, b) which is a major advancement in cod aquaculture given that the cost involved is minimal but the return enormous. Currently, several cod hatcheries are using photomanipulation techniques to obtain year-round seed supply. Broodstock management is the bedrock of an aquaculture operation on which further production success depends. Until recently, it was a general 160

Spawning characteristics

140 120 100 80 60 40 20 0

2002

2003 Year

2004

Fig. 24.3 Comparison of number of egg batches, spawning duration and number of eggs produced (in millions) of photo-manipulated (PM) and ambient (A) spawning groups of Atlantic cod. Closed symbols denote PM group and open symbol denote the A group. 䊊 and 䊉 denote number of egg batches, 䉫 and 䉬 spawning duration and 䊐 and 䊏 number of eggs produced. (Data extracted from Figures 1 and 2 from Penney et al., 2006a)


777

practice not to feed spawning cod during the spawning period on the expectation that, as they are stressed, they will not feed. The combined effects of spawning stress and starvation generally resulted in higher mortality, up to 50 %, in cod during spawning. A cod broodstock program initiated in 2002 at the Ocean Sciences Centre, Newfoundland, Canada, dramatically improved the egg fertilization and hatch rates of cod. Continued feeding during spawning season at a limited ration has reduced broodstock mortality to batch)

Process line/ Shift/sequence

Grow-out (record by batch – often combined or split)

Feed and medicines (record by batch/treatment)

< Batch attributes and process identifiers

Vehicle ID/ Journey ID

Processing/ Wholesale (split batches to trade units)

Ice and chemical inputs (record by batch/treatment)

Transport (aggregate trade units into logistics units)

Retail (record by sales unit)

< Ingredient and treatment sources and use

Labels on trade units, logistics units and usually sales units provide essential information, but most importantly, a key to the detailed product history via a unique identification (ID) code

Product name Product origin Farm/site/ batch ID Quantity Presentation Storage instructions 1

2 2 3 4 56 78 9 0 1

2 3 4 5 6>

Fig. 35.11 Example elements of traceability systems.

This, for instance, involves monitoring and recording product temperature throughout processing and distribution (‘the chill chain’). The records must be made available to relevant national authorities when required and, more significantly, must be available to the receiving food business on request. For businesses rearing animals, and this includes aquaculture, records must also be kept on the use of veterinary products. Regulation (EC) 1830/200327 adds further specific requirements for the traceability of genetically modified materials. Whilst implementing traceability is often perceived as a burden, many companies have found that greater monitoring, particularly if it is properly analysed, can result in significant efficiency gains and savings. This is particularly the case with respect to internal traceability – the factors over which the company has direct control. Downstream companies such as processors are also finding that analysis of traceability data passed to them can provide useful information for improving product quality or minimising waste.

Use of information technology in aquaculture

1093

Information and communication technologies that support traceability continue to become more powerful and cheaper to implement. The basic elements are a means of labelling batches with a code number, a database to record details about the batch and, critically, a means of linking related batch records so that the database can be queried to provide a full history (if tracing backwards), or to identify final products linked with a particular batch of feed ingredients. This is relatively straightforward in any modern multitable relational database. Often confused with traceability is product tracking, which is essentially quite separate, but frequently combined with traceability functions. Traceability records the origins of a product and the processes through which it has passed, whilst tracking is recording of the specific path taken by products through the production and distribution chain. This will normally include spatial and temporal data, often allowing the exact location to be determined in real time. Both tracking and traceability data are useful for management and are often linked in terms of collection and storage. The most effective systems make full use of automation where possible to minimise the amount of information that has to be entered into the computer system manually; and also make best use of networking technologies to link different elements together. Typically a tracking and traceability system might use: • Real-time (or sometimes batch) links between the traceability application and other management information tools, such as stock management – this eliminates the need for retyping and reduces potential transcription errors. • Automated data capture – such as bar code labels and scanners, or the more sophisticated radio frequency identification (RFID) tags and readers (Text Box 35.1) to reduce the need for manual input of batch

Box 35.1

RFID tags

Radio frequency identification (RFID) tags build on the functionality of bar codes in at least two important ways. First, they do not need to be scanned individually by an optical device; instead they are interrogated via radio signals, meaning that many tags can be scanned virtually simultaneously as they pass within range of the detector. Second, in addition to transmitting a code number, they can also store and transfer additional data. This may be product data that would normally be on printed labels but, through the coupling of RFID tags with temperature sensors for instance, could also allow product temperature to be interrogated remotely. Most RFID tags contain at least two parts: first, an integrated circuit for storing and processing information, handling the modulation and

1094


demodulation of the radio signal and other specialised functions; second, an antenna for receiving and transmitting the signal. There are at least three general types of RFID tag. • Passive RFID tags: Passive RFID tags have no internal power supply. These receive just enough electrical current from the incoming radio signal to power the integrated circuit and transmit a response. The range of passive tags is between 10 cm and several metres depending on the chosen radio frequency and design of the antenna. Passive RFID tags tend to be smaller and cheaper than other types, making them most suitable for tagging final individual products. Designs are also available for inserting under the skin of animals (or humans) (see earlier discussion of PIT tags). • Active RFID tags: Active RFID tags have an internal power source and can typically transmit data over several hundred metres with greater reliability than passive tags. They can include more sophisticated functionality (extended capability) such as incorporation of sensors for temperature, humidity, shock/vibration, light, radiation and specific gas detection. Logging facilities for these can also be included so that time series datasets can be retrieved from the tags. Battery life on such tags can be up to 10 years. As these are larger and more expensive, they are best suited at present for incorporation in containers or cartons rather than at the level of individual product. • Semi-passive RFID tags: Semi-passive RFID tags are similar to Active tags, but the power source is only used for the microchip (integrated circuit) and not for the broadcast signal. Most of the advantages of active RFID chips are retained, but battery life is improved with only some loss of range and sensitivity. For all types of tags, readers can be small portable devices, or built into other equipment. Some hand-held units have built-in displays and data logging facilities for subsequent download to a computer. Most, however, will be connected to computers and networks to directly load information into central databases. Further information: http://en.wikipedia.org/wiki/RFID

identification data into the computer system. This can be extended to include the use of other data logging instruments such as fish counters, weighing machines, feed dispensers, temperature probes, GPS devices, etc. As product moves through a process, such devices can capture and record relevant data automatically. • Network technologies for linking elements – for instance data can be passed from point of capture to a central database using a range of wired or wireless technologies; likewise the central data can also be accessed


1095

from many locations to provide management information wherever it is needed. Increasingly, tracking and traceability applications are Internetbased, allowing company employees and sometimes suppliers and customers to access customised reports or data input forms via standard web browsers. Companies providing tracking and traceability applications for aquaculture and fisheries include AkvaSmart, Maritech, AquaAssist, TraceAll, De Haan Automatisering (DHA), Marel Food Systems and Olrac. These are often extensions to packages originally developed for internal monitoring and control. Custom-built applications are also commonly in use, especially by larger vertically integrated companies. In general, tracing and tracking information is used within the market chain with only minimal information normally passed to the consumer (Text Box 35.2). However, in Taiwan, Tekho Company Ltd is using recyclable passive RFID tags on individual grouper sold through the An Pin Live fish Centre in Tainan to provide full traceability to restaurant customers. The system uses Microsoft BizTalk RFID platform which integrates database servers, web modules and hand-held devices. In the restaurant, a

Box 35.2

Case study – tracking technology in action

TraceAll, a UK company, provides tracking solutions for fisheries. Data loggers on fishing vessels collect position data from GPS devices and record corresponding data from sensors to detect the deployment of fishing gear, the temperature in the fish holds and the weight of fish caught. Operators can add additional data concerning species and observations on fishing conditions. The data are regularly uploaded via satellite telephone, cellular telephone or radio communication links, to a central database, providing shore-based managers with useful real-time information for marketing and fleet management. Once landed, boxes of live product such as Nephrops (langoustine) or pallets of chilled fish (e.g. in boxes) can be tracked in a similar way via sensors, data loggers and uploading via cellular telephone networks. The hardware consists of a small black box that can be easily hidden in packaging or transport containers. This uploads location, temperature, shock and, perhaps, other data from on-board sensors to the central server, either continuously or at set time intervals. Company employees or authorised customers can use a web browser to view the location of the product on real-time maps (e.g. Google maps) and view reports on the data collected. This has often proved invaluable, identifying exactly when and where products are spoilt or even stolen, but otherwise providing assurance of good practice. Further information: http://www.traceall.co.uk/

1096


waiter can scan a tag and print out a certificate showing the basic history and qualities of the fish. Consumers can also enter the fish code number into a website and obtain the full traceability history (Swedberg, 2008 and Microsoft, 2007).28,29 Having a variety of companies providing tracking, tracing and management information solutions provides competition and choice, but would lead to major inefficiencies if data cannot be easily transferred from one system to another. Much of the value of computerised traceability data would be lost for instance if downstream companies have to rekey data, or refer to paper records. This issue was addressed in the EU TraceFish project, which looked only at chain traceability, and developed draft standards for exchanging traceability information through the market chain. There are two key elements to this. The first is the use of a common standard for identifying products, locations and shipping containers. This currently exists in the form of GS1 (Global Standard One), formally EAN.UCC (European Article Numbering-Uniform Code Council). This is a system for allocating unique bar codes so that physical items can be labelled and immediately related to information about the item held in a computer database by reading the bar code with a hand scanner. For legal chain traceability purposes purchasers need only record the bar codes into their own systems. If there is a need to trace a product, the barcode will provide the link backwards through the chain. Barcodes are not very informative without the support of computer systems, however, so labels will normally include other human readable information. The barcode system on its own also does not allow for the passing on of some of the essential secondary information that is now required under EC legislation. For that, additional data must be passed on associated with the barcode. The TraceFish project promoted the use of XML (eXtensible Markup Language) as the universal standard for exchanging data between different computer systems, over the older EDI (electronic data interchange) standard. The work of TraceFish has been further developed under the EC TraceFood project which is developing ‘TraceCore’ XML standards for all food products. These have already been adopted by several software providers, including Olrac, for instance in the EC SHEEL project, which is developing ways for exchanging fishing boat logbook data. This is a complex and developing area, however. GS1 also has standards for the automatic transmission of electronic data between trading partners, a global data synchronisation network for ensuring all partners have consistent data in their systems, and is working on a standard RFID system for tracking items. The company TraceTracker is working closely with the EC Seafood Plus and Trace projects, as well as GS1 standards to provide a ‘global traceability network’ as a subscription service to enable companies with different information systems to easily exchange traceability data. The aquafeed company Skretting joined this system in March 2008 (Skretting, 2008).30


1097

35.3.3 Marketing and sales Marketing is concerned with discerning customer wants and focusing the company’s products or services to meet them. Ensuring customer awareness and encouraging them to purchase the company’s products or services follows on from this. Sales is the function of optimally matching supply and demand through customer communications and individual sales deals. Although related, marketing and sales are functionally different and often form separate departments in larger organisations. Many smaller aquaculture enterprises utilise the service of agents to handle sales, and rarely assign much resource to marketing. There are exceptions in companies that seek to differentiate their product and hence achieve a price premium. Aquaculture sales commonly involve telephone negotiation with customers with orders confirmed by email or fax. Accounting and stock control software will commonly handle the transaction once an order has been placed. For busier sales offices there can be considerable value in having linked sales and customer relations management software. Separate packages are available, or add-on modules to popular accountancy programmes. These allow sales people to record all their interactions with customers, note expected forward orders, share details with colleagues and analyse longer-term sales patterns. The task of matching actual production with customer orders as well as taking into account distribution logistics and costs is a complex one and often customised software solutions are required to achieve full integration with other systems. As far as possible, companies try to ensure they have firm orders for all production is before it is harvested, with long-term contracts quite common. However, production estimates may be inaccurate and adjustments need to be made to orders, or additional customers found, once final harvest details are available. Once deals are finalised, financial transactions are usually conducted through electronic fund transfer systems facilitated by the company’s bank. In the capture fisheries sector, fish auctions are common. Aquaculture producers might also use them when stock needs to be sold quickly and other channels to market are not available. These are increasingly being updated to ‘electronic fish auctions’ where bidding is via an electronic system, which is faster and provides electronic documentation for buyers, sellers and authorities. In some places, these have also been connected to the Internet, providing wider access for trading, or simply for monitoring market conditions. For some aquaculture producers, especially those marketing directly to consumers, the Internet may provide a suitable channel for direct sales. Establishing a commerce-enabled website is relatively straightforward, particularly if the company is already approved by their bank for receiving credit card payments. More technically complex is linking an Internet sales

1098


system with existing accounts and stock management systems, although this is also becoming easier using tools available from leading accountancy software suppliers.

35.3.4 Public relations Many aquaculture companies find it increasingly necessary to develop a public relations strategy. This may be for product promotion, investor relations, or to communicate with the wider public on issues such as food safety and environmental responsibility, where misinformation is commonly disseminated by other parties. Such communication strategies may use a number of channels, but developing a company web site is one of the most common and cost-effective. Designing and creating a site that communicates well is quite difficult and usually requires specialist advice and assistance. Maintaining a site to provide up-to-date news and information requires particular attention. In general this is an area where the aquaculture industry has much to learn, with the Internet providing opportunities for communication. These include the potential for developing interactive farm guides, quizzes for children, audio podcasts, slideshows and video clips to help educate the public, or packaged information for news media and politicians.

35.4 ICT in aquaculture innovation and learning 35.4.1 Linking innovation, research and learning It is widely recognised that innovative organisations are better able to respond to changes in the external environment and compete in the increasingly globalised economy. Innovation is therefore good for local and national economies and is invariably supported in many ways at the policy level. Central to this is the creation of strong linkages between commerce and research, and the fostering of lifelong learning. Exploration of the relationship between government, academic and commercial research, and economic development and performance is beyond the scope of this chapter. However, it is worth noting that the emergence and use of the Internet is helping to break down some of the traditional barriers for companies wanting to access research results or participate in research projects. This includes the development of online research repositories, either freely accessible or providing instant access to research papers for a fee. These are supported by online bibliographic search tools that offer much greater accessibility than the traditional printed versions. Presentations made at conferences are now much more commonly distributed from event or organisation websites. Access to researchers and debate on current issues has also been opened up by the use of public email


1099

and web discussion forums and blogs. To a more limited extent there has also been experimentation with ICT-based expert systems, to provide tailored knowledge and advice to non-experts depending on their responses to structured questions. For instance veterinary diagnostic software such as fish-vet (Zeldis and Prescott, 2000)31 and T-Vet (Li et al., 2006)32 or the earlier Hawaii Aquaculture Module Expert System for tilapia (Brock and Itoga, 1993).33 Lifelong learning is an important component as individuals within organisations who are open and engaged with learning are more likely to be oriented to problem solving and creative thinking. Furthermore, they will be better equipped to effect change through possession of latest knowledge and understanding. Lifelong learning may be formal, non-formal or informal. Formal learning generally involves taught courses, or at least supervised learning that is assessed and leads to formal qualifications. Non-formal learning is structured and organised, but does not lead to a qualification (e.g. in-service training). Informal learning involves working experience, discussion with colleagues and contacts, and knowledge acquired through books and other media.

35.4.2 Applications of ICT in aquaculture education and learning Once again, the Internet is central to many of the current developments in learning and teaching. One feature is the increasing volume of information or ‘learning resources’ that are available through the Internet. Whilst there are legitimate concerns about the quality of much of the information on the Internet (e.g. Keen, 2007),34 the steep change it brings in access is too great to be ignored. A rural aquaculture worker can now access from home a far larger knowledge base than has previously been available from the best academic libraries. Whilst the latter are by no means replicated by the Internet, the need for large physical repositories of printed materials will gradually decrease as electronic documents become the more prevalent format. The low cost of Internet publishing is one of the key drivers, lowering the barriers for anyone with information or opinions that they wish to disseminate. The quality control that has traditionally been exercised through academic peer review, specialist publishing companies or material selection by librarians does not generally exist on the Internet. This places more onus on users of the information to assess and verify its quality. It is also leading to new models of collaborative quality control such as that exercised by the Wikipedia encyclopaedia service. That said, the Internet is also allowing many people with valid, but very specialised, knowledge and experience to publish it without facing the barriers that may be encountered when dealing with other commercial or academic bodies. ICT is not only facilitating access to material, it is also providing lowercost tools for authoring. Word processors, presentation software and

1100


desk-top publishing applications enable individuals to be both author and publisher. Cost barriers are also falling for audio and video productions such that they are becoming an increasingly common way to communicate information and ideas. The Internet is also providing new channels of communication, again at lower cost and especially internationally. So far the predominant technology is text-based: email, bulletin boards and discussion blogs. However, with increasing bandwidth and computing power, video conferencing and messaging is becoming more common. This could progress further as mobile devices become more powerful and Internet connections faster and cheaper. Equally significant is the development of virtual communities facilitated by these technologies and the trend for people to spend increasing amounts of their time working and socialising online. Bringing together access to both knowledge and communications from virtually any location opens up new possibilities, especially higher and adult education. In particular it can be made available to people who might not previously have been able to access it, due to its location within college campuses. The emerging ICT platform to support these developments is the ‘virtual learning environment’ (VLE), which can be used for distance learning courses or for supporting face-to-face teaching on campus. These are essentially tools for creating and managing a website suitable for educational activities. They provide a content management system (CMS) that makes it easy for academic staff to upload and organise teaching materials, and tools such as email and bulletin board forums for interaction with and between students. Other facilities vary, but most have tools for tutors to set and students to upload assignments, and they usually have course management tools for tracking student progress. Other terms in common usage include learning management system (LMS), learning content management system (LCMS), course management system (CMS) or managed learning environment (MLE). These all have slightly different focus, and overlap to varying degrees. The term MLE is promoted as including all information systems involved in the delivery and administration of learning. The more sophisticated VLEs link with institutions’ other management information systems, such as student record systems and computer services user management. Direct linkages between VLEs and library systems are also under development. There are over 100 different VLE software packages available, although a process of consolidation is evident, with Blackboard now the leading commercial package and Moodle emerging as the most common Open Source solution. One of the challenges in implementing comprehensive and fully integrated VLEs has been the variety of structures in use. Educational provision is often organised into elements such as courses, programmes, electives, modules, units, classes, lectures, practicals, tutorials, etc. These can be


1101

arranged in a hierarchy according to length of time or academic credit accumulated. An important element in this ‘granularity’ of organisation is the ‘learning object’. This is generally taken as being the smallest identifiable component of teaching that still has structure with respect to learning objectives and pedagogy. Learning objects would include presentations and student exercises, for instance. Sub-components of these would be text, video or graphic objects, etc. The digitisation of learning objects for delivery via VLEs has opened up several major issues for the educational sector. Firstly, teaching materials often have to be significantly reworked or extended to be made available in digital format. This has drawn attention to the amount of duplication of effort that exists at institutional and, even more so, national or international levels. It would clearly be more efficient if learning objects can be shared, with new or adapted materials added to learning object repositories that can be accessed by all concerned. This should be readily feasible at institutional level, and has attractions at national and international levels. Issues of copyright, competition, economics and language create significant barriers, but these are being challenged and addressed through the emerging movement for open educational resources. Many learning object repositories have been established, which led to the early realisation that much of the value of these would be lost if there were not common access standards in place. The key elements of this are: • Metadata: Learning content and catalogue offerings must be labelled in a consistent way to support the indexing, storage, discovery (search) and retrieval of learning objects by multiple tools across multiple repositories. Various interim standards exist with the most important probably the Learning Object Metadata (LOM) standards developed by the Learning Technology Standards Committee (LTSC) of the IEEE. • Content packaging: The goal of content packaging specifications and standards is to enable organisations to transfer courses and content from one learning system (e.g. VLE) to another. Content packages include both learning objects and information about how they are to be put together to form larger learning units. They can also specify the rules for delivering content to a learner. The key standard in use is SCORM (Sharable Content Object Reference Model), primarily developed by ADL, a US government sponsored organisation that researches and develops specifications to encourage the adoption and advancement of e-learning. • Learner profiles: These standards allow different system components to share information about learners across multiple system components. Learner profile information can include personal data, learning plans, learning history, accessibility requirements, certifications

1102


and degrees, assessments of knowledge (skills/competencies). In addition, systems need to communicate learner data to the content, such as scores or completion status. Standards for learner profiles are less well developed, but are emerging out of initiatives such as European Qualification Framework, EUROPASS, European CV and the Diploma Supplement. In the UK, a draft British Standard has been developed (DD 8788-3:2006 UK lifelong learner information profile – UKLeaP), but is not regarded as comprehensive and is expected to interact with emerging European or wider international standards and be further developed.

All these standards could eventually become subsets of wider schemes, such as the emerging ‘semantic web’ and allied development of the Web Ontology Language. Much of the thrust of developments to date has been in terms of adapting existing teaching practices and pedagogical models to the Internet age. As new technologies mature and become more accessible, the balance of teaching approaches might change substantially. For aquaculture teaching there is substantial potential for the greater use of computer simulations – interactive software that allows students to test their understanding and skills and further develop their knowledge through problem-based learning and case studies. ICT can provide software models for student interaction, facilitate interactions between students and tutors and deliver appropriate information according to student needs. Virtual reality software could greatly enhance such simulations in the future, providing valuable visual and spatial elements that are easily lost in other representations. The Internet service ‘second life’ is pioneering virtual reality representations and interactions, including, for instance, virtual college courses. In addition to new opportunities, the use of ICT in education also poses a number of problems. One of the most widely discussed is that of plagiarism. It has become much easier for students to cut and paste material from other sources, or even access entire essays via the Internet. This is an issue that can largely be addressed within the education process and through altering the means by which assignments are set and assessed. However, there are also a number of online plagiarism detection services such as Turnitin, available to help tutors identify prior work within written materials. A related issue for assessment is authentication that work submitted, tests completed or contributions made online are entirely the work of the registered student. The use of video tutorials and video monitored tests may help in this respect. Biometric identifiers, including analysis of keyboard input patterns, voice recognition and fingerprint verification may also become more common. In the long term, there may be greater specialisation by individuals, institutions and Internet services with respect


1103

to developing and delivering teaching materials, coaching, tutoring or otherwise supporting learners, and assessing and accrediting learning outcomes.

35.4.3 Role of ICT in the innovation process There are many definitions of innovation, but in the sphere of commerce and economics these commonly emphasise the development and adoption of new technologies, services or management practices. We have already discussed the importance of linking industry and research and how this is being achieved through open research repositories and government funded research, and similarly, how widening access to education is regarded as a tool for stimulating and enabling innovation. A third leg is the promotion of collaboration between organisations, particularly small and medium scale enterprises (SMEs). The rationale for this is that smaller companies will rarely have all the knowledge and resources required to implement innovation, or even recognise opportunities for innovation. By improving networking between organisations, particularly at the personal level, new collaborations can be stimulated, leading to greater rates of innovation. A variety of web-based tools are being developed and deployed to facilitate this: • Benchmarking tools: These collect performance data from individual companies and compare them with the calculated mean so that users can see if their performance is above or below average. Benchmarking for aquaculture typically includes feed conversion, growth and mortality rates, although it could also include other management metrics such as production per person employed or cost per unit produced. Benchmarking tools are used internally by large companies to compare performance between sites or units. Their use in a wider context depends on some level of trust and collaboration existing between companies that are otherwise competitors. This is being fostered in the Sentinel Farms project for UK trout farmers (Turnbull, 2008).35 Farmers can upload mortality and FCR data manually or directly from their stock management systems to a central database. This allows for more or less real-time aggregation and analysis of the data, providing farmers with feedback on their performance compared with other farms of a similar type, and at the same time of year. It also means that participating farmers can be quickly alerted to changes in average mortality rates for instance, which may be indicative of emerging disease issues. The most common use of benchmarking, however, is to help identify the need for innovation among companies that are not performing so well.

1104


• Partnering tools: These are usually web-based databases where companies record their competences and needs with respect to products and services they either offer or require. Algorithms then match companies within the database and provide recommended contacts. Their usefulness depends greatly on the quality of data and number of companies involved. • Personal networking tools: Recognising that collaborations start with personal contacts and relationships, web-based services such as LinkedIn provide tools for individuals to present themselves and build a network of colleagues and associates who are also participating in the service. This effectively builds chains of personal links enabling people to find contacts with the skills and experience they need via personal contacts who are able to provide recommendations or other information. • Knowledge bases: There are numerous commercial, academic and nonprofit initiatives to create structured knowledge bases relevant for aquaculture. For instance the CABI Aquaculture Compendium, FishBase, LarvalBase and AquaNIC. Wikipedia has demonstrated the value of collaboration to create a global encyclopaedia based on the contributions of anyone with knowledge to share. It may be that the breadth and depth of Wikipedia increases to cover all aspects of the aquaculture sector in great detail (e.g. through the WikiBooks initiative). Alternatively, more specialist services, perhaps with greater time-sensitive content, could develop around a similar model. • Discussion list communities: email discussion lists and website discussion forums have been available for many years (e.g. the Yahoo groups for shrimp and tilapia or the SARNISSA project for Africa). Relatively few achieve widespread use, but those that do become invaluable tools for those involved, providing a peer group community for asking questions and sharing knowledge and advice. This can lead either directly to innovation or, at least, the establishment of further collaborations.

35.5 Conclusions Information and communications technologies are now used throughout the aquaculture sector from production of the feed ingredients to presentation of recipes to busy consumers. Although many aquaculture sectors are small scale and traditional in structure, they are nevertheless benefiting from ICT through better availability of technical information and access to markets or supplies. More industrialised branches of aquaculture such as salmon farming are highly technology dependent with computerised monitoring and control systems integral to most operations. Aquaculture customers are increasingly demanding customised products that meet their specific


1105

requirement. ICT systems will help companies to achieve this by enabling effective management of smaller batches with better product tracking. For the future, several trends are already apparent. Firstly the growth of the Internet will not stop at linking personal computers. Mobile phones now commonly have Internet connections and an increasing number of electronic devices will link directly to the net. This will make it much easier and cheaper to collect data. The value of that, however, will depend on how it is subsequently analysed and used to support management and improve control over production and distribution. From an ICT perspective, the key challenge will be in writing the Internet server-based applications that integrate input from many data sources, provide real-time analysis and output to a similarly diverse range of client access devices for reporting and control.

35.6 Acknowledgements The author would like to thank the following people for their assistance in providing information or illustrations used in preparing this chapter: Bob Bawden (Pisces Engineering Ltd), Alan Steel (Traceall Ltd), Professor Karim Erzini (Algarve University), Chris Hempleman (Maritech), Jorge Arturo Alvarez (Private Consultant), Sonia Tsai (Tekho Company Ltd), Philip Bodington (Selonda Aquaculture SA), Dr Carlos Mazorra (Tinamenor SA), Torbjorn Kvassheim (AquaScan AS), Frank Herr (Lotek Wireless Inc.), Kjetil Opshaug (Sølvtrans), David Jarron (Vaki), Sissel Wiedenmann, Trond Severinsen, and Einar Helsoe (Akva Group ASA). Responsibility for any errors or omissions remains entirely with the author.

35.7 Sources of further information and advice Information and communications technology (ICT) in aquaculture development (Section 35.1.1) • Information and Communication Technology in Aquaculture, A summary of different presentations made at MARSOURCE Seminars and Workshops for the ‘Maritime Information Society’ organised in Genoa, Bilbao and Sassnitz in 1998: http://www.feap.info/feap/ presentations/itechaq_en.asp • FAO (2006) Information and communication technologies benefit fishing communities, New Directions in Fisheries – A Series of Policy Briefs on Development Issues, No. 9, United Nationals Food and Agriculture Organization, Rome: http://www.sflp.org/briefs/eng/09.pdf • The e-Aqua project: http://www.e-aqua.org/ • Development Gateway Community for Information and Communications Technologies: http://ict.developmentgateway.org/

1106


• OECD Home Page for Information and Communication Technologies: http://www.oecd.org/topic/0,3373,en_2649_37441_1_1_1_1_37441,00. html

The functions of information and communications technology (Section 35.1.2) • Kotelnikov V (2007) Small and Medium Enterprises and ICT, AsiaPacific Development Information Programme, United Nations Development Programme, Bangkok: http://www.apdip.net/publications/ iespprimers/eprimer-sme.pdf

Principles of monitoring, control and automation (Section 35.2.1) • Hughes T A (2006) Measurement and Control Basics, 4th edn, The Instrumentation, Systems and Automation Society, Research Triangle Park, CA: http://www.isa.org/Template.cfm?Section=Books3&template=/ Ecommerce/ProductDisplay.cfm&ProductID=8879 • Cooper D J (2000) Practical Process Control Using Control Station, Department of Chemical Engineering, University of Connecticut: http:// www.engr.uconn.edu/~ewebhk/buttons/data/data1.html • MIT Open Courseware, Chemical Engineering, 10.450 Process Dynamics, Operations, and Control, Massachusetts Institute of Technology, Cambridge, MA: http://ocw.mit.edu/OcwWeb/Chemical-Engineering/ 10-450Spring-2006/CourseHome/index.htm • PAControl.com: http://www.pacontrol.com/

Sensors and monitoring tools for aquaculture stock (Section 35.2.2) Programmable logic controllers • Automation.com (2009) Programmable Logic Controller (PLC): Products, News, Articles & Resources, Automation Resources, Inc., Pelham, AL: http://www.automation.com/portals/programmable-logiccontroller-plc • Jack H (2008) Automating Manufacturing Systems with PLCs; Version 5.2, Grand Valley State University, Grand Rapids, MI: http://sites. google.com/site/automatedmanufacturingsystems/ • Bolton W (2006) Programmable Logic Controllers: an Introduction, Newnes, Oxford/Burlington MA. Communications protocols • Fundamentals of Communications, Alcatel Internetworking Inc., Agoura Hills, CA: http://www.ind.alcatel.com/fundamentals/index2. html?pass=true


1107

• Introduction to Data Communications, Eugene Blanchard: http://www. techbooksforfree.com/intro_to_data_com/ • Data Communication Fundamentals, Kennesaw State University, Kennesaw, GA: http://science.kennesaw.edu/~cxu/21_8040/07_funda/07_ funda_files/frame.htm • Scada Primer: http://members.iinet.net.au/~ianw/primer.html • Controllers and SCADA: http://www.pacontrol.com/Controller.html • Fieldbus: http://www.pacontrol.com/Fieldbus.html • Industrial Ethernet: http://www.pacontrol.com/Ethernet.html Process control equipment suppliers • Cowex a/s: http://www.cowex.com/ • Craig Ocean Systems Inc.: http://www.cos-inc.com/ • Aquadyne: http://www.aquadyne.com/ • Pisces Engineering: http://www.pisces-aqua.co.uk/farmpatrol.htm • SEDIA (Société d’Etude et Développement en Informatique et Automatismes): http://www.sedia.org/html/gb/aqualarm-supervision. html • Aqua Systems (UK) Ltd: http://www.aquasystems.co.uk/files/contents/ frame.htm • Automated Aquarium Systems: http://www.automatedaquariums.com/ • Invensys Eurotherm: http://www.eurotherm.co.uk/ • ABB Group: http://www.abb.com/ • Schneider Electric: http://www.schneider-electric.com/sites/corporate/ en/products-services/automation-control/automation-control.page • Rockwell Automation: http://www.rockwellautomation.com • Mitsubishi Electric: http://global.mitsubishielectric.com/bu/automation/ products/auto/index.html • Honeywell Automation and Control Solutions: http://www.honeywell. com/sites/acs/ • Siemens Industrial Automation Systems (SIMATIC): http://www.automation.siemens.com/simatic/portal/index_76.htm • Omron: http://www.omron.com/products/indu.html • GE Fanuc: http://www.gefanuc.com/ • Panasonic Industrial Solutions: http://industrial.panasonic.com/ • Campbell Scientific: http://www.campbellsci.com/index.cfm • Moore Industries: http://www.miinet.com/ • Omega Engineering Inc.: http://www.omega.com/ • Process Aquatics International: http://www.processaquatics.com/ Feeding system controllers • AkvaGroup: http://www.akvagroup.com/index.cfm?id=202355 • Pisces Engineering Ltd: http://www.pisces-aqua.co.uk/feeder_ controllers.htm

1108


• SEDIA: http://www.sedia.org/html/gb/aquaculture.html • Feeding Systems: http://www.feeding-systems.com/ • Arvo-Tec: http://www.arvotec.fi/ Fish counters and biomass estimators • Aquascan: http://www.aquascan.com/ • Vaki: http://www.vaki.is/ • Storvik: http://www.storvik.no/gml/index_english.html • AkvaGroup: http://www.akvasmart.com/index.cfm?id=202355 Video and security systems • Orbit Aquacam: http://www.orbitaquacam.com/ • Precision Aquaculture: http://precisionelectronics.co.uk/ • Integrated Aqua Systems: http://www.iasproducts.com/aCUvideomon. html • VideoRay: http://www.videoray.com/missions/9 • IndigoVision: http://www.indigovision.com/ Fish tags • Floy Tags: http://www.floytag.com/ (traditional visual tags) • Biomark: http://www.biomark.com/ (RFID/PIT tags) • Vemco: http://www.vemco.com/ (acoustic tags) • Hydroacoustic Technology Inc.: http://www.htisonar.com/ (acoustic tags) • LotekWireless Inc.: http://www.lotek.com/ • Star-Oddi.: http://www.star-oddi.com/ Other useful reading • Anon (undated) Acoustic fish tags, University of Rhode Island, Office of Marine Programmes, Narrangansett, RI: http://www.dosits.org/ gallery/tech/of/aft1.htm (acoustic tags) • Askgaard J M B (2008) Sea Cage Gateway – A Distributed Sensor Management Network in ActorFrame, MSc thesis, Norwegian University of Science and Technology, Trondheim, Norway: http://urn.ub.uu.se/ resolve?urn=urn:nbn:no:ntnu:diva-1010 • Dagorn L, Pincock D, Girard C, Holland K, Taquet M, Sancho G, Itano D and Aumeeruddy R (2007) Satellite-linked acoustic receivers to observe behavior of fish in remote areas, Aquatic Living Resources, 20(4), 307–12: http://www.ifremer.fr/docelec/doc/2007/publication-3731. pdf • Grødal, J A and Paaske F G (2008) Context-Aware Services in Aquaculture: FiFaMoS – Fish Farm Monitoring System, MSc thesis, Norwegian


•

•

•

•

•

• •

1109

University of Science and Technology, Trondheim, Norway: http://urn. ub.uu.se/resolve?urn=urn:nbn:no:ntnu:diva-1275 Halfdanarson B (1997) Estimating the future growth of salmon by using the Vaki Biomass Counter and Biomest Aquaculture Software, Aquaculture Trondheim 1997: Cultivation of Cold-Water Species: Production, Technology and Diversification, 13–16 August, Trondheim. (World Meeting Number 973 5006). Hateley J and Gregory J, Evaluation of a multi-beam imaging sonar system (DIDSON) as fisheries monitoring tool: Exploiting the acoustic advantage, Technical Report, Environment Agency, Warrington: http:// www.soundmetrics.com/NEWS/REPORTS/UKEA_DIDSON_Report. pdf Lines J A, Tillett R D, Ross L G, Chan D, Hockaday S and McFarlane N J B (2001) An automatic image-based system for estimating the mass of free-swimming fish, Computers and Electronics in Agriculture, 31, 151–68. Mills D J, Gardner C and Johnson C R (2006) Experimental reseeding of juvenile spiny lobsters (Jasus edwardsii): Comparing survival and movement of wild and naive lobsters at multiple sites, Aquaculture, 254(1–4), 256–68. Petrell R J, Shi X, Ward R K, Naiberg A and Savage C R (1997) Determining fish size and swimming speed in cages and tanks using simple video techniques, Aquacultural Engineering, 16(1–2), 63–84. Treasurer J (2002) Application of sonar systems in aquaculture, Fish Farmer, 25(4), 37–9. University of Tasmania project on determining salmon size in aquaculture facilities using underwater video: http://www.cis.utas.edu.au/ external/research/marineICT/projects/marinevideo/5.html

Stock management systems (Section 35.2.3) Relevant companies are listed in Table 35.2.

Business information systems (Section 35.2.4) • Lotus Notes & Domino: http://www-306.ibm.com/software/lotus • Microsoft Exchange Server: http://www.microsoft.com/exchange/default. mspx • Microsoft SharePoint Server: http://www.microsoft.com/sharepoint/ default.mspx • Business Link web site advice for business on IT and e-commerce: http:// www.businesslink.gov.uk/bdotg/action/layer?r.l1=1073861197&topicId =1073861197&r.l2=1075422920&r.s=b

1110


Business integration/enterprise resource planning (ERP) software • Wailgum T and Koch C (2007 – updated 2008) ERP definition and solutions, CIO, Framingham, MA: http://www.cio.com/article/40323/ ERP_definition_and_solutions • ERP vendors: http://en.wikipedia.org/wiki/List_of_ERP_vendors Further reading on background technologies (Sections 35.2.3 and 35.2.4) • Connolly T M Begg C E (2005), Database Systems: A Practical Approach to Design, Implementation and Management (4th edn), Pearson Education, Harlow. • Microsoft SQL: http://www.microsoft.com/sqlserver • Microsoft ODBC: http://support.microsoft.com/kb/110093

Planning and design (Section 35.2.5) The main aquaculture packages are listed in Table 35.3. Web-based software • FARMTM: http://www.farmscale.org/ • WinShell: http://www.longline.co.uk/winshell/ Environment • ECASA Project: http://www.ecasatoolbox.org.uk/ Business planning and strategy suppliers and software • Market Modelling Ltd: http://www.market-modelling.co.uk/ • Palo Alto Software Ltd: http://www.paloalto.co.uk/ • Rosetta IT Solutions Ltd: http://www.rosetta-it.com/ • Palisade: http://www.palisade.com • Arena simulation software by Rockwell Automation: http://www. arenasimulation.com/ • STELLA software by ISEE Systems: http://www.iseesystems.com/ Other useful reading • Corner R A, Brooker A J, Telfer T C and Ross L G (2006) A fully integrated GIS-based model of particulate waste distribution from marine fish-cage sites, Aquaculture, 258(1–4), 299–311. • Gifford J A, Benetti D D and Rivera J A (undated) National marine aquaculture initative: Using GIS for offshore aquaculture siting in the U.S. Caribbean and Florida, NOAA/NMFS, CARR 102 Cabo Rojo, PR 00623, National Oceanographic and Atmospheric Adminsitration, Washington, DC: http://www.lib.noaa.gov/docaqua/reports_noaaresearch/ nmaifinalreportgis.pdf


1111

• Kiefer D A, O’Brien F and Rensel J E J (2007) Modeling water column and benthic effects of fish mariculture of cobia (Rachycentron canadum) in Puerto Rico: Cobia AquaModel, Report for Ocean Harvest Aquaculture Inc. and The National Oceanic and Atmospheric Administration, Systems Science Applications Inc., Pacific Palisades, PA: http://www.lib. noaa.gov/docaqua/reports_miscellaneous/noaa_cobia_final_report_ May_2007.pdf • Kodra B (2007) Risk Analysis of tilapia recirculating aquaculture systems: A monte carlo simulation approach, MSc Thesis, Virginia Polytechnic Institute and State University, Blacksburg, VA: http://scholar.lib.vt.edu/ theses/available/etd-04232007-125139/ • Nunes A J P and Parsons G J (2006) A computer-based statistical model of the food and feeding patterns of the Southern brown shrimp Farfantepenaeus subtilis under culture conditions, Aquaculture, 252(2–4), 534–44. • Wang Y-H, Turton R and Semmens K (2007) Software development for predicting fish growth in trout raceways, Poster Presentation, Aquaculture Forum 20 January, West Virginia University Extension Service: http://www.wvu.edu/~agexten/aquaculture/07Forum/posters/Aqua_ forum_07.ppt • Wang Y-H (2006) Model and software development for predicting fish growth in trout raceways, MSc Thesis, Department of Chemical Engineering, West Virginia University, Morgantown, WV: http://www.caf. wvu.edu/afmdp/disciplines/engineering/publications/Wang%20 Yin-Han.pdf (Software model available at http://www.caf.wvu.edu/ afmdp/disciplines/engineering/chemsoftware.shtml) • Ferreira J G, Hawkins A J S and Bricker S B (2007) Management of productivity, environmental effects and profitability of shellfish aquaculture – the Farm Aquaculture Resource Management (FARM) model, Aquaculture 264, 160–74: http://www.fojo.org/papers/farm/farm.pdf

Quality management (Section 35.3.1) • Code of Conduct for Responsible Fisheries, Food and Agriculture Organization of the United Nations, Rome: http://www.fao.org/fishery/ccrf/1 • European Aquaculture Code of Conduct, Federation of European Aquaculture Producers, Liege: http://www.feap.info/consumer/codes/ feapintro_en.asp • Code of Good Practice for Scottish Finfish Aquaculture, Scottish Salmon Producers Organisation, Perth: http://www.scottishsalmon.co. uk/aboutus/codes.asp • Codes of Practice for Responsible Shrimp Farming, Global Aquaculture Alliance, St Louis, MO: http://www.gaalliance.org/code.html • GLOBALGAP Integrated Farm Assurance, GLOBALGAP, Cologne: http://www.globalgap.eu

1112


ISO Management Standards • International Organization for Standardization, Geneva: http://www.iso. org/iso/management_standards.htm Risk assessment and HACCP software suppliers and software • Risk Reasoning Ltd: http://www.riskreasoning.co.uk/ • Norback Ley and Associates: http://www.norbackley.com/ • She Software Ltd: http://www.shesoftware.com/ • HACCP Now: http://www.haccpnow.co.uk/ • HACCPHelp! TM: http://www.haccphelp.com/haccphelp_software.htm Example quality management suppliers and software (including HACCP compliance) • SoftExpert Ltd: http://www.softexpert.com/en/ • Qualsys Ltd: http://www.qualsys.co.uk/ • Lennox Hill Ltd: http://www.lennoxhill.co.uk/ • Pilgrim Software, Inc.: http://www.pilgrimsoftware.com/ • The Harrington Group: http://www.harrington-group.com/ • The Interax Group, Inc.: http://www.interaxgrp.com/ • Qudos: http://www.qudos-software.co.uk/

Market chain and traceability (Section 35.3.2) • EC (2007) Food Traceability, Fact Sheet, European Commission DG Health and Consumer Protection, Brussels: http://ec.europa.eu/food/ food/foodlaw/traceability/factsheet_trace_2007_en.pdf • EAN (2002) EAN Fish Traceability Guidelines, EAN International, Brussels: http://www.gs1.org/docs/traceability/GS1_fish_traceability.pdf • Codex Alimentarius (International Standards): http://www. codexalimentarius.net/web/index_en.jsp • GS1: http://www.gs1.org/ • Good Traceability Practice, TraceFood Framework: http://www. tracefood.org/index.php/GTP Example traceability suppliers and software (fisheries, processing and distribution) • DHA BV: http://www.dha-software.com/ • Traceall Ltd: http://www.traceall.co.uk/ • AkvaSmart TM: http://www.akvasmart.com • Innova: http://www.marelfoodsystems.com/Products/Innova • Tracetracker®: http://www.tracetracker.com/ • Olfish: http://www.olfish.com/ • WiseFishTM: http://www.wisefish.com/


1113

Coordination of traceability • Tracetracker®: http://www.tracetracker.com/ • Traceregister TM: http://traceregister.com/ (North American) EU projects on traceability • Fish-Tracenet: http://www.fishtracenet.org/ • FOODTRACE: http://www.eufoodtrace.org • TraceFood: http://www.tracefood.org/ • Trace: http://www.trace.eu.org/ • SEAFOOD plus: http://www.seafoodplus.org/ • E-passport for frozen shrimp, VietNamNet Bridge, 28/8/08: http:// english.vietnamnet.vn/tech/2008/08/801022/

Marketing and sales (Section 35.3.3) • CRM Landmark: http://www.crmlandmark.com/ Electronic fish auction companies • Pefa: http://www.pefa.com/ • Mercapesa: http://www.mercapesca.net/ • Aucxis Trading Solutions: http://www.aucxistrading.com/ Market models • Marketing Analytics, Inc.: http://www.marketinganalytics.com/ • Marketing Management Analytics: http://www.mma.com/ • Aprimo, Inc.: http://www.aprimo.com/

Public relations (Section 35.3.4) • The Institute for Public Relations, Gainesville, FL: http://www. instituteforpr.org/ Example PR software • DNA 13: http://www.dna13.com/ • Bluevizia: http://www.bluevizia.com/ • Glide Technologies: http://www.glidetechnologies.com/ • Vocus: http://www.vocus.com/ • Solcara: http://www.solcara.com/

Linking innovation, research and learning (Section 35.4.1) • Li D L and Fu Z (2002) Knowledge warehouse: A Web-based integrated information system for freshwater aquaculture, Proceedings of the Third

1114


Asian Conference for Information Technology in Agriculture, 26–28 October, Beijing, Agricultural Scientech Press, Beijing, 379–83: http:// zoushoku.narc.affrc.go.jp/ADR/AFITA/afita/afita-conf/2002/part4/ p379.pdf • EC Competitiveness & Innovation Framework Programme, European Commission DG Enterprise and Industry, Brussels: http://ec.europa.eu/ cip/index_en.htm • OECD Science and Innovation, Organization for Economic Cooperation and Development, Paris: http://www.oecd.org/topic/0,3373,en _2649_37417_1_1_1_1_37417,00.html • The Science Business Network: http://www.sciencebusiness.net/

Applications of ICT in aquaculture education and learning (Section 35.4.2) • AQUA-TNET Project: http://www.aquatnet.com/ • AQUA-TNET (2008) Draft report on innovation in aquaculture teaching and learning: http://docs.google.com/View?docid=dc8mztpb_2gjbsrx • OECD (2007) Giving Knowledge for Free: The Emergence of Open Educational Resources, Organization for Economic Development and Cooperation, Paris: http://www.oecd.org/document/41/0,3343,en_2649_ 37455_38659497_1_1_1_37455,00.html • IEEE Learning Technology Standards Committee Workgroup on Learning Object Metadata: http://ltsc.ieee.org/wg12/ • Dublin Core Metadata Initiative: http://dublincore.org/ • CanCore Learning Resource Metadata Initiative: http://www.cancore. ca/ • List of learning object repositories: http://www.uwm.edu/Dept/CIE/ AOP/LO_collections.html • Centre for Educational Technology Interoperability Standards: http:// zope.cetis.ac.uk/ • SCORM (Sharable Content Object Reference Model): http:// adlcommunity.net/course/view.php?id=25 • IMS Global Learning Consortium, Inc., Content Packaging Specification: http://www.imsproject.org/ • IEE Standards: http://ieeeltsc.org/ • The Higher Education Academy, Managing Effective Student Assessment: http://www.heacademy.ac.uk/ourwork/learning/assessment/mesa • Global Development Learning Network: http://www.gdln.org/ • Turnitin®: http://turnitin.com/ • Blackboard: http://www.blackboard.com/ • Moodle: http://moodle.com/ • European Qualifications Framework: http://ec.europa.eu/education/ lifelong-learning-policy/doc44_en.htm • EUROPASS: http://europass.cedefop.europa.eu/


1115

Semantic web • WrC: http://www.w3.org/2001/sw/ • The Semantic Web: http://semanticweb.org/ • Stojanovic´ N, Staab S and Studer R (2001) eLearning in the Semantic Web, WebNet2001-World Conference on the WWW and Internet, October 24–27, Orlando, FL: http://www.aifb.uni-karlsruhe.de/~sst/Research/ Publications/WebNet2001eLearningintheSemanticWeb.pdf Web ontology language • Costello R L and Jacobs D B (2003) A Quick Introduction to OWL Web Ontology Language, MITRE Corporation, Bedford, MA: http://www. iro.umontreal.ca/~lapalme/ift6281/OWL/CostelloQuickIntroOwl.pdf • W3C OWL web ontology overview: http://www.w3.org/TR/owlfeatures/ Virtual learning environment • Second Life: http://secondlife.com/

Role of ICT in the innovation process (Section 35.4.3) • EC, ICT for Competitiveness and Innovation, European Commission DG Enterprise and Industry, Brussels: http://ec.europa.eu/enterprise/ ict/index_en.htm • Aquaculture Innovation Network: http://www.aquainnovation.net • LinkedIn: http://www.linkedin.com/ • Itoga S and Brock J (1995) Hawaii Aquaculture Module Expert System for Macintosh Computers, CTSA#119, Center for Tropical and Subtropical Aquaculture, Waimanalo, HI: http://praise.manoa.hawaii.edu/ software.php • FishGuts – A multimedia guide to the art and science of fish anatomy, health and necropsy, developed at the University of Maryland Aquatic Pathobiology Centre, College Park, MD: http://aquaticpath. umd.edu/fg/ • CABI Aquaculture Compendium: http://www.cabi.org/compendia/ac/ index.asp • SARNISSA Project: http://www.sarnissa.org/ • AquaNIC: http://www.aquanic.org/ • FishBase: http://www.fishbase.org/ • LarvalBase: http://www.larvalbase.org/ • Yahoo shrimp discussion group: http://finance.groups.yahoo.com/group/ shrimp • Yahoo tilapia discussion group: http://tech.groups.yahoo.com/group/ tilapia/ • Other Yahoo groups can be found at http://groups.yahoo.com/

1116


35.8 References 1 nieto d (2005) Observatory and survey result report, EC E-aQua project. http:// www.e-aqua.org/ 2 timmons m b, ebeling j m, wheaton f w, summerfelt s t and vinci b j (2001) Recirculating aquaculture systems, Northeastern Regional Aquaculture Center, Ithaca, NY, Cayuga Aqua Ventures. 3 lekang o-i (2007) Aquaculture Engineering, Oxford, Blackwell. 4 shardlow t f and hyatt k d (2004) Assessment of the counting accuracy of the vaki infrared counter on chum salmon, North American Journal of Fisheries Management, 24(1), 249–52. 5 bjordal a, juell j e, lindem t and fernö a (1993) Hydroacoustic monitoring and feeding control in cage rearing of Atlantic salmon (Salmo salar L.), in Reinertsen H, Dehle L A, Jorgensen L and Tvinnereim K (eds), Fish Farming Technology, Rotterdam, Balkema, 203–8. 6 fisheries and oceans canada (2008) Echo-Sounding to Count Pacific Fish, Ottawa, ONT, http://www.dfo-mpo.gc.ca/science/Publications/article/2005/0209-2005-eng.htm, accessed January 2009. 7 costa c, loy a, cataudella s, davis d and scardi m (2006) Extracting fish size using dual underwater cameras, Aquacultural Engineering, 35(3), 218–27. 8 knudsen f r, fosseidengen j e, oppedal f, karlsen o and ona e (2004) Hydroacoustic monitoring of fish in sea cages: target strength (TS) measurements on Atlantic salmon (Salmo salar), Fisheries Research, 69(2), 205–9. 9 baras e, malbrouck c, houbart m, kestemont p and melard c (2000) The effect of PIT tags on growth and physiology of age-0 cultured Eurasian perch Perca fluviatilis of variable size, Aquaculture, 185(1–2), 159–73. 10 thorsteinsson v, arnold g, davenport j and maoiléidigh n o (2002) Tagging Methods for Stock Assessment and Research in Fisheries, Report of Concerted Action FAIR CT.96.1394 (CATAG), Reykjavik, Marine Institute Technical Report (79), http://www.hafro.is/Bokasafn/Timarit/catag.pdf, accessed January 2009. 11 star-oddi, GPS Fish Positioning System, Reykjavik, Star-Oddi, http://www.staroddi.com/Temperature_Recorders/GPS_fish_tag/, accessed January 2009. 12 dagorn l and holland k (2008) Development of ‘Business Card’ Tags: Interindividual Data Transfer, Pelagic Fisheries Research Program, University of Hawaii, Honolulu, HI, http://www.soest.hawaii.edu/PFRP/biology/dagorn_ business_tags.html, accessed January 2009. 13 chappell d (2008) A Short Introduction to Cloud Platforms, David Chappell & Associates, San Francisco, CA, http://www.davidchappell.com/ CloudPlatforms–Chappell.pdf, accessed January 2009. 14 istart (2007) Salmon company reels in a solution, Auckland, http://www.istart. co.nz/index/HM20/PC0/PVC197/EX232/CS2210, accessed January 2009. 15 halachmi i, simon y, guetta r and hallerman e m (2005) A novel computer simulation model for design and management of re-circulating aquaculture systems, Aquacultural Engineering, 32(3–4), 443–64. 16 nunes a j p and parsons g j (2006) A computer-based statistical model of the food and feeding patterns of the Southern brown shrimp Farfantepenaeus subtilis under culture conditions, Aquaculture, 252(2–4), 534–44. 17 neill w, brandes t, burke b, craig s, dimichele l, duchon k, edwards r, fontaine l, gatlin d. iii, hutchins c, miller j, ponwith b, stahl c, tomasso j and vega r (2004) Ecophys. Fish: A simulation model of fish growth in time-varying environmental regimes, Reviews in Fisheries Science, 12(4), 233–88. 18 mccausland w d, mente e, pierce g j and theodossiou i (2006) A simulation model of sustainability of coastal communities: Aquaculture, fishing, environ-


19 20

21 22 23

24

25

26

27

28 29

30 31

1117

ment and labour markets, Ecological Modelling, 193, 271–94, http://www.abdn. ac.uk/marfish/pdfs/McCausland2006.pdf, accessed January 2009. jorge arturo alvarez (2008) pers comm. hunter d c, telfer t c and ross l g (2006) Development of a GIS-based tool to assist planning of aquaculture developments. A report to The Scottish Aquaculture Research Forum, SARF-003, University of Stirling, http://www.aqua.stir.ac.uk/ GISAP/pdfs/SARF003_Full.pdf, accessed January 2009. bjørndal t, lane d e and weintraub a (2004) Optimal research models and the management of fisheries and aquaculture: A review, European Journal of Operational Research, 156(3), 533–40. hernandez j m, leon-santana m and leon c j (2007) The role of the water temperature in the optimal management of marine aquaculture, European Journal of Operational Research, 181(2), 872–86. forsberg o i and guttormsen a g (2006) Modeling optimal dietary pigmentation strategies in farmed Atlantic salmon: Application of mixed-integer nonlinear mathematical programming techniques, Aquaculture, 261(1), 118–24. ec (2002) Regulation (EC) No. 178/2002 of the European Parliament and of the Council of 28 January 2002 laying down the general principles and requirements of food law, establishing the European Food Safety Authority and laying down procedures in matters of food safety, Official Journal of the European Communities, L31, 1 February, 1–24, http://eur-lex.europa.eu/ pri/en/oj/dat/2002/l_031/l_03120020201en00010024.pdf, accessed January 2009. ec (2001) Regulation Commission (EC) No. 2065/2001 of 22 October 2001 laying down detailed rules for the application of Council Regulation (EC) No 104/2000 as regards informing consumers about fishery and aquaculture products, Official Journal of the European Communities, L278, 23 October, 6–8, http://eur-lex. europa.eu/LexUriServ/LexUriServ.do?uri=OJ:L:2001:278:0006:0008:EN:PDF, accessed January 2009. ec (2004) Regulation (EC) No. 852/2004 of the European Parliament and of the Council of 29 April 2004 on the hygiene of foodstuffs, Official Journal of the European Communities, L139, 30 April, 1–54, http://eur-lex.europa.eu/ LexUriServ/LexUriServ.do?uri=OJ:L:2004:139:0001:0054:EN:PDF, accessed January 2009. ec (2003) Regulation (EC) No. 1830/2003 of the European Parliament and of the Council of 22 September 2003 concerning the traceability and labelling of genetically modified organisms and the traceability of food and feed products produced from genetically modified organisms and amending Directive 2001/18/ EC, Official Journal of the European Communities, L268, 18 October, 1–5, http:// europa.eu/eur-lex/pri/en/oj/dat/2003/l_268/l_26820031018en00240028.pdf, accessed January 2009. swedberg c (2008) Taiwanese seafood producer tracks fish to the dish, RFID Journal, 10 March, http://www.rfidjournal.com/article/articleview/3964/1/1/, January 2009. microsoft (2007) Case Study: Tekho Company Ltd. Individual Fish Traced from Farm to Restaurant with BizTalk RFID, http://www.microsoft.com/canada/ partnersolutionmarketplace/CaseStudyDetail.aspx?casestudyid=4000000640, accessed January 2009. skretting (2008) Skretting invites the seafood industry to join the global traceability network, Company press release, Stavanger, 4 March 2008 http://www. tracetracker.com/cgi/doc.cgi?id=174, accessed January 2009. zeldis d and prescott s (2000) Fish disease diagnosis program – problems and some solutions, Aquacultural Engineering, 23(1–3), 3–11.

1118


32 li d, zhu w, duan y and fu z (2006) Towards developing a tele-diagnosis system on fish disease, Artificial Intelligence in Theory and Practice, 217, 445–54, http:// zoushoku.narc.affrc.go.jp/ADR/AFITA/afita/afita-conf/2002/part4/p374.pdf, accessed February 2009. 33 brock j and itoga s (1993) Hawaii Aquaculture Module Expert System (HAMES), Pacific Regional Aquaculture Information Service, University of Hawaii, Honolulu, HI, http://praise.manoa.hawaii.edu/software.php?download, accessed January 2009. 34 keen a (2008) The cult of the amateur. How today’s Internet is killing our culture, Doubleday, New York. 35 turnbull j (2008) pers comm.

36 Inland saline aquaculture G. L. Allan and D. S. Fielder, New South Wales Department of Primary Industries, Australia, K. M. Fitzsimmons, University of Arizona, USA, S. L. Applebaum, Jacob Blaustein Institute for Desert Research BGU, Israel, and S. Raizada, Central Institute of Fisheries Education Rohtak Centre (ICAR), India

Abstract: Increasing demand for aquaculture has led to the development of new production systems. Inland saline aquaculture, defined here as land-based aquaculture using saline groundwater, occurs in several countries including Israel, the USA, India and Australia. A number of species are cultured, or are being evaluated for their potential, including finfish such as tilapia, Asian sea bass and trout, shrimp and oysters. Sources of saline groundwater include ephemeral and permanent saline lakes, saline water extracted with coal seam gas and saline groundwater extracted from aquifers. Saline groundwater is extracted in some areas to protect the root zone of plants. Characteristics of saline-affected land are described, with particular focus on Australia and India. Another emerging source of saline groundwater is the coal bed methane gas industry. Saline water accompanies extraction of the gas and, while it can be a major environmental problem for the gas industry, it presents an opportunity for aquaculture. Saline groundwater can differ in chemistry compared with coastal seawater and adjusting the chemistry or choosing species that are tolerant to the differences is one of the major challenges for expansion of inland saline aquaculture. The chemistry of different sources of water is described and common methods of adjusting the chemistry described. Finally, case studies of inland saline aquaculture are presented for Australia, India, Israel and the USA. Novel food production methods, such as inland saline aquaculture, are needed to increase aquaculture production and meet increasing demands for seafood. Key words: inland saline aquaculture, desert aquaculture, Australia, India, Israel, USA.

36.1 Introduction Demand for seafood throughout the world is increasing (FAO, 2007) while production from capture fisheries is static or declining. To cater for global demands in 2020, an estimated 163 million tonnes of fish will be required

1120


and, given static production from capture fisheries, aquaculture will need to supply 70 million tonnes (FAO, 2007). Expansion of coastal aquaculture is limited in many areas because of other land and water use activities. Inland aquaculture already makes the greatest contribution to total aquaculture (approximately 60 %: FAO, 2007), but inland saline aquaculture also offers the potential to increase production of euryhaline and marine species. Inland saline aquaculture is defined here as land-based aquaculture using saline groundwater. Sources of saline groundwater include ephemeral and permanent saline lakes, saline water extracted with coal seam gas and saline groundwater extracted from aquifers, including shallow water tables where saline groundwater is extracted to protect the root zone of plants. Inland saline water can differ in chemistry compared with coastal seawater, and adjusting the chemistry or choosing species that are tolerant to the differences is one of the major challenges for expansion of inland saline aquaculture. A range of species have been evaluated for culture in saline groundwater including euryhaline finfish (e.g. Lates calcarifer, Sparus auratus, Dicentrarchus labrax, Argyrosomus japonicus), crustaceans (e.g. Penaeus monodon, Litopenaeus vannamei, Marsupenaeus japonicus) and molluscs (e.g. Saccostrea glomerata), diadromous species such as salmonids (e.g. Oncorynchus mykiss) and salt-tolerant freshwater species such as finfish (e.g. Oreochromis niloticus, Bidyanus bidyanus) and crustaceans (e.g. Macrobrachium rosenbergii). Different farming systems are used including earthen or plastic-lined ponds, tanks (including with recirculation technology) and raceways. Partridge et al. (2008) described the range of pond, tank and tank–pond hybrid systems that have been used for inland saline aquaculture. Commercial production using saline groundwater occurs in the USA, Israel, India and Australia. In Texas, farming shrimp (Litopenaeus vannamei) commenced in the 1970s after quarry operators attempted to culture shrimp using saline quarry water. Inland saline shrimp culture has been evaluated in Texas, Arizona, Arkansas, Alabama and Florida. In Arizona, saline groundwater (2–5 ppt) is used to grow marine shrimp in ponds and raceways with effluents used to irrigate olives, dates and other agricultural crops. In Florida and Alabama, saline aquifers are also tapped to provide water for pond culture. In Israel, inland saline aquaculture, known as ‘desert aquaculture’, began operating commercially in the late 1980s and is characterised by raising finfish in brackish geothermal water from deep aquifers, discovered in the 1940s. The depth of these aquifers varies, depending on the topography, between 450 and 1000 m below the surface. These aquifers contain huge quantities (billions of cubic meters) of brackish (3–7 ppt TDS – total dissolved solids) geothermal (∼40 °C) pollutant-free, ancient water. This socalled ‘artesian desert water’ rises by its own artesian pressure to the height of about sea level and therefore only has to be pumped up for use from an average depth of 400 m below the surface. Several farms in the Israeli

Inland saline aquaculture

1121

Negev desert (∼13 000 km2) are producing finfish in this ‘desert water’, Asian sea bass (Lates calcarifer) being the major species with an annual production of around 200 tonnes, followed by red drum, striped bass, sea bass, sea bream, tilapia and catfish, the total of which, 400–500 tonnes annually, are consumed domestically fresh. The white leg shrimp (Litopenaeus vannamei) was successfully cultured for several years, but production has ceased due to limited demand on the local market. In addition to the edible fish farming, a number of farms in the desert are using the brackish water, occasionally in combination with freshwater, to produce a variety of ornamental hobby fish, all of which are exported to Europe. The system operations for desert aquaculture in Israel are mostly based on water recirculation that includes mechanical and biological water filtration. However, a significant amount of fish culture effluent is diverted into irrigation systems providing fresh water rich with dissolved fish metabolites that benefit a variety of crops such as olives, dates, jojoba and hay for cattle. In India, culture of the giant freshwater prawn (Macrobrachium rosenbergii) occurs in freshwater ponds in the northwestern states, including Haryana. The practice has relied on transport of postlarvae (PLs) from coastal regions until recently after pioneering research by the Central Institution of Fisheries Education developed techniques for hatchery production using saline groundwater. In Australia, small-scale production of rainbow trout (Oncorynchus mykiss) occurs using saline groundwater in southwestern Western Australia (Trendall, 2008), and an Asian sea bass (Lates calcarifer) farm using deep saline aquifer water was operating but closed for a number of reasons including regulatory difficulties with expansion to achieve economies of scale. Research with rainbow trout demonstrated this species was suitable for culture using saline groundwater pumped into evaporation ponds to protect the root zone in southwestern New South Wales, but commercial development of that research has stalled because of the severe drought in the Murray–Darling River system in Australia (Allan et al., 2008a). In this chapter, key sources of saline groundwater from interception schemes and waste associated with the extraction of coal seam gas will be described and the chemistry and methods of remediating saline groundwater for culture discussed. Examples of inland saline aquaculture will be presented, including desert aquaculture in Israel, aquaculture using groundwater interception schemes in Australia, giant freshwater prawn culture in India and shrimp farming in the USA.

36.2 Saline groundwater from interception schemes to protect agriculture Increasing soil salinity is a global issue, and occurs in many semi-arid to arid regions where large-scale irrigated agriculture is practised. Rising saline

1122


water tables and the associated environmental degradation are problems in developed countries, e.g. Australia, Israel and the USA, and developing countries, e.g. India, Pakistan, China, Thailand and countries in the middleeast. Globally, an estimated 380 million ha of land is unusable for agriculture because of salinisation of soils and groundwater (Lambers, 2003). A commonly practised engineering solution to rising saline groundwater is the construction and operation of large-scale subsurface drainage systems, which collect saline groundwater and dispose of it in ponds or canals. These engineering schemes are very expensive to construct and operate. Incorporation of aquaculture into the design of these engineering schemes can provide a beneficial use of the otherwise waste water and a partial economic return on the initial investment. In the future, this may assist with raising finance for more engineering schemes to protect valuable arable land for agriculture and towns and cities from the ravages of salinity. For aquaculturists, a sure water supply and disposal through terminal evaporation ponds provide critical and expensive infrastructure. The situation in India and Australia illustrates the problem. Inland salinity in those countries is a major environmental problem that threatens productive agricultural enterprises, fragile ecosystems, valuable infrastructure as well as roads and buildings (including homes) in many country areas (Agarwal and Roest, 1996; Ingram et al., 1996; Qureshi and BarrettLennard, 1998; Allan et al., 2001; Anon, 2001). In Australia, some 5.7 million ha of land are under high risk of salinisation through dryland salinity with predictions that this may increase to over 17 million ha in 50 years (Anon, 2001). There are 11 saline groundwater subsurface drainage schemes, which incorporate more than 6000 ha of evaporation ponds operating in the Murray–Darling Basin (MDB) river system. A further eight schemes are planned for construction in the MDB. Adelaide, the capital of South Australia and home to over 1.1 million people, is threatened by salinity in the domestic water supply with extraction of salt through saline groundwater interception schemes along the Murray River as the primary response. In addition, 76 other towns in Australia were identified as being threatened by salinity, and groundwater schemes with evaporation ponds are being considered in many of these (Allan et al., 2001). Approximately 8.7 million ha of land is salt-affected in India and about 40 % of this salt-affected land is concentrated in the north-western, semiarid/arid states of Haryana, Punjab, Uttar Pradesh and Rajasthan. Disposal of saline drainage effluent from irrigated land may introduce significant environmental problems (Dr S. Raizada, CIFE, Rohtak Centre, pers comm, 2001). Haryana is a leading agriculture producing state and, since the 1980s, agricultural production has increased from 2.6 to 10.5 million tonnes. Most of this increase is associated with a concurrent large-scale increase in canal irrigation and an increase in the number of shallow tubewells from 25 000 to 550 000. Consequently, the area of irrigated land increased from 1.3 to


1123

2.6 million ha. However, creation of intensive irrigation facilities and inadequate and inefficient on-farm water management infrastructure has led to waterlogging and soil salinity. This problem is exacerbated by other factors such as impeded drainage conditions, topography, high salt content of parent material, poor water management practices, brackish and saline groundwaters (which as such are not suitable for irrigation) and, importantly, the arid and semi-arid climate. Groundwater tables are rising in almost 50 % of Haryana and 0.52 million ha of land is salt-affected (saline, sodic or both). A four-fold increase in salt-affected land has been predicted over the next 30 years, unless preventative measures are taken (Agarwal and Roest, 1996). In India, at least 21 pilot projects have been undertaken in Haryana, Rajasthan and Gujarat to demonstrate the efficacy and evaluate the feasibility of installing subsurface drainage schemes (Pal et al., 1999). A joint 10-year pilot-scale project to investigate several aspects of drainage and salt management was recently completed in Haryana by the Dutchbased International Institute for Land Reclamation and Improvement, Indian Council of Agricultural Research (ICAR) and CCS Haryana Agricultural University. Installation of other large-scale tile drainage schemes is now planned, but disposal of the saline groundwater will pose a serious problem. This may be solved by incorporation of evaporation ponds in the system.

36.3 Coal bed methane waste water A relatively new potential source of inland saline water for aquaculture is the water extracted during harvest of coal bed methane (CBM). CBM, also called coal seam gas and coal seam methane, is methane, gas produced with the formation of coal (http://www.australianminesatlas.gov.au/aimr/ commodity/coal_bed_methane.jsp). CBM is similar to conventional natural gas and can be used to generate electricity and, directly, to power domestic and industrial appliances such as water heaters, stoves, etc. Water accompanies the extraction of methane but, in contrast to conventional oil and gas production, the volume of water produced when CBM is extracted is greatest in the early stages of production and decreases as production of CBM increases (Veil et al., 2004). The chemistry of the water varies with the original conditions occurring during deposition, the depth of burial and the type of coal (Jackson and Myers 2002, cited in Veil et al., 2004) (see Table 36.1 for examples from Australia and the USA). There are significant reserves of CBM in the USA, Canada, China and Australia with reports of probable deposits elsewhere (e.g. Russia). In the USA, proven reserves were estimated at 19 620 billion cubic feet in 2006 (= 20 601 Petajoules; PJ) (Energy Information Administration, http://tonto. eia.doe.gov/dnav/ng/ng_enr_cbm_a_EPG0_r51_Bcf_a.htm). In the 1980s,

1124


Table 36.1 Water chemistry for inland saline water Cl

Country

Location

Salinity ppt

pH

Alkalinity mg/l

Seawater Australia

Coastal (east coast) Wakool (New South Wales) Undera (Victoria) Wakerie (South Australia) Wannamal (Western Australia) nr (Western Australia)

Cl/salinity

SO4

ion/Cl ratio

mg/l

ion/Cl ratio

% ion/Cl ratio relative to seawater

35.0 35.3

8.1

114.0

19 000.0 20 000.0

542.9 566.6

1.0 1.0

885.0 2500.0

0.0466 0.1250

100.0 268.4

19.6

7.9

195.0

11 000.0

561.2

1.0

1100.0

0.1000

214.7

10.0

nr

nr

4 130.0

413.0

1.0

1280.0

0.3099

665.4

16.0

7.0

nr

9 410.0

588.1

1.0

1600.0

0.1700

365.0

32.0

nr

nr

15 800.0

493.8

1.0

1614.0

0.1022

219.3

45.0

nr

nr

25 000.0

555.6

1.0

1400.0

0.0560

120.2

5.0

7.5–8.0

nr

700.0

140.0

1.0

nr

nr

nr

1.2

8.0–9.0

nr

590.0

491.7

1.0

5.0

nr

nr

nr

nr

Quirindi (CBM) Surat Basin (CBM) (min) Surat Basin (CBM) (max) Alabama

4.3

8.0–9.0

nr

1 900.0

441.9

1.0

10.0

3.9

nr

nr

2 274.0

583.1

1.0

3.0

0.0013

2.8

Arizona

7.1

nr

nr

2 016.0

283.9

1.0

2369.0

1.1751

2522.8

Florida

2.9

nr

nr

1 023.0

352.8

1.0

640.0

0.6256

1343.1

14.0

nr

nr

3 479.0

248.5

1.0

4775.0

1.3725

2946.7

Powder River Basin Jiangsu Province

0.9

nr

nr

13.0

15.1

1.0

2.4

0.1846

396.3

0.5

nr

nr

43.0

86.0

1.0

122.0

2.8372

6091.2

Ecuador

Guayas Province

2.5

nr

nr

1 344.0

537.6

1.0

125.0

0.0930

199.7

India

Haryana

25.0

8.4

148.7

9 738.4

389.5

1.0

129.7

0.0133

28.6

8.2

8.3

277.0

3 701.0

451.3

1.0

nr

nr

nr

30.0

nr

nr

21 300.0

710.0

1.0

nr

nr

nr

2.0

7.3

nr

1 225.0

612.5

1.0

USA

Texas

China

Haryana (Rothak) Rajasthan

Israel

CBM = coal bed methane; nr = not recorded.

480.0

0.3918

841.2


Ca

Mg

K % ion/Cl ratio relative to seawater

mg/l

ion/Cl ratio


mg/l

ion/Cl ratio

400.0 364.0

0.0211 0.0180

100.0 85.5

1350.0 1000.0

0.0711 0.0500

100.0 70.4

380.0 0.0200 365.0 0.0180

504.0

0.0460

218.5

820.0

0.0750

105.6

350.0

0.0847

402.5

470.0

0.1138

347.0

0.0369

175.2

439.0

592.0

0.0375

178.0

740.0

0.0296

10.0

1125

Na % ion/Cl ratio relative to seawater


mg/l

ion/Cl ratio

100.0 90.0

10 500.0 9 470.0

0.5526 0.4740

100.0 85.8

9.2 0.0010

5.0

4 210.0

0.3830

69.3

160.2

25.0 0.0061

30.3

2 700.0

0.6538

118.3

0.0467

65.7

81.6 0.0087

43.4

5 240.0

0.5569

100.8

1 537.0

0.0973

136.9

80.0 0.0051

25.3

8 026.0

0.5080

91.9

140.6

2 800.0

0.1120

157.6

28.0

12 000.0

0.4800

86.9

0.0143

67.9

30.0

0.0429

3.0

0.0051

24.2

1.0

9.0

0.0047

22.5

86.0

0.0378

494.0

mg/l

ion/Cl ratio

Reference

Spotte, 1979 Fielder et al., 2001 Fielder et al., 2001 Ingram et al., 1996 Flowers and Hutchinson, 2004 Prangnell & Fotedar, 2006 Partridge & Creeper, 2004 Dutney, pers comm Anon, 2004

140.0

0.0056

60.3

nr

nr

nr

3 000.0

4.2857

775.5

0.0017

2.4

nr

nr

nr

300.0

0.5085

92.0

3.0

0.0016

2.2

nr

nr

nr

1 700.0

0.8947

161.9

Anon, 2004

179.6

21.0

0.0092

13.0

8.0 0.0035

17.6

1 393.0

0.6126

110.8

0.2450

1 163.9

86.0

0.0427

60.0

11.0 0.0055

27.3

2 013.0

0.9985

180.7

74.0

0.0723

343.6

83.0

0.0811

114.2

55.0 0.0538

268.8

865.0

0.8456

153.0

961.0

0.2762

1312.1

581.0

0.1670

235.0

51.0 0.0147

73.3

2 996.0

0.8612

155.8

36.0

2.7692

13 153.8

16.0

1.2308

1732.2

305.0

23.4615

4245.4

Boyd & Thunjai, 2003 Boyd & Thunjai, 2003 Boyd & Thunjai, 2003 Boyd & Thunjai, 2003 Veil et al., 2004

44.0

1.0233

4 860.5

17.0

0.3953

556.4

9.0 0.2093

1046.5

105.0

2.4419

441.9

147.0

0.1094

519.5

79.0

0.0588

82.7

10.0 0.0074

37.2

496.0

0.3690

2 030.2

0.2085

990.2

1987.9

0.2041

287.3

322.0

0.0870

413.2667

477.0

0.1289

181.3924

10.6 0.0029

14.3

2 406.0

0.6501

661.3

0.0310

147.4730

377.9

0.0177

24.9699

76.4 0.0036

17.9

6 011.6

0.2822

127.0

0.1037

492.4490

92.0

0.0751

105.6992

27.0 0.0220

700.0

0.5714

nr

nr

nr

nr

nr

nr

110.2041

nr

nr

Boyd & Thunjai, 2003 66.8 Boyd & Thunjai, 2003 nr Barman et al., 2005 117.6 Raizada, pers comm. 51.0710 Shakeeb-UrRahman et al., 2005 103.4014 Appelbaum, pers. comm.

1126


this resource was not considered a target yet, today, there are over 200 wells in Montana alone, producing over US$300 million/y and total CBM production now accounts for 8 % of USA natural gas production (Anon, 2004). In Australia, as at December 2007, there were proven and probable reserves estimated at 7500 PJ producing 107 PJ (95 % in Queensland, with the remainder in NSW), and estimates that the potential increase in production could supply 50 % of Australia’s demand for the east coast by 2020 (http://www.australianminesatlas.gov.au/aimr/commodity/coal_bed_ methane.jsp). The large volume of water produced has made disposal of the water a priority topic. For example, the estimates for total water production from CBM harvest in Queensland, Australia currently is in excess of 4000 ML/y, and this is predicted to exceed 42 000 ML/y by 2010 (Anon, 2001). Opportunities for beneficial use of the water produced have included re-injection to assist oil or gas recovery, industrial uses (e.g. dust control), use by animals, including for stock or wildlife watering, irrigation, creation of recreation areas, constructed wetlands, fisheries and aquaculture (Fitzsimmons, 1988; Anon, 2004; Veil et al., 2004).

36.4 Chemistry and remediation Table 36.1 lists ionic composition of saline groundwater sources. While the chemistry differs greatly across locations there are some similarities. Most saline groundwater is deficient in potassium with the lowest levels recorded in the Wakool region of the MDB in Australia where potassium was present at 5 % of the concentration found in equivalent salinity seawater. With the exception of CBM waste water from Queensland Australia, calcium in saline groundwater was higher than in seawater by a multiplication factor of between 1.4 and 130 (highest was CBM waste water from Powder River Basin, USA). Sulphate was also in relative excess at all locations except Alabama and Haryana, India. Magnesium was deficient at some locations (lowest in CBM wastewater in Queensland, Australia) and in excess at others (highest in CBM wastewater in Powder River Basin). Not surprisingly, considerable research has been conducted on methods to ameliorate deficiencies in water chemistry. Boyd and Thunjai (2003) summarised deficiencies in a number of water sources around the world used for culturing shrimp and provided a list of mineral sources that could be used as sources for major cations. Given the physiological importance of potassium, this ion has probably received the most attention. Fielder et al. (2001) found red sea bream (Pagrus auratus) lost equilibrium and became moribund within three days of transfer to saline groundwater from Wakool (see Table 36.1 for ionic composition) but, provided potassium was added to the water, survival and growth was similar to that in controls with coastal seawater. Potassium addition has also been found useful for other


1127

species cultured in saline groundwater (Flowers and Hutchinson, 2004; Prangnell and Fotedar, 2005, 2006; Doroudi et al., 2006; Tantulo and Fotedar, 2006; Partridge and Lymbery, 2008). Doroudi et al. (2006) found that survival and growth of mulloway (Argyrosomus japonicus) in saline groundwater was similar to that recorded in sea cage or tank trials with coastal seawater, provided potassium concentration was adjusted to 40 % or more of the equivalent concentration in coastal seawater. Additions of magnesium to the water have also been investigated. Forsberg and Neill (1997) found survival of red drum (Scieanops ocellatus) improved in low-salinity water with the addition of magnesium chloride. Similarily, Roy et al. (2007) recorded an improvement in survival of L. vannamei when magnesium chloride was added to magnesium-deficient water but neither study recorded significant improvements in growth. Boyd et al. (2006) added potassium chloride (muriate of potash) and potassium magnesium sulfate (Kmag) to ponds in Alabama used for L. vannamei culture to increase potassium, magnesium and sulfate concentrations to about 40, 25 and 60 mg/L, respectively. This treatment was successful in increasing shrimp survival and production. Calcium imbalances are also common. Forsberg and Neill (1997) improved survival, growth and feed efficiency of red drum with addition of calcium chloride to low-salinity groundwater in west Texas. The CBM waste water from Queensland, Australia is deficient in potassium and calcium (Table 36.1 and Dutney et al., 2008). Dutney et al. (2008) reported difficulties with adjusting calcium because of the formation of calcium carbonate. Reducing the pH was effective, but this was expensive and impractical. Most other sources of saline groundwater have excessive calcium compared with seawater. In Haryana, saline groundwater is high in calcium and magnesium compared with equivalent salinity seawater and this was recognised as a problem with larval production of Macrobrachium rosenbergii. Scientists addressed this by a clever use of ion-exchange resin incorporated into practical, largescale filters (Dr S. Riazada pers comm, 2008). Using a filter containing approximately 0.5 m3 of ion exchange resin, 2500 L/d of saline groundwater can be treated, sufficient to operate a large Macrobrachium hatchery capable of producing 1.5 million PLs per year (Dr S. Raizada, pers comm). Remediation of culture water can be expensive and ions are lost from ponds in overflow after rains, through soil adsorption and water exchange. Pond sediments in particular adsorb potassium because the native soils contain clays that fix potassium between adjacent tetrahedral layers (Boyd et al., 2006). The efficacy of adjusting potassium deficiency in saline groundwater through dietary manipulation has been investigated as an alternative or complementary approach but has not been effective for finfish (Gong et al., 2004; Saoud et al., 2007; Allan et al., 2008b). Gong et al. (2004) did record an improvement in osmoregulatory capacity of L. vannamei reared in low-salinity groundwater in Arizona when diets were supplemented with magnesium, potassium, phospholipids and cholesterol.

1128


There are numerous other imbalances in ionic composition and possible contaminants in saline groundwater. For many of these ions, site-specific studies will be needed. Most studies have focussed on large deviations of single ions but, as production from saline groundwater sources increases, it is likely that chronic effects will become apparent. Research to understand how to construct artificial mixed-salt environments and physiological responses of aquaculture species in low-salinity water will be valuable in helping to understand these relationships (see for example Cheng et al., 2005; Sowers et al., 2006; Zhu et al., 2006). In addition to ionic composition per se, sub-optimal pH has also negatively impacted on potential for aquaculture using saline groundwater. Acidic conditions can arise from the presence of acid sulphate soils, use of acid-forming fertilisers on agricultural lands, ferrolysis and elevated concentrations of dissolved carbon dioxide (Partridge et al., 2008). Research in South Australia (Hutchinson, 2008) found concentrations of dissolved carbon dioxide were regularly in excess of 160 mg/L and fan-forced, packed column degassing columns were installed both prior to water storage and prior to water entering culture tanks. In the Powder River Basin of Wyoming, residual volatile organics were also stripped in degassing columns that had the added benefit of introducing dissolved oxygen, which was very low in the raw CBM water.

36.5 Case studies 36.5.1 Case study: Australia There has been significant national interest in inland saline aquaculture in Australia since the late 1990s (see http://www.australian-aquacultureportal. com/saline/saline.html) and a national R&D Plan and resource inventory have been published. The grow-out of marine species in shallow aquifers (including evaporation basins) was identified as currently having the highest commercial prospect. Partridge et al. (2008) has thoroughly reviewed development of inland saline aquaculture in Australia, including a description of the water sources and composition, facilities used and culture methods. They concluded that while developing these industries could provide significant benefits, the goal of sustainable development had not yet been realised. Key challenges were the suitability of the available species to the farming environment and the quantity, quality and consistency of available saline groundwater. The MDB is one of the largest sources of saline groundwater in Australia. It extends from southern Queensland in the north, through New South Wales and Victoria in the south and across South Australia in the west. Research into the aquaculture potential of saline groundwater within the MDB was initiated in Victoria when different species were held in saline groundwater (Ingram et al., 1996). Oyster and penaeid shrimp species did


1129

not survive and only a couple of the eight species of finfish survived, probably because of ionic deficiencies, particularly potassium (Table 36.1). The aquaculture potential of saline groundwater within the MDB has also been studied at two sites within South Australia (Flowers and Hutchinson, 2004; Hutchinson, 2008) and one site in New South Wales. The research approach and development toward a commercial industry at the location in New South Wales is presented here as a case study. The Wakool–Tullakool Sub-Surface Drainage Scheme (WTSSDS) in New South Wales is the largest subsurface drainage scheme in Australia. It disposes of up to 35 000 ML of saline groundwater each year. The WTSSDS consists of 60 bore pumps for salt interception and 1600 ha of ponds for evaporation and disposal of the saline groundwater. It is estimated that the WTSSDS has helped return 60 000 ha of unproductive salt-degraded land back to productive farming. NSW Department of Primary Industries established the Inland Saline Aquaculture Research Centre in 2002 (Fig. 36.1). Potassium concentration in groundwater from the WTSSDS was only 5 % of the concentration found in marine water of the same salinity and, as such, was not suitable for survival and growth of marine species. Addition of potassium in the form of potash fertiliser increased potassium concentration in the saline groundwater, and small-scale experiments demonstrated that marine species survived and grew in potassium-fortified groundwater at similar growth rates reported for the species in marine water (Fielder

Fig. 36.1 ISA Research Centre facilities, Wakool, NSW.

1130


et al., 2001). A list of potential candidate species was established which included red sea bream (Pagrus auratus), black tiger prawn (Penaeus monodon), mulloway (Argyrosomus japonicus), silver perch (Bidyanus bidyanus) and rainbow trout (Oncorynchus mykiss). Early trials focused on determining optimal salinity and potassium concentrations for red sea bream, silver perch, mulloway and black tiger prawn. The key finding was that marine species required potassium to be fortified in saline groundwater to above 50 % of the concentration found in marine water of the same salinity. Growth rates of red sea bream, mulloway and black tiger prawn during bioassays were comparable to published rates in marine water. Silver perch, a salt-tolerant native freshwater species, grew well in raw groundwater and did not require potassium adjustment (Fielder et al., 2001; Doroudi et al., 2006, 2007; Allan et al., 2008a). Upon completion of the bioassays, pilot-scale commercial production of black tiger prawns, snapper, silver perch, mulloway and trout was undertaken in plastic-lined ponds. Cool winters and fluctuating daily water temperatures up to 0–5 °C limited the growth of red sea bream, silver perch and black tiger prawns. Pilot-scale commercial production showed that mulloway grew well when water temperature exceeded 16 °C. Average pond water temperature was generally greater than 16 °C during the period of November–May in the region. Mulloway appeared stressed when water temperature was less than 12 °C and, when water temperature was less than 10 °C (typically June and July), some fish died (Fig. 36.2).

Temperature covered

350 Temperature uncovered

250 200

Weight covered

Covers destroyed

150

Weight uncovered

100

20

10

50 0

12

-M a 11 y-0 -J 5 un 11 -05 -J u 10 l-0 5 -A ug 9- -05 Se p 9- -05 O ct 8- -05 N ov 8- -05 D ec 7- -05 Ja n 6- -06 Fe b 8- -06 M ar 7- -06 Ap r 7- -06 M ay 6- -06 Ju n6- 06 Ju l 5- -06 Au g06

0

Date

Fig. 36.2 Water temperature and wet weight of mulloway in uncovered and covered ponds at ISA Research Centre, Wakool, NSW, Australia.

Water temperature (°C)

Wet weight (g)

300

30


1

1131

2 3

Fig. 36.3 Three floating solar covers positioned on a 0.05 ha experiment pond. Table 36.2 Water quality of uncovered and covered ponds during experiment at ISA Research Centre, Wakool, NSW, Australia

CO2 (mg/L) NH4 (mg/L) pH DO (mg/L) Salinity (ppt)

Covered pond

Uncovered pond

0–15 0–0.4 7.3–8.5 >5.0 17–28

0–5 0–0.2 7.4–8.6 >5.0 17–29

The use of floating solar covers on mulloway ponds was investigated as a novel way to increase water temperatures (Fig. 36.3). Three floating polythene strips were constructed to allow complete coverage of a 500 m2 pond. Subsurface aeration was supplied with an Aero-2 aspirator pump aerator which was positioned between two adjacent solar covers. Access to the fish for feeding and sampling was done by retracting one cover to expose a small area of the surface water. The floating solar covers increased mean minimum winter and summer water temperatures by 1.5 °C and 3.0 °C, respectively, and had little effect on the major water quality parameters compared with those of uncovered, ambient ponds (Table 36.2). After 12 months of growout, mulloway cultured in solar covered ponds were 20 % heavier than fish cultured in uncovered ponds. Trout survival and growth was excellent when pond water quality was high and fortification of groundwater with potassium was unnecessary. However, build-up of organic matter in static ponds (minimal water exchange) reduced growth.

1132


600 500 Average trout weight (g) 2004

Weight (g)

400

Average weight (g) of G&G sale trout 2004

300

Average trout weight (g) 2005

200

Average weight (g) of G&G sale trout 2005

100

5-Dec

5-Nov

5-Oct

5-Sep

5-Aug

5-Jul

5-Jun

5-May

0

Date

Fig. 36.4 Growth of rainbow trout in saline groundwater ponds at ISA Research Centre, Wakool, NSW, Australia (2004 & 2005).

The ambient pond water temperatures in the region were found to be potentially suitable for salmonid production for at least seven months of the year from April to October. Growth performance of the trout produced during three successive years was outstanding and after three months fish stocked at 40 g had an average wet weight of >310 g (Fig. 36.4). Survival was near to 100 % during winter but began to decrease as pond temperatures exceeded 21 °C in summer, indicating that 60 % exchange of pond water each day was inadequate to reduce heating of ponds during summer. Average feed conversion ratio (FCR) during the production period was 1.1 : 1. Despite increasing pond water temperatures market-size fish were continually harvested until late December. The rainbow trout cultured in saline groundwater were very popular with consumers due to the fresh, salty flavour compared with freshwater cultured rainbow trout and consequently returned up to two dollars per kg more than freshwater trout as they were considered a superior product. Economic analyses of rainbow trout culture in raceways was completed using an economic model (Johnston, 2008) and confirmed by independent investment analysis. These analyses indicated that a 200 t/y rainbow trout farm could return an attractive rate of return on investment. However, the biggest constraint to commercial development of inland saline aquaculture in southern NSW currently is the deficit of saline groundwater as a consequence of the severe, long-term drought in the MDB system. The extended drought has meant that little or no fresh, irrigation water has been available for irrigated cropping and significant rain has not fallen in the MDB for many years. As a consequence, the groundwater table has not been recharged and the saline groundwater table is very deep. Pumping of saline ground-


1133

water is therefore not needed and, as it is expensive, has been reduced. The volume of saline groundwater at the WTSSDS has decreased from an average of approximately 35 ML/d in ‘normal’ years to 4–5 ML/d in ‘drought’ years. The limited availability of saline groundwater has highlighted the need for on-going research to identify viable, commercial methods for reuse of saline groundwater in rainbow trout production as well as effluent disposal from evaporation basins.

36.5.2 Case study: India, culture of Macrobrachium rosenbergii Management of irrigation salinity has been a major issue in India for many years. For example, since 1966 the state of Haryana has experienced a major increase in development of new irrigation schemes. Approximately 70 % of Haryana’s net sown area, or 2.6 million ha, is irrigated from canals (54 % of area) or tubewells (46 % of area). However, major land degradation through rising groundwater tables, accumulation of soluble salts in the soil profile and reduced crop yields and, in extreme cases, abandonment of cultivation, is occurring on a wide scale – almost 50 % of the state. Agricultural production loss due to waterlogging and salinity in Haryana in 2000 was estimated at approximately US$22.5 million (Agarwal and Roest, 1996). Waterlogging and salinity problems are exacerbated in Haryana due to a topographical depression or basin, which covers an area of 1.7 million ha in the centre of the state. Groundwater, which in 55 % of the state is unfit (too saline) for irrigation, flows towards the centre of the basin and accumulates as it cannot be discharged through natural drains. As in Australia, the value of subsurface drainage systems for reducing water tables and improving productivity has been demonstrated in a number of pilot projects and more are being constructed or planned. For example, two large-scale subsurface projects (1000 ha each) in Haryana have recently been established in two clusters of villages in Gohana and Kalayat areas, with the aim to assess social, technical and economical parameters in farmers’ fields. Not only has agricultural productivity increased but also land value has increased and waterborne diseases and malaria were perceived to have reduced after the system was installed (Pal et al., 1999). Although the benefits of installing subsurface drainage systems appear to be high and environmentally sound, sustainable disposal of the collected saline groundwater is paramount. Evaporation basins offer a solution to this problem. This is recognised by Indian authorities, and installation of evaporation basins will be necessary as part of saline groundwater mitigation schemes. The potential to use saline groundwater for aquaculture in India has been identified as a high-priority research area. Research and education facilities have been constructed in Haryana (e.g. Central Institute of Fisheries Education (CIFE) at Rohtak) aimed specifically to evaluate the potential for aquaculture using saline groundwater and to educate farmers in developed technology.

1134


Recent research at the CIFE, Rohtak Centre has focussed on development of technology for hatchery and grow-out production of Macrobrachium rosenbergii, in shallow water table, saline groundwater of low salinity (4–12 ppt). This research was initiated for several reasons. Firstly, a small industry had developed in Haryana for growout of Macrobrachium in ponds using high-quality freshwater. Macrobrachium are not endemic to Haryana and PLs were sourced from coastal hatcheries, which was expensive due to costs of airfreight and, importantly, availability was often uncertain and delayed well into the summer growing season, thus reducing the grow-out period and potential return/ha. Production from local hatcheries would therefore improve availability and possibly reduce the purchase cost of PLs. Secondly, a great deal of saline groundwater was available for aquaculture, but little was known about pond management and the production performance of Macrobrachium in saline groundwater. Initial attempts to culture larvae in raw saline groundwater (12 ppt) were unsuccessful and led to investigation of the need for water chemistry amendment. Low potassium (11.7 % of seawater (SW)) and high magnesium (132 % of SW) and calcium (316 % of SW) concentrations in the groundwater compared with that of similar salinity seawater were found to cause total mortality of larvae within days of hatching. A simple and cheap method of filtering the groundwater through a zeolite, sodium–aluminium– orthosilicate, was used to reduce the calcium concentration to that of equivalent salinity SW. The process also decreased magnesium concentration which subsequently required addition of magnesium, as magnesium chloride, to restore the magnesium : calcium to 2.5 : 1. Addition of potassium chloride (or potash) increased the potassium level similar to that found in the same salinity seawater (Table 36.3). Once these ionic amendments were made, growth and survival of prawn larvae was high (routinely >40 % survival) and 100s of thousands of PLs were produced in an experiment-scale hatchery. Management of broodstock to provide gravid females in spring was also addressed because maintenance of prawns in outdoor ponds during winter

Table 36.3 Water chemistry of diluted coastal seawater (12 ppt) and inland saline groundwater (12 ppt) from Haryana, before and after amendment for larval rearing of Macrobrachium rosenbergii Ion Magnesium Calcium Potassium 1

Coastal sea water diluted1 (mg/L)

Raw saline groundwater (mg/L)

Amended saline groundwater (mg/L)

339.9 123.7 124.0

616.0 440.0 10.9

275–304 148–160 118

Adapted from Fielder et al., 2001.


1135

months from December to March was not possible due to sub-optimal temperatures. Broodstock were successfully held indoors in heated tanks during winter; however, the small number of prawns held and the high cost or, at times, unavailability of electricity precluded this as an option for a large-scale hatchery. Alternatively, polyhouses were constructed over two 450 m2 ponds and each was stocked in December with approximately 650 mature prawns. The minimum water temperature in the covered ponds was 19.5 °C, 7.5 °C greater than the minimum temperature in uncovered ponds, and approximately 90 % of prawns survived with 70 % of the female prawns becoming gravid by March. Polyhouses therefore effectively maintained suitable water temperature during winter for large-scale broodstock management and allowed timely supply of larvae for hatchery production at the start of spring. The semi-arid, inland environment of Haryana is characterised by extreme hot summers and cold winters which restrict the growout of Macrobrachium in ponds to nine months from April to mid-December. Therefore early stocking of juvenile prawns is essential to maximise the period of growth and subsequently produce the greatest volume of large, more valuable prawns. Macrobrachium are generally cultured in freshwater and their production in saline groundwater was not well understood. Laboratory and pilot-commercial scale experiments in ponds demonstrated that Macrobrachium grew well in raw saline groundwater up to 4 ppt, and production of approximately 1200 kg/ha was reliably achieved after 100 day grow-out. However, at salinities of 5–10 ppt, performance of Macrobrachium in raw saline groundwater was reduced and this was caused by low potassium concentration. The addition of potassium to the groundwater to provide 50–100 % of that found in similar salinity seawater significantly improved growth. Investigations at the Rohtak Centre are now concentrating on evaluation of the benefits of polyculture of Macrobrachium with carp species compared with prawn monoculture.

36.5.3 Case study: Israel, Desert aquaculture The availability of freshwater in Israel is limited due to climatic conditions with rainfall usually only in the winter and mainly in the northern and central areas of the country (Table 36.4). Though national projects have been undertaken to ease this shortage and to achieve a more rational water distribution and management policy throughout the country (Fig. 36.5) due to the continued water shortage, agriculture and aquaculture have been developed to high standards in terms of output per unit of water used. Fish farming in the country began in the 1940s. Today aquaculture is practised in 73 Kibbutz farms located mostly in the northern and central parts of the country. Total annual production, including the catch in the Sea of Galilee, the only freshwater lake in the country, amounts to ∼25 000 tonnes. The main species of fish produced are tilapias, carps, mullet and

1136


Table 36.4

Israel’s freshwater resources and average annual use

Resource Coastal aquifer Mountain aquifer Sea of Galilee and the Jordan River system West Galil aquifer Carmel aquifer Negev and Arava aquifer Total potential of replenishable water

Potential utility (million m3)

Addition potential (million m3)

250 600 640 170 40 55

90 million lost into the Dead Sea 55 million diverted to Jordan

1755

Treated sewage

270

Total potential

2025

Total

2400

145 230 million lost into the Mediterranean 375

trout, reared in earthen ponds and reservoirs filled with spring and rain water. The total annual fish consumption in Israel has reached over 75 000 tonnes (nearly 11 kg per capita). One third of this comes from local production and catch and two thirds are imported. Consumption forecasts for the years 2010 and 2020 are 86 000 tonnes and over 100 000 tonnes, respectively, demanding an increase in production and importation. Israel has to continue developing and expanding aquaculture to meet its increasing demand for fish. However, the continuous domestic freshwater shortage in Israel (Table 36.4) and its high costs, accompanied with intensive urbanisation and rising land prices, particularly along the Israeli coastal belt where fish farms have been traditionally operating, limit the expansion of aquaculture, highlighting the need for alternative water resources and sites. Two thirds of Israel is covered by desert, an area of ∼13 000 km2 which receives an annual rainfall of only 60–100 mm and is inhabited by just 2–3 % of the population. Shortly after the establishment of the state of Israel (1948), a 100 m deep drilling project, in search for freshwater in the Negev Highland district, the largest district of the Negev desert, was undertaken with disappointing results. However, in the late 1950s, further drilling for freshwater down to a depth of 1000 m led to the discovery of the ‘Nubian Sand Stone’ (300 m and below) and the ‘lower Cenomanian Turonian’ (800–1000 m) aquifers, containing huge reserves of billions m3 of unpolluted, brackish geothermal water – the ‘desert water’. In the Negev Highland district there are at present eight combined wells (600–750 m deep) supplying 6.3 million m3 of brackish geothermal


Mediterranean Sea West Galil Aquifer

1137

Sea of Galilee System Sea of Galilee

Hiafa Carmel Aquifer

Schem - Gilboa Aquifer

Tel Aviv Jordan River Jerusalem System Mountain Aquifer

Coastal Aquifer

Dead Sea

Beer Sheva

Arava Aquifer Negev Aquifer

Eilac

Fig. 36.5 The national water carrier: water transfer from wet to arid areas.

1138

New technologies in aquaculture Table 36.5 Mineral composition of desert brackish geothermal water compared with seawater and freshwater

pH EC mS Cl mg/L SO4 mg/L NO3 mg/L Br mg/L NH4 mg/L K mg/L Ca mg/L Mg mg/L Na mg/L HCO3 mg/L F mg/L Sr mg/L Fe mg/L Mn mg/L Ba mg/L SiO2 mg/L P mg/L Al mg/L Cu mg/L TOC TDS mg/L

Brackish water

Seawater

Freshwater

7.25 4.43 1225 480

– – 19 000 885 – – – 380 400 1350 10 500 – – – – – – – – – – – –

7.45 0.988 128 58.5 16.5 ND 0.144 5.54 64.3 27.9 85.0 260 – – – – – – – – – – 646

– – – 27 172 92 700 189 1.19 5.34 ND ND 0.03 17.04 ND 0.06 ND 6.00 ∼2919

ND = not determined; TDS = total dissolved solids; TOC = total organic carbon.

(38–40 °C) ‘desert water’ per annum to the farms of five major settlements in this district of ∼400 000 ha, with a population of about 5000 settlers in total. For the last 40 years this brackish water (3–7 ppt, TDS) has been successfully used for irrigation of agricultural crops and, since the late 1980s, has also been in use for aquaculture. This ‘desert water’, though resting deep in the ground (400–1000 m), is easily accessible as it rises by artesian pressure to nearly sea level and has just to be further raised to ground level from an average suction depth of about 400 m. The fact that this water is available at warm temperatures all year round (around 40 °C when reaching the surface) provides an excellent and realistic potential for the expanding national fish farming industry. Many studies have proven that growth rate, metabolic rate, feed intake, feed conversion and survival in fish are influenced largely by water salinity. This subsurface ‘desert water’, with a salinity ranging from 3–7 ppt (TDS) (Table 36.5), has been found most suitable for fish culture and is currently in use for raising freshwater and marine fish species in the Israeli desert. Species cultured include: tilapia (Oreochromis


1139

niloticus); barramundi (Lates calcarifer); gilthead sea bream (Sparus aurata); hybrid striped bass (Morone saxsatilis x M. chrysops); red drum (Sciaenops ocellatus); and catfish (Clarias gariepinus). Desalination of seawater or brackish water is one of the major steps towards combating the severe water shortage in Israel. Brine resulting from the process of desalination of seawater is easily returned to the sea. However, brine from desalination of inland water away from the sea is disposed of by using evaporation ponds. The desalination plant in Ramat Negev district, near the Israeli–Egyptian border, produces 3.5 millions m3 of freshwater annually, while producing as a by-product thousands of m3 of brine. This brine can be used for aquaculture, being particularly suitable for the reproduction of aquatic species that can grow in low-saline water but only breed in water of higher salinity such as seawater. Fish farming in the desert benefits from the following significant advantages: • the existence of large amounts of accessible subsurface unpolluted brackish geothermal water, the so-called ‘desert water’; • the moderate salinity of the water provides an osmoregulatory advantage for a number of species; • the geothermal ‘desert water’ provides constant temperatures favourable for faster fish growth and more economic production; • the expense to the contrary of the ‘desert water’ is lower than that of freshwater in the country; • land for aquaculture in the desert is readily available and much more accessible compared with the high priced land in other regions of the country; • the pollutant-free ‘desert water’ has the unique potential of yielding high quality fish products for marketing. Culture of ornamental fish has gained enormous popularity worldwide and interest appears to be continuously growing, making it potentially a very profitable global component of international trade worth more than US$10 billion annually. The culture of ornamental and tropical hobby fish in Israel for export started during the 1970s and is expanding due to continuous high demand. Today there are about 20 tropical fish farms, most of which are located in the Israeli desert area. The size of the farms is typically from 0.1–0.3 ha, each farm operating in separate hot-houses isolated from the others, with no common water system. Among the major ornamental fish species cultured in the desert farms in Israel are: guppy (Poecilia reticulate); platy (Xiphophorus maculates); swordtail (Xiphophorus helleri); angelfish (Pterophyllum scalare); and catfish (Corydoras). The routine use of saline groundwater for agricultural irrigation, together with the realisation that commercial production of fish reared in saline water in ponds and hothouses is not only feasible but also economical, has enabled Israeli fish farms in the desert to successfully combine aquaculture

1140


and agriculture into integrated farming systems in the sense that the effluent from fish ponds, rich with organic waste, is used for field and orchard irrigation making more rational use of the ‘desert water’. There are currently about 15 commercial fish farms operating in the Israeli desert which produce edible and ornamental fish as well as ornamental crustaceans (see example of a typical desert fish farm; Fig. 36.6). All edible fish that are produced in the desert are sold on the domestic market while most of the ornamental fish produced are exported. In order to expand its aquaculture activities it has become necessary for Israel to increase the use of available marginal water, i.e. existing brackish ‘desert water’, as well as desalinated sea and brackish water. Expansion of aquaculture in the Israeli Negev desert, adapting and developing technologies for intensive fish culture, especially in integrated operations with agriculture, is a matter of necessity. Thus the intensive utilisation of brackish geothermal water in the Israeli desert for integrated agriculture/aquaculture is enabling the continued expansion of Israel’s aquaculture industry while significantly easing the pressure on Israel’s scarce freshwater resources. Figure 36.7 shows the distribution of brackish geothermal water collected from several bores from a well head. The bulk of the brackish water flows directly to a reservoir, but part of the 40 °C brackish water goes directly to heat greenhouses before exiting to the reservoir. Another part flows to covered fish ponds providing clean and warm brackish water on demand. The fish ponds and the reservoir form a recirculation water system that provides a growing environment for fish culture. Freshwater from the reservoir and the effluent-rich water from the fish ponds is used for irrigation of open fields and orchards. Experiments for the use of saline water for agricultural irrigation began in the late 1940s. Ongoing research has led to widespread use of ‘drip irrigation’ systems and to the current use of saline water for irrigation. The use

Fig. 36.6 Typical Israeli desert fish farm for edible fish.


1141

Well head brackish geothermal water ~40°C

Geothermally heated greenhouses

Cattle

Effluent enriched water

Alfalfa

Fig. 36.7

Covered fish ponds

Water reservoir

Selected vegetables

Pomegranates Olives

Layout of integrated desert aqua/agriculture operation.

of saline water for commercial production of wheat, cotton and fodder began in 1972. Since then, sweet tomatoes, onions, sweet potatoes, alfalfa, jojoba, Salicornia, pomegranates and olives are also being produced with saline water. Recently saline water is being used for irrigation experimentally in vineyards and for growing almonds. Research programs which have been carried out at the Bengis Center for Desert Aquaculture (The Albert Katz Department of Dryland Biotechnologies of the Institutes for Desert Research at the Ben-Gurion University of the Negev) have proved that this brackish ‘desert water’, due to its moderate salinity, mineral composition, constant warmth, purity and availability regardless of the weather conditions, is highly advantageous for culturing warmwater aquatic species (e.g. tilapia; Fig. 36.8). Desert aquaculture is not a technological revolution; it is rather an innovative approach that differs from conventional fish farming. Arid or desert lands with subsurface water resources have huge potential for developing and sustaining aquaculture and agricultural products. Research findings continue to show that the possibility of using inland brackish water for farming aquatic species is a promising realistic alternative to many of the traditional operations. Further development of Israeli aquaculture will have to go hand in hand with the expansion of the existing domestic desert aquaculture. Technologies applied in arid or desert lands must minimise negative impacts on the unspoiled environment and should maximise the preservation of the land as well as the efficiency of water use. This can ideally be achieved by integrating aquaculture with agriculture, allowing the conservation of water through the expansion of the chain of users utilising the same

1142


Fig. 36.8 Happy red tilapia in an Israeli desert fish farm.

water source. The steadily growing consumer market for high-quality aquaculture products and the vast amounts of unpolluted brackish geothermal water accessible beneath the Israeli desert suggest the production of thousands of tonnes of fish and other aquatic organisms in the Israeli desert to be a reality forecast for the not too distant future. In the Israeli aquaculture development and expansion, the Negev Desert, associated with and guided by local applied research, will hold an increasingly dominant position (Applebaum, 1995, 1998).

36.5.4 Case study: USA, inland marine shrimp aquaculture Inland culture of marine shrimp in the USA began in the 1990s in two parallel activities. First, as a specialty enterprise devoted to production of pathogen free (SPF) broodstocks. Second, as commercial farms for grow-


1143

out of penaeid shrimp for domestic markets. Early SPF broodstock efforts were in cooperation with the University of Arizona with small projects, mostly in conjunction with tilapia farms using saline groundwater along the Salton Sea in Southern California and over saline aquifers in Southwestern Arizona. These efforts, while technically successful, led to only minor commercial activity selling SPF broodstock to hatcheries in the USA and abroad. Also in the 1990s, commercial activity began on production farms in the Pecos Valley of West Texas, in western Alabama, in Southern Florida and in the Hyder Valley of Southwestern Arizona. The goal of these farms was to produce high-quality marine shrimp for US consumer markets. By targeting a premium market with locally grown shrimp, the farmers hoped to cover the higher costs of production in the USA compared to imported shrimp. In practice, the farms have managed to develop niche markets to sell most of their shrimp. These include sales of 5–10 g shrimp to large public aquaria to feed display animals or to fishermen for bait, 15–20 g live shrimp to Oriental restaurants to put in live tanks for diners’ selection and, finally, 15–20 g, fresh and frozen shrimp for on-farm or direct delivery to local restaurants. At one time in the early 2000s there were at least two farms in Alabama, two in West Texas, four in Arizona and one in Florida. By 2008, only one farm in Alabama and one in Arizona appeared to be operating. The low prices of foreign shrimp and limited market appeal for higher cost domestic shrimp appeared to be the greatest obstacle. High labour and water costs were major contributors along with the higher than expected capital and operating costs. One of the major expenses was the costly acclimation procedure to adapt PLs to the salinity levels found on most of the inland farms. PLs typically arrived at the farms in 30 ppt water while the local aquifer water tends to be 2–5 ppt. At most of the farms, a recirculating water system was constructed to receive PLs and hold them while they are fed and farm water is added to the high-salinity water in which they arrived. The acclimation process often covered 2–4 weeks before the animals were fully acclimated and could be stocked into local ponds or raceways with saline groundwater. Other significant costs were adjustments to the feed and/or water amendments to account for differences in mineral constituents between the groundwater and oceanic water. The groundwaters used at the farms, while saline, usually had ratios of mineral salts that were somewhat different from the ratios in marine waters. In some instances, changes were made in the diets, especially mineral premixes to improve shrimp growth and survival (Gong et al., 2004). In other cases, it was easier to add commercially available minerals in bulk to the water (McIntosh and Fitzsimmons, 2003; Boyd et al., 2006). Once the shrimp are acclimated to the local low-salinity waters and stocked into the grow-out units, growth to harvest size of 15–25 g typically occurs over 3–5 months. At some farms, effluents are reused to irrigate salt-tolerant crops including olives, dates and

1144


Fig. 36.9 Effluent to olives.

wheat (Fig. 36.9). In other instances the saline effluent is blended with low-TDS water from adjacent wells to irrigate less salt-tolerant crops (McIntosh et al., 2003).

36.6 Future trends Inland saline aquaculture encompasses a number of culture species, systems and water types. The potential for expansion of these production systems is almost unlimited. With the increasing demands on potable water and marine coastal locations, use (or re-use) of inland saline waters provides a critical resource for high-quality seafood production using otherwise unproductive, or even detrimental, resources. Integration of aquaculture with conventional, halophytic or even seaweed culture would further increase the efficiency and sustainability of these food production systems (Riley et al., 1997; Brown et al., 1999). Basic and applied research into practical management systems for these systems is rapidly providing us with the knowledge of how to turn these into profitable farming ventures. Additional research into the physiological stresses of rearing more valuable species in inland saline systems and practical integration of aquaculture effluents for plant crop production are high priorities. The food and fuel crises of 2008 will inevitably be followed by another water crisis, impacts of climate change on conventional crops, fertilizer shortages and other consequences of increasing populations competing for limited resources. Novel food production methods are needed to further improve global wellbeing and inland saline aquaculture is bound to be a most valuable tool.


1145

36.7 References agarwal mc and roest cjw (1996) Towards improved water management in Haryana State, Final report of the Indo-Dutch operational research project on hydrological studies, Hisar, Haryana. allan gl, banens b and fielder ds (2001) Developing commercial inland saline aquaculture in Australia: Part 1 R&D Plan, Final report to FRDC Project No. 98/335, NSW Fisheries Final Report Series No. 31, NSW Fisheries, Cronulla, NSW. allan gl, blackburn j and fielder ds (2008a) Toward commercialisation of inland saline aquaculture in the Murray Darling Basin, Skretting Australasian Aquaculture Conference, 3–6 August, Brisbane. allan gl, heasman h and bennison s (2008b) Development of industrial-scale inland saline aquaculture: coordination and communication of R&D in Australia, Final report to FRDC Project No. 2004/241, NSW Department of Primary Industries – Fisheries Final Report Series No. 100, Cronulla, NSW. anon. (2001) Dryland salinity in Australia: A summary of the National Land and Water Resources Audit – extent impacts, processes and management options, Australian Natural Resources Atlas, Department of the Environment, Water, Heritage and the Arts, Canberra, http://www.anra.gov.au/topics/salinity/pubs/ national/salinity_summary.html, accessed January 2009. anon. (2004) Coal seam gas (CSG) water management study, Australian Department of Natural Resources, Mines and Energy, Contract NROOO11, Parsons Brinkerhoff, Brisbane, QLD. appelbaum s (1995) Technology for desert aquaculture, Journal of Arid Land Studies, Abstract No. 5S, 207–10. applebaum s (1998) Desert aquaculture – a new opportunity for world aquaculture production, Journal of Arid Land Studies, Abstract No. 7S, 101–3. barman uk, jana sn, garg sk, bhatnagar a and arasu art (2005) Effect of inland water salinity on growth, feed conversion efficiency and intestinal enzyme activity in growing grey mullet, Mugil cephalus (Linn.): field and laboratory studies, Aquaculture International, 13, 241–56. boyd ca, boyd ce and rouse db (2006) Water quality issues related to inland shrimp farming in Alabama (USA), Skretting Australasian Aquaculture Conference, 27–30 August, Adelaide, SA. boyd ce and thunjai t (2003) Concentrations of major ions in waters of inland shrimp farms in China, Ecuador, Thailand, and the United States. Journal of the World Aquaculture Society, 34, 524–32. brown jj, glenn ep, fitzsimmons km and smith se (1999) Halophytes for the treatment of saline aquaculture effluent, Aquaculture, 175, 255–68. cheng km, hu cq, liu yn, zheng sx and qi xj (2005) Dietary magnesium requirement and physiological responses of marine shrimp Litopenaeus vannamei reared in low salinity water, Aquaculture Nutrition, 11, 385–93. doroudi ms, fielder ds, allan gl and webster gk (2006) Combined effects of salinity and potassium concentration on juvenile mulloway (Argyrosomus japonicus, Temminck and Schlegel) in inland saline groundwater, Aquaculture Research, 37, 1034–9. doroudi ms, webster gk, allan gl and fielder ds (2007) Survival and growth of silver perch, Bidyanus bidyanus, a salt-tolerant freshwater species, in inland saline groundwater from southwestern New South Wales, Australia, Journal of the World Aquaculture Society, 38, 314–17. dutney l, burke m, willet d and collins a (2008) Evaluation of the potential for aquaculture in cotton catchments using coal seam gas water. Skretting Australasian Aquaculture Conference, 3–6 August, Brisbane.

1146


fao (2007) The State of World Fisheries and Aquaculture 2006, Rome, Food and Agriculture Organization of the United Nations. fielder ds, bardsley wj and allan gl (2001) Survival and growth of Australian snapper, Pagrus auratus, in saline groundwater from inland New South Wales, Australia, Aquaculture, 201, 73–90. fitzsimmons km (1988) Status of aquaculture in the state of Arizona, Geothermal Heat Center Bulletin, 11(1), 23–4. flowers tj and hutchinson w (2004) Preliminary studies towards the development of an aquaculture system to exploit saline groundwater from salt interception schemes in the Murray Darling Basin, SARDI Aquatic Sciences, Adelaide, SA. forsberg ja and neill wh (1997) Saline groundwater as an aquaculture medium: physiological studies on the red drum, Sciaenops ocellatus, Environmental Biology of Fishes, 49, 119–28. gong h, jiang dh, lightner dv, collins c and brock d (2004) A dietary modification approach to improve the osmoregulatory capacity of Litopenaeus vannamei cultured in the Arizona desert, Aquaculture Nutrition, 10, 227–36. hutchinson wg (2008) SARDI – Application for demonstration facility and summary of R&D progress, in Allan GL, Heasman H and Bennison S (eds), Development of Industrial-scale inland saline aquaculture: Coordination and communication of R&D in Australia, Final Report to FRDC Project no. 2004/241, NSW Department of Primary Industries – Fisheries Final Report Series 100, Cronulla, NSW, 38–52. ingram ba, mckinnon lj and gooley gj (1996) Growth and survival of selected aquatic animals in two saline groundwater evaporation basins: an Australian case study, Aquaculture Research, 33, 425–36. johnston b (2008) Profit model consultancy: Economic models for inland saline aquaculture of finfish, prawns and recirculation culture, in Allan GL, Heasman H and Bennison S (eds), Development of industrial-scale inland saline aquaculture: Coordination and communication of R&D in Australia, Final report to FRDC Project No. 2004/241, NSW Department of Primary Industries – Fisheries Final Report Series 100, Cronulla, NSW, 191–210. lambers h (2003) Dryland salinity: A key environmental issue in southern Australia, Plant and Soil, 257, v–vii. mcintosh d and fitzsimmons k (2003) Characterization of effluent from an inland, low-salinity shrimp farm: what contribution could this water make if used for irrigation, Aquacultural Engineering, 27, 147–56. mcintosh d, fitzsimmons kaguilar j and collins c (2003) Toward integrating olive production with inland shrimp farming, World Aquaculture, 34(1), 16–20. pal s, sharma br and parshad r (1999) Social audit on reclamation of salt affected soils in India, Indian Council of Agricultural Research, New Delhi. partridge gj and creeper j (2004) Skeletal myopathy in juvenile barramundi, Lates calcarifer (Bloch), cultured in potassium-deficient saline groundwater, Journal of Fish Diseases, 27, 523–30. partridge gj and lymbery aj (2008) The effect of salinity on the requirement for potassium by barramundi (Lates calcarifer) in saline groundwater, Aquaculture, 278, 164–70. partridge gj, lymbery aj and george rj (2008) Finfish mariculture in inland Australia: A review of potential water sources, species, and production systems, Journal of the World Aquaculture Society, 39, 291–310. prangnell di and fotedar r (2005) The effect of potassium concentration in inland saline water on the growth and survival of the western king shrimp, Penaeus latisulcatus Kishinouye, 1896, Journal of Applied Aquaculture, 17, 19–33. prangnell di and fotedar r (2006) Effect of sudden salinity change on Penaeus latisulcatus Kishinouye osmoregulation, ionoregulation and condition in inland


1147

saline water and potassium-fortified inland saline water, Comparative Biochemistry and Physiology A-Molecular & Integrative Physiology, 145, 449–57. qureshi rh and barrett-lennard eg (1998) Saline Agriculture for Irrigated Land in Pakistan: A Handbook. Monograph No. 50, Australian Centre for International Agricultural Research, Canberra. riley jj, fitzsimmons km and glenn ep (1997) Halophyte irrigation: An overlooked strategy for management of membrane filtration concentrate, Desalination, 110, 197–211. roy la, davis da, saoud ip and henry rp (2007) Effects of varying levels of aqueous potassium and magnesium on survival, growth, and respiration of the Pacific white shrimp, Litopenaeus vannamei, reared in low salinity waters, Aquaculture, 262, 461–9. saoud ip, roy la and davis da (2007) Chelated potassium and arginine supplementation in diets of Pacific white shrimp reared in low-salinity waters of west Alabama, North American Journal of Aquaculture, 69, 265–70. sowers ad, tomasso jr, browdy cl and atwood hl (2006) Production characteristics of Litopenaeus vannamei in low-salinity water augmented with mixed salts, Journal of the World Aquaculture Society, 37, 214–17. shakeeb ur r, jain ak, reddy ak, kumar g and raju kd (2005) Ionic manipulation of inland saline groundwater for enhancing survival and growth of Penaeus monodon (Fabricius), Aquaculture Research, 36, 1149–56. spotte s (1979) Fish and Invertebrate Culture: Water Management in Closed Systems, Wiley, Chichester. tantulo u and fotedar r (2006) Comparison of growth, osmoregulatory capacity, ionic regulation and organosomatic indices of black tiger prawn (Penaeus monodon Fabricius, 1798) juveniles reared in potassium fortified inland saline water and ocean water at different salinities, Aquaculture, 258, 594–605. trendall j (2008) Inland saltwater aquaculture saltwater trout: a case study in supply chain development, in Allan GL, Heasman H and Bennison S (eds), Development of industrial-scale inland saline aquaculture: Coordination and communication of R&D in Australia, Final Report to Fisheries Research and Development Corporation Project No. 2004/241, NSW Department of Primary Industries – Fisheries Final Report Series No. 100, Cronulla, NSW, 191–210. veil ja, puder mg, elcock d and redweik rj (2004) A White Paper Describing Produced Water from Production of Crude Oil, Natural Gas, and Coal Bed Methane, prepared by Argonne National Laboratory, Argonne, Illinois for the U.S. Department of Energy, National Energy Technology Laboratory. zhu cb, dong sl, wang f and zhang hh (2006) Effects of seawater potassium concentration on the dietary potassium requirement of Litopenaeus vannamei, Aquaculture, 258, 543–50.

37 Urban aquaculture: using New York as a model M. P. Schreibman and C. Zarnoch, City University of New York, USA

Abstract: Here we discuss the major ramifications of urban aquaculture development using New York City as a model and template. We define the parameters essential for successful aquaculture, as well as reflecting on the problems that we face as we move urban aquaculture from concept to practice and to ultimate success. We envision closed, water-reuse systems (recirculating aquaculture systems; RAS) as key to environmentally responsible, sustainable, intensive, and economically feasible aquaculture in metropolitan areas. We suggest that research must may play a major role in the development and application of technology, biological principles, and socioeconomic feasibility, each one of which is an important entity for successful urban aquaculture development. Furthermore, the future success of urban aquaculture is likely to depend upon support in the form of grants and subsidies, research, and access to capital. Key words: New York City, recirculating aquaculture systems, environmentally responsible, metropolitan area, technology.

37.1 Introduction The United Nations estimates that by 2025 the urban population of the world will increase to 5.1 billion people – the population size of the entire Earth in 1930 (Costa-Pierce and Desbonnet, 2005). It is also estimated that by the year 2020, 80 % of the population of the USA will live in a coastal city or within a one hour drive of an ocean or bay. There will be demand for aquaculture to supply 49 million Mt of product (16 million Mt higher than the 1999 levels) to maintain the current per capita consumption for a projected world population of 6.8 billion people in 2010 for a total demand of 142 million Mt (Timmons, 2005). These projections, coupled with an increasing demand for high-quality protein derived from seafood products, the drastically dwindling supplies of our natural fishing stores. The socioeconomic issues spawned by growing metropolises around the world,

Urban aquaculture: using New York as a model

1149

such as ecosystem stability, employment, and fuel costs will demand new approaches to address these issues. What novel technologies will enable intensive, sustainable production of aquatic organisms in populous areas? Urban aquaculture can respond to these needs using the water-reuse systems that have been developed and refined during recent years, coupled with responsible ecosystem management and creative economic planning. The term aquaculture need not be defined for the audience that will study the contents of this book. The term ‘urban’, however, may need some discussion. Our perception of what is urban and what is rural would no doubt be influenced by where we live – the new world, the old world, or in developing countries. In their discussion of what is meant by ‘urban’, Little and Bunting (2005) suggest that rural areas are those that are under agriculture, forest and woodland, and wild tracts of land that have never been manipulated. They conceptualize that urban areas are characterized by nucleated settlements, labor organizations, and markets and with connecting links. Thus, urban centers serve as major distribution hubs with an available labor force and potential sources of investment capital. While ‘urban’ centers may differ around the world, they are generally characterized by larger numbers of consumers who want high-quality, low-cost and diversified food sources, which are free from pollutants and chemical contamination. In our discussion, we will use the term ‘urban aquaculture’ to mean the rearing of aquatic organisms under controlled conditions in or near a populous area. These organisms could be consumed, adored as pets, used for research, used for stock enhancement, or used as bait by anglers. Conducting aquaculture in an urban environment has many incentives. In this chapter, we have chosen to use New York City as a template to discuss the scope, promises, and problems of urban aquaculture, knowing full well that New York is a unique environment. New York City typifies the characteristics needed for successful aquaculture but it also demonstrates the many problems that we face as we move urban aquaculture from concept, to practice, and to ultimate success. A New York aquaculture industry is feasible, profitable, and long overdue. Why choose New York City as model for urban aquaculture? The people of New York eat considerably more seafood than the US norm (Timmons et al., 2001). New York City serves as a large distribution hub for fish and aquatic products from around the country and the world. Unfortunately, little product is grown locally. The Hunts Point Market in the borough of the Bronx accounts for about one-third of the value of all wholesale seafood activity in the entire state (Sea Grant, 2001). The waters in proximity to New York City are home to many novel species for potential aquaculture development. New York City also has a large multicultural population for consuming these new products. In addition, there are a wide variety of ethnic neighborhoods in dynamic flux with distinctive seafood tastes and needs that are currently not being satisfied (Schreibman and Zarnoch,

1150


2005). Many of these features, increased demand for seafood, ability to generate product in great quantities in restrictive and limited space and where land and water are limited, have led to successful ventures in urban aquaculture in South and Southeast Asia, India, Vietnam, and select cities in the Americas. Uses of urban waters, sitings to dense population areas, seeking solutions to urban sanitary problems, and the need to improve economics have been some of the stimuli for success. Among the many parameters essential to an urban aquaculture industry, New York City provides more than 580 miles of land–water interface that can provide a network of water passages, in addition to the extensive rail and highway routes, for product distribution. New York City is central to a distribution network that stretches through bordering counties and neighboring states – all within a ‘few hours’ drive. New York’s superb interstate roadway system links suburban markets closely to New York through a large trucking and transportation industry. With two international airports and two major national airports in proximity with the inherent major freight businesses located on or near their properties, fresh cargo can reach remote markets quickly. New York’s port serves to transport properly packed cargo to other port cities. However, New York City experiences, as do many cities, blatant needs to improve its economic climate by developing new industries, creating jobs, and providing training, especially for socially disadvantaged and economically challenged citizens. Similarly, a vibrant aquaculture industry could help along these lines in many parts of the world. The USA imported more than $10 billion of seafood at the turn of this century. The total trade deficit in seafood, according to the US Department of Commerce is $6.2 billion. New York City relies heavily on aquaculture product imports from elsewhere in the nation and the world. In 1999, the largest source of fish and seafood purchased by the New York seafood industry was imports from outside the USA. The state’s seafood industry and others purchased an estimated $786 million worth of fish and seafood products from foreign sources. Shrimp, almost all of which is frozen, accounted for 42 % of the value of fish and seafood imported to New York in 1999. The New York seafood industry purchased an estimated $535 million worth of fish and seafood products from sources in other states in 1999. This is in addition to purchases from other countries. Even in a depressed economy there is an ever-growing plethora of restaurants which makes the greatest economic contribution from among the seafood consuming industry segments. This contribution is attributable to the substantial value added by restaurants to the fish and seafood products they purchase and from the great number of jobs generated in restaurants (Sea Grant, 2001). New York City and other metropolitan areas worldwide are not generally short on restaurants! Major universities are needed to participate in this growing industry by conducting research and development of the essential technologies,


1151

providing professional expertise and training opportunities, arranging for community outreach, and developing a strong aquaculture curriculum at all levels of education. Our own aquaculture programs and the use of fish in basic and applied science have been based at Brooklyn College, the City University of New York for more than 40 years. In more recent years we have been able to expand our aquatic research activities, especially those related to aquaculture and to the environment, by creating a two million dollar center of excellence, the Aquatic Research and Environmental Assessment Center (AREAC). Universities and other research and educational agencies can play a vital role in developing a sustainable urban industry, especially since private venture is unlikely or unwilling to sustain their own R & D programs.

37.2 Goals There are several vital components to be considered if successful urban aquaculture is to be achieved. Generally, success is measured by the production of a product that is in demand and one that generates a positive cash flow. The driving goal should be to create these products through environmentally responsible, sustainable practices. More specifically, the several key issues that need to be addressed for attaining success include determining when to start (acquiring the capital and gathering knowledge and support teams for both the aquaculture and the commerce components), assessing the technology to be employed, siting (where to place the facility), selecting the best candidates to grow, and determining how to market your product. It would be foolhardy not to be thoroughly educated in each of these areas. In addition, establishing collaborations with leading experts to help with biological aspects, business plans, engineering design, and implementation is essential. Timmons et al. (2002) reviewed the failure of several aquaculture ventures in the USA and noted several commonalities. These included a lack of experience with indoor production, labor-intensive technology, poor engineering, choice of sensitive species, and a lack of commitment from investors. This clearly reiterates our point in that a new aquaculture venture must recognize and address all of the major issues. Bioshelters, Inc., located in Amherst, MA, USA, is an example of an aquaculture venture that appears to have addressed all of these issues and enjoys success. Bioshelters is an integrated production system that grows basil along with tilapia in a closed loop RAS (termed ‘aquaponics’). The key principals of the company include experts in aquaculture production and economics as well as experts in marketing and sales. This combination of expertise has led to creative and effective marketing that creates demand for a high-quality product reliably and sustainably produced in their

1152


integrated system. Further innovative use of energy, labor, and space has also led to their success (www.bioshelters.com).

37.3 Technology We are strong proponents, with an ever-growing band of supporters, of indoor, water-reuse systems – the so called ‘recirculating aquaculture systems’ (RAS). (The reader is referred to Timmons et al., 2002 and Losordo, this volume) for an in-depth discussion of the design and utilization of RASs) Recirculating aquaculture systems hold the key to the economic success of urban aquaculture for they permit high-density growth of aquatic organisms in facilities that could be located in most parts of the city, including low value real estate value areas and brownfields. Essential to its utility is that RAS are environmentally friendly, adding only minimal amounts of water as a by-product of the production process. RAS may take different forms to accommodate different species and most phases of their life cycle, from spawning to preparation for market. The following lists the most significant advantages of RAS that dictate their use: • closed systems facilitating the control of disease, eliminating predators, and making them biosecure; • flexible in design to accommodate different organisms; • self-cleaning because of their circular design and hydrodynamic properties; • easy to monitor and maintain; • permit high-density growth and intensive stocking of fish; • expandable; • guarantee safety and quality of fish; • useful and uniform production all year through controlled environment; • environmentally friendly; • use municipal or potable water; • facilitate disease management; • require less land and water than extensive or semi-intensive aquaculture (conventional tilapia aquaculture requires 500 times more land area and 1000 times more water per unit of fish than a RAS-produced fish). Consumers have become sensitized to environmental and health concerns related to finfish production due to aggressive media coverage. Small producers in foreign countries, extensive or semi-intensive aquaculture practices, are difficult to regulate and no predominant player has emerged to set standards for healthy, sustainable seafood production and processing. And yet, there is a trend in the USA in retail trade towards healthy, environmentally safe, and organic foods that are produced under very strict standards. This provides a prime opportunity for future aquaculture


1153

endeavors to provide a certified healthy food product through the use of the RAS.

37.4 Potential urban aquaculture programs Urban aquaculture programs could develop along several lines that include finfish for food, ornamental organisms for hobbyists, the production of organisms used in research, and the rearing of baitfish. The market and the geographic location and structural flexibility of your facility will dictate your choice of aquaculture program and candidate species. Potential candidates come from a variety of water types (e.g., salt, fresh, and brackish water) and extremes of water temperatures. Commercial entities will likely decide on their program and candidate species early in the planning and development process, for the luxury of converting from one production system to another is prohibitive in cost. 37.4.1 Finfish for consumption The number of potential candidates for culture has increased significantly in recent years for both fresh and marine species, driven by consumer demand, profit margins, and development of new technologies. This has led to successful culturing of marine species, even exotic ones, with more rewarding market prices than the traditional freshwater species (Zohar et al., 2005). AREAC’s finfish aquaculture activities have varied over time as dictated by our specific research and development programs and have included the commercially important walleye (Stizosledion vitreum), summer flounder (Paralichthys dentatus), winter flounder (Pseudopleuronectes americanus), and tilapia (Oreochromis niloticus). Our most intensive culturing program, and one that is currently drawing major commercial attention, is the grow-out of tilapia – a highly recommended candidate for urban aquaculture. Focusing on a single species has distinct advantages since genetic and nutritional research programs can be directed more sharply. Fingerlings obtained from a local producer are brought into our facility at approximately 1–3 g in weight. These fingerlings, reared in a 10 m3 fiberglass tank, can be brought to market size (approximately 600 g) after 6–7 months of culturing. Tilapia are fast growers, resistant to disease, tolerant to over-crowding, highly compatible, and excel in activity and growth in RAS. Commercial entities could and do set up their own nurseries to control production which can reduce costs. Tilapia are prolific and easy to produce, with low mortality. Genetic programs are available to produce mainly male offspring – the desired gender for this industry – thus skirting the need for treatment of fry with sex steroids to produce the same desired end results. The restrictive aspects of maintaining a hatchery include the necessity of additional dedicated facilities, contending with another step in

1154


the life cycle and, most significantly, obtaining and maintaining a genetically reliable and preferred broodstock (i.e., a selective breeding program). It is our belief that tilapia, coupled with RAS technology, could be the keystone to the successful establishment of a major tilapia urban aquaculture industry, one billion pounds per year, in New York State (Timmons et al., 2001). The intention of this effort is to make tilapia the ‘poster fish’ for New York State urban aquaculture in very much the same way that salmon and catfish are identified with certain regions of the USA. The global seafood market is large and growing. The worldwide retail market is $200B and the US share is $27B. Within this market, tilapia sales from producers to distributors alone are estimated at $350M, with the fresh market being $150M. Retail sales of tilapia are at least double this amount. The market opportunity for tilapia is robust; consumption is growing at 35 % per year, with the fresh portion growing at a rate of 21 % annually. Tilapia is already the 3rd or 4th most consumed fish in the USA and growing, up from relative obscurity several years ago. A New York tilapia industry can model itself after the successful catfish industry in the southern USA. The catfish industry has developed a 273 million kg per year production base since the 1990s, adding nearly 46 million kg of production in just the last two or three years. In large measure, the catfish industry was patterned after the chicken broiler industry. The success of both these industries is attributed to their vertical integration of breeding, growing, processing, and distribution operations under a single business structure (Timmons, 2005). The success of the ‘tilapia plan’ is augmented by the use of RAS. In contrast to outdoor pond and net-pen systems, indoor fish production using RAS is sustainable, infinitely expandable, environmentally responsible, and has the ability to guarantee both the safety and the quality of the fish produced throughout the year (Timmons et al. 2001). Site selection for this type of aquaculture industry is aided by the flexibility of the RAS. These can be situated in close proximity to the market on underutilized low-value real estate such as brownfields (Schreibman and Zarnoch, 2005) and poorquality farmland (Doupé et al., 2003). Close proximity to the market will reduce transportation costs and also allow for selling a fresh product which generally demands twice the price of frozen products (Timmons et al., 2002). In addition to creating a food product, there is also the spin-off of creating a new job market. It has been estimated that an indoor aquaculture industry will create jobs in three primary areas: (i) growing the fish, (ii) processing the fish, and (iii) associated jobs including selling, general and administration, feed production, and distribution. According to available figures, each million pounds of production will require five people in the production facility – the processing facility will add an additional 10 people (Schreibman and Zarnoch, 2005). Therefore, there are 15 jobs created for every 450 000 kg of production, or 15 000 jobs will be generated by a 450 000 000 kg/year industry in New York State.


1155

The association of fish species with a particular country is evident at the international level. Commitment to single species has ignited the growth of economic development and employment of countries either through aquaculture or utilization of wild fisheries. Consider the development of the salmon industry in Norway and Chile, the culturing of turbot in Scotland, Patagonian toothfish in southern South America, shrimp culture in Ecuador, and the recent expansion of bluefin tuna farming in Mexico. While the growth of a single species using the technology we propose may not be applicable to urban aquaculture in some countries, the concept would be worth pursuing.

37.4.2 Ornamental aquaculture The ornamental industry presents a scenario similar to the consumable aquaculture industry – challenged natural fisheries resulting from overfishing and habitat destruction resulting from an increased demand for product by an expanding populace. The US ornamental retail aquarium market is valued at approximately $1 billion/year which demonstrates the significant market potential of these organisms. In addition, over 15 million ornamental fish are imported into the USA each month worth about $50 million/ year. Although many species are still collected from tropical lakes and streams of South and Central America, Asia, and Africa, imports are now beginning to come from aquaculture farms in Thailand, Malaysia, Singapore, Hong Kong, and Germany (Davenport, 1996; Corbin et al., 2003). In the USA, production of ornamental fish is valued at $52 million/year and most fish are produced in Florida (Chapman et al., 1994, 1997; Rowland and Cox, 2003). Research and development needs to continue in an attempt to ascertain the technical and marketing feasibility of bringing successful ornamental aquaculture ventures to non-traditional parts of the USA, most notably to New York and the Northeast, as well as to the rest of the world. The application of sustainable, ecologically responsible production of ornamental aquatic organisms by those countries that have provided them for so long would help to protect and restore their unbalanced ecosystems and increase the living standards of their people. Restoration of coral reefs, which have been so brutalized by an unregulated industry in the past, could be restored through responsible aquaculture and at the same time serve to stimulate the tourist industry, an industry that has waned in Belize and Australia because of ecosystem devastation. Highly valued ornamentals that bring very attractive market prices can be cultured in a wide range of rearing equipment. In our facility over 800 aquaria, ranging in size between 9.5 and 284 liters are used in the culture of ornamental organisms, both vertebrates and invertebrates. Some aquaria are RAS while others are balanced, static systems containing snails and aquatic plants (also of considerable market value) in addition to the fish creating a multitrophic aquaculture system. Additionally, much less space

1156


is required to establish a commercially successful ornamental fish entity compared to the dimensions and scope required for a viable food-fish business. Couple this with a comparison of price per kilogram of ornamental versus food fish and we can expect to see more commercial ventures springing up in the near future.

37.4.3 Aquaculture to produce research organisms AREAC has used aquatic animals in basic and applied research for almost 50 years, beginning in the early 1960s, when the live-bearing teleosts, platyfish and swordtails, were used to study such diverse physiological topics as osmoregulation, cancer, maturation, development, reproductive system structure and function, aquatic toxicology, and aging. Our program to study the impact of space travel on the neuroendocrine regulation of physiological processes, especially reproduction, reached its pinnacle on two space shuttle flights (STS-89 and STS-90) when adult and juvenile swordtails (Xiphophorus helleri) were flown in a closed equilibrated biological aquatic system (CEBAS) developed at Ruhr University in Germany (Bluem et al., 1994) in a cooperative program between NASA and DARA, the German space agency. This ‘closed equilibrated system’ could truly be called the first orbiting RAS. In more recent years, scientific research has moved away from the use of mammals as research models. Concerns of animal rights groups and more stringent guidelines for use of animals in academia and pharmaceutical companies have stimulated the search and application for unusual animal models to carry out research programs. In some cases these research organisms are grown by the investigators themselves. However, living resource centers are expensive to establish and maintain and it becomes more economical to procure these plants and animals from commercial biological supply houses. And, as we have witnessed in other areas that have depended on collection rather than culturing of aquatic organisms, depleted and challenged natural ecosystems will dictate the application of aquacultured technology to meet research demands.

37.4.4 Baitfish production The recreational fishing industry in New York State is important, thriving, and has significant economic momentum. However, New York imports almost all of the baitfish sold within its borders, importing primarily from Arkansas and Midwestern states. Precise economic data are not available, but wholesale value is estimated at $3–5 million per year; total retail sales of baitfish in the USA is around $1 billion, but farmgate sales are less than $100 million. Assuming that the size of the recreational fishery industry will remain fairly static, the potential for baitfish sales is somewhat bracketed into the $3–5 million range.


1157

37.5 The economics: siting, processing, and marketing for economic success Since we are proposing reliance on indoor, water-reuse systems, urban aquaculture facilities may be placed anywhere; therefore, siting need not be limited by environmental concerns or land constraints or proximity to water. However, location can have a large impact on economic viability as affected by local energy costs, a major factor for consideration in siting. To be successful, an urban aquaculture program will need to approach an energy cost of $0.02/KWH – not always easy to attain in this time of soaring energy costs and the present economic climate. Alternative sources of energy should be explored and could be used to help achieve manageable energy costs. For these reasons cogeneration plants, wastewater treatment systems, landfills, composting facilities, and producers or purveyors of manure have become popular sitings for joint ventures. Asia, which is a major contributor to the world aquaculture market, has had almost from its inception multiple roles for aquaculture in their rural and peri-rural farms. They have long accrued benefits from urban aquaculture by dealing with issues of waste disposal and treatment by coupling it to food production (Costa-Pierce and Desbonnet, 2005; Edwards, 2005; Phan Van and DePauw, 2005; Quy Hoan and Edwards, 2005). The concept of raising a single aquaculture product is being markedly modified with the introduction of the concept of coordinating the growth of multiple organisms where there was only one. This is especially attractive in the spatial confines of the metropolis. Aquaponics, the practice of growing fish and plants in the same closed system, and other multitrophic cocultured organisms, is receiving special attention. It has augmented the better known principle of hydroponics (soiless growth of plants with the addition of chemical fertilizers) which itself is now enjoying increased appreciation and application. Furthermore, the concept of expanded aquaculture systems, those that go beyond just raising fish to one that produces energy, has received special consideration. The energy generated by these systems can be combined with, and drive other, integrated food systems (as aquaponics) and even have residual energy to provide to the local community. Such ‘fuel cell systems’ (Timmons, 2005) would be well suited for large urban areas to deal with multiple municipal needs while at the same time assisting in achieving broader sustainable practices. Calculations suggest that for an urban (New York City) aquaculture entity to be highly competitive and successful it would need to produce 2 700 000 kg (of tilapia) per year. Additionally, this facility would need to be coupled to an operational and cost-effective processing plant and have direct costs of production close to $4.40 a kg (Timmons, 2005). This could be achieved by a single farm or by employing the methods of cooperatives, as used by dairy farmers in former years. In the cooperative model, farmers with much lower growing abilities can couple their products with other

1158


‘small farms’ to produce product and maintain quality control, distribution, and pricing through unity. The cooperative model helps to address the challenge of acquiring a large enough tract of land for the successful production levels that we have suggested in a metropolitan area. The Northeast USA has a competitive advantage because of its ability to grow the highest quality fish where consumer demand is most significant (Timmons, 2005). There are few, if any, filleting facilities in the USA, and most consumers prefer it in this form. Almost all fresh tilapia fillets marketed in the USA are imported from Central and South America and the Far East. These producers face significant transportation costs which give US, urban-based entities a distinct advantage. According to Timmons (2005), there are no commercial RAS operations in the USA that are of sufficient scales of production or processing to compete with large-scale aquaculture or off-shore commercial markets.

37.6 Marketing and competition There are a number of foreign countries that currently satisfy the demand for tilapia in the USA. Production in proximity to consumer, as in urban aquaculture, can have a great impact on providing better regulation of growth conditions and delivering a fresher product to the consumer. Of the current markets, there is, first, the international frozen market segment. These competitors are predominantly based in Southeast Asia and represent the lowest cost competitors. Their products are not fresh because they are frozen and shipped by sea to the USA, resulting in long lead times. Low-cost shipping combined with low-cost labor and land makes this segment the cheapest choice for tilapia. However, many of the aquaculture techniques they use are harmful to the environment and produce fish that were, until recently, not subject to extensive quality control (Islam et al., 2004). The World Health Organization (WHO) has established standards for aquaculture production using wastewater to address the human health risks associated with this practice (WHO, 2006). A second segment is the international fresh tilapia market. These producers, who are the primary competition for the US fresh tilapia market, are located in the South and Central America, and ship their fish by air to various locations in the USA overnight. The cost of shipping is offset by a price premium for fresh fish as well as low-cost labor and land in these regions. These producers generally use traditional aquaculture methods instead of RAS technology. A third, and final, segment is the domestic live market. These competitors are small and generally serve the ethnic restaurant market with live fish. Because production occurs in the USA (Florida, Texas, Missouri, California, New York, Virginia) and the product must be shipped live, there are the additional costs of shipping to consumers in excellent condition.


1159

This market has been saturated for over ten years and there is no reason to believe that it will expand; it may in fact decrease (Timmons, 2005). Currently, there are no domestic competitors in New York, urban or rural, who operate at a very large scale.

37.7 The role of the university 37.7.1 Research and development Universities and other government agencies, especially those with existing infrastructure, facilities and faculty, are better able to indulge in these expensive activities for they are better positioned to obtain grants and develop these programs on a smaller, less expensive level that can be up scaled for industry at a later date. There is also heuristic value when curriculum can be developed in conjunction with this research and development to satisfy increasing demands by students for this curriculum.

37.7.2 Education Educational programs that are built on an aquaculture foundation have expanded in the last ten years. They include the development of aquaculture and aquatic science curricula from pre-elementary to higher educational levels. Promoting interest and education of young minds and the general public can only have a positive impact of the future of aquaculture. 37.7.3 Community outreach University-based urban aquaculture programs can lead to a number of exciting community outreach activities. In an example from one of our more successful programs, several thousand pounds of tilapia raised for our studies have been given to homeless shelters. Tilapia have been donated to community programs, political rallies, and environmental awareness events. These are all positive expenditures of energy for they serve to familiarize citizens with the technology, needs, and current status of urban aquaculture. Community outreach programs develop interests and incite advocacy on the part of the participants on such major global issues, as sustainability, climate trends, and ecosystem stability.

37.8 Future trends The initiation of large-scale urban and peri-urban aquaculture industries, whether in New York State or elsewhere in the world, will require strong government support and coordination. The socioeconomic improvement that will be realized from the creation of such industries would justify the

1160


short-term assistance needed. Success will require support in at least three areas, as follows: • Grants and subsidies: Indoor aquaculture requires numerous expenses including electricity, heat, equipment, and real estate. Indoor aquaculture is already cost-competitive with outdoor systems and ocean-caught fish if done at large scale, e.g., 1000 metric ton per year of production (Timmons et al., 2004). However, to be as competitive as possible, costs must be reduced with access to low-cost electricity, heat for water (for instance waste heat from cogeneration or manufacturing facilities), equipment, and real estate (i.e., help in using abandoned or underutilized buildings, or brownfield sites). • Research: Aquaculture would benefit greatly from more comprehensive research related to the nutrition, genetics, animal health management, animal husbandry, and fundamental physiology. • Access to capital: Every pound of production capacity will require approximately $1.50 of capital investment for equipment and facilities (Timmons et al., 2004). Government loan guarantee programs or access to capital through state-backed industrial revenue bonds would assist potential farmers to get started. Growing urban aquaculture entities requires a collective effort among, farmers, research institutions, and political leaders. In the final analysis success in the aquaculture industry, especially urban-based ones, would be difficult without support in the form of government subsidies. Most other industries in the USA receive this form of support – why has aquaculture been ignored? So, what is the current status of urban aquaculture in New York and the northeast? Lots of potential energy but very little kinetic energy! Yet, for all of its potential and resources, New York City, does not currently have a single successful major aquaculture venture. The inertia and obstacles in moving successful urban aquaculture programs from discussion to reality must be overcome to face the ever-growing needs imposed by overfishing, pollution, and increasing demands for aquaculture products. These demands must be met locally and statewide by way of effective, dynamic, and significant initiatives. As a member of a university family, we firmly believe that educational collaborations within New York State can move towards these ends. The New York State public and private universities are numerous and scattered throughout the state with concentrations in the metropolitan area. They must partner and collaborate to make the case known for the importance of developing a statewide urban aquaculture industry. They must trumpet the important reasons for economic development, job training, education, and environmental stability to the policy makers and land users and to the individuals with capital who can support these essential ventures. A collaboration of universities can and must lead to the development and enhancement of effective urban aquaculture practices, programs, and ven-


1161

tures in New York City, as well as nationwide. In those municipalities that lack a university presence, the business sector needs to couple with the policy makers to move these endeavors along.

37.9 Acknowledgements Portions of this manuscript were taken from our article, ‘Urban Aquaculture in Brooklyn, New York, USA’ which appeared in Urban Aquaculture, B. Costa-Pierce, A. Desbonnet, P. Edwards and D. Baker (eds), CAB International Publishing, Cambridge, MA., 285 pp., 2005. Our programs have been funded by: United States National Park Service, United States Army Corps of Engineers, the Department of Environmental Conservation, Con Edison, NASA, New York Sea Grant, The New York City Board of Education, and the City University of New York. We acknowledge, with many thanks, the support over the years from the Gateway National Recreation Area and its former Chief of Natural Resources, Dr John T. Tanacredi. They provided the funds for our first small recirculating system. We are also grateful to our students at Brooklyn College, and students at every level of education who have participated in our programs as well as to the AREAC staff for their dedication and support of our aquaculture programs.

37.10 References bluem v andriske m, eichhorn h, kreuzberg k and schreibman m p (1994) A controlled aquatic ecological life support system (CAELSS) for combined production of fish and higher plant biomass suitable for integration into a lunar or planetary base, Acta Astronautica, 37, 361–71. chapman f a, fitz-coy s, thunberg e, rodrick j t, adams c m and andre m (1994) An Analysis of the United States of America International Trade in Ornamental Fish, University of Hawaii Sea Grant, Honolulu, HI. chapman f a, fitz-coy s a, thunberg e m, adams c m, rodrick j r and andre m (1997) United States of America trade in ornamental fish, J World Aqua Soc, 28, 1–10. corbin j s, cato j c and brown c l (2003) Marine ornamentals industry 2001: Priority recommendations for a sustainable future, in Cato JC and Brown CL (eds), Marine Ornamental Species. Collection, Culture and Conservation, Iowa State Press, Ames, IA, 3–10. costa-pierce b and desbonnet a (2005) A future urban ecosystem incorporating urban aquaculture for wastewater treatment and food production, in Costa-Pierce B, Desbonnet A Edwards P and Baker D (eds), Urban Aquaculture, CABI, Cambridge, MA, 1–14. davenport k e (1996) Characteristics of the current international trade in ornamental fish, with special reference to the European Union, OIE Revue Scientifique et Technique, 15, 436–43. doupé r g, lymbery a j and starcevich m r (2003) Rethinking the land: The development of inland saline aquaculture in Western Australia, Int J Agri Sustain, 1(1), 30–37.

1162


edwards p (2005) Development status of, and prospects for, wastewater-fed aquaculture in urban environments, in Costa-Pierce B, Desbonnet A, Edwards P and Baker D (eds), Urban Aquaculture, CABI, Cambridge, MA, 45–60. islam m s, chowdhury m t h, rahman m m and hossain m a (2004) Urban and periurban aquaculture as an immediate source of food fish: Perspectives of Dhaka City, Bangladesh, Urban Ecosystems, 7, 341–59. little d c and bunting s w (2005) Opportunities and constraints in urban aquaculture, with a focus on South and Southeast Asia, in Costa-Pierce B, Desbonnet A, Edwards P and Baker D (eds), Urban Aquaculture, CABI, Cambridge, MA, 25–44. phan van m and depauw n (2005) Wastewater-based urban aquaculture systems in Ho Chi Minh City, Vietnam, in Costa-Pierce B, Desbonnet A, Edwards P and Baker D (eds), Urban Aquaculture, CABI, Cambridge, MA, 77–102. quy hoan v and edwards p (2005) Wastewater reuse through urban aquaculture in Europe and North America, in Costa-Pierce B, Desbonnet A, Edwards P and Baker D (eds), Urban Aquaculture, CABI, Cambridge, MA, 103–18. rowland l w and cox l j (2003) Opportunities in Ornamental Aquaculture, National Coastal Resources Research and Development Institute, Portland, OR. sea grant (2001) The Economic Contribution of the Sport Fishing, Commercial Fishing and Seafood Industries to New York State, New York Sea Grant Publication Number NYSGI-T-01-001, Stony Brook, NY (prepared for SG by TECHLAW Inc.). schreibman m p and zarnoch c b (2005) Urban aquaculture in Brooklyn, New York, USA, in Costa-Pierce B, Desbonnet A, Edwards P and Baker D (eds), Urban Aquaculture, CABI, Cambridge, MA, 207–22. timmons m b, regenstein j m, schreibman m p and warner p (2001) Creating a Tilapia Industry for New York: 15 000 Jobs and One Billion Pounds, A White Paper Prepared for the New York AgriDevelopment Corporation. timmons m b, ebeling j m, wheaton f w, summerfelt s t and vinci b j (2002) Recirculating Aquaculture Systems, 2nd ed, Cayuga Aqua Ventures, Ithaca, NY. timmons m b, rivara g, baker d, regenstein j m, schreibman m p, warner p, barnes d and rivara k (2004) New York Aquaculture Industry: Constraints and Opportunities, A White Paper, Cornell Aquaculture Program, Cornell University, Ithaca, NY. timmons m b (2005) Competitive potential for USA urban aquaculture, in Costa-Pierce B, Desbonnet A, Edwards P and Baker D (eds), Urban Aquaculture, CABI, Cambridge, MA, 137–58. who (2006) Guidelines for the safe use of wastewater, excreta and greywater. Volume 3: Wastewater and excreta use in aquaculture, World Health Organization, Geneva. zohar y, tal y, schreier h, steven c, stubblefield j and place a (2005) Commercially feasible urban recirculating aquaculture: Addressing the marine sector, in Costa-Pierce B, Desbonnet A, Edwards P and Baker D (eds), Urban Aquaculture, CABI, Cambridge, MA, 159–72.

Index

a priori, 100 abalones, 591 acetate, 284 Acipenser spp., 124 acoustic Doppler current profiling, 684, 899 activated sludge technology, 1051 Aero-2 aspirator pump aerator, 1131 Aeromonas salmonicida, 783 aflatoxin, 509 Akva FishTalk Value Chain Planner, 1088 Akva Vicass, 1075 AkvaSmart, 1075, 1095 Alexandrium, 587, 595, 598 Alexandrium sp, 901 Alexandrium tamarense, 598 allozyme electrophoresis, 62–3 allozymes, 5 alum, 1001 aluminium sulfate, 1001 AMB Bio Media, 978 Amphidinium, 645 amphidinolides, 645 amplified fragment length polymorphism, 7–10 genetic linkage analysis, 9 genetic variation, 8 An Pin Live fish Centre, 1095 Analytical Hierarchy Process, 717 androgen, 154 androgenesis, 155, 187

aneuploids, 187 animal safety, 226 annular column, 614 antimicrobial peptides, 257–8 antinutritional factors, 287, 508 plant protein sources, 288 antiviral molecules, 252–3 Apex-IHN, 249 Aphanizomenon, 635 Aphanizomenon flos-aquae, 636 apoptosis, 253 apparent digestibility coefficients, 463 AquaAssist, 1095 aquaculture, 751 advances, xxix advances in catfish, tilapia and carp nutrition, 440–56 advances in disease diagnosis, vaccine development & other pathogen detection technologies, 197–209 advances in diagnostic methods (for bacterial diseases), 199–203 advances in vaccine development, 203–7 future trends, 208–9 key drivers for improvement, 198 limitations of current methods, 198–9 other pathogen control methods, 207–8

1164

Index

controlling fish reproduction, 109–30 factorial approach in quantifying nutritional requirements, 417–38 genome technology for genetic improvement, 3–41 global, xxvii inland saline (see inland saline aquaculture) integrated, 697 interactions with environment, 681–4 marine medical and health care products and their associated economic values, 867 monitoring and assessment techniques, 690–6 characterisation of benthic biota, 692 other indicators, 696 predictive assessments, 693–6 sediment condition, 691 visual assessment of sediment and epibenthic biota, 692–3 water quality, 690–1 new development for controlling parasitic diseases, 215–37 effect on the industry, 216–18 new development for controlling viral disease, 244–59 new technology, xxviii–xxix pharmaceuticals and neutraceuticals production, 866–86 algal targets for pharmaceuticals and nutraceuticals, 877–80 diversifying the aquaculture industry, 874–5 future trends, 886 green lipped mussel culture for nutraceuticals, 880–2 health claims for functional food in Australia, 885 major research and development steps required, 869 marine neutraceuticals, 872–4 marine pharmaceuticals, 870–2 polyculture potential for medicinal sea cucumbers and whelks, 882–4 sponge aquaculture for pharmaceuticals, 875–7 steps towards commercialisation, 884–6

predicting and assessing the environmental impact, 679–99 common condition indicators, method of use and comparative cost, 688 common environmental impacts both on and of aquaculture, 681 considerations in monitoring and assessment program development, 686–90 effects on environment, 681 potential conflicts in water usage, 680 site selection and carrying capacity, 684–6 production, xxvii–xxviii Rachycentron canadum cultivation, 804–18 recent technological advances and future trends, 696–9 changes in technology/monitoring approaches, 698–9 changes in types of aquaculture, 696–8 role of GIS in spatial decision support, 707–46 shellfish, impact of harmful algal blooms, 580–601 sterile and single-sex fish populations, 143–58 future trends, 157–8 use of ICT, 1064–105 Aquaculture Collaborative Research Support Project, 991 Aquaculture Engineering Group, 941 aquaculture feeds advances for basses and breams, 459–83 advances for salmonids, 498–522 advances in microalgal culture, 610–58 ingredient evaluation using digestibility, utilisation and nutritional factors as parameters, 387–410 aquaculture feeds and ingredients, 370–83 alternate protein and lipid sources, 378–83 canola/rapeseed products, 381 corn products, 380 distillers products, 381

Index peas and lupins, 382 plankton and krill, 382–3 seafood processing waste products, 382 single-cell protein products, 381–2 soybean products, 379–80 wheat and barley, 380–1 environmental pollutants and residues categories, 375–8 chemotherapeutic residues, 378 methylmercury, 375–6 farmed fish product safety, 374–5 future trends, 383 sustainability of ingredients, 371–4 Aquagard, 233 AquaMetric, 1074 AquaModel, 906 AquaNIC, 1104 aquanomics, 817–18 AquaOptima AS, 953 aquaponics, 1053–4, 1151, 1157 Aquatic Animal Health Code, 255 ‘aquatic chickens,’ 441 Aquatic Research and Environmental Assessment Center, 1151 ARA. see arachidonic acid Ara-A, 875 Ara-C, 875 arachidonic acid, 326–7 ARA/EPA on gilthead seabream larval growth, 327 stress regulation mechanisms by fatty acids, 327 ARC-GIS, 711 ArcView, 719 ARENA simulation software, 1086 Argyrosomus japonicus, 1127, 1130 Artemia, 624, 831, 857 Artemia salina, 645 Artemia salina test, 644 ‘artesian desert water,’ 1120 Arthrospira, 610, 624, 635, 636, 639, 640 Arthrospira platensis, 625, 878 Asian marine crabs, 846 Asian seabass advances in aquaculture feeds and feeding, 461–6 apparent digestibility coefficients, 464 digestibility, 463 effect of dietary protein on average daily weight gain, 462

1165

feeding studies, 464–6 miscellaneous studies, 466 replacement studies, 463–4 requirements, 461–3 theoretical feeding tables based on data from bioenergetic studies, 465 composition of weight gain, 425 energy and protein loss, 427 growth potential, 423 Asparagopsis armata, 878 Assessment of Estuarine Trophic Status, 694 Association of Official Analytical Chemists, 391 Association of Official Analytical Chemists International, 597 astaxanthin, 511–12, 515, 517, 615, 639, 880 asynchronus spawners, 116–17 Atlantic cod, 774–89 aquaculture production in Norway, 775 bottlenecks, 787–8 breeding program, 778–80 broodstock, 776–8 consumer preference for farmed cod, 789 difference in breeding programs, 779 differences in survival among families during test against vibriosis, 780 effect of photomanipulation on quality of eggs and larvae, 776 environmental issues, 788 infected by Francisella piscicida, 786 larval deformities, 783 larval rearing protocol, 781 production technology, nutrition, and disease management, 780–7 survival from hatching through weaning, 777 Atlantic halibut, 789–94 bottlenecks, 794 breeding program, 791 broodstock, 790–1 environmental issues, 794 gamete collection, 791 production technology, nutrition, and disease management, 791–4 Atlantic salmon. see Salmo salar

1166

Index

Aureoumbra lagunesis, 591 Australia oyster selection programs, 94–6 family selection, 95 Austrocochlea constricta, 758 automatic microdiet dispenser, 356 autonomous underwater vehicles, 693 Avarol, 877 azaspiracids, 589 bacterin, 282 barramundi. see Asian seabass; Lates calcarifer bastadins, 871 Beché-de-Mer, 882 Bechitin-W, 874 betaine, 449 β-glucans, 513 Bidyanus bidyanus, 753 Bif idobacter spp, 451 bioactive molecules, 643 biochemical oxygen demand, 946 biocidal compounds, 272 bio-clarifiers, 967 biocoils, 616 biocontrol agents, 272–3 agents used in aquaculture, 272 BioFence, 616 bio-floc technology, 1050–1 biological control, 222 biopesticides, 222 bio-protein, 381–2 biosecurity, 258 Bioshelters Inc., 1151–2 Blackboard, 1100 bloat, 502–3 blue crab, 846 bluegill. see Lepomis macrochirus Branchiomma luctuosum, 753 bream, Red sea bream and gilthead sea bream advances in aquaculture feeds and feeding, 466–76 ADC for protein and energy of Australian ingredients, 473 dietary digestible protein and digestible energy effects on relative protein deposition, 468 digestibility, 471–2 effect of increasing dietary inclusion content on ADC of gelatinised wheat starch, 471

feeding studies, 475–6 miscellaneous studies, 476 replacement studies, 472–5 requirements, 468–71 brevenal, 645 brevetoxin, 589, 645 brown tide, 591 bryostatin 1, 870, 871 ‘bubbled-washed’ bead filters, 961 Bugula neritina, 870 buoyancy, 350–1 business card tags, 1078 C. gigas, 94–6 CABI Aquaculture Compendium, 1104 calcium hypochlorite, 997 calcium peroxide, 998 calcium sulfate, 1000 Callinectes sapidus, 851 canola meal, 381 canthaxanthin, 511–12, 639 Carassius auratus, 753 carp. see also freshwater fish species commercially produced species, 441 general nutrient specifications for formulation of practical diets, 454 generic production diets, 454 recommended minimum amino acid levels in diets, 455 supplemental mineral levels recommended for practical diets, 456 Carraguard, 878 catamaran steel fish farm, 919, 928–9 with integrated feed barge for storage and equipment, 929 large, 916 catfish. see also freshwater fish species commercially produced species, 441 general nutrient specifications for formulation of practical diets, 454 generic production diets, 454 recommended minimum amino acid levels in diets, 455 supplemental mineral levels recommended for practical diets, 456 cell size hypothesis, 181 cemadotin, 645 centre feed sedimentation basins, 957 ceruloplasmin, 817

Index Chaetoceros, 624, 626, 628 Chaetoceros calcitrans, 615 Channa micropeltes, 1037, 1040 channel catfish. see Ictalurus punctatus Chattonella, 600 chelated copper compounds, 999 chemical oxygen demand, 946 chemotherapeutic residues, 378 chemotherapy, 225–9, 231–3 chemotherapeutants used against sea lice, 230 ideal chemotherapeutants, 231 resistance management principles, 232 Chinese mitten crabs, 846–7 product issues, 850 production systems broodstock quality and nutrition, 855–6 food and feeding, 853–4 grow-out, 851–2 hatchery practices, 856–7 nurseries, 858 chitin, 282, 874 chiton, 874 chitosan, 282, 874 Chlorella, 616, 624, 626, 628, 635, 636, 639, 645, 653, 879 Chlorella sp, 625 Chlorella-V12, 635 choline, 449 Chondrilla nucula, 753 CHORULON, 120 chromosome counting, 173 chromosome set manipulation, 58–9, 165–88 grass carp ploidy manipulations, 60 gynogenesis, androgenesis and aneuploids, 187 newly culture species, 59 principles and methods, 166–74, 167–70 blocking meiosis I, 170 cytogenetic techniques for verification, 174 gamete chromosome inactivation, 172 methods for meiosis and mitosis inhibition, 170–2 polyploids and uniparenteral inheritance identification, 172–4 schematic presentation, 169

1167

shellfish reproduction, 166–7 summary and perspectives, 187–8 tetraploid shellfish, 183–4, 186–7 triploid shellfish, 174–5, 178–83 Chrysochromulina polylepis, 591 Chrysochromulina quadrikonta, 594 circular flow tanks, 951–3 circular HDPE collar fish farm, 925–7 in grid mooring system, 926 circular HDPE pipe fish farm, 915 clay scatter method, 600 ‘clear water’ techniques, 625 closed equilibrated biological aquatic system, 1156 cloud computing, 1080 coal bed methane, 1123, 1126 coal seam gas, 1126 coal seam methane, 1126 cobia. see Rachycentron canadum Cochlodinium polykrikoides, 597, 600 Codex Alimentarius Commission, 1046 Codium spp, 878 colchicine, 148 cold banking, 813–14 cold-water marine finfish aquaculture biological and technological advances, 771–97 Atlantic cod, 774–89 Atlantic halibut, 789–94 current and past research activities, 774 future trends, 794–7 consumer preference, 797 environmental issues, 796–7 fish health, 796 improvements to current culture methods, 794–5 industry driven research and marketing, 797 nutrition, 795–6 selective breeding program, 796 studies involving all life stages, 794 life cycles of Atlantic cod and halibut in captivity, 773 Commission regulation (EC) No 1234/2003, 515 Committee on the Status of Endangered Wildlife in Canada, 774 comparative carcass analysis, 426 composite culture, 1048 concentrated aquatic animal production, 1005

1168

Index

conjugated linoleic acid, 520 consumer safety, 226 content management system, 1100 copper sulfate, 999 Corbicula fluminea, 754 corn gluten meal, 380 Cornell dual-drain, 954 Cornell-style side drain, 978 cortisol, 274 cottonseed meal, 445 Council Directive 91/492/EEC, 543 course management system, 1100 crab feed, 853 crabs aquaculture advances, 845–60 current situation, 848 Chinese mitten crab, 846–7 current situation, 849 future trends, 859–60 breeding, 859 hatchery methods, 860 nursery and grow-out, 860 product, 859 Mangrove crabs Scylla spp and other portunids, 847–8 product issues, 848–51 mitten crabs, 850 portunid crabs, 850–1 production systems, 851–8 breeding and hatchery technology, 855 broodstock quality and nutrition, 855–6 food and feeding, 853–5 grow-out, 851–3 hatchery practices, 856–7 nurseries, 857–8 Crassostrea ariakensis, 762 Crassostrea gigas, 621, 882 Crassostrea rhizophorae, 755 Crassostrea virginica, 175, 178, 755 critical standing crop, 1043 cross-flow raceway design, 951 crustacean viruses, 247 main crustacean viral diseases, 247 notifiable crustacean diseases, 248 Crypthecodinium, 879, 880 cryptophycin-52, 644 cryptophycin 249, 644 cryptophycin 309, 644 cryptophycins, 651 curacin A, 644 Cyanotech, 635

cyclooxygenase pathway, 277–8 Cyprinus carpio, 753 cytochalasin B, 148, 171–2 cytogenetics, 59, 61 daily loss of energy and protein, 426 De Haan Automatisering, 1095 decision support systems, and tools, 718–25 activity trade-off, 718–19 additional internal or external modules, 719–20 analytical scope and reporting, 720 biodiversity tools, 719 viewsheds, 719 DELPHI, 719 DEPOMOD, 694, 906, 1086 depuration, 564–5, 598 Dermochlorella, 643 desert aquaculture, 1120 desert water, 1136 DGGE techniques, 1022 DHA. see docosahexaenoic acid DHActive, 639 DHAGold, 639 diagnostic methods advances, 199–203 immunodiagnostic methods for fish pathogen detection, 201 loop-mediated isothermal amplification test, 203 key drivers for improvement, 198 limitations, 198–9 Diagnostic Tests for Aquatic Animals, 199 Dicathais orbita, 883–4 dichlorvos, 229, 231 diet feed improvement, 276–87, 289 alternative protein sources and feed hazards, 286–7, 289 antinutritional factors in plant protein sources, 288 dietary probiotics, 285–6 fatty acids and antioxidants, 277–8 non-nutritive immunostimulants, 281–2 non-starch polysaccharides and oligosaccharides, 283–5 nutritional competition, 280 other nutritional requirements, 278–80

Index diet replacement method, 394 dietary nucleotides, 279 dietary probiotics, 285–6 Dietary Supplementation Health and Education Act, 884–5 digestibility, 393–9 calculating diet and ingredient digestibilities, 397–8 collecting faeces for digestibility assessment, 395–6 correlation among protein digestibilities, 400 correlation of diet and ingredient digestibilities, 399 diet and ingredient digestibilities, 399 effects of species on assessment process, 398–9 experiment management issues, 396–7 feed issues in ingredient digestibility assessment, 393–5 digital elevation model, 744 6-dimethylaminopurine, 171–2 dinophysistoxin, 589 dinucleotide repeats, 10–11 dioxin, 509 Diploma supplement, 1102 disease resistance, 256–7 new technologies and prospects in diet and husbandry techniques, 267–91 complex interaction between pathogens, stress factors, feed, microbiota and immune response, 268 feed improvement, 276–87, 289 pathogen control, 268–73 welfare improvement, 273–6 distiller’s dried grains, 381 distiller’s dried grains with solubles, 381 ‘distributed control system,’ 1068 DNA fingerprinting, 97–8 DNA marker technologies, 4–18 amplified fragment length polymorphism (AFLP), 7–10 historical perspectives, 4–7 microsatellites, 10–13 single nucleotide polymorphism (SNP), 13–17 trends, 17–18

1169

DNA sequencing technologies, 18–26, 221 454 sequencing platform, 24–6 comparison of next generation sequencing platforms, 19 Solexa sequencing platform, 23–4 SOLiD sequencing platform, 19–23 DNA vaccine delivery, 209 DNP3, 1070 docosahexaenoic acid, 323–5 effect on survival of gilthead seabream larvae, 324 Dolabella auricularia, 644 dolastatin 10, 644 double-stranded RNA, 254 down-flow bubble oxygen contractor, 970 Dreissenia polymorpha, 754 ‘drip irrigation’ system, 1140 Dunaliella, 624, 635, 636, 879 Dunaliella salina, 620 Dunaliella tertiolecta, 627 Dysidea avara, 877 E. j. sinensis, 846, 853 Earthrise Nutritionals, 635 East Kolkata Wetlands, 1040 EC Seafood Plus and Trace project, 1096 EC SHEEL project, 1096 Eco-Flow, 953 ecological carrying capacity, 685 ecological sustainability, 373 ECOSIM, 692 Eco-Tank, 949 Ecteinascidia turbinata, 870 effluent limitation guidelines, 1005 eicosapentaenoic acid, 325–6 effect on survival of gilthead seabream larvae, 326 gilthead seabream larvae larval growth in relation to DHA + EPA + ARA, 328 electronic fish auctions, 1097 embankment ponds, 986 enteric viruses characteristics, 545 human, 544, 546–7 average concentration detected in wastewater samples, 554 and phages detection in shellfish samples, 561 in sewage and rivers, 555–8

1170

Index

titers, 554 enterprise resource planning, 1081 Environmental management systems, 690 environmental quality objectives, 689 environmental quality standards, 228, 689 environmental safety, 228 enzyme-linked immunoassay, 200, 597 EPA. see eicosapentaenoic acid Epinephelus aeneus, 477 Epinephelus coioides, 478, 481, 483 Epinephelus fuscoguttatus, 483 Epinephelus malabaricus, 478, 481 Eriocheir japonica, 846, 847 Eriocheir sinensis, 847 Eriocheir spp, 845 Escherichia coli, 451, 543 ET-743, 870, 871 Ethernet networking, 1070 ethnomedical, 873 EU TraceFish project, 1096 Euphausia superba, 519 EUROPASS, 1102 European Article Numbering-Uniform Code Council, 1096 European CV, 1102 European Galileo GPS system, 715 European Qualification Framework, 1102 European regulation 91/492/EC, 548, 560 European sea bass, energy and protein loss, 426 European Union Water Framework Directive, 688 EVOLVER, 1081, 1086 excavated ponds, 986–7 expandable bed filters, 960–2 eXtensible Markup Language, 1096 eye index, 829 faecal stripping techniques, 395–6 Farm Aquaculture Resource Management, 695 Farmcontrol, 1079 Farmocean, 939 fish farm completely elevated, 940 FAS ‘hooded’ oxygenator, 979 fatty acids, 322–3 fatty acids and antioxidants, 277–8 growth/disease resistance in essential fatty acids requirement, 277

fecundity, 88 feed conversion efficiency, 403–4 feed conversion ratio, 434, 462, 993, 1132 feed ingredients characterisation and preparation of ingredients, 390–1, 393 aquaculture feed ingredients composition, 392 ingredient identification, 390–1 preparation prior to evaluation, 393 defining ingredient digestibility, 393–9 calculating diet and ingredient digestibilities, 397–8 collecting faeces for digestibility assessment, 395–6 correlation among protein digestibilities, 400 correlation of diet and ingredient digestibilities, 399 diet and ingredient digestibilities, 399 effects of species on digestibility assessment process, 398–9 experiment management issues, 396–7 feed issues in ingredient digestibility assessment, 393–5 frontier technologies for evaluation, 408–9 growth and utilisation effect, 402–7, 408 biochemical, histological and sensory factors in evaluation, 407–8 energy retention by rainbow trout, 404 factors affecting nutrient and energy utilisation, 405–6 feed conversion efficiency, 403–4 gene and protein expression, 406–7 measuring growth, 402–3 nutrient retention, 404–5 reactive lysine assay chromatogram, 406 survival, 403 ingredient functionality and feed technical qualities lupin kernel meal, 410 pellet hardness, 408

Index ingredient palatability, 399–402 daily feed intake, 401 introduction, 388–90 components to ingredient evaluation, 388–9 consolidating the evaluation process, 389–90 ingredient risk management, 388 feed intake, 420–3 feline calicivirus, 565 Fenneropenaeus indicus, 653 fertilisation, 990–2, 1041–3 finfish genetic improvement, 55–72 future trends, 71–2 key drivers, 56–69 growth rate, disease resistance, and other quality traits improvement by selective breeding methods, 56–8 performance and other traits improvement by non-selective breeding methods, 58–9, 61–9 production- and consumer-related breeding-goal traits, 57 recent breeding programmes, 57 selective breeding programs risks, 69–71 fish health improvement, 273–6 mediators in neuroendocrine and immune system interaction, 275 neuroendocrine and immune function interaction, 274 rearing condition, 276 water quality and bioremediation, 274–6 fish farming current status and technical limitations, 924–9 catamaran steel fish farm, 928–9 circular HDPE collar fish farm, 925–7 comparisons of amount of biomass in one large net cage, 925 expanded polyester floatation attached under a bridge of steel, 927 HDPE pipes used for circular plastic fish farm manufacturing, 926

1171

interconnected hinged steel fish farm, 927–8 rigid steel fish farm, 929 floating fish farm design, 918, 920–4 categorisation, 918, 920 detail of mooring line connected to interconnected hinged steel fish farm, 922 grid mooring system for HDPE collar fish farms, 922 HDPE collar fish farm, 919 interconnected hinged steel fish farm, 919 mooring system, 921 the net cage, 920–1 steel catamaran fish farm, 919 structural analysis of fish farms, 921–4 historical development of technology, 914–18 centralised feeding systems used with HDPE collar fish farm, 917 circular high-density polyethylene pipe fish farm, 915 fish farm made of wood and expanded polyester, 915 interconnected hinged floating bridges of steel fish farm, 916 large catamaran-type fish farm, 916 modern net cage, 918 novel systems, 930–1, 933–5, 937–41 computer simulation of Nautilus fish farm exposed to waves, 938 Nautilus fish farm, 937–8 OceanGlobe fish farm, 938–9 PolarCirkel submergible fish farm, 934–5 SeaStation fish farm, 931, 933–4 submerged SeaStation fish farm, 933 Tension Leg Cage fish farm, 935–7 off-shore and open ocean advances in technology for, 914–42 supporting technologies, 937–41 other novel systems, 939–41 Aquaculture Engineering Group, 941 Farmocean, 939

1172

Index

Farmocean fish farm completely elevated, 940 SADCO, 939 SubFish, 939–40 technical properties of systems, 932 fish larvae nutrition and diet development, 315–59 diet manufacturing methods, 346–9 digestive system capacity, 343–5 dosage system, 355–9 factors affecting food particle utilisation, 318 feeding system, 354–5 food identification and ingestion, 332–3, 332–6 future directions, 359 Lates calcarifer, 317 microdiet characteristics, 349–52, 354 nutritional requirement, 322–32 nutritional requirement development, 319–22 ontogeny of digestive capacity, 336–43 fish meal, 372–3 fish pumps, 815 fish reproduction, 109–30 future trends, 128–30 reproductive endocrinology, 129–30 hormonal therapies for reproductive control, 118–22 gonadotropin preparations, 119–20 gonadotropin-releasing hormone agonists, 120–1 reproductive axis dysfunction & oocyte maturation & spermiation induction, 119 sustained-release delivery systems, 121–2 oocyte maturation and ovulation induction, 122–6 reproductive cycle control, 110–11, 113–16 major components and phases, environmental and endocrine control of the fish reproductive axis, 111 microphotographs of histological sections from ovaries, 112 spawning, 116

spermatogenesis & spermiation, 114–16 testes microphotographs, 115 vitellogenesis, oocyte maturation & ovulation, 113–14 reproductive strategies and captivity dysfunctions, 116–18 striped bass ovaries microphotographs, 117 spermiation induction, 126–7 spontaneous spawning versus artificial insemination, 127–8 fish vaccines, 203–7 fish viruses, 245 main fish viral diseases, 246 notifiable fish diseases, 246 FishBase, 1104 FishTalk, 1079 Fishtalk Service Log, 1081 fish-vet, 1099 flat photobioreactors, 616–17 floating bead filters, 967 floating fish farm design, 918, 920–4 flocculants, 1001–2 fluorescence antibody test, 200 foam fractionation, 947, 976 food conversion ratio, 1067 Francisella piscicida, 785 francisellosis, 785, 796 freshwater fish species advances in aquaculture nutrition, 440–56 nutrient requirements, 443–55 alternative protein sources, 445–6 complete feeds, 453–5 complete vs supplemental feeds, 452–3 energy, 446–7 lipids, 447–8 minerals, 450–1 prebiotics and probiotics, 451 protein, 443–5 vitamins, 448–50 recommended vitamin fortification levels for warm water fish, 455 fuel cell systems, 1157 fumonisins, 509 Gadus morhua, 771. see also Atlantic cod Galdieria sulphuraria, 878

Index Gambierdiscus toxicus, 645 gambieric acids, 645 gamete chromosomes, 172 gametogenesis, 123 gamma ray irradiation, 172 gene discovery technologies, 26–8 de novo sequencing of whole transcriptomes and gene discovery, 27–8 expressed sequence tags and gene discovery, 26–7 gene mapping, 62–3 gene sequencing, 209 general circulation models, 727 genetic drift, 89 genetic engineering, 256–7 genetic linkage mapping, 28–9 status of linkage maps in aquaculture species, 30–1 genetic variation and selective breeding in hatcherypropagated molluscan shellfish, 87–100 genetically modified organisms, 68 genome expression analysis technologies, 35–41 microarray technology, 35–40 development status in various aquaculture and aquatic species, 39 dye labeling, 37 vs tag- or sequence-based technology, 40–1 sequence tag-based technology, 40 genome mapping technologies, 28–9, 32–4 bacterial artificial chromosomebased physical mapping, 34 genetic linkage mapping, 28–9 quantitative trait loci (QTL) mapping, 29, 32 radiation hybrid mapping, 32–4 genome technology genetic improvement in aquaculture research, 3–41 DNA marker technologies, 4–18 DNA sequencing technologies, 18–26 gene discovery technologies, 26–8 genome expression analysis technologies, 35–41 genome mapping technologies, 28–9, 32–4

1173

genomic stability, 151–3 genomics, 67–8 geographical information systems, 685, 1086 climate change, 726–38 adapting to climate change and role of GIS, 733–4, 738 conclusion and future direction, 738 potential future climate change and its impact on aquaculture systems, 727–8, 732 database construction and project methodology, 711, 713–18 arithmetic operations, 715 buffers, 716 data rectification, 715 hierarchical models, 717–18 identifying data requirements, 711, 713–14 model verification, 718 neighbourhood analysis, 715 overlay, 716 reclassification, 716 setting the objectives, 711 verification, 714–15 weighted overlay, 716–17 decision support systems and tools, 718–25 activity trade-off, 718–19 additional internal or external modules, 719–20 analytical scope and reporting, 720 biodiversity tools, 719 viewsheds, 719 influence of climate change on aquaculture activities, 733 key capabilities, 709–11 analysis, 710–11 data acquisition and encoding, 709–10 data storage and retrieval, 710 display, 711 model to indicate vulnerability of global aquaculture to climate change, 735 modelling solid waste dispersal, 725 multi-site coastal zone planning, 739–45 approaches to model development, 739 biodiversity sub-model, 742–3

1174

Index

cage site suitability sub-model, 739–41 conclusion and future direction, 745 viewshed sub-model, 743–5 waste dispersion sub-model, 743 potential impact pathways of climate change on aquaculture systems and production, 729–31 predicted global average surface warming and sea level rise by the end of the 21st century, 728 role in spatial decision support in aquaculture, 707–46 selected applications and examples in aquaculture, 720–5 aquaculture and tourism, Tenenife, 725 detailed facility location, Scotland, 720 mangroves and aquaculture, Bangladesh, 721–3 sea urchin fishery management, Chile, 723 shellfish scenarios, Brazil, 721 waste dispersion models, UK, 723–5 shellfish culture scenarios in Brazil, 722 simple model of suitability for salmon cage location, 721 spatial planning context, 707–11 software and hardware development, 708–9 stages of development, 712 suitability of areas for aquaculture development in Spain, 726 suitability of areas for fishery restocking in Chile, 724 summary and future trends, 745–6 trade-offs between tilapia/carp and shrimp/crab cultures, 723 giant sea bass. see Asian seabass giant snakehead. see Channa micropeltes Gigartina skottsbergii, 878 gilthead sea bream. see also bream; Sparus aurata composition of weight gain, 424 energy and protein loss, 426

growth potential, 423 GIS. see geographical information systems global positioning system, 714–15 Global Standard One, 1096 global traceability network, 1096 glucosamine, 874 gnotobiology, 269 gonadotropin-releasing hormone agonists, 120–1 GONAZON, 120 gossypol, 445 green liver syndrome, 469 green water techniques, 625–6 green-lipped mussel. see Perna canaliculus greenshell mussel. see Perna canaliculus grouper advances in aquaculture feeds and feeding, 476–83 ADC for crude protein and energy for selected South East Asian ingredients, 480 digestibility, 479 feeding studies, 482 miscellaneous studies, 482–3 replacement studies, 480–2 requirements, 477–9 growth, 420–3 daily weight gain in relation to increasing body weights in gilthead sea bream, 423 daily weight gain in relation to increasing body weights in tilapia, 421 Gymnodinium, 587 Gymnodinium catenatum, 598 gynogenesis, 155–6, 187 gypsum, 1000, 1001 Haematococcus, 635, 636, 639, 880 Haematococcus pluvialis, 616 Halichondria okadai, 871 Halichondria panicea, 756 halichondrin B, 877 halichondrins, 876 Haliotis discus, 591 Haliotis sp., 623 harmful algal blooms clay sprinkling against surface patches of toxic dinoflagellate, 600

Index detection of phyto- and zooplankton species from ejected faeces from the Pacific oyster, 584 global increase, 581–7 climate changes, 581–2 coastal water utilisation for shellfish aquaculture, 582–5 dispersal associated with shellfish transportation, 585–7 large-scale cultivation of the shellfish, 583 impact on shellfisheries industries, 587–95 halo effects or value degradation products, 593–5 mass mortality and detrimental effects on molluscan shellfish, 590–3 phycotoxins accumulation, 587, 589–90 mechanism of phycotoxins-related shellfish poisoning, 588 and shellfisheries aquaculture, 580–601 shellfisheries damage due to toxic dinoflagellate, 592 temporal change of pacific oyster production, 594 temporal changes of toxicity in PST-contaminated oysters, 599 toxic dinoflagellate species that hampered shellfisheries, 588 treat prevention, 595–601 aquaculture sites selection, 597–8 blanket closure during the toxic algal bloom, 596–7 clay scatter, 599–601 cultivation treatment: phycotoxins depuration, 598–9 forecasts of the trajectory of the event by plankton monitoring, 595–6 Haslea ostrearia, 620, 640 hatcheries, 255 hatchery propagation, 89 Hawaii Aquaculture Module Expert System, 1099 hazard analysis and critical control points, 1086, 1088, 1091 HDPE collar fish farm, 919 Hei shen, 882

1175

HELIOGUARD 365, 643 hepatitis A virus, 544 herbal medicine, 270–1 herbicides, 998–9 heritability estimates, 90–2 larval traits, 91 Hesy Aquaculture, 948 Heterocapsa circularisquama, 591, 593 Heterocapsa triquetra, 595 Heterosigma akashiwo, 592, 595, 597 heterozygosity hypothesis, 179–80 high energy radiation, 153–4 high rate algal ponds, 654 high-hydrostatic pressure, 568 high-pressure liquid chromatography, 596, 597 Hippoglossus hippoglosus, 771. see also Atlantic halibut holothurians, 882 Homarus americanus, 823 Homarus gammarus, 823 host-parasite interactions, 218–20 immunomodulation, 219–20 HTE Biofilter, 970 Human Genome Project, 6 husbandry, 224–5 techniques and diet to improve disease resistance, 267–91 hydraulically integrated serial turbidostat algal reactor, 620 hydrocyclones. see swirl separator hydrogen peroxide, 998 hydroponics, 1157 hydrostatic pressure, 146 Hymeniacidon perleve, 753 ICT. see information and communications technology Ictalurus punctatus, 779 IDRISI, 711 IEC-60870-5-101, 1070 IEC-60870-5-104, 1070 IEC 61850, 1070 immunohistochemistry, 200 immunological manipulation, 154 In situ array technology, 36 in situ fluorometry, 901 inbreeding depression, 90 indirect fluorescence antibody test, 200 infectious pancreatic necrosis virus, 794 information and communications technology in aquaculture development, 1064–5

1176

Index

in aquaculture innovation and learning, 1098–104 applications of ICT in aquaculture education and learning, 1099–103 linking innovation, research and learning, 1098–9 role of ICT in innovation process, 1103–4 factors affecting adoption in aquaculture, 1066 farm patrol monitoring and control system from Pisces Engineering, 1069 functions, 1065, 1067 for productivity and effectiveness, 1067–88 Akvasmart FishTalk software, 1079, 1080 aquaculture stock management programmes, 1082–4 business information systems, 1081, 1085 planning and design, 1085–6, 1088 principles of monitoring, control and automation, 1067–70 software for aquaculture planning and design, 1087 stock management systems, 1078–81 for quality and customer service, 1088–98 elements of traceability systems, 1092 market chain and traceability, 1089–96 marketing and sales, 1097–8 public relations, 1098 RFID tags, 1093–4 active RFID tags, 1094 passive RFID tags, 1094 semi-passive RFID tags, 1094 sensors and monitoring tools for aquaculture stock, 1070, 1072–5, 1077–8, 1085–6 Akvasmart SmartEye camera system, 1076 AquaScan fish counter detail, 1072 AquaScan fish counters installed on Norwegian well boat graders, 1071 counting stock, 1070, 1072–3

estimating weight and biomass, 1073–5 feed management, 1075 fish identification and individual monitoring, 1075, 1077–8 laptop computer running AquaScan fish counting software, 1071 Lotek acoustic tags, 1077 record from Vaki fish counter, 1073 Vaki biomass frame, 1074 Vaki pipeline fish counter, 1072 tracking technology in action, 1095 use in aquaculture, 1064–105 ingredient replacement method, 394 inland saline aquaculture, 1119–44 case studies, 1128–44 Australia, 1128–33 effluent to olives, 1144 floating solar covers positioned on experiment pond, 1131 growth of rainbow trout in saline groundwater ponds at ISA Research Centre, 1132 happy red tilapia in an Israeli desert fish farm, 1142 India, culture of Macrobrachium rosenbergii, 1133–5 ISA Research Centre facilities, 1129 Isaraeli desert fish farm for edible fish, 1140 Israel, desert aquaculture, 1135–6, 1138–42 Israel’s freshwater resources and average annual use, 1136 layout of integrated desert aqua/ agriculture operation, 1141 mineral composition of desert brackish geothermal water vs seawater and freshwater, 1138 national water carrier: water transfer from wet to arid areas, 1137 USA, inland marine shrimp aquaculture, 1142–44 water chemistry of diluted coastal seawater and inland saline groundwater from Haryana, 1134 water quality of ponds at ISA Research Centre, 1131

Index water temperature and wet weight of mulloway in ponds at ISA Research Centre, 1130 chemistry and remediation, 1126–8 coal bed methane wastewater, 1123, 1126 future trends, 1144 saline water from interception schemes to protect agriculture, 1121–3 water chemistry for inland saline water, 1124–5 innate immunity, 250 Innovalg SARL, 636 inositol, 449 Instant Algae, 628 integrated agriculture/aquaculture systems, 1033 recent changes to traditional practice, 1037–9 crop/livestock/fish integration in China, 1038–9 livestock/fish integration, 1039 rice/fish integration, 1037–8 research and development for improved traditional practice, 1044–5 crop/livestock/fish integration, 1044–5 rice/fish integration, 1044 traditional aquaculture systems, 1034–6 crop/livestock/fish integration in China, 1035 livestock/fish integration, 1035–6 rice/fish integration, 1034–5 integrated fisheries aquaculture systems, 1033 recent changes to traditional practice, 1040–1 traditional aquaculture systems, 1037 integrated multitrophic aquaculture, 697, 1053 integrated peri-urban aquaculture systems, 1033 recent changes to traditional practice, 1039–40 traditional aquaculture systems, 1036 integrated pest management, 233–6 IPM scheme for parasite control, 234 integrated wastewater aquaculture, 753 INTER AQUA Advance A/S, 950

1177

interconnected hinged steel fish farm, 919, 927–8 with attached blowers and storage barge, 928 detail of connected mooring line, 922 IPM. see integrated pest management iron, 280 ISA Research Centre facilities, 1129 growth of rainbow trout in saline groundwater ponds, 1132 uncovered and covered ponds water quality, 1131 water temperature and wet weight of mulloway, 1130 ISO 9001, 1088 ISO 14001, 1088 ISO 22000, 1088 ISO 22003, 1088 Isochrysis, 624, 626, 628 Isochrysis galbana, 625, 627 Isochrysis T-ISO, 620, 622, 624 isoflavonoid phytoeostrogens, 509 ITT-Wedeco, 973 Ivermectin, 227 Jasus edwardsii, 826, 827, 828, 829, 833, 835, 836 Jasus lalandii, 824, 833 Jasus verreauxi, 824, 826, 827, 828, 829, 836 JECFA. see Joint FAO/WHO Committee on Food Additives Joint FAO/WHO Committee on Food Additives, 226–7 kairomones, 222 Kames cage, 740 Karenia brevis, 589, 596, 645 Karenia mikimotoi, 590, 598 KK3D, 1086 KMag, 1001 Lactobacillus, 452 Lamellidens marginalis, 755 Land Change Modeller, 719 LANDSAT SPOT, 713 Lanthella basta, 871 LarvalBase, 1104 Lates calcarifer, 317, 960, 1121 leaching, 349

1178

Index

learning content management system, 1100 learning management system, 1100 Learning Object Metadata, 1101 Learning Technology Standards Committee, 1101 lecithin, 449 Lepeophtheirus salmonis, 907 Lepomis macrochirus, 991 levamisole, 281–2 liming, 989–90 linkage maps, 64–5 commercially important finfish species, 65 LinkedIn, 1104 liquid chromatography-mass spectrometry/mass spectrometry, 596, 597 Lissondendorxy sp., 877 Listeria, 451 Litopenaeus vannamei, 1010–25, 1120, 1121, 1127 lobsters advances in aquaculture, 822–36 breeding, 827–8 broodstock, 827 maturation and mating, 828 spawning, 828 current situation and constraints, 823–7 hatchery-based lobster aquaculture, 826–7 lobster ranching, 824–6 species of interest, 823–4 future trends, 835–6 hatchery technology, 828–32 hatching, 829 incubation, 828–9 larval culture, 830 larval handling and assessment, 829–30 larval health, 832 larval nutrition, 831–2 larval systems, 830–1 product issues: markets, 835 production systems, 832–5 food and feeding, 834–5 grow-out, 833–4 nursery, 832–3 systems, 834 ‘long-arm’ aerator, 996 loop-mediated isothermal amplification, 202

loss on ignition, 907 Lotek MAP, 1077 Lotus Notes, 1089 low head oxygenator, 971–3 ‘lower Cenomanian Turonian’ aquifers, 1136 Loxechinus albus, 720, 723 Luffariella variabilis, 871, 876 Luminex xMAP, 203 Lyngbya majuscula, 644 Lyprinol, 880–2 lysozyme, 817 Macrobrachium rosenbergii, 1120, 1121, 1127, 1134 macronutrients, for salmonids, 506–7 carbohydrate, 507 fatty acids, 507 protein and amino acids, 506–7 magnesium salts, 1000–1 majusculamide C, 651 male-specific RNA, 560 managed learning environment, 1100 management information systems, 1065 mannan oligosaccharides, 513–14 manoalide, 871, 872, 876 Manual of Diagnostic Tests for Aquatic Animals, 255 map algebra, 710, 716 Marel Food Systems, 1095 marennine, 620, 640 mariculture, 870 Marine Shrimp Farming Program, 1013 Maritech, 1089, 1095 marker assisted selection, 66–9, 224, 779 genomics, 67–8 transgenesis, 68–9 marumerization, 348–9 massively parallel signature sequencing, 100 mathematical models, 219 Matrix, 1086 maximum residual level, 226–7 medicinal foods, 873 Mekong River Delta, 1040 melanism, 476 Melanotaenia fluviatilis, 753 membrane bioreactor technology, 557 mengovirus, 552 Mercatus Aqua Farmer, 1080

Index Mercatus Aqua Farmer and Farmcontrol, 1080 metabolic body weight, 419–20 metabolic rate, 425 metal ions, 279 methionine, 449 methylmercury, 375–6 microalgae advances in culture for aquaculture feed and other uses, 610–58 aquaculture feed, 621–35 commercial products currently available on the market, 629–34 ‘green water’ and ‘pseudo-green water’ techniques, 625–6 live prey, 624 major classes and genera used in aquaculture, 623 molluscs, 621–4 preserved microalgae for aquaculture, 627–8, 635 sea urchin culture, 626–7 shrimp culture, 626 commercial producers of microalgae pigment products, 641–2 commercially produced, 612 cosmetics, 643 current status and new techniques for culture, 611–21 advances in techniques, 617, 620–1 culture systems, 613 main features of different cultivation systems, 618–19 and cyanobacteria bioactive products, 646–9 main toxins, 650–1 cycle for photosynthetic oxygenation of wastewater, 655 dietary supplements and animal feed additives, 635–6 future trends, 657–8 high-wave molecules from algae, 637, 639–40 fatty acids, 637, 639 pigments, 639–40 and microalgae-like microorganisms PUFA content, 638 probiotics in aquaculture, 652–3 reactors and techniques for microalgae culture, 614–17 culture systems for benthic diatoms, 617

1179

flat photobioreactors, 616–17 sleeves and vertical columns, 614–15 tubular photobioreactors, 615–16 source of pharmaceuticals, 643–5, 651–2 wastewater reclamation and biofuel production by algae–bacteria consortia, 653–7 microbead filters, 969–70 microbound diets, 347 microcoated diets, 347 microcystins, 636 microencapsulated diets, 347–8 micropyle, 150 microsatellite-enriched small-insert genomic libraries, 12–13 microsatellites, 10–13 polymorphism, 11–12 Microsoft Access, 1079 Microsoft BizTalk RFID platform, 1095 Microsoft Exchange, 1089 Microsoft SQL databases, 1080 Microwave Telemetry Inc., 1078 Mikrocytos roughleyi, 96 mitochondrial genome, 6 ‘mixed-cell’ raceway design, 951 Model AJ 10, 979 Model 84P, 978 Modicon MODBUS, 1070 MODIS, 901 molecular farming, 651 molecular markers, 62–3 mollusc viruses, 247–8 Molluscan Broodstock Program, 94 molluscan shellfish current status of established breeding programs, 92, 94–7 C. gigas selection, 94 major selective breeding programs, 93 oyster selection programs in Australia, 94–6 Pacific oyster and green-lipped mussel selective breeding in New Zealand, 96–7 genetic variation and selective breeding, 87–100 monitoring genetic diversity and inbreeding risks, 88–90 present needs and future trends, 97–100

1180

Index

candidate genes, genomics and marker-assisted selection, 98–100 DNA fingerprinting, 97–8 quantitative trait loci mapping, 98 traits inheritance, 90–2 heritability estimates, 90–2 MOM, 1086 Moodle, 1100 mooring system, 921 connected to interconnected hinged steel fish farm, 922 and floats in still water, with Tension Leg Cage fish farm, 936 grid, circular HDPE collar fish farm, 926 grid mooring system for HDPE collar fish farms, 922 Morrison equation, 923 Mote Aquaculture Park in Sarasota, 977, 979 Mote Aquaculture sturgeon system, 977, 979 moving bed filters, 967–9 mulloway. see Argyrosomus japonicus Multi-Criteria Evaluation module, 717 Multi-Objective Land Allocation tool, 718, 722 multiple drain systems, 953–5 Murex whelks, 883 Muriellopsis sp., 640 mycalamide A, 876 Mycale hentscheli, 876 mycotoxins, 289 Myrionecta rubrum, 589, 593 Myspat INVE Technologies, 623 Mytilus edulis, 755, 758 NADPH-oxidase pathway, 278 Nannochloropsis, 624, 625, 628 nanotechnology, 209 National Estuarine Eutrophication Assessment, 694 National Pollutant Discharge Elimination system, 1005 national scenic area, 742 National Shellfish Sanitation Program, 548, 560 Nautilus fish farm, 937–8 Navicula, 623 NAVSTAR system, 714 near-horizontal tubular reactor, 615 near-infrared spectroscopy, 409

nephrocalcinosis, 792 Nile tilapia. see Oreochromis niloticus nitrification, 1016, 1022 Nitzschia, 623 Nitzschia navis-varingica, 589 nodavirus, 783 non-chemical methods, 221–5 non-nutritive immunostimulants, 281–2 as feed additives, 281 non-starch polysaccharide, 508 nori, 643 normalised difference vegetation index, 714 noroviruses, 544, 546 Northwest Marine Technology, 1075 Norwegian standard NS 9415, 924 Nostoc, 610, 635 Nostoc sp, 644 ‘Nubian Sand Stone,’ 1136 nutraceuticals, marine, 872–4 nutrient retention, 404–5 nutrigenomics, 389 Nutrinova, 639 nutrition determination, 319–22 diet manufacturing methods, 346–9 marumerization, 348–9 microbound diets, 347 microcoated diets, 347 microdiets using different techniques, 346 microencapsulated diets, 347–8 digestive system capacity, 343–5 degree of hydrolysis, 345 dosage system, 355–9 automatic microdiet dispenser, 356 cleaning time or cleaning efficiency, 358–9 delivery to the rearing tank, 356–7 fractioning of the daily ration into multiple events, 357 sparing on the quantity of microdiet, 357–8 feeding system, 354–5 fish larvae, 322–32 arachidonic acid requirements, 326–7 balanced EPA ratio, 327–8 docosahexaenoic acid requirement, 323–5 eicosapentaenoic acid requirement, 325–6

Index essential fatty acids requirements, 322–3 phospholipids, 328–30 protein and amino acid requirements, 331–2 vitamins and minerals, 330–1 food identification and ingestion, 332–3, 335–6 amino acids as feed attractant, 334 effect of krill hydrolysate inclusion method on growth of yellowtail kingfish, 336 feed attractants presentation, 336 feeding process, 333 krill hydrolysate effect on ingestion rates, 335 marine organism hydrolysates and free amino acids as feed attractants, 337 future directions, 359 microdiet characteristics, 349–52, 354 buoyancy, 350–1 Curnow et al. weaning protocols, 354 feeding protocols on barramundi larvae, 352 leaching, 349 leaching rates, 350 lysine leaching pattern, 350 references to weaning protocol, 353 sinking patterns of commercial diets, 351 weaning and co-feeding methods, 351–2, 354 ontogeny of digestive capacity in marine fish larvae, 336–43 comparison of digestive tract developmental stages, 339 intestinal brush order enzyme and intracellular peptidase activity, 340 nutritional requirements, 417–38 feed formulation and feed strategies, 433–5 comparison of energy and protein requirements in fish production, 436 daily energy and protein requirements calculation, 433 digestible energy and protein required for growth, 435

1181

grouper and mullet predicted energy and protein requirement, 436 feed ingredient evaluation, 431–2 future trends, 437–8 nutrient release, 437 quantification, 419–31 composition of weight gain, 424–5 energy and protein utilisation efficiency, 427–31 growth and feed intake, 420–3 metabolic body weight, 425–7 methodology, 419–20 Nuvan, 229 NZ Greenshell mussels, 882 Ocean Sciences Centre, 783 OceanGlobe fish farm, 938–9 in maintenance position with support vessel, 939 ochratoxins, 509 Octaform, 949 Odontella aurita, 636 off-shore farming characterisation and selection of sites, 897–9 definition, 897–8 site selection criteria and methods, 898–9 classification of off-shore waters based on wave heights, 898 context for off-shore farming, 895–7 environmental concerns, 904–9 finfish species cultivation, 899–901 cold and cool temperate water species, 900 potential environmental effects, 905–8 species in development, 900–1 tropical and sub-tropical species, 900 future trends, 909–10 mollusc culture, 901–4 drivers and limitations, 901 other considerations, 904 potential environmental effects, 908–9 species cultivated in off-shore environments, 902–4 technologies for off-shore mollusc farming, 901–2 opportunities and challenges, 895–910

1182

Index

potential environmental impacts form marine net pen farming, 905 submerged longline showing attachment of mussel, 903 used for molluscs suspension culture, 902 oil belching, 502–3 okadaic acid, 871 Olrac, 1095, 1096 Oncorhynchus mykiss, 148, 498–522, 779. see also salmonids Oncorynchus mykiss, 1121 oocyte maturation, 113–14 open database connectivity, 1081 Oracle applications, 1085 Oreochromis niloticus, 1034, 1038, 1044, 1045, 1047, 1049, 1051, 1052, 1138–9, 1153 organic carbon concentration, 965–6 oxidants, 997–8 oxygen cones, 970–1 oxylipines, 645 ozonation, 270 ozone contact, 947, 974–5 P. homarus, 825, 826, 834 Pacific oyster. see C. gigas paddlewheel aerators, 995 Pagrus auratus, 467, 1126 palatability, 399–402 Palinurus elephas, 824 Palo-Alto Software, 1086 Panulirus argus, 824, 830 Panulirus cygnus, 826, 833 Panulirus interruptus, 824 Panulirus japonicus, 824, 827, 835 Panulirus ornatus, 824, 825, 827, 829, 830, 832, 833, 834, 835, 836 Panulirus polyphagus, 824, 826 Panulirus versicolor, 826 Paralichthys dentatus, 1153 parasitic disease new development for control in aquaculture, 215–37 advances in parasite biology and host-parasite interactions, 218–20 advances in parasite control methods, 221–9, 231–6 advances in parasite identification methods, 220–1 effect on the industry, 216–18

future trends, 237 Parastichopus californicus, 882 parentage assignment-based pedigrees, 63–4 partitioned aquaculture system, 1054 passive integrated transponder tags, 1075 pateamine, 876 pathogen control, 268–73 biocontrol agents, 272–3 agents used in aquaculture, 272 hygiene improvement, 270 intestinal microbiota preservation, 269 new antimicrobial preparation and compounds, 270–2 new biocidal compounds, 272 Pavlova, 628 Pavlova lutheri, 622 PCB CB138, 758 peas and lupins, 382 Pecten maximus, 622 pectenotoxin, 589 peloruside, 876 PEPHA-CTIVE, 643 PEPHA-TIGHT, 643 peptidoglycan, 282 peridinin–protein complex, 594 periphyton, 1047 Perna canaliculus, 96–7, 880, 903–4 persistent organic pollutants, 376–8 pesticides, 376–7 polybrominated biphenyls, 377 polybrominated diphenyl esters, 376–7 polychlorinated biphenyls, 376–8 pesticides, 376–7 Phaeodactylum tricornutum, 620, 879, 880 pharmaceuticals, marine, 870–2 phospholipids, 328–30 phosphorus, 511 photobacteriosis, 816–17 Photobacterium damselae subspecies piscicida, 204–5 photobioreactors, 611 photoperiod manipulation, 144–5 photosynthetic oxygenation, 654 pH-STAT technique, 344 phycobilins, 593 phycobiliproteins, 640, 645, 878 phycocyanin, 640 phycoerythrin, 593, 640

Index phycofluor, 645 phycoremediation, 750 ‘phycosphere,’ 652 phytohormonal, 651 phytoremediation, 750, 757 Pinctada albina albina, 755 Pinctada imbricata, 753, 755, 759, 761 piscalators, 815 plankton and krill, 382–3 Plexiglas tubes, 615 PolarCirkel submergible fish farm, 934–5 being submerged, 935 polychlorinated biphenyls, 509 polyculture, 697 polyether okadaic acid, 589 Polygeyser, 961, 962, 967 polymerase chain reaction, 201, 221 pond dynamics, 1041 80:20pond fish culture, 1050 pond hydroponics, 1051–2 POND model, 720 ponds, for finfish production advances in technology and practice, 984–1006 amendments, 997–1002 herbicides, 998–9 microbial products, 999–1000 oxidants, 997–8 bottom treatments, 1002–3 dissolved oxygen management, 994–7 pond aeration and circulation, 996–7 pond aeration devices, 994–6 water circulators, 996 effluents, 1004–6 feeds and feed management, 992–4 feed management, 994 fish meal and fish oil, 992–3 nitrogen and phosphorus, 993–4 future trends, 1006 hydrologic types, 985–8 embankment ponds, 986 excavated ponds, 986–7 pond shape, 988 seepage and erosion control, 987 water reuse, 987 watershed ponds, 985–6 liming and fertilisation, 989–92 fertilisation, 990–2 liming, 989–90 mineral amendments, 1000–2

1183

calcium sulfate, 1000 flocculants, 1001–2 potassium and magnesium salts, 1000–1 sodium chloride, 1000 production methodology, 988–9 water quality monitoring, 1003–4 ‘pop-up’ satellite telemetry tags, 1078 Porphyra spp, 878, 879 Porphyridium cruentum, 640 portunid crabs, 847–8 product issues, 850–1 production systems broodstock quality and nutrition, 856 food and feeding, 854–5 grow-out, 852–3 hatchery practices, 857 nurseries, 858 Portunus pelagicus, 847, 852, 854, 858 Portunus sanguinolentus, 853 Portunus spp, 845, 851 poster fish, 1154 potassium permanganate, 997 potassium salts, 1000–1 PowerSim Solver, 720 prebiotics, 284–5, 451, 1020 Prialt, 871 PRIMER, 692 Pro Manager, 1079 probiotics, 451, 1020 Procentrum concavum, 871 production carrying capacity, 685 Profibus, 1070 programmable logic controller, 1068 proinflammatory cytokines, 278 proportional integral derivative, 1068 ‘prop-washed’ bead filters, 961 Prorocentruma spp., 595 protamine, 874 protein, 279 and amino acid, 331–2 protein content, 424 protein skimming, 947, 976 Protulines, 643 ‘pseudo-green water’ techniques, 625–6 Pseudo-nitzschia, 589, 595 Pseudopleuronectes americanus, 1153 Pseudopterogorgia elisabethae, 872 Pycese, 272 Pyrodinium, 587

1184

Index

QTL detection, 65–6 quantitative trait loci, 98, 252, 779 linkage maps for molluscan shellfish, 99 raceway tanks, 949–51 Rachycentron canadum aquaculture cultivation, 804–18 broodstock and spawning, 805–6 captive spawning, 806 eggs and collection, 806 natural spawning cycles, 805 custom-designed larval rearing system, 811 egg and larval cobia sizes, 807 emerging issues and future trends, 816–18 aquanomics, 817–18 diseases, 816–17 feeding protocol used for production of weanling cobia, 809 harvested at larger sizes, 816 juveniles and on-growing, 812–16 cold banking, 813–14 harvesting, processing and marketing, 814–16 juvenile nutrition, 812 low-salinity culture, 814 replacement proteins, 812–13 larval rearing, 807–12 broodstock diets, 811–12 feeding protocols, live feeds and enrichments, 807, 809 microdiets and weaning, 809–10 systems design, 810 larviculture in ponds, flow-through tanks and recirculating life support systems, 808 percent increase from initial weight of juvenile cobia, 815 radial flow separators, 957 radiation hybrid mapping, 32–4 gilthead sea bream, 34 zebrafish, 33–4 radio frequency identification tags, 1093–4 rainbow trout. see Oncorhynchus mykiss; Oncorynchus mykiss rain-fed ponds, 985–6 Ramsar Convention on Wetlands, 1040 RAMSAR site, 742 random amplified polymorphic DNA, 6

raster data, 710 recirculating aquaculture systems, 697, 1152 advances in technology and practice for land-based aquaculture systems, 945–79 biological filtration, 962–70 floating bead filters, 967 microbead filters, 969–70 moving bed filters, 967–9 organic carbon concentration, 965–6 quantifying the nitrification rate, 964 temperature on nitrification, 966 total ammonia nitrogen concentration, 965 commercially available fibreglass oxygen cone, 971 the Cornell dual-drain, 955 ‘cross-flow’ raceway, 951 definition, 946 design components, 947–8 drum screen filter for waste solids removal, 958 freshwater vs marine systems design, 975–7 changes in nitrification rates, 976–7 fine and dissolved solids control, 976 generic microbead filter, 969 incline belt filter manufactured by Salsnes Filter AS, 959 treating recycled system water, 960 low head oxygenator design, 972 mixed cell raceway design, 952 modern approach to a complete systems design, 977–9 moving bed media and filters, 968 octagonal structural aluminium tanks with interior fibreglass, 950 oxygenation components and processes, 970–3 low head oxygenator, 971–3 oxygen cones, 970–1 plan view of four-tank module for sturgeon production, 978 Polygeyser bead filter, 961 radial flow separator, 957 settleable solids capture components, 955–7

Index radial flow separators, 957 swirl separator, 955–7 sterilisation components and processes, 973–5 ozone contact, 974–5 UV light, 973–4 suspended solids capture components, 957–62 expandable bed filters, 960–2 screen filters, 958–60 swirl separator, 956 tank, water input manifolds, and drain design, 948–55 circular flow tanks, 951–3 multiple drain systems, 953–5 raceway tanks, 949–51 water input manifolds, 953 traditional tube in shell pressurised design and more recent drop-in open channel UV units, 974 types of particulate waste solids, 948 vertical manifold for evenly distributing water input, 954 Red River Delta, 1045 red sea bream. see bream; Pagrus auratus red tide. see harmful algal blooms Redfield Ratio, 991 Regulation EC/178/2002, 1090 Regulation EC/852/2004, 1090 Regulation EC/1830/2003, 1092 remote terminal units, 1068 remotely operated underwater vehicles, 693 Renibacterium salmoninarum, 205 Resilience, 872 reverse transcriptase – polymer chain reaction, 551 RFID. see radio frequency identification tags Rhizosolenia chunii, 595 Rhodomonas salina, 622 rice–crab farming systems, 851, 858 rigid steel fish farm, 929 truss work design, 930 @RISK, 1081, 1086 RNA interference, 254 RNAi-based gene therapies, 257 R-phycoerythrin, 879 RS-485, 1070 RyR1/FKBP12, 871

1185

S Lyprinol, 882 Sabella spallanzanii, 753 Saccostrea glomerata, 94–6, 758 SADCO, 939 fish farm with steel frame for net cage support, 940 Salmo salar, 498–522, 779. see also salmonids salmon vaccines, 204–5 Salmonella, 451 Salmonella Arizonale, 509 salmonids advances in aquaculture feeds and feeding, 498–522 choice of feedstuffs, 515–16 oils, 516 proteins, 515–16 consumption of dietary fish protein and production of farmed fish protein, 521 cross-sections of distal intestine of Atlantic salmon, 504 dietary additives, 511–14 carotenoids, 511–12 feed enzymes, 513 immunostimulants and pre-biotica, 513–14 vitamins, minerals and amino acids, 511 digestive physiology, 501–5 and regulation, 501 role of intestinal microflora, 502 feed and feedstuff related digestive function alterations, 502–5 impaired lipid digestion, 505 oil belching and pellet durability, 502–3 soybean meal-induced enteritis, 503–5 feed technology and formulation, 500–1 benefits and restrictions, 500–1 high-pressure moist extrusion technology, 500 trends, 501 feeding and feeding systems, 517–18 future trends, 518–22 feeds, 519–20 raw materials, 518–19 sustainability, 521–2 lifespan diets, 516–17 pigment strategies, 517 seasonal diets, 516–17

1186

Index

main principles of high-pressure moist extrusion feed manufacture, 500 nutrition and health, 507–10 malnutrition and fish health, 510 salmon feed history and human health, 510 nutritional requirements, 506–7 macronutrients, 506–7 micronutrients, 506 practical formulations, 515–17 species differences, 514–15 carbohydrate utilisation, 514 carotenoid utilisation, 515 oil belching and bloat, 514 unwanted dietary components and fish health, 507–10 contaminants in oils, 509–10 contaminants in protein feedstuffs, 509 inherent components in protein feedstuffs, 507–9 SAP applications, 1085 saponins, 508 SARNISSA project, 1104 saxitoxin, 587 scallop waste model, 759 scanning electron microscopy, 220 Scenedesmus, 624 Scenedesmus almeriensis, 640 Schizochytrium, 628, 639 Scieanops ocellatus, 1127 ‘scope for growth’ concept, 813 screen filters, 958–60 drum screen filters, 958–9 incline belt filters, 959–60 Scrippsiella trochoidea, 595 Scylla paramamosain, 847, 854, 857 Scylla serrata, 846, 848, 854, 857 Scylla spp, 845, 851, 860 Scytonema hofmanni, 644 scytonemin, 643 scytophycins, 644 sea-farming, 870 seafood processing waste products, 382 Seafood Services Australia, 690 SEAPURA, 878 SeaStation fish farm, 931, 933–4 submerged, 933 SeaWiFS, 901 secchi disc, 691, 754, 1003 sediment profile imagery, 693 segregation analysis, 168–9

selective breeding and genetic variation in hatcherypropagated molluscan shellfish, 87–100 selective breeding programs, 69–71 Sentinel Farms project, 1103 454 sequencing platform, 24–6 epigenetic analysis, 25 gene expression profiling, 25 whole genome sequencing, 25 serial analysis of gene expression, 100 serpentine photobioreactors, 615 sewage treatment plant, 759 sex chromosomes, 61–2 Sharable Content Object Reference Model, 1101 Sharepoint Services, 1089 shellfish chromosome set manipulation, 165–88 schematic presentation, 169 monitoring of viral contamination in growing areas, 542–69 shrimp, superintensive bio-floc production technologies, 1010–25 single nucleotide polymorphism (SNP), 13–17, 779 allele discrimination using BeadArray technology, 17 BeadArray technology, 16 direct DNA sequencing, 14 genotyping, 15 heteroduplex analysis, 14 single-strand conformation polymorphism, 14 single-cell oil, 637 single-sex and sterile population of fish for aquaculture endocrine sex reversal, 156–7 environmental manipulation of sex ratio, 157 future trends, 157–8 uniparenteral inheritance, 154–6 site of special scientific interest, 742 Skeletonema, 626 Skretting, 1096 SMART, 687 sodium chloride, 1000 sodium nitrate, 997–8 Solexa sequencing platform, 23–4 SOLiD sequencing platform, 19–23

Index base position sequenced by ligation and with various primers, 21 chemistry of sequencing platform, 22 clonal amplification of genomic DNA, 20 creation of ‘libraries’ of sheared segments, 20 Soy in Aquaculture website, 452 soy protein, 380 soybean meal, 379–80, 445, 853 Sparus aurata, 470 Sparus latus, 470 spawning, 116 special areas for conservation, 742 special protection area, 742 Speece Cone, 970 spermatogenesis, 110, 114 spermiation, 110, 114–15 spiroplasma bacteria, 846 Spirulina, 879 Spirulina meal, 853, 860 Spongia officinalis, 757, 758 STELLA, 1086 sterile and single-sex fish population in aquaculture, 143–58 direct induction, 145–6, 148–9 future trends, 157–8 genomic stability of triploids, 151–3 tetraploid-diploid crosses, 149–51 triploidy alternatives, 153–4 sterility hypothesis, 180–1 steroidogenesis, 111 Stizosledion vitreum, 1153 STS-89, 1156 STS-90, 1156 sturgeon. see Acipenser SubFish, 939–40 submerged longline technology, 901 summer flounder. see Paralichthys dentatus superintensive bio-floc production technologies, 1011–13 components, 1013–16 bio-floc microbial communities, 1016 feeds and feeding, 1014–15 shrimp stocks, 1013–14 systems engineering, 1015–16 current research priorities, 1017–24 economics and marketing, 1017–18 feed programs, 1020–1

1187

harvesting of grow-out systems, 1023–4 health management, 1018 husbandry, 1021–3 integration of research and commercialisation efforts, 1017 production systems, 1019–20 stocking and harvesting of nursery systems, 1023 for marine shrimp, technical challenges and opportunities, 1010–25 prioritised summary of technology gaps, 1024–5 bio-economic models, 1025 feeds and feeding, 1025 genetic improvement, 1024 health and biosecurity, 1025 larval culture, 1025 system engineering and lifesupport systems, 1024 value-added products, 1025 seed supply, 1018–19 genetics and breeding, 1018–19 seed production, 1019 Waddell Mariculture Center configuration of pilot scale raceway system for nursery production, 1014 greenhouse enclosed raceway system during winter operation, 1012 ‘supervisory control and data acquisition’ system, 1068 suppression subtractive hybridisation, 100 surgical castration, 153 sustained-release delivery systems, 121–2 cholesterol implants, 121 EVAc solid implant, 121–2 microspheres, 121 swirl separator, 955–7 Sydney rock oyster. see Saccostrea glomerata Symploca, 644 synchronus spawners, 116 synthadotin, 645 system of rice intensification, 1044 tagging, 1075 Taiwan paddlewheel aerator, 995–6

1188

Index

Taura Syndrome Virus, 1014 Taxol, 870 Tedania charcoti, 756 telemetry tags, 1077 telemetry technology, 691 Tension Leg Cage fish farm, 935–7 exposed to current and waves, 936 with mooring system and floats in still water, 936 terrace ponds, 985–6 tetradecylthioacetic acid, 520 tetraploid shellfish, 183–4, 186–7 induction, 183–4, 186 tetraploid induction, 185 performance, 186–7 tetraploid-diploid crosses, 149–51 Tetraselmis, 624, 626, 652 Tetraselmis suecica, 614, 625 Thalassiosira, 626 ‘the chill chain,’ 1092 the net cage, 920–1 The New Zealand King Salmon Company, 1085 thematic layers, 710 Thenus, 824, 830, 836 thermal pressure, 146 Thierry Chopins interdisciplinary research laboratory, 875 tilapia. see also freshwater fish species; Oreochromis niloticus commercially produced species, 441 composition of weight gain, 424 daily weight gain in relation to increasing body weights, 421, 423 general nutrient specifications for formulation of practical diets, 454 generic production diets, 454 growth potential, 422 recommended minimum amino acid levels in diets, 455 supplemental mineral levels recommended for practical diets, 456 Tilapia Genome Sequencing Project, 67 tilapia plan, 1154 titanium dioxide, 558 total ammonia nitrogen, 963 concentration, 965 total organic carbon, 907 total suspended solids, 1022

TraceAll, 1095 ‘TraceCore’ XML, 1096 traditional Asian aquaculture, 1029–56, 1033–4 bridging traditional and modern practice, 1050–4 CSC where an increasing protein level in supplementary feed is needed, 1030 definitions and principles, 1030–4 integrated aquaculture, 1033–4 intensity of production, 1030–2 extrapolated annual yield and intensity of culture, 1031 future trends, 1054–6 growth of Nile tilapia in fertilised ponds with additional feeding to 50% satiation by commercial pelleted feed, 1052 with additional fractions of satiation feeding with commercial pelleted feed, 1052 recent changes to traditional practice, 1037–41 integrated agriculture/aquaculture systems, 1037–9 integrated fisheries/aquaculture systems, 1040–1 integrated peri-urban aquaculture systems, 1039–40 recent development of semiintensive aquaculture, 1047–50 carp polyculture in Bangladesh, 1048–9 carp polyculture in India, 1047–8 small-scale farm integration in Malawi, 1049–50 reduction of wastes in situ, 1050–2 80:20 system, 1050 bio-floc technology, 1050–1 commercial pellets as supplementary feed, 1051 pond hydroponics, 1051–2 relationship between nutritional input and intensity of system, 1044 research and development for improved traditional practice, 1041–7 fertilisation, 1041–3

Index integrated agriculture/aquaculture systems, 1044–5 periphyton, 1047 supplementary feeding, 1043–4 wastewater-fed aquaculture, 1045–7 traditional aquaculture systems integrated agriculture/aquaculture systems, 1034–6 integrated fisheries/aquaculture systems, 1037 integrated peri-urban aquaculture systems, 1036 treatment of intensive aquaculture effluents, 1053–4 aquaponics, 1053–4 intensive cage culture within semi-intensive pond culture, 1053 intensive pond effluents for semi-intensive pond culture, 1053 partitioned aquaculture system, 1054 transgenesis, 68–9 transmission electron microscopy, 220 trepang, 882 triangular airlift reactor, 616 trimethylamineoxide, 507 triploid shellfish, 174–5, 178–83 growth, 175, 178–81 induction and post-larval growth, 176–7 positive correlation between meat weight and multilocus heterozygosity in diploids & triploids, 180 triploid C. virginica, 178 larval performance, 175 meat quality, 182 sterility and genome stability, 183 survival, 182 triploidy, 58–9 triploidy induction, 145–6, 148–9 diploid, triploid & tetraploid embryo production, 147 Trizol, 551 trypsin inhibitor activity, 508 T-tags, 1075 tubular photobioreactors, 615–16 Turboxygene Model LR200, 979 Turnitin, 1102

1189

T-Vet, 1099 TZT-1027, 645 UKLeaP, 1102 uniparenteral inheritance, 154–6 Upper Klamath Lake, 636 urban, vs rural, 1149 urban aquaculture description, 1149 the economics: siting, processing, and marketing, 1157–8 future trends, 1159–61 goals, 1151–2 marketing and competition, 1158–9 New York as a model, 1148–61 potential programs, 1153–6 role of university community outreach, 1159 education, 1159 research and development, 1159 technology, 1152–3 USDA Western Regional Aquaculture, 94 UV irradiation, 172, 270 UV light, 973–4 vaccination, 257 vaccine development, 223–4 advances, 203–7 electron micrographs of Renibacterium salmonarum, 206 western blot analysis Photobacterium damselae, 205 key drivers for improvement, 198 vector data, 710 VI alpha tags, 1075 Vibrio alginolyticus, 483, 753 Vibrio anguillarum, 783 Vibrio anguillarum II, 753 vibriosis, 780 viewshed sub-model, 744 Vig-1, 251 Vig-2, 251 viral contamination characteristics of the main enteric viruses, 545 detection methods, 550–3 quantification, 553 rapid review, 550–3 effects of different physical factors on virus inactivation in shellfish, 566–7

1190

Index

efficiency of different waste water treatment plant to remove norovirus, 558 human enteric viruses, 544, 546–7 adenovirus, 547 Aichi virus, 546 astrovirus, 546 enterovirus, 546 hepatitis A virus, 544 hepatitis E virus, 547 noroviruses, 544, 546 rotavirus, 546 input and flux, 553–62 animal output, 555 enteric viruses in sewage and rivers, 555–8 flux calculation from sewage, 558–9 potential indicators, 560, 562 seasonal outbreaks, 553–5 surface water, 559–60 monitoring of shellfish growing areas, 542–69 future trends, 568–9 other issues, 565, 568 possible sources for shellfish growing in coastal area, 550 reduction strategies, 562–5 depuration, 564–5 persistence of viruses in shellfish tissues, 563–4 virus resistance, 562 sources of pollution, 544–50 animal viruses, potential zoonotic viruses, 547–8 outbreaks with emphasis on the source of virus contamination, 548–50 titers of enteric viruses in stool specimens, 554 viral disease new developments for control in aquaculture, 244–59 advances in immunity of aquacultured species to viral diseases, 249–54 limitation of current management techniques, 248–9 new methods for disease control and future trends, 254–9 overview, 245, 247–8 viral nervous necrosis, 783, 796 ‘virtual learning environment,’ 1100

virus-induced genes, 251–2 virus-like particles, 563–4 visible implant elastomer tags, 1075 vitamin A, 331 vitamin B12, 449 vitamin C, 331, 450 vitamin D, 331 vitamins, 279 vitamins and minerals, 330–1 vitellogenesis, 110, 113 volatile suspended solids, 1022 volumetric nitrification rate, 964 volumetric TAN conversion rate, 964 Waddell Mariculture Center raceway system configuration of pilot scale for nursery production, 1014 enclosed, greenhouse during winter operation, 1012 walleye. see Stizosledion vitreum wastewater-fed aquaculture, 1045–7 water disinfection, 270 water input manifolds, 953 water recirculation system, 795. see also recirculating aquaculture systems watershed ponds, 985–6 weaning, 351–2, 354 Web Ontology Language, 1102 ‘wet chemistry’ nutrient analyses, 691 wheat and barley, 380–1 whirling disease, 221 white grouper composition of weight gain, 425 energy and protein loss, 426 growth potential, 423 ‘white-gut’ syndrome, 832 white-spot syndrome virus, 847 WikiBooks, 1104 winter flounder. see Pseudopleuronectes americanus WiseFish Production, 1089 xenobiotics, 271 Xiphophorus helleri, 1156 X-ray irradiation, 172 ‘Yang Cheng’ crabs, 850 yellowfin sea bream. see Sparus latus yessotoxins, 589 Yondelis, 870

Index Ziconitide, 871 Zirconia beads, 551 Zocar, 870 zooremediation, 751 of aquatic systems, 750–64 checklist for candidate species, 762 definitions, 751–2 the ethics of employing animals, 763 future trend, 761–4 nitrogen, phosphorus and metal content of dried tissues from Pinctada imbricata, 760 and pearl aquaculture, 758–9, 761 of pollutants, 752–8

1191

zooextraction of heavy metals, 755–7 zooextraction of nutrients and microorganisms, 752–4 zooextraction of organic pollutants, 757–8 zoostabilisation/degradation of organic pollutants, 758 zoostabilistaion/degradation of nutrients and mircoorganisms, 752–5 self-financing models, 756–7 phytoremediation, 756 zooremediation equivalents, 752

New Technologies in Aquaculture: Improving Production Efficiency, Quality and Environmental Management (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Processed Meats: Improving Safety, Nutrition and Quality (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Frying - Improving Quality (Woodhead Publishing in Food Science and Technology)

Improving the Sensory and Nutritional Quality of Fresh Meat: New Technologies (Woodhead Publishing in Food Science, Technology and Nutrition)

Maillard Reactions in Chemistry, Food and Health (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Yeasts in Food: Beneficial and Detrimental Aspects (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Food and Beverage Stability and Shelf Life (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Endocrine Disrupting Chemicals in Food (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Determination of Veterinary Residues in Food (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Tracing Pathogens in The Food Chain (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Food Colloids: Proteins, Lipids and Polysaccharides (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Food Emulsions and Foams (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Food Preservation Techniques (Woodhead Publishing in Food Science and Technology)

Food, diet and obesity (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Functional Foods: Principles and Technology (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Functional and Speciality Beverage Technology (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Food Preservation Techniques (Woodhead Publishing in Food Science and Technology)

Cereals Processing Technology (Woodhead Publishing in Food Science and Technology)

Fruit and Vegetable Processing: Improving Quality (Woodhead Publishing in Food Science and Technology)

Fruit and Vegetable Processing: Improving Quality (Woodhead Publishing in Food Science and Technology)

The Maillard Reaction in Foods and Medicine (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Environmentally-Compatible Food Packaging (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Handbook of Food Proteins (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Meat Products Handbook: Practical Science and Technology (Woodhead Publishing in Food Science, Technology and Nutrition)

Developing Children's Food Products (Woodhead Publishing Series in Food Science, Technology and Nutrition - Volume 204)

Reducing Saturated Fats in Foods (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Handbook of Indices of Food Quality and Authenticity (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Encapsulation and Controlled Release (Woodhead Publishing Series in Food Science, Technology and Nutrition)

New Technologies in Aquaculture: Improving Production Efficiency, Quality and Environmental Management (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Processed Meats: Improving Safety, Nutrition and Quality (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Frying - Improving Quality (Woodhead Publishing in Food Science and Technology)

Improving the Sensory and Nutritional Quality of Fresh Meat: New Technologies (Woodhead Publishing in Food Science, Technology and Nutrition)

Maillard Reactions in Chemistry, Food and Health (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Yeasts in Food: Beneficial and Detrimental Aspects (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Food and Beverage Stability and Shelf Life (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Endocrine Disrupting Chemicals in Food (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Determination of Veterinary Residues in Food (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Tracing Pathogens in The Food Chain (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Food Colloids: Proteins, Lipids and Polysaccharides (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Food Emulsions and Foams (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Food Preservation Techniques (Woodhead Publishing in Food Science and Technology)

Food, diet and obesity (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Functional Foods: Principles and Technology (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Functional and Speciality Beverage Technology (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Food Preservation Techniques (Woodhead Publishing in Food Science and Technology)

Cereals Processing Technology (Woodhead Publishing in Food Science and Technology)

Fruit and Vegetable Processing: Improving Quality (Woodhead Publishing in Food Science and Technology)

Fruit and Vegetable Processing: Improving Quality (Woodhead Publishing in Food Science and Technology)

The Maillard Reaction in Foods and Medicine (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Environmentally-Compatible Food Packaging (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Handbook of Food Proteins (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Meat Products Handbook: Practical Science and Technology (Woodhead Publishing in Food Science, Technology and Nutrition)

Developing Children's Food Products (Woodhead Publishing Series in Food Science, Technology and Nutrition - Volume 204)

Reducing Saturated Fats in Foods (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Handbook of Indices of Food Quality and Authenticity (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Encapsulation and Controlled Release (Woodhead Publishing Series in Food Science, Technology and Nutrition)

Recommend Documents