This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
l! .s
bll
0
'--"
-1
/
1 Hemoglobin � "' "'' high-affinity state � / "'
2
nH
=1
/
/
,
,/
// //� Hemoglobin /
_ _ _ _ _ _ _ _ _ ,_ _ _ _ / /
1
,'
I I
-2
I
1
/
low-affinity state = llH 1
-3 �----�---L--� -2 -1 2 0 3 log p02
globin. When nH
FIGURE 5-14 Hill plots for oxygen binding to myoglobin and hemo
= 1 , there is no evident cooperativity. The max i m u m
degree o f cooperativity observed for hemoglob i n corresponds approxi
mately to n H
= 3. Note that wh i l e this indicates a high level of cooper
ativity, nH is less than
n,
the number of Orbinding sites in hemoglobin.
This is normal for a protein that exhibits al losteric binding behavior.
Hill plots for myoglobin and hemoglobin are given in Figure 5-14. Two Models Suggest Mechanisms for Cooperative Binding
Biochemists now know a great deal about the T and R states of hemoglobin, but much remains to be learned about how the T � R transition occurs. Two models for the cooperative binding of ligands to proteins with mul tiple binding sites have greatly influenced thinking about this problem. The first model was proposed by Jacques Monod, Jeffries Wyman, and Jean-Pierre Changeux in 1965, and is called the MWC model or the concerted model (Fig. 5-15a). The concerted model assumes that the Ait O
rn 1�
ffi 1�
ffi 1�
� 1�
�L
AII D ..,.---
--->.
........----
--->.
........----
--->.
........----
�
........----
_,
(a)
EE 1�
rgj 1l
ffi 1� ItiLl 1�
tElEL
Reversible Binding of a Protein to a Ligand: Oxygen-Binding Proteins
subunits of a cooperatively binding protein are function ally identical, that each subunit can exist in (at least) two conformations, and that all subunits undergo the transi tion from one conformation to the other simultaneously. In this model, no protein has individual subunits in dif ferent conformations. The two conformations are in equilibrium. The ligand can bind to either conformation, but binds each with different affinity. Successive binding of ligand molecules to the low-affinity conformation (which is more stable in the absence of ligand) makes a transition to the high-affinity conformation more likely. In the second model, the sequential model (Fig. 5-1 5b) , proposed in 1966 by Daniel Koshland and colleagues, ligand binding can induce a change of con formation in an individual subunit. A conformational change in one subunit makes a similar change in an adjacent subunit, as well as the binding of a second lig and molecule, more likely. There are more potential intermediate states in this model than in the concerted model. The two models are not mutually exclusive; the concerted model may be viewed as the "all-or-none" lim iting case of the sequential model. In Chapter 6 we use these models to investigate allosteric enzymes. Hemoglobin Also Transports H
(b)
+
and C02
In addition to carrying nearly all the oxygen required by cells from the lungs to the tissues, hemoglobin carries two end products of cellular respiration-H + and C02from the tissues to the lungs and the kidneys, where they are excreted. The C02, produced by oxidation of organic fuels in mitochondria, is hydrated to form bicar bonate: C02 + H20 � H +
+ HC03
This reaction is catalyzed by carbonic anhydrase, an enzyme particularly abundant in erythrocytes. Carbon dioxide is not very soluble in aqueous solution, and bub bles of C02 would form in the tissues and blood if it were not converted to bicarbonate. As you can see from the
rn � rn � rn � EE � EE 1� ' 1� 1� 1l 1l ffi � m � � �� � rgj 1l 1l ' 1� 1l 1l ffi � � � � � ffi � ffi 1l 1l 1l ' 1� 1� �� �m L � .._.--- � L � .._.--- m L .._.--L � .._.--1� 1� 1l 1� ' 1� � .._.--� tBE �� L L .._.--L L � tEfE LL � .._.--- m LL .._.---
[165]
FIGURE S-15 Two general models for the interconversion of inactive and active forms o f a protein during cooperative ligand binding. Although t h e models
may be appl ied to any prote i n-i n c l u d i n g any enzyme (Chapter 6)-that exh i b its cooperative bindi ng, w e show here fou r subun its because t h e model was originally proposed for hemoglobin. (a) In the concerted, or ali-or-none, model (MWC model), a l l subeither all 0 (low affinity or i nactive) or all D (h igh
u n its are postu lated t o b e i n the same conformation,
affi n ity or active). Depend ing on the equ i l ibrium, K, ,
between 0 and D forms, the b i nd i ng of one or more l igand molecules (L) w i l l p u l l the equ i l i brium toward
the D form. Subun its with bound L are shaded. (b) I n
in either the 0 or D form. A very large n u mber of
the sequential model, each i nd ividual subu n i t can be conformations is thus possible.
. 1 66
�-- -1 '-
-'
Protein Function
reaction catalyzed by carbonic anhydrase, the hydration + of C02 results in an increase in the H concentration (a decrease in pH) in the tissues. The binding of oxygen by hemoglobin is profoundly influenced by pH and C02 concentration , so the interconversion of C02 and bicar bonate is of great importance to the regulation of oxygen binding and release in the blood. Hemoglobin transports about 40% of the total H and
+
1 5% to 20% of the C02 formed in the tissues to
the lungs and kidneys. (The remainder of the H
+
is ab
sorbed by the plasma's bicarbonate buffer; the remain der of the C02 is transported as dissolved HC03 and + C02.) The binding of H and C02 is inversely related to the binding of oxygen. At the relatively low pH and high C02 concentration of peripheral tissues, the + affinity of hemoglobin for oxygen decreases as H and C02 are bound, and 02 is released to the tissues. Con versely, in the capillaries of the lung, as C02 is ex creted and the blood pH consequently rises, the affinity of hemoglobin for oxygen increases and the protein binds more 02 for transport to the peripheral tissues. This effect of pH and C02 concentration on the binding and release of oxygen by hemoglobin is called the
Bohr effect, after Christian Bohr, the Dan
ish physiologist (and father of physicist Niels Bohr) who discovered it in 1 904. The binding equilibrium for hemoglobin and one molecule of oxygen can be designated by the reaction
Hb + 02 � Hb02
p02 (kPa) FIGURE 5-16 Effect of pH on oxygen binding to hemoglobin. The pH of blood is 7 . 6 i n the lu ngs and 7.2 i n the tissues. Experimental mea surements on hemoglobi n bi nding are often performed at pH 7.4.
rises, protonation of His HC3 promotes release of oxygen by favoring a transition to the T state. Proto nation o f the amino-terminal residues of the a sub units, certain other His residues, and perhaps other groups has a similar effect. Thus we see that the four polypeptide chains of he moglobin communicate with each other not only about + 02 binding to their heme groups but also about H bind ing to specific amino acid residues. And there is still
but this is not a complete statement. To account for the + effect of H concentration on this binding equilibrium, we rewrite the reaction as
more to the story. Hemoglobin also binds C02, again in a manner inversely related to the binding of oxygen. Car bon dioxide binds as a carbamate group to the a-amino group at the amino-terminal end of each globin chain,
HHb + + 02 � Hb02 + H +
forming carbaminohemoglobin:
+ where HHb denotes a protonated form of hemoglobin. This equation tells us that the 02-saturation curve of hemo + globin is influenced by the H concentration (Fig. 5-16). + Both 02 and H are bound by hemoglobin, but with inverse affinity. When the oxygen concentration is high, as in the lungs, hemoglobin binds 02 and releases protons. When
H 0 II I C + H2N-C-CII I II 0 R 0 Amino-terminal residue
H H 0"I I C-N-C-C-
11
I
II
R 0 0 Carbamino-terminal residue
the oxygen concentration is low, as in the peripheral tis + sues, H is bound and 02 is released. + Oxygen and H are not bound at the same sites in
+ This reaction produces H , contributing to the Bohr ef
heroes, whereas H
hemoglobin. Oxygen binds to the iron atoms of the + binds to any of several amino acid
bridges (not shown in Fig.
residues in the protein. A major contribution to the 1 46 Bohr effect is made by His (His HC3) of the {3 sub
T state and promote the release of oxygen.
units. When protonated, this residue forms one of the 94 (Asp FG I ) -that helps stabilize ion pairs-to Asp
fect. The bound carbamates also form additional salt
5-9) that help to stabilize the
When the concentration of carbon dioxide is high, as in peripheral tissues, some C02 binds to hemoglobin and the affinity for 02 decreases, causing its release.
5-9) . The ion
Conversely, when hemoglobin reaches the lungs, the
pair stabilizes the protonated form of His HC3, giving
high oxygen concentration promotes binding of 02 and
deoxyhemoglobin in the T state (Fig.
this residue an abnormally high pKa in the T state.
release of C02. It is the capacity to communicate ligand
R state
binding information from one polypeptide subunit to the
The pKa falls to its normal value of 6 . 0 in the
because the ion pair cannot form, and this residue is
others that makes the hemoglobin molecule so beauti
largely unprotonated in oxyhemoglobin at pH 7.6, the + blood pH in the lungs. As the concentration of H
fully adapted to integrating the transport of 02, C02, + and H by erythrocytes.
5.1
Reversible Binding of a Protein to a ligand: Oxygen-Binding Proteins
Oxygen Binding to Hemoglobin Is Regulated
p02 in lungs p02 in tissues (4,500 m)
by 2,3-Bisphosphoglycerate
The interaction of 2,3-bisphosphoglycerate (BPG) with hemoglobin molecules further refines the function of hemoglobin, and provides an example of heterotropic allosteric modulation. -o
o '\._ f' c I
(sea level)
•
38%
II I
H-C-H o-
1
•
p02 in lungs
0
H-C-0-P- o-
1
LO
•
l167]
0
0.5
0
I
-0-P= O
I
o-
2,3-Bisphosphoglycerate
0
16
� ---� -----L� �-L---
4
8
12
BPG is present in relatively high concentrations in ery throcytes. When hemoglobin is isolated, it contains substantial amounts of bound BPG, which can be diffi cult to remove completely. In fact, the 02-binding curves for hemoglobin that we have examined to this point were obtained in the presence of bound BPG. 2 ,3-Bis phosphoglycerate is known to greatly reduce the affinity of hemoglobin for oxygen-there is an inverse relation ship between the binding of 02 and the binding of BPG. We can therefore describe another binding process for hemoglobin:
sea level, hemoglobin is nearly satu rated with 02 in the l u ngs, but just
HbBPG + 02 � Hb02 + BPG
tissues is about 38% of the maxi m u m that can be carried in the blood.
BPG binds at a site distant from the oxygen-binding site and regulates the 02-binding affinity of hemoglobin in relation to the p02 in the lungs. BPG is important in the physiological adaptation to the lower p02 at high al titudes. For a healthy human at sea level, the binding of 02 to hemoglobin is regulated such that the amount of 02 delivered to the tissues is nearly 40% of the maxi mum that could be carried by the blood (Fig. !}- 1 7 ) . Imagine that this person is suddenly transported from sea level to an altitude of 4,500 meters, where the p02 is considerably lower. The delivery of 02 to the tissues is now reduced. However, after just a few hours at the higher altitude, the BPG concentration in the blood has begun to rise, leading to a decrease in the affinity of he moglobin for oxygen. This adjustment in the BPG level has only a small effect on the binding of 02 in the lungs but a considerable effect on the release of 02 in the tis sues. As a result, the delivery of oxygen to the tissues is restored to nearly 40% of the 02 that can be trans ported by the blood. The situation is reversed when the person returns to sea level. The BPG concentration in erythrocytes also increases in people suffering from hy poxia, lowered oxygenation of peripheral tissues due to inadequate functioning of the lungs or circulatory system.
p02 (kPa)
F I G U R E 5-1 7 Effect of BPG on oxygen binding to hemoglobin. The
B PG concentration in normal h u man blood is about 5 mM at sea level and about 8 mM at h i gh a l titudes . Note that hemoglobin binds to oxygen quite tightly when BPG is entirely absent, and the binding curve seems to be hyperbolic. In rea l ity, the measured H i l l coeffi cient for 02-binding cooperativity decreases only sl ightly (from 3 to about 2 .5 ) when B PG is removed from hemoglobin, but the rising part of the sigmoid cu rve is confined to a very sma l l region close to the ori gin. At over 60% satu rated i n the tissues, so the amount of 02 released i n the At h igh altitudes, 02 del ivery declines by about one-fourth, to 30% of maxi m u m . An increase in B PG concentration, however, decreases the affinity of hemoglobin for 02, so approximately 3 7% of what can be carried is aga i n del ivered to the tissues.
The site of BPG binding to hemoglobin is the cavity between the {3 subunits in the T state (Fig. 5-1 8 ). This cavity is lined with positively charged amino acid residues that interact with the negatively charged groups of BPG. Unlike 02, only one molecule of BPG is bound to each hemoglobin tetramer. BPG lowers hemo globin's affinity for oxygen by stabilizing the T state. The transition to the R state narrows the binding pocket for BPG, precluding BPG binding. In the absence of BPG, hemoglobin is converted to the R state more easily. Regulation of oxygen binding to hemoglobin by BPG has an important role in fetal development. Because a fetus must extract oxygen from its mother's blood, fetal hemoglobin must have greater affinity than the maternal hemoglobin for 02. The fetus synthesizes 'Y subunits rather than {3 subunits, forming a 2 y2 hemoglobin. This tetramer has a much lower affinity for BPG than normal adult hemoglobin, and a correspondingly higher affinity for 02. I Oxygen-Binding Proteins - Hemoglobin Is Susceptible to Allosteric Regulation
L1 68J Protei n Function
(a) FIGURE 5-1 8 Binding of BPG to deoxyhemoglobin. (a) BPG binding stabi l i zes the T state of deoxyhemoglobin (PDB I D 1 H GA), shown here as a mesh su rface i mage. (b) The negative charges of BPG i n teract with several positively charged groups (shown in blue in this su rface
Sickle-Cell Anemia Is a Molecular Disease of H emoglobin The hereditary human disease sickle-cell anemia demonstrates strikingly the importance of amino acid sequence in determining the secondary, tertiary, and quaternary structures of globular proteins, and thus their biological functions. Almost 500 genetic variants of hemoglobin are known to occur in the human population; all but a few are quite rare. Most variations consist of dif ferences in a single amino acid residue. The effects on he moglobin structure and function are often minor but can sometimes be extraordinary. Each hemoglobin variation is the product of an altered gene. The variant genes are called alleles. Because humans generally have two copies of each gene, an individual may have two copies of one al lele (thus being homozygous for that gene) or one copy of each of two different alleles (thus heterozygous). Sickle-cell anemia occurs in individuals who inherit the allele for sickle-cell hemoglobin from both parents. The erythrocytes of these individuals are fewer and also abnormal. In addition to an unusually large number of immature cells, the blood contains many long, thin, sickle shaped erythrocytes (Fig. 5-19). When hemoglobin from sickle cells (called hemoglobin S) is deoxygenated, it be comes insoluble and forms polymers that aggregate into tubular fibers (Fig. 5-20). Normal hemoglobin (hemoglo bin A) remains soluble on deoxygenation. The insoluble fibers of deoxygenated hemoglobin S cause the deformed, sickle shape of the erythrocytes, and the proportion of sickled cells increases greatly as blood is deoxygenated. The altered properties of hemoglobin S result from a single amino acid substitution, a Val instead of a Glu residue at position 6 in the two f3 chains . The R group of valine has no electric charge, whereas glutamate has a negative charge at pH 7.4. Hemoglobin S therefore has two fewer negative charges than hemoglobin A (one fewer on each f3 chain) . Replacement of the Glu residue by Val creates a "sticky" hydrophobic contact point at position 6 of the f3 chain, which is on the outer surface of
(b)
contour i mage) that surround the pocket between the {3 subunits i n the fol l owing transition to the R state (PDB ID 1 B B B ) . (Compare (b) and T state. (c) The binding pocket for B PG d isappears on oxygenation,
(c) with Fig. 5-1 0.)
the molecule. These sticky spots cause deoxyhemoglo bin S molecules to associate abnormally with each other, forming the long, fibrous aggregates characteristic of this disorder. I Oxygen-Binding Proteins - Defects in Hb lead to Serious Genetic Disease
Sickle-cell anemia, as we have noted, occurs in indi viduals homozygous for the sickle-cell allele of the gene encoding the f3 subunit of hemoglobin. Individuals who re ceive the sickle-cell allele from only one parent and are thus heterozygous experience a milder condition called sickle-cell trait; only about 1% of their erythrocytes be come sickled on deoxygenation. These individuals may live completely normal lives if they avoid vigorous exercise and other stresses on the circulatory system. Sickle-cell anemia is life-threatening and painful. Peo ple with this disease suffer repeated crises brought on by physical exertion. They become weak, dizzy, and short of breath, and they also experience heart murmurs and an in creased pulse rate. The hemoglobin content of their blood is only about half the normal value of 15 to 16 g/100 mL,
(b) FIGURE 5-19 A comparison of (a) uniform, cup-shaped, normal ery th rocytes with (b) the variably shaped erythrocytes seen in sickle-cell anemia, wh ich range from normal to spiny or sickle-shaped.
5.1
Hemoglobin A
Hemoglobin S
Reversible Binding of a Protein to a Ligand: Oxygen-Binding Proteins
[169]
ally high in certain parts of Africa. Investigation into this matter led to the finding that in heterozygous individu als, the allele confers a small but significant resistance to lethal forms of malaria. Natural selection has resulted in an allele population that balances the deleterious effects of the homozygous condition against the resistance to malaria afforded by the heterozygous condition. •
S U M M A RY 5 . 1
Reversi b l e Bindin g of a Protein to a lig a n d : Oxygen - Bi n d i n g Protein s
(a) •
•
Interaction between molecules
1 Strand formation
•
1 Alignment and crystallization (fiber formation)
•
(b) FIGURE 5-20 Normal and sickle-cell hemoglobin. (a) Subtle differences between the conformations of hemoglobin A and hemoglobin S result from a single amino acid change in the {3 chains. (b) As a result of this change, deoxyhemoglobin S has a hydrophobic patch on its surface, which causes the molecules to aggregate into strands that al ign into insoluble fibers. •
because sickled cells are very fragile and rupture easily; this results in anemia ("lack of blood") . An even more se rious consequence is that capillaries become blocked by the long, abnormally shaped cells, causing severe pain and interfering with normal organ function-a major fac tor in the early death of many people with the disease. Without medical treatment, people with sickle-cell anemia usually die in childhood. Curiously, the fre quency of the sickle-cell allele in populations is unusu-
•
Protein function often entails interactions with other molecules . A protein binds a molecule, known as a ligand, at its binding site. Proteins may undergo conformational changes when a ligand binds, a process called induced fit. In a multisubunit protein, the binding of a ligand to one subunit may affect ligand binding to other subunits. Ligand binding can be regulated. Myoglobin contains a heme prosthetic group, which binds oxygen. Heme consists of a single atom of Fe2 + coordinated within a porphyrin. Oxygen binds to myoglobin reversibly; this simple reversible binding can be described by an association constant Ka or a dissociation constant Kct· For a monomeric protein such as myoglobin, the fraction of binding sites occupied by a ligand is a hyperbolic function of ligand concentration. Normal adult hemoglobin has four heme-containing subunits, two a and two {3, similar in structure to each other and to myoglobin. Hemoglobin exists in two interchangeable structural states, T and R. The T state is most stable when oxygen is not bound. Oxygen binding promotes transition to the R state. Oxygen binding to hemoglobin is both allosteric and cooperative. As 02 binds to one binding site, the hemoglobin undergoes conformational changes that affect the other binding sites-an example of allosteric behavior. Conformational changes between the T and R states, mediated by subunit-subunit interactions, result in cooperative binding; this is described by a sigmoid binding curve and can be analyzed by a Hill plot. Two major models have been proposed to explain the cooperative binding of ligands to multisubunit proteins: the concerted model and the sequential model. Hemoglobin also binds H + and C02, resulting in the formation of ion pairs that stabilize the T state and lessen the protein's affinity for 02 (the Bohr effect) . Oxygen binding to hemoglobin is also modulated by 2 ,3-bisphosphoglycerate, which binds to and stabilizes the T state.
-
'
L1 70j •
Protein Fu nction
Sickle-cell anemia is a genetic disease caused by a single amino acid substitution (Glu6 to Val6) in each f3 chain of hemoglobin. The change produces a hydrophobic patch on the surface of the hemoglobin that causes the molecules to aggregate into bundles of fibers . This homozygous condition results in serious medical complications .
5 .2 Com plementary I nteractions between
Proteins and ligands: The I m m une System and I mm unogl obulins We have seen how the conformations of oxygen-binding proteins affect and are affected by the binding of small ligands (02 or CO) to the heme group. However, most protein-ligand interactions do not involve a prosthetic group. Instead, the binding site for a ligand is more often like the hemoglobin binding site for BPG-a cleft in the protein lined with amino acid residues, arranged to make the binding interaction highly specific. Effective discrim ination between ligands is the norm at binding sites, even when the ligands have only minor structural differences. All vertebrates have an immune system capable of distinguishing molecular "self" from "nonself" and then destroying what is identified as nonself. In this way, the immune system eliminates viruses, bacteria, and other pathogens and molecules that may pose a threat to the organism. On a physiological level, the immune re sponse is an intricate and coordinated set of interactions among many classes of proteins, molecules , and cell types. At the level of individual proteins, the immune re sponse demonstrates how an acutely sensitive and spe cific biochemical system is built upon the reversible binding of ligands to proteins.
viruses, or large molecules identified as foreign and target them for destruction. Making up 20% of blood protein, the immunoglobulins are produced by B lymphocytes, or B cells, so named because they complete their devel opment in the bone marrow. The agents at the heart of the cellular immune re sponse are a class of T lymphocytes, or T cells (so called because the latter stages of their development occur in the thymus) , known as cytotoxic T cells (Tc cells also called killer T cells) . Recognition of infected cells �r parasites involves proteins called T-cell recep tors on the surface of Tc cells. Receptors are proteins, usually found on the outer surface of cells and extend ing through the plasma membrane; they recognize and bind extracellular ligands, triggering changes inside the cell. In addition to cytotoxic T cells, there are helper T cells ( TH cells) , whose function it is to produce solu ble signaling proteins called cytokines, which include the interleukins. TH cells interact with macrophages. The TH cells participate only indirectly in the destruc tion of infected cells and pathogens , stimulating the selective proliferation of those Tc and B cells that can bind to a particular antigen. This process, called clonal selection, increases the number of immune system cells that can respond to a particular pathogen. The im portance of TH cells is dramatically illustrated by the epidemic produced by HIV (human immunodeficiency virus) , the virus that causes AIDS (acquired immune deficiency syndrome) . The primary targets of HIV infection are TH cells. Elimination of these cells pro gressively incapacitates the entire immune system. Table 5-2 summarizes the functions of some leukocytes of the immune system. Each recognition protein of the immune system, ei ther a T-cell receptor or an antibody produced by a B cell, specifically binds some particular chemical structure,
The Immune Response Features a S pecialized Array of Cells and Proteins Immunity is brought about by a variety of leukocytes (white blood cells) , including macrophages and lym phocytes, all of which develop from undifferentiated stem cells in the bone marrow. Leukocytes can leave the bloodstream and patrol the tissues, each cell producing one or more proteins capable of recognizing and binding to molecules that might signal an infection. The immune response consists of two complemen tary systems, the humoral and cellular immune systems. The humoral immune system (Latin humor, "fluid") is directed at bacterial infections and extracellular viruses (those found in the body fluids) , but can also respond to individual foreign proteins. The cellular immune system destroys host cells infected by viruses and also destroys some parasites and foreign tissues. At the heart of the humoral immune response are sol uble proteins called antibodies or immunoglobulins, often abbreviated Ig. Immunoglobulins bind bacteria,
TA B L E 5 -2
Some Types of Leukocytes Associated with the Immune System
Cell type
Function
Macrophages
Ingest large particles and cells by phagocytosis
B lymphocytes (B cells)
Produce and secrete antibodies
T lymphocytes (T cells)
Cytotoxic (killer) T cells (Tc)
Interact with infected host cells through receptors on T-cell surface
Helper T cells (TH)
Interact with macrophages and secrete cytokines (interleukins) that stimulate Tc, TH. and B cells to proliferate.
5.2 Com plementary Interactions between Proteins and ligands: The Immune System and I m munoglobulins
[171]
distinguishing it from virtually all others. Humans are
These small molecules are called
capable of producing more than
ies produced in response to protein-linked haptens
1 08 different antibodies
haptens.
The antibod
will
with distinct binding specificities. Given this extraordi
then bind to the same small molecules in their free form.
nary diversity, any chemical structure on the surface of
Such antibodies are sometimes used in the development
a virus or invading cell will most likely be recognized and
of analytical tests described later in this chapter or as
bound by one or more antibodies. Antibody diversity is
catalytic antibodies (see Box
derived from random reassembly of a set of im
more detailed description of antibodies and their binding
munoglobulin gene segments through genetic recombi
properties.
nation mechanisms that are discussed in Chapter (see Fig.
6-3) . We now turn to a
25
25-26) .
A specialized lexicon is used to describe the unique
Antibodies Have Two Identical Antigen-Binding Sites
interactions between antibodies or T-cell receptors and
Immunoglobulin G (IgG)
the molecules they bind. Any molecule or pathogen
body molecule and one of the most abundant proteins in
capable of eliciting an immune response is called an
the blood serum. IgG has four polypeptide chains: two
antigen. An antigen may be a virus, a bacterial
large ones, called heavy chains, and two light chains,
cell wall,
is the major class of anti
or an individual protein or other macromolecule. A com
linked by noncovalent and disulfide bonds into a com
plex antigen may be bound by several different antibod
plex of Mr
ies. An individual antibody or T-cell receptor binds only
interact at one end, then branch to interact separately
a particular molecular structure within the antigen,
with the light chains, forming a Y-shaped molecule
called its
(Fig.
antigenic determinant or epitope.
1 50,000. The heavy chains of an IgG molecule
5 -2 1 ) . At the "hinges" separating the base of an
It would be unproductive for the immune system to
IgG molecule from its branches, the immunoglobulin can
respond to small molecules that are common intermedi
be cleaved with proteases. Cleavage with the protease
ates and products of cellular metabolism. Molecules of Mr
papain liberates the basal fragment, called Fe because it
a Let's examine two imaginary enzymes-two "stickases"-that could catalyze this re action, both of which employ magnetic forces as a para digm for the binding energy used by real enzymes_ We first design an enzyme perfectly complementary to the substrate (Fig_ 6-5b) _ The active site of this stickase is a pocket lined with magnets_ To react (break) , the stick must reach the transition state of the reaction, but the stick fits so tightly in the active site that it cannot bend, because bending would eliminate some of the magnetic interactions between stick and enzyme_ Such an enzyme impedes the reaction, stabilizing the substrate instead_ In a reaction coordinate diagram (Fig. 6-5b) , this kind of ES complex would correspond to an energy trough from which the substrate would have difficulty escaping_ Such an enzyme would be useless. The modern notion of enzymatic catalysis, first pro posed by Michael Polanyi ( 1 921) and Haldane ( 1 930) , _
(a) No enzyme
0
·)
------+
Substrate (metal stick)
6/'\
------+
Transition state (bent stick)
was elaborated by Linus Pauling in 1 946: in order to cat alyze reactions, an enzyme must be complementary to the reaction transition state. This means that optimal interactions between substrate and enzyme occur only in the transition state_ Figure 6-5c demonstrates how such an enzyme can work. The metal stick binds to the stick ase, but only a subset of the possible magnetic interac tions are used in forming the ES complex_ The bound substrate must still undergo the increase in free energy needed to reach the transition state. Now, however, the increase in free energy required to draw the stick into a bent and partially broken conformation is offset, or "paid for," by the magnetic interactions (binding energy) that form between the enzyme and substrate in the transition state_ Many of these interactions involve parts of the stick that are distant from the point of breakage; thus in teractions between the stickase and nonreacting parts of the stick provide some of the energy needed to catalyze stick breakage. This "energy payment" translates into a lower net activation energy and a faster reaction rate.
c.?
5] ""
"' "' "' "' "" '"'
.;,;' ; !i; '
(!� ; '-�
*
>::
Products (broken stick)
(b) Enzyme complementary to substrate
�cfoc.�r�--
Magnets
1-
.ES
---
.__!��-
(c) Enzyme complementary to transition state ---> +
breakage of a metal stick. (a) Before the stick is broken, it must first
F I G U R E 6-5 An imaginary enzyme (stickase) designed to catalyze be bent (the transition state). In both stickase examples, magnetic i n
E
Reaction coordinate
i nteract ions compensates for the increase i n free energy req u i red to bend the stick. Reaction coordinate d iagrams (right) show the energy consequences of complementarity to su bstrate versus comp lementar
teractions take t h e p l ace o f weak bond i ng i nteractions between e n
ity to transition state (EP complexes are omitted). Ll.CM, the d i fference
zyme and substrate. (b) A stickase w ith a magnet- l i ned pocket
between the transition-state energies of the uncatalyzed and cat
complementary in structure to the stick (the su bstrate) stabi l i zes the
a l yzed reactions, is contributed by the magnetic i n teract ions be
substrate_ Bend ing is i m peded by the magnetic attraction between
tween the stick and stickase. When the enzyme is complementary to
stick and stickase. (c) An enzyme with a pocket compl ementary to
the substrate (b), the ES complex is more stable and has less free en
the reaction transition state helps to destabi l ize the stick, contributing to catalysis of the reaction . The b i n d i ng energy of the magnetic
ergy in the ground state than su bstrate alone. The result is an increase in the activation energy.
6.2 How Enzymes Work
�
J. G*
---- --�-J - -
-
-
- - - -- - --
,. _ _
p
-
�Ga
J.G
Reaction coordinate FIGURE 6-6 Role of binding energy in catalysis. To lower the activation energy for a reaction, the system must acquire an amount of energy equivalent to the amount by which llC* is lowered. Much of th i s energy comes from binding energy (LlCB) contri buted by formation of weak noncovalent i nteractions between substrate and enzyme in the transi tion state. The role of llCB is ana logous to that of llCM i n Figure 6-5 .
Real enzymes work on an analogous principle. Some weak interactions are formed in the ES complex, but the full complement of such interactions between substrate and enzyme is formed only when the substrate reaches the transition state. The free energy (binding energy) re leased by the formation of these interactions partially off sets the energy required to reach the top of the energy hill . The summation of the unfavorable (positive) activa tion energy LlG1 and the favorable (negative) binding en ergy LlGB results in a lower net activation energy (Fig. 6-6) . Even on the enzyme, the transition state is not a sta ble species but a brief point in time that the substrate spends atop an energy hill. The enzyme-catalyzed reac tion is much faster than the uncatalyzed process, however, because the hill is much smaller. The important principle is that weak binding interactions between the enzyme and the substrate provide a substantial driving force for enzymatic catalysis. The groups on the substrate that are involved in these weak interactions can be at some distance from the bonds that are broken or changed. The weak interactions formed only in the transition state are those that make the primary contribution to catalysis. The requirement for multiple weak interactions to drive catalysis is one reason why enzymes (and some coenzymes) are so large An enzyme must provide func tional groups for ionic, hydrogen-bond, and other inter actions, and also must precisely position these groups so that binding energy is optimized in the transition state. Adequate binding is accomplished most readily by positioning a substrate in a cavity (the active site) where it is effectively removed from water. The size of proteins reflects the need for superstructure to keep interacting groups properly positioned and to keep the cavity from collapsing. Binding Energy Contri butes to Reaction S pecificity and Catalysis Can we demonstrate quantitatively that binding energy accounts for the huge rate accelerations brought about
[191]
by enzymes? Yes . As a point of reference, E quation 6-6 allows us to calculate that LlG + must be lowered by about 5. 7 kJ/mol to accelerate a first-order reaction by a factor of ten, under conditions commonly found in cells. The energy available from formation of a single weak in teraction is generally estimated to be 4 to 30 kJ/mol. The overall energy available from a number of such interac tions is therefore sufficient to lower activation energies by the 60 to 1 00 kJ/mol required to explain the large rate enhancements observed for many enzymes. The same binding energy that provides energy for catalysis also gives an enzyme its specificity, the ability to discriminate between a substrate and a competing molecule. Conceptually, specificity is easy to distinguish from catalysis, but this distinction is much more difficult to make experimentally, because catalysis and specificity arise from the same phenomenon. If an enzyme active site has functional groups arranged optimally to form a vari ety of weak interactions with a particular substrate in the transition state, the enzyme will not be able to interact to the same degree with any other molecule. For example, if the substrate has a hydroxyl group that forms a hydrogen bond with a specific Glu residue on the enzyme, any mol ecule lacking a hydroxyl group at that particular position will be a poorer substrate for the enzyme. In addition, any molecule with an extra functional group for which the en zyme has no pocket or binding site is likely to be excluded from the enzyme. In general, specificity is derived from the formation of many weak interactions between the en zyme and its specific substrate molecule. The importance of binding energy to catalysis can be readily demonstrated. For example, the glycolytic enzyme triose phosphate isomerase catalyzes the inter conversion of glyceraldehyde 3-phosphate and dihy droxyacetone phosphate: 1
HC =O 21 HC -OH I
3CH20PO�-
Glyceraldehyde 3-phosphate
triose
phosphate isomerase
Dihydroxyacetone phosphate
This reaction rearranges the carbonyl and hy droxyl groups on carbons 1 and 2. However, more than 80% of the enzymatic rate acceleration has been traced to enzyme-substrate interactions involving the phos phate group on carbon 3 of the substrate. This was de termined by comparing the enzyme-catalyzed reactions with glyceraldehyde 3-phosphate and with glyceralde hyde (no phosphate group at position 3) as substrate. The general principles outlined above can be illus trated by a variety of recognized catalytic mechanisms. These mechanisms are not mutually exclusive, and a given enzyme might incorporate several types in its overall mechanism of action. Consider what needs to occur .for a reaction to take place. Prominent physical and thermodynamic factors contributing to LlG+ , the barrier to reaction, might include:
[192]
Enzymes
(1) the entropy (freedom of motion) of molecules in so lution, which reduces the possibility that they will react together; (2) the solvation shell of hydrogen-bonded wa ter that surrounds and helps to stabilize most biomole cules in aqueous solution; (3) the distortion of substrates that must occur in many reactions; and (4) the need for proper alignment of catalytic functional groups on the en zyme. Binding energy can be used to overcome all these barriers. First, a large restriction in the relative motions of two substrates that are to react, or entropy reduction, is one obvious benefit of binding them to an enzyme. Binding energy holds the substrates in the proper orien tation to react-a substantial contribution to catalysis, because productive collisions between molecules in solu tion can be exceedingly rare. Substrates can be precisely aligned on the enzyme, with many weak interactions be tween each substrate and strategically located groups on the enzyme clamping the substrate molecules into the proper positions. Studies have shown that constraining Reaction
Rate
0
(a)
enhancement
II CH3-C-OR +
k
0
II CHs-c-o-
-oR
tM
(b) 0 II C-OR
(
0
II c
h
(c)
f
0
\
Specific Catalytic Groups Contribute to Catalysis
C>
c-o II 0
1
1s 1 1
c II
0
0
105 M
II C-OR
�c-o -
FIGURE 6-7 Rate enhancement by entropy reduction. Shown here are reactions of an ester with a carboxylate group to form an anhydride. The R group is the same in each case. (a) For this bimolecular reaction, the k is second order, with un its of M - 1 s - 1 . (b) When the two
rate constant
reacting groups are i n a single molecule, and thus have l ess freedom of motion, the reaction is much faster. For th is unimolecular reaction, k has un its of s - 1 • Dividing the rate constant for (b) by the rate constant for (a)
gives a rate enhancement of about 1 05 M. (The enhancement has un its of molarity because we are comparing a unimolecular and a bimolecular centration of 1 M, the reacting groups would behave as though they were reaction.) Put another way, if the reactant in (b) were present at a con
present at a concentration of 1 05 M. Note that the reactant in (b) has free dom of rotation about three bonds (shown with curved arrows), but this
sti II represents a substantial reduction of entropy over (a). If the bonds that rotate in (b) are constrained as in (c), the entropy is reduced further and the reaction exhibits a rate enhancement of
the motion of two reactants can produce rate enhance ments of many orders of magnitude (Fig. 6-7). Second, formation of weak bonds between substrate and enzyme results in desolvation of the substrate. En zyme-substrate interactions replace most or all of the hy drogen bonds between the substrate and water. Third, binding energy involving weak interactions formed only in the reaction transition state helps to compensate ther modynamically for any distortion, primarily electron re distribution, that the substrate must undergo to react. Finally, the enzyme itself usually undergoes a change in conformation when the substrate binds, induced by multiple weak interactions with the sub strate. This is referred to as induced fit, a mechanism postulated by Daniel Koshland in 1 958. The motions can affect a small part of the enzyme near the active site, or can involve changes in the positioning of entire domains . Typically, a network o f coupled motions occurs through out the enzyme that ultimately brings about the re quired changes in the active site. Induced fit serves to bring specific functional groups on the enzyme into the proper position to catalyze the reaction. The conforma tional change also permits formation of additional weak bonding interactions in the transition state. In either case, the new enzyme conformation has enhanced cat alytic properties. As we have seen, induced fit is a com mon feature of the reversible binding of ligands to proteins (Chapter 5) . Induced fit is also important in the interaction of almost every enzyme with its substrate.
1 06 M relative to
(a).
In most enzymes, the binding energy used to form the ES complex is just one of several contributors to the overall catalytic mechanism. Once a substrate is bound to an en zyme, properly positioned catalytic functional groups aid in the cleavage and formation of bonds by a variety of mechanisms, including general acid-base catalysis, cova lent catalysis, and metal ion catalysis. These are distinct from mechanisms based on binding energy, because they generally involve transient covalent interaction with a substrate or group transfer to or from a substrate. General Acid-Base Catalysis Many biochemical re actions involve the formation of unstable charged inter mediates that tend to break down rapidly to their constituent reactant species, thus impeding the reaction (Fig. 6-8). Charged intermediates can often be stabi lized by the transfer of protons to or from the substrate or intermediate to form a species that breaks down more readily to products. For nonenzymatic reactions, the proton transfers can involve either the constituents of water alone or other weak proton donors or acceptors. Catalysis of the type that uses only the H + (H30 + ) or OH- ions present in water is referred to as specific acid-base catalysis. If protons are transferred between the intermediate and water faster than the intermediate breaks down to reactants, the intermediate is effectively stabilized every time it forms. No additional catalysis
[193J
6.2 How Enzymes Work
Reactant species Without catalysis, unstable (charged) intermediate breaks down rapidly to form reactants.
Rl
I
ll
H
R2
+
General acid form
General base form
residues
(proton donor)
(proton acceptor)
Glu, Asp
R-COOH
R- coo -
Ra
I
Cys
I
N-H
�4
His
B: , A
Ser BH K +
HOH When proton transfer to or from H20 is faster than the rate of breakdown of intermediates, the presence of other proton donors or acceptors does not increase the rate of the reaction.
Rl Ra I I H-C-0-C=O +
�2
H ....± R NH H
Lys, Arg
H-C-O-c-o-
1
Amino acid
When proton transfer to or from H20 is slower than the rate of breakdown of intermediates, only a fraction of the intermediates formed are stabilized. The presence of alternative proton donors (HA) or acceptors (8 ) increases the rate of the reaction.
:
l Products
FIGURE 6-8 How a catalyst circumvents unfavorable charge develop ment during cleavage of an amide. The hydrolysis of an amide bond,
shown here, is the same reaction as that catalyzed by chymotrypsi n and other proteases. Charge development is unfavorable and can be cir cu mvented by donation of a proton by H30 + (specific acid catalysis) or HA (general acid catalysis), where HA represents any acid. Si m i l arly, charge can be neutra l ized by proton abstraction by O H - (specific base catalysis) or B: (general base catalysis), where B: represents any base.
mediated by other proton acceptors or donors will oc cur. In many cases, however, water is not enough. The term general acid-base catalysis refers to proton transfers mediated by other classes of molecules. For nonenzymatic reactions in aqueous solutions, this oc curs only when the unstable reaction intermediate breaks down to reactants faster than protons can be transferred to or from water. Many weak organic acids can supplement water as proton donors in this situation, or weak organic bases can serve as proton acceptors. In the active site of an enzyme, a number of amino acid side chains can similarly act as proton donors and acceptors ( Fig-. 6-!J ) . These groups can be precisely
Tyr
R-NH2 R-s -
R- S H
R- C = C H
R - C = CH
I
I
HN ......_ .f" N : c H
HN ......_ .f" NH c H
\+
R- OH
-o-
R
\
R-o-
-Q-
R
OH
o-
FIGURE 6-9 Amino acids in general acid-base catalysis. Many organic reactions are p romoted by proton donors (general acids) or proton acceptors (general bases). The active sites of some enzymes contain amino acid functional groups, such as those shown here, that can par ticipate in the catalytic process as proton donors or proton acceptors.
positioned in an enzyme active site to allow proton transfers, providing rate enhancements of the order of 102 to 105. This type of catalysis occurs on the vast ma jority of enzymes. In fact, proton transfers are the most common biochemical reactions. Covalent Catalysis In covalent catalysis, a transient covalent bond is formed between the enzyme and the substrate. Consider the hydrolysis of a bond between groups A and B: A-B
H20
----+
A+B
In the presence of a covalent catalyst (an enzyme with a nucleophilic group X:) the reaction becomes A-B + X:
----+
A-X + B
H 20
----+
A + X: + B
This alters the pathway of the reaction, and it results in catalysis only when the new pathway has a lower acti vation energy than the uncatalyzed pathway. Both of the new steps must be faster than the uncatalyzed reaction. A number of amino acid side chains, including all those in Figure 6-9, and the functional groups of some enzyme cofactors can serve as nucleophiles in the formation of covalent bonds with substrates. These covalent com plexes always undergo further reaction to regenerate the free enzyme. The covalent bond formed between the enzyme and the substrate can activate a substrate for further reaction in a manner that is usually specific to the particular group or coenzyme. Metal Ion Catalysis Metals, whether tightly bound to the enzyme or taken up from solution along with the substrate, can participate in catalysis in several ways.
[194]
Enzymes
Ionic interactions between an enzyme-bound metal and a substrate can help orient the substrate for reaction or stabilize charged reaction transition states. This use of weak bonding interactions between metal and substrate is similar to some of the uses of enzyme-substrate bind ing energy described earlier. Metals can also mediate oxidation-reduction reactions by reversible changes in the metal ion's oxidation state. Nearly a third of all known en zymes require one or more metal ions for catalytic activity. Most enzymes combine several catalytic strate gies to bring about a rate enhancement. A good exam ple is the use of covalent catalysis, general acid-base catalysis, and transition-state stabilization in the reac tion catalyzed by chymotrypsin, detailed in Section 6.4.
S U M M A RY 6 . 2 •
•
•
•
•
protein chemistry and modern methods of site-directed mutagenesis (changing the amino acid sequence of a protein by genetic engineering; see Fig. 9-1 1 ) . These technologies permit enzymologists to examine the role of individual amino acids in enzyme structure and ac tion. However, the oldest approach to understanding enzyme mechanisms , and the one that remains most important, is to determine the rate of a reaction and how it changes in response to changes in experimental parameters, a discipline known as enzyme kinetics. We provide here a basic introduction to the kinetics of enzyme-catalyzed reactions. More advanced treat ments are available in the sources cited at the end of the chapter. S ubstrate Concentration Affects the Rate of
H ow Enzy mes Work
Enzymes are highly effective catalysts, commonly enhancing reaction rates by a factor of 1 05 to 1 0 1 7 . Enzyme-catalyzed reactions are characterized by the formation of a complex between substrate and enzyme (an E S complex) . Substrate binding occurs in a pocket on the enzyme called the active site. The function of enzymes and other catalysts is to lower the activation energy, ilG* , for a reaction and thereby enhance the reaction rate. The equilibrium of a reaction is unaffected by the enzyrne. A significant part of the energy used for enzymatic rate enhancements is derived from weak interactions (hydrogen bonds and hydrophobic and ionic interactions) between substrate and enzyme. The enzyme active site is structured so that some of these weak interactions occur preferentially in the reaction transition state, thus stabilizing the transition state. The need for multiple interactions is one reason for the large size of enzymes. The binding energy, LlGB, can be used to lower substrate entropy or to cause a conformational change in the enzyme (induced fit) . Binding energy also accounts for the exquisite specificity of enzymes for their substrates. Additional catalytic mechanisms employed by enzymes include general acid-base catalysis , covalent catalysis, and metal ion catalysis. Catalysis often involves transient covalent interactions between the substrate and the enzyme, or group transfers to and from the enzyme, so as to provide a new, lower-energy reaction path.
6.3 Enzyme Kinetics as an Approach to
Understanding Mechanism Biochemists commonly use several approaches to study the mechanism of action of purified enzymes. The three-dimensional structure of the protein provides im portant information, which is enhanced by classical
E nzyme-Catalyzed Reactions A key factor affecting the rate of a reaction catalyzed by an enzyme is the concentration of substrate, [S] . How ever, studying the effects of substrate concentration is complicated by the fact that [S] changes during the course of an in vitro reaction as substrate is converted to product. One simplifying approach in kinetics experi ments is to measure the initial rate (or initial velocity) , designated V0 (Fig. 6-10). In a typical reaction, the en zyme may be present in nanomolar quantities, whereas [S] may be five or six orders of magnitude higher. If only the beginning of the reaction is monitored (often the first 60 seconds or less) , changes in [S] can be limited to a few percent, and [S] can be regarded as constant. V0 can then be explored as a function of [S] , which is ad justed by the investigator. The effect on V0 of varying [S] when the enzyme concentration is held constant is
,
,
,
,
[S]
=
[S]
=
Km
=
0.5J.LM
0.2 J.LM
Time theoretical enzyme catalyzes the reaction S ;;:::= P, and is present at a
FIGURE 6-1 0 Initial velocities of enzyme-catalyzed reactions. A
ity, Vmax. of 1 �-tMimi n . The Michaelis constant, Km (explained in the text), is 0.5 �-tM. Progress cu rves are shown for substrate concentrations concentration sufficient to catalyze the reaction at a maxi mum veloc below, at, and above the Km. The rate of an enzyme-catalyzed reaction
taken at time = 0 defines the i n itial velocity, V0, of each reaction.
dec l i nes as substrate is converted to product. A tangent to each curve
6.3 Enzyme Kinetics as an Approach to Understanding Mechanism
[195]
- - - - - - - - - - - - - _v��� - - - - - - - - - - - - - -
Leon or Michael is, 1 875 - 1 949
Substrate concentration, [S] (mM) FIGURE 6-1 1 Effect of substrate concentration on the initial velocity of an enzyme-catalyzed reaction. The maximum velocity,
Vma" is extrapo V0 approaches but never qu ite reaches
Vmax · The su bstrate concentration at which V0 is half maximal is Km, the
lated from the plot, because
Michaelis constant. The concentration of enzyme in an experiment such as this is genera l ly so low that [5]
>>
[E] even when [5] is described as
reactions and are given only to help i l lustrate the meaning of V0 and [5] .
low or relatively low. The u n its shown are typical for enzyme-catalyzed
(Note that the curve describes part of a rectangular hyperbola, with one
approach a vertical asymptote at [5] = - Km.) asymptote at
Vmax· If the curve were continued below [5] = 0, it would
shown in Figure 6-1 1 . At relatively low concentrations of substrate, V0 increases almost linearly with an in crease in [S]. At higher substrate concentrations, V0 in creases by smaller and smaller amounts in response to increases in [S] . Finally, a point is reached beyond which increases in V0 are vanishingly small as [S] increases . This plateau-like V0 region is close to the maximum velocity, vmax · The ES complex is the key to understanding this ki netic behavior, just as it was a starting point for our dis cussion of catalysis. The kinetic pattern in Figure 6-1 1 led Victor Henri, following the lead of Wurtz, to propose in 1 903 that the combination of an enzyme with its sub strate molecule to form an ES complex is a necessary step in enzymatic catalysis. This idea was expanded into a general theory of enzyme action, particularly by Leonor Michaelis and Maud Menten in 1 9 1 3 . They pos tulated that the enzyme first combines reversibly with its substrate to form an enzyme-substrate complex in a relatively fast reversible step: E + S � ES "'
k_ ,
Maud Menten, 1 8 79- 1 960
At any given instant in an enzyme-catalyzed reac tion, the enzyme exists in two forms , the free or un combined form E and the combined form ES. At low [S] , most of the enzyme is in the uncombined form � · Here , the rate is proportional to [S] because the eqUI librium of E quation 6-7 is pushed toward formation of more ES as [S] increases. The maximum initial rate of the catalyzed reaction (Vmax) is observed when virtu ally all the enzyme is present as the ES complex and [E) is vanishingly small. Under these conditions, the enzyme is "saturated" with its substrate , so that fur ther increases in [S] have no effect on rate. This condi tion exists when [S) is sufficiently high that essentially all the free enzyme has been converted to the ES form. After the ES complex breaks down to yield the product P, the enzyme is free to catalyze reaction of another molecule of substrate. The saturation effect is a distin guishing characteristic of enzymatic catalysts and is re sponsible for the plateau observed in Figure 6-1 1 . The pattern seen in Figure 6-1 1 is sometimes referred to as saturation kinetics. When the enzyme is first mixed with a large excess of substrate, there is an initial period, the pre-steady state, during which the concentration of ES builds up. This period is usually too short to be easily observed, last ing just microseconds, and is not evident in Figure 6-10. The reaction quickly achieves a steady state in which [ES] (and the concentrations of any other intermediates) remains approximately constant over time. The concept of a steady state was introduced by G. E. Briggs and Hal dane in 1 925. The measured V0 generally reflects the steady state, even though V0 is limited to the early part of the reaction, and analysis of these initial rates is referred to as steady-state kinetics.
(6-7)
The ES complex then breaks down in a slower second step to yield the free enzyme and the reaction product P: (6-8)
Because the slower second reaction (Eqn 6-8) must limit the rate of the overall reaction, the overall rate must be proportional to the concentration of the species that reacts in the second step, that is, ES.
The Relationship between Substrate Concentration and Reaction Rate Can Be Expressed Quantitatively The curve expressing the relationship between [S] and V0 (Fig. 6-1 1 ) has the same general shape for most en zymes (it approaches a rectangular hyperbola) , wh1ch can be expressed algebraically by the Michaelis Menten equation. Michaelis and Menten derived this equation starting from their basic hypothesis that the rate-limiting step in enzymatic reactions is the
[196]
Enzymes
breakdown of the E S complex to product and free en zyme. The equation is Vo
Km + [SJ
Vnutx lSJ
=
1 (6-9)
The important terms are [S] , V0, Vmax' and a constant called the Michaelis constant, Km· All these terms are readily measured experimentally. Here we develop the basic logic and the algebraic steps in a modern derivation of the Michaelis-Menten equation, which includes the steady-state assumption introduced by Briggs and Haldane. The derivation starts with the two basic steps of the formation and break down of ES (Eqns 6-7 and 6-8) . Early in the reaction, the concentration of the product, [P] , is negligible, and we make the simplifying assumption that the reverse re action, P � S (described by k _ 2) , can be ignored. This assumption is not critical but it simplifies our task. The overall reaction then reduces to kl
k2
E + S � ES � E + P k
(6-15)
Adding the term k 1 [ES] [S] to both sides of the equation and simplifying gives k 1 [Et][S]
V0 is determined by the breakdown of ES to form prod uct, which is determined by [ES]:
CkdSl + k - 1 + k2l[ES]
[ES]
k 1 [Et] [S]
=
--'- --=-
k l [S] + L 1 + k2
Step 1
The rates of formation and breakdown of ES are determined by the steps governed by the rate con stants k1 (formation) and k _ 1 + k2 (breakdown to reac tants and products, respectively) , according to the expressions Rate of ES formation Step 2
=
k1([EJ - [ES]) [S]
Rate of ES breakdown = k _ dES] + k2[ES]
(6-12) (6-13)
We now make an important assumption: that the initial rate of reaction reflects a steady state in which [ES] is constant-that is, the rate of formation of E S i s equal t o the rate o f its breakdown. This i s called the steady-state assumption. The expressions in E quations 6-1 2 and 6-1 3 can be equated for the steady state , giving
[ES]
=
[EJ[S] [S] + (k_ 1 + k2)/k1
In a series of algebraic steps, we now solve E quation 6-1 4 for [ES] . First, the left side is multiplied out and the right side simplified to give
(6-18)
The term (k_ 1 + k2)/k1 is defined as the Michaelis constant, Km. Substituting this into E quation 6-1 8 sim plifies the expression to
= lEtl [SJ
[ESJ
Km
+
ISJ
(6-19)
Step 4
We can now express V0 in terms of [ES] . Substi tuting the right side of E quation 6-1 9 for [ES] in E qua tion 6-1 1 gives Vo
=
k2 [EJ [S)
(6-20)
Km + [S]
This equation can be further simplified. Because the maximum velocity occurs when the enzyme is saturated (that is, with [ES] [EtD Vmax can be defined as k2[Etl · Substituting this in Equation 6-20 gives E quation 6-9: =
Vo
=
Vmax (S] Km + [S]
This is the Michaelis-Menten equation, the rate equation for a one-substrate enzyme-catalyzed reac tion. It is a statement of the quantitative relationship be tween the initial velocity V0, the maximum velocity Vmax, and the initial substrate concentration [S], all re lated through the Michaelis constant Km. Note that Km has units of concentration. Does the equation fit experi mental observations? Yes; we can confirm this by con sidering the limiting situations where [S] is very high or very low, as shown in Figure 6-12 . An important numerical relationship emerges from the Michaelis-Menten equation in the special case when V0 is exactly one-half Vmax (Fig. 6-12) . Then Vmax
Vmax [S]
2
Km + [S]
(6-21)
On dividing by Vmax' we obtain
(6-14) Step 3
(6-17)
This can now be simplified further, combining the rate constants into one expression:
(6-11)
Because [ES] in E quation 6-1 1 is not easily measured ex perimentally, we must begin by finding an alternative ex pression for this term. First, we introduce the term [Et] , representing the total enzyme concentration (the sum of free and substrate-bound enzyme) . Free or unbound enzyme can then be represented by [Etl - [ES] . Also, because [S] is ordinarily far greater than [Et] , the amount of substrate bound by the enzyme at any given time is negligible compared with the total [S] . With these conditions in mind, the following steps lead us to an ex pression for V0 in terms of easily measurable parameters.
(6-16)
We then solve this equation for [ES] :
(6-10)
-1
=
1
[S]
2
Km + [S]
Solving for Km , we get Km + [S] Km
=
[S] , when Vo
=
(6-22)
2 [S], or
= 21 Vmax
(6-23)
6.3 Enzyme Kinetics as an Approach to Understanding Mechanism
[197]
This is a very useful, practical definition of Km : Km is equivalent to the substrate concentration at which V0 is one-half Vmax· The Michaelis-Menten equation (Eqn 6-9) can be algebraically transformed into versions that are useful in the practical determination of Km and Vmax (Box 6-1) and , as we describe later, in the analysis of inhibitor ac tion (see Box 6-2 on page 202) .
Kinetic Pa ra meters Are Used to Compare Enzyme Activities [S] (mM)
FIGURE 6-12 Dependence of initial velocity on substrate concentration. This graph shows the kinetic parameters that define the l i m its of the curve at high and low
[5] . At low [5L Km > > [5] and the [5] term in the denom
inator of the Michaelis-Menten equation {Eqn 6-9) becomes i nsignificant.
V0 = Vmax [5]/Km and V0 exhibits a l i near de [5], as observed here. At high [5], where [5] >> Km, the Km
The equation simplifies to pendence on
term in the denomi nator of the Michael is-Menten equation becomes in significant and the equation simpl ifies to V0 the p lateau observed at high
= Vm,.; this i s consistent with
[5] . The Michaelis-Menten equation is there
fore consistent with the observed dependence of V0 on IS], and the shape of the curve is defined by the terms VmaxfKm at low
BOX 6-1
[S] and Vmax at high [5].
It is important to distinguish between the Michaelis Menten equation and the specific kinetic mechanism on which it was originally based. The equation describes the kinetic behavior of a great many enzymes, and all en zymes that exhibit a hyperbolic dependence of V0 on [S] are said to follow Michaelis-Menten kinetics. The practical rule that Km = [S] when V0 = % Vmax (Eqn 6-23) holds for all enzymes that follow Michaelis Menten kinetics. (The most important exceptions to Michaelis-Menten kinetics are the regulatory enzymes, discussed in Section 6.5.) However, the Michaelis Menten equation does not depend on the relatively sim ple two-step reaction mechanism proposed by Michaelis
Tra n sformat i o n s of t h e M l c h a e l is-Menten Eq uati o n : The D o u b l e - Reciprocal Plot
The Michaelis-Menten equation �
_
o -
Vmax [S] Km + [S]
can be algebraically transformed into equations that are more useful in plotting experimental data. One common transformation is derived simply by taking the recipro cal of both sides of the Michaelis-Menten equation: 1
Vo
Km + [Sl Vmax [S]
Separating the components of the numerator on the right side of the equation gives 1
-
=
Vo
Km Vmax [S]
+
called a Lineweaver-Burk plot, has the great advantage of allowing a more accurate determination of Vmax' which can only be approximated from a simple plot of V0 versus [S] (see Fig. 6-12) . Other transformations of the Michaelis-Menten equation have been derived, each with some particular advantage in analyzing enzyme kinetic data. (See Prob lem 14 at the end of this chapter.) The double-reciprocal plot of enzyme reaction rates is very useful in distinguishing between certain types of enzymatic reaction mechanisms (see Fig. 6-1 4) and in analyzing enzyme inhibition (see Box 6-2).
[S] Vmax [S]
which simplifies to 1
Vo
This form of the Michaelis-Menten equation is called the Lineweaver-Burk equation. For enzymes obeying the Michaelis-Menten relationship, a plot of 1/V0 versus 1/[S] (the "double reciprocal" of the V0 versus [S] plot we have been using to this point) yields a straight line (Fig. 1 ) . This line has a slope of Km!Vmax. an intercept of 1/Vmax on the l!V0 axis, and an intercept of 1/Km on the 1/[S] axis. The double-reciprocal presentation, also
1
vm
P
"'
H.
For
example, the two electron pairs making up a C = 0 (carbonyl) bond are not shared equally; the carbon is relatively electron deficient as the oxygen draws away the electrons. Many reactions involve an electron-rich atom (a nucleophile) reacting with an
pocket
\
"
_.,..... N --..._
D l�
When substrate binds, the side chain of the residue adjacent to the peptide bond to be cleaved nestles in a hydrophobic pocket on the enzyme, positioning the peptide bond for attack.
Ser195
Gly193
electron (as in a free radical reaction) , a singleheaded (fishhook-type) arrow is used
H
'. I I
n
1 1 0 -{ Ser195
A covalent bond consists of a shared important to the reaction mechanism
C-CH-NH-M,,
Substrate (a polypeptide)
HO-
Product 2
Enzyme-product 2 complex
-�-�
Diffusion of the second product from the active site regenerates free enzyme.
H O-{Ser195
electron-deficient atom (an electrophile ) . Some common nucleophiles and electrophiles in biochemistry are shown at right. In general, a reaction mechanism is initiated at an unshared electron pair of a nucleophile. In mechanism diagrams, the base of the electron-pushing arrow originates near the electron-pair dots, and the head of the arrow points directly at the electro philic center being attacked. Where the unshared electron pair confers a formal negative charge on the nucleophile, the negative charge symbol itself can represent the unshared electron pair
Nucleophiles -a-
Negatively charged
anism, the nucleophilic electron pair in the ES complex between steps and is provided by the oxygen of the Ser1 95 hydroxyl
unprotonated hydroxyl
®
group. This electron pair
(2
of the
8 valence
electrons of the
hydroxyl oxygen) provides the base of the curved arrow. The electrophilic center under attack is the carbonyl carbon of the peptide bond to be cleaved. The C, 0, and N atoms have a max imum of 8 valence electrons, and
H has a maximum of 2. These
atoms are occasionally found in unstable states with less than their maximum allotment of electrons, but C, 0, and N cannot have more than 8. Thus, when the electron pair from chymo trypsin's Ser1 95 attacks the substrate's carbonyl carbon, an electron pair is displaced from the carbon valence shell (you cannot have
5 bonds to
carbon!) . These electrons move toward
the more electronegative carbonyl oxygen. The oxygen has
8
valence electrons both before and after this chemical process, but the number shared with the carbon is reduced from 4 to
2,
and
the carbonyl oxygen acquires a negative charge. In the next step, the electron pair conferring the negative charge on the oxygen moves back to re-form a bond with carbon and reestablish the carbonyl linkage. Again, an electron pair must be displaced from the carbon, and t his time it is the electron pair shared with the amino group of the peptide linkage. This breaks the peptide bond. The remaining steps follow a similar pattern.
:R -e-
,.....
and serves as the base of the arrow. In the chymotrypsin mech
CD
Electrophiles
oxygen (as in an group or an ionized carboxylic acid)
- s
sulfhydryl
carbonyl group (the more electronegative oxygen of the carbonyl away from the carbon)
r:R 'c=N-
-c
I
Carbanion
Carbon atom of a
group pulls electrons
Negatively charged
I
ll )
0
/
,.....
-N1
Uncharged amine group
h fiNyN :) Imidazole
IT-o-
Pronated imine group (activated for nucleophilic attack at the carbon by protonation of the imine)
T
:R - 0-P = O
I J
a-
Phosphorus of a phosphate group
,.....
Hydroxide ion
I
H
Proton
6.4
Interaction of Serl95 and Hi 57 generate a strongly nucleophilic alko:dde ion on Ser l9S; he ion attacks the peptide carbonyl group, forming a tetrahedral acylES complex enzyme. This i accom panied by formation of a hort-lived negative charge on the carbonyl oxygen of the H O _f Ser '-"' '?' sub trate. which l ' l l . II C-CH-NH-M. is stabilized by , formation of a covalent acyl-enzyme intermediate is
coupled to cleavage of the peptide bond. In the deacylation phase (steps
8
to
[209]
Instability of the negative charge on the substrate carbonyl oxygen leads to collapse of the tetrahedral inter mediate; re-formation of a double bond with carbon displaces the bond between carbon and the amino group of the peptide linkage, breaking the peptide bond. The amino leaving group is protonated by His57, facil itating its displacement.
chymotrypsin. The reaction has two phases. In the acylation phase
(steps
Examples of Enzymatic Reactions
\A
Product 1 l C l l NJ I J J )
HI
), deacylation regenerates the free enzyme; this is es
sentially the reverse of the acylation phase, with water m i rroring, i n re verse, the role of the amine component of the substrate. Chymotrypsin Mechanism
Short-lived intermediate* (deacylation)
Acyl-enzyme intermediate
H-Q/� / y
Acyl-enzyme intermediate
An incoming water
Collapse of the tetrahedral intermediate form. the second proc;luct, a carboXylate anion, and c:lisplaces Serl95.
*The tetrahedral i ntermediate in the chymotrypsin reaction pathway, and the second tetrahedral i ntermediate that forms l ater, are sometimes referred to as transition states, which can lead to confusion. An inter mediate is any chemical species wi th a fin ite l ifetime, "finite" being de fined as longer than the time required for a molecular vibration (-1 o - 1 3 seconds). A transition state i s simply the maxi m um-energy species formed on the reaction coordinate and does not have a finite l ifetime. The tetrahedral intermediates formed i n the chymotrypsin reaction closely resemble, both energetically and structura l ly, the transition states leadi ng to their formation and breakdown. However, the inter mediate represents a committed stage of completed bond formation,
molecule is deprotonated by general ba e catalysis. generating a strongly nucleophilic hydroxide ion. Attack of hydroxide on the ester linkage of the acylenzyme generates a second tetrahedral intermediate, with oxygen in the oxyanion hole again taking on a negative charge.
whereas the transition state is part of the process of reaction. In the case of chymotrypsin, given the close relationship between the intermediate and the actual transition state the distinction between them is routinely g lossed over. Furthermore, the i nteraction of the negatively charged oxygen with the amide nitrogens in the oxyanion hole, often referred to as transition-state stabilization, also serves to stabilize the intermediate in this case. Not a l l i ntermedi ates are so short-lived that they resemble transition states. The chymotrypsin acyl-enzyme i ntermediate is much more stable and more readily detected and studied, and it is never con fused with a transition state.
[21 o]
Enzymes
Evidence for Enzyme-Transition State Complementarity
-- ..�
The transition state of a reaction is difficult to study be cause it is so short-lived. To understand enzymatic catalysis, however, we must understand what occurs during this fleeting moment in the course of a reaction. Complementarity between an enzyme and the transition state is virtually a requirement for catalysis , because the energy hill upon which the transition state sits is what the enzyme must lower if catalysis is to occur. How can we obtain evidence for enzyme-transition state comple mentarity? Fortunately, we have a variety of ap proaches, old and new, to address this problem, each providing compelling evidence in support of this general principle of enzyme action.
Structure-Activity Correlations If enzymes are complementary to reaction transition states, then some functional groups in both the sub strate and the enzyme must interact preferentially in the transition state rather than in the ES complex. Changing these groups should have little effect on for mation of the ES complex and hence should not affect kinetic parameters (the dissociation constant, Kct; or sometimes Km, if Kct Km ) that reflect the E + S � E S equilibrium. Changing these same groups should have a large effect on the overall rate (kcat or kcat 1Km) of the re action, however, because the bound substrate lacks po tential binding interactions needed to lower the activation energy. An excellent example of this effect is seen in the kinetics associated with a series of related substrates for the enzyme chymotrypsin (Fig. 1 ) . Chymotrypsin normally catalyzes the hydrolysis of peptide bonds next to aromatic amino acids. The substrates shown in =
Substrate A
Substrate B
Substrate C
II
C2 C2 C2 I
2
0
0
Transition-State Analogs Even though transition states cannot be observed di rectly, chemists can often predict the approximate structure of a transition state based on accumulated knowledge about reaction mechanisms. The transition state is by definition transient and so unstable that di rect measurement of the binding interaction between this species and the enzyme is impossible. In some cases, however, stable molecules can be designed that resemble transition states. These are called transition-
heat (s- ')
Km ( mM)
0 . 14
15
0.06
II
H3 -C-NH-CH- -NH2
0
Figure 1 are convenient smaller models for the natural substrates (long polypeptides and proteins) . The ad ditional chemical groups added in each substrate (A to B to C) are shaded. As the table shows, the interaction between the enzyme and these added functional groups has a minimal effect on Km (taken here as a re flection of Kct) but a large, positive effect on kcat and kcat1Km. This is what we would expect if the interac tion contributed largely to stabilization of the transi tion state. The results also demonstrate that the rate of a reaction can be affected greatly by enzyme-sub strate interactions that are physically remote from the covalent bonds that are altered in the enzyme-cat alyzed reaction. Chymotrypsin is described in more detail in the text. A complementary experimental approach is to modify the enzyme, eliminating certain enzyme-sub strate interactions by replacing specific amino acid residues through site-directed mutagenesis (see Fig. 9-1 1 ) . Results from such experiments again demon strate the importance of binding energy in stabilizing the transition state .
0
II I 2 II II CHa- -NH- H- -NH-cH2- -NH2
H 1 2 � � ? 3 ? CH3 -C-NH -CH-C-NH-CH-LNH2
31
kcat1Km (M- 1 $ 1 ) 2
10
FIGURE 1 Effects of smal l structural changes in the substrate 2.8
25
114
on
k i netic
parameters
chymotrypsin-catalyzed hydrolysis.
for
amide
6.4 Examples of Enzymatic Reactions
_ . ... .
:..
.
�
.
.
:
.
-
-
-
,
.
•.
[21 1]
.. ·.
state analogs . In principle, they should bind to an enzyme more tightly than does the substrate in the ES complex, because they should fit the active site better (that is, form a greater number of weak interactions) than the substrate itself. The idea of transition-state analogs was suggested by Pauling in the 1 940s, and it has been explored using a number of enzymes. These experiments have the limitation that a transition-state analog cannot perfectly mimic a transition state. Some analogs, however, bind an enzyme 1 0 2 to 1 06 times more tightly than does the normal substrate, providing good evidence that enzyme active sites are indeed complementary to transition states. The same princi ple is used in the pharmaceutical industry to design new drugs. The powerful anti-HIV drugs called pro tease inhibitors were designed in part as tight-binding transition-state analogs directed at the active site of HIV protease.
Catalytic antibodies generally do not approach the catalytic efficiency of enzymes, but medical and indus trial uses for them are nevertheless emerging. For ex ample, catalytic antibodies designed to degrade cocaine are being investigated as a potential aid in the treatment of cocaine addiction.
Ester hydrolysis
- m-r
{,
R � _, o, 2 R
�")
Several
� Products
Catalytic Antibodies If a transition-state analog can be designed for the reac tion S --7 P then an antibody that binds tightly to this analog might be expected to catalyze S --7 P. Antibodies (immunoglobulins; see Fig. 5-2 1 ) are key components of the immune response. When a transition-state analog is used as a protein-bound epitope to stimulate the pro duction of antibodies , the antibodies that bind it are po tential catalysts of the corresponding reaction. This use of "catalytic antibodies," first suggested by William P. Jencks in 1 969, has become practical with the develop ment of laboratory techniques to produce quantities of identical antibodies that bind one specific antigen (mon oclonal antibodies, p. 1 73) . Pioneering work in the laboratories of Richard Lerner and Peter Schultz has resulted in the isolation of a number of monoclonal antibodies that catalyze the hy drolysis of esters or carbonates (Fig. 2) . In these reac tions, the attack by water (OH-) on the carbonyl carbon produces a tetrahedral transition state in which a partial negative charge has developed on the carbonyl oxygen. Phosphonate ester compounds mimic the structure and charge distribution of this transition state in ester hy drolysis , making them good transition-state analogs; phosphate ester compounds are used for carbonate hy drolysis reactions. Antibodies that bind the phospho nate or phosphate compound tightly have been found to accelerate the corresponding ester or carbonate hydrol ysis reaction by factors of 1 03 to 1 04. Structural analyses of a few of these catalytic antibodies have shown that some catalytic amino acid side chains are arranged such that they could interact with the substrate in the transition state.
Transition state
1 98-0 R, I, ,.....- ' p li Os -
R2
Analog (phosphonate ester)
Several
� Products
Transition state
H H-N H
Analog (phosphate ester)
FIGURE 2 The expected transition states for ester or carbonate hydroly sis reactions. Phosphonate ester and phosphate ester compounds, re spectively, make good transition-state analogs for these reactions.
[21 2]
Enzymes
Hexoki nase Undergoes I nduced F it on Substrate B i nd i ng Yeast hexokinase CMr 107,862) is a bisubstrate enzyme that catalyzes the reversible reaction
H
OH
H
OH
Glucose 6-phosphate
,8-D-Glucose
ATP and ADP always bind to enzymes as a complex with the metal ion Mg2 + . The hydroxyl at C-6 of glucose (to which the y-phos phoryl of ATP is transferred in the hexokinase reaction) is similar in chemical reactivity to water, and water freely enters the enzyme active site. Yet hexokinase favors the reaction with glucose by a factor of 1 06 . The enzyme can discriminate between glucose and water because of a conformational change in the enzyme when the correct substrates binds (Fig. 6-22). Hexokinase thus provides a good example of induced fit. When glucose is not present, the enzyme is in an inactive conformation with the active-site amino acid side chains out of position for reaction. When glucose (but not water) and Mg ATP bind, the binding energy derived from this interaction induces a conformational change in hexokinase to the catalytically active form. This model has been reinforced by kinetic studies. The five-carbon sugar xylose, stereochemically similar to glucose but one carbon shorter, binds to hexokinase •
but in a position where it cannot be phosphorylated. Nevertheless, addition of xylose to the reaction mixture increases the rate of ATP hydrolysis. Evidently, the binding of xylose is sufficient to induce a change in hex okinase to its active conformation, and the enzyme is thereby "tricked" into phosphorylating water. The hex okinase reaction also illustrates that enzyme specificity is not always a simple matter of binding one compound but not another. In the case of hexokinase, specificity is observed not in the formation of the ES complex but in the relative rates of subsequent catalytic steps. Water is not excluded from the active site, but reaction rates increase greatly in the presence of the functional phosphoryl group acceptor (glucose) . H "- -f'o 0
o " -f' c I H-C-OH H
I
H-C-OH I
I
HO-C-H
HO-C-H
I
I
H-C-OH
H-C-OH I CH20H
I
H-C-OH I CH20H
Xylose
Glucose
Induced fit is only one aspect of the catalytic mech anism of hexokinase-like chymotrypsin, hexokinase uses several catalytic strategies. For example, the active-site amino acid residues (those brought into posi tion by the conformational change that follows substrate binding) participate in general acid-base catalysis and transition-state stabilization.
(b)
(a) FIGURE 6-22 Induced fit in hexokinase. (a) Hexokinase has a U-shaped
formational change induced by binding of o-gl ucose (red) (derived from
structure (PDB ID 2YHX). (b) The ends pinch toward each other in a con-
PDB ID
1 H KG and PDB ID 1 GLKl.
6.4 Examples of Enzymatic Reactions
'
I
o 'o ,./ � I Mg2� '-.. / -o I Enolase .. H-N-H
proton by general base catalysis. Two Mgll• ion stabilize U1e resulting enolic
a
H
C-?- I -H
I Lys345
elimination of the -OH group by
Lys:l45 abstracts a
po2-
Mg2 +
I
OH
HO
intermediate.
o H .- o _./ "I I Mg2�.. C=C-C-H
0
\/
/
·-...
-o ·
H-N +-H Lys345
I
Glu211
I
Glu211 facilitates
ro�-
Mg��-
general acid
catalysis.
I
\
OH
0 ,.HO '- ,f'
HOH
po2-
l
o
3
H I / C - C=C ' ,f' H 0
-o
'
c
I
Glu211 Enolic intermediate
(a) 2-Phosphoglycerate bound to enzyme
[21 3]
Phosphoenolpyruvate
(b) MECHANISM FIGURE 6-23 Two-step reaction catalyzed by enolase.
2 2 in relation to the Mg + ions, Lys345 , and G l u 1 1 in the enolase active site.
(a) The mechanism by which enolase converts 2-phosphoglycerate (2-
N itrogen is shown in blue, phosphorus in orange; hydrogen atoms are
PGA) to phosphoenolpyruvate. The carboxyl group of 2-PGA is coordi
not shown (PDB ID l ONE).
nated by two magnesium ions at the active site. (b) The substrate, 2-PGA,
The Enolase Reaction Mechanism Bequ i n•s Metal ions
Another glycolytic enzyme , enolase, catalyzes the re versible dehydration of 2-phosphoglycerate to phos phoenolpyruvate: o o/ �c o "::
I
II
H-C-0-P -0 -
1
HO-CH2
I
o-
2-Phosphoglycerate
o o� /
I
0
II
a-
c
II
C-0-P-o - + H20 CH2
I
Phosphoenolpyruvate
Yeast enolase CMr 93,3 1 6) is a dimer with 436 amino acid residues per subunit. The enolase reaction illustrates one type of metal ion catalysis and pro vides an additional example of general acid-base catalysis and transition-state stabilization. The reac tion occurs in two steps ( F ig. f)-2:3 a ) . First, Lys3 45
acts as a general base catalyst, abstracting a proton from C-2 of 2-phosphoglycerate; then Glu2 1 1 acts as a general acid catalyst, donating a proton to the -OH leaving group. The proton at C-2 of 2-phosphoglycer ate is not very acidic and thus is not readily removed.
However, in the enzyme active site, 2-phosphoglycer ate undergoes strong ionic interactions with two bound Mg2 + ions (Fig. 6-23b) , making the C-2 proton more acidic (lowering the pKa) and easier to abstract. Hydrogen bonding to other active-site amino acid residues also contributes to the overall mechanism. The various interactions effectively stabilize both the enolate intermediate and the transition state preced ing its formation. Lysozyme Uses Two Successive N ucleophilic Displacement Reactions
Lysozyme is a natural antibacterial agent found in tears and egg whites. The hen egg white lysozyme CMr 14,296) is a monomer with 129 amino acid residues. This was the first enzyme to have its three-dimensional structure de termined, by David Phillips and colleagues in 1 965. The structure revealed four stabilizing disulfide bonds and a cleft containing the active site ( Fig. 6-24a) . More than five decades of investigations have provided a de tailed picture of the structure and activity of the enzyme, and an interesting story of how biochemical science progresses.
[214=
Enzymes
RO
I 0 I
=
CH3CHCoo-
NAc/AcN
OR
=
:y
-NH-C-CH3
II 0
to
GlcNAc
c
residues in enzyme binding site
Hydrogen bonds
NAc
I
I
/
I
�,
I
I
1
/
0
RO
FIGURE 6-24 Hen egg white lysozyme and the reaction it catalyzes. (a) Ribbon d iagram of the enzyme with the active-site residues Glu 35 and 2 Asp5 shown as blue stick structures and bound substrate shown in red (PDB ID 1 LZE). (b) Reaction catalyzed by hen egg white lysozyme. A seg ment of a peptidoglycan polymer is shown, with the lysozyme binding sites A through F shaded. The glycosidic C-0 bond between sugar residues bound to sites D and E is cleaved, as indicated by the red arrow.
(b)
The hydrolytic reaction is shown in the inset, with the fate of the oxygen in the H2 0 traced in red. Mur2Ac is N-acetylmuramic acid; GlcNAc, N acetylgl ucosamine. RO- represents a lactyl (lactic acid) group; -NAc
9 I
and AcN-, an N-acetyl group (see key).
The substrate of lysozyme is peptidoglycan, a carbohydrate found in many bacterial cell walls (see Fig. 20-3 1 ) . Lysozyme cleaves the (,8 1 �4) glycosidic G-O bond (see p. 243) between the two types of sugar residue in the molecule, N-acetylmuramic acid (Mur2Ac) and N-acetylglucosamine (GlcNAc) , often referred to as NAM and NAG, respectively, in the re search literature on enzymology (Fig. 6-24b). Six residues of the alternating Mur2Ac and GlcNAc in peptidoglycan bind in the active site, in binding sites labeled A through F. Model building has shown that the lactyl side chain of Mur2Ac cannot be accommo dated in sites C and E , restricting Mur2Ac binding to sites B, D, and F. Only one of the bound glycosidic bonds is cleaved, that between a Mur2Ac residue in site D and a GlcNAc residue in site E. The key cat alytic amino acid residues in the active site are Glu3 5 and Asp 5 2 ( Fig. 6-2 5a) . The reaction is a nucle ophilic substitution, with -OH from water replacing the GlcNAc at C-1 of Mur2Ac. With the active site residues identified and a detailed structure of the enzyme available, the path to under standing the reaction mechanism seemed open in the 1 960s. However, definitive evidence for a particular mechanism eluded investigators for nearly four decades.
There are two chemically reasonable mechanisms that could generate the observed product of lysozyme-medi ated cleavage of the glycosidic bond. Phillips and col leagues proposed a dissociative (SN1-type) mechanism (Fig. 6-25a, left) , in which the GlcNAc initially dissoci ates in step CD to leave behind a glycosyl cation (a car bocation) intermediate. In this mechanism, the departing GlcNAc is protonated by general acid catalysis by Glu35, located in a hydrophobic pocket that gives its carboxyl group an unusually high pKa. The carbocation is stabilized by resonance involving the adjacent ring oxygen, as well as by electrostatic interaction with the negative charge on the nearby Asp52 . In step ®, water attacks at C-1 of Mur2Ac to yield the product. The alternative mechanism (Fig. 6-25a, right) involves two consecutive direct displacement (SN2-type) steps. In step Q), Asp52 attacks C-1 of Mur2Ac to displace the GlcNAc. As in the first mechanism, Glu35 acts as a general acid to protonate the departing GlcNAc. In step ®, water attacks at C-1 of Mur2Ac to displace the Asp52 and generate product. The Phillips mechanism (SN 1), was widely accepted for more than three decades. However, some controversy persisted and tests continued. The scientific method sometimes advances an issue slowly, and a truly insightful experiment can be difficult to design. Some early
6.4 Examples of Enzymatic Reactions
[21 5]
Peptidoglycan binds in the active site of lysozyme
�1 mechanism 3 GJu 5 A rearrangement produces a glycosyl carbocation. General acid catalysis by GJu52 protonates the displaced GlcNAc oxygen and facilitates its departure.
0)_0 q
Asp52 acts as a covalent catalyst, directly displacing the GlcNAc via an SN2 mechanism. GJu3 5 protonates the GlcNAc to facilitate
r-t!� J Mur2�C"O cl �- GlcNAc ¥/I '--f'\..i?H --r H20H
·
..
-o
H
AcN
H
i' � �
T
-o
Lysozyme
o
H
Asp52
H
CD
TO
"\. c /
CH 2 0
�
OH
H
.
First product
35 Glu
)_0_
NAc
-f/?
H
AeN
3 Glu 5
-0
AO_
-f/l inle<moH•�
0
-0
---
Glycosyl carbocation intermediate
yo
Ac
-o
Asp52
O
H
I
0
Covalent
y52
0
Asp
® rH20
® rH20 Glu35 acts as a general base catalyst to facilitate the SN2 attack of water, displacing Asp52 and generating product.
General base catalysis by GJu35 facilitates the attack of water on the glycosyl carbocation to form product.
Lysozyme
CH20H
---- -
�� RO
AcN
Covalent intermediate bound in the active site
"
econd product
(a)
(b)
MECHANISM FIGURE 6-25 Lysozyme reaction. In this reaction (described
C-1 of Mur2Ac is i n
pathway (right) is the mechanism most consistent with current data. (b) A
in the text), the water introduced i nto the product at
surface rendering of the lysozyme active site with the covalent enzyme
the same configuration a s the original glycosidic bond. The reaction is
substrate intermediate shown as a ball-and-stick structure. Side chains of
thus a molecular substitution with retention of configuration. (a) Two pro posed pathways potentially explain the overal l reaction and its properties.
The SN 1 pathway (left) is the original Phi l l ips mechanism. The SN2
active-site residues are shown as ball-and-stick structures protruding from
ribbons (PDB I D 1 H6M).
[216]
Enzymes
arguments against the Phillips mechanism were suggestive but not completely persuasive. For example, the half-life 2 of the proposed glycosyl cation was estimated to be 10- 1 seconds, just longer than a molecular vibration and not long enough for the needed diffusion of other molecules. More important, lysozyme is a member of a family of en zymes called "retaining glycosidases," all of which cat alyze reactions in which the product has the same anomeric configuration as the substrate (anomeric con figurations of carbohydrates are examined in Chapter 7) , and all of which are known to have reactive covalent in termediates like that envisioned in the alternative (SN2) pathway. Hence, the Phillips mechanism ran counter to experimental findings for closely related enzymes. A compelling experiment tipped the scales decid edly in favor of the SN2 pathway, as reported by Stephen Withers and colleagues in 200 1 . Making use of a mutant enzyme (with residue 35 changed from Glu to Gln) and artificial substrates, which combined to slow the rate of key steps in the reaction, these workers were able to stabilize the elusive covalent intermediate. This in turn allowed them to observe the intermediate directly, using both mass spectrometry and x-ray crystallography (Fig. 6-25b) . Is the lysozyme mechanism now proven? No . A key feature of the scientific method, as Albert Einstein once summarized it, is "No amount of experimentation can ever prove me right; a single experiment can prove me wrong." In the case of the lysozyme mechanism, one might argue (and some have) that the artificial sub strates, with fluorine substitutions at C - 1 and C-2, that were used to stabilize the covalent intermediate might have altered the reaction pathway. The highly electronegative fluorine could destabilize an already electron-deficient oxocarbenium ion in the glycosyl cation intermediate that might occur in an SN 1 pathway. However, the SN2 pathway is now the mechanism most in concert with available data.
An U nderstanding of Enzyme Mechanism Drives I mportant Advances in Medicine
o o •(
----t-)n o o • L-Ala
I
H2N -(Gly)5-N- (L-Lys) H I
I
D-Glu
C=O
------.!... - 1 ., Ser-
Ht fu0.. 6
CH3
4k I H y-CH3 =o
:I'nmsPeplida�e
coo
} }
D-Ala
D-Ala
Peptidoglycan chain 1
-oo
(
---t-),
000
L-Ala
I
k I
D-Glu
0
H2N -( Gly 0-N- ( L-Lysl H I
H
)
..
00
·( ---t-)" ..
0
I
L-Ala
H
D-Glu
I
1
H 2N - ( Glyl5-N- ( L-Lys l
:�
:1:
Peptidoglycan chain 2
6�
C=O I
Ser
o o o(
I
L-Ala
OR
s�
o o •(
I
L-Ala D-Glu
D-Glu
I
I
l
(Gly)5-(L-Lys)-(D-Ala) -(Gly)5-(L-Lys)D-Ala
The drugs used to treat maladies ranging from headache to HIV infection are almost always in hibitors of an enzyme. Two examples are explored here: the antibiotic penicillin (and its derivatives) and the pro tease inhibitors used to treat HIV infections, all of which are irreversible inhibitors. Penicillin was discovered in 1 928 by Alexander Fleming, but it took another 1 5 years before this rela tively unstable compound was understood well enough to use it as a pharmaceutical agent to treat bacterial in fections. Penicillin interferes with the synthesis of pep tidoglycan (described in Chapter 20, Fig. 20-32) , the major component of the rigid cell wall that protects bac teria from osmotic lysis. Peptidoglycan consists of poly saccharides and peptides cross-linked in several steps that include a transpeptidase reaction (Fig . 6-26). It is
I
D-Ala Cross-linked peptidoglycan
e N-Acetylglucosamine • N-Acetylmuramic (GlcNAc)
acid (Mur2NAc)
FIGURE 6-26 The transpeptidase reaction. This reaction, which l i nks two peptidoglycan precursors into a larger polymer, is fac i l i tated by an active-site Ser and a covalent catalysis mechanism similar to that of chy motrypsin. Note that peptidoglycan is one of the few p laces in nature where o-amino acid residues are found. The active-site Ser attacks the carbonyl of the peptide bond between the two D-Aia residues, creating a covalent ester l i n kage between the substrate and the enzyme with re lease of the terminal D-Aia residue. An amino group from the second peptidoglycan precursor then attacks the ester l i n kage, displacing the enzyme and cross- l i nking the two precursors.
6.4 Exam ples of Enzymatic Reactions
Q-
� 0 H � II
Side chain
cH2 -
Penicillin G (benzylpenicillin)
�
Thiazolidine ring
Q-
H
�
S R - C -N - C-C.- \ /CH a c, H I I I ,,_ CHa C-N H C --.._ � 0 �
[21 7]
R groups
'
=
Penicillin V
o-CH2-
,8-Lactam COOH ring
Amoxicillin General structure of penicillins
(a)
0
II
!
1
H
�CI
H
R -C -N- C - -
(
·· � Ser-OH
09"
-
I
.-
s CH3 \ / c.,
--{a CH3 ; COOB
Penicillin
Stably derivatized, inactive transpeptidase
(b) FIGURE 6-27 Transpeptidase inhibition by /3-lactam antibiotics. (a)
by i njection. Pen i c i l l i n V is nearly as effective and is acid stable, so it
{3- Lactam antibiotics feature a five-membered thiazo l i dine ring fused
can be adm i n istered ora l l y. Amoxici l l i n has a broad range of effec
to a four-membered {3-lactam ri ng. The latter ring is strained and in
tiveness, is read i l y admin istered ora l l y, and is thus the most widely
c l udes an amide moiety that p l ays a critical role i n the i nactivation of
prescribed {3-lactam antibiotic. (b) Attack on the amide moiety of the
peptidoglycan synthesis. The R group varies i n different penic i l l i ns.
{3-lactam ring by a transpeptidase active-site Ser results i n a cova lent
Penici l l i n G was the first to be isolated and remains one of the most
acyl-enzyme product. This is hydrolyzed so slowly that adduct forma
effective, but it is degraded by stomach acid and must be adm i n i stered
tion is practically irrevers ible, and the transpeptidase is i nactivated.
this reaction that is inhibited by penicillin and related compounds (Fig. 6-27a), all of which mimic one con formation of the D-Ala-D-Ala segment of the peptido glycan precursor. The peptide bond in the precursor is replaced by a highly reactive /3-lactam ring. When peni cillin binds to the transpeptidase, an active-site Ser at tacks the carbonyl of the /3-lactam ring and generates a covalent adduct between penicillin and the enzyme. However, the leaving group remains attached because it is linked by the remnant of the /3-lactam ring (Fig. 6-2 7b) . The covalent complex irreversibly inacti vates the enzyme. This, in turn, blocks synthesis of the
bacterial cell wall, and most bacteria die as the fragile inner membrane bursts under osmotic pressure. Human use of penicillin and its derivatives has led to the evolution of strains of pathogenic bacteria that express ,8-lactamases ( Fig. 6-28a), enzymes that cleave /3-lactam antibiotics, rendering them inactive. The bacteria thereby become resistant to the antibi otics. The genes for these enzymes have spread rapidly through bacterial populations under the selective pres sure imposed by the use (and often overuse) of 13-lac tam antibiotics. Human medicine responded with the development of compounds such as clavulanic acid, a
[21 8]
Enzymes
er-0
H
\
HH I I 0
P-;11
tc '- c
�C 0
H+
�
I
CB20H
C - CH N-.. I \H CH T OOH
Inactive penicillin (a) FIGURE 6-28 fl-lactamases and fl-lactamase inhibition. (a) {3lactamases promote cl eavage of the {3-lactam ring in {3-lactam antibi otics, inactivating them . (b) Clavulanic acid is a suic ide i n h i b itor, making use of the normal chemical mechanism of {3-lactamases to cre ate a reactive species at the active site. This reactive species is attacked by groups in the active site to irreversibly acylate the enzyme.
suicide inactivator, which irreversibly inactivates the [3lactamases (Fig. 6-28b). Clavulanic acid mimics the structure of a [3-lactam antibiotic, and forms a covalent adduct with a Ser in the [3-lactamase active site. This leads to a rearrangement that creates a much more re active derivative, which is subsequently attacked by an other nucleophile in the active site to irreversibly acylate the enzyme and inactivate it. Arnoxicillin and clavulanic acid are combined in a widely used pharma ceutical formulation with the trade name Augmentin. The cycle of chemical warfare between humans and bacteria continues unabated. Strains of disease-causing bacteria that are resistant to both amoxicillin and clavulanic acid (reflecting mutations in [3-lactamase that render it unreactive to clavulanic acid) have been discovered. The development of new antibiotics prom ises to be a growth industry for the foreseeable future. Antiviral agents provide another example of modern drug development. The human immunodeficiency virus (HIV) is the causative agent of acquired immune defi ciency syndrome, or AIDS. In 2005, an estimated 37 to 45 million people worldwide were living with HIV infec tions, with 3 . 9 to 6.6 million new infections that year and more than 2.4 million fatalities. AIDS first surfaced as a world epidemic in the 1 980s; HIV was discovered soon after and identified as a retrovirus. Retroviruses pos-
j
Inactive f3·lactamase
(b)
sess an RNA genome and an enzyme, reverse transcrip tase, capable of using RNA to direct the synthesis of a complementary DNA. Efforts to understand HIV and de velop therapies for HIV infection benefited from decades of basic research on other retroviruses. A retro virus such as HIV has a relatively simple life cycle (see Fig. 26-33) . Its RNA genome is converted to duplex DNA in several steps catalyzed by a reverse transcrip tase (described in Chapter 26) . The duplex DNA is then inserted into a chromosome in the nucleus of the host cell by the enzyme integrase (described in Chapter 25) . The integrated copy of the viral genome can remain dor mant indefinitely. Alternatively, it can be transcribed back into RNA, which can then be translated into pro teins to construct new virus particles. Most of the viral genes are translated into large polyproteins, which are cut by the HIV protease into the individual proteins needed to make the virus (see Fig. 26-34) . There are only three key enzymes in this cycle-the reverse tran scriptase, the integrase , and the protease-which thus are the potential drug targets.
6.4 Examples of Enzymatic Reactions
Aided by general
The tetrahedral
ba
intermediate collapses; the amino acid leaving
e
catalysi , water
attacks the carbonyl carbon, generating a tetrahedral
o�
group i protonated as
intermediate.
it is expelled.
q
-vv--- c � /
0
c
� /
0
OH
�25
HIV protease
FIGURE 6-29 Mechanism of action of HIV protease. Two active-site Asp residues (from different subunits) act as general acid-base catalysts,
There are four major subclasses of proteases. Ser ine proteases, such as chymotrypsin and trypsin, and cysteine proteases (in which Cys serves a catalytic role similar to that of Ser in the active site) feature covalent enzyme-substrate complexes; aspartyl proteases and metalloproteases do not. The HIV protease is an as partyl protease . 1\vo active-site Asp residues facilitate a direct attack of water on the peptide bond to be cleaved (Fig. 6-29). The initial product of the attack of water on the carbonyl group of the peptide bond to be cleaved is an unstable tetrahedral intermediate , much as we have seen for the chymotrypsin reaction. This interme diate is close in structure and energy to the reaction transition state. The drugs that have been developed as HIV protease inhibitors form noncovalent complexes with the enzyme , but they bind to it so tightly that they can be considered irreversible inhibitors. The tight binding is derived in part from their design as transi tion-state analogs (see Box 6-3) . The success of these drugs makes a point worth emphasizing. The catalytic principles we have studied in this chapter are not sim ply abstruse ideas to be memorized-their application saves lives . The HIV protease cleaves peptide bonds between Phe and Pro residues most efficiently. The active site thus has a pocket to bind aromatic groups next to the bond to be cleaved. The structures of several HN protease inhibitors are shown in Figure 6-30. Although the struc tures appear varied, they all share a core structure-a main chain with a hydroxyl group positioned next to a branch containing a benzyl group. This arrangement tar gets the benzyl group to the aromatic binding pocket. The adjacent hydroxyl group mimics the negatively charged oxygen in the tetrahedral intermediate in the normal reac tion, providing a transition-state analog. The remainder of each inhibitor structure was designed to fit into and bind to various crevices along the surface of the enzyme, en hancing overall binding. Availability of these effective drugs has vastly increased the lifespan and quality of life of millions of people with HN and AIDS. •
OH
/
C\ Peptides
m:_) (
j
\../'"'
I
OH
' c ,.... II 0
[21 9]
Asp25
facil itating the attack of water on the peptide bond. The unstable tetra hedral intermediate in the reaction pathway is highl ighted in pink.
�N l � -) N
�J )1 � �H
H ):H 0 HOf) •H,SO, � 0 Hals •CH3S02- 0H HOP� u N
I
.#'
NCCCHala
Indinavir
H
/
CC
OH
Nelfinavir
Lopinavir
CX>r��£c 0 0
Saquinavir
FIGURE 6-30 HIV protease inhibitors. The hydroxyl group (red) acts as a transition-state analog, m i m icking the oxygen of the tetrahedral inter mediate. The adjacent benzyl group (bl ue) helps to properly position the drug in the active site.
[220]
Enzymes
S U M M A RY 6 . 4 •
regulatory proteins. Others are activated when peptide
Exa m p l es of Enzy matic Reacti ons
segments are removed by proteolytic cleavage; unlike ef fector-mediated regulation, regulation by proteolytic
Chymotrypsin is a serine protease with a
cleavage is irreversible. Important examples of both
well-understood mechanism, featuring general
mechanisms are found in physiological processes such as
acid-base catalysis , covalent catalysis, and
digestion, blood clotting, hormone action, and vision.
transition -state stabilization. •
Cell growth and survival depend on efficient use of resources, and this efficiency is made p o ssible by reg
Hexokinase provides an excellent example of induced fit as a means of using substrate binding energy.
•
The enolase reaction proceeds via metal ion catalysis.
•
Lysozyme makes use of covalent catalysis and
•
ulatory enzymes . No single rule governs the occur rence of different types of regulation in different systems. To a degree, allosteric (noncovalent) regula tion may permit fine-tuning of metabolic pathways that are required continuously but at different levels
general acid catalysis as it promotes two successive
of activity as cellular conditions change. Regulation by
nucleophilic displacement reactions.
covalent modification may be all or none-usually the
Understanding enzyme mechanism allows the
case with proteolytic cleavage-or it may allow for
development of drugs to inhibit enzyme action.
subtle changes in activity. Several types of regulation may occur in a single regulatory enzyme. The remain der of this chapter is devoted to a discussion of these
6.5 Regulatory Enzymes
methods of enzyme regulation.
In cellular metabolism, groups of enzymes work together
Allosteric Enzymes Undergo Conformational Changes i n
in sequential pathways to carry out a given metabolic process, such as the multireaction breakdown of glucose
Response t o Modulator Binding 5,
to lactate or the multireaction synthesis of an amino acid
A s w e saw i n Chapter
from simpler precursors. In such enzyme systems, the
ing "other shapes" or conformations induced by the bind
allosteric proteins are those hav
reaction product of one enzyme becomes the substrate
ing of modulators. The same concept applies to certain
of the next.
regulatory enzymes, as conformational changes induced
Most of the enzymes in each metabolic pathway fol
by one or more modulators interconvert more-active and
low the kinetic patterns we have already described. Each
less-active forms of the enzyme. The modulators for al
pathway, however, includes one or more enzymes that
losteric enzymes may be inhibitory or stimulatory. Often
have a greater effect on the rate of the overall sequence .
the modulator is the substrate itself; regulatory enzymes
exhibit increased or de
for which substrate and modulator are identical are called
creased catalytic activity in response to certain signals.
homotropic. The effect is similar to that of 02 binding to
Adjustments in the rate of reactions catalyzed by regula
hemoglobin (Chapter
tory enzymes, and therefore in the rate of entire metabolic
strate, in the case of enzymes-causes conformational
sequences, allow the cell to meet changing needs for en
changes that affect the subsequent activity of other sites
These
regulatory enzymes
5) :
binding of the ligand-or sub
ergy and for biomolecules required in growth and repair.
on the protein. When the modulator is a molecule other
In most multienzyme systems, the first enzyme of
than the substrate, the enzyme is said to be heterotropic.
the sequence is a regulatory enzyme. This is an excel
Note that allosteric modulators should not be confused
lent place to regulate a pathway, because catalysis of
with uncompetitive and mixed inhibitors. Although the
even the first few reactions of a sequence that leads to
latter bind at a second site on the enzyme, they do not
an unneeded product diverts energy and metabolites
necessarily mediate conformational changes between ac
from more important processes. Other enzymes in the
tive and inactive forms, and the kinetic effects are distinct.
sequence may play subtler roles in modulating the flux through a pathway, as described in Chapter
15.
The activities o f regulatory enzymes are modulated in a variety of ways .
Allosteric enzymes
function
through reversible, noncovalent binding of regulatory compounds called
effectors,
allosteric modulators
or
The properties of allosteric enzymes are significantly different from those of simple nonregulatory enzymes.
allosteric
Some of the differences are structural. In addition to active sites, allosteric enzymes generally have one or more regu latory, or allosteric, sites for binding the modulator
6-31 ).
Just
as
an
enzyme's active site is
(Fig.
specific
which are generally small metabolites or
for its substrate, each regulatory site is specific for its mod
co
ulator. Enzymes with several modulators generally have
cofactors. Other enzymes are regulated by reversible
valent modification.
Both classes of regulatory en
zymes tend to be multisubunit proteins, and in some
different specific binding sites for each. In homotropic en zymes, the active site and regulatory site are the same.
cases the regulatory site(s) and the active site are on sep
Allosteric enzymes are generally larger and more
arate subunits. Metabolic systems have at least two other
complex than nonallosteric enzymes. Most have two or
mechanisms of enzyme regulation. Some enzymes are
more subunits . Aspartate transcarbamoylas e , which
stimulated or inhibited when they are bound by separate
catalyzes an early reaction in the biosynthesis of pyrim-
6.5
� Substrate
8 Positive modulator Less-active enzyme
Regu latory Enzymes
[221]
idine nucleotides (see Fig. 22-36) , has 12 polypeptide chains organized into catalytic and regulatory subunits. Figure 6-32 shows the quaternary structure of this enzyme, deduced from x-ray analysis. In Many Pathways, Regulated Steps Are Catalyzed by
� IRI c
1l
R
A l losteric Enzymes
M•��ru.,neym,
I"'""'
enzyme-substrate complex
FIGURE 6-31 Subunit interactions in an allosteric enzyme, and inter actions with inhibitors and activators. In many al losteric enzymes the
substrate binding site and the modu lator binding site(s) are on different subun its, the catalytic (C) and regu latory (R) subun its, respectively. B i nding of the positive (sti m u l atory) modulator (M) to its specific site on the regulatory subunit is communi cated to the cata lytic subunit subunit active and capable of bi nding the substrate (5) with higher through a conformational change. This change renders the cata lytic
affi n i ty. On dissociation of the modulator from the regulatory subunit, the enzyme reverts to its i nactive or less active form.
In some multienzyme systems, the regulatory enzymes are specifically inhibited by the end product of the pathway whenever the concentration of the end product exceeds the cell's requirements. When the regulatory enzyme re action is slowed, subsequent enzymes may operate at dif ferent rates as their substrate pools are depleted. The rate of production of the pathway's end product is thereby brought into balance with the cell's needs. This type of regulation is called feedback inhibition. Buildup of the end product ultimately slows the entire pathway. One of the first known examples of allosteric feed back inhibition was the bacterial enzyme system that cat alyzes the conversion of L-threonine to L-isoleucine in five steps (Fig. 6-33) . In this system, the first enzyme, threonine dehydratase, is inhibited by isoleucine, the product of the last reaction of the series. This is an ex ample of heterotropic allosteric inhibition. Isoleucine is quite specific as an inhibitor. No other intermediate in this sequence inhibits threonine dehydratase, nor is any other enzyme in the sequence inhibited by isoleucine. Isoleucine binds not to the active site but to another spe cific site on the enzyme molecule, the regulatory site.
+
coo I
H3N-C-H I
H-C-OH
L-Threonine
I
CH3 threonine
dchydrata�e
B
FIGURE 6-33 Feedback inhibi tion. The conversion of L-th reo
n i ne to L-isoleucine is catalyzed by a sequence of five enzymes (E 1 to E5). Threonine dehydratase ( E 1 )
FIGURE 6-32 Two views of the regulatory enzyme aspartate transcar
is specifical l y i n h i bited a l losteri
bamoylase. (Derived from PDB ID 2AT2 .) This allosteric regulatory en
cally by L-isoleucine, the end
zyme has two stacked catalytic c l usters, each with th ree catalytic
product of the sequence, but not
polypeptide chains (in shades of blue and purple), and three regulatory low). The regulatory clusters form the poi nts of a triangle surrounding the cata lytic subun its. B i nding sites for allosteric modu lators are on the regulatory subunits. Modulator b i nding produces large changes i n en
by any of the four i ntermedi ates
coo
cl usters, each with two regulatory polypeptide cha i ns (in red and yel +
(A to D). Feedback inhibition is
I
H3N-C-H �--
I
H-C-CH3 I
zyme conformation and activity. The role of this enzyme i n nucleotide
CH2
synthesis, and details of its regulation, are di scussed i n Chapter 2 2 .
CH3
I
ind icated by the dashed feedback L-Isoleucine
l i ne and the ® symbol at the threon i ne dehydratase reaction arrow, a device used throughout this book.
222
Enzymes
This binding is noncovalent and readily reversible; if the isoleucine concentration decreases, the rate of threonine dehydration increases. Thus threonine dehydratase ac tivity responds rapidly and reversibly to fluctuations in the cellular concentration of isoleucine. As we shall see in Part II of this book, the patterns of regulation in many other metabolic pathways are much more complex. The Kinetic Properties of Allosteric Enzymes Diverge from
Ko.s
Michae!is-Menten Behavior
Allosteric enzymes show relationships between V0 and [S] that differ from Michaelis-Menten kinetics. They do exhibit saturation with the substrate when [S] is suffi ciently high, but for some allosteric enzymes, plots of V0 versus [S] (Fig. 6-:3-1) produce a sigmoid saturation curve, rather than the hyperbolic curve typical of non regulatory enzymes. On the sigmoid saturation curve we can find a value of [S] at which V0 is half-maximal, but we cannot refer to it with the designation Km, because the enzyme does not follow the hyperbolic Michaelis Menten relationship. Instead, the symbol [S]0.5 or K0.5 is often used to represent the substrate concentration giv ing half-maximal velocity of the reaction catalyzed by an allosteric enzyme (Fig. 6-34). Sigmoid kinetic behavior generally reflects coopera tive interactions between protein subunits. In other words, changes in the structure of one subunit are trans lated into structural changes in adjacent subunits, an ef fect mediated by noncovalent interactions at the interface between subunits. The principles are particularly well il lustrated by a nonenzyme: 02 binding to hemoglobin. Sig moid kinetic behavior is explained by the concerted and sequential models for subunit interactions (see Fig. 5-15). Homotropic allosteric enzymes generally are multi subunit proteins and, as noted earlier, the same binding site on each subunit functions as both the active site and the regulatory site. Most commonly, the substrate acts as a positive modulator (an activator), because the sub units act cooperatively: the binding of one molecule of substrate to one binding site alters the enzyme's confor mation and enhances the binding of subsequent sub strate molecules. This accounts for the sigmoid rather than hyperbolic change in V0 with increasing [S]. One characteristic of sigmoid kinetics is that small changes in the concentration of a modulator can be associated with large changes in activity. As is evident in Figure 6-34a, a relatively small increase in [S] in the steep part of the curve causes a comparatively large increase in V0. For heterotropic allosteric enzymes, those whose modulators are metabolites other than the normal sub strate, it is difficult to generalize about the shape of the substrate-saturation curve. An activator may cause the curve to become more nearly hyperbolic, with a decrease in K0.5 but no change in Vmax' resulting in an increased reaction velocity at a fixed substrate concentration (V0 is higher for any value of [S]; Fig. 6-34b, upper curve). Other heterotropic allosteric enzymes respond to an
[S ) (mM) (a)
K!"s Ko.s
Ko8s
[S] (mM) (b)
Vuuuc
------------------------·
Kos
[S) (mM)
(c) FIGURE 6-34 Substrate-activity curves for representative allosteric enzymes. Three examples of complex responses of al losteric enzymes to their modulators. (a) The sigmoid curve of a homotropi c enzyme, i n which the substrate also serves a s a positive (stimulatory) modulator, o r activator. Note the resemblance to the oxygen-saturation curve o f he moglobin (see Fig. 5-1 2).
(b) The effects of a positive modul ator (+ ) and
a negative modulator ( - ) on an al losteric enzyme i n which K05 is al
tered without a change i n Vmax· The central curve shows the substrate activity relationship without a modul ator.
(c)
A less common type of
modulation, in which Vmax is altered and K0 5 is nearly constant.
activator by an increase in Vmax with little change in K0.5 (Fig. 6-34c). A negative modulator (an inhibitor) may produce a more sigmoid substrate-saturation curve, with an increase in K0.5 (Fig. 6-34b, lower curve). Het erotropic allosteric enzymes therefore show different kinds of responses in their substrate-activity curves, because some have inhibitory modulators, some have activating modulators, and some have both.
6.5 Regu latory Enzymes
Some Enzymes Are Regulated by Reversible Covalent Modification
In another important class of regulatory enzymes, activ ity is modulated by covalent modification of one or more of the amino acid residues in the enzyme molecule. Over 500 different types of covalent modification have been found in proteins. Common modifying groups include phosphoryl, acetyl, adenylyl, uridylyl, methyl, amide, carboxyl, myristoyl, palmitoyl, prenyl, hydroxyl, sulfate, and adenosine diphosphate ribosyl groups (Fig. 6-35). There are even entire proteins that are used as special ized modifying groups, including ubiquitin and sumo. These varied groups are generally linked to and re moved from a regulated enzyme by separate enzymes. When an amino acid residue in an enzyme is modified, a novel amino acid with altered properties has effectively been introduced into the enzyme. Introduction of a charge can alter the local properties of the enzyme and induce a change in conformation. Introduction of a hydrophobic group can trigger association with a mem brane. The changes are often substantial and can be critical to the function of the altered enzyme. The variety of enzyme modifications is too great to cover in detail, but some examples can be offered. An example of an enzyme regulated by methylation is the methyl-accepting chemotaxis protein of bacteria. This protein is part of a system that permits a bacterium to swim toward an attractant (such as a sugar) in solution and away from repellent chemicals. The methylating agent is S-adenosylmethionine (adoMet) (see Fig. 18-18). Acetylation is a common modification, with approximately 80% of the soluble proteins in eukaryotes, including many enzymes, acetylated at their amino termini. Ubiquitin is added to proteins as a tag that predestines them for proteolytic degradation (see Fig. 27-47). Ubiquitination can also have a regulatory function. Sumo is found attached to many eukaryotic nuclear proteins with roles in the regulation of tran scription, chromatin structure, and DNA repair. ADP-ribosylation is an especially interesting reac tion, observed in a number of proteins; the ADP-ribose is derived from nicotinamide adenine dinucleotide (NAD) (see Fig. 8-38). This type of modification occurs for the bacterial enzyme dini.trogenase reductase, resulting in regulation of the important process of biological nitrogen fixation. Diphtheria toxin and cholera toxin are enzymes that catalyze the ADP-ribosylation (and inactivation) of key cellular enzymes or proteins. Phosphorylation is probably the most important type of regulatory modification. It is estimated that one third of all proteins in a eukaryotic cell are phosphory lated, and one or (often) many phosphorylation events are part of virtually every regulatory process. Some pro teins have only one phosphorylated residue, others have several, and a few have dozens of sites for phosphoryla tion. This mode of covalent modification is central to a large number of regulatory pathways, and we therefore
L223]
Covalent modification (target residues) Phosphorylation
(Tyr, Ser, Thr, His) 0
1)
ATP ADP
\,
II
1
Eu-P-oo-
Adenylylation
\, 1 ' Enz � 6-
(Tyr)
Enz
ATP PPi
0
-
/0
-O- CH2
H
H
H
0 --�-=--=/----)) Enz-�-CHs
Acetylation
(Lys, a-amino (amino terminus))
Enz
Acetyl-CoA
HS-CoA
Myristoylation
(a-amino (amino terminus))
� /
0 Enz-�-(CH2l12-CHs
Myristoyl-CoA HS-CoA Enz
Ubiquitination
(Lys)
� �c'-
�o
HS-
·
0
& tGa II �c-s�
--��--�
o-
®- �-s-e
-
activation
0
� /
Activated ubiquitin I·nz
1
HS-
Activated ubiquitin
� >
Enz-NH
� ��
0
A DP-ribosylation
(Arg, Gin, Cys, diphthamide-a modified His)
� /
NAD Em:
nicotinamide
----__=:: ,__....:::: ..., :...._ ____ -)
OH
Methylation
(Glu) S-adenosyl- S-adenosyl methionine homocysteine
Enz --�--=,__�/"'----�> Em-CHa FIGURE 6-35 Some enzyme modification reactions.
OH
[224]
Enzymes
discuss it in some detail. It will be discussed at length in Chapter 12. All of these modifications will be encountered again in this text. Phosphoryl Groups Affect the Structure a nd Catalytic Activity of Enzymes
The attachment of phosphoryl groups to specific amino acid residues of a protein is catalyzed by pro tein kinases; removal of phosphoryl groups is cat alyzed by protein phosphatases. The addition of a phosphoryl group to a Ser, Thr, or Tyr residue intro duces a bulky, charged group into a region that was only moderately polar. The oxygen atoms of a phos phoryl group can hydrogen-bond with one or several groups in a protein, commonly the amide groups of the peptide backbone at the start of an a helix or the charged guanidinium group of an Arg residue. The two negative charges on a phosphorylated side chain can also repel neighboring negatively charged (Asp or Glu) residues. When the modified side chain is located in a region of an enzyme critical to its three-dimen sional structure, phosphorylation can have dramatic effects on enzyme conformation and thus on substrate binding and catalysis. An important example of enzyme regulation by phosphorylation is seen in glycogen phosphorylase CMr 94,500) of muscle and liver (Chapter 15), which cat alyzes the reaction
more active phosphorylase a and the less active phospho rylase b (Fig. 6-36). Phosphorylase a has two subunits, each with a specific Ser residue that is phosphorylated at its hydroxyl group. These serine phosphate residues are required for maximal activity of the enzyme. The phos phoryl groups can be hydrolytically removed by a separate enzyme called phosphorylase phosphatase: Phosphorylase (more active)
a
+ 2H20
�
phosphorylase b + 2Pi (less active)
In this reaction, phosphorylase a is converted to phospho rylase b by the cleavage of two serine phosphate covalent bonds, one on each subunit of glycogen phosphorylase. Phosphorylase b can in turn be reactivated-cova lently transformed back into active phosphorylase a by another enzyme, phosphorylase kinase, which catalyzes the transfer of phosphoryl groups from ATP to the hydroxyl groups of the two specific Ser residues in phosphorylase b: 2ATP + phosphorylase b (less active)
�
2ADP + phosphorylase a (more active)
The glucose !-phosphate so formed can be used for ATP synthesis in muscle or converted to free glucose in the liver. Glycogen phosphorylase occurs in two forms: the
The breakdown of glycogen in skeletal muscles and the liver is regulated by variations in the ratio of the two forms of glycogen phosphorylase. The a and b forms dif fer in their secondary, tertiary, and quaternary struc tures; the active site undergoes changes in structure and, consequently, changes in catalytic activity as the two forms are interconverted. The regulation of glycogen phosphorylase by phos phorylation illustrates the effects on both structure and catalytic activity of adding a phosphoryl group. In the unphosphorylated state, each subunit of this enzyme is folded so as to bring the 20 residues at its amino termi nus, including a number of basic residues, into a region containing several acidic amino acids; this produces an
FIGURE 6-36 Regulation of muscle glycogen phosphorylase activity by multiple mechanisms. The activity of glycogen phosphorylase in muscle
other tissues, and activates the enzyme adenylyl cyclase. G l u cagon
(Glucose)n +Pi� (glucose)n -l +glucose 1-phosphate Glycogen Shortened glycogen chain
and epinephrine. Epinephrine binds to its receptor in muscle and some
is subjected to a m u lti level system of regulation, involving covalent
plays a simi lar role, binding to receptors in the l iver. This leads to the syn
modification (phosphorylation), allosteric regulation, and a regulatory
thesis of high levels of the modified nucleotide cycl i c AMP (cAMP; see
cascade sensitive to hormonal status that acts on the enzymes involved
p. 298), activating the enzyme cAMP-dependent protein kinase (also
in phosphorylation and dephosphorylation. In the more active form of
called protei n ki nase A or PKA). PKA phosphorylates several target pro
the enzyme, phosphorylase a, specific Ser residues, one on each sub
teins, among them phosphorylase ki nase and phosphoprotein phos
unit, are phosphorylated. Phosphorylase a is converted to the less active
phatase inhibitor 1 (PPI-1 ) . The phosphorylated phosphorylase kinase is
phosphorylase b by enzymatic loss of these phosphoryl groups, pro
activated and in turn phosphorylates and activates glycogen phosphory
moted by phosphoprotein phosphatase 1 (PP1 ). Phosphorylase b can be
lase. At the same time, the phosphorylated PPI-1 interacts with and in
reconverted (reactivated) to phosphorylase a by the action of phospho
h i bits PP1 . PPI-1 also keeps itself active (phosphorylated) by inhi biting
rylase kinase. The activity of both forms of the enzyme is a l losterically
phosphoprotein phosphatase 28 (PP2B), the enzyme that dephosphory
regulated by an activator (AMP) and by inhibitors (gl ucose &-phosphate
l ates (i nactivates) it. In this way, the equ i l ibrium between the a and b
and ATP) that bind to separate sites on the enzyme. The activities of
forms of glycogen phosphorylase is shifted decisively toward the more
phosphorylase kinase and PP1 are also regulated via a short pathway that responds to the hormones gl ucagon and epi nephrine. When blood
active glycogen phosphorylase a. Note that the two forms of phosphory 2 l ase ki nase are both activated to a degree by Ca + ion (not shown). This
sugar levels are low, the pancreas and adrenal glands secrete gl ucagon
pathway is discussed i n more detai l i n Chapters 1 4, 1 5, and 23.
6.5 Regulatory Enzymes
electrostatic interaction that stabilizes the conformation. 1 Phosphorylation of Ser 4 interferes with this interaction, forcing the amino-terminal domain out of the acidic envi ronment and into a conformation that allows interaction between the ® -Ser and several Arg side chains. In this conformation, the enzyme is much more active. Phosphorylation of an enzyme can affect catalysis in another way: by altering substrate-binding affinity. For example, when isocitrate dehydrogenase (an enzyme of the citric acid cycle; Chapter 16) is phosphorylated, elec trostatic repulsion by the phosphoryl group inhibits the binding of citrate (a tricarboxylic acid) at the active site. M u ltiple Phosphorylations Allow Exquisite Regulatory Control
The Ser, Thr, or Tyr residues that are phosphorylated in regulated proteins occur within common structural mo tifs, called consensus sequences, that are recognized by specific protein kinases (Table 6-10). Some kinases are basophilic, preferring to phosphorylate a residue having basic neighbors; others have different substrate prefer-
ences, such as for a residue near a Pro residue. Amino acid sequence is not the only important factor in deter mining whether a given residue will be phosphorylated, however. Protein folding brings together residues that are distant in the primary sequence; the resulting three dimensional structure can determine whether a protein kinase has access to a given residue and can recognize it as a substrate. Another factor influencing the substrate specificity of certain protein kinases is the proximity of other phosphorylated residues. Regulation by phosphorylation is often complicated. Some proteins have consensus sequences recognized by several different protein kinases, each of which can phosphorylate the protein and alter its enzymatic activ ity. In some cases, phosphorylation is hierarchical: a cer tain residue can be phosphorylated only if a neighboring residue has already been phosphorylated. For example, glycogen synthase, the enzyme that catalyzes the con densation of glucose monomers to form glycogen (Chapter 15), is inactivated by phosphorylation of spe cific Ser residues and is also modulated by at least four other protein kinases that phosphorylate four other
OH
Glucagon ---71'[cAMPJ
---
@ �- - - Insulin t. "("ICY - --
7
-.............. , .....
Glucose 6-phosphate - - -7® ATP - - -7® AMP - - -7@
td
OH
OH
',
'
'
'
'
'
\
Glucose ® � - - - 6-phosphate ® � - - - ATP @�-- - AM P
\
_
AT P
..... _ ....
,.-"
.,"
.;
"
/
/
/
I
\ I
I \ \ I I I I I I I I I I
Pho�phorylase b
ADP
[22s]
I
[226]
Enzy mes
TA B L E 6-10
* Consensus sequence and phosphorylated residue
Protein kinase Protein kinase A
-x-R-[RK]-x-[ST]-B-
Protein kinase G
-x-R-[RK]-x-[ST]-x-
Protein kinase C
-[RK](2)-x-[ST]-B-[RK](2)-
Protein kinase B 2+ Ca /calmodulin kinase I 2+ Ca /calmodulin kinase II
-x-R-x-[ST]-x-K-
Myosin light chain kinase (smooth muscle)
-K(2)-R-x(2)-S-x-B(2)-
Phosphorylase b kinase
-K-R-K-Q-I-S-V-R-
Extracellular signal-regulated kinase (ERK)
-P-x-[ST]-P(2)-
Cyclin-dependent protein kinase (cdc2)
-x-[ST]-P-x-[KR]-
Casein kinase I
-[SpTp]-x(2)-[ST]-B
13-Adrenergic receptor kinase
-x-[ST]-x(2)-[ED]-x-
Rhodopsin kinase
-x(2)-[ST]-E (n)-
Insulin receptor kinase
-x-E (3)-Y-M (4)-K(2)-S-R-G-D- l-M-T-M-Q-I-
Epidermal growth factor (EGF) receptor kinase
G-K(3)-L-P-A-T-G-D-1-M-N-M-S-P-V-G-D-E(4)-}-P-E-L-V-
-B-x-R-x(2)-[ST]-x(3) -B-B-x-[RK]-x(2)-[ST]-x(2)-
Casein kinase II
t
-[DE](n)-[ST]-x(3)
Sources: Pinna, L.A. & Ruzzene, M.H. (1996) How do protein kinases recognize their substrates? Biochim. Biophys. Acta 1314, 191-225; Kemp, B. E. & Pearson, R. B. (1990) Protein kinase recognition sequence motifs. Trends Biochem. Sci.15, 342-346; Kennelly, P.J. & Krebs, E.G. ( 1991) Consensus sequences as substrate specificity determinants for protein kinases and protein phosphatases. J. Bioi. Chern. 266, 15,555-15,558. * Shown here are deduced consensus sequences (in roman type) and actual sequences from known substrates (italic). The Ser (S), Thr (T). orTyr (Y) residue that undergoes phosphory· lation is in red; all amino acid residues are shown as their one-letter abbreviations (see Table 3- 1). x represents any amino acid. B. any hydrophobic amino acid. Sp, Tp, and Yp are Ser,
Thr, and Tyr residues that must already be phosphorylated lor the kinase to recognize the site. trhe best target site has two amino acid residues separating the phosphorylated and target Ser/ Thr residues; target sites with one or three intervening residues function at a reduced level.
Phosphorylation sites on 2 glyco gen _j_ synthase HaN
Kinase Protein kinase A Protein kinase G Protein kinase C CaZ+ /calmodulin kinase Phosphorylase b kinase Casein kinase I Casein kinase II Glyc ogen synthase kinase 3 Glycogen synthase kinase 4
3 r--� ABC
·-·
1 n AB
--�__,_ 1 1 ...J._ _ I _�_I-'-I__I _L_ _._ I
Phosphorylation sites l A, lB, 2, 4
4
5
Degree of synthase inactivation +
l A, B l , 2
+
l A
+
l B, 2 2
At least nine 5
3 A, 3B, 3 C
coo-
+ +
+ + + +
0
sites in the enzyme (Fig. 6-37). The enzyme is not a substrate for glycogen synthase kinase 3, for example, ufl.til one site has been phosphorylated by casein kinase II. Some phosphorylations inhibit glycogen synthase more than others, and some combinations of phosphory lations are cumulative. These multiple regulatory phos phorylations provide the potential for extremely subtle modulation of enzyme activity. To serve as an effective regulatory mechanism, phosphorylation must be reversible. In general, phos phoryl groups are added and removed by different en zymes, and the processes can therefore be separately regulated. Cells contain a family of phosphoprotein phosphatases that hydrolyze specific ®-Ser, ®- Thr, and ® -Tyr esters, releasing Pi. The phosphoprotein phosphatases we know of thus far act only on a subset of phosphoproteins, but they show less substrate specificity than protein kinases.
+ + +
Some Enzymes and Other Proteins Are Regulated by 2
+
FIGURE 6-37 Multiple regulatory phosphorylations. The enzyme glyco gen synthase has at least n i ne separate sites in five designated regions susceptible to phosphorylation by one of the cel l ular protein kinases. Thus, regu lation of this enzyme is a matter not of binary (on/off) switch ing but of finely tuned modulation of activity over a wide range i n response t o a variety o f signals.
Proteolytic Cleavage of a n Enzyme Precursor
For some enzymes, an inactive precursor called a zymo gen is cleaved to form the active enzyme. Many prote olytic enzymes (proteases) of the stomach and pancreas are regulated in this way. Chymotrypsin and trypsin are initially synthesized as chymotrypsinogen and trypsino gen (Fig. 6-38). Specific cleavage causes conforma tional changes that expose the enzyme active site.
6.5 Regu latory Enzymes
Chymotrypsinogen (inactive)
1
245
Trypsinogen (inactive) 1
6
7 I
l• l�Val-(Asp)4-Lys ·nli'I'O[W]H ida�. .;..>
:E .;..>
How can this information be used to develop a specific proce
u
concl
n�allon
[243]
The disaccharide maltose (Fig. 7-1 1 ) contains two o-glucose residues joined by a glycosidic linkage be tween C- 1 (the anomeric carbon) of one glucose residue and C-4 of the other. Because the disaccharide retains a free anomeric carbon (C-1 of the glucose residue on the right in Fig. 7-1 1) , maltose is a reducing sugar. The configuration of the anomeric carbon atom in the glycosidic linkage is a. The glucose residue with the free anomeric carbon is capable of existing in a- and {3-pyranose forms. K EY C O N V E N T I O N : To name reducing disaccharides such as maltose unambiguously, and especially to name more complex oligosaccharides, several rules are followed. By convention, the name describes the compound written with its nonreducing end to the left, and we can "build up" the name in the following order. (1) Give the config uration (a or /3) at the anomeric carbon joining the first monosaccharide unit (on the left) to the second. (2) Name the nonreducing residue; to distinguish five- and six-membered ring structures, insert "furano" or "pyrano" into the name. (3) Indicate in parentheses the two carbon atoms joined by the glycosidic bond, with an arrow connecting the two numbers; for example, (1�4) shows that C-1 of the first-named sugar residue is joined to C-4 of the second. (4) Name the second residue. If there is a third residue, describe the second glycosidic bond by the same conventions. (To shorten the descrip tion of complex polysaccharides, three-letter abbrevia tions or colored symbols for the monosaccharides are often used, as given in Table 7-1 .) Following this convention for naming oligosaccharides, maltose is a-o glucopyranosyl-(1 �4)-o-glucopyranose. Because most sugars encountered in this book are the o enantiomers and the pyranose form of hexoses predominates, we generally use a shortened version of the formal name of
n "u
hl•mi:u:t•t.tl
OR H
0
Abequose
Abe
Glucuronic acid
Arabinos e
Ara
Galactosamine
Fructose
Maltose a-o-glucopyranosyl-(1�4)-D-glucopyranose
FIGURE 7-1 1 Formation of maltose. A
TA B L E 7- 1
disaccharide is formed from
two monosaccharides (here, two molecules of o-glucose) when an -OH (alcohol) of one gl ucose molecule (right) condenses with the i n tramolecular hem i acetal o f t h e other glucose molecule (left), with
Fru
Gluc os amine
�
GlcA
0 GaiN � GleN
Fucose
A Fuc
N-Acetylgalactosamine 0 GalNAc
Galactose
0 Gal
N-Acetylglucosamine
Glucose Mannose Rhamnose
e Glc
Iduronic acid
• GlcNAc
�
IdoA
Muramic acid
Mur
Rha
N-Acetylmuramic acid
Mur2Ac
N-Acety!neuraminic acid (a sialic acid)
e Man
e l i m i nation of H20 and formation of a glycosidic bond. The reversal of
Ribose
Rib
this reaction is hydrolysis-attack by H20 on the glycosidic bond. The
Xylose
* Xyl
+ Neu5Ac
maltose molecule, shown here as an i l l ustration, reta i ns a reducing hemiacetal at the C-1 not involved i n the glycosidic bond. Because mutarotation interconverts the a and {3 forms of the hem i acetal, the bonds at this position are sometimes depi cted with wavy l i nes, as shown here, to i n d i cate that the structure may be either a or {3 .
Note: In a commonly used convention, hexoses are represented as circles, N-acetylhex osamines as squares, and hexosamines as squares divided diagonally. All sugars With the "gluco' configuration are blue, those with the "galacto' configuration are yellow, and "manno" sugars are green. Other substituents can be added as needed: sulfate (S). phosphate (P), 0-acetyl (OAc), or 0-methyl (Orne).
[_244j
Ca rbohyd rates a n d G lycobiology
such compounds, glVlng the configuration of the anomeric carbon and naming the carbons joined by the glycosidic bond. In this abbreviated nomenclature, maltose is Glc(al�4)Glc. • The disaccharide lactose (Fig. 7-12), which yields o-galactose and o-glucose on hydrolysis, occurs naturally in milk. The anomeric carbon of the glucose residue is available for oxidation, and thus lactose is a reducing di saccharide. Its abbreviated name is Gal(f3 1�4)Glc. Sucrose (table sugar) is a disaccharide of glucose and fructose. It is formed by plants but not by animals. In contrast to maltose and lactose, sucrose contains no free anomeric carbon atom; the anomeric carbons of both monosaccharide units are involved in the glycosidic bond (Fig. 7-12) . Sucrose is therefore a nonreducing sugar. In the abbreviated nomenclature, a double-headed arrow connects the symbols specifying the anomeric carbons and their configurations. For example, the ab breviated name of sucrose is either Glc(a l�2f3)Fru or Fru(f32�la) Glc. Sucrose is a major intermediate prod uct of photosynthesis; in many plants it is the principal form in which sugar is transported from the leaves to other parts of the plant body. Trehalose, Glc(al�la)Glc
(Fig. 7-12)-a disaccharide of o-glucose that, like su crose, is a nonreducing sugar-is a major constituent of the circulating fluid (hemolymph) of insects, serving as an energy-storage compound. Fungi also contain tre halose and are used as a commercial source of this sugar.
S U M M A RY 7 . 1
•
•
•
•
Lactose (/3 form) /3-n-galactopyranosyl-(1�4)-/3-n-glucopyranose Gai(f31�4)Glc
•
•
Sucrose /3-D-fructofuranosyl a-D-glucopyranoside Fru(2f3 - al)Glc = Glc(al -2f3)Fru H
Trehalose a-o-glucopyranosyl a-o-glucopyranoside Glc(al la)Glc
FIGURE 7-12 Some common disaccharides.
Like ma ltose in Figure
7-1 1 , these are shown as Haworth perspectives. The common name, fu l l systematic name, and abbreviation are given for each disaccharide. Formal nomenclature for sucrose names glucose as the parent glyco
side, although it is typica l l y depicted as shown, with gl ucose on the left.
Monos a c c h ari des and D is a c c h a ri des
Sugars (also called saccharides) are compounds containing an aldehyde or ketone group and two or more hydroxyl groups. Monosaccharides generally contain several chiral carbons and therefore exist in a variety of stereochemical forms, which may be represented on paper as Fischer projections. Epimers are sugars that differ in configuration at only one carbon atom. Monosaccharides commonly form internal hemiacetals or hemi.ketals, in which the aldehyde or ketone group joins with a hydroxyl group of the same molecule, creating a cyclic structure; this can be represented as a Haworth perspective formula. The carbon atom originally found in the aldehyde or ketone group (the anomeric carbon) can assume either of two configurations, a and /3, which are interconvertible by mutarotation. In the linear form, which is in equilibrium with the cyclic forms, the anomeric carbon is easily oxidized. A hydroxyl group of one monosaccharide can add to the anomeric carbon of a second monosaccharide to form an acetal. In this disaccharide, the glycosidic bond protects the anomeric carbon from oxidation. Oligosaccharides are short polymers of several monosaccharides joined by glycosidic bonds. At one end of the chain, the reducing end, is a monosaccharide unit with its anomeric carbon not involved in a glycosidic bond. The common nomenclature for di- or oligosaccharides specifies the order of monosaccharide units, the configuration at each anomeric carbon, and the carbon atoms involved in the glycosidic linkage(s).
7.2 Polysaccharides Most carbohydrates found in nature occur as polysac charides, polymers of medium to high molecular weight. Polysaccharides, also called glycans, differ from each other in the identity of their recurring monosaccharide units, in the length of their chains, in the types of bonds linking the units, and in the degree of branching. Homopolysaccharides contain only a single monomeric species; heteropolysaccharides contain two or more different kinds (Fig. 7-13). Some homopolysaccharides serve as storage forms of monosaccharides that are used as fuels; starch and glycogen are homopolysaccharides of this type. Other homopolysaccharides (cellulose and chitin, for example) serve as structural elements in plant
7 . 2 Polysa ccharides
Homopolysaccharides
Heteropolysaccharides
Unbranched
Two monomer types, unbranched
Branched
[245]
space is occupied by several types of heteropolysaccha rides, which form a matrix that holds individual cells to gether and provides protection, shape, and support to cells, tissues, and organs. Unlike proteins, polysaccharides generally do not have defining molecular weights. This difference is a consequence of the mechanisms of assembly of the two types of polymer. As we shall see in Chapter 27, proteins are synthesized on a template (messenger RNA) of de fined sequence and length, by enzymes that follow the template exactly. For polysaccharide synthesis there is no template; rather, the program for polysaccharide synthesis is intrinsic to the enzymes that catalyze the polymerization of the monomeric units, and there is no specific stopping point in the synthetic process.
Multiple monomer types, branched
Some H o mopolysaccharides Are Stored Forms of Fuel
FIGURE 7-1 3 Homo- and heteropolysaccharides.
Polysaccharides
may be composed of one, two, or several different monosaccharides, in straight or branched chains of varying l ength .
cell walls and animal exoskeletons. Heteropolysaccha rides provide extracellular support for organisms of all kingdoms. For example, the rigid layer of the bacterial cell envelope (the peptidoglycan) is composed in part of a heteropolysaccharide built from two alternating mono saccharide units. In animal tissues, the extracellular
Noureducing end
L
The most important storage polysaccharides are starch in plant cells and glycogen in animal cells. Both polysac charides occur intracellularly as large clusters or gran ules. Starch and glycogen molecules are heavily hydrated, because they have many exposed hydroxyl groups available to hydrogen-bond with water. Most plant cells have the ability to form starch (see Fig. 20-2) , and starch storage is especially abundant in tubers (underground stems) , such as potatoes, and in seeds. Starch contains two types of glucose polymer, amy lose and amylopectin (Fig. 7-14). The former consists
0
0
0
Reducing end
H
OR
(a) Amylose
0 Branch
H
OH
I
(a1�6) branch point
Amylose
0
- - }""'"'"'•
6 CH2
ends
0
J
Nonreducing ends
O
Main chain
R
OR
( b) FIGURE 7-14 Glycogen and starch. (a) A
(c) short segment of amylose, a
amylose and amylopectin l i ke that believed to occur i n starch gran u les.
l i near polymer of o-glucose residues in (al �4) l i n kage. A single chain
Strands of amylopectin (red) form double-helical structu res with each
can contain several thousand gl ucose residues. Amyl opect i n has
other or with amylose strands (blue). G l ucose residues at the nonreduc
stretches of s i m i larly l i n ked residues between branch points. G lycogen
ing ends of the outer branches are removed enzymatically during the
has the same basic structure, but has more branchi ng than amylopectin.
mobilization of starch for energy production. Glycogen has a similar
(b) An (al �6) branch point of glycogen or amylopectin. (c) A cluster of
structure but is more high l y branched and more compact.
[246]
Carbohydrates a n d G l ycobiology
of long, unbranched chains of o-glucose residues con nected by (al�4) linkages (as in maltose) . Such chains vary in molecular weight from a few thousand to more than a million. Amylopectin also has a high molecular weight (up to 200 million) but unlike amylose is highly branched. The glycosidic linkages joining successive glucose residues in amylopectin chains are (al�4) ; the branch points (occurring every 24 to 30 residues) are (a l�6) linkages. Glycogen is the main storage polysaccharide of animal cells. Like amylopectin, glycogen is a polymer of (a l�4)-linked subunits of glucose, with (a1�6)-linked branches, but glycogen is more extensively branched (on average, every 8 to 12 residues) and more compact than starch. Glycogen is especially abundant in the liver, where it may constitute as much as 7% of the wet weight; it is also present in skeletal muscle. In hepato cytes glycogen is found in large granules, which are themselves clusters of smaller granules composed of single, highly branched glycogen molecules with an average molecular weight of several million. Such glyco gen granules also contain, in tightly bound form, the enzymes responsible for the synthesis and degradation of glycogen. Because each branch in glycogen ends with a nonre ducing sugar unit, a glycogen molecule with n branches has n + 1 nonreducing ends, but only one reducing end. When glycogen is used as an energy source, glucose units are removed one at a time from the nonreducing ends. Degradative enzymes that act only at nonreducing ends can work simultaneously on the many branches, speeding the conversion of the polymer to monosaccharides. Why not store glucose in its monomeric form? It has been calculated that hepatocytes store glycogen equiva lent to a glucose concentration of 0.4 M. The actual concentration of glycogen, which is insoluble and con tributes little to the osmolarity of the cytosol, is about 0.01 J.LM . If the cytosol contained 0.4 M glucose, the osmolarity would be threateningly elevated, leading to osmotic entry of water that might rupture the cell (see Fig. 2-12) . Furthermore, with an intracellular glucose concentration of 0.4 M and an external concentration of about 5 mM (the concentration in the blood of a mam mal) , the free-energy change for glucose uptake into cells against this very high concentration gradient would be prohibitively large. Dextrans are bacterial and yeast polysaccharides made up of (al�6) -linked poly-o-glucose ; all have (a 1�3) branches, and some also have (a 1�2) or (a1�4) branches. Dental plaque, formed by bacteria growing on the surface of teeth, is rich in dextrans. Syn thetic dextrans are used in several commercial products (for example, Sephadex) that serve in the fractionation of proteins by size-exclusion chromatography (see Fig. 3-1 7b) . The dextrans in these products are chemi cally cross-linked to form insoluble materials of various porosities, admitting macromolecules of various sizes.
Some Homo polysaccharides Serve Structural Roles
Cellulose, a fibrous, tough, water-insoluble substance, is found in the cell walls of plants, particularly in stalks, stems, trunks, and all the woody portions of the plant body. Cellulose constitutes much of the mass of wood, and cotton is almost pure cellulose. Like amylose, the cellulose molecule is a linear, unbranched homopolysac charide, consisting of 10,000 to 1 5,000 o-glucose units. But there is a very important difference: in cellulose the glucose residues have the f3 configuration (Fig. 7-1 5 ) , whereas in amylose the glucose is in the a configuration. The glucose residues in cellulose are linked by ({31�4) glycosidic bonds, in contrast to the (a1�4) bonds of amylose . This difference gives cellulose and amylose very different structures and physical properties. Glycogen and starch ingested in the diet are hy drolyzed by a-amylases and glycosidases, enzymes in saliva and the intestine that break (a1�4) glycosidic bonds between glucose units. Most animals cannot use cellulose as a fuel source, because they lack an enzyme to hydrolyze the ({31�4) linkages. Termites readily di gest cellulose (and therefore wood) , but only because their intestinal tract harbors a symbiotic microorganism,
OH
I l l
OH
\
0
({:ll-->4)-linked o-glucose units
( a)
FIGURE 7-15 Cellulose. (a)
Two units of a cel lulose chain; the o-glu
cose residues are i n ({31 ---+4) linkage. The rigid chair structures can ro tate relative to one another.
(b)
Scale drawing of segments of two
parallel cel l u lose chains, showing the conformation of the o-glucose residues and the hydrogen-bond cross- l i n ks. In the hexose unit at the lower left, all hydrogen atoms are shown; in the other three hexose un its, the hydrogens attached to carbon have been omitted for clarity, as they do not participate i n hydrogen bonding.
7.2 Polysaccharides
[247]
FIGURE 7-16 Cellulose breakdown by wood fungi. A wood fungus growing on an oak log. All wood fungi have the enzyme cel l u l ase, which breaks the ({31 �4) glycosidic bonds in cel l u l ose, so that wood is a source of metabol izable sugar (gl ucose) for the fungus. The only vertebrates able to use cellulose as food are cattle and other ruminants (sheep, goats, camels, gi raffes). The extra stomach compartment (rumen) of a ruminant teems with bacteria and protists that secrete cel lulase.
H:J
C=O
I NH 0
2
0
0 I!
NH
I
(a)
C=O I CH3
H
NH I
C=O I CH3
FIGURE 7-1 7 Chitin. (a) A short segment of chitin, a homopolymer of N-acetyl-o-glucosamine units in (/31 �4) l i nkage.
(b)
A spotted june
beetle (Pelidnota punctata), showing its surface armor (exoskeleton) of chitin .
Steric Factors and Hydrogen Bonding Influence Homopolysaccharide Folding
(b)
Trichonympha, that secretes cellulase, which hy drolyzes the ({31�4) linkages. Wood-rot fungi and bac teria also produce cellulase (Fig. 7-16) . Chitin is a linear homopolysaccharide composed of N-acetylglucosamine residues in (131�4) linkage (Fig. 7-17) . The only chemical difference from cellulose is the replacement of the hydroxyl group at C-2 with an acetylated amino group. Chitin forms extended fibers similar to those of cellulose, and like cellulose cannot be digested by vertebrates. Chitin is the principal com ponent of the hard exoskeletons of nearly a million species of arthropods-insects, lobsters, and crabs, for example-and is probably the second most abundant polysaccharide, next to cellulose, in nature; an esti mated 1 billion tons of chitin are produced each year in the biosphere!
The folding of polysaccharides in three dimensions fol lows the same principles as those governing polypeptide structure: subunits with a more-or-less rigid structure dictated by covalent bonds form three-dimensional macromolecular structures that are stabilized by weak interactions within or between molecules: hydrogen bonds and hydrophobic and van der Waals interactions, and, for polymers with charged subunits, electrostatic interactions. Because polysaccharides have so many hydroxyl groups, hydrogen bonding has an especially important influence on their structure. Glycogen, starch, and cellulose are composed of pyranoside subunits (having six-membered rings) , as are the oligosaccha rides of glycoproteins and glycolipids to be discussed later. Such molecules can be represented as a series of rigid pyranose rings connected by an oxygen atom bridging two carbon atoms (the glycosidic bond) . There is , in principle, free rotation about both c-o bonds linking the residues (Fig. 7-15a) , but as in polypeptides (see Figs 4-2 , 4-8) , rotation about each bond is lim ited by steric hindrance by substituents. The three dimensional structures of these molecules can be
[248]
Carbo hyd rates a n d Glycobiology
described in terms of the dihedral angles, cp and P, about the glycosidic bond (Fig. 7-18 ), analogous to angles cp and 1Jf made by the peptide bond (see Fig. 4-2) . The bulkiness of the pyranose ring and its sub stituents, and electronic effects at the anomeric carbon, place constraints on the angles cp and P; thus certain conformations are much more stable than others, as can be shown on a map of energy as a function of cp and 1Jf (Fig. 7-19). The most stable three-dimensional structure for the (al�4)-linked chains of starch and glycogen is a tightly coiled helix (Fig. 7-20), stabilized by interchain hydro gen bonds. In amylose (with no branches) this structure is regular enough to allow crystallization and thus deter mination of the structure by x-ray diffraction. The aver age plane of each residue along the amylose chain forms a 60° angle with the average plane of the preceding residue, so the helical structure has six residues per turn. For amylose, the core of the helix is of precisely the right dimensions to accommodate iodine as complex ions (13- and 15-), giving an intensely blue complex. This interaction is a common qualitative test for amylose. For cellulose, the most stable conformation is that in which each chair is turned 180° relative to its neighbors, yielding a straight, extended chain. All -OH groups are available for hydrogen bonding with neighboring chains. With several chains lying side by side, a stabilizing network of interchain and intrachain hydrogen bonds produces straight, stable suprarnolecular fibers of great tensile strength (Fig. 7-15b) . This property of cellulose has made it a useful substance to civilizations for millennia. Many manufactured products, i ncluding papyrus, paper, card board, rayon, insulating tiles, and a variety of other useful materials, are derived from cellulose. The water content of
,� CH20H � 0 CH20H Q 4
HO
O I I I H
cP
OH
·�
4
HO
I
O
C ellulos e (f31--+ 4)Glc repeats
Amylose (al--+4)Glc repeats
Dextran (al--+6)Glc repeats (with (al--+3) branches, not shown) FIGURE 7-1 8 Conformation at the glycosidic bonds of cellulose, amy lose, and dextran. The polymers are depicted as rigid pyranose rings joi ned by glycosidic bonds, with free rotation about these bonds. Note that in dextran there is also free rotation about the bond between C-5 and C-6 (tors ion angle UJ (omega)).
these materials is low because extensive interchain hydro gen bonding between cellulose molecules satisfies their capacity for hydrogen-bond formation.
(b)
(a)
• f1>,1Jt
=
- 1 70°, - 170°
FIGURE 7-19 A map of favored conformations for oligosaccharides and polysaccharides. The torsion angles 1ft and cfJ (see Fig. 7-1 8), which de
ogous to the Ramachandran plot for peptides (see Figs 4-3, 4-8).
fine the spatial relationship between adjacent ri ngs, can in principle
(b)
have any value from 0° to 360°. I n fact, some of the torsion angles would
values fall on the energy diagram
give conformations that are sterically h i ndered, whereas others give con
The red dot indicates the least favored conformation, the blue dot the
formations that maximize hydrogen bonding.
most favored conformation. The known conformations of the three poly
(a) When
the relative en
ergy (l) is plotted for each value of ¢ and 1/1, with isoenergy ("same energy") contours drawn at i ntervals of 1 kcal/mol above the m i n i mum
energy state, the result is a map of preferred conformations. This is anal Two energetic extremes for the disaccharide Gai(J31 --+3)Gal; these
(a) as shown
by the red and blue dots .
saccharides shown in Figure 7-1 8 have been determined by x-ray crys tal lography, and a l l fal l with i n the lowest-energy regions of the map.
7 . 2 Polysaccha r i d es
[249]
0 Agarose 3)n-Gal(f31�4)3,6-anhydro-L-Gal2S(a l repeating units
FIGURE 7-21 Agarose.
The repeating u n i t consists of o-galactose
({3 1 ---74)-li nked to 3,6-anhydro-L-galactose (in which an ether bridge connects C-3 and C-6). These units are joi ned by (a1 ---? 3 ) glycosidic l i nks to form a polymer 600 to 700 residues long. A small fraction of the 3, 6-anhydrogalactose residues have a su lfate ester at C-2 (as shown here). (a l-->4)-linked
o-glucose units
(a)
(b)
FIGURE 7-20 Starch (amylose). (a) In the most stable conformation, with adjacent rigid chai rs, the polysaccharide chain is curved, rather than l i n ear as in cel l u lose (see Fig. 7-1 5).
(b) A model of a segment of amylose;
for clarity, the hydroxyl groups have been omitted from a l l but one of the gl ucose residues. Compare the two residues shaded in pink with the chemical structures in
(a). The conformation of (a1 -->4) linkages in amy
lose, amylopectin, and glycogen causes these polymers to assume tightly coiled helical structures. These compact structures produce the dense granules of stored starch or glycogen seen in many cells (see Fig. 20-2).
Bacterial a n d Algal Cel l Wa lls Contain Structural Heteropolysaccha rides The rigid component of bacterial cell walls (peptidogly can) is a heteropolymer of alternating ({31�4) -linked N-acetylglucosamine and N-acetylmmamic acid residues (see Fig. 20-31). The linear polymers lie side by side in the cell wall, cross-linked by short peptides, the exact structme of which depends on the bacterial species. The peptide cross-links weld the polysaccharide chains into a strong sheath that envelops the entire cell and prevents cellular swelling and lysis due to the osmotic entry of water. The enzyme lysozyme kills bacteria by hydrolyzing the ({3 1�4) glycosidic bond between N-acetylglucosa mine and N-acetylmuramic acid (see Fig. 6-24) . Lysozyme is notably present in tears, presumably as a de fense against bacterial infections of the eye. It is also pro duced by certain bacterial viruses to ensme their release from the host bacterial cell, an essential step of the viral infection cycle. Penicillin and related antibiotics kill bacte ria by preventing synthesis of the cross-links, leaving the cell wall too weak to resist osmotic lysis (see pp. 216-21 7) . Certain marine red algae, including some o f the sea weeds, have cell walls that contain agar, a mixture of sulfated heteropolysaccharides made up of D-galactose and an L-galactose derivative ether-linked between C-3 and C-6. Agar is a complex mixture of polysaccharides, all with the same backbone structure , but substituted to varying degrees with sulfate and pyruvate. Agarose CMr 150,000) is the agar component with the fewest charged groups (sulfates, pyruvates) ( Fig. 7-2 1 ) . The remarkable gel-forming property of agarose makes it �
useful in the biochemistry laboratory. When a suspen sion of agarose in water is heated and cooled, the agarose forms a double helix: two molecules in parallel orientation twist together with a helix repeat of three residues; water molecules are trapped in the central cavity. These structures in turn associate with each other to form a gel-a three-dimensional matrix that traps large amounts of water. Agarose gels are used as inert supports for the electrophoretic separation of nucleic acids, an essential part of the DNA sequencing process (p. 292) . Agar is also used to form a surface for the growth of bacterial colonies. Another commercial use of agar is for the capsules in which some vitamins and drugs are packaged; the dried agar material dis solves readily in the stomach and is metabolically inert. Glycosaminoglycans Are H eteropolysaccharides of the Extracel l u lar Matrix The extracellular space in the tissues of multicellular animals is filled with a gel-like material, the extracellu lar matrix (ECM) , also called ground substance , which holds the cells together and provides a porous pathway for the diffusion of nutrients and oxygen to individual cells. The reticular ECM that surrounds fi broblasts and other connective tissue cells is composed of an interlocking meshwork of heteropolysaccharides and fibrous proteins such as fibrillar collagens, elastin, and fibronectin. Basement membrane is a specialized ECM that underlies epithelial cells; it consists of special ized collagens, 1aminin, and heteropolysaccharides. These heteropolysaccharides, the glycosaminogly cans, are a family of linear polymers composed of repeating disaccharide units (Fig. 7-22 ) . They are unique to animals and bacteria and are not found in plants. One of the two monosaccharides is always either N-acetylglucosamine or N-acetylgalactosamine; the other is in most cases a uronic acid, usually D-glucuronic or L-iduronic acid. Some glycosaminoglycans contain es terified sulfate groups. The combination of sulfate groups and the carboxylate groups of the uronic acid residues gives glycosaminoglycans a very high density of negative charge. To minimize the repulsive forces among neighboring charged groups, these molecules assume an
[2s o]
Carbohydrates a n d Glycobiology
Glycosaminoglycan Number of disaccharides per chain
Repeating disaccharide
FIGURE 7-22 Repeating units of some common glycosaminoglycans of extracellular matrix. The molecules are copolymers of alternating uronic acid and a m i no sugar residues (keratan sulfate i s the exception),
2 X 1 0 ) and its associated water of hy
in the target cell's plasma membrane. Syndecan pres
hyaluronate (l'' ig.
ents FGF to the FGF plasma membrane receptor, and
dration occupy a volume about equal to that of a bacter
only then can FGF interact productively with its recep
ial cell! Aggrecan interacts strongly with collagen in the
tor to trigger cell division. Finally, in another type of
extracellular matrix of cartilage, contributing to the de
mechanism, the NS domains interact-electrostatically
velopment, tensile
and otherwise-with a variety of soluble molecules out
connective tissue.
side the cell, maintaining high local concentrations at the cell surface (Fig. 7-26d) .
strength,
and resiliency of this
Interwoven with these enormous extracellular pro teoglycans are fibrous matrix proteins such as collagen,
The importance of correctly synthesizing sulfated
elastin, and fibronectin, forming a cross-linked mesh
domains in heparan sulfate is demonstrated in mutant
work that gives the whole extracellular matrix strength
("knockout") mice lacking the enzyme that sulfates the
and resilience. Some of these proteins are multiadhe
C-2 hydroxyl of IdoA. These animals are born without
sive , a single protein having binding sites for several dif
kidneys and with very severe developmental abnormali
ferent matrix molecules. Fibronectin, for example, has
ties of the skeleton and eyes. Other studies demonstrate
separate domains that bind fibrin, heparan sulfate, colla
that membrane proteoglycans are important in lipopro
gen, and a family of plasma membrane proteins called
tein clearance in the liver. There is growing evidence
integrins that mediate signaling between the cell inte
that the path taken by developing axons in the nervous
rior and the extracellular matrix (see Fig. 1 2-28) . The
system, and thus the wiring circuitry, is influenced by
overall picture of cell-matrix interactions that emerges
7 . 3 Glycoco nj u g ates: Proteoglycans, Glycoprote ins, a n d Glyco l i p i d s
[2ss]
Proteoglycan
'1��1;�- Cross-linked fibers of collagen
Plasma membrane FIGURE 7-28 Interactions between cells and the extracellular matrix.
FIGURE 7-27 Proteoglycan aggregate of the extracellular matrix.
The assoc iation between cel l s and the proteoglycan of the extracel lu
Schematic drawing of a proteoglycan with many aggrecan molecules.
lar matrix is medi ated by a membrane protein (integrin) and by an ex
One very long molecule of hya luronan is associated noncovalently with
tracellu lar protein (fibronecti n in this example) with b i n d i ng sites for
about 1 00 molecules of the core protein aggrecan . Each aggrecan mol
both i n tegrin and the proteoglycan. Note the c lose association of col
ecule contains many covalently bound chondroitin sulfate and keratan
lagen fibers with the fibronectin and proteoglycan.
su lfate chains. L i n k proteins at the junction between each core protei n a n d the hyaluronan backbone mediate the core protei n-hyaluronan in
Glycoproteins Have Covalently Attached Oligosaccharides
teraction. The micrograph shows a single molecule of aggrecan, viewed with the atomic force microscope (see Box 1 1 -1 ).
Glycoproteins are carbohydrate-protein conjugates in which the glycans are smaller, branched, and more
shows an array of interactions between cel
structurally diverse than the glycosaminoglycans of
lular and extracellular molecules. These interactions
proteoglycans. The carbohydrate is attached at its
serve not merely to anchor cells to the extracellular
anomeric carbon through a glycosidic link to the -OH
matrix but also to provide paths that direct the migration
of a Ser or Thr residue (0-linked) , or through an N-gly
(Fig. 7 -28)
of cells in developing tissue and to convey information
cosyl link to the amide nitrogen of an Asn residue (N
in both directions across the plasma membrane.
linked)
(Fig. 7 - 2 9 ).
Some glycoproteins have a single
(b) N-linked
(a) 0-linked
� yt-o�-8-oJJrt 9
HOCfl.
)
�
FIGURE 7-29 Oligosaccharide linkages in glycopro teins. (a) 0- l i n ked ol igosaccharides have a glyco sidic bond to the hydroxyl group of Ser or Thr residues (pink), i l l ustrated here with Gai NAc as the sugar at the reducing end of the ol igosaccharide. One s i m p l e c h a i n a n d o n e complex cha i n are shown .
(b) N-linked
ol igosaccharides have an N-glycosyl bond to the am ide n itrogen of an Asn residue (green), i l l ustrated here with G lcNAc as the terminal sugar. Three com mon types of oligosaccharide chains that are N-li nked in glycoproteins are shown . A complete description of ol igosaccharide structure req u i res specification of the position and stereochemistry (a or {3) of each glyco sidic l i n kage.
Example :
1
er .E
�
H
NH I
C=O I CH3 GlcNAc
Asn
�
Examples:
• GlcNAc
e Man O Gal +Neu5Ac D
GalNAc
[2s6]
Ca rbohyd rates a n d Glycobiology
oligosaccharide chain, but many have more than one;
Many o f the proteins secreted by eukaryotic cells
the carbohydrate may constitute from 1% to 70% or
are glycoproteins, including most of the proteins of
Mucins are secreted
blood. For example, immunoglobulins (antibodies) and
more of the glycoprotein by mass.
or membrane glycoproteins that can contain large num
certain hormones , such as follicle-stimulating hormone,
bers of 0-linked oligosaccharide chains . Mucins are
luteinizing hormone, and thyroid-stimulating hormone,
present in most secretions; they give mucus its charac
are glycoproteins. Many milk proteins, including lactal
teristic slipperiness. About half of all proteins of mam
bumin, and some of the proteins secreted by the pan
mals are glycosylated, and about 1 % of all mammalian
creas (such as ribonuclease) are glycosylated, as are
genes encode enzymes involved in the synthesis and
most of the proteins contained in lysosomes.
attachment of these oligosaccharide chains . Sequences
The biological advantages of adding oligosaccha
for the attachment of 0-linked chains tend to be rich in
rides to proteins are slowly being uncovered. The very
Gly, Val, and Pro residues. In contrast the attachment of
hydrophilic clusters of carbohydrate alter the polarity
N-linked chains depends on the consensus sequence
and solubility of the proteins with which they are conju
N-{P}-[ST] (see Box 3-3 for the conventions on repre
gated. Oligosaccharide chains that are attached to newly
(ER)
senting consensus sequences) . As with proteoglycans,
synthesized proteins in the endoplasmic reticulum
not all potential sites are used.
and elaborated in the Golgi complex serve as destination
One class of glycoproteins found in the cytoplasm
labels and also act in protein quality control, targeting
and the nucleus is unique in that the glycosylated posi
misfolded proteins for degradation (see Fig. 27-39) .
tions in the protein carry only single residues of
When numerous negatively charged oligosaccharide
N-acetylglucosamine , in 0-glycosidic linkage to the
chains are clustered in a single region of a protein, the
hydroxyl group of Ser side chains. This modification
charge repulsion among them favors the formation of an
is reversible and often occurs on the same Ser residues
extended, rodlike structure in that region. The bulki
that are phosphorylated at some stage in the protein's
ness and negative charge of oligosaccharide chains also
activity. The two modifications are mutually exclusive,
protect some proteins from attack by proteolytic en
and this type of glycosylation may prove to be important
zymes. Beyond these global physical effects on protein
in the regulation of protein activity. We discuss it in the
structure, there are also more specific biological effects
context of protein phosphorylation in Chapter 1 2 .
of oligosaccharide chains in glycoproteins (Section 7.4) .
As we shall see in Chapter 1 1 , the external surface
The importance of normal protein glycosylation is clear
of the plasma membrane has many membrane glycopro
from the finding of at least 18 different genetic disorders
teins with arrays of covalently attached oligosaccharides
of glycosylation in humans, all causing severely defec
of varying complexity. The first well-characterized mem
tive physical or mental development; some of these dis
brane glycoprotein was glycophorin A of the erythrocyte
orders are fatal.
membrane (see Fig. 1 1-7) . It contains 60% carbohy drate by mass, in the form of 16 oligosaccharide chains (totaling 60 to 70 monosaccharide residues) covalently attached to amino acid residues near the amino termi
Glycolipids and lipopolysaccharides Are Membrane Com ponents
nus of the polypeptide chain. Fifteen of the oligosaccha
Glycoproteins are not the only cellular components that
ride chains are 0-linked to Ser or Thr residues , and one
bear complex oligosaccharide chains; some lipids, too,
is N-linked to an Asn residue.
have covalently bound oligosaccharides.
Gangliosides
Glycomics is the systematic characterization of all
are membrane lipids of eukaryotic cells in which the po
of the carbohydrate components of a given cell or tissue,
lar head group, the part of the lipid that forms the outer
including those attached to proteins and to lipids . For
surface of the membrane , is a complex oligosaccharide
glycoproteins, this also means determining which pro
containing a sialic acid (Fig. 7-9) and other monosac
teins are glycosylated and where in the amino acid se
charide residues . Some of the oligosaccharide moieties
quence each oligosaccharide is attached. This is a
of gangliosides , such as those that determine human
challenging undertaking, but worthwhile because of the
blood groups (see Fig. 1 0-15) , are identical with those
potential insights it offers into normal patterns of glyco
found in certain glycoproteins, which therefore also
sylation and the ways in which they are altered during
contribute to blood group type . Like the oligosaccharide
development or in genetic diseases or cancer. Current
moieties of glycoproteins, those of membrane lipids are
methods of characterizing the whole carbohydrate com
generally, perhaps always, found on the outer face of the
plement of cells depend heavily on sophisticated appli
plasma membrane.
cation of mass spectroscopy (see Fig. 7-37) .
Lipopolysaccharides are the dominant surface
The structures of a large number of 0- and N-linked
feature of the outer membrane of gram-negative
oligosaccharides from a variety of glycoproteins are
bacteria such as Escherichia coli and Salmonella
known; Figure 7-29 shows a few typical examples. We
typhimurium. These molecules are prime targets of
consider the mechanisms by which specific proteins ac
the antibodies produced by the vertebrate immune sys
quire specific oligosaccharide moieties in Chapter 2 7 .
tem in response to bacterial infection and are therefore
7 . 4 Carbo hyd rates as I n formationa l Molecules: The S u g a r Code
S U M MA RY 7 . 3
[2s7]
Glycoconjugates: P roteoglycans, Glycoproteins, and Glycoli pids
0-Specific chain
• GlcNAc • Man e Glc
•
O Gal
Proteoglycans are glycoconjugates in which one or more large glycans, called sulfated glycosaminoglycans (heparan sulfate, chondroitin sulfate, dermatan sulfate, or keratan sulfate) are covalently attached to a core protein. Bound to the outside of the plasma membrane by a transmembrane peptide or a covalently attached lipid, proteoglycans provide points of adhesion,
0
recognition, and information transfer between cells, or between the cell and the extracellular matrix.
HO •
Glycoproteins contain oligosaccharides covalently linked to Asp or Ser/Thr residues. The glycans are typically branched and smaller than glycosaminoglycans. Many cell surface or extracellular proteins are glycoproteins, as are
0
most secreted proteins . The covalently attached
Lipid A
oligosaccharides influence the folding and stability of the proteins, provide critical information about the targeting of newly synthesized proteins, and allow for specific recognition by other proteins. •
Glycomics is the determination of the full complement of sugar-containing molecules in a cell or tissue, and the determination of the function of each such molecule.
FIGURE 7-30 Bacterial lipopolysaccharides.
Schematic diagram of the
l i popolysaccharide of the outer membrane of Salmonella typhimurium. Kdo is 3-deoxy-o-manno-octu losonic acid (previously cal led ke todeoxyoctonic acid); Hep is L-glycero-o-manno-heptose; AbeOAc is
•
Glycolipids in plants and animals and lipopoly saccharides in bacteria are components of the cell envelope with covalently attached oligosaccharide chains exposed on the cell's outer surface.
abequose (a 3,6-dideoxyhexose) acetylated on one of its hydroxyls. There are six fatty acid residues i n the l i pid A portion of the molecule. D i fferent bacterial species have subtly different l i popolysaccharide structu res, but they have in common a l i pid region (l ipid A), a core oligosaccharide also known as endotoxin, and an "0-specific" chain, which is the principal determ inant of the serotype (immunological reactivity) of the bacteri u m . The outer membranes of the gram-negative
bacteria 5. typhimurium and E. coli contain so many l i popolysaccharide molecules that the cel l surface is virtua l l y covered with 0-specific
chains.
7.4 Carbohydrates as Informational Molecules: The Sugar Code Glycobiology, the study o f the structure and function of glycoconjugates, is one of the most active and exciting areas of biochemistry and cell biology. As is becoming increasingly clear, cells use specific oligosaccharides to encode important information about intracellular tar geting of proteins, cell-cell interactions, cell differentia tion and tissue development, and extracellular signals.
important determinants of the serotype of bacterial
Our discussion uses just a few examples to illustrate the
strains (serotypes are strains that are distinguished on
diversity of structure and the range of biological activity
the basis of antigenic properties) . The lipopolysaccha
of the glycoconjugates. In Chapter 20 we discuss the
rides of S. typhimurium contain six fatty acids bound
biosynthesis of polysaccharides, including peptidogly
to two glucosamine residues, one of which is the point of
can; and in Chapter 27, the assembly of oligosaccharide
attachment for a complex oligosaccharide
chains on glycoproteins .
(Fig. 7-30) .
E. coli has similar but unique lipopolysaccharides. The
Improved methods for the analysis of oligosaccha
lipid A portion of the lipopolysaccharides of some bacte
ride and polysaccharide structure have revealed remark
ria is called endotoxin; its toxicity to humans and other
able complexity and diversity in the oligosaccharides of
animals is responsible for the dangerously lowered
glycoproteins and glycolipids. Consider the oligosaccha
blood pressure that occurs in toxic shock syndrome re
ride chains in Figure 7-29, typical of those found in
sulting from gram-negative bacterial infections. •
many glycoproteins. The most complex of those shown
[2ss]
Carbohyd rates a n d Glycobiolog y
contains 1 4 monosaccharide residues of four different kinds, variously linked as (1�2) , (1�3) , (1�4) , ( 1�6) , (2�3) , and (2�6) , some with the a and some with the f3 configuration. Branched structures, not found in nu cleic acids or proteins, are common in oligosaccharides. With the reasonable assumption that 20 different mono saccharide subunits are available for construction of oligosaccharides, we can calculate that many billions of different hexameric oligosaccharides are possible; this compares with 6.4 x 107 (206) different hexapeptides possible with the 20 common amino acids, and 4,096 (46) different hexanucleotides with the four nucleotide sub units. If we also allow for variations in oligosaccharides resulting from sulfation of one or more residues, the number of possible oligosaccharides increases by two orders of magnitude. In reality, only a subset of possible combinations is found, given the restrictions imposed by the biosynthetic enzymes and the availability of precur sors. Nevertheless, the enormously rich structural infor mation in glycans does not merely rival but far surpasses that of nucleic acids in the density of information con tained in a molecule of modest size. Each of the oligosac charides represented in Figure 7-29 presents a unique, three-dimensional face-a word in the sugar code readable by the proteins that interact with it. lectins Are Proteins That Read the Sugar Code and Mediate Many Biological Processes
Lectins, found in all organisms, are proteins that bind carbohydrates with high specificity and with moderate to high affinity (Table 7-3) . Lectins serve in a wide variety of cell-cell recognition, signaling, and adhesion processes and in intracellular targeting of newly synthesized pro teins. Plant lectins, abundant in seeds, probably serve as TA B L E 7-3
deterrents to insects and other predators. In the labora tory, purified plant lectins are useful reagents for detect ing and separating glycans and glycoproteins with different oligosaccharide moieties. Here we discuss just a few examples of the roles of lectins in animal cells. Some peptide hormones that circulate in the blood have oligosaccharide moieties that strongly influence their circulatory half-life. Luteinizing hormone and thy rotropin (polypeptide hormones produced in the adre nal cortex) have N-linked oligosaccharides that end with the disaccharide GalNAc4S (f31�4) GlcNAc, which is recognized by a lectin (receptor) of hepatocytes. (GalNAc4S is N-acetylgalactosarnine sulfated on the -OH group at C-4.) Receptor-hormone interaction me diates the uptake and destruction of luteinizing hor mone and thyrotropin, reducing their concentration in the blood. Thus the blood levels of these hormones un dergo a periodic rise (due to pulsatile secretion by the adrenal cortex) and fall (due to continual destruction by hepatocytes) . The residues of Neu5Ac (a sialic acid) situated at the ends of the oligosaccharide chains of many plasma glycoproteins (Fig. 7-29) protect those proteins from uptake and degradation in the liver. For example, ceru loplasmin, a copper-containing serum glycoprotein, has several oligosaccharide chains ending in Neu5Ac. The mechanism that removes sialic acid residues from serum glycoproteins is unclear. It may be due to the activity of the enzyme sialidase (also called neuraminidase) pro duced by invading organisms or to a steady, slow release by extracellular enzymes. The plasma membrane of he patocytes has lectin molecules (asialoglycoprotein re ceptors; "asialo-" indicating "without sialic acid") that specifically bind oligosaccharide chains with galactose residues no longer "protected" by a terminal Neu5Ac
Some l.ectins and the Oligosaccharide Ligands They Bind
Lectin source and lectin
Abbreviation
Ligand(s)
ConA
Plant Concanavalin A
Grif[onia simplicifolia lectin 4
GS4
Manal-OCH3 b Lewis b (Le ) tetrasaccharide
Wheat germ agglutinin
WGA
Neu5Ac(a2�3)Ga1(.8 l�)Glc GlcNAc (I3 1�4) GlcNAc
Ricin
Gal(l3l�)Glc
Animal Galectin-1 Mannose-binding protein A VIral
Gal(l3 l�) Glc MBP-A
High-mannose octasaccharide
HA
Neu5Ac(a2�6) Gal(/3 1�4) Glc
VPl
Neu5Ac(aH3)Gal(l3 l�) Glc
Enterotoxin
LT
Gal
Cholera toxin
CT
GMI pentasaccharide
Influenza virus hemagglutinin
Polyoma virus protein 1
Bacterial
Source: Weiss , W.l. & Drickamer, K. ( 1996) Structural basis of lectin-carbohydrate recognition. Annu. Rev. Biochem. 65, 441-473.
7 . 4 Carbo hyd rates as I nfo rmational M o l e c u l es: The S u g a r Code
residue. Receptor-ceruloplasmin interaction triggers en docytosis and destruction of the ceruloplasmin.
Glycoprotein ligand for integrin Integrin
HN I H3C - C
�
� .......-- Glycoprotein ligand / for P-selectin '
---'--- ,�
Capillary endothelial cell
[zsg]
/
\
Free neutrophil
-
H
0
N-Acetylneuraminic acid (Neu5Ac) (a sialic acid)
A similar mechanism is apparently responsible for re moving "old" erythrocytes from the mammalian blood stream. Newly synthesized erythrocytes have several membrane glycoproteins with oligosaccharide chains that end in Neu5Ac. When the sialic acid residues are removed by withdrawing a sample of blood from experimental ani mals, treating it with sialidase in vitro, and reintroducing it into the circulation, the treated erythrocytes disappear from the bloodstream within a few hours; erythrocytes with intact oligosaccharides (withdrawn and reintroduced without sialidase treatment) continue to circulate for days. Cell surface lectins are important in the develop ment of some human diseases-both human lectins and the lectins of infectious agents. Selectins are a family of plasma membrane lectins that mediate cell-cell recogni tion and adhesion in a wide range of cellular processes. One such process is the movement of immune cells (neu trophils) through the capillary wall, from blood to tissues, at sites of infection or inflammation (Fig. 7-3 1 ). At an infection site, P-selectin on the surface of capillary endothelial cells interacts with a specific oligosaccharide of the glycoproteins of circulating neutrophils. This inter action slows the neutrophils as they adhere to and roll along the endothelial lining of the capillaries. A second interaction, between integrin molecules (p. 455) in the neutrophil plasma membrane and an adhesion protein on the endothelial cell surface, now stops the neutrophil and allows it to move through the capillary wall into the infected tissues to initiate the immune attack. 1\vo other selectins participate in this "lymphocyte homing": E selectin on the endothelial cell and L-selectin on the neu trophil bind their cognate oligosaccharides on the neutrophil and endothelial cell, respectively. Human selectins mediate the inflammatory re sponses in rheumatoid arthritis, asthma, psoriasis, mul tiple sclerosis, and the rejection of transplanted organs, and thus there is great interest in developing drugs that inhibit selectin-mediated cell adhesion. Many carcino mas express an antigen normally present only in fetal cells (sialyl Lewis x, or sialyl Lex) that, when shed into the circulation, facilitates tumor cell survival and metas tasis. Carbohydrate derivatives that mimic the sialyl
Adhesion
� B;��� 7 v
Extravasatio
FIGURE 7-31 Role of lectin-ligand interactions in lymphocyte move ment to the site of an infection or injury. A neutrop h i l c i rculating through a capil lary is slowed by transient i nteractions between P-selectin molecules in the plasma membrane of the capil lary endothelial cel l s a n d glycoprotein l igands for P-selectin on t h e neutrop h i l su rface. A s i t i nteracts with successive P-selectin molecules, t h e neutrop h i l rol ls along the cap i l l ary su rface. Near a site of inflammation, stronger i nter actions between integrin in the capi l l ary su rface and its l igand in the neutrop h i l su rface lead to tight adhesion. The neutrop h i l stops rol l i ng and, under the i nfluence of signals sent out from the site of inflamma tion, begins extravasation-escape through the capil lary wa l l-as it moves toward the site of i nflammation.
Lex portion of sialoglycoproteins or that alter the biosynthesis of the oligosaccharide might prove effective as selectin-specific drugs for treating chronic inflamma tion or metastatic disease. Several animal viruses, including the influenza virus, attach to their host cells through interactions with oligosaccharides displayed on the host cell surface. The lectin of the influenza virus, known as the HA (hemagglu tinin) protein, is essential for viral entry and infection. Af ter the virus has entered a host cell and has been replicated, the newly synthesized viral particles bud out of the cell, wrapped in a portion of its plasma membrane. A vi ral sialidase (neuraminidase) trims the terminal sialic acid residue from the host cell's oligosaccharides, releasing the viral particles from their interaction with the cell and pre venting their aggregation with one another. Another round of infection can now begin. The antiviral drugs os eltamivir (Tamiflu) and zanamivir (Relenza) (next page) are used clinically in the treatment of influenza. These drugs are sugar analogs; they inhibit the viral sialidase by competing with the host cell's oligosaccharides for binding. This prevents the release of viruses from the infected cell
[26oJ
Carb o hyd rates a n d G l ycobiology
and also causes viral particles to aggregate, both of which block another cycle of infection.
-{
�
0_/
NH
HN ··· '�
O
)--. NH2 NH
;;? COOH
�
Barry ) . Marshall
H
Oseltamivir (Tamiflu)
Zanamivir (Relenza)
Lectins on the surface of the herpes simplex viruses HSV- 1 and HSV-2 (the causative agents of oral and gen ital herpes, respectively) bind specifically to heparan sulfate on the host cell surface as a first step in the in fection cycle; infection requires precisely the right pat tern of sulfation on this polymer. Analogs of heparan sulfate that mimic its interaction with the viruses are be ing investigated as possible antiviral drugs, interfering with interactions between virus and cell. Some microbial pathogens have lectins that mediate bacterial adhesion to host cells or the entry of toxin into cells. For example , Helicobacter pylori-shown by Barry J. Marshall and J. Robin Warren in the 1 980s to be responsible for most gastric ulcers-adheres to the inner surface of the stomach as bacterial membrane lectins interact with specific oligosaccharides of mem brane glycoproteins of the gastric epithelial cells ( Fig. 7-3 2 ) . Among the binding sites recognized by H. pylori is the oligosaccharide Lewis b (Leb) , when it is part of the type 0 blood group determinant. This obser vation helps to explain the severalfold greater incidence of gastric ulcers in people of blood type 0 than in those of type A or B. Chemically synthesized analogs of the Leb oligosaccharide may prove useful in treating this type of ulcer. Administered orally, they could prevent bacterial adhesion (and thus infection) by competing with the gastric glycoproteins for binding to the bacterial lectin.
FIGURE 7-32 An ulcer in the making.
) . Robin Warren
OH
Helicobacter pylori cel ls adher
ing to the gastric su rface. This bacterium causes ulcers by interactions b between a bacterial su rface lectin and the Le ol igosaccharide (a blood group antigen) of the gastric epithel i u m .
Some of the most devastating of the human parasitic diseases, widespread in much of the developing world, are caused by eukaryotic microorganisms that display unusual surface oligosaccharides, which in some cases are known to be protective for the parasites. These or ganisms include the trypanosomes, responsible for African sleeping sickness and Chagas disease; Plasmo diumjalciparum, the malaria parasite; and Entamoeba histolytica, the causative agent of amoebic dysentery. The prospect of finding drugs that interfere with the syn thesis of these unusual oligosaccharide chains , and therefore with the replication of the parasites, has in spired much recent work on the biosynthetic pathways of these oligosaccharides. The cholera toxin molecule (produced by the bac terium Vibrio cholerae) triggers diarrhea after entering intestinal cells responsible for water absorption from the intestine. The toxin attaches to its target cell through the oligosaccharide moiety of ganglioside GM1 , a membrane phospholipid (for the structure of GM1 see Box 1 0-2 , Fig. 1 ) , on the surface of intestinal epithelial cells. Similarly, the pertussis toxin produced by Borde tella pertussis , the bacterium that causes whooping cough, enters target cells only after interacting with a host cell oligosaccharide (or perhaps several oligosac charides) bearing a terminal sialic acid residue. Under standing the details of the oligosaccharide-binding sites of these toxins (lectins) may allow the development of genetically engineered toxin analogs for use in vaccines . Toxin analogs engineered to lack the carbohydrate bind ing site would be harmless because they could not bind to and enter cells, but they might elicit an immune re sponse that would protect against later exposure to the natural toxin. It is also possible to imagine drugs that would act by mimicking cell surface oligosaccharides, binding to the bacterial lectins or toxins and preventing their productive binding to cell surfaces. Lectins also act intracellularly. An oligosaccharide containing mannose 6-phosphate marks newly synthe sized proteins in the Golgi complex for transfer to the lysosome (see Fig. 27-39) . A common structural feature on the surface of these glycoproteins, the signal patch, is recognized by an enzyme that phosphorylates (in a two-step process) a mannose residue at the terminus of an oligosaccharide chain. The resulting mannose 6-phosphate residue is then recognized by the cation dependent mannose 6-phosphate receptor, a membrane-
7 . 4 Carbohydrates as I nfo rmati o n a l M o lecu les: The S u g a r Code
associated lectin with its mannose phosphate binding site on the lumenal side of the Golgi complex. When a section of the Golgi complex containing this receptor buds off to form a transport vesicle, proteins containing mannose phosphate residues are dragged into the form ing bud by interaction of their mannose phosphates with the receptor; the vesicle then moves to and fuses with a lysosome, depositing its cargo therein. Many, perhaps all, of the degradative enzymes (hydrolases) of the lyso some are targeted and delivered by this mechanism. Some of the mannose 6-phosphate receptors can cap ture enzymes containing the mannose 6-phosphate residue and direct them to the lysosome. This process is the basis for "enzyme replacement therapy" to correct lysosomal storage disorders in humans. • Other lectins act in other kinds of protein sorting. Any newly synthesized protein in the endoplasmic reticu lum already has a complex oligosaccharide attached, which can be bound by either of two ER lectins that are also chaperones: calnexin (membrane-bound) or cal reticulin (soluble) . These lectins link the new protein with an enzyme that brings about rapid disulfide ex change as the protein tries various ways to fold, leading eventually to the native conformation. At this point, en zymes in the ER trim the oligosaccharide moiety to a form recognized by another lectin, ERGIC53, which draws the folded protein (glycoprotein) into the Golgi complex for further maturation. If a protein has not folded effectively, the oligosaccharide is trimmed to another form, this one recognized by a lectin, EDEM, that initiates movement of the defectively folded protein into the cytosol, where it will be degraded. Thus, protein glycosylation serves in the ER as a kind of quality control signal, allowing the cell to eliminate improperly folded proteins. (This process is described in greater detail in Chapter 27.)
[26 1]
Lectin-Carbohydrate I nteractions Are Highly Specific and Often Polyvalent
In all the functions of lectins described above, and in many more known to involve lectin-oligosaccharide interactions, it is essential that the oligosaccharide have a unique struc ture, so that recognition by the lectin is highly specific. The high density of information in oligosaccharides pro vides a sugar code with an essentially unlimited number of unique "words" small enough to be read by a single pro tein. In their carbohydrate-binding sites, lectins have a subtle molecular complementarity that allows interaction only with their correct carbohydrate cognates. The result is an extraordinarily high specificity in these interactions. The affinity between an oligosaccharide and each carbo hydrate binding domain (CBD) of a lectin is sometimes modest (micromolar to millimolar Kct values), but the ef fective affinity is in many cases greatly increased by lectin multivalency, in which a single lectin molecule has multi ple CBDs. In a cluster of oligosaccharides-as is com monly found on a membrane surface, for example-each oligosaccharide can engage one of the lectin's CBDs, strengthening the interaction. When cells express multi ple receptors, the avidity of the interaction can be very high, enabling highly cooperative events such as cell at tachment and rolling (see Fig. 7-3 1). X-ray crystallographic studies of the structures of several lectin-carbohydrate complexes have provided rich details of the lectin-sugar interaction (Fig. 7-33). In humans, a family of 1 l lectins that bind to oligosaccharide chains ending in sialic acid residues plays some important biological roles. All of these lectins bind sialic acids at f3 sandwich domains like those found in immunoglobulins (lgs; see this motif in the CDS protein in Fig. 4-21), and the proteins are therefore called siglecs 1 to 11 (sialic
(b) FIGURE 7-33 Details of a lectin-carbohydrate interaction.
Structure
bonded to Arg 1
11
and coordi nated with the manganese ion (shown
nose 6-phosphate (PDB ID 1 M6P). The prote i n is represented as a sur
smal ler than its van der Waals rad i us for clarity). Each hydroxyl group 1 of man nose is hydrogen-bonded to the protein. The His 05 hydrogen
face contour image, showing the su rface as predom i nantly negatively
bonded to a phosphate oxygen of mannose 6-phosphate may be the
of the bov i n e mannose 6-phosphate receptor complexed with man
charged (red) or positively cha rged (blue). Mannose 6-phosphate is
residue that, when protonated at low pH, causes the receptor to re
shown as a stick structu re; a manganese ion is shown in violet.
lease mannose 6-phosphate i nto the lysosome.
(b) An
e n larged view of the binding site. Man nose 6-phosphate is hydrogen-
[262]
Carbohydrates a n d G l yco b i o l o g y
acid-recognizing /g-superfamily lectins) , or sometimes sialoadhesins. The interaction of a siglec with sialic acid (Neu5Ac) involves each of the ring substituents unique to Neu5Ac: the acetyl group at C-5 llildergoes both hydrogen bond and van der Waals interactions with the protein; the carboxyl group makes a salt bridge with a conserved Arg residue; and the hydroxyls of the glycerol moiety hydrogen-bond with the protein. Siglecs regulate activi ties in the immune and nervous systems and in blood cell development. Siglec-7, for example, by binding to a specific ganglioside (GD3) containing two sialic acid residues, suppresses the activity of NK (natural killer) cells in the immune system, sparing cells targeted for immune destruction from the NK killing activity. The elevated GD3 levels in tumors such as malignant melanoma and neuroblastoma may be a mechanism for evading the protective action of the immune system. The structure of the mannose 6-phosphate recep tor/lectin reveals details of its interaction with mannose 6-phosphate that explain the specificity of the binding and the role for a divalent cation in the lectin-sugar interaction (Fig. 7-33a) . His 105 is hydrogen-bonded to one of the oxygen atoms of the phosphate (Fig. 7-33b) . When the protein tagged with mannose 6-phosphate reaches the lysosome (which has a lower internal pH than the Golgi complex) , the receptor loses its affinity for mannose 6-phosphate . Protonation of His 105 may be responsible for this change in binding. In addition to these very specific interactions, there are more general interactions that contribute to the binding of many carbohydrates to their lectins. For ex-
OR
� H
H Hydrophobic side
Indolyl moiety of Trp
FIGURE 7-34 Hydrophobic interactions of sugar residues.
Sugar u n its
such as galactose have a more polar side (the top of the cha i r as shown here, with the ri ng oxygen and several hydroxyls) that is avai lable to hydrogen-bond with the lectin, and a less polar side that can have hy drophobic interactions with nonpolar side chains in the prote i n , such as the i ndole ri ng of Trp residues.
ample, many sugars have a more polar and a less polar side (Fig. 7-34) ; the more polar side hydrogen-bonds with the lectin, while the less polar undergoes hydropho bic interactions with nonpolar amino acid residues. The sum of all these interactions produces high-affinity bind ing and high specificity of lectins for their carbohydrates. This represents a kind of information transfer that is clearly central in many processes within and between cells. Figure 7-35 summarizes some of the biological in teractions mediated by the sugar code.
0 1 igosaccharide chain
Pia rna membrane protein
\
•
,�
FIGURE 7-35 Roles of oligosaccharides in recognition and adhesion at the cell surface. (a) Ol igosaccharides with u n ique structures (represented as strings of hexa gons), components of a variety of glycoproteins or gly col i pids on the outer su rface of plasma membranes, i nteract with h igh specificity and affi n ity with lect i n s i n the extrace l l u lar m i l ieu.
(b)
Viruses that i n fect animal
cells, such as the i nfluenza virus, bind to cel l su rface glycoprote i n s as the first step in i nfection.
(c)
Bacterial
toxins, such as the cholera and pertussis toxins, bind to a su rface glycolipid before entering a cel l .
(d) Some bac
teria, such as H. pylori, adhere to and then colonize or M annose 6-phosphote residue on newly synthesi2ed protein
i nfect a n i m a l cel ls.
(e)
Select i ns (lectins) in the plasma
membrane of certa i n cells mediate cel l -cel l i nteractions, such as those of neutroph i l s with the endothel ial cel l s of
Lysosome
the cap i l l ary wall at an i nfection site.
(f) The man nose 6-
phosphate receptor/lectin of the trans Golgi complex binds to the o l i gosaccharide of lysosomal enzymes, tar geting them for transfer i nto the lysosome.
7 . 5 Work i n g with Carbohydrates
S U M M A RY 7 . 4
Carbohydrates as Informational Molecules : The Sugar Code
•
•
Monosaccharides can be assembled into an almost
ically cleave 0- or N-linked oligosaccharides or lipases that remove lipid head groups . Alternatively, 0-linked glycans can be released from glycoproteins by treat
the stereochemistry and position of glycosidic bonds, the type and orientation of substituent
The resulting mixtures of carbohydrates are re
groups, and the number and type of branches.
solved into their individual components by a variety of
Glycans are far more information-dense than
methods
nucleic acids or proteins.
used in protein and amino acid separation: fractional
Lectins, proteins with highly specific carbohydrate binding domains, are commonly found on the outer
"read" by lectins govern the rate of degradation of certain peptide hormones, circulating proteins , and blood cells.
(Fig. 7-36) , including the same techniques
precipitation by solvents, and ion-exchange and size exclusion chromatography (see Fig.
3-1 7) .
Highly puri
fied lectins, attached covalently to an insoluble support, are commonly used in affinity chromatography of carbo hydrates (see Fig.
3-1 7c) .
Hydrolysis of oligosaccharides and polysaccharides in strong acid yields a mixture of monosaccharides, which may be identified and quantified by chromato
Bacterial and viral pathogens and some eukaryotic
graphic techniques to yield the overall composition of
parasites adhere to their animal-cell targets
the polymer.
by the binding of lectins in the pathogens to
•
released by purified enzymes-glycosidases that specif
ment with hydrazine.
surface of cells, where they initiate interaction with
•
For analysis of the oligosaccharide moieties of glycoproteins and glycolipids, the oligosaccharides are
limitless variety of oligosaccharides, which differ in
other cells. In vertebrates, oligosaccharide tags
•
[263]
Oligosaccharide analysis relies increasingly on mass
oligosaccharides on the target cell surface.
spectrometry and high-resolution NMR spectroscopy.
Intracellular lectins mediate intracellular protein
Matrix-assisted laser desorption/ionization mass spec
targeting to specific organelles or to the secretory
trometry (MALDI MS) and tandem mass spectrometry
pathway.
(MS/MS) , both described in Box
X-ray crystallography of lectin-sugar complexes shows the detailed complementarity between the two molecules, which accounts for the strength and specificity of lectin interactions with carbohydrates.
3-2,
are readily appli
cable to polar compounds such as oligosaccharides. MALDI MS is a very sensitive method for determining the mass of a molecular ion (in this case, the entire oligosaccharide chain;
Fig. 7-37) . MS/MS reveals the
mass of the molecular ion and many of its fragments, which are usually the result of breakage of the glycosidic
4-5) , especially for
7.5 Working with Carbohydrates
bonds. NMR analysis alone (see Box
The growing appreciation of the importance of oligosac
mation about sequence, linkage position, and anomeric
oligosaccharides of moderate size, can yield much infor
charide structure in biological recognition has been the
carbon configuration. For example, the structure of the
driving force behind the development of methods for an
heparin segment shown as a space-filling model in
alyzing the structure and stereochemistry of complex
Figure
oligosaccharides . Oligosaccharide analysis is compli
Automated procedures and commercial instruments are
7-22 was obtained entirely by NMR spectroscopy.
cated by the fact that, unlike nucleic acids and proteins,
used for the routine determination of oligosaccharide
oligosaccharides can be branched and are joined by a va
structure, but the sequencing of branched oligosaccha
riety of linkages. The high charge density of many
rides joined by more than one type of bond remains a far
oligosaccharides and polysaccharides, and the relative
more formidable task than determining the linear se
lability of the sulfate esters in glycosaminoglycans, pres
quences of proteins and nucleic acids.
ent further difficulties.
Another important tool in working with carbohy
For simple, linear polymers such as amylose, the posi
drates is chemical synthesis, which has proved to be a
tions of the glycosidic bonds are determined by the classical
powerful approach to understanding the biological func
method of exhaustive methylation: treating the intact poly
tions of glycosaminoglycans and oligosaccharides . The
saccharide with methyl iodide in a strongly basic medium to
chemistry involved in such syntheses is difficult, but car
convert all free hydroxyls to acid-stable methyl ethers, then
bohydrate chemists can now synthesize short segments
hydrolyzing the methylated polysaccharide in acid. The
of almost any glycosaminoglycan, with correct stereo
only free hydroxyls present in the monosaccharide deriva
chemistry, chain length, and sulfation pattern, and
tives so produced are those that were involved in glycosidic
oligosaccharides significantly more complex than those
bonds. To determine the sequence of monosaccharide
shown in Figure
residues, including any branches that are present, exogly
thesis is based on the same principles (and has the same
cosidases of known specificity are used to remove residues
advantages) as peptide synthesis (see Fig.
one at a time from the nonreducing end(s) . The known
requires a set of tools unique to carbohydrate chemistry:
7-29.
Solid-phase oligosaccharide syn
3-29) ,
but
specificity of these exoglycosidases often allows deduction
blocking groups and activating groups that allow the syn
of the position and stereochemistry of the linkages.
thesis of glycosidic linkages with the correct hydroxyl
r·
2 64
Carbohydrates a n d G l ycobiology
Glycoprotein or glycolipid
Release oligosaccharides with endoglycosidase
ll)
Oligosaccharide mixture
Ion-exchange chromatography 2) Gel filtration 3) Lectin affinity chromatography
Separated oligosaccharides
Purified polysaccharide
Exhaustive methylation with CH31, strong base
Hydrolysis with strong acid
Smaller oligosaccharides
Fully methylated carbohydrate
Monosaccharides
High-performance liquid chromatography, or derivatization and gas-liquid chromatography
Composition of mixture
j
j
Acid hydrolysis yields monosaccharides methylated at every -OH except those involved in glycosidic bonds
FIGURE 7-36 Methods of carbohydrate analysis.
Resolution of tragm nts in mixture
E C H3
N
lN __
__L
I Ri bose I
N 6-Methyladenosine 0
k'J: > N
H
(a)
C!tbose I
N2-Methylguanosine
:J: >
NH2 � CH20H N O� N J
I�ibose I
5-Hydroxyrnethylcytidine
�·!
0
f1
l
0
N
[�ibose]
:X
1>l
Inosine
HN H2N
(b)
A
H,
l
N
[Ri}?Sel
7- Methylguanosine
HN
�N H
Pseudouridine
�N I I�ibose I
HN O
J s
4- Thiouridine
FIGURE 8-5 Some minor purine and pyrimidine bases, shown as the nudeosides. (a) M i nor bases of DNA. 5-Methylcytidine occurs in the DNA of a n i mals and h igher plants, N6-methyladenosine in bacterial
o1 -o- P II 0
Adenosine 5'-monophosphate
I -o-P-o II
0 Adenosine 2 '-monophosphate
I -o- P-o11
OH
0
0 Adenosine 3'-monophosphate
Adenosine 2 ',3' -cyclic monophosphate
FIGURE 8-6 Some adenosine monophosphates.
Adenosine 2 '-mono
phosphate, 3'-monophosphate, and 2') '-cyclic monophosphate are formed by enzymatic and alka l ine hydrolysis of RNA.
purine or pyrimidine ring is substituted, the usual con vention (used here) is simply to indicate the ring posi tion of the substituent by its number-for example, 5-methylcytosine,
7-methylguanine, and 5-hydroxy
methylcytosine (shown as the nucleosides in Fig. 8-5) .
0) is not identified. The convention changes when the
The element to which the substituent is attached (N, C, substituted atom is exocyclic (not within the ring struc ture) , in which case the type of atom is identified and
DNA, and 5-hydroxymethylcytidine in the DNA of bacteria i nfected
the ring position to which it is attached is denoted with
with certain bacteriophages.
a superscript. The amino nitrogen attached to C-6 of 6 adenine is N ; similarly, the carbonyl oxygen and amino 2 6 nitrogen at C-6 and C-2 of guanine are 0 and N , re 6 spectively. Examples of this nomenclature are N -
(b)
Some m i nor bases of tRNAs. I nosine
contai ns the base hypoxanth ine. Note that pseudou ridi ne, l i ke uridi ne, conta ins uracil; they are disti nct in the point of attachment to the ribose-i n uri di ne, urac i l is attached through N-1 , the usual attach ment point for pyr i m i d i nes; in pseudouridi ne, through C-5 .
Although nucleotides bearing the major purines and pyrimidines are most common, both DNA and RNA also
2
methyladenosine and N -methylguanosine (Fig. 8-5) . • Cells also contain nucleotides with phosphate groups in positions other than on the 5' carbon
bases; in some viral DNAs, certain bases may be hydrox
(Fig. 8-6). Ribonucleoside 2 ' ,3 '-cyclic monophosphates are isolatable intermediates, and ribonucleoside 3 ' monophosphates are end products of the hydrolysis of
ymethylated or glucosylated. Altered or unusual bases
RNA by certain ribonucleases . Other variations are
contain some minor bases
(Fig. 8-5). In DNA the most
common of these are methylated forms of the major
in DNA molecules often have roles in regulating or pro
adenosine
tecting the genetic information. Minor bases of many
guanosine 3 ' ,5'-cyclic monophosphate (cGMP) , consid
types are also found in RNAs, especially in tRNAs (see
ered at the end of this chapter.
3 ' ,5' -cyclic
monophosphate
(cAMP)
and
Fig. 8-25 and Fig. 26-23) . KEY CON V E N T I O N : The nomenclature for the minor bases can be confusing. Like the major bases, many have com
Phosphodiester Bonds Link S uccessive N ucleotides in N ucleic Acids
mon names-hypoxanthine , for example, shown as its
The successive nucleotides of both DNA and RNA are co
nucleoside inosine in Figure 8-5. When an atom in the
valently linked through phosphate-group "bridges," in
8 . 1 Some Basics
RNA
DNA
which the 5' -phosphate group of one nucleotide unit is joined to the 3' -hydroxyl group of the next nucleotide, creating a phosphodiester linkage (Fig. 8-7). Thus the covalent backbones of nucleic acids consist of alternating phosphate and pentose residues, and the nitrogenous bases may be regarded as side groups joined to the back bone at regular intervals. The backbones of both DNA and RNA are hydrophilic. The hydroxyl groups of the sugar residues form hydrogen bonds with water. The phosphate groups, with a pKa near 0, are completely iortized and neg atively charged at pH 7, and the negative charges are gen erally neutralized by ionic interactions with positive charges on proteins, metal ions, and polyamines.
End
5'
1
1
o-
?
I
-o-P=O
- o-P=O I
I
0 s· CH2
5' CH2
3'
Phospho I -o-P==O diester I linkage 0
1
3'
H
0 OH I -o- P=O I s·
3'
I
I
0
5'
and RNA have the same orientation along the chain (Fig. 8-7) , giving each linear nucleic acid strand a spe cific polarity and distinct 5' and 3' ends. By definition, the 5' end lacks a nucleotide at the 5' position and the 3' end lacks a nucleotide at the 3 ' position. Other groups (most often one or more phosphates) may be present on one or both ends. The 5' to 3' orientation of a strand of nucleic acid refers to the ends of the strand, not the orientation of the individual phosphodiester bonds linking its constituent nucleotides. •
End
5'
o-
KEY CO N V E N T I O N : All the phosphodiester linkages in DNA
3'
CH2
�I
3'
0
H
0
I
OH
-o- =0
- o-P=O
I
0
0
I 5' CH2
s·CH2 , 0
OH
H
The covalent backbone of DNA and RNA is subject to slow, nonenzymatic hydrolysis of the phosphodiester bonds. In the test tube, RNA is hydrolyzed rapidly under alkaline conditions, but DNA is not; the 2 ' -hydroxyl groups in RNA (absent in DNA) are directly involved in the process. Cyclic 2 ' ,3' -monophosphate nucleotides are the first products of the action of alkali on RNA and are rapidly hydrolyzed further to yield a mixture of 2 ' and 3 ' -nucleoside monophosphates (Fig. 8-8) .
[275]
3' End
3' End
FIGURE 8-7 Phosphodiester linkages in the covalent backbone of DNA and RNA. The phosphodiester bonds (one of which is shaded i n the D N A ) l i n k successive n ucleotide u n its. The backbone o f alternating pentose and phosphate groups i n both types of nucleic acid is h ighly polar. The 5' end of the macromolecule lacks a nucleotide at the 5 '
position, and the 3 ' end lacks a nucleotide at the 3 ' position.
I
I
-o-P=O
6I I
I
0
2' ,3'-Cyclic monophosphate derivative
-o- P=O
Mixture of 2'- and H2o ----=---' --� 3'-monophosphate derivatives
CH2
-
CH2
+
RNA
I
0
-o-P=O I
OH
�
0
Shortened -o- =O RNA I
FIGURE 8-8 Hydrolysis of RNA under alkaline conditions. The 2 ' hydroxyl acts as a nucleop h i l e in an i ntramolecular displ acement. The 2 ', 3 ' -cyc l i c
OH
monophosphate derivative is further hydrolyzed t o a mixture of 2' · and 3 ' -monophosphates. DNA, which lacks 2' hydroxyls, is stable under s i m i lar conditions.
' 276
-,
1
N u cleotides a n d N u c l e i c Acids
The nucleotide sequences of nucleic acids can be represented schematically, as illustrated below by a seg ment of DNA with five nucleotide units. The phosphate groups are symbolized by ®, and each deoxyribose is symbolized by a vertical line, from C-1 ' at the top to C-5 ' at the bottom (but keep in mind that the sugar is always in its closed-ring /3-furanose form in nucleic acids) . The connecting lines between nucleotides (which pass through ®) are drawn diagonally from the middle (C-3 ' ) o f the deoxyribose o f one nucleotide t o the bottom (C-5 ') of the next. A
5' End
G
T
®���JcJOH
FIGURE 8-9 Tautomeric forms of uracil.
tautomeric forms, but they are more rarely encou ntered.
quences for the structure, electron distribution, and light absorption of nucleic acids. Electron delocalization among atoms in the ring gives most of the bonds partial double-bond character. One result is that pyrimidines are planar molecules and purines are very nearly planar, with a slight pucker. Free pyrimidine and purine bases may exist in two or more tautomeric forms depending on the pH. Uracil, for example, occurs in lactarn, lactim, and double lactim forms ( Fig. 8-9) . The structures shown in Figure 8-2 are the tautorners that predominate at pH 7.0. All nucleotide bases absorb UV light, and nu cleic acids are characterized by a strong absorption at wavelengths near 260 nrn (Fig. 8-10). The purine and pyrimidine bases are hydropho bic and relatively insoluble in water at the near-neu tral pH of the cell. At acidic or alkaline pH the bases become charged and their solubility in water in creases. Hydrophobic stacking interactions in which two or more bases are positioned with the planes of their rings parallel (like a stack of coins) are one of two important modes of interaction between bases in nucleic acids . The stacking also involves a combina tion of van der Waals and dipole-dipole interactions between the bases. Base stacking helps to minimize contact of the bases with water, and base-stacking in teractions are very important in stabilizing the three-
End
KEY CO N V E N T I O N : The sequence of a single strand of nu cleic acid is always written with the 5 ' end at the left and the 3' end at the right-that is, in the 5' 4 3' direction. •
A short nucleic acid is referred to as an oligonu cleotide. The definition of "short" is somewhat arbi trary, but polymers containing 50 or fewer nucleotides are generally called oligonucleotides. A longer nucleic acid is called a polynucleotide. The Properties of N u cleotide Bases Affect the Three Dimensional Structure of N ucleic Acids
Free pyrimidines and purines are weakly basic corn pounds and thus are called bases. The purines and pyrimidines common in DNA and RNA are aromatic molecules (Fig. 8-2), a property with important conse-
� .: �
FIGURE 8-1 0 Absorption spectra of the com mon nucleotides. The spectra are shown as the variation in molar extinction coefficient with wavelength. The molar extinction coeffi cients at 260 nm and pH 7.0 (e2 6 0) are l i sted
i n the table. The spectra of corresponding
ribonucleotides and deoxyribonucleotides, as wel l as the n u c leosides, are essential ly
· c::; � .... � 0 '"'
.: 0
.s ....
:a '"'
:< � '"'
� 0 �
14,000 12,000
Molar extinction coefficient at 260 nm, IC 1cm- 1 ) e2eo ( !
10,000 8,000
- AMP - GMP ···- UMP - dTMP - CMP
6,000 4,000 2,000
identica l . For m i xtu res of n u c leotides, a wavelength of 2 60 nm (dashed vertical l i ne) is used for absorption measurements.
The lactam form predo m i
decreases. The other free pyrimidi nes and the free puri nes also have
Some simpler representations of this pentadeoxyri bonucleotide are pA-C-G-T-Ao H, pApCpGpTpA, and pACGTA.
"'
Double lactim
Uracil
nates at pH 7 . 0; t h e other forms become more pro m i nent a s pH
A
3'
Lactim
Lactam
230
240
250
260
Wavelength (nm)
270
280
15 ,400 1 1 , 700 9,900 9,200 7,500
8 . 2 N u cleic Acid Structure
5'
[2n]
3'
H- e
Guanine
N
1/ ' C ......
II
\ -C / -1'
. --
3'
FIGURE 8-1 1 Hydrogen-bonding patterns in the base pairs defined by Watson and Crick. Here as elsewhere, hydrogen bonds are repre
5'
sented by three blue l ines.
dimensional structure of nucleic acids, as described later. The functional groups of pyrimidines and purines are ring nitrogens, carbonyl groups, and exocyclic amino groups. Hydrogen bonds involving the amino and carbonyl groups are the most important mode of interaction between two (and occasionally three or four) complementary strands of nucleic acid. The most common hydrogen-bonding patterns are those defined by James D. Watson and Francis Crick in 1 953, in which A bonds specifically to T (or U) and G bonds to C ( Fig. 8-1 1 ) . These two types of base pairs pre dominate in double-stranded DNA and RNA, and the tautomers shown in Figure 8-2 are responsible for these patterns. It is this specific pairing of bases that permits the duplication of genetic information, as we shall discuss later in this chapter.
james D. Watson
Francis Crick, 1 9 1 6-2004
S U M M A RY 8 . 1 •
•
Some Bas i cs
A nucleotide consists of a nitrogenous base (purine or pyrimidine) , a pentose sugar, and one or more phosphate groups. Nucleic acids are polymers of nucleotides, joined together by phosphodiester linkages between the 5' -hydroxyl group of one pentose and the 3' -hydroxyl group of the next. There are two types of nucleic acid: RNA and DNA. The nucleotides in RNA contain ribose, and the common pyrimidine bases are uracil and cytosine. In DNA, the nucleotides contain 2' -deoxyribose, and the common pyrimidine bases are thymine and cytosine. The primary purines are adenine and guanine in both RNA and DNA.
8.2 N ucleic Acid Structure The discovery of the structure of DNA by Watson and Crick in 1 953 was a momentous event in science, an event that gave rise to entirely new disciplines and influ enced the course of many established ones. In this sec tion we focus on DNA structure, some of the events that led to its discovery, and more recent refinements in our understanding of DNA. RNA structure is also introduced. As in the case of protein structure (Chapter 4) , it is sometimes useful to describe nucleic acid structure in terms of hierarchical levels of complexity (primary, sec ondary, tertiary) . The primary structure of a nucleic acid is its covalent structure and nucleotide sequence. Any regular, stable structure taken up by some or all of
[2 78]
N u cleotides a n d N u cl e i c Acids
the nucleotides in a nucleic acid can be referred to as secondary structure. All structures considered in the remainder of this chapter fall under the heading of sec ondary structure . The complex folding of large chromo somes within eukaryotic chromatin and bacterial nucleoids is generally considered tertiary structure; this is discussed in Chapter 24. DNA Is a Double Helix That Stores Genetic I nformation
DNA was first isolated and characterized by Friedrich Miescher in 1 868. He called the phosphorus-containing substance "nuclein." Not until the 1 940s, with the work of Oswald T. Avery, Colin MacLeod, and Maclyn McCarty, was there any compelling evidence that DNA was the ge netic material. Avery and his colleagues found that DNA extracted from a virulent (disease-causing) strain of the bacterium Streptococcus pneumoniae and injected into a nonvirulent strain of the same bacterium trans formed the nonvirulent strain into a virulent strain. They concluded that the DNA from the virulent strain carried the genetic information for virulence. Then in 1 952 , ex periments by Alfred D. Hershey and Martha Chase, in which they studied the infection of bacterial cells by a virus (bacteriophage) with radioactively labeled DNA or protein, removed any remaining doubt that DNA, not protein, carried the genetic information. Another important clue to the structure of DNA came from the work of Erwin Chargaff and his col leagues in the late 1 940s . They found that the four nu cleotide bases of DNA occur in different ratios in the DNAs of different organisms and that the amounts of certain bases are closely related. These data, collected from DNAs of a great many different species, led Char gaff to the following conclusions : 1.
The base composition of DNA generally varies from one species to another.
2.
DNA specimens isolated from different tissues of the same species have the same base composition.
3.
The base composition of DNA in a given species does not change with an organism's age, nutritional state, or changing environment.
4.
In all cellular DNAs, regardless of the species, the number of adenosine residues is equal to the number of thymidine residues (that is, A T) , and the number of guanosine residues is equal to the number of cytidine residues (G C) . From these relationships it follows that the sum of the purine residues equals the sum of the pyrimidine residues; that is, A + G T + C. =
=
=
These quantitative relationships , sometimes called "Chargaff's rules ," were confirmed by many subsequent researchers. They were a key to establishing the three dimensional structure of DNA and yielded clues to how genetic information is encoded in DNA and passed from one generation to the next.
FIGURE 8-12 X-ray diffraction pattern of DNA. The spots form ing a cross in the center denote a hel i ca l structure. The heavy bands at the left and right arise from the recurring bases.
To shed more light on the structure of DNA, Ros alind Franklin and Maurice Wilkins used the powerful method of x-ray diffraction (see Box 4-5) to analyze DNA fibers . They showed in the early 1 950s that DNA produces a characteristic x-ray diffraction pattern (Fig. 8-1 2 ). From this pattern it was deduced that DNA molecules are helical with two periodicities along their long axis, a primary one of 3.4 A and a secondary one of 34 A. The problem then was to formulate a three-dimensional model of the DNA molecule that could account not only for the x-ray diffraction data C base equiva but also for the specific A T and G lences discovered by Chargaff and for the other chem ical properties of DNA. =
Rosa l i n d Frankl in, 1 92 0-1 958
=
Maurice Wilki ns, 1 9 1 6-2004
James Watson and Francis Crick relied on this accu mulated information about DNA to set about deducing its structure. In 1 953 they postulated a three-dimensional model of DNA structure that accounted for all the avail able data. It consists of two helical DNA chains wound around the same axis to form a right-handed double helix (see Box 4-1 for an explanation of the right- or left handed sense of a helical structure) . The hydrophilic backbones of alternating deoxyribose and phosphate groups are on the outside of the double helix, facing the surrounding water. The furanose ring of each deoxyri bose is in the C-2' endo conformation. The purine and pyrimidine bases of both strands are stacked inside the
8 . 2 N u cl e i c Acid Structure
(a)
(b)
(c)
FIGURE 8-1 3 Watson-Crick model for the structure of DNA. The
A
original model proposed by Watson and Crick had 1 0 base pa i rs, or 34
A (3.6
(3.4 nm), per turn of the helix; subsequent measurements revea led
1 0. 5 base pai rs, or 36
nm), per turn.
(a) Schematic representa (b) Stick representation showing stacking of the bases. (c) Space-fi l l i ng model.
tion, showing d i mensions of the helix. the backbone and
double helix, with their hydrophobic and nearly planar ring structures very close together and perpendicular to the long axis. The offset pairing of the two strands cre ates a major groove and minor groove on the surface of the duplex (Fig. 8-13) . Each nucleotide base of one strand is paired in the same plane with a base of the other strand. Watson and Crick found that the hydrogen bonded base pairs illustrated in Figure 8 -1 1 , G with C and A with T, are those that fit best within the structure, providing a rationale for Chargaff's rule that in any DNA, G C and A T. It is important to note that three hy drogen bonds can form between G and C, symbolized G=C, but only two can form between A and T, symbol ized A=T. This is one reason for the finding that separa tion of paired DNA strands is more difficult the higher the ratio of G -c to A=T base pairs. Other pairings of bases tend (to varying degrees) to destabilize the dou ble-helical structure. When Watson and Crick constructed their model, they had to decide at the outset whether the strands of DNA should be parallel or antiparallel-whether their 3' ,5' -phosphodiester bonds should run in the same or opposite directions. An antiparallel orientation pro duced the most convincing model, and later work with DNA polymerases (Chapter 25) provided experimental evidence that the strands are indeed antiparallel, a find ing ultimately confirmed by x-ray analysis. To account for the periodicities observed in the x-ray diffraction patterns of DNA fibers, Watson and Crick ma nipulated molecular models to arrive at a structure in which the vertically stacked bases inside the double helix =
[279]
would be 3.4 A apart; the secondary repeat distance of about 34 A was accounted for by the presence of 10 base pairs in each complete turn of the double helix. In aque ous solution the structure differs slightly from that in fibers, having 10.5 base pairs per helical tum (Fig. 8-13). As Figure 8-14 shows, the two antiparallel polynu cleotide chains of double-helical DNA are not identical in either base sequence or composition. Instead they are complementary to each other. Wherever adenine oc curs in one chain, thymine is found in the other; simi larly, wherever guanine occurs in one chain, cytosine is found in the other. The DNA double helix, or duplex, is held together by two forces, as described earlier: hydrogen bonding between complementary base pairs (Fig. 8 -1 1 ) and base-stacking interactions. The complementarity be tween the DNA strands is attributable to the hydrogen bonding between base pairs. The base-stacking interac tions, which are largely nonspecific with respect to the identity of the stacked bases, make the major contribu tion to the stability of the double helix. The important features of the double-helical model of DNA structure are supported by much chemical and bio logical evidence. Moreover, the model immediately sug gested a mechanism for the transmission of genetic information. The essential feature of the model is the complementarity of the two DNA strands. As Watson and Crick were able to see, well before confirmatory data be carne available, this structure could logically be replicated by (1) separating the two strands and (2) synthesizing a complementary strand for each. Because nucleotides in each new strand are joined in a sequence specified by the base-pairing rules stated above, each preexisting strand
3'
5'
=
F I G U R E 8-1 4 Complementarity of
strands in the The
DNA
double helix.
complementary
antipara l l e l
strands o f D NA fol l ow t h e pai ring rules proposed by Watson and Crick. The base-pai red antipara l lel strands d i ffer in base compos ition: the l eft strand has the composition A3 T2 G 1 C3; the right, A2 T3 G3 C, . They also differ i n sequence when each chain is
read in the 5 ' � 3 ' d i rection. Note the base equivalences: A
3'
5'
=
C in the duplex.
=
T and G
[2ao]
N u cleotides a n d N u cleic Acids
DNA Can Occur i n Different Three-Dimensional Forms
New
Parent strand
Parent strand Daughter strands
FIGURE 8-15 Replication of DNA as suggested by Watson and Crick.
DNA is a remarkably flexible molecule. Considerable ro tation is possible around several types of bonds in the sugar-phosphate (phosphodeoxyribose) backbone, and thermal fluctuation can produce bending, stretching, and unpairing (melting) of the strands. Many significant deviations from the Watson-Crick DNA structure are found in cellular DNA, some or all of which may be im portant in DNA metabolism. These structural variations generally do not affect the key properties of DNA de fined by Watson and Crick: strand complementarity, an tiparallel strands , and the requirement for A =T and G=C base pairs. Structural variation in DNA reflects three things : the different possible conformations of the deoxyri bose, rotation about the contiguous bonds that make up the phosphodeoxyribose backbone (Fig. 8 -1 6a), and free rotation about the C-1 '-N-glycosyl bond (Fig. 8 - 1 6b) . Because of steric constraints, purines in purine nucleotides are restricted to two stable confor mations with respect to deoxyribose, called syn and
The preexisting or "parent" strands become separated, and each is the template for biosynthesis of a complementary "daughter" strand ( i n pink).
functions as a template to guide the synthesis of one com plementary strand (Fig. 8-15). These expectations were experimentally confirmed, inaugurating a revolution in our understanding of biological inheritance.
- WORKED EXAMPLE 8-1 Base Pairing in DNA In samples of DNA isolated from two unidentified species of bacteria, X and Y, adenine makes up 32% and 1 7% , respectively, of the total bases. What relative pro portions of adenine, guanine, thymine , and cytosine would you expect to find in the two DNA samples? What assumptions have you made? One of these species was isolated from a hot spring (64 °C) . Which species is most likely the thermophilic bacterium, and why? Solution: For any double-helical DNA, A T and G C . The DNA from species X has 32% A and therefore must contain 32% T. This accounts for 64% of the bases and leaves 36% as G=C pairs: 18% G and 1 8% C. The sam ple from species Y, with 1 7% A, must contain 1 7% T, ac counting for 34% of the base pairs. The remaining 66% of the bases are thus equally distributed as 33% G and 33% C. This calculation is based on the assumption that both DNA molecules are double-stranded. The higher the G + C content of a DNA molecule , the higher the melting temperature. Species Y, having the DNA with the higher G + C content (66%), most likely is the thermophilic bacterium; its DNA has a higher melting temperature and thus is more stable at the temperature of the hot spring. =
(a)
=
OH OH
syn-Adenosine
<x5 �
HOC � O H H H
I
R
HOqH2� 0 H
OH OH
anti-Adenosine (b)
H
OH OH
anti-Cytidine
FIGURE 8-1 6 Structural variation in DNA. (a) The conformation of a nucleotide in DNA is affected by rotation about seven different bonds. Six of the bonds rotate freely. The l i m i ted rotation about bond 4 gives rise to ring pucker, in which one of the atoms in the five-membered fu ranose ring is out of the plane described by the other four. Th is confor mation is endo or exo, depending on whether the atom is displaced to the same side of the plane as C-5 ' or to the opposite side (see Fig. 8-3b).
(b)
For purine bases in nucl eotides, only two conformations with
respect to the attached ri bose un its are sterica l l y permitted, anti or syn. Pyrimidi nes genera l l y occur i n the anti conformation.
8 . 2 N u c l e i c Acid Structure
anti (Fig. 8 -1 6b) . Pyrimidines are generally restricted to the anti conformation because of steric interference between the sugar and the carbonyl oxygen at C-2 of the pyrimidine. The Watson-Crick structure is also referred to as B-form DNA, or B-DNA. The B form is the most stable structure for a random-sequence DNA molecule under physiological conditions and is therefore the standard point of reference in any study of the properties of DNA. Two structural variants that have been well char acterized in crystal structures are the A and Z forms. These three DNA conformations are shown in Figure 8-17 , with a summary of their properties. The A form is favored in many solutions that are relatively devoid of water. The DNA is still arranged in a right-handed dou ble helix, but the helix is wider and the number of base pairs per helical turn is 1 1 , rather than 1 0. 5 as in B DNA. The plane of the base pairs in A-DNA is tilted about 20° with respect to the helix axis. These struc tural changes deepen the major groove while making the minor groove shallower. The reagents used to pro mote crystallization of DNA tend to dehydrate it, and thus most short DNA molecules tend to crystallize in the A form. Z-form DNA is a more radical departure from the B structure ; the most obvious distinction is the left handed helical rotation. There are 12 base pairs per helical turn, and the structure appears more slender and elongated. The DNA backbone takes on a zigzag appearance . Certain nucleotide sequences fold into left-handed Z helices much more readily than others. Prominent examples are sequences in which pyrim-
[2s1]
idines alternate with purines, especially alternating C and G or 5-methyl-C and G residues . To form the left handed helix in Z-DNA, the purine residues flip to the syn conformation, alternating with pyrimidines in the anti conformation. The major groove is barely appar ent in Z-DNA, and the minor groove is narrow and deep. Whether A-DNA occurs in cells is uncertain, but there is evidence for some short stretches (tracts) of Z-DNA in both bacteria and eukaryotes. These Z DNA tracts may play a role (as yet undefined) in reg ulating the expression of s ome genes or in genetic recombination. Certa i n DNA Sequences Adopt U nusual Structures
Other sequence-dependent structural variations found in larger chromosomes may affect the function and me tabolism of the DNA segments in their immediate vicin ity. For example, bends occur in the DNA helix wherever four or more adenosine residues appear se quentially in one strand. Six adenosines in a row pro duce a bend of about 18°. The bending observed with this and other sequences may be important in the bind ing of some proteins to DNA. A rather common type of DNA sequence is a palin drome. A palindrome is a word, phrase, or sentence that is spelled identically read either forward or backward; two examples are ROTATOR and NURSES RUN. The term is applied to regions of DNA with inverted repeats of base sequence having twofold symmetry over two
FIGURE 8-1 7 Comparison of A, B, and Z forms of DNA. Each struc
ture shown here has 36 base pairs. The bases are shown in gray, the phosphate atoms in yellow, and the ri boses and phosphate oxygens i n blue. B l ue is the color used t o represent DNA strands i n l ater chapters. The table summarizes some properties of the three forms of D NA.
A form
T 1
2s A
A form
B form
Z form
-26 A
B form
-2o A
Z form
-1s A
Helical sense Diameter Base pairs per helical turn Helix rise per base pair Base tilt normal to the helix axis Sugar pucker conformation
Right handed
Right handed
Left handed
11
10.5
12
20°
60
Glycosyl bond conformation
Anti
Anti
2.6 A C-3' endo
3 .4 A
3. 7 A
C-2 ' endo
C-2' endo for pyrimidines; C-3' endo for purines Anti for pyrimidines; syn for purines
70
[w2J
N u cleotides a n d N u c l e i c Acids
Palindrome
5,
T T A G C A C G T G C T A A I I
I
I I
I I
I
I
I
I
I
I
I
··-...,-T""T"IT G C G A T �A T C G C A.,.1_,1_,1.---+• 3,
1
'
C�T A\r' ---/c T TA AG C c G GC T A
A A T C G T G C A C G A T T
Mirror repeat � T T A G C A C C A C G A T T I
I
I
I
I
I I
I
I I I
I
I I
A A T C G T G G T G C T A A FIGURE 8-18 Palindromes and mirror repeats.
II I 1
Hairpin
(a)
quences of double-stranded nucleic acids with twofol d sym metry. I n
3'
5'
order t o superimpose o n e repeat (shaded sequence) on the other, it must be rotated 1 80° about the horizontal axis then 1 80° about the ver
"
... ........ ._ _
tical axis, as shown by the colored arrows. A m i rror repeat, on the
1
other hand, has a symmetric sequence with i n each strand. Superim
C�'l' A\r' .Yc T A AG CT G GCT CA
posing one repeat on the other req u i res only a s i ngle 1 80° rotation about the vertical axis.
•
•
T G C GA T A 'J' CA T C G C A ..... 3, ...._ • __,�T" "TI""'I" I TiTT I I"'r- ,. 5, ! I II .J...ll.L 3' • • A C G C T A T G A G T AG C G T
Pa l i n d romes are se
strands of DNA ( Fig. 8-1 8). Such sequences are self complementary within each strand and therefore have the potential to form hairpin or cruciform (cross shaped) structures ( Fig. 8- 1 9 ). When the inverted re peat occurs within each individual strand of the DNA, the sequence is called a mirror repeat. Mirror repeats do not have complementary sequences within the same strand and cannot form hairpin or cruciform structures. Sequences of these types are found in virtually every large DNA molecule and can encompass a few base pairs or thousands. The extent to which palindromes occur as cruciforms in cells is not known, although some cruci form structures have been demonstrated in vivo in Es cherichia coli. Self-complementary sequences cause isolated single strands of DNA (or RNA) in solution to fold into complex structures containing multiple hairpins. Several unusual DNA structures involve three or even four DNA strands. Nucleotides participating in a Watson-Crick base pair (Fig. 8-1 1) can form additional hydrogen bonds, particularly with functional groups ar rayed in the major groove. For example, a cytidine residue (if protonated) can pair with the guanosine residue of a G==C nucleotide pair (Fig. 8 -20); a thymi dine can pair with the adenosine of an A =T pair. The N-7, 06, and N6 of purines, the atoms that participate in the hydrogen bonding of triplex DNA, are often referred to as Hoogsteen positions, and the non-Watson-Crick pairing is called Hoogsteen pairing, after Karst Haag steen, who in 1 963 first recognized the potential for these unusual pairings. Hoogsteen pairing allows the formation of triplex DNAs. The triplexes shown in Figure 8-20 (a, b) are most stable at low pH because the C==G c + triplet requires a protonated cytosine. I n the triplex, the pKa of this cytosine is >7.5, altered from its normal value of 4.2. The triplexes also form most readily within long sequences containing only pyrimidines or only purines in a given strand. Some triplex DNAs contain two pyrirni-
\. I I I
II I � II I ,
A GC C T A
(b)
\.
GT C
r
I II I II
• 3' 5' •
G A
T
:o:
Cruciform
FIGURE 8-19 Hairpins and cruciforms.
Pa l i ndromic DNA ( o r RNA)
sequences can form alternative structures with intrastrand base pair ing.
(a) When only a s i ngle DNA (or RNA) strand is i nvolved, the struc (b) When both strands of a dup lex DNA are
ture is cal led a hairpin.
i nvolved, it is cal led a cruc iform . B l u e shad i ng highl ights asymmetric sequences that can pa i r with the complementary sequence either i n the same strand or i n the complementary strand.
dine strands and one purine strand; others contain two purine strands and one pyrimidine strand. Four DNA strands can also pair to form a tetraplex (quadruplex) , but this occurs readily only for DNA se quences with a very high proportion of guanosine residues (Fig. 8-20c, d) . The guanosine tetraplex, or G tetraplex, is quite stable over a wide range of condi tions. The orientation of strands in the tetraplex can vary as shown in Figure 8-20e. In the DNA of living cells, sites recognized by many sequence-specific DNA-binding proteins (Chapter 28) are arranged as palindromes, and polypyrimidine or poly purine sequences that can form triple helices are found within regions involved in the regulation of expression of some eukaryotic genes. In principle, synthetic DNA strands designed to pair with these sequences to form
1 '-C -N
�
0);-
CH
-l
8 . 2 N u cleic Acid Structure
\__ 0
,,,
N
H, ''
H
K
� _
_,.... H
R _,....
l'\9"
K
�
0
C H3
y 0
'C-1 '
[283]
l ' -(
H
C-1' T=A•T
(a)
Guanosine tetraplex (c)
(b)
(d)
FIGURE 8-20 DNA structures containing three or four DNA strands.
(a)
Base-pa i r i ng patterns in one well -characterized form of triplex
DNA. The Hoogsteen pair i n each case is shown in red.
(b) Triple
helical DNA conta i n i n g two pyri m i d i ne strands (poly(()) and one
purine strand (poly(G)) (derived from PDB I D 1 BCE). The dark blue and
l i ght blue strands are antipara l lel and paired by normal Watson-Crick
base-pai r i ng patterns. The third (a l l -pyrimidi ne) strand (purple) is par al lel to the purine strand and pai red through non-Watson-Crick hydro gen bonds. The triplex is viewed end-on, with five triplets shown. Only
(c) Base-pairing pattern i n (d) Two successive tetraplets from a
the triplet c losest to the viewer is colored. the guanos ine tetrap lex structure.
G tetraplex structure, viewed end-on with the one closest to the viewer in color.
(e)
Antiparallel
Poss ible variants in the orientation of strands in a G
tetraplex.
triplex DNA could disrupt gene expression. This ap proach to controlling cellular metabolism is of commer cial interest for its potential application in medicine and agriculture. Messenger RNAs Code for Polypeptide Chains
We now turn our attention to the expression of the ge netic information that DNA contains. RNA, the second major form of nucleic acid in cells, has many functions. In gene expression, RNA acts as an intermediary by us ing the information encoded in DNA to specify the amino acid sequence of a functional protein. Given that the DNA of eukaryotes is largely con fined to the nucleus whereas protein synthesis occurs
(e)
on ribosomes in the cytoplasm, some molecule other than DNA must carry the genetic message from the nucleus to the cytoplasm. As early as the 1950s, RNA was considered the logical candidate: RNA is found in both the nucleus and the cytoplasm, and an increase in protein synthesis is accompanied by an increase in the amount of cytoplasmic RNA and an increase in its rate of turnover. These and other observations led several researchers to suggest that RNA carries genetic infor mation from DNA to the protein biosynthetic machin ery of the ribosome. In 1961 Franc;ois Jacob and Jacques Monod presented a unified (and essentially correct) picture of many aspects of this process. They proposed the name "messenger RNA" (mRNA) for that portion of the total cellular RNA carrying the genetic
[2s4]
N u c l eotides a n d N u c l e i c Acids
5' _______ 3' Gene (a) Monocistronic
these RNAs reflect a diversity of structure much richer than that observed in DNA molecules. The product of transcription of DNA is always single-stranded RNA The single strand tends to assume
5 · -----------��-- 3' Gene 1 Gene 3 Gene 2 (b) Polycistronic
between two purines than between a purine and pyrim
a right-handed helical conformation dominated by base stacking interactions
(Fig. 8-2 2 ), which are stronger
FIGURE 8-21 Bacterial mRNA. Schematic diagrams show (a) mono
idine or between two pyrimidines. The purine-purine in
cistronic and (b) polycistronic mRNAs of bacteria. Red segments rep
teraction is so strong that a pyrimidine separating two
resent RNA cod i ng for a gene product; gray segments represent
purines is often displaced from the stacking pattern so
noncod i ng RNA. In the polycistronic transcript, noncoding RNA sepa
that the purines can interact. Any self-complementary
rates the three genes.
sequences in the molecule produce more complex structures. RNA can base-pair with complementary re gions of either RNA or DNA Base pairing matches the
information from DNA to the ribosomes, where the
pattern for DNA:
messengers provide the templates that specify amino
with the occasional T residue in some RNAs) . One dif
G pairs with
C and A pairs with
acid sequences in polypeptide chains. Although mRNAs
ference is that base pairing between
from different genes can vary greatly in length, the
unusual in DNA-is fairly common in RNA
mRNAs from a particular gene generally have a defined
Fig.
size. The process of forming mRNA on a DNA template
duplexes are antiparallel, as in DNA
is known as
transcription.
8 -24) .
U
(or
G and U residues (see
The paired strands in RNA or RNA-DNA
RNA has no simple , regular secondary structure
In bacteria and archaea, a single mRNA molecule
that serves as a reference point, as does the double he
may code for one or several polypeptide chains. If it car
lix for DNA The three-dimensional structures of many
ries the code for only one polypeptide, the mRNA is
RNAs, like those of proteins, are complex and unique.
monocistronic; if it codes for two or more different polypeptides, the mRNA is polycistronic. In eukary
Weak interactions, especially base-stacking interac tions, help stabilize RNA structures, just as they do in
otes, most mRNAs are monocistronic. (For the purposes
DNA. Where complementary sequences are present,
of this discussion, "cistron" refers to a gene. The term it
the predominant double-stranded structure is an A
self has historical roots in the science of genetics, and its
form right-handed double helix. Z-form helices have
formal genetic definition is beyond the scope of this
been made in the laboratory (under very high-salt or
text.) The minimum length of an mRNA is set by the length of the polypeptide chain for which it codes. For example, a polypeptide chain of
1 00 amino acid residues 300
requires an RNA coding sequence of at least
nucleotides, because each amino acid is coded by a nucleotide triplet (this and other details of protein synthesis are discussed in Chapter
27).
However,
mRNAs transcribed from DNA are always somewhat longer than the length needed simply to code for a polypeptide sequence (or sequences) . The additional, noncoding RNA includes sequences that regulate pro tein synthesis.
Figure 8-2 1 summarizes the general
structure of bacterial mRNAs.
Many RNAs Have More Complex Three-Dimensional Structures Messenger RNA is only one of several classes of cellular RNA Transfer RNAs are adapter molecules in protein synthesis; covalently linked to an amino acid at one end, they pair with the mRNA in such a way that amino acids are j oined to a growing polypeptide in the correct sequence. Ribosomal RNAs are components of ribo somes. There is also a wide variety of special-function zymatic activity. All the RNAs are considered in detail in RNAs, including some (called ribozymes) that have en Chapter
26.
The diverse and often complex functions of
FIGURE 8-22 Typical right-handed stacking pattern of single-stranded RNA. The bases are shown in gray, the phosphate atoms in yellow, and
RNA strands in succeeding chapters, j ust as blue is used for DNA.
the riboses and phosphate oxygens in green. G reen is used to represent
8 . 2 N u cleic Acid Structure
high-temperature conditions) . The B form of RNA has not been observed. Breaks in the regular A-form helix caused by mismatched or unmatched bases in one or both strands are common and result in bulges or inter nal loops ( Fig. 8 - 2 3 ) . Hairpin loops form between nearby self-complementary sequences. The potential for base-paired helical structures in many RNAs is ex tensive ( Fig. 8-24) , and the resulting hairpins are the most common type of secondary structure in RNA. Spe cific short base sequences (such as UUCG) are often found at the ends of RNA hairpins and are known to form particularly tight and stable loops. Such se quences may act as starting points for the folding of an RNA molecule into its precise three-dimensional struc ture. Other contributions are made by hydrogen bonds that are not part of standard Watson-Crick base pairs . For example , the 2 ' -hydroxyl group of ribose can hy drogen-bond with other groups. Some of these proper ties are evident in the structure of the phenylalanine transfer RNA of yeast-the tRNA responsible for insert ing Phe residues into polypeptides-and in two RNA enzymes, or ribozymes, whose functions, like those of
FIGURE 8-24 Base-paired helical structures in an RNA. Shown here is the possible secondary structure of the M1 RNA component of the
enzyme RNase P of E. coli, with many hairpins. RNase P, which also
contains a protein component (not shown), functions i n the processing
of transfer RNAs (see Fig. 2 6-2 7). The two brackets ind icate add i tional comp lementary sequences that may b e p a i red i n t h e three d i mensional structure. The blue dots ind icate non-Watson-Crick G=U base pairs (boxed inset). Note that G=U base pairs are al lowed only when presynthesized strands of RNA fold up or anneal with each other. There are no RNA polymerases (the enzymes that synthesize RNAs on a DNA template) that insert a U opposite a template G, or vice versa, during RNA synthesis.
( N'ff-----
All, then Ren der > Scheme > Ball and Stick) . Identify the sugar-phosphate backbone for each strand of the DNA duplex. Locate and identify individual bases. Identify the 5' end of each strand. Locate the major and minor grooves. Is this a right- or left handed helix? (b) Obtain the file for 1 45D, a DNA with the Z conforma tion. Display the molecule as a ball-and-stick structure. Identify the sugar-phosphate backbone for each strand of the DNA duplex. Is this a right- or left-handed helix? (c) To fully appreciate the secondary structure of DNA, view the molecules in stereo. On the control menu, Select > All, then Render > Stereographic > Cross-eyed or Wall eyed. You will see two images of the DNA molecule. Sit with your nose approximately 1 0 inches from the monitor and fo cus on the tip of your nose (cross-eyed) or the opposite edges of the screen (wall-eyed ) . In the background you should see three images of the DNA helix. Shift your focus to the middle image, which should appear three-dimen sional. (Note that only one of the two authors can make this work.)
Data Analysis Problem 1 7 . Chargaff's Studies of DNA Structure The chapter section "DNA Is a Double Helix that Stores Genetic Informa tion" includes a summary of the main findings of Erwin Char gaff and his coworkers, listed as four conclusions ("Chargaff's rules"; p. 278) . In this problem, you will examine the data Chargaff collected in support of these conclusions. In one paper, Chargaff (1950) described his analytical methods and some early results. Briefly, he treated DNA
samples with acid to remove the bases, separated the bases by paper chromatography, and measured the amount of each base with UV spectroscopy. His results are shown in the three tables below. The molar ratio is the ratio of the number of moles of each base in the sample to the number of moles of phosphate in the sample-this gives the fraction of the total number of bases represented by each particular base. The recovery is the sum of all four bases (the sum of the molar ratios) ; full recovery of all bases in the DNA would give a recovery of 1 .0.
Molar ratios in ox DNA
Base Adenine Guanine Cytosine Thymine Recovery
Thymus
Spleen
Liver
Prep. 1 Prep. 2 Prep. 3
Prep. 1 Prep. 2
Prep. 1
0.26 0.21 0.16 0.25
0.88
0.28 0.24 0.18 0.24
0.88
0.84
0. 94
0. 94
0.26 0.20
0.26 0.21 0. 1 7 0.24
0.25 0.20 0.15 0.24
0.30 0.22 0. 1 7 0.25
Molar ratios in human DNA Sperm
Base Adenine Guanine Cytosine Thymine Recovery
Prep. 1 Prep. 2 0 .29 0 . 18 0.18 0.3 1
0.96
0.27 0.17 0.18 0.30
0.92
Thymus
Liver
Prep. 1
Normal Carcinoma
0.28 0.19 0.16 0.28
0.27 0.18 0.15 0.27
0.27 0.19
0.87
0. 91
Molar ratios in DNA of microorganisms Avian tubercle bacilli
Yeast Base Adenine Guanine Cytosine Thymine Recovery
Prep. 1
Prep. 2
Prep. 1
0.24 0. 14 0.13 0.25
0.30 0. 18 0.15 0.29
0.12 0.28 0.26 0.11
0. 76
0. 92
0. 77
(a) Based on these data, Chargaff concluded that "no dif ferences in composition have so far been found in DNA from different tissues of the same species." This corresponds to conclusion 2 in this chapter. However, a skeptic looking at the data above might say, "They certainly look different to me!" If you were Chargaff, how would you use the data to convince the skeptic to change her mind? (b) The base composition of DNA from normal and can cerous liver cells (hepatocarcinoma) was not distinguishably different. Would you expect Chargaff's technique to be capable of detecting a difference between the DNA of normal and can cerous cells? Explain your reasoning. As you might expect, Chargaff's data were not completely convincing. He went on to improve his techniques, as described
[3o2]
N u cleotides a n d N u cleic Acids
in a later paper (Chargaff, 195 1 ) , in which he reported molar
tetranucleotide polymer (AGCT)n and therefore not capable of
ratios of bases in DNA from a variety of organisms:
containing sequence information. Although the data presented above show that DNA cannot be simply a tetranucleotide-if so,
Source
A:G
Ox
T:C
A:T
G:C
Purine:pyrimidine
Salmon
1 .43 1 .04 1 . 00 1 . 56 1 . 75 1 .00 1 .0 0 1 .45 1 .29 1 .06 0.91 1 .43 1 .4 3 1 . 02 1 . 02
Wheat
1 .22
1 . 18
1 .00
0.97
0.99
Yeast
1 .67
1 .92
1 .03
1 .20
1 .0
1 .29
Hwnan Hen
1.1 1 .0 0.99 1 .02
Haemophilus injiuenzae type c
E. coli K- 1 2
Serratia marcescens Bacillus schatz
still possible that the DNA from different organisms was a slightly
more complex, but still monotonous, repeating sequence. To address this issue, Chargaff took DNA from wheat germ and treated it with the enzyme deoxyribonuclease for different time intervals. At each time interval, some of the DNA was converted to small fragments; the remaining, larger fragments he called the "core." In the table below, the " 1 9% core" corresponds to the larger fragments left behind when 8 1 % of the DNA was degraded; the "8% core" corresponds to
1 . 74
1 .54
1 . 07
0.91
1 .0
1 .05
0 .95
1 .09
0.99
1 .0
0.4
0.4
1 .09
1 .08
1.1
Adenine
0.27
0.33
0. 7
0.7
0.95
0.86
0.9
Guanine
0.22
0.20
0.20
0.7
0.6
1 .12
0.89
1 .0
Cytosine
0.22
0.14
Thymine
0.98
0.16 0.26
Avian tubercle bacillus
all samples would have molar ratios of 0.25 for each base-it was
(c) According to Chargaff, as stated in conclusion 1 in this
the larger fragments left after 92% degradation.
Base
Recovery
chapter, "The base composition of DNA generally varies from
Intact DNA
0.27
19%
Core
0.95
8%
Core
0 . 35
0.92 0.23
one species to another." Provide an argument, based on the data presented so far, that supports this conclusion. (d) According to conclusion 4, "In all cellular DNAs, re gardless of the species . . . A + G
=
T + C . " Provide an argu
ment, based on the data presented so far, that supports this conclusion. Part of Chargaffs intent was to disprove the "tetranucleotide hypothesis"; this was the idea that DNA was a monotonous
(e) How would you use these data to argue that wheat germ DNA is not a monotonous repeating sequence? References Chargaff, E. (1950) Chemical specificity of nucleic acids and mecha nism of their enzymic degradation. Experientia 6, 201-209. Chargaff, E. (1951) Structure and function of nucleic acids as cell
constituents. Fed Proc. 10, 654-659.
Of a l l the natura l systems, l iving matter is the one which, in the face of great transformations, p reserves i nscribed i n its
o rga n i zati o n the
largest amount of its own past h i story. -Emile Zuckerkandl and L inus Pauling
article in journal of Theoreti cal B iology, 7 965
DNA-Based I nformation Technologies 9.1
9.2 9.3
9.4
DNA Cloning: The Basics
From Genes to Genomes
3 04
315
From Genomes to Proteomes
324
Genome Alteration s and New Products of Biotech nology
330
e now turn t o a technology that is fundamental to the advance of modern biological sciences, defining present and future biochemical fron tiers and illustrating many important principles of bio chemistry. Elucidation of the laws governing enzymatic catalysis , macromolecular structure, cellular metabo lism, and information pathways allows research to be di rected at increasingly complex biochemical processes. Cell division, immunity, embryogenesis, vision, taste, oncogenesis , cognition-all are orchestrated in an elab orate symphony of molecular and macromolecular interactions that we are now beginning to understand with increasing clarity. The real implications of the bio chemical j ourney begun in the nineteenth century are found in the ever-increasing power to ana lyze and alter living systems. To understand a complex biological process, a biochemist isolates and studies the individual components in vitro, then pieces together the parts to get a coherent picture of the overall process. A major source of molecular insights is the cell's own information archive , its DNA. The sheer size of chromosomes, however, pre sents an enormous challenge: how does one Pau l Berg find and study a particular gene among the
tens of thousands of genes nested in the billions of base pairs of a mammalian genome? Solutions began to emerge in the 1970s. Decades of advances by thousands of scientists working in genetics , biochemistry, cell biology, and physical chemistry came together in the laboratories of Paul Berg, Herbert Boyer, and Stanley Cohen to yield techniques for locating, isolating, preparing, and studying small segments of DNA derived from much larger chromosomes. Techniques for DNA cloning . paved the way to the m9dern fields of genomics and' proteomics, the study of genes and proteins on the scale of whole cells and organisms. These new methods are transforming basic research, agriculture, medicine, ecology, forensics, and many other fields, while occa sionally presenting society with difficult choices and ethical dilemmas. We begin this chapter with an outline of the funda mental biochemical principles of the now-classic disci pline of DNA cloning. Next, we illustrate the range of applications and the potential of a range of newer tech nologies, with a broad emphasis on modern advances in genomics and proteomics .
Herbert Boyer
Stanley N. Cohen
i
303
J
l 3 04J
D N A-Ba sed I nfo rmation Te chnologies
9.1 DNA Cloning: The Basics A clone is an identical copy. This term originally applied to cells of a single type, isolated and allowed to repro duce to create a population of identical cells. DNA cloning involves separating a specific gene or DNA seg ment from a larger chromosome, attaching it to a small molecule of carrier DNA, and then replicating this mod ified DNA thousands or millions of times through both an increase in host cell number and the creation of mul tiple copies of the cloned DNA in each cell. The result is selective amplification of a particular gene or DNA seg ment. Cloning of DNA from any organism entails five general procedures: 1.
Cutting DNA at precise locations. Sequence specific endonucleases (restriction endonucleases) provide the necessary molecular scissors.
2. Selecting a small molecule of DNA capable of self-replication. These DNAs are called cloning vectors (a vector is a delivery agent) . They are typically plasmids or viral DNAs. 3. Joining two DNA fragments covalently. The enzyme DNA ligase links the cloning vector and DNA to be cloned. Composite DNA molecules comprising covalently linked segments from two or more sources are called recombinant DNAs. 4.
Moving recombinant DNA from the test tube to a host cell that will provide the enzymatic machinery for DNA replication.
5.
Selecting or identifying host cells that contain recombinant DNA .
The methods used to accomplish these and related tasks are collectively referred to as recombinant DNA tech nology or, more informally, genetic engineering. Much of our initial discussion will focus on DNA cloning in the bacterium Escherichia coli, the first or ganism used for recombinant DNA work and still the most common host cell. E. coli has many advantages: its DNA metabolism (like many other of its biochemical processes) is well understood; many naturally occurring cloning vectors associated with E. coli, such as plasmids and bacteriophages (bacterial viruses; also called phages) , are well characterized; and techniques are available for moving DNA expeditiously from one bacte rial cell to another. The principles discussed here are broadly applicable to DNA cloning in other organisms, a topic discussed more fully later in the chapter. Restriction Endonucleases and DNA ligase Yield Recombinant DNA
Particularly important to recombinant DNA technology is a set of enzymes (Table 9-1 ) made available through decades of research on nucleic acid metabolism. Two classes of enzymes lie at the heart of the classic approach to generating and propagating a recombinant DNA mole cule (Fig. 9-1 ) . First, restriction endonucleases
Cloning vector (plasmid)
©
!
G) Cloning vector is cleaved wilh restriction endonuclea e.
� 1®
Eukaryotic chromosome
DNA fragment of interest is obtained by cleaving chromosome with a restriction endonuclease.
are ligated J.;' ) @ Fragments the prepared cloning .-.
1"·"•"' '� '
to
vector.
H Recombinant � vector
1@
l@
DNA is introduced. into the host cell.
Propagation cloning produces many copies of recombinant DNA.
FIGURE 9-1 Schematic illustration of DNA cloning. A cloning vector and eukaryotic chromosomes are separately cleaved with the same re striction endonuclease. The fragments to be cloned are then l igated to the cloning vector. The resulting recombinant DNA (only one recom binant vector is shown here) is i ntroduced i nto a host cell where it can be propagated (cloned). Note that this drawing is not to scale: the size
of the E. coli chromosome relative to that of a typical cloning vector (such as a plasmid) is much greater than depicted here.
(also called restriction enzymes) recognize and cleave DNA at specific sequences (recognition sequences or re striction sites) to generate a set of smaller fragments. Second, the DNA fragment to be cloned is joined to a suitable cloning vector by using DNA ligases to link the DNA molecules together. The recombinant vector is then introduced into a host cell, which amplifies the fragment in the course of many generations of cell division. Restriction endonucleases are found in a wide range of bacterial species. Werner Arber discovered in the early 1 960s that their biological function is to recognize and cleave foreign DNA (the DNA of an infecting virus,
9 . 1 D N A Cloning: The B a s ics
TA B L E 9-1
Enzyme(s)
[3os]
Some Enzymes Used in Recombinant DNA Tecbnolagy
--� ------------------�
Function
Type II restriction endonucleases
Cleave DNAs at specific base sequences
DNA ligase
Joins two DNA molecules or fragments
DNA polymerase I (E. coli)
Fills gaps in duplexes by stepwise addition of nucleotides to 3' ends
Reverse transcriptase
Makes a DNA copy of an RNA molecule
Polynucleotide kinase
Adds a phosphate to the 5' -OH end of a polynucleotide to label it or permit ligation
Terminal transferase
Adds homopolymer tails to the 3' OH ends of a linear duplex
Exonuclease III
Removes nucleotide residues from the 3' ends of a DNA strand
Bacteriophage A exonuclease
Removes nucleotides from the 5' ends of a duplex to expose single-stranded 3' ends
-
Alkaline phosphatase
Removes terminal phosphates from either the 5' or 3' end (or both)
for example) ; such DNA is said to be restricted. In the host cell's DNA, the sequence that would be recognized by its own restriction endonuclease is protected from di gestion by methylation of the DNA, catalyzed by a spe cific DNA methylase. The restriction endonuclease and the corresponding methylase are sometimes referred to as a restriction-modification system. There are three types of restriction endonucleases, designated I, II, and III. Types I and III are generally large, multisubunit complexes containing both the en donuclease and methylase activities. Type I restriction endonucleases cleave DNA at random sites that can be more than 1 ,000 base pairs (bp) from the recognition sequence. Type III restriction endonucleases cleave the DNA about 25 bp from the recognition sequence. Both TA B L E 9-2 BamHJ
Clal
types move along the DNA in a reaction that requires the energy of ATP. Type II restriction endonucleases, first isolated by Hamilton Smith in 1 970, are simpler, re quire no ATP, and cleave the DNA within the recognition sequence itself. The extraordinary utility of this group of restriction endonucleases was demonstrated by Daniel Nathans, who first used them to develop novel methods for mapping and analyzing genes and genomes. Thousands of restriction endonucleases have been discovered in different bacterial species, and more than 1 00 different DNA sequences are recognized by one or more of these enzymes. The recognition sequences are usually 4 to 6 bp long and palindromic (see Fig. 8-1 8) . Table 9-2 lists sequences recognized by a few type II restriction endonucleases.
Recognition Sequences for Some Type II Restriction Endonudeases t
*
(5') G G A T C C (3') CCTAGG
*
t
*
i
(5') A T C G A T (3') TAGCTA
*
i
t *
EcoRI
(5') G A A T T C (3') CTTAAG
EcoRV
(5') G A T A T C (3 ') CTATAG
Haem
(5') G G C C (3') CCGG
*
t
t*
*t
i
i
t
HindIII
(5') A A G C T T (3') TTCGAA
NotI
(5') G C G G C C G C (3 ') CGCCGGCG
Pstl
(5') C T G C A G (3 ') GACGTC
Pvuii
(5') C A G C T G (3') GTCGAC
Tth l l l l
(5') G A C N N N G T C (3 ') CTGNNNCAG
i
t
* t
i
*
t
i
Arrows indicate the phosphodiester bonds cleaved by each restriction endonuclease. Asterisks indicate bases that are methylated by the corresponding methylase (where known). N denotes any base. Note that the name of each enzyme consists of a three-letter abbreviation (in italics) of the bacterial species from which it is derived, sometimes followed by a strain designation and Roman numerals to distinguish different restriction endonucleases isolated from the same bacterial species. Thus BamHI is the first (I) restriction endonuclease characterized from Bacillus amyloliquefaciens, strain H.
i
t
i
l_ 3 06]
D N A- Based I n fo rmation Tec h n o l o g ies
Some restriction endonucleases make staggered cuts on the two DNA strands, leaving two to four nu cleotides of one strand unpaired at each resulting end. These unpaired strands are referred to as sticky ends ( Fig. 9-2 a) , because they can base-pair with each other or with complementary sticky ends of other DNA fragments. Other restriction endonucleases cleave both strands of DNA at the opposing phosphodiester bonds, leaving no unpaired bases on the ends, often called blunt ends (Fig. 9-2b) . The average size of the DNA fragments produced by cleaving genomic DNA with a restriction endonuclease depends on the frequency with which a particular re striction site occurs in the DNA molecule; this in turn depends largely on the size of the recognition sequence. Recognition
Cleavage site
_· L _
/ sequences _/
In a DNA molecule with a random sequence in which all four nucleotides were equally abundant, a 6 bp se quence recognized by a restriction endonuclease such as BamHI would occur on average once every 46 (4,096) bp, assuming the DNA had a 50% G=C content. En zymes that recognize a 4 bp sequence would produce smaller DNA fragments from a random-sequence DNA molecule; a recognition sequence of this size would be 4 expected to occur about once every 4 (256) bp. In nat ural DNA molecules, particular recognition sequences tend to occur less frequently than this because nu cleotide sequences in DNA are not random and the four nucleotides are not equally abundant. In laboratory ex periments, the average size of the fragments produced by restriction endonuclease cleavage of a large DNA Cleavage site
+
Chromosomal - - - G G T' G � b-.J'_T_C . A G C T T C G C A T T A G C A G : C T G T A G C - - DNA
1
j
1 i
- - - C C A � T T A A;QJ T C G A A G C G T A A T C G T C I G A C , A T C G - - -
- - - G G T Gi - - - C C A -iC T T A� A·
1.-( •;-; ( l�l('lJiJJl l'lHionuvk;L-.:l J-" -, 1 ' 1
�T T C J A G C T T C G C A T T A G C A G m r c G A A G C G T AA T C G T C
1'1"1/ "
!"('�[!'!!. JU!)
-.. exonuclease and terminal trans ferase (Table 9-1) . The fragments to be joined were given complementary homopolymeric tails. Peter Lobban and Dale Kaiser used this method in 1971 in the first ex periments to join naturally occurring DNA fragments. Similar methods were used soon after in the laboratory of Paul Berg to join DNA segments from simian virus 40 (SV40) to DNA derived from bacteriophage >-.. , thereby creating the first recombinant DNA molecule with DNA segments from different species.
[3o7]
Plasmids Plasmids are circular DNA molecules that replicate separately from the host chromosome. Natu rally occurring bacterial plasmids range in size from 5,000 to 400,000 bp. They can be introduced into bacte rial cells by a process called transformation. The cells (generally E. coli) and plasmid DNA are incubated to gether at 0 oc in a calcium chloride solution, then sub jected to a shock by rapidly shifting the temperature to 37 to 43 °C. For reasons not well understood, some of the cells treated in this way take up the plasmid DNA. Some species of bacteria, such as Acinetobacter baylyi, are naturally competent for DNA uptake and do not re quire the calcium chloride treatment. In an alternative method, cells incubated with the plasmid DNA are sub j ected to a high-voltage pulse. This approach, called electroporation, transiently renders the bacterial membrane permeable to large molecules. Regardless of the approach, few cells actually take up the plasmid DNA, so a method is needed to select those that do. The usual strategy is to use a plasmid that includes a gene that the host cell requires for growth under specific conditions, such as a gene that confers resistance to an antibiotic. Only cells transformed by the recombinant plasmid can grow in the presence of that antibiotic, making any cell that contains the plasmid "selectable" under those growth conditions. Such a gene is called a selectable marker. Investigators have developed many different plas mid vectors suitable for cloning by modifying naturally occurring plasmids . The now classic E. coli plasmid pBR322 offers a good example of the features useful in a cloning vector (Fig. 9-3 ) .
EcoRI H1
Tetracycline resistance (tetR) pBR322
(4,36lbp)
Cloning Vectors Al low Amplification of Inserted DNA Segments
The principles that govern the delivery of recombinant DNA in clonable form to a host cell, and its subsequent amplification in the host, are well illustrated by consid ering three popular cloning vectors commonly used in experiments with E. coli-plasmids, bacteriophages, and bacterial artificial chromosomes-and a vector used to clone large DNA segments in yeast.
Origin of replication
(ori)
Puuii
FIGURE 9-3 The constructed E. coli plasmid pBR322. Note the location of some i mportant restriction s ites-for Psti, EcoRI, BamHI,
Sail, and Pvui i; ampicil l i n- and tetracycl i ne-resistance genes; and the
repl ication origin (ori). Constructed in 1 977, this was one of the early
plasm ids designed expressly for cloning in £. coli.
[3 os]
D N A - Based I n fo rmation Tec h n o l ogies
U
Q
Important pBR322 features include: amp
o 6''0 °
1 �o c
Q)
pBR322 i cleaved at the ampicillin resistance element by Pst l .
®
')
V
Foreign DNA is ligated to cleaved pBR322. Where ligatwn is successful, the ampicillin-resistance element is disrupted. The tetracycline-resistance element remains intact.
oro o
®
1 . An origin of replication, ori, a sequence where replication is initiated by cellular enzymes (Chapter 25) . This sequence is required to propagate the plasmid and maintain it at a level of 1 0 to 20 copies per cell.
pBR322 plasmid
R
I' I , t n n. nd I O U Jt.:u I
n
:
�
Fo ign D A
ll ,\ l .
og 1
cells are transformed, then transformation grown on agar plates containing of E. coli cells tetracycline to select for those that have taken up plasmid. Ho t D Au--""=--
E. coli
1 @
selection
of
All colonies have plasmids
Agar containing tetracycline (control)
3.
Several unique recognition sequences (Pstl, EcoRI, BamHI, Sall, Pvull) that are targets for different restriction endonucleases, providing sites where the plasmid can later be cut to insert foreign DNA.
4.
Small size (4,361 bp) , which facilitates entry of the plasmid into cells and the biochemical manipulation of the DNA.
Transformation of typical bacterial cells with purified DNA (never a very efficient process) becomes less suc cessful as plasmid size increases, and it is difficult to clone DNA segments longer than about 1 5 ,000 bp when plasmids are used as the vector. Bacteriophages Bacteriophage A. has a very efficient mechanism for delivering its 48,502 bp of DNA into a bacterium, and it can be used as a vector to clone some what larger DNA segments (Fig. 9-5 ) . Two key fea tures contribute to its utility: 1.
2.
Agar containing tetracycline
Agar containing ampicillin + tetracycline
Cells that grow on tetracycline but not on tetracycline + ampicillin contain recombinant plasmids with disrupted ampicillin resistance, hence the foreign DNA. Cells with pBR322 without foreign DNA retain ampicillin resistance and grow on both plates. F I G U RE 9-4 Use of pBR322 to clone foreign DNA in f. coli and
identify cells containing it.
Two genes that confer resistance to different antibiotics (tetR , ampR) , allowing the identification of cells that contain the intact plasmid or a recombinant version of the plasmid (Fig. 9-4) .
transformed cells
Individual colonies are transferred to matching positions on additional plates. One plate contains tetracycline, the other tetracycline and ampicillin. Colonies with recombinant plasmids
®
2.
Plasmid Cloning
About one-third of the A. genome is nonessential and can be replaced with foreign DNA. DNA is packaged into infectious phage particles only if it is between 40,000 and 53,000 bp long, a constraint that can be used to ensure packaging of recombinant DNA only.
Researchers have developed bacteriophage A. vec tors that can be readily cleaved into three pieces, two of which contain essential genes but which together are only about 30,000 bp long. The third piece , "filler" DNA, is discarded when the vector is to be used for cloning, and additional DNA is inserted between the two essential segments to generate ligated DNA mole cules long enough to produce viable phage particles. In effect, the packaging mechanism selects for recombi nant viral DNAs . Bacteriophage A. vectors permit the cloning of DNA fragments of up to 23,000 bp. Once the bacteriophage A. fragments are ligated to foreign DNA fragments of suit able size , the resulting recombinant DNAs can be pack aged into phage particles by adding them to crude bacterial cell extracts that contain all the proteins needed to assemble a complete phage. This is called in vitro packaging (Fig. 9-5) . All viable phage particles will contain a foreign DNA fragment. The subsequent transmission of the recombinant DNA into E. coli cells is highly efficient.
9 . 1 D N A C l o n i n g : The Basics
re�tnt·tion
endnnnclell5e
Filler DNA (not needed
§§�§�§=�� �� �oreign D�A ! � fragments
DN.\ liga-
Lack essential DNA and/or are too small to be packaged
Recombinant DNAs
[3o9]
Bacterial Artificial Chromosomes (BACs) Bacte rial artificial chromosomes are simply plasmids designed for the cloning of very long segments (typically 1 00,000 to 300,000 bp) of DNA (Fig. 9-6) . They generally in clude selectable markers such as resistance to the an tibiotic chloramphenicol (CmR) , as well as a very stable origin of replication (ori) that maintains the plasmid at one or two copies per cell. DNA fragments of several hundred thousand base pairs are cloned into the BAC vector. The large circular DNAs are then introduced into host bacteria by electroporation. These procedures use host bacteria with mutations that compromise the struc ture of their cell wall, permitting the uptake of the large DNA molecules.
Cloning sites (include lacZ)
1
�
F plasmid
par genes
in vitro
�A. ]"
packaging n• rru:t10n
bacteriophage oontaining foreign DNA
,
cntlntlU ll'a�c
,
J
Large foreign DNA fragment with appropriate sticky enrls
FIGURE 9-5 Bacteriophage cloning vectors. Recomb i nant DNA meth
ods are used to modify the bacteriophage r.. genome, removing the
ll!":\ !J!!a�t!
genes not needed for phage production and replacing them with
"filler" DNA to make the phage DNA large enough for packaging into phage particles. As shown here, the fil ler is replaced with foreign D NA i n clon i ng experiments. Recombi nants are packaged into viable phage particles in vitro only if they incl ude an appropriately sized foreign DNA fragment as wel l as both of the essential r.. DNA end fragments.
FIGURE 9-6 Bacterial artificial chromosomes (BACs) as cloning vectors. The vector is a relatively simple plasmid, with a repl ication ori gin (ori) that di rects replication. The par genes, derived from a type of
r
electroporation
plasmid cal led an F plasmid, assist i n the even distribution of plasm ids to daughter cel ls at cell division. This increases the l i kelihood of each daughter cel l carrying one copy of the plasmid, even when few copies are present. The low number of copies is useful in cloning l arge seg ments of DNA because it l imits the opportunities for unwanted recom bi nation reactions that can unpredictably alter large cloned DNAs over time. The BAC includes selectable markers. A JacZ gene (required for the production of the enzyme j3-galactosidase) is situated i n the cloning region such that it is inactivated by cloned DNA inserts. I ntroduction of recombinant BACs into cel ls by electroporation is promoted by the use of cells with an altered (more porous) cel l wal l . Recombinant DNAs are screened for resistance to the antibiotic chloramphenicol (Cm R). Plates
selection of
chloramphenicol-
resi tant ce\il:l
1
Agar containing chloramphenicol and substrate for ,a-galactosidase
-:::=:z ::: S
also contain a substrate for J3-galactosidase that yields a colored prod uct. Colonies with active J3-galactosidase and hence no DNA insert i n the BAC vector turn bl ue; colonies without f:l-galactosidase activity and thus with the desired DNA i nserts-are white.
Colonies with recombinant BACs are white.
' 310
D N A-Based I n formation Tec h n o l o g ies
Yeast Artificial Chromosomes (YACs) E. coli cells are by no means the only hosts for genetic engineering. Yeasts are particularly convenient eukaryotic organisms for this work. As with E. coli, yeast genetics is a well developed discipline. The genome of the most com monly used yeast, Saccharomyces cerevisiae, contains only 1 4 X 1 06 bp (a simple genome by eukaryotic standards, less than four times the size of the E. coli chromosome) , and its entire sequence is known. Yeast is also very easy to maintain and grow on a large scale in the laboratory. Plasmid vectors have been constructed for yeast, employing the same principles that govern the use of E. coli vectors described above . Convenient methods are now available for moving DNA into and out of yeast cells, facilitating the study of many aspects of eukaryotic cell biochemistry. Some recombinant plas mids incorporate multiple replication origins and other elements that allow them to be used in more than one species (for example, yeast or E. coli) . Plasmids that can be propagated in cells of two or more different species are called shuttle vectors. Research with large genomes and the associated need for high-capacity cloning vectors led to the devel opment of yeast artificial chromosomes (YACS; Fig. 9- 7) . YAC vectors contain all the elements needed to maintain a eukaryotic chromosome in the yeast nu cleus: a yeast origin of replication, two selectable mark ers, and specialized sequences (derived from the telomeres and centromere, regions of the chromosome discussed in Chapter 24) needed for stability and proper segregation of the chromosomes at cell division. Before being used in cloning, the vector is propagated as a cir cular bacterial plasmid. Cleavage with a restriction en donuclease (BamHI in Fig. 9-7) removes a length of DNA between two telomere sequences (TEL) , leaving the telomeres at the ends of the linearized DNA. Cleav age at another internal site (EcoRI in Fig. 9-7) divides the vector into two DNA segments, referred to as vector arms, each with a different selectable marker. The genomic DNA is prepared by partial digestion with restriction endonucleases (EcoRI in Fig. 9-7) to ob tain a suitable fragment size. Genomic fragments are then separated by pulsed field gel electrophoresis, a varia tion of gel electrophoresis (see Fig. 3-18) that allows the separation of very large DNA segments. The DNA fragments of appropriate size (up to about 2 x 1 06 bp) are mixed with the prepared vector arms and ligated. The ligation mixture is then used to transform treated yeast cells with very large DNA molecules. Culture on a medium that requires the presence of both selectable marker genes ensures the growth of only those yeast cells that contain an artificial chromosome with a large insert sandwiched between the two vector arms (Fig. 9-7) . The stability of YAC clones increases with size (up to a point) . Those with inserts of more than 1 50,000 bp are nearly as stable as normal cellular chromosomes, whereas those with inserts of less than 1 00,000 bp are gradually lost dur ing mitosis (so generally there are no yeast cell clones
BamHI digestion creates linear chromosome with telomeric ends EcoRl
TEL
Y
X
Left arm has selectable marker X
TEL
?,:;��· �-j[:)
V' ;
�
1
,
n ..r "-' 2 tu ., ...,.. (, "'
Right arm has selectable marker Y
C: J '" Fragments of genomic
Ligate
DNA generated by light digestion with EcoRI
YAC
Enzymatic cligestion of cell wall
Transform
Select for
X and Y -·--·�
Yeast spheroplast
Yeast cell
Yeast with YAC clone
FIGURE 9-7 Construction of a yeast artificial chromosome (YAC). A YAC vector includes an origin of repl ication (ori), a centromere (CEN),
two telomeres (TEL), and selectable markers (X and Y). Digestion with
Bam H I and fcoR I generates two separate DNA arms, each with a
telomeric end and one selectable marker. A large segment of DNA (e.g., up to 2
x
1 06 bp from the h u man genome) i s ligated to the two
arms to create a yeast artificial chromosome. The YAC transforms yeast cel l s (prepared by removal of the cel l wal l to form spheroplasts), and
the cells are selected for X and Y; the surviving cells propagate the DNA i nsert.
carrying only the two vector ends ligated together or with only short inserts) . YACs that lack a telomere at either end are rapidly degraded. Specific DNA Sequences Are Detectable by Hybridization
DNA hybridization, a process outlined in Chapter 8 (see Fig. 8-29) , is the most common sequence-based process for detecting a particular gene or segment of nucleic acid. There are many variations of the basic method, most making use of a labeled (such as radioactive) DNA
9 . 1 D N A Cloning: The Bas ics
Agar plate with transformed bacterial colonies
-----
[31 1j
or RNA fragment, known as a probe, complementary to the DNA being sought. In one classic approach to detect a particular DNA sequence within a DNA library (a col lection of DNA clones) , nitrocellulose paper is pressed onto an agar plate containing many individual bacterial colonies from the library, each colony with a different recombinant DNA. Some cells from each colony adhere to the paper, forming a replica of the plate. The paper is treated with alkali to disrupt the cells and denature the DNA within, which remains bound to the region of the paper around the colony from which it came . Added ra dioactive DNA probe anneals only to its complementary DNA. After any unannealed probe DNA is washed away, the hybridized DNA can be detected by autoradiography (Fig. 9-8 ) . A common limiting step in detecting and cloning a gene is the generation of a complementary strand of nucleic acid to use as a probe. The origin of a probe de pends on what is known about the gene under investiga tion. Sometimes a homologous gene cloned from another species makes a suitable probe . Or, if the pro tein product of a gene has been purified, probes can be designed and synthesized by working backward from the amino acid sequence, deducing the DNA sequence that would code for it (Fig. 9-9) . Now, researchers typ ically obtain the necessary DNA sequence information from sequence databases that detail the structure of millions of genes from a wide range of organisms .
Press nitrocellulose paper onto the agar plate. Some cells from each colony stick to the paper.
Nitrocellulose paper
DNA bound to paper
Radiolabeled DNA probe Incubate the paper with the radiolabeled probe, then wash. ....,._ . �--\-- Probe annealed to
FIGURE 9-9 Probe to detect the gene for a protein of known amino acid sequence. Because more than one DNA sequence can code for
colonies of interest \
any given amino acid sequence, the genetic code is said to be "degen erate." (As described in Chapter 27, an amino acid is coded for by a set of three nucleotides called a codon. Most a m i no acids have two or
Expose
more codons; see Fig. 2 7-7.) Thus the correct DNA sequence for a known amino acid sequence cannot be known in advance. The probe
x-ray film to paper.
is designed to be complementary to a region of the gene with m i n i ma l degeneracy, that is, a region with the fewest possible codons for the amino acids-two codons at most in the example shown here. Ol igonucleotides are synthesized with
selectively randomized
FIGURE 9-8 Use of hybridization to identify a clone with a particular
sequences, so that they conta i n either of the two possible nucleotides
DNA segment. The radioactive DNA probe hybridizes to complemen
at each position of potential degeneracy (shaded in p i n k). The ol igonu
tary DNA and is revealed by autoradiography. Once the labeled
cleotide shown here represents a mixture of eight different sequences:
colonies have been identified, the corresponding colonies on the orig
one of the eight w i l l complement the gene perfectly, and a l l eight w i l l
inal agar plate can be used as a source of cloned DNA for further study.
match a t least 1 7 o f the 2 0 positions.
Known amino acid sequence H3N - - - Gly - Leu - Pro - Trp - Glu - Asp - Met - Trp - Phe - Val - Arg - - - coo+
Possible codons
(5') G G A U U A C C A : u G G G A A G A C A U G U G G U U C U UU GGC UUG C C C : GAG GAU GGU CUA C C U 1 G G G C UC C C G i C UU
Region of minimal degeneracy
C UG
Synthetic probes
G U:A G u:c G UIU G U:G
U
C C G G GAA G G A UA U G U G G U U U. G U 20 nucleotides long, 8 possible sequences
A G A C3') AGG C GA CGC CGU CGG
[3 1 2]
D N A-Based I nfo rmation Tech n o l o g i e s
Bacterial promoter (P) and operator (0) sequences
Expression of Cloned Genes Produces large Quantities of Protein
Frequently it is the product of the cloned gene, rather than the gene itself, that is of primary interest particularly when the protein has commercial, therapeu tic, or research value. With an increased understanding of the fundamentals of DNA, RNA, and protein metabo lism and their regulation in E. coli, investigators can now manipulate cells to express cloned genes in order to study their protein products. Most eukaryotic genes lack the DNA sequence elements-such as promoters, sequences that instruct RNA polymerase where to bind-required for their expression in E. coli cells, so bacterial regulatory se quences for transcription and translation must be in serted at appropriate positions relative to the eukaryotic gene in the vector DNA. (Promoters, regulatory se quences, and other aspects of the regulation of gene ex pression are discussed in Chapter 28.) In some cases cloned genes are so efficiently expressed that their protein product represents 1 0% or more of the cellular protein; they are said to be overexpressed. At these con centrations some foreign proteins can kill an E. coli cell, so gene expression must be limited to the few hours be fore the planned harvest of the cells. Cloning vectors with the transcription and transla tion signals needed for the regulated expression of a cloned gene are often called expression vectors. The rate of expression of the cloned gene is controlled by re placing the gene's own promoter and regulatory se quences with more efficient and convenient versions supplied by the vector. Generally, a well-characterized promoter and its regulatory elements are positioned near several unique restriction sites for cloning, so that genes inserted at the restriction sites will be expressed from the regulated promoter element ( Fig. 9-1 0 ). Some of these vectors incorporate other features, such as a bacterial ribosome binding site to enhance transla tion of the mRNA derived from the gene, or a transcrip tion termination sequence. Genes can similarly be cloned and expressed in eu karyotic cells, with various species of yeast as the usual hosts. A eukaryotic host can sometimes promote post translational modifications (changes in protein structure made after synthesis on the ribosomes) that might be re quired for the function of a cloned eukaryotic protein. Alterations i n Cloned Genes Produce Modified Proteins
Cloning techniques can be used not only to overproduce proteins but to produce protein products subtly altered from their native forms. Specific amino acids may be re placed individually by site-directed mutagenesis. This powerful approach to studying protein structure and function changes the amino acid sequence of a pro tein by altering the DNA sequence of the cloned gene. If appropriate restriction sites flank the sequence to be
Gene encoding repressor that binds 0 and regulates P
Polylinker with unique sites for several restriction / endonucleases (i.e., cloning sites)
,(� � ,(
Transcription termination sequence
ori
Selectable genetic marker (e.g., antibiotic resistance) FIGURE 9-10 DNA sequences in a typical f. coli expression vector.
The gene to be expressed is inserted i nto one of the restriction sites i n the polyl i nker, near the promoter (P), with the end encod i n g the amino terminus proxi m a l to the promoter. The promoter a l lows efficient transcription of the inserted gene, and the transcription termination se quence sometimes i mproves the amount and stabil ity of the mRNA produced. The operator (0) permits regulation by means of a repressor that binds to it (Chapter 28). The ribosome binding site provides se quence signals needed for efficient translation of the mRNA derived from the gene. The selectable marker allows the selection of cel l s con tain ing the recombi nant DNA.
altered, researchers can simply remove a DNA segment and replace it with a synthetic one that is identical to the original except for the desired change (Fig. 9-l l a). When suitably located restriction sites are not present, an approach called oligonucleotide-directed muta genesis (Fig. 9-l lb) can create a specific DNA se quence change. A short synthetic DNA strand with a specific base change is annealed to a single-stranded copy of the cloned gene within a suitable vector. The mismatch of a single base pair in 1 5 to 20 bp does not prevent annealing if it is done at an appropriate temper ature. The annealed strand serves as a primer for the synthesis of a strand complementary to the plasmid vec tor. This slightly mismatched duplex recombinant plas mid is then used to transform bacteria, where the mismatch is repaired by cellular DNA repair enzymes (Chapter 25) . About half of the repair events will re move and replace the altered base and restore the gene to its original sequence; the other half will remove and replace the normal base, retaining the desired muta tion. Transformants are screened (often by sequencing their plasmid DNA) until a bacterial colony containing a plasmid with the altered sequence is found. Changes can also be introduced that involve more than one base pair. Large parts of a gene can be deleted by cutting out a segment with restriction endonucleases
9 . 1 D N A Clon i n g : The Basics
� �
Recombinant DNA
plasmid
o
Ge n
Single strand of recombinant smid DNA Ge"'
h
ligonucleotid �V ith sequence hru1g
ynthetic DNA fragment with specific base-
() �
pair change
lJ!\ •. 1 •l.1 111rr dNTP , I>'JA 11
DNA liga.;e
•
Plasmid contains gen with desired base pair change. -
(a)
In E . coli cells, about half the plasmids will have gene with desired base-pair change. (b) FIGURE 9-1 1 Two approaches to site-directed mutagenesis. (a) A syn thetic DNA segment replaces a DNA fragment that has been removed by cleavage with a restriction endonuclease. (b) A synthetic ol igonu cleotide with a desi red sequence change at one position is hybridized to a single-stranded copy of the gene to be altered. This acts as primer
duction of the altered DNA into the cell permits investi gation of the consequences of the alteration. Site directed mutagenesis has greatly facilitated research on proteins by allowing investigators to make specific changes in the primary structure of a protein and to ex amine the effects of these changes on the folding, three dimensional structure, and activity of the protein. Terminal Tags Provide Binding Sites for Affinity Purification
Affinity chromatography is one of the most efficient meth ods available for protein purification (see Fig. 3-1 7c) . Unfortunately, there are many proteins for which there is no known ligand that can be conveniently immobilized on a chromatographic medium. The use of fusion pro teins has made it possible to purify almost any protein by affinity chromatography. First, the gene encoding the target protein is fused to a gene encoding a peptide or protein that binds to a known ligand with high affinity and specificity. The pep tide or protein used for this purpose, which may be at tached at either the amino or carboxyl terminus, is called a terminal tag or (more often) simply a tag. Some proteins and peptides commonly used as tags are listed in Table 9-3 along with their ligands. The general procedure is illustrated by the attach ment of a tag consisting of glutathione-S-transferase (GST) . GST is a small enzyme CMr 26,000) that binds tightly and specifically to the molecule glutathione (Fig 9-1 2 ) . If the GST gene sequence is fused to a tar get gene, the fusion protein acquires the capacity to bind glutathione. The fusion protein is expressed in a bacterial or other host organism, and a crude extract is prepared. A column is filled with a porous matrix con sisting of the ligand (in this case, glutathione) immobi lized to microscopic beads of a stable polymer such as cross-linked agarose. As the crude extract percolates through this column matrix, the fusion protein becomes immobilized by binding to the glutathione. The other TA B L E 9-3
Tag protein/ peptide Protein A
Molecular mass (kDa) 59 0.8
Immobilized ligand Fe portion of IgG
Ni2 +
for synthesis of a duplex DNA (with one mismatch), which is then used
(His)6
to transform cells. Cel lular DNA repair systems w i l l convert about 50%
Glutathione-Stransferase (GST)
26
Glutathione
Maltose-binding protein
41
Maltose
,a-Galactosidase
116
of the mismatches to reflect the desi red sequence change.
and ligating the remaining portions to form a smaller gene . Parts of two different genes can be ligated to create new combinations. The product of such a fused gene is called a fusion protein. Researchers now have ingenious methods to bring about virtually any genetic alteration in vitro. Reintro-
[31 3]
Chitin-binding domain
5.7
p-Aminophenyl-,8o-thiogalactoside (TPEG) Chitin
[314]
D N A-Based I n fo rmation Tec h n o l o g ies
(b)
(a)
Transcription
Glutathione-S-transferase (GST)
r-
Gene for target protein """'
'" GST
Gene for fusion protein
�
FIGURE 9-1 2 The use of tagged proteins in protein purification. The use of a GST tag is illustrated. (a) G lutathione-5-transferase (CST) is a smal l enzyme (depicted here by the purple icon) that binds glutathione
r. -:c c
(a gl utamate residue to which a Cys-Giy dipeptide is attached at the carboxyl carbon of the G l u side chain, hence the abbreviation GSH).
•e c
(b) The GST tag is fused to the carboxyl termi nus of the target protein by genetic engineering. The tagged protein is expressed i n host cel ls,
Express fusion protein in a cell.
Prepare cell extract containing fusion protein as part of the cell protein mixture.
and is present i n the crude extract when the cells are lysed. The extract is subjected to chromatography on a column conta i n i ng a medi u m with i m mobilized glutathione. The G ST-tagged protein binds t o the gl utathione, retard ing its m igration through the column, wh i l e the other proteins wash through rapi d ly. The tagged protei n is subse quently eluted from the column with a solution conta i ning elevated salt concentration or free gl utathione.
proteins in the extract are washed through the column and discarded. The interaction between GST and glu tathione is strong but noncovalent, allowing the fusion protein to be gently eluted from the column using a solu tion containing either a higher concentration of salts or free glutathione to compete with the immobilized ligand for GST binding. Fusion proteins can often be obtained with good yield and high purity in this way. In some com mercially available systems, the tag can be partially or completely removed from the purified fusion protein us ing a protease that cleaves a sequence near the junction between the target protein and its fused tag. A short tag with widespread application consists of a simple sequence of six or more histidine residues. These histidine tags or His tags, as they are more commonly known, bind tightly and specifically to nickel ions. Chro matography media with immobilized Ni2 + can then be used to efficiently separate His-tagged proteins from oth ers in an extract. Larger tags, such as maltose-binding protein, can enhance solubility and compensate for lack of stability in target proteins, allowing the purification of proteins that cannot be purified by other methods. Tag technology is powerful and convenient, and has been used successfully in thousands of published stud ies. However, one must be wary when using tagged pro teins in experiments. Terminal tags are not inert. Even very small tags can affect the properties of the proteins to which they are attached and thus affect experimental results. Activity may be affected even when tags are re moved by proteases, if one or a few extra amino acid residues remain associated with the target protein. Re sults obtained from tagged proteins should always be evaluated with the aid of well-designed controls to as sess the effect of the tag on protein function.
Elute fusion protein.
S U M M A RY 9 . 1 •
•
•
D N A Clon ing: The Bas i cs
DNA cloning and genetic engineering involve the cleavage of DNA and assembly of DNA segments in new combinations-recombinant DNA Cloning entails cutting DNA into fragments with enzymes; selecting and possibly modifying a fragment of interest; inserting the DNA fragment into a suitable cloning vector; transferring the vector with the DNA insert into a host cell for replication; and identifying and selecting cells that contain the DNA fragment. Key enzymes in gene cloning include restriction endonucleases (especially the type II enzymes) and DNA ligase .
9.2 From Genes to Genomes
•
Cloning vectors include plasmids, bacteriophages, and, for the longest DNA inserts, bacterial artificial chromosomes (BACs) and yeast artificial chromosomes (YACs) .
•
Cells containing particular DNA sequences can be identified by DNA hybridization methods.
•
Genetic engineering techniques manipulate cells to express and/or alter cloned genes.
•
Proteins or peptides can be attached to a protein of interest by altering its cloned gene, creating a fusion protein. The additional peptide segments can be used to detect the protein, or to purify it using convenient affinity chromatography methods.
9.2 From Genes to Genomes The modern science of genomics now permits the study of DNA on a cellular scale, from individual genes to the entire genetic complement of an organism-its genome . Genomic databases are growing rapidly, as one sequencing milestone is superseded by the next. Biology in the twenty-first century will move forward with the aid of informational resources undreamed of only a few years ago. We now turn to a consideration of some of the technologies fueling these advances.
[315]
Using hybridization methods, researchers can order individual clones in a library by identifying clones with overlapping sequences. A set of overlapping clones rep resents a catalog for a long contiguous segment of a genome, often referred to as a contig (Fig. 9-1 3 ) . Pre viously studied sequences or entire genes can be located within the library using hybridization methods to deter mine which library clones harbor the known sequence. If the sequence has already been mapped on a chromo some, investigators can determine the location (in the genome) of the cloned DNA and any contig of which it is a part. A well-characterized library may contain thou sands of long contigs, all assigned to and ordered on par ticular chromosomes to form a detailed physical map. The known sequences within the library (each called a sequence-tagged site, or STS) can provide landmarks for genomic sequencing proj ects. As more and more genome sequences become avail able, the utility of genomic libraries is diminishing and investigators are constructing more specialized libraries designed to study gene function. An example is a library that includes only those genes that are expressed-that is, are transcribed into RNA-in a given organism or even in certain cells or tissues. Such a library focuses on those portions of a genome relevant to the function of a tissue or cell type. The researcher first extracts mRNA from an organism or from specific cells of an
DNA libra ries Provide Specialized Catalogs of Genetic Information
A DNA library is a collection of DNA clones, gathered to gether as a source of DNA for sequencing, gene discov ery, or gene function studies. The library can take a variety of forms, depending on the source of the DNA. Among the largest types of DNA library is a genomic library, produced when the complete genome of a par ticular organism is cleaved into thousands of fragments, and all the fragments are cloned by insertion into a cloning vector. The first step in preparing a genomic library is par tial digestion of the DNA by restriction endonucleases, such that any given sequence will appear in fragments of a range of sizes-a range that is compatible with the cloning vector and ensures that virtually all sequences are represented among the clones in the library. Frag ments that are too large or too small for cloning are re moved by centrifugation or electrophoresis. The cloning vector, such as a BAC or YAC plasmid, is cleaved with the same restriction endonuclease and ligated to the genomic DNA fragments. The ligated DNA mixture is then used to transform bacterial or yeast cells to pro duce a library of cell types, each type harboring a differ ent recombinant DNA molecule. Ideally, all the DNA in the genome under study will be represented in the library. Each transformed bacterium or yeast cell grows into a colony, or "clone ," of identical cells, each cell bearing the same recombinant plasmid, one of many represented in the overall library.
--- 11 111111 1111 llll ll ll 11 1! 11 11 11 1111 ---
Segment of chromosome from organism X A BC D
BAC
clones 6 11 5 II
41 II I
ll
3 1 !I I I 2 1 II I I
EF
71 1?1�I
IIII 01
£1 1
Ill
II I I
G H 1
J
K L
MNO
PQ
11 11 w
£IT]
9 l ll fl ll 11 11
s 111 IJ ll ll I
FIGURE 9-1 3 Ordering of the clones in a DNA library. Shown here is
a segment of a chromosome from a hypothetical organism X, with
markers A through Q representi ng sequence-tagged sites (STSs-DNA segments of known sequence, including known genes) . Below the
chromosome is an array of ordered BAC clones, numbered 1 to 9. Or
dering the clones on the genetic map is a many-stage process. The
presence or absence of an STS on an individual clone can be deter m ined by hybridization-for example, by probing each clone with DNA complementary to the STS. Once the STSs on each BAC clone are identified, the clones (and the STSs themselves, if their location is not yet known) can be ordered on the map. For example, compare
clones 3, 4, and 5. Marker E (blue) is found on a l l three clones; F (red)
on clones 4 and 5, but not on 3; and C (green) only on clone 5. This ind icates that the order of the sites is f, F, C. The clones partia l l y
overlap a n d their order must b e 3, 4, 5 . The resulting ordered series of clones is cal led a contig.
13 1 6 L
--'
D N A - Based I nfo rmation Te c h n o l ogies
organism and then prepares complementary DNAs ( cDNAs ) from the RNA in a multistep reaction cat alyzed by the enzyme reverse transcriptase (Fig. 9-14). The resulting double-stranded DNA fragments are then inserted into a suitable vector and cloned, creating a population of clones called a eDNA library. The search for a particular gene is made easier by focusing on a eDNA library generated from the mRNAs of a cell known to express that gene. For example, if we wished to clone globin genes, we could first generate a eDNA library from erythrocyte precursor cells, in which about half the mRNAs code for globins. To aid in the mapping of large genomes , cDNAs in a library can be partially sequenced at random to produce a useful type of STS called an ex pressed sequence tag (EST). ESTs, ranging in size from a few dozen to several hundred base pairs , can be
5'
mRNA
5'
5'
mRNA-DNA hybrid
3'
3'
3' -
5'
5'
Duplex DNA
3' -
AAAAAAA
1
1 1
1 1
AI
mRNA template is annealed to a synthetic
oligonucleotide (oligo dT) primer.
� 3 ' 1T T T T T T T TI
positioned within the larger genome map , providing markers for expressed genes. Hundreds of thousands of ESTs were included in the detailed physical maps used as a guide to sequencing the human genome. A eDNA library can be made even more specialized by cloning cDNAs or eDNA fragments into a vector that fuses each eDNA sequence with the sequence for a marker, or reporter gene ; the fused genes form a "reporter construct. " Two useful markers are the genes for green fluorescent protein and epitope tags . A target gene fused with a gene for green fluorescent pro tein (GFP) generates a fusion protein that is highly fluorescent-it literally lights up ( Fig. 9-1 5a) . GFP, derived from the jellyfish Aequorea victoria, has a f3-barrel structure, with a fluorophore in the center of the barrel (see Box 1 2-3, p. 434) . The fluorophore is
Transcription Insert GFP eDNA
(a)
AAAAAAA
transcriptase and dNTPs yield a oomplementary DNA strand.
Reverse
� T T T T T T T TI
-.---,----..---, In s ert Epitope eDNA tag
r:( b)
AAAAAAA
---+·� �� )
degraded with alkali.
'lb prime
synthesis of a seoond strand, an oligonucleotide of known sequence is often ligated to the 3' end of the eDNA T T T T T T T TI
DNA polymerase I and dNTPs extend the primer to yield double-stranded DNA
I T T T T T T T TI AAAAAAAA
lMak
Express tagged protein in a cell.
extract.
mRNA is
T T T T T T T TI
'----..·-·------/
II
Precipitate tagged protein
• Identify new proteins in
with , pecific antibody.
Precipitate
precipitate (e.g., with mass spectrometry). FIGURE 9-1 5 Specialized DNA libraries. (a) Cloning of eDNA next to a gene for green fluorescent prote i n (GFP) creates a reporter construct. RNA transcription proceeds through the gene of interest (insert DNA) and the reporter gene, and the mRNA transcript is then expressed as a fusion protein . The GFP part of the protei n is visible in the fluorescence microscope. The photograph shows a nematode worm conta i n i ng a
FIGURE 9-14 Construction of a eDNA library from mRNA. A cel l's
GFP fusion protei n expressed only i n the four "touch" neurons that run
m RNA includes transcripts from thousands of genes, and the cDNAs
the length of i ts body.
generated are correspondi ngly heterogeneous. The duplex DNA
cloned next to a gene for an epitope tag, the resu lting fusion protei n
8 Reporter
Constructs (b) I f the eDNA is
produced by this method i s i nserted into a n appropriate cloning vector.
can b e precipitated b y antibodies t o the epitope. Any other proteins
Reverse transcriptase can synthesize DNA on an RNA or a D NA
that interact with the tagged protein a lso precipitate, helping to eluci
template (see Fig. 2 6-3 3 ) .
date protein-protei n i nteractions.
9.2 From Genes to Genomes
derived from a rearrangement and oxidation of several amino acid residues in an autocatalytic reaction that requires only molecular oxygen (see Box 12-3, Fig. 3). Thus the protein is readily cloned in an active form in almost any cell. Just a few molecules of this protein can be observed microscopically, allowing the study of its location and movements in a cell. Careful protein engi neering has generated mutant forms of GFP with a range of different colors and other properties (bright ness, stability), and related proteins have recently been isolated from other species. An epitope tag is a short protein sequence that is bound tightly by a well-characterized monoclonal anti body (p. 1 73). The tagged protein can be specifically precipitated from a crude protein extract by interac tion with the antibody (Fig. 9-15b). If any other pro teins bind to the tagged protein, those will precipitate as well, providing information about protein-protein interactions in a cell. The diversity and utility of special ized DNA libraries (and tagged proteins) are growing every year. The Polymerase Chain Reaction Amplifies Specific DNA Sequences
The Human Genome Project, along with the many asso ciated efforts to sequence the genomes of organisms of every type, is providing unprecedented access to gene sequence information. This in turn is simplifying the process of cloning individual genes for more detailed biochemical analysis. If we know the sequence of at least the flanking parts of a DNA segment to be cloned, we can hugely amplify the number of copies of that DNA segment, using the polymerase chain reaction (PCR), a process conceived by Kary Mullis in 1 983. The amplified DNA can be cloned directly or used in a variety of analytical procedures. The PCR procedure has an elegant simplicity. Two synthetic oligonucleotides are prepared, complemen tary to sequences on opposite strands of the target DNA at positions defining the ends of the segment to be am plified. The oligonucleotides serve as replication primers that can be extended by DNA polymerase. The 3' ends of the hybridized probes are oriented toward each other and positioned to prime DNA synthesis across the desired DNA segment ( Fig. 9-1 6) . (DNA polymerases synthesize DNA strands from deoxyribonu cleotides, using a DNA template, as described in Chapter 25.) Isolated DNA containing the segment to be amplified is heated briefly to denature it, and then cooled in the presence of a large excess of the synthetic oligonucleotide primers. The four deoxynucleoside triphosphates are then added, and the primed DNA seg ment is replicated selectively. The cycle of heating, cool ing, and replication is repeated 25 or 30 times over a few hours in an automated process, amplifying the DNA segment between the primers until it can be readily
[31 7]
analyzed or cloned. PCR uses a heat-stable DNA poly merase, such as the Taq polymerase (derived from a bacterium that lives at 90 °C), which remains active af ter every heating step and does not have to be replen ished. Careful design of the primers used for PCR, such as including restriction endonuclease cleavage sites, can facilitate the subsequent cloning of the amplified DNA (Fig. 9-16b). This technology is highly sensitive: PCR can detect and amplify as little as one DNA molecule in almost any type of sample. Although DNA degrades over time (p. 289), PCR has allowed successful cloning of DNA from samples more than 40,000 years old. Investigators have used the technique to clone DNA fragments from the mummified remains of humans and extinct animals such as the woolly mammoth, creating the new fields of molecular archaeology and molecular paleontology. DNA from burial sites has been amplified by PCR and used to trace ancient human migrations. Epidemiologists can use PCR-enhanced DNA samples from human remains to trace the evolution of human pathogenic viruses. In addition to its usefulness for cloning DNA, PCR is a potent tool in forensic medicine (Box 9-1). It is also be ing used for detection of viral infections before they cause symptoms and for prenatal diagnosis of a wide array of genetic diseases. The PCR method is also important in advancing the goal of whole genome sequencing. For example, the mapping of expressed sequence tags to particular chro mosomes often involves amplification of the EST by PCR, followed by hybridization of the amplified DNA to clones in an ordered library. Investigators found many other applications of PCR in the Human Genome Pro ject, to which we now turn. Genome Sequences Provide the Ultimate Genetic libraries
The genome is the ultimate source of information about an organism, and there is no genome we are more inter ested in than our own. Less than 1 0 years after the de velopment of practical DNA sequencing methods, serious discussions began about the prospects for se quencing the entire 3 billion base pairs of the human genome. The international Human Genome Project got underway with substantial funding in the late 1 980s. The effort eventually included significant contributions from 20 sequencing centers distributed among six na tions: the United States, Great Britain, Japan, France, China, and Germany. General coordination was provided by the Office of Genome Research at the National Insti tutes of Health, led first by James Watson and after 1 992 by Francis Collins. At the outset, the task of sequencing a 3 X 109 bp genome seemed to be a titanic job, but it gradually yielded to advances in technology. The com pleted sequence of the human genome was published in April 2003, several years ahead of schedule.
[31s]
D N A-Based I n formation Technologies
Region of target DNA to be amplified
FIGURE 9-16 Amplification of a DNA segment by the polymerase chain reaction. (a) The PCR procedure has three steps. DNA strands are
CD Heat to separate
strands. ® Add synthetic oligo nucleotide primers; cool.
3 'c=:======;:;;;;;;= ;;;= ===:r========:::::::�
CJ 5 ' ======�====�======:::J :: 5'r:::== D CJ
@ Add thermostable DNA polymerase to catalyze 5' � 3' DNA synthesis.
1 5'
3'
1
CD separated by heating, then Q) annealed to an excess of short
synthetic D NA primers (blue) that flank the region to be ampl ified;
G) new DNA is synthesized by polymerization. The three steps are re
peated for 25 or 30 cycles. The thermostable DNA polymerase Taql
(from Thermus aquaticus, a bacterial species that grows in hot springs) is not denatured by the heating steps. (b) DNA amplified by PCR can be cloned. The primers can i nclude noncomplementary ends that have a site for cleavage by a restriction endonuclease. Although these parts of the primers do not anneal to the target DNA, the PCR process in corporates them i nto the DNA that is amplified. Cleavage of the ampl i fied fragments at these sites creates sticky ends, used i n ligation of the ampl ified DNA to a cloning vector.
CD Heat to separate strands.
@ Anneal primers containing
noncomplementary regions with cleavage site for restriction endonuclease.
DNA synthesis (step @ ) is catalyzed by the thermostable DNA polymerase (still present). (5')GAATTC
(5')GAATTC
/
!
&pomteP' Q)
through @.
After 25 cycles, the target sequence has been amplified about 1Q6-fold.
(a)
IBI
l
CTTAAG(5' ) /
•
Replication
/
CTTAAG (5 ' )GAATTC
5'
Polymerase Chain Reaction
G AATTC
� � � � �
l
�
CTTAAG(5') /
PCR
CTTAAG GAATTC(3') EcoRI
endonuclease
Clone by insertion at an EcoRI site in a cloning vector.
(b)
CTTAA G
9.2 From Genes to Genomes
[319]
A Potent Wea p o n in Fore n s i c M e d i c i n e
BOX 9-1
Traditionally, one of the most accurate methods for plac ing an individual at the scene of a crime has been a fingerprint. With the advent of recombinant DNA tech nology, a more powerful tool is now available: DNA fingerprinting (also called DNA typing or DNA profil ing) . The method was first described by English geneti cist Alec Jeffreys in 1 985. DNA fingerprinting is based on sequence poly morphisms, slight sequence differences between indi viduals, 1 bp in every 1 ,000 bp, on average. Each difference from the prototype human genome sequence (the first one obtained) occurs in some fraction of the human population; every individual has some differ ences. Some of the sequence changes affect recognition sites for restriction enzymes, resulting in variation in the size of DNA fragments produced by digestion with a particular restriction enzyme. These variations are re striction fragment length polymorphisms (RFLPs ) .
Another type of sequence variation, and the one now used most commonly in DNA typing, involves short tandem repeats (STRs). The detection of RFLPs relies on a specialized hy bridization procedure called Southern blotting (Fig. 1 ) . DNA fragments from digestion of genomic DNA by restriction endonucleases are separated by size elec trophoretically, denatured by soaking the agarose gel in alkali, and then blotted onto a nylon membrane to re produce the distribution of fragments in the gel. The membrane is immersed in a solution containing a ra dioactively labeled DNA probe. A probe for a sequence that is repeated several times in the human genome generally identifies a few of the thousands of DNA fragments generated when the human genome is di gested with a restriction endonuclease. Autoradiogra phy reveals the fragments to which the probe hybridizes, as in Figure 1 . The method is very accurate (continued on next page)
!
Chromosomal DNA (e.g., Suspect 1) Cleave with restriction endonucleases.
I�
# , ,.. �._: ) ( .... 1)";-, ·r •
!
\.,.: /"
' • ;..
DNA fragments
�
Separate fragments by agarose gel electrophoresis (unlabeled).
1(..-=£1,_
"' '11'1.
-
= - = -
Denature DNA, and transfer to nylon membrane.
-
Radiolabeled DNA probe
= !- - ! -
-! Incubate wit.h probe, then wa h.
F I G U RE 1 The Southern blot procedure, as applied to RFLP DNA fin· gerprinting. Southern blotti ng (used for many purposes in molecular
-
Expose x-ray film to membrane.
Radioactive DNA probes were used to identify a smal l subset of frag ments that contained sequences complementary to the probe. The
biology) was named after Jeremy Southern, who developed the tech
sizes of the identified fragments varied from one i ndividual to the
nique. In this example of a forensic app l i cation, the DNA from a se
next, as seen here in the different patterns for the three i ndividuals
men sample obtained from a rape and murder victim was compared
(victim and two suspects) tested. One suspect's DNA exh i b i ts a
with DNA samples from the victim and two suspects. Each sample
banding pattern identical to that of the semen sample taken from
was cleaved i nto fragments and separated by gel electrophores is.
the victim.
[no]
D N A-Based I n formation Tec h n o logies
BOX 9-1
A Potent Wea pon in Fore n s i c M e d i c i n e
and was first used in court cases in the late 1 980s. How ever, it requires a large sample of undegraded DNA (>25 ng) . That amount of DNA is often not available at a crime scene or disaster site. The requirement for more-sensitive DNA typing methods led to a focus on the polymerase chain reaction (PCR; see Fig. 9-1 6) , and on STRs. An STR locus is a short DNA sequence, repeated many times in tandem at a particular location in a chromosome; most commonly, the repeated sequences are 4 bp long. The STR loci that are most useful for DNA typing are quite short, from 4 to 50 repeats long ( 1 6 to 200 total base pairs for tetranu cleotide repeats) , and have multiple length variants in the human population. More than 20,000 tetranu cleotide STR loci have been characterized in the human genome. More than a million STRs of all types may be present in the human genome, accounting for about 3% of all human DNA. The polymerase chain reaction is readily applied to STR analysis, and the focus of forensic scientists changed from RFLPs to STRs as the promise of in creased sensitivity became apparent in the early 1 990s. The DNA sequences flanking STRs are unique to each type of STR and identical (except for very rare muta tions) in all humans. PCR primers are targeted to this flanking DNA, and designed to amplify the DNA across
TA B L E 1
Locus
(continued from previous page)
the STR (Fig. 2a) . The length of the PCR product then reflects the length of the STR in that sample . Since each human inherits one chromosome from each parent, the STR lengths on the two chromosomes are often different, generating two signals from one indi vidual. If multiple STR loci are analyzed, a profile can be generated that is essentially unique to a particular individual. PCR amplification allows investigators to obtain DNA fingerprints from less than 1 ng of partially degraded DNA, an amount that can be obtained from a single hair follicle, a drop of blood, a small semen sam ple on a bed sheet, or samples that might be months or even many years old. Successful forensic use of STR analysis required standardization. The first forensic STR standard was established in the United Kingdom in 1 995. The U.S. standard, called the COmbined DNA Index System (CODIS) , was established in 1 998. The CODIS system is based on 1 3 well-studied STR loci (Table 1 ) , which must be present in any DNA typing experiment carried out in the United States. The amelogenin gene is also used as a marker. This gene, present on the human sex chromosomes, has slightly different flanking DNA on the X and Y chromosomes. PCR amplification across the amelogenin gene thus generates different-size products that can reveal the sex of the DNA donor.
Properties of the Loci Used for the CODIS Database
----
Chromosome
Repeat motif
Repeat length (ranget
Number of alleles seent
CSFlPO
5
TAGA
5-16
20
FGA
4
CTTT
12.2-51.2
80
THO!
11
TCAT
3-14
20
TPOX
2
GAAT
4-16
15
VWA
12
[TCTG][TCTA]
10-25
28
D381358
3
[TCTG][TCTA]
8-2 1
24
D58818
5
AGAT
7-18
15
D7S820
7
GATA
5-16
30
D881 179
8
[TCTA][TCTG]
7-20
17
Dl383 1 7
13
TATC
5-16
17
D 1 68539
16
GATA
5-16
19
D 18851
18
AGAA
7-39.2
51
D21Sl l
21
[TCTA][TCTG]
12-4 1 .2
82
X,Y
Not applicable
Amelogenin
Source: Adapted from Butler, J.M. (2005) Forensic DNA Typing, 2nd edn, Academic Press, San Diego, p. 96.
• Repeat lengths observed in the human population. Partial or imperfect repeats can be included in some alleles. t Number of different alleles observed to date in the human population. Careful analysis of a locus in many individuals is a prerequisite to its use in forensic DNA typing.
9 . 2 From Genes to Genomes
The CODIS database contained 2.8 million samples prior to 2006, and is linked to all 50 United States. As of mid-2005, it had assisted more than 25,000 forensic investigations. Convenient kits have been developed commercially that allow the amplification of 1 6 or more STR loci in one test tube. These "multiplex" STR kits (Fig. 2b) have PCR primers unique to each locus. Each primer is care fully designed to avoid hybridization to any other primer in the kit and to generate PCR products of different sizes so as to spread out the signals from the different loci dur ing electrophoresis. The primers are linked to colored dyes to help distinguish the different PCR products. The most widely used kits now include the 13 CODIS loci, amelogenin, and two additional loci used by law enforce ment agencies elsewhere in the world ( 1 6 total) . The kits are very precise in establishing human identity. When good DNA profiles are obtained, the chance of an acci dental match between two individuals in the human pop ulation is less than 1 in 1 0 18 (quintillion) . DNA typing has been used to both convict and ac quit suspects and, in other cases, to establish paternity with an extraordinary degree of certainty. The impact of these procedures on court cases will continue to grow as standards are improved and as international DNA typing databases grow. Even very old mysteries can be solved: in 1 996, DNA fingerprinting helped to confirm the iden tification of the bones of the last Russian czar and his family, who were assassinated in 1918.
(a) 20 a· 5' 3' 5'
l
Allele 2 PCR amplifimtion
c-::J
TR sequences
Run PCR fragments on a � ..;_. ·� 'i*..-� �-;;j::, ,... �· :> e�r.·# ·�· \) .4} -:: --
�- Ql �· ,·; �- =-:· ��; 1:� ��� · ;' ·=·
j
II
nlcohol w :�ldchyde
Ha
CHa
Vitamin A1 ( retinol )
'\
CHJ
1r.CH20H
CH,b
CH3
j
j
oxidatiOn of
H/
CH3
(d)
light
visible
j
�
-------+
u
1 .2
c""'o
11-cis-Retinal (visual pigment)
(b)
Retinoic acid
(c)
12
CH,�
Hormonal signal to epithelial cells
Neuronal signal to brain
jn j
-----7
[3 61]
R/c""'o
CH3
all-trans-Retinal (e)
{:1-Carotene (a) FIGURE 1 0-21 Vitamin A1 and its precursor and derivatives. (a) {3-
Carotene is the precursor of vitami n A 1 . Isoprene structural units are set off by dashed red l ines (see p. 3 59). Cleavage of {3-carotene yields two
widespread in nature. In the dark, retinal of rhodopsi n is in the 1 1 -cis form (c). When a rhodopsi n molecule i s excited by visible light, the 1 1 -cis-retinal undergoes a series of photochemical reactions that con
molecules of vitamin A1 (retinol) (b). Oxidation at C-1 5 converts retinol
vert it to all-trans-retinal (e), forci n g a change in the shape of the entire
to the aldehyde, retinal (c), and further oxidation produces retinoic acid
rhodopsi n molecule. This transformation i n the rod cel l of the verte
(d), a hormone that regulates gene expression. Retinal combines with
brate retina sends an electrical signal to the bra i n that is the basis of
the prote i n opsin to form rhodopsin (not shown), a visual pigment
visual transduction, a topic we address in more deta i l i n Chapter 1 2 .
Vitamins E and K and the lipid Quinones Are
protein that holds blood clots together. Henrik Dam and Edward A Doisy independently discovered that vitamin K deficiency slows blood clotting, which can be fatal. Vita min K deficiency is very uncommon in humans, aside from a small percentage of infants who suffer from hem orrhagic disease of the newborn, a potentially fatal dis order. In the United States, newborns are routinely given a 1 mg injection of vitamin K. Vitamin K1 (phyllo quinone) is found in green plant leaves; a related form, vitamin K2 (menaquinone) , is formed by bacteria living in the vertebrate intestine.
Oxidation-Reduction Cofactors
Vitamin E is the collective name for a group of closely related lipids called tocopherols, all of which contain a substituted aromatic ring and a long iso prenoid side chain (Fig. 10-22a). Because they are hy drophobic, tocopherols associate with cell membranes, lipid deposits, and lipoproteins in the blood. Tocopherols are biological antioxidants. The aromatic ring reacts with and destroys the most reactive forms of oxygen radicals and other free radicals, protecting unsaturated fatty acids from oxidation and preventing oxidative damage to mem brane lipids, which can cause cell fragility. Tocopherols are found in eggs and vegetable oils and are especially abun dant in wheat germ. Laboratory animals fed diets depleted of vitamin E develop scaly skin, muscular weakness and wasting, and sterility. Vitamin E deficiency in humans is very rare; the principal symptom is fragile erythrocytes. The aromatic ring of vitamin K (Fig. 1 0-22b) un dergoes a cycle of oxidation and reduction during the formation of active prothrombin, a blood plasma protein essential in blood clotting. Prothrombin is a proteolytic enzyme that splits peptide bonds in the blood protein fibrinogen to convert it to fibrin, the insoluble fibrous
Edward A. Daisy, 1 893-1 986
Henrik Dam, 1 895-1 976
HO
(a)
Vitamin
E: an antioxidant
Ha
w
�
9�
Ha
C H2-CH2-CH2-CH-CH2-CH2-CH2-CH-CH2-CH2-CH2-CH-C Ha CHa
CH3
(b)
Ha
Vitamin K,: a blood-clotting
H=
cofactor (phylloquinone)
H2-
(
9Hs
H2- H2- H-G H2
)
2
-
9Hs
H2- Hz-GH- H3
(c) Warfarin: a blood anticoagulant
(d) Ubiquinone: a mitochondrial electron carrier (coenzyme Q) (n = 4 to 8 )
(e) Plastoquinone: a chloroplast electron carrier (n
(f)
=
4 to 8 )
Dotichol: a sugar carrier
(n
=
9 to 22)
Ha
9 H�
9Ha
HO-CH2-CH2- H - H,- ( 1-!2- H= - H2 ), - H2- H= -CH�
F IGURE 10-22 Some other biologically active isoprenoid compounds or derivatives. U n its derived from isoprene are set off by dashed red l ines. In most mamma l ian tissues, ubiquinone (also called coenzyme Q)
Warfarin (Fig. 1 0-22c) is a synthetic compound that inhibits the formation of active prothrombin. It is partic ularly poisonous to rats, causing death by internal bleeding. Ironically, this potent rodenticide is also an in valuable anticoagulant drug for treating humans at risk for excessive blood clotting, such as surgical patients and those with coronary thrombosis. • Ubiquinone (also called coenzyme Q) and plasto quinone (Fig. 1 0-22d, e) are isoprenoids that function as lipophilic electron carriers in the oxidation-reduction reactions that drive ATP synthesis in mitochondria and chloroplasts, respectively. Both ubiquinone and plasto quinone can accept either one or two electrons and either one or two protons (see Fig. 1 9-2) . Dolichols Activate Sugar Precursors for Biosynthesis
During assembly of the complex carbohydrates of bacte rial cell walls, and during the addition of polysaccharide
1
has 1 0 isoprene un its. Dol i chols of animals have 1 7 to 2 1 isoprene
units (85 to 1 OS carbon atoms), bacterial dolichols have 1 1 , and those
of plants and fungi have 1 4 to 24.
units to certain proteins (glycoproteins) and lipids (gly colipids) in eukaryotes, the sugar units to be added are chemically activated by attachment to isoprenoid alco hols called dolichols (Fig. 1 0-22f) . These compounds have strong hydrophobic interactions with membrane lipids, anchoring the attached sugars to the membrane, where they participate in sugar-transfer reactions. Many N atural Pigments Are lipidic Conjugated Dienes
Conjugated dienes have carbon chains with alternating single and double bonds. Because this structural arrange ment allows the delocalization of electrons, the corn pounds can be excited by low-energy electromagnetic radiation (visible light) , giving them colors visible to hu mans and other animals. Carotene (Fig. 1 0-2 1 ) is yellow orange ; similar compounds give bird feathers their striking reds, oranges, and yellows (Fig. 1 0 - 23). Like sterols, steroids, dolichols , vitamins A, E , D, and K,
1 0.4 Working with Lipids
0
HO
Canthaxanthin (bright red)
:Q
7. ...
H
_,
.
. ;� '"" . '" J., ..:.•· . ..
;,
0
[363]
� ... .
:-:- -,,, ,_..
•. ..
.· " •
_,. r.\.. • :·r· a ::·
·' ' · · · ··' .
"'
Zeaxanthin (bright yellow)
FIGURE 1 0-23 Lipids as pigments in plants and bird feathers. Com
ments that color their feathers red or yellow by eating plant materials that
pounds with long conjugated systems absorb l ight in the visible region of
contain carotenoid pigments, such as canthaxanthin and zeaxanthin. The
the spectrum. Subtle differences in the chemistry of these compounds
differences in pigmentation between male and female birds are the result
produce pigments of strikingly different colors. Birds acquire the pig-
of differences in i ntestinal uptake and processing of carotenoids.
ubiquinone, and plastoquinone, these pigments are syn thesized from five-carbon isoprene derivatives; the biosynthetic pathway is described in detail in Chapter 2 1 .
S U M M A RY 1 0 . 3
L i p i d s a s S i g n a l s, Cofa ctors, a n d P i g m e n t s
•
•
•
•
•
•
Some types of lipids, although present in relatively small quantities, play critical roles as cofactors or signals. Phosphatidylinositol bisphosphate is hydrolyzed to yield two intracellular messengers, diacylglycerol and inositol l ,4,5-trisphosphate. Phosphatidylinositol 3,4,5-trisphosphate is a nucleation point for supramolecular protein complexes involved in biological signaling. Prostaglandins, thromboxanes, and leukotrienes (the eicosanoids) , derived from arachidonate, are extremely potent hormones. Steroid hormones, derived from sterols, serve as powerful biological signals, such as the sex hormones. Vitamins D, A, E , and K are fat-soluble compounds made up of isoprene units. All play essential roles in the metabolism or physiology of animals. Vitamin D is precursor to a hormone that regulates calcium metabolism. Vitamin A furnishes the visual pigment of the vertebrate eye and is a regulator of gene expression during epithelial cell growth. Vitamin E functions in the protection of membrane lipids from oxidative damage, and vitamin K is essential in the blood-clotting process. Ubiquinones and plastoquinones, also isoprenoid derivatives, are electron carriers in mitochondria and chloroplasts, respectively.
•
•
Dolichols activate and anchor sugars to cellular membranes; the sugar groups are then used in the synthesis of complex carbohydrates, glycolipids, and glycoproteins. Lipidic conjugated dienes serve as pigments in flowers and fruits and give bird feathers their striking colors.
1 0.4 Working with Lipids Because lipids are insoluble in water, their extraction and subsequent fractionation require the use of organic solvents and some techniques not commonly used in the purification of water-soluble molecules such as proteins and carbohydrates. In general, complex mix tures of lipids are separated by differences in polarity or solubility in nonpolar solvents. Lipids that contain ester- or amide-linked fatty acids can be hydrolyzed by treatment with acid or alkali or with specific hydrolytic enzymes (phospholipases, glycosidases) to yield their components for analysis. Some methods commonly used in lipid analysis are shown in Figure 10-24 and discussed below. Lipid Extraction Requires Organic Solvents Neutral lipids (triacylglycerols, waxes, pigments, and so forth) are readily extracted from tissues with ethyl ether, chloroform, or benzene, solvents that do not per mit lipid clustering driven by hydrophobic interactions. Membrane lipids are more effectively extracted by more polar organic solvents, such as ethanol or methanol, which reduce the hydrophobic interactions among lipid molecules while also weakening the hydrogen bonds and electrostatic interactions that bind membrane lipids to membrane proteins. A commonly used extractant is a
Tissue
FIGURE 1 0-24 Common procedures in the extraction, separation, and identification of cellular lipids. (a) Tissue is homogenized in a
homogenized in chloroform/methanol/water
chloroform/methanol/water m i xture, which on addition of water and removal of unextractable sediment by centrifugation yields two phases. Different types of extracted l i pids in the ch loroform phase may be separated by (b) adsorption chromatography on a column of s i l ica gel, through which solvents of i ncreasing polarity are passed, or
(c) thin-layer chromatography (TLC), in which l i p ids are carried up a
Methanol/water
sil ica gel-coated plate by a rising solvent front, less polar l i p ids travel ing farther than more polar or charged l ipids. TLC with appropriate solvents can also be used to separate closely related l ipid species; for example, the charged l ipids phosphatidylserine, phosphatidylglycerol, and phosphatidy l inositol are easily separated by TLC. For the determination of fatty acid composition, a l ipid fraction conta i n i ng ester- l i n ked fatty acids is transesterified in a warm aqueous
(b)
/
(c)
/
solution of NaOH and methanol (d), producing a m ixture of fatty acyl methyl esters. These methyl esters are then separated on the basis of chain length and degree of saturation by (e) gas-liquid chromatogra phy (GLC) or (f) h igh-performance l iquid chromatography (H PLC). Pre cise determination of molecular mass by mass spectrometry al lows
�
Adso rption chromatography
_yv
L__ _ _
Thin-layer chromatography
•
1
2 3 4 5 6 7
8 9
Neutral Polar Charged lipids lipids lipids
unambiguous identification of individual l ipids.
mixture of chloroform, methanol, and water, initially in volume proportions (1 :2:0.8) that are miscible, produc ing a single phase. After tissue is homogenized in this solvent to extract all lipids, more water is added to the resulting extract and the mixture separates into two phases, methanol/water (top phase) and chloroform (bottom phase) . The lipids remain in the chloroform layer, and the more polar molecules such as proteins and sugars partition into the methanol/water layer. Adsorption Chromatogra phy Separates lipids of
Fatty acyl methyl esters
(e)
Gas-liquid chromatography
High performance liquid chromatography
18:0
16:1
Elution time
Different Polarity
Complex mixtures of tissue lipids can be fractionated by chromatographic procedures based on the different po larities of each class of lipid. In adsorption chromatogra phy (Fig. 1 0-24b) , an insoluble, polar material such as silica gel (a form of silicic acid, Si(OH) 4) is packed into a glass column, and the lipid mixture (in chloroform solution) is applied to the top of the column. (In high performance liquid chromatography, the column is of smaller diameter and solvents are forced through the column under high pressure .) The polar lipids bind tightly to the polar silicic acid, but the neutral lipids pass directly through the column and emerge in the first chloroform wash. The polar lipids are then eluted, in or der of increasing polarity, by washing the column with solvents of progressively higher polarity. Uncharged but polar lipids (cerebrosides, for example) are eluted with acetone, and very polar or charged lipids (such as glycerophospholipids) are eluted with methanol. Thin-layer chromatography on silicic acid employs the same principle (Fig. 1 0-24c) . A thin layer of silica gel is spread onto a glass plate, to which it adheres. A small sample of lipids dissolved in chloroform is applied near
1 0 . 4 Worki n g with L i p i d s
one edge of the plate, which is dipped in a shallow con tainer of an organic solvent or solvent mixture; the entire setup is enclosed in a chamber saturated with the solvent vapor. As the solvent rises on the plate by capillary ac tion, it carries lipids with it. The less polar lipids move farthest, as they have less tendency to bind to the silicic acid. The separated lipids can be detected by spraying the plate with a dye (rhodamine) that fluoresces when associated with lipids, or by exposing the plate to iodine fumes. Iodine reacts reversibly with the double bonds in fatty acids, such that lipids containing unsaturated fatty acids develop a yellow or brown color. Several other spray reagents are also useful in detecting specific lipids. For subsequent analysis, regions containing separated lipids can be scraped from the plate and the lipids recovered by extraction with an organic solvent. Gas-liquid Chromatography Resolves M ixtures of Volatile lipid Derivatives
Gas-liquid chromatography separates volatile compo nents of a mixture according to their relative tendencies to dissolve in the inert material packed in the chro matography column or to volatilize and move through the column, carried by a current of an inert gas such as helium. Some lipids are naturally volatile, but most must first be derivatized to increase their volatility (that is, lower their boiling point) . For an analysis of the fatty acids in a sample of phospholipids, the lipids are first transesterified: heated in a methanol/HCl or methanol/NaOH mixture to convert fatty acids esteri fied to glycerol into their methyl esters (Fig. 10-24d) . These fatty acyl methyl esters are then loaded onto the gas-liquid chromatography column, and the column is heated to volatilize the compounds. Those fatty acyl es ters most soluble in the column material partition into (dissolve in) that material; the less soluble lipids are car ried by the stream of inert gas and emerge first from the column. The order of elution depends on the nature of the solid adsorbant in the column and on the boiling point of the components of the lipid mixture. Using these techniques, mixtures of fatty acids of various chain lengths and various degrees of unsaturation can be completely resolved (Fig. 1 0-24e) . Specific Hydrolysis Aids in Determination of lipid Structure
Certain classes of lipids are susceptible to degradation un der specific conditions. For example, all ester-linked fatty acids in triacylglycerols, phospholipids, and sterol esters are released by mild acid or alkaline treatment, and some what harsher hydrolysis conditions release amide-bound fatty acids from sphingolipids. Enzymes that specifically hydrolyze certain lipids are also useful in the determina tion of lipid structure. Phospholipases A, C, and D (Fig. 1 0-16) each split particular bonds in phospholipids and yield products with characteristic solubilities and chromatographic behaviors. Phospholipase C, for example,
[3 65]
releases a water-soluble phosphoryl alcohol (such as phos phocholine from phosphatidylcholine) and a chloroform soluble diacylglycerol, each of which can be characterized separately to determine the structure of the intact phospholipid. The combination of specific hydrolysis with characterization of the products by thin-layer, gas-liquid, or high-performance liquid chromatography often allows determination of a lipid structure. Mass Spectrometry Reveals Complete lipid Structure
To establish unambiguously the length of a hydrocarbon chain or the position of double bonds, mass spectromet ric analysis of lipids or their volatile derivatives is in valuable. The chemical properties of similar lipids (for example, two fatty acids of similar length unsaturated at different positions, or two isoprenoids with different numbers of isoprene units) are very much alike, and their order of elution from the various chromatographic procedures often does not distinguish between them. When the eluate from a chromatography column is sampled by mass spectrometry, however, the compo nents of a lipid mixture can be simultaneously separated and identified by their unique pattern of fragmentation (Fig. 10-25). lipidomics Seeks to Catalog All lipids and Their Functions
In exploring the biological role of lipids in cells and tis sues, it is important to know which lipids are present and in what proportions , and to know how this lipid composition changes with embryonic development, dis ease, or drug treatment. As lipid biochemists have be come aware of the thousands of different naturally occurring lipids, they have proposed a new nomencla ture system, with the aim of making it easier to compile and search databases of lipid composition. The system places each lipid in one of eight chemical groups (Table 10 -3) designated by two letters. Within these groups, finer distinctions are indicated by numbered classes and subclasses. For example, all glycerophosphocholines are GP0 1 ; the subgroup of glycerophosphocholines with two fatty acids in ester linkage is designated GP0 1 0 1 ; with one fatty acid ether-linked at position 1 and one in ester linkage at position 2, this becomes GP0 102. Specific fatty acids are designated by numbers that give every lipid its own unique identifier, so that each individual lipid, including lipid types not yet discovered, can be un ambiguously described in terms of a 1 2-character iden tifier. One factor used in this classification is the nature of the biosynthetic precursor. For example, prenol lipids (dolichols and vitamins E and K, for example) are formed from isoprenyl precursors . Polyketides, which we have not discussed in this chapter, include some nat ural products, many toxic, with biosynthetic pathways related to those for fatty acids. The eight chemical cate gories in Table 10-3 do not coincide perfectly with the divisions according to biological function that we have
90
0
�
92
70
N
60
10
§ 50 �
"
"" � ::l
�
01
· II +o+ I H II I I I 108 I
u.
92
0
I
164
I I I
: 220 : I I
206
164
I
I
I I I
234 I
300 : 32 : 356 I I 314 342
I I I
260 : I
274 I
I l I
I
I
I I
I
40 30 20
55
67
260
151
274
10 60
80
300
3 14
328
100 120 140 160 180 200 220 240 260 280 300 320 340 360 380 m lz The prominent ions at m/z
92, 1 08, 1 5 1 , and 1 64 contai n the
FIGURE 1 0-25 Determination of fatty acid structure by mass spec trometry. The fatty acid is first converted to a derivative that m i n i m izes
pyridine ring of the picolinol and various fragments of the carboxyl group,
migration of the double bonds when the molecule is fragmented by
showing that the compound is indeed a picolinyl ester. The molecular ion,
electron bombardment. The derivative shown here is a pico l i nyl ester
M+ (m/z
=
=
3 7 1 ), confirms the presence of a C 1 8 fatty acid with two dou
of l inoleic acid-1 8:2(.:l g· 1 2 ) (M, 3 7 1 )-in which the alcohol is picol i
ble bonds. The uniform series of ions 1 4 atomic mass units (u) apart repre
nol (red). When bombarded with a stream of electrons, this molecule
sents loss of each successive methyl and methylene group from the methyl
is volati l ized and converted to a parent ion (M+; M, 3 7 1 ), in which the
end of the acyl chain (begin n i ng at C-1 8; the right end of the molecule as
N atom bears the positive charge, and a series of smal ler fragments produced by breakage of C-C bonds in the fatty acid. The mass spec trometer separates these charged fragments according to their
shown here), unti l the ion at mlz
=
300 is reached. This is fol lowed by a
gap of 26 u for the carbons of the terminal double bond, at m/z further gap of 1 4 u for the C-1 1 methylene group, at m/z
=
=
2 74; a
260; and so
mass/charge ratio (m/z). (To review the principles of mass spectrome
forth. By this means the entire structure is determined, although these data
try, see Box 3-2 .)
alone do not reveal the configuration (cis or trans) of the double bonds.
used in this chapter. For example, the structural lipids of membranes include both glycerophospholipids and sphingolipids , separate categories in Table 1 0 -3. Each method of categorization has its advantages. The application of mass spectrometric techniques with high throughput and high resolution can provide quantitative catalogs of all the lipids present in a spe cific cell type-the lipidome-under particular condi tions, and of the ways in which the lipidome changes with differentiation, disease such as cancer, or drug treatment. An animal cell contains about a thousand different lipid species, each presumably having a spe-
cific function. These functions are known for a growing number of lipids , but the still largely unexplored lipidome offers a rich source of new problems for the next generation of biochemists and cell biologists to solve.
S U M MA RY 1 0 .4 •
Worki n g w i t h l i p i d s
In the determination of lipid composition, the lipids are first extracted from tissues with organic solvents and separated by thin-layer, gas-liquid, or high-performance liquid chromatography.
TA B L E 1 0-3
Category
Category code
Examples
Fatty acids
FA
Oleate, stearoyl-CoA, palmitoylcarnitine
Glycerolipids
GL
Di- and triacylglycerols
Glycerophospholipids
GP
Phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine
Sphingolipids
SP
Sphingomyelin, ganglioside GM2
Sterol lipids
ST
Cholesterol, progesterone, bile acids
Prenol lipids
PR
Farnesol, geraniol, retinol, ubiquinone
Saccharolipids
SL
Lipopolysaccharide
Polyketides
PK
Tetracycline, aflatoxin B 1
Further Read ing
•
•
•
Phospholipases specific for one of the bonds in a phospholipid can be used to generate simpler compounds for subsequent analysis. Individual lipids are identified by their chromatographic behavior, their susceptibility to hydrolysis by specific enzymes, or mass spectrometry. Lipidomics combines powerful analytical techniques to determine the full complement of lipids in a cell or tissue (the lipidome) and to assemble annotated databases that allow comparisons between lipids of different cell types and under different conditions.
[3 67]
Lipids as Nutrients Angerer, P. & von Schacky, C. (2000) Omega-3 polyunsaturated fatty acids and the cardiovascular system. Curr: Opin. Lipidol. 11, 57-63 . Covington, M.B. (2004) Omega-3 fatty acids. Am. Fam Physician 70, 133-140 Succinct statement of the findings that omega-3 fatty acids reduce the risk of cardiovascular disease. de Logeril, M., Salen, P., Martin, J.L., Monjaud, 1., Delaye, J., & Marnelle, N. (1 999) Mediterranean diet, traditional risk factors, and the rate of cardiovascular complications after myocardial infarc tion: final report of the Lyon Diet Hea1t Study. Circulation 99, 779-785. Mozaffarian, D., Katan, M.B., Ascherio, P.H., Starnpfer, M.J., & Willet, W.C. (2006) Trans fatty acids and cardiovascular disease. N Engl J Med. 354, 1601-1 6 1 3. A summaJy of the evidence that dietary trans fatty acids predis pose to coronaJy heart disease.
Key Terms Structural Lipids in Membranes
Terms in bold are defined ·in the glossary. fatty acid
343
acids ( PUFAs )
neutral glycolipids
polyunsaturated fatty triacylglycerols lipases
gangliosides
345 346
346
phospholipid glycolipids
349 349
glycerophospholipid ether lipid
350
plasmalogens
350 352 sphingolipids 352 ceramide 354 sphingomyelin 354 glycosphingolipids 354 cerebrosides 354 globosides 354 galactolipids
354
350
354 355 cholesterol 355 prostaglandins 358 thromboxanes 358 leukotrienes 359 vitamin 360 vitamin D3 360 cholecalciferol 360 sterols
vitamin A
360 361 tocopherols 36 1 vitamin K 361 dolichols 362 (retinol)
vitamin
E
lipidome
366
Bogdanov, M. & Dowhan, W. ( 1 999) Lipid-assisted protein folding. J. Biol. Chem 274, 36,827-36,830 A minireview of the role of membrane lipids in the folding of membrane proteins. De Rosa, M. & Garnbacorta, A. (1 988) The lipids of archaebacte ria Frog Lipid Res . 27, 153-1 75. Dowhan, W. ( 1 997) Molecular basis for membrane phospholipid diversity: why are there so many lipids? Annu. Rev. Biochem. 66, 199-232. Gravel, R.A., Kaback, M.M., Proia, R., Sandhoff, K., Suzuki, K., & Suzuki, K. (2001) The GM2 gangliosidoses. In The Metabolic and Molecular Bases of Inherited Disease, 8th edn (Scriver, C.R., Sly, W.S., Childs, B . , Beaudet, AL., Valle, D. , Kinzler, K.W., & Vogelstein, B., eds), pp. 3827-3876, McGraw-Hill, Inc., New York. This article is one of many in a four-volume set that contains de finitive descriptions of the clinical, biochemical, and genetic aspects of hundreds of human metabolic diseases-an authOJitative source and fascinating reading. Hoekstra, D. ( ed. ). ( 1 994) Cell Lipids, Current Topics in Mem branes, Vol. 4, Academic Press, Inc , San Diego.
Lipids as Signals, Cofactors, and Pigments Bell, R.M., Exton, J.H., & Prescott, S.M. (eds). ( 1 996) Lipid
Further Reading
Second Messengers , Handbook of Lipid Research, VoL 8, Plenum
General
Press, New York.
Fahy, E., Subramaniam, S., Brown, H.A., Glass, C.K., Merrill, A.H., Jr. , Murphy, R.C., Raetz, C.R.H., Russell, D.W., Seyarna, Y. , Shaw, W., Shimizu, T., Spener, F., van Meers, G., Van Nieuwenhze, M.S., White, S.H., Witzturn, J.L., & Dennis, E.A. (2005) A comprehensive classification system for lipids J. Lipid Res 46, 839-862. A new system of nomenclature for biological lipids, separating them into eight major categories The defmitive reference on lipid classification
Binkley, N.C. & Suttie, J.W. ( 1 995) Vitamin K nutrition and osteoporosis. J. Nutr. 125, 1 8 1 2-1 82 1 .
Gurr, M.I., Harwood, J.L., & Frayn, K.N. (2002) Lipid Biochem istry: An Introduction, 5th edn, Blackwell Science Ltd., Oxford. A good general resource on lipid structure and metabolism, at the intermediate level. Vance, D.E. & Vance, J.E. (eds). (2002) Biochemistry of Lipids, Upoproteins, and Membranes, New Comprehensive Biochemistry, Vol 36, Elsevier Science Publishing Co., Inc., New York An excellent collection of reviews on various aspects of lipid structure, biosynthesis, and function.
Brigelius-Flohe, R. & Traber, M.G. (1 999) Vitamin E: function and metabolism. FASEB J 13, 1 145-1 1 55.
Chojnacki, T. & Dallner, G. ( 1988) The biological role of dolichol.
Biochem J. 251, 1-9.
Clouse, S.D. (2002) Brassinosteroid signal transduction: clarifying the pathway from ligand perception to gene expression. Mol Cell 10, 973-982
Lemmon, M.A. & Ferguson, K.M. (2000) Signal-dependent mem brane targeting by pleckstrin homology (PH) domains. Biochem. J. 350, 1-18 Prescott, S.M., Zimmerman, G.A., Stafforini, D.M., & Mcintyre, T.M. (2000) Platelet-activating factor and related lipid mediato rs . Annu. Rev Biochem 69, 4 1 9-445. Schneiter, R. ( 1 999) Brave little yeast, please guide us to Thebes: sphingolipid function in S. cerevisiae BioEssays 2 1 , 1004-1010.
[368]
lipids
Suttie, J.W. ( 1 993) Synthesis o f vitamin K-dependent proteins. FASEB J 7, 445-452.
Vermeer, C. (1990) y-Carboxyglutamate-containing proteins and the vitamin K-dependent carboxylase . Biochem J. 266, 625-636 . Describes the biochemical basis for the requirement of vitamin K in blood clotting and the importance of carboxylation in the synthesis of the blood-clotting protein thrombin. Viitala, J. & Jiirnefelt, J. ( 1 985) The red cell surface revisited. Trends Biochem. Sci. 10, 392-395. Includes discussion of the human A, B, and 0 blood type determinants. Weber, H. (2002) Fatty acid-derived signals in plants. Trends Plant SC'i 7, 2 1 7-224. Zittermann, A. (2001) Effects of vitamin K on calcium and bone metabolism. Curr Opin Clin Nutr Metab Care 4, 483-487 Working with Lipids
Christie, W.W. ( 1 998) Gas chromatography-mass spectrometry methods for structural analysis of fatty acids Lipids 33, 343-353 . A detailed description of the methods used to obtain data such as those presented in Figure 1 0-25.
(a) What structural aspect of these IS-carbon fatty acids can be correlated with the melting point? (b) Draw all the possible triacylglycerols that can be con structed from glycerol, palmitic acid, and oleic acid. Rank them in order of increasing melting point. (c) Branched-chain fatty acids are found in some bacterial membrane lipids. Would their presence increase or decrease the fluidity of the membranes (that is, give them a lower or higher melting point)? Why?
3. Preparation of Bearnaise Sauce During the prepara
tion of bearnaise sauce, egg yolks are incorporated into melted butter to stabilize the sauce and avoid separation . The stabiliz ing agent in the egg yolks is lecithin (phosphatidylcholine) . Suggest why this works.
4. Isoprene Units in Isoprenoids Geraniol, farnesol, and squalene are called isoprenoids, because they are synthesized
from five-carbon isoprene units. In each compound, circle the five-carbon units representing isoprene units (see Fig. 1 0 -22) .
Christie, W.W. (2003) Lipid Analysis, 3rd edn, The Oily Press, Bridgwater, England. German, J.B., Gillies, L.A., Smilowitz, J.T., Zivkovic, A.M., & Watkins, S.M. (2007) Lipidomics and lipid profiling in metabolomics. Curr Opin Lipidol. 18, 66-71 Short review of the goals and methods of lipidomics. Griffiths, W., Desiderio, D.M., & Nibbering, N.M. (2007) Lipid Mass Spectrometry in Metabolomics and Systems Biology, Wiley InterScience, New York.
OH Geraniol
OH
Hamilton, R.J. & Hamilton, S. (eds). (1 992) Lipid Analysis. A Practical Approach, IRL Press, New York. This text, now out of print, is available as part of the IRL Press Practical Approach Series on CD-ROM, from Oxford University Press (www.oup-usa.org/acadsci/pasbooks .html) Matsubara, T. & Hagashi, A. ( 1 99 1 ) FAB/mass spectrometry of lipids. Frog Lipid Res 30, 301-322 An advanced discussion of the identification of lipids by fast atom bombardment (FAB) mass spectrometry, a powerful technique for structure determination Watson, A.D. (2006) Lipidomics: a global approach to lipid analysis in biological systems . J Lipid Res 47, 2 1 01-2 1 1 1 . A short, intermediate-level review of the classes of lipids, the methods for extracting and separating them, and mass spectrometric means for identifying and quantifying all lipids in a given cell, tissue, or organelle. Wenk, M.R. (2005) The emerging field of lipidomics. Nat. Rev. Drug
Squalene
Discov. 4, 594-61 0.
Intermediate-level discussion of the methods of lipidomics and the potential of this approach in biomedical research and drug development.
ties; the one on the left smells like spearmint, and that on the right, like caraway. Name the compounds using the RS system.
Problems 1. Operational Definition of Lipids How is the definition
of "lipid" different from the types of definitions used for other biomolecules that we have considered, such as amino acids, nucleic acids, and proteins?
2. Melting Points of Lipids The melting points of a series
69.6 °C; oleic acid, -5 °C ; and linolenic acid, - 1 1 °C .
of 18-carbon fatty acids are: stearic acid, 1 3 . 4 °C; linoleic acid,
5 . Naming Lipid Stereoisomers The two compounds be low are stereoisomers of carvone with quite different proper
Problems
6. RS Designations for Alanine and Lactate Draw (using wedge-bond notation) and label the (R) and
(S)
isomers of
(a) All detergents are amphipathic. What are the hy drophilic and hydrophobic portions of lysolecithin?
2-aminopropanoic acid (alanine) and 2-hydroxypropanoic acid (lactic acid) .
H2N /
I
[3 69]
(b) The pain and inflammation caused by a snake bite can be treated with certain steroids. What is the basis of this
I
H
H
C
C
� COOH
OH /
CH3
2-Aminopropanoic acid (alanine)
treatment? (c) Though the high levels of phospholipase A2 in venom
� COOH CH3
2-Hydroxypropanoic acid (lactic acid)
can be deadly, this enzyme is necessary for a variety of normal metabolic processes. What are these processes?
15. Lipids in Blood Group Determination We note in Fig ure 1 0- 1 5 that the structure of glycosphingolipids determines the blood groups A, B, and 0 in humans. It is also true that gly
7. Hydrophobic and Hydrophilic Components of Mem
coproteins determine blood groups. How can both statements
brane Lipids A common structural feature of membrane
be true?
lipids is their amphipathic nature. For example , in phos phatidylcholine, the two fatty acid chains are hydrophobic and the phosphocholine head group is hydrophilic. For each of the following membrane lipids, name the components that serve as
the
hydrophobic
and
hydrophilic
units:
(a)
phos
phatidylethanolamine; (b) sphingomyelin; (c) galactosylcere broside; (d) ganglioside; (e) cholesterol.
8. Structure of Omega-6 Fatty Acid Draw the structure of the omega-6 fatty acid 1 6: 1 .
drogenation, used in the food industry, converts double bonds in
the fatty acids of the oil triacylg]ycerols to -CH2-CH2-. How
does this affect the physical properties of the oils?
10. Alkali Lability of Triacylglycerols A common proce dure for cleaning the grease trap in a sink is to add a product that contains sodium hydroxide. Explain why this works.
Lipid
Structure
the
hormone
vasopressin
stimulates
cleavage
of
phosphatidylinositol 4,5-bisphosphate by hormone-sensitive phospholipase C, two products are formed. What are they? Com pare their properties and their solubilities in water, and predict whether either would diffuse readily through the cytosol.
1 7 . Storage of Fat-Soluble Vitamins In contrast to water soluble vitamins, which must be part of our daily diet, fat-soluble vitamins can be stored in the body in amounts sufficient for many
9 . Catalytic Hydrogenation of Vegetable Oils Catalytic hy
1 1 . Deducing
16. Intracellular Messengers from Phosphatidylinositols When
from
Composition
Compositional analysis of a certain lipid shows that it has exactly one mole of fatty acid per mole of inorganic phos phate Could this be a glycerophospholipid? A ganglioside? A sphingomyelin?
months. Suggest an explanation for this difference.
18. Hydrolysis of Lipids Name the products of mild hydroly sis with dilute NaOH of (a) 1 -stearoyl-2,3-dipalmitoylglycerol;
(b)
1 -palmitoyl-2-oleoylphosphatidylcholine.
19. Effect of Polarity on Solubility Rank the following in order of increasing solubility in water: a triacylglycerol, a dia cylglycerol,
and a monoacylglycerol,
all containing only
palmitic acid.
20. Chromatographic Separation of Lipids A mixture of lipids is applied to a silica gel column, and the column is then washed with increasingly polar solvents. The mixture consists of phosphatidylserine, phosphatidylethanolamine,
12. Deducing Lipid Structure from Molar Ratio of Com
phosphatidylcholine, cholesteryl palmitate (a sterol ester) ,
ponents Complete hydrolysis of a glycerophospholipid yields
sphingomyelin, palmitate, n-tetradecanol, triacylglycerol, and
_9 glycerol, two fatty acids ( 1 6: 1 (6 ) and 1 6 : 0) , phosphoric acid,
cholesterol. In what order will the lipids elute from the column?
and serine in the molar ratio 1 : 1 : 1 : 1 : 1 . Name this lipid and
Explain your reasoning.
draw its structure.
2 1 . Identification of Unknown Lipids Johann Thudichum,
13. Impermeability of Waxes What property of the waxy
who practiced medicine in London about 1 00 years ago, also
cuticles that cover plant leaves makes the cuticles imperme
dabbled in lipid chemistry in his spare time. He isolated a vari
able to water?
14. The Action of Phospholipases The venom
of the E astern diamondback rattler and the Indian cobra contains phospholipase A2 , which catalyzes the hy drolysis of fatty acids at the C-2 position of glycerophos pholipid s . The phospholipid breakdown product of this reaction is lysolecithin (lecithin is phosphatidylcholine) . At high concentrations, this and other lysophospholipids
ety of lipids from neural tissue, and characterized and named many of them. His carefully sealed and labeled vials of isolated lipids were rediscovered many years later. (a) How would you confirm, using techniques not avail able to Thudichum, that the vials labeled "sphingomyelin" and "cerebroside" actually contain these compounds? (b) How would you distinguish sphingomyelin from phos phatidylcholine by chemical, physical, or enzymatic tests?
act as detergents, dissolving the membranes of erythro
22. Ninhydrin to Detect Lipids on TLC Plates Ninhydrin
cytes and lysing the cells. Extensive hemolysis may b e life
reacts specifically with primary amines to form a purplish-blue
threatening.
product. A thin-layer chromatogram of rat liver phospholipids
is sprayed with ninhydrin, and the color is allowed to develop. Which phospholipids can be detected in this way?
Data Analysis Problem 23. Determining the Structure of the Abnormal Lipid in Thy-Sachs Disease Box 10-2 , Figure 1 , shows the pathway
of breakdown of gangliosides in healthy (normal) individuals and individuals with certain genetic diseases. Some of the data on which the figure is based were presented in a paper by Lars Svennerholm ( 1962) . Note that the sugar Neu5Ac, N-acetylneuraminic acid, represented in the Box 1 0-2 figure as + , is a sialic acid. Svennerholm reported that "about 90% of the monosia!io gangliosides isolated from normal human brain" consisted of a compound with ceramide, hexose, N-acetylgalactosamine, and N-acetylneuraminic acid in the molar ratio 1 :3 : 1 : 1 . (a) Which of the gangliosides (GMl through GM3 and glo boside) in Box 10-2, Figure 1, fits this description? Explain your reasoning. (b) Svennerholm reported that 90% of the gangliosides from a patient with Tay-Sachs had a molar ratio (of the same four components given above) of 1 :2 : 1 : 1 . Is this consistent with the Box 1 0-2 figure? Explain your reasoning. To determine the structure in more detail, Svennerholm treated the gangliosides with neuraminidase to remove the N acetylneuraminic acid. This resulted in an asialoganglioside that was much easier to analyze. He hydrolyzed it with acid collected the ceramide-containing products, and determine the molar ratio of the sugars in each product. He did this for both the normal and the Tay-Sachs gangliosides. His results are shown below.
d
Ganglioside Ceramide Glucose Galactose Galactosamine Normal Fragment 1 Fragment 2 Fragment 3 Fragment 4 Tay-Sachs Fragment 1 Fragment 2 Fragment 3
1 1 l
1 l 1
1 1
0 1 1 2
0 0 1 1
1
0
0 0 1
1
1
(c) Based on these data, what can you conclude about the structure of the normal ganglioside? Is this consistent with the structure in Box 10-2? Explain your reasoning. (d) What can you conclude about the structure of the Tay Sachs ganglioside? Is this consistent with the structure in Box 1 0-2? Explain your reasoning. Svennerholm also reported the work of other researchers who "permethylated" the normal asialoganglioside. Permethylation is the same as exhaustive methylation: a methyl group is added to every free hydroxyl group on a sugar. They found the following permethylated sugars: 2,3,6-trimethylglycopyranose; 2,3,4,6tetramethylgalactopyranose; 2,4,6-trimethylgalactopyranose; and 4,6-dimethyl-2-deoxy-2-aminogalactopyranose. (e) To which sugar of GM1 does each of the permethylated sugars correspond? Explain your reasoning. (f) Based on all the data presented so far, what pieces of information about normal ganglioside structure are missing? Reference
Svennerholm, L. ( 1 962) The chemical structure of normal human brain and Tay-Sachs gangliosides. Biochem Biophys Res Comm 9, 436-441 .
mak good neighbors. -Robert Fro I, "Mending Wall, " in North of Boston,
1�
Bio ogical embranes and Transport 1 1 .1
1 1 .2
1 1 .3
The Composition and Architecture of Membranes Membrane Dynamics
381
Sol ute Transport across Membranes
3 72
389
T
he first cell probably came into being when a mem brane formed, enclosing a small volume of aqueous solution and separating it from the rest of the uni verse. Membranes define the external boundaries of cells and regulate the molecular traffic across that boundary (Fig. 1 1- 1 ) ; in eukaryotic cells, they divide the internal space into discrete compartments to segre gate processes and components. They organize complex reaction sequences and are central to both biological en ergy conservation and cell-to-cell communication. The biological activities of membranes flow from their re markable physical properties. Membranes are flexible, self-sealing, and selectively permeable to polar solutes.
FIGURE 1 1 -1 Biological membranes. Viewed in cross section, a l l cell membranes share a characteristic trilaminar appearance. This erythro cyte was stained with osm i u m tetroxide and viewed with an electron
ture, 5 to 8 nm (50 to 80 Al thick. The tri laminar image consists of microscope. The plasma membrane appears as a three-layer struc
two electron-dense layers (the osmi um, bound to the inner and outer surfaces of the membrane) separated by a less dense central region.
Their flexibility permits the shape changes that accom pany cell growth and movement (such as amoeboid movement) . With their ability to break and reseal, two membranes can fuse, as in exocytosis, or a single mem brane-enclosed compartment can undergo fission to yield two sealed compartments, as in endocytosis or cell division, without creating gross leaks through cellular surfaces. Because membranes are selectively perme able, they retain certain compounds and ions within cells and within specific cellular compartments, while excluding others. Membranes are not merely passive barriers. They include an array of proteins specialized for promoting or catalyzing various cellular processes . At the cell surface, transporters move specific organic solutes and inorganic ions across the membrane; receptors sense extracellular signals and trigger molecular changes in the cell; adhe sion molecules hold neighboring cells together. Within the cell, membranes organize cellular processes such as the synthesis of lipids and certain proteins, and the en ergy transductions in mitochondria and chloroplasts. Because membranes consist of just two layers of mole cules, they are very thin-essentially two-dimensional. Intermolecular collisions are far more probable in this two-dimensional space than in three-dimensional space, so the efficiency of enzyme-catalyzed processes organ ized within membranes is vastly increased. In this chapter we first describe the composition of cellular membranes and their chemical architecture the molecular structures that underlie their biological functions. Next, we consider the remarkable dynamic features of membranes, in which lipids and proteins move relative to each other. Cell adhesion, endocytosis, and the membrane fusion accompanying neurotransmit ter secretion illustrate the dynamic roles of membrane proteins. We then turn to the protein-mediated passage of solutes across membranes via transporters and ion channels. In later chapters we discuss the roles of mem branes in signal transduction (Chapters 12 and 23) , energy transduction (Chapter 1 9) , lipid synthesis (Chapter 2 1 ) , and protein synthesis (Chapter 27) .
[3 7 1]
[3 72]
Biological Membranes a n d Transport
1 1 .1 The Composition and Architecture of Mem branes One approach to understanding membrane function is to study membrane composition-to determine, for example, which components are common to all mem branes and which are unique to membranes with specific functions. So before describing membrane structure and function we consider the molecular components of mem branes: proteins and polar lipids, which account for almost all the mass of biological membranes, and carbohydrates, present as part of glycoproteins and glycolipids.
cardiolipin (Fig. 11-2); this distribution is reversed in the inner mitochondrial membrane, which has very low cholesterol and high cardiolipin. In all but a few cases, the functional significance of these combinations is not yet known. Plasma
� Q)
Q) 1'1 til .... ..0 Q)
Ei Ei
Q)
Each Type of Membrane Has Characteristic
� 0
..., til 0.. Q) ..0 ...,
Lipids and Proteins
The relative proportions of protein and lipid vary with the type of membrane (Table 1 1-1), reflecting the diversity of biological roles. For example, certain neurons have a myelin sheath, an extended plasma membrane that wraps around the cell many times and acts as a pas sive electrical insulator. The myelin sheath consists pri marily of lipids, whereas the plasma membranes of bacteria and the membranes of mitochondria and chloro plasts, the sites of many enzyme-catalyzed processes, contain more protein than lipid (in mass per total mass) . For studies of membrane composition, the first task is to isolate a selected membrane. When eukaryotic cells are subjected to mechanical shear, their plasma mem branes are torn and fragmented, releasing cytoplasmic components and membrane-bounded organelles such as mitochondria, chloroplasts, lysosomes, and nuclei. Plasma membrane fragments and intact organelles can be isolated by techniques described in Chapter 1 (see Fig. 1-8) and in Worked Example 2-1 , p. 53. Cells clearly have mechanisms to control the kinds and amounts of membrane lipid they synthesize and to target specific lipids to particular organelles. Each kingdom, each species, each tissue or cell type, and the organelles of each cell type have a characteristic set of membrane lipids. Plasma membranes, for example, are enriched in cholesterol and contain no detectable
til ll::
Inner mitochondrial Outer mitochondrial Lysosomal Nuclear Rough ER Smooth ER Golgi 0
40
20
60
80
Percent membrane lipid Cholesterol
• Cardiolipin 0 Minor lipids
• Sphingolipids � Phosphatidylcholine � Phosphatidylethanolamine
FIGURE 11-2 Lipid composition of the plasma membrane and or
ganelle membranes of a rat hepatocyte. The functional spec i a l i zation
of each membrane type is reflected in its u n ique l i p i d composition. Cholesterol is prominent in plasma membranes but barely detectable i n m itochondrial membranes. Cardiolipin is a major component of the i n ner m itochondrial membrane but not of the p l asma membrane . Phosphatidylserine, phosphatidy l i nositol, and phosphatidylglycerol are relatively m i nor components (yellow) of most membranes but serve critical functions; phosphatidyl i nositol and its derivatives, for example, are i mportant in signal transductions triggered by hormones. Sphi n gol ipids, phosphatidylcholi ne, and phosphatidylethanol a m i n e are present in most membranes, but in varyi n g proportions. G lycolipi ds, which are major components of the chloroplast membranes of plants, are virtually absent from animal cells.
TA BLE 1 1 - 1
Components (% by weight)
Human myelin sheath
Protein
Phospholipid
Sterol
Sterol type
Other lipids
30
30
19
Cholesterol
Galactolipids, plasmalogens
Cholesterol
Mouse liver
45
27
25
Maize leaf
47
26
7
Sitosterol
Galactolipids
Yeast
52
7
4
Ergosterol
Triacylglycerols, steryl esters
Paramecium (ciliated protist)
56
40
4
Stigmasterol
E. coli
75
25
0
Note: Values do not add up to 100% in every case, because there are components other than protein , phospholipids, and sterol; plants, for example, have high levels of glycolipids.
1 1 . 1 The Composition a n d Architecture of Mem branes
The protein composition of membranes from differ ent sources varies even more widely than their lipid composition, reflecting functional specialization. In ad dition, some membrane proteins are covalently linked to oligosaccharides. For example, in glycophorin, a glyco protein of the erythrocyte plasma membrane, 60% of the mass consists of complex oligosaccharides cova lently attached to specific amino acid residues . Ser, Thr, and Asn residues are the most common points of attach ment (see Fig. 7-29) . The sugar moieties of surface gly coproteins influence the folding of the proteins, as well as their stability and intracellular destination, and they play a significant role in the specific binding of ligands to glycoprotein surface receptors (see Fig. 7-35) . Some membrane proteins are covalently attached to one or more lipids, which serve as hydrophobic anchors that hold the proteins to the membrane, as we shall see.
tion of individual protein and lipid molecules within membranes, led to the development of the fluid mo saic model for the structure of biological membranes (Fig. 11-3). Phospholipids form a bilayer in which the nonpolar regions of the lipid molecules in each layer face the core of the bilayer and their polar head groups face outward, interacting with the aqueous phase on either side. Proteins are embedded in this bilayer sheet, held by hydrophobic interactions between the membrane lipids and hydrophobic domains in the pro teins. Some proteins protrude from only one side of the membrane; others have domains exposed on both sides. The orientation of proteins in the bilayer is asymmetric, giving the membrane "sidedness": the protein domains exposed on one side of the bilayer are different from those exposed on the other side, reflect ing functional asymmetry. The individual lipid and pro tein units in a membrane form a fluid mosaic with a pattern that, unlike a mosaic of ceramic tile and mor tar, is free to change constantly. The membrane mosaic is fluid because most of the interactions among its components are noncovalent, leaving individual lipid and protein molecules free to move laterally in the plane of the membrane. We now look at some of these features of the fluid mosaic model in more detail and consider the experi mental evidence that supports the basic model but has necessitated its refinement in several ways.
All Biological Membranes Share Some Fundamental Properties
Membranes are impermeable to most polar or charged solutes, but permeable to nonpolar compounds ; they are 5 to 8 nm (50 to 80 A) thick and appear trilaminar when viewed in cross section with the electron micro scope (Fig. 1 1-1). The combined evidence from elec tron microscopy and studies of chemical composition, as well as physical studies of permeability and the mo-
/
Glycolipid
•
[3 7 3]
Oligo accharide
• C chains of
glycoprotein
Outside
'}
Lipid bilayer
lnside
Sterol
� Integral protein
(single trans membrane helix)
)
;
Phospholipid polar heads
Peripheral protein
FIGURE 11-3 Fluid mosaic model for membrane structure. The fatty
movement of either from one leaflet of the b i layer to the other is re
acyl chains in the i nterior of the membrane form a flu id, hydrophobic
stricted. The carbohydrate moieties attached to some proteins and
region. Integral proteins float i n this sea of l i p i d, held by hydrophobic
l ipids of the plasma membrane are exposed on the extracel l u lar sur
i nteracti ons with their nonpolar a m i no acid side chains. Both proteins
face of the membrane.
and l i p i ds are free to move lateral l y i n the plane of the b i l ayer, but
[}74]
Biological Mem bra n es a n d Tra nsport
A lipid B ilayer Is the Basic Structural Element of Membranes
Glycerophospholipids, sphingolipids, and sterols are vir tually insoluble in water. When mixed with water, they spontaneously form microscopic lipid aggregates, clus tering together, with their hydrophobic moieties in con tact with each other and their hydrophilic groups interacting with the surrounding water. This clustering reduces the amount of hydrophobic surface exposed to water and thus minimizes the number of molecules in the shell of ordered water at the lipid-water interface (see Fig. 2-7), resulting in an increase in entropy. Hy drophobic interactions among lipid molecules provide the thermodynamic driving force for the formation and maintenance of these clusters . Depending on the precise conditions and the nature of the lipids, three types of lipid aggregate can form when amphipathic lipids are mixed with water (Fig. 1 1- 4 ). Micelles are spherical structures that contain anywhere from a few dozen to a few thousand amphi pathic molecules. These molecules are arranged with their hydrophobic regions aggregated in the interior, where water is excluded, and their hydrophilic head groups at the surface, in contact with water. Micelle for mation is favored when the cross-sectional area of the head group is greater than that of the acyl side chain(s), as in free fatty acids, lysophospholipids (phospholipids lacking one fatty acid), and detergents such as sodium dodecyl sulfate (SDS; p. 89) . A second type of lipid aggregate in water is the bi layer, in which two lipid monolayers (leaflets) form a two-dimensional sheet. Bilayer formation is favored if the cross-sectional areas of the head group and acyl side chain(s) are similar, as in glycerophospholipids and sphingolipids. The hydrophobic portions in each mono layer, excluded from water, interact with each other. The
Individual units are wedge-shaped (cross section of head greater than that of side chain)
(a) Micelle
hydrophilic head groups interact with water at each sur face of the bilayer. Because the hydrophobic regions at its edges (Fig. ll-4b) are in contact with water, the bilayer sheet is relatively unstable and spontaneously folds back on itself to form a hollow sphere, a vesicle (Fig. 11-4c). The continuous surface of vesicles eliminates exposed hydrophobic regions, allowing bilayers to achieve maxi mal stability in their aqueous environment. Vesicle forma tion also creates a separate aqueous compartment. It is likely that the precursors to the first living cells resem bled lipid vesicles, their aqueous contents segregated from their surroundings by a hydrophobic shell. The lipid bilayer is 3 nm (30 A) thick. The hydrocar bon core, made up of the -CH2- and -CH3 of the fatty acyl groups , is about as nonpolar as decane, and vesicles formed in the laboratory from pure lipids (lipo somes) are essentially impermeable to polar solutes, as is the lipid bilayer of biological membranes (although the latter, as we shall see, are permeable to solutes for which they have specific transporters). Plasma membrane lipids are asymmetrically distrib uted between the two monolayers of the bilayer, although the asymmetry, unlike that of membrane proteins, is not absolute. In the plasma membrane of the erythrocyte, for example , choline-containing lipids (phosphatidyl choline and sphingomyelin) are typically found in the outer (extracellular, or exoplasmic) leaflet (Fig. 1 1- 5 ), whereas phosphatidylserine, phosphatidylethanolamine, and the phosphatidylinositols are much more common in the inner (cytoplasmic) leaflet. Changes in the distri bution of lipids between plasma membrane leaflets have biological consequences . For example, only when the phosphatidylserine in the plasma membrane moves into the outer leaflet is a platelet able to play its role in for mation of a blood clot. For many other cell types, phos phatidylserine exposure on the outer surface marks a cell for destruction by programmed cell death.
Individual units are cylindrical (cross section of head equals that of side chain)
(b) Bilayer
Aqueous cavity
(c) Vesicle
FIGURE 11-4 Amphipathic lipid aggregates that form in water. (a) In
edges of the sheet are protected from i nteraction with water. (c) When
m icel les, the hydrophobic chains of the fatty acids are sequestered at
a two-d i mensional bilayer folds on itself, it forms a closed b i l ayer, a
the core of the sphere. There is virtually no water i n the hydrophobic
three-di mensional hollow vesicle ( l i posome) enclosing an aqueous
interior. (b) I n an open b i l ayer, all acyl side chains except those at the
cavity.
1 1 . 1 The Composition and Architecture of Mem branes
Membrane phospholipid
Percent of total membrane phospholipid
100 Phosphatidylethanolamine
30
Phosphatidylcholine
27
Sphingomyelin
23
Phosphatidylserine
15
Phosphatidylinositol 4,5-bisphosphate
0
Outer monolayer
100
-
• l
Phosphatidylinositol Phosphatidylinositol 4-phosphate
Amphil.ropic protein
Distribution in membrane Inner monolayer
[3 7 5]
5
protein
Phosphatidic acid FIGURE 11-5 Asymmetric distribution of phospholipids between
Integral protein (hydrophobic domain coated with detergent)
the inner and outer monolayers of the erythrocyte plasma mem brane. The distribution of a specific phosphol ipid i s determi ned by
treating the intact cel l with phospholipase C, which cannot reach
FIGURE 11-6 Peripheral, integral, and amphitropic proteins. Mem
lipids in the inner monolayer (leaflet) but removes the head groups of
brane proteins can be operationally distinguished by the conditions re
l ipids in the outer monolayer. The proportion of each head group re
q u i red to release them from the membrane. Most peripheral proteins are released by changes in pH or ionic strength, removal of Ca 2 + by a
leased provides an estimate of the fraction of each l i pid i n the outer monol ayer.
chelating agent, or addition of urea or carbonate. I ntegral p roteins are extractable with detergents, which di srupt the hydrophobic interac tions with the l i p i d b i l ayer and form m icel le-l i ke clusters around i ndi
Three Types of Membrane Proteins Differ in Their Association with the Membrane
Integral membrane proteins are very firmly associ ated with the lipid bilayer, and are removable only by agents that interfere with hydrophobic interactions, such as detergents , organic solvents, or denaturants (Fig. 1 1- 6 ) . Peripheral membrane proteins associ ate with the membrane through electrostatic interac tions and hydrogen bonding with the hydrophilic domains of integral proteins and with the polar head groups of membrane lipids. They can be released by relatively mild treatments that interfere with electro static interactions or break hydrogen bonds; a commonly used agent is carbonate at high pH. Amphitropic proteins are found both in the cytosol and in associ ation with membranes. Their affinity for membranes results in some cases from the protein's noncovalent interaction with a membrane protein or lipid, and in other cases from the presence of one or more lipids covalently attached to the amphitropic protein (see Fig. 11-14). Generally, the reversible association of amphitropic proteins with the membrane is regu lated; for example, phosphorylation or ligand binding can force a conformational change in the protein, ex posing a membrane-binding site that was previously inaccessible.
vidual prote i n molecules. I ntegral proteins cova lently attached to a membrane l i pid, such as a glycosyl phosphatidy l i nositol (GPI; see Fig. 1 1 - 1 4), can be released by treatment with phospholipase C. Am phitropic proteins are sometimes associated with membranes and sometimes not, dependi n g on some type of regulatory process such as reversible palm itoylation .
Many Membrane Proteins Span the lipid B ilayer
Membrane protein topology (the localization of protein domains relative to the lipid bilayer) can be deter mined with reagents that react with protein side chains but cannot cross membranes-polar chemical reagents that react with primary amines of Lys residues, for ex ample, or enzymes such as trypsin that cleave proteins but cannot cross the membrane . The human erythro cyte is convenient for such studies because it has no membrane-bounded organelles; the plasma membrane is the only membrane present. If a membrane protein in an intact erythrocyte reacts with a membrane-im permeant reagent, that protein must have at least one domain exposed on the outer (extracellular) face of the membrane. Trypsin cleaves extracellular domains but does not affect domains buried within the bilayer or exposed on the inner surface only, unless the plasma membrane is broken to make these domains accessible to the enzyme.
[376]
Biological M e m b ra n e s a n d Tra nsport
Experiments with such topology-specific reagents
that each has a specific orientation in the bilayer, giving
glycophorin
the membrane a distinct sidedness. For glycophorin,
spans the plasma membrane. Its amino-terminal domain
and for all other glycoproteins of the plasma membrane,
(bearing the carbohydrate chains) is on the outer surface
the glycosylated domains are invariably found on the
show that the erythrocyte glycoprotein
and is cleaved by trypsin. The carboxyl terminus pro
extracellular face of the bilayer. As we shall see, the
trudes on the inside of the cell, where it cannot react with
asymmetric arrangement of membrane proteins results
impermeant reagents. Both the amino-terminal and car
in functional asymmetry. All the molecules of a given ion
boxyl-terminal domains contain many polar or charged
pump, for example, have the same orientation in the
amino acid residues and are therefore hydrophilic. How
membrane and pump ions in the same direction.
ever, a segment in the center of the protein (residues to
93)
75
contains mainly hydrophobic amino acid residues,
suggesting that glycophorin has a transmembrane seg ment an·anged as shown in
Figure 1 1-7.
These noncrystallographic experiments also revealed that the orientation of glycophorin in the membrane is asymmetric: its amino-terminal segment is always on the outside. Similar studies of other membrane proteins show
Integral Proteins Are Held in the Membrane by Hydrophobic I nteractions with lipids The firm attachment of integral proteins to membranes is the result of hydrophobic interactions between mem brane lipids and hydrophobic domains of the protein. Some proteins have a single hydrophobic sequence in the middle (as in glycophorin) or at the amino or carboxyl terminus. Others have multiple hydrophobic sequences, each of which, when in the a-helical conformation, is long enough to span the lipid bilayer
(Fig. 1 1-8 ).
One of the best-studied membrane-spanning pro teins, bacteriorhodopsin, has seven very hydrophobic in ternal sequences and crosses the lipid bilayer seven times. Bacteriorhodopsin is a light-driven proton pump densely packed in regular arrays in the purple membrane
of the bacterium Halo bacterium salinarum. X-ray crys
tallography reveals a structure with seven a-helical seg
ments, each traversing the lipid bilayer, connected by nonhelical loops at the inner and outer face of the mem brane
(Fig. 11-H ). In the amino acid sequence of bacte 20 hydrophobic residues can be identified, each forming an a helix that riorhodopsin, seven segments of about
spans the bilayer. The seven helices are clustered to gether and oriented not quite perpendicular to the bilayer plane, a pattern that (as we shall see in Chapter
12) is a
common motif in membrane proteins involved in signal reception. Hydrophobic interactions between the nonpo lar amino acids and the fatty acyl groups of the membrane loside
lipids firmly anchor the protein in the membrane. Crystallized membrane proteins solved (i.e., their molecular structure deduced) by crystallography often include molecules of phospholipids, which are pre sumed to be positioned in the crystals as they are in the native membranes. Many of these phospholipid mole cules lie on the protein surface, their head groups inter acting with polar amino acid residues at the inner and
131
FIGURE 11-7 Transbilayer disposition of glycophorin in an erythro cyte. One hydrophi l ic domain, conta i n ing a l l the sugar residues, is on
the outer su rface, and another hydrop h i l i c dom a i n protrudes from the i nner face of the membrane. Each red hexagon represents a tetrasac charide (conta i n i n g two NeuSAc (sial ic acid), Gal, and Gai NAc) 0/ i n ked to a Ser or Thr residue; the blue hexagon represents a n
outer membrane-water interfaces and their side chains associated with nonpolar residues. These annular lipids form a bilayer shell (annulus) around the protein, oriented roughly as expected for phospholipids in a bi layer
(Fig. 1 1-10). Other phospholipids are found at
the interfaces between monomers of multisubunit mem
ol igosaccharide N-l i n ked t o an A s n residue. The relative size o f the
brane proteins, where they form a "grease seal." Yet oth
o l i gosaccharide u n its i s larger than shown here. A segment of 1 9 hy
ers are embedded deep within a membrane protein,
drophobic residues (residues 75 to 93) forms an
often with their head groups well below the plane of the
a hel ix that traverses
the membrane b i l ayer (see Fig. 1 1 -1 1 a). The segment from residues
bilayer. For example, succinate dehydrogenase (Com
64 to 74 has some hydrophobic residues and probably penetrates the
plex II, found in mitochondria; see Fig.
outer face of the lipid b i layer, as shown.
19-10) has sev
eral deeply embedded phospholipid molecules.
1 1 . 1 The Com position a n d Architect u re of Mem branes
[3 77]
Type I
\
Type III
arboxyl terminus
FIGURE 11-9 Bacteriorhodopsin, a membrane-spanning protein. (PDB ID 2AT9) The s i ngle polypeptide cha i n folds i nto seven hy drophobic
a hel ices, each of which traverses the l i p i d b i layer rough l y
perpend icular t o t h e p l a n e o f t h e membrane. The seven transmem Type IV
brane helices are clustered, and the space around and between them is filled with the acyl chains of membrane l i pids. The l i ght-absorbi ng pigment retinal (see Fig. 1 0-2 1 ) is buried deep in the membrane i n contact with several of the helical segments (not shown). The hel i ces are colored to correspond with the hydropathy plot in Figure 1 1 -1 1 b .
TypeV
Type VI
FIGURE 11-8
Integral membrane proteins.
For known proteins of
the plasma membrane, the spatial relations h i ps of protein domains to the lipid b i l ayer fal l i nto six categories. Types I and II have a s i ngle transmembrane hel ix; the ami no-terminal domain i s outside the cell in type I proteins and ins ide i n type II. Type Ill proteins have multiple transmembrane hel ices i n a s i ngle polypeptide. I n type I V proteins, transmembrane domains of several different polypeptides assemble to form a channel through the membrane. Type V proteins are held to the b i layer primarily by cova lently l i n ked lipids (see Fig. 1 1 -1 4), and type VI proteins have both transmembrane helices and l i pid (GPJ) anchors. In this figure, and i n figu res throughout the book, we represent transmembrane protein segments in their most l ikely conformations: as
a hel ices of six to seven turns. Sometimes these hel ices are shown sim ply as cylinders. As relatively few membrane protein structures have
been deduced by x-ray crysta l lography, our representation of the ex tramembrane doma ins is arbitrary and not necessari ly to scale.
proteins. (a) The crystal structure of sheep aquaporin (PDB JD 2860),
depicted as a green surface representation. ( b ) The crysta l structure of the F0 i ntegral protein complex of the V-type Na + -ATPase from Entero·
FIGURE 11-10 Lipid annuli associated with two i ntegral membrane a transmembrane water channel, i ncludes a shell of phosphol i pids po
coccus hirae (PDB ID 2Bl2) has 1 0 identical subun its, each with four
siti oned with their head groups (bl ue) at the expected pos itions on the
transmembrane helices, surrou nding a centra l cavity fil led with phos
i n ner and outer membrane su rfaces and their hydrophobic acyl chains
phatidylglycerol (PG). Here five of the subu n i ts have been cut away to
(gold) inti mately associated with the surface of the prote i n exposed to
reveal the PG molecules associated with each subunit around the inte
the b i l ayer. The l ipid forms a "grease seal" around the protein, which i s
rior of this structure.
[378]
Biological M e m b ra n e s a n d Transport
The Topology of an I ntegra l Membrane Protein Can Sometimes Be Predicted from Its Sequence
�
3
£ .....
0
-o c
Determination of the three-dimensional structure of a
t.
brane proteins, but relatively few three-dimensional
-3
0
100
50
Residue number
100
50
0
structures have been established by crystallography or NMR spectroscopy. The presence of unbroken sequences
130
t Hydrophobic Hydrophilic
130
t
(a) Glycophorin
of more than 20 hydrophobic residues in a membrane protein is commonly taken as evidence that these se quences traverse the lipid bilayer, acting as hydrophobic
50
anchors or forming transmembrane channels. Virtually all integral proteins have at least one such sequence. Application of this logic to entire genomic sequences leads to the conclusion that in many species, 20% to 30% of all proteins are integral membrane proteins. What can we predict about the secondary structure of the membrane-spanning portions of integral pro teins? An a-helical sequence of 20 to 25 residues is just long enough to span the thickness (30
A)
of the
lipid bilayer (recall that the length of an a helix is 1.5
A
(0.15 nm) per amino acid residue). A polypeptide chain surrounded by lipids, having no water molecules with which to hydrogen-bond, will tend to form
a
� � -o
t Hydrophobic Hydrophilic
.s
>.
�
0
::c:
-3
0. 0 .... -o >.
10
50
Residue number 100
150
200
250
�
(b) Bacteriorhodopsin
helices or {3
FIGURE 11-11 Hydropathy plots. Hydropathy i ndex (see Table 3-1 ) i s
sheets, in which intrachain hydrogen bonding is maxi
plotted against residue number for two i ntegral membrane proteins.
mized. If the side chains of all amino acids in a helix are
The hydropathy i ndex for each a m i no acid residue i n a sequence of
nonpolar, hydrophobic interactions with the surround
defined length, or "window," i s used to calcu late the average hy
ing lipids further stabilize the helix.
dropathy for that wi ndow. The horizontal axis shows the residue num
Several simple methods of analyzing amino acid
ber i n the m iddle of the window. (a) G l ycophori n from h uman
sequences yield reasonably accurate predictions of
erythrocytes has a s i ngle hydrophobi c sequence between residues 75
secondary structure for transmembrane proteins. The
a n d 93 (yellow); compare t h i s w i th Figure 11-7. (b) Bacteri
relative polarity of each amino acid has been deter
orhodopsin, known from i ndependent physical studies to have seven
mined experimentally by measuring the free-energy change accompanying the movement of that amino acid side chain from a hydrophobic solvent into water. This free energy of transfer, which can be expressed as a
transmembrane hel i ces (see Fig. 1 1 -9), has seven hydrophobic re gions. N ote, however, that the hydropathy plot is ambiguous in the re gion of segments 6 and 7. X-ray crysta l lography has confirmed that this region has two transmembrane segments.
hydropathy index (see Table 3-1), ranges from
very exergonic for charged or polar residues to very
structure are scanned in this way, we find a reasonably
endergonic for amino acids with aromatic or aliphatic
good correspondence between predicted and known
hydrocarbon side chains. The overall hydropathy index
membrane-spanning segments. Hydropathy analysis
(hydrophobicity) of a sequence of amino acids is esti
predicts a single hydrophobic helix for glycophorin
mated by summing the free energies of transfer for the
(Fig. 11-lla) and seven transmembrane segments for
residues in the sequence. To scan a polypeptide se
bacteriorhodopsin (Fig. 11-llb)-in agreement with
quence for potential membrane-spanning segments, an
experimental studies.
investigator calculates the hydropathy index for suc
On the basis of their amino acid sequences and hy
cessive segments (called windows) of a given size,
dropathy plots, many of the transport proteins de
7 to 20 residues. For a window of seven residues, 7, 2 to 8, 3 to 9, and so on, are plotted as in Figure 1 1- 1 1 (plotted for the middle residue in each window-residue 4 for residues 1 to 7, for example). A region with more than from
scribed in this chapter are believed to have multiple
for example, the indices for residues 1 to
membrane-spanning helical regions-that is, they are type III or type IV integral proteins (Fig. 11-8). When predictions are consistent with chemical studies of pro tein localization (such as those described above for gly
20 residues of high hydropathy index is presumed
cophorin and bacteriorhodopsin), the assumption that
to be a transmembrane segment. When the sequences
hydrophobic regions correspond to membrane-spanning
of membrane proteins of known three-dimensional
domains is much better justified.
1 1 .1 The Composition a n d Arch itecture of Memb ranes
[379]
• Charged residues • Trp OTyr
K+
channel
Maltoporin
FIGURE 11-12 Tyr and Trp residues of membrane proteins clustering at the water-lipid interface. The detai led structures of these five i nte
Outer membrane phospholipase A
OmpX
Phosphoporin E
E (PDB 10 1 PHO) are p roteins of the outer membrane of E. coli.
Residues of Tyr (orange) and Trp (red) are found p redom i nantly where
gral membrane proteins are known from crystallographic studies. The
the nonpolar region of acyl chai ns meets the polar head group region.
K+ channel (PDB ID 1 BLB) is from the bacterium Streptomyces lividans
Charged residues (Lys, Arg, Glu, Asp; shown i n b l ue) are found almost
(see Fig. 1 1 -48); maltoporin (PDB I D 1 AF6), outer membrane phospho
exclusively in the aqueous phases.
lipase A (PDB ID 1 QDS), OmpX (PDB ID 1 QJ9), and phosphoporin
A further remarkable feature of many transmem brane proteins of known structure is the presence of Tyr and Trp residues at the interface between lipid and wa ter (Fig. 1 1-12). The side chains of these residues ap parently serve as membrane interface anchors, able to interact simultaneously with the central lipid phase and the aqueous phases on either side of the membrane. An other generalization about amino acid location relative to the bilayer is described by the positive-inside rule: the positively charged Lys, His, and Arg residues of membrane proteins occur more commonly on the cyto plasmic face of membranes. Not all integral membrane proteins are composed of transmembrane a helices. Another structural motif com mon in bacterial membrane proteins is the fJ barrel (see Fig. 4-17b), in which 20 or more transmembrane seg ments form {3 sheets that line a cylinder (Fig. 1 1-13). The same factors that favor a-helix formation in the hy drophobic interior of a lipid bilayer also stabilize {3
FepA
OmpLA
Maltoporin
barrels: when no water molecules are available to hydrogen-bond with the carbonyl oxygen and nitrogen of the peptide bond, maximal intrachain hydrogen bonding gives the most stable conformation. Planar {3 sheets do not maximize these interactions and are generally not found in the membrane interior; {3 barrels allow all possi ble hydrogen bonds and are apparently common among membrane proteins. Porins, proteins that allow certain polar solutes to cross the outer membrane of gram negative bacteria such as E. coli, have many-stranded f3 barrels lining the polar transmembrane passage. A polypeptide is more extended in the {3 conforma tion than in an a helix; just seven to nine residues of f3 conformation are needed to span a membrane. Recall that in the f3 conformation, alternating side chains project above and below the sheet (see Fig. 4--6). In f3 strands of membrane proteins, every second residue in the mem brane-spanning segment is hydrophobic and interacts with the lipid bilayer; aromatic side chains are commonly found at the lipid-protein interface. The other residues may or may not be hydrophilic. The hydropathy plot is not useful in predicting transmembrane segments for proteins with f3 barrel motifs, but as the database of known {3-barrel motifs increases, sequence-based predic tions of transmembrane f3 conformations have become feasible. For example, some outer membrane proteins of gram-negative bacteria (Fig. 11-13) have been correctly predicted, by sequence analysis, to contain {3 barrels.
FIGURE 11-13 Membrane proteins with P-barrel structure. Th ree pro teins of the £. coli outer membrane are shown, v iewed in the plane of
Cova lently Attached lipids Anchor
the membrane. FepA (POB 10 1 FEP), i nvolved i n i ron uptake, has 2 2
Some Membrane Proteins
a phosphol ipase, is a 1 2 -stranded {3 barrel that exists as a d i mer i n the
Some membrane proteins contain one or more cova lently linked lipids, which may be of several types: long chain fatty acids, isoprenoids, sterols, or glycosylated
membrane-spann i ng {3 strands. OmpLA (derived from P O B I D 1 Q DS),
membrane. Ma ltoporin (derived from PDB 10 1 MAL), a maltose trans
porter, is a trimer; each monomer consists of 1 6 {3 strands.
L3 soj
Biological M em bra nes a n d Tra nsport
derivatives of phosphatidylinositol (GPis; Fig. 1 1-1 4) . The attached lipid provides a hydrophobic anchor that inserts into the lipid bilayer and holds the protein at the membrane surface. The strength of the hydrophobic in teraction between a bilayer and a single hydrocarbon chain linked to a protein is barely enough to anchor the protein securely, but many proteins have more than one attached lipid moiety. Other interactions, such as ionic attractions between positively charged Lys residues in the protein and negatively charged lipid head groups, probably contribute to the stability of the attachment. The association of these lipid-linked proteins with the membrane is certainly weaker than that for integral membrane proteins and is, in at least some cases, re versible. But treatment with alkaline carbonate does not release GPI-linked proteins, which are therefore, by the working definition, integral proteins. Beyond merely anchoring a protein to the mem brane, the attached lipid may have a more specific role. In the plasma membrane, proteins with GPI an chors are exclusively on the outer face and are clus tered in certain regions, as we shall see (pp. 384-386), whereas other types of lipid-linked proteins (with far nesyl or geranylgeranyl groups attached; Fig. 11-14) are exclusively on the inner face. In polarized epithe lial cells (such as intestinal epithelial cells, see Fig. 11-44), in which apical and basal surfaces have
different roles, GPI-linked proteins are directed specifically to the apical surface. Attachment of a spe cific lipid to a newly synthesized membrane protein therefore has a targeting function, directing the pro tein to its correct membrane location.
S U M M A R Y 11.1 •
•
•
Biological membranes define cellular boundaries, divide cells into discrete compartments, organize complex reaction sequences, and act in signal reception and energy transformations. Membranes are composed of lipids and proteins in varying combinations particular to each species, cell type, and organelle. The lipid bilayer is the basic structural unit. Peripheral membrane proteins are loosely associated with the membrane through electrostatic interactions and hydrogen bonds or by covalently attached lipid anchors. Integral proteins associate firmly with membranes by hydrophobic interactions between the lipid bilayer and their nonpolar amino acid side chains, which are oriented toward the outside of the protein molecule. Amphitropic proteins associate reversibly with membranes.
FIGURE 11-14 Lipid-linked membrane proteins. Covalently attached l ipids anchor membrane proteins to the l ipid b i l ayer. A palm itoyl group i s shown at tached by thioester l i n kage to a Cys res idue; an N-myristoyl group is general l y attached t o an amino-term inal Gly; t h e farnesyl a n d geranylgeranyl groups at tached to carboxyl-terminal Cys residues are isoprenoids of 1 5 and 20 car bons, respectively. These three lipid-protein assemblies are fou nd only on the i n ner face of the plasma membrane. Glycosyl phosphatidy l i nositol (GPI) an chors are derivatives of phosphatidy l i nositol i n which the i nositol bears a short o l i gosaccharide covalently joined to the carboxyl-terminal residue of a pro tein through phosphoethanolamine. GPI-Ii nked proteins are always on the ex tracel l u l a r face of the plasma membrane.
Palmitoy! group on internal Cys (or Ser)
N-Myristoyl group on amino-terminal Gly
Farnesyl (or geranylgeranyl) group on carboxyl-terminal Cys
s
coo -
coo-
I CH2 I CH 0 '\. � / NH I OCH3
T h e Co m p ositi o n a n d A rchitect u re o f M e mbra n e s
C=O I NH I CH2 I R2 I GPT anchor on
?
carboxyl terminu ·
-P=O I
-o
Outside
Inside
1 1 . 2 Membrane Dynam ics
•
•
Many membrane proteins span the lipid bilayer several times, with hydrophobic sequences of about 20 amino acid residues forming transmembrane a helices. Multistranded f3 barrels are also common in integral proteins in bacterial membranes. Tyr and Trp residues of transmembrane proteins are commonly found at the lipid-water interface.
(a) Paracrystalline state (gel)
The lipids and proteins of membranes are inserted into the bilayer with specific sidedness; thus membranes are structurally and functionally asymmetric. Plasma membrane glycoproteins are always oriented with the oligosaccharide-bearing domain on the extracellular surface. (b) Fluid state
1 1 .2 Membrane Dynamics One remarkable feature of all biological membranes is their flexibility-their ability to change shape without losing their integrity and becoming leaky. The basis for this property is the noncovalent interactions among lipids in the bilayer and the mobility allowed to individ ual lipids because they are not covalently anchored to one another. We turn now to the dynamics of mem branes: the motions that occur and the transient struc tures allowed by these motions.
[381]
1l
HeaL produces thermal motion ofside chains (gel �fluid transition)
FIGURE 11-15 Two extreme states of bilayer lipids. (a) In the paracrys tal l i ne state, or gel phase, polar head groups are un iformly arrayed at the su rface, and the acyl chains are nearly moti onless and packed with regular geometry. (b) In the l i q u id-disordered state, or fluid state, acyl chains undergo much thermal motion and have no regular organiza tion. Intermed iate between these extremes is the l iquid-ordered state,
Acyl Groups in the Bilayer I nterior Are Ordered to Varying Degrees
Although the lipid bilayer structure is quite stable, its in dividual phospholipid and sterol molecules have much freedom of motion (Fig. 1 1- 1 5 ) . The structure and flexibility of the lipid bilayer depend on the kinds of lipids present, and change with temperature. Below nor mal physiological temperatures, the lipids in a bilayer form a semisolid gel phase, in which all types of motion of individual lipid molecules are strongly constrained; the bilayer is paracrystalline (Fig. 11-15a). Above phys iological temperatures, individual hydrocarbon chains of fatty acids are in constant motion produced by rotation about the carbon-carbon bonds of the long acyl side chains. In this liquid-disordered state , or fluid state (Fig. 11-15b), the interior of the bilayer is more fluid than solid and the bilayer is like a sea of constantly mov ing lipid. At intermediate (physiological) temperatures, the lipids exist in a liquid-ordered state; there is less thermal motion in the acyl chains of the lipid bilayer, but lateral movement in the plane of the bilayer still takes place. These differences in bilayer state are easily ob served in liposomes composed of a single lipid, but bio logical membranes contain many lipids with a variety of fatty acyl chains and thus do not show sharp phase changes with temperature. At temperatures in the physiological range for a mammal (about 20 to 40°C), long-chain saturated fatty acids (such as 16:0 and 18:0) pack into a liquid-ordered array, but the kinks in unsaturated fatty acids (see Fig.
i n which i ndividual phospholipid molecules can diffuse latera l l y but the acyl groups remain extended and more or less ordered.
10-2) interfere with packing, favoring the liquid-disor dered state. Shorter-chain fatty acyl groups have the same effect. The sterol content of a membrane (which varies greatly with organism and organelle; Table 11-1) is another important determinant of lipid state. The rigid planar structure of the steroid nucleus, inserted between fatty acyl side chains, reduces the freedom of neighboring acyl chains to move by rotation about their carbon-carbon bonds, forcing the chains into their fully extended conformation. The presence of sterols there fore reduces the fluidity in the core of the bilayer, thus favoring the liquid-ordered phase, and increases the thickness of the lipid leaflet (as described below). Cells regulate their lipid composition to achieve a constant membrane fluidity under various growth condi tions. For example, bacteria synthesize more unsatu rated fatty acids and fewer saturated ones when cultured at low temperatures than when cultured at higher temperatures (Table 11-2). As a result of this ad justment in lipid composition, membranes of bacteria cultured at high or low temperatures have about the same degree of fluidity. Transbilayer Movement of Lipids Requires Catalysis
At physiological temperatures, transbilayer- or "flip flop"-diffusion of a lipid molecule from one leaflet of
[382]
Biological M e m b ranes a n d Tra n sport
TA B LE 1 1 -2
Fatty Add Composiden Temperatures Percentage of total fatty acids* 10 oc
Myristic acid Palmitic acid
40 oc
30 oc
(14:0)
4
4
4
8
( 16:0)
18
25
29
48
26
24
23
9
Palmitoleic acid Oleic acid
20 oc
(16: 1)
(18:1)
Hydroxyrnyristic acid Ratio of unsaturated to saturatedt
38
34
30
12
13
10
10
8
2.0
2.9
1.6
0.38
Soun:e: Data from Marr, A.G. & Ingraham, J.l. ( 1962) Effect of temperature on the composition of fatty acids in Escherichia co li. J. Bacterial. 84, 1260. *The exact fatty acid composition depends not only on growth temperature but on growth stage and growth medium composition. ! Ratios calculated as the total percentage of 16:1 plus 18: 1 divided by the total percentage of 14:0 plus 16:0 Hydroxymyristic acid was omitted from this calculation.
the bilayer to the other (Fig. l l-16a) occurs very slowly if at all in most membranes, although lateral dif fusion in the plane of the bilayer is very rapid (Fig . l l -16b). Transbilayer movement requires that a polar or charged head group leave its aqueous environment and move into the hydrophobic interior of the bilayer, a process with a large, positive free-energy change. There are, however, situations in which such movement is es sential. For example, in the ER, membrane glycerophos pholipids are synthesized on the cytosolic surface, whereas sphingolipids are synthesized or modified on the lumenal surface. To get from their site of synthesis to their eventual point of deposition, these lipids must undergo flip-flop diffusion. Several families of proteins , including the flip pases, floppases, and scramblases (Fig. l l-16c), facil itate the transbilayer movement of lipids , providing a path that is energetically more favorable and much faster than the uncatalyzed movement. The combina tion of asymmetric biosynthesis of membrane lipids, very slow uncatalyzed flip-flop diffusion, and the pres ence of selective, energy-dependent lipid translocators is responsible for the transbilayer asymmetry in lipid composition shown in Figure 11-5. Besides contribut ing to this asymmetry of composition, the energy dependent transport of lipids to one bilayer leaflet may, by creating a larger surface on one side of the bilayer, be important in generating the membrane cur vature essential in the budding of vesicles. Flippases catalyze translocation of the aminophos pholipids phosphatidylethanolamine and phosphatidyl serine from the extracellular to the cytosolic leaflet of the plasma membrane, contributing to the asymmetric dis tribution of phospholipids : phosphatidylethanolamine and phosphatidylserine primarily in the cytosolic leaflet, and the sphingolipids and phosphatidylcholine in the outer leaflet. Keeping phosphatidylserine out of the ex tracellular leaflet is important: its exposure on the outer
(a) Uncatalyzed transbilayer ("flip·flop") diffusion
(b) Uncatalyzed lateral diffusion
very fast
(1 JJ-rn/S)
(c) Catalyzed transbilayer translocations +
Outside
NH3
Inside ATP
ADP+Pi
Flippase (P-type ATPase) moves PE and PS from outer to cytosolic leaflet
ATP
ADP+Pi
Floppase
(ABC transporter)
moves phospholipids from cytosolic to outer leaflet
Scramblase moves lipids in either direction, toward equilibrium
FIGURE 11-16 Motion of single phospholipids in a bilayer. (a) Uncat alyzed movement from one leaflet to the other is very slow, but (b) lat eral diffusion with i n the leaflet is very rapid, requiring no catalysis. (c) Three types of phospholipid translocaters i n the plasma mem
brane. F l i ppases translocate primarily ami nophosphol ipids (phos phatidylethanolamine (PE), phosphatidylserine (PS)) from the outer (exo plasmic) leaflet to the i n ner (cytosolic) leaflet; they req u i re ATP and are members of the P-type ATPase fam i l y. Floppases move phospholipids from the cytosolic to the outer leaflet, require ATP, and are members of the ABC transporter fam i l y. Scramblases equ i l ibrate phospho l i pids
across both leaflets; they do not require ATP but are activated by Ca2 + .
1 1 . 2 Membrane Dynamics
surface triggers apoptosis (programmed cell death; see Chapter 12) and engulfment by macrophages that carry phosphatidylserine receptors. Flippases also act in the ER, where they move newly synthesized phospholipids from their site of synthesis in the cytosolic leaflet to the lumenal leaflet. Flippases consume about one ATP per molecule of phospholipid translocated, and they are structurally and functionally related to the P-type ATP ases (active transporters) described on page 396. Floppases move plasma membrane phospholipids from the cytosolic to the extracellular leaflet, and like flippases are ATP-dependent. Floppases are members of the ABC transporter family described on page 400, all of which actively transport hydrophobic substrates out ward across the plasma membrane. Scramblases are proteins that move any membrane phospholipid across the bilayer down its concentration gradient (from the leaflet where it has a higher concentration to the leaflet where it has a lower concentration); their activity is not dependent on ATP. Scramblase activity leads to con trolled randomization of the head-group composition on the two faces of the bilayer. The activity rises sharply with 2 an increase in cytosolic Ca + concentration, which may result from cell activation, cell injury, or apoptosis; as noted above , exposure of phosphatidylserine on the outer surface marks a cell for apoptosis and engulfment by macrophages. Finally, a group of proteins that act pri marily to move phosphatidylinositol lipids across lipid bilayers, the phosphatidylinositol transfer proteins, are believed to have important roles in lipid signaling and membrane trafficking. Lipids a n d Proteins Diffuse Laterally i n the Bilayer
Individual lipid molecules can move laterally in the plane of the membrane by changing places with neigh boring lipid molecules; that is, they undergo Brownian movement within the bilayer (Fig. l l- 16b), which can be quite rapid. A molecule in the outer leaflet of the ery throcyte plasma membrane, for example, can diffuse lat erally so fast that it circumnavigates the erythrocyte in seconds. This rapid lateral diffusion in the plane of the bilayer tends to randomize the positions of individual molecules in a few seconds. Lateral diffusion can be shown experimentally by attaching fluorescent probes to the head groups of lipids and using fluorescence microscopy to follow the probes over time (Fig. 1 1-17) . In one technique, a small re gion (5 JLm2) of a cell surface with fluorescence-tagged lipids is bleached by intense laser radiation so that the irradiated patch no longer fluoresces when viewed with less-intense (nonbleaching) light in the fluorescence mi croscope. However, within milliseconds, the region re covers its fluorescence as unbleached lipid molecules diffuse into the bleached patch and bleached lipid mole cules diffuse away from it. The rate of jluorescence re covery after photobleaching, or FRAP, is a measure of the rate of lateral diffusion of the lipids. Using the FRAP
[383]
Cell
Fluorescent probe on lipids
l
React cell with fiuorescent probe to label lipids
microscope
1
With time, unbleached phospholipids diffuse into bleached area
of fluorescence return
FIGURE 1 1 -17 Measurement of lateral diffusion rates of lipids by fluorescence recovery after photobleaching (FRAP). Lipi ds i n the
outer leaflet of the plasma membrane are labeled by reaction with a membrane-i mpermeant fluorescent probe (red), so the surface is uni formly labeled when viewed with
a
fluorescence m icroscope. A sma l l
area i s bleached b y irradiation with an i ntense laser beam a n d be comes nonfluorescent. With the passage of time, labeled lipid mole cules d iffuse i nto the bleached region,
and it aga i n becomes
fluorescent. Researchers can track the time course of fluorescence re turn and determine a diffusion coefficient for the labeled lipid . The dif fusion rates are typically h igh; a l i pid moving at this speed cou ld c i rcumnavigate an E. coli cel l i n one second. (The FRAP method can also be used to measure lateral diffusion of membrane proteins.)
[3 s4]
Biological M em branes and Tra nsport
technique, researchers have shown that some mem brane lipids diffuse laterally at rates of up to
1 JLm!S .
Another technique, single particle tracking, allows one to follow the movement of a single lipid molecule in
the plasma membrane on a much shorter time scale. Re
sults from these studies confirm rapid lateral diffusion within small, discrete regions of the cell surface and
Plasma membrane
show that movement from one such region to a nearby
Ankyrin ----����
region ("hop diffusion") is inhibited; membrane lipids behave as though corralled by fences that they can occa sionally cross by hop diffusion
(Fig. 1 1- 1 8 ) .
Many membrane proteins seem to be afloat in a sea of lipids. Like membrane lipids, these proteins are free to diffuse laterally in the plane of the bilayer and are in con
Spectrin ------':--=41. """"'...._�...-,.·
Path of single ---.:...;-..!P.=1�,...-t./ lipid molecule Junctional complex -----iJJ::._-----:iJE";:_ :--.:!! �� (actin) Inside
stant motion, as shown by the FRAP technique with fluo rescence-tagged
surface
proteins .
Some
membrane
proteins associate to form large aggregates ("patches") on the surface of a cell or organelle in which individual protein molecules do not move relative to one another; for example, acetylcholine receptors form dense, near crystalline patches on neuronal plasma membranes at synapses. Other membrane proteins are anchored to in ternal structures that prevent their free diffusion. In the erythrocyte membrane, both glycophorin and the chlo ride-bicarbonate exchanger (p.
395) are tethered to spec (Fig. 1 1-1 9 ) .
trin, a filamentous cytoskeletal protein
One possible explanation for the pattern o f lateral diffu sion of lipid molecules shown in Figure
FIGURE 1 1 - 1 9 Restricted motion of the erythrocyte chloride bicarbonate exchanger and glycophorin. The proteins span the mem
brane and are tethered to spectrin, a cytoskeletal protein, by another protein, ankyrin, l i m iting their lateral mob i l ity. Ankyrin i s anchored i n the membrane b y a covalently bound palm itoyl side cha i n (see Fig. 1 1 -1 4). Spectrin, a long, filamentous protein, i s cross-l i n ked at ju nc tional complexes conta i n i n g actin . A network of cross-l i nked spectri n molecules attached to the cytoplasmic face o f the plasma membrane sta b i l i zes the membrane, making it resistant to deformation. Th i s net work of anchored membrane proteins may form the "corra l " suggested by the experiment shown in Figure 1 1 -1 8; the l i pid tracks shown here are confined to regions defined by the tethered membrane protei ns.
11-18 is that
membrane proteins immobilized by their association with spectrin form the "fences" that define the regions of rela tively unrestricted lipid motion.
Sphingolipids and Cholesterol Cluster Together in Membrane Rafts We have seen that diffusion of membrane lipids from one bilayer leaflet to the other is very slow unless catalyzed, and that the different lipid species of the plasma mem brane are asymmetrically distributed in the two leaflets of the bilayer (Fig.
11-5). Even within a single leaflet, the
lipid distribution is not random. Glycosphingolipids (cere brosides and gangliosides), which typically contain long chain saturated fatty acids, form transient clusters in the outer leaflet that largely exclude glycerophospholipids, which typically contain one unsaturated fatty acyl group
i
t
Start
Finish
and a shorter saturated acyl group. The long, saturated acyl groups of sphingolipids can form more compact, more stable associations with the long ring system of cholesterol than can the shorter, often unsaturated, chains of phos pholipids. The cholesterol-sphingolipid microdomains in
0.1 "'"
,__
FIGURE 1 1 -1 8 Hop diffusion of individual lipid molecules. The mo
tion of a single fluorescently labeled l ipid molecule in a cel l surface i s recorded on v ideo b y fluorescence microscopy, with a t i m e resolution of 25 JLS (equivalent to 40,000 frames/s). The track shown here repre
sents a molecule fol l owed for 56 ms (2,250 frames); the trace begins i n
the purple area a n d continues through b l ue, green, a n d orange. The
the outer monolayer of the plasma membrane, visible with atomic force microscopy (Box
11-1), are slightly thicker
and more ordered (less fluid) than neighboring mi crodomains rich in phospholipids and are more difficult to dissolve with nonionic detergents; they behave like liquid ordered sphingolipid
rafts adrift on an ocean of liquid (Fig. 1 1-20, p. 386).
disordered phospholipids
These lipid rafts are remarkably enriched in two
pattern of movement i n d icates rapid diffusion with i n a confined region
classes of integral membrane proteins: those anchored
(about 250 nm in d i ameter, shown by a single color), with occasional
to the membrane by two covalently attached long-chain
hops into an adj o i n i ng region. This fi nding suggests that the l i p i ds are
saturated fatty acids (two palmitoyl groups or a palmi
corralled by molec u l ar fences that they occasion a l l y j ump.
toy! and a myristoyl group) and GPI-anchored proteins
1 1 . 2 Membra n e Dynamics
BOX 1 1 -1
M E T H O D S
[3ss]
Ato m i c F o rce M icroscopy to V is u a l ize M e m b ra n e P rote i n s
In atomic force microscopy (AFM), the sharp tip of a mi croscopic probe attached to a flexible cantilever is drawn across an uneven surface such as a membrane (Fig. 1). Electrostatic and van der Waals interactions between the tip and the sample produce a force that moves the probe up and down (in the z dimension) as it encounters hills and valleys in the sample. A laser beam reflected from the cantilever detects motions of as little as 1 A. In one type of atomic force microscope, the force on the probe is held constant (relative to a standard force, on the order of piconewtons) by a feedback cir cuit that causes the platform holding the sample to rise or fall to keep the force constant. A series of scans in the x and y dimensions (the plane of the membrane) yields a three-dimensional contour map of the surface with resolution near the atomic scale-0. 1 nm in the vertical dimension, 0.5 to 1 .0 nm in the lateral dimensions. The membrane rafts shown in Figure 1 1-20b were visualized by this technique. In favorable cases, AFM can be used to study single membrane protein molecules. Single molecules of bac teriorhodopsin (see Fig. 1 1-9) in the purple membranes of the bacterium Halobacterium salinarum are seen as highly regular structures (Fig. 2a) . When several im ages of individual units are superimposed with the help of a computer, the real parts of the image reinforce each other and the noise in individual images is averaged out, yielding a high-resolution image of the protein (inset in Fig. 2a) . AFM of purified E. coli aquaporin, reconstituted
Laser
�
La.er light detector (detects cantilever deflection)
X
Platform moves to maintain constant pressure on cantilever tip. Excursions in the z dimension are plotted as a function of x, y.
FIGURE 1
into lipid bilayers and viewed as if from the outside of a cell, shows the fine details of the protein's periplasmic domains (Fig. 2b) . And AFM reveals that F0 , the proton driven rotor of the chloroplast ATP synthase (p. 760) , is composed of many subunits (14 in Fig. 2c) arranged in a circle.
0 ··; 0{.) 0 .
o o o o·
c oOo o· () ' �. · r �
(a)
10 nm
FIGURE 2
t---i
2 nm
(Fig. 1 1-14) . Presumably these lipid anchors, like the acyl chains of sphingolipids, form more stable associa tions with the cholesterol and long acyl groups in rafts than with the surrounding phospholipids. Ot is notable that other lipid-linked proteins, those with covalently attached isoprenyl groups such as farnesyl, are not pref erentially associated with the outer leaflet of sphin golipid/cholesterol rafts (Fig. 1 1-20a) .) The "raft" and "sea" domains of the plasma membrane are not rigidly separated; membrane proteins can move into and out of
(c)
...
lipid rafts on a time scale of seconds. But in the shorter time scale (microseconds) more relevant to many mem brane-mediated biochemical processes, many of these proteins reside primarily in a raft. We can estimate the fraction of the cell surface oc cupied by rafts from the fraction of the plasma mem brane that resists detergent solubilization, which can be as high as 50% in some cases: the rafts cover half of the ocean (Fig. 1 1-20b) . Indirect measurements in cultured fibroblasts suggest a diameter of roughly 50 nm for an
[3 86]
Biological Mem branes a n d Tra nsport
Caveolin is an integral membrane protein with two
Raft, enriched in sphingolipids, cholesterol
globular domains connected by a hairpin-shaped hy drophobic domain, which binds the protein to the cytoplas mic leaflet of the plasma membrane. Three palmitoyl groups attached to the carboxyl-terminal globular domain further anchor it to the membrane. Caveolin (actually, a
Outsi de
family of related caveolins) binds cholesterol in the mem brane, and the presence of caveolin forces the associated lipid bilayer to curve inward, forming
caveolae ("little (Fig. 1 1-2 1). Caveolae are unusual rafts: they involve both leaflets of the bilayer caves'') in the surface of the cell
the cytoplasmic leaflet, from which the caveolin globular Pre.nylated protein
domains project, and the extracellular leaflet, a typical sphingolipid/cholesterol raft with associated GPI-anchored proteins. Caveolae are implicated in a variety of cellular
(a)
functions, including membrane trafficking within cells and the transduction of external signals into cellular responses. The receptors for insulin and other growth factors, as well as certain GTP-binding proteins and protein kinases asso ciated with transmembrane signaling, seem to be localized
(b)
(a)
FIGURE 11-20 Membrane microdomains (rafts). (a) Stable assoc iations
Plasma membrane
of sphi ngol ipids and cholesterol i n the outer leaflet produce a m i
Outside
crodoma in, slightly thicker than other membrane regions, that is en riched with specific types of membrane proteins. GPI-Iinked proteins
Inside
are common i n the outer leaflet of these rafts, and proteins with one or several covalently attached long-chain acyl groups are common in the i n ner leaflet. Caveolin is especially common i n inwardly cu rved rafts cal led caveolae (see Fig. 1 1 -2 1 ). Proteins with attached prenyl groups (such as Ras; see Box 1 2-2) tend to be excluded from rafts. (b) In this ar tificial membrane-reconstituted (on a mica su rface) from cholesterol, synthetic phospholipid (dioleoylphosphatidylcho l ine), and the G P I I i n ked protein placental alkal ine phosphatase-the greater thickness of raft regions is visualized by atomic force mi croscopy (see Box 1 1 -1 ). The rafts protrude from a lipid b ilayer ocean (the black surface is the top of the upper monolayer); sharp peaks represent GPI-Ii nked proteins. Note that these peaks are found a l most exclusively i n the rafts.
individual raft, which corresponds to a patch containing a few thousand sphingolipids and perhaps
10 to 50
membrane proteins. Because most cells express more than 50 different kinds of plasma membrane proteins, it is likely that a single raft contains only a subset of mem brane proteins and that this segregation of membrane proteins is functionally significant. For a process that in volves interaction of two membrane proteins, their pres ence in a single raft would hugely increase the likelihood of their collision. Certain membrane receptors and sig naling proteins, for example, seem to be segregated to gether in membrane rafts. Experiments show that
(b)
Caveolin dimer (si'i fatly acyl moieties)
FIGURE 11-21 Caveolin forces inward curvature of a membrane. Caveolae are sma l l i nvaginations in the plasma membrane, as seen i n (a) a n electron micrograph of an adipocyte surface-labeled with a n
electron-dense marker. (b) Each caveo l i n monomer has a central hy drophobic domain and three long-cha i n acyl groups (red), which hold the molecule to the i nside of the plasma membrane. When several
signaling through these proteins can be disrupted by
caveo l i n d i mers are concentrated in a small region (a raft), they force a
manipulations that deplete the plasma membrane of
cu rvature in the l ipid b i layer, forming a caveola. Cholesterol molecules
cholesterol and destroy lipid rafts.
i n the b i l ayer are shown in orange.
1 1 . 2 M e m b ra n e Dynamics
in rafts and perhaps in caveolae. We discuss some possible roles of rafts in signaling in Chapter 12. Membrane Curvature and Fusion Are Central to Many Biological Processes Caveolin is not unique in its ability to induce curvature in membranes. Changes of curvature are central to one of the most remarkable features of biological membranes: their ability to undergo fusion with other membranes without losing their continuity. Although membranes are stable, they are by no means static. Within the eukaryotic endomembrane system (which includes the nuclear mem brane, endoplasmic reticulum, Golgi, and various small vesicles) , the membranous compartments constantly re organize. Vesicles bud from the ER to carry newly synthe sized lipids and proteins to other organelles and to the plasma membrane. Exocytosis, endocytosis, cell division, fusion of egg and sperm cells, and entry of a membrane enveloped virus into its host cell all involve membrane re organization in which the fundamental operation is fusion of two membrane segments without loss of continuity (Fig. 1 1-22 ). Most of these processes begin with a local increase in membrane curvature. Three mechanisms for inducing membrane curvature are shown in Figure 1 1-23. A protein that is intrinsically curved may force curvature in a bilayer by binding to it; the binding energy provides the driving force for the increase in bilayer curva ture. Alternatively, many subunits of a scaffold protein may assemble into curved supramolecular complexes and
[3 8 7]
stabilize curves that spontaneously form in the bilayer. Or, a protein may insert one or more hydrophobic helices into one face of the bilayer, expanding its area relative to the other face and thereby forcing curvature. Specific fusion of two membranes requires that (1) they recognize each other; (2) their surfaces become closely apposed, which requires the removal of water molecules normally associated with the polar head groups of lipids; (3) their bilayer structures become lo cally disrupted, resulting in fusion of the outer leaflet of each membrane (hemifusion) ; and (4) their bilayers fuse to form a single continuous bilayer. The fusion occurring in receptor-mediated endocytosis, or regulated secretion, also requires that (5) the process is triggered at the ap propriate time or in response to a specific signal. Integral proteins called fusion proteins mediate these events, bringing about specific recognition and a transient local distortion of the bilayer structure that favors membrane fusion. (Note that these fusion proteins are unrelated to the products encoded by two fused genes, also called fu sion proteins, discussed in Chapter 9.) (a)
A protein with intrinsic curvature on its surface interacts strongly with a curved membrane surface, allowing both membrane and protein to achieve their lowest energy.
Budding of vesicles from Golgi complex Exocytosis
Endocytosis Fusion of endosome and lysosome
If a membrane region spontaneously curves, monomeric subunits of certain proteins can polymerize into a superstructure that favors and maintains the curvature.
Viral infection
(c) Fusion
of sperm and egg Fusion of small vacuoles (plants)
A protein with one or more amphipathic helices inserted into one leaflet of the bilayer crowds the lipids in that leaflet, forcing the membrane to bend.
Separation of two plasma membranes at cell division
FIGURE 11-22 Membrane fusion. The fusion of two membranes is central to a variety of cel lular processes involving organelles and the
FIGURE 11-23 Three models for protein-induced curvature of
plasma membrane.
membranes.
[3ssJ
Biological Mem branes a n d Tra nsport
Cytosol Secretory vesicle
""'
Neurotransmitter-filled vesicle approaches plasma membrane.
� Ne urotransmitter molecules \__ v-SNARE
(t-
II II •
NARE
Plasma membrane
AP25 v-SNARE and t-SNARE bind to each other, zipping up from the amino termini and drawing the two membranes together.
l '
.
'
Zipping causes curvature and lateral tension on bilayers, favoring hemifusion between outer leaflets.
�· · �
A well-studied example of membrane fusion is that occurring at synapses, when intracellular vesicles loaded with neurotransmitter fuse with the plasma membrane. This process involves a family of proteins called SNARE S (Fig. 1 1-24) . SNAREs in the cytoplas mic face of the intracellular vesicle are called v SNAREs; those in the target membrane with which the vesicle fuses (the plasma membrane during exocytosis) are t-SNAREs. Two other proteins , SNAP25 and NSF, are also involved. During fusion, a v-SNARE and t SNARE bind to each other and undergo a structural change that produces a bundle of long thin rods made up of helices from both SNARES and two helices from SNAP25 (Fig. 1 1-24) . The two SNAREs initially interact at their ends, then zip up into the bundle of helices. This structural change pulls the two membranes into contact and initiates the fusion of their lipid bilayers. The complex of SNAREs and SNAP25 is the target of the powerful Clostridium botulinum toxin, a pro tease that cleaves specific bonds in these proteins , pre venting neurotransmission and thereby causing the death of the organism. Because of its very high speci ficity for these proteins, purified botulinum toxin has served as a powerful tool for dissecting the mechanism of neurotransmitter release in vivo and in vitro. I ntegral Proteins of the Plasma Membrane Are I nvolved in Surface Adhesion, Signaling, a n d Other Cellular Processes
Hemifusion: inner leaflets of both membranes come into contact.
l
- ,
Complete fusion creates a fusion pore.
l
Pore widens; vesicle contents are released outside cell.
\� .. ' . ./
FIGURE 1 1 -24 Membrane fusion during neurotransmitter release at a synapse. The secretory vesicle membrane conta i n s the v-SNARE
synaptobrev i n (red). The target (plasma) membrane contains the t-SNAREs syntaxin (bl ue) and SNAP25 (violet). When a local increase in 2 [Ca + ] signals release of neu rotransm itter, the v-SNARE, SNAP25, and
t-SNARE interact, forming a coiled bundle of four a hel ices, pu l l i ng the two membranes together and disrupting the bilayer loca lly. This leads first to hemifusion, joining the i n ner leaflets of the two membranes, then to complete membrane fusion and neurotransm itter release.
Several families of integral proteins in the plasma mem brane provide specific points of attachment between cells, or between a cell and extracellular matrix pro teins. Integrins are surface adhesion proteins that me diate a cell's interaction with the extracellular matrix and with other cells, including some pathogens. Inte grins also carry signals in both directions across the plasma membrane, integrating information about the extracellular and intracellular environments. All inte grins are heterodirneric proteins composed of two un like subunits , a and (3, each anchored to the plasma membrane by a single transmembrane helix. The large extracellular domains of the a and (3 subunits combine to form a specific binding site for extracellular proteins such as collagen and fibronectin, which contain a com mon determinant of integrin binding, the sequence Arg-Gly-Asp (RGD) . We discuss the signaling functions of integrins in more detail in Chapter 12 (p. 455) . Other plasma membrane proteins involved in sur face adhesion are the cadherins, which undergo ho mophilic ("with same kind") interactions with identical cadherins in an adjacent cell. Selectins have extracel 2 lular domains that, in the presence of Ca + , bind spe cific polysaccharides on the surface of an adjacent cell. Selectins are present primarily in the various types of blood cells and in the endothelial cells that line blood vessels (see Fig. 7-3 1 ) . They are an essential part of the blood-clotting process. Integral membrane proteins play roles in many other cellular processes. They serve as transporters and ion
1 1 . 3 Sol ute Tra nsport across Mem b ranes
channels (discussed in Section 11.3) and as receptors for hormones, neurotransmitters, and growth factors (Chap ter 12). They are central to oxidative phosphorylation and photophosphorylation (Chapter 19) and to cell-cell and cell-antigen recognition in the immune system (Chap ter 5) . Integral proteins are also important players in the membrane fusion that accompanies exocytosis, endocyto sis, and the entry of many types of viruses into host cells.
S U M M A RY 11.2 •
•
•
M e m b ra n e D y n a m i cs
Flip-flop diffusion of lipids between the inner and outer leaflets of a membrane is very slow except when specifically catalyzed by fiippases, floppases, or scramblases. Lipids and proteins can diffuse laterally within the plane of the membrane, but this mobility is limited by interactions of membrane proteins with internal cytoskeletal structures and interactions of lipids with lipid rafts. One class of lipid rafts consists of sphingolipids and cholesterol with a subset of membrane proteins that are GPI-linked or attached to several long-chain fatty acyl moieties.
Ion channel (down electrochemical gradient; may be gated by a ligand or ion)
•
•
Lipids in a biological membrane can exist in liquid-ordered or liquid-disordered states; in the latter state, thermal motion of acyl chains makes the interior of the bilayer fluid. Fluidity is affected by temperature, fatty acid composition, and sterol content.
Simple diffusion (nonpolar compounds only, down concentration gradient)
•
Caveolin is an integral membrane protein that associates with the inner leaflet of the plasma membrane, forcing it to curve inward to form caveolae, probably involved in membrane transport and signaling. Specific proteins cause local membrane curvature and mediate the fusion of two membranes, which accompanies processes such as endocytosis, exocytosis, and viral invasion. Integrins are transmembrane proteins of the plasma membrane that act both to attach cells to each other and to carry messages between the extracellular matrix and the cytoplasm.
1 1 .3 Sol ute Tra nsport across Membra nes Every living cell must acquire from its surroundings the raw materials for biosynthesis and for energy production, and must release to its environment the byproducts of metabolism. A few nonpolar compounds can dissolve in the lipid bilayer and cross the membrane unassisted, but for transmembrane movement of any polar compound or ion, a membrane protein is essential. In some cases a membrane protein simply facilitates the diffusion of a solute down its concentration gradient, but transport can also occur against a gradient of concentration, electrical charge, or both, in which case the process requires energy (Fig. J 1--2 5 ). The energy may come directly from ATP hydrolysis or may be supplied in the form of one solute moving down its electrochemical gradient, with the release of enough energy to drive another solute up its gradient. Ions may also move across membranes via Primary active transport (against ion channels formed by proteins, electrochemical or they may be carried across by gradient) ionophores, small molecules that mask the charge of ions and allow them to diffuse through the lipid bilayer. With very few exceptions, the traffic of small molecules across the plasma membrane is mediated by proteins such as transmembrane channels, carriers, or pumps. Within the eukaryotic cell, different compartments have different concentrations of ions and of metabolic intermediates and products, and these, too, must move across intracellular mem branes in tightly regulated, pro tein-mediated processes. 0
Ion
g
Ion
[3s9J
Secondary active transport (against electrochemical gradient, driven by ion moving down its gradient)
FIGURE 1 1 -25 Summary of transport types.
[39(0
B i o l o g i ca l Mem branes a n d Tra nsport
(a)
FIGURE 1 1 -26 Movement of solutes across a per meable membrane. (a) Net movement of an elec
trica l l y neutral solute is toward the side of lower sol ute concentration unti l equ i l i brium is achi eved. The sol ute concentrations on the left and right sides of the membrane are designated C1 and C2 • The rate of transmembrane movement (indi cated by the arrows) is proportional to the concentration Cl
>>
Cz
Before equilibrium Net flux
Cl
=
Cz
At equilibrium No net flux
vm
>
gradient, C2/C1 • (b) Net movement of an electri cally charged solute is di ctated by a combination
0
Before equilibrium
At equilibrium
Wml
and the chemical
concentration difference (C2/C 1 ) across the mem brane; net ion movement continues until this elec
�
trochem ical potenti al reaches zero.
Passive Tra nsport Is Facil itated by Mem brane Proteins When two aqueous compartments containing unequal concentrations of a soluble compound or ion are sepa rated by a permeable divider (membrane), the solute moves by
of the electrical potential
simple diffusion from the region of higher
concentration, through the membrane, to the region of lower concentration, until the two compartments have
Membrane proteins lower the activation energy for transport of polar compounds and ions by providing an alter native path through the bilayer for specific solutes. Proteins that bring about this
facilitated diffusion, or passive transport, are not enzymes in the usual sense; their "sub
strates" are moved from one compartment to another but are not chemically altered . Membrane proteins that speed
equal solute concentrations (Fig. l l-26a ) . When ions of
opposite charge are separated by a permeable mem
Hydrated solute
brane, there is a transmembrane electrical gradient, a
membrane potential,
Vm (expressed in millivolts) . This
membrane potential produces a force opposing ion move
ments that increase Vm and driving ion movements that
(a)
reduce Vm (Fig. ll-26b). Thus the direction in which a charged solute tends to move spontaneously across a membrane depends on both the chemical gradient (the difference in solute concentration) and the electrical gra
' )
\
) (
-/A\..
(., J::
'A" ��
Simple ditl'usion wi01out transporter
dient (Vm) across the membrane. Together, these two factors are referred to as the electrochemical gradient or
electrochemical potential. This behavior of solutes
is in accord with the second law of thermodynamics: mol ecules tend to spontaneously assume the distribution of greatest randomness and lowest energy. To pass through a lipid bilayer, a polar or charged solute must first give up its interactions with the water molecules in its hydration shell, then diffuse about 3 nm (30
A)
through a substance (lipid) in which it is poorly
soluble ( Fig. 1 1-2 7 ). The energy used to strip away the hydration shell and to move the polar compound from
(b)
water into lipid, then through the lipid bilayer, is regained as the compound leaves the membrane on the other side and is rehydrated. However, the intermediate stage of transmembrane passage is a high-energy state com parable to the transition state in an enzyme-catalyzed chemical reaction. In both cases, an activation barrier must be overcome to reach the intermediate stage
Transporter FIGURE 1 1 -27 Energy changes accompanying passage of a hydrophilic solute through the lipid bilayer of a biological membrane. (a) I n sim
ple diffusion, removal of the hydration shell is highly endergonic, and
(Fig. 11-27; compare with Fig. 6-3). The energy of
activation (liG:J:) for translocation of a polar solute
the energy of activation (D.G*) for diffusion through the b i l ayer is very
across the bilayer is so large that pure lipid bilayers are
fusion of the solute. It does this by form ing noncovalent i nteractions
h igh. (b) A transporter protein reduces the llG* for transmembrane dif
virtually impermeable to polar and charged species over
with the dehyd rated solute to replace the hydrogen bondi ng with wa
periods of time relevant to cell growth and division.
ter and by providing a hydrop h i l i c transmembrane pathway.
1 1 . 3 Sol ute Tra nsport across M em branes
the movement of a solute across a membrane by facilitating diffusion are called transporters or permeases. Like enzymes, transporters bind their substrates with stereochemical specificity through multiple weak, non covalent interactions. The negative free-energy change associated with these weak interactions, LlGbinding, counterbalances the positive free-energy change that accompanies loss of the water of hydration from the substrate , LlGdehydratiow thereby lowering LlG+ for trans membrane passage (Fig. 1 1-27) . Transporters span the lipid bilayer several times , forming a transmembrane channel lined with hydrophilic amino acid side chains . The channel provides an alternative path for a specific substrate to move across the lipid bilayer without its having to dissolve in the bilayer, further lowering LlG+ for transmembrane diffusion. The result is an increase of several to many orders of magnitude in the rate of transmembrane passage of the substrate. Transporters Can Be Grouped i nto Superfamilies Based on Their Structures We know from genomic studies that transporters con stitute a significant fraction of all proteins encoded in the genomes of both simple and complex organisms . There are probably a thousand or more different trans porters in the human genome. Transporters fall within two very broad categories: carriers and channels (Fig. 1 1-28 ) . Carriers bind their substrates with high stereo specificity, catalyze transport at rates well below the limits of free diffusion, and are saturable in the same sense as are enzymes: there is some substrate concen tration above which further increases will not produce a greater rate of transport. Channels generally allow transmembrane movement at rates orders of magnitude greater than those typical of carriers, rates approaching the limit of unhindered diffusion. Channels typically show less stereospecificity than carriers and are usually not saturable. Most channels are oligomeric complexes of several, often identical, subunits , whereas many car riers function as monomeric proteins . The classification as carrier or channel is the broadest distinction among transporters. Within each of these categories are super families of various types, defined not only by their pri-
I
Transporters
I
Carriers
I
Secondary active transporters
I
I
Passive transporters
FIGURE 1 1 -28 Classification of transporters.
[39 1]
mary sequences but by their secondary structures. Some channels are constructed primarily of helical transmembrane segments, others have /3-barrel struc tures . Among the carriers, some simply facilitate diffu sion down a concentration gradient; they are the passive transporter superfamily. Active trans porters can drive substrates across the membrane against a concentration gradient, some using energy provided directly by a chemical reaction (primary ac tive transporters) and some coupling uphill transport of one substrate with downhill transport of another (sec ondary active transporters) . We now consider some well-studied representatives of the main transporter superfamilies. You will encounter some of these trans porters again in later chapters in the context of the metabolic pathways in which they participate. The Glucose Transporter of Erythrocytes Mediates Passive Transport Energy-yielding metabolism in erythrocytes depends on a constant supply of glucose from the blood plasma, where the glucose concentration is maintained at about 5 mM. Glucose enters the erythrocyte by facilitated dif fusion via a specific glucose transporter, at a rate about 50,000 times greater than uncatalyzed transmembrane diffusion. The glucose transporter of erythrocytes (called GLUT1 to distinguish it from related glucose transporters in other tissues) is a type III integral pro tein CMr �45,000) with 12 hydrophobic segments, each of which is believed to form a membrane-spanning helix. The detailed structure of GLUT1 is not yet known, but one plausible model suggests that the side-by-side as sembly of several helices produces a transmembrane channel lined with hydrophilic residues that can hydro gen-bond with glucose as it moves through the channel (Fig. 1 1-29). The process of glucose transport can be described by analogy with an enzymatic reaction in which the "substrate" is glucose outside the cell CSout) , the "prod uct" is glucose inside (Sin) , and the "enzyme" is the transporter, T. When the initial rate of glucose uptake is measured as a function of external glucose concentra tion (Fig. 1 1 -30), the resulting plot is hyperbolic; at high external glucose concentrations the rate of uptake approaches Vmax · Formally, such a transport process can be described by the equations
Channel
Primary active transporters
in which k 1 , k _ 1 , and so forth, are the forward and re verse rate constants for each step; T1 is the transporter conformation in which the glucose-binding site faces
[39 2J
Biologi cal M e m b ranes a n d Tra nsport
g$ 0
u � ;::1 1':1
· �§ 'o �
v
- - - -- - - - ------- - - - - - -mm:
:;., ::t � 0
�� -
·�
"'"
>
....
"; � :.0
·s -
(a)
-
S
coo-
er Leu Val Thr Asn Phe Ile -
-
-
-
-
-
Q)
[Slout
Extracellular glucose (mM) concentration,
-
2
1
(c) F IGURE 1 1 -29 Proposed structure of GLUT1 . (a) Transmembrane he l i ces are represented here as obli que (angled) rows of three or four
(b)
[S�out (:J
FIGURE 1 1 -30 Kinetics of glucose transport into erythrocytes. (a) The i n itial rate of glucose entry i nto an erythrocyte, V0, depends on the
i n itial concentration of glucose on the outside, [Slo u t· (b) Double
amino acid residues, each row depicting one turn of the a hel i x . N i ne
rec iprocal plot of the data i n (a). The ki netics of fac i l itated diffusion is
or red), often separated by several hydrophobic residues (ye l low). Th is
these plots with Figure 6-1 1 , and with Figure 1 in Box 6-1 . Note that
of the 1 2 helices contain three or more polar or charged residues (blue representation of topology i s not intended to represent three-d i men sional structure. (b) A hel i ca l wheel d iagram shows the d istribution of
analogous to the ki netics of a n enzyme-catalyzed reaction. Compare K, i s analogous to Km, the Michael i s constant.
polar and nonpolar residues on the surface of a hel i ca l segment. The helix is diagrammed as though observed along its axis from the a m i no terminus. Adjacent residues in the l i near sequence are con nected, and each residue i s pl aced around the wheel i n the position it occupies in the hel ix; recall that 3.6 res idues are requ i red to make one complete turn of the
a helix. I n this example, the polar residues (bl ue) are on one
side of the hel ix and the hydrophobi c residues (yel low) on the other.
Th i s is, by defi n ition, an amphipathic helix. (c) Side-by-side associa
Outside
tion of four amph ipath ic heli ces, each with its polar face oriented toward the central cavity, can produce a transmembrane channel l i ned with polar (and charged) residues. Th is channel provides many oppor tunities for hydrogen bonding with glucose as it moves through.
Inside
out, and T2 the conformation in which it faces in. The steps are summarized in Figur�· 1 1-:J I . Given that every step in this sequence is reversible, the transporter is, in principle, equally able to move glucose into or out of the cell. However, glucose always moves down its concentra tion gradient, which normally means into the cell. Glucose that enters a cell is generally metabolized immediately, and the intracellular glucose concentration is thereby kept low relative to its concentration in the blood.
FIGURE 1 1 �3 1 Model of glucose transport into erythrocytes by G L UT1 . The transporter exists in two conformations: T 1 , with the
glucose-binding site exposed on the outer su rface of the plasma mem brane, and T2 , with the binding site exposed on the i n ner su rface. G l u cose transport occurs i n four steps. CD G l u cose i n blood plasma binds
to a stereospec ific s i te on T 1 ; this lowers the activation energy for ell a conformational change from gl ucoseou t · T 1 to gl ucose;n T2 , effecti ng the transmembrane passage of the glucose.
·
Q) G l ucose is re
leased from T2 i nto the cytoplasm, and @ the transporter retu rns to the T1 conformation, ready to transport another gl ucose molecule.
1 1 . 3 Solute Tra nsport across Mem branes
[}93]
TA B L E 1 1 -3
Transporter
Tissue(s) where expressed
Gene
Role*
GLUTl
Ubiquitous
SLC2Al
Basal glucose uptake
GLUT2
Liver, pancreatic islets, intestine
SLC2A2
In liver, removal of excess glucose from blood; in pancreas, regulation of insulin release
GLUT3
Brain (neuronal)
SLC2A3
Basal glucose uptake
GLUT4
Muscle, fat, heart
SLC2A4
Activity increased by insulin
GLUT5
Intestine, testis, kidney, sperm
SLC2A5
Primarily fructose transport
GLUT6
Spleen, leukocytes, brain
SLC2A6
Possibly no transporter function
GLUT7
Liver microsomes
SLC2A7
GLUTS
Testis, blastocyst, brain
SLC2A8
GLUT9
Liver, kidney
SLC2A9
GLUTIO
Liver, pancreas
SLC2A 1 0
GLUTH
Heart, skeletal muscle
SLC2A l l
GLUT1 2
Skeletal muscle, adipose, small intestine
SLC2A12
*Dash indicates role uncertain.
The rate equations for glucose transport can be derived exactly as for enzyme-catalyzed reactions (Chapter 6), yielding an expression analogous to the Michaelis-Menten equation: " _ vo -
Vma� [SJout
Kt
( 1 1-1)
fSlout
in which V0 is the initial velocity of accumulation of glucose inside the cell when its concentration in the surrounding medium is [Slout, and Kt CKtransport) is a constant analogous to the Michaelis constant, a combi nation of rate constants that is characteristic of each transport system. This equation describes the initial velocity, the rate observed when [Slin 0. As is the case for enzyme-catalyzed reactions, the slope-inter cept form of the equation describes a linear plot of l! V0 against 1/[Slout, from which we can obtain values of Kt and Vmax (Fig. 1 1-30b) . When [Slout Kt, the rate of uptake is 1/z vmax ; the transport process is half-satu rated. The concentration of glucose in blood is 4.5 to 5 mM, about three times Kt, which ensures that GLUT1 is nearly saturated with substrate and operates near =
=
Vmax ·
Because no chemical bonds are made or broken in the conversion of Sout to Sin, neither "substrate" nor "product" is intrinsically more stable, and the process of entry is therefore fully reversible. As [SLn approaches [Slout' the rates of entry and exit become equal. Such a system is therefore incapable of accumulating glucose within a cell at concentrations above that in the sur rounding medium; it simply equilibrates glucose on the two sides of the membrane much faster than would oc cur in the absence of a specific transporter. GLUTl is specific for o-glucose, with a measured Kt of 1 .5 mM. For the close analogs o-mannose and o-galactose,
which differ only in the position of one hydroxyl group, the values of Kt are 20 and 30 mM, respectively; and for 1-glucose, Kt exceeds 3,000 mM. Thus GLUT I shows the three hallmarks of passive transport: high rates of diffu sion down a concentration gradient, saturability, and specificity. Twelve glucose transporters are encoded in the human genome, each with its unique kinetic proper ties , patterns of tissue distribution, and function (Table 1 1-3) . In liver, GLUT2 transports glucose out of hepatocytes when liver glycogen is broken down to replenish blood glucose. GLUT2 has a Kt of about 66 mM and can therefore respond to increased levels of in tracellular glucose (produced by glycogen breakdown) by increasing outward transport. Skeletal and heart muscle and adipose tissue have yet another glucose transporter, GLUT4 CKt 5 mM) , which is distin guished by its response to insulin: its activity increases when insulin signals a high blood glucose concentra tion, thus increasing the rate of glucose uptake into muscle and adipose tissue (Box 1 1-2 describes some malfunctions of this transporter) . =
The Chloride-Bicarbonate Exchanger Catalyzes Electro neutral Cotransport of Anions across the Plasma Membrane The erythrocyte contains another facilitated diffusion sys tem, an anion exchanger that is essential in C02 transport to the lungs from tissues such as skeletal muscle and liver. Waste C02 released from respiring tissues into the blood plasma enters the erythrocyte, where it is converted to bi carbonate (HC03) by the enzyme carbonic anhydrase. (Recall that HC03 is the primary buffer of blood pH; see Fig. 2-20.) The HC03 reenters the blood plasma for
394
B i o l o g i ca l M e m b ranes a n d Transport
D efective G l u cose a n d Water Tra n s p o rt i n Two F o r m s o f D i a b etes
BOX 1 1 -2
transporters) results in low rates of glucose uptake into muscle and adipose tissue. One consequence is a pro longed period of high blood glucose after a carbohydrate rich meal. This condition is the basis for the glucose tolerance test used to diagnose diabetes (Chapter 23) . The water permeability of epithelial cells lining the renal collecting duct in the kidney is due to the presence of an aquaporin (AQP-2) in their apical plasma mem branes (facing the lumen of the duct) . Vasopressin (an tidiuretic hormone, ADH) regulates the retention of water by mobilizing AQP-2 molecules stored in vesicle membranes within the epithelial cells, much as insulin mobilizes GLUT4 in muscle and adipose tissue. When the vesicles fuse with the epithelial cell plasma mem brane, water permeability greatly increases and more water is reabsorbed from the collecting duct and re turned to the blood. When the vasopressin level drops, AQP-2 is resequestered within vesicles, reducing water retention. In the relatively rare human disease diabetes insipidus, a genetic defect in AQP-2 leads to impaired water reabsorption by the kidney. The result is excre tion of copious volumes of very dilute urine.
When ingestion of a carbohydrate-rich meal causes blood glucose to exceed the usual concentration be tween meals (about 5 mM) , excess glucose is taken up by the myocytes of cardiac and skeletal muscle (which store it as glycogen) and by adipocytes (which convert it to triacylglycerols) . Glucose uptake into myocytes and adipocytes is mediated by the glucose transporter GLUT4. Between meals, some GLUT4 is present in the plasma membrane , but most is sequestered in the membranes of small intracellular vesicles (Fig. 1 ) . In sulin released from the pancreas in response to high blood glucose triggers the movement of these intracel lular vesicles to the plasma membrane , where they fuse, thus exposing GLUT4 molecules on the outer sur face of the cell (see Fig. 1 2-1 6) . With more GLUT4 mol ecules in action, the rate of glucose uptake increases 1 5-fold or more. When blood glucose levels return to normal, insulin release slows and most GLUT4 mole cules are removed from the plasma membrane and stored in vesicles. In type 1 Guvenile-onset) diabetes mellitus, the in ability to release insulin (and thus to mobilize glucose
®
When in ulin interac with it receptor, ve icles move to urface and fuse with the pla ma membrane, increasing th numb r of glucos transporters in the plasma membrane. •
I
Insulin· receptor membrane
en
Kidney
Intracellular vesicles
AQP-7
Water (high) , glycerol (high) , urea (high) , arsenite
Adipose tissue, kidney, testis
Plasma membrane
AQP-8 t
Water (high)
Testis, kidney, liver, pancreas, small intestine, colon
Plasma membrane, intracellular vesicles
AQP-9
Water (low) , glycerol (high) , urea (high) , arsenite
Liver, leukocyte, brain, testis
Plasma membrane
AQP-10
Water (low) , glycerol (high) , urea (high)
Small intestine
Intracellular vesicles
Source: Data from King, L.S., Kozono, D., & Agre, P. (2004) From structure to disease: the evolving tale of aquaporin biology. Nat. Rev. 5, 688. •Aquaporins that are present primarily in the apical or in the basolateral membrane are noted as localized in one of these membranes; those present in both membranes a re described as localized in the plasma membrane.
tAQP-8 might also be permeated by urea.
cells) , transports glycerol efficiently. Mice with defec tive AQP-7 develop obesity and adult-onset diabetes, presumably as a result of their inability to move glycerol into or out of adipocytes as triacylglycerols are con verted to free fatty acids and glycerol, and vice versa. I on-Selective Channels Allow Rapid Movement of Ions across Membra nes
Ion-selective channels-first recognized in neurons and now known to be present in the plasma membranes of all cells, as well as in the intracellular membranes of eukaryotes-provide another mechanism for moving in organic ions across membranes. Ion channels, together with ion pumps such as the Na + K+ ATPase, determine a plasma membrane's permeability to specific ions and reg ulate the cytosolic concentration of ions and the mem brane potential. In neurons, very rapid changes in the activity of ion channels cause the changes in membrane potential (action potentials) that carry signals from one end of a neuron to the other. In myocytes, rapid opening of Ca2 + channels in the sarcoplasmic reticulum releases the Ca2+ that triggers muscle contraction. We discuss the signaling functions of ion channels in Chapter 12. Here we describe the structural basis for ion-channel
function, using as examples a voltage-gated K+ channel, the neuronal Na + channel, and the acetylcholine recep tor ion channel. Ion channels are distinct from ion transporters in at least three ways . First, the rate of flux through chan nels can be several orders of magnitude greater than the turnover number for a transporter-1 0 7 to 1 0 8 ions/s for an ion channel, approaching the theoretical maximum for unrestricted diffusion. By contrast , the turnover rate of the Na+ K + ATPase is about 1 00 s- 1 ! Second, ion channels are not saturable: rates do not approach a maximum at high substrate concentration. Third, they are gated in response to some cellular event. In ligand-gated channels (which are generally oligomeric) , binding of an extracellular or intracellular small molecule forces an allosteric transition in the protein, which opens or closes the channel. In volt age-gated ion channels, a change in transmembrane electrical potential (Vm) causes a charged protein do main to move relative to the membrane, opening or closing the channel. Both types of gating can be very fast. A channel typically opens in a fraction of a mil lisecond and may remain open for only milliseconds, making these molecular devices effective for very fast signal transmission in the nervous system.
1 1 . 3 Solute Tra nsport across Membranes
I on-Channel Function Is Measured Electrical ly Because a single ion channel typically remains open for only a few milliseconds, monitoring this process is be yond the limit of most biochemical measurements. Ion fluxes must therefore be measured electrically, either as changes in Vm (in the millivolt range) or as electric cur rents I (in the microampere or picoampere range) , using microelectrodes and appropriate amplifiers. In patch clamping, a technique developed by Erwin Neher and Bert Sakrnann in 1 976, very small currents are meas ured through a tiny region of the membrane surface containing only one or a few ion-channel molecules (Fig. 1 1-4 7) . The researcher can measure the size and duration of the current that flows during one opening of an ion channel and can determine how often a channel
[" J L_407
-
opens and how that frequency is affected by membrane potential, regulatory ligands, toxins, and other agents 4 Patch-clamp studies have revealed that as many as 1 0 ions can move through a single ion channel i n 1 ms . Such an ion flux represents a huge amplification of the initial signal; for example, only two acetylcholine molecules are needed to open an acetylcholine receptor channel (as described below) .
Channel
Erwin Neher
Bert Sakmann
The Structure of a K + Channel Reveals the Basis for Its Specificity
Patch of membrane placed in aqueous solution /- " I
Electronics to hold transmembrane potential (Vml constant and measure current flowing across membrane FIGURE 1 1 -47 Electrical measurements of ion-channel function. The "activity" of an ion channel is estimated by measuring the flow of ions through it, using the patch -clamp techn iq u e. A fi nely drawn-out pi pette (mi cropi pette) is pressed against the cell su rface, and negative pressure in the pi pette forms a pressure seal between pi pette and mem brane. As the pi pette is pulled away from the cell, it pulls off a tiny patch of membrane (which may contain one or a few ion channels) . Af ter placing the pi pette and attached patch i n an aqueous solution, the researcher can measure channel activity as the electric current that flows between the contents of the pi pette and the aqueous solution In practice, a circuit is set up that "cla mps" the transmembrane potential at a given value and measu res the current that must flow to mainta i n t h i s voltage. W i t h h ighly sensitive current detectors, researchers can measure the current flowing through a single ion channel, typica l l y a few picoamperes . The trace showing the current as a function of time (in m i l l iseconds) reveals how fast the channel opens and closes, how frequently it opens, and how long it stays open. Clamping the Vm at d if ferent values permits determination of the effect of membrane poten
tial on these parameters of channel function.
The structure of a potassium channel from the bacterium Streptomyces lividans , deter mined crystallographically by Roderick MacKinnon in 1 998, provides much insight into the way ion channels work. This bacterial ion channel is related in sequence to all other known K+ channels and serves as the prototype for such channels, including the voltage-gated K+ Roderick Mac Ki nnon channel of neurons. Among the members of this protein family, the similarities in se quence are greatest in the "pore region," which conrains the ion selectivity filter that allows K + (radius 1 .33 A) to pass 10,000 times more readily than Na+ (radius 0.95 A! at a rate (about 1 08 ions/s) approaching the theoretical limit for unrestricted diffusion. The K + channel consists of four identical subunits that span the membrane and form a cone within a cone surrounding the ion channel, with the wide end of the double cone facing the extracellular space (Fig. 1 1 -48) . Each subunit has two transmembrane a he lices as well as a third, shorter helix that contributes to the pore region. The outer cone is formed by one of the transmembrane helices of each subunit. The inner cone ' formed by the other four transmembrane he lices surrounds the ion channel and cradles the ion selectivity filter. Both the ion specificity and the high flux through the channel are understandable from what we know of the channel's structure . At the inner and outer plasma '
[4 oa]
Biological Membranes and Tra nsport
(a)
(b)
Backbone carbonyl oxygens form cage that fits K+ precisely, replacing waters of hydration sphere
Alternating K+ sites (blue or green) occupied
Outside
In
ide
J
K+ with hydrating water molecules
Large water-liB d vestibule al lows hydration of K+
sphere. Further stabilization is provided by the short helices in the pore region of each subunit, with the par tial negative charges of their electric dipoles pointed at K+ in the channel. About two-thirds of the way through the membrane, this channel narrows in the region of the selectivity filter, forcing the ion to give up its hydrating water molecules. Carbonyl oxygen atoms in the back bone of the selectivity filter replace the water molecules in the hydration sphere, forming a series of perfect coor dination shells through which the K+ moves. This favor able interaction with the filter is not possible for Na + , which i s too small t o make contact with all the potential oxygen ligands. The preferential stabilization of K+ is the basis for the ion selectivity of the filter, and muta tions that change residues in this part of the protein eliminate the channel's ion selectivity. The K+ -binding sites of the filter are flexible enough to collapse to fit any Na + that enters the channel, and this conformational change closes the channel. There are four potential K+ -binding sites along the selectivity filter, each composed of an oxygen "cage" that provides ligands for the K+ ions ( Fig. 1 1-4!) ) . In the crystal structure, two K+ ions are visible within the selectivity filter, about 7.5 A apart, and two water mole cules occupy the unfilled positions. K+ ions pass through the filter in single file; their mutual electrostatic repulsion most likely just balances the interaction of each ion with the selectivity filter and keeps them mov ing. Movement of the two K+ ions is concerted: first they occupy positions 1 and 3, then they hop to positions 2 and 4 (Fig. l l-48c) . The energetic difference between
(c)
FIGURE 1 1 -48 The K + channel of Streptomyces Jividans. (PDB I D
1 BLB) (a) Viewed i n the plane of the membrane, the channel consists
of eight transmembrane hel ices (two from each of four identical sub
un its), form ing a cone with its wide end toward the extracellular space. The i n ner helices of the cone (lighter colored) l i ne the transmembrane channel, and the outer hel ices i nteract with the l i p i d b i l ayer. Short seg ments of each subunit converge in the open end of the cone to make a selectivity filter. (b) Th is view, perpendicular to the pl ane of the mem brane, shows the four subun its arranged around a central channel j ust wide enough for a s i ngle K + ion to pass. (c) D iagram of a K + channel i n cross section, showing the structural features critical to function. (See a I so Fig. 1 1 -49 .)
FIGURE 1 1 -49 K + binding sites in the selectivity pore of the K+ chan
nel. (PDB ID 1 )95) Carbonyl oxygens (red) of the peptide backbone i n
t h e selectivity filter protrude i nto t h e channel, i nteracting w i t h a n d sta b i l i z i ng a K + ion passing through. These l igands are perfectly posi tioned to i nteract with each of four K + ions, but not with the smaller ions. Th i s preferential interaction with K + is the basis for the ion selectivity. The mutual repulsion between K + ions results in occupa tion of only two of the four K + s ites at a time (both green or both blue) Na
membrane surfaces, the entryways to the channel have several negatively charged amino acid residues, which presumably increase the local concentration of cations such as K+ and Na + . The ion path through the mem brane begins (on the inner surface) as a wide, water filled channel in which the ion can retain its hydration
+
and counteracts the tendency for a lone K+ to stay bound i n one site.
The combi ned effect of K + binding to carbonyl oxygens and repu l sion
between K + ions ensu res that each ion keeps moving, changing posi tions with i n 1 0 to 1 00 ns, and that there are no large energy barri ers to ion flow through the membrane.
1 1 . 3 Sol ute Tra nsport across Mem branes
these two configurations ( 1 , 3 and 2, 4) is very small; en ergetically, the selectivity pore is not a series of hills and valleys but a fiat surface, which is ideal for rapid ion movement through the channel. The structure of the channel seems to have been optimized during evolution to give maximal flow rates and high specificity. Voltage-gated K+ channels are more complex struc tures than that illustrated in Figure 1 1-48, but they are variations on the same theme. For example, the mam malian voltage-gated K+ channels in the Shaker family have an ion channel like that of the bacterial channel shown in Figure 1 1 -48, but with additional protein do mains that sense the membrane potential, move in re sponse to a change in potential, and in moving trigger (a)
(c)
[4o9]
the opening or closing of the K + channel (Fig. 1 1-50) . The critical transmembrane helix in the voltage-sensing domain of Shaker K+ channels contains four Arg residues; the positive charges on these residues cause the helix to move relative to the membrane in response to changes in the transmembrane electrical field (the membrane potential) . Cells also have channels that specifically conduct Na + or Ca2 + , and exclude K + . In each case, the ability to discriminate among cations requires both a cavity in the binding site of just the right size (neither too large nor too small) to accommodate the ion and the precise posi tioning within the cavity of carbonyl oxygens that can replace the ion's hydration shell. This fit can be achieved Voltage sensor
View from inside face Open
Closed
(d)
FIGURE 1 1 -50 Structural basis for voltage gating i n the K+ channel.
conserved Arg residues and is believed to be the chief moving part of the
(PDB ID 2A79) This crystal structure of the Kv1 .2-132 subunit complex
voltage-sensing mechanism. (c) A schematic diagram of the voltage
from rat brain shows the basic K+ channel (corresponding to that shown
gated channel, showing the basic pore structure (center) and the extra
in Fig. 1 1 -48) with the extra machinery necessary to make the channel
structu res that make the channel voltage-sensitive; 54, the Arg-containing
sensitive to gating by membrane potential: four transmembrane helical
helix, is orange_ For clarity, the 13 subunits are not shown in this view.
extensions of each subunit and four 13 subun its. The entire complex,
Normally, the transmembrane electrical potential (inside negative) exerts
viewed (a) in the plane of the membrane and (b) perpendicular to the
a pull on positively charged Arg side chains in 54, toward the cytosol i c
membrane plane (as viewed from outside the membrane), is represented
side. When the membrane is depolarized the pull is lessened, a n d with
as in Figure 1 1 -48, with each subunit in a different color; each of the four
complete reversal of the membrane potential, 54 is drawn toward the ex
13 subu nits i s colored l i ke the subunit with which it associates. I n (b), each 56 from each of four subun its form the channel itself, and are compara
tracel lular side. (d) This movement of 54 is physically coupled to opening and closing of the K + channel, which is shown here i n its open and c losed conformations. Although K + is present in the closed channel, the
ble to the two transmembrane hel ices of each subunit in Figure 1 1 -48. 5 1
pore closes on the bottom, near the cytosol, preventing K + passage.
transmembrane helix of one subunit (red) is numbered, 51 to 56. 55 and
t o 54 are four transmembrane hel ices. The 5 4 hel ix conta ins the highly
[4 1 o]
Biological Mem branes a n d Tra nsport
with molecules smaller than proteins; for example, vali nomycin (Fig. 1 1-45) can provide the precise fit that gives high specificity for the binding of one ion rather than another. Chemists have designed small molecules with very high specificity for binding of Li+ (radius 0.60 A) , Na+ (radius 0.95 A) , K + (radius 1 .33 A) , or Rb + (radius 1 .48 A) . The biological versions, however-the channel proteins-not only bind specifically but con duct ions across membranes in a gated fashion. Gated I on Channels Are Central in Neuronal Function Virtually all rapid signaling between neurons and their target tissues (such as muscle) is mediated by the rapid opening and closing of ion channels in plasma mem branes. For example, Na + channels in neuronal plasma membranes sense the transmembrane electrical gradi ent and respond to changes by opening or closing. These voltage-gated ion channels are typically very selective for Na + over other monovalent or divalent cations (by factors of 100 or more) and have very high flux rates (> 107 ions/s) . Closed in the resting state, Na+ channels are opened-activated-by a reduction in the mem brane potential; they then undergo very rapid inactiva tion. Within milliseconds of opening, a channel closes and remains inactive for many milliseconds. Activation followed by inactivation of Na + channels is the basis for signaling by neurons (see Fig. 1 2-25) . Another very well-studied ion channel is the nico tinic acetylcholine receptor, which functions in the passage of an electrical signal from a motor neuron to a muscle fiber at the neuromuscular junction (signaling the muscle to contract) . Acetylcholine released by the motor neuron diffuses a few micrometers to the plasma membrane of a myocyte, where it binds to an acetyl choline receptor. This forces a conformational change in the receptor, causing its ion channel to open. The result ing inward movement of positively charged ions into the myocyte depolarizes its plasma membrane and triggers contraction. The acetylcholine receptor allows Na + , Ca2+, and K+ to pass through its channel with equal ease, but other cations and all anions are unable to pass. Movement of Na + through an acetylcholine receptor ion channel is unsaturable (its rate is linear with respect to extracellular [Na +]) and very fast -about 2 x 1 07 ions/s under physiological conditions.
Acetylcholine
The acetylcholine receptor channel is typical of many other ion channels that produce or respond to electrical signals: it has a "gate" that opens in response to stimula tion by a signal molecule (in this case acetylcholine) and an intrinsic timing mechanism that closes the gate after a
split second. Thus the acetylcholine signal is transient an essential feature of all electrical signal conduction. Based on similarities between the amino acid se quences of other ligand-gated ion channels and the acetylcholine receptor, neuronal receptor channels that respond to the extracellular signals y-aminobutyric acid (GABA) , glycine, and serotonin are grouped to gether in the acetylcholine receptor superfamily, and probably share three-dimensional structure and gating mechanisms. The GABAA and glycine receptors are anion channels specific for Cl- or HC03, whereas the serotonin receptor, like the acetylcholine receptor, is cation-specific . Another class of ligand-gated ion channels respond to intracellular ligands: 3 ' ,5'-cyclic guanosine mono nucleotide (cGMP) in the vertebrate eye, cGMP and cAMP in olfactory neurons, and ATP and inositol 1 ,4 ,5trisphosphate (IP3) in many cell types. These channels are composed of multiple subunits, each with six trans membrane helical domains. We discuss the signaling functions of these ion channels in Chapter 12. Table 1 1-6 shows some transporters discussed in other chapters in the context of the pathways in which they act. Defective I on Channels Can Have Severe Physiological Consequences The importance of ion channels to physiological processes is clear from the effects of mutations in specific ion-channel proteins (Table 1 1-7, Box 1 1-3) . Genetic defects in the voltage-gated Na + channel of the myocyte plasma membrane result in diseases in which muscles are periodically either paralyzed (as in hyper kalemic periodic paralysis) or stiff (as in paramyotonia congenita) . Cystic fibrosis is the result of a mutation that changes one amino acid in the protein CFTR, a Cl ion channel; the defective process here is not neuro transmission but secretion by various exocrine gland cells with activities tied to Cl- ion fluxes. Many naturally occurring toxins act on ion channels, and the potency of these toxins further illustrates the importance of normal ion-channel function. Tetro dotoxin (produced by the puffer fish, Sphaeroides rubripes) and saxitoxin (produced by the marine di noflagellate Gonyaulax, which causes "red tides") act by binding to the voltage-gated Na + channels of neurons and preventing normal action potentials. Puffer fish is an ingredient of the Japanese delicacy fugu, which may be prepared only by chefs specially trained to separate succulent morsel from deadly poison. Eating shellfish that have fed on Gonyaulax can also be fatal; shellfish are not sensitive to saxitoxin, but they concentrate it in their muscles, which become highly poisonous to organ isms higher up the food chain. The venom of the black mamba snake contains dendrotoxin, which interferes with voltage-gated K + channels. Tubocurarine, the active
1 1 .3 Solute Tra nsport across Membranes
TAB L E 1 1 -6
[41 1]
Transport Systems Desaibed Elsewhere in This Text
--------�
Transport system and location
Figure number
Role
Adenine nucleotide antiporter of mitochondrial inner membrane
1 9-28
Imports substrate ADP for oxidative phosphorylation, and exports product ATP
Acyl-carnitine/carnitine transporter of mitochondrial inner membrane
1 7-6
Imports fatty acids into matrix for f3 oxidation
Pi-H+ symporter of mitochondrial inner membrane
1 9-28
Supplies Pi for oxidative phosphorylation
Malate-a-ketoglutarate transporter of mitochondrial inner membrane
1 9-29
Shuttles reducing equivalents (as malate) from matrix to cytosol
Glutamate-aspartate transporter of mitochondrial inner membrane
1 9-29
Completes shuttling begun by malate-a-ketoglutarate shuttle
Citrate transporter of mitochondrial inner membrane
2 1-1 0
Provides cytosolic citrate as source of acetyl-GoA for lipid synthesis
Pyruvate transporter o f mitochondrial inner membrane
21-10
Is part of mechanism for shuttling citrate from matrix to cytosol
Fatty acid transporter of myocyte plasma membrane
1 7-3
Imports fatty acids for fuel
Complex I, III, and N proton transporters of mitochondrial inner membrane
19-16
Acts as energy-conserving mechanism in oxidative phosphorylation, converting electron flow into proton gradient
Thermogenin (uncoupler protein) , a proton pore of mitochondrial inner membrane
19-34, 23-35
Allows dissipation of proton gradient in mitochondria as means of thermogenesis and/or disposal of excess fuel
Cytochrome bj complex, a proton transporter of chloroplast thylakoid
1 9-59
Acts as proton pump, driven by electron flow through the Z scheme; source of proton gradient for photosynthetic ATP synthesis
Bacteriorhodopsin, a light-driven proton pump
1 9-66
Is light-driven source of proton gradient for ATP synthesis in halophilic bacterium
FoF1 ATPase/ATP synthase of mitochond1ial inner membrane, chloroplast thylakoid, and bacterial plasma membrane
1 9-64
Interconverts energy of proton gradient and ATP during oxidative phosphorylation and photophosphorylation
Pi-triose phosphate antiporter of chloroplast inner membrane
20-15, 20-16
Exports photosynthetic product from stroma; imports Pi for ATP synthesis
Bacterial protein transporter
27-44
Exports secreted proteins through plasma membrane
Protein translocase of ER
27-38
Transports into ER proteins destined for plasma membrane, secretion, or organelles
Nuclear pore protein translocase
27-42
Shuttles proteins between nucleus and cytoplasm
LDL receptor in animal cell plasma membrane
2 1-42
Imports, by receptor-mediated endocytosis, lipid carrying particles
Glucose transporter of animal cell plasma to membrane; regulated by insulin IP3-gated Ca2 + channel of endoplasmic reticulum
1 2-16
Increases capacity of muscle and adipose tissue to take up excess glucose from blood Allows signaling via changes of cytosolic Ca2 +
cGMP-gated Ca2+ channel of retinal rod and cone cells
1 2-36
Allows signaling via rhodopsin linked to cAMP phosphodiesterase in vertebrate eye
Voltage-gated Na+ channel of neuron
1 2-25
Creates action potentials in neuronal signal transmission
12-10
concentration
component of curare (used as an arrow poison in the Amazon region) , and two other toxins from snake ven oms, cobrotoxin and bungarotoxin, block the acetyl choline receptor or prevent the opening of its ion
channel. By blocking signals from nerves to muscles, all these toxins cause paralysis and possibly death. On the positive side, the extremely high affinity of bungaro toxin for the acetylcholine receptor CKct 1 0 - 15 M) has =
[4 12]
Biological Mem branes a n d Tra nsport
TAB L E 1 1 -7
Some Diseases Resulting from lon Channel Defects
Ion channel
Affected gene
Disease
Na + (voltage-gated, skeletal muscle)
SCN4A
Hyperkalemic periodic paralysis (or paramyotonia congenita)
Na + (voltage-gated, neuronal)
SCNJA
Generalized epilepsy with febrile seizures
Na + (voltage-gated, cardiac muscle) 2 Ca + (neuronal) 2 Ca + (voltage-gated, retina) Ca2 + (polycystin-1)
SCN5A
Long QT syndrome 3
CACNAJA
Familial hemiplegic migraine
CACNAJF
Congenital stationary night blindness
PKDJ
Polycystic kidney disease
K+ (neuronal)
KCNQ4
Dominant deafness
K+ (voltage-gated, neuronal)
KCNQ2
Benign familial neonatal convulsions
Nonspecific cation (cGMP-gated, retinal)
CNCGJ
Retinitis pigmentosa
Acetylcholine receptor (skeletal muscle)
CHRNAJ
Congenital myasthenic syndrome
Cl-
CFTR
Cystic fibrosis
proved useful experimentally: the radiolabeled toxin was used to quantify the receptor during its purification. •
Tetrodotoxin
H
concentration to the side with lower. Others transport solutes against an electrochemical gradient; this requires a source of metabolic energy. •
Carriers, like enzymes, show saturation and stereospecificity for their substrates. Transport via these systems may be passive or active. Primary active transport is driven by ATP or electron-transfer reactions; secondary active transport is driven by coupled flow of two solutes, one of which (often H + or Na + ) flows down its electrochemical gradient as the other is pulled up its gradient.
•
The GLUT transporters, such as GLUT! of erythrocytes, carry glucose into cells by facilitated diffusion. These transporters are uniporters, carrying only one substrate. Symporters permit simultaneous passage of two substances in the same direction; examples are the lactose transporter of E. coli, driven by the energy of a proton gradient Oactose-H+ symport) , and the glucose transporter of intestinal epithelial cells, driven by a Na + gradient (glucose-Na + symport) . Antiporters mediate simultaneous passage of two substances in opposite directions; examples are the chloride-bicarbonate exchanger of erythrocytes and the ubiquitous Na + K+ ATPase.
•
In animal cells, Na + K + ATPase maintains the differences in cytosolic and extracellular concentrations of Na + and K + , and the resulting Na + gradient is used as the energy source for a variety of secondary active transport processes.
•
The Na + K+ ATPase of the plasma membrane and the Ca2 + transporters of the sarcoplasmic and endoplasmic reticulum (the SERCA pumps) are examples of P-type ATPases; they undergo reversible phosphorylation during their catalytic cycle. F-type ATPase proton pumps (ATP synthases) are central to energy-conserving
r NHz
N
H OH N
HaC CHa r\:OCH "-+/ CH2\J" _ O� c � 3 -H H 0'0 H2/ HaCO OH - H CH3 Saxitoxin
D-Tubocurarine
S U M M A RY 1 1 . 3 •
�
chloride
S o l u t e Tra n s p o rt a cross M e mbra n e s
Movement of polar compounds and ions across biological membranes requires transporter proteins. Some transporters simply facilitate passive diffusion across the membrane from the side with higher
Further Reading
mechanisms in mitochondria and chloroplasts. V-type ATPases produce gradients of protons across some intracellular membranes, including plant vacuolar membranes.
Further Reading Composition and Architecture of Membranes
•
ABC transporters carry a variety of substrates (including many drugs) out of cells , using ATP as energy source.
•
Ionophores are lipid-soluble molecules that bind specific ions and carry them passively across membranes, dissipating the energy of electrochemical ion gradients.
•
•
[41 3]
Boon, J.M. & Smith, B.D. (2002) Chemical control of phospholipid distribution across bilayer membranes . Med Res Rev. 22, 251-281. Intermediate-level review of phospholipid asymmetry and factors that influence it. Dowhan, W. ( 1997) Molecular basis for membrane phospholipids di versity: why are there so many lipids? Annu. Rev. Biochem. 66, 199-232. Ediden, M. (2002) Lipids on the frontier: a century of cell-membrane bilayers. Nat. Rev. Mol. Cell Biol. 4, 4 1 4-4 1 8.
Water moves across membranes through aquaporins. Some aquaporins are regulated; some also transport glycerol or urea. Ion channels provide hydrophilic pores through which select ions can diffuse, moving down their electrical or chemical concentration gradients; they characteristically are unsaturable, have very high flux rates, and are highly specific for one ion. Most are voltage- or ligand-gated. The neuronal Na + channel is voltage-gated, and the acetylcholine receptor ion channel is gated by acetylcholine, which triggers conformational changes that open and close the transmembrane path.
Short review of how the notion of a lipid bilayer membrane was developed and confirmed. Haltia, T. & Freire, E. ( 1 995) Forces and factors that contribute to the structural stability of membrane proteins. Biochim. Biophys Acta 1241, 295-322. Good discussion of the secondary and tertiary structures of membrane proteins and the factors that stabilize them . Von Heijne, G. (2006) Membrane protein topology. Nat. Rev. Mol Cell Biol. 7, 909-918.
White, S.H., Ladokhin, A.S., Jayasinghe, S., & Hristova, K.
(2001) How membranes shape protein structure. J Biol. Chem 276, 32,395-32,398. Brief, intermediate-level review of the forces that shape trans membrane helices. Wimley, W.C. (2003) The versatile f3 barrel membrane protein. Curr: Opin. Struct Biol 13, 1-8.
Intermediate-level review.
Membrane Dynamics
Key Terms
Arnaout, M.A., Mahalingam, B., & Xiong, J.-P. (2005) Integrin
Terms in bold are defined in the glossary.
Biol.
fluid mosaic model 373 micelle 374 bilayer 374 integral proteins
375
peripheral proteins 375 amphitropic proteins 375 hydropathy index 378 {3 barrel 379 gel phase 381 liquid-disordered state 381 liquid-ordered state 381 flippases 382 floppases 383 scramblases 383 FRAP 383 microdomains 384 rafts 384 caveolin 386 caveolae 386 fusion proteins 387 SNAREs 388 simple diffusion 390 membrane potential ( Vm) 390
structure, allostery, and bidirectional signaling. Annu. Rev. Cell Dev. 21, 381-410.
Brown, D.A. & London, E. ( 1 998) Functions of lipid rafts in biolog ical membranes. Annu. Rev. Cell Dev. Biol . 14, 1 1 1-136.
electrochemical gradient 390 electrochemical potential 390 facilitated diffusion 390
Daleke, D.L. (2007) Phospholipid flippases. J Biol. Chem. 282,
821-825. Intermediate-level review.
passive transport
Deveaux, P.F., Lopez-Montero, I., & Bryde, S. (2006) Proteins involved in lipid translocation in eukaryotic cells. Chem. Phys. Lipids 141, 1 1 9-132.
transporters
Didier, M., Lenne, P.-F., Rigneault, H., & He, H.-T (2006)
390 391
carriers 391 channels 391 electroneutral 395 cotransport systems antiport 395
395
symport 395 uniport 395 active transport 395 electrogenic 396 P-type ATPases 396 SERCA pump 397 F-type ATPases 399 ATP synthase 399
V-type ATPases
399 ABC transporters 400 ionophores 404 aquaporins (AQPs) 404 ion channel 406
Dynamics in the plasma membrane: how to combine fluidity and order. EMBO J 25, 3446-3457. Intermediate-level review of studies of membrane dynamics, with fluorescent and other probes. Edidin, M. (2003) The state of lipid rafts: from model membranes to cells. Annu. Rev. Biophys Biomol. Struct. 32, 257-283 .
Advanced review. Frye, L.D. & Ediden, M. (1 970) The rapid intermixing of cell surface antigens after formation of mouse-human heterokaryons .
J Cell Sci. 7, 3 1 9-335. The classic demonstration of membrane protein mobility. Graham, T.R. (2004) Flippases and vesicle-mediated protein trans
port. Trends Cell Biol. 14, 670-677. Intermediate review of flippase function. Jahn, R. & Scheller, R.H. (2006) SNAREs-engines for membrane fusion. Nat. Rev. Cell Mol. Biol. 7, 63 1-643 . Excellent intermediate-level review of the role of SNAREs in membrane fusion, and the fusion mechanism itself. Janmey, P.A. & Kunnunen, P.K.J. (2006) Biophysical properties of lipids and dynamic membranes. Trends Cell Biol. 16, 538-546
[4 14]
Biological Mem bra n es and Tra nsport
Linder, M.E. & Deschenes, R.J. (2007) Palmitoylation: policing
Stokes, D.L. & Green, N.M. (2003) Structure and function of the
protein stability and traffic. Nat. Rev Mol. Cell Biol. 8,
calcium pump. Annu Rev. Biophys Biomol Struct. 32,
74-84.
Marguet, D., Lenne, P.-F., Rigneault, H., & He, H.-T. (2006) Dy
445-468
Advanced review
namics in the plasma membrane: how to combine fluidity and order.
Sui, H., Han, B.-G., Lee, J.K., Walian, P., & Jap, B.K. (2001)
EMBO J. 2 5 , 3446-3457
Structural basis of water-specific transport through the AQP1 water
Intermediate-level review of the methods and results of studies
channel. Natur-e 414,
872-878.
High-resolution solution of the aquaporin structure by x-ray
on molecular motions in the membrane .
Mayer, A. (2002) Membrane fusion in eukaryotic cells. Annu Rev
crystallography.
Toyoshima, C. & Mizutani, T. (2004) Crystal structure of the
Cell Dev Biol. 18, 289-3 14. Advanced review of membrane fusion, with emphasis on the conserved general features
calcium pump with a bound ATP analogue. Nature 43 0 ,
529-535.
Toyoshima, C., Nomura, H., & Tsuda, T. (2004) Lumenal gating
Palsdottir, H. & Hunte, C. (2004) Lipids in membrane protein
mechanism revealed in calcium pump crystal structures with
structures. Biochim Biophys Acta 1666,
phosphate analogs Natur-e 432,
2-18
Parton, R.G. (2003) Caveolae-from ultrastructure to molecular mechanisms Nat Rev Mol. Cell Biol 4,
162-167.
A concise historical review of caveolae, caveolin, and rafts.
Parton, R.G. & Simons, K. (2007) The multiple faces of caveolae Nat Rev Mol Cell Biol. 8, 185-194
Phillips, S.E., Vmcent, P., Rizzieri, K.E., Schaaf, G., & Bankaitis, V.A. (2006) The diverse biological functions of phos phatidylinositol transfer proteins in eukaryotes Grit Rev Biochem
Mol. Biol 4 1 , 2 1-49 Advanced review of the role of these proteins in lipid signaling
361-368.
The supplementary materials available with the online version of this article include an excellent movie of the putative gating mechanism.
Watson, R.T. & Pessin, J.E. (2006) Bridging the GAP between insulin signaling and GLUT4 translocation. Trends Biochem. Sci.
3 1 , 215-222 . Intermediate-level review of the regulation of glucose transpmt through GLUT4.
Ion Channels
and membrane trafficking
Ashcroft, F.M. (2006). From molecule to malady. Nature 440,
Pomorski, T. , Holthuis, J.C.M., Herrmann, A., & van Meer, G.
440-447.
(2004) Tracking down lipid flippases and their biological functions. J Cell Sci. 117, 805-8 13
in ion channels lead to disease in humans.
Sprong, H., van der Sluijs, P. , & van Meer, G. (2001) How pro
Doyle, D.A., Cabral, K.M., Pfuetzner, R.A., Kuo, A., Gulbis,
teins move lipids and lipids move proteins. Nat. Rev Mol Cell Biol.
2, 504-5 13 . Intermediate-level review.
Throm, L.K. ( ed. ). (2005) Pr-otein-Lipid Inter-actions. From Membmne
Domains to Cellular- Networ-ks, W!ley-VCH, Weinheim, Germany.
van Deurs, B., Roepstortf, K., Hommelgaard, A.M., & Sandvig, K. (2003) Caveolae: anchored, multifunctional platforms in the lipid ocean. Trends Cell Biol
13, 92-100.
J.M., Cohen, S.L., Chait, B.T., & MacKinnon, R. (1 998) The
structure of the potassium channel: molecular basis of K + conduction and selectivity. Science 280,
69-77.
The first crystal structure of an ion channel is described.
Edelstein, S.J. & Changeux, J.P. (1 998) Allosteric transitions of the acetylcholine receptor. A dv. Prot Chem 5 1 , 1 2 1-1 84 . Advanced discussion of the conformational changes induced by acetylcholine.
Gadsby, D.C., Vergani, P., & Csanady, L. (2006) The ABC protein
Yeagle, P.L. (ed.). (2004) The Structure of Biological
turned chloride channel whose failure causes cystic fibrosis. Nature
Membranes, 2nd edn, CRC Press, Inc ., Boca Raton, FL.
Zimmerberg, J. & Kozlov, M.M. (2006) How proteins produce cellular membrane curvature. Nat Rev. Mol Cell Biol 7,
A short review of the many known cases in which genetic defects
9-19
440, 477-483 This is one of seven excellent reviews of ion channels published together in this issue of Natur-e
Gouaux, E. & MacKinnon, R. (2005) Principles of selective ion
Transporters
transport in channels and pumps. Science
Abramson, J., Smirnova, I., Kasho, V., Verner, G., Kaback, H.R., & Iwata, S. (2003) Structure and mechanism of the lactose permease of Escherichia coli. Science
30 1 , 6 1 0-615.
3 10, 1461-1465.
Short review of the architectural features of channels and pumps that give each protein its ion specificity.
Guggino, W.B. & Stanton, B.A. (2006) New insights into cystic
Fujiyoshi, Y., Mitsuoka, K., de Groot, B.L., Philippsen, A.,
fibrosis: molecular switches that regulate CFTR. Natur-e Rev Malec
Grubmiiller, H., Agre, P., & Engel, A. (2002) Structure and
Cell Bioi 7, 426-436
function of water channels. Curr: Opin Struct Bioi 12,
509-5 1 5. Jorgensen, P.L., Hakansson, K.O., & Karlish, S.J.D. (2003) Structure and mechanism of Na,K-ATPase: functional sites and their interactions. Annu. Rev. Physiol . 65 ,
Hille, B. (2001) Jon Channels of Excitable Membranes, 3rd edn, Sinauer Associates, Sunderland, MA.
8 1 7-849.
Intermediate-level text emphasizing the function of ion channels.
Jiang, Y., Lee, A., Chen, J., Ruta, V., Cadene, M., Chait, B.T., & MacKinnon, R. (2003) X-ray structure of a voltage-dependent K +
Kjellbom, P., Larsson, C., Johansson, I., Karlsson, M., &
channel. Nature 42 3 ,
Johanson, U. ( 1 999) Aquaporins and water homeostasis in plants .
King, L.S., Kozono, D., & Agre, P. (2004) From structure to dis
Trends Plant Sci 4, 308-3 14.
33-4 1 .
ease: the evolving tale of aquaporin biology. Nat Rev Mol Cell Bioi.
Intermediate-level review.
5, 687-698
Kiihlbrandt, W. (2004) Biology, structure and mechanism of P-type 5, 282-295.
ATPases. Nat Rev Mol. Cell Bioi.
Intermediate-level review, very well illustrated
Intermediate-level review of the localization of aquaporins in mammalian tissues and the effects of aquaporin defects on physiology.
Lee, A.G. & East, J.M. (2001) What the structure of a calcium
J. 3 5 6 , 665-683.
Mueckler, M. (1 994) Facilitative glucose transporters. Eur: J.
pump tells us about its mechanism. Biochem
Schmitt, L. & Tampe, R. (2002) Structure and mechanism of ABC
structure of a mammalian voltage-dependent Shaker family K +
transporters. Curr: Opin. Struct Bioi. 12,
channel. Science 3 09,
Biochem. 21 9, 713-725.
Long, S.B., Campbell, E.B., & MacKinnon, R. (2005) Crystal
754-760.
897-902
Problems
Long, S.B., Campbell, E.B., & MacKinnon, R. (2005) Voltage
sensor of Kv 1 .2 : structural basis of electromechanical coupling. Science 309, 903-908.
These two articles by Long and coauthors describe the structural studies that led to models for voltage sensing and gating in the K+ channel. Miyazawa, A., Fujiyoshi, Y. , & Unwin, N. (2003) Structure and gating mechanism of the acetylcholine receptor pore. Nature 423, 949-955.
Intermediate-level review. Neher, E. & Sakmann, B. ( 1 992) The patch clamp technique. Sci_ Am (March) 266, 44-51.
2. Evidence for a Lipid Bilayer In 1 925, E . Gorter and F. Grendel used an apparatus like that described in Problem 1 to determine the surface area of a lipid monolayer formed by lipids extracted from erythrocytes of several animal species. They used a microscope to measure the dimensions of individ ual cells, from which they calculated the average surface area of one erythrocyte. They obtained the data shown in the table. Were these investigators justified in concluding that "chromo cytes [erythrocytes] are covered by a layer of fatty substances that is two molecules thick" (i.e., a lipid bilayer)?
Clear description of the electro physiological methods used to measure the activity of single ion channels, by the Nobel Prize winning developers of this technique. Sheppard, D.N. & Welsh, M.J. ( 1 999) Structure and function of
the CFTR chloride channel . Physiol Rev. 79, S23-S46. One of 1 1 reviews in this journal issue on the CFTR chloride channel; the reviews cover structure, activity, regulation, biosynthe sis, and pathophysiology. Shi, N., Ye, S., Alam, A., Chen, L., & Jiang, Y. (2006) Atomic struc ture of a Na+ - and K + -conducting channel Nature 440, 427-429
Crystallographic study of an ion channel that admits both Na + and K + , and the structural explanation for this dual specificity. Tombola, F., Pathak, M.M., & Isacoff, E.Y. (2006) How does voltage open an ion channel? Annu Rev. Cell Dev. Biol 22, 23-52. Advanced review of the mechanisms of voltage gating of ion channels Yellen, G. (2002) The voltage-gated potassium channels and their
relatives . Nature 419. 35-42
P ro b l e m s 1 . Determining the Cross-Sectional Area of a Lipid
Molecule When phospholipids are layered gently onto the surface of water, they orient at the air-water interface with their head groups in the water and their hydrophobic tails in the air. An experimental apparatus ( a) has been devised that reduces the surface area available to a layer of lipids. By meas uring the force necessary to push the lipids together, it is pos sible to determine when the molecules are packed tightly in a continuous monolayer; as that area is approached, the force needed to further reduce the surface area increases sharply (b). How would you use this apparatus to determine the aver age area occupied by a single lipid molecule in the monolayer? Force applied here to compress f"l monolayer
. . . - --- 'l!l
·- - --- �
40
(a)
8 �
�
30 20
(b)
Total surface
Animal
Volume of
Number
area of lipid
Total surface
packed
of cells
monolayer
area of one 2 cell (p,m )
cells
(mL)
(per mm3)
2 from cells (m )
Dog
40
8,000,000
Sheep
10
9,900,000
6.0
29.8
4,740,000
0.92
99.4
Human
62
98
Source: Data from Gorter, E & Grende l , F. (1925) On bimolecular layers Exp Med 41, 439-443.
of lipoids on the chromocytes of the blood. J.
3. Number of Detergent Molecules per Micelle When a small amount of the detergent sodium dodecyl sulfate (SDS; Na+CH3 (CH2) 1 1 0803) is dissolved in water, the deter gent ions enter the solution as monomeric species. As more detergent is added, a concentration is reached (the critical mi celle concentration) at which the monomers associate to form micelles The critical micelle concentration of SDS is 8.2 mM. The micelles have an average particle weight (the sum of the molecular weights of the constituent monomers) of 1 8,000. Calculate the number of detergent molecules in the average micelle. 4. Properties of Lipids and Lipid Bilayers Lipid bilayers formed between two aqueous phases have this important property: they form two-dimensional sheets, the edges of which close upon each other and undergo self-sealing to form
vesicles (liposomes) . (a) What properties of lipids are responsible for this prop erty of bilayers? Explain. (b) What are the consequences of this property for the structure of biological membranes? 5. Length of a Fatty Acid Molecule The carbon-carbon bond distance for single-bonded carbons such as those in a saturated fatty acyl chain is about 1 .5 A. Estimate the length of a single molecule of palmitate in its fully extended form. If two molecules of palmitate were placed end to end, how would their total length compare with the thickness of the lipid bi layer in a biological membrane? 6. Temperature Dependence of Lateral Diffusion The experiment described in Figure 1 1-1 7 was performed at 37 °C. If the experiment were carried out at 10 oc, what effect would
� 10 Q) u
[4 1 5]
you expect on the rate of diffusion? Why?
0.2
0.6
1.0
Area (nm2/molecule)
7. Synthesis of Gastric Juice: Energetics Gastric juice 1.4
(pH 1 .5) is produced by pumping HCl from blood plasma (pH 7.4) into the stomach. Calculate the amount of free energy
[416]
Biological M embranes and Tra n sport
required to concentrate the H
+
° in 1 L of gastric juice at 37 C .
sphingomyelin. Although the phospholipid components of the
Under cellular conditions, h o w many moles of ATP must be hy
membrane can diffuse in the ftuid bilayer, this sidedness is pre
drolyzed to provide this amount of free energy? The free
served at all times. How?
energy change for ATP hydrolysis under cellular conditions i s about - 58 kJ/mol (as explained in Chapter 13) . Ignore the effects of the transmembrane electrical potential.
15. Membrane Permeability At pH 7, tryptophan crosses a lipid bilayer at about one-thousandth the rate of indole, a closely related compound:
8. Energetics of the Na+K + ATPase For a typical verte
� v-- N/
brate cell with a membrane potential of - 0 . 070 V (inside neg ative) , what is the free-energy change for transporting 1 mol of
Na + from the cell into the blood at 37 oc? Assume the concen + tration of Na inside the cell is 1 2 mM and that in blood plasma
H
Suggest an explanation for this observation.
is 145 mM.
9. Action of Ouabain on Kidney Tissue Ouabain specifi
+ + cally inhibits the Na K ATPase activity of animal tissues but
is not known to inhibit any other enzyme. When ouabain is added to thin slices of living kidney tissue, it inhibits oxygen consumption by
66% . Why? What does this observation tell us
about the use of respiratory energy by kidney tissue?
10. Energetics of Symport Suppose you determined ex perimentally that a cellular transport system for glucose,
driven by symport of Na +, could accumulate glucose to con
centrations 25 times greater than in the external medium, + while the external [Na ] was only 10 times greater than the in + tracellular [Na ] . Would this violate the laws of thermodynam ics? If not, how could you explain this observation?
16. Water Flow through an Aquaporin A human erythro 5 cyte has about 2 X 1 0 AQP-1 monomers . If water molecules 8 ftow through the plasma membrane at a rate of 5 X 1 0 per
AQP - 1 tetramer per second, and the volume of an erythrocyte 11 is 5 x 10mL, how rapidly could an erythrocyte halve its volume as it encountered the high osmolarity (1
M) in the in
terstitial ftuid of the renal medulla? Assume that the erythro cyte consists entirely of water.
17. Labeling the Lactose Transporter A bacterial lactose transporter, which is highly specific for lactose, contains a Cys residue that is essential to its transport activity. Covalent reac tion of N-ethylmaleimide (NEM) with this Cys residue irre versibly inactivates the transporter. A high concentration of lactose in the medium prevents inactivation by NEM, presum
1 1 . Location of a Membrane Protein The following observa
ably by sterically protecting the Cys residue, which is in or near
tions are made on an w1knovvn membrane protein, X. It can be
the lactose-binding site . You know nothing else about the trans
extracted from disrupted erythrocyte membranes into a concen
porter protein. Suggest an experiment that might allow you to
trated salt solution, and it can be cleaved into fragments by
determine the Mr of the Cys-containing transporter polypeptide.
proteolytic enzymes. Treatment of erythrocytes with proteolytic
18. Predicting Membrane Protein Topology from Se quence You have cloned the gene for a human erythrocyte
enzymes followed by disruption and extraction of membrane components yields intact X. However, treatment of erythrocyte "ghosts" (which consist of just plasma membranes, produced by disrupting the cells and washing out the hemoglobin) with prote olytic enzymes followed by disruption and extraction yields ex tensively fragmented X. What do these observations indicate about the location of X in the plasma membrane? Do the proper ties of X resemble those of an integral or peripheral membrane
protein?
12. Membrane Self-sealing Cellular membranes are self sealing-if they are punctured or disrupted mechanically, they quickly and automatically reseal. What properties of mem branes are responsible for this important feature?
protein, which you suspect is a membrane protein. From the nucleotide sequence of the gene, you know the amino acid se quence. From this sequence alone, how would you evaluate the possibility that the protein is an integral protein? Suppose the protein proves to be an integral protein, either type I or type
II.
Suggest biochemical or chemical experiments that
might allow you to determine which type it is.
19. Intestinal Uptake of Leucine You are studying the up take of L-leucine by epithelial cells of the mouse intestine. Measurements of the rate of uptake of L-leucine and several of its analogs, with and without Na + in the assay buffer, yield the results given in the table. What can you conclude about the
13. Lipid Melting Temperatures Membrane lipids in tissue
properties and mechanism of the leucine transporter? Would
samples obtained from different parts of the leg of a reindeer
you expect L-leucine uptake to be inhibited by ouabain?
have different fatty acid compositions. Membrane lipids from
Uptake in
presence of Na +·
tissue near the hooves contain a larger proportion of unsatu rated fatty acids than those from tissue in the upper leg. What
Uptake in
absence of Na +
is the significance of this observation?
Substrate
Vmax
Kt (mM)
Vmax
14. Flip-Flop Diffusion The inner leaflet (monolayer) of
L-Leucine
420
0.24
23
0.2
the human erythrocyte membrane consists predominantly of
o-Leucine
310
4.7
5
4.7
phosphatidylethanolamine and phosphatidylserine . The outer
L-Valine
225
0.31
leaflet consists predominantly of phosphatidylcholine and
19
Kt (mM)
0.31
Problems
20. Effect of an Ionophore on Active Transport Consider the leucine transporter described in Problem 19. Would Vmax and/or Kt change if you added a Na + ionophore to the assay so lution containing Na + ? Explain. 2 1 . Surface Density of a Membrane Protein E. coli can be induced to make about 1 0,000 copies of the lactose trans porter CMr 3 1 ,000) per cell. Assume that E. coli is a cylinder 1 �tm in diameter and 2 �tm long. 'What fraction of the plasma membrane surface is occupied by the lactose transporter mol ecules? Explain how you arrived at this conclusion. 22. Use of the Helical Wheel Diagram A helical wheel is a two-dimensional representation of a helix, a view along its cen tral axis (see Fig. 1 1-29b; see also Fig. 4-4d) . Use the helical wheel diagram below to determine the distribution of amino acid residues in a helical segment with the sequence -Val Asp-Arg-Val-Phe-Ser-Asn-Val-Cys-Thr-His-Leu-Lys-Thr Leu-Gln-Asp-Lys-
[417]
(c) Go to the Protein Data Bank (www.rcsb.org) . Use the PDB identifier 1 DE P to retrieve the data page for a por tion of the ,8-adrenergic receptor (one type of epinephrine receptor) isolated from a turkey. Using Jmol to explore the structure, predict whether this portion of the receptor is lo cated within the membrane or at the membrane surface. Explain. (d) Retrieve the data for a portion of another receptor, the acetylcholine receptor of neurons and myocytes, using the PDB identifier 1Al l . As in (c) , predict where this portion of the receptor is located and explain your answer. If you have not used the PDB, see Box 4-4 (p. 129) for more information.
Data Analysis Problem 25. The Fluid Mosaic Model of Biological Membrane Structure Figure 1 1-3 shows the currently accepted fluid
mosaic model of biological membrane structure. This model was presented in detail in a review article by S. J . Singer i n 1 9 7 1 . I n the article, Singer presented the three models of membrane structure that had been proposed by that time:
What can you say about the surface properties of this helix? How would you expect the helix to be oriented in the tertiary structure of an integral membrane protein? 23. Molecular Species in the E. coli Membrane The plasma membrane of E. coli is about 75% protein and 25% phospholipid by weight. How many molecules of membrane lipid are present for each molecule of membrane protein? As sume an average protein Mr of 50,000 and an average phos pholipid Mr of 750. What more would you need to know to estimate the fraction of the membrane surface that is covered by lipids?
Biochemistry on the I nternet 24. Membrane Protein Topology The receptor for the hormone epinephrine in animal cells is an integral membrane protein CMr 64,000) that is believed to have seven membrane spanning regions. (a) Show that a protein of this size is capable of spanning the membrane seven times. (b) Given the amino acid sequence of this protein, how would you predict which regions of the protein form the membrane-spanning helices?
B
A
c A. The Davson-Danielli-Robertson Model. This was the most widely accepted model in 1 9 7 1 , when Singer's review was published. In this model, the phospholipids are arranged as a bilayer. Proteins are found on both surfaces of the bilayer, at tached to it by ionic interactions between the charged head groups of the phospholipids and charged groups in the pro teins. Crucially, there is no protein in the interior of the bilayer. B. The Benson Lipoprotein Subunit Model. Here, the pro teins are globular and the membrane is a protein-lipid mixture. The hydrophobic tails of the lipids are embedded in the hy drophobic parts of the proteins. The lipid head groups are exposed to the solvent. There is no lipid bilayer.
[4 1 8]
Biological Mem branes and Tra nsport
C. The Lipid-Globular Protein Mosaic Model. This is the
monolayer area to cell membrane area was about 2 .0 . At
model shown in Figure 1 1-3 . The lipids form a bilayer and pro
higher pressures-thought to be more like those found in
teins are embedded in it, some extending through the bilayer
cells-the ratio was substantially lower.
and others not. Proteins are anchored in the bilayer by hy
(e) Circular dichroism spectroscopy uses changes in po
drophobic interactions between the hydrophobic tails of the
larization of UV light to make inferences about protein second
ary structure (see Fig. 4-9) . On average, this technique showed
lipids and hydrophobic portions of the protein. For the data given below, consider how each piece of in formation aligns with each of the three models of membrane
that membrane proteins have a large amount of a helix and little
structure. Which model(s) are supported, which are not sup
proteins having a globular structure.
ported, and what reservations do you have about the data or
or no f3 sheet. This finding was consistent with most membrane (f) Phospholipase C is an enzyme that removes the polar head group (including the phosphate) from phospholipids. In
their interpretation? Explain your reasoning. (a) When cells were fixed, stained with osmium tetroxide,
several studies, treatment of intact membranes with phospho
and examined in the electron microscope, they gave images
lipase C removed about 70% of the head groups without dis
like that in Figure 1 1- 1 : the membranes showed a "railroad
rupting the "railroad track" structure of the membrane.
track" appearance, with two dark-staining lines separated by a (b) The thickness of membranes in cells fixed and stained
5 to 9 nm The thickness of a "naked" phospholipid bilayer, without proteins, was 4 to 4.5 nm
in the same way was found to be
(g) Singer described a study in which "a glycoprotein of molecular weight about 3 1 ,000 in human red blood cell mem
light space. .
The thickness of a single monolayer of proteins was about 1
.
nm.
(c) In Singer's words: "The average amino acid composi
branes is cleaved by tryptic treatment of the membranes into soluble glycopeptides of about 10,000 molecular weight, while the remaining portions are quite hydrophobic" (p. 1 99) . Trypsin treatment did not cause gross changes in the mem branes, which remained intact.
tion of membrane proteins is not distinguishable from that of
Singer's review also included many more studies in this
soluble proteins. In particular, a substantial fraction of the
area. In the end, though, the data available in 1971 did not con
residues is hydrophobic" (p. 1 6 5) .
clusively prove Model C was correct. As more data have accu
(d) As described in Problems 1 and 2 of this chapter, re searchers had extracted membranes from cells, extracted
mulated, this model of membrane structure has been accepted by the scientific community.
the lipids, and compared the area of the lipid monolayer with the area of the original cell membrane. The interpretation of the results was complicated by the issue illustrated in the graph of Problem 1 : the area of the monolayer depended on how hard it was pushed. With very light pressures, the ratio of
Reference Singer, S.J. (1971) The molecular organization of biological mem branes . In Structure and Function ofBiological Membranes (Roth field, L.l., ed.) , pp . 145-222, Academic Press, Inc., New York.
When I first entered the study of hormone action, some 2 5 years ago, there was a widespread fee l i n g among b i o l ogists that hormone action cou l d not be stud ied mea n i ngfu l ly in the absence of orga n i zed cel l structure. However, as I reflected on the h i story of b i ochemistry, it
seemed to me there was a real pos s i b i l ity that hormones m ight act at the molec u l ar leve l . -Earl W Sutherland, Nobel Address, 7 9 7 7
Biosignaling 1 2. 1
General Features of Signai Transduction
1 2.2
G Protein-Coupled Receptors and Second Messengers
1 2 .3 1 2 .4
423
Receptor Tyrosine Kinases
1 2 .7
Gated lon Channels
449
455
1 2 . 1 General Features of Signal Transduction
Regulation ofTranscription by Steroid Hormones
1 2.9
446
lntegrins: Bidirectional Cell Adhesion Receptors
1 2.8
445
Multivalent Adaptor Proteins and Membrane Rafts
1 2 .6
439
Receptor Guanylyl Cyclases, cGMP, and Protein Kinase G
1 2.5
medium. In multicellular organisms, cells with different functions exchange a wide variety of signals. Plant cells respond to growth hormones and to variations in sunlight. Animal cells exchange information about the concentra tions of ions and glucose in extracellular fluids, the inter dependent metabolic activities taking place in different tissues, and, in an embryo, the correct placement of cells during development. In all these cases, the signal repre sents information that is detected by specific receptors and converted to a cellular response, which always in volves a chemical process. This conversion of informa tion into a chemical change, signal transduction, is a universal property of living cells.
41 9
456
Signaling in Microorganisms and Plants
457
1 2. 1 0 Sensory Transduction in Vision, Olfaction, and Gustation 1 2.1 1
461
Regulation of the Cell Cycle by Protein Kinases
469
1 2 . 1 2 Oncogenes, Tumor Suppressor Genes, and Programmed Cell Death
T
473
he ability of cells to receive and act on signals from beyond the plasma membrane is fundamental to life. Bacterial cells receive constant input from mem brane proteins that act as information receptors, sam pling the surrounding medium for pH, osmotic strength, the availability of food, oxygen, and light, and the pres ence of noxious chemicals, predators, or competitors for food. These signals elicit appropriate responses, such as motion toward food or away from toxic substances or the formation of dormant spores in a nutrient-depleted
Signal transductions are remarkably specific and exquis itely sensitive. Specificity is achieved by precise molec ular complementarity between the signal and receptor molecules (Fig. 1 2-la), mediated by the same kinds of weak (noncovalent) forces that mediate enzyme substrate and antigen-antibody interactions. Multicel lular organisms have an additional level of specificity, because the receptors for a given signal, or the intracel lular targets of a given signal pathway, are present only in certain cell types . Thyrotropin-releasing hormone, for example, triggers responses in the cells of the anterior pituitary but not in hepatocytes, which lack receptors for this hormone. Epinephrine alters glycogen metabo lism in hepatocytes but not in adipocytes; in this case, both cell types have receptors for the hormone, but whereas hepatocytes contain glycogen and the glycogen metabolizing enzyme that is stimulated by epinephrine, adipocytes contain neither. Three factors account for the extraordinary sensi tivity of signal transducers: the high affinity of receptors for signal molecules, cooperativity (often but not al ways) in the ligand-receptor interaction, and amplifica tion of the signal by enzyme cascades. The affinity
[420]
Biosignaling
Signal
(a) Specificity
(c) Desensitization/Adaptation
Signal molecule fits binding site on its complementary receptor; other signals do not fit.
Receptor activation triggers a feedback circuit that shuts off the receptor or removes it from the cell surface.
t
Response
Effect
(b) Amplification
(d) Integration
When enzymes activate enzymes, the number of affected molecules increases geometrically in an enzyme cascad
ignal
�e._�::::J-T-C�--,
When two signals have opposite effects on a metabolic characteristic such as the concentration of a second messenger X, or the membrane potential Vm• the regulatory outcome results from the integrated input from both receptors.
l
Blood glucose
I
h
[430]
Biosignaling
accounts for the very low concentration of epinephrine (or any other hormone) required for hormone activity.
other factors, providing a fine-tuning of the response to 13-adrenergic stimulation. A third mechanism for termi nating the response is to remove the second messenger: hydrolysis of cAMP to 5' -AMP (not active as a second messenger) by cyclic nucleotide phosphodiesterase (Fig. 1 2-4a, step (7_); 12-4b) . Finally, at the end of the signaling pathway, the metabolic effects that result from enzyme phosphoryla tion are reversed by the action of phosphoprotein phos phatases, which hydrolyze phosphorylated Ser, Thr, or Tyr residues, releasing inorganic phosphate (Pi) . About 1 50 genes in the human genome encode phosphoprotein phosphatases, fewer than the number encoding protein kinases ( -500) . Some of these phosphatases are known to be regulated; others may act constitutively. When [cAMP] drops and PKA returns to its inactive form (step C1) in Fig. 12-4a) , the balance between phosphorylation and dephosphorylation is tipped toward dephosphorylation by these phosphatases.
Several Mechan i sms Cause Termination of the /3-Adrenergic Response
To be useful, a signal-transducing system has to turn off after the hormonal or other stimulus has ended, and mechanisms for shutting off the signal are intrinsic to all signaling systems. Most systems also adapt to the con tinued presence of the signal by becoming less sensitive to it, in the process of desensitization. The 13-adrenergic system illustrates both. When the concentration of epi nephrine in the blood drops below the Kct for its recep tor, the hormone dissociates from the receptor and the latter resumes the inactive conformation, in which it can no longer activate G8. A second means of ending the response to 13adrenergic stimulation is the hydrolysis of GTP bound to the G"' subunit, catalyzed by the intrinsic GTPase ac tivity of the G protein. Conversion of bound GTP to GDP favors the return of Ga to the conformation in which it binds the G,a .,., subunits-the conformation in which the G protein is unable to interact with or stimulate adeny lyl cyclase. This ends the production of cAMP. The rate of inactivation of Gs depends on the GTPase activity, which for Ga alone is very feeble. However, GTPase acti vator proteins (GAPs) strongly stimulate this GTPase activity, causing more rapid inactivation of the G protein (see Box 12-2) . GAPs can themselves be regulated by Q)
Binding of epinephrine (E) to fl-adrenergic receptor triggers dissociation of Gs�r from G8., (not shown).
The /3-Adrenergic Receptor Is Desensitized by Phosphorylation and by Association with Arrestin
The mechanisms for signal termination described above take effect when the stimulus ends. A different mecha nism, desensitization, damps the response even while the signal persists. Desensitization of the 13-adrenergic receptor is mediated by a protein kinase that phosphory lates the receptor on the intracellular domain that nor mally interacts with Gs (Fig. 12-8). When the receptor is
®
Gs�r recruits flARK to the mem brane, where it phosphorylates Ser residues at the carboxyl terminus of the receptor.
®
fl-Arrestin (flarr) binds to the phosphorylated carboxyl-terminal domain of the receptor.
Receptor-arrestin complex enters the cell by endocytosis.
@
In endocytic vesicle, arrestin dissociates; receptor is dephosphorylated and returned to cell surface.
FIGURE 1 2 -8 Desensitization of the P-adrenergic receptor in the continued presence of epinephrine. Th i s process is mediated by two
proteins: /3-adrenergic protein kinase (/3ARK) and /3-arrestin (/3arr; also known as arrestin 2 ) .
1 2 .2 G Protein-Coupled Receptors and Second Messengers
occupied by epinephrine, P-adrenergic receptor ki nase, or PARK (also commonly called GRK2 ; see below) , phosphorylates several Ser residues near the carboxyl terminus of the receptor, which is on the cyto plasmic side of the plasma membrane. Normally located in the cytosol, .BARK is drawn to the plasma membrane by its association with the Gs/3-r subunits and is thus posi tioned to phosphorylate the receptor. Receptor phos phorylation creates a binding site for the protein P-arrestin, or Parr (also called arrestin 2) , and binding of ,8-arrestin effectively prevents further interaction between the receptor and the G protein. The binding of ,8-arrestin also facilitates receptor sequestration, the re moval of receptor molecules from the plasma membrane by endocytosis into small intracellular vesicles. Recep tors in the endocytic vesicles are eventually dephospho rylated and returned to the plasma membrane, completing the circuit and resensitizing the system to epinephrine . .8-Adrenergic receptor kinase is a member of a family of G protein-coupled receptor kinases ( GRKs), all of which phosphorylate GPCRs on their car boxyl-terminal cytoplasmic domains and play roles simi lar to that of .BARK in desensitization and resensitization of their receptors. At least five different GRKs and four different arrestins are encoded in the human genome; each GRK is capable of desensitizing a particular subset of GPCRs, and each arrestin can interact with many dif ferent types of phosphorylated receptors. Cyclic AMP Acts as a Second M essenger for Many Regulatory M olecules Epinephrine is just one of many hormones, growth fac tors, and other regulatory molecules that act by chang ing the intracellular [cAMP] and thus the activity of PKA (Table 1 2-3). For example, glucagon binds to its recep tors in the plasma membrane of adipocytes , activating (via a Gs protein) adenylyl cyclase. PKA, stimulated by the resulting rise in [cAMP] , phosphorylates and acti vates two proteins critical to the mobilization of the fatty acids of stored fats (see Fig. 1 7-3) . Similarly, the pep tide hormone ACTH (adrenocorticotropic hormone, also called corticotropin) , produced by the anterior pituitary, binds to specific receptors in the adrenal cortex, activat ing adenylyl cyclase and raising the intracellular [cAMP] . PKA then phosphorylates and activates several of the enzymes required for the synthesis of cortisol and other steroid hormones. In many cell types, the catalytic sub unit of PKA can also move into the nucleus, where it phosphorylates the cAMP response element binding protein ( CREB ), which alters the expression of spe cific genes regulated by cAMP. Some hormones act by inhibiting adenyly1 cyclase, thus lowering [cAMP] and suppressing protein phos phorylation. For example, the binding of somatostatin to its receptor leads to activation of an inhibitory G pro tein, or G1, structurally homologous to G8, that inhibits adenylyl cyclase and lowers [cAMP] . Somatostatin therefore counterbalances the effects of glucagon. In
[431]
TA B LE 1 2 - 3 Corticotropin (ACTH) Corticotropin-releasing hormone (CRH) Dopamine [D1 , D2) Epinephrine (,B-adrenergic) Follicle-stimulating hormone (FSH) Glucagon Histamine [H2 ] Luteinizing hormone (LH) Melanocyte-stimulating hmmone (MSH) Odorants (many) Parathyroid hormone Prostaglandins E 1 , E 2 (PGE 1, PGE 2) Serotonin [5-HT- la, 5-HT-2] Somatostatin Tastants (sweet, bitter) Thyroid-stimulating hormone (TSH) Note: Receptor subtypes in square brackets. Subtypes may have different transduction mechanisms. For example, serotonin is detected in some tissues by receptor subtypes 5-HT-la and 5-HT-lb, which act through adenylyl cyclase and cAMP, and in other tissues by receptor subtype 5-HT-lc, acting through the phospholipase C-IP3 mechanism (see Table 12-4),
adipose tissue, prostaglandin E 1 (PGE 1 ; see Fig. 1 0-1 8) inhibits adenylyl cyclase, thus lowering [cAMP] and slowing the mobilization of lipid reserves triggered by epinephrine and glucagon. In certain other tissues PGE 1 stimulates cAMP synthesis: its receptors are coupled to adenylyl cyclase through a stimulatory G protein, Gs . In tissues with a2-adrenergic receptors, epinephrine low ers [cAMP]; in this case, the receptors are coupled to adenylyl cyclase through an inhibitory G protein, Gi. In short, an extracellular signal such as epinephrine or PGE 1 can have quite different effects on different tis sues or cell types, depending on three factors: the type of receptor in the tissue, the type of G protein CGs or GJ with which the receptor is coupled, and the set of PKA tar get enzymes in the cells. By summing the influences that tend to increase and decrease [cAMP], a cell achieves the integration of signals that we noted as a general feature of signal-transducing mechanisms (Fig. 12-1 d) . A fourth factor that explains how so many types of signals can be mediated by a single second messenger (cAMP) is the confinement of the signaling process to a specific region of the cell by adaptor proteins noncatalytic proteins that hold together other protein molecules that function in concert (further described below) . AKAPs (A kinase anchoring proteins) are multivalent adaptor proteins; one part binds to the R subunits of PKA (see Fig. 12-6a) and another to a spe cific structure in the cell, confining the PKA to the vicin ity of that structure. For example, specific AKAPs bind PKA to microtubules, actin filaments, ion channels, mitochondria, or the nucleus. Different types of cells
[432]
Biosignaling
'
'
As is now clear, to fully understand cellular signaling researchers need tools precise enough to detect and study the spatiotemporal aspects of signaling processes at the subcellular level and in real time. In studies of the intracel lular localization of biochemical changes, biochemistry meets cell biology, and techniques that cross this boundary have become essential in understanding signaling path ways. Fluorescent probes have found wide application in signaling studies. Labeling of functional proteins with a flu orescent tag such as the green fluorescent protein (GFP) reveals their subcellular localizations (see Fig. 9-15a) . Changes in the state of association of two proteins Csuch as the R and C subunits of PKA) can be seen by measuring the nonradiative transfer of energy between fluorescent probes attached to each protein, a technique called fluo rescence resonance energy transfer (FRET; Box 12-3) .
• Active PKA C ,' catalytic subunits ·. '
FIGURE 1 2-9 Nucleation of supramolecular complexes by A kinase anchoring proteins (AKAPs). Several types of AKAPs (green) act as
mu ltivalent scaffolds, holding PKA catalytic subun its (blue), through the AKAP's i nteraction with the PKA regu latory subunits (red), in prox i m ity to a particular region or organelle in the cel l . AKAP79, at the cy top lasmic su rface of the plasma membrane, b i nds both PKA and adenylyl cyclase (AC). The cAMP produced by AC reaches the nearby PKA q u i ckly and with very l ittle d i l ution. AKAP79 can a l so bind (not shown here) PKA, PKA's target protei n (an ion channel), and phospho protein phosphatase, which removes phosphate from the target protein. AKAP250, also known as gravin, holds PKA to the plasma membrane while also binding cAMP phosphodiesterase (POE), which terminates the PKA signal by converting cAMP to AMP. In both examples, the AKAP bri ngs about a h igh local concentration of enzymes and second messengers, so that the signa l i ng c i rcuit remai ns h i ghly localized.
have different complements of AKAPs, so cAMP might stimulate phosphorylation of mitochondrial proteins in one cell and phosphorylation of actin filaments in an other. In some cases, an AKAP connects PKA with the enzyme that triggers PKA activation (adenylyl cyclase) or terminates PKA action (cAMP phosphodiesterase or phosphoprotein phosphatase) (Fig. 1 2-9) . The very close proximity of these activating and inactivating en zymes presumably achieves a highly localized, and very brief, response. We will see later that some membrane bound signaling proteins (including adenylyl cyclase) are localized to specific areas of the membrane in rafts or caveolae (see Section 1 2 .5) .
TAB L E 1 2 -4
2+
Have Related Roles a s Second Messengers
A second broad class of GPCRs are coupled through a G protein to a plasma membrane phospholipase C (PLC) that is specific for the membrane phospholipid phosphatidylinositol 4,5-bisphosphate, or PIP2 (see Fig. 1 0- 16) . When one of the hormones that acts by this mechanism (Table 1 2-4) binds its specific receptor in the plasma membrane (Fig. 12-10, step (D), the receptor hormone complex catalyzes GTP-GDP exchange on an associated G protein, Gq (step ®), activating it much like the {3-adrenergic receptor activates Gs (Fig. 1 2-4) . The activated Gq in turn activates the PIP2-specific PLC (Fig. 1 2-10, step @) , which catalyzes (step @) the production of two potent second messengers, diacyl glycerol and inositol 1 ,4,5-trisphosphate , or IP3 (not to be confused with PIP3, p. 44 1 ) .
or -o- P=O H
I
0
H Inositol 1,4,5-trisphosphate (IP3)
2+ Some Signals That Art through Phospholipase.;: C,.;.;. I P� 31a � nd �Ca ,;::._
Acetylcholine [muscarinic Mil a 1-
Diacylglycerot I n ositol Trisphosphate, and Ca
Adrenergic agonists
�
_ _ _ _ _ _ _ _ _ _
Gastrin-releasing peptide
Platelet-derived growth factor (PDGF)
Glutamate
Serotonin [5-HT-lc]
Angiogenin
Gonadotropin-releasing hormone (GRH)
Thyrotropin-releasing hormone (TRH)
Angiotensin II
Histamine [Hd
Vasopressin
ATP (Pzx, Pzy] Auxin
Light (Drosophila) Oxytocin
Note: Receptor subtypes are in square brackets; see footnote to Table 12-3.
1 2 .2 G Protein-Coupled Receptors and Second Messengers
[433]
FIGURE 1 2- 1 0 Hormone-activated phospholipase C and IP3• Two in tracel l u l ar second messengers are produced i n the hormone-sensitive
E traceHular space
phosphatidylinositol system: inositol 1 ,4,5-tri sphosphate ( I P3 ) and di acylglycerol. Both contribute to the activation of protei n ki nase C . By 2 rai s i ng cytoso l i c [Cal + ] , I P3 a l so activates other Ca + -dependent 2 enzymes; thus Ca + also acts as a second messenger.
®
The occupied receptor causes GDP-GTP exchange on Gq.
®
Phospholipase C (PLC)
it.
Plasma
Gq, with bound GTP, moves to PLC and activates
@
Active PLC cleaves phosphatidylinositol 4,5-bisphosphate (PIP2 ) to inositol trisphosphate (IP3) and diacylglycerol.
®
IP3 binds to a specific receptor on the endoplasmic reticulum, releasing sequestered C a2 + .
Cytosol
Phosphorylation of cellular proteins by protein kinase C produces some ofthe cellular responses to the hormone.
Inositol trisphosphate, a water-soluble compound, diffuses from the plasma membrane to the endoplasmic reticulum (ER) , where it binds to specific IP3-gated Ca2 + channels, causing them to open. The action of the SERCA pump (see Fig. 1 1-36) ensures that [Ca2 +] in the ER is orders of magnitude higher than that in the cytosol, so when these gated Ca2 + channels open, Ca2 + rushes into the cytosol (Fig. 1 2-10, step @) , and the cytosolic [Ca2 +] rises sharply to about 1 0 - 6 M. One ef fect of elevated [Ca2 +] is the activation of protein ki nase C (PKC). Diacylglycerol cooperates with Ca2 + in activating PKC, thus also acting as a second messenger (step @) . Activation involves the movement of a PKC
domain (the pseudosubstrate domain) away from its lo cation in the substrate-binding region of the enzyme, al lowing the enzyme to bind and phosphorylate proteins that contain a PKC consensus sequence-Ser or Thr residues embedded in an amino acid sequence recog nized by PKC (step (f)) . There are several isozymes of PKC, each with a characteristic tissue distribution, tar get protein specificity, and role. Their targets include cytoskeletal proteins, enzymes, and nuclear proteins that regulate gene expression. Taken together, this family of enzymes has a wide range of cellular actions, affecting neuronal and immune function and the regula tion of cell division, for example.
[434]
Biosignaling
M E T H O D S
F R ET: B i o c h e m istry V i s u a l ized i n a L i v i n g Cel l
Fluorescent probes are conunonly used to detect rapid biochemical changes in single living cells. They can be designed to give an essentially instantaneous report (within nanoseconds) on the changes in intracellular concentration of a second messenger or in the activity of a protein kinase. Furthermore, fluorescence microscopy has sufficient resolution to reveal where in the cell such changes are occurring. In one widely used procedure, the fluorescent probes are derived from a naturally oc curring fluorescent protein, the green fluorescent pro tein (GFP) of the jellyfish Aequorea victoria (Fig. 1). When excited by absorption of a photon of light, GFP emits a photon (that is, it fluoresces) in the green region of the spectrum. GFP is an 1 1-stranded {3 barrel, and the light-absorbing/emitting center of the protein (its chromophore) comprises a modified (oxidized) form of the tripeptide -Ser65-Tyr66-Gly67- located within the barrel (Fig. 2) . Oxidation of the tripeptide is catalyzed by the GFP protein itself (Fig. 3) , with no other protein or cofactors required (other than molecu lar oxygen) , so it is possible to clone the protein into vir tually any cell, where it can serve as a fluorescent marker for itself or for any protein to which it is fused (see Fig. 9- 15a) . Variants of GFP, with different fluorescence spectra, are produced by genetic engineering of its gene. For example, in the yellow fluorescent protein (YFP) ,
FIGURE 2 Green fluorescent protein (GFP), with the fluorescent ch ro mophore shown i n ball-and-stick form (derived from P D B I D 1 GFL).
Ala206 in GFP is replaced by a Lys residue, changing the wavelength of light absorption and fluorescence. Other variants of GFP fluoresce blue (BFP) or cyan (CFP) light, and a related protein (mRFP1) fluoresces red light (Fig. 4) . GFP and its variants are compact structures that retain their ability to fold into their native {3-barrel conformation even when fused with another protein. In vestigators are using these fluorescent hybrid proteins as spectroscopic rulers to measure distances between
�02
H202 H H ultiplc ep
�N-Ser HOV N� /Gly
Mature chromophore
� er"" HO / (-:--.OR 0
�
/
Gly
H+
F IGURE 3 The chromophore in GFP is derived from a series of three amino acids:
FIGURE 1 Aequorea victoria, a jellyfish abundant i n Puget Sound, Washi ngton State.
-Ser65 -Tyr6 6-Gi l7-. Maturation of the chromophore i nvolves an internal rearrangement,
coupled to an oxidation reaction that takes place in m u ltiple steps. An abbreviated mecha n ism is shown here.
1 2 .2 G Protein-Coupled Receptors and Second Messengers
700
Wavelength (nm)
FIGURE 4 E m ission spectra of GFP variants.
interacting components within a cell and, indirectly, to measure local concentrations of compounds that change the distance between two proteins. An excited fluorescent molecule such as GFP or YFP can dispose of the energy from the absorbed pho ton in either of two ways: (1) by fluorescence, emitting a photon of slightly longer wavelength (lower energy) than the exciting light, or (2) by nonradiative fluores cence resonance energy transfer (FRET), in which the energy of the excited molecule (the donor) passes directly to a nearby molecule (the acceptor) without
CFP -
emission of a photon, exciting the acceptor (Fig. 5) . The acceptor can now decay to its ground state by fluo rescence; the emitted photon has a longer wavelength (lower energy) than both the original exciting light and the fluorescence emission of the donor. This second mode of decay (FRET) is possible only when donor and acceptor are close to each other (within 1 to 50 A) ; the efficiency of FRET is inversely proportional to the sixth power of the distance between donor and acceptor. Thus very small changes in the distance between donor and acceptor register as very large changes in FRET, measured as the fluorescence of the acceptor molecule when the donor is excited. With sufficiently sensitive light detectors, this fluorescence signal can be located to specific regions of a single, living cell. FRET has been used to measure [cAMP] in living cells. The gene for GFP is fused with that for the regula tory subunit (R) of cAMP-dependent protein kinase (PKA) , and the gene for BFP is fused with that for the catalytic subunit (C) (Fig. 6) . When these two hybrid proteins are expressed in a cell, BFP (donor; excitation at 380 nm, emission at 460 nm) and GFP (acceptor; ex citation at 475 nm, emission at 545 nm) in the inactive (continued on next page) cAMP-dependent protein kinase (PKA)
�/�RET I '\ \
nm � � nm
527
433
�'-/ ,_,
I
�
[435]
IJ t
"-\..,, 545 nm
380 nm
YFP -
380 nm
protein protein interaction
460 nm
Genetically engineered hybrid proteins
+
FIGURE S When the donor protein (CFP) is excited with monochro matic l ight of wavelength 433 nm, it emits fl uorescent l ight at 476 n m
(left). When the (red) protein fused with C F P i nteracts with the (purple) protei n fused with YFP, that i nteraction bri ngs CFP and YFP close enough to al low fluorescence resonance energy transfer ( FRET) be
FIGURE 6 Measuring [cAMP] with FRET. Gene fusion creates hybrid
tween them. Now, when CFP absorbs l ight of 433 nm, i n stead of fluo
proteins that exh i b i t FRET when the PKA regulatory (R) and catalytic
resc i n g at 476 nm, i t transfers energy d i rectly to YFP, which then
(C) subunits are associated ( l ow [cAMP]). When [cAMP] rises, the
fluoresces at its characteristic emission wavelength, 527 nm. The ratio
subunits d issociate and FRET ceases. The ratio of emission at 460 nm
of light emission at 527 and 476 nm is therefore a measure of the in
(dissociated) and 545 nm (complexed) thus offers a sensitive measure
teraction of the red and purple proteins.
of [cAMP] .
[436]
B iosi g n a l i n g
F R ET: B i o chem i stry V i s u a l ized i n a Living Ce l l
(continued from previous page)
BOX 1 2-3
PKA (RzC tetramer) are close enough to liDdergo FRET. 2 Wherever in the cell [cAMP] increases, the R C complex 2 2 dissociates into R and 2C and the FRET signal is lost, be 2 cause donor and acceptor are now too far apart for effi cient FRET. Viewed in the fluorescence microscope, the region of higher [cAMP] has a minimal GFP signal and higher BFP signal. Measuring the ratio of emission at 46 0 nm and 545 nm gives a sensitive measure of the change in [cAMP]. By determining this ratio for all regions of the cell, the investigator can generate a false color image of the cell in which the ratio, or relative [cAMP] , is repre sented by the intensity of the color. Images recorded at timed intervals reveal changes in [cAMP] over time. A variation of this technology has been used to measure the activity of PKA in a living cell (Fig. 7) . Re searchers create a phosphorylation target for PKA by producing a hybrid protein containing four elements: YFP (acceptor) ; a short peptide with a Ser residue sur rounded by the consensus sequence for PKA; a ®-Ser binding domain (called 14-3-3) ; and CFP (donor) . When the Ser residue is not phosphorylated, 14-3-3 has no affinity for the Ser residue and the hybrid protein exists in an extended form, with the donor and acceptor too far apart to generate a FRET signal. Wherever PKA is
The action of a group of compounds known as tumor promoters is attributable to their effects on PKC. The best understood of these are the phorbol es ters, synthetic compounds that are potent activators of PKC. They apparently mimic cellular diacylglycerol as second messengers, but unlike the naturally occurring diacylglycerols they are not rapidly removed by metabo lism. By continuously activating PKC, these synthetic tumor promoters interfere with the normal regulation of cell growth and division (as discussed in Section 12. 1 2) , thus promoting the formation of tumors. • ,
0
CH3 CHa
Myristoylphorbol acetate (a phorbol ester)
433 nm
�
CFP
Ser
I /s 476
PKA con
quence
=
ensus
ATP
ADP
\. / ,
>
�
527
��� ,-� � I
433
nm
=
PI\..\
14-3 -3 (phosphoserine binding domain)
FIGURE 7 Measuring the activity of PKA with FRET. An engi neered pro tein l i n ks YFP and CFP via a peptide that contains a Ser residue sur
®-Ser-binding doma i n . Active PKA phosphorylates the Ser
rounded by the consensus sequence for phosphorylation by PKA, and the 1 4-3-3
residue, which docks with the 1 4-3-3 binding domain, bringing the fluorescence proteins close enough to al low FRET to occur, reveal i n g t h e presence o f active PKA.
active in the cell, it phosphorylates the Ser residue of the hybrid protein, and 1 4-3-3 binds to the ®-Ser. In doing so, it draws YFP and CFP together and a FRET signal is detected with the fluorescence microscope, re vealing the presence of active PKA.
Calcium Is a Second Messenger That May Be localized in Space and Time
There are many variations on this basic scheme for Ca2+ signaling. In many cell types that respond to extracellu lar signals, Ca2+ serves as a second messenger that triggers intracellular responses, such as exocytosis in neurons and endocrine cells, contraction in muscle, and cytoskeletal rearrangements during amoeboid move ment. In unstimulated cells, cytosolic [Ca2+] is kept very low ( < 1 0 - 7 M) by the action of Ca2+ pumps in the ER, mitochondria, and plasma membrane (as further discussed below) . Hormonal, neural, or other stimuli cause either an influx of Ca2+ into the cell through spe cific Ca2+ channels in the plasma membrane or the re lease of sequestered Ca2+ from the ER or mitochondria, in either case raising the cytosolic [Ca2+] and triggering a cellular response. Changes in intracellular [Ca2+] are detected by Ca2+ -binding proteins that regulate a variety of Ca2+ dependent enzymes. Calmodulin (CaM; Mr 1 7,000) is an acidic protein with four high-affinity Ca2+ -binding sites. When intracellular [Ca2+] rises to about 1 0-6 M (1 J.LM) , the binding of Ca2+ to calmodulin drives a conformational change in the protein (Fig. 1 2-l la). Calmodulin associates with a variety of proteins and,
1 2.2 G Prote i n -Coupled Receptors a n d Second Messengers
TABLE 1 2 -5
=437]
Some Proteins Regulated by u2+ and CalmoduBn
Adenylyl cyclase (brain) 2 Ca +/calmodulin-dependent protein kinases (CaM kinases I to IV) 2 Ca + -dependent Na + channel (Paramecium) 2 Ca + -release channel of sarcoplasmic reticulum Calcineurin (phosphoprotein phosphatase 2B) cAMP phosphodiesterase cAMP-gated olfactory channel 2 cGMP-gated Na + , Ca + channels (rod and cone cells) Glutamate decarboxylase Myosin light chain kinases NAD + kinase Nitric oxide synthase Phosphoinositide 3-kinase 2+ 2 Plasma membrane Ca ATPase (Ca + pump) FIGURE 1 2- 1 1 Calmodulin. Th i s is the prote i n mediator of many Ca2 + -sti m u l ated enzymatic reactions. Cal mod u l i n has four h igh affinity Ca 2 + -binding sites (Kd 0.1 to 1 IJ-M). (a) A ribbon model of the �
crystal structure of calmodu l i n (PDB I D 1 CLL). The four Ca2 + -binding sites are occupied by Ca2 + (purple). The ami no-term i nal doma i n is on the left; the carboxyl-term i na l domain on the right. (b) Calmodu l i n
associated with a hel ical domain (red) of one o f t h e many enzymes i t regul ates, calmodul in-dependent protein k i nase I I (PDB I D 1 COL). Notice that the long central
a helix of calmodu l i n visible i n (a) has
bent back on itself i n b i nding to the hel i ca l substrate doma i n . The central helix of calmodu l i n is clearly more flexible in solution than i n the crystal . (c) Each of the four Ca2 + -binding sites occurs i n a hel i x loop-hel ix motif cal led the EF hand, also found in many other Ca2 + binding protei ns.
in its Ca2 + -bound state, modulates their activities (Fig. 12-1 1 b) . It is a member of a family of Ca2+ -binding proteins that also includes troponin (p. 1 78) , which triggers skeletal muscle contraction in response to increased [Ca2 + ] . This family shares a characteristic Ca2+-binding structure, the EF hand (Fig. 12-l lc) . Calmodulin is an integral subunit of the Ca2 +I calmodulin-dependent protein kinases ( CaM ki nases, types I through IV). When ·intracellular [Ca2+]
increases in response to a stimulus, calmodulin binds Ca2 + , undergoes a change in conformation, and acti vates the CaM kinase. The kinase then phosphorylates target enzymes, regulating their activities. Calmodulin is also a regulatory subunit of phosphorylase b kinase of muscle, which is activated by Ca2 + . Thus Ca2+ triggers ATP-requiring muscle contractions while also activating glycogen breakdown, providing fuel for ATP synthesis. Many other enzymes are also known to be modulated by Ca2+ through calmodulin (Table 12-5) . The activity of the second messenger Ca2+, like that of cAMP, can be spatially restricted; after its release triggers a local
RNA helicase (p68)
response, Ca2+ is generally removed before it can dif fuse to distant parts of the cell. Very commonly, Ca2+ level does not simply rise and then decrease, but rather oscillates with a period of a few seconds (Fig. 12-12)-even when the extracellu lar concentration of the triggering hormone remains constant. The mechanism underlying [Ca2+ ] oscillations presumably entails feedback regulation by Ca2+ on some part of the Ca2+ -release process. Whatever the mechanism, the effect is that one kind of signal (hor mone concentration, for example) is converted into an other (frequency and amplitude of intracellular [Ca2+] "spikes") . Another variation is the occurrence of local ized Ca2+ "blips," "puffs," and "waves"-transient in creases in [Ca2+] that are limited to specific subcellular r gions ( Fig. 2-1 3 ) . The Ca2+ signal dirnini hes as a2+ diffus s away from th initial source (th Ca2+ channel) , is sequestered in the ER, or is pumped out of the cell. There is significant cross-talk between the Ca2+ and cAMP signaling systems. In some tissues, both the en zyme that produces cAMP Cadenylyl cyclase) and the enzyme that degrades cAMP (phosphodiesterase) are stimulated by Ca2 + . Temporal and spatial changes in [Ca2+] can therefore produce transient, localized changes in [cAMP]. We have noted already that PKA, the enzyme that responds to cAMP, is often part of a highly localized supramolecular complex assembled on scaf fold proteins such as AKAPs. This subcellular localiza tion of target enzymes, combined with temporal and spatial gradients in [Ca2+] and [cAMP], allow a cell to re spond to one or several signals with subtly nuanced metabolic changes, localized in space and time.
�-438]
Biosigna l i n g
600 'i 3
500
;;, 400 S2.
� 300 Ql 0
8 200 0.5
0 (a)
100 +---.--.r-�---.--.---�--r--. 400 300 200 100 0
1.0
Time (s)
(b)
[C a h] (JiM)
been s t i m u lated with extrac e l l u l a r ATP, which raises their i ntern a l
F I G U R E 1 2- 1 2 Triggering of oscillations in intracell ular [Ca2+] by extracellular signals. (a) A dye (lura) that u ndergoes flu orescence
[Ca2 + ] . T h e ce l l s a r e heterogeneous i n the i r responses; some have
changes when it b i nds Ca2 + is a l l owed to d i ffuse i nto cel l s, and i ts
h i gh i ntracel l u l a r [Ca2 + ] (red), others m uc h lower (bl ue). (b) When
such a probe is used in a s i n g l e hepatocyte, the agon ist norep i neph
i n stantaneous l i gh t output is measured by f l u orescence m i c roscopy.
rine (added at the arrow) causes osc i l l ations of [Ca2 + ] from 200 to
F l u o rescence i n tensity is represented by color; the color sca l e re lates i ntensity of color to [Ca2 + 1 , a l lowing deter m i nation of the ab
500 nM. S i m i l a r osc i l l ations are i n d u ced i n other cel l types by other
sol ute [Ca2 + ] . I n t h i s case, thymocytes (ce l l s of the thymus) have
extrace l l u l a r s i g n a l s.
(a) Low [IP3]
Blip
J
IP3-gated Ca2• channel
� •
•
� e
w
e . ., .,
Ca2•
•
•
'
ee
•
•
ill \If .,
.,
e
., e e
.,
ill ill ill
•
•
•
•
Puff
�
•
IP3
a2+
(b) Intermediate [IP3]
Will ill
�
e
...
•
(c) High [IP3] Wave
•
t
C)
e
'-J C) i) A
. .. '
() ()
-
�
• •
•
(ij>
•
...
•
• •
• •
F I G U R E 1 2 - 1 3 Transient and highly localized increases in [Ca2 + ] .
Ca2+ c h a n n e l s in a c l uster to open, produ c i n g a "puff" of Ca2 + i n
(a) The I Prgated Ca2 + channels o f t h e endop l a s m i c retic u l u m occ u r
which the i n crease i n [Ca2 + L its d u ration, a n d the area (vo l u me) af
i n c l usters, each capable o f i n dependently respon d i ng t o the I P3 s i g
fected are l a rger than i n a b l i p . (c) A sufficiently l a rge puff produces
n a l . A relatively weak sti m u l us that produces a sma l l rise i n [IP3]
el evated [ Ca2 + ] over an area great enough to i n c l ude neighbori ng
may cause a s i ng l e channel to open briefly, res u l t i n g in a h i g h l y
cl usters of Ca2+ channels. Open i n g of the c h a n n e l s in neighboring
loca l i zed a n d tra n s ient "bl i p" i n [Ca2 + J . (b) A somewhat stronger
c l u sters propagates th i s effect, and the res u l t i s a wave of e levated
sti m u l u s that generates a l a rger i ncrease i n [ I P3 ] may cause a l l the
[Ca2 + ] moving a l ong the ER.
1 2.3 Receptor Tyrosine Kinases
S U M M A RY 1 2 .2
•
•
•
•
•
•
•
•
G P rote i n -Co u p l e d Rece pto rs a n d S e c o n d M es s e n g e rs
G protein-coupled receptors (GPCRs) act through heterotrimeric G proteins. On ligand binding, GPCRs catalyze the exchange of GTP for GDP on the G protein, causing dissociation of the Ga subunit; Ga then stimulates or inhibits the activity of an effector enzyme, changing the level of its second messenger product. The .B-adrenergic receptor activates a stimulatory G protein, G8, thereby activating adenylyl cyclase and raising the concentration of the second messenger cAMP. Cyclic AMP stimulates cAMP-dependent protein kinase to phosphorylate key target enzymes, changing their activities. Enzyme cascades, in which a single molecule of hormone activates a catalyst to activate another catalyst, and so on, result in the large signal amplification that is characteristic of hormone receptor systems. Cyclic AMP concentration is eventually reduced by cAMP phosphodiesterase, and G8 turns itself off by hydrolysis of its bound GTP to GDP, acting as a self-linuting binary switch. When the epinephrine signal persists, .B-adrenergic receptor-specific protein kinase and .B-arrestin temporarily desensitize the receptor and cause it to move into intracellular vesicles. Some receptors stimulate adenylyl cyclase through G8; others inhibit it through Gi. Thus cellular [cAMP] reflects the integrated input of two (or more) signals. Noncatalytic adaptor proteins such as AKAPs hold together proteins involved in a signaling process, increasing the efficiency of their interactions and in some cases confining the process to a specific subcellular location. Some GPCRs act via a plasma membrane phospholipase C that cleaves PIP2 to diacylglycerol and IPs. By opening Ca2 + channels in the endoplasmic reticulum, IPs raises cytosolic [Ca2 +]. Diacylglycerol and Ca2 + act together to activate protein kinase C, which phosphorylates and changes the activity of specific cellular proteins. Cellular [Ca2 + ] also regulates (often through calmodulin) many other enzymes and proteins involved in secretion, cytoskeleton rearrangements, or contraction.
1 2 .3 Receptor Tyrosine Kinases The receptor tyrosine kinases (RTKs ), a large family of plasma membrane receptors with intrinsic protein ki nase activity, transduce extracellular signals by a mecha nism fundamentally different from that of GPCRs. RTKs
[439]
have a ligand-binding domain on the extracellular face of the plasma membrane and an enzyme active site on the cytoplasmic face, connected by a single transmembrane segment. The cytoplasmic domain is a protein kinase that phosphorylates TYr residues in specific target proteins-a TYr kinase. The receptors for insulin and epidermal growth factor are prototypes for this group. Stimulation of the Insulin Receptor I nitiates a Cascade of Protein Phosphorylation Reactions
Insulin regulates both metabolic enzymes and gene ex pression. Insulin does not enter cells, but initiates a sig nal that travels a branched pathway from the plasma membrane receptor to insulin-sensitive enzymes in the cytosol and to the nucleus, where it stimulates the tran scription of specific genes. The active insulin receptor protein (INS-R) consists of two identical a subunits pro truding from the outer face of the plasma membrane and two transmembrane .B subunits with their carboxyl termini protruding into the cytosol (Fig. 1 2-14) . The a subunits contain the insulin-binding domain, and the in tracellular domains of the .B subunits contain the protein kinase activity that transfers a phosphoryl group from ATP to the hydroxyl group of Tyr residues in specific target proteins. Signaling through INS-R begins when the binding of insulin activates the TYr kinase activity, and each .B subunit phosphorylates three critical Tyr residues near the carboxyl terminus of the other .B sub unit in the (a/3) 2 dimer. This autophosphorylation opens up the active site so that the enzyme can phos phorylate Tyr residues of other target proteins. The mechanism of activation of the INS-R protein kinase is sinillar to that described for PKA and PKC: a region of the cytoplasmic domain (an autoinhibitory sequence) that normally occludes the active site moves out of the active site after being phosphorylated, opening up the site for the binding of target proteins (Fig. 12-14) . One of the target proteins of INS-R (Fig. 12-15 , step (D) is insulin receptor substrate-1 (IRS-1 ; step @) . Once phosphorylated on several of its TYr residues, IRS-1 becomes the point of nucleation for a complex of proteins (step @ ) that carry the message from the insulin recep tor to end targets in the cytosol and nucleus, through a long series of intermediate proteins. First, a ®-T.Yr residue of IRS-1 binds to the SH2 domain of the protein Grb2. (SH2 is an abbreviation of Src homology 2, so named because the sequence of an SH2 domain is simi lar to that of a domain in Src (pronounced sark), an other protein Tyr kinase.) Several signaling proteins contain SH2 domains, all of which bind ®-TYr residues in a protein partner. Grb2 is an adaptor protein, with no intrinsic enzymatic activity. Its function is to bring to gether two proteins (in this case, IRS-I and the protein Sos) that must interact to enable signal transduction. In addition to its SH2 C®-Tyr-binding) domain, Grb2 also contains a second protein-binding domain, SH3, that binds to a proline-rich region of Sos, recruiting Sos to the growing receptor complex. When bound to Grb2,
[440]
Biosignaling
FIGURE 12-14 Activation of the insulin-receptor tyrosine kinase by autophosphorylation. (a) The insu l i n-binding region of the insulin re
ceptor l ies outside the cel l and comprises (b) two
a subun its and the
extracel l u lar portions of two {3 subun its, i ntertwined to form the i nsu l i n b i nd i ng site (pink; shown a s a surface contour model o f the crystal structu re, derived from PDB I D 2 DTG). (The structure of the transmem brane domain has not been solved by crysta l lography.) The binding of insulin (red; PDB ID 2CEU) i s communicated through the s i ngle trans membrane helix of each {3 subunit to the paired Tyr k i nase domains i n s i d e t h e cel l, activating them t o phosphorylate each other on three Tyr residues. (c) In the inactive form of the Tyr k i nase doma i n (PDB I D 1 1 RK), the activation loop (bl ue) sits i n the active site, and none o f the critical Tyr residues (black and red bal l-and-stick structu res) are phos phorylated. Th i s conformation i s sta b i l i zed by hydrogen bond ing be tween Tyr 1 1 62 and Asp 1 1 32 . (d) Activation of the Tyr kinase a l lows each f3 subunit to phosphorylate three Tyr residues (Tyr 1 1 s8, Tyr 1 1 62 , Tyr 1 1 63 ) on the other {3 subun it, shown here (PDB ID 1 1 R3). (Phosphoryl groups are depicted as an orange space-fill ing phosphorus atom and red ball and-stick oxygen atoms.) The i ntroduction of three h ig h l y charged
®-Tyr residues forces a 30 A change in the position of the activation
loop, away from the substrate-binding site, which becomes available to b i nd and phosphorylate a target protein, shown here as a red arrow.
binding site Inactive (unphosphorylated) tyrosine kinase domain
Active (triply phosphorylated) tyrosine kinase domain
Sos acts as a guanosine nucleotide-exchange factor (GEF) , catalyzing the replacement of bound GDP with GTP on Ras, a G protein. Ras is the prototype of a family of small G proteins that mediate a wide variety of signal transductions (see Box 12-2) . Like the trimeric G protein that functions with the {3-adrenergic system (Fig. 12-5) , Ras can exist in either the GTP-bound (active) or GDP-bound (inac tive) conformation, but Ras ( -20 kDa) acts as a monomer. When GTP binds, Ras can activate a protein kinase, Raf-1 (Fig. 12-15, step @) , the first of three protein kinases-Raf-1 , MEK, and ERK-that form a cascade in which each kinase activates the next by phosphorylation (step @). The protein kinases MEK and ERK are activated by phosphorylation of both a Thr and a Tyr residue. When activated, ERK mediates some of the biological effects of insulin by entering the
nucleus and phosphorylating transcription factors, such as Elkl (step @) , that modulate the transcription of about 1 00 insulin-regulated genes (step (])) . The proteins Raf-1 , MEK, and ERK are members of three larger families, for which several nomenclatures are employed. ERK is in the MAPK family (mitogen activated protein kinases; mitogens are extracellular sig nals that induce mitosis and cell division) . Soon after discovery of the first MAPK enzyme, that enzyme was found to be activated by another protein kinase, which was named MAP kinase kinase (MEK belongs to this fam ily) ; and when a third kinase that activated MAP kinase kinase was discovered, it was given the slightly ludicrous family name MAP kinase kinase kinase (Raf-1 is in this family; Fig. 12-15, step @) . Somewhat less cumbersome are the abbreviations for these three families: MAPK, MAPKK, and MAPKKK. Kinases in the MAPK and
1 2 .3 Receptor Tyro s i n e Ki nases
CD
FIGURE 1 2 - 1 5 Regulation of gene expression
Insulin receptor binds insulin and undergoes autophosphorylation on its carboxyl-terminal Tyr residues.
by insulin through a MAP kinase cascade. The
insu l i n receptor ( I N S-R) consists of two
brane and two {3 subun its that traverse the
®
membrane and protrude from the cytosol ic face. Binding of i n su l i n to the
autophosphorylation of Tyr residues i n the carboxyl-termina l domain of the {3 subun its.
SH2 domain of Grb2 binds to ®-Tyr ofiRS-1. Sos binds to Grb2, then to Ras, causing GDP release and GTP binding to Ras.
Cytosol
@
®
j j@ P P
---�
(J)
1
1
DNA
New proteins
ER
p
K
ERK moves into the nucleus and phosphorylates . nuclear transcnpbon factors such as Elkl, activating them.
k i nase domain, which then catalyzes phos phorylation of other target proteins. The signal ing pathway by which insu l i n regulates the express ion of specific genes consists of a tivates the next. I N S - R is a Tyr-spec ific k i nase; t h e other k i nases (a l l shown i n b l ue) phosphoryl ate Ser or Thr residues. MEK is a dual-specific i ty kinase, which phosphorylates
Raf-1 phosphorylates MEK on two Ser residues, activating it. MEK phosphorylates ERK on a Thr and a Tyr residue, activating it.
@
Autophosp horylation further activates the Tyr
cascade of protei n ki nases, each of which ac
Activated Ras binds and activates Raf-1. Nucleu
a subun its trig
gers a conformational change that al lows the
®
�
a sub
un its on the outer face of the plasma mem
Insulin receptor phosphorylates IRS-I on its Tyr residues.
[§] �(E�K)_/ ® (P)
[441]
both a Thr and a Tyr residue i n ERK (extracellu lar regu lated ki nase); MEK is m itogen-activated, ERK-activating ki nase; SRF is serum response factor.
�
. i� " "
Phosphorylated Elkl joins SRF to stimulate the transcription and translation of a set of genes needed for cell division.
MAPKKK families are specific for Ser or Thr residues, and MAPKKs (here, MEK) phosphorylate both a Ser and a Tyr residue in their substrate, a MAPK (here, ERK) . Biochemists now recognize the insulin pathway as but one instance of a more general scheme in which hormone signals, via pathways similar to that shown in Figure 1 2-15, result in phosphorylation of target en zymes by protein kinases. The target of phosphorylation is often another protein kinase, which then phosphory lates a third protein kinase, and so on. The result is a cascade of reactions that amplifies the initial signal by many orders of magnitude (see Fig. 12-1b) . MAPK cas cades (Fig. 12- 15) mediate signaling initiated by a vari ety of growth factors, such as platelet-derived growth factor (PDGF) and epidermal growth factor (EGF) . An other general scheme exemplified by the insulin receptor pathway is the use of nonenzymatic adaptor proteins to bring together the components of a branched signaling pathway, to which we now turn.
The Membrane Phospholipid P I P3 Functions at a Branch in Insulin Signaling
The signaling pathway from insulin branches at IRS-1 (Fig. 12-15, step ®) . Grb2 is not the only protein that associates w:ith phosphorylated IRS-1 . The enzyme phosphoinositide 3-kinase (PI -3K) binds IRS-1 through PI-3K's SH2 domain (Fig. 12-16). Thus activated, PI3K converts the membrane lipid phosphatidylinositol 4,5-bisphosphate (PIP2 ; see Fig. 1 0-16) to phos phatidylinositol 3,4,5-trisphosphate (PIP3) . The multi ply charged head group of PIP3, protruding on the cytoplasmic side of the plasma membrane, is the start ing point for a second signaling branch involving another cascade of protein kinases. When bound to PIP3, protein kinase B (PKB; also called Akt) is phosphorylated and activated by yet another protein kinase, PDK1 . The acti vated PKB then phosphorylates Ser or Thr residues in its target proteins, one of which is glycogen synthase ki nase 3 (GSK3) . In its active, nonphosphorylated form, GSK3 phosphorylates glycogen synthase, inactivating it and thereby contributing to the slow:ing of glycogen syn thesis. (This mechanism is only part of the explanation for the effects of insulin on glycogen metabolism.) When phosphorylated by PKB, GSK3 is inactivated. By thus preventing inactivation of glycogen synthase in liver and muscle, the cascade of protein phosphorylations initiated by insulin stimulates glycogen synthesis (Fig. 12- 16). In a third signaling branch in muscle and fat tissue, PKB triggers the movement of glucose trans porters (GLUT4) from internal vesicles to the plasma
[442]
Biosi g n a l i n g
CD
IRS- 1, phosphorylated by the insulin receptor, activates PI-3K by binding to its SH2 domain. PI-3K converts PIP2 to PIP3.
FIGURE 12-16 Activation of glycogen synthase by insulin.
Transmission of the s i gnal is mediated by Pl-3 kinase (PI-3 K) and protein ki nase B (PKB).
®
GSK3, inactivated by phosphorylation, cannot convert glycogen synthase (GS) to its inactive form by phosphorylation, so GS remains active.
Glycogen
@
Synthesis of glycogen from glucose is accelerated.
membrane, stimulating glucose uptake from the blood (Fig. 12-16, step @; see also Box 1 1-2) . Protein kinase B functions in several other signal ing pathways, including that triggered by 6.9tetrahydrocannabinol (THC) , the active ingredient of marijuana and hashish. THC activates the CB 1 receptor in plasma membranes in the brain, triggering a signaling cas cade that involves MAPKs. One consequence of CB 1 acti vation is the stimulation of appetite, a well-established effect of marijuana use. The normal ligands for the CB1 re ceptor are endocannabinoids such as anandamide, which serve to protect the brain from the toxicity of excessive neuronal activity-as in an epileptic seizure. Hashish has for centuries been used in the treatment of epilepsy. CHa
HO
(CR2l3- R� t.9-Tetrahydrocannabinol (THC)
Anandamide (arachidonylethanolamide, an endogenous cannabinoid)
a..�:,-- PIP2
D-�+- PIP3
L
�
·B ' -"
PKB bound to PIP3 is phosphorylated by PDKl (not shown) . Thus activated, PKB phosphorylates GSK3 on a Ser residue, a 1 :!-:!:3 shows just a few of the multivalent proteins known to participate in sig naling. Many of the complexes include components with membrane-binding domains. Given the location of so many signaling processes at the inner surface of the /,.,--- ---......
Adaptor
SH3
\-
/�
Binding domains
Grb2
� proline-rich protein or membrane lipid PIP3
(,....}
® Tyr-® Tyr-
Adaptor
PIP3 Kinase
phospholipids (Ca2+-dependent)
l
DNA transcriptional activation
Phosphatase
carboxyl-terminal domain marking protein for attachment of ubiquitin I
Transcription
Signal regulation
.
�
C2 H GTPase-activating t-"
Ras signaling
�A
--- ------
---·-- ---
- ---- -
RasGAP
STAT
socs
�
socs
Phospholipid second messenger signaling FIGURE 1 2 -23 Some binding modules of signaling proteins. Each
activities. The name of each protein is given at its carboxyl -terminal
protein is represented by a l i ne (with the amino term inus to the left);
end. These signa ling proteins interact with phosphorylated proteins
symbols i ndicate the location of conserved binding dom a i ns (with
or phosphol i pids i n many permutations and combinations to form
specificities as l isted in the key; PH denotes plextrin homology; other
i ntegrated signa l i ng complexes.
abbreviations explained in the text); green boxes indi cate cata l ytic
1 2. 6 Gated lon Channels
proximity and correct orientation and even conferring allosteric properties on the interactions among the ki nases, which makes their serial phosphorylation sensi tive to very small stimuli. Phosphotyrosine phosphatases remove the phos phate from ®-Tyr residues, reversing the effect of phosphorylation. Some of these are receptorlike mem brane proteins, presumably controlled by extracellular factors not yet identified; other PTPases are soluble and contain SH2 domains. In addition, animal cells have protein ®- Ser and ®-Thr phosphatases, which re verse the effects of Ser- and Thr-specific protein ki nases. We can see, then, that signaling occurs in protein circuits, which are effectively hard-wired from signal receptor to response effector and can be switched off instantly by the hydrolysis of a single upstream phos phate ester bond. The multivalency of signaling proteins allows for the assembly of many different combinations of signaling modules, each combination suited to particular signals, cell types, and metabolic circumstances, yielding diverse signaling circuits of extraordinary complexity. Membrane Rafts and Caveolae Segregate
activity; mutant receptors lacking this activity remain in the raft during treatment with EGF. Caveolin, an in tegral membrane protein localized in caveolae, is phosphorylated on Tyr residues in response to insulin, and the now-activated E GF-R may be able to draw its binding partners into the raft. Spatial segregation of signaling proteins in rafts adds yet another dimension to the already complex processes initiated by extra cellular signals. S U M MA RV 1 2 . 5
•
•
•
Signaling Proteins
Membrane rafts (Chapter 1 1) are regions of the mem brane bilayer enriched in sphingolipids, sterols, and certain proteins, including many attached to the bi layer by GPI anchors. The f3-adrenergic receptor is segregated in rafts that contain G proteins, adenylyl cyclase, PKA, and a specific protein phosphatase , PP2, which together provide a highly integrated sig naling unit. By segregating in a small region of the plasma membrane all of the elements required for re sponding to and ending the signal, the cell is able to produce a highly localized and brief "puff" of second messenger. Some RTKs (EGF-R and PDGF-R) seem to be local ized in rafts, and this sequestration is very probably functionally significant. When cholesterol is removed from rafts by treatment of the membrane with cy clodextrin (which binds and removes cholesterol) , the rafts are disrupted and the RTK signaling pathways become defective. If an RTK in a raft is phosphorylated, and the only locally available PTPase that reverses this phosphory lation is in another raft, then dephosphorylation of the RTK is slowed or prevented. Interactions between adaptor proteins might be strong enough to recruit into a raft a signaling protein not normally located there, or might even be strong enough to pull recep tors out of a raft. For example, the E GF-R in isolated fibroblasts is normally concentrated in specialized rafts called caveolae (see Fig. 1 1-2 1 ) , but treatment with EGF causes the receptor to leave the raft. This migration depends on the receptor's protein kinase
[449]
•
•
M u ltiva l e n t A d a p t o r P rote i n s a n d M e m b ra n e Rafts
Many signaling proteins have domains that bind phosphorylated Tyr, Ser, or Thr residues in other proteins; the binding specificity for each domain is determined by sequences that adjoin the phosphorylated residue in the substrate. SH2 and PTB domains bind to proteins containing ®-Tyr residues; other domains bind ®-Ser and ®-Thr residues in various contexts. SH3 and PH domains bind the membrane phospholipid PIP3. Many signaling proteins are multivalent, with several different binding modules. By combining the substrate specificities of various protein kinases with the specificities of domains that bind phosphorylated Ser, Thr, or Tyr residues, and with phosphatases that can rapidly inactivate a signaling pathway, cells create a large number of multiprotein signaling complexes. Membrane rafts and caveolae sequester groups of signaling proteins in small regions of the plasma membrane, enhancing their interactions and making signaling more efficient.
1 2.6 Gated I on Chan nels Ion Channels U nderlie Electrical Signaling i n Excitable Cells
Certain cells in multicellular organisms are "excitable": they can detect an external signal, convert it into an electrical signal (specifically, a change in membrane po tential), and pass it on. Excitable cells play central roles in nerve conduction, muscle contraction, hormone se cretion, sensory processes, and learning and memory. The excitability of sensory cells, neurons, and myocytes depends on ion channels, signal transducers that pro vide a regulated path for the movement of inorganic ions such as Na+ , K+, Ca2+, and Cl - across the plasma mem brane in response to various stimuli. Recall from Chap ter 1 1 that these ion channels are "gated": they may be open or closed, depending on whether the associated re ceptor has been activated by the binding of its specific
l_4 50j
�
I
Biosig n a l i n g
FIGURE 1 2-24 Transmembrane electrical potential. (a) The electrogen ic Na + K + ATPase produces a transmembrane electrical poten tial of about - 60 mV ( i nside negative). (b) Blue arrows show the d i rection in which ions tend to move spontaneously across the
(a) The electrogenic Na+K+ ATPase establishes the membrane potential.
plasma membrane in an animal cel l , driven by the combination of
Membrane potential - 50 to - 70 mV
chemical and electrical grad ients. The chemical gradient drives N a + and Ca 2 + i nward (prod u c i ng depolarization) and K + outward (producing hyperpolar i zation). The electrical gradient drives Cl- outward, against its concentration gradient (producing
Plasma membrane
=
+
+
depolarization).
(b)
+
+
+
ligand (a neurotransmitter, for example) or by a change in the transmembrane electrical potential, Vm · The Na + K+ ATPase is electrogenic; it creates a charge im balance across the plasma membrane by carrying 3 Na + out of the cell for every 2 K+ carried in (Fig. 1 2-24a), making the inside negative relative to the outside. The membrane is said to be polarized. KEY CO N V E N T I O N : Vm is negative when the inside of the cell is negative relative to the outside. For a typical animal cell, Vm = - 50 to - 70 mV. •
Because ion channels generally allow passage of ei ther anions or cations but not both, ion flux through a channel causes a redistribution of charge on the two sides of the membrane, changing Vm · Influx of a posi tively charged ion such as Na + , or efflux of a negatively charged ion such as Cl-, depolarizes the membrane and brings Vm closer to zero. Conversely, efflux of K+ hyper polarizes the membrane and Vm becomes more nega tive. These ion fluxes through channels are passive, in contrast to active transport by the Na+K+ ATPase. The direction of spontaneous ion flow across a polarized membrane is dictated by the electrochemical potential of that ion across the membrane, which has two components: the difference in concentration (C) of the ion on the two sides of the membrane, and the dif ference in electrical potential, typically expressed in millivolts. The force (�G) that causes a cation (say, Na +) to pass spontaneously inward through an ion channel is a function of the ratio of its concentrations on the two sides of the membrane (Gin/Gout) and of the dif ference in electrical potential (Vm or �lji) :
(12-1)
where R is the gas constant, T the absolute temperature, the charge on the ion, and J the Faraday constant. (Note that the sign of the charge on the ion determines the sign of the second term in Eqn 12-1 .) In a typical neu ron or myocyte, the concentrations of Na + , K+, Ca2 + , and Cl- in the cytosol are very different from those in the ex tracellular fluid (Table 12-6) . Given these concentration differences, the resting Vm of about -60 mV, and the re lationship shown in Equation 12-1 , the opening of a Na + or Ca2 + channel will result in a spontaneous inward flow of Na + or Ca2+ (and depolarization) , whereas opening Z
+ +
Ions tend to move down their electrochemical gradient across the polarized membrane.
[Na+ l High
0 0 2 K•
High
�--411� [K+]
Low
[Ca2 + J H.igh
+
+
+
+
of a K+ channel will result in a spontaneous outward flux of K+ (and hyperpolarization) (Fig. 12-24b) . A given ionic species continues to flow through a channel only as long as the combination of concentra tion gradient and electrical potential provides a driving force. For example, as Na + flows down its concentration gradient, it depolarizes the membrane. When the mem brane potential reaches_ct- 70 mV, the effect of this mem brane potential (resistance to further entry of Na +) exactly equals the effect of the [Na +] gradient (promotion of Na + flow inward) . At this equilibrium potential (E) , the driving force (�G) tending to move a Na+ ion is zero. The equilibrium potential is different for each ionic species because the concentration gradients differ. The number of ions that must flow to produce a physiologically significant change in the membrane po tential is negligible relative to the concentrations of Na + , K+, and Cl- in cells and extracellular fluid, s o the ion fluxes that occur during signaling in excitable cells have essentially no effect on the concentrations of these ions. With Ca2+, the situation is different; because the intra cellular [Ca2+] is generally very low (�10-7 M) , inward flow of Ca2 + can significantly alter the cytosolic [Ca2 +]. The membrane potential of a cell at a given time is the result of the types and numbers of ion channels open at that instant. In most cells at rest, more K+ channels than Na+ , CC, or Ca2 + channels are open and thus the resting potential is closer to the E for K+ ( 98 mV) than that for any other ion. When channels for Na + , Ca2 + , or Cl- open, the membrane potential moves toward the E for that ion. The precisely timed opening and closing of ion channels and the resulting transient changes in -
1 2.6 Gated ion Channels
TAB LE 1 2-6
lon Conctntradons K+ Out
Squid axon
400
20
Frog muscle
124
2.3
In
Out
In
Out
In
10
40-150
50
440
:S0.4
1 0.4
109
10 7 ions/s) . After being opened-activated-by a reduction in transmembrane electrical potential, a Na+ channel undergoes very rapid inactivation-within milliseconds, the channel closes and remains inactive for many milliseconds. As voltage-gated K+ channels open in response to the depolarization induced by the opening of Na + channels, the resulting efflux of K+ repolarizes the membrane locally. A brief pulse of depolarization thus traverses the axon as local depolarization triggers the brief opening of neighboring Na+ channels, then K+ channels (Fig. 12-25) . The short refractory period that follows the opening of each Na + channel, during which it cannot open again, ensures that a unidirectional wave of depolarization-the action potential-sweeps from the nerve cell body toward the end of the axon (step CD in Fig. 12-25) . When the wave of depolarization reaches the voltage-gated Ca2 + channels, they open (step @) , and Ca2 + enters from the extracellular space. The rise in cy toplasmic [Ca2 + ] then triggers release of acetylcholine by exocytosis into the synaptic cleft (step @) . Acetyl-
I Domain �
III
�
choline diffuses to the postsynaptic cell (another neu ron or a myocyte) , where it binds to acetylcholine re ceptors and triggers depolarization. Thus the message is passed to the next cell in the circuit. We see, then, that gated ion channels convey signals in either of two ways: by changing the cytoplasmic concentration of an ion (such as Ca2 +), which then serves as an intracellular second messenger, or by changing Vm and affecting other membrane proteins that are sensitive to Vm· The passage of an electrical signal through one neuron and on to the next illustrates both types of mechanism. We discussed the structure and mechanism of volt age-gated K+ channels in some detail in Section 1 1 .3 (see Figs 1 1--48 through 1 1-50) . Here we take a closer look at Na + channels. The essential component of a Na+ channel is a single, large polypeptide (1 ,840 amino acid residues) organized into four domains clustered around a central channel (Fig. 1 2-26a, b ), providing a path for Na + through the membrane. The path is made Na +-specific by a "pore region" composed of the segments between trans membrane helices 5 and 6 of each domain, which fold into the channel. Helix 4 of each domain has a high density of positively charged Arg residues; this segment is believed
Selectivity filter (pore region)
IV
Activation gate (a)
Inactivation gate
Voltage sensor
FIGURE 1 2-26 Voltage-gated Na+ channels of neurons. Sodium chan nels of different tissues and organisms have a variety of subunits, but only the principal subunit
(a) is essential.
(a) The
a subunit is a large
protein with four homologous domains (I to IV, shown spread out here
Activation gate
to i l l ustrate the parts), each conta i n ing six transmembrane hel ices (1 to 6). Hel i x 4 in each domain (bl ue) is the voltage sensor; helix 6 (orange) is thought to be the activation gate. The segments between helices 5 and
6, the pore region (red), form the selectivity fi lter, and the segment con necting domains Ill and IV (green) i s the i nactivation gate. (b) The four domains are wrapped about a central transmembrane channel l i ned
with polar amino acid residues. The four pore regions (red) come to gether near the extracellu lar su rface to form the selectivity filter, which is conserved i n all N a + channels. The filter gives the channel its abil ity to discriminate between Na + and other ions of simi lar size. The inacti
�id-;;-Membrane polarized, Voltage sensor channel closed
vation gate (green) c loses (dotted l i nes) soon after the activation gate opens. (c) The voltage-sensing mechanism i nvolves movement of hel i x 4 (bl ue) perpendicular t o t h e plane o f t h e membrane i n response t o a change in transmembrane potential. As shown at the top, the strong positive charge on helix 4 a l lows it to be pul led inward in response to the i nsi de-negative membrane potential Wml· Depolarization lessens this pull, and helix 4 relaxes by moving outward (bottom). This move ment is communicated to the activation gate (orange), inducing confor mational changes that open the channel in response to depolarization.
M.embrane de� olarized, ••
(c)
Na '
channel open
1 2 .6 Gated l o n Channels
to move within the membrane in response to changes in the transmembrane voltage, from the resting potential of about -60 mV to about + 30 mV. The movement of helix 4 triggers opening of the channel, and this is the basis for the voltage gating (Fig. 12-26c) . Inactivation of the channel is thought to occur by a ball-and-chain mechanism. A protein domain on the cy toplasmic surface of the Na + channel, the inactivation gate (the ball) , is tethered to the channel by a short seg ment of the polypeptide (the chain; Fig. 12-26b) . This domain is free to move about when the channel is closed, but when it opens, a site on the inner face of the channel becomes available for the tethered ball to bind, blocking the channel. The length of the tether seems to determine how long an ion channel stays open: the longer the tether, the longer the open period. Other gated ion channels may be inactivated by a similar mechanism. The Acetylcholine Receptor Is a Ligand-Gated I on Channel
The nicotinic acetylcholine receptor mediates the passage of an electrical signal at some types of synapses and at a neuromuscular junction (between motor neuron and muscle fiber) , signaling the muscle to contract. (Nicotinic acetylcholine receptors were originally distinguished from muscarinic acetylcholine receptors by the sensitivity of the former to nicotine, the latter to the mushroom alkaloid muscarine. They are structurally and functionally different.) Acetyl choline released by the presynaptic neuron or motor neuron diffuses a few micrometers to the plasma mem brane of the postsynaptic neuron or myocyte, where it binds to the acetylcholine receptor. This forces a con formational change in the receptor, causing its ion channel to open. The resulting inward movement of cations depolarizes the plasma membrane. In a muscle fiber, this triggers contraction. The acetylcholine recep tor allows ready passage to Na +, Ca2 + , and K+ ions, but other cations and all anions are unable to pass. Move ment of Na + through an acetylcholine receptor ion chan nel is unsaturable (its rate is linear with respect to extracellular [Na +]) and very fast-about 2 x 107 ions/s under physiological conditions.
[453]
ceptor, but not the exact mechanism of "desensitization," in which the gate remains closed even in the continued presence of acetylcholine. The nicotinic acetylcholine receptor has five sub units: single copies of subunits {3, y, and 8, and two identical a subunits that each contain an acetylcholine binding site. All five subunits are related in sequence and tertiary structure, each having four transmembrane helical segments (Ml to M4) (Fig. 1 2-27a) . The five subunits surround a central pore, which is lined with their M2 helices (Fig. 12-27b, c) . The pore is about 20 A wide in the parts of the channel that protrude on the cy toplasmic and extracellular surfaces, but narrows as it passes through the lipid bilayer. Near the center of the bilayer is a ring of bulky hydrophobic side chains of Leu residues in the M2 helices, positioned so close together that they prevent ions from passing through the channel (Fig. 12-27d) . Allosteric conformational changes in duced by acetylcholine binding to the two a subunits in clude a slight twisting of the M2 helices, which draws these hydrophobic side chains away from the center of the channel, opening it to the passage of ions. Neurons Have Receptor Channels That Respond to Different Neurotransmitters
Animal cells, especially those of the nervous system, con tain a variety of ion channels gated by ligands, voltage, or both. We have so far focused on acetylcholine as neuro transmitter, but there are many others. 5-Hydroxytrypta mine (serotonin) , glutamate, and glycine all can act through receptor channels that are structurally related to the acetylcholine receptor. Serotonin and glutamate trig ger the opening of cation (K+ , Na + , Ca2 +) channels, whereas glycine opens Cl--specific channels. Cation and anion channels are distinguished by subtle differences in the amino acid residues that line the hydrophilic channel. Cation channels have negatively charged Glu and Asp side chains at crucial positions. When a few of these acidic residues are experimentally replaced with basic residues, the cation channel is converted to an anion channel. +
coo I
H3N- CH
I
CH2 Serotonin ( 5-hydroxytryptamine) Acetylcholine
Like other gated ion channels, the acetylcholine re ceptor opens in response to stimulation by its signal molecule and has an intrinsic timing mechanism that closes the gate milliseconds later. Thus the acetylcholine signal is transient-as we have seen, an essential feature of electrical signal conduction. We understand the struc tural changes underlying gating in the acetylcholine re-
I
CH2
I coo-
Glutamate
Depending on which ion passes through a channel, binding of the ligand (neurotransmitter) for that chan nel results in either depolarization or hyperpolarization of the target cell. A single neuron normally receives input from many other neurons, each releasing its own characteristic neurotransmitter with its characteristic depolarizing or hyperpolarizing effect. The target cell's
[4 s 4]
Biosig n a l i n g
(a) Subunit folds into four transmembrane a helices +
NH3
(b) M2 amphipathic helices surround channel
(c) Acetylcholine binding sites
coo-
Bulky, hydrophobic Leu side chains of M2 helices close the channel.
Binding of two acetylcholine molecules causes twisting of the M2 helices.
M2 helices now have smaller, polar residues lining the channel.
FIGURE 1 2-27 The acetylcholine receptor ion channel. (a) Each of the
(d) This top view of a cross section through the center of the M2 hel i ces
five homologous subun its (a2 f3y/3) has four transmembrane hel ices, M 1
shows five Leu side chains (yellow), one from each M2 hel i x, protrud
drophobic residues. (b) The five subunits are arranged around a central
passage of Ca2 + , Na + , or K + . When both acetylchol ine receptor sites
to M4. The M2 helices are amphipathic; the others have mainly hy
i ng into the channel and constricting it to a diameter too sma l l to al low
transmembrane channel, which is l i ned with the polar sides of the M2
(one on each a subunit) are occupied, a conformational cha nge oc
hel ices. At the top and bottom of the channel are rings of negatively
curs. As the M2 hel i ces twist slightly, the five Leu residues rotate away
cha rged amino acid residues. (c) A model of the acetylcho l i ne recep
from the channel and are replaced by smal ler, polar residues (blue).
tor, based on electron mi croscopy and x-ray structure determi nation of
Th is gating mechanism opens the channel, a l lowing the passage of Ca2 + , N a + , or K + .
a related protein (the acetylcholi ne-binding protein from a mollusk).
Vm therefore reflects the integrated input (Fig. 1 2-ld) from multiple neurons. The cell responds with an action potential only if the integrated input adds up to a net de polarization of sufficient size. The receptor channels for acetylcholine, glycine, glu tamate, and y-aminobutyric acid (GABA) are gated by extracellular ligands. Intracellular second messengers such as cAMP, cGMP, IP3, Ca2 + , and ATP-regulate ion channels of another class, which, as we shall see in Section 12.10, participate in the sensory transductions of vision, olfaction, and gustation. Toxins Target I on Channels
Many of the most potent toxins found in nature act on ion channels. As we noted in Section 1 1 .3, for example, dendrotoxin (from the black mamba snake) blocks the action of voltage-gated K+ channels, tetrodotoxin
(produced by puffer fish) acts on voltage-gated Na + channels, and cobrotoxin disables acetylcholine recep tor ion channels. Why, in the course of evolution, have ion channels become the preferred target of toxins, rather than some critical metabolic target such as an en zyme essential in energy metabolism? Ion channels are extraordinary amplifiers; opening of a single channel can allow the flow of 10 million ions per second. Consequently, relatively few molecules of an ion channel protein are needed per neuron for signaling functions. This means that a relatively small number of toxin molecules with high affinity for ion channels, acting from outside the cell, can have a very pronounced effect on neurosignaling throughout the body. A compa rable effect by way of a metabolic enzyme, typically present in cells at much higher concentrations than ion channels, would require far more copies of the toxin molecule.
1 2 . 7 l ntegrins: B i d i rectio n a l Cell Adhesion Receptors
S U M M A RY 1 2 . 6
Gated l o n C h a n n e l s
•
Ion channels gated by membrane potential or ligands are central to signaling in neurons and other cells.
•
The voltage-gated Na + and K+ channels of neuronal membranes carry the action potential along the axon as a wave of depolarization (Na + influx) followed by repolarization (K+ efflux) .
•
The gating mechanism for voltage-sensitive channels involves the movement, perpendicular to the plane of the membrane, of a transmembrane peptide with a high charge density, due to the presence of Arg or other charged residues.
•
Arrival of an action potential at the distal end of a presynaptic neuron triggers neurotransmitter release. The neurotransmitter (acetylcholine , for example) diffuses to the postsynaptic neuron (or the myocyte, at a neuromuscular junction) , binds to specific receptors in the plasma membrane, and triggers a change in Vm.
•
The acetylcholine receptor of neurons and myocytes is a ligand-gated ion channel; acetylcholine binding triggers a conformational change that opens the channel to Na + and Ca2 + ions.
•
[4ss]
Neurotoxins produced by many organisms attack neuronal ion channels, and are therefore fast-acting and deadly.
Cysteine-rich domain
Outside
Actin filaments in cytt�skeleton
/
FIGURE 1 2-28 Two-way signaling by integrins. A l l i ntegrins have one
a and one {3 subun it, each with a short cytoplasmic extension, a single transmembrane hel ix, and a large extracellu lar domain with the l ig and-b inding site. The {3 subunit is rich in Cys res idues and has exten
1 2.7 l nteg ri ns: Bidirectional Cel l
sive i ntrachain disu lfide bonding. The
a subunit in many integrins has
several binding sites for d ivalent cations such as Ca2 +, which are i n
Adhesion Receptors
trinsic to the l igand-binding activity. Ligands in the extrace l l u l a r matrix
Integrins are proteins of the plasma membrane that me diate the adhesion of cells to each other and to the extra cellular matrix, and carry signals in both directions across the membrane (Fig. 12-28). The mammalian genome encodes 1 8 different a subunits and 8 different f3 sub units, which are found in a range of combinations with various ligand-binding specificities in various tissues. Each of the 24 different integrins found thus far seems to have a unique function. Because they can inform cells about the extracellular neighborhood, integrins play cru cial roles in processes that require selective cell-cell inter actions, such as embryonic development, blood clotting, immune cell function, and tumor growth and metastasis. The extracellular ligands that interact with integrins include collagen, fibrinogen, fibronectin, and many other proteins that have the sequence recognized by integrins: -Arg-Gly-Asp- (RGD) . The short, cytoplasmic exten sions of the a and f3 subunits interact with cytoskeletal proteins just beneath the plasma membrane-talin, a actinin, vinculin, paxillin, and others-modulating the assembly of actin-based cytoskeletal structures. The dual association of integrins with the extracellular matrix and the cytoskeleton allows the cell to integrate infor mation about its extracellular and intracellular environ ments, and to coordinate cytoskeletal positioning with
n i zed by an i ntegrin, or proteoglycan components such as heparan sul
include proteins such as collagen that have the RGD sequence recog fate. The extracellu lar l igand b i n d i ng is comm u n i cated to the cytosol i c domains, produc ing conformational changes that affect the assoc iation of i ntegrin with proteins such as tal in, which, i n turn, connect the integrin to actin filaments in the cytoskeleton underlying the plasma membrane . B i nding of i ntracellular protein l igands to the cytosol i c doma i n c a n alter t h e affi n ity o f t h e integrin for i t s extrace l l u lar b i n d i n g partners, cha nging t h e cel l's adhesion t o t h e extracel l u lar matrix.
extracellular adhesion sites. In this capacity, integrins govern the shape, motility, polarity, and differentiation of many cell types. In "outside-in" signaling, the extracellular domains of an integrin undergo dramatic, global conforma tional changes when ligand binds at a site many angstroms from the transmembrane helices. These changes somehow alter the dispositions of the cytoplasmic tails of the a and f3 subunits, changing their interactions with intracellular pro teins and thereby conducting the signal inward. The conformation and adhesiveness of integrin extracellular domains are also dramatically altered by signals from inside the cell. In one conformation, the extracellular domains have no affinity for the proteins of the extracellular matrix, but signals from the cell can fa vor another conformation in which integrins adhere tightly to extracellular proteins (Fig. 12-28) .
[4s6]
Biosignaling
Regulation of adhesiveness is central to leukocyte homing to the site of an infection (see Fig. 7-3 1 ) , interactions between immune cells, and phagocytosis by macrophages. During an immune response, for example, leukocyte integrins are activated (exposing their extra cellular ligand-binding sites) from inside the cell via a signaling pathway triggered by cytokines (extracellular developmental signals) . Thus activated, the integrins can mediate the attachment of leukocytes to other im mune cells or can target cells for phagocytosis. Mutation in an integrin gene encoding the f3 subunit known as CD18 is the cause of leukocyte adhesion deficiency, a rare human genetic disease in which leukocytes fail to pass out of blood vessels to reach sites of infection. In fants with a severe defect in CD18 commonly die of in fections before the age of two. An integrin specific to platelets (aubf33) is involved in both normal and pathological blood clotting. Local damage to blood vessels at a site of injury exposes high-affinity binding sites (RGD sequences in thrombin and collagen, for example) for the integrins of platelets, which attach themselves to the lesion, to other platelets, and to the clot ting protein fibrinogen, leading to clot formation that pre vents further bleeding. Mutations in the a or f3 subunit of platelet integrin aubf33 lead to a bleeding disorder known as Glanzma:n:n thrombasthenia, in which individuals bleed excessively after a relatively minor injury. Overly effective blood coagulation is also undesirable. Dysregulation of platelet adhesion can lead to pathological blood clot for mation, resulting in blockage of the arteries that supply blood to the heart and brain and increasing the risk of heart attack and stroke. Drugs such as tirofiban and eptifi batide that block the external ligand-binding sites of platelet integrin reduce clot formation and are useful in treating and preventing heart attacks and strokes. When tumors metastasize, tumor cells lose their ad hesion to the originating tissue and invade new loca tions. Both the changes in tumor cell adhesion and the development of new blood vessels (angiogenesis) to support the tumor at a new location are modulated by specific integrins. These proteins are therefore potential targets for drugs that suppress the migration and reloca tion of tumor cells. • ,
S U M M A RY 1 2 . 7 •
•
•
l n t e g r i n s : B i d i recti o n a l C e l l A d h e s i o n Receptors
Integrins are a family of dimeric (a{3 ) plasma membrane receptors that interact with extracellular macromolecules and the cytoskeleton, carrying signals in and out of the cell. The active and inactive forms of an integrin differ in the conformation of their extracellular domains. Intracellular events and signals can interconvert the active and inactive forms. Integrins mediate various aspects of the immune response, blood clotting, and angiogenesis, and they play a role in tumor metastasis.
1 2.8 Regu lation of Transcription by Steroid Hormones The steroid, retinoic acid (retinoid) , and thyroid hor mones form a large group of hormones (receptor lig ands) that exert at least part of their effects by a mechanism fundamentally different from that of other hormones: they act in the nucleus to alter gene expres sion. We discuss their mode of action in detail in Chap ter 28, along with other mechanisms for regulating gene expression. Here we give a brief overview. Steroid hormones (estrogen, progesterone, and cor tisol, for example) , too hydrophobic to dissolve readily in the blood, are transported on specific carrier proteins from their point of release to their target tissues. In tar get cells, these hormones pass through the plasma membrane by simple diffusion and bind to specific re ceptor proteins in the nucleus (Fig. 12-29) . Steroid hormone receptors with no bound ligand (aporecep tors) often act to suppress the transcription of target genes. Hormone binding triggers changes in the confor mation of a receptor protein so that it becomes capable of interacting with specific regulatory sequences in DNA called hormone response elements (HREs), thus altering gene expression (see Fig. 28-34) . The bound receptor-hormone complex enhances the expression of specific genes adjacent to HREs, with the help of several other proteins essential for transcription. Hours or days are required for these regulators to have their full effect-the time required for the changes in RNA syn thesis and subsequent protein synthesis to become evident in altered metabolism. The specificity of the steroid-receptor interac tion is exploited in the use of the drug tamox ifen to treat breast cancer. In some types of breast cancer, division of the cancerous cells depends on the continued presence of estrogen. Tamoxifen is an estro gen antagonist; it competes with estrogen for binding to the estrogen receptor, but the tamoxifen-receptor com plex has little or no effect on gene expression. Conse quently, tamoxifen administered after surgery or during chemotherapy for hormone-dependent breast cancer slows or stops the growth of remaining cancerous cells. Another steroid analog, the drug mifepristone (RU486) , binds to the progesterone receptor and blocks hormone actions essential to implantation of the fertilized ovum in the uterus. •
Tamoxifen
Mifepristone (RU486)
1 2 .9 S i g n a l i n g in M icroorganisms a n d Pla nts
Serum binding protein with bound hormone
[4s 7]
CD
I
Plasma membrane
Hormone (H), carried to the target tissue on serum binding proteins, diffuses across the plasma membrane and binds to its specific receptor protein (Rec) in the nucleus.
®
Hormone binding changes the conformation of Rec; it forms homo or heterodimers with other hormone receptor complexes and binds to specific regulatory regions called hormone response elements (HREs) in the DNA adjacent to specific genes.
Nucleus Rec
®
RNA pol ymeras
r.:ransc:Mplion)
HRE
Ql.R
� �� ��
,
·
\
G ne
@
A
:/
®
Receptor attracts coactivator or corepressor protein(s) and, with them, regulates transcription of the adjacent gene(s), increasing or decreasing the rate of mRNA formation.
0
Altered levels of the hormone regulated gene product produce the cellular response to the hormone.
translation on ribosomes
FIGURE 1 2-29 General mechanism by which steroid and thyroid hormones, retinoids, and vitamin D regulate gene expression. The deta i l s of transcription and protein synthesis are discussed in Chapters 26 and 2 7 . Some
steroids also act through plasma membrane receptors by a comp letely different mechanism.
1 2.9 Signaling in Microorganisms and Plants
Certain effects of steroids seem to occur too fast to be the result of altered protein synthesis via the classic mechanism of steroid hormone action through nuclear receptors. For example, the estrogen-mediated dilation of blood vessels is known to be independent of gene transcription or protein synthesis, as is the steroid induced decrease in cellular [cAMP] . Another transduc tion mechanism involving plasma membrane receptors may be responsible for some of these effects.
Much of what we have said here about signaling relates to mammalian tissues or cultured cells from such tissues. Bacteria, archaea, eukaryotic microorganisms, and vas cular plants must also respond to a variety of external signals-02 , nutrients, light, noxious chemicals, and so on. We turn here to a brief consideration of the kinds of signaling machinery used by microorganisms and plants.
S U M M A RY 1 2 . 8
i n a Two-Component System
Bacterial Signaling Entails Phosphorylation
R e g u l a t i o n of Tra n sc r i p t i o n by Stero i d H o r m o n e s
•
Steroid hormones enter cells and bind to specific receptor proteins.
•
The hormone-receptor complex binds specific regions of DNA, the hormone response elements, and interacts with other proteins to regulate the expression of nearby genes.
•
Certain effects of steroid hormones may occur through a different, faster, signaling pathway.
responds to nutrients in its environ ment, including sugars and amino acids, by swimming toward them, propelled by one or a few flagella. A fam ily of membrane proteins have binding domains on the outside of the plasma membrane to which specific at tractants (sugars or amino acids) bind (Fig. 1 2-30). Ligand binding causes another domain on the inside of the plasma membrane to autophosphorylate a His residue. This first component of the two-component system, the receptor histidine kinase, then cat alyzes transfer of the phosphoryl group from the His residue to an Asp residue on a second, soluble protein,
Escherichia coli
[4 s8]
Biosig n a l i n g
Receptor/His kinase (component 1)
FIGURE 1 2-30 The two-component sig
I
naling mechanism i n bacterial chemo taxis. When an attractant l igand (A) b i nds
to the receptor doma i n of the membrane bound receptor, a protei n H is k i nase i n the cytoso l i c dom a i n (component 1 ) i s activated and autophosphorylates a H i s residue. Th is phosphoryl group i s then transferred to an Asp residue on compo nent 2 (in some cases, as shown here, a separate protein; in others, another do m a i n of the receptor protein). After phos phorylation, component 2 moves to the
d q� �)� �
Attractant
base of the flagellum, where it reverses the d i rection of rotation of the flage l l a r motor.
'
His
\
Phosphorylated form of component 2 reverses direction of motor
E. coli
Plasma membrane
the response regulator; this phosphoprotein moves to the base of the flagellum, carrying the signal from the membrane receptor. The flagellum is driven by a rotary motor that can propel the cell through its medium or cause it to stall, depending on the direction of motor rotation. Information from the receptor allows the cell to determine whether it is moving toward or away from the source of the attractant. If its motion is toward the attractant, the response regulator signals the cell to continue in a straight line; if away from it, the cell tum bles momentarily, acquiring a new direction. Repeti tion of this behavior results in a random path, biased toward movement in the direction of increasing attrac tant concentration. E. coli detects not only sugars and amino acids but also 0 2 , extremes of temperature, and other environ mental factors, using this basic two-component system. TWo-component systems have been detected in many other bacteria, both gram-positive and gram-negative, and in archaea, as well as in protists and fungi. Clearly, this signaling mechanism developed early in the course of cellular evolution and has been conserved. Various signaling systems used by animal cells also have analogs in bacteria. As the full genomic sequences of more, and more diverse, bacteria become known, re searchers have discovered genes that encode proteins similar to protein Ser or Thr kinases, Ras-like proteins regulated by GTP binding, and proteins with SH3 do mains. Receptor Tyr kinases have not been detected in bacteria, but ®-Tyr residues do occur in some bacte rial proteins, so there must be an enzyme that phospho rylates Tyr residues. Signaling Systems of Plants Have Some of the Same
Rotary motor (controls flagellum)
Response regulator (component 2)
to warn of the presence of noxious chemicals and dam aging pathogens (Fig. 12-3 1 ) . At least a billion years of evolution have passed since the plant and animal branches of the eukaryotes diverged, which is reflected in the differences in signaling mechanisms: some plant mechanisms are conserved-that is, are similar to those in animals (protein kinases, adaptor proteins, cyclic nucleotides, electrogenic ion pumps, and gated ion channels) ; some are similar to bacterial two-component systems; and some are unique to plants (light-sensing mechanisms, for example) (Table 12-7) . The genome of the plant Arabidopsis thaliana, for example, encodes about 1 ,000 protein Sertrhr kinases, including about 60 MAPKs and nearly 400 membrane-associated receptor ki nases that phosphorylate Ser or Thr residues; a variety of protein phosphatases; adaptor proteins that form scaf folds on which proteins assemble in signaling complexes;
Temperature Humidity
Wind
=:=>
Insects Herbivores Pathogens
Pathogens Parasites
Com ponents Used by Microbes and Mammals
Like animals, vascular plants must have a means of com munication between tissues to coordinate and direct growth and development; to adapt to conditions of 02 , nutrients, light, temperature, and water availability; and
Toxic molecules Water status
Microorganisms Gravity
FIGURE 1 2-31 Some stimuli that produce responses in plants.
1 2 . 9 Signaling i n M icroorga n i s m s and Plants
[4s9]
TAB L E 1 2-7 Mammals
Plants
Bacteria
Ion channels
+
+
+
Electrogenic ion pumps
+
+
+
'I\vo-component His kinases
+
+
+
Adenylyl cyclase
+
+
+
Guanylyl cyclase
+
+
?
Receptor protein kinases (Sertrhr) Ca2 + as second messenger
+
+
?
+
+
Ca2 + channels
?
+
+
?
Calmodulin, CaM-binding protein
+
+
MAPK cascade
+
+
Cyclic nucleotide-gated channels IP3-gated Ca2 + channels
+
+
+
+
Phosphatidylinositol kinases
+
+
+
+1-
Trimeric G proteins
+
+1 -
Signaling component
GPCRs PI-specific phospholipase C
+
?
Tyrosine kinase receptors
+
?
SH2 domains
+
?
Nuclear steroid receptors
+
Protein kinase A
+
Protein kinase G
+
enzymes for the synthesis and degradation of cyclic nu cleotides; and I 00 or more ion channels, including about 20 gated by cyclic nucleotides. Inositol phospholipids are present, as are kinases that interconvert them by phos phorylation of inositol head groups. However, some types of signaling proteins common in animal tissues are not present in plants, or are repre sented by only a few genes. Cyclic nucleotide-dependent protein kinases (PKA and PKG) seem to be absent, for example. Heterotrimeric G proteins and protein Tyr kinase genes are much less prominent in the plant genome, and genes for GPCRs, the largest family of pro teins in the human genome ( - 1 ,000 genes) , are very sparsely represented in the plant genome. DNA-binding nuclear steroid receptors are certainly not prominent, and may be absent from plants. Although plants lack the most widely conserved light-sensing mechanism present in animals (rhodopsin, with retinal as pigment) , they have a rich collection of other light-detecting mecha nisms not found in animal tissues-phytochromes and cryptochromes, for example (Chapter 19) . The kinds o f compounds that elicit signals in plants are similar to certain signaling molecules in mammals (Fig. 12-32). Instead of prostaglandins, plants have jas monate; instead of steroid hormones, brassinosteroids. About 100 different small peptides serve as plant signals, and both plants and animals use compounds derived from aromatic amino acids as signals.
+
?
Animals
Plants
0
coo-
OH
0
Jasmonate
U:Jcoo H
[ndole-3-acetate (an auxin)
OH
'(c) Prostaglandin E 1
HO
� I
'
N
I
•
NH 3
H
Serotonin (5-hydroxytryptamine)
OH HO HO Brassinolide (a brassinosteroid)
Estradiol
FIGURE 1 2-32 Structural similarities between plant and animal signals.
[460]
Biosign a l i n g
Plants Detect Ethylene through a Two-Component System and a MAPK Cascade
The gaseous plant hormone ethylene (CH2 =CH 2 ) , which stimulates the ripening of fruits (among other functions) , acts through receptors that are related in primary sequence to the receptor His kinases of the bacterial two-component systems and probably evolved from them. In Arabidopsis , the two-compo nent signaling system is contained within a single inte gral membrane protein of the endoplasmic reticulum (not the plasma membrane) . Ethylene diffuses into the cell through the plasma membrane and into the ER. The first downstream component affected by eth ylene signaling is a protein Ser/Thr kinase (CTR l ; Fig. 1 2-33) with sequence homology to Raf, the pro tein kinase that begins the MAPK cascade in the mam malian response to insulin (see Fig. 12-1 5) . In plants,
8�
Ethylene
Ethylene receptor
I ®
2
Two-component system
ER lumen
I
Endoplasmic reticuJum
Cytosol
Nucleus
.r DNA
J.'\/"r mRNA � Ethylene response proteins
FIGURE 1 2-33 Transduction mechanism for detection of ethylene by plants. The ethylene receptor (pink) in the endoplasmic reticu l u m is a
two-component system contained in a si ngle protein, with a receptor domain (component 1 ) and a response regul ator domain (component 2 ) . The receptor controls ( i n ways we do not yet u nderstand) the activ ity of CTR l , a protein ki nase similar to MAPKKKs and therefore pre sumed to be part of a MAPK cascade. CTRl is a negative regulator of the ethylene response; when CTRl is inactive, the ethylene signal is
transm itted through the gene product EIN2 (thought to be a nuclear envelope protei n), which causes increased synthesis of ERFl , a tran scription factor. ERFl stimulates expression of proteins specific to the ethylene response.
in the absence of ethylene, the CTR1 kinase is active and inhibits the MAPK cascade, preventing transcrip tion of ethylene-responsive genes. Exposure to ethyl ene inactivates the CTRl kinase, thereby activating the MAPK cascade that leads to activation of the tran scription factor EIN3. Active E IN3 stimulates the syn thesis of a second transcription factor (ERF1 ) , which in turn activates transcription of ethylene-responsive genes; the gene products affect processes ranging from seedling development to fruit ripening. Although ap parently derived from the bacterial two-component signaling system, the ethylene system in Arabidopsis is different in that the His kinase activity that defines component 1 in bacteria is not essential to signal trans duction in Arabidopsis. Receptorlike Protein Kinases Transduce Signals from Peptides and Brassinosteroids
One common motif in plant signaling involves receptor like kinases (RLKs) , which have a single helical seg ment in the plasma membrane that connects a receptor domain on the outside with a protein Ser/Thr kinase on the cytoplasmic side. This type of receptor participates in the defense mechanism triggered by infection with a bacterial pathogen (Fig. 1 2-34a) . The signal to turn on the genes needed for defense against infection is a pep tide (flg22) released by breakdown of flagellin, the ma jor protein of the bacterial flagellum. Binding of flg22 to the FLS2 receptor of Arabidopsis induces receptor dimerization and autophosphorylation on Ser and Thr residues, and the downstream effect is activation of a MAPK cascade like that described above for insulin ac tion (Fig. 12-15) . The final kinase in this cascade acti vates a specific transcription factor, triggering synthesis of the proteins that defend against the bacterial infec tion. The steps between receptor phosphorylation and the MAPK cascade are not yet known. A phosphoprotein phosphatase (KAPP) associates with the active receptor protein and inactivates it by dephosphorylation to end the response. The MAPK cascade in the plant's defense against bacterial pathogens is remarkably similar to the innate immune response in mammals (Fig. 12-34b) that is trig gered by bacterial lipopolysaccharide and mediated by the Toll-like receptors (TLRs, a name derived from a Drosophila mutant originally called Toll (German, "mad") ; TLRs were subsequently found in many other organisms and were shown to function in embryonic de velopment) . Other membrane receptors use similar mechanisms to activate a MAPK cascade, ultimately ac tivating transcription factors and turning on the genes essential to the defense response. Most of the several hundred RLKs in plants are pre sumed to act in similar ways: ligand binding induces dimerization and autophosphorylation, and the acti vated receptor kinase triggers downstream responses by phosphorylating key proteins at Ser or Thr residues.
1 2. 1 0 Sensory Tra nsd uction in Vision, Olfaction, a n d Gustation
(a)
Plant (Arabidopsis)
(b)
[46 1]
Mammal Toll-like receptors
cascade
Transcription factors WRKY22, 29
Transcription factors Jun, Fos
Transcription factor NFKB
[mmune response proteins FIGURE 1 2-34 Similarities between the signaling pathways that trig
phosphorylation triggers proteolytic degradation of the inhibitor and
ger immune responses in plants and animals. (a) I n Arabidopsis
frees the transcription factors to sti mulate gene expression related to
thaliana, the peptide flg2 2 , derived from the flagella of a bacterial
the i mmune response. (b) In mammals, a toxic bacterial l ipopolysac
pathogen, bi nds to its receptor (FLS) in the p l asma membrane, caus i ng
charide (LPS; see Fig. 7-30) is detected by p l asma membrane recep
the receptor to form di mers and triggering autophosphorylation of the
tors, which then associate with and activate a soluble protein kinase
cytosol i c protein kinase domain on a Ser orThr residue (not a Tyr). Thus
( I RAK). The major flagel lar protein of pathogen i c bacteria acts through
activated, the protein k i nase phosphorylates downstream proteins (not
a s i m i l a r receptor, also activating IRAK. The activated I RAK i n i tiates
shown). The activated receptor also activates (by means unknown) a
two distinct MAPK cascades that end i n the nucleus, causing the
MAPK cascade, which leads to phosphorylation of a nuclear protein
synthesis of proteins needed in the i mmune response. jun, Fos, and
that normally i n h ibits the transcription factors WRKY22 and 29; this
NFKB are transcription factors.
S U M M A RY 1 2 . 9
•
S ig n a l i n g i n M icro o rg a n isms a n d Pla nts
•
Bacteria and eukaryotic microorganisms have a variety of sensory systems that allow them to sample and respond to their environment. In the two-component system, a receptor His kinase senses the signal and autophosphorylates a His residue, then phosphorylates an Asp residue of the response regulator.
•
Plants respond to many environmental stimuli and employ hormones and growth factors to coordinate the development and metabolic activities of their tissues. Plant genomes encode hundreds of signaling proteins, including some very similar to those of mammals.
•
1\vo-component signaling mechanisms common in bacteria are found in modified forms in plants, used in the detection of chemical signals and light.
Plant receptorlike kinases (RLKs) participate in detecting a wide variety of stimuli, including brassinosteroids, peptides that originate from pathogens, and developmental signals. RLKs autophosphorylate Ser!rhr residues, then activate downstream proteins, which in some cases are MAPK cascades. The end result is increased transcription of specific genes.
1 2. 1 0 Sensory Transd uction in Vision, Olfaction, and Gustation The detection of light, odors, and tastes (vision, olfaction, and gustation, respectively) in animals is accomplished by specialized sensory neurons that use signal-transduction mechanisms fundamentally similar to those that detect hormones, neurotransmitters, and growth factors. An initial sensory signal is amplified greatly by mechanisms that include gated ion channels and intracellular second
[462]
Biosig n a l i n g
messengers; the system adapts to continued stimulation by changing its sensitivity to the stimulus (desensitiza tion) ; and sensory input from several receptors is inte grated before the final signal goes to the brain. The Visual System Uses Classic G PCR Mechanisms
In the vertebrate eye, light entering through the pupil is focused on a highly organized collection of light sensitive neurons (Fig. 1 2-35 ) . The light-sensing cells are of two types: rods (about 1 09 per retina) , which sense low levels of light but cannot discriminate colors, and cones (about 3 x 1 06 per retina) , which are less sensitive to light but can discriminate colors. Both cell types are long, narrow, specialized sensory neurons with two distinct cellular compartments: the outer segment contains dozens of membranous disks loaded with re ceptor proteins and their photosensitive chromophore retinal; the inner segment contains the nucleus and many mitochondria, which produce the ATP essential to phototransduction. Like other neurons, rods and cones have a trans membrane electrical potential (Vm) , produced by the electrogenic pumping of the Na +K+ ATPase in the plasma membrane of the inner segment (Fig. 12-36 ) .
v = -45 m
mv:' ' 0 '
Ion channel open
Na+ - -·
""- Na+K+
ATPase
Light •
Eye
Light
•
Ion channel closed
FIGURE 1 2-36 Light-induced hyperpolarization of rod cells. The rod cel l consi sts of an outer segment, fil led with stacks of membranous di sks (not shown) conta i n i ng the photoreceptor rhodopsi n, and an i n
/ � "---y-----J
To optic Ganglion Interconnecting nerve neurons neurons
n e r segment that conta i n s t h e nuc leus and other organel les (not shown). The i n ner segment synapses with i nterconnecting neurons (see Fig. 1 2-35). Cones have a simi lar structure. ATP in the inner segment
l ight on the retina, which is composed of layers of neurons. The pri
powers the N a + K+ ATPase, which creates a transmembrane electrical potential by pumping 3 N a + out for every 2 K + pumped in. The mem brane potential is reduced by the inflow of N a and Ca2 + through
mary photosensory neurons are rod cells (yellow), which are responsi
cGMP-gated cation channels in the outer-segment plasma membrane.
FIGURE 12-35 Light reception in the vertebrate eye. The lens focuses
+
ble for h igh-resolution and n i ght vision, and cone cel ls of three
When rhodopsi n absorbs l ight, it triggers degradation of cGMP (green
subtypes (pink), which initiate color vision. The rods and cones form
dots) in the outer segment, causing closure of the ion channel . Without
synapses with several ranks of interconnecting neurons that convey
cation i nflux through this channel, the cel l becomes hyperpolarized.
and i ntegrate the electrical signals. The signals eventua l l y pass from
This electrical signal is passed to the brain through the ranks of neurons
ganglion neurons through the optic nerve to the b ra i n .
shown i n Figure 1 2-3 5 .
1 2 . 1 0 Sensory Tra nsd uction in Vision, Olfaction, a n d Gustation
Also contributing to the membrane potential is an ion channel in the outer segment that permits passage of either Na + or Ca2 + and is gated (opened) by cGMP. In the dark, rod cells contain enough cGMP to keep this chan nel open. The membrane potential is therefore deter mined by the difference between the amount of Na + and K+ pumped by the inner segment (which polarizes the membrane) and the influx of Na+ through the ion chan nels of the outer segment (which tends to depolarize the membrane) . The essence of signaling in the rod or cone cell is a light-induced decrease in [cGMP] , which causes the cGMP-gated ion channel to close. The plasma membrane then becomes hyperpolarized by the Na +K+ ATPase. Rod and cone cells synapse with interconnecting neu rons (Fig. 12-35) that carry information about the elec trical activity to ganglion neurons near the inner surface of the retina. The ganglion neurons integrate the output from many rod or cone cells and send the resulting signal through the optic nerve to the visual cortex of the brain. Visual transduction begins when light falls on rhodopsin, many thousands of molecules of which are present in each disk of the outer segments of rod and cone cells. Rhodopsin (Mr 40,000) is an integral protein with seven membrane-spanning a helices (Fig. 1 2-3 7 ), the characteristic GPCR architecture. The light-absorbing pigment (chromophore) 1 1 -cis retinal is covalently attached to opsin, the protein component of rhodopsin, through a Schiff base to a Lys residue. The retinal molecule lies near the middle of the bilayer (Fig. 1 2-37) , oriented with its long axis approximately in the plane of the membrane. When a photon is absorbed by the retinal component of rhodopsin, the energy causes a photochemical change; 1 1 -cis-retinal is converted to all-trans-retinal (see Figs 1-18b and 1 0-2 1 ) . This change in the structure of the chromophore forces conformational changes in the rhodopsin molecule-the first stage in visual transduction. Retinal is derived from vitamin A 1 (retinol) , which is produced from .B-carotene (see Fig. 1 0-2 1 ) . Dietary deficiency of vitamin A leads to night blindness (the inability to adapt to low light levels) , which is relatively common in some developing countries. Vita min A supplements or vegetables rich in carotene (such as carrots) supply the vitamin and reverse the night blindness. • Excited Rhodopsin Acts through the G Protein Transdudn to Red uce the cGMP Concentration
In its excited conformation, rhodopsin interacts with a second protein, transducin, which hovers nearby on the cytoplasmic face of the disk membrane (Fig. 12-37) . Transducin (T) belongs to the same family of het erotrimeric GTP-binding proteins as Gs and Gi. Although specialized for visual transduction, transducin shares
[463]
FIGURE 1 2-37 Complex of rhodopsin with the G protein transducin. (PDB 10 1 BAC) Rhodopsin (red) has seven transmembrane hel ices em
bedded in the disk membranes of rod outer segments and is oriented
with its carboxyl term inus on the cytosol i c side and its a m i no term i nus i n side the disk. The chromophore 1 1 -cis-reti nal (blue space-fi l l ing
structure), attached through a Schiff base l i nkage to Lys256 of the sev enth helix, lies near the center of the bilayer. (This location is similar to
that of the epineph ri ne-binding site in the {3-adrenergic receptor.) Sev eral Ser and Thr residues near the carboxyl terminus are su bstrates for phosphorylations that are part of the desensitization mechanism for rhodopsi n . Cytoso l i c loops that i nteract with the G protein transducin are shown i n orange; their exact positions are not yet known. The th ree subun its of transducin (green) are shown in their l i kely arrangement. Rhodopsin is pal mitoyl ated at its carboxyl term i nus, and both the
a
and y subun its of transducin have attached l i p i ds (yellow) that assist i n anchoring them t o t h e membrane.
many functional features with Gs and Gi. It can bind either GDP or GTP. In the dark, GDP is bound, all three subunits of the protein (Ta, Tf3• and Ty) remain together, and no signal is sent. When rhodopsin is excited by light, it interacts with transducin, catalyzing the replacement of bound GDP by GTP from the cytosol (Fig. 12-38, steps CD and @ ) . Transducin then dissociates into Ta and Tf3"Y• and the Ta-GTP carries the signal from the ex cited receptor to the next element in the transduction pathway, a cGMP phosphodiesterase; this enzyme con verts cGMP to 5'-GMP (steps ® and @). Note that this is not the same cyclic nucleotide phosphodiesterase that hydrolyzes cAMP to terminate the .B-adrenergic re sponse. One isoform of the cGMP-specific PDE is unique to the visual cells of the retina.
!464_j
l_
Biosigna l i n g
CD
®
Activated rhodopsin Light absorption catalyzes replacement converts 1 1-cisof GDP by GTP retinal to on transducin (T), all-trans-retinal, which then dissociates activating rhodopsin (Rh). into Ta·GTP and TiJ-r ·
®
Ta-GTP activates cGMP phosphodiesterase (PDE) by binding and removing its inhibitory subunit (I).
@
Active PDE reduces [cGMP] to below the level needed to keep cation channels open.
5'-GMP
('ii::l -�
I
@ C ation channels
Di k membrane
Excitation
Recov ry/Adaptation
close, preventing influx ofNa+ and Ca2 +; membrane is hyperpolarized. This signal passes to the brain.
® Continued efflux of
Ca2+ through the Na+.c a 2+ exchanger reduces cytosolic [Ca2+] .
Rhodopsin kinase (RK) phosphorylates "bleached" rhodopsin; low [Ca2•] and recoverin (Recov) stimulate this reaction. Arrestin (Arr) binds phosphorylated carboxyl terminus, inactivating rhodopsin.
®
Slowly, arrestin dissociates, rhodopsin is dephosphorylated, and all-trans-retinal is replaced with 11-cis-retinal. Rhodopsin is ready for another phototransduction cycle.
Q)
Reduction of [Ca2•] activates guanylyl cyclase (GC) and inhibits PDE; [cGMPl rises toward "dark" level, reopening cation channels and returning Vm to prestimulus level.
' Plasma membrane
FIGURE 1 2-38 Molecular consequences of photon absorption by rhodopsin in the rod outer segment.
The top half of the figure (steps adaptation after i l lumi nation.
G) to ®l descri bes excitation; the bottom (steps ® to @l , recovery and
The PDE of the retina is an integral protein with its active site on the cytoplasmic side of the disk membrane. In the dark, a tightly bound inhibitory subunit very effec tively suppresses the PDE activity. When Ta·GTP en counters the PDE , the inhibitory subunit leaves the enzyme and instead binds T"' and the enzyme's activity immediately increases by several orders of magnitude. Each molecule of the active PDE degrades many mole cules of cGMP to the biologically inactive 5' -GMP, lower ing [cGMP] in the outer segment within a fraction of a second. At the new, lower [cGMP], the cGMP-gated ion channels close, blocking reentry of Na + and Ca2 + into the outer segment and hyperpolarizing the membrane of the rod or cone cell (step @) . Through this process, the initial stimulus-a photon-changes the Vm of the cell. Several steps in the visual-transduction process re sult in a huge amplification of the signal. Each excited rhodopsin molecule activates at least 500 molecules of transducin, each of which can activate a molecule of the
PDE . This phosphodiesterase has a remarkably high turnover number, each activated molecule hydrolyzing 4,200 molecules of cGMP per second. The binding of cGMP to cGMP-gated ion channels is cooperative, and a relatively small change in [cGMP] therefore registers as a large change in ion conductance. The result of these am plifications is exquisite sensitivity to light. Absorption of a single photon closes 1 ,000 or more ion channels and changes the cell's membrane potential by about 1 mV. The Visual Signal Is Quickly Terminated
As your eyes move across this line, the retinal images of the first words disappear rapidly-before you see the next series of words. In that short interval, a great deal of biochemistry has taken place. Very shortly after illu mination of the rod or cone cells stops, the photo sensory system shuts off. The a subunit of transducin (with bound GTP) has intrinsic GTPase activity. Within
1 2 . 1 0 Sensory Transduction in Vision, Olfaction, and G u station
milliseconds after the decrease in light intensity, GTP is hydrolyzed and Ta reassociates with T,By· The inhibitory subunit of the PDE , which had been bound to Ta-GTP, is released and reassociates with the enzyme, strongly in hibiting its activity. To return [cGMP] to its "dark" level, the enzyme guanylyl cyclase converts GTP to cGMP (step (/) in Fig. 12-38) in a reaction that is inhibited by high [Ca2 +] (> 100 nM) . Calcium levels drop during illu mination, because the steady-state [Ca2 +] in the outer segment is the result of outward pumping of Ca2 + through the Na + -Ca2 + exchanger of the plasma mem brane (see Fig. 12-36) and influx of Ca2 + through open cGMP-gated channels. In the dark, this produces a [Ca2 +] of about 500 nM-enough to inhibit cGMP syn thesis. After brief illumination, Ca2 + entry slows and [Ca2 +] declines (step @) . The inhibition of guanylyl cyclase by Ca2 + is relieved, and the cyclase converts GTP to cGMP to return the system to its prestimulus state (step (7)). Rhodopsin itself also undergoes changes in response to prolonged illumination. The conformational change in duced by light absorption exposes several Thr and Ser residues in the carboxyl-terminal domain. These residues are quickly phosphorylated by rhodopsin ki nase (step ® in Fig. 12-38) , which is functionally and structurally homologous to the �-adrenergic kinase �ARK) that desensitizes the �-adrenergic receptor (Fig. 12-8) . The Ca2 + -binding protein recoverin in hibits rhodopsin kinase at high [Ca2 +], but the inhibition is relieved when [Ca2 +] drops after illumination, as de scribed above. The phosphorylated carboxyl-terminal domain of rhodopsin is bound by the protein arrestin 1 , preventing further interaction between activated rhodopsin and transducin. Arrestin 1 is a close homolog of arrestin 2 �arr; Fig. 12-8) . On a relatively long time scale (seconds to minutes) , the all-trans-retinal of an ex cited rhodopsin molecule is removed and replaced by 1 1cis-retinal, to produce rhodopsin that is ready for another round of excitation (step ® in Fig. 12-38) . Cone Cells Specialize in Color Vision
Color vision involves a path of sensory transduction in cone cells essentially identical to that described above, but triggered by slightly different light receptors. Three types of cone cells are specialized to detect light from dif ferent regions of the spectrum, using three related pho toreceptor proteins (opsins) . Each cone cell expresses only one kind of opsin, but each type is closely related to rhodopsin in size, amino acid sequence, and presumably three-dimensional structure. The differences among the opsins, however, are great enough to place the chro mophore, 1 1-cis-retinal, in three slightly different envi ronments, with the result that the three photoreceptors have different absorption spectra (Fig. 12-39) . We discriminate colors and hues by integrating the output from the three types of cone cells, each containing one of the three photoreceptors.
100 90 80 70 -e 60 50 .� 40 � 30 20 10 0
[465]
Q) s:: ro
0 rLl ..0 ro Q) ..., Q)
�
400 450 500 550 600 650 Wavelength (nm)
FIGURE 1 2-39 Absorption spectra of purified rhodopsin and the red, green, and blue receptors of cone cells. The spectra, obtained from i n
dividual cone cel ls isolated from cadavers, peak at about 420, 530, and 5 60 nm, and the maximum absorption for rhodopsin is at about 500 nm. For reference, the visible spectrum for h umans is about 380 to 750 nm.
Color blindness, such as the inability to distin guish red from green, is a fairly common, geneti cally inherited trait in humans. The various types of color blindness result from different opsin mutations. One form is due to loss of the red photoreceptor; af fected individuals are red- dichromats (they see only two primary colors) . Others lack the green pigment and are green - dichromats. In some cases, the red and green photoreceptors are present but have a changed amino acid sequence that causes a change in their absorption spectra, resulting in abnormal color vision. Depending on which pigment is altered, such individuals are red-anomalous trichromats or green-anomalous trichromats. Examination of the genes for the visual receptors has allowed the diagnosis of color blindness in a famous "patient" more than a century after his death (Box 12-4) ! • Vertebrate Olfaction a n d Gustation Use Mechan isms Similar to the Visual System
The sensory cells that detect odors and tastes have much in common with the rod and cone cells. Olfactory neurons have long thin cilia extending from one end of the cell into a mucous layer that overlays the cell. These cilia present a large surface area for interaction with ol factory signals. The receptors for olfactory stimuli are ciliary membrane proteins with the familiar GPCR struc ture of seven transmembrane a helices. The olfactory signal can be any one of the many volatile compounds for which there are specific receptor proteins. Our abil ity to discriminate odors stems from hundreds of differ ent olfactory receptors in the tongue and nasal passages and from the brain's ability to integrate input from
[466]
Biosignaling
The chemist John Dalton (of atomic theory fame) was color-blind. He thought it probable that the vitreous hu mor of his eyes (the fluid that fills the eyeball behind the lens) was tinted blue, unlike the colorless fluid of normal eyes. He proposed that after his death, his eyes should be dissected and the color of the vitreous humor deter mined. His wish was honored. The day after Dalton's death in July 1844, Joseph Ransome dissected his eyes and found the vitreous humor to be perfectly colorless. Ransome, like many scientists, was reluctant to throw samples away. He placed Dalton's eyes in a jar of preser vative, where they stayed for a century and a half. Then, in the rnid-1990s, molecular biologists in En gland took small samples of Dalton's retinas and ex tracted DNA. Using the known gene sequences for the opsins of the red and green light receptors, they ampli fied the relevant sequences (using techniques described
in Chapter 9) and determined that Dalton had the opsin gene for the red photopigment but lacked the opsin gene for the green photopigment. Dalton was a green dichromat. So, 150 years after his death, the experiment Dalton started-by hypothesizing about the cause of his color blindness-was finally finished.
different types of olfactory receptors to recognize a "hybrid" pattern, extending our range of discrimination far beyond the number of receptors. The olfactory stimulus arrives at the sensory cells by diffusion through the air. In the mucous layer covering the olfactory neurons, the odorant molecule binds di-
rectly to an olfactory receptor or to a specific binding pro tein that carries the odorant to a receptor (Fig. 1 2-40). Interaction between odorant and receptor triggers a change in receptor conformation that results in the replacement of bound GDP by GTP on a G protein, G01t, analogous to transducin and to Gs of the ,B-adrenergic
C1)
FIGURE 1 Dalton's eyes.
Olfactory neuron
Cilia
Odorant (0) arrives at the mucous layer and binds directly to an olfactory receptor (OR) or to a binding protein (BP) that carries it to the OR.
II ®
Activated OR catalyzes GDP-GTP exchange on a G protein (Golf), causing its dissociation into a and f3r ·
Dendrite
Axon
®
Air Mucous layer
cAMP-gated cation channels open. Ca2+ enters, raising internal [Ca2 +] .
�0 0 •:. :::• 1, a preference. (b) All four types of knockout strains had the same re sponses to salt and bitter tastes as did wild-type mice. Which of the above issues did this experiment address? What do you conclude from these results? The researchers then studied umami taste reception by measuring the relative lick rates of the different mouse strains with different quantities of MSG in the feeding solution. Note that the solutions also contained inosine monophosphate (IMP), a strong potentiator of umami taste reception (and a common ingredient in ramen soups, along with MSG) , and ameloride, which suppresses the pleasant salty taste imparted by the sodium of MSG. The results are shown in the graph.
Ql +'
"" .... "
�
� Ql
Wild type and TlR2 knockout
:d""
Q) 0::
T1R1 knockout T1R3 knockout 1
1
10
MS G + IMP + ameloride (mM)
100
(c) Are these data consistent with the umami taste recep tor consisting of a heterodimer of T 1 R 1 and T1R3? Why or why not? (d) Which model(s) of taste encoding does this result sup port? Explain your reasoning. Zhao and coworkers then performed a series of similar ex periments using sucrose as a sweet taste. These results are shown below. 20
Wild Lype and. TlRl knockout
100
Sucrose (mM)
1000
(e) Are these data consistent with the sweet taste recep tor consisting of a heterodimer of T1R2 and T1R3? Why or why not? (f) There were some unexpected responses at very high sucrose concentrations. How do these complicate the idea of a heterodimeric system as presented above? In addition to sugars, humans also taste other compounds (e.g. , the peptides monellin and aspartame) as sweet; mice do not taste these as sweet. Zhao and coworkers inserted into TIR2 knockout mice a copy of the human T 1R2 gene under the control of the mouse T 1 R2 promoter. These modified mice now tasted monellin and saccharin as sweet. The researchers then went further, adding to T l R 1 knockout mice the RASSL protein-a G protein-linked receptor for the synthetic opiate spiradoline; the RASSL gene was under the control of a pro moter that could be induced by feeding the mice tetracycline. These mice did not prefer spiradoline in the absence of tetra cycline; in the presence of tetracycline, they showed a strong preference for nanomolar concentrations of spiradoline. (g) How do these results strengthen Zhao and coauthors' conclusions about the mechanism of taste sensation? Reference Zhao, G.Q., Zhang, Y., Boon, M.A., Chandrashekar, J., Eden bach, 1., Ryba, N.J.P., & Zuker, C. (2003) The receptors for mam malian sweet and umarni taste. Cell l l 5 , 255-266.
PA RT
II
B I OE N E RG ETI CS AN D M ETABOLISM
13
Bioenergetics and Biochemical Reaction Types
14
489
Glycolysis, Gluconeogenesis, and the Pentose Phosphate Pathway
527
Principles of Metabolic Regulation
16
The Citric Acid Cycle
17
Fatty Acid Catabolism
18
Amino Acid Oxidation and the Production of Urea
19
615 647
673
Oxidative Phosphorylation and 707
Photophosphorylation 20
Carbohydrate Biosynthesis in Plants and Bacteria
773
21
lipid Biosynthesis
22
Biosynthesis of Amino Adds, Nucleotides, and Related Molecules
23
805 851
Hormonal Regulation and Integration of Mammalian Metabolism
etabolism is a highly coordinated cellular activ
569
15
901
Part II is the central metabolic pathways, which are few
ity in which many multienzyme systems (meta
in number and remarkably similar in all forms of life. Liv
bolic pathways) cooperate to (1) obtain chemical
ing organisms can be divided into two large groups
energy by capturing solar energy or degrading energy
according to the chemical form in which they obtain car
rich nutrients from the environment; (2) convert nutrient
bon from the environment. Autotrophs (such as photo
molecules into the cell's own characteristic molecules,
synthetic bacteria, green algae, and vascular plants) can
including precursors of macromolecules; (3) polymerize
use carbon dioxide from the atmosphere as their sole
monomeric precursors into macromolecules: proteins,
source of carbon, from which they construct all their
nucleic acids, and polysaccharides; and (4) synthesize
carbon-containing biomolecules (see Fig. 1-5) . Some
and degrade biomolecules required for specialized cellu
autotrophic organisms , such as cyanobacteria, can
lar functions, such as membrane lipids, intracellular
also use atmospheric nitrogen to generate all their
messengers, and pigments.
nitrogenous components. Heterotrophs cannot use
Although metabolism embraces hundreds of differ
atmospheric carbon dioxide and must obtain carbon
ent enzyme-catalyzed reactions, our major concern in
from their environment in the form of relatively complex
[48 6]
Bioenergetics a n d Meta b o l i s m
organic molecules such as glucose. Multicellular animals and most microorganisms are heterotrophic. Autotrophic cells and organisms are relatively self-sufficient, whereas heterotrophic cells and organisms, with their require ments for carbon in more complex forms, must subsist on the products of other organisms. Many autotrophic organisms are photosynthetic and obtain their energy from sunlight, whereas het erotrophic organisms obtain their energy from the degradation of organic nutrients produced by au totrophs. In our biosphere , autotrophs and heterotrophs live together in a vast, interdependent cycle in which au totrophic organisms use atmospheric carbon dioxide to build their organic biomolecules, some of them generat ing oxygen from water in the process. Heterotrophs in turn use the organic products of autotrophs as nutrients
FIGURE 2 Cycling of nitrogen in the biosphere. Gaseous n itrogen (N2) makes up 80% of the earth's atmosphere.
and return carbon dioxide to the atmosphere. Some of
N2. Thus, in addition to the global carbon and oxygen
the oxidation reactions that produce carbon dioxide also
cycle, a nitrogen cycle operates in the biosphere, turn
consume oxygen, converting it to water. Thus carbon,
ing over huge amounts of nitrogen (Fig. 2 ). The cycling
oxygen, and water are constantly cycled between the
of carbon, oxygen, and nitrogen, which ultimately in
heterotrophic and autotrophic worlds, with solar energy
volves all species, depends on a proper balance between
as the driving force for this global process (Fig. 1 ) .
the activities of the producers (autotrophs) and con
All living organisms also require a source of nitro gen, which is necessary for the synthesis of amino acids,
sumers (heterotrophs) in our biosphere . These cycles of matter are driven by an enormous
nucleotides, and other compounds. Bacteria and plants
flow of energy into and through the biosphere, beginning
can generally use either ammonia or nitrate as their sole
with the capture of solar energy by photosynthetic organ
source of nitrogen, but vertebrates must obtain nitrogen
isms and use of this energy to generate energy-rich car
in the form of amino acids or other organic compounds.
bohydrates and other organic nutrients; these nutrients
Only a few organisms-the cyanobacteria and many
are then used as energy sources by heterotrophic organ
species of soil bacteria that live symbiotically on the
isms. In metabolic processes, and in all energy transfor
roots of some plants-are capable of converting
mations, there is a loss of useful energy (free energy) and
("fixing") atmospheric nitrogen (N2 ) into ammonia.
an inevitable increase in the amount of unusable energy
Other bacteria (the nitrifying bacteria) oxidize ammonia
(heat and entropy) . In contrast to the cycling of matter,
to nitrites and nitrates ; yet others convert nitrate to N2. The anammox bacteria convert ammonia and nitrite to
therefore, energy flows one way through the biosphere; or
ganisms cannot regenerate useful energy from energy dis
sipated as heat and entropy. Carbon, oxygen, and nitrogen FIGURE 1 Cycling of carbon dioxide and oxy
recycle continuously, but energy is constantly trans
gen between the autotrophic (photosynthetic)
formed into unusable forms such as heat.
and heterotrophic domains in the biosphere.
The flow of mass through this cycle is enor mous; about 4 x 1 0 1 1 metric tons of carbon are turned over in the biosphere annually.
Metabolism, the sum of all the chemical transfor mations taking place in a cell or organism, occurs through a series of enzyme-catalyzed reactions that con stitute metabolic pathways. Each of the consecutive steps in a metabolic pathway brings about a specific, small chemical change, usually the removal, transfer, or addition of a particular atom or functional group. The precursor is converted into a product through a series of metabolic intermediates called metabolites. The term
intermediary metabolism is often applied to the com bined activities of all the metabolic pathways that inter convert precursors, metabolites, and products of low molecular weight (generally, Mr < 1 ,000) .
Bioen ergetics and Meta b o l i s m
[487]
Catabolism is the degradative phase of metabolism
the pathway is regenerated in a series of reactions that
in which organic nutrient molecules (carbohydrates,
converts another starting component into a product. We
fats, and proteins) are converted into smaller, simpler
shall see examples of each type of pathway in the follow
end products (such as lactic acid, C02 , NH3) . Catabolic
ing chapters.
pathways release energy, some of which is conserved in
Most cells have the enzymes to carry out both the
the formation of ATP and reduced electron carriers
degradation and the synthesis of the important categories
(NADH, NADPH, and FADH2) ; the rest is lost as heat. In
of biomolecules-fatty acids, for example. The simultane
anabolism, also called biosynthesis, small, simple pre
ous synthesis and degradation of fatty acids would be
cursors are built up into larger and more complex mole
wasteful, however, and this is prevented by reciprocally
cules, including lipids, polysaccharides, proteins, and
regulating the anabolic and catabolic reaction sequences:
nucleic acids. Anabolic reactions require an input of en
when one sequence is active, the other is suppressed.
ergy, generally in the form of the phosphoryl group
Such regulation could not occur if anabolic and catabolic
transfer potential of ATP and the reducing power of
pathways were catalyzed by exactly the same set of en
NADH, NADPH, and FADH2 (Fig. 3).
zymes, operating in one direction for anabolism, the oppo
Some metabolic pathways are linear, and some are
site direction for catabolism: inhibition of an enzyme
branched, yielding multiple useful end products from a
involved in catabolism would also inhibit the reaction se
single precursor or converting several starting materials
quence in the anabolic direction. Catabolic and anabolic
into a single product. In general, catabolic pathways are
pathways that connect the same two end points (glucose
convergent and anabolic pathways divergent (Fig. 4 ).
� � pyruvate, and pyruvate � � glucose, for example)
Some pathways are cyclic: one starting component of
may employ many of the same enzymes, but invariably at least one of the steps is catalyzed by different enzymes in
r
l1
the catabolic and anabolic directions, and these enzymes Cell macromolecules
Proteins Polysaccharides Lipids Nucleic acids
Energy containing nutrients
Carbohydrates Fats Proteins
are the sites of separate regulation. Moreover, for both an abolic and catabolic pathways to be essentially irre versible, the reactions unique to each direction must include at least one that is thermodynamically very favor able-in other words, a reaction for which the reverse re action is very unfavorable. As a further contribution to the separate regulation of catabolic and anabolic reaction se quences, paired catabolic and anabolic pathways com monly take place in different cellular compartments: for example, fatty acid catabolism in mitochondria, fatty acid synthesis in the cytosol. The concentrations of intermedi
Anabolism
Catabollam
ates, enzymes, and regulators can be maintained at differ ent levels in these different compartments. Because metabolic pathways are subject to kinetic control by sub strate concentration, separate pools of anabolic and cata bolic intermediates also contribute to the control of metabolic rates. Devices that separate anabolic and cata
bolic processes will be of particular interest in our discus sions of metabolism. Precursor molecules
Amino acids Sugars Fatty acids Nitrogenous bases
Energy depleted end products
C02 H20 NH3
Metabolic pathways are regulated at several levels, from within the cell and from outside. The most immedi ate regulation is by the availability of substrate; when the intracellular concentration of an enzyme's substrate is near or below Km (as is commonly the case) , the rate of the reaction depends strongly upon substrate concentra
FIGURE 3 Energy relationships between catabolic and anabolic path ways. Catabolic pathways del iver chem ical energy in the form of ATP,
NADH, NADPH, and FADH 2 . These energy carriers are used i n ana
tion (see Fig. 6-1 1 ) . A second type of rapid control from within is allosteric regulation (p. 220) by a metabolic in
bolic pathways to convert small precursor molecules i nto cel l u l ar
termediate or coenzyme-an amino acid or ATP, for ex
macromolecules.
ample-that signals the cell's internal metabolic state.
[4ss]
Bioe n ergetics a n d Metabolism
Rubber
Phospholipids Triacylglycerols Starch Glycogen
Alanine
"""
'' Sucrose
Glucose Serine
Carotenoid pigments
Stemid hormones
Isopentenyl pyrophosphate
Bile acids
Fatty acids Mevalonate
Phenyl alanine
.Pyruvate '*
Acetoacetyl-CoA
Cholesteryl esters
Vitamin K
Eicosanoids
Leucine
Fatty acid
Isoleucine
Triacylglycetols
(a) Converging catabolism
CDP-diacylglycerol Oxaloacetate
Phospholipids
(b) Diverging anabolism
FIGURE 4 Three types of nonlinear metabolic pathways. (a) Converging, catabol ic, (b) diverging, anabolic, and (c)
co2
cycl i c pathways. In (c), one of the starting materials (ox al oacetate in this case) is regenerated and reenters the pathway. Acetate, a key metabol ic i ntermediate, is the breakdown product of a variety of fuels (a), serves as the precursor for an array of products (b), and is consumed in
(c) Cyclic pathway
the catabolic pathway known as the citric acid cycle (c).
When the cell contains an amount of, say, aspartate suffi
produced either by substrate oxidation or by light
cient for its immediate needs, or when the cellular level
absorption, drives the synthesis of ATP.
of ATP indicates that further fuel consumption is unnec
Chapters 20 through 22 describe the major anabolic
essary at the moment, these signals allosterically inhibit
pathways by which cells use the energy in ATP to pro
the activity of one or more enzymes in the relevant path
duce carbohydrates, lipids, amino acids, and nucleotides
way. In multicellular organisms the metabolic activities
from simpler precursors. In Chapter 23 we step back
of different tissues are regulated and integrated by
from our detailed look at the metabolic pathways-as
growth factors and hormones that act from outside the
they occur in all organisms, from Escherichia coli to
cell. In some cases this regulation occurs virtually instan
humans-and consider how they are regulated and inte
taneously (sometimes in less than a millisecond) through
grated in mammals by hormonal mechanisms.
changes in the levels of intracellular messengers that
As we undertake our study of intermediary metabo
modify the activity of existing enzyme molecules by al
lism, a final word. Keep in mind that the myriad reac
losteric mechanisms or by covalent modification such as
tions described in these pages take place in, and play
phosphorylation. In other cases, the extracellular signal
crucial roles in, living organisms . As you encounter each
changes the cellular concentration of an enzyme by al
reaction and each pathway ask, What does this chemical
tering the rate of its synthesis or degradation, so the ef
transformation do for the organism? How does this path
fect is seen only after minutes or hours.
way interconnect with the other pathways operating si
We begin Part II with a discussion of the basic ener
multaneously in the same cell to produce the energy and
getic principles that govern all metabolism (Chapter 13).
products required for cell maintenance and growth?
We then consider the major catabolic pathways by
How do the multilayered regulatory mechanisms coop
which cells obtain energy from the oxidation of various
erate to balance metabolic and energy inputs and out
fuels (Chapters 14 through 1 9) . Chapter 19 is the pivotal
puts, achieving the dynamic steady state of life? Studied
point of our discussion of metabolism; it concerns
with this perspective, metabolism provides fascinating
chemiosmotic energy coupling, a universal mechanism
and revealing insights into life, with countless applica
in which a transmembrane electrochemical potential,
tions in medicine, agriculture, and biotechnology.
The tota l energy of the u n iverse is consta n t; the total entropy is conti n ual l y i nc reasing.
-Rudolf Clau iu
, The Mec h a n iGJI Theory f Heat w i t h Its App l ica t i o n to the Steam-Engine and to the Phy ical Properties of Bodies, 7 865 (trans. 1 867)
The isomorphism of entropy and i nformation establ ishes a l i n k between th two forms of power: the power to do and the power to d i re 1 what is done.
-Franr;ois jacob,
La logique du vivant: u ne h i stoire de l ' hered ite (The Logic of L i fe: A H i stor r Her dityl 19 0
Bioenergetics and Biochemical Reaction Types 13.1
Bioenergetics and Thermodynamics
1 3 .2
Chemical logic and Common Biochemical Reactions
490
into heat and that this process of respiration is essential to life. He observed that
495
1 3 .3
Phosphoryl Group Transfers and ATP
1 3 .4
Biological Oxidation-Reduction Reactions
501 512
iving cells and organisms must perform work to stay alive, to grow, and to reproduce. The ability to har ness energy and to channel it into biological work is a fundamental property of all living organisms; it must have been acquired very early in cellular evolution. Modern or ganisms carry out a remarkable variety of energy trans ductions, conversions of one form of energy to another. They use the chemical energy in fuels to bring about the synthesis of complex, highly ordered macromolecules from simple precursors. They also convert the chemical energy of fuels into concentration gradients and electrical gradients, into motion and heat, and, in a few organisms such as fireflies and deep-sea fish, into light. Photosynthetic organisms transduce light energy into all these other forms of energy. The chemical mechanisms that underlie biological energy transductions have fascinated and challenged biologists for centuries. The French chemist Antoine Lavoisier recognized that animals somehow trans Antoine Lavo isier, 1 743-1 794 form chemical fuels (foods)
. . . in general, respiration is nothing but a slow combustion of carbon and hydrogen, which is en tirely similar to that which occurs in a lighted lamp or candle , and that, from this point of view, animals that respire are true combustible bodies that burn and consume themselves . . . One may say that this analogy between combustion and respiration has not escaped the notice of the poets, or rather the philosophers of antiquity, and which they had ex pounded and interpreted. This fire stolen from heaven, this torch of Prometheus , does not only represent an ingenious and poetic idea, it is a faith ful picture of the operations of nature , at least for animals that breathe ; one may therefore say, with the ancients, that the torch of life lights itself at the moment the infant breathes for the first time, and it does not extinguish itself except at death. * I n the twentieth century, we began t o understand much of the chemistry underlying that "torch of life ." Bi ological energy transductions obey the same chemical and physical laws that govern all other natural processes. It is therefore essential for a student of biochemistry to understand these laws and how they apply to the flow of energy in the biosphere. In this chapter we first review the laws of thermody namics and the quantitative relationships among free en ergy, enthalpy, and entropy. We then review the common types of biochemical reactions that occur in living cells, reactions that harness, store, transfer, and release the *From a memoir by Armand Seguin and Antoine Lavoisier, dated 1 789, quoted in Lavoisier, ale, Paris.
A.
(1862)
Oeuvres de Lavoisier,
lmprimerie Imperi
[490]
Bioen ergetics a n d Biochemical Reaction Types
energy taken up by organisms from their surroundings. Our focus then shifts to reactions that have special roles in biological energy exchanges, particularly those involv ing ATP. We finish by considering the importance of oxi dation-reduction reactions in living cells, the energetics of biological electron transfers, and the electron carriers commonly employed as cofactors in these processes.
1 3 . 1 Bioenergetics and Thermodynamics Bioenergetics is the quantitative study of energy transductions-changes of one form of energy into an other-that occur in living cells, and of the nature and function of the chemical processes underlying these transductions. Although many of the principles of ther modynamics have been introduced in earlier chapters and may be familiar to you, a review of the quantitative aspects of these principles is useful here. Biological Energy Tra nsformations Obey the Laws of Thermodyna mics Many quantitative observations made by physicists and chemists on the interconversion of different forms of en ergy led, in the nineteenth century, to the formulation of two fundamental laws of thermodynamics. The first law is the principle of the conservation of energy: for any physical or chemical change, the total amount of energy in the universe remains constant; energy may changeform or it may be transportedfrom one region to another, but it cannot be created or destroyed. The second law of thermodynamics, which can be stated in several forms, says that the universe always tends toward increasing disorder: in all natural processes, the en tropy of the universe increases.
second law of thermodynamics. But living organisms do not violate the second law; they operate strictly within it. To discuss the application of the second law to biolog ical systems, we must first define those systems and their surroundings. The reacting system is the collection of matter that is undergoing a particular chemical or physical process; it may be an organism, a cell, or two reacting com pounds. The reacting system and its surroundings to gether constitute the universe. In the laboratory, some chemical or physical processes can be carried out in iso lated or closed systems, in which no material or energy is exchanged with the surroundings. Living cells and or ganisms, however, are open systems, exchanging both material and energy with their surroundings; living sys tems are never at equilibrium with their surroundings, and the constant transactions between system and sur roundings explain how organisms can create order within themselves while operating within the second law of thermodynamics. In Chapter 1 (p. 22) we defined three thermody namic quantities that describe the energy changes oc curring in a chemical reaction:
Gibbs free energy, G, expresses the amount of en ergy capable of doing work during a reaction at con stant temperature and pressure . When a reaction proceeds with the release of free energy (that is, when the system changes so as to possess less free energy) , the free-energy change, !J.G, has a negative value and the reaction is said to be exergonic. In en dergonic reactions, the system gains free energy and !J.G is positive. Enthalpy, H, is the heat content of the reacting system. It reflects the number and kinds of chemical bonds in the reactants and products. When a chem ical reaction releases heat, it is said to be exother mic; the heat content of the products is less than that of the reactants and t::.H has, by convention, a negative value. Reacting systems that take up heat from their surroundings are endothermic and have positive values of !::.H.
Entropy, S, is a quantitative expression for the ran domness or disorder in a system (see Box 1-3). When the products of a reaction are less complex and more disordered than the reactants, the reac tion is said to proceed with a gain in entropy.
" ow, in lhe second law of thermodynamic
Living organisms consist of collections of molecules much more highly organized than the surrounding ma terials from which they are constructed, and organisms maintain and produce order, seemingly oblivious to the
The units of !J.G and t::.H are joules/mole or calories/mole (recall that 1 cal = 4.184 J) ; units of entropy are joules/ mole · Kelvin (J/mol · K) (Table 13-1) . Under the conditions existing in biological systems (including constant temperature and pressure) , changes in free energy, enthalpy, and entropy are related to each other quantitatively by the equation t.G
=
t.H - Tt.S
(13-1)
1 3 . 1 Bioenergetics a n d Thermod y n a m i cs
I
TABLE 1 3 - 1
Some Physical Constanb and Units Used In Thennodynamks
Boltzmann constant, k = Avogadro's number, N Faraday constant, J Gas constant, R ( =
= =
=
2 1 .381 x 1 0 - 3 J/K 1 23 6.022 x 10 mol96,480 JN mol 8 . 3 1 5 J/mol K 1 . 987 caVmol K) ·
·
·
Units of A.G and f1H are J/mol (or caVmol) Units of AS are J/mol K (or caVmol K) 1 cal = 4 . 1 84 J ·
·
Units of absolute temperature, T, are Kelvin, K 25 oc 298 K At 25 °C, RT 2.478 kJ/mol ( 0 . 592 kcal!mol) = =
=
in which A.G is the change in Gibbs free energy of the re acting system, M! is the change in enthalpy of the sys tem, T is the absolute temperature, and A.S is the change in entropy of the system. By convention, A.S has a posi tive sign when entropy increases and A.H, as noted above, has a negative sign when heat is released by the system to its surroundings. Either of these conditions, which are typical of energetically favorable processes, tend to make A.G negative . In fact, A.G of a sponta neously reacting system is always negative. The second law of thermodynamics states that the entropy of the universe increases during all chemical and physical processes, but it does not re quire that the entropy increase take place in the re acting system itself. The order produced within cells as they grow and divide is more than compensated for by the disorder they create in their surroundings in the course of growth and division (see Box 1-3 , case 2) . In short, living organisms preserve their internal or der by taking from the surroundings free energy in the form of nutrients or sunlight, and returning to their surroundings an equal amount of energy as heat and entropy.
Cells Require Sources of Free Energy Cells are isothermal systems-they function at essen tially constant temperature (and also function at con stant pressure) . Heat flow is not a source of energy for cells, because heat can do work only as it passes to a zone or object at a lower temperature. The energy that cells can and must use is free energy, described by the Gibbs free-energy function G, which allows prediction of the direction of chemical reactions, their exact equilib rium position, and the amount of work they can (in theory) perform at constant temperature and pressure . Heterotrophic cells acquire free energy from nutrient molecules, and photosynthetic cells acquire it from ab sorbed solar radiation. Both kinds of cells transform this free energy into ATP and other energy-rich compounds
[491]
capable of providing energy for biological work at con stant temperature.
Standard Free-Energy Change Is Directly Related to the Equilibrium Constant The composition of a reacting system (a mixture of chemical reactants and products) tends to continue changing until equilibrium is reached. At the equilib rium concentration of reactants and products , the rates of the forward and reverse reactions are exactly equal and no further net change occurs in the sys tem. The concentrations of reactants and products at equilibrium define the equilibrium constant, Keq (p. 2 4) . In the general reaction aA + bB � c C + dD, where a, b, c, and d are the number of molecules of A, B , C, and D participating, the equilibrium constant is given by
Keq
[C]c[D] d
[A]a[B]b
= =�:-.
{13-2)
where [A) , [B) , [C) , and [D] are the molar concentrations of the reaction components at the point of equilibrium. When a reacting system is not at equilibrium, the tendency to move toward equilibrium represents a driv ing force, the magnitude of which can be expressed as the free-energy change for the reaction, A.G. Under stan dard conditions (298 K = 25 °C) , when reactants and products are initially present at 1 M concentrations or, for gases, at partial pressures of 1 0 1 .3 kilopascals (kPa) , or 1 atm, the force driving the system toward equilibrium is defined as the standard free-energy change, A.G0• By this definition, the standard state for reactions that involve + hydrogen ions is [H ] = 1 M, or pH 0. Most biochemical reactions, however, occur in well-buffered aqueous solu tions near pH 7; both the pH and the concentration of water (55.5 M) are essentially constant. KEY CO NVE NTI O N : For convenience of calculations, bio
chemists define a standard state different from that used in chemistry and physics: in the biochemical stan dard state, [H + ] is 10- 7 M (pH 7) and [H2 0] is 55.5 M. For 2 reactions that involve Mg + (which include most of 2 those with ATP as a reactant) , [Mg + ] in solution is com monly taken to be constant at 1 mM . • Physical constants based on this biochemical stan dard state are called standard transformed con stants and are written with a prime (such as A.G'o and K�q) to distinguish them from the untransformed con stants used by chemists and physicists. (Note that most other textbooks use the symbol A.G0' rather than A.G'0• Our use of A.G'0, recommended by an international com mittee of chemists and biochemists, is intended to emphasize that the transformed free energy, G ' , is the criterion for equilibrium.) For simplicity, we will here after refer to these transformed constants as standard
free-energy changes.
[49 2]
Bioen ergetics a n d Biochemical Reaction Types
K EY CON V E N T I O N : In another simplifying convention used 2 by biochemists, when H20, H + , and/or Mg + are reac tants or products, their concentrations are not included in equations such as E quation 1 3-2 but are instead incorporated into the constants K�q and 6.G'0. •
Just as K�q is a physical constant characteristic for each reaction, so too is 6.G'o a constant. As we noted in Chapter 6 , there is a simple relationship between K�q and 6.G'0:
(13-3)
The standard free-energy change of a chemical reac tion is simply an alternative mathematical way of expressing its equilibrium constant. Table 1 3-2 shows the relationship between 6.0'0 and K�q· If the equilibrium constant for a given chemical reaction is 1 .0, the standard free-energy change of that reaction is 0.0 (the natural logarithm of 1 .0 is zero) . If K�q of a reaction is greater than 1 .0, its 6.G'0 is negative . If K�q is less than 1 .0, 6.0'0 is positive. Because the relationship between 6.0'0 and K�q is exponential, relatively small changes in 6.0'0 correspond to large changes in K�q· It may be helpful to think of the standard free energy change in another way. 6.0 '0 is the difference be tween the free-energy content of the products and the free-energy content of the reactants, under standard conditions. When 6.G'0 is negative, the products contain less free energy than the reactants and the reaction will proceed spontaneously under standard conditions; all chemical reactions tend to go in the direction that re sults in a decrease in the free energy of the system. A
TAB L E 1 3 -2
K�q 1 03 2 10 1 10
10- 1
10-
2 3
w-4
1 0- 5 10- 6
When K�q i s . . . > 1 .0 1.0 < 1 .0
t:.G'0 is . . .
Starting with all components at 1 M , the reaction . . .
negative
proceeds forward
zero
is at equilibrium
positive
proceeds in reverse
positive value of 6.0'0 means that the products of the re action contain more free energy than the reactants, and this reaction will tend to go in the reverse direction if we start with 1 . 0 M concentrations of all components (stan dard conditions) . Table 13-3 summarizes these points.
- WORKED EXAMPLE 1 3-1
Calculation of AG'0
Glucose !-phosphate � glucose 6-phosphate
Calculate the standard free-energy change of the reac tion catalyzed by the enzyme phosphoglucomutase
given that, starting with 20 mM glucose 1-phosphate and no glucose 6-phosphate, the final equilibrium mixture at 25 oc and pH 7.0 contains 1 .0 mM glucose 1 -phosphate and 1 9 mM glucose 6-phosphate. Does the reaction in the direction of glucose 6-phosphate formation proceed with a loss or a gain of free energy?
[glucose 6-phosphate) 19 mM [glucose !-phosphate) l.OmM 19
Solution: First we calculate the equilibrium constant: K' q e
=
=
--
=
ln K�q K)(298 K)(ln 19) - -(8.315J/mol· -7.3 kJ/mol
We can now calculate the standard free-energy change: t.G'o
= -RT =
(kJ/mol)
(kcaVmol)*
- 17.1
-4.1
- 1 1 .4
-2.7
57
- 1 .4
0.0
0.0
-
1
10-
Relationship between Equilibrium Constants and Standard Free-Energy Changes of Chemical Reactions ____, _ _ _ _ _
TAB L E 1 3-3
.
5.7
1 .4
1 1 .4
2 .7
17.1
4. 1
22.8
5.5
28 . 5
6.8
34.2
8.2
• Although joules and kilojoules are the standard units o f energy and are used through out this text, biochemists and nutritionists sometimes express L1G'0 values in kilocalo ries per mole. We have therefore included values in both kilojoules and kilocalories in this table and in Tables 13-4 and 13-6. To convert kilojoules to kilocalories, divide the number of kilojoules by 4. 184.
Because the standard free-energy change is negative, the conversion of glucose ! -phosphate to glucose 6-phosphate proceeds with a loss (release) of free energy. (For the reverse reaction, 6.0'0 has the same magnitude but the opposite sign.) Table 1 3-4 gives the standard free-energy changes for some representative chemical reactions. Note that hydrolysis of simple esters, amides, peptides, and glyco sides, as well as rearrangements and eliminations, pro ceed with relatively small standard free-energy changes, whereas hydrolysis of acid anhydrides is accompanied by relatively large decreases in standard free energy. The complete oxidation of organic compounds such as glucose or palmitate to C02 and H20, which in cells re quires many steps, results in very large decreases in standard free energy. However, standard free-energy
B ioenergetics a n d Thermodynam ics
13.1
[493]
TA B L E 1 3 -4 AG'o
(kJ/mol)
Reaction type
(kcaJ/mol)
Hydrolysis reactions
Acid anhydrides - 91 . 1 - 30.5 -45. 6 - 19.2 - 43.0
- 2 1 .8 - 7.3 - 1 0.9 - 4.6 - 10.3
Ethyl acetate + H20 � ethanol + acetate Glucose 6-phosphate + H20 � glucose + P;
- 1 9.6 - 13 8
-4.7 -3.3
Glutamine + H2 0 � glutamate + NH; Glycylglycine + H20 � 2 glycine
- 14.2 - 9.2
-3.4 - 2.2
- 15.5 - 1 5.9
-3.7 - 3.8
- 7.3
- 1 .7
- 1.7 - 0.4
3.1
0.8
Acetic anhydride + H20 � 2 acetate ATP + H20 � ADP + P; ATP + H20 � AMP + PP; PP; + H2 0 � 2P; UDP-glucose + H20 � UMP + glucose 1-phosphate Esters
.
Amides and peptides
Glycosides Maltose + H2 0 � 2 glucose Lactose + H2 0 � glucose + galactose Rearrangements
Glucose !-phosphate � glucose 6-phosphate Fructose 6-phosphate � glucose 6-phosphate Elimination of water
Malate � fumarate + H20 Oxidations with molecular oxygen
Glucose + 602 � 6C02 + 6H20 Palmitate + 2302 � 16C02 + 16H20
changes such as those in Table 13-4 indicate how much free energy is available from a reaction under standard conditions. To describe the energy released under the conditions existing in cells, an expression for the actual free-energy change is essential. Actual Free-Energy Changes Depend on Reactant and Product Concentrations
We must be careful to distinguish between two different quantities: the actual free-energy change, A.G, and the standard free-energy change, A.G'0• Each chemical reac tion has a characteristic standard free-energy change, which may be positive, negative, or zero, depending on the equilibrium constant of the reaction. The standard free-energy change tells us in which direction and how far a given reaction must go to reach equilibrium when the initial concentration of each component is 1. 0 M, the pH is 7.0, the temperature is 25 oc, and the pressure is 1 0 1 .3 kPa (1 atm) . Thus tlG'0 is a constant: it has a characteristic, unchanging value for a given reaction. But the actual free-energy change, tlG, is a function of reactant and product concentrations and of the temper ature prevailing during the reaction, none of which will
-2,840 - 9, 770
-686 - 2,338
necessarily match the standard conditions as defined above. Moreover, the tlG of any reaction proceeding spontaneously toward its equilibrium is always negative, becomes less negative as the reaction proceeds, and is zero at the point of equilibrium, indicating that no more work can be done by the reaction. tlG and tlG'0 for any reaction aA + bB � cC + dD are related by the equation t:.G
=
t:.G'o
+ RT ln
[CJ"[Dld (A]a(B]b
'I (13-4)
in which the terms in red are those actually prevailing in the system under observation. The concentration terms in this equation express the effects commonly called mass action, and the term [Cf[D] ct/[A]a[B]b is called the mass-action ratio, Q. Thus E quation 1 3--4 can be expressed as tlG = tlG'o + RT ln Q. As an example, let us suppose that the reaction A + B � C + D is taking place under the standard conditions of temperature (25 °C) and pressure ( 1 0 1 . 3 kPa) but that the concentrations of A, B, C, and D are not equal and none of the compo nents is present at the standard concentration of 1 .0 M. To determine the actual free-energy change, tlG, under these nonstandard conditions of concentration as the
[494]
Bioenergetics a n d Biochemical Reaction Types
reaction proceeds from left to right, we simply enter the actual concentrations of A, B, C, and D in E quation 1 3-4; the values of R, T, and 6.G'0 are the standard val ues . 6.G is negative and approaches zero as the reaction proceeds, because the actual concentrations of A and B decrease and the concentrations of C and D increase. Notice that when a reaction is at equilibrium-when there is no force driving the reaction in either direction and 6.G is zero-Equation 1 3-4 reduces to
and the reaction rate increases dramatically. The free energy changefor a reaction is independent of the path way by which the reaction occurs; it depends only on the nature and concentration of the initial reactants and the final products. Enzymes cannot, therefore, change equilibrium constants; but they can and do increase the rate at which a reaction proceeds in the direction dictated by thermodynamics (see Section 6.2) . Standard Free-Energy Changes Are Additive
or t!.. G'o =
-
RT ln K�q
which is the equation relating the standard free-energy change and equilibrium constant (Eqn 1 3-3) . The criterion for spontaneity of a reaction is the value of 6.G, not 6.0'0• A reaction with a positive 6.G '0 can go in the forward direction if 6.G is negative. This is possible if the term RT In ([products]/[reactants]) in E quation 1 3- 4 is negative and has a larger absolute value than 6.G'0. For example, the immediate removal of the products of a reaction can keep the ratio [products]/ [reactants] well below 1 , such that the term RT In ([products]/[reactants]) has a large, negative value. 6.G'0 and 6.G are expressions of the maximum amount of free energy that a given reaction can theoretically deliver-an amount of energy that could be realized only if a perfectly efficient device were available to trap or harness it. Given that no such device is possible (some energy is always lost to entropy during any process) , the amount of work done by the reaction at constant temperature and pressure is always less than the theoretical amount. Another important point is that some thermody namically favorable reactions (that is, reactions for which 6.G'0 is large and negative) do not occur at mea surable rates. For example, combustion of firewood to C02 and H20 is very favorable thermodynamically, but firewood remains stable for years because the activation energy (see Figs 6-2 and 6-3) for the combustion reac tion is higher than the energy available at room temper ature. If the necessary activation energy is provided (with a lighted match, for example) , combustion will be gin, converting the wood to the more stable products C02 and H2 0 and releasing energy as heat and light. The heat released by this exothermic reaction provides the activation energy for combustion of neighboring regions of the firewood; the process is self-perpetuating. In living cells, reactions that would be extremely slow if uncatalyzed are caused to proceed not by supplying additional heat but by lowering the activation energy through use of an enzyme. An enzyme provides an alter native reaction pathway with a lower activation energy than the uncatalyzed reaction, so that at room tempera ture a large fraction of the substrate molecules have enough thermal energy to overcome the activation barrier,
In the case of two sequential chemical reactions, A ;;===: B and B ;;===: C, each reaction has its own equilibrium con stant and each has its characteristic standard free energy change, 6.G]0 and 6.G'z0. As the two reactions are sequential, B cancels out to give the overall reaction A ;;===: C, which has its own equilibrium constant and thus its own standard free-energy change, 6.G��tal· The 6.G'0 values of sequential chemical reactions are additive. For the overall reaction A ;;===: C, 6.G��ta1 is the sum of the individual standard free-energy changes, 6.G]0and 6.Gz0, f of the two reactions: 6.G ��tal 6.0{0+ 6.Gt
(1) (2)
Sum:
=
A�C
This principle of bioenergetics explains how a thermody namically unfavorable (endergonic) reaction can be driven in the forward direction by coupling it to a highly exergonic reaction through a common intermediate. For example, the synthesis of glucose 6-phosphate is the first step in the utilization of glucose by many organisms:
13.8
Glucose + Pi � glucose 6-phosphate + H20 6.G'0
=
kJ/mol
The positive value of 6.0'0 predicts that under standard conditions the reaction will tend not to proceed sponta neously in the direction written. Another cellular reac tion, the hydrolysis of ATP to ADP and Pi, is very exergonic: 6.G'0
( 1) (2)
=
-30.5
kJ/mol
These two reactions share the common intermediates Pi and H20 and may be expressed as sequential reactions: Glucose + Pi � glucose 6-phosphate + H20 ATP + H20 � ADP + Pi
ATP + glucose � ADP + glucose 6-phosphate
Sum:
13.8
( -30.5
-16.7
The overall standard free-energy change is obtained by adding the 6.G'0 values for individual reactions: 6.G'0
=
kJ/mol +
kJ/mol)
=
kJ/mol
The overall reaction is exergonic. In this case, energy stored in ATP is used to drive the synthesis of glucose 6-phosphate, even though its formation from glucose and inorganic phosphate (Pi) is endergonic. The pathway of glucose 6-phosphate formation from glucose by phosphoryl transfer from ATP is different from reactions
1 3 .2
(1) and (2) above, but the net result is the same as the sum of the two reactions. In thermodynamic calcula tions, all that matters is the state of the system at the be ginning of the process and its state at the end; the route between the initial and final states is immaterial. We have said that /1G'0 is a way of expressing the equilibrium constant for a reaction. For reaction (1) above, K�q,
=
[glucose 6-phosphate] 3.9 X 10- M[glucose][P;] 3
=
1
Notice that H20 is not included in this expression, as its concentration (55.5 M) is assumed to remain unchanged by the reaction. The equilibrium constant for the hydro lysis of ATP is K'e q2
=
[ADP] [Pi] [ATPJ
=
20 .
X 105 M
[ADP] [Pi] [glucose 6-phosphate] ----:-::---:':=-: : :-:::-:::-c-: ---=[glucose] [Pi] [ATPJ (K�q )(K�q ) (3. 9 X 10- 3M- 1)(2 .0 7.8 X 102
The equilibrium constant for the two coupled reactions is K'eq,
=
=
=
1
2
=
X
105M)
This calculation illustrates an important point about equilibrium constants: although the !1G'0 values for two reactions that sum to a third, overall reaction are addi tive, the K�q for the overall reaction is the product of the individual K�q values for the two reactions. Equilib rium constants are multiplicative. By coupling ATP hy drolysis to glucose 6-phosphate synthesis, the K�q for formation of glucose 6-phosphate from glucose has been raised by a factor of about 2 x 1 05 . This common-intermediate strategy is employed by all living cells in the synthesis of metabolic intermediates and cellular components. Obviously, the strategy works only if compounds such as ATP are continuously avail able. In the following chapters we consider several of the most important cellular pathways for producing ATP.
S U M M A RY 1 3 . 1 •
•
•
Bioenergetics a n d Thermodynamics
Living cells constantly perform work. They require energy for maintaining their highly organized structures, synthesizing cellular components, generating electric currents, and many other processes. Bioenergetics is the quantitative study of energy relationships and energy conversions in biological systems. Biological energy transformations obey the laws of thermodynamics.
All
chemical reactions are influenced by two forces: the tendency to achieve the most stable bonding state (for which enthalpy, H, is a useful expression) and the tendency to achieve the highest degree of
Chem ical Logic a n d Co m m o n B iochemical Reactions
[495]
randomness, expressed as entropy, S. The net driving force in a reaction is /1G, the free-energy change, which represents the net effect of these two factors: /1G /1H - T!l.S. •
•
•
•
=
The standard transformed free-energy change, /1G'0, is a physical constant that is characteristic for a given reaction and can be calculated from the equilibrium constant for the reaction: /1G'0 -RT In K�q· =
The actual free-energy change, /1G, is a variable that depends on /1G'0 and on the concentrations of reactants and products: !1G !1G'0 + RT ln ([products]/[reactants] ) . =
When /1G is large and negative, the reaction tends to go in the forward direction; when /1G is large and positive, the reaction tends to go in the reverse direction; and when /1G = 0, the system is at equilibrium. The free-energy change for a reaction is independent of the pathway by which the reaction occurs. Free-energy changes are additive; the net chemical reaction that results from successive reactions sharing a common intermediate has an overall free-energy change that is the sum of the t::. G values for the individual reactions.
1 3 .2 Chemical Logic and Common Biochemical Reactions The biological energy transductions we are concerned with in this book are chemical reactions. Cellular chem istry does not encompass every kind of reaction learned in a typical organic chemistry course. Which reactions take place in biological systems and which do not is de termined by (1) their relevance to that particular meta bolic system and (2) their rates. Both considerations play major roles in shaping the metabolic pathways we consider throughout the rest of the book. A relevant re action is one that makes use of an available substrate and converts it to a useful product. However, even a po tentially relevant reaction may not occur. Some chemi cal transformations are too slow (have activation energies that are too high) to contribute to living sys tems even with the aid of powerful enzyme catalysts. The reactions that do occur in cells represent a toolbox that evolution has used to construct metabolic pathways that circumvent the "impossible" reactions. Learning to recognize the plausible reactions can be a great aid in developing a command of biochemistry. Even so, the number of metabolic transformations taking place in a typical cell can seem overwhelming. Most cells have the capacity to carry out thousands of specific, enzyme-catalyzed reactions: for example, trans formation of a simple nutrient such as glucose into amino acids, nucleotides, or lipids; extraction of energy from fu els by oxidation; and polymerization of monomeric sub units into macromolecules.
[49 6]
Bioenergetics a n d B iochemical Reaction Types
To study these reactions, some organization is es sential. There are patterns within the chemistry of life; you do not need to learn every individual reaction to comprehend the molecular logic of biochemistry. Most of the reactions in living cells fall into one of five general categories: ( 1 ) reactions that make or break carbon-carbon bonds; (2) internal rearrangements, iso merizations, and eliminations; (3) free-radical reactions; (4) group transfers; and (5) oxidation-reductions. We discuss each of these in more detail below and refer to some examples of each type in later chapters. Note that the five reaction types are not mutually exclusive; for example, an isomerization reaction may involve a free radical intermediate. Before proceeding, however, we should review two basic chemical principles. First, a covalent bond consists of a shared pair of electrons , and the bond can be broken in two general ways (Fig. 13-1 ) . In homolytic cleav age, each atom leaves the bond as a radical, carrying one unpaired electron. In heterolytic cleavage, which is more common, one atom retains both bonding elec trons. The species most often generated when C-C and C-H bonds are cleaved are illustrated in Figure 13-1 . Carbanions, carbocations, and hydride ions are highly unstable; this instability shapes the chemistry of these ions, as we shall see. The second basic principle is that many biochemical reactions involve interactions between nucleophiles Homolytic cleavage
I
-C-H
i
I I
H atom
I
I
I
I
1
I
I
I
I
-C :
I
+
Carbanion
I
-C-H
I
I
I
I
I
I
-c �
I
I
-c
I
Carbanion FIGURE 1 3-1
unprotonated hydroxyl
group or an ionized carboxylic acid)
/""' - s:
Negatively charged
carbonyl group (the
more electronegative
oxygen of the carbonyl group pulls electrons
away from the carbon)
" r:H+ C=, -
sulfhydryl
I
/ VI
r- -c:
H
I
Carbanion
-N1
/""'
Pronated imine group
(activated for nucleophilic
attack at the carbon by
Uncharged
protonation of the imine)
amine group
h
N
H NV
��
Carbon atom of a
cj/:R ru
o: )_
Imidazole
0
Phosphorus of
a phosphate group
/""'
H-OT
Hydroxide ion
FIGURE 1 3-2
Common nucleophiles and electrophiles in biochemi
cal reactions.
Chemical reaction mechanisms, wh ich trace the for
mation and breakage of covalent bonds, are communicated with dots
by dots (:) . Cu rved arrows ( r-- ) represent the movement of electron
a single-headed (fish hook-type) arrow is used (/""' ) . Most reaction
steps i nvolve an unshared e lectron pair.
H� Proton
+
Carbocation
- c - c- �
oxygen (as in an
pairs. For movement of a si ngle electron (as in a free rad ical reaction),
Carbon radicals
I
Negatively charged
c-
bonded electrons i mportant to the reaction mechanism are designated
- c - c- � - c · + · c -
I
-
ing." A covalent bond consists of a shared pai r of electrons. Non
� -C ' + ' H
-C-H
(":R
/""' : -o
and cu rved arrows, a convention known informal ly as "electron push
Carbon radical
Heterolytic cleavage
Electrophiles
Nucleophiles
+
H: Hydride
I
c-
1
Carbocation
Two mechanisms for cleavage of a C--C or C-H bond.
In a homolytic cleavage, each atom keeps one of the bonding electrons, resulting in the formation of carbon radicals (carbons having unpaired electrons) or uncharged hydrogen atoms. In a heterolytic c leavage, one of the atoms retains both bonding electrons. This can result i n the for mation of carbanions, carbocations, protons, or hydride ions.
(functional groups rich in and capable of donating elec trons) and electrophiles (electron-deficient functional groups that seek electrons) . Nucleophiles combine with and give up electrons to electrophiles. Common biological nucleophiles and electrophiles are shown in Figure 13-2 . Note that a carbon atom can act as either a nucleophile or an electrophile, depending on which bonds and functional groups surround it.
Reactions That Make or Break Carbon-Carbon Bonds Heterolytic cleavage of a C-C bond yields a carbanion and a carbocation (Fig. 1 3-1 ) . Con versely, the formation of a C-C bond involves the combination of a nucleophilic carbanion and an elec trophilic carbocation. Carbanions and carbocations are generally so unstable that their formation as reaction intermediates can be energetically inaccessible even with enzyme catalysts. For the purpose of cellular bio chemistry they are impossible reactions-unless chemical assistance is provided in the form of func tional groups containing electronegative atoms (0 and
Chem ica l log i c and Common Biochem ical Reactions
1 3 .2
N) that can alter the electronic structure of adjacent carbon atoms so as to stabilize and facilitate the forma tion of carbanion and carbocation intermediates. Carbonyl groups are particularly important in the chemical transformations of metabolic pathways. The car bon of a carbonyl group has a partial positive charge due to the electron-withdrawing property of the carbonyl oxy gen, and thus is an electrophilic carbon (Fig. 13-3a). A carbonyl group can thus facilitate the fonnation of a car banion on an adjoining carbon by delocalizing the carban ion's negative charge (Fig. 13- 3b) . An imine (C + NH2) group can serve a similar function (Fig. 13-3c). The ca pacity of carbonyl and imine groups to delocalize elec trons can be further enhanced by a general acid catalyst or by a metal ion such as Mg2+ (Fig. 13-3d; see also Figs 6-21 and 6-23). The importance of a carbonyl group is evident in three major classes of reactions in which C-C bonds are formed or broken (Fig. 13-4): aldol condensations , Claisen ester condensations , and decarboxylations. In each type of reaction, a carbanion intermediate is stabi lized by a carbonyl group, and in many cases another carbonyl provides the electrophile with which the nucle ophilic carbanion reacts. An aldol condensation is a common route to the formation of a C-C bond; the aldolase reaction, which converts a six-carbon compound to two three-carbon compounds in glycolysis, is an aldol condensation in re verse (see Fig. 14-5) . In a Claisen condensation, the carbanion is stabilized by the carbonyl of an adjacent thioester; an example is the synthesis of citrate in the cit ric acid cycle (see Fig. 16-9) . Decarboxylation also com monly involves the formation of a carbanion stabilized by a carbonyl group; the acetoacetate decarboxylase
o tu .e:.
o1
(b) - c - c =- � - c = c -
�NH2 11 .
-r; (c) -C- 1 I I
=-
I
NH2 I
1
I
� -C-C=C-
I
I
/ HA
(d)
o' II
-c-
FIGURE 1 3-3 Chemical properties of carbonyl groups. (a) The carbon atom of a carbonyl group is an electroph i le by v i rtue of the electron withdrawi n g capacity of the electronegative oxygen atom, which re sults in a resonance hybrid structure in which the carbon has a partial positive charge. (b) With i n a molecule, delocal ization of electrons i nto a carbonyl group stab i l i zes a carbanion on an adjacent carbon, fac i l itating its formation . (c) ! m i nes function m u ch l i ke carbonyl groups in faci l itating electron withd rawal . (d) Carbonyl groups do not a lways function alone; thei r capacity as electron s i nks often is aug mented by interaction with either a metal ion (Me2 + , such as Mg2 + ) or a general acid (HA).
H+
[497]
0 R.,' R R., R. II I " I '� II I ''"3 R -C-C : ......+ C 0 � R - C-C -C - O H I I I I I 0
H
H4 H Aldol condensation
O
II
H
I
HI
_
R1
1 (1!
CoA-S-C-C :......+ C - 0
I �
O H
II
H+
�
R.
I
0
II
HI �
..
0
I
H+
__L__.
11
CoA-S-C-C - C - OH
I
H
Claisen ester condensation
R -C- -C II'\
R
I �
0 H
II
I
R-C - C - H + CO2
I
o H H Decarboxylation of a /3-keto acid
F IGURE 13-4 Some common reactions that form and break C-C bonds in biological systems. For both the aldol condensation and the
Cla isen condensation, a carbanion serves as nucleophile and the car bon of a carbonyl group serves as electroph i le. The carbanion is stabi l ized in each case by another carbonyl at the adjoi n i ng carbon. In the decarboxylation reaction, a carban ion is formed on the carbon shaded b l ue as the C02 leaves. The reaction would not occur at an apprecia
ble rate without the stabi l izing effect of the carbonyl adjacent to the carbanion carbon. Wherever a carbanion is shown, a stab i l izing reso nance with the adjacent carbonyl, as shown in Figure 1 3-3 b, is as sumed. An i m i ne ( Fig. 1 3-3c) or other electron-withdrawing group (including certai n enzymatic cofactors such as pyridoxal) can replace the carbonyl group in the stab i l i zation of carbanions.
reaction that occurs in the formation of ketone bodies during fatty acid catabolism provides an example (see Fig. 1 7-18) . Entire metabolic pathways are organized around the introduction of a carbonyl group in a particu lar location so that a nearby carbon-carbon bond can be formed or cleaved. In some reactions, an imine or a spe cialized cofactor such as pyridoxal phosphate plays the electron-withdrawing role of the carbonyl group. The carbocation intermediate occurring in some re actions that form or cleave C-C bonds is generated by the elimination of a very good leaving group, such as py rophosphate (see Group Transfer Reactions below) . An example is the prenyltransferase reaction (Fig. 13-5 ) , an early step in the pathway of cholesterol biosynthesis. Internal Rearrangements, lsomerizations, and Eliminations Another common type of cellular reac tion is an intramolecular rearrangement in which redis tribution of electrons results in alterations of many different types without a change in the overall oxidation state of the molecule . For example, different groups in a molecule may undergo oxidation-reduction, with no net change in oxidation state of the molecule; groups at a double bond may undergo a cis-trans rearrangement; or the positions of double bonds may be transposed. An ex ample of an isomerization entailing oxidation-reduction is the formation of fructose 6-phosphate from glucose
L498]
Bioen ergetics a n d Biochemical Rea ction Types
CH Hz I 0 0 I I /c,C4'c,CH3 -o - P-0P-0 H I I oo-
6-phosphate in glycolysis (Fig. 1 3-6 ; this reaction is discussed in detail in Chapter 1 4) : C-1 is reduced (alde hyde to alcohol) and C-2 is oxidized (alcohol to ketone) . Figure 1 3-6b shows the details of the electron move ments in this type of isomerization. A cis-trans re arrangement is illustrated by the prolyl cis-trans isomerase reaction in the folding of certain proteins (see Fig. 4-7b) . A simple transposition of a C = C bond oc curs during metabolism of oleic acid, a common fatty acid (see Fig. 1 7-9) . Some spectacular examples of double-bond repositioning occur in the biosynthesis of cholesterol (see Fig. 2 1-33) . An example of an elimination reaction that does not affect overall oxidation state is the loss of water from an alcohol, resulting in the introduction of a C=C bond:
a
Dirnethyiallyi pyrophosphate
Isopente nyl pyTophosphate
PP;
CH3 H I CHr_,_c2 '-�4'c'-CH3 o o /CH 2 ...-.:: CI � -o - Pl - 0 - PI - 0 /C ' CH I I '( o - o- H H 2
Isopentenyl pyrophosphate
�w
I
H H
� �
Dimethylallylic carbocation
HI OH
� � -o -�P - 0-P-0 I Ioo F I G U R E 1 3 - 5 Carbocations in carbon-carbon bond formation. I n p renyl transferase catal yzes condensation of i sopentenyl py rophosphate and d i methy l a l l y l pyrophosph ate to form geranyl py is
i n iti ated by
e l i m i nation of pyrophosphate from the d i m ethy l a l l y l pyrophos p h ate to generate a carbocat ion, sta b i l i zed by reson ance with the adjacent C=C bond.
(a)
/ ' c=C
1 � H/
H 20
"-
R1
Free-Radical Reactions Once thought to be rare, the homolytic cleavage of covalent bonds to generate free radicals has now been found in a wide range of biochem ical processes. These include: isomerizations that make use of adenosylcobalarnin (vitamin B12) or S-adenosyl methionine, which are initiated with a 5'-deoxyadenosyl radical (see the methylrnalonyl-CoA mutase reaction in Box 1 7-2) ; certain radical-initiated decarboxylation re actions (Fig. 13-7) ; some reductase reactions, such as that catalyzed by ribonucleotide reductase (see Fig. 22-4 1 ) ; and some rearrangement reactions, such as that catalyzed by DNA photolyase (see Fig. 25-27) .
o n e o f t h e early steps i n chol esterol b i osynthes i s, the enzyme
F i g . 2 1 -3 6 ) . The reaction
H
R
Similar reactions can result from eliminations in arnines.
Geranyt pyrophosphate
rophosphate (see
H 20
R - - -R ____1__.
I
I I
H OHH H H oH OHH H H 0 I I I I I 1 2 2 H-� -?- ? -? -? -? -o-r - o - ;:::::=== H- ? -� -?I - ?- ?- ?I -o-rI - o OH 0 H OHOHH 0 o OH H OHOHH 0 1
pJw,p holw." '''
Glucose 6-phosphate
/:
(b)
")I
H
r,l -C-
-C 0 OH H I
Bz
G) @ @
l " OII I l'l'a:- t
B1 abstracts a proton. This allows the formation of a C = C double bond
Electrons from carbonyl form an 0-H bond with the hydrogen ion donated by B2•
FIGURE 1 3 - 6 Isomerization and elimination reactions. (a) The con
1
Fructose 6-phosphate
�y H @
I
} dJH H -C=C-
.
Bz ·
J
An electron pair is displaced from the C = C bond to form a C - H bond with the proton donated by B1•
@
H I
-C-C-
----.
I OH 0I
B2 abstracts a proton, allowing the formation of a C = O bond.
Enediol intermediate
version of gl ucose 6-phosphate to fructose 6-phosphate, a reaction of
follow the path of oxidation from left to right. B 1 and B2 are ionizable groups on the enzyme; they are capable of donati ng and accepti ng
sugar metabolism catalyzed by phosphohexose isomerase. (b) Th i s
protons (acti ng as general acids or general bases) as the reaction pro
reaction proceeds through an enediol intermediate. The curved b l ue
ceeds. P i n k screens i ndicate nucleophi l ic groups; b l ue, electroph i l ic.
arrows represent movement of bonding electron pairs. Pink screens
1 3 .2
ooc
Chem ical Logic a n d Common Biochemical Reactions
[499]
ooc
-x·� H�"'
a,c-r
CH3-C
Acetate
stabilization
Molecular Biology, 3rd edn (Fasman, G.D., ed.), Physical and Chemical Data, Vol. 1, pp.
.fo
on
o·'
Source: Data mostly from Jencks, W.P. (1976) in Handbook of Biochemistry and
I Thio
·
gen atom in oxygen esters. The complete structure of coenzyme A (CoA, or CoASH) is shown in Figure 8-3 8.
are resonance-stabilized, is greater for thioesters than for comparable oxygen esters (Fig. 1 3-1 7) . In both cases, hydrolysis of the ester generates a carboxylic acid, which can ionize and assume several resonance forms. Together, these factors result in the large, nega tive !::. G '0 ( - 3 1 .4 kJ/mol) for acetyl-GoA hydrolysis. To summarize, for hydrolysis reactions with large, negative, standard free-energy changes, the products are more stable than the reactants for one or more of the following reasons: (1) the bond strain in reactants due to electrostatic repulsion is relieved by charge separation, as for ATP; (2) the products are stabilized by ionization, as for ATP, acyl phosphates, and thioesters; (3) the prod ucts are stabilized by isomerization (tautomerization) , as
I
.' - R resonance
FIGURE 1 3-17 Free energy of hydrolysis for
stabilization
.!0 for thioester hydrolysis
0 -R I!.G for oxygen
ester hydrolysis
thioesters and oxygen esters. The products of
both types of hydrolysis reaction have about the same free-energy content (C), but the thioester has a higher free-energy content than the oxygen
ester. Orbital overlap between the 0 and C atoms + R-SH
+ R-OH
a l lows resonance stabilization in oxygen esters; orbital overlap between 5 and C atoms is poorer and provides l ittle resonance stabi l ization.
[soo]
Bioen ergetics a n d Biochemical Reaction Types
for PEP; and/or (4) the products are stabilized by reso nance, as for creatine released from phosphocreatine, carboxylate ion released from acyl phosphates and thioesters, and phosphate (Pi) released from anhydride or ester linkages. ATP Provides Energy by Group Transfers, Not by Simple Hydrolysis
Throughout this book you will encounter reactions or processes for which ATP supplies energy, and the con tribution of ATP to these reactions is commonly indi cated as in Figure 1 3-18a, with a single arrow showing the conversion of ATP to ADP and Pi (or, in some cases, of ATP to AMP and pyrophosphate, PP;) . When written this way, these reactions of ATP seem to be simple hy drolysis reactions in which water displaces Pi (or PPi) , and one is tempted to say that an ATP-dependent reac tion is "driven by the hydrolysis of ATP." This is not the case. ATP hydrolysis per se usually accomplishes noth ing but the liberation of heat, which cannot drive a chemical process in an isothermal system. A single re action arrow such as that in Figure 1 3-1 8a almost in variably represents a two-step process (Fig. 13-18b) in which part of the ATP molecule, a phosphoryl or (a) Written as a one-step reaction
� _/
ATP + 1\ti a
ADP + P.
+
coo
I
H3N-CH I CH2 I CH2 I
c � " 0 NH2
Glutamate
�
Glutamine
c oo -
H8N-6R j
CHl!
I
CH2
)
, o�
o / 0
®
pI
.. P p9'
0
Enzyme-bound glutamyl phosphate
(b) Actual two-step reaction FIGURE 1 3-18 ATP hydrolysis in two steps. (a) The contribution of ATP to a reaction is often shown as a s i ngle step, but is a l most always a two step process. (b) Shown here is the reaction catalyzed by ATP-dependent gl utamine synthetase. to gl utamate, then released as P,.
(X)
CD
A phosphoryl group is transferred from ATP
the phosphoryl group is displaced by N H 3 and
pyrophosphoryl group or the adenylate moiety (AMP) , is first transferred to a substrate molecule or to an amino acid residue in an enzyme, becoming covalently attached to the substrate or the enzyme and raising its free-energy content. Then, in a second step, the phos phate-containing moiety transferred in the first step is displaced, generating Pi, PPi, or AMP. Thus ATP partic ipates covalently in the enzyme-catalyzed reaction to which it contributes free energy. Some processes do involve direct hydrolysis of ATP (or GTP) , however. For example, noncovalent binding of ATP (or GTP) , followed by its hydrolysis to ADP (or GDP) and Pi, can provide the energy to cycle some pro teins between two conformations, producing mechani cal motion. This occurs in muscle contraction (see Fig. 5-31), and in the movement of enzymes along DNA (see Fig. 25-35) or of ribosomes along messenger RNA (see Fig. 27-30) . The energy-dependent reactions cat alyzed by helicases, RecA protein, and some topoiso rnerases (Chapter 25) also involve direct hydrolysis of phosphoanhydride bonds. The AAA + ATPases involved in DNA replication and other processes described in Chapter 25 use ATP hydrolysis to cycle associated pro teins between active and inactive forms. GTP-binding proteins that act in signaling pathways directly hy drolyze GTP to drive conformational changes that termi nate signals triggered by hormones or by other extracellular factors (Chapter 1 2) . The phosphate compounds found in living organisms can be divided somewhat arbitrarily into two groups, based on their standard free energies of hydrolysis (Fig. 1 3-19). "High-energy" compounds have a 6.G'0 of hydrolysis more negative than - 25 kJ/rnol; "low-energy" compounds have a less negative 6.G'0. Based on this cri terion, ATP, with a 6.G'0 of hydrolysis of -30.5 kJ/rnol ( - 7.3 kcal/rnol) , is a high-energy compound; glucose 6-phosphate, with a 6.G'0 of hydrolysis of - 13.8 kJ/rnol ( -3.3 kcallrnol) , is a low-energy compound. The term "high-energy phosphate bond," long used by biochemists to describe the P-0 bond broken in hydrolysis reactions, is incorrect and misleading as it wrongly suggests that the bond itself contains the en ergy. In fact, the breaking of all chemical bonds re quires an input of energy. The free energy released by hydrolysis of phosphate compounds does not come from the specific bond that is broken; it results from the products of the reaction having a lower free-energy content than the reactants. For simplicity, we will sometimes use the term "high-energy phosphate corn pound" when referring to ATP or other phosphate compounds with a large, negative, standard free en ergy of hydrolysis. As is evident from the additivity of free-energy changes of sequential reactions (see Section 13.1), any phosphorylated compound can be synthesized by cou pling the synthesis to the breakdown of another phos phorylated compound with a more negative free energy of hydrolysis. For example, because cleavage of Pi from
1 3 .3 Phosphoryl Group Transfers a n d AlP
- 70
-60
- 50
coo-
-
3
0
II
CH2
0- P 0 � / c
I
HOH
1,3-Bisphosphoglycerate y
CH2-0
- 40
-
l
C-0- P •
--®
Phosphoenolpyruvate
•
":
I Adenine � P
-J Creatine '
/Phosphocreatine p
Glucose 6p
I
Glycerol-
P
Sum:
from high-energy phosphoryl group
cose and glycerol) to form their low-energy phos phate derivatives. This flow of phosphoryl groups, catalyzed by kinases, proceeds with an overal l loss of free energy under i ntrace l l u lar conditions. Hy drolysis of low-energy phosphate compounds re leases P;, which has an even lower phosphoryl group transfer potential (as defined in the text).
1
L
PEP ------+ pyruvate Pi -61.9 ADP + Pi ------+ ATP +30.5 PEP + ADP ------+ pyruvate + ATP - 1 + H20
®,
compounds
phosphoenolpyruvate releases more energy than is needed to drive the condensation of Pi with ADP, the di rect donation of a phosphoryl group from PEP to ADP is thermodynamically feasible:
(1) (2)
sented by
donors via ATP to acceptor molecules (such as glu
/
-w
0
This shows the flow of phosphoryl groups, repre
Lo w -energy
J
p
FIGURE 1 3 - 1 9 Ranking of biological phosphate compounds by standard free energies of hydrolysis.
High-energy compounds
ATP
- 20
[s o7]
+ H20
+
3 4 .
Notice that while the overall reaction is represented as the algebraic sum of the first two reactions, the overall reaction is actually a third, distinct reaction that does not involve Pi; PEP donates a phosphoryl group di rectly to ADP. We can describe phosphorylated com pounds as having a high or low phosphoryl group transfer potential, on the basis of their standard free en ergies of hydrolysis (as listed in Table 13-6). The phos phoryl group transfer potential of PEP is very high, that of ATP is high, and that of glucose 6-phosphate is low (Fig. 13-19) . Much of catabolism is directed toward the synthesis of high-energy phosphate compounds, but their forma tion is not an end in itself; they are the means of activat ing a very wide variety of compounds for further chemical transformation. The transfer of a phosphoryl group to a compound effectively puts free energy into that compound, so that it has more free energy to give up during subsequent metabolic transformations. We described above how the synthesis of glucose 6-phos phate is accomplished by phosphoryl group transfer from ATP. In the next chapter we see how this phospho rylation of glucose activates, or "primes," the glucose for catabolic reactions that occur in nearly every living cell. Because of its intermediate position on the scale of
group transfer potential, ATP can carry energy from high-energy phosphate compounds produced by catabo lism to compounds such as glucose, converting them into more reactive species. ATP thus serves as the uni versal energy currency in all living cells. One more chemical feature of ATP is crucial to its role in metabolism: although in aqueous solution ATP is thermodynamically unstable and is therefore a good phosphoryl group donor, it is kinetically stable. Because of the huge activation energies (200 to 400 kJ/mol) re quired for uncatalyzed cleavage of its phosphoanhy dride bonds, ATP does not spontaneously donate phosphoryl groups to water or to the hundreds of other potential acceptors in the cell. Only when specific en zymes are present to lower the energy of activation does phosphoryl group transfer from ATP proceed. The cell is therefore able to regulate the disposition of the energy carried by ATP by regulating the various enzymes that act on it. ATP Donates Phosphoryl, Pyrophosphoryl, and Adenylyl G roups
The reactions of ATP are generally SN2 nucleophilic displacements (see Section 13.2) in which the nucle ophile may be, for example, the oxygen of an alcohol or carboxylate, or a nitrogen of creatine or of the side chain of arginine or histidine. Each of the three phos phates of ATP is susceptible to nucleophilic attack (Fig. 13-20) , and each position of attack yields a dif ferent type of product. Nucleophilic attack by an alcohol on the 'Y phosphate (Fig. 13-20a) displaces ADP and produces a new phos phate ester. Studies with 1 8 0-labeled reactants have shown that the bridge oxygen in the new compound is
[sos]
Bioene rgetics a n d Biochemical Reaction Types
FIGURE 1 3-20 Nucleophilic displacement reactions of
ATP. Any of the three P atoms (a,
(3, or y) may serve as the
Three positions on ATP for attack by the nucleophile R180
may be an alcohol (ROH), a carboxyl group ( RCOO - ), or phate, for examp le)_ (a) When the oxygen of the nuc leo phile attacks the y position, the bri dge oxygen of the product is labeled, i n dicating that the group transferred (-OPO� -) . (b) Attack on the
(3 position displaces AMP
and leads to the transfer of a pyrophosphoryl (not py rophosphate) group to the nucleophile. (c) Attack on the
a
position displaces PP; and transfers the adenylyl group
to the nucleophi le.
(3
0
0
(b r:
0
a phosphoanhydride (a nuc leoside mono- or di phos
from ATP is a phosphoryl (-PO� - ), not a phosphate
II
II
'Y
electrophilic target for nucleop h i l i c attack-in this case, by the labeled nuc leoph i l e R- 1 8 0:. The n uc l eoph i le
II
0
+
/
R 1 "0 - P -o-
I
o-
p
1
II
0
+
II
0
R 1 RO - P - O -P - O
I
o-
o-
II
0
+
R1HO - P-0
I
�
-
Rib H Adenine
o-
ADP
AMP
PP;
Phosphoryl transfer
Pyrophosphoryl transfer
Adenylyl transfer
(a)
(b)
(c)
derived from the alcohol, not from ATP; the group trans ferred from ATP is therefore a phosphoryl (-Po§ - ) , not a phosphate (- OPO§ - ) . Phosphoryl group transfer from ATP to glutamate (Fig. 13-18) or to glucose (p. 2 1 2) in volves attack at the I' position of the ATP molecule. Attack at the {3 phosphate of ATP displaces AMP and transfers a pyrophosphoryl (not pyrophosphate) group to the attacking nucleophile (Fig. 13-20b) . For example, the formation of 5-phosphoribosyl-1 -pyrophosphate (p. 861 ) , a key intermediate in nucleotide synthesis, results from attack of an -OH of the ribose on the {3 phosphate. Nucleophilic attack at the a position of ATP dis places PPi and transfers adenylate (5' -AMP) as an adenylyl group (Fig. 1 3-20c) ; the reaction is an adeny lylation (a-den ' -i-li-la'-shun, one of the most ungainly words in the biochemical language) . Notice that hydro lysis of the a-{3 phosphoanhydride bond releases con siderably more energy ( -46 kJ/mol) than hydrolysis of the {3-!' bond ( -31 kJ/mol) (Table 13-6). Furthermore, the PPi formed as a byproduct of the adenylylation is hy drolyzed to two Pi by the ubiquitous enzyme inorganic pyrophosphatase, releasing 1 9 kJ/mol and thereby providing a further energy "push" for the adenylylation reaction. In effect, both phosphoanhydride bonds of ATP are split in the overall reaction. Adenylylation reac tions are therefore thermodynamically very favorable. When the energy of ATP is used to drive a particularly unfavorable metabolic reaction, adenylylation is often the mechanism of energy coupling. Fatty acid activation is a good example of this energy-coupling strategy. The first step in the activation of a fatty acid either for energy-yielding oxidation or for use in the synthesis of more complex lipids-is the formation of its thiol ester (see Fig. 1 7-5) . The direct condensation of a fatty acid with coenzyme A is endergonic, but the formation of fatty acyl-CoA is made exergonic by step wise removal of two phosphoryl groups from ATP. First, adenylate (AMP) is transferred from ATP to the carboxyl group of the fatty acid, forming a mixed anhy-
� ·
dride (fatty acyl adenylate) and liberating PPi. The thiol group of coenzyme A then displaces the adenylyl group and forms a thioester with the fatty acid. The sum of these two reactions is energetically equivalent to the exergonic hydrolysis of ATP to AMP and PPi (!J.G ' 0 = - 45.6 kJ/mol) and the endergonic formation of fatty acyl-CoA (!J.G '0 = 3 1 .4 kJ/mol) . The formation of fatty acyl-CoA is made energetically favorable by hydrolysis of the PPi by inorganic pyrophosphatase. Thus, in the activation of a fatty acid, both phosphoan hydride bonds of ATP are broken. The resulting !J.G'o is the sum of the !J.G '0 values for the breakage of these bonds, or -45.6 kJ/mol + ( -19 .2) kJ/mol: t:.. G ' 0
= -64. 8 kJ/mol
The activation of amino acids before their polymer ization into proteins (see Fig. 27- 1 9) is accomplished by an analogous set of reactions in which a transfer RNA molecule takes the place of coenzyme A. An interesting use of the cleavage of ATP to AMP and PPi occurs in the firefly, which uses ATP as an energy source to produce light flashes (Box 1 3-1 ) . Assembly of I nformational Macromolecules Requires Energy
When simple precursors are assembled into high molec ular weight polymers with defined sequences (DNA, RNA, proteins) , as described in detail in Part III, energy is required both for the condensation of monomeric units and for the creation of ordered sequences. The precursors for DNA and RNA synthesis are nucleoside triphosphates, and polymerization is accompanied by cleavage of the phosphoanhydride linkage between the a and {3 phosphates, with the release of PPi (Fig. 13-20) . The moieties transferred to the growing polymer in these reactions are adenylate (AMP) , guanylate (GMP) , cytidylate (CMP) , or uridylate (UMP) for RNA synthe sis, and their deoxy analogs (with TMP in place of UMP)
1 3 . 3 Phosphoryl Group Transfers a n d ATP
BOX 1 3-1
[so9]
F i refly F l a s h e s · G l owing Reports of ATP
�------� L-
-------------� ---� � �
Bioluminescence requires considerable amounts of en
ferin. This process is accompanied by emission of light.
ergy. In the firefly, ATP is used in a set of reactions that
The color of the light flash differs with the firefly species
converts chemical energy into light energy. In the 1 950s,
and seems to be determined by differences in the struc
from many thousands of fireflies collected by children in
ture of the luciferase . Luciferin is regenerated from oxy
and around Baltimore, William McElroy and his col
luciferin in a subsequent series of reactions.
leagues at The Johns Hopkins University isolated the
In the laboratory, pure firefly luciferin and luciferase
principal biochemical components: luciferin, a complex
are used to measure minute quantities of ATP by the in
carboxylic acid, and luciferase , an enzyme. The genera
tensity of the light flash produced. As little as a few pica 12 moles ( 1 0 - mol) of ATP can be measured in this way.
tion of a light flash requires activation of luciferin by an enzymatic reaction involving pyrophosphate cleavage of
An enlightening extension of the studies in luciferase
ATP to form luciferyl adenylate (Fig. 1 ) . In the presence
was the cloning of the luciferase gene into tobacco
of molecular oxygen and luciferase, the luciferin under
plants. When watered with a solution containing lu
goes a multistep oxidative decarboxylation to oxyluci-
ciferin, the plants glowed in the dark (see Fig. 9-29) .
I C-0-P-O-j Rib H Adenine [ � X . H 0I 0II HO�S S H Luciferyl adenylate a
o-
1
AMP
ATP
The firefly, a beetle of the Lampyridae fam i ly.
�X HO�S S Luciferin
H
C02 + AMP
H
regen rating
FIGURE 1 I mportant components i n the firefly biolumi nescence cycle.
reattiona
�
�N>- J I
111!11 �
__ ___
C H3
R'
(TPP) (Fig. 14-14 ), a coenzyme derived from vitamin
B1. Lack of vitamin B1 in the human diet leads to the con dition known as beriberi, characterized by an accumula tion of body fluids (swelling) , pain, paralysis, and ultimately death. • Thiamine pyrophosphate plays an important role in the cleavage of bonds adjacent to a carbonyl group, such as the decarboxylation of a-keto acids, and in chemical rearrangements in which an activated acetaldehyde group is transferred from one carbon atom to another (Table 14-1) . The functional part of TPP, the thiazolium ring, has a relatively acidic proton at C-2. Loss of this proton produces a carbanion that is the active species in
TPP-dependent reactions (Fig. 14-14) . The carbanion readily adds to carbonyl groups, and the thiazolium ring is thereby positioned to act as an "electron sink" that greatly facilitates reactions such as the decarboxylation catalyzed by pyruvate decarboxylase. Fermentations Are Used to Produce Some Common Foods and Industrial Chemicals
Our progenitors learned millennia ago to use fermenta tion in the production and preservation of foods. Certain microorganisms present in raw food products ferment the carbohydrates and yield metabolic products that give the foods their characteristic forms, textures, and tastes. Yogurt, already known in Biblical times, is pro duced when the bacterium Lactobacillus bulgaricus ferments the carbohydrate in milk, producing lactic acid; the resulting drop in pH causes the milk proteins to precipitate, producing the thick texture and sour taste
1 4.4 G l u coneogenesis
TA B L E 1 4-1
0II
Enzyme
Pathway(s)
Bond cleaved
Pyruvate decarboxylase
Ethanol fermentation
R1 - - c 0
Synthesis of acetyl-GoA Citric acid cycle
Transketolase
Carbon-assimilation reactions Pentose phosphate pathway
propionic acid and C02 ; the propionic acid precipitates milk proteins, and bubbles of C02 cause the holes char acteristic of Swiss cheese. Many other food products are the result of fermentations: pickles, sauerkraut, sausage, soy sauce, and a variety of national favorites, such as kimchi (Korea) , tempoyak (Indonesia) , kefir (Russia) , dahi (India) , and pozol (Mexico) . The drop in pH associ ated with fermentation also helps to preserve foods, be cause most of the microorganisms that cause food spoilage cannot grow at low pH. In agriculture, plant byproducts such as corn stalks are preserved for use as animal feed by packing them into a large container (a silo) with limited access to air; microbial fermentation produces acids that lower the pH. The silage that results from this fermentation process can be kept as animal feed for long periods without spoilage. In 1 9 1 0 Chaim Weizmann (later to become the first president of Israel) discovered that the bac terium Clostridium acetobutyricum ferments starch to butanol and acetone. This discovery opened the field of industrial fermentations , in which some read ily available material rich in carbohydrate (corn starch or molasses, for example) is supplied to a pure culture of a specific microorganism, which ferments it into a product of greater commercial value. The ethanol used to make "gasohol" is produced by micro bial fermentation, as are formic, acetic, propionic, bu tyric, and succinic acids, and glycerol, methanol, isopropanol, butanol, and butanediol. These fermen tations are generally carried out in huge closed vats in which temperature and access to air are controlled to favor the multiplication of the desired microorganism and to exclude contaminating organisms. The beauty of industrial fermentations is that complicated, multi step chemical transformations are carried out in high yields and with few side products by chemical facto ries that reproduce themselves-microbial cells. For some industrial fermentations , technology has been
o-
4-o
II
Pyruvate dehydrogenase a - Ketoglutarate dehydrogenase
of unsweetened yogurt. Another bacterium, Propioni bacterium jreudenreichii, ferments milk to produce
�o
"o -
R2-C -C
0 OH II
H I
R3-C -C -R4
I
[ss1]
Bond formed / p R1- C,:r
'H
/ p R2- C,:r " S-CoA
0 OH II
H I
R3-C -C-R5
I
developed to immobilize the cells in an inert support, to pass the starting material continuously through the bed of immobilized cells, and to collect the desired product in the effluent-an engineer's dream! S U M M A RV 1 4 . 3
•
•
•
Fates of Pyru vate u n d e r A n a e ro b i c Co n d it i o n s : F e r m e n ta t i o n
The NADH formed in glycolysis must be recycled to regenerate NAD + , which is required as an electron acceptor in the first step of the payoff phase. Under aerobic conditions, electrons pass from NADH to 02 in mitochondrial respiration. Under anaerobic or hypoxic conditions, many organisms regenerate NAD+ by transferring electrons from NADH to pyruvate, forming lactate. Other organisms, such as yeast, regenerate NAD + by reducing pyruvate to ethanol and C02 . In these anaerobic processes (fermentations) , there is no net oxidation or reduction of the carbons of glucose. A variety of microorganisms can ferment sugar in fresh foods, resulting in changes in pH, taste, and texture, and preserving food from spoilage. Fermen tations are used in industry to produce a wide variety of commercially valuable organic compounds from inexpensive starting materials.
1 4.4 Gluconeogenesis The central role of glucose in metabolism arose early in evolution, and this sugar remains the nearly universal fuel and building block in modern organisms, from mi crobes to humans. In mammals, some tissues depend almost completely on glucose for their metabolic energy. For the human brain and nervous system, as well as the erythrocytes, testes, renal medulla, and embryonic tis sues, glucose from the blood is the sole or major fuel source. The brain alone requires about 120 g of glucose
[ss2]
Glycolysis, G l uconeogen esis, a n d t h e Pentose P h osphate Pathway
each day-more than half of all the glucose stored as glycogen in muscle and liver. However, the supply of glu cose from these stores is not always sufficient; between meals and during longer fasts, or after vigorous exercise, glycogen is depleted. For these times, organisms need a method for synthesizing glucose from noncarbohydrate precursors. This is accomplished by a pathway called gluconeogenesis ("new formation of sugar") , which converts pyruvate and related three- and four-carbon compounds to glucose. Gluconeogenesis occurs in all animals, plants , fungi, and microorganisms. The reactions are essen tially the same in all tissues and all species. The impor tant precursors of glucose in animals are three-carbon compounds such as lactate, pyruvate, and glycerol, as well as certain amino acids (Fig. 1 4-1 5 ) . In mammals,
Blood glucose
GlycoproLeins
Other monosaccharides
Sucrose
Glucose 6-phosphate Animals
Plants
� ;!� } ( �� Pyruvate Glucogenic Glycerol c
e
i
Lactate
amino acids
i
Triacyl glycerols
l
3-Phospho glycerate C02 fixation
FIGURE 1 4- 1 5 Carbohydrate synthesis from simple precursors. The pathway from phosphoenolpyruvate to gl ucose 6-phosphate is common to the b iosynthetic conversion of many different precursors of carbohy drates in a n i mals and plants. The path from pyruvate to phospho enolpyruvate leads through oxaloacetate, an intermediate of the citric acid cycle, which we discuss i n Chapter 1 6. Any compound that can be converted to either pyruvate or oxaloacetate can therefore serve as start i ng material for gluconeogenesis. This incl udes alanine and aspartate, which are convertible to pyruvate and oxaloacetate, respectively, and other amino acids that can also yield th ree- or four-carbon fragments, the so-called glucogenic amino acids (Table 1 4-4; see also Fig. 1 8-1 5). Plants and photosynthetic bacteria are uniquely able to convert C02 to carbohydrates, using the glyoxylate cycle (p. 639).
gluconeogenesis takes place mainly in the liver, and to a lesser extent in renal cortex and in the epithelial cells that line the inside of the small intestine. The glu cose produced passes into the blood to supply other tissues. After vigorous exercise, lactate produced by anaerobic glycolysis in skeletal muscle returns to the liver and is converted to glucose, which moves back to muscle and is converted to glycogen-a circuit called the Cori cycle (Box 1 4-2; see also Fig. 23-20) . In plant seedlings, stored fats and proteins are converted, via paths that include gluconeogenesis, to the disaccha ride sucrose for transport throughout the developing plant. Glucose and its derivatives are precursors for the synthesis of plant cell walls, nucleotides and coen zymes, and a variety of other essential metabolites. In many microorganisms, gluconeogenesis starts from simple organic compounds of two or three carbons, such as acetate, lactate, and propionate, in their growth medium. Although the reactions of gluconeogenesis are the same in all organisms, the metabolic context and the regulation of the pathway differ from one species to an other and from tissue to tissue. In this section we focus on gluconeogenesis as it occurs in the mammalian liver. In Chapter 20 we show how photosynthetic organisms use this pathway to convert the primary products of photosynthesis into glucose, to be stored as sucrose or starch. Gluconeogenesis and glycolysis are not identical pathways running in opposite directions, although they do share several steps (Fig. 1 4-16) ; 7 of the 1 0 enzymatic reactions of gluconeogenesis are the re verse of glycolytic reactions. However, three reactions of glycolysis are essentially irreversible in vivo and cannot be used in gluconeogenesis: the conversion of glucose to glucose 6-phosphate by hexokinase, the phosphorylation of fructose 6-phosphate to fructose 1 ,6-bisphosphate by phosphofructokinase- ! , and the conversion of phosphoenolpyruvate to pyruvate by pyruvate kinase (Fig. 14- 16) . In cells, these three re actions are characterized by a large negative free-en ergy change, whereas other glycolytic reactions have a !1G near 0 (Table 1 4-2) . In gluconeogenesis, the three irreversible steps are bypassed by a separate set of en zymes, catalyzing reactions that are sufficiently exer gonic to be effectively irreversible in the direction of glucose synthesis. Thus, both glycolysis and gluconeo genesis are irreversible processes in cells. In animals, both pathways occur largely in the cytosol, necessitat ing their reciprocal and coordinated regulation. Sepa rate regulation of the two pathways is brought about through controls exerted on the enzymatic steps unique to each. We begin by considering the three bypass reac tions of gluconeogenesis. (Keep in mind that "bypass" refers throughout to the bypass of irreversible glyco lytic reactions.)
1 4.4 G l u coneo g enesis
[s53]
TAB L E 1 4-2 !:lG'0 (kJ/mol) !:lG (kJ/mol)
Glycolytic reaction step CD Glucose + ATP � glucose 6-phosphate + ADP
@ Glucose 6-phosphate ==== fructose 6-phosphate @ Fructose 6-phosphate + ATP � fructose 1 ,6-bisphosphate + ADP @ Fructose 1 ,6-bisphosphate ==== dihydroxyacetone phosphate + glyceraldehyde 3-phosphate
® Dihydroxyacetone phosphate ==== glyceraldehyde 3-phosphate @ Glyceraldehyde 3-phosphate + Pi + NAD+ ==== 1 ,3-bisphosphoglycerate + NADH + H+ (j) 1 ,3-Bisphosphoglycerate + ADP ==== 3-phosphoglycerate + ATP @ 3-Phosphoglycerate ==== 2-phosphoglycerate ® 2-Phosphoglycerate ==== phosphoenolpyruvate + H 0 2 @ Phosphoenolpyruvate + ADP � pyruvate + ATP
?C
r.Jycoly,i
J y 3( �1:
ATP I
ATP 1
II
Glucose
�
" �UUI.· •·
ADP
fru
- --Lys
1
0
I
.t0
C - CH.", - C
GTP
GDP
�YK n
Pyruvate
0
0
Guanosine�Lo-P- 0- P-0-P-o-
�-
� --fo
r.
Site 2
Oxaloacetate o
\
0 II
/� IS'�\,
Long b;otinyl-Ly, tether moves ,' C02 from site 1 : to site 2. \ \
? f'o CH3 -C-C " oATP
---.._
Site 1
ATP
Pyruvate
Bicarbonate
HO-C"
oxidation (Chapter 1 7) , and its accumulation signals the availability of fatty acids as fuel.) As we shall see in Chapter 1 6 (see Fig. 16-15) , the pyruvate carboxylase reaction can replenish intermediates in another central metabolic pathway, the citric acid cycle.
ro�
-P0� 1 cH2=c-coo0
Phosphoenolpyruvate
Oxaloacetate
" o-
FIGURE 1 4-18 Role of biotin in the pyruvate carboxylase reaction. The cofactor biotin is covalently attached to the enzyme through an amide l i n kage to the e-a m i n o group of a Lys residue, forming a biotinyl-enzyme. The reaction occurs in two phases, which occur at two different sites i n the enzyme. At catalytic site 1 , bicarbonate ion i s converted t o C02 at t h e expense o f ATP. Then C0 2 reacts with biotin, form i n g carboxybiotinyl-enzyme. The long arm composed of biotin
(b)
and the Lys side chain to which it i s attached then carry the C02 of
FIGURE 14-1 7 Synthesis of phosphoenolpyruvate from pyruvate.
where C02 is released and reacts with the pyruvate, form i ng oxaloac
carboxybiotinyl-enzyme to catalytic site 2 on the enzyme su rface,
(a) I n m itochondria, pyruvate is converted to oxaloacetate in a biotin
etate and regenerating the bioti nyl-enzyme. The general role of flexible
requi ring reaction catalyzed by pyruvate carboxylase. (b) I n the cy
arms i n carrying reaction intermed iates between enzyme active sites i s
tosol, oxaloacetate is converted to phosphoenolpy ruvate by PEP
described i n Figure 1 6-1 7, and t h e mechanistic details o f t h e pyruvate
carboxyki nase. The C02 i ncorporated i n the pyruvate carboxylase re action is lost here as C02 • The decarboxylation leads to a rearrange
carboxylase reaction are shown in Figure 1 6-1 6 . Simi lar mechanisms occur i n other biotin-dependent carboxylation reactions, such as those
ment of electrons that faci I itates attack of the carbonyl oxygen of the
catalyzed by propionyi-CoA carboxylase (see Fig . 1 7-1 1 ) and acety i
pyruvate moiety on the y phosphate of GTP.
CoA carboxylase (see Fig . 2 1 -1 ).
1 4.4 G l uconeogenesis
Because the mitochondrial membrane has no trans porter for oxaloacetate, before export to the cytosol the oxaloacetate formed from pyruvate must be reduced to malate by mitochondrial malate dehydrogenase, at the expense of NADH:
Oxaloacetate NADH H+ +
+
�
L-malate + NAD+ (14-5)
The standard free-energy change for this reaction is quite high, but under physiological conditions (includ ing a very low concentration of oxaloacetate) 11G 0 and the reaction is readily reversible. Mitochondrial malate dehydrogenase functions in both gluconeogenesis and the citric acid cycle, but the overall flow of metabo lites in the two processes is in opposite directions. Malate leaves the mitochondrion through a specific transporter in the inner mitochondrial membrane (see Fig. 19-30) , and in the cytosol it is reoxidized to ox aloacetate, with the production of cytosolic NADH: =
Malate + NAD+
�
oxaloacetate + NADH H+ (14-6) +
The oxaloacetate is then converted to PEP by phospho enolpyruvate carboxykinase (Fig. 14-17) . This Mg2 + -dependent reaction requires GTP as the phos phoryl group donor:
Oxaloacetate GTP � PEP + C02 GDP (14-7) +
+
The reaction is reversible under intracellular conditions; the formation of one high-energy phosphate compound (PEP) is balanced by the hydrolysis of another (GTP) . The overall equation for this set of bypass reactions, the sum of Equations 1 4-4 through 14-7, is
Pyruvate ATP GTP HCO:l PEP + ADP GDP P; C02 (14-8) 0.9 kJ/mol +
+
There is a logic to the route of these reactions through the mitochondrion. The [NADH]/[NAD + ] ra tio in the cytosol is 8 x 10 - 4 about 10 5 times lower than in mitochondria. Because cytosolic NADH is con sumed in gluconeogenesis (in the conversion of 1 ,3bisphosphoglycerate to glyceraldehyde 3-phosphate; Fig. 14-16) , glucose biosynthesis cannot proceed unless NADH is available. The transport of malate from the mi tochondrion to the cytosol and its reconversion there to oxaloacetate effectively moves reducing equivalents to the cytosol, where they are scarce. This path from pyru vate to PEP therefore provides an important balance be tween NADH produced and consumed in the cytosol during gluconeogenesis. A second pyruvate � PEP bypass predominates when lactate is the glucogenic precursor (Fig. 14-19). This pathway makes use of lactate produced by glyco lysis in erythrocytes or anaerobic muscle, for example, and it is particularly important in large vertebrates after vigorous exercise (Box 14 2) The conversion of lactate ,
/ CO ca!IJOxvkll�,�-� r z
+
+
=
Two high-energy phosphate equivalents (one from ATP and one from GTP) , each yielding about 50 kJ/mol under cellular conditions, must be expended to phosphorylate one molecule of pyruvate to PEP. In contrast, when PEP is converted to pyruvate during glycolysis, only one ATP is generated from ADP. Although the standard free energy change (11G'0) of the two-step path from pyruvate to PEP is 0.9 kJ/mol, the actual free-energy change (11G) , calculated from measured cellular concentrations of intermediates, is very strongly negative ( -25 kJ/mol) ; this results from the ready consumption of PEP in other reactions such that its concentration remains relatively low The reaction is thus effectively irreversible in the cell. Note that the C02 added to pyruvate in the pyru vate carboxylase step is the same molecule that is lost in the PEP carboxykinase reaction (Fig. 14-1 7b) . This carboxylation-decarboxylation sequence represents a way of "activating" pyruvate, in that the decarboxylation of oxaloacetate facilitates PEP formation. In Chapter 21 we shall see how a similar carboxylation-decarboxylation sequence is used to activate acetyl-CoA for fatty acid biosynthesis (see Fig. 21-1).
.
PEP
Oxaloacetate
k NAD+
cytosolic
Malate
malate
dPh_vdrogenase
+
!::,. G '0
-
cvtosolic
�
+
[sss]
NAD
l
dnu�NAD+
nutochun .
,J
mrdn.U!
lwei"'"'""'"
.ro:l
mo tnohn mlriul
NADH + H+
o rbrr� yli nofo e ·
�
•
C02
Pyruvate
..:::;: ::l
Cytosol
.Mitochondrion
Pyruvate
C 02
Oxaloacetate
Oxaloacetat.e
•
PUt PEP
Malate
t I
C02
Pyruvate
hu·t.nletf--
NAD + Lactate
Pyruvate
dc·hyrirngdl H'•:
.A-
AD
FIGURE 14-1 9 Alternative paths from pyruvate to phosphoenolpyru vate. The relative i mportance of the two pathways depends on the
availabil ity of lactate or pyruvate and the cytosol i c req u i rements for NADH for gl uconeogenesis. The path on the right predominates when
lactate is the precu rsor, because cytosol i c NADH is generated in the
lactate dehydrogenase reaction and does not have to be shuttled out of the mitochondrion (see text) .
[ss6]
G l ycolysis, G l uconeog e n e s is, a n d t h e Pentose Phosp hate Pathway
to pyruvate in the cytosol of hepatocytes yields NADH, and the export of reducing equivalents (as malate) from mitochondria is therefore unnecessary. After the pyru vate produced by the lactate dehydrogenase reaction is transported into the mitochondrion, it is converted to oxaloacetate by pyruvate carboxylase, as described above. This oxaloacetate, however, is converted directly to PEP by a mitochondrial isozyme of PEP carboxyki nase, and the PEP is transported out of the mitochon drion to continue on the gluconeogenic path. The mitochondrial and cytosolic isozymes of PEP carboxyki nase are encoded by separate genes in the nuclear chro mosomes, providing another example of two distinct enzymes catalyzing the same reaction but having differ ent cellular locations or metabolic roles (recall the isozymes of hexokinase) . Conversion of Fructose 1 ,6-Bisphosphate to Fructose 6-Phosphate Is the Second Bypass
The second glycolytic reaction that cannot participate in gluconeogenesis is the phosphorylation of fructose 6phosphate by PFK-1 (Table 1 4-2, step @) . Because this reaction is highly exergonic and therefore irreversible in intact cells, the generation of fructose 6-phosphate from fructose 1 ,6-bisphosphate (Fig. 14-16) is catalyzed by a different enzyme, Mg2 + -dependent fructose 1 ,6bisphosphatase (FBPase-1 ) , which promotes the es sentially irreversible hydrolysis of the C-1 phosphate (not phosphoryl group transfer to ADP):
Fructose 1,6-bisphosphate H20 +
fructose 6-phosphate -16.3 kJ/mo
�
+ Pi
t::. G ' 0
=
l
FBPase-1 is so named to distinguish it from another, similar enzyme (FBPase-2) with a regulatory role, which we discuss in Chapter 15. TAB L E 1 4-3
Conversion of Glucose 6-Phosphate to Glucose Is the Third Bypass
The third bypass is the final reaction of gluconeogenesis, the dephosphorylation of glucose 6-phosphate to yield glucose (Fig. 14-16) . Reversal of the hexokinase reac tion (p. 532) would require phosphoryl group transfer from glucose 6-phosphate to ADP, forming ATP, an ener getically unfavorable reaction (Table 1 4-2, step Q)) . The reaction catalyzed by glucose 6-phosphatase does not require synthesis of ATP; it is a simple hydrolysis of a phosphate ester:
Glucose 6-phosphate H20 +
�
glucose -13.8 kJ/mo + Pi
!::. G '0
l
=
This Mg2 + -activated enzyme is found on the lumenal side of the endoplasmic reticulum of hepatocytes, renal cells, and epithelial cells of the small intestine (see Fig. 15-28) , but not in other tissues, which are therefore unable to supply glucose to the blood. If other tissues had glucose 6-phosphatase, this enzyme's activity would hydrolyze the glucose 6-phosphate needed within those tissues for glycolysis. Glucose produced by gluconeogenesis in the liver or kidney or ingested in the diet is delivered to these other tissues, including brain and muscle, through the bloodstream. Gluconeogenesis Is Energetica lly Expensive, but Essential
2 Pyruvate 2G 2NADH 2H+ 4H20 glucose GD 6 2NAD+ (14-9)
The sum of the biosynthetic reactions leading from pyruvate to free blood glucose (Table 1 4-3) is + 4ATP + +
TP + 4ADP + 2
+
P + Pi +
+
�
For each molecule of glucose formed from pyruvate, six high-energy phosphate groups are required, four from ATP and two from GTP. In addition, two molecules of
Sequential Reactions in
Pyruvate + HCO,j + ATP -----4 oxaloacetarc + ADP + P, Oxaloacetate + GTP
� phosphoenolpyruvate + C02 + GDP
Phosphoenolpyruvate + H20 � 2-phosphoglycerate
X2 X2 X2
2-Phosphoglycerate == 3-phosphoglycerate
X2
3-Phosphoglycerate + ATP � 1 ,3-bisphosphoglycerate + ADP
X2
1 ,3-Bisphosphoglycerate + NADH + H+ � glyceraldehyde 3-phosphate + NAD+ + Pi
X2
Glyceraldehyde 3-phosphate � dihydroxyacetone phosphate
Glyceraldehyde 3-phosphate + dihydroxyacetone phosphate == fructose 1 ,6-bisphosphate Fructose
1 ,G-bisphosphate -----4 fructose
G-phosphate +
Pi
Fructose 6-phosphate � glucose 6-phosphate Glucose ()-phosphate +
H20 -----4 glucose + Pi
Sum: 2 Pyruvate + 4ATP + 2GTP + 2NADH + 2H+ + 4H20 -----4 glucose + 4ADP + 2GDP + 6Pi + 2NAD + Note: The bypass reactions are in red; a l l other reactions a re reversible steps of glycolysis. The figures at the right indicate that the reaction is to be counted twice, because two three-carbon precursors are required to make a molecule of glucose. The reactions required to replace the cytosolic NADH consumed in the glyceraldehyde 3-phosphate dehydroge nase reaction (the conversion of lactate to pyruvate in the cytosol or the transport of reducing equivalents from mitochondria to the cytosol in the form of malate) a re not considered in this summary. Biochemical equations are not necessarily balanced for H and charge (p. 501).
1 4.4 G l u co n eogenesis
[ssiJ
NADH are required for the reduction of two molecules of 1 ,3-bisphosphoglycerate. Clearly, E quation 14-9 is not simply the reverse of the equation for conversion of glucose to pyruvate by glycolysis, which would require only two molecules of ATP:
amino groups in liver mitochondria, the carbon skele tons remaining (pyruvate and a-ketoglutarate, respec tively) are readily funneled into gluconeogenesis.
2ADP + 2Pi + NAD+ --> 2 + 2ATP + 2NADH + 2H+ + 2H20
No net conversion of fatty acids to glucose occurs in mammals. As we shall see in Chapter 17, the catabolism of most fatty acids yields only acetyl-GoA. Mammals cannot use acetyl-GoA as a precursor of glucose, be cause the pyruvate dehydrogenase reaction is irre versible and cells have no other pathway to convert acetyl-GoA to pyruvate. Plants, yeast, and many bacteria do have a pathway (the glyoxylate cycle; see Fig. 1 6-20) for converting acetyl-GoA to oxaloacetate, so these or ganisms can use fatty acids as the starting material for gluconeogenesis. This is important during the germina tion of seedlings, for example; before leaves develop and photosynthesis can provide energy and carbohydrates, the seedling relies on stored seed oils for energy produc tion and cell wall biosynthesis. Although mammals cannot convert fatty acids to carbohydrate, they can use the small amount of glycerol produced from the breakdown of fats (triacylglycerols) for gluconeogenesis. Phosphorylation of glycerol by glycerol kinase, followed by oxidation of the central car bon, yields dihydroxyacetone phosphate, an intermedi ate in gluconeogenesis in liver. As we will see in Chapter 21, glycerol phosphate is an essential intermediate in triacylglycerol synthesis in adipocytes, but these cells lack glycerol kinase and so cannot simply phosphorylate glycerol. Instead, adipocytes carry out a truncated version of gluconeoge nesis, known as glyceroneogenesis: the conversion of pyruvate to dihydroxyacetone phosphate via the early reactions of gluconeogenesis, followed by reduction of the dihydroxyacetone phosphate to glycerol phosphate (see Fig. 21-21).
Glucose
+
pyruvate
The synthesis of glucose from pyruvate is a relatively ex pensive process . Much of this high energy cost is neces sary to ensure the irreversibility of gluconeogenesis. Under intracellular conditions, the overall free-energy change of glycolysis is at least -63 kJ/mol. Under the same conditions the overall !J.G of gluconeogenesis is - 16 kJ/mol. Thus both glycolysis and gluconeogenesis are essentially irreversible processes in cells. Citric Acid Cycle I ntermediates and Some Amino Acids Are Glucogenic
The biosynthetic pathway to glucose described above al lows the net synthesis of glucose not only from pyruvate but also from the four-, five-, and six-carbon intermedi ates of the citric acid cycle (Chapter 1 6) . Citrate, isoci trate, a-ketoglutarate, succinyl-CoA, succinate, fumarate, and malate-all are citric acid cycle intermediates that can undergo oxidation to oxaloacetate (see Fig. 16-7) . Some or all of the carbon atoms of most amino acids de rived from proteins are ultimately catabolized to pyru vate or to intermediates of the citric acid cycle. Such amino acids can therefore undergo net conversion to glucose and are said to be glucogenic (Table 14-4) . Alanine and glutamine, the principal molecules that transport amino groups from extrahepatic tissues to the liver (see Fig. 18-9) , are particularly important gluco genic amino acids in mammals. After removal of their
TA B LE 1 4-4 Pyruvate Alanine Cysteine Glycine Serine Threonine Tryptophan*
Glucogenk Amlno Achk, � by
. .,_.,
a-Ketoglutarate Arginine Glutamate Glutamine Histidine Proline
__.
_ _ _ _ _
Succinyl-CoA Isoleucine* Methionine Threonine Valine
Fumarate Phenylalanine* Tyrosine* Oxaloacetate Asparagine Aspartate
Note: All these amino acids are precursors of blood glucose or liver glycogen, because
they can be converted to pyruvate or citric acid cycle intermediates. Of the 20 common amino acids, only leucine and lysine are unable to furnish carbon for net glucose synthesis. *These amino acids are also ketogenic (see Fig. 18-2 1).
Mammals Can not Convert Fatty Acids to Glucose
Glycolysis and G luconeogenesis Are Reciprocally Regulated
If glycolysis (the conversion of glucose to pyruvate) and gluconeogenesis (the conversion of pyruvate to glu cose) were allowed to proceed simultaneously at high rates, the result would be the consumption of ATP and the production of heat. For example, PFK-1 and FBP ase-1 catalyze opposing reactions: ATP +
fructose 6-phosphate
Fructose 1,6-bisphosphate
fructose 1,6-bisphosphate
-----> I ' Fl\. 1
ADP +
fructose 6-phosphate
+ H20 --� FB P·
e- 1
The sum of these two reactions is ATP + H20
-->
ADP + Pi +
heat
+ Pi
These two enzymatic reactions, and several others in the two pathways, are regulated allosterically and by
[sss]
G l ycolysis, G l uconeogenesis, a n d the Pentose Phosp hate Pathway
covalent modification (phosphorylation) . In Chapter 1 5 we take u p the mechanisms o f this regulation i n detail. For now, suffice it to say that the pathways are regulated so that when the flux of glucose through glycolysis goes up, the flux of pyruvate toward glucose goes down, and vice versa.
S U M MA RY 1 4 .4 •
G l u co n e o g e n es i s
Gluconeogenesis is a ubiquitous multistep process in which glucose is produced from lactate, pyruvate, or oxaloacetate, or any compound (including citric acid cycle intermediates) that can be converted to one of these intermediates . Seven of the steps in gluconeogenesis are catalyzed by the same enzymes used in glycolysis; these are the reversible reactions.
•
Three irreversible steps in glycolysis are bypassed by reactions catalyzed by gluconeogenic enzymes: (1) conversion of pyruvate to PEP via oxaloacetate, catalyzed by pyruvate carboxylase and PEP carboxykinase; (2) dephosphorylation of fructose 1 ,6-bisphosphate by FBPase- 1 ; and (3) dephosphorylation of glucose 6-phosphate by glucose 6-phosphatase.
•
Formation of one molecule of glucose from pyruvate requires 4 ATP, 2 GTP, and 2 NADH; it is expensive.
•
In mammals, gluconeogenesis in the liver, kidney, and small intestine provides glucose for use by the brain, muscles, and erythrocytes.
•
Pyruvate carboxylase is stimulated by acetyl-GoA, increasing the rate of gluconeogenesis when the cell has adequate supplies of other substrates (fatty acids) for energy production.
•
Animals cannot convert acetyl-GoA derived from fatty acids into glucose; plants and microorganisms can.
•
Glycolysis and gluconeogenesis are reciprocally regulated to prevent wasteful operation of both pathways at the same time.
1 4.5 Pentose Phosphate Pathway of Glucose Oxidation In most animal tissues, the major catabolic fate of glucose 6-phosphate is glycolytic breakdown to pyruvate, much of which is then oxidized via the citric acid cycle , ultimately leading to the formation of ATP. Glucose 6-phosphate does have other catabolic fates , however, which lead to specialized products needed by the cell. Of particular importance in some tissues is the oxidation of glucose 6-phosphate to pentose phosphates by the pentose phosphate pathway (also called the phosphogluconate pathway or the hexose "
monophosphate pathway; Fig. 1 4-20) . In this oxida tive pathway, NADP + is the electron acceptor, yielding NADPH. Rapidly dividing cells, such as those of bone marrow, skin, and intestinal mucosa, and those of tu mors, use the pentose ribose 5-phosphate to make RNA, DNA, and such coenzymes as ATP, NADH, FADH2 , and coenzyme A In other tissues, the essential product of the pen tose phosphate pathway is not the pentoses but the electron donor NADPH, needed for reductive biosynthe sis or to counter the damaging effects of oxygen radicals. Tissues that carry out extensive fatty acid synthesis (liver, adipose, lactating mammary gland) or very active synthesis of cholesterol and steroid hormones (liver, ad renal glands, gonads) require the NADPH provided by this pathway. Erythrocytes and the cells of the lens and cornea are directly exposed to oxygen and thus to the damaging free radicals generated by oxygen. By main taining a reducing atmosphere (a high ratio of NADPH + to NADP and a high ratio of reduced to oxidized glu tathione) , such cells can prevent or undo oxidative dam age to proteins, lipids, and other sensitive molecules. In erythrocytes, the NADPH produced by the pentose phosphate pathway is so important in preventing oxida tive damage that a genetic defect in glucose 6-phos phate dehydrogenase, the first enzyme of the pathway, can have serious medical consequences (Box 1 4-4) . • Nonoxidative phase
Glucose 6-phosphate 2 GSH NADPCNADPH� GSSG J Fatty acietc.ds, NADPH Precursors Oxidative phase
t==
6- Phosphogluconate
COz
lulatbJolk .Jutt«• •
Ribulose 5-phosphate
Ribose
�
NADP +
sterols,
reductive biosynthesi•
1 coenzymes, Nucleotides, DNA, RNA 5-phosphate
FIGURE 1 4-20 General scheme of the pentose phosphate pathway. NADPH formed in the oxidative phase is used to reduce gl utathione, GSSG (see Box 1 4--4) and to support reductive biosynthesis. The other product of the oxidative phase is ri bose 5-phosphate, which serves as a precursor for nucleotides, coenzymes, and nucleic acids. I n cells that are not using ribose 5-phosphate for biosynthesis, the nonoxidative phase recycles six molecules of the pentose into five molecules of the hexose gl ucose 6-phosphate, a l lowing continued production of NADPH and converting glucose 6-phosphate (in six cycles) to C02 •
1 4.5 Pentose P h os p hate Pathway of Gl ucose Oxidation
B O X 1 4-4
TM E D I C I N E
[ss9]
hy P ytha g o ra s We. fii l D ti,clro g e na s e Deficie n cy
Fava beans, an ingredient of falafel, have been an impor
killed by a level of oxidative stress that is tolerable to a
tant food source in the Mediterranean and Middle East
G6PD-deficient human host. Because the advantage of
since antiquity. The Greek philosopher and mathemati
resistance to malaria balances the disadvantage of low
cian Pythagoras prohibited his followers from dining on
ered resistance to oxidative damage, natural selection
fava beans , perhaps because they make many people
sustains the G6PD-deficient genotype in human popula
sick with a condition called favism, which can be fatal. In favism, erythrocytes begin to lyse
24
to
48
hours after
tions where malaria is prevalent. Only under over whelming oxidative stress, caused by drugs, herbicides,
ingestion of the beans, releasing free hemoglobin into
or divicine, does G6PD deficiency cause serious medical
the blood. Jaundice and sometimes kidney failure can
problems.
result. Similar symptoms can occur with ingestion of the
An antimalarial drug such as primaquine is believed
antimalarial drug primaquine or of sulfa antibiotics, or
to act by causing oxidative stress to the parasite . It is
following exposure to certain herbicides. These symp
ironic that antimalarial drugs can cause human illness
toms have a genetic basis: glucose 6-phosphate dehy
through the same biochemical mechanism that provides
400
resistance to malaria. Divicine also acts as an antimalar
drogenase (G6PD) deficiency, which affects about
million people worldwide. Most G6PD-deficient individ
ial drug, and ingestion of fava beans may protect against
uals are asymptomatic; only the combination of G6PD
malaria. By refusing to eat falafel, many Pythagoreans
deficiency and certain environmental factors produces
with normal G6PD activity may have unwittingly in
the clinical manifestations.
creased their risk of malaria!
Glucose
6-phosphate
dehydrogenase
1
catalyzes
the first step in the pentose phosphate pathway (see
14-21) ,
Fig.
0,
which produces NADPH. This reductant,
essential in many biosynthetic pathways, also protects cells from oxidative damage by hydrogen peroxide CH202) and superoxide free radicals, highly reactive ox idants generated as metabolic byproducts and through the actions of drugs such as primaquine and natural products such as divicine-the toxic ingredient of fava beans. During normal detoxification, H202 is converted to H20 by reduced glutathione and glutathione peroxi dase, and the oxidized glutathione is converted back to the reduced form by glutathione reductase and NADPH (Fig.
1). H202 is also broken down to H20 and 02 by cata
lase, which also requires NADPH. In G6PD-deficient indi viduals, the NADPH production is diminished and detoxification of H202 is inhibited. Cellular damage re sults: lipid peroxidation leading to breakdown of erythro cyte membranes and oxidation of proteins and DNA. The geographic distribution of G6PD deficiency is instructive. Frequencies as high as
25%
uperoxide radical
·
t 0
2H1 Hyd ro�en peroJUde
e-
1{e� H ,0.,
H
/ """::; ( \
glu l ntnwru •no "''" -� --=-----, -
-
�0 Hydroxyl free radical
Mitochondrial respiration, ionizing radiation, sulfa drugs, herbicides, antimalarials, divic.ine
'OH
II
�®4r � �
2G S H
,/
Oxidative damage to lipids, proteins, DNA
Africa, parts of the Middle East, and Southeast Asia, ar eas where malaria is most prevalent. In addition to such epidemiological observations, in vitro studies show that
GS G
:
�
NADP+
Glucose 6-phosphate
occur in tropical
2 �0
L
NADPH
glucose
6·phosphate
+ H+
6-Phosphoglucono-o-lactone
dehydrogenase
(G6PD)
FIGURE 1 Role of NADPH and gl utath ione i n protecting cel l s against highly reactive oxygen derivatives. Reduced gl utath ione (GSH) protects
Plasmodium falci
the cell by destroying hydrogen peroxide and hydroxyl free radicals.
parum, is inhibited in G6PD-deficient erythrocytes. The
Regeneration of GSH from its oxidized form (GSSG) requi res the
parasite is very sensitive to oxidative damage and is
NADPH produced i n the glucose 6-phosphate dehydrogenase reaction.
growth of one malaria parasite ,
The Oxidative Phase Produces Pentose Phosphates and NADPH
form 6-phosphoglucono-8-lactone, an intramolecular es ter. NADP+ is the electron acceptor, and the overall equilibrium lies far in the direction of NADPH formation.
The first reaction of the pentose phosphate pathway
The lactone is hydrolyzed to the free acid 6-phosphoglu
(Fig. 14-2 1 ) is the oxidation of glucose 6-phosphate by glucose 6-phosphate dehydrogenase ( G6PD) to
conate undergoes oxidation and decarboxylation by
conate by a specific
lactonase, then 6-phosphoglu
[s6o]
Glycolysis, G l uconeogenes i s, a n d the Pentose Phosphate Pathway
H ¢oH Oj HFI H09 H HCOH HI I CHzOP03-
�
Glucose 6-phosphate
z
6-phosphogluconate dehydrogenase to form the ke topentose ribulose 5-phosphate; the reaction generates a second molecule of NADPH. (This ribulose 5-phos phate is important in the regulation of glycolysis and gluconeogenesis, as we shall see in Chapter 15.) Phos phopentose isomerase converts ribulose 5-phosphate to its aldose isomer, ribose 5-phosphate. In some tissues, the pentose phosphate pathway ends at this point, and its overall equation is
Glucose 6-phosphate 2NADP+ ribose 5-phosphate +
+
�
H20 C02 + 2NADPH + 2H+
+
The net result is the production of NADPH, a reductant for biosynthetic reactions, and ribose 5-phosphate, a precursor for nucleotide synthesis.
6-Phospho glucono-8-lactone
The Nonoxidative Phase Recycles Pentose Phosphates to Glucose 6-Phosphate
In tissues that require primarily NADPH, the pentose phosphates produced in the oxidative phase of the path way are recycled into glucose 6-phosphate. In this nonoxidative phase, ribulose 5-phosphate is first epimerized to xylulose 5-phosphate:
o� /o"::cI HCOH I HOCH I HCOH I HCOH I CHzOPO� -
6-Phospho gluconate
Ribulose 5-phosphate
,-- NADP + Mg2+
NADPH + H+ COz CHzOH I C=O I HCOH D-Ribulose I 5-phosphate HCOH I CHzOPo5 CHO I HCOH I HCOH I HCOH I CHzOPo�-
CH20H I C=O I H-C-OH I H-C-OH I CHzOPo�-
o-Ribose 5-phosphate
FIGURE 14-21 Oxidative reactions of the pentose phosphate pathway. The end products are ribose 5-phosphate, C02 , and NADPH,
ribo::;e
:1 -phoophote epimer;t):;-< >--
--< >-
Omnerase Glyceraldehyde 5C 3-phosphate
7�
[5 61]
�
SC
6C
(b)
to five hexoses (6C). Note that this involves two sets of the i nterconver
14-22 Nonoxidative reactions of the pentose phosphate
pathway. (a) These reactions convert pentose phosphates to hexose
sions shown in (a). Every reaction shown here is reversi ble; unidirec
phosphates, allowing the oxidative reactions (see Fig. 1 4-2 1 ) to con
tional arrows are used only to make clear the direction of the reactions
tinue. Transketolase and transaldolase are specific to th is pathway; the
during continuous oxidation of g l ucose 6-phosphate. In the l i ght
other enzymes also serve in the glycolytic or gluconeogenic pathways.
i ndependent reactions of photosynthesis, the direction of these reac
(b) A schematic diagram showing the pathway from six pentoses (SC)
tions is reversed (see Fig. 2 0-1 0) .
CH :P H
+ pi
Ketose donor
0
� /
H
kz
r
TPP
" �
Aldose acceptor
0
/ ( I Rt
I
I
+
I
-
C=O
I
HO - C - H
�c I
H- C - OH
I
FIGURE 1 4-23
Ribose 5-phosphate
CH20H
I
C=O I HO - C - H
0 H � /
H- C - OH I + H- C - OH H - C - OH I I CH20POJ CH20POg-
Xylulose 5-phosphate
I
CHOH
�'J
(a)
CH,OH
(-()
TPP
transketolase
(b)
o � / c
I
H
I
H - C - OH I CH20POg
Glyceraldehyde 3-phosphate
+
H- C - OH I H- C - OH I H- C - OH
I
CH2 0POg-
Sedoheptulose 7-phosphate
The first reaction catalyzed by transketolase. (a) The general reaction catalyzed by transke
tolase is the transfer of a two-carbon group, carried tempora ri ly on enzyme-bound TPP, from a ketose donor
to an aldose acceptor. (b) Conversion of two pentose phosphates to a triose phosphate and a seven-carbon sugar phosphate, sedoheptulose 7 -phosphate.
[} 62]
G l ycolysis, G l uconeogenes i s, a n d t h e Pentose Phosphate Pathway
FIGURE 1 4-24 The reaction catalyzed b
CII ,OII
I
-
C= O
Iran aldolase.
I
C H20H I
HO - C - H
I
H
C - OH
H
C - OH
H
C - OH
I
�c
+
CH
HO
o
I
H - C - OH
H- C - O H
I
ti·an�alc\ olnsc
H- C - OH
I
I
+
H - C - OH
I
.,
CH�OPO:i
CH20PO�-
I
H- C - OH I CHzOPOt Fructose 6-phosphate
Erythrose 4-phosphate
Glyceraldehyde 3-phosphate
Sedoheptulose 7-phosphate FIGURE 1 4-25 The second reaction cat
I
HO - C - H
I
H 0 / �
C H10POj
alyzed by transketolase.
C=O
�c/H
0
I C=O I
CHoOH
OH
I C=O I
C-H
I
H -- C - O H
H 0 � / c
I
CH10PO}
Xylulose 5-phosphate
fructose 6-phosphate and the tetrose erythrose 4-phosphate (Fig. 14-24 ). Now transketolase acts again, forming fructose 6-phosphate and glyceraldehyde 3-phosphate from erythrose 4-phosphate and xylulose 5-phosphate ( Fig. 1 4-25 ) . Two molecules of glycer aldehyde 3-phosphate formed by two iterations of these reactions can be converted to a molecule of fructose 1 , 6bisphosphate as in gluconeogenesis (Fig. 14-16) , and fi nally FBPase- 1 and phosphohexose isomerase convert fructose 1 ,6-bisphosphate to glucose 6-phosphate. Overall, six pentose phosphates have been converted to five hexose phosphates (Fig. 14-22b)-the cycle is now complete! Transketolase requires the cofactor thiamine pyro phosphate (TPP) , which stabilizes a two-carbon carbanion in this reaction (Fig. 1 4-26a), just as it does in the pyruvate decarboxylase reaction (Fig. 14-14) . Transal dolase uses a Lys side chain to form a Schiff base with the carbonyl group of its substrate, a ketose, thereby stabilizing a carbanion (Fig. 14-26b) that is central to the reaction mechanism. The process described in Figure 14-2 1 is known as the oxidative pentose phosphate pathway. The first and third steps are oxidations with large, negative stan dard free-energy changes and are essentially irreversible in the cell. The reactions of the nonoxidative part of the pentose phosphate pathway (Fig. 14-22) are readily re versible and thus also provide a means of converting hexose phosphates to pentose phosphates. As we shall see in Chapter 20, a process that converts hexose phos phates to pentose phosphates is crucial to the photosyn thetic assimilation of C02 by plants. That pathway, the reductive pentose phosphate pathway, is essentially
I
�c/H
TPP
H- C - OH +
HO - C - H
0
I
H- C - OH
I
+
H - C - OH
H - C - OH
I
I
I
H - C - OH
I
2 C H 2 0P0:3 .
CH20PO�-
Glyceraldehyde 3-phosphate
Erythrose 4-phosphate
CHzOPO�Fructose 6-phosphate
(a) Transketolase
OH
OH
I
I
HOH2C-C
Y\�
HOH2 - 1 '
II
R _:N
c:r- s ·�
CH3
resonance stabilization
R'
TPP
/OH
/OR
c
c
H
H
I
I
Proton ated Schiff base FIGURE 1 4-26 Carbanion intermediates stabilized by covalent interac tions with transketolase and transaldolase. (a) The ring ofTPP stabilizes
the carbanion in the dihydroxyethyl group carried by transketolase; see Fig. 1 4-1 4 for the chemistry ofTPP action. (b) In the transaldolase reac tion, the protonated Schiff base formed between the E-amino group of a Lys side cha i n and the substrate stabil izes the C-3 carba n ion formed after aldol cleavage.
the reversal of the reactions shown in Figure 1 4-22 and employs many of the same enzymes. All the enzymes in the pentose phosphate pathway are located in the cytosol, like those of glycolysis and most of those of gluconeogenesis. In fact, these three pathways are connected through several shared interme diates and enzymes. The glyceraldehyde 3-phosphate formed by the action of transketolase is readily converted
1 4.5 Pentose Phosp hate Pathway of G l u cose Oxidation
to dihydroxyacetone phosphate by the glycolytic enzyme triose phosphate isomerase, and these two trioses can be joined by the aldolase as in gluconeogenesis , forming fructose 1 ,6-bisphosphate. Alternatively, the triose phos phates can be oxidized to pyruvate by the glycolytic reac tions. The fate of the trioses is determined by the cell's relative needs for pentose phosphates, NADPH, and ATP. Wernicke-Korsakoff Syndrome Is Exacerbated by a Defect in Transketolase
,
Wernicke-Korsakoff syndrome is a disorder caused by a severe deficiency of thiamine , a component of TPP. The syndrome is more common among people with alcoholism than in the general pop ulation, because chronic, heavy alcohol consumption interferes with the intestinal absorption of thiamine. The syndrome can be exacerbated by a mutation in the gene for transketolase that results in an enzyme with a lowered affinity for TPP-an affinity one-tenth that of the normal enzyme . This defect makes individuals much more sensitive to a thiamine deficiency: even a moderate thiamine deficiency (tolerable in individuals with an unmutated transketolase) can drop the level of TPP below that needed to saturate the enzyme. The re sult is a slowing down of the whole pentose phosphate pathway. In people with Wernicke-Korsakoff syndrome this results in a worsening of symptoms, which can in clude severe memory loss , mental confusion, and par tial paralysis. •
needs of the cell and on the concentration of NADP + in the cytosol. Without this electron acceptor, the first re action of the pentose phosphate pathway (catalyzed by G6PD) cannot proceed. When a cell is rapidly convert ing NADPH to NADP + in biosynthetic reductions, the level of NADP + rises, allosterically stimulating G6PD and thereby increasing the flux of glucose 6-phosphate through the pentose phosphate pathway ( Fig. 1 4-27 ). When the demand for NADPH slows, the level of ADP drops, the pentose phosphate pathway slows, and glu cose 6-phosphate is instead used to fuel glycolysis.
S U M M A RY 1 4 . 5
•
•
Gl ucose 6-Phosphate Is Partitioned between Glycolysis and the Pentose Phosphate Pathway
•
Whether glucose 6-phosphate enters glycolysis or the pentose phosphate pathway depends on the current
Glucose 1 Glucose 6-phosphate
��!��ate pathway
glycolysis
�+��p�- - - - - - - -,�
6-Phosphogluconolactone
l }-- NADPH
Pentose phosphates
ATP
•
Entry of glucose 6-phosphate either into glycolysis or into the pentose phosphate pathway is largely determined by the relative concentrations of NADP + and NADPH.
FIGURE 1 4-27 Role of NADPH in regulating the partitioning of glu
rises and i n h ibits the first enzyme i n the pentose phosphate pathway. As a result, more gl ucose 6-phosphate is avai lable for glycolysis.
The first phase of the pentose phosphate pathway consists of two oxidations that convert glucose 6-phosphate to ribulose 5-phosphate and reduce NADP + to NADPH. The second phase comprises nonoxidative steps that convert pentose phosphates to glucose 6-phosphate , which begins the cycle again.
A genetic defect in transketolase that lowers its affinity for TPP exacerbates the Wernicke-Korsakoff syndrome.
!
biosynthesis and gl utathione reduction (see Fig. 1 4-20), [NADPH]
NADPH provides reducing power for biosynthetic reactions, and ribose 5-phosphate is a precursor for nucleotide and nucleic acid synthesis. Rapidly growing tissues and tissues carrying out active biosynthesis of fatty acids, cholesterol, or steroid hormones send more glucose 6-phosphate through the pentose phosphate pathway than do tissues with less demand for pentose phosphates and reducing power.
•
!
pathway. When NADPH is form i n g faster than it is being used for
The oxidative pentose phosphate pathway (phosphogluconate pathway, or hexose monophosphate pathway) brings about oxidation and decarboxylation at C-1 of glucose 6-phosphate, reducing NADP + to NADPH and producing pentose phosphates.
In the second phase, transketolase (with TPP as cofactor) and transaldolase catalyze the interconversion of three-, four-, five-, six-, and seven-carbon sugars, with the reversible conversion of six pentose phosphates to five hexose phosphates. In the carbon-assimilating reactions of photosynthesis , the same enzymes catalyze the reverse process, the reductive pentose phosphate pathway: conversion of five hexose phosphates to six pentose phosphates.
!
cose &-phosphate between glycolysis and the pentose phosphate
P e n t o s e P h o s p hate Pathway o f G l u co s e Oxidation
•
:I j
______________
[s63]
·
5 64
G l ycolysis, G l u coneogenesis, a n d the Pentose Phosphate Pathway
Knowles, J. & Albery, W.J. ( 1977) Perfection in enzyme catalysis:
Key Terms
the energetics of triose phosphate isomerase . Acc. Chem Res . 10,
Terms in bold are defined in the glossary.
glycolysis 528 fermentation 528 lactic acid fermentation 530 hypoxia 530 ethanol (alcohol) fermentation 530 isozymes 532 acyl phosphate 536 substrate-level phosphorylation respiration-linked phosphorylation phosphoenolpyruvate (PEP) 538
537 537
mutases 544 isomerases 544 lactose intolerance 545 galactosemia 545 thiamine pyrophosphate (TPP) 549 gluconeogenesis 552 biotin 554 pentose phosphate pathway 558 phosphogluconate pathway 558 hexose monophosphate pathway 558
105- 1 1 1 .
Kresge, N., Simoni, R.D., & Hill, R.L. (2005) Otto Fritz Meyerhof and the elucidation of the glycolytic pathway. J. Bioi. Chern. 280, 3 . Brief review o f classic papers, which are also available online
Kritikou, E. (2006) p53 turns on the energy switch. Nat Rev. Mol. Cell Biol. 7, 552-553.
Pelicano, H., Martin, D.S., Zu, R-H., & Huang, P. (2006) Glycoly sis inhibition for anticancer treatment. Oncogene 25, 4633-4646. Intermediate-level review.
Phillips, D., Blake, C.C.F., & Watson, H.C. (eds). ( 1 981) The Enzymes of Glycolysis: Structure, Activity and Evolution. Philos Trans R Soc Land. Ser: B Biol Sci. 293, 1-214. A collection of excellent reviews on the enzymes of glycolysis, written at a level challenging but comprehensible to a beginning student of biochemistry
Plaxton, W.C. ( 1 996) The organization and regulation of plant gly colysis Annu Rev. Plant Physiol. Plant Mol Biol. 47, 1 8 5-2 1 4. Very helpful review of the subcellular localization of glycolytic enzymes and the regulation of glycolysis in plants.
Further Reading General Fruton, J.S. ( 1 999) Proteins, Genes, and Enzymes: The Interplay of Chemistry and Biology, Yale University Press, New Haven. This text includes a detailed historical account of research on glycolysis.
Glycolysis Boiteux, A. & Hess, B. ( 1 98 1 ) Design of glycolysis. Philos. Trans R Soc Land Ser: B Biol Sci. 293, 5-22 . Intermediate-level review of the pathway and the classic view of its control
Dandekar, T. , Schuster, S., Snel, B., Huynen, M., & Bork, P. ( 1 999) Pathway alignment: application to the comparative analysis of glycolytic enzymes Biochem J. 343, 1 1 5- 124 .
Intermediate-level review of the bioinformatic view of the evolu
tion of glycolysis.
Dang, C.V. & Semenza, G.L. ( 1 999) Oncogenic alterations of metabolism. Trends Biochem Sci 24, 68-72. Brief review of the molecular basis for increased glycolysis in tumors.
Erlandsen, H., Abola, E.E., & Stevens, R.C. (2000) Combining structural genomics and enzymology: completing the picture in metabolic pathways and enzyme active sites Curr: Opin. Struct Bioi. 1 0, 7 1 9-730 Intermediate-level review of the structures of the glycolytic enzymes.
Gatenby, R.A. & Gillies, R.J. (2004) Why do cancers have high aerobic glycolysis? Nat. Rev Cancer 4, 891-899.
Hardie, D.G. (2000) Metabolic control: a new solution to an old problem . Curr: Biol 1 0, R757-R759.
Harris, A.L. (2002) Hypoxia-a key regulatory factor in tumour growth. Nat Rev Cancer 2, 38-47.
Heinrich, R., Melendez-Hevia, E., Montero, F. , Nuno, J.C., Stephani, A., & Waddell, T.D. ( 1 999) The structural design of
Rose, I. ( 1 98 1 ) Chemistry of proton abstraction by glycolytic enzymes (aldolase, isomerases, and pyruvate kinase) . Philos. Trans R. Soc. Land. Ser: B Biol Sci. 293, 1 3 1-1 4 4. Intermediate-level review of the mechanisms of these enzymes.
Shirmer, T. & Evans, P.R. ( 1 990) Structural basis for the allosteric behavior of phosphofructokinase. Nature 343, 140-145.
Smith, T.A. (2000) Mammalian hexokinases and their abnormal expression in cancer Br: J. Biomed Sci. 57, 1 70-1 78.
A review of the four hexokinase isozymes of mammals: their
properties and tissue distributions and their expression during the development of tumors
Feeder Pathways for Glycolysis Elsas, L.J. & Lai, K. ( 1 998) The molecular biology of galactosemia . Genet. Med l, 40-48.
Novelli, G. & Reichardt, J.K. (2000) Molecular basis of disorders of human galactose metab olism: past, present, and future. Mol Genet Metab. 7 1 , 62-65.
Petry, K.G. & Reichardt, J.K. ( 1 998) The fundamental importance of human galactose metabolism: lessons from genetics and biochem istry. Trends Genet 14, 98-102
Van Beers, E.H., Buller, H.A., Grand, R.J., Einerhand, A.W.C.,
& Dekker, J. ( 1 995) Intestinal brush border glycohydrolases: structure, function, and development. Grit. Rev. Biochem Mol Biol. 30, 1 9 7-262 .
Fermentations Demain, A.L., Davies, J.E., Atlas, R.M., Cohen, G., Hershberger, C.L. , Hu, W.-S., Sherman, D.H., Willson, R.C., & Wu, J.H.D. (eds). ( 1 999) Manual of Industrial Microbiology and Biotechnology , American Society for Microbiology, Washington, D C. Classic introduction to all aspects of industrial fermentations.
Liese, A., Seelbach, K., & Wandrey, C. (eds). (2006) Industrial Biotransjormations , John Wiley & Sons, New York. The use of microorganisms in industry for the synthesis of
valuable products from inexpensive starting materials .
glycolysis: an evolutionary approach. Biochem. Soc Trans 27, 294-298.
Gluconeogenesis
Keith, B. & Simon, M.C. (2007) Hypoxia-inducible factors, stem
Gerich, J.E., Meyer, C., Woerle, H.J., & Stumvoll, M. (2001) Re
cells, and cancer. Cell 129, 465-472.
nal gluconeogenesis: its importance in human glucose homeostasis .
Intermediate-level review.
Diabetes Care 24, 382-39 1 .
P ro b l e m s
Intermediate-level review of the conttibution of kidney tissue to
gluconeogenesis .
Gleeson, T. (1 996) Post-exercise lactate metabolism: a comparative review of sites, pathways, and regulation. Annu. Rev. Physiol. 58, 565-58 1 .
Hers, H.G. & Hue, L. ( 1 983) Gluconeogenesis and related aspects of glycolysis. Annu Rev. Biochem
5 2 , 6 1 7-653.
Matte, A., Tari, L.W., Goldie, H., & Delbaere, L.T.J. (1 997) Structure and mechanism of phosphoenolpyruvate carboxykinase. J Biol Chem.
272, 81 05-8 1 08.
Oxidative Pentose Phosphate Pathway Chayen, J., Howat, D.W., & Bitensky, L. (1 986) Cellular biochem istry of glucose 6-phosphate and 6-phosphogluconate dehydrogenase activities. CeU Biochem. Funct 4, 249-253.
Horecker, B.L. ( 1 976) Unraveling the pentose phosphate pathway. In Reflections on Biochemistry (Kornberg, A, Cornudella, 1. ,
Horecker, B .1. , & Oro, J. , eds), pp. 65-72, Pergamon Press, Inc.,
Oxford.
Kletzien, R.F., Harris, P.K., & Foellrni, L.A. ( 1 994) Glucose 6-phosphate dehydrogenase: a "housekeeping" enzyme subject to tissue-specific regulation by hormones, nutrients, and oxidant stress. FASEB J 8, 174-1 8 1 .
An intermediate-level review. Kresge, N., Simoni, R.D., & Hill, R.L. (2005) Bernard 1. Horecker's contributions to elucidating the pentose phosphate pathway. J Biol Chem.
2 80, 26 .
Brief review of classic papers, which are also available online.
Luzzato, 1., Mehta, A., & Vullia.my, T. (2001) Glucose 6-phosphate
dehydrogenase deficiency. In The Metabolic and Molecular Bases of Inherited Disease, 8th edn (Scriver, C.R. , Sly, W.S., Childs, B., Beaudet, A 1. , Valle, D., Kinzler, K . W., & Vogelstein, B. , eds), pp_ 451 7-4553, McGraw-Hill Inc., New York.
The four-volume treatise in which this article appears is filled with
fascinating information about the clinical and biochemical features of
hundreds of inherited diseases of metabolism
Martini, G. & Ursini, M.V. ( 1 996) A new lease on life for an old enzyme. BioEssays 18, 631-637.
An intermediate-level review of glucose 6-phosphate dehydro
genase, the effects of mutations in this enzyme in humans, and the effects of knock-out mutations in mice
Notaro, R., Afolayan, A., & Luzzatto, L. (2000) Human mutations in glucose 6-phosphate dehydrogenase reflect evolutionary history. FASEB J. 14, 485-494.
Wood, T. ( 1 985) The Pentose Phosphate Pathway, Academic Press, Inc , Orlando, FL.
Wood, T. ( 1 986) Physiological functions of the pentose phosphate pathway. Cell Biochem Funct 4, 2 4 1-247.
Problems 1. Equation for the Preparatory Phase of Glycolysis Write balanced biochemical equations for all the reactions in the catabolism of glucose to two molecules of glyceraldehyde 3-phosphate (the preparatory phase of glycolysis) , including the standard free-energy change for each reaction. Then write the overall or net equation for the preparatory phase of glycol ysis, with the net standard free-energy change. 2. The Payoff Phase of Glycolysis in Skeletal Muscle In working skeletal muscle under anaerobic conditions, glycer-
[s 6s]
aldehyde 3-phosphate is converted to pyruvate (the payoff phase of glycolysis) , and the pyruvate is reduced to lactate. Write balanced biochemical equations for all the reactions in this process, with the standard free-energy change for each re action. Then write the overall or net equation for the payoff phase of glycolysis (with lactate as the end product) , including the net standard free-energy change. 3. GLUT Transporters Compare the localization of GLUT4 with that of GLUT2 and GLUT3, and explain why these local izations are important in the response of muscle, adipose tis sue, brain, and liver to insulin.
4. Ethanol Production in Yeast When grown anaerobically on glucose, yeast (S. cerevisiae) converts pyruvate to ac etaldehyde, then reduces acetaldehyde to ethanol using elec trons from NADH. Write the equation for the second reaction, and calculate its equilibrium constant at 25 °C, given the stan dard reduction potentials in Table 1 3-7.
Fructose 1,6-bisphosphate glyceraldehyde 3-phosphate dihydroxyacetone phosphate
5. Energetics of the Aldolase Reaction Aldolase cat alyzes the glycolytic reaction �
+
The standard free-energy change for this reaction in the direction written is + 23.8 kJ/mol. The concentrations of the three interme diates in the hepatocyte of a mammal are: fructose 1 ,6-bisphos phate, 1.4 X 10- 5 M; glyceraldehyde 3-phosphate, 3 X 10- 6 M; and dihydroxyacetone phosphate, 1 .6 X 10- 5 M. At body temperature (37 °C), what is the actual free-energy change for the reaction? 6. Pathway of Atoms in Fermentation A "pulse-chase" experiment using 14C-labeled carbon sources is carried out on a yeast extract maintained under strictly anaerobic conditions to produce ethanol. The experiment consists of incubating a small amount of 1 4C-labeled substrate (the pulse) with the yeast extract just long enough for each intermediate in the fer mentation pathway to become labeled. The label is then "chased" through the pathway by the addition of excess unla beled glucose. The chase effectively prevents any further en try of labeled glucose into the pathway. (a) If [1-1 4C]glucose (glucose labeled at C-1 with 14C) is used as a substrate, what is the location of 14C in the product ethanol? Explain. (b) Where would 14C have to be located in the starting glucose to ensure that all the 1 4C activity is liberated as 14C0 2 during fermentation to ethanol? Explain.
7. Heat from Fermentations Large-scale industrial fer menters generally require constant, vigorous cooling. Why? 8. Fermentation to Produce Soy Sauce Soy sauce is pre pared by fermenting a salted mixture of soybeans and wheat with several microorganisms, including yeast, over a period of 8 to 12 months. The resulting sauce (after solids are removed) is rich in lactate and ethanol. How are these two compounds produced? To prevent the soy sauce from having a strong vine gary taste (vinegar is dilute acetic acid) , oxygen must be kept out of the fermentation tank. Why?
l566]
G l ycolysis, G l u coneogenesis, a n d the Pentose Phosp hate Pathway
9. Equivalence of Triose Phosphates 1 4C-Labeled glycer aldehyde 3-phosphate was added to a yeast extract. After a short time, fructose 1 ,6-bisphosphate labeled with 1 4C at C-3 and C-4 was isolated. What was the location of the 1 4C label in the starting glyceraldehyde 3-phosphate? Where did the second 1 4 C label in fructose 1 ,6-bisphosphate come from?
Explain. 10. Glycolysis Shortcut Suppose you discovered a mutant yeast whose glycolytic pathway was shorter because of the presence of a new enzyme catalyzing the reaction
NAD+ Glyceraldehyde 3-phosphate +
Hp
NADH
� /)
+
H+
3-phosphoglycerate
Would shortening the glycolytic pathway in this way ben efit the cell? Explain. 1 1 . Role of Lactate Dehydrogenase During strenuous activity, the demand for ATP in muscle tissue is vastly in creased. In rabbit leg muscle or turkey flight muscle, the ATP is produced almost exclusively by lactic acid fermentation. ATP is formed in the payoff phase of glycolysis by two reac tions, promoted by phosphoglycerate kinase and pyruvate ki nase. Suppose skeletal muscle were devoid of lactate dehydrogenase. Could it carry out strenuous physical activ ity; that is, could it generate ATP at a high rate by glycolysis? Explain. 12. Efficiency of ATP Production in Muscle The trans formation of glucose to lactate in myocytes releases only about 7% of the free energy released when glucose is completely ox idized to C0 and H 0. Does this mean that anaerobic glycoly 2 2 sis in muscle is a wasteful use of glucose? Explain. 13. Free-Energy Change for Triose Phosphate Oxida tion The oxidation of glyceraldehyde 3-phosphate to 1 ,3bisphosphoglycerate, catalyzed by glyceraldehyde 3-phosphate dehydrogenase, proceeds with an unfavorable equilibrium constant (K�q 0.08; t:iG'o 6.3 kJ/mol) , yet the flow through this point in the glycolytic pathway proceeds smoothly. How =
=
does the cell overcome the unfavorable equilibrium? 14. Arsenate Poisoning Arsenate is structurally and chemi cally similar to inorganic phosphate (Pi) , and many enzymes that require phosphate will also use arsenate. Organic com pounds of arsenate are less stable than analogous phosphate compounds, however. For example, acyl arsenates decom pose rapidly by hydrolysis:
0 0 II II R-C-0-As-o- + H2 0
I
�
o0
II
0
II
R -e- o- + HO-As-o- + H+ I o-
On the other hand, acyl phosphates, such as 1 ,3-bisphospho glycerate, are more stable and undergo further enzyme catalyzed transformation in cells . (a) Predict the effect on the net reaction catalyzed by glyceraldehyde 3-phosphate dehydrogenase if phosphate were replaced by arsenate. (b) What would be the consequence to an organism if ar senate were substituted for phosphate? Arsenate is very toxic to most organisms. Explain why. 15. Requirement for Phosphate in Ethanol Fermenta tion In 1906 Harden and Young, in a series of classic studies
on the fermentation of glucose to ethanol and C02 by extracts of brewer's yeast, made the following observations. (1) Inor ganic phosphate was essential to fermentation; when the sup ply of phosphate was exhausted, fermentation ceased before all the glucose was used. (2) During fermentation under these con ditions, ethanol, C02, and a hexose bisphosphate accumulated. (3) When arsenate was substituted for phosphate, no hexose bisphosphate accumulated, but the fermentation proceeded until all the glucose was converted to ethanol and C02. (a) Why did fermentation cease when the supply of phos phate was exhausted? (b) Why did ethanol and C02 accumulate? Was the con version of pyruvate to ethanol and C02 essential? Why? Iden tify the hexose bisphosphate that accumulated. Why did it accumulate? (c) Why did the substitution of arsenate for phosphate prevent the accumulation of the hexose bisphosphate yet allow fermentation to ethanol and C02 to go to completion? (See Problem 1 4.) 16. Role of the Vitamin Niacin Adults engaged in strenu ous physical activity require an intake of about 1 60 g of carbo hydrate daily but only about 20 mg of niacin for optimal nutrition. Given the role of niacin in glycolysis, how do you explain the observation? 1 7 . Synthesis of Glycerol Phosphate The glycerol 3phosphate required for the synthesis of glycerophospholipids can be synthesized from a glycolytic intermediate. Propose a reaction sequence for this conversion. 18. Severity of Clinical Symptoms Due to Enzyme Deficiency The clinical symptoms of two forms of galactosemia-deficiency of galactokinase or of UDP-glucose: galactose ! -phosphate uridylyltransferase-show radically dif ferent severity. Although both types produce gastric discom
fort after milk ingestion, deficiency of the transferase also leads to liver, kidney, spleen, and brain dysfunction and even tual death. What products accumulate in the blood and tissues with each type of enzyme deficiency? E stimate the relative toxicities of these products from the above information. 19. Muscle Wasting in Starvation One consequence of starvation is a reduction in muscle mass. What happens to the muscle proteins? 20. Pathway of Atoms in Gluconeogenesis A liver extract capable of carrying out all the normal metabolic reactions of
Problems
the liver is briefly incubated in separate experiments with the following 14C-labeled precursors. o / (a) [14C] Bicarbonate, H0-14C
�
0
(b) [l-14C]Pyruvate, CH3-C-14Coo
ll
Explain how this reaction inhibits the transformation of lactate to pyruvate. Why does this lead to hypoglycemia? 2 6 . Blood Lactate Levels during Vigorous Exer cise The c onc entrations of lactate in blood plasma be fore, during, and after a 400 m sprint are shown in the graph.
0
Trace the pathway of each precursor through gluconeogene sis. Indicate the location of 14C in all intermediates and in the product, glucose.
200
�
2 1 . Energy Cost of a Cycle of Glycolysis and Gluconeo genesis What is the cost (in ATP equivalents) of transforming glucose to pyruvate via glycolysis and back again to glucose via gluconeogenesis?
3 a) ..., (lj ..., "
� ..9 P=l
lysis Why is it important that gluconeogenesis is not the exact reversal of glycolysis?
150
100
50
23. Energetics of the Pyruvate Kinase Reaction Explain in bioenergetic terms how the conversion of pyruvate to phos
24. Glucogenic Substrates A common procedure for de termining the effectiveness of compounds as precursors of glucose in mammals is to starve the animal until the liver glycogen stores are depleted and then administer the com pound in question. A substrate that leads to a net increase in liver glycogen is tenned glucogenic, because it must first be converted to glucose 6-phosphate. Show by means of known enzymatic reactions which of the following substances are glucogenic. (a) Succinate, -ooc - CH2-CH2- COo
I
(b) Glycerol, OH
I
I
OH OH
CH 2 -C-CH 2
I
(c) Acetyl-CoA,
(d)
H
II
0 CH3-C-S-CoA
Pyruvate,
Run +Before_.., ' ..._---After ---�
"0 0
22. Relationship between Gluconeogenesis and Glyco
phoenolpyruvate in gluconeogenesis overcomes the large, negative standard free-energy change of the pyruvate kinase reaction in glycolysis.
[s67]
o L---L---�---L----� 0 40 60 20 Time (min)
(a) What causes the rapid rise in lactate concentration? (b) What causes the decline in lactate concentration after completion of the sprint? Why does the decline occur more slowly than the increase? (c) Why is the concentration of lactate not zero during the resting state? 27. Relationship between Fructose 1 ,6-Bisphosphatase and Blood Lactate Levels A congenital defect in the liver enzyme fructose 1 ,6-bisphosphatase results in abnormally high levels of lactate in the blood plasma. Explain. , .,
28. Effect of Phloridzin on Carbohydrate Metabolism Phloridzin, a toxic glycoside from the bark of the pear tree, blocks the normal reabsorption of glucose from the kidney tubule, thus causing blood glucose to be almost completely ex creted in the urine. In an experiment, rats fed phloridzin and sodium succinate excreted about 0.5 mol of glucose (made by gluconeogenesis) for every 1 mol of sodium succinate in gested. How is the succinate transformed to glucose? Explain the stoichiometry.
0
II
CH3-c-coo-
(e) Butyrate, CH3-CH2-CH2-C00-
25. Ethanol Mfects Blood Glucose Levels The consumption of alcohol (ethanol) , especially after peri ods of strenuous activity or after not eating for several hours, results in a deficiency of glucose in the blood, a condition known as hypoglycemia. The first step in the metabolism of ethanol by the liver is oxidation to acetaldehyde, catalyzed by liver alcohol dehydrogenase:
Phloridzin
29. Excess 02 Uptake during Gluconeogenesis Lactate absorbed by the liver is converted to glucose, with the input of
[56s]
G l ycolysis, G l u coneogenesis, a n d the Pentose Ph osph ate Pathway
6 mol of ATP for every mole of glucose produced. The extent of
which interconverts L-arabinose and L-ribulose; araB, L-ribu
this process in a rat liver preparation can be monitored by admin 14 4 istering [ C]lactate and measuring the amount of C]glucose
lokinase, which uses ATP to phosphorylate L-ribulose at C-5;
produced. Because the stoichiometry of
L-ribulose 5-phosphate and L-xylulose 5-phosphate; talE,
ATP production is known (about 5 ATP the extra
02
e
02 consumption and per 02) , we can predict
consumption above the normal rate when a given
amount of lactate is administered. However, when the extra
02
araD, L-ribulose 5-phosphate epimerase, which interconverts transaldolase; and tktA , transketolase .
(b) For each o f the three ara enzymes, briefly describe
the chemical transformation it catalyzes and, where possible,
used in the synthesis of glucose from lactate is actually measured,
name an enzyme discussed in this chapter that carries out an
it is always higher than predicted by known stoichiometric rela
analogous reaction.
tionships. Suggest a possible explanation for this observation.
30. Role of the Pentose Phosphate Pathway If the oxida tion of glucose 6-phosphate via the pentose phosphate path way were being used primarily to generate NADPH for biosynthesis, the other product, ribose 5-phosphate, would ac cumulate . What problems might this cause?
The five E. coli genes inserted in Z. mobilis allowed the
entry of arabinose into the nonoxidative phase of the pentose
phosphate pathway (Fig. 1 4-22) , where it was converted to glucose 6-phosphate and fermented to ethanol. (c) The three ara enzymes eventually converted arabi
nose into which sugar?
(d) The product from part (c) feeds into the pathway shown in Figure 14-22. Combining the five E. coli enzymes listed above with the enzymes of this pathway, describe the
Data Analysis Problem
overall pathway for the fermentation of 6 molecules of arabi
31. Engineering a Fermentation System Fermentation of plant matter to produce ethanol for fuel is one potential method for reducing the use of fossil fuels and thus the
C02
emissions that lead to global warming . Many microorganisms can break down cellulose then ferment the glucose to ethanol. However, many potential cellulose sources, including agricul tural residues and switchgrass,
also
contain substantial
amounts of arabinose, which is not as easily fermented.
H " .f'o c I HO-C-H I H-C-OH I H-C-OH I CH20H D-Arabinose
nose to ethanol. (e) What is the stoichiometry of the fermentation of 6 mol ecules of arabinose to ethanol and
C02? How many ATP mole
cules would you expect this reaction to generate? (f) Z. mobilis uses a slightly different pathway for ethanol
fermentation from the one described in this chapter. As a re
sult, the expected ATP yield is only 1 ATP per molecule of ara binose. Although this is less beneficial for the bacterium, it is better for ethanol production. Why? Another sugar commonly found in plant matter is xylose .
H " .f'o c I H-C-OH I HO-C-H I H-C-OH I CH20H D-Xylose
Escherichia coli is capable of fermenting arabinose to ethanol, but it is not naturally tolerant of high ethanol levels, thus limiting its utility for commercial ethanol production. An
(g) What additional enzymes would you need to introduce
other bacterium, Zymomonas mobilis, is naturally tolerant of
into the modified Z. mobilis strain described above to enable
high levels of ethanol but cannot ferment arabinose. Deanda,
it to use xylose as well as arabinose to produce ethanol? You
Zhang, E ddy, and Picataggio (1 996) described their efforts to
don't need to name the enzymes (they may not even exist in
combine the most useful features of these two organisms by
the real world!) ; just give the reactions they would need to
introducing the E. coli genes for the arabinose-metabolizing
catalyze .
enzymes into Z. mobilis.
(a) Why is this a simpler strategy than the reverse: engi
neering E. coli to be more ethanol-tolerant? Deanda and colleagues inserted five E. coli genes into the
Z. mobilis genome: araA , coding for L-arabinose isomerase,
Reference Deanda, K., Zhang, M., Eddy, C., & Picataggio, S. ( 1 996) Devel opment of an arabinose-fermenting Zymomonas mobilis strain by metabolic pathway engineering. Appl. Environ 4465-4470
Microbial. 6 2 ,
Formation of l iver g lycogen from lactic acid is thus seen to esta b l i s h a n i m portant connection between t h e metabol ism o f t h e muscle and that of the l iver. Muscle glycogen becomes ava i lable as blood sugar through the i ntervention of the l iver, and blood sugar in turn i s con verted i nto m uscle glycoge n . There ex i sts therefore a complete cyc le of the g l u cose molec u le i n the body . . . Epi neph r i ne was fou nd to accel e rate th i s cycl e i n the d i rection of m u s c l e glycogen to l iver glycogen . . . Insu l i n, on the other hand, was fou n d to accelerate the cycle in the d i rection of blood g l u cose to m uscle glycogen. -C. F. Cori and C. T. Cori, article in journal of Biological Chemi stry, 7 929
Principles of Metabolic Regulation 1 5.1
Regulation o f Metabolic Pathways
1 5.2
Analysis of Metabolic Control
1 5.3
Coordinated Regulation of Glycolysis and Gluconeogenesis
570
5 77
582 594
1 5 .4
The Metabolism of Glycogen in Animals
1 5.5
Coordi nated Regulation of Glycogen Synthesis and Breakdown
M
602
etabolic regulation, a central theme in biochem istry, is one of the most remarkable features of living organisms. Of the thousands of enzyme catalyzed reactions that can take place in a cell, there is probably not one that escapes some form of regulation. This need to regulate every aspect of cellular metabo lism becomes clear as one examines the complexity of metabolic reaction sequences. Although it is convenient for the student of biochemistry to divide metabolic processes into "pathways" that play discrete roles in the cell's economy, no such separation exists in the living cell. Rather, every pathway we discuss in this book is inextricably intertwined with all the other cellular pathways in a multidimensional network of reactions (Fig. 1 5-1 ) . For example, in Chapter 14 we discussed four possible fates for glucose 6-phosphate in a hepato cyte: breakdown by glycolysis for the production of ATP, breakdown in the pentose phosphate pathway for the production of NADPH and pentose phosphates, use in the synthesis of complex polysaccharides of the extra cellular matrix, or hydrolysis to glucose and phosphate to replenish blood glucose. In fact, glucose 6-phosphate has other possible fates in hepatocytes, too; it may, for example, be used to synthesize other sugars, such as glucosamine, galactose, galactosamine, fucose, and neu raminic acid, for use in protein glycosylation, or it may
be partially degraded to provide acetyl-GoA for fatty acid and sterol synthesis. And the bacterium Es cherichia coli can use glucose to produce the carbon skeleton of every one of its several thousand types of molecules. When any cell uses glucose 6-phosphate for one purpose, that "decision" affects all the other path ways for which glucose 6-phosphate is a precursor or in termediate: any change in the allocation of glucose 6-phosphate to one pathway affects, directly or indi rectly, the flow of metabolites through all the others. Such changes in allocation are common in the life of a cell. Louis Pasteur was the first to describe the more than 10-fold increase in glucose consumption by a yeast culture when it was shifted from aerobic to anaerobic conditions. This "Pasteur effect" occurs without a signif icant change in the concentrations of ATP or most of the hundreds of metabolic intermediates and products de rived from glucose. A similar effect occurs in the cells of skeletal muscle when a sprinter leaves the starting blocks. The ability of a cell to carry out all these inter locking metabolic processes simultaneously-obtaining every product in the amount needed and at the right time, in the face of major perturbations from outside, and without generating leftovers-is an astounding accomplishment. In this chapter we use the metabolism of glucose to illustrate some general principles of metabolic regula tion. First we look at the general roles of regulation in achieving metabolic homeostasis and introduce meta bolic control analysis, a system for analyzing complex metabolic interactions quantitatively. We then describe the specific regulatory properties of the individual en zymes of glucose metabolism; for glycolysis and gluco neogenesis, we described the catalytic activities of the enzymes in Chapter 14. Here we also discuss both the catalytic and regulatory properties of the enzymes of glycogen synthesis and breakdown, one of the best studied cases of metabolic regulation. Note that in
[s7o]
Principles of Meta b o l i c Regu lation
M ETABOLJ
P T HW A Y
G lyrnn Bios} nthesi\ and Mel:.�bnlism
Bio�) nl h!.'sis of Sccond a r� :\ Jetuholitcs
FIGURE 1 5-1 Metabolism as a three-dimensional meshwork. A typical
( Kyoto Encyclopedia of Genes and Genomes) PATHWAY database
eukaryotic cell has the capacity to make about 30,000 different pro
(www.genome.ad .j p/kegg/pathway/map/mapO l l OO.htm l ) . Each area
teins, which cata lyze thousands of different reactions involving many
can be further expanded for i ncreas ingly deta i l ed information, to the
hundreds of metabolites, most shared by more than one "pathway."
level of specific enzymes and i ntermediates.
This overview i mage of metabolic pathways is from the online KEGG
selecting carbohydrate metabolism to illustrate the prin ciples of metabolic regulation, we have artificially sepa rated the metabolism of fats and carbohydrates . In fact, these two activities are very tightly integrated, as we shall see in Chapter 23.
1 5 . 1 Regu lation of Meta bolic Pathways The pathways of glucose metabolism provide , in the catabolic direction, the energy essential to oppose the forces of entropy and, in the anabolic direction, biosyn thetic precursors and a storage form of metabolic en ergy. These reactions are so important to survival that very complex regulatory mechanisms have evolved to
ensure that metabolites move through each pathway in the correct direction and at the correct rate to match exactly the cell's or the organism's changing circum stances. By a variety of mechanisms operating on differ ent time scales, adjustments are made in the rate of metabolite flow through an entire pathway when exter nal circumstances change. Circumstances do change, sometimes dramatically. For example, the demand for ATP in insect flight muscle increases 1 00-fold in a few seconds when the insect takes flight. In humans, the availability of oxygen may decrease due to hypoxia (diminished delivery of oxygen to tissues) or ischemia (diminished flow of blood to tis sues) . The relative proportions of carbohydrate, fat, and
1 5 . 1 Regu lation of Meta b o l i c Pathways
protein in the diet vary from meal to meal, and the sup ply of fuels obtained in the diet is intermittent, requiring metabolic adjustments between meals and during peri ods of starvation. Wound healing requires huge amounts of energy and biosynthetic precursors. Cells and Organisms Maintain a Dynam i c Steady State
Fuels such as glucose enter a cell, and waste products such as C02 leave, but the mass and the gross composi tion of a typical cell, organ, or adult animal do not change appreciably over time; cells and organisms exist in a dynamic steady state . For each metabolic reaction in a pathway, the substrate is provided by the preceding reaction at the same rate at which it is converted to product. Thus, although the rate (v) of metabolite flow, or flux, through this step of the pathway may be high and variable, the concentration of substrate, S, remains constant. So, for the two-step reaction A
u1
---+
S
---+ Vz
P
when v 1 = v2, [S] is constant. For example, changes in v 1 for the entry of glucose from various sources into the blood are balanced by changes in v2 for the uptake of glucose from the blood into various tissues, so the con centration of glucose in the blood ([S]) is held nearly constant at 5 mM. This is homeostasis at the molecular level. The failure of homeostatic mechanisms is often at the root of human disease. In diabetes mellitus, for ex ample, the regulation of blood glucose concentration is defective as a result of the lack of or insensitivity to in sulin, with profound medical consequences. When the external perturbation is not merely tran sient, or when one kind of cell develops into another, the adjustments in cell composition and metabolism can be more dramatic and may require significant and lasting changes in the allocation of energy and synthetic pre cursors to bring about a new dynamic steady state . Con sider, for example, the differentiation of stem cells in the bone marrow into erythrocytes. The precursor cell contains a nucleus, mitochondria, and little or no hemo globin, whereas the fully differentiated erythrocyte con tains prodigious amounts of hemoglobin but has neither nucleus nor mitochondria; the cell's composition has permanently changed in response to external develop mental signals , with accompanying changes in metabo lism. This cellular differentiation requires precise regulation of the levels of cellular proteins. In the course of evolution, organisms have acquired a remarkable collection of regulatory mechanisms for main taining homeostasis at the molecular, cellular, and organis mal levels, as reflected in the proportion of genes that encode regulatory machinery. In humans, about 4,000 genes C� 12% of all genes) encode regulatory proteins, in cluding a variety of receptors, regulators of gene expres sion, and more than 500 different protein kinases! In many cases, the regulatory mechanisms overlap: one enzyme is subject to regulation by several different mechanisms.
[571]
Both the Amount a n d the Catalytic Activity of an Enzyme Can Be Regu lated
The flux through an enzyme-catalyzed reaction can be modulated by changes in the number of enzyme mole cules or by changes in the catalytic activity of each enzyme molecule already present. Such changes occur on time scales from milliseconds to many hours, in re sponse to signals from within or outside the cell. Very rapid allosteric changes in enzyme activity are generally triggered locally, by changes in the local concentration of a small molecule-a substrate of the pathway in which that reaction is a step (say, glucose for glycoly sis) , a product of the pathway (ATP from glycolysis) , or a key metabolite or cofactor (such as NADH) that indi cates the cell's metabolic state. Second messengers (such as cyclic AMP and Ca2+) generated intracellularly in response to extracellular signals (hormones, cy tokines, and so forth) also mediate allosteric regulation, on a slightly slower time scale set by the rate of the signal-transduction mechanism (see Chapter 12). Extracellular signals (Fig. 15-2 (D) may be hormonal (insulin or epinephrine, for example) or neuronal (acetyl choline) , or may be growth factors or cytokines. The num ber of molecules of a given enzyme in a cell is a fimction of the relative rates of synthesis and degradation of that en zyme. The rate of synthesis can be adjusted by the activa tion (in response to some outside signal) of a transcription factor (Fig. 1 5-2, @; described in more detail in Chapter 28) . Transcription factors are nuclear proteins that, when activated, bind specific DNA regions (response ele ments) near a gene's promoter (its transcriptional starting point) and activate or repress the transcription of that gene, leading to increased or decreased synthesis of the encoded protein. Activation of a transcription factor is sometimes the result of its binding of a specific ligand and sometimes the result of its phosphorylation or dephosphorylation. Each gene is controlled by one or more response elements that are recognized by specific transcription factors. Some genes have several response elements and are therefore controlled by several different transcription factors, re sponding to several different signals. Groups of genes en coding proteins that act together, such as the enzymes of glycolysis or gluconeogenesis, often share common re sponse element sequences, so that a single signal, acting through a particular transcription factor, turns all of these genes on and off together. The regulation of carbohydrate metabolism by specific transcription factors is described in Section 15.3. The stability of messenger RNAs-their resistance to degradation by cellular ribonucleases (Fig. 15-2, @) varies, and the amount of a given mRNA in the cell is a function of its rates of synthesis and degradation (Chap ter 26) . The rate at which an mRNA is translated into a protein by ribosomes (Fig. 15-2, @) is also regulated, and depends on several factors described in detail in Chapter 27. Note that an n-fold increase in an mRNA does not always mean an n-fold increase in its protein product.
Lsn�
P r i nciples of Metabo l i c Reg u l a t i o n
•
1
•
Receptor
�
(,) Extracellular
ignal
l
fc;\, Enzyme undergoes
\V pho phorylation/dephosphorylation
� Transcription of \.!:.J pecific genets
®
Enzyme binds ligand allosteric effector)
Nucleus
G)
..� �!� .... � ... . ...�... ;, �
FIGURE 15-2 Factors affecting the activity of enzymes. The total activity of an enzyme can be changed by altering the number of its molecules in the cell, or its effective activity in a subcellular compartment (G)
Once synthesized, protein molecules have a finite lifetime, which may range from minutes to many days (Table 1 5-1). The rate of protein degradation (Fig. 15-2, @) differs from one enzyme to another and depends on the conditions in the cell. Some proteins are tagged by the covalent attachment of ubiquitin for degradation in proteasomes, as discussed in Chapter 28 (see, for example, the case of cyclin, in Fig. 12-46) . Rapid turnover (synthesis followed by degradation) is energetically expensive, but proteins with a short half life can reach new steady state levels much faster than those with a long half-life, and the benefit of this quick responsiveness must balance or outweigh the cost to the cell.
Tissue
Average Half-life of Proteins In Mammalian---Tissues ----� Half-life (days)
Liver
0.9
Kidney
1.7
Heart
4.1
Brain
4.6
Muscle
En do pia mic reticulum
{;\ Protein degradation \.V (ubiquitin; proteasome)
mRNA translation on ribosome
TABLE 15-1
(";;\. Enzyme sequeste-red \!V in ubcellula.r organelle
10.7
through @l, or by modulating the activity of existing molecules (Q) through @l, as detailed in the text. An enzyme may be influenced by a combination of such factors.
Yet another way to alter the effective activity of an enzyme is to sequester the enzyme and its substrate in different compartments (Fig. 15-2, @). In muscle, for example, hexokinase cannot act on glucose until the sugar enters the myocyte from the blood, and the rate at which it enters depends on the activity of glucose trans porters (see Table 1 1-3) in the plasma membrane. Within cells, membrane-bounded compartments segre gate certain enzymes and enzyme systems, and the transport of substrate across these intracellular mem branes may be the limiting factor in enzyme action. By these several mechanisms for regulating enzyme level, cells can dramatically change their complement of enzymes in response to changes in metabolic circum stances. In vertebrates, liver is the most adaptable tis sue; a change from a high-carbohydrate to high-lipid diet, for example, affects the transcription of hundreds of genes and thus the levels of hundreds of proteins. These global changes in gene expression can be quanti fied by the use of DNA microarrays (see Fig. 9-22) that display the entire complement of mRNAs present in a given cell type or organ (the transcriptome) or by two dimensional gel electrophoresis (see Fig. 3-2 1 ) that displays the protein complement of a cell type or organ (its proteome) . Both techniques offer great insights into metabolic regulation. The effect of changes in the
1 5 . 1 Regul ation of Metabolic Pathways
proteome is often a change in the total ensemble of low molecular weight metabolites, the metabolome . Once the regulatory mechanisms that involve pro tein synthesis and degradation have produced a certain number of molecules of each enzyme in a cell, the activity of those enzymes can be further regulated in several other ways: by the concentration of substrate, the presence of allosteric effectors, covalent modifica tions, or binding of regulatory proteins-all of which can change the activity of an individual enzyme molecule (Fig. 1 5-2, (j) to @). All enzymes are sensitive to the concentration of their substrate(s) (Fig. 15-2, (j)). Recall that in the sim plest case (an enzyme that follows Michaelis-Menten ki netics), the initial rate of the reaction is half-maximal when the substrate is present at a concentration equal to Km (that is, when the enzyme is half-saturated with substrate) . Activity drops off at lower [S] , and when [S] < < Km, the reaction rate is linearly dependent on [S]. This is important because intracellular concentrations of substrate are often in the same range as, or lower than, Km. The activity of hexokinase, for example, changes with [glucose], and intracellular [glucose] varies with the concentration of glucose in the blood. As we will see, the different forms (isozymes) of hexokinase have different Km values and are therefore differently affected by changes in intracellular [glucose], in ways that make sense physiologically. - WORKED EXAMPLE 1 S-1
Activity of a Glucose Transporter
If Kt (the equivalent of Km) for the glucose transporter in liver (GLUT2) is 40 mM, calculate the effect on the rate of glucose flux into a hepatocyte of increasing the blood glucose concentration from 3 mM to 10 mM. Solution: We use Equation 1 1-1 (p. 393) to find the ini
tial velocity (flux) of glucose uptake.
At 3 mM glucose Vo
= =
Vmax ( 3 mM)/(40 mM
Vmax (3 mM/43 mM)
3 mM)
+ =
0.07 Vmax
At 10 mM glucose Vo
=
=
Vmax (10 mM)/(40 mM
Vmax (10 mM/50 mM)
+
=
[s73]
Required change in [S] to increase V0 from 10% to 90% Vmax
Hill coefficient
(nn) 0.5
X6,600
1.0
X81
2.0
X9
3.0
X4.3
4.0
X3
to sigmoid kinetics, or vice versa (see Fig. 1 5-14b, for example) . In the steepest part of the sigmoid curve, a small change in the concentration of substrate, or of allosteric effector, can have a large impact on reaction rate. Recall from Chapter 5 (p. 1 64) that the cooperativ ity of an allosteric enzyme can be expressed as a Hill coefficient, with higher coefficients meaning greater cooperativity. For an allosteric enzyme with a Hill coefficient of 4, activity increases from 10% vmax to 90% Vrnax with only a 3-fold increase in [S], compared with the 8 1 -fold rise in [S] needed by an enzyme with no cooperative effects (Hill coefficient of 1 ; Table 15-2) . Covalent modifications of enzymes or other proteins (Fig. 15-2, @) occur within seconds or minutes of a reg ulatory signal, typically an extracellular signal. By far the most common modifications are phosphorylation and de phosphorylation (Fig. 1 5-3 ) ; up to half the proteins in a eukaryotic cell are phosphorylated under some circum stances. Phosphorylation by a specific protein kinase may alter the electrostatic features of an enzyme's active site cause movement of an inhibitory region of the en z e protein out of the active site, alter the enzyme's in teraction with other proteins, or force conformational changes that translate into changes in Vmax or Km. For
�
Protein ---- -�ubstrate .... 1Sertrhrtryr-;-oH "
�......._�
�"
10 mM) 0.20 Vmax
So a rise in blood glucose from 3 mM to 1 0 mM increases the rate of glucose influx into a hepatocyte by a factor of 0.20/0.07 = 3. FIGURE 1 5-3 Protein phosphorylation and dephosphorylation. Pro
Enzyme activity can be either increased or decreased by an allosteric effector (Fig. 1 5-2, @; see Fig. 6-34) . Allosteric effectors typically convert hyperbolic kinetics
te in kinases transfer a phosphoryl group from ATP to a Ser, Thr, or Tyr residue in an enzyme or other prote i n substrate . Prote in phosphatases remove the phosphoryl group as P; .
[574]
Principles of Meta b o l i c Regul ation
covalent modification to be useful in regulation, the cell must be able to restore the altered enzyme to its original activity state. A family of phosphoprotein phosphatases, at least some of which are themselves under regulation, catalyzes the dephosphorylation of proteins. Finally, many enzymes are regulated by association with and dissociation from another, regulatory protein (Fig. 1 5-2, @) . For example, the cyclic AMP-dependent protein kinase (PKA; see Fig. 12-6) is inactive until cAMP binding separates catalytic from regulatory subunits. These several mechanisms for altering the flux through a step in a metabolic pathway are not mutually exclusive. It is very common for a single enzyme to be regulated at the level of transcription and by both al losteric and covalent mechanisms. The combination provides fast, smooth, effective regulation in response to a very wide array of perturbations and signals. In the discussions that follow, it is useful to think of changes in enzymatic activity as serving two distinct though complementary roles. We use the term metabolic regulation to refer to processes that serve to maintain homeostasis at the molecular level-to hold some cellular parameter (concentration of a metabolite, for example) at a steady level over time, even as the flow of metabolites through the pathway changes. The term metabolic con trol refers to a process that leads to a change in the out put of a metabolic pathway over time, in response to some outside signal or change in circumstances. The distinc tion, although useful, is not always easy to make. Reactions Fa r from Equilibrium in Cel ls Are Com m on Points of Regulation
For some steps in a metabolic pathway the reaction is close to equilibrium, with the cell in its dynamic steady state (Fig. 15-4). The net flow of metabolites through these steps is the small difference between the rates of the forward and reverse reactions, rates that are very similar when a reaction is near equilibrium. Small changes in substrate or product concentration can produce large
CD
�A
net rate:
10.01
v=
0.01 10
v=
® B
V=
200
190 10
v=
® c
V=
500
490 10
V=
D
FIGURE 15-4 Near-equilibrium and nonequilibrium steps in a meta
bolic pathway. Steps (I) and
Q) of this pathway are near equi l ibrium i n the cell; for each step, the rate (V) of the forward reaction is only sl ightly greater than the reverse rate, so the net forward rate (1 0) is rel atively low and the free-energy change, D.C', is close to zero. An in crease in [C] or [D] can reverse the di rection of these steps. Step G) is mai ntained in the cell far from equ i l ibrium; its forward rate greatly ex ceeds its reverse rate. The net rate of step G) (1 0) is much larger than the reverse rate (0.01 ) and is identical to the net rates of steps (I) and Q) when the pathway is operating in the steady state. Step G) has a large, negative D.C'.
changes in the net rate, and can even change the direc tion of the net flow. We can identify these near-equilib rium reactions in a cell by comparing the mass action ratio, Q, with the equilibrium constant for the reaction, K�q- Recall that for the reaction A + B � C + D, Q [C] [D]/[A] [B]. When Q and K�q are within 1 to 2 orders of magnitude of each other, the reaction is near equilibrium. This is the case for 6 of the 10 steps in the glycolytic path way (Table 15-3). Other reactions are far from equilibrium in the cell. For example, K�q for the phosphofructokinase-! (PFK-1) reaction is about 1,000, but Q ([fructose 1,6bisphosphate] [ADP]/[fructose 6-phosphate] [ATP]) in a hepatocyte in the steady state is about 0. 1 (Table 15-3) . It is because the reaction is so far from equilibrium that the process is exergonic under cellular conditions and tends to go in the forward direction. The reaction is held far from equilibrium because, under prevailing cellular conditions of substrate, product, and effector concen trations, the rate of conversion of fructose 6-phosphate to fructose 1 ,6-bisphosphate is limited by the activity of PFK-1, which is itself limited by the number of PFK-1 molecules present and by the actions of allosteric effec tors. Thus the net forward rate of the enzyme-catalyzed reaction is equal to the net flow of glycolytic intermedi ates through other steps in the pathway, and the reverse flow through PFK- 1 remains near zero. The cell cannot allow reactions with large equilib rium constants to reach equilibrium. If [fructose 6-phos phate], [ATP] , and [ADP] in the cell were held at typical levels (low millimolar concentrations) and the PFK-1 re action were allowed to reach equilibrium by an increase in [fructose 1,6-bisphosphate] , the concentration of fructose 1 ,6-bisphosphate would rise into the molar range, wreaking osmotic havoc on the cell. Consider an other case: if the reaction ATP � ADP + Pi were al lowed to approach equilibrium in the cell, the actual free-energy change (LlG') for that reaction (LlGP; see Worked Example 1 3-2, p. 503) would approach zero, and ATP would lose the high phosphoryl group transfer potential that makes it valuable to the cell. It is therefore essential that enzymes catalyzing ATP breakdown and other highly exergonic reactions in a cell be sensitive to regulation, so that when metabolic changes are forced by external circumstances, the flow through these en zymes will be adjusted to ensure that [ATP] remains far above its equilibrium level. When such metabolic changes occur, the activities of enzymes in all intercon nected pathways adjust to keep these critical steps away from equilibrium. Thus, not surprisingly, many enzymes (such as PFK-1) that catalyze highly exergonic reac tions are subject to a variety of subtle regulatory mech anisms. The multiplicity of these adjustments is so great that we cannot predict by examining the properties of any one enzyme in a pathway whether that enzyme has a strong influence on net flow through the entire path way. This complex problem can be approached by meta bolic control analysis, as described in Section 15.2. =
15.1 Regul ation of Metabolic Pathways
[s7s]
TABLE 15-3
Mass action ratio, Q
K�q
Enzyme
Aldolase
Liver
Heart
-27
No
-14
-23
9 X 10-6
Yes
+24
2.4 x 10-1
Yes
2 x 10-2
8 X 10-2
No
1.0 X 103
9 x 10-2
3 X 10-2
1.2 x 10-6
1.0 X 10-4 4 x w-2
Triose phosphate isomerase
!!.G' (kJ/mol) in heart
!!.G'o (kJ/mol) -17
1 X 103
Hexokinase PFK-1
Reaction near equilibrium in vivo?*
-6.0
+7.5
+3.8
Glyceraldehyde 3-phosphate dehydrogenase + phosphoglycerate kinase Phosphoglycerate mutase Enolase
2 X 103
6 X 102
1 X 10-1
1 x w-1 2.9
3
Pyruvate kinase
2 X 104
Phosphoglucose isomerase
4 X 10-1
7 x w-1 3.1 X 10-1
1.2 X 10-1 1.4
Yes
+4.4
+0.6
Yes
-3.2
-0.5 -17
-31
No
40 2.4 X 10-1
+3.5
-13
Yes
9.0
Yes
+2.2
No
-5.0
-1.4
Pyruvate carboxylase + PEP carboxykinase Glucose 6-phosphatase
Source: K�q
and Q from Newsholme,
7
1 X 10-3
E.A. & Start, C. (1973)
Regulation in Metabolism, Wiley Press, New York, pp. 97,263.
*For simplicity, any reaction for which the absolute value of the calculated
llG'
After the protection of its DNA from damage, perhaps nothing is more important to a cell than maintaining a constant supply and concentration of ATP. Many ATP using enzymes have Km values between 0.1 and 1 mM, and the ATP concentration in a typical cell is about 5 mM. If [ATP ] were to drop significantly, these enzymes would be less than fully saturated by their substrate (ATP) , and the rates of hundreds of reactions that involve ATP would decrease (Fig. 1 5-5 ) ; the cell would probably not survive this kinetic effect on so many reactions. There is also an important thermodynamic effect of lowered [ATP]. Because ATP is converted to ADP or AMP when "spent" to accomplish cellular work, the [ATP ]/[ADP ] ratio profoundly affects all reactions that employ these cofactors. (The same is true for other important cofactors, such as NADH/NAD + and NADPH/NADP + .) For example, consider the reaction catalyzed by hexokinase:
K�
data.
11G'
=
11G'• + RT ln
[ADP] (glucose 6-phosphate] [ATP][glucose]
Because an alteration of this driving force profoundly influences every reaction that involves ATP, organ isms have evolved under strong pressure to develop regulatory mechanisms responsive to the [ATP ]/[ADP ] ratio. AMP concentration is an even more sensitive indi cator of a cell's energetic state than is [ATP ] . Normally
Vmax
---------------- -------- -- -----
ADP + glucose 6-phosphate
[ADPl.q[glucose 6-phosphateleq =
llG'0 were calculated from these
determines the magnitude and sign of !!.G' and therefore the driving force, !!.G', of the reaction:
Metabolic Regulation
------+
and
is less than 6 is considered near equilibrium.
Adenine N ucleotides Play Special Roles in
ATP + glucose
llG'
-5.0
-17
Yes
1.2 X 102
8.5 X 102
- 23
[ATP]eq[glucoseleq
=
2 X 103
Note that this expression holds true only when reac tants and products are at their equilibrium concentra tions, where !!.G' = 0. At any other set of concentrations, !!.G' is not zero. Recall (from Chapter 1 3) that the ratio of products to substrates (the mass action ratio, Q)
5
10
15
20
25
30
35
40
ATP concentration [mM]
FIGURE 15-5 Effect of ATP concentration on the initial velocity of a typical AlP-dependent enzyme. These experi mental data y ield a Km for
ATP of 5 mM. The concentration of ATP in animal tissues is -5 mM.
[Y76=
Prin ciples of Metabo lic Regu lation
TABLE lS-4 Concentration after ATP depletion
Concentration before ATP depletion
Adenine nucleotide
(mM)
(mM)
Relative change 10%
ATP
5. 0
4.5
ADP
1.0
1.0
0
0.6
600%
AMP
0. 1
by a reduced nutrient supply or by increased exercise. The action of AMPK (not to be confused with the cycl ic AMP-dependent protein kinase; see Section 15.5) in creases glucose transport and activates glycolysis and fatty acid oxidation, while suppressing energy-requiring processes such as the synthesis of fatty acids, choles terol, and protein (Fig. 1 5-6) . We discuss AMPK fur ther, and the detailed mechanisms by which it effects these changes, in Chapter 23. In addition to ATP, hundreds of metabolic interme diates also must be present at appropriate concentra tions in the cell. To take just one example: the glycolytic intermediates dihydroxyacetone phosphate and 3phosphoglycerate are precursors of triacylglycerols and serine, respectively. When these products are needed, the rate of glycolysis must be adjusted to provide them without reducing the glycolytic production of ATP. The
cells have a far higher concentration of ATP (5 to 10 mM) than of AMP ( AMP + ATP
If ATP is consumed such that its concentration drops 10%, the relative increase in [AMP] is much greater than that of [ADP] (Table 15-4). It is not surprising, therefore, that many regulatory processes are keyed to changes in [AMP]. Probably the most important media tor of regulation by AMP is AMP-activated protein kinase (AMPK) , which responds to an increase in [AMP] by phosphorylating key proteins and thus regu lating their activities. The rise in [AMP] may be caused Brain (hypothalamus)
Leptin, adiponectin \
__
t
t[AMP] -1-[ATP]
Food intake
\
\
\
EJNS
\
Exercise
'
'' '
/
/ / /
/
/
/
/
Fatty acid uptake, oxidation Glucose uptake Mitochondrial biogenesis
Heart -... - - -
--
Fatty acid oxidation Glucose uptake Glycolysis
Fatty acid synthesis
Lipolysis
FIGURE 1 5-6 Role of AMP-activated protein kinase (AMPK) in carbo hydrate and fat metabolism. AMPK is activated by elevated [AMP] or
decreased [ATP], by exercise, by the sympathetic nervous system (SNS), or by peptide hormones produced in adipose tissue (/eptin and adiponectin, described in more deta i l in Chapter 23). When activated, AMPK phosphorylates target proteins and shifts metabol ism in a
_
\ \ \ \ \ \
I I \
Skeletal muscle
Pancreatic fJ cell
---���
secretion
Fatty acid synthesis Cholesterol synthesis variety of tissues away from energy-consu ming processes such as the synthesis of glycogen, fatty acids, and cholesterol; shifts metabol ism in extrahepatic tissues to the use of fatty acids as a fuel; and triggers gluconeogenesis in the l iver to provide glucose for the brain. In the hypothalamus, AMPK sti m u lates feeding behavior to provide more dietary fuel.
1 5.2 A n a lysis of Meta b o l i c Control
same is true for maintaining the levels of other impor tant cofactors, such as NADH and NADPH: changes in their mass action ratios (that is, in the ratio of reduced to oxidized cofactor) have global effects on metabolism. Of course, priorities at the organismal level have also driven the evolution of regulatory mechanisms. In mammals, the brain has virtually no stored source of energy, depending instead on a constant supply of glu cose from the blood. If blood glucose drops from its nor mal concentration of 4 to 5 mM to half that level, mental confusion results, and a fivefold reduction in blood glu cose can lead to coma and death. To buffer against changes in blood glucose concentration, release of the hormones insulin and glucagon, elicited by high or low blood glucose, respectively, triggers metabolic changes that tend to return the blood glucose concentration to normal. Other selective pressures must also have operated throughout evolution, selecting for regulatory mecha nisms that accomplish the following: 1. Maximize the efficiency of fuel utilization by preventing the simultaneous operation of pathways in opposite directions (such as glycolysis and gluconeogenesis). 2. Partition metabolites appropriately between alternative pathways (such as glycolysis and the pentose phosphate pathway). 3.
Draw on the fuel best suited for the immediate needs of the organism (glucose, fatty acids, glycogen, or amino acids).
4. Slow down biosynthetic pathways when their products accumulate. The remaining chapters of this book present many ex amples of each kind of regulatory mechanism.
S U M M A RY 1 5 . 1 •
•
•
Regulation of Metabolic Pathways
In a metabolically active cell in a steady state, intermediates are formed and consumed at equal rates. When a transient perturbation alters the rate of formation or consumption of a metabolite, compensating changes in enzyme activities return the system to the steady state. Cells regulate their metabolism by a variety of mechanisms over a time scale ranging from less than a millisecond to days, either by changing the activity of existing enzyme molecules or by changing the number of molecules of a specific enzyme. Various signals activate or inactivate transcription factors, which act in the nucleus to regulate gene expression. Changes in the transcriptome lead to changes in the proteome, and ultimately in the metabolome of a cell or tissue.
•
•
•
[sn]
In multistep processes such as glycolysis, certain reactions are essentially at equilibrium in the steady state; the rates of these reactions rise and fall with substrate concentration. Other reactions are far from equilibrium; these steps are typically the points of regulation of the overall pathway. Regulatory mechanisms maintain nearly constant levels of key metabolites such as ATP and NADH in cells and glucose in the blood, while matching the use or production of glucose to the organism's changing needs. The levels of ATP and AMP are a sensitive reflection of a cell's energy status, and when the [ATP]/[AMP] ratio decreases, the AMP-activated protein kinase (AMPK) triggers a variety of cellular responses to raise [ATP] and lower [AMP].
15.2 Analysis of Metabolic Control Detailed studies of metabolic regulation were not feasible until the basic chemical steps in a pathway had been clarified and the responsible enzymes characterized. Beginning with Eduard Buchner's discovery (c. 1900) that an extract of broken yeast cells could con vert glucose to ethanol and C02, a major thrust of bio chemical research was to deEduard Buchner, duce the steps by which this 1860-1917 transformation occurred and to purify and characterize the enzymes that catalyzed each step. By the middle of the twentieth century, all 10 enzymes of the glycolytic pathway had been purified and characterized. In the next 50 years much was learned about the regulation of these enzymes by intra cellular and extracellular signals, through the kinds of allosteric and covalent mechanisms described in this chapter. The conventional wisdom was that in a linear pathway such as glycolysis, catalysis by one enzyme must be the slowest and must therefore determine the rate of metabolite flow, or flux, through the whole path way. For glycolysis, PFK- 1 was considered the rate-lim iting enzyme, because it was known to be closely regulated by fructose 2 ,6-bisphosphate and other al losteric effectors. With the advent of genetic engineering technology, it became possible to test this "single rate-determining step" hypothesis by increasing the concentration of the enzyme that catalyzes the "rate-limiting step" in a path way and determining whether flux through the pathway increases proportionally. Most often it does not; the sim ple solution (a single rate-determining step) is wrong. It has now become clear that in most pathways the control of flux is distributed among several enzymes, and the
[578]
Prin ciples of Meta b o l i c Regulation
extent to which each contributes to the control varies with metabolic circumstances-the supply of the start ing material (say, glucose) , the supply of oxygen, the need for other products derived from intermediates of the pathway (say, glucose 6-phosphate for the pentose phosphate pathway in cells synthesizing large amounts of nucleotides), the effects of metabolites with regula tory roles, and the hormonal status of the organism (such as the levels of insulin and glucagon) , among other factors. Why are we interested in what limits the flux through a pathway? To understand the action of hor mones or drugs, or the pathology that results from a fail ure of metabolic regulation, we must know where control is exercised. If researchers wish to develop a drug that stimulates or inhibits a pathway, the logical target is the enzyme that has the greatest impact on the flux through that pathway. And the bioengineering of a microorganism to overproduce a product of commercial value (p. 312) requires a knowledge of what limits the flux of metabolites toward that product. The Contribution of Each Enzyme to Flux through a Pathway Is Experimentally Measurable
There are several ways to determine experimentally how a change in the activity of one enzyme in a pathway affects metabolite flux through that pathway. Consider the experimental results shown in Figure 15-7. When a sample of rat liver was homogenized to release all solu ble enzymes, the extract carried out the glycolytic con version of glucose to fructose 1 ,6-bisphosphate at a measurable rate. (This experiment, for simplicity, fo cused on just the first part of the glycolytic pathway.)
0.10 0.08
1>phate
t
P,
"'
'
H�O
Glycolysis
(c) FIGURE 1 5-16 Role of fructose 2,6-bisphosphate in regulation of gly colysis and gluconeogenesis. Fructose 2,6-bisphosphate (F2 6BP) has
opposite effects on the enzymatic activities of phosphofructoki nase-1 (PFK-1 , a glycolytic enzyme) and fructose 1 ,6-bisphosphatase (FBPase1 , a gluconeogenic enzyme). (a) PFK-1 activity in the absence of F26BP (blue curve) is half-maximal when the concentration of fructose 6-phosphate is 2 mM (that is, K0 5 2 mM). When 0. 1 3 J.LM F26BP is present (red curve), the K0 5 for fructose 6-phosphate is only 0.08 mM. =
Thus F26BP activates PFK-1 by increasing its apparent affinity for fruc tose &-phosphate (see Fig. 1 5-1 4b). (b) FBPase-1 activity is inhibited by as l ittle as 1 J.LM F26BP and is strongly inh ibited by 25 J.LM. In the ab sence of this inhibitor (blue curve) the K0 5 for fructose 1 ,6-bisphos phate is 5 J.LM, but in the presence of 25 J.LM F26BP (red curve) the K0,5 is >70 J.LM. Fructose 2,6-bisphosphate also makes FBPase-1 more sen sitive to inhibition by another al losteric regu lator, AMP. (c) Summary of regulation by F26BP.
J
-, r �5 88
Pri n c i p les of Metabolic Regulation
1' [F26BPJ
ATP
ADP
y AI· �
Frncto e 6-phosphate
ypi )
nr
Stimulates glycolysis, inhibits gluconeogenesis
"'
FBPase-2
(inactive)
pn.tem kill.�>•
'
('f' [cAMP] )
ADP
Fructose 2,6-bisphosphate (a)
0
-¥ lF26BPI Inhibits glycolysis, stimulates gluconeogenesis
II )...:.-____::-+- o-P -o ..... I o-
FIGURE 1 5- 1 7 Regulation of fructose 2,6-bisphosphate level. (a)
The cellular concentration of the regulator fructose 2,6-bisphosphate (F26BP) is determ ined by the rates of its synthesis by phosphofructokinase-2
(PFK-2) and its breakdown by fructose 2,6-bisphosphatase (FBPase-2). (b) Both enzyme activities are part of the same polypeptide chain, and they are reciprocally regulated by insulin and glucagon.
affinity for its substrate (Fig. 1 5-1 6c) , thereby slowing gluconeogenesis. The cellular concentration of the allosteric regu lator fructose 2 ,6-bisphosphate is set by the relative rates of its formation and breakdown (.Fig. 1 5 - 1 7 a ) . It is formed by phosphorylation of fruc tose 6 -phosphate, catalyzed by phosphofructoki nase-2 ( PFK-2 ) , and is broken down by fructose 2 , 6-bisphosphatase (FBPase-2 ) . (Note that these enzymes are distinct from PFK- 1 and FBPas e- 1 , which catalyze the formation and breakdown , re spectively, of fructose 1 ,6-bisphosphate.) PFK-2 and FBPase-2 are two separate enzymatic activities of a single , bifunctional protein. The balance of the se two activities in the liver, which determines the cel lular level of fructose 2 , 6-bisphosphate , is regulated by glucagon and insulin (Fig . 1 5- 1 7b) . As we saw in Chapter 1 2 (p. 431) , glucagon stim ulates the adenylyl cyclase of liver to synthesize 3 ' , 5 ' cyclic AMP (cAMP) from ATP. Cyclic AMP then activates cAMP-dependent protein kinase, which transfers a phosphoryl group from ATP to the bifunc tional protein PFK-2/FBPase-2. Phosphorylation of this protein enhances its FBPase-2 activity and in hibits its PFK-2 activity. Glucagon thereby lowers the cellular level of fructose 2 ,6-bisphosphate, inhibiting glycolysis and stimulating gluconeogenesis . The re sulting production of more glucose enables the liver to replenish blood glucose in response to glucagon. Insulin has the opposite effect, stimulating the activ ity of a phosphoprotein phosphatase that catalyzes removal of the phosphoryl group from the bifunc tional protein PFK-2/FBPase-2 , activating its PFK-2 activity, increasing the level of fructose 2 ,6-bisphos phate, stimulating glycolysis, and inhibiting gluconeo genesis.
Xylulose 5-Phosphate Is a Key Reg ulator of Carbohydrate and Fat Metabolism
Another regulatory mechanism also acts by controlling the level of fructose 2,6-bisphosphate. In the mammalian liver, xylulose 5-phosphate (see p. 560) , a product of the pentose phosphate pathway (hexose monophosphate pathway) , mediates the increase in glycolysis that fol lows ingestion of a high-carbohydrate meal. The xylu lose 5-phosphate concentration rises as glucose entering the liver is converted to glucose 6-phosphate and en ters both the glycolytic and pentose phosphate path ways. Xylulose 5-phosphate activates phosphoprotein phosphatase 2A (PP2A; Fig. 15-18) , which dephos phorylates the bifunctional PFK-2/FBPase-2 enzyme (Fig. 1 5-1 7) . Dephosphorylation activates PFK-2 and inhibits FBPase-2, and the resulting rise in fructose 2 ,6bisphosphate concentration stimulates glycolysis and inhibits gluconeogenesis. The increased glycolysis boosts the production of acetyl-GoA, while the in creased flow of hexose through the pentose phosphate pathway generates NADPH. Acetyl-GoA and NADPH are the starting materials for fatty acid synthesis, which has long been known to increase dramatically in re sponse to intake of a high-carbohydrate meal. Xylulose 5-phosphate also increases the synthesis of all the en zymes required for fatty acid synthesis, meeting the prediction from metabolic control analysis. We return to this effect in our discussion of the integration of carbo hydrate and lipid metabolism in Chapter 23. The Glycolytic Enzyme Pyruvate Ki nase I s Allosterica l ly I n h ibited b y ATP
At least three isozyrnes of pyruvate kinase are found in vertebrates, differing in their tissue distribution and
1 5 . 3 Coordi nated Regulation of G l ycolysis a n d G l uconeogenesis
[sa9]
(b) Scaffold/ A subunit
I atory unit 2
Sub
their response to modulators . High concentrations of ATP, acetyl-GoA, and long-chain fatty acids (signs of abundant energy supply) allosterically inhibit all isozymes of pyruvate kinase (Fig. 15-1 9 ). The liver isozyme (L form) , but not the muscle isozyme (M form) , is subj ect to further regulation by phosphoryla tion. When low blood glucose causes glucagon release, cAMP-dependent protein kinase phosphorylates the L isozyme of pyruvate kinase , inactivating it. This slows the use of glucose as a fuel in liver, sparing it for export to the brain and other organs. In muscle, the effect of increased [cAMP] is quite different. In response to epi nephrine, cAMP activates glycogen breakdown and glycolysis and provides the fuel needed for the fight-or flight response.
Substrate-
trate-
Holoenzyme
1
Holoenzyme 2
FIGURE 1 5-18 Structure and action of phosphoprotein phosphatase 2 2A (PP2A). (a) The catalytic subunit has two Mn + ions in its active
site, positioned close to the substrate recognition surface formed by the interface between the catalytic subunit and the regulatory subunit (PDB I D 2 NPP). Microcystin-LR, shown here i n red, is a specific i n h ibitor of PP2A. The catalytic and regulatory subunits rest in a scaffold (the A subun it) that positions them relative to each other and shapes the substrate recognition site. (b) PP2A recognizes several target pro teins, its specificity provided by the regulatory subunit. Each of several regu latory subun its fits the scaffold containing the catalytic subun it, and each regulatory subunit creates its unique substrate-binding site. All glycolytic tissues, including liver
Liver only glucagon I I I
@
ADP
ll6
F16BP - - - - - ,
+
ATP
steps
PEP
� (.._ ) Pyruvate kinase L
( inactive)
ADP
1 1
�---+
Pyruvate
:
I I I I I I .
FIGURE 15-19 Regulation of pyruvate kinase. The enzyme is al losteri cally inhibited by ATP, acetyi-CoA, and long-chain fatty acids (al l signs of an abundant energy supply), and the accumulation of fructose 1 ,6bisphosphate triggers its activation. Accumulation of alanine, which can be synthesized from pyruvate i n one step, al losterical ly inhibits pyruvate ki nase, slowing the production of pyruvate by glycolysis. The l iver isozyme (L form) is also regulated hormonal ly. Glucagon activates
kinase
IlM
ATP
'! I I I I
�-- -- " ATP, @- - - -- - acetyi-CoA, �- _ _ _ long-chain fntty �'
ll
Pyruvate
transamination
Alanine - - - - - /
I
acids
j
:
cAMP-dependent protei n ki nase (PKA; see Fig. 1 5-3 5), which phos phorylates the pyruvate kinase L isozyme, inactivating it. When the gl ucagon level drops, a protei n phosphatase (PP) dephosphorylates pyruvate kinase, activating it. This mechanism prevents the l iver from consuming glucose by glycolysis when blood glucose is low; instead, the l iver exports glucose. The muscle isozyme (M form) is not affected by this phosphorylation mechan ism .
[s9o]
Principles of Metabolic Regulation
The Gluconeogenic Conversion of Pyruvate to Phosphoenol Pyruvate I s Under Multiple Types of Reg ulation
In the pathway leading from pyruvate to glucose, the first control point determines the fate of pyruvate in the mitochondrion: its conversion either to acetyl-GoA (by the pyruvate dehydrogenase complex) to fuel the citric acid cycle (Chapter 1 6) or to oxaloacetate (by pyruvate carboxylase) to start the process of gluconeogenesis (Fig. 1 5-20) . When fatty acids are readily available as fuels, their breakdown in liver mitochondria yields acetyl-GoA, a signal that further oxidation of glucose for fuel is not necessary. Acetyl-GoA is a positive allosteric modulator of pyruvate carboxylase and a negative mod ulator of pyruvate dehydrogenase, through stimulation of a protein kinase that inactivates the dehydrogenase. When the cell's energy needs are being met, oxidative phosphorylation slows, NADH rises relative to NAD + and inhibits the citric acid cycle, and acetyl-GoA accu mulates. The increased concentration of acetyl-GoA in hibits the pyruvate dehydrogenase complex, slowing the formation of acetyl-GoA from pyruvate, and stimulates gluconeogenesis by activating pyruvate carboxylase,
t t t pvruvnte � Glucose
(-�@
1
: I \1 \
,
- -�
(8}
Oxaloacetate
'":.;:,�;:::
Pyruvate
dehydrogenase complex
C02
' - - - - - - - - - - - Acetyl-CoA
1 1
I Citric acid cycle I Energy FIGURE 1 5-20 Two alternative fates for pyruvate. Pyruvate can be converted to glucose and glycogen via gl uconeogenesis or oxidized to acetyl-CoA for energy production. The first enzyme in each path is reg ulated al losterically; acetyl-CoA, produced either by fatty acid oxida tion or by the pyruvate dehydrogenase complex, sti mulates pyruvate carboxylase and inhibits pyruvate dehydrogenase.
allowing conversion of excess pyruvate to oxaloacetate (and, eventually, glucose) . Oxaloacetate formed in this way is converted to phosphoenolpyruvate (PEP) in the reaction catalyzed by PEP carboxykinase (Fig. 1 5-1 1 ) . In mammals, the regulation of this key enzyme occurs primarily at the level of its synthesis and breakdown, in response to di etary and hormonal signals. Fasting or high glucagon levels act through cAMP to increase the rate of tran scription and to stabilize the mRNA. Insulin, or high blood glucose, has the opposite effects. We discuss this transcriptional regulation in more detail below. Gener ally triggered by a signal from outside the cell (diet, hor mones) , these changes take place on a time scale of minutes to hours. Transcriptional Regulation of Glycolysis and Gluconeogenesis Changes the N u m ber of Enzyme Molecules
Most of the regulatory actions discussed thus far are mediated by fast, quickly reversible mechanisms: al losteric effects, covalent alteration (phosphorylation) of the enzyme , or binding of a regulatory protein. An other set of regulatory processes involves changes in the number of molecules of an enzyme in the cell, through changes in the balance of enzyme synthesis and breakdown, and our discussion now turns to regu lation of transcription through signal-activated tran scription factors. In Chapter 1 2 we encountered nuclear receptors and transcription factors in the context of insulin signal ing. Insulin acts through its receptor in the plasma mem brane to turn on at least two distinct signaling pathways, each involving activation of a protein kinase. The MAP kinase ERK, for example, phosphorylates the transcrip tion factors SRF and Elk1 (see Fig. 1 2-1 5) , which then stimulate the synthesis of enzymes needed for cell growth and division. Protein kinase B (PKB; also called Akt) phosphorylates another set of transcription factors (PDX1 , for example) , and these stimulate the synthesis of enzymes that metabolize carbohydrates and the fats formed and stored following excess carbohydrate intake in the diet. In pancreatic f3 cells, PDX1 also stimulates the synthesis of insulin itself. More than 150 genes are transcriptionally regulated by insulin; humans have at least seven general types of insulin response elements, each recognized by a subset of transcription factors activated by insulin under vari ous conditions. Insulin stimulates the transcription of the genes that encode hexokinases II and IV, PFK- 1 , pyru vate kinase, and PFK-2/FBPase-2 (all involved in glycol ysis and its regulation) ; several enzymes of fatty acid synthesis; and glucose 6-phosphate dehydrogenase and 6-phosphogluconate dehydrogenase, enzymes of the pentose phosphate pathway that generate the NADPH required for fatty acid synthesis. Insulin also slows the
15.3 Coord i nated Reg u l ation of G lycolysis a n d Gluco neoge nesis
[s91]
TABLE 15-5 Change in gene expression
Pathway
Increased expression Hexokinase
II
Glycolysis
Hexokinase
IV
Glycolysis
Phosphofructokinase-1 (PFK-1)
Glycolysis
Pyruvate kinase
Glycolysis
PFK-2/FBPase-2
Regulation of glycolysis/gluconeogenesis
Glucose 6-phosphate dehydrogenase
Pentose phosphate pathway (NADPH)
6-Phosphogluconate dehydrogenase
Pentose phosphate pathway (NADPH)
Pyruvate dehydrogenase
Fatty acid synthesis
Acetyl-GoA carboxylase
Fatty acid synthesis
Malic enzyme
Fatty acid synthesis (NADPH)
ATP-citrate lyase
Fatty acid synthesis (provides acetyl-GoA)
Fatty acid synthase complex
Fatty acid synthesis
Stearoyl-GoA dehydrogenase
Fatty acid desaturation
Acyl-GoA-glycerol transferases
Triacylglycerol synthesis
Decreased expression PEP carboxykinase
Gluconeogenesis
Glucose 6-phosphatase (catalytic subunit)
Glucose release to blood
expression of the genes for two enzymes of gluconeoge nesis: PEP carboxykinase and glucose 6-phosphatase (Table 1 5-5) . One transcription factor important to carbohydrate metabolism is ChREBP (carbohydrate response ele ment binding protein; Fig. 15-21) , which is expressed primarily in liver, adipose tissue, and kidney. It serves to coordinate the synthesis of enzymes needed for carbohy drate and fat synthesis. ChREBP in its inactive state is phosphorylated, and is located in the cytosol. When the phosphoprotein phosphatase PP2A (Fig. 1 5-18) removes a phosphoryl group from ChREBP, the transcription fac tor can enter the nucleus. Here, nuclear PP2A removes another phosphoryl group, and ChREBP now joins with a partner protein, Mlx, and turns on the synthesis of several enzymes: pyruvate kinase, fatty acid synthase , and acetyl-GoA carboxylase, the first enzyme in the path to fatty acid synthesis (Fig. 1 5-2 1 ) .
FIGURE 1 5-21 Mechanism of gene regulation by the transcription factor ChREBP. When ChREB P in the cytosol of a hepatocyte is phos
phorylated on a Ser and a Thr residue, it cannot enter the nucleus. De phosphorylation of (E)- Ser by protei n phosphatase PP2A al lows ChREBP to enter the nucleus, where a second dephosphorylation, of (E)-Th r, activates ChREBP so that it can associate with its partner protein, Mix. ChREBP-Mix now binds to the carbohydrate response element (ChoRE) in the promoter and stimulates transcription. PP2A is allosterically activated by xylulose 5-phosphate, an intermediate in the pentose phosphate pathway.
�
/ GLlYf2
Glucose
/
Plasma membrane
Cytosol
Glucose
hexokma. • I\' ' gluc1'kinase
Glucose 6-phosphate
� �
J
Xyl lose 5-phosphate
l, _
Xylulose
4 �
@
PP2A�
P,
�
Nucleus
l s 92 1
P r i n c i p les of Metabo l i c Regu lation
Controlling the activity of PP2A-and thus, ultimately, the synthesis of this group of metabolic enzymes-is xylu lose 5-phosphate, an intermediate not of glycolysis or glu coneogenesis but of the pentose phosphate pathway. When blood glucose concentration is high, glucose enters the liver and is phosphorylated by hexokinase N. The glu cose 6-phosphate thus formed can enter either the gly colytic pathway or the pentose phosphate pathway. If the latter, two initial oxidations produce xylulose 5-phosphate, which serves as a signal that the glucose-utilizing pathways are well-supplied with substrate. It accomplishes this by al losterically activating PP2A, which then dephosphorylates ChREBP, allowing the transcription factor to turn on the ex pression of genes for enzymes of glycolysis and fat synthe sis (Fig. 1 5--2 1 ) . Glycolysis yields pyruvate, and conversion of pyruvate to acetyl-GoA provides the starting material for fatty acid synthesis: acetyl-GoA carboxylase converts acetyl-GoA to malonyl-GoA, the first committed intermedi ate in the path to fatty acids. The fatty acid synthase com plex produces fatty acids for export to adipose tissue and storage as triacylglycerols (Chapter 21) . In this way, excess dietmy carbohydrate is stored as fat. Another transcription factor in the liver, SREBP lc, a member of the family of sterol response ele ment binding proteins (see Fig. 2 1-43) , turns on the synthesis of pyruvate kinase, hexokinase IV, lipoprotein lipase, acetyl-GoA carboxylase, and the fatty acid syn thase complex that will convert acetyl-GoA (produced from pyruvate) into fatty acids for storage in adipocytes. The synthesis of SREBC-1 c is stimulated by insulin and depressed by glucagon. SREBP- l c also suppresses the expression of several gluconeogenic enzymes: glucose 6-phosphatase, PEP carboxykinase, and FBPase-1 . The transcription factor CREB (cyclic AMP re sponse element binding protein) turns on the syn thesis of glucose 6-phosphatase and PEP carboxykinase in response to the increase in [cAMP] triggered by glucagon. In contrast, insulin-stimulated inactivation of other transcription factors turns off several gluco neogenic enzymes in the liver: PEP carboxykinase , fruc tose 1 ,6-bisphosphatase, the glucose 6-phosphate transporter of the endoplasmic reticulum, and glucose 6-phosphatase . For example , FOXOl (forkhead box other) stimulates the synthesis of gluconeogenic en zymes and suppresses the synthesis of the enzymes of glycolysis, the pentose phosphate pathway, and triacyl glycerol synthesis (Fig. 15-2 2 ). In its unphosphory lated form, FOXOl acts as a nuclear transcription factor. In response to insulin, FOX01 leaves the nucleus and in the cytosol is phosphorylated by PKB, then tagged with ubiquitin and degraded by the proteasome. Glucagon prevents this phosphorylation by PKB, and FOX01 re mains active in the nucleus . Complicated though the processes outlined above may seem, regulation of the genes encoding enzymes of carbohydrate and fat metabolism is proving far more complex and more subtle than we have shown here.
"
Insulin
Plasma / membrane
B_
DNA � mRNA 'PEP carboxykmase Glucose 6-phosphatase
FICiURE 1 5-22 Mechanism of gene regulation by the transcription factor FOXO l . Insu l i n activates the signa l i ng cascade shown in Figure
1 2-1 6, leading to activation of protein k inase B (PKB). FOX01 in the cytosol is phosphorylated by PKB, and the phosphorylated transcrip tion factor is tagged by the attachment of ubiquitin for degradation by proteasomes. FOX01 that remains unphosphorylated or is dephospho rylated can enter the nucleus, bind to a response element, and trigger transcription of the associated genes. Insu l i n therefore has the effect of turn i ng off the expression of these genes, which include PEP carboxy kinase and glucose &-phosphatase.
Multiple transcription factors can act on the same gene promoter; multiple protein kinases and phosphatases can activate or inactivate these transcription factors; and a variety of protein accessory factors modulate the action of the transcription factors. This complexity is apparent, for example, in the gene encoding PEP car boxykinase, a very well-studied case of transcriptional control. Its promoter region (Fig. 15-2 3 ) has 1 5 or more response elements that are recognized by at least a dozen known transcription factors, with more likely to be discovered. The transcription factors act in combina tion on this promoter region, and on hundreds of other gene promoters, to fine-tune the levels of hundreds of metabolic enzymes, coordinating their activity in the metabolism of carbohydrates and fats. The critical im portance of transcription factors in metabolic regulation is made clear by observing the effects of mutations in their genes. For example, at least five different types of maturity-onset diabetes of the young (MODY) are asso ciated with mutations in specific transcription factors (Box 1 5-3) .
15.3 Coord i n ated Regulation of G l ycolysis a n d G l ucon eogenesis
SREBP-1
[s93]
HNF-1
-1500 Transcription factors
FOX01 PPAR'Y2 HNF-3,3 SREBP-1 HNF-4a COUP-TF RAR
GR T3R C/EBP HNF-1 NF1 ATF3 CREB NFKB TBP Med. TFIIH
forkhead box other 1 peroxisome proliferator-activated receptor "(2 hepatic nuclear factor-3,3 sterol regulatory element binding protein-1 hepatic nuclear factor-4a chicken ovalbumin upstream promoter-transcription factor retinoic acid receptor glucocorticoid receptor thyroid hormone receptor CAAT/enhance binding protein hepatic nuclear factor-1 nuclear factor 1 activating transcription factor 3 cAMP regulatory element binding protein nuclear factor KB TATA-box binding protein mediator transcription factor IIH
Response elements and regulatory binding sites in promoter
dAF2 dAF1 SRE AF1 AF2 GRE TRE CRE
FIGURE 1 5-23 The PEP carboxykinase promoter region, showing the complexity of regulatory input to this gene. This diagram shows the tran
scription factors (smaller icons, bound to the DNA) known to regulate the transcription of the PEP carboxykinase gene. The extent to which this gene is expressed depends on the combined input affecting all of these
BOX 1 5 - 3
distal accessory factor 2 distal accessory factor 1 sterol regulatory element accessory factor 1 accessory factor 2 glucocorticoid regulatory element thyroid hormone regulatory element cAMP regulatory element
factors, which can reflect the avai lability of nutrients, blood glucose level, and other factors that go into making up the cell's need for this enzyme at this particular time. Pl , P2, P3 1, P3 11, and P4 are protein binding sites identified by DNase I footprinting (see Box 26-1 ) . The TATA box is the as sembly point for the RNA polymerase II (Pol II) transcription complex.
G enet i c M utations That Lea d to R a re F o r m s of D i ab etes
The term "diabetes" describes a variety of medical con ditions that have in common an excessive production of urine . In Box 1 1-2 we described diabetes insipidus, in which defective water reabsorption in the kidney results from a mutation in the gene for aquaporin. "Diabetes mellitus" refers specifically to disease in which the abil ity to metabolize glucose is defective, due either to the failure of the pancreas to produce insulin or to tissue re sistance to the actions of insulin. There are two common types of diabetes mellitus. Type 1 , also called insulin-dependent diabetes mellitus (IDDM) , is caused by autoimmune attack on the insulin producing f3 cells of the pancreas. Individuals with IDDM must take insulin by injection or inhalation to compensate for their missing f3 cells. IDDM develops in childhood or in the teen years; an older name for the disease is juvenile diabetes. Type 2 , also called non insulin-dependent diabetes mellitus (NIDDM) , typically develops in adults over 40 years old. It is far more com mon than IDDM, and its occurrence in the population is strongly correlated with obesity. The current epidemic
of obesity in the more developed countries brings with it the promise of an epidemic of NIDDM, providing a strong incentive to understand the relationship between obesity and the onset of NIDDM at the genetic and bio chemical levels. After completing our look at the metab olism of fats and proteins in later chapters, we will return (in Chapter 23) to the discussion of diabetes, which has a broad effect on metabolism: of carbohy drates, fats, and proteins . Here we consider another type of diabetes in which carbohydrate and fat metabolism is deranged: mature onset diabetes of the young (MODY) , in which genetic mutation affects a transcription factor important in car rying the insulin signal into the nucleus, or affects an en zyme that responds to insulin. In MODY2, a mutation in the hexokinase IV (glucokinase) gene affects the liver and pancreas, tissues in which this is the main isoform of hexokinase. The glucokinase of pancreatic f3 cells func tions as a glucose sensor. Normally, when blood glucose ( continued on next p age)
[s 94]
Principles of Meta b o l i c Regu lation
BOX 1 S - 3
Genetic M u tations That Lead to Ra re F o r m s of D i a betes
(continued from revious po e)
� L� -----� --------
rises, so does the glucose level in (3 cells, and because glucokinase has a relatively high Km for glucose, its ac tivity increases with rising blood glucose levels. Metabo lism of the glucose 6-phosphate formed in this reaction raises the ATP level in (3 cells, and this triggers insulin release by the mechanism shown in Figure 23-28. In healthy individuals, blood glucose concentrations of - 5 m M trigger this insulin release. But individuals with inac tivating mutations in both copies of the glucokinase gene have very high thresholds for insulin release , and consequently, from birth, they have severe hyper glycemia-permanent neonatal diabetes. In individuals with one mutated and one normal copy of the glucoki nase gene, the glucose threshold for insulin release rises to about 7 mM. As a result these individuals have blood glucose levels only slightly above normal: they generally have only mild hyperglycemia and no symptoms. This
S U M M A RY 1 5 . 3
•
•
•
•
•
•
•
condition (MODY2) is generally discovered by accident during routine blood glucose analysis. There are at least five other types of MODY, each the result of an inactivating mutation in one or another of the transcription factors essential to the normal de velopment and function of pancreatic (3 cells. Individu als with these mutations have varying degrees of reduced insulin production and the associated defects in blood glucose homeostasis. In MODY1 and MODY3, the defects are severe enough to produce the long-term complications associated with IDDM and NIDDM cardiovascular problems, kidney failure, and blindness. MODY4, 5, and 6 are less severe forms of the disease. Al together, MODY disorders represent a small percentage of NIDDM cases. Also very rare are individuals with mu tations in the insulin gene itself; they have defects in insulin signaling of varying severity.
Coo r d in ate d Regulation of G lycolysis an d G l u con eogen esis
Gluconeogenesis and glycolysis share seven enzymes, catalyzing the freely reversible reactions of the pathways . For the other three steps, the forward and reverse reactions are catalyzed by different enzymes, and these are the points of regulation of the two pathways . Hexokinase IV (glucokinase) has kinetic properties related to its special role in the liver: releasing glucose to the blood when blood glucose is low, and taking up and metabolizing glucose when blood glucose is high. PFK- 1 is allosterically inhibited by ATP and citrate. In most mammalian tissues , including liver, fructose 2 ,6-bisphosphate is an allosteric activator of this enzyme. Pyruvate kinase is allosterically inhibited by ATP, and the liver isozyme also is inhibited by cAMP-dependent phosphorylation. Gluconeogenesis is regulated at the level of pyruvate carboxylase (which is activated by acetyl-GoA) and FBPase-1 (which is inhibited by fructose 2 ,6-bisphosphate and AMP) . To limit substrate cycling between glycolysis and gluconeogenesis, the two pathways are under reciprocal allosteric control, mainly achieved by the opposing effects of fructose 2 ,6-bisphosphate on PFK-1 and FBPase- 1 . Glucagon or epinephrine decreases [fructose 2 ,6-bisphosphate] , by raising [cAMP] and bringing
about phosphorylation of the bifunctional enzyme PFK-2/FBPase-2. Insulin increases [fructose 2 ,6-bisphosphate] by activating a phosphoprotein phosphatase that dephosphorylates and thus activates PFK-2. •
•
Xylulose 5-phosphate, an intermediate of the pentose phosphate pathway, activates phosphoprotein phosphatase PP2A, which dephosphorylates several target proteins, including PFK-2/FBPase-2, tilting the balance toward glucose uptake, glycogen synthesis, and lipid synthesis in the liver. Transcription factors including ChREBP, CREB , SREBP, and FOX01 act i n the nucleus t o regulate the expression of specific genes coding for enzymes of the glycolytic and gluconeogenic pathways. Insulin and glucagon act antagonistically in activating these transcription factors, thus turning on and off large numbers of genes.
15.4 The Metabolism of Gl ycogen in Animals Our discussion of metabolic regulation, using carbohy drate metabolism as the primary example, now turns to the synthesis and breakdown of glycogen. In this section we focus on the metabolic pathways; in Section 1 5.5 we turn to the regulatory mechanisms. In organisms from bacteria to plants to vertebrates, excess glucose is converted to polymeric forms for stor age-glycogen in vertebrates and many microorganisms, starch in plants. In vertebrates, glycogen is found primarily in the liver and skeletal muscle; it may represent up to 10% of the weight of liver and 1% to 2% of the weight of muscle. If this much glucose were dissolved in the cytosol of a he patocyte, its concentration would be about 0.4 M, enough
15.4 The Meta bolism of G l ycogen in A n i m a l s
FIGURE 1 5-24 Glycogen granules in a hepatocyte. Glycogen, a stor age form of carbohydrate, appears as electron-dense particles, often in aggregates or rosettes. In hepatocytes glycogen is closely associated with tubules of the smooth endoplasmic reticu lum. Many mitochondria are also evident in this micrograph.
to dominate the osmotic properties of the cell. When stored as a large polymer (glycogen), however, the same mass of glucose has a concentration of only 0.01 JLM. Glyco gen is stored in large cytosolic granules. The elementary particle of glycogen, the ,8-particle, is about 21 nm in diam eter and consists of up to 55,000 glucose residues with about 2,000 nonreducing ends. Twenty to 40 of these par ticles cluster together to form a-rosettes, easily seen with the microscope in tissue samples from well-fed animals (Fig. 1 5-24) but essentially absent after a 24-hour fast. The glycogen in muscle is there to provide a quick source of energy for either aerobic or anaerobic metab olism. Muscle glycogen can be exhausted in less than an hour during vigorous activity. Liver glycogen serves as a reservoir of glucose for other tissues when dietary glu cose is not available (between meals or during a fast);
[s9s]
this is especially important for the neurons of the brain, which cannot use fatty acids as fuel. Liver glycogen can be depleted in 12 to 24 hours. In humans, the total amount of energy stored as glycogen is far less than the amount stored as fat (triacylglycerol) (see Table 23-5) , but fats cannot be converted to glucose in mammals and cannot be catabolized anaerobically. Glycogen granules are complex aggregates of glyco gen and the enzymes that synthesize it and degrade it, as well as the machinery for regulating these enzymes. The general mechanisms for storing and mobilizing glycogen are the same in muscle and liver, but the enzymes differ in subtle yet important ways that reflect the different roles of glycogen in the two tissues. Glycogen is also ob tained in the diet and broken down in the gut, and this in volves a separate set of hydrolytic enzymes that convert glycogen to free glucose. (Dietary starch is hydrolyzed in a similar way.) We begin our discussion with the break down of glycogen to glucose 1-phosphate (glycogenoly sis), then turn to synthesis of glycogen (glycogenesis). Glycogen Breakdown Is Catalyzed by Glycogen Phosphorylase
In skeletal muscle and liver, the glucose units of the outer branches of glycogen enter the glycolytic pathway through the action of three enzymes: glycogen phospho rylase, glycogen debranching enzyme, and phosphoglu comutase. Glycogen phosphorylase catalyzes the reaction in which an (a1�4) glycosidic linkage between two glu cose residues at a nonreducing end of glycogen under goes attack by inorganic phosphate (PD, removing the terminal glucose residue as a-n-glucose 1-phosphate (Fig. 1 5-25 ). This phosphorolysis reaction is different from the hydrolysis of glycosidic bonds by amylase dur ing intestinal degradation of dietary glycogen and starch. In phosphorolysis, some of the energy of the glycosidic
Nonreducing end
0-
p. 1
"'I1
H g· pl
OH Glycogen chain (glucose)n
g lH Hnching t• l lZJlllt-'
� Glucose
Unbranched (al-+4) polymer; substrate for further phosphorylase action
FIGURE 1 5-26 Glycogen breakdown near an (al -76) branch point.
Following sequential removal of terminal gl ucose residues by glycogen phosphorylase (see Fig. 1 5-25), glucose residues near a branch are re moved in a two-step process that requires a bifunctional debranching enzyme. First, the transferase activity of the enzyme shifts a block of three glucose residues from the branch to a nearby nonreducing end, to which they are reattached in (al -74) l i n kage. The single glucose residue rema i n i ng at the branch point, in (al -76) l i nkage, is then re leased as free glucose by the debranching enzyme's (al -76) glucosi dase activity. The gl ucose residues are shown i n shorthand form, which omits the --H, --OH, and -CH20H groups from the pyranose rings.
Because muscle and adipose tissue lack glucose 6phosphatase, they cannot convert the glucose 6-phos phate formed by glycogen breakdown to glucose, and these tissues therefore do not contribute glucose to the blood. The Sugar Nucleotide UDP-Giucose Donates Glucose for Glycogen Synthesis
Many of the reactions in which hexoses are transformed or polymerized involve sugar nucleotides, compounds in which the anomeric carbon of a sugar is activated by attachment to a nucleotide through a phosphate ester linkage. Sugar nucleotides are the substrates for polymer ization of monosaccharides into disaccharides, glycogen,
15.4 The Metabolism of G l ycogen in A n i m a l s
BOCHo r� yrO OH H H � H HO o-
FIGURE 1 5-27 Reaction catalyzed by phosphoglucomutase.
The reaction begins with the enzyme phosphorylated on a Ser residue. In step (]). the enzyme donates its phosphoryl group (green) to glucose 1 -phosphate, producing glucose 1 ,6-bisphos phate. In step @, the phosphoryl group at C-1 of glucose 1 ,6bisphosphate (red) is transferred back to the enzyme, re-formi ng the phosphoenzyme and producing glucose 6-phosphate.
r
0 - -o-
HO
'--
Glucose 1 -phosphate
0 II
H HO
-
@oH
- P-o-
6-
Glucose 1,6-bisphosphate
[s97]
0
II
-o-P-O -- CB2
6-
�0
Ji-ft H HO
Glucose 6-phosphate
Glucose 6-phosphatase
G6P G6P transporter
(T1)
t
ER lumen
I
G6P
P,
FIGURE 15-28 Hydrolysis of glu
Plasma membrane
Cytosol
Glucose transporter (T2)
-::-----> P1
-
\
cose 6-phosphate by glucose 6-
Capillary
l
GLUT2
P; transporter (T3) Increased blood glucose concentration
phosphatase of the ER. The catalytic site of glucose 6-phosphatase faces the lumen of the ER. A glucose 6phosphate (G6P) transporter (Tl ) carries the substrate from the cy tosol to the lumen, and the prod ucts glucose and P, pass to the cytosol on specific transporters (T2 and T3). G lucose leaves the cel l via the G LUT2 transporter in the plasma membrane.
CR20H 0
o- Glucosyl group
Luis Lelo i r, 1 906-1 987
starch, cellulose, and more com plex extracellular polysaccharides. They are also key intermediates in the production of the aminohex oses and deoxyhexoses found in some of these polysaccharides, and in the synthesis of vitamin C (1-ascorbic acid) . The role of sugar nucleotides in the biosyn thesis of glycogen and many other carbohydrate derivatives was dis covered in 1 953 by the Argentine biochemist Luis Leloir.
H
Uridine
HO ?
�
-o-P-O-P-o-
1
0
I
O- C H2
UDP-glucose (a sugar nucleotide)
[s98]
P r i n c i ples of Meta b o l i c Reg u l ation
B OX 1 5 -4
Much of what is written in present-day biochemistry text books about the metabolism of glycogen was discovered between about 1 925 and 1 950 by the remarkable husband and wife team of Carl F. Cori and Gerty T. Cori. Both trained in medicine in Europe at the end of World War I (she completed premedical studies and medical school in one year!) . They left Europe together in 1922 to establish research laboratories in the United States, first for nine years in Buffalo, New York, at what is now the Roswell Park Memorial Institute, then from 1931 until the end of their lives at Washington University in St. Louis. In their early physiological studies of the origin and fate of glycogen in animal muscle , the Goris
The Caris i n Gerty Cori's laboratory, around 1 947.
The suitability of sugar nucleotides for biosynthetic reactions stems from several properties : 1.
Their formation is metabolically irreversible, contributing to the irreversibility of the synthetic pathways in which they are intermediates. The condensation of a nucleoside triphosphate with a hexose ! -phosphate to form a sugar nucleotide has a small positive free-energy change , but the reaction releases PPi, which is rapidly hydrolyzed by inorganic pyrophosphatase (Fig. 15-29), in a reaction that is strongly exergonic (�G '0 - 19.2 kJ/mol) . This keeps the cellular concentration of PPi low, ensuring that the =
demonstrated the conversion of glycogen to lactate in tissues, movement of lactate in the blood to the liver, and, in the liver, reconversion of lactate to glycogen a pathway that came to be known as the Cori cycle (see Fig. 23-20) . Pursuing these observations at the bio chemical level, they showed that glycogen was mobi lized in a phosphorolysis reaction catalyzed by the enzyme they discovered, glycogen phosphorylase. They identified the product of this reaction (the "Cori ester") as glucose 1 -phosphate and showed that it could be reincorporated into glycogen in the reverse reaction. Although this did not prove to be the reaction by which glycogen is synthesized in cells, it was the first in vitro demonstration of the synthesis of a macro molecule from simple monomeric subunits, and it in spired others to search for polymerizing enzymes. Arthur Kornberg, discoverer of the first DNA poly merase, said of his experience in the Goris' lab, "Glyco gen phosphorylase , not base pairing, was what led me to DNA polymerase." Gerty Cori became interested in human genetic diseases in which too much glycogen is stored in the liver. She was able to identify the biochemical defect in several of these diseases and to show that the diseases could be diagnosed by assays of the en zymes of glycogen metabolism in small samples of tis sue obtained by biopsy. Table 1 summarizes what we now know about 13 genetic diseases of this sort. • Carl and Gerty Cori shared the Nobel Prize in Phys iology or Medicine in 1 94 7 with Bernardo Houssay of Ar gentina, who was cited for his studies of hormonal regulation of carbohydrate metabolism. The Cori labora tories in St. Louis became an international center of bio chemical research in the 1 940s and 1 950s, and at least six scientists who trained with the Goris became Nobel laureates: Arthur Kornberg (for DNA synthesis, 1 959) , Severo Ochoa (for RNA synthesis , 1959) , Luis Leloir (for the role of sugar nucleotides in polysaccharide syn thesis, 1 970) , Earl Sutherland (for the discovery of
actual free-energy change in the cell is favorable. In effect, rapid removal of the product, driven by the large, negative free-energy change of PPi hydrolysis, pulls the synthetic reaction forward, a common strategy in biological polymerization reactions. 2 . Although the chemical transformations o f sugar nucleotides do not involve the atoms of the nucleotide itself, the nucleotide moiety has many groups that can undergo noncovalent interactions with enzymes; the additional free energy of binding can contribute significantly to catalytic activity (Chapter 6; see also p . 297) .
15.4 The Meta bo l i s m of G l ycogen i n A n i m a l s
cAMP in the regulation of carbohydrate metabolism, 1971) , Christian de Duve (for subcellular fractionation,
[:;9
D-glucose 6-phosphate + ADP
Glucose 6-phosphate � glucose 1-phosphate
[6oo]
Principles of Meta bolic Regulation
FIGURE 1 5-29 Formation of a sugar nucleotide. A con densation reaction occurs between a nucleoside triphos phate (NTP) and a sugar phosphate. The negatively charged oxygen on the sugar phosphate serves as a nucle oph i le, attack i ng the a phosphate of the nucleoside triphosphate and displacing pyrophosphate. The reaction is pulled in the forward di rection by the hydrolysis of PP, by i norganic pyrophosphatase.
� 0 0 II / '11 ·�� · � II lsugar �O-P-0- + 0-P-0 P 0-P-O�llibose HBase l i0 I I I I oo o oSugar phosphate
NTP
�I
NDP·>- ugar
p)TOpho;phoJ-yl as
0 0 II II l sugar � O-P-0-P-O �llibose H Base l I I ao-
0 0 II II 0-P--0-P-0 6
te l
6
sugar nucleotide (NDP-sugar)
Pyrophosphate (PP;) inorg
pyrophosphal
2
e
0 I -o-P-OH I
-o Phosphate (P;)
Net reaction: Sugar phosphate + NTP
+
UTP
�
NDP-sugar + 2P;
glucose formation, because pyrophosphate is rapidly hy drolyzed by inorganic pyrophosphatase (Fig. 1 5-29) . UDP-glucose is the immediate donor of glucose residues in the reaction catalyzed by glycogen syn thase, which promotes the transfer of the glucose residue from UDP-glucose to a nonreducing end of a branched glycogen molecule (Fig. 15-30). The overall
The product of this reaction is converted to UDP-glucose by the action of UDP-glucose pyrophosphorylase, in a key step of glycogen biosynthesis:
Glucose 1-phosphate
�
UDP-glucose + PP;
Notice that this enzyme is named for the reverse reaction; in the cell, the reaction proceeds in the direction of UDP-
6CH20H 15 0 H H H ��� H�
FIGURE 1 5-30 Glycogen synthesis. A glycogen chain is elongated by glycogen synthase. The enzyme transfers the glucose residue of UDP glucose to the nonreducing end of a glycogen branch (see Fig. 7-1 4) to make a new (al --?4) l inkage.
H HO
0 II -o-P-0-P-0 II I 0 O-CH2
-o
C'H 0 11
-- n . u 11
. , �·
UDP-glucose
OH
H
0
OH
Nonreducing end of a glycogen chain with n residues
(n > 4)
�Q H H HI 4� OH H / 1 HO ""'--/ -<J C H ., OH
New nonreducing end
H
OH
L H .on
< H 01 1
�I
ll
II
-I
I H Elongated glycogen with n + 1 residues
H
J
-1
H
�· II
{ 1r
�
{l
II
<JJ I
4�•1 H
II
H
0
15.4 The Meta bolism of G l ycogen in A n i m a l s
Nonreducing end
(al�4)
Nonreducing end
�hn �
u
Tt t·.u th.Jtl� tlJl' lUL
O_ iJL iJLJ(:t U U
.,
,
,
,
Nonreducing end
,
,
_q
[601]
(aH6) B"n" ,run,
.U,JCLUb
FIGURE 1 5-31 Branch synthesis in glycogen. The glycogen-branching enzyme (also called amylo (1 �4) to (1 �6) transglycosylase, or glycosyl-(4�6)-transferase) forms a new branch point during glycogen synthesis.
equilibrium of the path from glucose 6-phosphate to glycogen lengthened by one glucose unit greatly favors synthesis of glycogen. Glycogen synthase cannot make the (a1�6) bonds found at the branch points of glycogen; these are formed by the glycogen-branching enzyme, also called amylo ( 1�4) to ( 1�6) transglycosylase , or glyco syl-(4�6) -transferase. The glycogen-branching en zyme catalyzes transfer of a terminal fragment of 6 or 7 glucose residues from the nonreducing end of a glyco gen branch having at least 1 1 residues to the C-6 hy droxyl group of a glucose residue at a more interior position of the same or another glycogen chain, thus creating a new branch (Fig. 15-3 1 ) . Further glucose residues may be added to the new branch by glycogen synthase. The biological effect of branching is to make the glycogen molecule more soluble and to increase the number of nonreducing ends. This increases the num ber of sites accessible to glycogen phosphorylase and glycogen synthase, both of which act only at nonreduc ing ends. Glycogen in Primes the I nitial S ugar Residues in Glycogen
Glycogen synthase cannot initiate a new glycogen chain de novo. It requires a primer, usually a pre formed (a 1 �4) polyglucose chain or branch having at least eight glucose residues. So, how is a new glycogen molecule initiated? The intriguing protein glycogenin (Fig. 1 5-3 2 ) is both the primer on which new chains are assembled and the enzyme that catalyzes their as sembly. The first step in the synthesis of a new glyco gen molecule is the transfer of a glucose residue from UDP-glucose to the hydroxyl group of Tyr 194 of glyco genin, catalyzed by the protein's intrinsic glucosyl transferase activity (Fig. 1 5-33 ) . The nascent chain is extended by the sequential addition of seven more
glucose residues, each derived from UDP-glucose; the reactions are catalyzed by the chain-extending activity of glycogenin. At this point, glycogen synthase takes over, further extending the glycogen chain. Glycogenin remains buried within the f3-particle, covalently at tached to the single reducing end of the glycogen mol ecule (Fig. 1 5-33b).
FIGURE 1 5-32 Glycogenin structure. (PDB 1 D 1 LL2) Muscle glyco gen in (M, 3 7,000) forms dimers in solution. Humans have a second isoform in liver, glycogenin-2 . The substrate, U DP-glucose (shown as a red bal l-and-stick structure), is bound to a Rossmann fold near the amino terminus and is some distance from the Tyr1 94 residues (turquoise)-1 5 A from the Tyr in the same monomer, 1 2 A from the Tyr in the dimeric partner. Each U DP-glucose is bound through its phos phates to a Mn2 + ion (green) that is essential to catalysis. Mn2 + is be lieved to function as an electron-pair acceptor (Lewis acid) to stabi l ize the leaving group, U DP. The glycosidic bond in the product has the same configuration about the C-1 of glucose as the substrate U DP-glu cose, suggesting that the transfer of gl ucose from U DP to Tyr1 94 occurs in two steps. The first step is probably a nucleophilic attack by Asp162 (orange), forming a temporary intermediate with inverted configura tion. A second nucleophilic attack by Tyr1 94 then restores the starting configuration.
[6o2]
Principles of Meta bolic Regulation
(a)
(b)
Each chain has 12 to 14 glucose residues
H HO 0 II UDP-glucose -o-P-O-P-o 11
0
I
0
-
I
I Ribose H Uracil !
UDP-glucose
CH20H 0 H
HO
R
f
H HO 0 DP-gluco e II -o-P-O-P-oI 11 0 0� tendul
Repeats six times
•
•
•
The Metabol i s m of G l ycogen i n A n i m als
Glycogen is stored in muscle and liver as large particles. Contained within the particles are the enzymes that metabolize glycogen, as well as regulatory enzymes. Glycogen phosphorylase catalyzes phosphorolytic cleavage at the nonreducing ends of glycogen chains , producing glucose 1 -phosphate. The debranching enzyme transfers branches onto main chains and releases the residue at the (a 1 �6) branch as free glucose. Phosphoglucomutase interconverts glucose 1 -phosphate and glucose 6-phosphate. Glucose 6-phosphate can enter glycolysis or, in liver, can be converted to free glucose by glucose 6-phosphatase in the endoplasmic reticulum, then released to replenish blood glucose.
glycogenin
- primer
H HO
H H 0
S U M M A RY 1 5 .4
G
second tier
third tier fourth tier outer tier (unbranched)
FIGURE 1 5-33 Glycogen in and the structure of the glycogen particle.
Glycogeni n catalyzes two distinct reactions. Initial attack by the hy droxyl group of Tyr194 on C-1 of the glucosyl moiety of U DP-glucose results in a glucosylated Tyr residue. The C-1 of another U DP-glucose molecule is now attacked by the C-4 hydroxyl group of the terminal glucose, and this sequence repeats to form a nascent glycogen mole cule of eight gl ucose residues attached by (a1 �4) glycosidic l i nkages. (b) Structure of the glycogen particle. Starting at a central glycogen in molecule, glycogen chains (1 2 to 1 4 residues) extend in tiers. Inner chains have two (a1 �6) branches each. Chains in the outer tier are un branched. There are 1 2 tiers in a mature glycogen particle (only 5 are shown here), consisting of about 55,000 glucose residues in a mole cule of about 21 nm diameter and M, -1 X 1 07 . (a)
•
•
The sugar nucleotide UDP-glucose donates glucose residues to the nonreducing end of glycogen in the reaction catalyzed by glycogen synthase. A separate branching enzyme produces the (al�6) linkages at branch points. New glycogen particles begin with the autocatalytic formation of a glycosidic bond between the glucose of UDP-glucose and a Tyr residue in the protein glycogenin, followed by addition of several glucose residues to form a primer that can be acted on by glycogen synthase.
1 5 .5 Coordinated Regulation of Glycogen Sy nthesis and Breakdown As we have seen, the mobilization of stored glycogen is brought about by glycogen phosphorylase, which de grades glycogen to glucose 1 -phosphate (Fig. 15-25) .
15.5 Coord i nated Regulation of G l ycogen Synthesis a n d Breakdown
Glycogen phosphorylase provides an especially instruc tive case of enzyme regulation. It was one of the first known examples of an allosterically regulated enzyme and the first enzyme shown to be controlled by reversible phosphorylation. It was also one of the first allosteric en zymes for which the detailed three-dimensional struc tures of the active and inactive forms were revealed by x-ray crystallographic studies. Glycogen phosphorylase is also another illustration of how isozymes play their tissue-specific roles. G lycogen Phosphorylase Is Regulated Allosterically and Hormonally
In the late 1 930s, Carl and Gerty Cori (Box 15-4) discov ered that the glycogen phos phorylase of skeletal muscle exists in two interconvertible forms: glycogen phosphory lase a, which is catalytically active, and glycogen phos phorylase b, which is less ac tive (Fig. 1 5-34). Subsequent studies by Earl Sutherland Earl W. Sutherland, Jr., showed that phosphorylase b 1 9 1 5-1 974 predominates in resting muscle, but during vigorous mus cular activity epinephrine triggers phosphorylation of a specific Ser residue in phosphorylase b, converting it to its more active form, phosphorylase a. (Note that glyco gen phosphorylase is often referred to simply as phosphorylase-so honored because it was the first phosphorylase to be discovered; the shortened name has persisted in common usage and in the literature.) The enzyme (phosphorylase b kinase) responsi ble for activating phosphorylase by transferring a phos phoryl group to its Ser residue is itself activated by Ser1 4 side chain
OH
OH
I
I
C H2
Phosphorylase b (less act e)
I
Q H2
Ser 14 side chain
t
pho:-- pho1 yla:--t·
ph1l!"ph;lla!"l' a
PPl
2Pt
2ATP
2H20
2ADP
epinephrine,
',t[Ca2+], tlAMPJ (muscle)
®
[6o3]
epinephrine or glucagon through a series of steps shown in Figure 15-35 . Sutherland discovered the second messenger cAMP, which increases in concentration in response to stimulation by epinephrine (in muscle) or glucagon (in liver) . Elevated [cAMP] initiates an en zyme cascade, in which a catalyst activates a catalyst, which activates a catalyst (see Section 1 2 . 1 ) . Such cas cades allow for large amplification of the initial signal (see pink boxes in Fig. 1 5-35) . The rise in [cAMP] acti vates cAMP-dependent protein kinase, also called pro tein kinase A (PKA) . PKA then phosphorylates and activates phosphorylase b kinase, which catalyzes the phosphorylation of Ser residues in each of the two iden tical subunits of glycogen phosphorylase, activating it and thus stimulating glycogen breakdown. In muscle, this provides fuel for glycolysis to sustain muscle con traction for the fight-or-flight response signaled by epi nephrine. In liver, glycogen breakdown counters the low blood glucose signaled by glucagon, releasing glucose. These different roles are reflected in subtle differences in the regulatory mechanisms in muscle and liver. The glycogen phosphorylases of liver and muscle are isozymes, encoded by different genes and differing in their regulatory properties. In muscle, superimposed on the regulation of phos phorylase by covalent modification are two allosteric control mechanisms (Fig. 1 5-35) . Ca2+ , the signal for muscle contraction, binds to and activates phosphory lase b kinase, promoting conversion of phosphorylase b to the active a form. Ca2 + binds to phosphorylase b kinase through its 8 subunit, which is calmodulin (see Fig. 1 2-1 1 ) . AMP, which accumulates in vigorously con tracting muscle as a result of ATP breakdown, binds to and activates phosphorylase, speeding the release of glucose ! -phosphate from glycogen. When ATP levels are adequate, ATP blocks the allosteric site to which AMP binds, inactivating phosphorylase. When the muscle returns to rest, a second enzyme, phosphorylase a phosphatase , also called phospho protein phosphatase 1 (PP 1 ) , removes the phospho ryl groups from phosphorylase a, converting it to the less active form, phosphorylase b. Like the enzyme of muscle, the glycogen phos phorylase of liver is regulated hormonally (by phos phorylation/dephosphorylation) and allosterically. The dephosphorylated form is essentially inactive. When the blood glucose level is too low, glucagon (acting through the cascade mechanism shown in Fig. 1 5-35) activates
FIGURE 1 5-34 Regulation of muscle glycogen phosphorylase by cova lent modification. In the more active form of the enzyme, phosphory lase a, Ser 1 4 residues, one on each subunit, are phosphorylated. Phosphorylase a is converted to the less active form, phosphorylase b, by enzymatic loss of these phosphoryl groups, catalyzed by phospho rylase a phosphatase (also known as phosphoprotein phosphatase 1 , PP1 ) . Phosphorylase b can be reconverted (reactivated) to phosphory lase a by the action of phosphorylase b kinase. (See also Fig. 6-36 on glycogen phosphorylase regulation.)
[604]
Principles of Meta bolic Regulation
FIGURE 1 5-35 Cascade mechanism of epinephrine and
By binding to specific surface receptors, either epinephrine acting on a myocyte (left) or glucagon acting on a hepatocyte (right) activates a GTP-binding pro tein Gsa (see Fig. 1 2-4). Active Gsa triggers a rise in [cAMP], activating PKA. This sets off a cascade of phosphorylations; PKA activates phosphorylase b kinase, which then activates glycogen phosphorylase. Such cascades effect a large am pl ification of the i nitial signal; the figures in pink boxes are probably low estimates of the actual increase in number of molecules at each stage of the cascade. The resulting break down of glycogen provides glucose, which in the myocyte can supply ATP (via glycolysis) for muscle contraction and in the hepatocyte is released i nto the blood to counter the low blood glucose. glucagon action.
Myocyte
Epinephrine
6
I I �----
/
Inactive PKA
t [C a2•J - - - - - - - - - - - - - - - Inactive phosphorylase b k.ina e
� ,-
Active PKA .-------__-. I 1 0.x molecules )
____
---•)1 ,-
1
---•)1
t�� ----------------
\... )
Allosteric sites empty
lX���:�?.I���i�jJ
Active glycogen phosphorylase a
r· ··-···--· · · --·-··--·- -----·-··-·-
I
/
---
( active)
FIGURE 1 5-36 Glycogen phosphorylase of liver as a glucose sensor.
Glucose binding to an al losteric site of the phosphorylase a isozyme of l iver i nduces a conformational change that exposes its phosphorylated Ser residues to the action of phosphorylase a phosphatase (PP1 ). This
1
ll·�?-��-��1��nl,l\ ipids
Triacylglycerols and cholesteryl esters
FIGURE 1 7-2 Molecular structure of a chylomicron. The surface is a layer of phospholipids, with head groups facing the aqueous phase. Triacylglycerols sequestered in the i nterior (yellow) make up more than 80% of the mass. Several apolipoproteins that protrude from the sur face (B-48, C-111, C-1 1) act as signa ls in the uptake and metabolism of chylomicron contents. The diameter of chylomicrons ranges from about 1 00 to 500 nm.
[649]
them to muscle and adipose tissue (Fig. 1 7-1 , step @) . In the capillaries of these tissues, the extracellular enzyme lipoprotein lipase, activated by apoC-II, hydrolyzes triacylglycerols to fatty acids and glycerol (step @) , which are taken up by cells in the target tissues (step (7)) . In muscle, the fatty acids are oxidized for energy; in adipose tissue, they are reesterified for storage as tria cylglycerols (step @) . The remnants of chylomicrons, depleted o f most of their triacylglycerols but still containing cholesterol and apolipoproteins, travel in the blood to the liver, where they are taken up by endocytosis, mediated by recep tors for their apolipoproteins. Triacylglycerols that enter the liver by this route may be oxidized to provide energy or to provide precursors for the synthesis of ketone bod ies, as described in Section 1 7.3. When the diet contains more fatty acids than are needed immediately for fuel or as precursors , the liver converts them to triacylglyc erols, which are packaged with specific apolipoproteins into VLDLs. The VLDLs are transported in the blood to adipose tissues, where the triacylglycerols are removed and stored in lipid droplets within adipocytes. H ormones Trigger Mobilization of Stored Triacylglycerols
Neutral lipids are stored in adipocytes (and in steroid synthesizing cells of the adrenal cortex, ovary, and testes) in the form of lipid droplets, with a core of sterol esters and triacylglycerols surrounded by a monolayer of phos pholipids. The surface of these droplets is coated with perilipins, a family of proteins that restrict access to lipid droplets, preventing untimely lipid mobilization. When hormones signal the need for metabolic energy, triacyl glycerols stored in adipose tissue are mobilized (brought out of storage) and transported to tissues (skeletal mus cle, heart, and renal cortex) in which fatty acids can be ox idized for energy production. The hormones epinephrine and glucagon, secreted in response to low blood glucose levels, activate the enzyme adenylyl cyclase in the adipocyte plasma membrane (f'ig. 1 7-3 ), which produces the intracellular second messenger cyclic AMP (cAMP; see Fig. 12-4). Cyclic AMP-dependent protein kinase (PKA) phosphorylates perilipin A, and the phosphorylated per ilipin causes hormone-sensitive lipase in the cytosol to move to the lipid droplet surface, where it can begin hy drolyzing triacylglycerols to free fatty acids and glycerol. PKA also phosphorylates hormone-sensitive lipase, dou bling or ttipling its activity, but the more than 50-fold in crease in fat mobilization triggered by epinephrine is due primarily to perilipin phosphorylation. Cells with defective perilipin genes have almost no response to increases in cAMP concentration; their hormone-sensitive lipase does not associate with lipid droplets. As hormone-sensitive lipase hydrolyzes triacylglyc erol in adipocytes, the fatty acids thus released (free fatty acids, FFA) pass from the adipocyte into the blood, where they bind to the blood protein serum albumin.
l_6so]
Fatty Acid Cata b o l i s m
CH20H
Hormone
I
HO-C-H
I
Glycerol
CH20H gf� �: ·r •I kmu '
cAMP
+
�KA � � Y �..JP2
Perilipin .
p"'
.--® ---®
Hormonesen itive lipa e
.-
�� H rn
Lipid drople
(:l Qx;dauon, citric acid cycle, re.'ij>in,ltory cllain
L-Glycerol 3-phosphate gJ_·ro r"l �i phoHp . l ! o dch\-rlm� ·r. 1
ATP
Fatty acids
Triacylglycerol
ADP
Fatty acid transporter
® � P T
ATP
Adipocyte
Myocyte
trHN'
ploosphat�1l
Dihydroxyacetone phosphate
�mPra�e
Bloodstream
n-Glyceraldehyde 3-phosphate
FIGURE 1 7-3 Mobilization of triacylglycerols stored in adipose tissue.
When low levels of glucose in the blood trigger the release of glucagon,
G) the hormone binds its receptor in the adipocyte membrane and thus (I) stimulates adenylyl cyclase, via a G protein, to produce cAMP. This activates PKA, which phosphorylates @ the hormone-sensitive lipase and @ peri lipin molecules on the surface of the l ipid droplet. Phospho
rylation of perilipin permits hormone-sensitive lipase access to the sur face of the l ipid droplet, where � it hydrolyzes triacylglycerols to free fatty acids. @ Fatty acids leave the adipocyte, bind serum albumin in the blood, and are carried in the blood; they are released from the albu min and (!) enter a myocyte via a specific fatty acid transporter. ® In the myocyte, fatty acids are oxidized to C02, and the energy of oxida tion is conserved in ATP, which fuels muscle contraction and other en ergy-requiring metabolism in the myocyte.
This protein (Mr 66,000) , which makes up about half of the total serum protein, noncovalently binds as many as 1 0 fatty acids per protein monomer. Bound to this soluble protein, the otherwise insoluble fatty acids are carried to tissues such as skeletal muscle, heart, and renal cortex. In these target tissues, fatty acids dissociate from albumin and are moved by plasma membrane transporters into cells to serve as fuel. About 95% of the biologically available energy of tri acylglycerols resides in their three long-chain fatty acids; only 5% is contributed by the glycerol moiety. The glycerol released by lipase action is phosphorylated by glycerol kinase (Fig. 1 7-4) , and the resulting glycerol 3-phosphate is oxidized to dihydroxyacetone phos phate. The glycolytic enzyme triose phosphate iso merase converts this compound to glyceraldehyde 3-phosphate, which is oxidized via glycolysis .
Glycolysis FIGURE 1 7-4 Entry of glycerol into the glycolytic pathway.
Fatty Acids Are Activated and Transported i nto Mitochondria
The enzymes of fatty acid oxidation in animal cells are located in the mitochondrial matrix, as demonstrated in 1 948 by Eugene P. Kennedy and Albert Lehninger. The fatty acids with chain lengths of 12 or fewer carbons enter mitochondria without the help of membrane transporters. Those with 1 4 or more carbons, which constitute the majority of the FFA obtained in the diet or released from adipose tissue, cannot pass directly through the mitochondrial membranes-they must first undergo the three enzymatic reactions of the carnitine shuttle. The first reaction is catalyzed by a family of isozymes (different isozymes specific for fatty acids hav ing short, intermediate, or long carbon chains) present in the outer mitochondrial membrane, the acyl-CoA synthetases, which promote the general reaction Fatty acid + CoA + ATP � fatty acyl- CoA + AMP + PP; Thus, acyl-GoA synthetases catalyze the formation of a thioester linkage between the fatty acid carboxyl group and the thiol group of coenzyme A to yield a fatty acyl-CoA,
1 7. 1 Digestion, M o b i l ization, a n d Tra n s p o rt of Fats
0 II
0 II
[6s1J
0 f1 II
-o-P-0-P-0-P-0-( Adenosine I I
( o-I
I
o-
o-
ATP
/0
Fatty acid
R-C � 0 l:�tt.Y .""' 1
· t " o.,\
:-;\ n t lwt:l:-;t�
0 II
0 II
1
I
- o-P-O-P-o -
+
oaPyrophosphate
inlll'"=! � v c , 8-CoA cis-D.3-
Dodecenoyl-CoA
..\ J.
Oxidation of Unsaturated Fatty Acids Requires
un
(
A '
mrr t "
Two Additional Reactions
The fatty acid oxidation sequence just described is typi cal when the incoming fatty acid is saturated (that is, has only single bonds in its carbon chain) . However, most of the fatty acids in the triacylglycerols and phos pholipids of animals and plants are unsaturated, having one or more double bonds. These bonds are in the cis configuration and cannot be acted upon by enoyl-CoA hydratase, the enzyme catalyzing the addition of H20 to 2 the trans double bond of the A -enoyl-CoA generated during f3 oxidation. 1\vo auxiliary enzymes are needed for f3 oxidation of the common unsaturated fatty acids: an isomerase and a reductase. We illustrate these auxil iary reactions with two examples.
�
0
t li
0
H I'
/j
c, H
trans-D.2-
Dodecenoyl-CoA
{j oxidnuon ::-
c-IJ-yhyrdrgo0xnyabsuety.-atc Acetoacetate
Acetone
NADH + H+
aceloac • · � • l dt>carbox ,.· l ..ua:.
OH I
�o
CH3-C-CH2-C
�
'o-
n-.B-Hydroxybutyrate
Ketone Bodies, Formed i n the liver, Are Exported to Other Organs as Fuel
The first step in the formation of acetoacetate, occur ring in the liver (Fig. 1 7-18), is the enzymatic conden sation of two molecules of acetyl-GoA, catalyzed by thiolase; this is simply the reversal of the last step of ,B oxidation. The acetoacetyl-GoA then condenses with acetyl-GoA to form /3-hydroxy-p-methylglutaryl-CoA (HMG-CoA), which is cleaved to free acetoacetate and acetyl-GoA. The acetoacetate is reversibly reduced by D-,(3-hydroxybutyrate dehydrogenase, a mitochondrial enzyme, to D-,(3-hydroxybutyrate . This enzyme is spe cific for the D stereoisomer; it does not act on L-,(3hydroxyacyl-GoAs and is not to be confused with L-,(3-hydroxyacyl-GoA dehydrogenase of the ,(3-oxidation pathway. In healthy people, acetone is formed in very small amounts from acetoacetate, which is easily de carboxylated, either spontaneously or by the action of
0
II
,_
CH:l -C-CHa
Acetone
::; (' ( )2
NAD+ o
�
OH I
/C-CH2 -CH-CHa
()
D-,8-Hydroxybutyrate
FIGURE 1 7-1 8 Formation of ketone bodies from acetyi-CoA. Healthy, wel l-nourished individuals produce ketone bodies at a relatively low rate. When acetyi-CoA accumulates (as in starvation or untreated dia betes, for example), thiolase catalyzes the condensation of two acetyi CoA molecules to acetoacetyi-CoA, the parent compound of the three ketone bodies. The reactions of ketone body formation occur in the matrix of l iver mitochondria. The six-carbon compound !3-hydroxy-/3methylglutaryi-CoA (HMG-CoA) is also an intermediate of sterol biosynthesis, but the enzyme that forms HMG-CoA in that pathway is cytosolic. HMG-CoA lyase is present only in the mitochondrial matrix.
acetoacetate decarboxylase (Fig. 1 7-18). Because individuals with untreated diabetes produce large quan tities of acetoacetate, their blood contains significant amounts of acetone, which is toxic. Acetone is volatile and imparts a characteristic odor to the breath, which is sometimes useful in diagnosing diabetes. • In extrahepatic tissues, D-,(3-hydroxybutyrate is oxi dized to acetoacetate by D-,8-hydroxybutyrate dehydro genase (Fig. 1 7-19). The acetoacetate is activated to its coenzyme A ester by transfer of GoA from succinyl-GoA,
1 7. 3 Ketone Bod ies
D-,8-Hydroxybutyrate
Acetoacetate
0
II
0 /
C H3 - C- CH2- C
/0
CH3-c ,
rCoA
"-
Acetoacetyl-CoA
S-CoA
SH
/0
CHa-c "'-r't.A
,
S-C•1A
2 Acetyl-CoA
FIGURE 1 7- 1 9 o-{j-Hydroxybutyrate as a fuel. o-,8-Hydroxybutyrate, synthesized in the l iver, passes into the blood and thus to other tissues, where it is converted in three steps to acetyi-CoA. It is first oxidized to acetoacetate, which is activated with coenzyme A donated from suc ci nyi-CoA, then split by thiolase. The acetyi-CoA thus formed is used for energy production.
an intermediate of the citric acid cycle (see Fig. 1 6-7) , in a reaction catalyzed by P-ketoacyl-CoA trans ferase, also called thiophorase. The acetoacetyl-GoA is then cleaved by thiolase to yield two acetyl-GoAs, which enter the citric acid cycle. Thus the ketone bodies are used as fuels in all tissues except liver, which lacks thio phorase. The liver is therefore a producer of ketone bod ies for the other tissues, but not a consumer. The production and export of ketone bodies by the liver allows continued oxidation of fatty acids with only minimal oxidation of acetyl-GoA. When intermediates of the citric acid cycle are being siphoned off for glucose synthesis by gluconeogenesis, for example, oxidation of cycle intermediates slows-and so does acetyl-GoA oxi dation. Moreover, the liver contains only a limited amount of coenzyme A, and when most of it is tied up in acetyl-GoA, {3 oxidation slows for want of the free coen zyme. The production and export of ketone bodies frees coenzyme A, allowing continued fatty acid oxidation.
[667]
diverting acetyl-GoA to ketone body production ( Fig. 1 7-20) . In untreated diabetes, when the insulin level is insufficient, extrahepatic tissues cannot take up glucose efficiently from the blood, either for fuel or for conversion to fat . Under these conditions , levels of malonyl-GoA (the starting material for fatty acid syn thesis) fall, inhibition of carnitine acyltransferase I is relieved, and fatty acids enter mitochondria to be de graded to acetyl-GoA-which cannot pass through the citric acid cycle because cycle intermediates have been drawn off for use as substrates in gluconeogene sis . The resulting accumulation of acetyl-GoA acceler ates the formation of ketone bodies beyond the capacity of extrahepatic tissues to oxidize them. The increased blood levels of acetoacetate and D-{3-hy droxybutyrate lower the blood pH, causing the condi tion known as acidosis. Extreme acidosis can lead to coma and in some cases death. Ketone bodies in the blood and urine of individuals with untreated diabetes can reach extraordinary levels-a blood concentration of 90 mg/1 00 mL (compared with a normal level of d-chain
H3N-C-H
CH2
CH2
CH3
CHs
I
I
Ull l n otntnsf(• ra::;:;e
I
coo-
>I
I
C=O
I
I
CH2
CH2
I
I
CH3-CH
CH3-CH
I
I
CHs
CHs
Leucine
FIGURE 1 8-28
I
I
CH3-CH
CHz
If
8-CoA 0� / c �
I
C=O
CH3-CH
�:
CHs
coo-
I
H3N-C-H
+
I
I
coo-
coo-
CH3-CH
CHs
Valine
Isoleucine
I
I
CH3-CH
CHs
I
8-CoA 0� / c
C=O
I
CH3-CH
CHs
The carbon skeletons of asparagine and aspartate ul timately enter the citric acid cycle as oxaloacetate. The
I
H3N-C-H
+
Asparagine and Aspartate Are Degraded to Oxaloacetate
coo-
I
a-Keto acids Catabolic pathways for the three branched
All three pathways occur i n extrahepatic tissues and share the first two enzymes, as shown here. The branched-chain a-keto acid dehydrogenase chain amino acids: valine, isoleucine, and leucine.
[7o1]
( [ c l l _v d r ngl·na�(' con1ple.x
I
Maple syrup urine disease
.,.
8-CoA 0� / � c
I
CH2
I
CH3-CH
I
CH3
Acyl-CoA derivatives
complex is analogous to the pyruvate and a-ketogl utarate dehydro genase complexes and requi res the same five cofactors (some not shown here). Th is enzyme is defective in people with maple syrup urine disease.
[7o2]
A m i n o Acid Oxidation a n d the Production of U rea
and tetrahydrobiopterin in the oxidation of phenylalanine by phenylalanine hydroxylase. •
'"l amm ot1 an
rt " n1
f
l
"
-
IAspartate I
•
a-Ketoglutarate
>LP
� Glutamate •
Oxaloacetate
FIGURE 1 8-29
Catabolic pathway for asparagine and aspartate.
Both amino acids are converted to oxaloacetate.
•
enzyme asparaginase catalyzes the hydrolysis of as paragine to aspartate, which undergoes transamination with a-ketoglutarate to yield glutamate and oxaloac etate (Fig. 1 8 -29). We have now seen how the 20 common amino acids, after losing their nitrogen atoms, are degraded by de hydrogenation, decarboxylation, and other reactions to yield portions of their carbon backbones in the form of six central metabolites that can enter the citric acid cycle. Those portions degraded to acetyl-CoA are completely oxidized to carbon dioxide and water, with generation of ATP by oxidative phosphorylation. As was the case for carbohydrates and lipids, the degradation of amino acids results ultimately in the gen eration of reducing equivalents (NADH and FADH2 ) through the action of the citric acid cycle. Our survey of catabolic processes concludes in the next chapter with a discussion of respiration, in which these reducing equiv alents fuel the ultimate oxidative and energy-generating process in aerobic organisms.
S U M M A R Y 18. 3
Path ways of Amino Acid Deg radation
•
After the removal of amino groups , the carbon skeletons of amino acids undergo oxidation to compounds that can enter the citric acid cycle for oxidation to C02 and H20 . The reactions of these pathways require several cofactors, including tetrahydrofolate and S-adenosyl methionine in one-carbon transfer reactions
•
•
Depending on their degradative end product, some amino acids can be converted to ketone bodies, some to glucose, and some to both. Thus amino acid degradation is integrated into intermediary metabolism and can be critical to survival under conditions in which amino acids are a significant source of metabolic energy. The carbon skeletons of amino acids enter the citric acid cycle through five intermediates: acetyl-CoA, a-ketoglutarate, succinyl-CoA, fumarate, and oxaloacetate. Some are also degraded to pyruvate, which can be converted to either acetyl-CoA or oxaloacetate. The amino acids producing pyruvate are alanine, cysteine, glycine, serine, threonine, and tryptophan. Leucine, lysine, phenylalanine, and tryptophan yield acetyl-CoA via acetoacetyl-GoA. Isoleucine, leucine, threonine, and tryptophan also form acetyl-CoA directly. Arginine, glutamate, glutamine, histidine, and proline produce a-ketoglutarate; isoleucine, methionine, threonine, and valine produce succinyl-CoA; four carbon atoms of phenylalanine and tyrosine give rise to fumarate; and asparagine and aspartate produce oxaloacetate. The branched-chain amino acids (isoleucine, leucine, and valine), unlike the other amino acids, are degraded only in extrahepatic tissues. Several serious human diseases can be traced to genetic defects in the enzymes of amino acid catabolism.
Key Terms Terms in bold are defined in the glossary.
aminotransferases 677 transaminases 677 transamination 6 7 7 pyridoxal phosphate (PLP) 677 creatine kinase 678 oxidative deamination 679 L-glutarnate dehydrogenase
679
glutamine synthetase glutaminase 680 glucose-alanine cycle ammonotelic 682 ureotelic 682 uricotelic 682 urea cycle 682
680 681
urea 684 essential amino acids 686 ketogenic 688 glucogenic 688 tetrahydrofolate 689 S -adenosylmethionine ( adoMet) 689 tetrahydrobiopterin 692 phenylketonuria (PKU) 697 mixed-function oxidases 697 alkaptonuria 698 maple syrup urine disease 7 01
Further Read ing
[7o3]
Further Reading
This review details what is known about some levels of regulation not covered in the chapter, such as hormonal and nutritional regulation.
General
Disorders of Amino Acid Degradation
Arias, I.M., Boyer, J.L., Chisari, F.V., Fausto, N., Schachter, D., & Shafritz, D.A. (2001) The Liver: Biology and Pathobiology, 4th
Ledley, F.D., Levy, H.L., & Woo, S.L.C. (1 986) Molecular analysis
Bender, D.A. ( 1 985) Amino Acid Metabolism, 2nd edn, Wiley
Nyhan, W.L. ( 1984) Abnormalities in Amino Acid Metabolism in
edn, Lippincott Williams & Wilkins, Philadelphia.
of the inheritance of phenylketonuria and mild hyperphenylalanine mia in families with both disorders. N. Engl. J Med. 314, 1276-1280 .
Interscience, Inc., New York
Clinical Medicine, Appleton-Century-Crofts, Norwalk, CT.
Brosnan, J.T. (2001) Amino acids, then and now-a reflection on
Scriver, C.R., Beaudet, A.L., Sly, W.S., Valle, D., Childs, B., Kinzler, A.W., & Vogelstein, B. (eds) (2001) The Metabolic and
Sir Hans Krebs' contribution to nitrogen metabolism. IUBMB Life 52, 265-270. An interesting tour through the life of this important biochemist.
Campbell, J.W. (1991) Excretory nitrogen metabolism. In Environ mental and Metabolic Animal Physiology, 4th edn (Prosser, C .L , ed.) , pp. 277-324, John Wiley & Sons, Inc., New York. Coomes, M.W. ( 1 997) Amino acid metabolism In Textbook of Biochemistry with Clinical Correlations, 5th edn (Devlin, T.M., ed.) , pp 779-823, Wiley-Liss, New York Frey, P.A. & Hegeman, A.D. (2006) Enzymatic Reaction Mechanisms , Oxford University Press, New York. A good source for in-depth discussion of the classes of enzymatic reaction mechanisms described in the chapter. uniformity. J Biochem. ll8, 463-4 73.
Hayashi, H. ( 1 995) Pyridoxal enzymes: mechanistic diversity and Mazelis, M. (1 980) Amino acid catabolism. In The Biochemistry of Plants: A Comprehensive Treatise (Stumpf, P.K. & Conn, E.E . , eds), Vol. 5: Amino Acids and Derivatives (Miflin, B.J., ed.), pp 541-567, Academic Press, Inc., New York . A discussion of the various fates of amino acids in plants.
Amino Acid Metabolism Christen, P. & Metzler, D.E. ( 1 985) Transaminases, Wiley Interscience, Inc. , New York.
Curthoys, N.P. & Watford, M. (1 995) Regulation of glutaminase activity and glutamine metabolism. Annu. Rev. Nutr. 15, 133-159. hydroxylases. Annu. Rev. Biochem 68, 355-382.
Fitzpatrick, P.F. (1 999) Tetrahydropterin-dependent amino acid
Eliot, A.C. & Kirsch, J.F. (2004) Pyridoxal phosphate enzymes: mechanistic, structural and evolutionary considerations. Annu. Rev. Biochem 73, 383-4 1 5 .
Pencharz, P.B. & Ball, R.O. (2003) Different approaches t o define individual amino acid requirements. Annu Rev_ Nutr. 23, 1 0 1-1 1 6. Determination of which amino acids are essential in the human diet is not a trivial problem, as this review relates.
The Urea Cycle Brusilow, S.W. & Horwich, A.L. (2001) Urea cycle enzymes. In
The Metabolic Bases of Inherited Disease, 8th edn (Scriver, C.R . , Beaudet, A . C. , Sly, WS. , Valle, D . , Childs, B., Kinzler, K . , & Vogelstein, B , eds), pp 1 909-1963, McGraw-Hill Companies, Inc. , New York. An authoritative source on this pathway.
Holmes, F.L. (1 980) Hans Krebs and the discovery of the ornithine cycle. Fed Proc 39, 2 1 6-225. A medical historian reconstructs the events leading to the discovery of the urea cycle.
Kirsch, J.F., Eiche1e, G., Ford, G.C., Vincent, M.G., Jansonius, J.N., Gehring, H., & Christen, P. ( 1 984) Mechanism of action of aspartate aminotransferase proposed on the basis of its spatial structure. J Mol. Biol. 174, 497-525_
Morris, S.M. (2002) Regulation of enzymes of the urea cycle and arginine metabolism. Annu Rev. Nutr. 22, 87-105.
Molecular Bases of Inherited Disease, 8th edn, Part 5: Amino Acids, McGraw-Hill, Inc., New York
Scriver, C.R., Kaufinan, S., & Woo, S.L.C. ( 1988) Mendelian hyperphenylalaninernia. Annu. Rev. Genet 22, 301-321.
Problems 1 . Products of Amino Acid Transamination Name and draw the structure of the a-keto acid resulting when each of the following amino acids undergoes transamination with a ketoglutarate: (a) aspartate, (b) glutamate, (c) alanine, (d) phenylalanine. 2. Measurement of Alanine Aminotransferase Activity The activity (reaction rate) of alanine aminotransferase is usu ally measured by including an excess of pure lactate dehydro genase and NADH in the reaction system. The rate of alanine disappearance is equal to the rate of NADH disappearance measured spectrophotometrically. Explain how this assay works. 3. Alanine and Glutamine in the Blood Normal human blood plasma contains all the amino acids required for the syn thesis of body proteins, but not in equal concentrations. Ala nine and glutamine are present in much higher concentrations than any other amino acids. Suggest why. 4. Distribution of Amino Nitrogen If your diet is rich in alanine but deficient in aspartate, will you show signs of aspar tate deficiency? Explain. 5. Lactate versus Alanine as Metabolic Fuel: The Cost of Nitrogen Removal The three carbons in lactate and ala nine have identical oxidation states, and animals can use ei ther carbon source as a metabolic fuel. Compare the net ATP yield (moles of ATP per mole of substrate) for the complete oxidation (to C02 and H20) of lactate versus alanine when the cost of nitrogen excretion as urea is included.
coo l HO-C-H I H-C-H I H Lactate
coo I H3 N-C-H +
I
H-C-H I H
Alanine
6. Ammonia Toxicity Resulting from an Arginine Deficient Diet In a study conducted some years ago, cats were fasted overnight then given a single meal complete in all
[7o4�
A m i n o Acid Oxidation a n d the Prod u ction of U rea
amino acids except arginine. Within 2 hours, blood ammonia levels increased from a normal level of 18 p,g/1 to 1 40 p,g/1, and the cats showed the clinical symptoms of ammonia toxic ity. A control group fed a complete amino acid diet or an amino acid diet in which arginine was replaced by ornithine showed no unusual clinical symptoms. (a) What was the role of fasting in the experiment? (b) What caused the ammonia levels to rise in the experi mental group? Why did the absence of arginine lead to ammonia toxicity? Is arginine an essential amino acid in cats? Why or why not? (c) Why can ornithine be substituted for arginine? 7. Oxidation of Glutamate Write a series of balanced equa tions, and an overall equation for the net reaction, describing the oxidation of 2 mol of glutamate to 2 mol of a-ketoglutarate and 1 mol of urea. 8. Transamination and the Urea Cycle Aspartate amino transferase has the highest activity of all the mammalian liver aminotransferases. Why? 9. The Case against the Liquid Protein Diet A ' " weight-reducing diet heavily promoted some years ago required the daily intake of "liquid protein" (soup of hy drolyzed gelatin) , water, and an assortment of vitamins. All other food and drink were to be avoided. People on this diet typically lost 10 to 1 4 lb in the first week. (a) Opponents argued that the weight loss was almost en tirely due to water loss and would be regained very soon after a normal diet was resumed. What is the biochemical basis for this argument? (b) A few people on this diet died. What are some of the dangers inherent in the diet, and how can they lead to death? 10. Ketogenic Amino Acids Which amino acids are exclu sively ketogenic? 1 1 . A Genetic Defect in Amino Acid Metabolism: A Case History A two-year-old child was taken to the hos pital. His mother said that he vomited frequently, especially after feedings. The child's weight and physical development were be low normal. His hair, although dark, contained patches of white. A urine sample treated with ferric chloride (FeCl3) gave a green color characteristic of the presence of phenylpyruvate. Quantita tive analysis of urine samples gave the results shown in the table.
Concentration (mM) Substance Phenylalanine Phenylpyruvate Phenyllactate
Patient's urine
Normal urine
7.0 4.8 1 0.3
0.01 0 0
(d) Why does the boy's hair contain patches of white? "
12. Role of Cobalamin in Amino Acid Catabolism Pernicious anemia is caused by impaired absorption of vitamin Biz· What is the effect of this impairment on the catabolism of amino acids? Are all amino acids equally affected? (Hint: See Box 1 7-2.) 13. Vegetarian Diets Vegetarian diets can provide high levels of antioxidants and a lipid profile that can help prevent coronary disease. However, there can be some associated problems. Blood samples were taken from a large group of volunteer subjects who were vegans (strict vegetari ans: no animal products) , lactovegetarians (vegetarians who eat dairy products) , or omnivores (individuals with a normal, varied diet including meat) . In each case, the volunteers had followed the diet for several years. The blood levels of both ho mocysteine and methylmalonate were elevated in the vegan group, somewhat lower in the lactovegetarian group, and much lower in the omnivore group. Explain. 14. Pernicious Anemia Vitamin BI2 deficiency can arise from a few rare genetic diseases that lead to low Biz levels despite a normal diet that includes Biz-rich meat and dairy sources. These conditions cannot be treated with dietary Biz supplements. Explain. 15. Pyridoxal Phosphate Reaction Mechanisms Threo nine can be broken down by the enzyme threonine dehy dratase, which catalyzes the conversion of threonine to a-ketobutyrate and ammonia. The enzyme uses P1P as a co factor. Suggest a mechanism for this reaction, based on the mechanisms in Figure 1 8-6. Note that this reaction includes an elimination at the f3 carbon of threonine. OH
I
+
NH3
I
CH 3- CH -CH-COO -
Threonine
PLP
-o th -' r'-" ca= m :. ne----+ dehydratase
0
II
CH3-CH2-C -COOa-
NH3
+ H20
Ketobutyrate
16. Pathway of Carbon and Nitrogen in Glutamate Me tabolism When [2-I4C , I 5N] glutamate undergoes oxidative degradation in the liver of a rat, in which atoms of the follow ing metabolites will each isotope be found: (a) urea, (b) succi nate, (c) arginine, (d) citrulline, (e) ornithine, (f) aspartate? H
coo
kI �tI -H
H�
H
(a) Suggest which enzyme might be deficient in this child. Propose a treatment. (b) Why does phenylalanine appear in the urine in large amounts? (c) What is the source of phenylpyruvate and phenyllac tate? Why does this pathway (normally not functional) come into play when the concentration of phenylalanine rises?
+
CH2
I
CH2
I coo Labeled glutamate 17. Chemical Strategy of Isoleucine Catabolism Isoleucine is degraded in six steps to propionyl-CoA and acetyl-CoA.
Pro b l e m s
+
0 � � c/
� / c
o
o
I
+
S-CoA
H NH3 I I CHa-C-CH2-c-cool I CH3 H Leucine
I
H3N-C-H I H-C-CH3 I CH2 I CH3 Isoleucine
CH2 I CH3 Propionyl-CoA
6 steps
+
S-CoA
H 0 II I CHa -C-CH2-C-COO I CH3 a-Ketoisocaproate CoA-SH
I
CH3 Acetyl-CoA
(a) The chemical process of isoleucine degradation in cludes strategies analogous to those used in the citric acid cycle and the f3 oxidation of fatty acids. The intermediates of isoleucine degradation (I to V) shown below are not in the proper order. Use your knowledge and understanding of the citric acid cycle and {3-oxidation pathway to arrange the intermediates in the proper metabolic sequence for isoleucine degradation. 0 ��c /
(b)
H
o
I
CH3-C-CH2-C-8-CoA I CH3 Isovaleryl-CoA
o-
(c)
I
§C-CH3 H-Cr' I CH3
C=O I H-C-CH3 I CH2 I CH3
I
II
0� � / c
0 ��c /
S-CoA
0 II
I
� / c
S-CoA
I
(d)
I
r
HC03
0 II
OH 0 I II -OOC-CH2-C-CH2-C-8-CoA I CH3 {3-Hydroxy-{3-methylglutaryl-CoA
/ -CoA 0 ��c /H
H" / " HO - C CH3 I CH3 v
any necessary cofactors.
II
r
IV
(b) For each step you propose, describe the chemical process, provide an analogous example from the citric acid cycle or {3-oxidation pathway (where possible) , and indicate
0
-ooC-CH2-C=C-C-8-CoA I I H3C H {3-Methylglutaconyl-CoA (e) H20
H-C-CH3 I CH2 I CH3
III
l
CH3-C=C-C-8-CoA I I H3C H {3-Methylcrotonyl-CoA
S-CoA
H-C-CH3 I C=O I CH3
l
(a)
� / c
0
[los]
0 II
(f)l
0
II
-ooC-CH2-C-CH3 + CH3-C-8-CoA Acetyl-CoA Acetoacetate Data Analysis Problem
19. Parallel Pathways for Amino Acid and Fatty Acid Degradation The carbon skeleton of leucine is degraded by a series of reactions closely analogous to those of the citric acid cycle and f3 oxidation. For each reaction, (a) through (f) , shown at right, indicate its type, provide an analogous exam
20. Maple Syrup Urine Disease Figure 1 8-28 shows the pathway for the degradation of branched-chain amino acids and the site of the biochemical defect that causes maple syrup urine disease. The initial findings that eventually led to the discovery of the defect in this disease were presented in three papers published in the late 1950s and early 1960s. This problem traces the history of the findings from initial clin ical observations to proposal of a biochemical mechanism. Menkes, Hurst, and Craig ( 1954) presented the cases of four siblings, all of whom died following a similar course of symptoms. In all four cases, the mother's pregnancy and the
ple from the citric acid cycle or {3-oxidation pathway (where possible) , and note any necessary cofactors.
birth had been normal. The first 3 to 5 days of each child's life were also normal. But soon thereafter each child began having
18. Role of Pyridoxal Phosphate in Glycine Metabolism The enzyme serine hydroxymethyltransferase requires pyridoxal phosphate as cofactor. Propose a mechanism for the reaction cat alyzed by this enzyme, in the direction of serine degradation (glycine production) . (Hint: See Figs 18-19 and 18-20b.)
.. ..
•
[7o6]
A m i n o Acid Oxidation a n d the Prod uction of U rea
(b) The table includes taurine, an amino acid not nor
convulsions, and the children died between the ages of 11 days and 3 months. Autopsy showed considerable swelling of the brain in all cases. The children's urine had a strong, unusual "maple syrup" odor, starting from about the third day of life. Menkes (1959) reported data collected from six more chil dren. All showed symptoms similar to those described above, and died within 15 days to 20 months of birth. In one case, Menkes was able to obtain urine samples during the last months of the in fant's life. When he treated the urine with 2,4-dinitrophenylhy drazone, which forms colored precipitates with keto compounds, he found three a-keto acids in unusually large amounts:
coo� I C=O I CH2 I
CH3-CH I CH3 a-Ketoisocaproate
coo� I C=O I CH3-CH I CH3 a-Ketoisovalerate
mally found in proteins. Taurine is often produced as a by product of cell damage. Its structure is: 0
+
II
H3N- CH2- CH2-S-O� II
0
Based on its structure and the information in this chapter, what is the most likely amino acid precursor of taurine? Ex plain your reasoning. (c) Compared with the normal values given in the table, which amino acids showed significantly elevated levels in the pa tient's blood in January 1 957? Which ones in the patient's urine? Based on their results and their knowledge of the path way shown in Figure 18-28, Dancis and coauthors concluded: "although it appears most likely to the authors that the pri
coo l C=O I CH3-CH I
CH2 I CH3 a-Keto-f3-methyl-n-valerate
mary block is in the metabolic degradative pathway of the branched-chain amino acids, this cannot be considered estab lished beyond question." (d) How do the data presented here support this con clusion? (e) Which data presented here do not fit this model of
(a) These a-keto acids are produced by the deamination of amino acids. For each of the a-keto acids above, draw and name the amino acid from which it was derived.
maple syrup urine disease? How do you explain these seem ingly contradictory data? (f) What data would you need to collect to be more secure in your conclusion?
Dancis, Levitz, and Westall ( 1960) collected further data that led them to propose the biochemical defect shown in Fig ure 18-28. In one case, they examined a patient whose urine first showed the maple syrup odor when he was 4 months old. At the age of 10 months (March 1 956) , the child was admitted
References
to the hospital because he had a fever, and he showed grossly retarded motor development. At the age of 20 months (Janu ary 1957), he was readmitted and was found to have the de generative neurological symptoms seen in previous cases of maple syrup urine disease; he died soon after. Results of his blood and urine analyses are shown in the table below, along
Dancis, J., Levitz, M., & Westall , R. (1960) Maple syrup urine dis ease: branched-chain keto-aciduria. Pediatrics 25, 72�79. Menkes, J.H. (1959) Maple syrup disease: isolation and identification of organic acids in the urine. Pediatrics 23, 348�353. Menkes, J.H., Hurst, P.L., & Craig J.M. (1954) A new syndrome: progressive familial infantile cerebral dysfunction associated with an unusual urinary substance. Pediatrics 14, 462-466.
with normal values for each component.
Urine (mg/24 h) Normal Amino acid(s) Alanine Asparagine and glutamine Aspartic acid Arginine Cystine Glutamic acid Glycine Histidine Isoleucine Leucine Lysine Methionine Ornithine Phenylalanine Proline Serine Taurine Threonine Tryptophan Tyrosine Valine
5-15 5-15 1-2 1 . 5-3 2-4 1 . 5-3 20-40 8-15 2-5 3-8 2-12 2-5 1-2 2-4 2-4 5-15 1-10 5-10 3-8 4-8 2-4
Plasma (mg/ml)
Patient
Normal
Mar. 1956
Jan. 1957
0.2 0.4 0.2 0.3 0.5 0.7 4.6 0.3 2.0 2 .7 1 .6
0.4 0 1 .5 0.7 0.3 1.6 20.7 4.7 13.5 39 .4 4.3 14 1 .3 2.6 0.3 0 18.7 0 2.3 3.7 15.4
1.4 0 0.4 0.5 1 .2 0.2 0.6 0.9 0.3 1 .6
.
Patient Jan. 1957
3.0-4.8 3.0-5.0 0.1-0.2 0.8-1 .4 1 .0-1.5 1 .0-1 .5 1 .0-2.0 1 .0-1 . 7 0.8-1 .5 1 . 7-2.4 1 . 5-2.7 0.3-0.6 0.6-0.8 1 .0-1 . 7 1 .5-3.0 1 .3-2.2 0.9-1 .8 1 .2-1 .6
Not measured 1 .5-2.3 2.0-3.0
0.6 2.0 0.04 0.8 0 0.9 1 .5 0.7 2.2 14 .5 1 .1 2.7 0 .5 0 .8 0.9 0.9
0.4 0.3 0 0.7
13.1
If an idea presents itself to us, we m ust not rej ect it s i m p l y because it does not agree with the logical deductions of a rei gn i n g theory.
-Claude Bernard, An Introduction to the Study of Experimental
Med i c i ne, 1 8 13
The aspect of the present position of consensus that I fi nd most remark able and adm i rable, is the a ltru ism and generosi ty with which former opponents of the chem iosmotic hypothesis have not on ly come to accept i t, but have actively promoted it to the status of a theory.
-Peter Mitchell, Nobel Address,
1978
Oxidative hosphory af on and Photophosphorylation OXIDATIVE PHOSPHORYLATION
708
1 9. 1
Electron-Transfer Reactions i n Mitochondria
1 9.2
ATP Synthesis
1 9.3
Regulation of Oxidative Phosphorylation
1 9.4
Mitochondria in Thermogenesis, Steroid Synthesis,
723
and Apoptosis
1 9.5
732
735
Mitochondrial Genes: Their Origin and the Effects of Mutations
738
PHOTOSYNTHESIS: HARVESTING LIGHT ENERGY
1 9.6
General Features of Photophosphorylation
1 9.7
light Absorption
1 9.8
The Central Photochemical Event: light-Driven Electron Flow
1 9.9
744
749
ATP Synthesis by Photophosphorylation
1 9. 1 0 The Evolution of Oxygenic Photosynthesis
0
742
759 761
xidative phosphorylation is the culmination of energy-yielding metabolism in aerobic organ isms. All oxidative steps in the degradation of carbohydrates , fats, and amino acids converge at this fi nal stage of cellular respiration, in which the energy of oxidation drives the synthesis of ATP. Photophosphory lation is the means by which photosynthetic organisms
capture the energy of sunlight-the ultimate source of energy in the biosphere-and harness it to make ATP. Together, oxidative phosphorylation and photophospho rylation account for most of the ATP synthesized by most organisms most of the time. In eukaryotes, oxidative phosphorylation occurs in mitochondria, photophosphorylation in chloroplasts. Oxidative phosphorylation involves the reduction of 02 to H20 with electrons donated by NADH and FADH2; it occurs equally well in light or darkness. Photophospho rylation involves the oxidation of H20 to 02, with NADP + as ultimate electron acceptor; it is absolutely dependent on the energy of light. Despite their differ ences, these two highly efficient energy-converting processes have fundamentally similar mechanisms. Our current understanding of ATP synthesis in mi tochondria and chloroplasts is based on the hypothesis, introduced by Peter Mitchell in 1961, that transmem brane differences in proton concentration are the reser voir for the energy extracted from biological oxidation reactions. This chemiosmotic theory has been ac cepted as one of the great unifying principles of twenti eth century biology. It provides insight into the processes of oxidative phosphorylation and photophosphorylation, and into such apparently disparate energy transduc tions as active transport across membranes and the motion of bacterial flagella. Oxidative phosphorylation and photophosphoryla tion are mechanistically similar in three respects. (1) Both processes involve the flow of electrons through a chain of membrane-bound carriers. (2) The free energy made available by this "downhill" (exergonic) electron flow is coupled to the "uphill" transport of protons
[!o7]
[?ot�j
Oxid ative Phosphorylation a n d Photop hosphorylation
across a proton-impermeable membrane, conserving the free energy of fuel oxidation as a transmembrane elec trochemical potential (p . 390) . (3) The transmembrane flow of protons down their concentration gradient through specific protein channels provides the free en ergy for synthesis of ATP, catalyzed by a membrane pro tein complex (ATP synthase) that couples proton flow to phosphorylation of ADP. The chapter begins with oxidative phosphorylation. We first describe the components of the electron-trans fer chain, their organization into large functional com plexes in the inner mitochondrial membrane, the path of electron flow through them, and the proton move ments that accompany this flow. We then consider the remarkable enzyme complex that, by "rotational cataly sis , " captures the energy of proton flow in ATP, and the regulatory mechanisms that coordinate oxidative phos phorylation "'ith the many catabolic pathways by which fuels are oxidized. We also describe the roles that mito chondria play in thermogenesis, steroid synthesis, and apoptosis. With this understanding of mitochondrial ox idative phosphorylation, we turn to photophosphoryla tion, looking first at the absorption of light by photosynthetic pigments, then at the light-driven flow of electrons from H 2 0 to NADP+ and the molecular ba sis for coupling electron and proton flow. We also con sider the similarities of structure and mechanism between the ATP synthases of chloroplasts and mito chondria, and the evolutionary basis for this conserva tion of mechanism.
( F oF l)
ATP synthase
1 9. 1 Electron-Tra nsfer Reactions in
Mitochondria The discovery in 1948 by Eugene Kennedy and Albert Lehninger that mitochondria are the site of oxidative phos phorylation in eukaryotes marked the beginning of the modern phase of studies in biological energy transductions. Mitochondria, like gram-negative bacteria, have two membranes (Fig. 19-1). The outer mitochondrial mem brane is readily permeable to small molecules CMr 90% efficiency. Within 3 ps of the excitation of P870, pheophytin has re ceived an electron and become a negatively charged radi cal; less than 200 ps later, the electron has reached the quinone Q8 (Fig. 1 9-55b). The electron-transfer reactions not only are fast but are thermodynamically "downhill" ; the excited special pair (Chi) � is a very good electron donor (E'o - 1 V) , and each successive electron transfer is to an acceptor of substantially less negative E'0. The standard free-energy change for the process is therefore negative and large; recall from Chapter 1 3 that t!..G 'o -nJt!..£ ' 0; here, t!..£ ' 0 is the difference between the stan dard reduction potentials of the two half-reactions =
=
----+
+
(Chi)� "(Chl):7 e (2) Q + 2H+ + 2e- QH2 (1)
Thus tlE'o =
----+
-0.045 V -
( - 1.0 V)
E ' o = - l.O V E'0 = =
-0.045 V
and
!lG'0
=
-2(96.5 kJN mol)(0.95 V) -180 kJ/mol ·
=
The combination of fast kinetics and favorable thermody namics makes the process virtually irreversible and highly efficient. The overall energy yield (the percentage of the photon's energy conserved in QH2) is >30% , with the re mainder of the energy dissipated as heat and entropy. I n Plants, Two Reaction Centers Act i n Ta ndem
The photosynthetic apparatus of modern cyanobacte ria, algae , and vascular plants is more complex than the one-center bacterial systems, and it seems to have evolved through the combination of two simpler bacte rial photocenters. The thylakoid membranes of chloro plasts have two different kinds of photosystems, each with its own type of photochemical reaction center and set of antenna molecules. The two systems have dis tinct and complementary functions ( Fig. 1 H-56 ) Pho tosystem II (PSII) is a pheophytin-quinone type of
.
0.95 V
Photosystem I
Photosystem II - 1.0 -
Pheo p
A
Fd:NADP+ oxidoreductase
p
Light
0Plastocyan j n
Proton grarueni
(
NADP+ NADPH
�
plastoquinone = second quinone Ao = electron acceptor chlorophyll A1 = phylloquinone
PQA
=
PQB
FIGURE 19-56 Integration of photosystems I and II in chloroplasts. This "Z scheme" shows the pathway of electron transfer from H20 (lower left) to NADP+ (far right) in noncyclic photosynthesis. The position on the vertical scale of each electron carrier reflects its standard reduction po· tential. To raise the energy of electrons derived from H20 to the energy level required to reduce NADP + to NADPH, each electron must be "lifted" twice (heavy arrows) by photons absorbed in PSI I and PSI. One photon is required per electron in each photosystem. After excitation,
the high-energy electrons flow "downhill" through the carrier chains shown. Protons move across the thylakoid membrane during the water· spl itting reaction and during electron transfer through the cytochrome b6f complex, producing the proton gradient that is essential to ATP for mation. An alternative path of electrons is cyclic electron transfer, in which electrons move from ferredoxin back to the cytochrome b6f com plex, instead of reducing NADP+ to NADPH. The cyclic pathway pro· duces more ATP and less NADPH than the noncyclic.
1 9.8
system (like the single photosystem of purple bacte ria) containing roughly equal amounts of chlorophylls a and b. Excitation of its reaction-center P680 drives electrons through the cytochrome b6f complex with concomitant movement of protons across the thy lakoid membrane . Photosystem I (PSI) is struc turally and functionally related to the type I reaction center of green sulfur bacteria. It has a reaction center designated P700 and a high ratio of chlorophyll a to chlorophyll b. Excited P700 passes electrons to the Fe-S protein ferredoxin, then to NADP + , producing NADPH. The thylakoid membranes of a single spinach chloroplast have many hundreds of each kind of pho tosystem. These two reaction centers in plants act in tandem to catalyze the light-driven movement of electrons from H20 to NADP + (Fig. 1 9-56) . Electrons are carried be tween the two photosystems by the soluble protein plastocyanin, a one-electron carrier functionally simi lar to cytochrome c of mitochondria. To replace the elec trons that move from PSII through PSI to NADP + , cyanobacteria and plants oxidize H20 (as green sulfur bacteria oxidize H2S) , producing 02 (Fig. 1 9-56, bottom left) . This process is called oxygenic photosynthesis to distinguish it from the anoxygenic photosynthesis of purple and green sulfur bacteria. All 02-evolving photo synthetic cells-those of plants, algae , and cyanobacte ria- contain both PSI and PSII; organisms with only one photosystem do not evolve 02. The diagram in Fig ure 1 9-56, often called the Z scheme because of its overall form, outlines the pathway of electron flow be tween the two photosystems and the energy relation ships in the light reactions. The Z scheme thus describes the complete route by which electrons flow from H20 to NADP + , according to the equation 2H20 + 2NADP+ + 8
photons �
02 + 2NADPH + 2 H +
For every two photons absorbed (one by each photosys tem), one electron is transferred from H20 to NADP + . To form one molecule of 02, which requires transfer of four electrons from two H20 to two NADP + , a total of eight photons must be absorbed, four by each photosystem. The mechanistic details of the photochemical reac tions in PSII and PSI are essentially similar to those of the two bacterial photosystems, with several important additions . In PSII, two very similar proteins , D 1 and D2, form an almost symmetric dimer, to which all the electron-carrying cofactors are bound (Fig. 1 9-5 7 ) . Excitation of P680 in PSII produces P680*, an excellent electron donor that, within picoseconds, transfers an electron to pheophytin, giving it a negative charge C Pheo -) . With the loss of its electron, P680* is trans formed into a radical cation, P680 + . · Pheo - very rapidly passes its extra electron to a protein-bound plasto quinone, PQA (or QA) , which in turn passes its electron to another, more loosely bound plastoquinone, PQB (or Qg) . When PQB has acquired two electrons in two such transfers from PQA and two protons from the solvent
The Central P h otochem ical Event: Li g ht-Driven Electro n Flow
Stroma (N side)
FIGURE 1 9-57
elongates.
[}s 3]
Photosystem II of the cyanobacterium Synechococcus
The monomeric form of the complex shown here has two major transmembrane proteins, D1 and D2, each with its set of cofac tors. Although the two subunits are nearly symmetric, electron flow oc curs through only one of the two branches of cofactors, that on the right (on D1 ) . The arrows show the path of electron flow from the Mn ion cluster (Mn4) of the water-spl itting enzyme to the qui none PQ8 . The photochemical events occur in the sequence indicated by the step numbers . Notice the close simi larity between the positions of cofactors here and the positions in the bacterial photoreaction center shown in Figure 1 9-55 . The role of the Tyr residues is d iscussed later in the text.
water, it is in its fully reduced quinol form, PQ8H2 • The overall reaction initiated by light in PSII is 4 P680 + 4H+ + 2 PQ8 + 4
photons �
4 P680+ + 2 PQ8H2
( 19-12)
Eventually, the electrons in PQgH2 pass through the cy tochrome b6j complex (Fig. 1 9-56) . The electron ini tially removed from P680 is replaced with an electron obtained from the oxidation of water, as described below. The binding site for plastoquinone is the point of action of many commercial herbicides that kill plants by block ing electron transfer through the cytochrome b6f com plex and preventing photosynthetic ATP production. The photochemical events that follow excitation of PSI at the reaction-center P700 are formally similar to those in PSII. The excited reaction-center P700* loses an electron to an acceptor, A0 (believed to be a special form of chlorophyll, functionally homologous to the pheophytin of PSII) , creating A0 and P700 + (Fig. 1 9-56, right side) ; again, excitation results in charge separation at the photochemical reaction center. P700 + is a strong oxidizing agent, which quickly acquires an electron from plastocyanin, a soluble Cu-containing electron-transfer protein. A0 is an exceptionally strong reducing agent that passes its electron through a chain of carriers that leads to NADP + . First, phylloquinone (A1 ) accepts an electron and passes it to an iron-sulfur protein (through three Fe-S centers in PSI) . From here, the electron moves to ferredoxin (Fd) , another iron-sulfur protein loosely associated with the thylakoid membrane. Spinach ferredoxin CMr 1 0,700) contains a 2Fe-2S cen ter (Fig. 1 9-5) that undergoes one-electron oxidation and reduction reactions. The fourth electron carrier in
[7s4]
Oxi dative Phosp horylation a n d Photophosph orylation
the chain is the flavoprotein ferredoxin:NADP + oxi doreductase, which transfers electrons from reduced ferredoxin (Fdrect) to NADP + : 2 Fdred + 2 H + + NADP +
�
Antenna Chlorophylls Are Tightly I ntegrated with Electron Carriers The electron-carrying cofactors of PSI and the light harvesting complexes are part of a supramolecular com plex (Fig. 1 9-58a) , the structure of which has been solved crystallographically. The protein consists of three
2Fdox + NADPH + H +
This enzyme is homologous to the ferredoxin:NAD re ductase of green sulfur bacteria (Fig. 1 9-54b) . (a)
Light
\
Subunit B
\
-/
/--..( CWl2 ��Jf Ch( P
Ex�n
transfer
Lumen (P side)
PlasUx:yanin[
�
70°
ubunit. A Chi
�
PSI
c
Subunit
•
I
FB ..
F
Stroma (N side)
A
Ferredoxin
(b)
FIGURE 1 9-58
The supramolecular complex o f PSI a n d its associated
Schematic drawing of the essential proteins and cofactors in a single unit of PSI. A large number of antenna chloro phylls surround the reaction center and convey to it (red arrows) the energy of absorbed photons. The result is excitation of the pai r of chlorophyll molecules that constitute P700, greatly decreasing its re duction potential; P700 then passes an electron through two nearby chlorophylls to phylloqui none (QK; also called A1). Reduced phyllo quinone is reoxidized as it passes two electrons, one at a time (blue arrows), to an Fe-S protein (Fx) near the N side of the membrane. From Fx, electrons move through two more Fe-S centers (FA and F6) to the Fe-5 protein ferredoxin in the stroma. Ferredoxin then donates electrons antenna chlorophylls. (a)
to NADP + (not shown), reducing it to NADPH, one of the forms i n which the energy of photons is trapped in chloroplasts. (b) The trimeric structure (derived from PDB ID l ) B O), viewed from the thylakoid l umen perpendicular to the membrane, showing all protein subunits (gray) and cofactors. (c) A monomer of PSI with all the proteins omitted, revea l i ng the antenna and reaction-center chlorophy l l s (green with dark green Mg2 + ions in the center), carotenoids (yellow), and Fe-5 centers of the reaction center (space fi ll ing red and orange structures). The proteins in the complex hold the components rigidly i n orientations that maximize effic ient exci ton transfers between excited antenna molecules and the reaction center.
1 9.8
identical complexes, each composed of 1 1 different pro teins (Fig. 1 9-58b) . In this remarkable structure the many antenna chlorophyll and carotenoid molecules are pre cisely arrayed around the reaction center (Fig. 1 9-58c) . The reaction center's electron-carrying cofactors are therefore tightly integrated with antenna chlorophylls. This arrangement allows very rapid and efficient exciton transfer from antenna chlorophylls to the reaction center. In contrast to the single path of electrons in PSII, the electron flow initiated by absorption of a photon is be lieved to occur ttu·ough both branches of carriers in PSI. '.
The Centra l Photchemical Event: lig ht-Driven Electron Flow
[!ss]
The Cytochrome blComplex links Photosystems II and I Electrons temporarily stored in plastoquinol as a result of the excitation of P680 in PSII are carried to P700 of PSI via the cytochrome b6f complex and the soluble protein plastocyanin (Fig. 1 9-56, center) . Like Complex III of mi tochondria, the cytochrome b6f complex (Fig. 1 9-59) contains a b-type cytochrome with two heme groups (designated bH and bL) , a Rieske iron-sulfur protein (M,. 20,000) , and cytochrome f (named for the Latin frons, "leaf') . Electrons flow through the cytochrome b6j
.
-+- Plastocyanin
et'·. �
_ _ _ . .-'
Heme f
(P
Lumen side)
Stroma (N side)
(b)
(a)
FIGURE 1 9-59
tochrome b6f complex. (a)
Rieske iron sulfur protein :
. . ' '
Pla to- ',
Thylakoid lumen (p side)
I
ubunit IV
Stroma (N side) (c)
Electron and proton flow through the cy
The crystal structure of the complex (PDB ID 1 UM3) reveals the positions of the cofactors involved in electron transfers. In addition to the hemes of cytochrome b (heme bH and bL; also cal led heme bN and br, respectively, be cause of their proximity to the N and P sides of the bilayer) and cytochrome f (heme f), there is a fourth (heme x) near heme bH; there is also a {3-carotene of unknown function. Two sites bind plastoqui none: the PQH2 site near the P side of the bilayer, and the PQ site near the N side. The Fe-5 center of the Rieske protei n l ies just outside the bilayer o n the P side, and the heme f site is on a protei n domain that extends wel l i nto the thylakoid lumen. (b) The complex is a homodimer arranged to create a cavern connecting the PQH 2 and PQ sites (compare this with the struc ture of mitochondrial Complex Ill in Fig. 1 9-1 1 ). Th is cavern al lows plastoquinone to move between the sites of its oxidation and reduction. (c) Plastoqu inol (PQH 2 ) formed in PSI I is oxidized by the cytochrome b6f complex in a series of steps l ike those of the Q cycle in the cytochrome be, complex (Complex I l l ) of mito chondria (see Fig. 1 9-1 2). One electron from PQH 2 passes to the Fe-5 center of the Rieske protein, the other to heme bL of cytochrome b6. The net effect is passage of electrons from PQH2 to the soluble protein plastocyanin, which carries them to PSI .
[!so]
Oxidative Phosph orylation a n d Photophosphorylation
complex from PQ8H2 to cytochrome f, then to plasto cyanin, and finally to P700, thereby reducing it. Like Complex III of mitochondria, cytochrome b 6f conveys electrons from a reduced quinone-a mobile, lipid-soluble carrier of two electrons (Q in mitochondria, PQ8 in chloroplasts)-to a water-soluble protein that carries one electron (cytochrome c in mitochondria, plastocyanin in chloroplasts) . As in mitochondria, the function of this complex involves a Q cycle (Fig. 1 9-12) in which electrons pass, one at a time, from PQ8H2 to cy tochrome b 6 . This cycle results in the pumping of pro tons across the membrane; in chloroplasts, the direction of proton movement is from the stromal compartment to the thylakoid lumen, up to four protons moving for each pair of electrons. The result is production of a proton gradient across the thylakoid membrane as electrons pass from PSII to PSI. Because the volume of the flat tened thylakoid lumen is small, the influx of a small number of protons has a relatively large effect on lume nal pH. The measured difference in pH between the stroma (pH 8) and the thylakoid lumen (pH 5) repre sents a 1 ,000-fold difference in proton concentration-a powerful driving force for ATP synthesis. Cyclic Electron Flow between PSI and the Cytochrome b/ Complex Increases the Produ ction of ATP Relative to NADPH
Electron flow from PSII through the cytochrome b 6f complex, then through PSI to NADP+ , is sometimes called noncyclic electron flow, to distinguish it from cyclic electron flow, which occurs to varying degrees depending primarily on the light conditions. The non cyclic path produces a proton gradient, which is used to drive ATP synthesis, and NADPH, which is used in re ductive biosynthetic processes. Cyclic electron flow in volves only PSI, not PSII (Fig. 1 9-56) . Electrons passing from P700 to ferredoxin do not continue to NADP+ , but move back through the cytochrome b6 f complex to plas tocyanin. (This electron path parallels that in green sulfur bacteria, shown in Fig. 19-54b.) Plastocyanin then donates electrons to P700, which transfers them to ferredoxin. In this way, electrons are repeatedly recy cled through the cytochrome b6f complex and the reac tion center of PSI, each electron propelled around the cycle by the energy of one photon. Cyclic electron flow is not accompanied by net formation of NADPH or evo lution of 02. However, it is accompanied by proton pumping by the cytochrome b6f complex and by phos phorylation of ADP to ATP, referred to as cyclic pho tophosphorylation. The overall equation for cyclic electron flow and photophosphorylation is simply ADP + Pi
light
ATP + H 2 0
By regulating the partitioning of electrons between NADP+ reduction and cyclic photophosphorylation, a plant adjusts the ratio of ATP to NADPH produced in the light-dependent reactions to match its needs for these products in the carbon-assimilation reactions and other
biosynthetic processes. As we shall see in Chapter 20, the carbon-assimilation reactions require ATP and NADPH in the ratio 3:2. This regulation of electron-transfer pathways is part of a short-term adaptation to changes in light color (wave length) and quantity (intensity), as further described below. State Transitions Change the Distribution of LHCII between the Two Photosystems
The energy required to excite PSI (P700) is less (light of longer wavelength, lower energy) than that needed to ex cite PSII (P680) . If PSI and PSII were physically contigu ous, excitons originating in the antenna system of PSII would migrate to the reaction center of PSI, leaving PSII chronically underexcited and interfering with the opera tion of the two-center system. This imbalance in the sup ply of excitons is prevented by separation of the two photosystems in the thylakoid membrane (Fig. 1 9-60) . PSII is located almost exclusively in the tightly appressed membrane stacks of thylakoid grana; its associated light harvesting complex (LHCII) mediates the tight associa tion of adjacent membranes in the grana. PSI and the ATP synthase complex are located almost exclusively in the nonappressed thylakoid membranes (the stromal lamel lae) , where they have access to the contents of the stroma, including ADP and NADP+ . The cytochrome b6f complex is present primarily in the grana. The association of LHCII with PSI and PSII depends on light intensity and wavelength, which can change in the short term, leading to state transitions in the chloroplast. In state 1 , a critical Ser residue in LCHII is not phosphorylated, and LHCII associates with PSII. Under conditions of intense or blue light, which favor absorption by PSII, that photosystem reduces plasto quinone to plastoquinol (PQH2) faster than PSI can oxi dize it. The resulting accumulation of PQH2 activates a protein kinase that triggers the transition to state 2 by phosphorylating a Thr residue on LHCII (Fig. 1 9-6 1 ). Phosphorylation weakens the interaction of LHCII with PSII, and some LHCII dissociates and moves to the stro mal lamellae; here it captures photons (excitons) for PSI, speeding the oxidation of PQH2 and reversing the imbalance between electron flow in PSI and PSII. In less intense light (in the shade, with more red light) , PSI ox idizes PQH2 faster than PSII can make it, and the result ing increase in [PQ] triggers dephosphorylation of LHCII, reversing the effect of phosphorylation. The state transition in LCHII localization is mutually regulated with the transition from cyclic to noncyclic photophosphorylation, described above; the path of electrons is primarily noncyclic in state 1 and primarily cyclic in state 2 . Water Is Split b y t h e Oxygen-Evolving Complex
The ultimate source of the electrons passed to NADPH in plant (oxygenic) photosynthesis is water. Having given up an electron to pheophytin, P680+ (of PSII) must acquire
1 9.8
The Central Photochem ical Event: Lig ht-Driven Electron Flow
[7 s 7]
Ferredoxin: NADP+
oxidoreductase
�
(a) Stroma
Appressed membranes (grana! lamellae)
-
'-L--L-L-L-L_J Fatty
acid synthase
C02
n1ductwn
H
dehydration
l0 1"-->
H2 0
H
I
II
0
I R H
CH3-C=C-C- S
t•educlion
+W ' NADP
Saturated acyl group, lengthened by two carbons
FIGURE 21-2 Addition of two carbons to a growing fatty acyl chain: a
Each malonyl group and acetyl (or longer acyl) group is activated by a thioester that links it to fatty acid synthase, a multi enzyme system described later in the text. CD Condensation of an activated acyl group (an acetyl group from acetyi-CoA is the first acyl group) and two car bons derived from malonyi-CoA, with elimination of C02 from the mal onyl group, extends the acyl chain by two carbons. The mechanism of the first step of this reaction is given to illustrate the role of decarboxylation in faci litating condensation. The /3-keto product of this condensation is then reduced in three more steps nearly identical to the reactions of !3 oxidation, but in the reverse sequence: Q) the /3-keto group is reduced to an alcohol, ® elimination of H 20 creates a double bond, and @ the double bond is reduced to form the corresponding saturated fatty acyl group. four-step sequence.
The low-resolution structures of (a) the mammalian (porcine; derived from PDB ID 2CF2) and (b) fungal enzyme systems (derived from PDB IDs 2 UV9, 2 UVA, 2 UVB, and 2 UVC) are shown. (a) All of the active sites in the mammalian system are located in different domains within a single large polypeptide chain. The different enzymatic activites are: /3-ketoacyi ACP synthase (KS), malonyl/acetyl-CoA-ACP transferase (MAT), /3hydroxyacyl-ACP dehydratase (DH), enoyi-ACP reductase (ER), and /3-ketoacyi-ACP reductase (KR). ACP is the acyl carrier protein. The linear arrangement of the domains in the polypeptide is shown in the lower panel. The seventh domain (TE) is a thioesterase that releases the palmi tate product from ACP when the synthesis is completed. The ACP and TE domains are disordered in the crystal and are therefore not shown in the structure. (b) In the structure of the FAS I from the fungus Thermomyces Januginosus, the same active sites are divided between two multifunc tional polypeptide chains that function together. Six copies of each polypeptide are found in the heterododecameric complex. A wheel of six a subunits, which include ACP as well as the KS and KR active sites, is found at the center of the complex. In the wheel three subunits are found on one face, three on the other. On either side of the wheel are domes formed by !rimers of the !3 subunits (containing the ER and DH active sites, as well as two domains with active sites analogous to MAT in the mammalian enzyme). The domains of one of each type of subunit are col ored according to the active site colors of the mammal ian enzyme in (a). FIGURE 21-3 The structure of fatty acid synthase type I systems.
808
Lipid Biosynthesis
4H +
+ 4e �
t���
�����J
Fatty acid synthase
m -+ + 4e'- >
t � -> ->
"""-.n..L .J&__,->
FIGURE 2 1 -4 The overall process of palmitate synthesis. The fatty acyl chain grows by two-carbon units donated by activated malonate, with loss of C02 at each step. The initial acetyl group is shaded yellow, C-1 and C-2 of malonate are shaded pink, and the carbon released as C02 is shaded green. After each two-carbon addition, reductions convert the growing chain to a saturated fatty acid of four, then six, then eight carbons, and so on. The final product is pal mitate (1 6:0).
With FAS I systems, fatty acid synthesis leads to a single product, and no intermediates are released. When the chain length reaches 16 carbons, that prod uct (palmitate, 16:0; see Table 1 0-1) leaves the cycle. Carbons C- 16 and C-15 of the palmitate are derived from the methyl and carboxyl carbon atoms, respectively, of an acetyl-GoA used directly to prime the system at the outset ( Fig. 2 1 -4) ; the rest of the carbon atoms in the chain are derived from acetyl-GoA via malonyl-GoA. FAS II, in plants and bacteria, is a dissociated sys tem; each step in the synthesis is catalyzed by a sepa rate and freely diffusible enzyme. Intermediates are also diffusible and may be diverted into other pathways (such as lipoic acid synthesis) . Unlike FAS I, FAS II gen erates a variety of products, including saturated fatty acids of several lengths, as well as unsaturated, branched, and hydroxy fatty acids. An FAS II system is also found in vertebrate mitochondria. The discussion to follow will focus on the mammalian FAS I. The Mammalian Fatty Acid Synthase Has M u ltiple Active Sites
The multiple domains of mammalian FAS I function as distinct but linked enzymes. The active site for each en zyme is found in a separate domain within the larger polypeptide. Throughout the process of fatty acid syn thesis, the intermediates remain covalently attached as thioesters to one of two thiol groups. One point of
HS
+
Palmitate
attachment is the -SH group of a Cys residue in one of the synthase domains (j3-ketoacyl-ACP synthase; KS) ; the other is the -SH group of acyl carrier protein, a sep arate domain of the same polypeptide. Hydrolysis of thioesters is highly exergonic, and the energy released helps to make two different steps CCD and @ in Fig. 21-6) in fatty acid synthesis (condensation) ther modynamically favorable. Acyl carrier protein (ACP) is the shuttle that holds the system together. The Escherichia coli ACP is a small protein CMr 8,860) containing the prosthetic group 4' -phosphopantetheine (Fig. 2 1-5 ; compare this with the panthothenic acid and f3-mercaptoeth ylamine moiety of coenzyme A in Fig. 8-38) . The 4' -phosphopantetheine prosthetic group of E. coli ACP is believed to serve as a flexible arm, tethering the growing fatty acyl chain to the surface of the fatty acid synthase complex while carrying the reaction in termediates from one enzyme active site to the next. The ACP of mammals has a similar function and the same prosthetic group; as we have seen, however, it is embedded as a domain in a much larger multifunc tional polypeptide. Fatty Acid Synthase Receives the Acetyl a n d Malonyl Gro u ps
Before the condensation reactions that build up the fatty acid chain can begin, the two thiol groups on the enzyme complex must be charged with the correct acyl
2 1 .1 Biosynthesis of Fatty Acids and Eicosa noids
I
Ser side chain
CH2
I
0
I
-0-P=O
I
0
I
CH2
I
CH3 -C-CHs
I
CHOH
Pantothenic acid
I
C=O
I
HN
I
CHz
4' -Phospho pantetheine
I
CHz
I
C=O
I
HN
I
CH2
I
Malonyl groups are esterified to the - SH group.
CHz
I
SH
FIGURE 2 1 -5 Acyl carrier protein (ACP). The prosthetic group is 4' phosphopantethei ne, which is covalently attached to the hydroxyl group of a Ser residue in ACP. Phosphopantetheine contains the B vita min pantothenic acid, also found in the coenzyme A molecule. lts -SH group is the site of entry of malonyl groups during fatty acid synthesis.
groups (Fig. 2 1 -6, top) . First, the acetyl group of acetyl-GoA is transferred to ACP in a reaction catalyzed by the malonyllacetyl-CoA-ACP transferase (MAT in Fig. 2 1-6) domain of the multifunctional polypeptide. The acetyl group is then transferred to the Cys -SH group of the P-ketoacyl-ACP synthase (KS) . The sec ond reaction, transfer of the malonyl group from mal onyl-GoA to the -SH group of ACP, is also catalyzed by malonyl/acetyl-CoA-ACP transferase. In the charged synthase complex, the acetyl and malonyl groups are ac tivated for the chain-lengthening process. The first four steps of this process are now considered in some detail; all step numbers refer to Figure 2 1-6. Step CD Condensation
The first reaction in the for mation of a fatty acid chain is a formal Claisen conden sation involving the activated acetyl and malonyl groups to form acetoacetyl-ACP, an acetoacetyl group bound to ACP through the phosphopantetheine -SH group; simultaneously, a molecule of C02 is produced. In this reaction, catalyzed by {3-ketoacyl-ACP synthase, the acetyl group is transferred from the Cys -SH group of the enzyme to the malonyl group on the -SH of ACP, becoming the methyl-terminal two-carbon unit of the new acetoacetyl group.
[so9]
The carbon atom of the C02 formed in this reaction is the same carbon originally introduced into malonyl GoA from HC03 by the acetyl-GoA carboxylase reaction (Fig. 2 1-1) . Thus C02 is only transiently in covalent linkage during fatty acid biosynthesis; it is removed as each two-carbon unit is added. Why do cells go to the trouble of adding C02 to make a malonyl group from an acetyl group, only to lose the C02 during the formation of acetoacetate? Recall that in the f3 oxidation of fatty acids (see Fig. 1 7-8) , cleavage of the bond between two acyl groups (cleavage of an acetyl unit from the acyl chain) is highly exergonic, so the simple condensation of two acyl groups (two acetyl GoA molecules, for example) is highly endergonic. The use of activated malonyl groups rather than acetyl groups is what makes the condensation reactions ther modynamically favorable. The methylene carbon (C-2) of the malonyl group, sandwiched between carbonyl and carboxyl carbons, is chemically situated to act as a good nucleophile. In the condensation step (step (D) , decar boxylation of the malonyl group facilitates the nucle ophilic attack of the methylene carbon on the thioester linking the acetyl group to {3-ketoacyl-ACP synthase, dis placing the enzyme's -SH group. Coupling the conden sation to the decarboxylation of the malonyl group renders the overall process highly exergonic. A similar carboxylation-decarboxylation sequence facilitates the formation of phosphoenolpyruvate from pyruvate in glu coneogenesis (see Fig. 14-17). By using activated malonyl groups in the synthesis of fatty acids and activated acetate in their degradation, the cell makes both processes energetically favorable, although one is effectively the reversal of the other. The extra energy required to make fatty acid synthesis fa vorable is provided by the ATP used to synthesize mal onyl-GoA from acetyl-GoA and HC03 (Fig. 2 1-1). Step ® Reduction of the Carbonyl Group The ace toacetyl-ACP formed in the condensation step now under goes reduction of the carbonyl group at C-3 to form D-{3-hydroxybutyryl-ACP. This reaction is catalyzed by P-ketoacyl-ACP reductase (KR) and the electron donor is NADPH. Notice that the D-{3-hydroxybutyryl group does not have the same stereoisomeric form as the L-{3-hydrox yacyl intermediate in fatty acid oxidation (see Fig. 17-8) . Step @ Dehydration
The elements of water are now removed from C-2 and C-3 of D-{3-hydroxybutyryl-ACP to yield a double bond in the product, trans-112butenoyl-ACP. The enzyme that catalyzes this dehy dration is P-hydroxyacyl-ACP dehydratase (DH) . Step @ Reduction of the Double Bond Finally, the 2 double bond of trans-Ll -butenoyl-ACP is reduced (saturated) to form butyryl-ACP by the action of enoyl-ACP reductase (ER) ; again, NADPH is the elec tron donor.
[s10j
Lipid Biosynthesis
FIGURE 2 1 -6 Sequence of events during synthesis of a fatty acid. The
mammalian FAS I complex is shown schematically, with catalytic do mains colored as in Figure 2 1 -3 . Each domain of the larger polypep tide represents one of the six enzymatic activities of the complex, arranged in a large, tight "5" shape. The acyl carrier protein (ACP) is not resolved in the crystal structure shown in Figure 2 1 -3, but is attached to the KS domain. The phosphopantetheine arm of ACP ends in an -SH. After the first panel, the enzyme shown in color is the one that will act in the next step. As in Figure 2 1 -4, the initial acetyl group is shaded yel low, C-1 and C-2 of malonate are shaded pink, and the carbon released as C02 is shaded green. Steps CD to @ are described in the text.
Enoyl-ACP
-�-
reductase
�-Hydroxyacyl-ACP dehydratase
ll·Kftoacyi-ACP H synthase
SH
CoA-SH
®
Translocation of butyryl group to Cys on 13-ketoacyl-ACP synthase (KS)
0
®
Recharging of ACP with another malonyl group (MAT)
CoA-SH
0
II
Malonyl-CoA
9c -cn2\. �c-s II (;or
0� r";
-o
V U ;.!
3
CH3- CH2- CH2- C - S
Fatty acid synthase complex charged with an acetyl and a malonyl group
'
HS
Butyryl-ACP
0
NADP +
CD
Condensation (KS)
NADPH
H+
0
II
0
II
+
---_J ---1
@
Reduction of double bond (ER)
CH3- CH = CH- C - S
S-C - CH2 - C --CH3
II
0
HS
13-Ketobutyryl-ACP
trans-!!.2-Butenoyl-ACP
0
II
®
Reduction of 13-keto group (KR)
NADPH + n + NADP +
C H3 - CH-CH2 - C -S
I
OH
®
Dehydration (DH) 13-Hydroxybutyryl-ACP
2 1 . 1 Biosynthesis of Fatty Acids and Eicosanoids
The Fatty Acid Synthase Reactions Are Repeated to Form Palmitate
Production of the four-carbon, saturated fatty acyl-ACP marks completion of one pass through the fatty acid syn thase complex. The butyryl group is now transferred from the phosphopantetheine -SH group of ACP to the Cys -SH group of ,8-ketoacyl-ACP synthase, which ini tially bore the acetyl group (Fig. 21-6) . To start the next cycle of four reactions that lengthens the chain by two more carbons, another malonyl group is linked to the now unoccupied phosphopantetheine -SH group of ACP ( Fig. 2 1 -7 ) . Condensation occurs as the butyryl
0
II
+
Butyryl group
then seven cycles of condensation and reduction:
o
" ,f" c -- CH2- c " f"
0
group, acting like the acetyl group in the first cycle, is linked to two carbons of the malonyl-ACP group with concurrent loss of C02. The product of this condensation is a six-carbon acyl group, covalently bound to the phos phopantetheine -SH group. Its ,8-keto group is reduced in the next three steps of the synthase cycle to yield the saturated acyl group, exactly as in the first round of re actions-in this case forming the six-carbon product. Seven cycles of condensation and reduction pro duce the 1 6-carbon saturated palmitoyl group, still bound to ACP. For reasons not well understood, chain elongation by the synthase complex generally stops at this point and free palmitate is released from the ACP by a hydrolytic activity (thioesterase; TE) in the multifunc tional protein. We can consider the overall reaction for the synthe sis of palmitate from acetyl-GoA in two parts. First, the formation of seven malonyl-GoA molecules:
7 Acetyl-CoA + 7C02 7ATP -+ 7 malonyl-CoA + 7ADP + 7Pi (21-1)
CH 3 -CH 2-CH2-C- S
-o
[st t]
Acetyl-CoA + 7 malonyl-CoA + 14NADPH + 14H+ -+ palmitate + 7C02 + 8 CoA + 14NADP+ + 6H20 (21-2)
S-CoA Malonyl-CoA
CoA-SH
Note that only six net water molecules are produced, because one is used to hydrolyze the thioester linking the palmitate product to the enzyme. The overall process (the sum of Eqns 2 1-1 and 21-2) is
8 Acetyl-CoA + 7 ATP + 14NADPH + 14H+ -+ palmitate + 8 CoA + 7ADP + 7Pi + 14NADP+ + 6H20 (21-3)
0 'I
t
-S - - CH2- C -CH2 -CH2 - CH3
II
0
H
,6-Ketoacyl-ACP FIGURE 2 1 -7 Beginning of the second round of the fatty acid syn
The butyryl group is on the Cys -SH group. The incom ing malonyl group is first attached to the phosphopantetheine -SH group. Then, in the condensation step, the entire butyryl group on the Cys -SH is exchanged for the carboxyl group of the malonyl residue, which is lost as C02 (green). This step is analogous to step G) in Figure 2 1-6. The product, a six-carbon {3-ketoacyl group, now contains four carbons derived from malonyi-CoA and two derived from the acetyi CoA that started the reaction. The {3-ketoacyl group then undergoes steps 0 through @, as in Figure 2 1 -6. thesis cycle.
The biosynthesis of fatty acids such as palmitate thus re quires acetyl-GoA and the input of chemical energy in two forms: the group transfer potential of ATP and the reducing power of NADPH. The ATP is required to attach C0 2 to acetyl-GoA to make malonyl-GoA; the NADPH is required to reduce the double bonds. In nonphotosynthetic eukaryotes there is an addi tional cost to fatty acid synthesis, because acetyl-GoA is generated in the mitochondria and must be transported to the cytosol. As we will see, this extra step consumes two ATPs per molecule of acetyl-GoA transported, in creasing the energetic cost of fatty acid synthesis to three ATPs per two-carbon unit. Fatty Acid Synthesis Occurs in the Cytosol of Many Organisms but i n the Chloroplasts of Plants
In most higher eukaryotes, the fatty acid synthase com plex is found exclusively in the cytosol (Fig. 2 1-8 ), as are the biosynthetic enzymes for nucleotides, amino acids, and glucose. This location segregates synthetic processes from degradative reactions, many of which take place in the mitochondrial matrix. There is a corre sponding segregation of the electron-carrying cofactors used in anabolism (generally a reductive process) and those used in catabolism (generally oxidative) .
[s1 2]
lipid Biosynthesis
Animal cells, yeast cells
Plant cells
n••• •
•
•
•• •
•
•
---
Fatty acid oxidation Acetyl-CoA production Ketone body synthesis Fatty acid elongation
.....-:;c:;av:�g•
by ,.,umd
prot cas{•
migrates to nucleus
DNA
I
[
�
c:;� c�
Transcription of target genes is activated
sterol levels decline, the complex m igrates to the Golgi complex, and SREBP is cleaved by two different proteases in succession. The liber ated ami no-termi nal domain of SREBP migrates to the nucleus, where it activates transcription of sterol-regu Iated genes.
[842]
Lipid Biosynthesis
H�IC:-Coi\ 1
1
Acetyl-CoA
Golgi complex. In the Golgi complex, SREBP is cleaved twice by two different proteases, the second cleavage releasing the amino-terminal domain into the cytosol. This domain travels to the nucleus and activates tran scription of its target genes. The amino-terminal domain of SREBP has a short half-life and is rapidly degraded by proteasomes (see Fig. 27-48) . When sterol levels in crease sufficiently, the proteolytic release of SREBP amino-terminal domains is again blocked, and protea some degradation of the existing active domains results in a rapid shut-down of the gene targets. Several other mechanisms also regulate cholesterol synthesis ( Fig. 2 1-44 ) . Hormonal control is mediated by covalent modification of HMG-CoA reductase itself. The enzyme exists in phosphorylated (inactive) and de phosphorylated (active) forms. Glucagon stimulates phosphorylation (inactivation) , and insulin promotes dephosphorylation, activating the enzyme and favoring cholesterol synthesis. High intracellular concentrations of cholesterol activate ACAT, which increases esterifi cation of cholesterol for storage. Finally, a high cellular
multistep
{3-Hydroxy-{3-methyl glutaryl-CoA J'('ducta.-;(•
@+--- - - - - insulin
�{;>+. 'J
.. ·:'t!'f!· .),
.1
//
Preuroporphyrinogen �
.•
"
li :· t'l'!:.>.
.
Urophorphyrinogen III �
.. fi{�,,it:
'"
Oz
Dopamine
·1-
NHa
Tetrahydrobiopterin 02 H20 Dihydrobiopte1in
� ��
ru,mntlr mmonvrl dt.carbox ·I o
+
NHa I CH2-CH-Coo-
H
5-Hydroxy try ptophan
••
erotonin
Epinephrine FIGURE 22-29 Biosynthesis of some neurotransmitters from amino acids. The key step is the same in each
case: a PLP-dependent decarboxylation (shaded in pink).
designed to interfere with either the synthesis or the ac tion of histamine. A prominent example is the histamine receptor antagonist cimetidine (Tagamet), a structural analog of histamine:
It promotes the healing of duodenal ulcers by inhibiting secretion of gastric acid. Polyamines such as spermine and spermidine, in volved in DNA packaging, are derived from methionine and ornithine by the pathway shown in Figure 22-30 . The first step is decarboxylation of ornithine, a precursor of arginine (Fig. 22-10) . Ornithine decarboxylase, a PLP-requiring enzyme, is the target of several powerful inhibitors used as pharmaceutical agents (Box 22-3) . •
[ss o]
Biosynthesis of A m i n o Acids, N u cleotid es, a n d Rel ated Molecules
ATP
I Methionine 1 --\,. __o,.--/ '----� --"'
coo I
H3N-C-H +
I
CH 2
S-Adenosylmethionine
I
CHz
I
+s
I
---0deno ine I
CHa
Hs
•
NHa +
+
I
H3N-CHz-CHz-CH2-CH -COO-
-�::
.,.
Putrescine
CH3-S--i Adenosine
CH2
'
�
H3N-(CH:.!)4-NH3
Ornithine
-,Ad nos�
tHa
Decarboxylated adoMet
Methylthioadenosine +
prop)'laminotransl(>ra"Se Il
FIGURE 22-30 Biosynthesis of spermidine and spermine. The PLP
dependent decarboxylation steps are shaded in pink. In these reac tions, 5-adenosyl meth ionine (in its decarboxylated form) acts as a source of propylamino groups (shaded blue).
+
H3N-(CH2)a -NH-(CH2)4 -NH3
I
Spermidine
CH3-S--i Adenosine +
+
I
H3N-(CH2h -NH-(CHz)4 -NH-(CHz)a-NH3 Spermine
Curing African Sleeping Sickness with a Biochemical Tro an Horse African sleeping sickness, or African trypanosomiasis, is caused by protists (single-celled eukaryotes) called trypanosomes (Fig. 1 ). This disease (and related try panosome-caused diseases) is medically and economi cally significant in many developing nations. Until the late twentieth century, the disease was virtually incur able. Vaccines are ineffective because the parasite has a novel mechanism to evade the host immune system. The cell coat of trypanosomes is covered with a sin gle protein, which is the antigen to which the immune system responds. Every so often, however, by a process of genetic recombination (see Table 28-1), a few cells in the population of infecting trypanosomes switch to a new protein coat, not recognized by the immune system. This process of "changing coats" can occur hundreds of times. The result is a chronic cyclic infection: the human host develops a fever, which subsides as the immune system beats back the first infection; trypanosomes with changed coats then become the seed for a second infec tion, and the fever recurs. This cycle can repeat for weeks, and the weakened person eventually dies. Some modern approaches to treating African sleep ing sickness have been based on an understanding of enzymology and metabolism. In at least one such approach, this involves pharmaceutical agents designed as mechanism-based enzyme inactivators (suicide
FIGURE 1 Trypanosoma brucei rhodesiense, one of several try panosomes known to cause African sleeping sickness.
inactivators; p. 204). A vulnerable point in trypanosome metabolism is the pathway of polyamine biosynthesis. The polyamines spermine and spermidine, involved in DNA packaging, are required in large amounts in rap idly dividing cells. The first step in their synthesis is cat alyzed by ornithine decarboxylase, a PLP-requiring enzyme (see Fig. 22-30). In mammalian cells, ornithine decarboxylase undergoes rapid turnover-that is, a constant round of enzyme degradation and synthesis. In some trypanosomes, however, the enzyme (for rea sons not well understood) is stable, not readily replaced by newly synthesized enzyme. An inhibitor of ornithine
22.3 Molecules Derived from A m i no Acids
[ss1]
Ornithine
Putrescine
FIGURE 2 Mechanism of ornithine decarboxylase reaction.
decarboxylase that binds permanently to the enzyme
putrescine is produced (see
would thus have little effect on human cells, which
mechanism, several suicide inactivators have been de
could rapidly replace inactivated enzyme, but would
signed,
adversely affect the parasite.
(DFMO). DFMO
The first few steps of the normal reaction catalyzed by ornithine decarboxylase are shown in Figure
2.
of
which
is
Based on this
difluoromethylornithine
is relatively inert in solution. When it
binds to ornithine decarboxylase, however, the enzyme
Once
is quickly inactivated
C02 is released, the electron movement is reversed and
(Fig. 3).
The inhibitor acts by
providing an alternative electron sink in the form of two strategically placed fluorine atoms, which are ex
DFMO
cellent leaving groups. Instead of electrons moving into
F"- /F
the ring structure of PLP, the reaction results in dis
CH o I // H2N-CCH1 3-C1
(?� Vv
®--o-c
one
Fig. 22-30).
CH
placement of a fluorine atom. The
S
of a Cys residue at
the enzyme's active site then forms a covalent complex
0
with the highly reactive PLP-inhibitor adduct in an es sentially irreversible reaction. In this way, the inhibitor makes use of the enzyme's own reaction mechanisms to kill it.
oH
DFMO
l_+N _lCH3 H
treat African sleeping sickness caused by Trypanosoma
_
Pyridoxal phosphate
has proved highly effective against African
sleeping sickness in clinical trials and is now used to
brucei gambiense. Approaches such as this show great promise for treating a wide range of diseases. The
Schiff base
design of drugs based on enzyme mechanism and struc ture can complement the more traditional trial-and error methods of developing pharmaceuticals.
F
FIGURE 3 Inhibition of ornithine decarboxylase by DFMO.
additional rearrangements
)
Stuck!
[ss2�
Biosynthesis of Amino Acids, N ucl eotides, a n d Re lated Molecules
+
coo-
I HN-C-H 3
I
CH2
I
CH2 I CH2 I NH I + C=NH2
I
C
NADP
NJ
+
coo-
I HN-C-H 3 I CH2
,
1
I
CH2 I CH2 I NH I C=N-OH
H20
\.�
2NADPH,02
coo-
+
I HN-C-H 3
I
ADP ,fl,O
J
I
CH2
�
CH2 I CH2 + NO' I NH Nitric I oxide C=O
I
I
NH2
NH2
NH2 Arginine
Citrulline
Hydroxyarginine
FIGURE 22-31 Biosynthesis of nitric oxide. Both steps are catalyzed by nitric oxide synthase. The ni trogen of the NO is derived from the guan idinium group of arginine.
phosphate. D-Amino acids are commonly found in certain bacterial walls and certain antibiotics.
Arginine Is the Precursor for Biological Synthesis of N itric Oxide A surprise finding in the mid-1980s was the role of nitric oxide (NO)-previously known mainly as a component of smog-as an important biological messenger. This simple gaseous substance diffuses readily through mem branes, although its high reactivity limits its range of dif fusion to about a 1 mm radius from the site of synthesis. In humans NO plays a role in a range of physiological processes, including neurotransmission blood clotting and the control of blood pressure. Its �ode of action i� described in Chapter 12 (p. 446). Nitric oxide is synthesized from arginine in an NADP H-dependent reaction catalyzed by nitric oxide synthase (Fig. 22-3 1 ) , a dimeric enzyme structurally related to NADPH cytochrome P -450 reductase (see Box 21-1). The reaction is a five-electron oxidation. Each subunit of the enzyme contains one bound mole cule of each of four different cofactors: FMN, FAD, tetrahydrobiopterin, and Fe:J+ heme. NO is an unstable molecule and cannot be stored. Its synthesis is stimu lated by interaction of nitric oxide synthase with Ca2+ calmodulin (see Fig. 12-11).
S U M M A R Y 2 2 .3 •
•
•
Molecules Derived from Amino Acids
Many important biomolecules are derived from amino acids. Glycine is a precursor of porphyrins. Degradation of iron-porphyrin (heme) generates bilirubin, which is converted to bile pigments, with several physiological functions. Glycine and arginine give rise to creatine and phosphocreatine, an energy buffer. Glutathione, formed from three amino acids, is an important cellular reducing agent. Bacteria synthesize D-amino acids from L-amino acids in racemization reactions requiring pyridoxal
•
•
The aromatic amino acids give rise to many plant substances. The PLP -dependent decarboxylation of some amino acids yields important biological amines, including neurotransmitters. Arginine is the precursor of nitric oxide, a biological messenger.
22.4 Biosynthesis a nd Degradation of Nudeotides As discussed in Chapter 8, nucleotides have a variety of important functions in all cells. They are the precursors of DNA and RNA. They are essential carriers of chemical energy-a role primarily of ATP and to some extent GTP. They are components of the cofactors NAD FAD S-adenosylmethionine, and coenzyme A, as well as of activated biosynthetic intermediates such as UDP glucose and CDP-diacylglycerol. Some, such as cAMP and cGMP, are also cellular second messengers. Two types of pathways lead to nucleotides: the de novo pathways and the salvage pathways. De novo synthesis of nucleotides begins with their metabolic pre cursors: amino acids, ribose 5-phosphate, C02, and NH3. Salvage pathways recycle the free bases and nucleo sides released from nucleic acid breakdown. Both types of pathways are important in cellular metabolism and both are discussed in this section. The de novo pathways for purine and pyrimidine biosynthesis seem to be nearly identical in all living or ganisms. Notably, the free bases guanine adenine thymine, cytidine, and uracil are not inten� ediates i� these pathways; that is, the bases are not synthesized and then attached to ribose, as might be expected. The purine ring structure is built up one or a few atoms at a time, attached to ribose throughout the process. The pyrimidine ring is synthesized as orotate , attached to
22.4 B i osynth es i s a n d Deg radation of Nucleotides
ribose phosphate, and then converted to the common pyrimidine nucleotides required in nucleic acid synthe sis. Although the free bases are not intermediates in the de novo pathways, they are intermediates in some of the salvage pathways. Several important precursors are shared by the de novo pathways for synthesis of pyrimidines and purines. Phosphoribosyl pyrophosphate (PRPP) is important in both, and in these pathways the structure of ribose is retained in the product nucleotide, in contrast to its fate in the tryptophan and histidine biosynthetic pathways dis cussed earlier. An amino acid is an important precursor in each type of pathway: glycine for purines and aspartate for pyrimidines. Glutamine again is the most important source of amino groups-in five clifferent steps in the de novo pathways. Aspartate is also used as the source of an amino group in the purine pathways, in two steps. 1\vo other features deserve mention. First, there is evidence, especially in the de novo purine pathway, that the enzymes are present as large, multienzyme com plexes in the cell, a recurring theme in our discussion of metabolism. Second, the cellular pools of nucleotides (other than ATP) are quite small, perhaps 1% or less of the amounts required to synthesize the cell's DNA. Therefore, cells must continue to synthesize nu cleotides during nucleic acid synthesis, and in some cases nucleotide synthesis may limit the rates of DNA replication and transcription. Because of the impor tance of these processes in dividing cells, agents that in hibit nucleotide synthesis have become particularly important in medicine. We examine here the biosynthetic pathways of purine and pyrimidine nucleotides and their regulation, the formation of the deoxynucleotides, and the degrada tion of purines and pyrimidines to uric acid and urea. We end with a discussion of chemotherapeutic agents that affect nucleotide synthesis.
De N ovo Purine N ucleotide Synthesis Begins with PRPP The two parent purine nucleotides of nucleic acids are adenosine 5'-monophosphate (AMP; adenylate) and guanosine 5'-monophosphate (GMP; guanylate), contain ing the purine bases adenine and guanine. Figure 22-32 shows the origin of the carbon and ni trogen atoms of the purine ring system, as determined by John Buchanan using isotopic tracer experiments in birds. The de tailed pathway of purine biosyn thesis was worked out primarily by Buchanan and G. Robert Greenberg in the 1950s. In the first committed step of the pathway, an amino group John Buchanan
Aspartate
[ss3]
Glycine
Formate
Formate
FIGURE 22-32 Origin of the ring atoms of purines. Th is i nformation was obtained from isotopic experiments with 1 4C- or 15 N-Iabeled pre cursors. Formate is supplied in the form of N10-formyltetrahydrofolate.
donated by glutamine is attached at C-1 of PRPP ( Fig 22-33). The resulting 5-phosphoribosylamine is highly unstable, with a half-life of 30 seconds at pH 7.5. The purine ring is subsequently built up on this struc ture. The pathway described here is identical in all organisms, with the exception of one step that differs in higher eukaryotes as noted below. The second step is the addition of three atoms from glycine (Fig. 22-33, step @). An ATP is consumed to ac tivate the glycine carboxyl group (in the form of an acyl phosphate) for this condensation reaction. The added glycine amino group is then formylated by N10-formylte trahydrofolate (step @), and a nitrogen is contributed by glutamine (step @), before dehydration and ring clo sure yield the five-membered imidazole ring of the purine nucleus, as 5-aminoimidazole ribonucleotide (AIR; step @). At this point, three of the six atoms needed for the second ring in the purine structure are in place. To complete the process, a carboxyl group is first added (step @). This carboxylation is unusual in that it does not require biotin, but instead uses the bicarbonate gen erally present in aqueous solutions. A rearrangement transfers the carboxylate from the exocyclic amino group to position 4 of the imidazole ring (step (f)). Steps @ and (f) are found only in bacteria and fungi. In higher eukaryotes, including humans, the 5-aminoimidazole ri bonucleotide product of step @ is carboxylated directly to carboxyaminoimidazole ribonucleotide in one step in stead of two (step IQ§)). The enzyme catalyzing this re action is AIR carboxylase. Aspartate now donates its amino group in two steps c® and @): formation of an amide bond, followed by elimination of the carbon skeleton of aspartate (as fumarate). (Recall that aspartate plays an analogous role in two steps of the urea cycle; see Fig. 18-10.) The final carbon is contributed by N10-formyltetrahydrofo late (step @), and a second ring closure takes place to yield the second fused ring of the purine nucleus (step @). The first intermediate with a complete purine ring is inosinate (IMP). .
[aa4]
Biosynthesis of A m i n o Acids, N u c l eotides, and Related Molecules
�O-CH2
0
AIR
p -ixo--®-® 1'H'
�
H
5-Phosphoribosyl 1-pyrophosphate (PRPP)
OH OH CD
�- H2
HC0 :3 ATP
ADP + P;
Gl utamine
H
G lutamate
ppl
H
0
l
N5-Carboxyaminoimidazole ribonucleotide (N5-CAIR)
R
5-Phospho-.B n-ribosylamine
H
OH OH
@
Glycine
ATP ADP
+
P,
Glycinamide ribonucleotide (GAR)
� N10-Formyl H4 folate � H4 folate
R
®
H N H2c"" 'c-H I II O=C O
�
Formylglycinamide ribonucleotide (FGAR)
R
r
Carboxyamino imidazole ribonucleotide (CAIR) R Aspartate..
coo
l CH2
I
ATP AD P + P;
0
H I HC-
cooH2 I
G lu tam ine
, e-ll 'cB
C
N
N -Succi nyl-5-aminoi.m.idazole-4-
carbox�ide ribonucleotide SAICAR)
R
®� Fumarate
Glutamate
5-Aminoimidazole-4-catboxamide
ATP ADP
H N H. c"" 'c-H 2
I
HN=C
II
0
+
ribon ucleotide !AlGAR!
P;
@ � N10-Formyl H4 folate � H4 folate
Formylglycinamidine ribonucleotide (FGAM)
0
II
N""0' ...-\_ H
H2
II
C O=C-N"" :N
H H
R
�
amidotransferase GAR transformylase
FGAR amidotransferase FGAM cyclase (AIR synthetase)
@ N5-CAIR synthetase � AIR carboxylase G) N5-CAIR mutase
De novo synthesis of purine nucleotides: construction
of the purine ring of inosinate (IMP).
Each addition to the puri ne ring is shaded to match Figure 22-32. After step (I), R symbolizes the 5-phospho-o-ribosyl group on which the purine ring is bui lt. Formation of 5-phosphoribosylamine (step G)J is the first committed step in purine synthesis. Note that the product of step @, AICAR, is the rem nant of ATP released during h istidine biosynthesis (see Fig. 22-20, step �)J. Abbreviations are given for most i ntermediates to simpl ify the naming of the enzymes. Step � is the alternative path from AIR to CAIR occurring i n h igher eukaryotes.
CD glutamine-PRPP
@ GAR synthetase
5-Aminoimidazole ribonucl otide (AIR I
FIGURE 22-33
N-Formylaminoimidazole4-carboxamide ribonucleotide (FAICARl
Inosinate (IMP)
�
SAlCAR synthetase SAICAR lyase
AICAR transformylase
@ IMP synthase
[BBsJ
22.4 B i osynthesis a n d D e g radation of Nucleotides
- OOC-CH2
GTP
GOP + P,
Aspartate II •
Inosinate (IMP)
H
i._�N> N
FIGURE 22-34 Biosynthesis of
Fumarate ---,d:::._ 0> N
� �-I:)
N
l
HN�N'
'l-):_N> NH2
Adenylosuccinate
0
AMP and GMP from IMP.
c-c oo-
�H
-
H20
XMP-glutamine
amidotransferasc
AMP + PPi
J
�)
Guanylate (GMP)
Xanthylate CXMP)
As in the tryptophan and histidine biosynthetic pathways, the enzymes of IMP synthesis seem to be or ganized as large, multienzyme complexes in the cell. Once again, evidence comes from the existence of single polypeptides with several functions, some catalyzing nonsequential steps in the pathway. In eukaryotic cells ranging from yeast to fruit flies to chickens, steps (D, @, and @ in Figure 22-33 are catalyzed by a multifunc tional protein. An additional multifunctional protein cat alyzes steps ® and @. In humans, a multifunctional enzyme combines the activities of AIR carboxylase and SAICAR synthetase (steps @ and @). In bacteria, these activities are found on separate proteins, but the pro teins may form a large noncovalent complex. The chan neling of reaction intermediates from one enzyme to the next permitted by these complexes is probably espe cially important for unstable intermediates such as 5phosphoribosylamine. Conversion of inosinate to adenylate requires the insertion of an amino group derived from aspartate (Fig. 22-34) ; this takes place in two reactions similar to those used to introduce N-1 of the purine ring (Fig. 22-33, steps @ and @). A crucial difference is that GTP rather than ATP is the source of the high-energy phos phate in synthesizing adenylosuccinate. Guanylate is formed by the NAD + -requiring oxidation of inosinate at C-2, followed by addition of an amino group derived from glutamine. ATP is cleaved to AMP and PPi in the final step (Fig. 22-34). Pu rine N ucleotide Biosynthesis Is Regulated by Feedback I nhibition
Three major feedback mechanisms cooperate in regu lating the overall rate of de novo purine nucleotide synthesis and the relative rates of formation of the two end products, adenylate and guanylate (Fig. 2 2-3 5 ) .
1
Ribose 5-phosphate ribose phosphate pyrophosphokinase (PRPP synthetase)
®
vntheta�·w
" - Cytidine 5'-triphos phate (CTP) phosphoribosyltransferase. The first step in this pathway (not shown here; see Fig. 1 8-1 1 a) i s the synthesis of carbamoyl phosphate from C02 and N H!, catalyzed in eukaryotes by carbamoyl phosphate synthetase I I .
22.4 Bio synthesis a n d Degradation of Nucleotides
[ss7]
identical polypeptide chains (each of Mr 230,000), each with active sites for all three reactions. This suggests that large, multienzyme complexes may be the rule in this pathway. Once orotate is formed, the ribose 5-phosphate side chain, provided once again by PRPP, is attached to yield orotidylate (Fig.
22-36).
Orotidylate is then decarboxy
lated to uridylate, which is phosphorylated to UTP. CTP is formed from UTP by the action of cytidylate syn thetase , by way of an acyl phosphate intermediate (consuming one ATP) . The nitrogen donor is normally glutamine, although the cytidylate synthetases in many species can use NH� directly.
Pyrimidine N ucleotide Biosynthesis Is Regulated by Feedback Inhibition Regulation of the rate of pyrimidine nucleotide synthe sis in bacteria occurs in large part through aspartate transcarbamoylase (ATCase) , which catalyzes the first reaction in the sequence and is inhibited by CTP, the end product of the sequence (Fig.
22-36). The bacterial
ATCase molecule consists of six catalytic subunits and
6-32).
six regulatory subunits (see Fig.
The catalytic
subunits bind the substrate molecules , and the allosteric subunits bind the allosteric inhibitor, CTP. The entire ATCase molecule, as well as its subunits, exists in two FIGURE 22-37 Channeling of intermediates in bacterial carbamoyl phosphate synthetase.
(Derived from PDB ID 1 M6V) The reaction cat alyzed by this enzyme is i l l ustrated in Figure 1 8-1 1 a. The large and small subun its are shown in gray and blue, respectively; the channel between active sites (almost 1 00 A long) is shown as a yellow mesh. A glutamine molecule (green) binds to the small subun it, donating its amido n itrogen as N H; in a glutam ine amidotransferase-type reac tion. The NH; enters the channel, which takes it to a second active site, where it combines with bicarbonate in a reaction requ iring ATP (bound ADP in bl ue). The carbamate then reenters the channel to reach the third active site, where it is phosphorylated to carbamoyl phos phate (bound ADP in red).
conformations, active and inactive. When CTP is not bound to the regulatory subunits, the enzyme is maxi mally active. As CTP accumulates and binds to the regu latory subunits, they undergo a change in conformation. This change is transmitted to the catalytic subunits, which then also shift to an inactive conformation. ATP prevents the changes induced by CTP. activity of ATCase.
Normal activity ......__ TP ( ·no TP) � "' - u- + 11.
omn �
Carbamoyl phosphate reacts with aspartate to yield
// � '/______ "-cTP
N-carbamoylaspartate in the first committed step of pyrimidine biosynthesis (Fig. catalyzed by
22-36).
Figure 2 2-38
shows the effects of the allosteric regulators on the
This reaction is
aspartate transcarbamoylase. In bacte
ria, this step is highly regulated, and bacterial aspartate transcarbamoylase is one of the most thoroughly stud ied allosteric enzymes (see below) . By removal of water
di hydroorotase , the pyrimidine ring is closed to form L from N-carbamoylaspartate, a reaction catalyzed by
10 K0_5
dihydroorotate . This compound is oxidized to the
=
1
30
20
12 mM
K0_5
=
23 mM
[Aspartate] (mM)
pyrimidine derivative orotate, a reaction in which NAD + is the ultimate electron acceptor. In eukaryotes, the first
FIGURE 22-38 Allosteric regulation of aspartate transcarbamoylase
three enzymes in this pathway-carbamoyl phosphate
by CTP and ATP.
synthetase II, aspartate transcarbamoylase, and dihy droorotase-are part of a single trifunctional protein. The protein, known by the acronym CAD, contains three
Addition of 0.8 mM CTP, the al losteric inhi bitor of ATCase, increases the K0 _5 for aspartate (lower curve) and the rate of conversion of aspartate to N-carbamoylaspartate. ATP at 0.6 mM fully reverses this effect (middle curve).
[ass]
B i osynthes i s of A m i n o Acids, Nucleotides, a n d Related Molecules
N u cl eoside Mono phosphates Are Converted
dNDP
NDP
to N u cleoside Triphosphates
Nucleotides to be used in biosynthesis are generally converted to nucleoside triphosphates. The conversion pathways are common to all cells. Phosphorylation of AMP to ADP is promoted by adenylate kinase, in the reaction
ATP + AMP � 2 ADP The ADP so formed is phosphorylated to ATP by the gly colytic enzymes or through oxidative phosphorylation. ATP also brings about the formation of other nucle oside diphosphates by the action of a class of enzymes called nucleoside monophosphate kinases. These enzymes, which are generally specific for a particular base but nonspecific for the sugar (ribose or deoxyri bose), catalyze the reaction
ATP + NMP
�
ADP + NDP
The efficient cellular systems for rephosphorylating ADP to ATP tend to pull this reaction in the direction of products. Nucleoside diphosphates are converted to triphos phates by the action of a ubiquitous enzyme, nucleoside diphosphate kinase, which catalyzes the reaction
NTPn + NDPA
�
NDPn + NTPA
This enzyme is notable in that it is not specific for the base (purines or pyrimidines) or the sugar (ribose or de oxyribose). This nonspecificity applies to both phos phate acceptor (A) and donor (D), although the donor (NTPD) is almost invariably ATP because it is present in higher concentration than other nucleoside triphos phates nnder aerobic conditions. Ribonu cleotides Are the Precursors of Deoxyribonucleotides
Deoxyribonucleotides, the building blocks of DNA, are derived from the corresponding ribonucleotides by direct reduction at the 2 '-carbon atom of the D-ribose to form the 2 ' -deoxy derivative. For example, adenosine diphosphate (ADP) is reduced to 2 ' -deoxyadenosine diphosphate (dADP), and GDP is reduced to dGDP. This reaction is somewhat unusual in that the reduction occurs at a nonactivated carbon; no closely analogous chemical reactions are known. The reaction is catalyzed by ribonucleotide reductase , best characterized in E. coli, in which its substrates are ribonucleoside diphosphates. The reduction of the D-ribose portion of a ribonu cleoside diphosphate to 2 ' -deoxy-D-ribose requires a pair of hydrogen atoms, which are ultimately donated by NADPH via an intermediate hydrogen-carrying protein, thioredoxin. This ubiquitous protein serves a similar redox function in photosynthesis (see Fig. 20-19) and other processes. Thioredoxin has pairs of -SH groups that carry hydrogen atoms from NADPH to the ribonu-
NADPH + H+
NADPH + W
(a)
(b)
FIGURE 22-39 Reduction of ribonucleotides to deoxyribonucleotides by ribonucleotide reductase.
Electrons are transmitted (blue arrows) to the enzyme from NADPH via (a) glutaredoxi n or (b) thioredoxi n . The sulfide groups in glutaredoxin reductase are contributed by two molecules of bound glutathione (GSH; GSSG i ndicates oxidized glu tathione). Note that thioredoxin reductase is a flavoenzyme, with FAD as prosthetic group.
cleoside diphosphate. Its oxidized (disulfide) form is reduced by NADPH in a reaction catalyzed by thiore doxin reductase (Fig. 2 2-39 ), and reduced thiore doxin is then used by ribonucleotide reductase to reduce the nucleoside diphosphates (NDPs) to deoxyri bonucleoside diphosphates (dNDPs). A second source of reducing equivalents for ribonucleotide reductase is glutathione (GSH). Glutathione serves as the reductant for a protein closely related to thioredoxin, glutare doxin, which then transfers the reducing power to ribonucleotide reductase (Fig. 22-39). Ribonucleotide reductase is notable in that its reac tion mechanism provides the best-characterized exam ple of the involvement of free radicals in biochemical transformations, once thought to be rare in biological systems. The enzyme in E. coli and most eukaryotes is a dimer, with subunits designated R l and R2 (Fig. 22-40). The Rl subunit contains two kinds of regulatory sites, as described below. The two active sites of the enzyme are formed at the interface between the Rl and R2 subunits. At each active site, Rl contributes two sulfhydryl groups required for activity and R2 contributes a stable tyrosyl radical. The R2 subunit also has a binuclear iron (Fe3+ ) cofactor that helps generate and stabilize the tyrosyl radicals (Fig. 22-40). The tyrosyl radical is too far from the active site to interact directly with the site, but it
22.4 Biosynthesis a n d Degradation of N ucleotides
Regulatory sites
Allosteric effectors
Substrate specificity it,e
Pri mary r gulation ite
·v
I
�) r'
Active site
[ss9]
I
ATP. dATP, dGTP, dTTP
Rl ubunit
ATP, dATP
(b) (c)
-Q-o·+-XH
-o-OH+ -X'
FIGURE 22-40 Ribonucleotide reductase. (a) Subunit structure. The
(a) generates another radical at the active site that func tions in catalysis. A likely mechanism for the ribonu cleotide reductase reaction is illustrated in Figure 22-4 1 . In E. coli, likely sources o f the required reducing equivalents
for this
reaction are
thioredoxin
glutaredoxin, as noted above.
and
functions of the two regulatory sites are explained in Figure 22-42. Each active site contains two thiols and a group (-XH) that can be converted to an active-site radical; this group is probably the -SH of Cys439, which functions as a thiyl radical. (b) The R2 subunits of E. coli ribonu cleotide reductase (PDB ID 1 PF R) . The Tyr residue that acts as the tyrosyl radical is shown in red; the binuclear iron center is orange. (c) The tyro syl radical functions to generate the active-site radical (-X \ which is used in the mechanism shown in Figure 22--41 .
Rl subunit
A 3 '-ribonucleotide radical is formed,
Ribonucleotide
R2 subunit
reductase
The enzyme dithiol is
®
reduced to complete the cycle.
x·
I
(i)
tep Is r v rsed, re�nerntlng a tyrosyl raaiaa] on Lh enzyme.
The 2'-bydruJC;YI i8
p:rotonated.
dNDP
H20 is eliminated to form a radical�
®
stabilized carbocation.
MECHAN I SM
FIGURE
22-41
Proposed mechanism for ri bonucleotide reductase.
Dithiol is oxidized on the enzyme; two electrons are trans ferred to the 2' -carbon.
X- H I
In the enzyme of E. coli and most eu karyotes, the active thiol groups are on the R1 subunit; the ac tive-site radical (-X') is on the R2 subunit and in E. coli is prob ably a thiyl radical of Cys4 39 (see Fig. 22-40).
[s9o]
B iosynthesis of Amino Acid s, N ucleotides, a n d Related Molecules
Regulation at primary regulatory sites
Regulation at substratespecificity sites
! ,.... - - ...... �
�
....... - -
®
®
�
®
®
�
ATP
...... ,
(d)ATP
-- dCDP +-------- CDP -------.... ,dCD P -----+ dCTP dCTP +---
�
dTfP \� - � � � �� � -� � -� �- �- �- � � � � � � � � - / � -\
dTTP +--�-+--d UDP 1---------------· UDP -------+ dUDP
®..-- �@y
�
-d ;;, .,;,;;;_ ;o _ _ GDP ----------+ dGDP -----+ dGTP , GDP +--..,;;;dGTP +----
�
®
,.... - - - - - - - - - - - - - - - - - �
dA TP +------ dADP +-------'"---ADP --------+ dADP -----+ dATP I
'
r ucts
P od
-
- --
...
Substrates
FIGURE 22-42 Regulation of ribonucleotide reductase by deoxynu cleoside triphosphates.
The overall activity of the enzyme is affected by binding at the primary regulatory site (left). The substrate specificity of the enzyme is affected by the nature of the effector molecule bound
Three classes of ribonucleotide reductase have been reported. Their mechanisms (where known) generally conform to the scheme in Figure 22--41, but they differ in the identity of the group supplying the active-site radical and in the cofactors used to generate it. The E. coli en zyme (class I) requires oxygen to regenerate the tyrosyl radical if it is quenched, so this enzyme functions only in an aerobic environment. Class II enzymes, found in other microorganisms, have 5'-deoxyadenosylcobalamin (see Box 17 -2) rather than a binuclear iron center. Class III enzymes have evolved to function in an anaerobic envi ronment. E. coli contains a separate class III ribonu cleotide reductase when grown anaerobically; this enzyme contains an iron-sulfur cluster (structurally dis tinct from the binuclear iron center of the class I enzyme) and requires NADPH and S-adenosylmethionine for ac tivity. It uses nucleoside triphosphates rather than nucle oside diphosphates as substrates. The evolution of different classes of ribonucleotide reductase for produc tion of DNA precursors in different environments reflects the importance of this reaction in nucleotide metabolism. Regulation of E. coli ribonucleotide reductase is un usual in that not only its activity but its substrate speci ficity is regulated by the binding of effector molecules. Each R 1 subunit has two types of regulatory site (Fig. 22--40). One type affects overall enzyme activity and binds either ATP, which activates the enzyme, or dATP, which inactivates it. The second type alters substrate specificity in response to the effector molecule-ATP, dATP, dTIP, or dGTP-that is bound there (Fig. 22-42). When ATP or dATP is bound, reduction of UDP and CDP is favored. When dTTP or dGTP is bound, reduction of GDP or ADP, respectively, is stimulated. The scheme is designed to provide a balanced pool of precursors for
Prod
ucts
at the second type of regulatory site, the substrate-specificity site (right). The diagram indicates inhibition or stimulation of enzyme ac tivity with the four d ifferent substrates. The pathway from dUDP to dTTP is described later (see Figs 22�43, 22�44).
DNA synthesis. ATP is also a general activator for biosynthesis and ribonucleotide reduction. The pres ence of dATP in small amounts increases the reduction of pyrimidine nucleotides. An oversupply of the pyrimi dine dNTPs is signaled by high levels of dTTP, which shifts the specificity to favor reduction of GDP. High lev els of dGTP, in turn, shift the specificity to ADP reduc tion, and high levels of dATP shut the enzyme down. These effectors are thought to induce several distinct enzyme conformations with altered specificities.
Thymidylate Is Derived from dCDP a nd d U M P DNA contains thymine rather than uracil, and the d e novo pathway to thymine involves only deoxyribonu cleotides. The immediate precursor of thymidylate (dTMP) is dUMP. In bacteria, the pathway to dUMP begins with formation of dUTP, either by deamination of dCTP or by phosphorylation of dUDP ( Fig. 22-43 ) . The dUTP is converted to dUMP by a dUTP ase. The latter reaction must be efficient to keep dUTP pools low and prevent incorporation of uridy late into DNA. Conversion of dUMP to dTMP is catalyzed by thymidylate synthase. A one-carbon unit at the hydrox ymethyl (-CH20H) oxidation level (see Fig. 18-1 7) is transferred from .I'?,N10-methylenetetrahydrofolate to dUMP, then reduced to a methyl group (Fig. 22-44 ). The reduction occurs at the expense of oxidation of tetrahy drofolate to dihydrofolate, which is unusual in tetrahydro folate-requiring reactions. (The mechanism of this reaction is shown in Fig. 22-50.) The dihydrofolate is re duced to tetrahydrofolate by dihydrofolate reductase a regeneration that is essential for the many processes that
22.4 B i osynthesis a n d Degradation of N ucleotides
DP
----- >
ribonucleotide
UDP
reductase ----- >
dCDP
nucleoside diphosphate
dUDP
kinase
------c>
dCTP
1
dcaminase
dUTP
1
dUTPasc
dUMP
1
ll1ymidy laLe nthasc'
dTMP FIGURE 22-43 Biosynthesis of thymidylate (dTMP). The pathways are shown beginning with the reaction catalyzed by ribonucleotide reduc tase. Figure 22-44 gives details of the thymidylate synthase reaction.
require tetrahydrofolate. In plants and at least one protist, thymidylate synthase and dihydrofolate reductase reside on a single bifimctional protein. About 1 0% of the human population (and up to , 50% of people in impoverished communities) suf fers from folic acid deficiency. When the deficiency is se vere, the symptoms can include heart disease, cancer, and some types of brain dysfunction. At least some of these symptoms arise from a reduction of thymidylate synthesis, leading to an abnormal incorporation of uracil into DNA. Uracil is recognized by DNA repair pathways (described in Chapter 25) and is cleaved from the DNA. The presence of high levels of uracil in DNA leads to strand breaks that can greatly affect the function and regulation of nuclear DNA, ultimately causing the ob served effects on the heart and brain, as well as in creased mutagenesis that leads to cancer. •
l
H2 yN HN
N5,N10-Methylene telrahydrofolate
Glycine
[s91]
H Nl I A C H2 N
I BN-R
7,8-Dihydrofolate
....
N ADPH + H+ NADP '
Serine
CH:t
I l:IN-R Tetrahydrofolate FIGURE 22-44 Conversion of dUMP to dTMP by thymidylate syn thase and dihydrofolate reductase.
Serine hydroxymethyltransferase is required for regeneration of the N5,N1 0-methylene form of tetrahydro-
folate. In the synthesis of dTMP, all three hydrogens of the added methyl group are derived from N5,N1 0-methylenetetrahydrofolate (pink and gray).
\ 892 _]
B i o synthesis of A m i n o Acids, N u c l eotides, a n d Related Molecules
converted to uric acid by xanthine oxidase (Fig.
Degradation of Pu rines a nd Pyrimidines Produces
22-45).
Uric acid is the excreted end product of purine ca
Uric Add a nd U rea, Respectively
tabolism in primates, birds, and some other animals. A
P urine nucleotides are degraded by a pathway in which they lose their phosphate through the action of
5'-nu
cleotidase (Fig. 2 2-4!'> ) . Adenylate yields adenosine, which is deaminated to inosine by adenosine deami nase, and inosine is hydrolyzed to hypoxanthine (its
healthy adult human excretes uric acid at a rate of about
0.6 g/24
h; the excreted product arises in part from in
gested purines and in part from turnover of the purine nucleotides of nucleic acids. In most mammals and many other vertebrates, uric acid is further degraded to
purine base) and D-ribose. Hypoxanthine is oxidized suc
allantoin by the action of urate oxidase. In other or
cessively to xanthine and then uric acid by xanthine ox
ganisms the pathway is further extended, as shown in
idase, a fiavoenzyme with an atom of molybdenum and
Figure
four iron-sulfur centers in its prosthetic group. Molecular
22-45.
The pathways for degradation of pyrimidines gener
oxygen is the electron acceptor in this complex reaction.
ally lead to NH t production and thus to urea synthesis.
GM P catabolism also yields uric acid as end product.
Thymine, for example, is degraded to methylmalonylsemi
GM P is first hydrolyzed to guanosine, which is then
aldehyde
cleaved to free guanine. Guanine undergoes hydrolytic
olism. It is further degraded through propionyl-CoA and
removal of its amino group to yield xanthine, which is
methylmalonyl-CoA to succinyl-CoA (see Fig.
(Fig. 22-46), an intermediate of valine catab
18-27).
Excreted
by:
Primates, birds, reptiles, insects unllt u uf t-_
�
C02
H N NH2 C _...... C=O I I O=C ..._ _...... C ..._ I N H N H H
Allantoin
Most mammals
Allantoate
Bony fishes
Guanine
guani1w
ch·am i l l i l.->c·
d luntrqt':l"'�"
H20
cool CHO
Glyoxylate Urea
Uric acid FIGURE 22-45 Catabolism of purine nucleotides. Note that primates ex crete much more nitrogen as urea via the urea cycle (Chapter 1 8) than as
4NH;
Amphibians, cartilaginous fishes Marine invertebrates
uric acid from purine degradation. Similarly, fish excrete much more nitrogen as N H! than as urea produced by the pathway shown here.
22.4 B i osynthesis a n d D e g radation of Nucleotides
0 II
c
/ "
HN
1
C
0? "'-N/
C-CH3
Thymine
11
CH
lated in a sterile "bubble" environment. ADA deficiency was one of the first targets of human gene therapy trials (see Box 9-2). • Purine and Pyrimidine Bases Are Recycled
H
by Salvage Pathways H�
NADPH NADP'
Free purine and pyrimidine bases are constantly released in cells during the metabolic degradation of nucleotides. Free purines are in large part salvaged and reused to make nucleotides, in a pathway much simpler than the de novo synthesis of purine nucleotides described earlier. One of the primary salvage pathways consists of a single reaction catalyzed by adenosine phosphoribosyltrans ferase, in which free adenine reacts with PRPP to yield the corresponding adenine nucleotide: Adenine
-f'o H2N-C-NH-CH2 -CH-C
II
I CH
o
3
NH;
"-0 -
{3-Ureidoisobutyrate
+ HCO:J {3-Aminoisobutyrate
a- l{etoglutarate
" f.
lil
" Glutamate
0
0
�
,f'
C-CH-C
/
H
I
CHs
[893]
"-
o-
Methylmalonyl semialdehyde FIGURE 22-46 Catabolism of a pyrimidine. Shown here is the pathway for thymine. The methylmalonylsemialdehyde is further degraded to succinyi-CoA.
Genetic aberrations in human purine metabolism have been found, some with serious conse quences. For example, adenosine deaminase (ADA) deficiency leads to severe immunodeficiency disease in which T lymphocytes and B lymphocytes do not de velop properly. Lack of ADA leads to a 100-fold increase in the cellular concentration of dATP, a strong inhibitor of ribonucleotide reductase (Fig. 22-42). High levels of dATP produce a general deficiency of other dNTPs in T lymphocytes. The basis for B-lymphocyte toxicity is less clear. Individuals with ADA deficiency lack an ef fective immune system and do not survive unless iso-
+ PRPP
_____,.
AMP + PPi
Free guanine and hypoxanthine (the deamination prod uct of adenine; Fig. 22--45) are salvaged in the same way by hypoxanthine-guanine phosphoribosyltrans ferase. A similar salvage pathway exists for pyrimidine bases in microorganisms, and possibly in mammals. A genetic lack of hypoxanthine-guanine phospho ribosyltransferase activity, seen almost exclusively in male children, results in a bizarre set of symptoms called Lesch-Nyhan syndrome. Children with this ge netic disorder, which becomes manifest by the age of 2 years, are sometimes poorly coordinated and mentally re tarded. In addition, they are extremely hostile and show compulsive self-destructive tendencies: they mutilate themselves by biting off their fingers, toes, and lips. The devastating effects of Lesch-Nyhan syndrome il lustrate the importance of the salvage pathways. Hypox anthine and guanine arise constantly from the breakdown of nucleic acids. In the absence of hypoxanthine-guanine phosphoribosyltransferase, PRPP levels rise and purines are overproduced by the de novo pathway, resulting in high levels of uric acid production and goutlike damage to tissue (see below). The brain is especially dependent on the salvage pathways, and this may account for the cen tral nervous system damage in children with Lesch-Ny han syndrome. This syndrome was another target of early trials in gene therapy (see Box 9-2). • Excess Uric Acid Causes Gout
Long thought, erroneously, to be due to "high liv ing," gout is a disease of the joints caused by an elevated concentration of uric acid in the blood and tissues. The joints become inflamed, painful, and arthritic, owing to the abnormal deposition of sodium urate crys tals. The kidneys are also affected, as excess uric acid is deposited in the kidney tubules. Gout occurs predomi nantly in males. Its precise cause is not known, but it of ten involves an underexcretion of urate. A genetic deficiency of one or another enzyme of purine metabo lism may also be a factor in some cases. I ..
f894 L
B i o synthesis of A m i n o Acids, N u c leotides, a n d Rel ated M o l e c u l e s
Many Chemothera peutic Agents Target Enzymes
OH
I
N'-"'c......_c _..
I
RC
""'-
II
N
�
.,.... C --. 1 N N R
Hypoxanthine (enol form)
Oxypurinol F I G U R E 22-47 Allopurinol, an inhibitor of xanthine oxidase. Hypo xanth i ne is the normal substrate of xanth i ne oxidase. Only a slight al teration i n the structure of hypoxanthine (shaded pi n k) yields the medically effective enzyme inhibitor al lopurinol . At the active site, al lopurinol is converted to oxypurinol, a strong competitive inhibitor that remains tightly bound to the reduced form of the enzyme.
Gout is effectively treated by a combination of nu tritional and drug therapies. Foods especially rich in nucleotides and nucleic acids, such as liver or glandular products, are withheld from the diet. Major alleviation of the symptoms is provided by the drug allopurinol ( Fig. 22-4 7 ) , which inhibits xanthine oxidase, the en zyme that catalyzes the conversion of purines to uric acid. Allopurinol is a substrate of xanthine oxidase, which converts allopurinol to oxypurinol (alloxanthine). Oxypurinol inactivates the reduced form of the enzyme by remaining tightly bound in its active site. When xan thine oxidase is inhibited, the excreted products of purine metabolism are xanthine and hypoxanthine, which are more water-soluble than uric acid and less likely to form crystalline deposits. Allopurinol was de veloped by Gertrude Elion and George Hitchings, who also developed acyclovir, used in treating people with genital and oral herpes infections, and other purine analogs used in cancer chemotherapy. •
i n the N ucleotide Biosynthetic Pathways The growth of cancer cells is not controlled in the same way as cell growth in most normal tissues. Cancer cells have greater requirements for nucleotides as precursors of DNA and RNA, and consequently are generally more sensitive than normal cells to inhibitors of nucleotide biosynthesis. A growing array of important chemotherapeutic agents-for cancer and other dis eases-act by inhibiting one or more enzymes in these pathways. We describe here several well-studied exam ples that illustrate productive approaches to treatment and help us understand how these enzymes work. The first set of agents includes compounds that in hibit glutamine amidotransferases. Recall that gluta mine is a nitrogen donor in at least half a dozen separate reactions in nucleotide biosynthesis. The binding sites for glutamine and the mechanism by which NH ; is ex tracted are quite similar in many of these enzymes. Most are strongly inhibited by glutamine analogs such as aza serine and acivicin ( Fig. 22-48). Azaserine, charac terized by John Buchanan in the 1950s, was one of the first examples of a mechanism-based enzyme inactivator (suicide inactivator; p. 204 and Box 22-3). Acivicin shows promise as a cancer chemotherapeutic agent. Other useful targets for pharmaceutical agents are thymidylate synthase and dihydrofolate reductase, en zymes that provide the only cellular pathway for thymine synthesis ( Fig. 22-49) . One inhibitor that acts on thymidylate synthase, fluorouracil, is an important chemotherapeutic agent. Fluorouracil itself is not the enzyme inhibitor. In the cell, salvage pathways convert it to the deoxynucleoside monophosphate FdUMP, which binds to and inactivates the enzyme. Inhibition by FdUMP ( Fig. 2 2-50 ) is a classic example of mecha nism-based enzyme inactivation. Another prominent chemotherapeutic agent, methotrexate, is an inhibitor of dihydrofolate reductase. This folate analog acts as a competitive inhibitor; the enzyme binds methotrexate with about 100 times higher affinity than dihydrofolate. Aminopterin is a related compound that acts similarly.
NHz
I
#
I
I
CHz-c-coo-
C- CHz
0{"
+
NH3
I
H
Glutamine
Azaserine ,.
NH"
o I N....- "CH-C-COO
II
I
I
c --CH2 H c( Acivicin FIGURE 22-48 Azaserine and acivicin, inhibitors of glutamine amido
Gertrude El ion ( 1 9 1 8-1 999) and George H i tchi ngs ( 1 905-1 998)
transferases.
These analogs of glutamine i nterfere in several amino acid and nucleotide biosynthetic pathways.
22.4 Bi osynthesis a n d Degradation of N u c leotides
FdUMP dUMP
FdUMP
dUMP
dTMP
[s9s]
�.N10-Methylene H4 folate
7 ,8-Dihydrofolate
N 5 ,N10 -Methylene H4 folate
Enzyme thiolate adds at C-6 of dUMP, a Michael type addition; N 10 is protonated and N5-iminium ion is formed from methylene-H4 folate.
Glycine
�..,
I, I
�
H4 folate
Methotrexate Aminopterin Trime!.hoprim
Serine
\
F HN Oj__ NH J Fluorouracil
( a)
�
H3CO ,. (Ni(NH2 H3CO�N NH� -CRa
C-5 carbanion
adds lo N5-irniniurn ion.
Trimethoprim
S
R
Methylidene is formed at C-5 of pyrimidine; N5 is eliminated to form H4 folate.
Methotrexate
(b) FIGURE 22-49 Thymidylate synthesis and folate metabolism
Dead-end covalent complex
as targets of chemotherapy. (a)
During thymidylate synthesis, N5 ,N 1 0-methylenetetrahydrofolate is converted to 7,8-di hydrofolate; the N5,N 1 0-methylenetetrahydrofolate is regenerated in two steps (see Fig. 2 2-44) . This cycle is a major target of several chemothera peutic agents. (b) Fluorouracil and methotrexate are i mportant chemotherapeutic agents. In cells, fluorouraci l is converted to FdUMP, which inhibits thymidylate synthase. Methotrexate, a structural analog of tetrahydrofolate, inhibits di hydrofolate reductase; the shaded amino and methyl groups replace a carbonyl oxygen and a proton, respec tively, in folate (see Fig. 2 2-44). Another i mportant folate analog, ami nopterin, is identical to methotrexate except that it lacks the shaded methyl group. Trimethoprim, a tight-binding inh ibitor of bacte rial dihydrofolate reductase, was developed as an antibiotic.
HN
H I
O)._l'i/ ·-H ,\ ""-
HB
1,3 hydride shift generates dTMP and dihydrofolate.
dTMP
MECHANISM FIGURE 22-50 Conversion of dUMP to dTMP and its in hibition by FdUMP.
The left side is the normal reaction mechanism of thymidylate synthase. The nucleophilic su lfhydryl group contributed by the enzyme in step CD and the ring atoms of d U M P taking part i n the reaction are shown in red; : B denotes a n amino acid side chain that acts as a base to abstract a proton after step ® The hydrogens derived from the methylene group of N5,N1 0-methylenetetrahydrofo-
late are shaded in gray. The 1 ,3 hydride shift (step Q)J, moves a hydride ion (shaded pink) from C-6 of H4 folate to the methyl group of thymi dine, resulting in the oxidation of tetrahydrofolate to dihydrofolate. This hydride shift is blocked when FdUMP is the substrate (right). Steps CD and 0 proceed normally, but result in a stable complex-consisting of FdUMP linked covalently to the enzyme and to tetrahydrofolate-that Thymidylate Synthase Mechanism inactivates the enzyme
.•
L89 6_]
Biosynthesis of A m i n o Acids, Nucl eotides, a n d Rel ated Molecules
The medical potential of inhibitors of nucleotide biosynthesis is not limited to cancer treatment. All fast-growing cells (including bacteria and protists) are potential targets. Trimethoprim, an antibiotic developed by Hitchings and Elion, binds to bacterial dihydrofolate reductase nearly 100,000 times better than to the mammalian enzyme. It is used to treat certain urinary and middle-ear bacterial infections. Parasitic protists, such as the trypanosomes that cause African sleeping sickness (African trypanoso miasis) , lack pathways for de novo nucleotide biosyn thesis and are particularly sensitive to agents that interfere with their scavenging of nucleotides from the surrounding environment using salvage path ways. Allopurinol (Fig. 22-4 7) and several similar purine analogs have shown promise for the treatment of African trypanosomiasis and related afflictions. See Box 22-3 for another approach to combating African trypanosomiasis, made possible by advances in our understanding of metabolism and enzyme mechanisms . •
SUMMA RV 2 2 .4
Biosynthesis and Degradation of Nucleotides
•
•
•
• •
•
•
The purine ring system is built up step-by-step beginning with 5-phosphoribosylamine. The amino acids glutamine, glycine, and aspartate furnish all the nitrogen atoms of purines. Two ring-closure steps form the purine nucleus. Pyrimidines are synthesized from carbamoyl phosphate and aspartate, and ribose 5-phosphate is then attached to yield the pyrimidine ribonucleotides. Nucleoside monophosphates are converted to their triphosphates by enzymatic phosphorylation reactions. Ribonucleotides are converted to deoxyribonucleotides by ribonucleotide reductase, an enzyme with novel mechanistic and regulatory characteristics. The thymine nucleotides are derived from dCDP and dUMP. Uric acid and urea are the end products of purine and pyrimidine degradation. Free purines can be salvaged and rebuilt into nucleotides. Genetic deficiencies in certain salvage enzymes cause serious disorders such as Lesch-Nyhan syndrome and ADA deficiency.
Key Terms Terms in bold are defined in the glossary.
nitrogen cycle 852 nitrogen fixation 852 anammox 852 symbionts 852 nitrogenase complex 854
spermidine 879 ornithine decarboxylase 879 de novo pathway 882 salvage pathway 882
leghemoglobin 856 glutamine synthetase 857 glutamate synthase 857 glutamine amidotransferases 859 5-phosphoribosyl-1 pyrophosphate (PRPP) 86 1 tryptophan synthase 868 porphyrin 873 porphyria 873 bilirubin 875 phosphocreatine 876 creatine 876 glutathione (GSH) 876 auxin 878 dopamine 878 norepinephrine 878 epinephrine 878 y-aminobutyrate (GABA) 878 serotonin 878 histamine 878 cimetidine 879 spermine 879
inosinate (IMP) 883 carbamoyl phosphate synthetase II 886 aspartate transcarbamoylase
887
nucleoside mono phosphate kinase 888 nucleoside diphosphate kinase 888 ribonucleotide reductase 888 thioredoxin 888 thymidylate synthase dihydrofolate reductase 890 adenosine deaminase deficiency 893 Lesch-Nyhan syndrome 893 allopurinol 894 azaserine 894 acivicin 894 fluorouracil 894
890
methotrexate 894 aminopterin 894
Further Reading Nitrogen Fixation
Arp, D.J. & Stein, L.Y. (2003) Metabolism of inorganic N com pounds by ammonia-oxidizing bacteria. Grit Rev Biochem Mol
Biol. 38, 491-495.
Burris,
R.H.
(1 995) Breaking the N-N bond. Annu. Rev Plant
Physiol Plant Mol Biol . 46, 1-19.
Fuerst, J.A. (2005) Intracellular compartmentation in plancto mycetes. Annu. Rev. Microbial. 59, 299-328.
Igarishi, R.Y. & Seefeldt, L.C. (2003) Nitrogen fixation: the mech anism of the Mo-dependent nitrogenase . Grit. Rev. Biochem. Mol
Biol 38, 35 1-384
Patriarca, E.J., Tate,
R., & Iaccarino, M.
(2002) Key role of bac
terial NH; metabolism in rhizobium-plant symbiosis. Microbial. Mol.
Biol. Rev 66, 203-222.
A good overview of ammonia assimilation in bacterial systems
Accumulation of uric acid crystals in the joints, possibly caused by another genetic deficiency, results in gout.
and its regulation.
Enzymes of the nucleotide biosynthetic pathways are targets for an array of chemotherapeutic agents used to treat cancer and other diseases.
rhizobia! bacteria and their hosts.
Prell, J. & Poole, P. (2006) Metabolic changes of rhizobia in legume nodules. Trends Microbial 14, 161-168. A good summary of the intricate symbiotic relationship between Sinha, S.C. & Smith, J.L. (2001) The PRT protein family. Gurr: Opin. Struct. Biol. 1 1 , 733-739.
Problems
Description of a protein family that includes many arnidotrans ferases, with channels for the movement of NH3 from one active site to another.
[897]
Molecular Bases of Inherited Disease, 8th edn, McGraw-Hill Profes sional, New York. This four-volume set has good chapters on disorders of amino
Amino Acid Biosynthesis
acid, porphyrin, and heme metabolism. See also the chapters on
in
born errors of purine and pyrimidine metabolism.
Frey, P.A. & Hegeman, A.D. (2007) Enzymatic Reaction Mecha nisms, Oxford University Press, New York.
An updated summary of reaction mechanisms, including one
Problems
carbon metabolism and pyridoxal phosphate enzymes.
Neidhardt, F.C. (ed.). ( 1 996) Escherichia coli and Salmonella: Cel lular and Molecular Biology, 2nd edn, ASM Press, Washington, DC . Volume 1 of this two-volume set has 13 chapters devoted to de tailed descriptions of amino acid and nucleotide biosynthesis in bac teria. The web-based version at www.ecosaL org is updated regularly. A valuable resource .
Pan P., Woehl, E., & Dunn, M.F. (1 997) Protein architecture, dy namics and allostery in tryptophan synthase channeling. Trends
Biochem Sci. 22, 22-27.
Richards, N.G.J. & Kilberg, M.S. (2006) Asparagine synthetase chemotherapy. Annu Rev Biochem 75, 629-654.
Compounds Derived from Amino Acids
Ajioka R.S., Phillips, J.D., & Kushner, J.P. (2006) Biosynthesis of heme in mammals Biochim Biophys Acta Mol Cell Res. 1763,
723-736, Bredt, D.S. & Snyder, S.H. (1 994) Nitric oxide: a physiologic mes senger molecule. Annu Rev Biochem 63, 1 75-195.
Meister, A. & Anderson, M.E. ( 1 983) Glutathione Annu_ Rev. Biochem 52, 7 1 1-760
Morse, D. & Choi, A.M.K. (2002) Herne oxygenase-1-the "emerg ing molecule" has arrived. Am.
J. Resp. Cell Mol Biol. 2 7 , 8-16 .
Rondon, M.R., Trzebiatowski, J.R., & Escalante-Semerena, J.C. (1 997) Biochemistry and molecular genetics of cobalamin biosynthesis. Frog. Nucleic Acid Res Mol Biol 56, 347-384.
Stadtman, T.C. (1 996) Selenocysteine. Annu. Rev Biochem. 65, 83-100.
1 . ATP Consumption by Root Nodules in Legumes Bac
teria residing in the root nodules of the pea plant consume more than 20% of the ATP produced by the plant. Suggest why these bacteria consume so much ATP.
2 . Glutamate Dehydrogenase and Protein Synthesis The bacterium Methylophilus methylotrophus can synthe size protein from methanol and ammonia. Recombinant DNA techniques have improved the yield of protein by introducing into M. methylotrophus the glutamate dehydrogenase gene from E. coli. Why does this genetic manipulation increase the protein yield?
3. PLP Reaction Mechanisms Pyridoxal phosphate can help catalyze transformations one or two carbons removed from the a carbon of an amino acid. The enzyme threonine synthase (see Fig. 22-15) promotes the PLP-dependent con version of phosphohomoserine to threonine . Suggest a mecha nism for this reaction. 4. Transformation of Aspartate to Asparagine There are two routes for transforming aspartate to asparagine at the ex pense of ATP. Many bacteria have an asparagine synthetase that uses ammonium ion as the nitrogen donor. Mammals have an asparagine synthetase that uses glutamine as the nitrogen donor. Given that the latter requires an extra ATP (for the syn thesis of glutamine) , why do mammals use this route?
Nucleotide Biosynthesis
Carreras, C.W. & Santi, D.V. ( 1995) The catalytic mechanism and
structure of thyrnidylate synthase . Annu Rev Biochem 64, 721-762
Holmgren, A. ( 1 989) Thioredoxin and glutaredoxin systems. J. Biol. Chem 264, 1 3,963-13,966.
Kappock, T.J., Ealick, S.E., & Stubbe, J. (2000) Modular evolu tion of the purine biosynthetic pathway. Curr: Opin. Chem Biol 4,
567-572. Kornberg, A. & Baker, T.A. ( 1 99 1 ) DNA Replication, 2nd edn,
W. H. Freeman and Company, New York.
This text includes a good summary of nucleotide biosynthesis.
Licht, S., Gerfen, G.J., & Stubbe, J. (1 996) Thiyl radicals in ri bonucleotide reductases_ Science 2 7 1 , 4 77-481 .
Nordlund, P. & Reichard, P. (2006) Ribonucleotide reductases. Annu. Rev. Biochem 75, 681-706.
5. Equation for the Synthesis of Aspartate from Glu cose Write the net equation for the synthesis of aspartate (a nonessential amino acid) from glucose, carbon dioxide, and ammoma. 6. Asparagine Synthetase Inhibitors in Leukemia Therapy Mammalian asparagine synthetase is a glutamine-dependent amidotransferase. Efforts to identify an effective inhibitor of human asparagine synthetase for use in chemotherapy for patients with leukemia has focused not on the amino-terminal glutaminase domain but on the carboxyl terminal synthetase active site. Explain why the glutaminase domain is not a promising target for a useful drug.
accompanied by delightful tales of science and politics
7. Phenylalanine Hydroxylase Deficiency and Diet Tyro sine is normally a nonessential amino acid, but individuals with a genetic defect in phenylalanine hydroxylase require tyrosine in their diet for normal growth. Explain.
Stubbe, J. & Riggs-Gelasco, P. (1 998) Harnessing free radicals:
8. Cofactors for One-Carbon Transfer Reactions Most
Schachman, H.K. (2000) Still looking for the ivory tower. Annu Rev Biochem 69, 1-29. A lively description of research on aspartate transcarbarnoylase,
formation and function of the tyrosyl radical in ribonucleotide reduc tase. Trends Biochem Sci 23, 438-443_
Genetic Diseases
Scriver, C.R., Beaudet, A.L., Valle, D., Sly, W.S., Childs, B., Kin zler, L.W., & Vogelstein, B. (eds). (2001) The Metabolic and
one-carbon transfers are promoted by one of three cofactors: biotin, tetrahydrofolate, or S-adenosylmethionine (Chapter 18). S-Adenosylmethionine is generally used as a methyl group donor; the transfer potential of the methyl group in ff-methyl tetrahydrofolate is insufficient for most biosynthetic reactions.
[a9 al
Biosynthesis of A m i n o Acids, N u c l eotides, a n d Related M o l e c u l e s
However, one example o f the u s e o f N' -methyltetrahydrofolate
14. Pathway of Carbon in Pyrimidine Biosynthesis Pre
in methyl group transfer is in methionine formation by the me
dict the locations of 14C in orotate isolated from cells grown on
of Fig. 22- 1 5) ; methionine
a small amount of uniformly labeled e4c]succinate . Justify
thionine synthase reaction (step
®
is the immediate precursor of S-adenosylmethionine (see Fig. 18-18) . Explain how the methyl group of S-adenosylmethion ine can be derived from N"-methyltetrahydrofolate , even
though the transfer potential of the methyl group in tf'-methyl
tetrahydrofolate is one one-thousandth of that in S-adenosyl methionine.
your prediction.
15. Nucleotides
as
Poor Sources of Energy Under
starva
tion conditions, organisms can use proteins and amino acids as sources of energy. Deamination of amino acids produces carbon skeletons that can enter the glycolytic pathway and the citric acid cycle to produce energy in the form of ATP. Nucleotides, on
9. Concerted Regulation in Amino Acid Biosynthesis
the other hand, are not similarly degraded for use as energy
The glutamine synthetase of E coli is independently modulated
yielding fuels. What observations about cellular physiology sup
by various products of glutamine metabolism (see Fig. 22-6) . In
port this statement? What aspect of the structure of nucleotides
this concerted inhibition, the extent of enzyme inhibition is
makes them a relatively poor source of energy?
greater than the sum of the separate inhibitions caused by each product. For E coli grown in a medium rich in histidine, what would be the advantage of concerted inhibition?
16. Treatment of Gout Allopurinol
(see Fig. 22-4 7) ,
an inhibitor of xanthine oxidase, is used to treat chronic gout. Explain the biochemical basis for this treatment .
10. Relationship between Folic Acid Deficiency
Patients treated with allopurinol sometimes develop xanthine
Folic acid deficiency, believed to be the
stones in the kidneys, although the incidence of kidney dam
most common vitamin deficiency, causes a type of anemia in
age is much lower than in untreated gout. Explain this obser
which hemoglobin synthesis is impaired and erythrocytes do
vation in the light of the following solubilities in urine: uric
not mature properly. What is the metabolic relationship be
acid, 0 . 1 5 g/L; xanthine, 0 . 05
and Anemia
tween hemoglobin synthesis and folic acid deficiency?
1 1 . Nucleotide Biosynthesis in Amino Acid Auxotrophic
giL;
and hypoxanthine, 1 . 4 g/1 .
1 7. Inhibition of Nucleotide Synthesis by Azaserine The diazo compound 0- (2-diazoacetyl) -L-serine, known also as
cells can synthesize all 20 common
azaserine (see Fig. 22-48) , is a powerful inhibitor of glutamine
amino acids, but some mutants, called amino acid auxotrophs,
amidotransferases. If growing cells are treated with azaserine,
are unable to synthesize a specific amino acid and require its
what intermediates of nucleotide biosynthesis will accumu
addition to the culture medium for optimal growth. Besides
late? Explain.
Bacteria Wild-type E coli
their role in protein synthesis, some amino acids are also pre cursors for other nitrogenous cell products. Consider the three amino acid auxotrophs that are unable to synthesize glycine, glutamine , and aspartate, respectively. For each mutant, what nitrogenous products other than proteins would the cell fail to synthesize?
12. Inhibitors of Nucleotide Biosynthesis
Suggest mecha
nisms for the inhibition of (a) alanine racemase by L-fiuoroalanine and (b) glutamine amidotransferases by azaserine.
13. Mode of Action of Sulfa Drugs
Some bacteria
require p-aminobenzoate in the culture medium for normal growth, and their growth is severely inhibited by the addition of sulfanilamide, one of the earliest sulfa drugs. More over, in the presence of this drug, 5-aminoimidazole-4-carbox amide ribonucleotide (AICAR; see Fig. 22-33) accumulates in the culture medium. These effects are reversed by addition of excess p-aminobenzoate.
18. Use of Modern Molecular Techniques to Determine the Synthetic Pathway of a Novel Amino Acid Most of the biosynthetic pathways described in this chapter were deter mined before the development of recombinant DNA technology and genomics, so the techniques were quite different from those that researchers would use today. Here we explore an ex ample of the use of modern molecular techniques to investigate the pathway of synthesis of a novel amino acid, (2S)-4-amino-2hydroxybutyrate (AHBA) . The techniques mentioned here are described in various places in the book; this problem is designed to show how they can be integrated in a comprehensive study. AHBA is a y-amino acid that is a component of some aminoglycoside antibiotics, including the antibiotic bu tirosin. Antibiotics modified by the addition of an AHBA residue are often more resistant to inactivation by bacterial
0
H2N
p-Aminobenzoate
Data Analysis Problem
r\. \J _ - 0£-NH2 II ·
Sulfanilamide
(a) What is the role of p-aminobenzoate in these bacteria?
antibiotic-resistance enzymes. As a result, understanding how AHBA is synthesized and added to antibiotics is useful in the design of pharmaceuticals. In an article published in 2005, Li and coworkers describe how they determined the synthetic pathway of AHBA from glutamate .
(Hint: See Fig. 18-16.) (b) Why does AICAR accumulate in the presence of sul fanilamide? (c) Why are the inhibition and accumulation reversed by addition of excess p-aminobenzoate?
T
-o"
NHa
� c 7o c II
o
I
a-
Glutamate
+
OH
�
NHa
C I
70
o-
AHBA
Problems
(a) Briefly describe the chemical transformations needed to convert glutamate to AHBA. At this point, don't be con cerned about the order of the reactions. Li and colleagues began by cloning the butirosin biosynthetic gene cluster from the bacterium Bacillus circulans , which makes large quantities ofbutirosin. They identified five genes that are essential for the pathway: btrl, btrJ, btrK, btrO, and btrV.
They cloned these genes into E. coli plasmids that allow overex pression of the genes, producing proteins with "histidine tags" (see p. 3 14) fused to their amino termini to facilitate purification. The predicted amino acid sequence of the Btrl protein showed strong homology to known acyl carrier proteins (see
Fig. 2 1-5) . Using mass spectrometry (see Box 3-2) , Li and col leagues found a molecular mass of 1 1 ,812 for the purified Btri protein (including the His tag) . When the purified Btri was in cubated with coenzyme A and an enzyme known to attach CoA to other acyl carrier proteins, the majority molecular species had an Mr of 1 2 , 1 53. (b) How would you use these data to argue that Btri can function as an acyl carrier protein with a CoA prosthetic group? Using standard terminology, Li and coauthors called the form of the protein lacking CoA apo-Btri and the form with CoA (linked as in Fig. 2 1-5) holo-Btri. When holo-Btri was incu bated with glutamine, ATP, and purified BtrJ protein, the holo Btrl species of Mr 12, 1 53 was replaced with a species of M, 12,28 1 , corresponding to the thioester of glutamate and holo Btri. Based on these data, the authors proposed the following structure for the Mr 12,281 species ( y-glutamyl-S-Btri) :
NHa '
c
�!
?0
Btrl y-Glutarnyl-S-Btrl
[899]
(c) What other structure(s) is (are) consistent with the data above? (d) Li and coauthors argued that the structure shown here ( y-glutamyl-S-Btri) is likely to be correct because the a carboxyl group must be removed at some point in the syn thetic process. Explain the chemical basis of this argument. (Hint: See Fig. 1 8-6c.) The BtrK protein showed significant homology to PLP-de pendent amino acid decarboxylases, and BtrK isolated from E. coli was found to
contain tightly bound PLP. When y-glutamyl S-Btrl was incubated with purified BtrK, a molecular species of Mr 1 2,240 was produced. (e) What is the most likely structure of this species? (f) Interestingly, when the investigators incubated gluta
mate and ATP with purified Btri, BtrJ, and BtrK, they found a molecular species of M, 12,370. What is the most likely struc ture of this species? Hint: Remember that BtrJ can use ATP to y-glutamylate nucleophilic groups. Li and colleagues found that BtrO is homologous to monooxygenase enzymes (see Box 21-1) that hydroxylate alkanes, using FMN as a cofactor, and BtrV is homologous to an NAD(P)H oxidoreductase . Two other genes in the cluster, btrG and btrH, probably encode enzymes that remove the y-glutamyl group and attach AHBA to the target antibiotic molecule. (g) Based on these data, propose a plausible pathway for the synthesis of AHBA and its addition to the target antibiotic. Include the enzymes that catalyze each step and any other substrates or cofactors needed (ATP, NAD, etc.) . Reference
Li, Y., Llewellyn, N.M., Giri, R., Huang, F., & Spencer, J.B. (2005) Biosynthesis of the unique amino acid side chain of
bu
tirosin: possible protective-group chemistry in an acyl carrier pro tein-mediated pathway. Chem.
Biol. 1 2 , 665-675 .
We recognize that each tissue a nd, more genera l ly, each cel l of the or ga n i sm secretes . . . spec i a l products or ferments i nto the blood which thereby i nfluence a l l the other cel ls thus i ntegrated with each other by a mechanism other than the nervous system.
- Charles Edouard Brown-Sequard and }. d'Arsonval, article in Com ptes Rend us de Ia Societe de B iologie, 7 89 7
Hormonal Regulation and I ntegration of Mammalian Metabolism 23.1
Hormones: Diverse Structures for Diverse Functions
23.2
hormones and hormonal mechanisms, then tum to the
901
tissue-specific functions regulated by these mecha
Tissue-Specific Metabolism: The Division of labor
23.3
Hormonal Regulation of Fuel Metabolism
922
23.4
Obesity and the Regulation of Body Mass
930
23.5
Obesity, the Metabolic Syndrome, and Type 2 Dia betes
912
938
nisms. We discuss the distribution of nutrients to vari ous organs-emphasizing the central role played by the liver-and the metabolic cooperation among these or gans. To illustrate the integrative role of hormones, we describe the interplay of insulin, glucagon, and epineph rine in coordinating fuel metabolism in muscle, liver, and adipose tissue. The metabolic disturbances in diabetes further illustrate the importance of hormonal regulation of metabolism. We discuss the long-term hormonal reg
I
n Chapters
1 3 through 22 we have discussed metabo
lism at the level of the individual cell, emphasizing central pathways common to almost all cells, bacter
ulation of body mass and, finally, the role of obesity in development of the metabolic syndrome and diabetes.
ial, archaeal, and eukaryotic . We have seen how meta
23.1 Hormones: Diverse Structures for
bolic processes within cells are regulated at the level of
Diverse Functions
individual enzyme reactions, by substrate availability, by allosteric mechanisms, and by phosphorylation or other
Virtually every process in a complex organism is regu
covalent modifications of enzymes.
lated by one or more hormones: maintenance of blood
To appreciate fully the significance of individual meta
pressure, blood volume, and electrolyte balance; em
bolic pathways and their regulation, we must view these
bryogenesis; sexual differentiation, development, and
pathways in the context of the whole organism. An essen
tial characteristic of multicellular organisms is cell differ
reproduction; hunger, eating behavior, digestion, and fuel allocation-to name but a few. We examine here the
entiation and division of labor. The specialized functions of
methods for detecting and measuring hormones and
the tissues and organs of complex organisms such as hu
their interaction with receptors, and consider a repre
mans impose characteristic fuel requirements and patterns
sentative selection of hormone types.
of metabolism. Hormonal signals integrate and coordinate
The coordination of metabolism in mammals is
neuroendocrine system. Individual
the metabolic activities of different tissues and optimize
achieved by the
the allocation of fuels and precursors to each organ.
cells in one tissue sense a change in the organism's cir
In this chapter we focus on mammals, looking at the
cumstances and respond by secreting a chemical mes
specialized metabolism of several major organs and tis
senger that passes to another cell in the same or
sues and the integration of metabolism in the whole or
different tissue, where the messenger binds to a recep
ganism. We begin by examining the broad range of
tor molecule and triggers a change in this second cell. In
[9o 1]
[902]
H o r m o n a l Regulation a n d I ntegration of M a m m a l i a n Meta b o l i s m
neuronal signaling (Fig. 23-la) , the chemical messenger (neurotransmitter; acetylcholine, for example) may travel only a fraction of a micrometer, across the synaptic cleft to the next neuron in a network. In hormonal signaling, the messengers-hormones-are carried in the bloodstream to neighboring cells or to distant organs and tissues; they may travel a meter or more before encountering their
(a) Neuronal signaling
target cell (Fig. 23-1b). Except for this anatomic differ ence, these two chemical signaling mechanisms are re markably similar. Epinephrine and norepinephrine, for example, serve as neurotransmitters at certain synapses of the brain and neuromuscular junctions of smooth mus cle, and as hormones that regulate fuel metabolism in liver and muscle. The following discussion of cellular signaling emphasizes hormone action, drawing on discussions of fuel metabolism in earlier chapters, but most of the funda mental mechanisms described here also occur in neuro transmitter action.
The Detection a nd Purification of Hormones Requires a Bioassay
Target cells 3
• • •
••
.
( i
'
;J / impul
erve
e
Contraction •
'
Secretion
/
Metabolic • change
(b)
Endocrine signaling
FIGURE 23-1 Signaling by the neuroendocrine system. (a) In neuronal signal ing, electrical signals (nerve impu lses) originate in the cell body of a neuron and travel very rapidly over long distances to the axon tip, where neurotransmitters are released and diffuse to the target cel l . The target cell (another neuron, a myocyte, or a secretory cell) is only a fraction of a micrometer or a few micrometers away from the site of neurotransmitter release. (b) In the endocrine system, hormones are secreted i nto the bloodstream, which carries them throughout the body to target tissues that may be a meter or more away from the secreti ng cel l . Both neurotransm itters a n d hormones interact with specific receptors on or in their target cells, triggering responses.
How is a hormone detected and isolated? First, re searchers find that a physiological process in one tis sue depends on a signal that originates in another tissue. Insulin, for example, was first recognized as a substance that is produced in the pancreas and affects the volume and composition of urine (Box 23-1). Once a physiological effect of the putative hormone is discovered, a quantitative bioassay for the hormone can be developed. In the case of insulin, the assay con sisted of injecting extracts of pancreas (a crude source of insulin) into experimental animals deficient in insulin, then quantifying the resulting changes in glucose concentration in blood and urine. To isolate a hormone, the biochemist fractionates extracts con taining the putative hormone, with the same tech niques used to purify other biomolecules (solvent fractionation, chromatography, and electrophoresis), and then assays each fraction for hormone activity. Once the chemical has been purified, its composition and structure can be determined. This protocol for hormone characterization is de ceptively simple. Hormones are extremely potent and are produced in very small amounts. Obtaining suffi cient hormone to allow its chemical characterization often involves biochemical isolations on a heroic scale. When Andrew Schally and Roger Guillemin independ ently purified and characterized thyrotropin-releasing hormone (TRH) from the hypothalamus, Schally's group processed about 20 tons of hypothalamus from nearly two million sheep, and Guillemin's group ex tracted the hypothalamus from about a million pigs! TRH proved to be a simple derivative of the tripeptide Glu-His-Pro (Fig. 2 3-2 ) . Once the structure of the hormone was known, it could be chemically synthe sized in large quantities for use in physiological and biochemical studies. For their work on hypothalamic hormones, Schally and Guillemin shared the Nobel Prize in Physiology or Medicine in 1 977, along with Rosalyn Yalow, who (with Solomon A Berson) developed the extraordinarily sen sitive radioimmunoassay (RIA) for peptide hormones and used it to study hormone action. RIA revolutionized
2 3 . 1 Hormones: Diverse Structures for Diverse F u n ctions
B O X 23 - 1
[9o3]
;,; ��...��"K·�,r�u How Is a Hormone Discovered ? The Arduous Path to ··;,;.r:. Purified I nsulin
Millions of people with type 1 diabetes mellitus inject themselves daily with pure insulin to compensate for the lack of production of this critical hormone by their own pancreatic f3 cells. Insulin injection is not a cure for dia betes, but it allows people who otherwise would have died young to lead long and productive lives. The dis covery of insulin, which began with an accidental obser vation, illustrates the combination of serendipity and careful experimentation that led to the discovery of many of the hormones. In 1 889, Oskar Minkowski, a young assistant at the Medical College of Strasbourg, and Josef von Mer ing, at the Hoppe-Seyler Institute in Strasbourg, had a friendly disagreement about whether the pancreas, known to contain lipases, was important in fat diges tion in dogs . To resolve the issue, they began an ex periment on the digestion of fats. They surgically removed the pancreas from a dog, but before their ex periment got any farther, Minkowski noticed that the dog was now producing far more urine than normal (a common symptom of untreated diabetes) . Also , the dog's urine had glucose levels far above normal (an other symptom of diabetes ) . These findings sug gested that lack of some pancreatic product caused diabetes. Minkowski tried unsuccessfully to prepare an ex tract of dog pancreas that would reverse the effect of re moving the pancreas-that is, would lower the urinary or blood glucose levels . We now know that insulin is a protein, and that the pancreas is very rich in proteases (trypsin and chymotrypsin) , normally released directly into the small intestine to aid in digestion. These pro teases doubtless degraded the insulin in the pancreatic extracts in Minkowski's experiments. Despite considerable effort, no significant progress was made in the isolation or characterization of the "antidiabetic factor" until the summer of 1 92 1 , when Frederick G. Banting, a young scientist working in the
Frederick G. Banti ng, 1 89 1 -1 941
J. j .
R. Macleod, 1 876-1 935
laboratory of J. J. R. MacLeod at the University of Toronto, and a student assistant, Charles Best, took up the problem. By that time, several lines of evidence pointed to a group of specialized cells in the pancreas (the islets of Langerhans ; see Fig. 23-27) as the source of the antidiabetic factor, which carne to be called in sulin (from Latin insula, "island"). Taking precautions to prevent proteolysis, Banting and Best (later aided by biochemist J. B. Collip) suc ceeded in December 1 92 1 in preparing a purified pan creatic extract that cured the symptoms of experimental diabetes in dogs. On January 25, 1 922 (just one month later!) , their insulin preparation was inj ected into Leonard Thompson, a 1 4-year-old boy severely ill with diabetes mellitus. Within days, the levels of ketone bodies and glucose in Thompson's urine dropped dra matically; the extract saved his life . In 1 923, Banting and MacLeod won the Nobel Prize for their isolation of insulin. Banting immediately announced that he would share his prize with Best; MacLeod shared his with Collip . By 1 923, pharmaceutical companies were supply ing thousands of patients throughout the world with insulin extracted from porcine pancreas. With the de velopment of genetic engineering techniques in the 1 980s (Chapter 9) , it became possible to produce un limited quantities of human insulin by inserting the cloned human gene for insulin into a microorganism, which was then cultured on an industrial scale. Some patients with diabetes are now fitted with implanted insulin pumps, which release adjustable amounts of insulin on demand to meet changing needs at meal times and during exercise. There is a reasonable prospect that, in the future, transplantation of pan creatic tissue will provide diabetic patients with a source of insulin that responds as well as normal pan creas , releasing insulin into the bloodstream only when blood glucose rises.
Charles Best, 1 899-1 978
].
B. Col l i p, 1 892-1 965
904
J
H o r m o n a l Reg u l ation a n d I nte g ration of M a m m a lian Meta bo lism
CH., O = C/ 'CH., Q
I
- II
I
/
l C H2
0
II
II
NH - CH - C --I NH - CH - C --1
I
I I
I
I
:
Hz
�
I I
-.....:
CH2
I
- CH -
.f'o NH ,
C - NH
I
CH
HC - N
Pyroglutamate
Histidine
Radiolabeled hormone
(a)
CH2
l
0)0)� 0�0) 0)�� 0)
F I G U R E 23-2 The structure of thyrotropin-releasing hormone (TRH).
Purified (by heroic efforts) from extracts of hypothalamus, TRH proved to be a derivative of the tripeptide G lu-H is-Pro. The side-chain car boxyl group of the a m i no-term inal Glu forms an amide (red bond) with the residue's a-amino group, creating pyroglutamate, and the carboxyl group of the carboxyl-terminal Pro is converted to an am ide (red -NH2). Such modifications are common among the sma l l pep tide hormones. In a typical protein of M, -50,000, the charges on the amino- and carboxyl-term inal groups contribute relatively l ittle to the overal l charge on the molecule, but in a tripeptide these two charges domi nate the properties of the molecule. Formation of the am ide derivatives removes these cha rges.
Rosalyn S. Yalow
CD
� (!)(!)(!)
,. ,. ,. ,. T T ,. TT TT TTTTTT
hormone research by making possible the rapid, quantitative, and specific measurement of hormones in minute amounts. Hormone-specific antibod ies are the key to the radio-im munoassay. Purified hormone, injected into rabbits, elicits an tibodies that bind to the hor mone with very high affinity and specificity. When a con stant amount of isolated anti body is incubated with a fixed amount of the radioactively la beled hormone, a certain frac tion of the radioactive hormone binds to the antibody ( Fig. 2 :3-!l ) . If, in addition to the ra diolabeled hormone, unlabeled hormone is also present, the un labeled hormone competes with and displaces some of the la beled hormone from its binding site on the antibody. This bind ing competition can be quanti fied by reference to a standard curve obtained with known amounts of unlabeled hormone. The degree to which labeled hor mone is displaced from antibody is a measure of the amount of (unlabeled) hormone in a sam ple of blood or tissue extract. By using very highly radioactive hormone, researchers can make
(!)(!)(!) (!)(!) 0)
Radiolabeled and unlabeled hormone
(b)
tJ ..Q
..9 0
:.a
J!
TT T T T TT T T T
0)
1.2
/ Standard
...-----...
-81 ...
< ----::: "C
"C QJ
Qj
Roger Guillemin
(!)(!)(!) T (!)(!)(!) (!)(!) � �
Antibody
Prolylamide
pyroGlu-His-Pro-NH2
Andrew V. Schal l y
TTT TTT TTT
::c
j
0 :;::; Ol ...
g
.0
3
0.
curve
0.6
0.4 0.2
0
1
100
10
1000
Unlabeled ACTH added (pg)
(T )
FIGURE 23-3 Radioimmunoassay (RIA). (a)
A low concentration of radiolabeled hormone (red) is incubated with CD a fixed amount of anti body specific for that hormone or (1) a fixed amount of antibody and various concentrations of unlabeled hormone (blue). I n the latter case, unlabeled hormone competes with labeled hormone for binding to the antibody; the amount of labeled hormone bound varies inversely with the concentration of unlabeled hormone present. (b) A radioim munoassay for adrenocorticotropic hormone (ACTH; also called corticotropin). A standard curve of the ratio [bound]/[unbound] radio labeled ACTH vs. [unlabeled ACTH added] (on a logarithmic scale) is constructed and used to determine the amount of (unlabeled) ACTH in an unknown sample. If an al iquot conta i n i ng an unknown quantity of unlabeled hormone gives, say, a val ue of 0.4 for the ratio [bound]/[un bound] (see arrow), the al iquot must contain about 20 pg of ACTH .
the assay sensitive t o picograms o f hormone in a sample. A newer variation of this technique, enzyme-linked im munosorbent assay (ELISA) , is illustrated in Figure 5-26b. Hormones Act through Specific High-Affinity Cellular Receptors As we saw in Chapter 12, all hormones act through highly specific receptors in hormone-sensitive target cells, to which the hormones bind with high affinity (see
2 3 . 1 Hormones: Dive rse Structu res for Diverse F u nctions
Fig. 12-la). Each cell type has its own combination of hor mone receptors, which define the range of its hormone re sponsiveness. Moreover, two cell types with the same type of receptor may have different intracellular targets of hor mone action and thus may respond differently to the same hormone. The specificity of hormone action results from structural complementarity between the hormone and its receptor; this interaction is extremely selective, so struc turally similar hormones can have different effects. The high affinity of the interaction allows cells to respond to very low concentrations of hormone. In the design of drugs intended to intervene in honnonal regulation, we need to know the relative specificity and affinity of the drug and the natural hormone. Recall that hormone-receptor in teractions can be quantified by Scatchard analysis (see Box 12-1 ) , which, under favorable conditions, yields a quantitative measure of affinity (the dissociation constant for the complex) and the number of hormone-binding sites in a preparation of receptor. The locus of the encounter between hormone and receptor may be extracellular, cytosolic, or nuclear, depending on the hormone type. The intracellular consequences of hormone-receptor interaction are of at least six general types : (1) a second messenger (such as cAMP or inositol trisphosphate) generated inside the cell acts as an allosteric regulator of one or more enzymes; (2) a receptor tyrosine kinase is activated by the extra cellular hormone; (3) a receptor guanylyl cyclase is acti vated and produces the second messenger cGMP; (4) a change in membrane potential results from the opening or closing of a hormone-gated ion channel; (5) an adhe sion receptor on the cell surface interacts with molecules in the extracellular matrix and conveys information to the cytoskeleton; or (6) a steroid or steroidlike molecule causes a change in the level of expression (transcription of DNA into mRNA) of one or more genes, mediated by a nuclear hormone receptor protein (see Fig. 1 2-2) . Water-soluble peptide and amine hormones (insulin and epinephrine, for example) act extracellularly by binding to cell surface receptors that span the plasma membrane ( Fig. 23-4). When the hormone binds to its extracellular domain, the receptor undergoes a confor mational change analogous to that produced in an al losteric enzyme by binding of an effector molecule . The conformational change triggers the downstream effects of the hormone. A single hormone molecule, in forming a hormone receptor complex, activates a catalyst that produces many molecules of second messenger, so the receptor serves not only as a signal transducer but also as a signal amplifier. The signal may be further amplified by a signal ing cascade, a series of steps in which a catalyst activates a catalyst, resulting in very large amplifications of the original signal. A cascade of this type occurs in the regu lation of glycogen synthesis and breakdown by epinephrine (see Fig. 12-7) . Epinephrine activates (through its receptor) adenylyl cyclase, which produces many molecules of cAMP for each molecule of receptor bound hormone. Cyclic AMP in turn activates cAMP-
Peptide or amine hormone binds to receptor on the outside of the cell; acts through receptor without entering the cell.
[9os]
Steroid or thyroid hormone enters the cell; hormone receptor complex acts in the nucleus.
econd messenger (e.g. cAMP) --'!'"""� ofsp cific genes
Altered transcription
Altered activity of preexisting enzyme
Altered amount of newly synthesized proteins
F IGURE 23-4 Two general mechanisms of hormone action. The pep tide and amine hormones are faster acting than steroid and thyroid hormones.
dependent protein kinase (protein kinase A) , which acti vates glycogen phosphorylase b kinase, which activates glycogen phosphorylase b. The result is signal amplifica tion: one epinephrine molecule causes the production of many thousands of molecules of glucose 1-phosphate from glycogen. Water-insoluble hormones (steroid, retinoid, and thyroid hormones) readily pass through the plasma membrane of their target cells to reach their receptor proteins in the nucleus (Fig. 23-4) . With this class of hormones , the hormone-receptor complex itself carries the message; it interacts with DNA to alter the expres sion of specific genes, changing the enzyme complement of the cell and thereby changing cellular metabolism (see Fig. 1 2-29) . Hormones that act through plasma membrane re ceptors generally trigger very rapid physiological or bio chemical responses. Just seconds after the adrenal medulla secretes epinephrine into the bloodstream, skeletal muscle responds by accelerating the breakdown of glycogen. By contrast, the thyroid hormones and the sex (steroid) hormones promote maximal responses in their target tissues only after hours or even days. These differences in response time correspond to different modes of action. In general, the fast-acting hormones lead to a change in the activity of one or more preexist ing enzymes in the cell, by allosteric mechanisms or
[9 o6]
H ormonal Regu lation a n d I ntegration of M a m m a l i a n Meta bolism
covalent modification. The slower-acting hormones gen erally alter gene expression, resulting in the synthesis of more (upregulation) or less (downregulation) of the regulated protein(s) . Hormones Are Chemically Diverse Mammals have several classes of hormones, distinguish able by their chemical structures and their modes of action (Table 23-1 ) . Peptide, amine, and eicosanoid hormones act from outside the target cell via surface re ceptors. Steroid, vitamin D, retinoid, and thyroid hor mones enter the cell and act through nuclear receptors. Nitric oxide also enters the cell, but activates a cytosolic enzyme , guanylyl cyclase (see Fig. 1 2-20) . Hormones can also be classified by the way they get from their point of release to their target tissue. En docrine (from the Greek endon, "within," and krinein, "to release") hormones are released into the blood and carried to target cells throughout the body (insulin and glucagon are examples) . Paracrine hormones are re leased into the extracellular space and diffuse to neigh boring target cells (the eicosanoid hormones are of this type) . Autocrine hormones affect the same cell that re leases them, binding to receptors on the cell surface. Mammals are hardly unique in possessing hormonal signaling systems. Insects and nematode worms have highly developed systems for hormonal regulation, with fundamental mechanisms similar to those in mammals. Plants, too, use hormonal signals to coordinate the ac tivities of their tissues (Chapter 1 2) . The study of hor mone action is not as advanced in plants as in animals, but we do know that some mechanisms are shared. To illustrate the structural diversity and range of ac tion of mammalian hormones , we consider representa tive examples of each major class listed in Table 23- 1 . Peptide Hormones Peptide hormones may have from 3 to 200 or more amino acid residues. They in clude the pancreatic hormones insulin, glucagon, and
TAB L E 2 3 - 1
somatostatin; the parathyroid hormone calcitonin; and all the hormones of the hypothalamus and pituitary (de scribed below) . These hormones are synthesized on ribo somes in the form of longer precursor proteins (prohormones) , then packaged into secretory vesicles and proteolytically cleaved to form the active peptides. Insulin is a small protein (Mr 5,800) with two polypeptide chains, A and B, joined by two disulfide bonds. It is syn thesized in the pancreas as an inactive single-chain pre cursor, preproinsulin (Fig. 23-5 ) , with an amino-terminal "signal sequence" that directs its passage into secretory vesicles. (Signal sequences are discussed in Chapter 27; see Fig. 27-38.) Proteolytic removal of the signal se quence and formation of three disulfide bonds produces proinsulin, which is stored in secretory granules in pan creatic {3 cells. When blood glucose is elevated sufficiently to trigger insulin secretion, proinsulin is converted to ac tive insulin by specific proteases, which cleave two pep tide bonds to form the mature insulin molecule. In some cases, prohormone proteins , rather than yielding a single peptide hormone, produce several active hormones. Pro-opiomelanocortin (POMC) is a spectacu lar example of multiple hormones encoded by a single gene. The POMC gene encodes a large polypeptide that is progressively carved up into at least nine biologically ac tive peptides (Fig. 23-6 ) . In many peptide hormones the terminal residues are modified, as in TRH (Fig. 23-2) . The concentration of peptide hormones in secretory granules is so high that the vesicle contents are virtually crystalline; when the contents are released by exocyto sis, a large amount of hormone is released suddenly. The capillaries that serve peptide-producing endocrine glands are fenestrated (and thus permeable to pep tides) , so the hormone molecules readily enter the bloodstream for transport to target cells elsewhere. As noted earlier, all peptide hormones act by binding to re ceptors in the plasma membrane. They cause the gener ation of a second messenger in the cytosol, which changes the activity of an intracellular enzyme , thereby altering the cell's metabolism.
Classes of Hormones
Type
Example
Synthetic path
Peptide
Insulin, glucagon
Proteolytic processing of prohormone
Catecholamine
Epinephrine
From tyrosine
Eicosanoid
PGE1
From arachidonate (20:4 fatty acid)
Steroid
Testosterone
From cholesterol
Vitamin D
1 ,25-Dihydroxycholecalciferol
From cholesterol
Retinoid
Retinoic acid
From vitamin A
Thyroid
Triiodothyronine (T3)
From Tyr in thyroglobulin
Nitric oxide
Nitric oxide
From arginine + 02
Mode of action
Plasma membrane receptors; second messengers
Nuclear receptors; transcriptional regulation
Cytosolic receptor (guanylyl cyclase) and second messenger (cGMP)
23 . 1 Hormones: Diverse Structures for Diverse Fu nctions
Preproinsulin
Proinsulin
Signal
Ha.,. _
equence
c
A
FIGURE 23-5
Mature insulin
t
NHa
, - ·S-S
B
I
,s-s
s
A chain I
s-
[9o7]
B ch ain
Insulin. Mature insulin is formed from its larger precursor preproinsu l i n by proteolytic pro cessing. Removal of a 23 amino acid segment (the signal sequence) at the amino terminus of preproin sulin and formation of three disulfide bonds produces proinsu l i n. Further proteolytic cuts remove the C pep tide from proinsulin to produce mature i nsulin, com posed of A and B chains. The amino acid sequence of bovine i nsul i n is shown in Figure 3-24.
I
coo
ignal equenc
peptide
�
Pro-opiomelanocortin (POMC) gene
I
----------------------------------� DNA
i i
5' ------
Signal peptide
3'
mRNA
y-MSH
FIGURE 23-6
Proteolytic processing of the pro-opiomelanocortin
(POMC) precursor. The
i nitial gene product of the POMC gene is a long polypeptide that undergoes cleavage by a series of specific proteases to produce ACTH, /3- and y-l ipotropin, a-, /3-, and y MSH (melanocyte-stimulating hormone, or melanocortin), CLIP (corticotropin-like intermediary peptide), f3-endorphin, and Met enkephal in. The points of cleavage are paired basic residues, Arg-Lys, Lys-Arg, or Lys-Lys.
Catecholamine Hormones The water-soluble com pounds epinephrine (adrenaline) and norepineph rine (noradrenaline) are catecholamines, named for the structurally related compound catechol. They are synthesized from tyrosine. Tyrosine � L-Dopa
�
Dopamine �
Norepinephrine � Epinephrine
Catecholamines produced in the brain and in other neural tissues function as neurotransmitters, but epinephrine
y-Lipotl'opin
i
i
f3 -Endorphin
D
Met-enk.ephalin
and norepinephrine are also hormones, synthesized and secreted by the adrenal glands. Like the peptide hor mones, catecholamines are highly concentrated in secre tory vesicles and released by exocytosis, and they act through surface receptors to generate intracellular sec ond messengers. They mediate a wide variety of physio logical responses to acute stress (see Table 23-6) .
Eicosanoid Hormones
The eicosanoid hormones (prostaglandins, thromboxanes, and leukotrienes) are
[9os]
H o r m o n a l Regu lation a n d I ntegration of M a m m a l i a n Meta b o l i s m
derived from the 20-carbon polyunsaturated fatty acid arachidonate. Phospholipids
1
Arachidonate (20:4)
Prostaglandins
Thromboxanes
Leukotrienes
Unlike the hormones described above, they are not syn thesized in advance and stored; they are produced, when needed, from arachidonate enzymatically released from membrane phospholipids by phospholipase A2 . The enzymes of the pathway leading to prostaglandins and thromboxanes (see Fig. 2 1-15) are very widely dis tributed in mammalian tissues ; most cells can produce these hormone signals, and cells of many tissues can respond to them through specific plasma membrane receptors. The eicosanoid hormones are paracrine hor mones, secreted into the interstitial fluid (not primarily into the blood) and acting on nearby cells. Prostaglandins promote the contraction of smooth muscle , including that of the intestine and uterus (and can therefore be used medically to in duce labor) . They also mediate pain and inflammation in all tissues. Many antiinflammatory drugs act by inhibit ing steps in the prostaglandin synthetic pathway (see Fig. 2 1-15) . Thromboxanes regulate platelet function and therefore blood clotting. Leukotrienes LTC4 and LTD4 act through plasma membrane receptors to stimu late contraction of smooth muscle in the intestine, pul monary airways, and trachea. They are mediators of anaphylaxis, a severe, detrimental immune response. • Steroid Hormones The steroid hormones (adreno cortical hormones and sex hormones) are synthesized from cholesterol in several endocrine tissues. Cholesterol
1
/
j
Vitamin D Hormone Calcitriol (1 ,25-dihydroxy cholecalciferol) is produced from vitamin D by enzyme catalyzed hydroxylation in the liver and kidneys (see Fig. 1 0-20a) . Vitamin D is obtained in the diet or by photolysis of 7 -dehydrocholesterol in skin exposed to sunlight. 7-Dehydrocholesterol
1
UV light
Vitamin D3 (cholecalciferol)
1
25-Hydroxycholecalciferol
1
1 ,25- Dihydroxycholecalciferol
Calcitriol works in concert with parathyroid hor mone in Ca2+ homeostasis, regulating [Ca2+ ] in the blood and the balance between Ca2+ deposition and Ca2+ mobilization from bone. Acting through nuclear re ceptors, calcitriol activates the synthesis of an intestinal Ca2 + -binding protein essential for uptake of dietary Ca2+ . Inadequate dietary vitamin D or defects in the biosynthesis of calcitriol result in serious diseases such as rickets, in which bones are weak and malformed (see Fig. 1 0-20b). •
Testosterone
Retinoid Hormones Retinoids are potent hormones that regulate the growth, survival, and differentiation of cells via nuclear retinoid receptors. The prohormone retinol is synthesized from /3-carotene, primarily in liver (see Fig. 1 0-2 1 ) , and many tissues convert retinol to the hormone retinoic acid (RA) .
Estradiol (sex hormones)
13-Carotene
Progesterone
Cortisol (glucocorticoid)
hydroxyl groups. Many of these reactions involve cy tochrome P-450 enzymes (see Box 2 1-1) . The steroid hormones are of two general types. Glucocorticoids (such as cortisol) primarily affect the metabolism of car bohydrates; mineralocorticoids (such as aldosterone) regulate the concentrations of electrolytes in the blood. Androgens (testosterone) and estrogens (such as estra diol; see Fig. 1 0-1 9) are synthesized in the testes and ovaries. Their synthesis also involves cytochrome P-450 enzymes that cleave the side chain of cholesterol and in troduce oxygen atoms. These hormones affect sexual development, sexual behavior, and a variety of other re productive and nonreproductive functions. All steroid hormones act through nuclear recep tors to change the level of expression of specific genes (p . 456) . They can also have more rapid effects, prob ably mediated by receptors in the plasma membrane.
Aldosterone (mineralocorticoid)
1
They travel to their target cells through the blood stream, bound to carrier proteins. More than 50 corti costeroid hormones are produced in the adrenal cortex by reactions that remove the side chain from the D ring of cholesterol and introduce oxygen to form keto and
1
Vitamin A1 (retinol)
1
Retinoic acid
2 3 . 1 Hormones: Diverse Structures for Diverse F u n ctions
All
tissues are retinoid targets, as all cell types have at least one form of nuclear retinoid recep tor. In adults, the most significant targets include cornea, skin, epithelia of the lungs and trachea, and the immune system. RA regulates the synthesis of proteins essential for growth or differentiation. Excessive vita min A can cause birth defects, and pregnant women are advised not to use the retinoid creams that have been developed for treatment of severe acne. • Thyroid Hormones The thyroid hormones T4 (thy roxine) and T3 (triiodothyronine) are synthesized from the precursor protein thyroglobulin CMr 660,000) . Up to 20 Tyr residues in thyroglobulin are enzymatically iodi nated in the thyroid gland, then two iodotyrosine residues condense to form the precursor to thyroxine. When needed, thyroxine is released by proteolysis. Con densation of monoiodotyrosine with diiodothyronine produces T3, which is also an active hormone released by proteolysis. Thyroglobulin-Tyr
1
Thyroglobulin -Tyr- I (iodinated Tyr residues)
1
proteolysis
Thyroxine (T4), triiodothyronine (T3 )
The thyroid hormones act through nuclear receptors to stimulate energy-yielding metabolism, especially in liver and muscle, by increasing the expression of genes en coding key catabolic enzymes. Nitric Oxide (NO) Nitric oxide is a relatively stable free radical synthesized from molecular oxygen and the guanidinium nitrogen of arginine (see Fig. 22-31) in a reaction catalyzed by NO synthase.
+
Arginine + 1! NADPH
202
NO
+
----t
citrulline
+
2H20 +
signals by the endocrine tissues. For a more complete answer, we must look at the hormone-producing systems of the human body and some of their functional interrelationships. Figure 23-7 shows the anatomic location of the major endocrine glands in humans, and Figure 2 3-8 represents the "chain of command" in the hormonal sig naling hierarchy. The hypothalamus, a small region of the brain ( Fig. 23-9 ), is the coordination center of the endocrine system; it receives and integrates messages from the central nervous system. In response to these messages, the hypothalamus produces regulatory hor mones (releasing factors) that pass directly to the nearby pituitary gland, through special blood vessels and neurons that connect the two glands (Fig. 23-9b) . The pituitary gland has two functionally distinct parts. The posterior pituitary contains the axonal endings of many neurons that originate in the hypothalamus . These neurons produce the short peptide hormones oxytocin and vasopressin (Fig. 23-1 0 ), which move down the axon to the nerve endings in the pituitary, where they are stored in secretory granules to await the signal for their release. The anterior pituitary responds to hypothalamic hormones carried in the blood, producing tropic hormones, or tropins (from the Greek tropos, "turn") . These relatively long polypeptides activate the next rank of endocrine glands (Fig. 23-8) , which includes the adrenal cortex, thyroid gland, ovaries, and testes. These glands in turn secrete their specific hormones, which are carried in the bloodstream to the target tissues. For
._------- Hypothalamus ------ Pituitary
------- Thyroid
1! NADP +
This enzyme is found in many tissues and cell types: neu rons, macrophages, hepatocytes, myocytes of smooth muscle , endothelial cells of the blood vessels, and ep ithelial cells of the kidney. NO acts near its point of re lease, entering the target cell and activating the cytosolic enzyme guanylyl cyclase, which catalyzes the formation of the second messenger cGMP (see Fig. 12-20) .
[9o9]
�--7---
Parathyroids (behind the thyroid)
f -7:---:--- Adipose tissue
--�--:1-----:---- Adrenals �:.......Jt--...L,_-;---- Pancreas ___, &.--,--:- Kidneys Ovaries
it'-=::.._
_
Hormone Release Is Regulated by a Hierarchy of Neuronal and Hormonal Signals The changing levels of specific hormones regulate spe cific cellular processes, but what regulates the level of each hormone? The brief answer is that the central nervous system receives input from many internal and external sensors-signals about danger, hunger, dietary intake, blood composition and pressure, for example and orchestrates the production of appropriate hormonal
'----- Testes (male)
FIGURE 23-7 The major endocrine glands. The glands are shaded pink.
1 91 OJ
H o r m o n a l Regu lation a n d I ntegrati o n of M a m m a l i a n Meta b o l i s m
9 entraJfl!rl\l!
Sensory inp
Neuroendocrine origins of signals
FIGURE 23-8 The major endocrine systems and their target
nvironment
tissues.
Signals originating in the central nervous system (top) pass via a series of relays to the ultimate target tissues (bottom). In addition to the systems shown, the thymus, pineal gland, and groups of cells in the gastrointestinal tract also secrete hormones.
S)«l.etn
Hypothalamus
111
Hypothalamic hormones
( releasing factors)
First targets
l
I
Anterior pituit.ary
1
Corticotropin
Thyrotropin
(ACTH)
M, 28,000
M, 4 .500
Second targets
Adrenal corte�
Thyroid
Cortisol,
Thyroxine
hormone
M, 24,000
Ultimate targets
!
Many tissues
Luteinizing
Somatotropin
Prolactin
Oxytocin
Vasopressin
M, 20,500
(growth hormone)
M, 22,000
M, 1,007
(antidiuretic
hormon e
!
hormone! M, 1 .040
M, 2 1 ,500
Ovaries/testes
corticosterone, (T4J, triiodoaldosterone
Follicle·
stimulating
thyronine (Tal
l
Muscles, liver
l
Progesteron e, estradiOl
Blood glucose
lrvel
I
IRiet celb of
prcrr !
Adrenal medulla
Insulin,
glucagon,
Testostel'one
somatostatin
Liver, bone
Reproductive organs
example, corticotropin-releasing hormone from the hy pothalamus stimulates the anterior pituitary to release ACTH, which travels to the zona fasciculata of the adre nal cortex and triggers the release of cortisol. Cortisol, the ultimate hormone in this cascade, acts through its
Mammary glands
Smooth muscle, mammary glands
Arteriole .
kidney
!ll Liver, muscles
Epinephrine
Liver, muscles, heart
receptor in many types of target cells to alter their metabolism. In hepatocytes, one effect of cortisol is to increase the rate of gluconeogenesis. Hormonal cascades such as those responsible for the release of cortisol and epinephrine result in large
Afferent nerve signals to hypothalamus
� .::: :... :; _ ._ ::..:. _ .._ _ _ _ _
�
Hypothalamus Anterior pituitary Posterior pituitary
(a)
FIGURE 23-9 Neuroendocrine origins of hormone signals. (a) Location of the hy
pothalamus and pituitary gland. (b) Details of the hypothalamus-pituitary system. Signals from connecting neurons stimu late the hypothalamus to secrete releasing factors i nto a blood vessel that carries the hormones directly to a capil lary net work in the anterior pituitary. In response to each hypothalamic releasing factor, the anterior pituitary releases the appropriate hormone into the general circula tion. Posterior pituitary hormones are synthesized i n neurons arising i n the hypo thalamus, transported along axons to nerve endings in the posterior pituitary, and stored there until released into the blood in response to a neuronal signal .
Anterior pituitary \\11..-- Capillary , network
Posterior pituitary
--
Release of posterior pituitary hormones (vasopressin, oxytocin) Veins carry hormones to systemic blood
(b)
Release of anterior pituitary hormones (tropins)
2 3 . 1 H o rmones: Diverse Structu res for Dive rse F u n ctions
+
I
Infection
+
NH
l
3
ys
? Tyr
I
Ile I Gln
S I S
tJ sn
Cys
I
Pro
I
ru Gly I
NHa
I
ys ? Tyr
NH2 Human oxytocin
Fear
S
I
S
Cys
I
Pro
I
rg
,,. - - �
C=O
I I
I I I
Gly
I
I
I
NH2
H ormones: Diverse Structures for Diverse
Hormones are chemical messengers secreted by certain tissues into the blood or interstitial fluid, serving to regulate the activity of other cells or tissues.
+--- Hypoglycemia
®
"' @
Hypothalamus
1 I I
f --
-?
®
"' @
Anterior pituitary
1
Adrenocorticotropic hormone (ACTH) (f.Lg)
I I
I I I I I I I I I I I
"' @
' - - - - - - - - - - Cortisol (mg)
/ 1 "-.
FIGURE 23-1 1 Cascade of hormone release following central nervous system input to the hypothalamus.
In each endocrine tissue along the pathway, a sti mulus from the level above is received, amplified, and transduced into the release of the next hormone in the cascade. The cascade is sensitive to regulation at several levels through feedback inhibition by the u ltimate hormone (in this case, cortisol). The product therefore regulates its own production, as in feedback inhibition of biosynthetic pathways with in a single cel l . •
Functions •
/
Corticotropin-releasing hormone (CRH) (ng)
Human vasopressin (antidiuretic hormone)
amplifications of the initial signal and allow exquisite fine-tuning of the output of the ultimate hormone (Fig. 23-1 1 ) . At each level in the cascade, a small signal elicits a larger response. For example, the ini tial electrical signal to the hypothalamus results in the release of a few nanograms of corticotropin-releasing hormone, which elicits the release of a few micrograms of corticotropin. Corticotropin acts on the adrenal cor tex to cause the release of milligrams of cortisol, for an overall amplification of at least a millionfold. At each level of a hormonal cascade, feedback inhi bition of earlier steps in the cascade is possible; an un necessarily elevated level of the ultimate hormone or of an intermediate hormone inhibits the release of earlier hormones in the cascade. These feedback mechanisms accomplish the same end as those that limit the output of a biosynthetic pathway (compare Fig. 23-1 1 with Fig. 6-33) : a product is synthesized (or released) only until the necessary concentration is reached.
1
Hemorrhage
I I
sn
FIGURE 23-10 Two hormones of the posterior pituitary gland. The carboxyl-terminal residue of both peptides is glyci nam ide, - N H-CH 2 -CONH2 (as noted in Fig. 2 3-2 , amidation of the car boxyl terminus is common in short peptide hormones). These two hor mones, identical in all but two residues (shaded), have very different biological effects. Oxytocin acts on the smooth muscle of the uterus and mammary gland, causing uterine contractions during labor and promoting m i l k release during lactation. Vasopressi n (also called an tidiuretic hormone) increases water reabsorption in the kidney and promotes the constriction of blood vessels, thereby increasing blood pressure.
S U MMARY 2 3 . 1
'
Central Pain _..... nervous system
tJ
C=O
I
l
I Phe I Gln
[911�
•
Radioimmunoassay and ELISA are two very sensitive techniques for detecting and quantifying hormones. Peptide, amine, and eicosanoid hormones act outside the target cell on specific receptors in the plasma membrane, altering the level of an intracellular second messenger.
[?1 2] •
•
•
Hormonal Regu lation a n d I ntegration of M a m m a l i a n Meta b o l i s m
Steroid, vitamin D, retinoid, and thyroid hormones enter target cells and alter gene expression by interacting with specific nuclear receptors. Hormonal cascades, in which catalysts activate catalysts, amplify the initial stimulus by several orders of magnitude, often in a very short time (seconds) . Nerve impulses stimulate the hypothalamus to send specific hormones to the pituitary gland, thus stimulating (or inhibiting) the release of tropic hormones. The anterior pituitary hormones in turn stimulate other endocrine glands (thyroid, adrenals, pancreas) to secrete their characteristic hormones, which in turn stimulate specific target tissues.
fats, which serve as fuel throughout the body; in the brain, cells pump ions across their plasma membranes to pro duce electrical signals. The liver plays a central processing and distributing role in metabolism and furnishes all other organs and tissues with an appropriate mix of nutrients via the bloodstream. The functional centrality of the liver is indicated by the common reference to all other tissues and organs as "extrahepatic" or "peripheral." We therefore begin our discussion of the division of metabolic labor by considering the transformations of carbohydrates, amino acids, and fats in the mammalian liver. This is followed by brief descriptions of the primary metabolic functions of adipose tissue, muscle, brain, and the medium that inter connects all others: the blood. The Liver Processes a nd Distributes N utrients
23.2 Tissue-Specific Metabolism: The Division of labor Each tissue of the human body has a specialized func tion, reflected in its anatomy and metabolic activity ( Fig. 23-1 2 ) . Skeletal muscle allows directed motion; adipose tissue stores and releases energy in the form of
During digestion in mammals, the three main classes of nutrients (carbohydrates, proteins, and fats) undergo enzymatic hydrolysis into their simple constituents. This breakdown is necessary because the epithelial cells lining the intestinal lumen absorb only relatively small molecules. Many of the fatty acids and monoacylglyc erols released by digestion of fats in the intestine are Brain
Secretes insulin and glucagon in response to changes in blood glucose concentration.
Processes fats, carbohydrates, proteins from diet; synthesizes and distributes lipids, ketone bodies, and glucose for other tissues; converts excess nitrogen to urea.
Pancreas
Transports ions to maintain membrane potential; integrates inputs from body and surroundings; sends signals to other organs.
Lymphatic system
Liver Carries lipids from intestine to liver.
Portal vein Carries nutrients from intestine to liver.
Absorbs nutrients from the diet, moves them into blood or lymphatic system.
Synthesizes, stores, and mobilizes triacylglycerols. (Brown adipose tissue: carries out thermogenesis.)
ses ATP to do mechanical work.
Skeletal muscle FIGURE 23- 1 2 Specialized metabolic functions of mammalian tissues.
23.2 Tissue-Specific Metabolism: The Division of labor
reassembled within these epithelial cells into triacyl glycerols (TAGs) .
[?1 3]
To meet these changing circumstances, the liver has remarkable metabolic flexibility. For example, when the
After being absorbed, most sugars and amino acids
diet is rich in protein, hepatocytes supply themselves
and some reconstituted TAGs pass from intestinal ep
with high levels of enzymes for amino acid catabolism and
ithelial cells into blood capillaries, and travel in the
gluconeogenesis. Within hours after a shift to a high
bloodstream to the liver; the remaining TAGs enter adi
carbohydrate diet, the levels of these enzymes begin to
pose tissue via the lymphatic system. The portal vein is
drop and the hepatocytes increase their synthesis of en
a direct route from the digestive organs to the liver, and
zymes essential to carbohydrate metabolism and fat syn
liver therefore has first access to ingested nutrients. The
thesis. Liver enzymes turn over (are synthesized and
liver has two main cell types. Kupffer cells are phago
degraded) at
cytes, important in immune function.
other tissues, such as muscle. Extrahepatic tissues also
Hepatocytes, of
5 to 1 0 times the rate of enzyme turnover in
primary interest here, transform dietary nutrients into
can adjust their metabolism to prevailing conditions, but
the fuels and precursors required by other tissues, and
none is as adaptable as the liver, and none is so central to
export them via the blood. The kinds and amounts of nu
the organism's overall metabolism. What follows is a
trients supplied to the liver vary with several factors, in
survey of the possible fates of sugars, amino acids, and
cluding the diet and the time between meals. The
lipids that enter the liver from the bloodstream. To help
demand of extrahepatic tissues for fuels and precursors
you recall the metabolic transformations discussed here,
varies among organs and with the level of activity and
Table
overall nutritional state of the individual.
indicates by figure number where each pathway is
TA BLE 23-2 Pathway
23-2 shows the major pathways and processes and
Pathways of Carbohydrate, Amino Add, and Fat Metabolism Illustrated In Earlier Chapters -1 � Figure reference
Citric acid cycle:
1 6-7
acetyl-GoA � 2C02
Oxidative phosphorylation:
1 9-20
ATP synthesis
Carbohydrate catabolism Glycogenolysis:
glycogen � glucose ! -phosphate � blood glucose
Hexose entry into glycolysis: Glycolysis:
fructose, mannose, galactose � glucose 6-phosphate
Lactic acidfermentation:
pyruvate � acetyl-GoA
glucose � lactate + 2ATP
Pentose phosphate pathway:
14-10 14-2
glucose � pyruvate
Pyruvate dehydrogenase reaction:
1 5-25; 1 5-26
glucose 6-phosphate � pentose phosphates + NADPH
16-2 14-3 14-21
Carbohydrate anabolism Gluconeogenesis:
citric acid cycle intermediates � glucose
Glucose-alanine cycle: Glycogen synthesis:
glucose � pyruvate � alanine � glucose
glucose 6-phosphate � glucose ! -phosphate � glycogen
14-16 18-9 15-30
Amino acid and nucleotide metabolism Amino acid degradation:
amino acids � acetyl-GoA, citric acid cycle intermediates
22-9
Amino acid synthesis Urea cycle:
18-10
NH3 � urea
Glucose-alanine cycle: Nucleotide synthesis:
18-15
alanine � glucose
amino acids � purines, pyrimidines
18-9 22-33; 22-36 22-29
Hormone and neurotransmitter synthesis
Fat catabolism {3 Oxidation offatty acids: fatty acid � acetyl-GoA
1 7-8
Oxidation of ketone bodies:
1 7-19
{3-hydroxybutyrate � acetyl-GoA � C02 via citric acid cycle
Fat anabolism Fatty acid synthesis:
acetyl-GoA � fatty acids
Triacylglycerol synthesis: Ketone body formation:
acetyl-GoA � fatty acids � triacylglycerol
acetyl-GoA � acetoacetate, {3-hydroxybutyrate
Cholesterol and cholesteryl ester synthesis: Phospholipid synthesis:
acetyl-GoA � cholesterol � cholesteryl esters
fatty acids � phospholipids
2 1-6 2 1-18; 2 1-19 1 7-18 21-33 to 2 1-37 2 1-17; 2 1-23 to 2 1-28
[914]
H o r m o n a l Regulation a n d I n tegration of M a m m a l i a n Meta b o l i s m
presented in detail. Here, we provide surrunaries of the
needs of the organism. By the action of various alloster
pathways, referring to the numbered pathways and reac
ically regulated enzymes , and through hormonal regula
tions in Figures 23-13 to 23-15.
tion of enzyme synthesis and activity, the liver directs the flow of glucose into one or more of these pathways.
Sugars
The
glucose
transporter
of
CD
hepatocytes
Glucose 6-phosphate is dephosphorylated by
(GLUT2) is so effective that the concentration of glu
glucose 6-phosphatase to yield free glucose
cose in a hepatocyte is essentially the same as that in the
Fig. 1 5-28) , which is exported to replenish blood glu
(see
blood. Glucose entering hepatocytes is phosphorylated
cose. Export is the predominant pathway when glucose
by hexokinase IV (glucokinase) to yield glucose 6-phos
6-phosphate is in limited supply, because the blood
phate . Glucokinase has a much higher K111 for glucose
glucose concentration must be kept sufficiently high
( 1 0 mM) than do the hexokinase isozymes in other cells
( 4 mM) to provide adequate energy for the brain and
(p. 584) and, unlike these other isozymes, it is not inhib
other tissues.
ited by its product, glucose 6-phosphate. The presence
needed to form blood glucose is converted to liver glyco
(g)
Glucose 6-phosphate not irrunediately
of glucokinase allows hepatocytes to continue phospho
gen, or has one of several other fates. Following glycoly
rylating glucose when the glucose concentration rises
sis and the pyruvate dehydrogenase reaction,
well above levels that would overwhelm other hexoki
acetyl-GoA so formed can be oxidized for energy produc
@
the
nases. The high K111 of glucokinase also ensures that the
tion by the citric acid cycle, with ensuing electron trans
phosphorylation of glucose in hepatocytes is minimal
fer
when the glucose concentration is low, preventing the
(Normally, however, fatty acids are the preferred fuel for
and
oxidative
phosphorylation
yielding
ATP.
@ Acetyl-GoA can
liver from consuming glucose as fuel via glycolysis. This
energy production in hepatocytes.)
spares glucose for other tissues. Fructose, galactose,
also serve as the precursor of fatty acids, which are in
and mannose, all absorbed from the small intestine , are
corporated into TAGs and phospholipids, and of choles
also converted to glucose 6-phosphate by enzymatic
terol. Much of the lipid synthesized in the liver is
pathways examined in Chapter 1 4 . Glucose 6-phosphate
transported to other tissues by blood lipoproteins.
is at the crossroads of carbohydrate metabolism in the
ternatively, glucose 6-phosphate can enter the pentose
liver. It may take any of several major metabolic routes
phosphate
(Fig. 23-13 ) , depending on the current metabolic
(NADPH) , needed for the biosynthesis of fatty acids and
pathway,
@ Al
yielding both reducing power
cholesterol, and D-ribose 5-phosphate, a precursor for nucleotide biosynthesis. NADPH is also an essential co Liver glycogen
® Glucose 6phosphate
factor in the detoxification and elimination of many
Hepatocyte
---•••
Blood
drugs and other xenobiotics metabolized in the liver.
_.,.,.
_
glucose
Amino Acids Amino acids that enter the liver follow s v ral important m tabolic rout s (Fig. 23-1 4 ). CD Tl t ey a re pre ·urs r Jor protein synthesis, a process ·
discussed in Chapter 27. The liver constantly renews its
glycolysiB
NADPH Triacylglyoerol , phospholipids
®
l phosphat J t. t � · let �
t ��'.:; Chol"""''
Pyruvate
ucleotide
Ribose 5-
Acetyl- oA
@
ADP + P;
02
ATP
H20
oxidative phosphorylation
own proteins, which have a relatively high turnover rate (average half-life of hours to days) , and is also the site of biosynthesis of most plasma proteins .
(2) Alternatively,
amino acids pass in the bloodstream to other organs , to be used in the synthesis of tissue proteins .
@
Other
amino acids are precursors in the biosynthesis of nu cleotides, hormones, and other nitrogenous compounds in the liver and other tissues.
@ Amino acids not needed as biosynthetic precur
sors are transaminated or deaminated and degraded to yield pyruvate and citric acid cycle intermediates, with various fates;
@ the arrunonia released is converted to
the excretory product urea.
®
Pyruvate can be con
verted to glucose and glycogen via gluconeogenesis, or
@ it can be converted to acetyl-GoA, which has several possible fates: (j) oxidation via the citric acid cycle and @ oxidative phosphorylation to produce ATP, or CID con
@ Citric acid cycle inter
FIGURE 23-1 3 Metabolic pathways for glucose 6-phosphate in the
version to lipids for storage.
l iver.
mediates can be siphoned off into glucose synthesis by
Here and in Figures 23-1 4 and 2 3-1 5, anabolic pathways are generally shown leading upward, catabolic pathways leading down ward, and distribution to other organs horizontal ly. The numbered processes in each figure are described in the text.
gluconeogenesis. The liver also metabolizes amino acids that arrive in termittently from other tissues. The blood is adequately
2 3 . 2 Tissu e-Specific Meta b o l i s m : The Division of Labor
[915]
Hepatocyte Nucl otides, hormones, porphyrins
t
®
Glycogen in m uscle
@ � NH3
""'--f+-- GlucOse
t..,
t ro�cl ..1-u
@
_ _ _ _ _ _
gluconeogenesis
Pyruvate
Lipids
• '--
� Urea e
@
Alanine
Fatty acids
®
L Acet;l-CoA
Glycogen
G)
ADP
P· ATP
�?--� ® · ( �
C02
02
H20
oxidative phoS'phoryl11ti
o:;,
FIGURE 23-14 Metabolism of amino acids in the l iver.
supplied with glucose just after the digestion and ab sorption of dietary carbohydrate or, between meals, by
Liver lipids
®l
the conversion of liver glycogen to blood glucose. During the interval between meals, especially if prolonged, some muscle protein is degraded to amino acids. These amino acids donate their amino groups (by transamination) to
@
®
i s transported t o the liver and deaminated.
Hepatocytes convert the resulting pyruvate to blood glu cose (via gluconeogenesis for excretion
@ . One benefit of this glucose-alanine cy
blood glucose between meals. The amino acid deficit in curred in muscles is made up after the next meal by in coming dietary amino acids.
Lipids
The fatty acid components of lipids entering he
(Fig. 23-15 ) .
CD Some are converted to liver lipids. ® Under most cir cumstances, fatty acids are the primary oxidative fuel in the
liver. Free fatty acids may be activated and oxidized to yield acetyl-GoA and NADH.
® The
®
P n.xidll:tion
Steroid hormones
t
NADH
Cholesterol
Ketone • @--I!H.,. bodies ;;.. ®'- Acety l -CoA---;;;; in blood
®I � tr= l@ ·-
ADP
patocytes also have several different fates
Free fatty acids in blood
Bile salts
@) , and the ammonia to urea
cle (see Fig. 1 8-9) is the smoothing out of fluctuations in
Plasma lipoproteins
®
Fatty acids
pyruvate, the product of glycolysis, to yield alanine , which
Hepatocyte
C02
-t
Pi
ATP
02 H20 oxidative phosphorylation
acetyl-GoA is further oxi
dized via the citric acid cycle, and ® oxidations in the cycle
drive the synthesis of ATP by oxidative phosphorylation.
FIGURE 23-1 5 Metabolism of fatty acids in the liver..
, 916 1
H o r m o n a l R e g u l ation a n d I nteg ration of M a m m a l i a n Meta b o l i s m
@ Excess acetyl-GoA, not required by the liver, is con verted to acetoacetate and ,B-hydroxybutyrate; these ke tone bodies circulate in the blood to other tissues, to be used as fuel for the citric acid cycle. Ketone bodies may be regarded as a transport form of acetyl groups. They can supply a significant fraction of the energy in some ex trahepatic tissues-up to one-third in the heart, and as much as 60% to 70% in the brain during prolonged fast ing. @ Some of the acetyl-GoA derived from fatty acids (and from glucose) is used for the biosynthesis of choles terol, which is required for membrane synthesis. Choles terol is also the precursor of all steroid hormones and of the bile salts, which are essential for the digestion and absorption of lipids. The other two metabolic fates of lipids involve spe cialized mechanisms for the transport of insoluble lipids in blood. (j) Fatty acids are converted to the phospho lipids and TAGs of plasma lipoproteins, which carry lipids to adipose tissue for storage as TAGs. ® Some free fatty acids are bound to serum albumin and carried to the heart and skeletal muscles, which take up and oxidize free fatty acids as a major fuel. Serum albumin is the most abundant plasma protein; one molecule can carry up to 10 molecules of free fatty acid. The liver thus serves as the body's distribution center, exporting nutrients in the correct proportions to other organs, smoothing out fluctuations in metabolism caused by intermittent food intake, and processing excess amino groups into urea and other products to be disposed of by the kidneys. Certain nutrients are stored in the liver, in cluding Fe ions and vitamin A. The liver also detoxifies foreign organic compounds, such as drugs, food additives, preservatives, and other possibly harmful agents with no food value. Detoxification often involves the cytochrome P-450-dependent hydroxylation of relatively insoluble organic compounds, making them sufficiently soluble for further breakdown and excretion (see Box 2 1-1 ) . (a)
Adipose Tissues Store and Supply Fatty Acids
There are two distinct types of adipose tissue, white and brown, with quite distinct roles, and we focus first on the more abundant of the two . White adipose tissue (WAT) ( Fig. 2:3 -16a) is amorphous and widely distrib uted in the body: under the skin, around the deep blood vessels , and in the abdominal cavity. The adipocytes of WAT are large (diameter 30 to 70 fLm) , spherical cells, completely filled with a single large lipid (TAG) droplet that constitutes about 65% of the cell mass and squeezes the mitochondria and nucleus into a thin layer against the plasma membrane (Fig. 23-1 6b) . In humans, WAT typically makes up about 1 5% of the mass of a healthy young adult. The adipocytes are metabolically very active, responding quickly to hormonal stimuli in a meta bolic interplay with the liver, skeletal muscles, and heart. Like other cell types, adipocytes have an active gly colytic metabolism, oxidize pyruvate and fatty acids via the citric acid cycle, and carry out oxidative phosphoryla tion. During periods of high carbohydrate intake , adipose tissue can convert glucose (via pyruvate and acetyl-GoA) to fatty acids, convert the fatty acids to TAGs, and store the TAGs as large fat globules-although, in humans, much of the fatty acid synthesis occurs in hepatocytes . Adipocytes store TAGs arriving from the liver (carried in the blood as VLDLs; see Fig. 2 1-40a) and from the intes tinal tract (carried in chylomicrons), particularly after meals rich in fat. When the demand for fuel rises, lipases in adipocytes hydrolyze stored TAGs to release free fatty acids, which can travel in the bloodstream to skeletal muscle and the heart. The release of fatty acids from adipocytes is greatly accelerated by epinephrine, which stimulates the cAMP-dependent phosphorylation of per ilipin and thus gives the hormone-sensitive lipase access to TAGs in the lipid droplet (see Fig. 1 7-3) . Hormone sensitive lipase is also stimulated by phosphorylation,
(b)
White adipocyte
(c) Brown adipocyte
Nucleus
FIGURE 2 3 - 1 6 Adipocytes of white and brown adipose tissue. (a)
Colorized scanning electron micrograph of human adipocytes i n white ad i pose tissue (WAT). I n fat tissues, cap i l laries and col l agen fibers form a supporting network around spherical adipocytes. Almost the entire vol ume of each of these metabolica l ly active cel ls is taken up by a fat droplet. (b) A typical adipocyte from WAT and (c) an adipocyte
from brown adipose tissue (BAT). In BAT cells, mitochondria are much more prominent, the nucleus is near the center of the cell, and mu lti ple fat droplets are present. White adipocytes are larger and conta i n a si ngle huge l ipid droplet, wh ich squeezes the mitochondria and nu cleus against the plasma membrane.
2 3 . 2 Tiss u e-Specific Meta b o l i s m : The Division of Labor
[91 7]
but this is not the main cause of increased lipolysis . Insulin counterbalances this effect o f epinephrine, decreasing the activity of the lipase . The breakdown and synthesis of TAGs in adipose tissue constitute a substrate cycle; up to 70% of the fatty acids released by hormone-sensitive lipase are reesterified in adipocytes, re-forming TAGs. Recall from Chapter 1 5 that such substrate cycles allow fine regula tion of the rate and direction of flow of intermediates through a bidirectional pathway. In adipose tissue, glyc erol liberated by hormone-sensitive lipase cannot be reused in the synthesis of TAGs, because adipocytes lack glycerol kinase. Instead, the glycerol phosphate required for TAG synthesis is made from pyruvate by glyceroneogenesis, involving the cytosolic PEP car boxykinase (see Fig. 2 1-22) . In addition to its central function as a fuel depot, adipose tissue plays an important role as an endocrine organ, producing and releasing hormones that signal the state of energy reserves and coordinate metabolism of fats and carbohydrates throughout the body. We return to this function later in the chapter as we discuss the hormonal regulation of body mass. Brown Adipose Tissue Is Thermogenic In small vertebrates and hibernating animals, a signifi cant proportion of the adipose tissue is brown adipose tissue (BAT), distinguished from WAT by its smaller (diameter 20 to 40 JLm) , differently shaped (polygonal, not round) adipocytes (Fig. 23- 1 6c) . Like white adipocytes, brown adipocytes store triacylglycerols, but in several smaller lipid droplets per cell rather than as a single central droplet. BAT cells have more mitochondria and a richer supply of capillaries than WAT cells, and it is the cytochromes of mitochondria and the hemoglobin in capillaries that give BAT its characteristic brown color. A unique feature of brown adipocytes is their strong expression of the gene UNCI , which encodes ther mogenin, the mitochondrial uncoupling protein (see Fig. 1 9-34) . Thermogenin activity is responsible for the principal function of BAT: thermogenesis. In brown adipocytes, fatty acids stored in lipid droplets are released, enter mitochondria, and un dergo complete conversion to C02 via {3 oxidation and the citric acid cycle. The reduced FADH 2 and NADH so generated pass their electrons through the respira tory chain to molecular oxygen. In WAT, protons pumped out of the mitochondria during electron transfer reenter the matrix through ATP synthase, with the energy of electron transfer conserved in ATP syn thesis. In BAT, thermogenin provides an alternative route for protons to reenter the matrix that bypasses ATP synthase; the energy of the proton gradient is thus dissipated as heat, which can maintain the body (especially the nervous system and viscera) at its op timal temperature when the ambient temperature is relatively low.
FIGURE 23-1 7 Distribution of brown adipose tissue in a newborn infant.
At birth, human infants have brown fat distributed as shown here, to protect the major blood vessels and the i nternal organs. Th is brown fat recedes over time, so that an adult has no major reserves of brown adipose.
In the human fetus, differentiation of fibroblast "preadipocytes" into BAT begins at the twentieth week of gestation, and at the time of birth BAT represents 1 % of total body weight. The brown fat deposits are located where the heat generated by thermogenesis can ensure that vital tissues-blood vessels to the head, major ab dominal blood vessels, and the viscera, including the pancreas, adrenal glands, and kidneys-are not chilled as the newborn enters a world of lower ambient temper ature (Fig. 23-1 7 ). At birth, WAT development begins and BAT begins to disappear. By adulthood humans have no discrete deposits of BAT, although brown adipocytes remain scattered throughout the WAT, making up about 1 % of all adipocytes. Adults also have preadipocytes that can be induced to differentiate into BAT during adapta tion to chronic cold exposure. Humans with pheochro mocytoma (tumors of the adrenal gland) overproduce epinephrine and norepinephrine, and one effect is dif ferentiation of preadipocytes into discrete regions of BAT, localized roughly as in newborns. In the induced adaptation to chronic cold, and in the normal differen tiation of WAT and BAT, the nuclear transcription factor PPARy (described later in the chapter) plays a central role.
[?1a]
H o r m o n a l Regulation a n d I ntegration of M a m m a l i a n Meta bolism
bodies. The glucose is phosphorylated, then degraded
Muscles Use AlP for Mechanical Work Metabolism in the cells of skeletal muscle-myocytes is specialized to generate ATP as the irrunediate source of energy for contraction. Moreover, skeletal muscle is adapted to do its mechanical work in an intermittent fash ion, on demand. Sometimes skeletal muscles must work at their maximum capacity for a short time, as in a 100 m sprint; at other times more prolonged work is required, as in running a marathon or in extended physical labor. There are two general classes of muscle tissue, which differ in physiological role and fuel utilization.
Slow-twitch muscle, also called red muscle, provides relatively low tension but is highly resistant to fatigue. It produces ATP by the relatively slow but steady process of oxidative phosphorylation. Red muscle is very rich in mitochondria and is served by very dense networks of blood vessels, which bring the oxygen essential to ATP production.
Fast-twitch muscle, or white muscle, has
fewer mitochondria than red muscle and is less well sup plied with blood vessels, but it can develop greater ten sion, and do so faster. White muscle is quicker to fatigue because when active, it uses ATP faster than it can re place it. There is a genetic component to the proportion of red and white muscle in any individual; with training, the endurance of fast-twitch muscle can be improved. Skeletal muscle can use free fatty acids, ketone bod ies, or glucose as fuel, depending on the degree of mus cular activity
( Fig. 23- 1 8 ). In resting muscle, the
primary fuels are free fatty acids from adipose tissue and ketone bodies from the liver. These are oxidized and degraded to yield acetyl-GoA, which enters the citric acid cycle for oxidation to C02. The ensuing transfer of electrons to 02 provides the energy for ATP synthesis by
by glycolysis to pyruvate, which is converted to acetyl GoA and oxidized via the citric acid cycle and oxidative phosphorylation. In maximally active fast-twitch muscles, the de mand for ATP is so great that the blood flow cannot pro vide 02 and fuels fast enough to supply sufficient ATP by aerobic respiration alone.
three ATP, because phosphorolysis of glycogen pro duces glucose 6-phosphate (via glucose 1 -phosphate) , sparing the ATP normally consumed in the hexokinase reaction. Lactic acid fermentation thus responds more quickly than oxidative phosphorylation to an increased need for ATP, supplementing basal ATP production by aerobic oxidation of other fuels via the citric acid cycle and respiratory chain. The use of blood glucose and muscle glycogen as fuels for muscular activity is greatly enhanced by the secretion of epinephrine, which stimu lates both the release of glucose from liver glycogen and the breakdown of glycogen in muscle tissue. The relatively small amount of glycogen (about 1% of the total weight of skeletal muscle) limits the amount of glycolytic energy available during all-out exertion. Moreover, the accumulation of lactate and consequent decrease in pH in maximally active muscles reduces their efficiency. Skeletal muscle , however, contains another source of ATP, phosphocreatine ( 1 0 to 30 mM) , which can rapidly regenerate ATP from ADP by the cre atine kinase reaction: o-
1
-o-P=O
uses blood glucose in addition to fatty acids and ketone
N-H
I I
+
C=NH2 + ADP
1
CHa-N
I
Lactate
during recovery
NH2 ATP +
I
+
C-NH2
I
CHa-N
I
CH2
coo-
coo-
Phosphocreatine
Fatty acids,
during activity
CH2
I
Muscle glycogen
conditions,
mentation (p. 530) . Each glucose unit degraded yields
oxidative phosphorylation. Moderately active muscle
Bursts of heavy activity
Under these
stored muscle glycogen is broken down to lactate by fer
I
creatine
During periods of active contraction and glycolysis, this
ketone bodies , blood lucose
reaction proceeds predominantly in the direction of
g
ATP synthesis; during recovery from exertion, the same enzyme resynthesizes phosphocreatine from creatine C re atine
and ATP. Given the relatively high levels of ATP and phosphocreatine in muscle, these compounds can be detected in intact muscle, in real time, by NMR spec troscopy
(Fig. 23-19).
After a period of intense muscular activity, the in dividual continues breathing heavily for some time, Muscle contraction
using much of the extra 02 for oxidative phosphoryla tion in the liver. The ATP produced is used for gluco
FIGURE 23-18 Energy sources for muscle contraction. Different fuels
neogenesis (in the liver) from lactate that has been
are used for ATP synthesis during bursts of heavy activity and during l ight activity or rest. Phosphocreatine can rapidly supply ATP.
thus formed returns to the muscles to replenish their
carried in the blood from the muscles. The glucose
2 3 . 2 Tissue-S pecific Metabo l i s m : The D i v i s i o n of Labor
[9 1 9]
Muscle: ATP produced by glycolysis for rapid contraction. · -.
0
-5
-10
-15
-2 0
Lactate
Chemical shift (parts per million) (identity of the compound) FIGURE 2 3 - 1 9
.,..,t-{
_ _ _ Glycogen
ATP
Phosphocreatine buffers ATP concentration during
exercise. A "stack plot" of magnetic resonance spectra (of 3 1 P) showing
inorgan ic phosphate (P;), phosphocreatine (PCr), and ATP (each of its three phosphates giving a signal). The series of plots represents the pas sage of time, from a period of rest to one of exercise, and then of re covery. Note that the ATP signal hardly changes during exercise, kept high by continued respiration and by the reservoi r of phosphocreatine, which d i m i nishes during exercise. During recovery, when ATP produc tion by catabolism is greater than ATP uti lization by the (now resting) muscle, the phosphocreatine reservoir is refi lled.
Lactate
glycogen, completing the Cori cycle (Fig. 23-20 ; see also Box 1 5-4) . Actively contracting skeletal muscle generates heat as a byproduct of imperfect coupling of the chemical en ergy of ATP with the mechanical work of contraction. This heat production can be put to good use when ambient temperature is low: skeletal muscle carries out shivering thermogenesis, rapidly repeated muscle contraction that produces heat but little motion, helping to maintain the body at its preferred temperature of 37 °C . Heart muscle differs from skeletal muscle in that .,. it is continuously active in a regular rhythm of contraction and relaxation, and it has a completely aerobic metabolism at all times. Mitochondria are much more abundant in heart muscle than in skeletal muscle, making up almost half the volume of the cells (Fig. 28-2 1 ) . The heart uses mainly free fatty acids, but also some glucose and ketone bodies taken up from the blood, as sources of energy; these fuels are oxidized via the citric acid cycle and oxidative phosphorylation to generate ATP. Like skeletal muscle, heart muscle does not store lipids or glycogen in large amounts. It does have small amounts of reserve energy in the form of phosphocreatine, enough for a few seconds of contrac tion. Because the heart is normally aerobic and obtains its energy from oxidative phosphorylation, the failure of
..
Electron micrograph of heart muscle. In the profuse m itochondria of heart tissue, pyruvate (from glucose), fatty acids, and ketone bodies are oxid ized to drive ATP synthesis. Th is steady aerobic metabolism allows the human heart to pump blood at a rate of nearly 6 L/m in, or about 350 L/hr-or 200 X 1 06 L over 70 years. FIGURE 23-21
Blood glucose
Blood
(
ATP
I
., Glucose
Liver: ATP used i:tr synthesis of glucose (gluconeogenesis) during recovery.
FIGURE 23-20 Metabolic cooperation between skeletal muscle and the liver: the Cori cycle. Extremely active muscles use glycogen as
energy source, generati ng lactate via glycolysis. During recovery, some of this lactate is transported to the l iver and converted to glucose via gl uconeogenesis. This gl ucose is released to the blood and returned to the muscles to replenish their glycogen stores. The overal l pathway (glucose � lactate � gl ucose) constitutes the Cori cycle.
[92o]
Horm ona l Regulation a n d I n te g ration of M a m m a l i a n Meta b o l i s m
02 to reach a portion of the heart muscle when the blood vessels are blocked by lipid deposits (atherosclerosis) or blood clots (coronary thrombosis) can cause that region of the heart muscle to die. This is what happens in myocardial infarction, more commonly known as a heart attack. •
(a)
The Brain Uses Energy for Transmission of Electrical I mpulses The metabolism of the brain is remarkable in several respects. The neurons of the adult mammalian brain normally use only glucose as fuel (Fig. 23-2 2 ). (Astro cytes, the other major cell type in the brain, can oxidize fatty acids.) The brain has a very active respiratory me tabolism (Fig. 23-23 ) ; it uses 02 at a fairly constant rate, accounting for almost 20% of the total 02 con sumed by the body at rest. Because the brain contains very little glycogen, it is constantly dependent on in coming glucose in the blood. Should blood glucose fall significantly below a critical level for even a short time, severe and sometimes irreversible changes in brain function may result. Although the neurons of the brain cannot directly use free fatty acids or lipids from the blood as fuels , they can, when necessary, use 13-hydro:xybutyrate (a ketone body) , formed from fatty acids in the liver. The capacity of the brain to oxidize 13-hydro:xybutyrate via acetyl-GoA becomes important during prolonged fasting or starva tion, after liver glycogen has been depleted, because it allows the brain to use body fat as an energy source. This spares muscle proteins-until they become the brain's ultimate source of glucose (via gluconeogenesis in the liver) during severe starvation. Neurons oxidize glucose by glycolysis and the citric acid cycle, and the flow of electrons from these oxidations through the respiratory chain provides almost all the ATP Starvation
Ket()ne bodies
Normal diet Olucose
(b)
mg/100 g /min FIGURE 23-23 Glucose metabolism in the brain. The technique of positron emission tomography (PET) scanning shows metabolic activ ity in specific regions of the brain. PET scans al low visual ization of isotopically labeled glucose in precisely local ized regions of the brain of a l iving person, i n real time. A positron-emitting glucose analog (2-[ 1 6 F]-fluoro-2-deoxy-o-glucose) is i njected into the bloodstream; a few seconds later, a PET scan shows how much of the glucose has been taken up by each region of the brain-a measure of metabolic ac tivity. Shown here are PET scans of front-to-back cross sections of the brain at three levels, from the top (at the left) downward (to the right). The scans compare glucose metabolism when the experimental subject (a) is rested and (b) has been deprived of sleep for 48 hours.
used by these cells. Energy is required to create and maintain an electrical potential across the neuronal plasma membrane. The membrane contains an electro genic ATP-driven antiporter, the Na+K+ ATPase, which simultaneously pumps 2 K+ ions into and 3 Na + ions out of the neuron (see Fig. 1 1-37) . The resulting transmem brane potential changes transiently as an electrical signal (action potential) sweeps from one end of a neuron to the other (see Fig. 12-25) . Action potentials are the chief mechanism of information transfer in the nervous system, so depletion of ATP in neurons would have disastrous ef fects on all activities coordinated by neuronal signaling. Blood Carries Oxygen, Metabolites, a nd Hormones
Electrogenic transport by Na+K+ ATPase FIGURE 23-22 The fuels that supply ATP in the brain. The energy source used by the brain varies with nutritional state. The ketone body used during starvation is J3-hydroxybutyrate. Electrogenic transport by the Na + K+ ATPase maintains the transmembrane potential essential to i nformation transfer among neurons.
Blood mediates the metabolic interactions among all tis sues. It transports nutrients from the small intestine to the liver, and from the liver and adipose tissue to other organs; it also transports waste products from the extra hepatic tissues to the liver for processing and to the kid neys for excretion. Oxygen moves in the bloodstream from the lungs to the tissues, and C02 generated by tis sue respiration returns via the bloodstream to the lungs for exhalation. Blood also carries hormonal signals from one tissue to another. In its role as signal carrier, the cir culatory system resembles the nervous system; both regulate and integrate the activities of different organs.
2 3 . 2 Tissue-S pecific Meta b o l i s m : The Division of Labor
Cell
Blood plasma
Inorganic components ( 10%) NaCl, bicarbonate, phosphate, CaC12, MgC12, KCl, Na2S04
Organic metabolites and waste products (20%) glucose, amino acids, lactate, pyruvate, ketone bodies, citrate, urea, uric acid
Plasma proteins (70%) Major plasma proteins: serum albumin, very-low-density lipoproteins (VLDL), low-density lipoproteins (LDL),
high-density lipoproteins (HDL), immunoglobulins (hundreds of kinds), fibrinogen, prothrombin, many specialized transport proteins such as transferrin
FIGURE 23-24 The composition of blood. Whole blood can be sepa rated into blood plasma and cel ls by centrifugation. About 1 0% of blood plasma is sol utes, of which about 1 0% consists of inorganic salts, 20% small organic molecules, and 70% plasma proteins. The major d issolved components are l isted. Blood contains many other substances, often in trace amounts. These incl ude other metabol ites, enzymes, hormones, vitam ins, trace elements, and b i le pigments. Measurements of the concentrations of components i n blood plasma are i mportant in the diagnosis and treatment of many diseases.
The average adult hwnan has 5 to 6 L of blood. Almost half of this volume is occupied by three types of blood cells (Fig. 23-24) : erythrocytes (red cells) , filled with hemo globin and specialized for carrying 02 and C02 ; much smaller nwnbers of leukocytes (white cells) of several types (including lymphocytes, also found in lymphatic tissue) , which are central to the immune system that de fends against infections; and platelets, which help to me diate blood clotting. The liquid portion is the blood plasma, which is 90% water and 1 0% solutes. Dissolved or suspended in the plasma is a large variety of proteins, lipoproteins, nutrients, metabolites, waste products, inor ganic ions, and hormones. More than 70% of the plasma solids are plasma proteins, primarily immunoglobulins (circulating antibodies) , serwn albumin, apolipoproteins involved in the transport of lipids, transferrin (for iron transport) , and blood-clotting proteins such as fibrinogen and prothrombin. The ions and low molecular weight solutes in blood plasma are not fixed components but are in constant flux between blood and various tissues. Dietary uptake of the
L921J
inorganic ions that are the predominant electrolytes of blood and cytosol (Na + , K + , and Ca2+ ) is, in general, counterbalanced by their excretion in the urine. For many blood components, something near a dynamic steady state is achieved: the concentration of the component changes little, although a continuous flux occurs between the digestive tract, blood, and urine. The plasma levels of Na + , K + , and Ca2+ remain close to 140, 5, and 2.5 mM, re spectively, with little change in response to dietary intake. Any significant departure from these values can result in serious illness or death. The kidneys play an especially im portant role in maintaining ion balance by selectively fil tering waste products and excess ions out of the blood while preventing the loss of essential nutrients and ions. The human erythrocyte loses its nucleus and mito chondria during differentiation. It therefore relies on glycolysis alone for its supply of ATP. The lactate pro duced by glycolysis returns to the liver, where gluconeo genesis converts it to glucose, to be stored as glycogen or recirculated to the peripheral tissues. The erythro cyte has constant access to glucose in the bloodstream. The concentration of glucose in plasma is subject to tight regulation. We have noted the constant requirement of the brain for glucose and the role of the liver in maintaining blood glucose in the normal range, 60 to 90 mg/100 mL of whole blood ( -4.5 mM) . (Because ery throcytes make up a significant fraction of blood volwne, their removal by centrifugation leaves a supernatant fluid, the plasma, containing the "blood glucose" in a smaller volume. To convert blood glucose to plasma glucose con centration, multiply the blood glucose level by 1 . 1 4 . ) When blood glucose i n a hwnan drops t o 4 0 mg/100 mL (the hypoglycemic condition) , the person experiences discomfort and mental confusion (Fig. 23-25 ) ; further FIGURE 23-25 Physiological effects of low blood glucose in humans. Blood gl ucose levels
Blood gluco e
of 40 mg/1 00 ml and below constitute severe hypoglycem ia.
(mg/100 mLl
100 90
-
-
o
-
70
-
60 50
-
}
Normal range Subtle neurological signs; hunger Release of glucagon, epinephrine, cortisol Sweating, trembling
Lethargy Convulsions, coma
Permanent brain damage (if prolonged) Death
[?22]
Hormonal Regulation and I ntegration of Mammalian Metabolism
reductions lead to coma, convulsions, and, in extreme hypoglycemia, death. Maintaining the normal concentra tion of glucose in blood is therefore a very high priority of the organism, and a variety of regulatory mechanisms have evolved to achieve that end. Among the most impor tant regulators of blood glucose are the hormones insulin, glucagon, and epinephrine, as discussed in Section 23.3. •
S U MMARY 2 3 . 2
Tissue-S pecific Meta bolism:
•
•
mal metabolic states-well-fed, fasted, and starving and look at the metabolic consequences of diabetes mellitus, a disorder that results from derangements in the signaling pathways that control glucose metabolism.
Amino acids are used to synthesize liver and plasma proteins, or their carbon skeletons are converted
I nsulin Counters H ig h Blood Glucose
The liver converts fatty acids to triacylglycerols, phospholipids, or cholesterol and its esters, for transport as plasma lipoproteins to adipose tissue for storage. Fatty acids can also be oxidized to yield ATP or to form ketone bodies, which are circulated to other tissues. White adipose tissue stores large reserves of triacylglycerols, and releases them into the blood in response to epinephrine or glucagon. Brown adipose tissue is specialized for thermogenesis, the result of fatty acid oxidation in uncoupled mitochondria.
•
Skeletal muscle is specialized to produce and use ATP for mechanical work. During strenuous muscular activity, glycogen is the ultimate fuel, supplying ATP through lactic acid fermentation. During recovery, the lactate is reconverted (through gluconeogenesis) to glycogen and glucose in the liver. Phosphocreatine is an immediate source of ATP during active contraction.
• •
23.3 Hormonal Regulation of Fuel Metabolism
undergo oxidation by glycolysis, the citric acid cycle, and respiratory chain to yield ATP, or enter the pentose phosphate pathway to yield pentoses and NADPH.
Glucose 6-phosphate is the key intermediate in carbohydrate metabolism. It may be polymerized into glycogen, dephosphorylated to blood glucose,
to glucose and glycogen by gluconeogenesis; the ammonia formed by deamination is converted to urea. •
The blood transfers nutrients, waste products , and hormonal signals among tissues and organs .
or converted to fatty acids via acetyl-CoA. It may
In mammals there is a division of metabolic labor among specialized tissues and organs. The liver is the central distributing and processing organ for nutrients. Sugars and amino acids produced in digestion cross the intestinal epithelium and enter the blood, which carries them to the liver. Some triacylglycerols derived from ingested lipids also make their way to the liver, where the constituent fatty acids are used in a variety of processes.
•
•
The minute-by-minute adjustments that keep the blood glucose level near 4.5 mM involve the combined actions of insulin, glucagon, epinephrine, and cortisol on meta bolic processes in many body tissues, but especially in liver, muscle, and adipose tissue. Insulin signals these tissues that blood glucose is higher than necessary; as a result, cells take up excess glucose from the blood and convert it to glycogen and triacylglycerols for storage. Glucagon signals that blood glucose is too low, and tis sues respond by producing glucose through glycogen breakdown and (in the liver) gluconeogenesis and by oxidizing fats to reduce the use of glucose. Epinephrine is released into the blood to prepare the muscles, lungs, and heart for a burst of activity. Cortisol mediates the body's response to longer-term stresses. We discuss these hormonal regulations in the context of three nor
The Division of la bor •
uses most of its ATP for the active transport of Na +
and K + to maintain the electrical potential across the neuronal membrane.
Heart muscle obtains nearly all its ATP from oxidative phosphorylation. The neurons of the brain use only glucose and f3-hydroxybutyrate as fuels, the latter being important during fasting or starvation. The brain
Acting through plasma membrane receptors (see Figs 1 2-15, 1 2-16), insulin stimulates glucose uptake by muscle and adipose tissue (Table 23-3) , where the glucose is converted to glucose 6-phosphate. In the liver, insulin also activates glycogen synthase and inacti vates glycogen phosphorylase, so that much of the glu cose 6-phosphate is channeled into glycogen. Insulin also stimulates the storage of excess fuel as fat in adipose tissue (Fig. 23-26). In the liver, insulin activates both the oxidation of glucose 6-phosphate to pyruvate via glycolysis and the oxidation of pyruvate to acetyl-CoA. If not oxidized further for energy produc tion, this acetyl-CoA is used for fatty acid synthesis, and the fatty acids are exported from the liver as the TAGs of plasma lipoproteins (VLDLs) to adipose tissue . Insulin stimulates the synthesis of TAGs in adipocytes, from fatty acids released from the VLDL triacylglycerols. These fatty acids are ultimately derived from the excess glucose taken up from blood by the liver. In summary, the effect of insulin is to favor the conversion of excess blood glucose to two storage forms: glycogen (in the liver and muscle) and triacylglycerols (in adipose tis sue) (Table 23-3) . Besides acting directly on muscle and liver to change their metabolism of carbohydrates and fats, insulin can also act in the brain to signal these tissues indirectly, as described later.
23.3 Hormonal Regulation of Fuel Metabolism
[923]
, , \ I � /�
,, I t ; / - Insulin - to brain, adipose, muscle
Pancreas
)
Insulin -
Blood vessel
Amino acids
Am] �
Liver
Py ruvate
ino acids N H3 -> Urea
a-Keto acids Protein synthesis
Fats
1
AceLy lCoA
1
ATP
_}
/
L --+ J
Q.,�
TAG
Intestine
Adipose tissue
TAG
FIGURE 23-26 The well-fed state: the lipogenic liver. Immediately after a calorie-rich meal, gl ucose, fatty acids, and amino acids enter the liver. Insu l i n released in response to the high blood glucose concentration stimu lates glucose uptake by the tissues. Some glucose is exported to the brain for its energy needs, and some to adipose and muscle tissue. I n the liver, excess gl·ucose is oxidized to acetyi-CoA, which is used to
TAB L E 23-3
synthesize fatty acids for export as triacylglycerols in VLDls to adipose and muscle tissue. The NADPH necessary for lipid synthesis is obtained by oxidation of glucose in the pentose phosphate pathway. Excess amino acids are converted to pyruvate and acetyi-CoA, which are also used for l ipid synthesis. Dietary fats move via the lymphatic system, as chylomicrons, from the i ntestine to muscle and adipose tissues.
Effects of Insulin on Blood Glucose: Uptake of Glucose by Cells and Storage as Triacylglycerols and G lycogen
___.
_ _ _ _ _ _ _
Metabolic effect
Target enzyme
i Glucose uptake (muscle, adipose)
i Glucose transporter (GLUT4)
i Glycogen synthesis (liver, muscle)
i Glycogen synthase
i Glucose uptake (liver)
i Glucokinase (increased expression)
� Glycogen breakdown (liver, muscle)
� Glycogen phosphorylase
i Glycolysis, acetyl-GoA production
i PFK-1 (by i PFK-2) i Pyruvate dehydrogenase complex
(liver, muscle)
i Fatty acid synthesis (liver)
i Triacylglycerol synthesis (adipose tissue)
Pancreatic f3 Cells Secrete I nsulin in Response to Chang es in Blood Glucose When glucose enters the bloodstream from the intestine after a carbohydrate-rich meal, the resulting increase in blood glucose causes increased secretion of insulin (and
i Acetyl-GoA carboxylase i Lipoprotein lipase
decreased secretion of glucagon) by the pancreas. In sulin release is largely regulated by the level of glucose in the blood supplying the pancreas. The peptide hor mones insulin, glucagon, and somatostatin are produced by clusters of specialized pancreatic cells, the islets of Langerhans (Fig. 23-2 7 ). Each cell type of the islets
[924]
H o r m o n a l Regulation a n d I ntegrati o n of M a m m a l i a n Meta b o l i s m
Pancreas
a
ce l l (glucagon)
/
f3 cell (insulin)
I
FIGURE 23-27 The endocrine system of the pancreas. The pancreas contains both exocrine cells (see Fig. 1 8-3b), which secrete digestive enzymes in the form of zymogens, and clusters of endocrine cells, the islets of Langerhans. The islets contain a, {3, and 13 cel ls (also known as A, B, and D cells, respectively), each cell type secreting a specific pep tide hormone.
produces a single hormone: a cells produce glucagon; f3 cells, insulin; and 8 cells, somatostatin. As shown in Figure 2:3-2 8, when blood glucose rises, CD GLUT2 transporters carry glucose into the f3 cells, where it is immediately converted to glucose 6-phosphate by hexokinase IV (glucokinase) and enters
glycolysis . With the higher rate of glucose catabolism, ® [ATP] increases, causing the closing of ATP-gated K+ channels in the plasma membrane. ® Reduced efflux of K + depolarizes the membrane. (Recall from Section 1 2 . 6 that exit of K+ through an open K + chan nel hyperpolarizes the membrane; closing the K+ chan nel therefore effectively depolarizes the membrane.) Membrane depolarization opens voltage-gated Ca2 + channels , and @ the resulting increase i n cytosolic [Ca2 + ] triggers @ the release of insulin by exocytosis . Parasympathetic and sympathetic nervous system sig nals also affect (stimulate and inhibit, respectively) in sulin release. A simple feedback loop limits hormone release: insulin lowers blood glucose by stimulating glu cose uptake by the tissues; the reduced blood glucose is detected by the f3 cell as a diminished flux through the hexokinase reaction; this slows or stops the release of insulin. This feedback regulation holds blood glucose concentration nearly constant despite large fluctua tions in dietary intake. The activity of ATP-gated K+ channels is central to the regulation of insulin secretion by f3 cells. The channels are octamers of four identical Kir6.2 subunits and four identical SUR1 subunits, and are constructed along the same lines as the K + channels of bacteria and those of other eukaryotic cells (see Figs 1 1-48, 1 1-49, and 1 1-50) . The four Kir6.2 subunits form a cone around the K + channel and function as the selectivity filter and ATP-gating mechanism (Fig. 2:3-29). When [ATP] rises (indicating increased blood glucose) , the K + channels close, depolarizing the plasma membrane and triggering insulin release as shown in Figure 23-28.
•
CD GluCe
Separated chromosomes
IV
25.1 DNA Replication
when it meets the first (arrested) fork. The final few hundred base pairs of DNA between these large protein complexes are then replicated (by an as yet unknown mechanism) , completing two topologically interlinked (catenated) circular chromosomes (Fig. 25-19). DNA circles linked in this way are known as catenanes. Sep aration of the catenated circles in E. coli requires topoi somerase IV (a type II topoisomerase) . The separated chromosomes then segregate into daughter cells at cell division. The terminal phase of replication of other circu lar chromosomes, including many of the DNA viruses that infect eukaryotic cells, is similar.
[991]
ORC Origin DNA
Repl ication in Euka ryotic Cells Is Both Similar and More Complex
The DNA molecules in eukaryotic cells are considerably larger than those in bacteria and are organized into com plex nucleoprotein structures (chromatin; p. 962) . The essential features of DNA replication are the same in eukaryotes and bacteria, and many of the protein complexes are functionally and structurally conserved. However, eukaryotic replication is regulated and coordi nated with the cell cycle, introducing some additional complexities. Origins of replication have a well-characterized structure in some lower eukaryotes, but they are much less defined in higher eukaryotes. In vertebrates, a vari ety of A=T-rich sequences may be used for replication initiation, and the sites may vary from one cell division to the next. Yeast (Saccharomyces cerevisiae) has de fined replication origins called autonomously replicating sequences (ARS) , or replicators. Yeast replicators span 150 bp and contain several essential, conserved sequences. About 400 replicators are distributed among the 1 6 chromosomes of the haploid yeast genome. Regulation ensures that all cellular DNA is replicated once per cell cycle. Much of this regulation involves pro teins called cyclins and the cyclin-dependent kinases (CDKs) with which they form complexes (p. 469) . The cy clins are rapidly destroyed by ubiquitin-dependent prote olysis at the end of the M phase (mitosis) , and the absence of cyclins allows the establishment of pre-replicative complexes (pre-RCs) on replication initiation sites. In rapidly growing cells, the pre-RC forms at the end of M phase. In slow-growing cells, it does not form until the end of G 1 . Formation of the pre-RC renders the cell competent for replication, an event sometimes called licensing. As in bacteria, the key event in the initiation of replication in all eukaryotes is the loading of the replica tive helicase, a heterohexameric complex of minichro mosome maintenance (MCM) proteins (MCM2 to MCM7) . The ring-shaped MCM2-7 helicase, functioning much like the bacterial DnaB helicase, is loaded onto the DNA by another six-protein complex called ORC (origin recognition complex) (Fig. 25-20) . ORC has five AAA + ATPase domains among its subunits and is functionally analogous to the bacterial DnaA. Two other proteins, CDC6 (cell division cycle) and CDT1 �
FIGURE 25-20 Assembly of a pre-replicative complex at a eukaryotic replication origin. The initiation site (origin) is bound by ORC, CDC6,
and CDT1 . These proteins, many of them AAA+ ATPases, promote load i ng of the replicative hel icase, MCM2-7, in a reaction that is analogous to the loading of the bacterial DnaB helicase by DnaC protein. Loading of the MCM helicase complex onto the DNA forms the pre-replicative complex, or pre-RC, and is the key step in the initiation of repl ication.
(CDC 1 0-dependent transcript 1 ) , are also required to load the MCM2-7 complex, and the yeast CDC6 is an other AAA + ATPase. Commitment to replication requires the synthesis and activity of S-phase cyclin-CDK complexes (such as the cyclin E-CDK2 complex; see Fig. 12-45) and CDC7DBF4. Both types of complexes help to activate replica tion by binding to and phosphorylating several proteins in the pre-RC. Other cyclins and CDKs function to in hibit the formation of more pre-RC complexes once replication has been initiated. For example, CDK2 binds to cyclin A as cyclin E levels decline during S phase, in hibiting CDK2 and preventing the licensing of additional pre-RC complexes.
[y92_j '
. ,
DNA Metabolism
The rate of movement of the replication fork in eu karyotes (-50 nucleotides/s) is only one-twentieth that observed in E. coli. At this rate, replication of an aver age human chromosome proceeding from a single origin would take more than 500 hours. Replication of human chromosomes in fact proceeds bidirectionally from many origins, spaced 30 to 300 kbp apart. Eukaryotic chromosomes are almost always much larger than bac terial chromosomes, so multiple origins are probably a universal feature of eukaryotic cells. Like bacteria, eukaryotes have several types of DNA polymerases. Some have been linked to particular func tions, such as the replication of mitochondrial DNA. The replication of nuclear chromosomes involves DNA poly merase a, in association with DNA polymerase 8. DNA polymerase a is typically a multisubunit enzyme with similar structure and properties in all eukaryotic cells. One subunit has a primase activity, and the largest sub unit CMr - 1 80,000) contains the polymerization activity. However, this polymerase has no proofreading 3 '�5 ' exonuclease activity, making it unsuitable for high fidelity DNA replication. DNA polymerase a is believed to function only in the synthesis of short primers (either RNA or DNA) for Okazaki fragments on the lagging strand. These primers are then extended by the multi subunit DNA polymerase 5. This enzyme is associated with and stimulated by proliferating cell nuclear antigen (PCNA; Mr 29,000) , a protein found in large amounts in the nuclei of proliferating cells. The three-dimensional structure of PCNA is remarkably similar to that of the {3 subunit of E. coli DNA polymerase III (Fig. 25-l Ob) , al though primary sequence homology is not evident. PCNA has a function analogous to that of the {3 subunit, forming a circular clamp that greatly enhances the pro cessivity of the polymerase. DNA polymerase 8 has a 3 ' �5' proofreading exonuclease activity and seems to carry out both leading and lagging strand synthesis in a complex comparable to the dimeric bacterial DNA poly merase III. Yet another polymerase, DNA polymerase e , re places DNA polymerase 8 in some situations, such as in DNA repair. DNA polymerase e may also function at the replication fork, perhaps playing a role analogous to that of the bacterial DNA polymerase I , removing the primers of Okazaki fragments on the lagging strand. Two other protein complexes also function in eu karyotic DNA replication. RPA (replication protein A) is a eukaryotic single-stranded DNA-binding protein, equivalent in function to the E. coli SSB protein. RFC (replication factor C) is a clamp loader for PCNA and fa cilitates the assembly of active replication complexes. The subunits of the RFC complex have significant se quence similarity to the subunits of the bacterial clamp loading ( 1') complex. The termination of replication on linear eukaryotic chromosomes involves the synthesis of special struc tures called telomeres at the ends of each chromo some, as discussed in the next chapter.
Viral DNA Polymerases Provide Targets for Antiviral Therapy
Many DNA viruses encode their own DNA poly merases, and some of these have become targets for pharmaceuticals. For example, the DNA polymerase of the herpes simplex virus is inhibited by acyclovir, a compound developed by Gertrude Elion (p. 894) . Acyclovir consists of guanine attached to an incomplete ribose ring.
Acyclovir
It is phosphorylated by a virally encoded thymidine ki nase; acyclovir binds to this viral enzyme with an affinity 200-fold greater than its binding to the cellular thymi dine kinase. This ensures that phosphorylation occurs mainly in virus-infected cells. Cellular kinases convert the resulting acyclo-GMP to acyclo-GTP, which is both an inhibitor and a substrate of DNA polymerases; acy clo-GTP competitively inhibits the herpes DNA poly merase more strongly than cellular DNA polymerases. Because it lacks a 3' hydroxyl, acyclo-GTP also acts as a chain terminator when incorporated into DNA. Thus viral replication is inhibited at several steps. •
S U M M A RY 2 5 . 1 •
•
•
•
•
DNA Replication
Replication of DNA occurs with very high fidelity and at a designated time in the cell cycle. Replication is semiconservative, each strand acting as template for a new daughter strand. It is carried out in three identifiable phases: initiation, elongation, and termination. The process starts at a single origin in bacteria and usually proceeds bidirectionally. DNA is synthesized in the 5'�3 ' direction by DNA polymerases. At the replication fork, the leading strand is synthesized continuously in the same direction as replication fork movement; the lagging strand is synthesized discontinuously as Okazaki fragments , which are subsequently ligated. The fidelity of DNA replication is maintained by ( 1 ) base selection by the polymerase, (2) a 3 '�5 ' proofreading exonuclease activity that is part of most DNA polymerases, and (3) specific repair systems for mismatches left behind after replication. Most cells have several DNA polymerases. In E. coli, DNA polymerase III is the primary replication enzyme. DNA polymerase I is responsible for special functions during replication, recombination, and repair. The separate initiation, elongation, and termination phases of DNA replication involve an array of enzymes and protein factors, many belonging to the AAA + ATPase family.
25.2 DNA Repair •
[993]
The replication proteins in bacteria are organized into replication factories, in which template DNA is spooled through two replisomes tethered to the bacterial plasma membrane.
25.2 DNA Repair
Most cells have only one or two sets of genomic DNA. Damaged proteins and RNA molecules can be quickly re placed by using information encoded in the DNA, but DNA molecules themselves are irreplaceable. Maintaining the integrity of the information in DNA is a cellular imperative, supported by an elaborate set of DNA repair systems. DNA can become damaged by a variety of processes, some spontaneous, others catalyzed by envirorunental agents (Chapter 8) . Replication itself can very occasionally dam age the information content in DNA when errors intro duce mismatched base pairs (such as G paired with T) . The chemistry of DNA damage is diverse and com plex. The cellular response to this damage includes a wide range of enzymatic systems that catalyze some of the most interesting chemical transformations in DNA metabolism. We first examine the effects of alterations in DNA sequence and then consider specific repair systems. M utations Are Linked to Cancer
The best way to illustrate the importance of DNA repair is to consider the effects of unrepaired DNA damage (a lesion) . The most serious outcome is a change in the base sequence of the DNA, which, if replicated and transmitted to future generations of cells, becomes perma nent. A permanent change in the nucleotide sequence of DNA is called a mutation. Mutations can involve the re placement of one base pair with another (substitution mu tation) or the addition or deletion of one or more base pairs (insertion or deletion mutations) . If the mutation affects nonessential DNA or if it has a negligible effect on the func tion of a gene, it is known as a silent mutation. Rarely, a mutation confers some biological advantage. Most nonsi lent mutations, however, are neutral or deleterious. In mammals there is a strong correlation between the accumulation of mutations and cancer. A simple test developed by Bruce Ames measures the potential of a given chemical compound to promote certain easily detected mutations in a specialized bacterial strain (Fig. 25-21 ) . Few of the chemicals that we encounter in daily life score as mutagens in this test. However, of the com pounds known to be carcinogenic from extensive animal trials, more than 90% are also found to be mutagenic in the Ames test. Because of this strong correlation be tween mutagenesis and carcinogenesis, the Ames test for bacterial mutagens is widely used as a rapid and inex pensive screen for potential human carcinogens. The genome of a typical mammalian cell accumu lates many thousands of lesions during a 24-hour period. However, as a result of DNA repair, fewer than 1 in 1 ,000 become a mutation. DNA is a relatively stable molecule ,
{ c) FIGURE 25-21 Ames test for carcinogens, based on their mutagenicity.
A strain of Salmonella typhimurium having a mutation that inactivates an enzyme of the histidine biosynthetic pathway is plated on a histidine-free medium. Few cells grow. (a) The few small colonies of 5. typhimurium that do grow on a histidine-free medium carry sponta neous back-mutations that permit the histidine biosynthetic pathway to operate. Three identical nutrient plates (b), (c), and (d) have been inoculated with an equal number of cells. Each plate then receives a disk of filter paper containing progressively lower concentrations of a mutagen. The mutagen greatly i ncreases the rate of back-mutation and hence the number of colonies. The clear areas around the filter paper indicate where the concentration of mutagen is so h igh that it is lethal to the cel ls. As the mutagen diffuses away from the filter paper, it is d i l uted to sublethal concentrations that promote back-mutation. Mutagens can be compared on the basis of their effect on mutation rate. Because many compounds undergo a variety of chemical trans formations after entering cells, compounds are sometimes tested for mutagenicity after first incubating them with a l iver extract. Some substances have been found to be mutagenic only after this treatment.
but in the absence of repair systems, the cumulative effect of many infrequent but damaging reactions would make life impossible. • All Cells Have M ultiple DNA Repair Systems
The number and diversity of repair systems reflect both the importance of DNA repair to cell survival and the diverse sources of DNA damage (Table 25-5) . Some common types of lesions, such as pyrimidine dimers (see Fig. 8-31), can be repaired by several distinct systems. Many DNA repair processes also seem to be extraordinarily inefficient ener getically-an exception to the pattern observed in the vast majority of metabolic pathways, where every ATP is gener ally accounted for and used optimally. When the integrity of the genetic information is at stake, the amount of chemical energy invested in a repair process seems almost irrelevant. DNA repair is possible largely because the DNA mol ecule consists of two complementary strands. DNA dam age in one strand can be removed and accurately replaced by using the undamaged complementary strand
[994]
DNA Metabolism
TABLE 25-5
CH3 I
Types of DNA Repair Systems In £ CDII Type of damage
E�es/proteins
3'
Mismatch repair
DNA glycosylases AP endonucleases
DNA polymerase I DNA ligase
G A T c
Direct repair
I
replication Mismatches CH3 I
5'
G A T C
3'
1
}
Abnormal bases (uracil, hypoxanthine, xanthine) ; alkylated bases; in some other organisms, pyrimidine dimers
3' 5'
5' ... 3'
C T A G .1.
·.Gila
For a short period following replication, the template strand is methylated and the new strand is not.
DNA lesions that cause large structural changes (e.g., pyrimidine dimers)
DNA photolyases
Pyrimidine dimers
06-Methylguanine-DNA
06 -Methylguanine
AlkB protein
1-Methylguanine, 3-methylcytosine
methyltransferase
5'
c T A G
Nucleotide-excision repair
ABC excinuclease DNA polymerase I DNA ligase
3'
CH3
Dam methylase MutH, MutL, MutS proteins DNA helicase II SSB DNA polymerase III Exonuclease I Exonuclease VII RecJ nuclease Exonuclease X DNA ligase Base-excision repair
5'
CH3 I
5' 3'
•
c T A
I I l-i-.L..L1
3' 5'
Hemimethylated DNA
as a template. We consider here the principal types of re pair systems, beginning with those that repair the rare nucleotide mismatches that are left behind by replication. Mismatch Repair Correction of the rare mismatches left after replication in E. coli improves the overall fidelity of replication by an additional factor of 1 02 to 103 . The mismatches are nearly always corrected to reflect the in formation in the old (template) strand, so the repair sys tem must somehow discriminate between the template and the newly synthesized strand. The cell accomplishes this by tagging the template DNA with methyl groups to distinguish it from newly synthesized strands. The mis match repair system of E. coli includes at least 1 2 protein components (Table 25-5) that function either in strand discrimination or in the repair process itself. The strand discrimination mechanism has not been worked out for most bacteria or eukaryotes, but is well understood for E. coli and some closely related bacter ial species. In these bacteria, strand discrimination is based on the action of Dam methylase, which, as you will recall, methylates DNA at the � position of all adenines within (5')GATC sequences. Immediately after passage of the replication fork, there is a short period (a few sec onds or minutes) during which the template strand is methylated but the newly synthesized strand is not (Fig. 25-22). The transient unmethylated state of
G A T c
C T A G I
9as 01111
Ill
J V)BH
9:EJa I
5' 3'
G A T C C T A G I
After a few minutes the new strand is methylated and the two strand can no longer be distinguished.
3' 5'
CH 3 CH3 I
5' 3'
G A T C C T A G I
3' 5'
CH3
FIGURE 25-22 Methylation and mismatch repair. Methylation of DNA strands can serve to d istinguish parent (template) strands from newly synthesized strands in E. coli DNA, a function that is critical to mismatch repair (see Fig. 2 5-23). The methylation occurs at the N6 of adeni nes in (S')GATC sequences. This sequence is a pal i ndrome (see Fig. 8-1 8), present in opposite orientations on the two strands.
25.2 DNA Repair
GATC sequences in the newly synthesized strand per mits the new strand to be distinguished from the tem plate strand. Replication mismatches in the vicinity of a hemimethylated GATC sequence are then repaired ac cording to the information in the methylated parent (template) strand. Tests in vitro show that if both strands are methylated at a GATC sequence, few mis matches are repaired; if neither strand is methylated, repair occurs but does not favor either strand. The cell's methyl-directed mismatch repair system efficiently re pairs mismatches up to 1 ,000 bp from a hemimethylated GATC sequence. How is the mismatch correction process directed by relatively distant GATC sequences? A mechanism is illustrated in Figure 25-23 . MutL protein forms a complex with MutS protein, and the complex binds to all mismatched base pairs (except C-C) . MutH protein binds to MutL and to GATC sequences encountered by the MutL-MutS complex. DNA on both sides of the mis match is threaded through the MutL-MutS complex, creating a DNA loop ; simultaneous movement of both legs of the loop through the complex is equivalent to the complex moving in both directions at once along the DNA. MutH has a site-specific endonuclease activ ity that is inactive until the complex encounters a hemimethylated GATC sequence. At this site, MutH catalyzes cleavage of the unmethylated strand on the 5 ' side of the G in GATC, which marks the strand for re pair. Further steps in the pathway depend on where the mismatch is located relative to this cleavage site ( Fig. 25-24). When the mismatch is on the 5' side of the cleav age site (Fig. 25-24 , right side) , the unmethylated strand is unwound and degraded in the 3 '�5' direc tion from the cleavage site through the mismatch, and this segment is replaced with new DNA. This process requires the combined action of DNA helicase II, SSB, exonuclease I or exonuclease X (both of which de grade strands of DNA in the 3 '�5' direction) , DNA polymerase III, and DNA ligase . The pathway for re pair of mismatches on the 3 ' side of the cleavage site is similar (Fig. 25-24, left) , except that the exonucle ase is either exonuclease VII (which degrades single stranded DNA in the 5 ' �3 ' or 3 '�5' direction) or RecJ nuclease (which degrades single-stranded DNA in the 5 '�3 ' direction) . Mismatch repair is a particularly expensive process for E. coli in terms of energy expended. The mismatch may be 1 ,000 bp or more from the GATC sequence. The degradation and replacement of a strand segment of this length require an enormous investment in activated de oxynucleotide precursors to repair a single mismatched base. This again underscores the importance to the cell of genomic integrity. All eukaryotic cells have several proteins struc turally and functionally analogous to the bacterial MutS and MutL (but not MutH) proteins. Alterations in hu man genes encoding proteins of this type produce some of the most common inherited cancer-susceptibility
G
Mismatched base pair
CH3 I
�
5' 3 ' --------�
'
'
'
'
T C
C T A G '
"
[995]
'11' ;
/
;
;
/ -
l=l-
3' 5'
CFI.a
I
CHs
l
CRa
1
:VIutH cleave tb • unm •thylaeed B'lrand
CH3 I
· -··"--- ·---
.. ....r--·-·--�
·-----
F IGURE 25-23 A model for the early steps of methyl-directed mis
match repair. The proteins i nvolved in this process in f. coli have
been purified (see Table 2 5-5 ) . Recogn ition of the sequence ( 5 ' ) GATC and of the m ismatch are special ized functions of the MutH and MutS proteins, respectively. The Mutl protein forms a complex with MutS at the mismatch. DNA is threaded through this complex such that the complex moves simu ltaneously in both d i rections along the DNA until it encounters a MutH protein bou nd at a hemi methy lated GATC sequence. MutH cleaves the unmethylated strand on the 5 ' side of the G in this sequence. A complex consisting of DNA he l icase II and one of several exonucleases then degrades the un methylated DNA strand from that point toward the m ismatch (see Fig. 2 5-2 4) .
[?96
�
DNA Meta bolism
5' 3'
3' 5' TP.
ADP+ Pi *'
CH3 I
v-ATP ADP+Pi
CH3 I
M• .
or
CH1 I
•
l
!I
CH3 I
TP
\ !I
ADP+Pi CH3 I
l"
r 'r r \I L•l ' l nH
CH3 I
\I I t ! ll
(
CH3 I
FIGURE 25-24 Completing methyl-directed mismatch repair. The combined action of DNA hel icase II, 558, and one of four different exonucleases removes a segment of the new strand between the MutH cleavage site and a point just beyond the mismatch, The exonuclease
syndromes (see Box 25- 1 , p, 1003) , further demonstrat ing the value to the organism of DNA repair systems. The main MutS homologs in most eukaryotes, from yeast to humans, are MSH2 (MutS homolog 2) , MSH3, and MSH6. Heterodimers of MSH2 and MSH6 generally bind to single base-pair mismatches, and bind less well to slightly longer mispaired loops. In many organisms the longer mismatches (2 to 6 bp) may be bound in stead by a heterodimer of MSH2 and MSH3, or are bound by both types of heterodirners in tandem. Ho mologs of MutL, predominantly a heterodimer of MLH1 (MutL homolog 1 ) and PMS 1 (post-meiotic segrega tion) , bind to and stabilize the MSH complexes. Many details of the subsequent events in eukaryotic mis match repair remain to be worked out. In particular, we do not know the mechanism by which newly synthe sized DNA strands are identified, although research has revealed that this strand identification does not involve GATC sequences. Base-Excision Repair Every cell has a class of en zymes called DNA glycosylases that recognize particu larly common DNA lesions (such as the products of cytosine and adenine deamination; see Fig. 8-30a) and remove the affected base by cleaving the N-glycosyl bond. This cleavage creates an apurinic or apyrimidinic
CH3 I
CH3 I
l
Ha
r I>N '"" "iS!l
Ill
''"
I
CHs -- ---·
-
--
that is used depends on the location of the cleavage site relative to the mismatch, as shown by the alternative pathways here. The resulting gap is filled i n (dashed l ine) by DNA polymerase Ill, and the nick is sealed by DNA l igase (not shown).
site in the DNA, commonly referred to as an AP site or abasic site. Each DNA glycosylase is generally specific for one type of lesion. Uracil DNA glycosylases, for example, found in most cells, specifically remove from DNA the uracil that results from spontaneous deamination of cytosine. Mutant cells that lack this enzyme have a high rate of G-C to A=T mutations. This glycosylase does not re move uracil residues from RNA or thymine residues from DNA. The capacity to distinguish thymine from uracil, the product of cytosine deamination-neces sary for the selective repair of the latter-may be one reason why DNA evolved to contain thymine instead of uracil (p . 289) . Most bacteria have just one type of uracil DNA glyco sylase, whereas humans have at least four types, with dif ferent specificities-an indicator of the importance of uracil removal from DNA. The most abundant human uracil glycosylase, UNG, is associated with the human replisome, where it eliminates the occasional U residue inserted in place of a T during replication. The deamina tion of C residues is 1 00-fold faster in single-stranded DNA than in double-stranded DNA, and humans have the enzyme hSMUG 1 , which removes any U residues that oc cur in single-stranded DNA during replication or tran scription. Two other human DNA glycosylases, TDG and
25.2 DNA Repair
MBD4, remove either U or T residues paired with G, gen erated by deamination of cytosine or 5-methylcytosine, respectively. Other DNA glycosylases recognize and remove a va riety of damaged bases, including formamidopyrimidine and 8-hydroxyguanine (both arising from purine oxida tion) , hypoxanthine (arising from adenine deamina tion) , and alkylated bases such as 3-methyladenine and 7-methylguanine. Glycosylases that recognize other le sions, including pyrimidine dimers, have also been iden tified in some classes of organisms. Remember that AP sites also arise from the slow, spontaneous hydrolysis of the N-glycosyl bonds in DNA (see Fig. 8-30b) . Once an AP site has been formed by a DNA glyco sylase, another type of enzyme must repair it. The re pair is not made by simply inserting a new base and re-forming the N-glycosyl bond. Instead, the deoxyri bose 5 ' -phosphate left behind is removed and replaced with a new nucleotide . This process begins with one of the AP endonucleases, enzymes that cut the DNA strand containing the AP site. The position of the inci sion relative to the AP site (5 ' or 3 ' to the site) varies with the type of AP endonuclease. A segment of DNA including the AP site is then removed, DNA polymerase I replaces the DNA, and DNA ligase seals the remaining nick ( Fig. 25-2 5 ) . In eukaryotes, nucleotide replace ment is carried out by specialized polymerases , as described below.
DNA g l�·c
-_ ---"""'_
N
H2C=O H�
H H t ,O C CN 0 _..c_; NHz
+
Formaldehyde
Adenine
CN r0 NHz
_,,
_ _
I
NH2
I
Cytosine
25.2 DNA Repair
The Interaction of Replication Forks with DNA Damage
G 00�
to create a specialized DNA polymerase, DNA poly merase V, that can replicate past many of the DNA le
Can Lead to Error-Prone Translesion DNA Synthesis
sions that would normally block replication. Proper base
The repair pathways considered to this point generally
pairing is often impossible at the site of such a lesion, so
work only for lesions in double-stranded DNA, the undam
this translesion replication is error-prone.
aged strand providing the correct genetic information to
Given the emphasis on the importance of genomic in
restore the damaged strand to its original state. However,
tegrity throughout this chapter, the existence of a system
in certain types of lesions, such as double-strand breaks,
that increases the rate of mutation may seem incongru
double-strand cross-links, or lesions in a single-stranded
ous. However, we can think of this system as a despera
DNA, the complementary strand is itself damaged or is ab
tion strategy. The umuC and umuD genes are fully
sent. Double-strand breaks and lesions in single-stranded
induced only late in the SOS response, and they are not
DNA most often arise when a replication fork encounters
activated for translesion synthesis initiated by UmuD
an unrepaired DNA lesion
cleavage unless the levels of DNA damage are particularly
(Fig. 25-30). Such lesions and
all replication forks are blocked. The mutations
DNA cross-links can also result from ionizing radiation and
high and
oxidative reactions.
resulting from DNA polymerase V-mediated replication
At a stalled bacterial replication fork, there are two
kill some cells and create deleterious mutations in others,
avenues for repair. In the absence of a second strand, the
but this is the biological price a species pays to overcome
information required for accurate repair must come from
an otherwise insurmountable barrier to replication, as it
a separate, homologous chromosome. The repair system
permits at least a few mutant daughter cells to survive.
thus involves homologous genetic recombination. This
In addition to DNA polymerase V, translesion repli
recombinational DNA repair is considered in detail in
cation requires the RecA protein. RecA filaments bound
Section
25.3. Under some conditions, a second repair error-prone translesion DNA synthesis
to single-stranded DNA at one chromosomal location
pathway,
can activate DNA polymerase V complexes bound at dis
(often abbreviated TLS), becomes available. When this
tant sites on the chromosome. This has been described
pathway is active, DNA repair becomes significantly less
as acting "in trans," a phenomenon aided by looping of
accurate and a high mutation rate can result. In bacteria,
the chromosome that brings distant sites adjacent to
error-prone translesion DNA synthesis is part of a cellu
each other. Yet another DNA polymerase, DNA poly
lar stress response to extensive DNA damage known, ap
merase IV, is also induced during the SOS response.
propriately enough, as the
Some SOS
Replication by DNA polymerase IV, a product of the
proteins, such as the UvrA and UvrB proteins already de
dinE gene, is also highly error-prone. The bacterial DNA
scribed (Table 25-6) , are normally present in the cell but
polymerases IV and V are part of a family of TLS poly
are induced to higher levels as part of the SOS response.
merases found in all organisms. These enzymes lack a
SOS response.
Additional SOS proteins participate in the pathway for
proofreading exonuclease activity, and the fidelity of
error-prone repair; these include the UmuC and UmuD
base selection during replication can be reduced by a
proteins ("Umu" from unmutable; lack of the umu gene
factor of
function eliminates error-prone repair) . The UmuD pro
error in
102 , lowering overall replication fidelity to � 1 ,000 nucleotides.
one
tein is cleaved in an 80S-regulated process to a shorter
Mammals have many low-fidelity DNA polymerases
form called UmuD ' , which forms a complex with UmuC
of the TLS polymerase family. However, the presence of
Unrepaired lesion
1
Unrepaired break
I
Single-stranded
DNA
/
Recombinational
DNA repair or
error-prone repair
Double-strand break
/
Recombinational DNA repair
FIGURE 25-30 DNA damage and its effect on DNA
replication. If the repI ication fork encounters an un
repaired lesion or strand break, replication generally halts and the fork may collapse. A lesion is left be hind in an unreplicated, single-stranded segment of the DNA (left); a strand break becomes a double strand break (right). I n each case the damage to one strand cannot be repai red by mechanisms described earlier in this chapter, because the complementary strand required to direct accurate repair is damaged or absent. There are two possible avenues for repair: recombinational DNA repair (described in Fig. 25-39) or, when lesions are unusua lly numerous, error-prone repair. The latter mechanism involves a novel DNA polymerase (DNA polymerase V, en coded by the umuC and umuD genes) that can repli cate, albeit inaccurately, over many types of lesions . The repair mechan ism is "error-prone" because mu tations often result.
� 00�
DNA Metabolism
TABLE 25-6
Genes Induced as Part of the SOS Response In E. coli
Gene name
-------
Protein encoded and/or role in DNA repair
Genes of known function
polE (dinA) uvrA
}
l umuD j uvrE
umuC
sulA
Encodes polymerization subunit of DNA polymerase II, required for replication restart in recombinational DNA repair Encode ABC excinuclease subunits UvrA and UvrB Encode DNA polymerase V Encodes protein that inhibits cell division, possibly to allow time for DNA repair
recA
Encodes RecA protein, required for error-prone repair and recombinational repair
dinE
Encodes DNA polymerase IV
ssb
Encodes single-stranded DNA-binding protein (SSB)
hirnA
Encodes subunit of integration host factor (IHF), involved in site-specific recombination, replication, transposition, regulation of gene expression
Genes involved in DNA metabolism, but role in DNA repair unknown
uvrD
Encodes DNA helicase II (DNA-unwinding protein)
recN
Required for recombinational repair
Genes of unknown function
dinD dinF Note:
Some of these genes and their functions are further discussed in Chapter 28.
these enzymes does not necessarily translate into an un acceptable mutational burden, because most of these en zymes also have specialized functions in DNA repair. DNA polymerase 11 (eta) , for example, found in all eu karyotes, promotes translesion synthesis primarily across cyclobutane T-T dimers. Few mutations result in this case, because the enzyme preferentially inserts two A residues across from the linked T residues. Sev eral other low-fidelity polymerases, including DNA poly merases {3, t (iota) , and A , have specialized roles in eukaryotic base-excision repair. Each of these enzymes has a 5'-deoxyribose phosphate lyase activity in addi tion to its polymerase activity. After base removal by a glycosylase and backbone cleavage by an AP endonucle ase, these polymerases remove the abasic site (a 5 ' -de oxyribose phosphate) and fill in the very short gap . The frequency of mutation due to DNA polymerase 11 activ ity is minimized by the very short lengths (often one nu cleotide) of DNA synthesized. What emerges from research into cellular DNA repair sys tems is a picture of a DNA metabolism that maintains ge nomic integrity with multiple and often redundant systems. In the human genome, more than 130 genes encode pro teins dedicated to the repair of DNA. In many cases, the loss of function of one of these proteins results in genomic insta bility and an increased occurrence of oncogenesis (Box 25-1). These repair systems are often integrated with the DNA replication systems and are complemented by recom bination systems, which we tum to next.
S U M M A RY 2 5 .2 •
•
•
•
•
DNA Repair
Cells have many systems for DNA repair. Mismatch repair in E. coli is directed by transient nonmethylation of (5') GATC sequences on the newly synthesized strand. Base-excision repair systems recognize and repair damage caused by environmental agents (such as radiation and alkylating agents) and spontaneous reactions of nucleotides. Some repair systems recognize and excise only damaged or incorrect bases, leaving an AP (abasic) site in the DNA. This is repaired by excision and replacement of the DNA segment containing the AP site. Nucleotide-excision repair systems recognize and remove a variety of bulky lesions and pyrimidine dimers. They excise a segment of the DNA strand including the lesion, leaving a gap that is filled in by DNA polymerase and ligase activities . Some DNA damage is repaired by direct reversal of the reaction causing the damage : pyrimidine dimers are directly converted to monomeric pyrimidines by a photolyase, and the methyl group of 06methylguanine is removed by a methyltransferase. In bacteria, error-prone translesion DNA synthesis, involving TLS DNA polymerases, occurs in response to very heavy DNA damage. In eukaryotes, similar polymerases have specialized roles in DNA repair that minimize the introduction of mutations.
25.2 DNA
BOX 25-1
� 00�
D N A R e p a i r a n d Ca n ce r ..;...__�---------"-__;._l
Human cancers develop when genes that regulate nor mal cell division (oncogenes and tumor suppressor genes; Chapter 1 2) fail to function, are activated at the wrong time, or are altered. As a consequence , cells may grow out of control and form a tumor. The genes con trolling cell division can be damaged by spontaneous mutation or overridden by the invasion of a tumor virus (Chapter 26) . Not surprisingly, alterations in DNA repair genes that result in an increased rate of mutation can greatly increase an individual's susceptibility to cancer. Defects in the genes encoding the proteins involved in nucleotide-excision repair, mismatch repair, recombina tional repair, and error-prone translesion DNA synthesis have all been linked to human cancers. Clearly, DNA repair can be a matter of life and death. Nucleotide-excision repair requires a larger num ber of proteins in humans than in bacteria, although the overall pathways are very similar. Genetic defects that inactivate nucleotide-excision repair have been associated with s everal genetic disease s , the best studied of which is xeroderma pigmentosum (XP) . Because nucleotide-excision repair is the sole repair pathway for pyrimidine dimers in humans, people with XP are extremely sensitive to light and readily develop sunlight-induced skin cancers. Most people with XP also have neurological abnormalitie s , pre sumably because of their inability to repair certain le sions caused by the high rate of oxidative metabolism in neurons. Defects in the genes encoding any of at least seven different protein components of the nu cleotide-excision repair system can result in XP, giv ing rise to seven different genetic groups denoted XPA to XPG. Several of these proteins (notably those defective in XPB, XPD, and XPG) also play roles in transcription-coupled base-excision repair of oxida tive lesions , described in Chapter 26. Most microorganisms have redundant pathways for the repair of cyclobutane pyrimidine dimers-making use of DNA photolyases and sometimes base-excision repair as alternatives to nucleotide-excision repair-but humans and other placental mammals do not. This lack of a back-up for nucleotide-excision repair for removing pyrimidine dimers has led to speculation that early mammalian evolution involved small, furry, nocturnal animals with little need to repair UV damage. However, mammals do have a pathway for the translesion bypass of cyclobutane pyrimidine dimers, which involves DNA
25.3 DNA Recombination
Repair
The rearrangement of genetic information within and among DNA molecules encompasses a variety of processes, collectively placed under the heading of genetic recombination. The practical applications of DNA rearrangements in altering the genomes of
polymerase Tl · This enzyme preferentially inserts two A residues opposite a T-T pyrimidine dimer, minimizing mutations. People with a genetic condition in which DNA polymerase T/ function is missing exhibit an XP-like illness known as XP-variant or XP-V. Clinical manifesta tions of XP-V are similar to those of the classic XP dis eases, although mutation levels are higher in XP-V when cells are exposed to UV light. Apparently, the nu cleotide-excision repair system works in concert with DNA polymerase T/ in normal human cells, repairing and/or bypassing pyrimidine dimers as needed to keep cell growth and DNA replication going. Exposure to UV light introduces a heavy load of pyrimidine dimers, and some must be bypassed by translesion synthesis to keep replication on track. When one system is missing, it is partly compensated for by the other. A loss of DNA poly merase T/ activity leads to stalled replication forks and bypass of UV lesions by different, more mutagenic, translesion synthesis (TLS) polymerases. As when other DNA repair systems are absent, the resulting increase in mutations often leads to cancer. One of the most common inherited cancer-suscepti bility syndromes is hereditary nonpolyposis colon can cer (HNPCC) . This syndrome has been traced to defects in mismatch repair. Human and other eukaryotic cells have several proteins analogous to the bacterial MutL and MutS proteins (see Fig. 25-23) . Defects in at least five different mismatch repair genes can give rise to HNPCC. The most prevalent are defects in the hMLHl (human MutL homolog 1 ) and hMSH2 (human MutS homolog 2) genes. In individuals with HNPCC, cancer generally develops at an early age, with colon cancers being most common. Most human breast cancer occurs in women with no known predisposition. However, about 10% of cases are associated with inherited defects in two genes, BRCA l and BRCA2. Human BRCA1 and BRCA2 are large proteins ( 1 ,834 and 3,4 1 8 amino acid residues, respec tively) that interact with a wide range of other proteins involved in transcription, chromosome maintenance , DNA repair, and control o f the cell cycle. BRCA2 has been implicated in the recombinational DNA repair of double-strand breaks. However, the precise molecular function of BRCAl and BRCA2 in these various cellular processes is not yet clear. Women with defects in either the BRCA l or BRCA2 gene have a greater than 80% chance of developing breast cancer.
increasing numbers of organisms are now being explored (Chapter 9). Genetic recombination events fall into at least three general classes. Homologous genetic recombination (also called general recombination) involves genetic exchanges between any two DNA molecules (or seg ments of the same molecule) that share an extended
:-1 oo4 '
�
DNA Meta b o l i s m
region of nearly identical sequence. The actual sequence of bases is irrelevant, as long as it is similar in the two DNAs. In site-specific recombination the exchanges occur only at a particular DNA sequence. DNA trans position is distinct from both other classes in that it usually involves a short segment of DNA with the remarkable ca pacity to move from one location in a chromosome to another. These "jumping genes" were first observed in maize in the 1 940s by Barbara McClintock. There is in addition a wide range of unusual genetic rearrange ments for which no mechanism or purpose has yet been pro Barbara McCli ntock, posed. Here we focus on the 1 902-1 992 three general classes. The functions of genetic recombination systems are as varied as their mechanisms . They include roles in specialized DNA repair systems, specialized activities in DNA replication, regulation of expression of certain genes, facilitation of proper chromosome segregation during eukaryotic cell division, maintenance of genetic diversity, and implementation of programmed genetic rearrangements during embryonic development. In most cases, genetic recombination is closely integrated with other processes in DNA metabolism, and this be comes a theme of our discussion.
(recipient) . Recombination during conjugation, although rare in wild bacterial populations, contributes to genetic diversity. In eukaryotes, homologous genetic recombination can have several roles in replication and cell division, including the repair of stalled replication forks. Recom bination occurs with the highest frequency during meiosis, the process by which diploid germ-line cells with two sets of chromosomes divide to produce haploid gametes (sperm cells or ova) in animals (haploid spores in plants) -each gamete having only one member of each chromosome pair (l 3 ' direction on single-stranded D NA. D isassembly proceeds, also in the 5 '---> 3 ' d i rection, from the end opposite to that where extension occurs. (d) Fi lament assembly is assisted by the ReeF, RecO, and RecR proteins (RecFOR). The RecX protein inhibits RecA filament extension. The Din I protein stabi l i zes RecA filaments, preventing disassembly.
(b)
(c)
Circular single stranded DNA
5' �
nucleation
Circular duplex DNA with single-strand gap
3'
0 RecA protein
+ 5'
Homologous linear duplex DNA
3'
RecA protein
extension
5'
Branched intermediates
3'
0
disassembly
5'
ADP
t
Pt RecA protein binds to single-stranded or gapped DNA. The complementary strand of the linear DNA pairs with a circular single strand. The other linear strand is displaced (left) or pairs with its complement in the circular duplex to yield a Holliday intermediate (right).
3'
(d)
SSB
ffi rn
0 RecFOR t !�
0
+
l
0
ADP + Pi
RecA protein
ATP ADP + Pi
+ Continued branch migration yields a circular duplex with a nick and either a displaced linear strand (left) or a partially single-stranded linear duplex (right).
FIGURE that can align two DNA molecules. Strands are then exchanged between the two DNAs to create hybrid DNA. The exchange occurs at a rate of 6 bp/s and pro gresses in the 5' �3 ' direction relative to the single stranded DNA within the RecA filament. This reaction can involve either three or four strands (Fig. 25-37) ; in the latter case, a Holliday intermediate forms during the process.
ATP
RecA protein
25-37 RecA-promoted
DNA strand exchange in vitro.
Strand exchange involves the separation of one strand of a duplex DNA from its complement and transfer of the strand to an alternative comple mentary strand to form a new duplex (heteroduplex) DNA. The transfer forms a branched intermediate. Formation of the final product depends on branch migration, which is faci l itated by RecA. The reaction can in volve three strands (left) or a reciprocal exchange between two homolo gous duplexes-four strands in all (right). When four strands are i nvolved, a Holliday intermediate results. RecA promotes the branch-migration phases of these reactions, using energy derived from ATP hydrolysis.
25.3 DNA Recombination
As the duplex DNA is incorporated within the RecA filament and aligned with the bound single-stranded DNA over regions of hundreds of base pairs, one strand of the duplex switches pairing partners (Fi�. 2 5-:ls , step @ ) . Because DNA is a helical structure, continued strand exchange requires an ordered rotation of the two aligned DNAs . This brings about a spooling action (steps ® and @) that shifts the branch point along the helix. ATP hydrolysis is coupled to the late stages of
c1")
�
Three-stranded pairing intermediate
Homologous duplex DNA
Homologous duplex DNA
®
ATP
@
5'
L
i 1 009
DNA strand exchange, in which the hybrid DNA created in the initial pairing reaction is extended. The coupling mechanism is not yet understood. Once a Holliday intermediate has formed, a host of enzymes-topoisomerases, the RuvAB branch migration protein, a resolvase, other nucleases, DNA polymerase I or III, and DNA ligase-are required to complete recombina tion. The RuvC protein CMr 20,000) of E. coli cleaves Hol liday intermediates to generate full-length, unbranched chromosome products.
RecA protein
5'((:_�� 3 ' �
'
3'
FIGURE 25-38 Model for RecA-mediated DNA strand exchange. A three-strand reaction is shown. The bal l s representing RecA protein are undersized relative to the thickness of DNA to clarify the fate of the DNA strands. CD RecA forms a filament on the single-stranded D NA. (I) A homologous duplex incorporates into this complex. ® As spooling shifts the three-stranded region from left to right, one of the strands in the duplex is transferred to the single strand originally bound in the filament. The other strand of the duplex is displaced, and a new duplex forms within the fi lament. As rotation continues (@) and @), the displaced strand separates entirely. In this model, hydrolysis of ATP by RecA rotates the two DNA molecules relative to each other and thus d i rects the strand exchange from left to right as shown.
All Aspects of DNA Metabolis m Come Together to Repair Stal led Replication Forks
Like all cells, bacteria sustain high levels of DNA dam age even under normal growth conditions. Most DNA lesions are repaired rapidly by base-excision repair, nucleotide-excision repair, and the other pathways described earlier. Nevertheless, almost every bacter ial replication fork encounters an unrepaired DNA le sion or break at some point in its journey from the replication origin to the terminus (Fig. 25-30) . For many types of lesions , DNA polymerase III cannot proceed and the encounter tends to leave the lesion in a single-strand gap. An encounter with a DNA strand break creates a double-strand break. Both sit uations require recombinational DNA repair ( Fig. 2 5-8 9 ) . Under normal growth conditions, stalled replication forks are reactivated by an elaborate re pair pathway encompassing recombinational DNA re pair, the restart of replication, and the repair of any lesions left behind. All aspects of DNA metabolism come together in this process. After a replication fork has been halted, it can be restored by at least two major paths, both of which re quire the RecA protein. The repair pathway for lesion containing DNA gaps also requires the ReeF, RecO, and RecR proteins. Repair of double-strand breaks re quires the RecBCD enzyme (Fig. 25-39) . Additional recombination steps are followed by origin-inde pendent restart of replication, in which the repli cation fork reassembles with the aid of a complex of seven proteins (PriA, B, and C, and DnaB, C, G, and T) . This complex, originally discovered as a compo nent required for the replication of c/>X 1 74 DNA in vitro, is now termed the replication restart primo some . Restart of the replication fork also requires DNA polymerase II, in a role not yet defined; this poly merase II activity gives way to DNA polymerase III for the extensive replication generally required to com plete the chromosome. In at least some cases , replica tion restart can occur downstream of a blocking DNA lesion before the lesion is repaired. The repair of stalled replication forks entails coordi nated transitions between replication and recombina tion. The recombination steps function to fill the DNA gap or rejoin the broken DNA branch to recreate the
� � 01
DNA Metabolism
FIGURE 25-39 Models for recombinational DNA
3'
repair of stalled replication forks. The replication
fork collapses on encountering a DNA lesion (left) or strand break (right). Recombination enzymes promote the DNA strand transfers needed to re· pair the branched DNA structure at the repl ication fork. A lesion in a single-strand gap is repaired in a reaction requiring the ReeF, RecO, and RecR proteins. Double·strand breaks are repaired in a pathway requiring the RecBCD enzyme. Both pathways require RecA. Recombination interme· diates are processed by additional enzymes (e.g., RuvA, RuvB, and RuvC, which process Holliday intermediates). Lesions in double-stranded DNA are repaired by nucleotide-excision repair or other pathways. The replication fork re-forms with the aid of enzymes catalyzing origin·independent replication restart, and chromosomal replication is completed. The overal l process requires an elaborate coordination of all aspects of bacterial DNA metabolism.
/DNA
nick
1
======;•
strand
II Rt h )
invasion
RecA
RecBCD
----
Pol I
replication
----
revc,.,e
brancl!
migrotioo
resolution of Hollidny intermedlnt�
Origin-independent replication restart
branched DNA structure at the replication fork. Lesions left behind in what is now duplex DNA are repaired by pathways such as base-excision or nucleotide-excision repair. Thus a wide range of enzymes encompassing every aspect of DNA metabolism ultimately take part in the repair of a stalled replication fork. This type of repair process is a primary function of the homologous recom bination system of every cell, and defects in recombina tional DNA repair play an important role in human disease (Box 25-1 ) . Site-Specific Recombination Results in Precise DNA Rearrangements
Homologous genetic recombination, the type we have discussed so far, can involve any two homologous
sequences. The s econd general type of recombina tion, site-specific recombination, is a very different type of process: recombination is limited to specific sequences . Recombination reactions of this type oc cur in virtually every cell, filling spe cialized roles that vary greatly from one species to another. Exam ples include regulation of the expression of certain genes and promotion of programmed DNA re arrangements in embryonic development or in the replication cycles of some viral and plasmid DNAs. E ach site-specific recombination system consists of an enzyme called a recombinase and a short (20 to 200 bp) , unique DNA sequence where the recombi nase acts (the recombination site) . One or more aux iliary proteins may regulate the timing or outcome of the reaction.
25.3 DNA Recombination
3'
Recombi nase
I
'
5'
3'
-'l'yr
Tyr -
5' 3'
CD 3'
3'
5' /
5'
01
5'
Tyr
Tyr I
5'
3'
� �J
Jf
.s·
HO
Tyr ··-··
5'
5'
3'
3'
- , 1.r'e!) I
3'
( OH
'
3'
3'
5'
5'
3'
/
Tyr I
Tyr
HO
OH
5'
(
Tyr
I.J (
!
/
3'
5' 3'
5'
3'
5'
5'
3' 5'
3'
3'
5' ;-Tyr J
I Tyr
(
Tyr 3'
5'
3'
(a}
There are two general classes of site-specific recom bination systems, which rely on either Tyr or Ser residues in the active site. In vitro studies of many site specific recombination systems in the tyrosine class have elucidated some general principles, including the fundamental reaction pathway (Fig. 2 5-40a) . Several of these enzymes have been crystallized, revealing structural details of the reaction. A separate recombi nase recognizes and binds to each of two recombination sites on two different DNA molecules or within the same DNA. One DNA strand in each site is cleaved at a spe cific point within the site, and the recombinase becomes covalently linked to the DNA at the cleavage site through a phosphotyrosine bond (step (D). The tran sient protein-DNA linkage preserves the phosphodiester bond that is lost in cleaving the DNA, so high-energy co factors such as ATP are unnecessary in subsequent steps. The cleaved DNA strands are rejoined to new partners to form a Holliday intermediate, with new phosphodiester bonds created at the expense of the protein-DNA linkage (step ®). To complete the reaction, the process must be repeated at a second point within each of the two
(b)
FIGURE 25-40 A site-specific recombination reaction. (a} The reac
tion shown here is for a common class of site-specific recombinases cal led integrase-class recombinases (named after bacteriophage A inte grase, the first recombi nase characterized). These enzymes use Tyr residues as nucleophi les at the active site. The reaction is carried out within a tetramer of identical subunits. Recombinase subunits bind to a specific sequence, the recombination site. CD One strand in each D NA is cleaved at particular points in the sequence. The nucleophile is the -OH group of an active-site Tyr residue, and the product is a co valent phosphotyrosine l i n k between protein and D NA. CD The cleaved strands join to new partners, producing a Hol l iday i ntermedi ate. Steps ® and @) complete the reaction by a process simi lar to the first two steps. The original sequence of the recombi nation site is regenerated after recombining the DNA flanking the site. These steps occur within a complex of mu ltiple recombinase subunits that some times includes other proteins not shown here. (b) Surface contour model of a four-subunit integrase-c lass recombi nase cal led the Cre recombi nase, bound to a Holl iday intermediate (shown with l ight blue and dark blue hel ix strands). The protein has been rendered transpar ent so that the bound DNA is visible (derived from PDB ID 3CRX). Another group of recombinases, cal led the resolvase/invertase fami ly, use a Ser residue as nucleophile at the active site.
recombination sites (steps ® and @)). In the systems that employ an active-site Ser residue , both strands of each recombination site are cut concurrently and re joined to new partners without the Holliday intermedi ate. In both types of system, the exchange is always reciprocal and precise, regenerating the recombination sites when the reaction is complete. We can view a recombinase as a site-specific endonuclease and ligase in one package . The sequences of the recombination sites recognized by site-specific recombinases are partially asynunetric (nonpalindromic), and the two recombining sites align in the same orientation during the recombinase reaction. The outcome depends on the location and orientation of
[
1 01
��
DNA Metabolism
Deletion and insertion
Inversion
ll Sites of exchange
insertion
---:.;:;.; .
(a)
deletion
+
(b)
FIGURE 15-41 Effects of site-specific recombination. The outcome of site-specific recombination depends on the location and orientation of the recombination sites (red and green) in a double-stranded DNA molecule. Orientation here (shown by arrowheads) refers to the order of nucleotides in the recombi nation site, not the 5 '�3 ' d i rection.
the recombination sites (Fig. 25-41 ). If the two sites are on the same DNA molecule, the reaction either inverts or deletes the intervening DNA, determined by whether the recombination sites have the opposite or the same orien tation, respectively. If the sites are on different DNAs, the recombination is intermolecular; if one or both DNAs are circular, the result is an insertion. Some recombinase sys tems are highly specific for one of these reaction types and act only on sites with particular orientations. The first site-specific recombination system studied in vitro was that encoded by bacteriophage A. When A phage DNA enters an E. coli cell, a complex series of reg ulatory events commits the DNA to one of two fates. The A DNA replicates and produces more bacteriophages (destroying the host cell) , or it integrates into the host
(a) Recombination sites with opposite orientation in the same DNA
molecule. The result is an inversion. (b) Recombination sites with the same orientation, either on one DNA molecule, producing a deletion, or on two DNA molecu les, producing an insertion.
chromosome and (as prophage) replicates passively along with the chromosome for many cell generations. In tegration is accomplished by a phage-encoded, tyrosine class recombinase (A integrase) that acts at recombination sites on the phage and bacterial DNAs-at attachment sites attP and attB, respectively (Fig. 25-42 ). The role of site-specific recombination in regulating gene expression is considered in Chapter 28. Complete Chromosome Replication Can Require Site-Specific Reco m bination
Recombinational DNA repair of a circular bacterial chromosome , while essential, sometimes generates deleterious byproducts. The resolution of a Holliday
Bacterial attachment site (attB)
I
ll
a ttL
Phage attachment site (attP)
Integration:
A integrase (INT) IHF
Point of crossover
A
Phage
DNA
Excision:
A integrase (INT) IHF
FIS + XIS
E. coli chromosome
FIGURE 15-41 Integration and excision of bacteriophage A DNA at
the chromosomal target site. The attachment site on the A phage DNA (attP) shares only 1 5 bp of complete homology with the bacterial site (attB) in the region of the crossover. The reaction generates two new
attachment sites (attR and a ttL) flanking the integrated phage DNA.
The recombinase is the A i ntegrase (or INT protein). Integration and excision use different attachment sites and different auxil iary proteins. Excision uses the proteins XIS, encoded by the bacteriophage, and FIS, encoded by the bacterium. Both reactions require the protein IHF (integration host factor), encoded by the bacterium.
25.3
DNA Recombination
� � 01
"jump," from one place on a chromosome (the donor site) to another on the same or a different chromosome (the target site) . DNA sequence homology is not usually
transposition; the
required for this movement, called
new location is determined more or less randomly. In sertion of a transposon in an essential gene could kill the cell, so transposition is tightly regulated and usually very infrequent. Transposons are perhaps the simplest of molecular parasites, adapted to replicate passively within the chromosomes of host cells. In some cases they carry genes that are useful to the host cell, and thus exist in a kind of symbiosis with the host.
Inser tion sequences (simple transposons) contain Bacteria have two classes of transposons. termination
of replkauon
�O::: = : D = i m e r i c g e n = o m e = � f\ � � � ��=====djj} :::::: resolution to monomers by XerCD system
only the sequences required for transposition and the genes for the proteins (transposases) that promote the process.
Complex transposons contain one or more
genes in addition to those needed for transposition. These extra genes might, for example, confer resistance to antibiotics and thus enhance the survival chances of the host cell. The spread of antibiotic-resistance ele ments among disease-causing bacterial populations that is rendering some antibiotics ineffectual (p. 949) is mediated in part by transposition. •
Bacterial transposons vary in structure, but most have
short repeated sequences at each end that serve as binding sites for the transposase. When transposition occurs, a short sequence at the target site (5 to
10 bp) is duplicated
to form an additional short repeated sequence that flanks
(Fig. 25-44) . These
FIGURE 25-43 DNA deletion to undo a deleterious effect of recombi
each end of the inserted transposon
national DNA repair. The resolution of a Holl iday intermediate during
duplicated segments result from the cutting mechanism
recombinational DNA repair (if cut at the points indicated by red arrows) can generate a contiguous dimeric chromosome. A specialized site-spe cific recombinase in E. coli, XerCD, converts the dimer to monomers, al lowing chromosome segregation and cell division to proceed.
used to insert a transposon into the DNA at a new location.
intermediate at a replication fork by a nuclease such as RuvC , followed by completion of replication, can give rise to one of two products: the usual two monomeric chromosomes or a contiguous dimeric chromosome
Transposase makes staggered cuts in the target site.
Terminal rep ats
I
Transposon
t��
Target DNA
(Fig. 2 5-43 ) . In the latter case, the covalently linked chromosomes cannot be segregated to daughter cells at cell division and the dividing cells become "stuck." A specialized site-specific recombination system in E. coli, the XerCD system, converts the dimeric chromosomes
The transposon is inserted at the site of the cuts.
to monomeric chromosomes so that cell division can proceed. The reaction is a site-specific deletion reaction (Fig. 25-4lb) . This is another example of the close coor dination between DNA recombination processes and other aspects of DNA metabolism.
Replication fills in the gaps, duplicating the sequences flanking the transposon.
Transposable Genetic Elements Move from One location to Another
FIGURE 25-44 Duplication of the DNA sequence at a target site when
We now consider the third general type of recombina
a transposon is inserted. The sequences that are dupl icated following
tion system: recombination that allows the movement of
transposon insertion are shown in red. These sequences are generally only a few base pairs long, so their size relative to that of a typical transposon is greatly exaggerated in th is drawing.
transposable elements, or
transposons. These seg
ments of DNA, found in virtually all cells, move , or
�0 1 �
DNA Metabolism
There are two general pathways for transposition in bacteria. In direct (or simple) transposition (Fig. 25-45, left) , cuts on each side of the transposon excise it, and the transposon moves to a new location. This leaves a double-strand break in the donor DNA that must be re paired. At the target site, a staggered cut is made (as in Fig. 25-44) , the transposon is inserted into the break, and DNA replication fills in the gaps to duplicate the
Direct transposition
i
Replicative transposition
CD
1
Cleavage
t
I m munoglobulin Genes Assemble by Recombination 3' 5'
Target
DNA
target site sequence. In replicative transposition (Fig. 25-45, right) , the entire transposon is replicated , leav ing a copy behind at the donor location. A cointe grate is an intermediate in this process, consisting of the donor region covalently linked to DNA at the tar get site. Two complete copies of the transposon are present in the cointegrate, both having the same rela tive orientation in the DNA. In some well-character ized transposons, the cointegrate intermediate is converted to products by site-specific recombination, in which specialized recombinases promote the re quired deletion reaction. Eukaryotes also have transposons, structurally sim ilar to bacterial transposons, and some use similar trans position mechanisms. In other cases, however, the mechanism of transposition seems to involve an RNA intermediate. Evolution of these transposons is inter twined with the evolution of certain classes of RNA viruses. Both are described in the next chapter.
@
Free ends of transposons attack target DNA
....../.
� - :; / ---=-=-::
...::::====�
Gaps filled Cleft) or entire transposon replicated (right)
Some DNA rearrangements are a programmed part of development in eukaryotic organisms . An important example is the generation of complete immunoglobulin genes from separate gene segments in vertebrate genomes. A human (like other mammals) is capable of producing millions of different immunoglobulins (anti bodies) with distinct binding specificities, even though the human genome contains only �29,000 genes. Re combination allows an organism to produce an extraor dinary diversity of antibodies from a limited DNA-coding capacity. Studies of the recombination mechanism re veal a close relationship to DNA transposition and sug gest that this system for generating antibody diversity may have evolved from an ancient cellular invasion of transposons. We can use the human genes that encode proteins of the immunoglobulin G (IgG) class to illustrate how anti body diversity is generated. Immunoglobulins consist
FIGURE 25-45 Two general pathways for transposition: direct (sim
CD The DNA is first cleaved on each side of the transposon, at the sites i n dicated by arrows. (I) The l iberated 3 ' hydroxyl groups a t the ends o f the transposon act as nucleophiles in a di rect attack on phosphodiester bonds in the target D NA. The target phosphodiester bonds are staggered (not d i rectly across from each other) in the two D NA strands. @ The transposon is now linked to the target DNA. I n direct transposition (left), replication fi l ls in gaps at each end to complete the process. I n replicative transposition (right), the entire transposon is replicated to create a cointegrate i ntermedi ate. @) The cointegrate is often resolved later, with the aid of a separate site-specific recombi nation system. The cleaved host DNA left behind after direct transposition is either repai red by DNA end-join i ng or de graded (not shown). The latter outcome can be lethal to an organism. ple) and replicative.
@
Site-specific recombination (within transposon)
l
25.3 DNA Recombination
of two heavy and two light polypeptide chains (see Fig. 5-2 1 ) . Each chain has two regions, a variable region, with a sequence that differs greatly from one immunoglobulin to another, and a region that is virtually constant within a class of immunoglobulins. There are also two distinct families of light chains, kappa and lambda, which differ somewhat in the sequences of their constant regions. For all three types of polypeptide chain (heavy chain, and kappa and lambda light chains) , diversity in the variable regions is generated by a similar mechanism. The genes for these polypeptides are divided into segments, and the genome contains clusters with multiple versions of each segment. The joining of one version of each gene segment creates a complete gene. Figure 2 5-46 depicts the organization of the DNA encoding the kappa light chains of human IgG and shows how a mature kappa light chain is generated. In undifferentiated cells, the coding information for this polypeptide chain is separated into three segments. The V (variable) segment encodes the first 95 amino acid residues of the variable region, the J (joining) segment encodes the remaining 1 2 residues of the variable region, and the C segment encodes the constant region.
V segments ( 1 to -300)
J segments
=
=
}
C segment C
01
The genome contains -300 different V segments, 4 dif ferent J segments, and 1 C segment. As a stem cell in the bone marrow differentiates to form a mature B lymphocyte, one V segment and one J segment are brought together by a specialized recombi nation system (Fig. 25-46) . During this programmed DNA deletion, the intervening DNA is discarded. There are about 300 X 4 1 ,2 00 possible V-J combinations. The recombination process is not as precise as the site specific recombination described earlier, so additional variation occurs in the sequence at the V-J junction. This increases the overall variation by a factor of at least 2.5, so the cells can generate about 2 . 5 X 1 ,2 00 3 ,000 different V-J combinations. The final joining of the V-J combination to the C region is accomplished by an RNA splicing reaction after transcription, a process described in Chapter 26. The recombination mechanism for joining the V and J segments is illustrated in Figure 25-4 7. Just beyond each V segment and just before each J segment lie recom bination signal sequences (RSS) . These are bound by proteins called RAG 1 and RAG2 (products of the recom bination activating gene) . The RAG proteins catalyze the
�
- - {Yi]-L��HJ�-� ��r@:4)Jl�fu�-
G �
- -
g�:
-linc
recombination resulting in deletion of DNA between
V and J segments
Mature light chain gene �
- - {_\'LH v2 ��s�t.J�±f{��-c
i- -· -
���� hocytc
transcription
Primary transcript
Processed mRNA lrnnslation
FIGURE 25-46 Recombination of the V and I
gene segments of the human lgG kappa light Light-chain polypeptide Variable region protein folding and assembly
Constant region
chain. This process is designed to generate anti body diversity. At the top is shown the arrange ment of lgG-coding sequences in a stem cel l of the bone marrow. Recombi nation deletes the DNA between a particular V segment and a J segment. After transcription, the transcript is processed by RNA spl ici ng, as described i n Chapter 26; translation produces the l ight-chain polypeptide. The l ight chain can combine with any of 5,000 possible heavy chains to produce an antibody molecule.
1016
DNA Metabolism
sequence structure found in most transposons. In the test tube,
RAG 1 and RAG2 can associate with this deleted DNA and insert it, transposonlike, into other DNA mole
V segment
cules (probably a rare reaction in B lymphocytes) . Al
J segment
though we cannot know for certain, the properties of the dcavuge
I \1 I
immunoglobulin gene rearrangement system suggest an
I{ \ . :2
intriguing origin in which the distinction between host and parasite has become blurred by evolution.
�----------M-��---------�
D N A Reco m b i n a t i o n
S U M M A RY 2 5 . 3 •
intramolecular
transesterification
DNA sequences are rearranged in recombination reactions, usually in processes tightly coordinated with
•
� �--
DNA replication or repair.
Homologous genetic recombination can take place between any two
DNA molecules that share
sequence homology. In meiosis (in eukaryotes) , this type of recombination helps to ensure accurate
double-strand
chromosomal segregation and create genetic
break repair
diversity. In both bacteria and eukaryotes it
via end-joining
serves in the repair of stalled replication forks.
A Holliday intermediate forms during homologous recombination. v
FIGURE 25-47
•
J
Mechanism of immunoglobulin gene rearrangement
The RAG l and RAG2 proteins bind to the recombination signal se quences (RSS) and cleave one DNA strand between the RSS and the V (or J) segments to be joined. The liberated 3 ' hydroxyl then acts as a nucleophile, attacking a phosphodiester bond in the other strand to cre ate a double-strand break. The resulting hairpin bends on theV and J seg ments are cleaved, and the ends are covalently l inked by a complex of proteins specialized for end-joining repair of double-strand breaks. The steps in the generation of the double-strand break catalyzed by RAG l and RAG2 are chemically related to steps in transposition reactions.
Site-specific recombination occurs only at specific target sequences, and this process can also involve a Holliday intermediate. Recombinases cleave the
DNA at specific points and ligate the strands to new partners. This type of recombination is found in virtually all cells, and its many functions include
DNA integration and regulation of gene expression. •
In virtually all cells, transposons use recombination to move within or between chromosomes. In vertebrates, a programmed recombination reaction related to transposition joins immunoglobulin gene segments to form immunoglobulin genes during
formation of a double-strand break between the signal
B-lymphocyte differentiation.
sequences and the V (or J) segments to be joined. The V and
J
segments are then joined with the aid of a second
complex of proteins. The genes for the heavy chains and the lambda light
Key Terms
chains form by similar processes. Heavy chains have more
Terms in bold are defined in the glossary_
gene segments than light chains, with more than 5,000
template
sequences during B-lymphocyte differentiation. Each
leading strand
Okazaki fragments 979 979
981 DNA polymerase III 982 replisome 984 helicases 984 topoisomerases 984 primases 984 DNA ligases 984
mature B lymphocyte produces only one type of antibody,
DNA unwinding element (DUE) 985 AAA + ATPases 985 primosome 987 catenanes 991 pre-replicative complex
possible combinations. Because any heavy chain can
977 semiconservative
combine with any light chain to generate an immunoglob 7 ulin, each human has at least 3 , 000 x 5,000 1 .5 x 1 0
replication fork
=
possible IgGs. And additional diversity is generated by high mutation rates (of unknown mechanism) in the
V
977
replication origin
proofreading
978
978
double-strand breaks by RAG 1 and RAG2 does mirror
979 979 exonuclease 979 endonuclease 979 DNA polymerase I 979 primer 980
several reaction steps in transposition (Fig. 25-4 7) . In
primer terminus
addition, the deleted
processivity
but the range of antibodies produced by the B lympho cytes of an individual organism is clearly enormous. Did the immune system evolve in part from ancient transposons? The mechanism for generation of the
DNA, with its terminal RSS, has a
lagging strand nucleases
980
980
(pre-RC) 991 licensing 991
Further Reading
minichromosome
homologous genetic
maintenance (MCM) proteins
recombination
991
site-specific
ORC (origin recognition complex)
recombination
991
DNA polymerase
DNA transposition
a
992 992 992
DNA polymerase B DNA polymerase
e
repair meiosis
993 base-excision repair 996 DNA glycosylases 996 AP site 996 DNA photolyases
1005 double-strand break repair model 1 006
1 00 1 1001
O'Donnell, M. (2006) Replisome architecture and dynamics in
Escherichia coli. J Biol. Chem. 281, 10,653-10,656. An excellent summary of what goes on at a replication fork. Stillman, B. (2005) Origin recognition and the chromosome cycle.
FEES Lett. 579, 877-884. Good summary of the initiation of eukaryotic DNA replication.
DNA Repair Begley, T.J. & Samson, L.D. (2003) AlkB mystery solved: oxidative demethylation of N 1 -methyladenine and N3-methylcytosine adducts by a direct reversal mechanism.
Trends Biochem. Sci. 28, 2-5.
Erzberger, J.P. & Berger, J.M. (2006) Evolutionary relationships
Holliday
and structural mechanisms of
1 006 transposons 1 0 1 3 transposition 1 0 1 3 insertion sequence 1 0 1 3 cointegrate 1 0 1 4
Biomol. Struct. 35, 93-114.
intermediate
error-prone translesion DNA synthesis
1 004 1 004
branch migration
997 998
AP endonucleases
1 004 1 004
01
recombinational DNA
mutation
S O S response
1 003
G �
AAA + proteins . Annu Rev Biophys.
Friedberg, E.C., Fischhaber, P.L., & Kisker, C. (2001) Error-prone DNA polymerases: novel structures and the benefits of infidelity.
Cell
107, 9-12 Goodman, M.F. (2002) Error-prone repair DNA polymerases in prokaryotes and eukaryotes. Annu.
Rev Biochem. 71, 1 7-50.
Review of a class of DNA polymerases that continues to grow.
Kunkel, T.A. & Erie, D.A. (2005) DNA mismatch repair. Annu. Rev. Biochem 74, 68 1-710.
Further Reading
Lindahl, T. & Wood, R.D. (1999) Quality control by DNA repair. Science 286, 1897-1905.
Genend Friedberg, E.C., Walker, G.C., Siede, W., Wood, R.D., Schultz, R.A., & Ellenberger, T. (2006) DNA Repair and Mutagenesis, 2nd edn, American Society for Microbiology, Washington, DC. A thorough treatment of DNA metabolism and a good place to
Marnett, L.J. & Plastaras, J.P. (2001) Endogenous DNA damage and mutation. Trends
Genet. 17, 214-221.
Sancar, A. (1996) DNA excision repair. Annu Rev Biochem 65, 43-8 1 .
start exploring this field.
Sutton, M.D., Smith, B.T., Godoy, V.G., & Walker, G.C. (2000)
Kornberg, A. & Baker, T.A. (1991) DNA Replication, 2nd edn,
The SOS response: recent insights into umuDC-dependent mutagen
W. H Freeman and Company, New York. Excellent primary source for all aspects of DNA metabolism.
Rev Genet. 34, 4 79-497.
excision repair, and its relation to aging and disease. DNA
DNA Replication
Repair 6,
544-559.
Benkovic, S.J., Valentine, A.M., & Salinas, F. (2001) R eplisome mediated DNA replication
esis and DNA damage toleranc e . Annu.
Wilson, D.M. III & Bohr, V.A. (2007) The mechanics of base
Annu Rev. Biochem. 70, 18 1-208.
This review describes the similar strategies and enzymes of DNA replication in different classes of organisms.
Wood, R.D., Mitchell, M., Sgouros, J., & Lindahl, T. (2001) Human DNA repair genes.
Science 291, 1284-1289 .
What an early look at the human genome revealed about DNA repair.
Bloom, L.B. (2006) Dynamics of loading the Escherichia coli DNA polymerase processivity clamp
Grit Rev. Biochem Mol Biol. 41,
1 79-208.
Frick, D.N. & Richardson, C.C. (2001) DNA primases. Annu. Rev.
Biochem 70, 39-80.
DNA Recombination Cox, M.M. (2001) Historical overview: searching for replication help in all of the rec places. Proc.
Natl. Acad. Sci USA 98, 8173-8180.
A review of how recombination was shown to be a replication
Heller, R.C. & Marians, K.J. (2006) Replisome assembly and the
fork repair process.
direct restart of stalled replication forks.
Cox, M.M. (2007) R egulation of bacterial RecA protein function.
Nat Rev. Mol Celt Biol. 7,
932-943. Mechanisms for the restart of replication forks before the repair of DNA damage.
Hiibscher, U., Maga, G., & Spadari, S. (2002) Eukaryotic DNA polymerases . Annu.
Rev Biochem 71, 133- 1 63.
Good summary of the properties and roles of the more than one dozen known eukaryotic DNA polymerases.
Rev. Mol. Cell
253-254.
Gellert, M. (2002) V(D)J recombination: RAG proteins, repair factors, and regulation . Annu
Rev. Biochem 71, 101-132.
nisms of site-specific recombination. Annu.
Rev. Biochem. 75,
567-605.
Hallet, B. & Sherratt, D.J. (1997) Transposition and site-specific
Biol. 7, 751- 76 1 . Kamada, K., Horiuchi, T., Ohsnmi, K., Shimamoto, N., & Morikawa, K. (1996) Structure of a replication-tenninator protein complexed with DNA. Nature
383, 598-603.
The report revealing the structure of the Tus-Ter complex
Kool, E.T. (2002) Active site tightness and substrate fit in DNA replication . Annu
Craig, N.L. (1995) Unity in transposition reactions. Science 270,
Grindley, N.D.F., Whiteson, K.L., & Rice, P.A. (2006) Mecha
lndiani, C. & O'Donnell, M. (2006) The replication clamp-loading machine at work in the three domains of life. Nat
Grit. Rev Biochem. Mol. Biol. 42, 41-63.
Rev Biochem 71, 191-219.
Excellent sununary of the molecular basis of replication fidelity by a DNA polymerase-base-pair geometry as well as hydrogen bonding.
recombination: adapting DNA cut-and-paste mechanisms to a variety of genetic rearrangements.
FEMS Microbial. Rev. 21, 157-1 78 .
Haniford, D.B. (2006) Transpososome dynamics and regulation in Tn10 transposition.
Grit Rev. Biochem Mol Biol. 41, 407-424.
A detailed look at one well-studied bacterial transposon.
Lusetti, S.L. & Cox, M.M. (2002) The bacterial RecA protein and the recombinational DNA repair of stalled replication forks. Annu
Rev. Biochem. 71, 7 1-100.
� 01 �
DNA Metabolism
Paques, F. & Haber, J.E. (1 999) Multiple pathways of recombina
tion induced by double-strand breaks in Saccharomyces cerevisiae
Microbial. Mol Biol Rev. 63, 349-404.
Singleton, M.R., Dillingham, M.S., Gaudier, M., Kowal czykowski, S.C., & Wigley, D.B. (2004) C1ystal structure of
RecBCD enzyme reveals a machine for processing DNA breaks.
Nature 432, 187-193. Van Duyne, G.D. (200 1 ) A structural view of Cre-loxP site-specific
recombination. Annu Rev Biophys Biomol Struct. 30, 87-104 A nice structural analysis of a site-specific recombination system
(a) If any one of the four nucleotide precursors were omit ted from the incubation mixture, would radioactivity be found in the precipitate? Explain. (b) Would 3 2P be incorporated into the DNA if only dTTP were labeled? Explain.
(c) Would radioactivity be found in the precipitate if 3 2P
labeled the {3 or y phosphate rather than the the deoxyribonucleotides? Explain.
a
phosphate of
6. The Chemistry of DNA Replication All DNA poly
merases synthesize new DNA strands in the 5'�3' direction. In some respects, replication of the antiparallel strands of du
Problems
plex DNA would be simpler if there were also a second type of polymerase , one that synthesized DNA in the 3' �5 ' direction.
1 . Conclusions from the Meselson-Stahl Experiment
The Meselson-Stahl experiment (see Fig. 25-2) proved that
The two types of polymerase could, in principle, coordinate DNA synthesis without the complicated mechanics required
DNA undergoes semiconservative replication in E. coli. In the
for lagging strand replication. However, no such 3 '�5'
strands are cleaved into pieces of random size, then joined
mechanisms for 3 '�5' DNA synthesis. Pyrophosphate should
"dispersive" model of DNA replication, the parent DNA with pieces of newly replicated DNA to yield daughter du plexes. Explain how the results of Meselson and Stahl's exper iment ruled out such a model. of E. coli growing in a medium containing 1 5NH Cl is switched 4 to a medium containing 1 4NH4Cl for three generations (an eightfold increase in population) . What is the molar ratio of hy
brid DNA (5N- 1 4N) to light DNA (4N-14N) at this point?
3. Replication of the E. coli Chromosome The E coli
chromosome contains 4,639,221 bp.
(a) How many turns of the double helix must be unwound during replication of the E. coli chromosome?
(b) From the data in this chapter, how long would it take
to replicate the E. coli chromosome at 37 oc if two replication
forks proceeded from the origin? Assume replication occurs at a rate of 1 ,000 bp/s. Under some conditions E. coli cells can di
vide every 20 min. How might this be possible?
(c) In the replication of the E. coli chromosome, about
how many Okazaki fragments would be formed? What factors guarantee that the numerous Okazaki fragments are assem bled in the correct order in the new DNA? Composition of DNAs
be one product of both proposed reactions. Could one or both mechanisms be supported in a cell? Why or why not? (Hint: You may suggest the use of DNA precursors not actually pres
2. Heavy Isotope Analysis of DNA Replication A culture
4. Base
synthesizing enzyme has been found. Suggest two possible
Made
ent in extant cells.) 7. Leading and Lagging Strands Prepare a table that lists
the names and compares the functions of the precursors, en
zymes, and other proteins needed to make the leading strand versus the lagging strand during DNA replication in E. coli. 8. Function of DNA Ligase Some E. coli mutants contain
defective DNA ligase. When these mutants are exposed to 3 H
labeled thymine and the DNA produced is sedimented on an alkaline sucrose density gradient, two radioactive bands ap pear. One corresponds to a high molecular weight fraction, the other to a low molecular weight fraction. Explain. 9. Fidelity of Replication of DNA What factors promote
the fidelity of replication during synthesis of the leading strand of DNA? Would you expect the lagging strand to be made with the same fidelity? Give reasons for your answers. 10. Importance of DNA Topoisomerases in DNA Repli cation DNA unwinding, such as that occurring in replication,
from Single
affects the superhelical density of DNA. In the absence of
Stranded Templates Predict the base composition of the to
topoisomerases, the DNA would become overwound ahead of
tal DNA synthesized by DNA polymerase on templates
a replication fork as the DNA is unwound behind it. A bacter
provided by an equimolar mixture of the two complementary strands of bacteriophage ¢X1 74 DNA (a circular DNA mole
ial replication fork will stall when the superhelical density (a)
of the DNA ahead of the fork reaches + 0 . 1 4 (see Chapter 24) .
cule) . The base composition of one strand is A, 24. 7% ; G,
Bidirectional replication is initiated at the origin of a 6,000
24. 1 % ; C, 18.5%; and T, 32.7% . What assumption is necessaJy to answer this problem?
bp plasmid in vitro, in the absence of topoisomerases. The
5. DNA Replication Kornberg and his colleagues incubated
soluble extracts of E. coli with a mixture of dATP, dTTP, dGTP, and dCTP, all labeled with 32P in the a-phosphate group. After a time, the incubation mixture was treated with trichloroacetic acid, which precipitates the DNA but not the nucleotide precursors. The precipitate was collected, and the extent of precursor incorporation into DNA was determined from the amount of radioactivity present in the precipitate.
plasmid initially has a a of -0.06. How many base pairs will be
unwound and replicated by each replication fork before the forks stall? Assume that each fork travels at the same rate and
that each includes all components necessary for elongation ex cept topoisomerase. 1 1 . The Ames Test In a nutrient medium that lacks histi
cline,
a
thin layer of agar containing - 1 09 Salmonella ty
phimurium histidine auxotrophs (mutant cells that require
histidine to survive) produces - 1 3 colonies over a two-day
Problems
� 01 �
incubation period at 37 oc (see Fig. 25-2 1 ) . How do these
Data Ana lysis Problem
repeated in the presence of 0.4 p,g of 2-aminoanthracene. The
1 6 . Mutagenesis in Escherichia coli Many mutagenic
colonies arise in the absence of histidine? The experiment is number of colonies produced over two days exceeds 10,000.
compounds act by alkylating the bases in DNA. The alkylating
What does this indicate about 2-aminoanthracene? What can
agent R7000 (7-methoxy-2-nitronaptho[2, 1 -b ]furan) is an
you surmise about its carcinogenicity?
extremely potent mutagen.
CH3
1 2 . DNA Repair Mechanisms Vertebrate and plant cells
n _ 1 1JJ-No,
often methylate cytosine in DNA to form 5-methylcytosine (see Fig. 8-5a) . In these same cells, a specialized repair sys tem recognizes G-T mismatches and repairs them to o-c
base pairs. How might this repair system be advantageous to
the cell? (Explain in terms of the presence of 5-methylcytosine
R7000
in the DNA.) .. .
13. DNA Repair in People with Xeroderma Pig mentosum The condition known as xeroderma pig-
mentosum (XP) arises from mutations in at least seven different human genes (see Box 25-1 ) . The deficiencies are generally in genes encoding enzymes involved in some part of the pathway for human nucleotide-excision repair. The vari ous types of XP are denoted A through G (XPA, XPB, etc.) , with a few additional variants lumped under the label XP-V. Cultures of fibroblasts from healthy individuals and from patients with XPG are irradiated with ultraviolet light. The DNA is isolated and denatured, and the resulting single-stranded DNA is characterized by analytical ultracentrifugation. (a) Samples from the normal fibroblasts show a significant reduction in the average molecular weight of the single stranded DNA after irradiation, but samples from the XPG fi broblasts show no such reduction. Why might this be? (b) If you assume that a nucleotide-excision repair system is operative in fibroblasts, which step might be defective in the cells from the patients with XPG? Explain. 14. Holliday Intermediates How does the formation of
Holliday intermediates in homologous genetic recombination differ from their formation in site-specific recombination? 15. A Connection between Replication and Site-Specific Recombination Most wild strains of Saccharomyces cere v·isiae have multiple copies of the circular plasmid 2p, (named for its contour length of about 2 p,m) , which has �6,300 bp of DNA. For its replication the plasmid uses the host replication system, under the same strict control as the host cell chromo somes, replicating only once per cell cycle. Replication of the
plasmid is bidirectional, with both replication forks initiating at a single, well-defined origin. However, one replication cycle of a 2p, plasmid can result in more than two copies of the plas
In vivo, R7000 is activated by the enzyme nitroreductase, and this more reactive form covalently attaches to DNA-primarily, but not exclusively, to G-C base pairs. In a 1 996 study, Quillardet, Touati, and Hofnung explored the mechanisms by which R7000 causes mutations in E. coli.
They compared the genotoxic activity of R7000 in two strains of E. coli: the wild-type (uvr+) and mutants lacking uvrA ac
tivity (uvr- ; see Table 25-6) . They first measured rates of mu tagenesis. Rifampicin is an inhibitor of RNA polymerase (see Chapter 26) . In its presence, cells will not grow unless certain mutations occur in the gene encoding RNA polymerase; the appearance of rifampicin-resistant colonies thus provides a useful measure of mutagenesis rates. The effects of different concentrations of R7000 were de termined, with the results shown in the graph below. "'0
.g
1l 1,000 �----, 0, rn
8
§
100
] §
""
.� 00
10
� � ·c ·a s
.ci iU (l::.ndi !G A ··Ci tc u Gl la· A ; (j:J ii�J::tJ:!:�H:Q':im�·:: :O� !�::; :�::r:::Uj - - - 3 ' .
Reading frame 2
- - -]) Ju C uJJc G Gj[EJ;:=-::_g] Ju G G//A G A//u U C//A C A/ /G
Reading frame 3
- - - U U[[C U C[[G G A[ [C C u[JG G A[ [G A u[ [U C A[ [C A G[ [![ - - -
U ---
FIGURE 27-5 Reading frames in the genetic code. I n a triplet, nonoverlapping code, a l l m R NAs have three potentia l reading frames, shaded here in different colors. The triplets, and hence the amino acids specified, are different in each reading frame.
nucleotide triplets are read in a successive, nonoverlap ping fashion. A specific first codon in the sequence es tablishes the reading frame, in which a new codon begins every three nucleotide residues. There is no punctuation between codons for successive amino acid residues. The amino acid sequence of a protein is de fined by a linear sequence of contiguous triplets. In prin ciple, any given single-stranded DNA or mRNA sequence has three possible reading frames. Each read ing frame gives a different sequence of codons ( Fig. 2 7-5 ), but only one is likely to encode a given protein. A key question remained: what were the three-letter code words for each amino acid? In 196 1 Marshall Niren berg and Heinrich Matthaei reported the first break through. They incubated syn thetic polyuridylate, poly(U) , with an E. coli extract, GTP, ATP, and a mixture of the 20 amino acids in 20 different tubes, each tube containing a different radioactively labeled amino acid. Because poly(U) mRNA is made up of many suc Marshall N i renberg cessive UUU triplets, it should promote the synthesis of a polypeptide containing only the amino acid encoded by the triplet UUU. A radioactive polypeptide was indeed formed in only one of the 20 tubes, the one containing radioactive phenylalanine . Nirenberg and Matthaei therefore concluded that the triplet codon UUU encodes
phenylalanine . The same approach soon revealed that polycytidylate, poly(C) , encodes a polypeptide contain ing only proline (polyproline) , and polyadenylate, poly(A) , encodes polylysine. Polyguanylate did not gen erate any polypeptide in this experiment because it spontaneously forms tetraplexes (see Fig. 8-20) that cannot be bound by ribosomes. The synthetic polynucleotides used in such experi ments were prepared with polynucleotide phosphory lase (p. 1 049) , which catalyzes the formation of RNA polymers starting from ADP, UDP, CDP, and GDP. This enzyme, discovered by Severo Ochoa, requires no template and makes polymers with a base composition that directly reflects the relative concentrations of the nucleoside 5 ' -diphosphate precursors in the medium. If polynucleotide phosphorylase is presented with UDP only, it makes only poly(U) . If it is presented with a mixture of five parts ADP and one part CDP, it makes a polymer in which about five-sixths of the residues are adenylate and one-sixth are cytidylate. This ran dom polymer is likely to have many triplets of the se quence AAA, smaller numbers of AAC, ACA, and CAA triplets, relatively few ACC, CCA, and CAC triplets , and very few CCC triplets (Table 27- 1 ) . Using a vari ety of artificial mRNAs made by polynucleotide phos phorylase from different starting mixtures of ADP, GDP, UDP, and CDP, the Nirenberg and Ochoa groups soon identified the base compositions of the triplets coding for almost all the amino acids. Although these experiments revealed the base composition of the coding triplets, they usually could not reveal the se quence of the bases.
� 06�
Protein Metabolism
TABLE 2 7- 1
Incorporation of Amino Adds into Polypeptides in Response to Random Polymers of RNA Observed frequency of incorporation (Lys = 100)
Amino acid
Tentative assignment for nucleotide composition of corresponding codon*
Expected frequency of incorporation based on assignment (Lys = 100)
Asparagine
24
A2 C
20
Glutamine
24
A2C
20
6
AC 2
4
100
AAA
1 00
Histidine Lysine Proline Threonine
7
AC 2 , CCC
26
A2 C, AC 2
4.8 24
Note: Presented here is a summary of data from one of the early experiments designed to elucidate the genetic code. A synthetic RNA 5:1 ratio directed polypeptide synthesis, and both the identity and the quantity of incorporated
containing only A and C residues in a
amino acids were determined. Based on the relative abundance of A and C residues in the synthetic RNA, and assigning the codon AAA (the most likely codon) a frequency of 100, there should be three different codons of composition A2C, each at a relative frequency of 20; three of composition AC2, each at a relative frequency of 4.0; and CCC at a relative frequency of 0.8. The CCC assignment was based on information derived from prior studies with poly( C). Where two tentative codon assignments a re made, both are proposed to code for the same amino acid. *These designations of nucleotide composition contain no information on nucleotide sequence (except, of course, AAA and CCC).
KEY CONVENT I O N : Much of the following discussion deals
chemically synthesized small oligonucleotides. With this
with tRNAs . The amino acid specified by a tRNA is indi
technique researchers determined which aminoacyl
cated by a superscript, such as tRNAA1a, and the amino
tRNA bound to
acylated tRNA by a hyphenated name: alanyl-tRNAAJa or
some codons, either no aminoacyl-tRNA or more than
Ala-tRNAAJa. •
one would bind. Another method was needed to com
In
1 964
54
of the
64 possible
plete and confirm the entire genetic code.
Nirenberg and Philip Leder achieved an
other experimental breakthrough. Isolated
E. coli ribo
At about this time , a com plementary approach was pro
somes would bind a specific aminoacyl-tRNA in the
vided by
presence of the corresponding synthetic polynucleotide
who developed chemical meth
H.
Gobind Khorana,
messenger. For example, ribosomes incubated with
ods to synthesize polyribonu
poly(U) and phenylalanyl-tRNAPhe (Phe-tRNAPhe) bind
cleotides with defined, repeating
both RNAs, but if the ribosomes are incubated with
sequences of two to four bases.
poly(U) and some other aminoacyl-tRNA, the aminoacyl
The polypeptides produced by
tRNA is not bound, because it does not recognize the
these mRNAs had one or a few
UUU triplets in poly(U)
amino acids in repeating pat
(Table
2 7-2) .
Even trinu
cleotides could promote specific binding of appropriate
terns.
tRNAs , so these experiments could be carried out with
combined with information from
These
patterns,
when
the random polymers used by
TABLE 2 7- 2
triplet codons. For
Trinudeotides That Induce Specific Binding of Aminoacyl-tRNAs to Ribosomes
Relative increase in 14C-labeled aminoacyl-tRNA bound to ribosome*
Trinucleotide Phe-tRNAPhe Lys..tRNALys Pro-tRNAPro uuu
4.6
0
0
AAA
0
7.7
0
CCC
0
0
3.1
Source: Modified from N i renberg, M. synthesis. Science 145, 1399.
& Leder, P. ( 1964) RNA code words and protein
14 *Each number represents the factor by which the amount of bound C increased when the indicated trinucleotide was present, relative to a control with no trinucleotide
H . Gobi nd Khorana
Nirenberg and colleagues, permitted unambiguous codon assignments. The copolymer (AC)n, for example, has alter nating ACA and CAC codons: ACACACACACACACA. The polypeptide synthesized on this messenger contained equal amounts of threonine and histidine. Given codon has one A and two Cs (Table
27-1) ,
that a histidine
CAC must code
for histidine and ACA for threonine. Consolidation of the results from many experi ments permitted the assignment of 61 of the
64 possible
codons. The other three were identified as termination codons, in part because they disrupted amino acid coding patterns when they occurred in a synthetic RNA polymer
(Fig. 2 7-6). Meanings for all the triplet Fig. 2 7-7) were established by
codons (tabulated in
1 966
and have been verified in many different ways.
27.1 The Genetic Code
Reading frame 1
- - -j:�i'ij':t;,tA:li�::r:�.: ·'lli:J jA,::·�:::�j jU
5'
A
Aj j�:::�i::j:[lj l�i:;];�:!::;:fij'j A A - -
Reading frame 2
- - - G jlJ A A ljG U AjjA G UjjA A G j jp
Reading frame 3
n -
G
u
IA A GIIu A A II G
u
A II A G
u
A
[2 06�
3'
A j jG U A l A - - -
I I A A G I Iu A A 1 - - -
FIGURE 2 7-6 Effect of a termination codon in a repeating tetranucleotide. Termi nation codons (pi nk) are encountered every fourth codon in three different reading frames (shown in different colors) . Dipeptides or tripeptides are synthesized, depending on where the ribosome in itially binds. The cracking of the genetic code is regarded as one of the most important scientific discoveries of the twenti eth century. Codons are the key to the translation of genetic in formation, directing the synthesis of specific proteins. The reading frame is set when translation of an mRNA molecule begins, and it is maintained as the synthetic machinery reads sequentially from one triplet to the next. If the initial reading frame is off by one or two bases, or if translation somehow skips a nucleotide in the mRNA, all the subsequent codons will be out of reg ister; the result is usually a "missense" protein with a garbled amino acid sequence. Several codons serve special functions (Fig. 27-7) . The initiation codon AUG is the most common signal for the beginning of a polypeptide in all cells, in addition to coding for Met residues in internal positions of
!
First letter of codon (5' end)
u
c
A
G
Second letter of codon
A
c
u
G
uuu uuc
Phe Phe
ucu ucc
Ser Ser
UAU UAC
Tyr Tyr
UGU UGC
Cys Cys
UUA UUG
Leu Leu
UCA UCG
Ser Ser
UAA UAG
Stop Stop
UGA UGG
Stop Trp
cuu cue
Leu Leu
ccu
CCC
Pro Pro
CAU CAC
His His
CGU CGC
Arg Arg
CUA CUG
Leu Leu
CCA CCG
Pro Pro
CAA CAG
Gin CGA Gin CGG
Arg Arg
AUU AUC
Ile Ile
ACU ACC
Thr Thr
AAU AAC
Asn Asn
AGU AGC
Ser Ser
AUA AUG
Ile Met
ACA ACG
Thr Thr
AAA AAG
Lys Lys
AGA AGG
Arg Arg
GUU GUC
Val Val
GCU GCC
Ala Ala
GAU GAC
Asp
Asp GGU GGC
Gly
GUA GUG
Val Val
GCA GCG
Ala Ala
GAA GAG
Glu GGA Glu GGG
Gly Gly
Gly
F I G U R E 2 7 - 7 "Dictionary" of amino acid code words in mRNAs. The codons are written in the 5 ' --1 3 ' d i rection. The third base of each codon (in bold type) plays a lesser role in specifying an amino acid than the first two. The three termination codons are shaded i n pink, the i n itiation codon AUG in green. All the amino acids except methionine and tryptophan have more than one codon. In most cases, codons that specify the same amino acid differ only at the third base.
polypeptides. The termination codons (UAA, UAG, and UGA) , also called stop codons or nonsense codons, normally signal the end of polypeptide synthesis and do not code for any known amino acids. Some deviations from these rules are discussed in Box 27-1 . As described in Section 27.2, initiation of protein synthesis in the cell is an elaborate process that relies on initiation co dons and other signals in the mRNA In retro spect, the experiments of Nirenberg, Khorana, and oth ers to identify codon function should not have worked in the absence of initiation codons. Serendipitously, exper imental conditions caused the normal initiation require ments for protein synthesis to be relaxed. Diligence combined with chance to produce a breakthrough-a common occurrence in the history of biochemistry. In a random sequence of nucleotides, 1 in every 20 codons in each reading frame is, on average , a termina tion codon. In general, a reading frame without a termi nation codon among 50 or more codons is referred to as an open reading frame (ORF ) . Long open reading frames usually correspond to genes that encode pro teins. In the analysis of sequence databases, sophisti cated programs are used to search for open reading frames in order to find genes among the often huge background of nongenic DNA An uninterrupted gene coding for a typical protein with a molecular weight of 60,000 would require an open reading frame with 500 or more codons. A striking feature of the genetic code is that an amino acid may be specified by more than one codon, so the code is described as degenerate. This does not sug gest that the code is flawed: although an amino acid may have two or more codons, each codon specifies only one amino acid. The degeneracy of the code is not uniform. Whereas methionine and tryptophan have single codons, for example, three amino acids (Arg, Leu, Ser) have six codons, five amino acids have four, isoleucine has three, and nine amino acids have two (Table 27-3) . The genetic code is nearly universaL With the in triguing exception of a few minor variations in mitochon dria, some bacteria, and some single-celled eukaryotes (Box 2 7-1) , amino acid codons are identical in all species examined so far. Human beings, E. coli, tobacco plants, amphibians, and viruses share the same genetic code. Thus it would appear that all life forms have a common evolutionary ancestor, whose genetic code has been pre served throughout biological evolution. Even the varia tions reinforce this theme.
� 07�
Protein Metabolism
B O X 2 7-1 In biochemistry, as in other disciplines, exceptions to
encodes only 10 to 20 proteins. Mitochondria have their own
general rules can be problematic for instructors and
tRNAs, so their code variations do not affect the much larger
frustrating for students. At the same time, though, they
cellular genome. The most common changes in mitochon
teach us that life is complex and inspire us to search for
dria (and the only code changes that have been observed in
more surprises. Understanding the exceptions can even
cellular genomes) involve termination codons. These
reinforce the original rule in surprising ways.
changes affect termination in the products of only a subset
One would expect little room for variation in the ge netic code. Even a single amino acid substitution can have
of genes, and sometimes the effects are minor because the genes have multiple (redundant) termination codons. Vertebrate mtDNAs have genes that encode
profoundly deleterious effects on the structure of a pro tein. Nevertheless, variations in the code do occur in some
teins ,
13 pro 2 rRNAs, and 22 tRNAs (see Fig. 1 9-38) . The
organisms, and they are both interesting and instructive.
small number of codon reassignments, along with an un
The types of variation and their rarity provide powerful ev
usual set of wobble rules (p.
idence for a common evolutionary origin of all living things.
sufficient to decode the protein genes, as opposed to the
1 072) , makes the 22 tRNAs
To alter the code, changes must occur in the
32 tRNAs required for the normal code. In mitochon
gene(s) encoding one or more tRNAs, with the obvious
dria, these changes can be viewed as a kind of genomic
target for alteration being the anticodon. Such a change
streamlining, as a smaller genome confers a replication
would lead to the systematic insertion of an amino acid
advantage on the organelle. Four codon families (in
at a codon that, according to the normal code (see
which the amino acid is determined entirely by the first
Fig.
27-7) , does not specify that amino acid. The genetic code, in effect, is defined by two elements: (1) the anti
two nucleotides) are decoded by a single tRNA with a U
codons on tRNAs (which determine where an amino acid
codon. Either the U pairs somehow with any of the four
is placed in a growing polypeptide) and
possible bases in the third position of the codon or a
(2) the specificity
residue in the first (or wobble) position in the anti
of the enzymes-the aminoacyl-tRNA synthetases-that
"two out of three" mechanism is used-that is, no base
charge the tRNAs , which determines the identity of the
pairing is needed at the third position. Other tRNAs rec
amino acid attached to a given tRNA.
ognize codons with either A or G in the third position,
Most sudden changes in the code would have cata strophic effects on cellular proteins, so code alterations
and yet others recognize U or C, so that virtually all the tRNAs recognize either two or four codons.
are more likely to persist where relatively few proteins
In the normal code, only two amino acids are specified
would be affected-such as in small genomes encoding
by single codons: methionine and tryptophan (see Table
only a few proteins. The biological consequences of a
27 -3). If all mitochondrial tRNAs recognize two codons, we
code change could also be limited by restricting changes
would expect additional Met and Trp codons in mitochon
to the three termination codons, which do not generally
dria. And we find that the single most common code varia
occur within genes (see Box
27-4 for exceptions to this
rule) . This pattern is in fact observed.
tion is the normal termination codon UGA specifying tryptophan. The tRNATrp recognizes and inserts a Trp
Of the very few variations in the genetic code that we
residue at either UGA or the normal Trp codon, UGG. The
know of, most occur in mitochondrial DNA (mtDNA) , which
second most common variation is conversion of AUA from
TABLE 2 7 -3 Amino acid
Number of codons
Met
1
Trp
1
Amino acid Tyr
Number of codons 2
Ile
3
Wobble Allows Some tRNAs to Recognize More than One Codon
When several different codons specify one amino acid, the difference between them usually lies at the third base position (at the
3 ' end) . For example , alanine is
XY� XYg. The first two letters of each codon are the pri
coded by the triplets GCU, GCC, GCA, and GCG. The
Asn
2
Ala
4
codons for most amino acids can be symbolized by
Asp
2
Gly
4
or
Cys
2
Pro
4
Gln
2
Thr
4
Glu
2
Val
4
His
2
Arg
6
Lys
2
Leu
6
direction) pairs with the third base of the anticodon
Phe
2
Ser
6
(Fig. 2 7-Sa). If the anticodon triplet of a tRNA recog
mary determinants of specificity, a feature that has some interesting consequences.
Transfer RNAs base-pair with mRNA codons at a three-base sequence on the tRNA called the
anticodon. 5' �3 '
The first base of the codon in mRNA (read in the
nized only one codon triplet through Watson-Crick base
27.1
The Genetic Code
� 07�
Known Variant Codon Assignments in Mitochondria Codons*
Normal code assignment Animals Vertebrates Drosophila
UGA
AVA
AGA AGG
CUN
CGG
Stop
lle
Arg
Leu
Arg
Trp
Met Met
Stop Ser
+ +
+ +
Met Met +
+ + +
Thr Thr +
+ ? +
Trp
+
+
+
+
+
+
+
+
+
+
+
+
?
+
+
+
Trp
Yeasts Saccharomyces cerevisiae Torulopsis glabrata Schizosaccharomyces pombe
Trp Trp Trp
Filamentous fungi
Trp
Trypanosomes Higher plants Chlamydomonas reinhardtii
Trp ?
*N indicates any nucleotide; + , codon has the same meaning as in the normal code; ?, codon not observed in this mitochondrial genome.
an lie codon to a Met codon; the normal Met codon is AUG, and a single tRNA recognizes both codons. The known cod ing variations in mitochondria are summarized in Table 1 . Turning t o the much rarer changes in the codes for cellular (as distinct from mitochondrial) genomes, we find that the only known variation in a bacterium is again the use of UGA to encode Trp residues, occurring in the sim plest free-living cell, Mycoplasma capricolum. Among eukaryotes, the only known extramitochondrial coding changes occur in a few species of ciliated protists, in which both termination codons UAA and UAG can specify gluta mine. There are also rare but interesting cases where stop codons have been adapted to encode amino acids that are not among the standard 20, as detailed in Box 27-3. 3'
Changes in the code need not be absolute; a codon might not always encode the same amino acid. For example, in many bacteria-including E. coli--GUG (Val) is some times used as an initiation codon that specifies Met. This oc curs only for those genes in which the GUG is properly located relative to particular mRNA sequences that affect the initiation of translation (as discussed in Section 27.2) . These variations tell us that the code is not quite as uni versal as once believed, but that its flexibility is severely constrained. The variations are obviously derivatives of the normal code, and no example of a completely different code has been found. The limited scope of code variants strengthens the principle that all life on this planet evolved on the basis of a single (slightly flexible) genetic code.
pairing at all three positions, cells would have a different tRNA for each amino acid codon. This is not the case, however, because the anticodons in some tRNAs include the nucleotide inosinate (designated I) , which contains the uncommon base hypoxanthine (see Fig. 8-5b ) .
5' tRNA
3
2
1
3
-
mRNA 5' -----
11 2
(a)
31 ----Codon
3'
2
3
1
c-G-ir
Codon (5') e-G-A 1
2
G-C- 1
Anticodon (3') G-C-1
(b)
1
2
3
3
2
1
G-C- 1 (5') c-G-c (3') 1
2
3
FIGURE 17-8 Pairing relationship of codon and anticodon. (a) Align ment of the two RNAs is antiparallel. The tRNA is shown in the tradi tional cloverleaf configuration. (b) Three different codon pairing relationships are possible when the tRNA anticodon contains inosinate.
�07�
Protein Metabolism
Inosinate can form hydrogen bonds with three different nucleotides (U, C, and A; Fig. 27-8b), although these pairings are much weaker than the hydrogen bonds of Watson-Crick base pairs (G = C and A= U). In yeast, one tRNAArg has the anticodon (5')ICG, which recognizes three arginine codons: (5')CGA, (5')CGU, and (5')CGC. The first two bases are identical (CG) and form strong Watson-Crick base pairs with the corresponding bases of the anticodon, but the third base (A, U, or C) forms rather weak hydrogen bonds with the I residue at the first position of the anticodon. Examination of these and other codon-anticodon pairings led Crick to conclude that the third base of most codons pairs rather loosely with the corresponding base of its anticodon; to use his picturesque word, the third base of such codons (and the first base of their cor responding anticodons) "wobbles." Crick proposed a set of four relationships called the wobble hypothesis: 1.
The first two bases of an mRNA codon always form strong Watson-Crick base pairs with the correspon ding bases of the tRNA anticodon and confer most of the coding specificity.
2. The first base of the anticodon (reading in the 5'�3' direction; this pairs with the third base of the codon) determines the number of codons rec ognized by the tRNA. When the first base of the an ticodon is C or A, base pairing is specific and only one codon is recognized by that tRNA. When the first base is U or G, binding is less specific and two different codons may be read. When inosine (I) is the first (wobble) nucleotide of an anticodon, three different codons can be recognized-the maximum number for any tRNA. These relationships are sum marized in Table 27-4. 3. When an amino acid is specified by several different codons, the codons that differ in either of the first two bases require different tRNAs. 4. A minimum of 32 tRNAs are required to translate all 61 codons (31 to encode the amino acids and 1 for initiation). The wobble (or third) base of the codon contributes to specificity, but, because it pairs only loosely with its corresponding base in the anticodon, it permits rapid dissociation of the tRNA from its codon during protein synthesis. If all three bases of a codon engaged in strong Watson-Crick pairing with the three bases of the anti codon, tRNAs would dissociate too slowly and this would severely limit the rate of protein synthesis. Codon-anticodon interactions balance the requirements for accuracy and speed. The genetic code tells us how protein sequence in formation is stored in nucleic acids and provides some clues about how that information is translated into pro tein. We now turn to the molecular mechanisms of the translation process.
TA B LE 27-4
How the Wobble Base of the Anticodon Determines the Number of Codons a tRNA can Recognize
--------------�
1 . One codon recognized: Anticodon
(3')
X- Y- Q (5')
(3')
X- Y- A (5')
Codon
(5')
X'- Y'-G (3')
(5')
X'-Y'-U (3')
2. Two codons recognized: Anticodon
(3')
X- Y- U (5')
(3')
X- Y- G (5')
Codon
(5')
X'- Y'-� (3')
(5')
X'- Y'-3 (3')
3. Three codons recognized: Anticodon
(3')
X -Y-! (5')
Codon
(5')
X'-Y'-� (3') C.
Note: X andY denote bases complementary to and capable of strong Watson-Crick base pairing with X' andY'. respectively. Wobble bases-in the 3' position of codons
and 5' position of anticodons-are shaded in pink.
Translational Frameshifting and RNA Editing Affect How the Code Is Read
Once the reading frame has been set during protein syn thesis, codons are translated without overlap or punctu ation until the ribosomal complex encounters a termination codon. The other two possible reading frames usually contain no useful genetic information, but a few genes are structured so that ribosomes "hic cup" at a certain point in the translation of their mRNAs, changing the reading frame from that point on. This ap pears to be a mechanism either to allow two or more re lated but distinct proteins to be produced from a single transcript or to regulate the synthesis of a protein. One of the best-documented examples of transla tional frameshifting occurs during translation of the mRNA for the overlapping gag and pol genes of the Rous sarcoma virus (see Fig. 26-35). The reading frame for pol is offset to the left by one base pair (- 1 reading frame) relative to the reading frame for gag (Fig. 27-9) . The product of the pol gene (reverse transcrip tase) is translated as a larger polyprotein, on the same mRNA that is used for the gag protein alone (see Fig. 26-34). The polyprotein, or gag-pol protein, is then trimmed to the mature reverse transcriptase by prote olytic digestion. Production of the polyprotein requires a translational frameshift in the overlap region to allow the ribosome to bypass the UAG termination codon at the end of the gag gene (shaded pink in Fig. 27-9). Frameshifts occur during about 5% of translations of this mRNA, and the gag-pol polyprotein (and ulti mately reverse transcriptase) is synthesized at about one-twentieth the frequency of the gag protein, a level that suffices for efficient reproduction of the virus. In
27. 1 The Genetic Code
gag
Go?�
reading frame
�-�-�-�-�-�-�-� � · ftJ �U� M'fii! 'I tJJ l lf!Uf Ji (fiJ I: ,(l;BJI s - --li'UR�!J:
--- c u
AGG G
c u c c
put t·eacling frame
G
c u u
GA
c
AAA
A' Q:j G G A G G G C c A --- 3' u lA u AIIG G GilA G GiiG c ciA--Ile - Gly - Arg - Ala
u u
FIGURE 27-9 Translational frameshifting in a retroviral transcript. The gag-pol overlap region in Rous sarcoma virus RNA is shown.
some retroviruses, another translational frameshift allows translation of an even larger polyprotein that includes the product of the env gene fused to the gag and pol gene products (see Fig. 26-34). A similar mechanism produces both the T and y subunits of E. coli DNA polymerase III from a single dnaX gene transcript (see Table 25-2). Some mRNAs are edited before translation. RNA editing can involve the addition, deletion, or alteration of nucleotides in the RNA in a manner that affects the meaning of the transcript when it is translated. Addition or deletion of nucleotides has been most commonly ob served in RNAs originating from the mitochondrial and chloroplast genomes of eukaryotes. The reactions re quire a special class of RNA molecules encoded by these same organelles, with sequences complementary to the edited mRNAs. These guide RNAs (gRNAs; Fig. 27- 1 0) act as templates for the editing process.
DNA coding strand Edited mRNA
The initial transcripts of the genes that encode cy tochrome oxidase subunit II in some protist mitochon dria provide an example of editing by insertion. These transcripts do not correspond precisely to the sequence needed at the carboxyl terminus of the protein product. A posttranscriptional editing process inserts four U residues that shift the translational reading frame of the transcript. Figure 27-10 shows the added U residues in the small part of the transcript that is affected by editing. Note that the base pairing between the initial transcript and the guide RNA involves a number of G U base pairs (blue dots), which are common in RNA molecules. RNA editing by alteration of nucleotides most com monly involves the enzymatic deamination of adenosine or cytidine residues, forming inosine or uridine, respec tively ( Fig. 27-1 1 ), although other base changes have been described. Inosine is interpreted as a G residue =
FIGURE 27-10 RNA editing of the transcript
5·--- IA:'.ll\'' �lfl:rt'it':::.iVIl� :' O:]tA:{; 7z��:� JA :'qJE§;::JI'; ''�G! I�?�: ,;;.WI ---
3·
Lys - Val Glu Asn Leu Val ---i:A::A 'Ai'li'Gi'Q'·'�]iG A uliu G Ull A U Aile c uiiG G ui-- Lys - Val - Asp - Cys - lie - Pro - Gly �
•
•
•
3'
5'
(b)
0 (�NH N -lN) \
0 OH \
\
Adenosine
I nsertion of four
U
residues (pink) produces a
revised read ing frame. (b) A special class of guide RNAs, complementary to the edited process. Note the presence of two
mRNA 5' ---A A A GU A G A u u G u AU A c c u G G Guide RNA sU u AUA u c u A A u A U A u G G A U A
I
from Trypanosoma brucei mitochondria. (a)
product, act as templates for the editing
(a)
0 OH
of the cytochrome oxidase subunit II gene
Ino·ine
(a)
FIGURE 27-1 1 Deamination reactions that result in RNA editing. (a)
The conversion of adenosine nucleotides to i nosi ne nucleotides is
U-
- 3'
base
Watson-Crick pai ring .
J
(AoNH
A� lNAO oc 2 o HH HH 0 OH
\
G=U
pai rs, signified by a blue dot to indicate non
�
� \ I
' Cytidine
N \oc , o HH HH 0 OH I
(b)
\
Uridine
catalyzed by ADAR enzymes. (b) Cytidine to uridine conversions are catalyzed by the APOBEC family of enzymes.
� 07�
Protein Metabolism
Residue number 2,156 2,146 2,150 2,154 2,152 2,148 Human liver 5' - - -{O�.'\!t.l1'Zf:H\!!�Ji;i�f1;'€l:1 it!ii��j�ffH�;!:Oii;!�jt·Jf'1'�!iijjjt,A: tf t'£li�Ji:;:Q"'AtllC A All'\1t411J®llltl �����i!fi!J �Cti��:�J llm1tqi,ll -- - 3' (apoB-100) - Gin - Leu - Gin - Thr - Tyr - Met - Ile - Gin - Phe - Asp - Gin - Tyr Human intestine -- -i.m:[L\:,:Ail f�:i·P£:,GJ l'0i'·i:W:ii!:�It'l f�12·:�i!!llijjl ttt.r:: �iil.UI [tA;;:Q::S.I i�!i�;Jf:'A] ltJiA' AIf:llllitWi !:��1:·11Eil !IWjl�ili il'i.�fill --(apoB-48) - Gin - Leu - Gin - Thr - Tyr - Met - Ile Stop FIGURE 27- 1 2 RNA editing of the transcript of the gene for the apoB-1 00 component of LDL. Deami na
tion, which occurs only in the intestine, converts a specific cytidine to u ridi ne, changing
a
Gin codon to
a stop codon and producing a truncated protei n.
during translation. The adenosine deamination reac tions are carried out by adenosine deaminases that act on RNA (ADARs). The cytidine deaminations are car ried out by the apoB mRNA editing catalytic peptide (APOBEC) family of enzymes, which includes the re lated activation-induced deaminase (AID) enzymes. Both groups of deaminase enzymes have a homologous zinc-coordinating catalytic domain. A well-studied example of RNA editing by deamina tion occurs in the gene for the apolipoprotein B compo nent of low-density lipoprotein in vertebrates. One form of apolipoprotein B, apoB-100 (Mr 513,000), is synthe sized in the liver; a second form, apoB-48 CMr 250,000), is synthesized in the intestine. Both are encoded by an mRNA produced from the gene for apoB-100. An APOBEC cytidine deaminase found only in the intestine binds to the mRNA at the codon for amino acid residue 2,153 (CAA = Gln) and converts the C to aU, to create the termination codon UAA. The apoB-48 produced in the intestine from this modified mRNA is simply an ab breviated form (corresponding to the amino-terminal half) of apoB-100 (Fig. 2 7- 1 2 ). This reaction permits tissue-specific synthesis of two different proteins from one gene. The ADAR-promoted A to I editing is particularly common in transcripts derived from the genes of pri mates, and perhaps 90% or more of the editing occurs in the short interspersed elements (SINEs) called Alu ele ments (see Fig. 24-8). There are over a million of the 300 bp Alu elements in human DNA, making up about 10% of the genome. These are concentrated near protein-encoding genes, often appearing in introns and untranslated regions at the 3' and 5' ends of transcripts. When it is first synthesized (prior to processing), the average human mRNA includes 10 to 20 Alu elements. The ADAR enzymes bind to and promote A to I editing only in duplex regions of RNA. The abundant Alu ele ments offer many opportunities for intramolecular base pairing within the transcripts, providing the duplex tar gets required by the ADARs. Some of the editing affects the coding sequences of genes. Defects in ADAR func tion have been associated with a variety of human neu rological conditions, including amyotrophic lateral sclerosis (ALS), epilepsy, and major depression.
The genomes of all vertebrates are replete with SINEs, but there are many different types of SINES present in most of these organisms. The Alu elements predominate only in the primates. Careful screening of genes and transcripts indicates that A to I editing is 30 to 40 times more prevalent in humans than in mice, largely due to the presence of many Alu elements. Large-scale A to I editing and an increased level of alter native splicing (see Fig. 26-22) are two features that set primate genomes apart from those of other mammals. It is not yet clear whether these reactions are incidental, or whether they played key roles in the evolution of primates and, ultimately, humans.
S U M M A R Y 27.1 •
•
•
•
•
•
•
•
The G e n e tic Co d e
The particular amino acid sequence of a protein is constructed through the translation of information encoded in mRNA. This process is carried out by ribosomes. Amino acids are specified by mRNA codons consisting of nucleotide triplets. Translation requires adaptor molecules, the tRNAs, that recognize codons and insert amino acids into their appropriate sequential positions in the polypeptide. The base sequences of the codons were deduced from experiments using synthetic mRNAs of known composition and sequence. The codon AUG signals initiation of translation. The tripletsUAA,UAG, andUGA are signals for termination. The genetic code is degenerate: it has multiple codons for almost every amino acid. The standard genetic code is universal in all species, with some minor deviations in mitochondria and a few single-celled organisms. The third position in each codon is much less specific than the first and second and is said to wobble. Translational frameshifting and RNA editing affect how the genetic code is read during translation.
27.2 Protein Synthesis
27.2 Protein Synthesis
Protein Biosynthesis Takes Place in
As we have seen for DNA and RNA (Chapters 25 and 26),
Five Stages
� 07�
the synthesis of polymeric biomolecules can be consid
Stage 1: Activation of Amino Acids
ered in terms of initiation, elongation, and termination
thesis of a polypeptide with a defined sequence, two
stages. These fundamental processes are typically brack
fundamental chemical requirements must be met: (1)
For the syn
eted by two additional stages: activation of precmsors be
the carboxyl group of each amino acid must be acti
fore synthesis and postsynthetic processing of the
vated to facilitate formation of a peptide bond, and (2)
completed polymer. Protein synthesis follows the same
a link must be established between each new amino
pattern. The activation of amino acids before their incor
acid and the information in the mRNA that encodes it.
poration into polypeptides and the posttranslational pro
Both these requirements are met by attaching the
cessing of the completed polypeptide play particularly
amino acid to a tRNA in the first stage of protein syn
important roles in ensliTing both the fidelity of synthesis
thesis. Attaching the right amino acid to the right tRNA
and the proper function of the protein product. The cellu
is critical. This reaction takes place in the cytosol, not
lar components involved in the five stages of protein syn
on the ribosome. Each of the 20 amino acids is cova
coli and other bacteria are listed in Table 27-5;
the requirements in eukaryotic cells are quite similar, al
lently attached to a specific tRNA at the expense of ATP energy, using Mg2+ -dependent activating enzymes
though the components are in some cases more numer
known as aminoacyl-tRNA synthetases. When attached
thesis in E.
ous. An initial overview of the stages of protein synthesis
provides a useful outline for the discussion that follows.
TA BLE 27-5
to their amino acid (aminoacylated) the tRNAs are said to be "charged."
Components Required for the Ave Major Stages of Protein
s�m£mU
__ �--------------------
Stage
Essential components
l. Activation of amino acids
20 amino acids 20 aminoacyl-tRNA synthetases 32 or more tRNAs ATP Mg2+
2. Initiation
mRNA N-Formylmethionyl-tRNAJMet Initiation codon in mRNA (AUG) 30S ribosomal subunit 50S ribosomal subunit Initiation factors (IF-1 , IF-2, IF-3) GTP Mg2+
3. Elongation
Functional 70S ribosome (initiation complex) Aminoacyl-tRNAs specified by codons
�
Elongation factors (EF-Tu, EF-Ts, EF-G) GTP Mg2+ 4. Termination and ribosome
recycling
Termination codon in mRNA Release factors (RF-1, RF-2, RF-3, RRF) EF-G IF-3
5 . Folding and posttranslational processing
Specific enzymes, cofactors, and other components for removal of initiating residues and signal sequences, additional proteolytic processing, modification of terminal residues, and attachment of acetyl, phosphoryl, methyl, carboxyl, carbohydrate, or prosthetic groups
� 07�
Protein Metabolism
TABLE 27-6 Subunit
308 508
RNA and Protein Components of the E. alii Ribosome Number of different proteins
21
33
Total number
Protein
Number and
of proteins
designations
type of rRNA.s
81-821
21
36
L1-L36*
1 (168 rRNA)
2 (58 and 238 rRNAs)
•The Ll to L36 protein designations do not correspond to 36 different proteins. The protein originally designated L7 is in fact a modified form of L12, and
L8 is a complex of three
other proteins. Also, L26 proved to be the same protein as S20 (and not part
of the 50S subunit). This gives 33 different proteins in the large subunit. There are four copies of the L7/L12 protein, with the three extra copies bringing the total protein count to 36.
Stage 2: Initiation The mRNA bearing the code for the polypeptide to be synthesized binds to the smaller of two ribosomal subunits and to the initiating aminoacyl tRNA. The large ribosomal subunit then binds to form an initiation complex. The initiating aminoacyl-tRNA base pairs with the mRNA codon AUG that signals the begin ning of the polypeptide. This process, which requires GTP, is promoted by cytosolic proteins called initiation factors. Stage 3: Elongation The nascent polypeptide is lengthened by covalent attachment of successive amino acid units, each carried to the ribosome and correctly positioned by its tRNA, which base-pairs to its corre sponding codon in the mRNA. Elongation requires cy tosolic proteins known as elongation factors. The binding of each incoming aminoacyl-tRNA and the movement of the ribosome along the mRNA are facili tated by the hydrolysis of GTP as each residue is added to the growing polypeptide. Stage 4: Termination and Ribosome Recycling Completion of the polypeptide chain is signaled by a ter mination codon in the mRNA. The new polypeptide is released from the ribosome, aided by proteins called re lease factors, and the ribosome is recycled for another round of synthesis. Stage 5: Folding and Posttranslational Processing In order to achieve its biologically active form, the new polypeptide must fold into its proper three-dimensional conformation. Before or after folding, the new polypep tide may undergo enzymatic processing, including re moval of one or more amino acids (usually from the amino terminus); addition of acetyl, phosphoryl, methyl, carboxyl, or other groups to certain amino acid residues; proteolytic cleavage; and/or attachment of oligosaccha rides or prosthetic groups. Before looking at these five stages in detail, we must ex amine two key components in protein biosynthesis: the ribosome and tRNAs.
The Ribosome Is a Complex Supramolecular Machine
Each E. coli cell contains 1 5,000 or more ribosomes, ac counting for almost a quarter of the dry weight of the cell. Bacterial ribosomes contain about 65% rRNA and 35% protein; they have a diameter of about 18 nm and are composed of two unequal subunits with sedimenta tion coefficients of 308 and 50S and a combined sedi mentation coefficient of 70S. Both subunits contain dozens of ribosomal proteins and at least one large rRNA (Table 27-6) . Following Zamecnik's dis covery that ribosomes are the complexes responsible for protein synthesis, and following elucidation of the genetic code, the study of ribosomes acceler ated. In the late 1 960s Masayasu Nomura and colleagues demon strated that both ribosomal sub units can be broken down into their RNA and protein compo nents, then reconstituted in Masayasu Nomura vitro. Under appropriate experimental conditions, the RNA and protein sponta neously reassemble to form 308 or 50S subunits nearly identical in structure and activity to native subunits. This breakthrough fueled decades of research into the function and structure of ribosomal RNAs and proteins. At the same time, increasingly sophisticated structural methods revealed more and more details about ribo some structure. The dawn of a new millennium brought with it the elucidation of the first high-resolution structures of bac terial ribosomal subunits, providing a wealth of sur prises ( Fig. 27-13 ). First, the traditional focus on the protein components of ribosomes was shifted. The ribo somal subunits are huge RNA molecules. In the 50S sub unit, the 58 and 238 rRNAs form the structural core. The proteins are secondary elements in the complex, decorating the surface. Second and most important, there is no protein within 18 A of the active site for
27.2 Protein Synthesis
l!.
07�J
p
50S
(a)
30S
(c)
(d)
50S
FIGURE 27- 1 3 The bacterial ribosome. Our understanding of ri bo
shown) winds through grooves or chan nels on the 305 subunit
some structure has been greatly enhanced by m u ltiple h igh-resolution
surface. (b) The assembled active bacterial ri bosome, viewed down
i m ages of the bacterial ribosome and its subun its, contributed by
into the groove separati ng the subun its (derived from PDB ID 20W8,
several research groups. A sampl i ng is presented here. (a) The 505 and
1 V5A, and 1 GIX). A l l components are colored as in (a). (c) A pair of
305 bacterial subunits, split apart to visualize the su rfaces that i nter
ribosome images i n the same orientation as in (b), but with all com
act in the active ri bosome. The structure on the left is the 505 subunit
ponents shown as su rface renderings to emphasize the mass of the
(derived from PDB I D 20W8, 1 V5A, and 1 GIX), with tRNAs (dis played as green backbone structures) bound to sites E, P, and A, de
entire structure. In the structure on the right, the tRNAs have been omitted to give a better sense of the cleft where protein synthesis
scri bed later in the text; the tRNA anticodons are in red. Proteins
occurs. (d) The 505 bacterial ri bosome subunit (PDB ID 1 Q7Y). The
appear as blue wormlike structures representing the peptide back
subunit is again viewed from the side that attaches to the 305 subun it,
bone; the rRNA as a gray rendering of the surface featu res. The struc
but tilted down slightly compared with its orientation in (a). The active
ture on the right is the 305 subu n i t (derived from PDB ID 20W8).
site for peptide bond formation (the peptidyl transferase activity), deep
Prote i n backbones are brown worm l ike structures and the rRNA is a
with i n a su rface groove and far away from any protein, is marked by a
lighter tan surface rendering. The part of the mRNA that i nteracts with
bound i n h i bitor, puromycin (red).
the tRNA anticodons is shown in red . The rest of the m RNA (not
peptide bond formation. The high-resolution structure thus confirms what many had suspected for more than a decade: the ribosome is a ribozyme. In addition to the in sight they provide into the mechanism of protein syn thesis (as elaborated below), the detailed structures of
the ribosome and its subunits have stimulated a new look at the evolution of life (Box 27-2). The bacterial ribosome is complex, with a combined molecular weight of -2.7 million. The two irregularly shaped ribosomal subunits fit together to form a cleft
� 07�
Protein Metabolism
BOX 27-2
From a n RNA Worl d to a Pro te i n World
to stabi l ize them.
for catalysis of reactions involving a growing range of metabolites and macromolecules could have led to larger and more complex RNA catalysts. The many neg atively charged phosphoryl groups in the RNA backbone limit the stability of very large RNA molecules. In an RNA world, divalent cations or other positively charged groups could be incorporated into the structures to aug ment stability. Certain peptides could stabilize large RNA mole cules. For example, many ribosomal proteins in modern eukaryotic cells have long extensions, lacking second ary structure, that snake into the rRNAs and help stabi lize them (Fig. 1). Ribozyme-catalyzed synthesis of peptides could thus initially have evolved as part of a general solution to the structural maintenance of large RNA molecules. The synthesis of peptides may have helped stabilize large ribozymes, but this advance also marked the beginning of the end for the RNA world. Once peptide synthesis was possible, the greater cat alytic potential of proteins would have set in motion an irreversible transition to a protein-dominated metabolic system. Most enzymatic processes, then, were eventually surrendered to the proteins-but not all. In every organ ism, the critical task of synthesizing the proteins re mains, even now, a ribozyrne-catalyzed process. There appears to be only one good arrangement (or just a very few) of nucleotide residues in a ribozyrne active site that can catalyze peptide synthesis. The rRNA residues that seem to be involved in the peptidyl transferase activity of ribosomes are highly conserved in the large-subunit rRNAs of all species. Using in vitro evolution (SELEX; see Box 26-3), investigators have isolated artificial ri bozyrnes that promote peptide synthesis. Intriguingly, most of them include the ribonucleotide octet (5')AUAACAGG(3'), a highly conserved sequence found at the peptidyl transferase active site in the ribo somes of all cells. There may be just one optimal solution to the overall chemical problem of ribozyme-catalyzed synthesis of proteins of defined sequence. Evolution found this solution once, and no life form has notably improved on it.
through which the mRNA passes as the ribosome moves along it during translation (Fig. 27-13b). The 57 pro teins in bacterial ribosomes vary enormously in size and structure. Molecular weights range from about 6,000 to 75,000. Most of the proteins have globular domains arranged on the ribosome surface. Some also have snakelike extensions that protrude into the rRNA core of the ribosome, stabilizing its structure. The functions of some of these proteins have not yet been elucidated
in detail, although a structural role seems evident for many of them. The sequences of the rRNAs of many organisms are now known. E ach of the three single-stranded rRNAs of E. coli has a specific three-dimensional con formation featuring extensive intrachain base pairing. The predicted secondary structure of the rRNAs ( Fig. 2 7-1 4) has largely been confirmed in the high resolution models, but fails to convey the extensive
Extant ribozyrnes generally promote one of two types of reactions: hydrolytic cleavage of phosphodiester bonds or phosphoryl transfers (Chapter 26). In both cases, the substrates of the reactions are also RNA mol ecules. The ribosomal RNAs provide an important ex pansion of the catalytic range of known ribozymes. Coupled to the laboratory exploration of potential RNA catalytic function (see Box 26-3), the idea of an RNA world as a precursor to current life forms becomes in creasingly attractive. A viable RNA world would require an RNA capable of self-replication, a primitive metabolism to generate the needed ribonucleotide precursors, and a cell bound ary to aid in concentrating the precursors and seques tering them from the environment. The requirements
'
FIGURE 1 The 50S subu n it of a bacterial ribosome (PDB 10 1 NKW).
The protein backbones are shown as blue worm l i ke structures; the rRNA components are transparent. The u n structured extensions of many of the ribosomal proteins snake into the rRNA structures, helping
27.2 Protein Synthesis
Bacterial ribosome
Eukaryotic ribosome
70S Mr2.7 x 106
80S Mr4.2 x 106
60S
50S
Mr 1.8
x
106
58 rRNA (120 nucleotides) 238 rRNA (3,200 nucleotides) 36 proteins
Mr2.8
16S rRNA
5' �
3'
�07�
1'
X
106
58 rRNA (120 nucleotides) 288 rRNA (4,700 nucleotides) 5.88 rRNA 160 nucleotides) - 49 proteins
40S
5S rRNA
FIGURE 27-14 Bacterial rRNAs. Diagrams of the secondary structure of E. coli 1 65 and 55 rRNAs. The first (5' end) and fi nal (3' end) ribonu cleotide residues of the 1 65 rRNA are n u mbered.
network of tertiary interactions apparent in the com plete structure. The ribosomes of eukaryotic cells (other than mito chondrial and chloroplast ribosomes) are larger and more complex than bacterial ribosomes (Fig. 27-15 ), with a diameter of about 23 nm and a sedimentation coefficient of about 80S. They also have two subunits, which vary in size among species but on average are 60S and 40S. Altogether, eukaryotic ribosomes contain more than 80 different proteins. The ribosomes of mitochon dria and chloroplasts are somewhat smaller and simpler than bacterial ribosomes. Nevertheless, ribosomal struc ture and function are strikingly similar in all organisms and organelles. Transfer RNAs Have Characteristic Structural Features
To understand how tRNAs can serve as adaptors in translating the language of nucleic acids into the lan guage of proteins, we must first examine their struc ture in more detail. Transfer RNAs are relatively small and consist of a single strand of RNA folded into a precise three-dimensional structure (see Fig. 8-25a).
Mr 0.9
x
106
168 rRNA (1,540 nucleotides) 21 proteins
Mr 1.4
x
106
188 rRNA (1,900 nucleotides) - 33 proteins
FIGURE 27-15 Summary of the composition and mass of ribosomes in bacteria and eukaryotes. R i bosomal s u b u n i ts are identified by the i r 5 (Svedberg un it) val u es, sedimentation coefficients that refer to thei r
rate of sedimentation in a centrifuge. The 5 values are not necessarily additive when subunits are combined, because rates of sedimentation are affected by shape as well as mass.
The tRNAs in bacteria and in the cytosol of eukary otes have between 73 and 93 nucleotide residues, cor responding to molecular weights of 24 ,000 to 3 1 ,000. Mitochondria and chloroplasts contain distinctive , somewhat smaller tRNAs. Cells have at least one kind of tRNA for each amino acid; at least 32 tRNAs are re quired to recognize all the amino acid codons (some recognize more than one codon), but some cells use more than 32. Yeast alanine tRNA (tRNAA1a) , the first nucleic acid to be completely sequenced (Fig. 27-16), con tains 76 nucleotide residues, 10 of which have modified bases. Comparisons of tRNAs from various species have revealed many conunon structural features
� 08�
Protein Metabolism
3' A C
5' pO G G c G u
Robert W. Holley, 1 92 2-1 993 D
G
g
1 Gm G
D
u u
s·l
I
uCCGG A G A G G G
c c
o
5'
3' A S ite for amino acid C attachment c A c c u G c 0 C U U A .A: GO c C
C
,D G
:r
pG
Amino acid
C arm
Pu •
•
Tl{tCarm
D arm Pu •
• •
•
G*
A Contain two or three D re idue at different positions G
c
Wobble position
Extra arm
Variable in size, not present in all tRNAs •
•
Py
•
Pu
Anticodon
arm
5.� 3, •
Anticodon
13'
FIGURE 27- 1 7 General cloverleaf secondary structure of tRNAs. The
Anticodon triplet
large dots on the backbone represent nucleotide residues; the b l ue
FIGURE 27-16 N ucleotide sequence of yeast tRNAA1•. This structure
common to a l l tRNAs are shaded in pink. Transfer RNAs vary in length
l i nes represent base pairs. Characteristic and/or i nvariant residues
was deduced in 1 965 by Robert W. Hol ley and h i s col l eagues; it is
from 73 to 93 nuc leotides. Extra nucleotides occur in the extra arm or
shown in the cloverleaf conformation in which i ntrastrand base pairing
i n the D arm. At the end of the anticodon arm is the anti codon loop,
is max i m a l . The fol lowing symbols are used for the modified nu
which always contains seven unpaired nucleotides. The D arm contains
cleotides (shaded p i n k): 1/J, pseudou ridine; I, inosine; T, r ibothymidi ne; 1 D, 5 , 6-dihydrou ridi ne; m11, 1 -methy l i nosine; m G, 1 -methylguanosine; 2 2 m G, N -di methylguanos i n e (see Fig. 2 6-2 3) . B l u e li nes between
two or three D (5,6-di hydrouridine) residues, depending on the tRNA. In
para l lel sections i nd icate Watson-Crick base pai rs. In RNAs, guanosine
Py, pyrimidine nucleotide; G*, guanylate or 2 ' -0-methylguanylate.
some tRNAs, the D arm has only three hydrogen-bonded base pairs. I n addition to the symbols explai ned i n Figure 27- 1 6: Pu, purine nucleotide;
is often base-paired with uridine, although the G=U pair is not as stable as the Watson-Crick G=C pair (Chapter 8). The anticodon can recogn ize three codons for alanine (GCA, GCU, and GCC). Other features of tRNA structure are shown in Figu res 2 7- 1 7 and 27-1 8 .
( Fig. 27-17 ) . Eight or more of the nucleotide residues have modified bases and sugars, many of which are methylated derivatives of the principal bases. Most
FIGURE 27-18 Three-dimensional struc
ture of yeast tRNAPhe deduced from x-ray diffraction analysis. The shape
tRNAs have a guanylate (pG) residue at the 5' end, and all have the trinucleotide sequence CCA(3 ') at the 3 ' end. When drawn in two dimensions, the hydrogen bonding pattern of all tRNAs forms a cloverleaf struc ture with four arms; the longer tRNAs have a short fifth arm, or extra arm (Fig. 27- 1 7) . In three dimensions , a tRNA has the form of a twisted L ( Fig. 27- 1 8 ) .
Darm (residues 10-25)
resembles a twisted L. (a) Schematic dia gram with the various arms identified in Figure 27-17 shaded in different colors. (b) A space-fi l l i ng model, with the same color coding (PDB ID 4TRA) . The CCA sequence at the 3' end (orange) is the at tachment point for the amino acid.
Anticodon arm
[
(a)
(b)
27.2 Protein Synthesis
Two of the arms of a tRNA are critical for its adap tor function. The
amino acid arm can carry a specific
amino acid esterified by its carboxyl group to the 2'- or
G 08�
This reaction occurs in two steps in the enzyme's ac tive site. In step
G)
(Fig. 27-19) an enzyme-bound in
termediate, aminoacyl adenylate (aminoacyl-AMP), is
3'-hydroxyl group of the A residue at the 3' end of the
formed. In the second step the aminoacyl group is trans
tRNA. The anticodon arm contains the anticodon. The
ferred from enzyme-bound aminoacyl-AMP to its corre
other major arms are the D arm, which contains the un
sponding specific tRNA. The course of this second step
usual nucleotide dihydrouridine (D), and the
TI/JC
depends on the class to which the enzyme belongs, as
arm, which contains ribothymidine (T), not usually
shown by pathways �and @in Figure 27-19. The re
present in RNAs, and pseudouridine
sulting ester linkage between the amino acid and the
(t/1), which has an
unusual carbon-carbon bond between the base and ri
tRNA
bose (see Fig. 26-23). The D and Tt/JC arms contribute
energy of hydrolysis
important interactions for the overall folding of tRNA
rophosphate formed in the activation reaction undergoes
molecules, and the Tt/JC arm interacts with the large
hydrolysis to phosphate by inorganic pyrophosphatase.
subunit rRNA.
Thus
( Fig. 27-20) has a highly negative standard free
(AG'0
=
-29 kJ/mol). The py
two high-energy phosphate bonds are ultimately
expended for each amino acid molecule activated, ren Having looked at the structures of ribosomes and tRNAs,
dering the overall reaction for amino acid activation es
we now consider in detail the five stages of protein
sentially irreversible:
synthesis.
Amino acid
Stage 1 : Aminoacyl-tRNA Synthetases Attach the Correct
+ tRNA + ATP �
aminoacyl-tRNA llG'0
Amino Acids to Their tRNAs During the first stage of protein synthesis, taking place in the cytosol, aminoacyl-tRNA synthetases esterify the 20 amino acids to their corresponding tRNAs. Each enzyme is specific for one amino acid and one or more corresponding
tRNAs.
Most
organisms
have
one
aminoacyl-tRNA synthetase for each amino acid. For amino acids with two or more corresponding tRNAs, the same enzyme usually aminoacylates all of them. The structures of all the aminoacyl-tRNA syn thetases of E.
coli have been determined. Researchers
have divided them into two classes (Table 27-7) based on substantial differences in primary and tertiary struc ture and in reaction mechanism
=
+AMP + 2Pi -29 kJ/mol
Proofreading by Aminoacyl-tRNA Synthetases The aminoacylation of tRNA accomplishes two ends: (1) it activates an amino acid for peptide bond forma tion and (2) it ensures appropriate placement of the amino acid in a growing polypeptide. The identity of the amino acid attached to a tRNA is not checked on the ribosome, so attachment of the correct amino acid to the tRNA is essential to the fidelity of protein synthesis.
As you will recall from Chapter
6, enzyme speci
ficity is limited by the binding energy available from enzyme-substrate interactions. Discrimination between
(Fig. 27-19 ); these
two similar amino acid substrates has been studied in
idence for a common ancestor, and the biological, chem
guishes between valine and isoleucine, amino acids that
two classes are the same in all organisms. There is no ev
ical, or evolutionary reasons for two enzyme classes for essentially identical processes remain obscure.
detail in the case of Ile-tRNA synthetase, which distin differ by only a single methylene group (-CH2-):
The reaction catalyzed by an aminoacyl-tRNA syn
Amino acid
+
Leu
ys
M t
Glu II Note:
'frp Tyr Val
Ala n
Asp Gly Bis
Lys Ph
Pr
S r
Thr
Here, Arg represents arginyl-tRNA synthetase, and so forth. The classification applies
to all organisms for which tRNA synthetases have been analyzed and is based on protein structural distinctions and on the mechanistic distinction outlined in Figure 27-19.
+
I
HN-C-H 3
9I
H-C - CH3
H- - CH3
CH3
CH2 I CH3 Isoleucine
I
The Two Oasses of Amlnoacyl-tRNA Synthetases Class II
Arg Gln
I
aminoacyl-tRNA + AMP + PPi
Class I
I
H3N-C-H
+ tRNA + ATP �
TABLE 27-7
coo
coo
thetase is
Valine
Ile-tRNA synthetase favors activation of isoleucine (to form Ile-AMP) over valine by a factor of 200-as we would expect, given the amount by which a methylene group (in Ile) could enhance substrate binding. Yet va line is erroneously incorporated into proteins in positions normally occupied by an Ile residue at a frequency of only about 1 in 3,000. How is this greater than 10-fold increase in accuracy brought about? Ile-tRNA synthetase, like some other aminoacyl-tRNA synthetases, has a proofread ing function.
�08�
Protein Metabolism
H R- �-0 11 NH3 0
� 0 II / - IIP' -PII' � -P o-
0
I
0
Amino acid
I
0
-
vI
ATP
.
-
MECHANISM FIGURE 27-19 Aminoacylation of tRNA by aminoacyl-tRNA synthetases. Step
-
0
second step the a m i noacyl group is trans is somewhat different for the two cl asses of aminoacyl-tRNA synthetases (see Table 2 7-7). OH
For class I enzymes,
OH
of the 3' -term i n a l A residue, then action . For class I I enzymes, cyl group
3'-hydroxyl group of the term inal adenylate.
I
:�,:i�:�::·'/ ntl/
OH
OH
5' -Aminoacyl adenylate (aminoacyl-AMP)
I
�. . -
3' end of tRNA
i
H
H
CH2
I
,
- OH
H R-
7
, OH .
�
0
-0
.NH3 0
rII
-o
s
-
H R-C
�eno in
e
I
+�
o-
?
C-0-P -0
II
0
I
� Adenosine [
0
Aminoacyl-AMP
Aminoacyl-AMP
0
+
@ the ami noa
i s transferred d i rectly to the
0
0
I
H
(§} to the
3 '-hydroxyl group by a transesterification re
I
IIIII II'
[Adenin
@ the a m i noacyl group
is transferred i n itia l l y to the 2'-hydroxyl group
C-0-P-0-
II
is formation of an ami noacyl adenylate,
which remains bound to the active site. I n the ferred to the tRNA. The mechanism of this step
a-Carboxyl of amino acid attacks a-phosphate of ATP, forming 5' amino acyl adenylate
H R -C ._1 NH3
G)
-0-
I
-o-P=O
I
t�A
Aminoacyl group is transferred to 2' -OH of the 3' -terminal A residue of tRNA, releasing AMP.
.
Aminoacyl group is transferred directly to the 3'-0H of the 3'-terminal A residue of tRNA, generating the aminoacyl-tRNA product.
H 0- -C-R
�
_,- li
r OH
CH2
I
0 +N1-I3
CH2
I
0
I
I
transesterification
-0-P=O
I
0
+
0
I
-o-P=O
Transesterification moves aminoacyl group to 3' -OH of the same tRNA residue, generating the aminoacyl tRNA product.
I
0
+
Aminoacyt-tRNA
27.2 Protein Synthesis
3 ' end oftRNA
0
Anrinoacyl group
I
-0-P=O I
0
5'
D
arm
The overall error rate of protein synthesis ( 1 mis take per 104 amino acids incorporated) is not nearly as low as that of DNA replication. Because flaws in a pro tein are eliminated when the protein is degraded and are not passed on to future generations, they have less bio logical significance. The degree of fidelity in protein syn thesis is sufficient to ensure that most proteins contain no mistakes and that the large amount of energy re quired to synthesize a protein is rarely wasted. One de fective protein molecule is usually unimportant when many correct copies of the same protein are present. �
CH2 I
pG
� 08�
Amino acid arm T1fC arm arm
FIGURE 27-20 General structure of aminoacyl-tRNAs. The ami noacyl group is esterified to the 3' position of the term inal A residue. The es ter l i nkage that both activates the amino acid and joins it to the tRNA is shaded pink.
Recall a general principle from the discussion of proofreading by DNA polymerases (p. 982): if available binding interactions do not provide sufficient discrimi nation between two substrates, the necessary specificity can be achieved by substrate-specific binding in two successive steps. The effect of forcing the system through two successive filters is multiplicative. In the case of Ile-tRNA synthetase, the first filter is the initial binding of the amino acid to the enzyme and its activa tion to aminoacyl-AMP. The second is the binding of any incorrect aminoacyl-AMP products to a separate active site on the enzyme; a substrate that binds in this second active site is hydrolyzed. The R group of valine is slightly smaller than that of isoleucine, so Val-AMP fits the hy drolytic (proofreading) site of the Ile-tRNA synthetase but Ile-AMP does not. Thus Val-AMP is hydrolyzed to va line and AMP in the proofreading active site, and tRNA bound to the synthetase does not become aminoacyl ated to the wrong amino acid. In addition to proofreading after formation of the aminoacyl-AMP intermediate, most aminoacyl-tRNA synthetases can also hydrolyze the ester linkage be tween amino acids and tRNAs in the aminoacyl-tRNAs. This hydrolysis is greatly accelerated for incorrectly charged tRNAs, providing yet a third filter to enhance the fidelity of the overall process. The few aminoacyl tRNA synthetases that activate amino acids with no close structural relatives (Cys-tRNA synthetase, for ex ample) demonstrate little or no proofreading activity; in these cases, the active site for aminoacylation can suffi ciently discriminate between the proper substrate and any incorrect amino acid.
Interaction between an Aminoacyl-tRNA Syn thetase and a tRNA: A "Second Genetic Code" An individual aminoacyl-tRNA synthetase must be spe cific not only for a single amino acid but for certain tRNAs as welL Discriminating among dozens of tRNAs is just as important for the overall fidelity of protein biosynthesis as is distinguishing among amino acids. The interaction between aminoacyl-tRNA synthetases and tRNAs has been referred to as the "second genetic code," reflecting its critical role in maintaining the accuracy of protein synthesis. The "coding" rules appear to be more complex than those in the "first" code. Figure 2 7-2 1 summarizes what we know about the nucleotides involved in recognition by some aminoacyl tRNA synthetases. Some nucleotides are conserved in 3' •
5'
Amin o acid arm
D ann
Anticodon ru:m Anticodon FIGURE 27-21 Nucleotide positions in tRNAs that are recognized by aminoacyl-tRNA synthetases. Some positions (blue dots) are the same in all tRNAs and therefore cannot be used to discri m i nate one from an other. Other positions are known recogn ition poi nts for one (orange) or more (green) ami noacyl-tRNA synthetases. Structural features other than sequence are important for recognition by some of the synthetases.
Protein Metabolism
FIGURE 27-22 Aminoacyl-tRNA synthetases. Both synthetases are complexed with their cognate tRNAs (green stick structures). Bound ATP (red) pi npoi nts the active site near the end of the ami noa cyl arm. (a) G l n-tRNA synthetase from E. coli, a typical monomeric class I synthetase (POB 1 0
(a}
1 QRT) . (b) Asp-tRNA synthetase from yeast, a typical di meric class I I synthetase (POB 1 0 1 ASZ).
all tRNAs and therefore cannot be used for discrimina
by the Ala-tRNA synthetase, as long as the RNA contains
tion. By observing changes in nucleotides that alter sub
the critical
strate specificity, researchers have identified nucleotide
alanine system may be an evolutionary relic of a period
positions that are involved in discrimination by the
when RNA oligonucleotides, ancestors to tRNA, were
aminoacyl-tRNA synthetases. These nucleotide positions
aminoacylated in a primitive system for protein synthesis.
G
=
U (Fig. 27-23b) . This relatively simple
seem to be concentrated in the amino acid arm and the
The interaction of aminoacyl-tRNA synthetases and
anticodon arm, including the nucleotides of the anti
their cognate tRNAs is critical to accurate reading of the
codon itself, but are also located in other parts of the
genetic code. Any expansion of the code to include ·new
tRNA molecule . Determination of the crystal structures
amino acids would necessarily require a new aminoacyl
of aminoacyl-tRNA synthetases complexed with their
tRNA synthetase:tRNA pair. A limited expansion of the
cognate tRNAs and ATP has added a great deal to our
genetic code has been observed in nature; a more exten
understanding of these interactions
sive expansion has been accomplished in the laboratory
( Fig. 27-22 ) .
Ten or more specific nucleotides may be involved in
(Box 2 7-3) .
recognition of a tRNA by its specific aminoacyl-tRNA 3'
synthetase. But in a few cases the recognition mecha
•
nism is quite simple. Across a range of organisms from bacteria to humans, the primary determinant of tRNA recognition by the Ala-tRNA synthetases is a single G U base pair in the amino acid arm of tRNAAJa (Fig. 27-2:1a) . =
•
5'
76
•
A short synthetic RNA with as few as 7 bp arranged in a simple hairpin minihelix is efficiently aminoacylated
3'
FIGURE 27-23 Structural elements of tRNAAi a that are required for recognition by Ala-tRNA synthetase. (a) The tRNAAi a structural elements recogn ized by the Ala-tRNA synthetase are un usual l y simple. A single G=U base pair (pink) is the only element needed for specific bind i ng and ami noacylation. (b) A short synthetic RNA m i n i hel ix, with the critical G=U base pair but lacking most of the rema i n i ng tRNA structure. Th i s is a m i noacylated spec ifica lly with alanine a l most as efficiently as the compl ete tRNAAi a_
(a)
(b)
27.2 Protein Synthesis
� 08�
Nat u ra l a n d U n n atura l Expa n s i o n of---t h e G e n et i c Code ----�
�------�-
As we have seen, the 20 amino acids commonly found in proteins offer only limited chemical functionality. Living systems generally overcome these limitations by using enzymatic cofactors or by modifying particular amino acids after they have been incorporated into proteins. In principle, expansion of the genetic code to introduce new amino acids into proteins offers another route to new functionality, but it is a very difficult route to ex ploit. Such a change might just as easily result in the in activation of thousands of cellular proteins . Expanding the genetic code to include a new amino acid requires several cellular changes. A new aminoacyl tRNA synthetase must generally be present, along with a cognate tRNA. Both of these components must be highly specific, interacting only with each other and the new amino acid. Significant concentrations of the new amino acid must be present in the cell, which may entail the evolution of new metabolic pathways. As outlined in Box 27-1, the anticodon on the tRNA would most likely pair with a codon that normally specifies termination. Making all of this work in a living cell seems unlikely, but it has happened both in nature and in the laboratory. There are actually 22 rather than 20 amino acids specified by the known genetic code. The two extra ones are selenocysteine and pyrrolysine, each found in only a very few proteins but both offering a glimpse into the in tricacies of code evolution. coo
I H3N-CH I CH2 I SeH Selenocysteine +
Pyrrolysine
A few proteins in all cells (such as formate dehydro genase in bacteria and glutathione peroxidase in mam mals) require selenocysteine for their activity. In E. coli selenocysteine is introduced into the enzyme formate dehydrogenase during translation, in response to an in frame UGA codon. A special type of Ser-tRNA, present at lower levels than other Ser-tRNAs, recognizes UGA and no other codons. This tRNA is charged with serine by the normal serine aminoacyl-tRNA synthetase, and the ser ine is enzymatically converted to selenocysteine by a separate enzyme before its use at the ribosome. The charged tRNA does not recognize just any UGA codon;
some contextual signal in the mRNA, still to be identified, ensures that this tRNA recognizes only the few UGA codons, within certain genes, that specify selenocysteine. In effect, UGA doubles as a codon for both termination and (very occasionally) selenocysteine. This particular code expansion has a dedicated tRNA as described above, but it lacks a dedicated cognate aminoacyl-tRNA synthetase. The process works for selenocysteine, but one might consider it an intermediate step in the evolu tion of a complete new codon definition. Pyrrolysine is found in a group of anaerobic archaea called methanogens (see Box 22- 1 ) . These organisms produce methane as a required part of their metabolism, and the Methanosarcinaceae group can use methyl amines as substrates for methanogenesis. Producing methane from monomethylamine requires the enzyme monomethylamine methyltransferase. The gene encod ing this enzyme has an in-frame UAG termination codon. The structure of the methyltransferase was elucidated in 2002, revealing the presence of the novel amino acid pyrrolysine at the position specified by the UAG codon. Subsequent experiments demonstrated that-unlike se lenocysteine-pyrrolysine was attached directly to a dedicated tRNA by a cognate pyrrolysyl-tRNA syn thetase. These cells produce pyrrolysine via a metabolic pathway that remains to be elucidated. The overall sys tem has all the hallmarks of an established codon assign ment, although it only works for UAG codons in this particular gene. As in the case of selenocysteine, there are probably contextual signals that direct this tRNA to the correct UAG codon. Can scientists match this evolutionary feat? Modifi cation of proteins with various functional groups can provide important insights into the activity and/or struc ture of the proteins. However, protein modification is of ten quite laborious. For example, an investigator who wishes to attach a new group to a particular Cys residue will have to somehow block the other Cys residues that may be present on the same protein. If one could instead adapt the genetic code to enable a cell to insert a modi fied amino acid at a particular location in a protein, the process could be rendered much more convenient. Peter Schultz and coworkers have done just that. To develop a new codon assignment, one again needs a new aminoacyl-tRNA synthetase and a novel cognate tRNA, both adapted to work only with a par ticular new amino acid. E fforts to create such an "un natural" code expansion initially focused on E. coli. The codon UAG was chosen as the best target for en coding a new amino acid. UAG is the least used of the three termination codons, and strains with tRNAs se lected to recognize UAG (see Box 27-4) do not ex hibit growth defects. To create the new tRNA and (continued on next page)
� 08�
Protein Metabolism
B OX 27-3
Nat u ra l a n d U n n a t u r a l E x pa n s i o n of t h e G e n et i c Cod e
--------�-
(continued from 3'
l
Expression
MjtRNATyr gene Randomize MjtRNATy• sequence at 1 1 po ition transform cells to create library.
Add plasmid encoding engineered barnase gene. Barnase gene
Library
( ((
�
----�----�"
J
1
l
® Cells containing MjtRNATyr variants aminoacylated by endogenous tRNA synthetases die. Survivors have MjtRNATyr variant that are not aminoacylated.
Negative s lection
Remove barnase plasmid.
MjTyrRS gene
#
..
Add plasmid encoding MjTyrRS and engineered 13-lactamase gene.
13-lactamase gene
Grow in medium containing ampicillin .
(
!
Po itive election
1
®
Cells live only if they contain MjtRNATyr variants aminoacylated by MjTyrRS. FIGURE 1 Selecting MjtRNATyr variants that function only with the tyro
by endogenous (E. coli) a m i noacyl-tRNA synthetases, i nserting an
syl tRNA synthetase MJTyrRS. The sequence of the gene encod ing Mj tRNATY•, on a plasmid, is randomized at 1 1 positions that do not interact
/3-lactamase, a n d also engineered with TAG sequences t o produce UAG
with MJTyrRS (red dots). The mutageni zed plasmids are introduced i nto £. coli cells to create a l i brary of m i l l ions of MjtRNATyr variants, rep resented by the six cells shown here. The toxic barnase gene, engi
amino acid i n stead of stopping translation. Another gene, encod i n g stop codons, is provided on yet another plasmid that also expresses the gene encodi ng MJTyrRS. This serves as a means of positive selection for T the remaining MjtRNA yr variants. Those variants that are ami noacy
neered to include the sequence TAG so that its transcript incl udes UAG
lated by MJTyrRS al low expression of the /3-lactamase gene, which al
codons, is provided on a separate plasmid, providing a negative selec
lows cells to grow on ampic i l l i n . Mu ltiple rounds of negative and positive selection yield the best MjtRNATyr variants that are aminoacyl
tion. If this gene is expressed, the cel l s die. It can only be expressed if the MjtRNATyr variant expressed by that particular cel l is ami noacyl ated
ated u n iquely by MJTyrRS and used efficiently in translation.
27.2 Protein Synthesis
� 08�
tRNA synthetase , the genes for a tyrosyl-tRNA and its
its transcript contained several UAG codons and intro
cognate tyrosyl-tRNA synthetase were taken from the
ducing this gene into the cells along with the gene en
archaean
coding MjTyrRS. Those MjtRNATyr variants that could
Methanococcus jannaschii (MjtRNATyr
and MjTyrRS) . MjTyrRS does not bind to the anti
be aminoacylated by MjTyrRS allowed growth on ampi
codon loop of MjtRNATyr, allowing the anticodon loop
cillin only when MjTyrRS was also expressed in the cell.
to be modified to CUA (complementary to UAG) with
Several rounds of this negative and positive selection scheme identified a new MjtRNATyr variant that was not
out affecting the interaction. Because the archaeal and bacterial systems are orthologous, the modified
affected by endogenous enzymes, was aminoacylated
archaeal components could be transferred to
by MjTyrRS, and functioned well in translation.
E. coli
Second, the MjTyrRS had to be modified to recog
cells without disrupting the intrinsic translation sys tem of the cells.
nize the new amino acid. The gene encoding MjTyrRS
ified to generate an ideal product tRNA-one that was
variants . Variants that would aminoacylate the new
First, the gene encoding MjtRNATyr had to be mod
was now mutagenized to create a large library of MjtRNATyr variant with endogenous amino acids were
not recognized by any aminoacyl-tRNA synthetases en
E. coli, but was aminoacylated by Mj
eliminated using the barnase gene selection. A second
TyrRS. Finding such a variant could be accomplished
positive selection (similar to the ampicillin selection
dogenous to
via a series of negative and positive selection cycles de
above) was carried out so that cells would survive only if
signed to efficiently sift through variants of the tRNA
the MjtRNATyr variant was aminoacylated only in the
gene (Fig.
1). Parts of the MjtRNATyr sequence were
presence of the unnatural amino acid. Several rounds of
randomized, allowing creation of a library of cells that
negative and positive selection generated a cognate
each expressed a different version of the tRNA. A gene
tRNA synthetase-tRNA pair that recognized only the un
encoding barnase (a ribonuclease toxic to
E. coli) was
natural amino acid. These components were then re
engineered so that its mRNA transcript contained sev
named to reflect the unnatural amino acid used in the
eral UAG codons, and this gene was also introduced
selection.
pressed in a particular cell in the library was aminoacyl
constructed, each capable of incorporating one particular
into the cells on a plasmid. If the MjtRNATyr variant ex
Using this approach, many E.
coli strains have been
ated by an endogenous tRNA synthetase it would
unnatural amino acid into a protein in response to a
express the barnase gene and that cell would die (a
UAG codon. The same approach has been used to artifi
negative selection) . Surviving cells would contain tRNA
cially expand the genetic code of yeast and even mam
variants that were not aminoacylated by endogenous
malian cells. Over 30 different amino acids (Fig. 2) can
tRNA synthetases, but could potentially be aminoacyl
be
ated by MjTyrRS. A positive selection (Fig.
introduced site-specifically and efficiently into
cloned proteins in this way. The result is an increasingly
1) was then
set up by engineering the /3-lactamase gene (which
useful and flexible toolkit with which to advance the
confers resistance to the antibiotic ampicillin) so that
study of protein structure and function.
coo +
I
H3N-CH
I
coo+
I
H3N- CH
I
I
H3N- CH
I
Q Q Q C=O
N
CH3
N+
I
II
II
N-
(a)
(b)
C-N F" / \ // c N /1 F F
(c)
coo -
coo -
coo+
+
I
+
I
H3N- CH
H3N- CH
I
I
Do
Q
(d)
(e)
CH2
I
0
0
OH
Br
coo-
I + H3N-CH I
CH2
I
CH2
I
CH2
I
I
CH2 SH
(f)
FIGURE 2 A sa mpling of un natural amino acids that have been added
with a nearby group when activated by l ight), (d) a highly fluorescent
to the genetic code. These un natural amino acids add u n i quely reac-
amino acid, (e) an amino acid with a heavy atom (Br) for use in crys-
tive chemical groups such as (a) a ketone, (b) an azide, (c) a pho-
tal l ography, and (f ) a long-chain cysteine analog that can form ex-
tocross l i nker (a functional group designed to form a covalent bond
tended disu lfide bonds.
� 08�
Protein Metabolism
Stage 2 : A Specific Amino Acid I nitiates Protein Synthesis
Protein synthesis begins at the amino-terminal end and proceeds by the stepwise addition of amino acids to the carboxyl-terminal end of the growing polypeptide, as determined by Howard Dintzis in 1961 (Fig. 2 7-24). The AUG initiation codon thus specifies an amino terminal methionine residue. Although methionine has only one codon, (5')AUG, all organisms have two tRNAs for methionine. One is used exclusively when (5')AUG is the initiation codon for protein synthesis. The other is used to code for a Met residue in an internal position in a polypeptide. The distinction between an initiating (5')AUG and an internal one is straightforward. In bacteria, the two types of tRNA specific for methionine are designated tRNAMet and tRNAfMet. The amino acid incorporated in response to the (5')AUG initiation codon is N-formylmethionine (fMet) . It arrives at the ribosome as N-formylmethionyl tRNA!Met (fMet-tRNA!Met) , which is formed in two succes sive reactions. First, methionine is attached to tRNAfMet by the Met-tRNA synthetase (which in E. coli amino acylates both tRNAfMet and tRNAMet) : Methionine
+ tRNAfMet + ATP
-----+
+ AMP + PP;
Next, a transformylase transfers a formyl group from N10-formyltetrahydrofolate to the amino group of the Met residue: Met-tRNAfMet
-----+
tetrahydrofolate + tMet-tRNAfMet
The transformylase is more selective than the Met tRNA synthetase; it is specific for Met residues attached to tRNAfMet, presumably recognizing some unique struc tural feature of that tRNA. By contrast, Met-tRNAMet inserts methionine in interior positions in polypeptides. H
l
Amino terminus
Carboxyl terminus
4 min 7 min
16 min 60 min 146
1 Residue number
FIGURE 27-24 Proof that polypeptides grow by addition of amino add residues to the carboxyl end: the Dintzis experiment. Reticulo cytes (im mature erythrocytes) actively synthesizing hemoglobin were i ncubated with radioactive leucine (sel ected because it occurs fre quently i n both the a- and {3-globin chains). Samples of completed a chains were isolated from the reticu l ocytes at various times afterward, and the d i stribution of radioactivity was determ i ned. The dark red zones show the portions of completed a-globin cha ins conta i n i ng ra dioactive Leu residues. At 4 m i n, only a few residues at the carboxyl
end of a-globin were labeled, because the only complete globin
chains with incorporated label after 4 min were those that had nearly
completed synthesis at the time the label was added. With longer incu
Met-tRNAfMet
N10-Formyltetrahydrofolate +
Direction of chain growth
coo
I
H-C-N-C-H II I 0 CH2 I CH2 I
s I
CH3 N-Formylmethionine
Addition of the N-formyl group to the amino group of methionine by the transformylase prevents fMet from entering interior positions in a polypeptide while also al lowing fMet-tRNAfMet to be bound at a specific ribosomal initiation site that accepts neither Met-tRNAMet nor any other aminoacyl-tRNA. In eukaryotic cells, all polypeptides synthesized by cytosolic ribosomes begin with a Met residue (rather than fMet) , but, again, the cell uses a specialized initiat ing tRNA that is distinct from the tRNAMet used at (5 ')AUG codons at interior positions in the mRNA.
bation ti mes, successively longer segments of the polypeptide con tained labeled residues, a lways in a block at the carboxyl end of the chain. The u n labeled end of the polypeptide (the a m i no termi nus) was thus defined as the i n itiating end, which means that polypeptides grow by successive addition of amino acids to the carboxyl end.
Polypeptides synthesized by mitochondrial and chloroplast ribosomes, however, begin with N-formylmethionine. This strongly supports the view that mitochondria and chloroplasts originated from bacterial ancestors that were symbiotically incorporated into precursor eukary otic cells at an early stage of evolution (see Fig. 1-36) . How can the single (5')AUG codon determine whether a starting N-formylmethionine (or methionine, in eukaryotes) or an interior Met residue is ultimately inserted? The details of the initiation process provide the answer. The initiation of polypeptide synthesis in bacteria requires (1) the 308 ri bosomal subunit, (2) the mRNA coding for the polypep tide to be made, (3) the initiating fMet-tRNAfMet, (4) a set of three proteins called initiation factors (IF-1, IF-2, and IF-3) , (5) GTP, (6) the 50S ribosomal subunit, and (7) Mg2 + . Formation of the initiation complex takes place in three steps (Fig. 2 7-25) . In step CD the 30S ribosomal subunit binds two initi ation factors, IF-1 and IF-3. Factor IF-3 prevents the 30S and 50S subunits from combining prematurely. The mRNA then binds to the 30S subunit. The initiating (5')AUG is guided to its correct position by the Shine Dalgarno sequence (named for Australian researchers John Shine and Lynn Dalgarno, who identified it) in the The Three Steps of Initiation
27.2 Protein Synthesis
8 ----
308 subunit
\(
8
3'
'
( 3 ' ) UAC (5' J Anticodon
3'
®
3'
FIGURE 27-25 Formation o f the initiation complex i n bacteria. The com plex forms i n three steps (described in the text) at the expense of the hy drolysis of GTP to GOP and P;. I F-1 , I F-2, and IF-3 are initiation factors. P designates the peptidyl site, A the ami noacyl site, and E the exit site. Here the anticodon of the tRNA is oriented 3 ' to 5 ', left to right, as in Figure 27-8 but opposite to the orientation in Figures 27-21 and 27-2 3 .
�08�
mRNA. This consensus sequence is an initiation signal of four to nine purine residues, 8 to 13 bp to the 5' side of the initiation codon (Fig. 2 7-26a) . The sequence base-pairs with a complementary pyrimidine-rich se quence near the 3' end of the 16S rRNA of the 30S riboso mal subunit (Fig. 27-26b) . This mRNA-rRNA interaction positions the initiating (5')AUG sequence of the mRNA in the precise position on the 30S subunit where it is re quired for initiation of translation. The particular (5')AUG where fMet-tRNAfMet is to be bound is distinguished from other methionine codons by its proximity to the Shine Dalgarno sequence in the mRNA. Bacterial ribosomes have three sites that bind tRNAs, the aminoacyl (A) site , the peptidyl (P) site , and the exit (E) site. The A and P sites bind to aminoacyl tRNAs, whereas the E site binds only to uncharged tRNAs that have completed their task on the ribosome. Both the 30S and the 50S subunits contribute to the charac teristics of the A and P sites, whereas the E site is largely confined to the 50S subunit. The initiating (5')AUG is positioned at the P site, the only site to which fMet-tRNAfMet can bind (Fig. 27-25). The fMet tRNAfMet is the only aminoacyl-tRNA that binds first to the P site; during the subsequent elongation stage, all other incoming aminoacyl-tRNAs (including the Met tRNAMet that binds to interior AUG codons) bind first to the A site and only subsequently to the P and E sites. The E site is the site from which the "uncharged" tRNAs leave during elongation. Factor IF-1 binds at the A site and prevents tRNA binding at this site during initiation. In step ® of the initiation process (Fig. 27-25), the complex consisting of the 30S ribosomal subunit, IF-3, and mRNA is joined by both GTP-bound IF-2 and the ini tiating fMet-tRNAfMet . The anticodon of this tRNA now pairs correctly with the mRNA's initiation codon. In step ® this large complex combines with the 50S ribosomal subunit; simultaneously, the GTP bound to IF-2 is hydrolyzed to GOP and Pi, which are released from the complex. All three initiation factors depart from the ribosome at this point. Completion of the steps in Figure 27-25 produces a functional 70S ribosome called the initiation complex, containing the mRNA and the initiating fMet-tRNAfMet. The correct binding of the fMet-tRNAfMet to the P site in the complete 70S initiation complex is assured by at least three points of recognition and attachment: the codon-anticodon interaction involving the initiation AUG fixed in the P site; interaction between the Shine Dalgarno sequence in the mRNA and the 16S rRNA; and binding interactions between the ribosomal P site and the fMet-tRNAfMet . The initiation complex is now ready for elongation. Translation is gener ally similar in eukaryotic and bacterial cells; most of the significant differences are in the mechanism of initia tion. Eukaryotic mRNAs are bound to the ribosome as a Initiation in Eukaryotic Cells
� 09�
Protein Metabolism
coli trpA (5') A G c A c G .Pt G coli araB u u u G G A u 0: E. coli lacl c A A u u c A G ¢>Xl 74 phage A protein A A u c u u G G A phage cro A u G u A c u A E.
E.
G G G A G AG u G G tJ G A 0: 0: c
A A u c u G A u G G A A C G C U A C (3') G A A A c G A u G G c G A U U G C A
u
G A A u G u G
A A A c C A G U A
u u u u u u A u G
G u u c G U U c u G A A C A A C G C
G
A G 0: A G G u
u G u A u G
\
Shine-Dalgarno sequence; pairs with 168 rRNA
Initiation codon; pairs with fMet-tRNAIMet
(a)
3'
Bacterial mRNA with consensus Shine-Dalgarno sequence
3' end of 16S rRNA
OH
I
I I I
G A
A u c u u c c 11 c c A
(5') G A u u c c u A G G A G G u u U G A c c U
A O Q IJII· IIJ-IJ IIIIII III.
(b) FIGURE 27-26 Messenger R N A sequences that serve a s signals for initi
tions of the mRNA transcripts of five bacterial genes are shown. Note the
ation of protein synthesis in bacteria. (a) Alignment of the i n itiating
unusual example of the E. coli Lacl protein, which i n itiates with a GUG
AUG (shaded in green) at its correct location on the 305 ribosomal sub
(Val) codon (see Box 2 7-1 ) . (b) The 5hine-Dalgarno sequence of the
unit depends i n part on upstream 5hine-Dalgarno sequences (pink). Por-
mRNA pairs with a sequence near the 3' end of the 1 65 rRNA.
complex with a number of specific binding proteins. Several of these tie together the 5' and 3 ' ends of the message. At the 3 ' end, the mRNA is bound by the poly(A) binding protein (PAB) . Eukaryotic cells have at least nine initiation factors. A complex called eiF4F, which includes the proteins eiF4E , eiF4G, and eiF4A, binds to the 5' cap (see Fig. 26-13) through eiF4E . The protein eiF4G binds to both eiF4E and PAB, effectively tying them together (Fig. 2 7-27 ). The protein eiF4A has an RNA helicase activity. It is the eiF4F complex that associates with another factor, eiF3, and with the 40S ribosomal subunit. The efficiency of translation is affected by many properties of the mRNA and proteins in this complex, including the length of the 3' poly(A)
tract (in most cases, longer is better) . The end-to-end arrangement of the eukaryotic mRNA facilitates transla tional regulation of gene expression, considered in Chapter 28. The initiating (5')AUG is detected within the mRNA not by its proximity to a Shine-Dalgarno-like se quence but by a scanning process: a scan of the mRNA from the 5' end until the first AUG is encountered, sig naling the beginning of the reading frame. The eiF4F complex is probably involved in this process, perhaps using the RNA helicase activity of eiF4A to eliminate secondary structure in the 5' untranslated portion of the mRNA. Scanning is also facilitated by another pro tein, eiF4B.
40S rihosomal.subunit
FIGURE 27-27 Protein complexes in the for mation of a eukaryotic initiation complex. The 3' and 5 ' ends of eukaryotic mRNAs are l i n ked by a complex of proteins that incl udes several i n itiation factors and the poly(A) binding protein (PAB). The factors eiF4E and e i F4G are part of a larger complex called ei F4F. This complex b i nds to the 405 ri boso mal subunit.
Gene
3' untranslated region
(3 ' )
27.2 Protein Synthesis
� 09�
TAB L E 27-8 Factor
Function
Bacterial
IF-1
Prevents premature binding of tRNAs to A site
IF-2
Facilitates binding of fMet-tRNAfMet to 308 ribosomal subunit
IF-3
Binds to 308 subunit; prevents premature association of 508 subunit; enhances specificity of P site for fMet-tRNAfMet
Eukaryotic
eiF2
Facilitates binding of initiating Met-tRNAMet to 40S ribosomal subunit
eiF2B, eiF3
First factors to bind 408 subunit; facilitate subsequent steps
eiF4A
RNA helicase activity removes secondary structure in the mRNA to permit binding to 408 subunit; part of the eiF4F complex
eiF4B
Binds to mRNA; facilitates scanning of mRNA to locate the first AUG
eiF4E
Binds to the 5' cap of mRNA; part of the eiF4F complex
eiF4G
Binds to eiF4E and to poly(A) binding protein (PAB) ; part of the eiF4F complex
eiF5
Promotes dissociation of several other initiation factors from 40S subunit as a prelude to association of 60S subunit to form 80S initiation complex
eiF6
Facilitates dissociation of inactive 80S ribosome into 408 and 60S subunits
The roles of the various bacterial and eukaryotic ini tiation factors in the overall process are sunuuarized in Table 2 7-8. The mechanism by which these proteins act is an important area of investigation. Stage 3: Peptide Bonds Are Formed in the Elongation Stage
The third stage of protein synthesis is elongation. Again, our initial focus is on bacterial cells. Elongation requires (1) the initiation complex described above, (2) aminoacyl-tRNAs, (3) a set of three soluble cytosolic proteins called elongation factors (EF-Tu, EF-Ts, and EF-G in bacteria) , and (4) GTP. Cells use three steps to add each amino acid residue, and the steps are repeated as many times as there are residues to be added. Elongation Step 1 : Binding of an Incoming Aminoacyl-tRNA In the first step of the elongation cycle (Fig. 2 7-28), the appropriate incoming aminoacyl tRNA binds to a complex of GTP-bound EF-Tu. The resulting aminoacyl-tRNA-EF-Tu-GTP complex binds to the A site of the 708 initiation complex. The GTP is hydrolyzed and an EF-Tu-GDP complex is released from the 708 ribosome. The EF-Tu-GTP complex is regenerated in a process involving EF-Ts and GTP. Elongation Step 2: Peptide Bond Formation A peptide bond is now formed between the two amino acids bound by their tRNAs to the A and P sites on the ribosome. This occurs by the transfer of the initiating N-formylmethionyl group from its tRNA to the amino
group of the second amino acid, now in the A site ( Fig. 2 7-2 9 ) . The a-amino group of the amino acid in the A site acts as a nucleophile, displacing the tRNA in the P site to form the peptide bond. This reaction produces a dipeptidyl-tRNA in the A site, and the now "uncharged" (deacylated) tRNAtMet remains bound to the P site. The tRNAs then shift to a hybrid binding state, with elements of each spanning two different sites on the ribosome, as shown in Figure 27-29. The enzymatic activity that catalyzes peptide bond formation has historically been referred to as peptidyl transferase and was widely assumed to be intrinsic to one or more of the proteins in the large ri bosomal subunit. We now know that this reaction is catalyzed by the 238 rRNA (Fig. 27-13d) , adding to the known catalytic repertoire of ribozymes. This dis covery has interesting implications for the evolution of life (see Box 27-2) . Elongation Step 3: 'Ii"anslocation In the final step of the elongation cycle, translocation, the ribosome moves one codon toward the 3' end of the mRNA (Fig. 27-30a). This movement shifts the anticodon of the dipeptidyl-tRNA, which is still attached to the second codon of the mRNA, from the A site to the P site, and shifts the deacylated tRNA from the P site to the E site, from where the tRNA is released into the cytosol. The third codon of the mRNA now lies in the A site and the second codon in the P site. Movement of the ribosome along the mRNA requires EF-G (also known as translocase) and the energy provided by hydrolysis of another molecule of GTP. A change in the three-dimensional conformation of
� 09�
Protein Metabolism
E site
Initiation complex
P site
A site
tl'llet !Metr-t.RNA Aminoacyl tRNA2
t
lncomin aminoacyl tRNA
peptide bond formation
binding of incom1ng
E site
aminoacyl tRNA
P ite
A site
Deacylated tM tRNA e t GDP
1 FIGURE 27-29 Second elongation step in bacteria: formation of the first peptide bond. The peptidyl transferase catalyzing this reaction is the 2 3 5 rRNA ribozyme. The N-formylmethionyl group is transferred to the amino group of the second ami noacyl-tRNA in the A site, forming FIGURE 27-28 First elongation step in bacteria: binding of the second aminoacyl-tRNA. The second ami noacyl-tRNA (AA2) enters the A site
a d i peptidyl-tRNA. At this stage, both tRNAs bound to the ribosome shift position i n the 505 subunit to take up a hybrid b i n d i ng state. The uncharged tRNA sh ifts so that its 3' and 5' ends are in the E site. Simi
of the ri bosome bound to E F-Tu (shown here as Tu), which also con
larly, the 3 ' and 5' ends of the peptidyl tRNA sh ift to the P site. The an
tains GTP. B i nding of the second ami noacyl-tRNA to the A site is ac
ticodons remain in the A and P sites.
companied by hydrolysis of the GTP to GOP and P; and release of the E F-Tu-G OP complex from the ribosome. The bound GOP is released when the E F-Tu-G O P complex b i nds to EF-Ts, and E F-Ts is subse quently released when another molecule of GTP bi nds to E F-Tu . Th is recycles E F-Tu and makes it ava i l able to repeat the cycle.
the entire ribosome results in its movement along the mRNA. Because the structure of EF-G mimics the structure of the EF-Tu-tRNA complex (Fig. 27-30b) , EF-G can bind the A site and presumably displace the peptidyl-tRNA.
After translocation, the ribosome, with its attached dipeptidyl-tRNA and mRNA, is ready for the next elon gation cycle and attachment of a third amino acid residue. This process occurs in the same way as addition of the second residue (as shown in Figs 27-28, 27-29, and 27-30) . For each amino acid residue correctly added to the growing polypeptide, two GTPs are hy drolyzed to GDP and Pi as the ribosome moves from codon to codon along the mRNA toward the 3 ' end.
2 7 . 2 Protein Synthesis
E site
P site
� 09�
A site
Deacylated tRNAf!lfet
(b) FIGURE 27-30 Third elongation step in bacteria: translocation. (a) The GTP
ri bosome moves one codon toward the 3' end of the mRNA, using en ergy provided by hydrolysis of GTP bound to EF-G (translocase). The
+ GDP + Pi
d i peptidyl-tRNA is now entirely in the P site, leaving the A site open for the i ncoming (third) ami noacyl-tRNA. The uncharged tRNA dissoci ates from the E site, and the elongation cycle begins again. (b) The struc
E site
P site
A site
ture of EF-G m i m ics the structure of EF-Tu complexed with tRNA. Shown here are (left) E F-Tu complexed with tRNA (green) (PDB ID 1 B23) and (right) EF-G complexed with GDP (red) (PDB I D 1 DAR). The
Incoming aminoacyl-tRNA3
carboxyl-terminal part of EF-G (dark gray) m i m ics the structure of the anticodon loop of tRNA in both shape and charge distribution.
(eEF la, eEFl,By, and eEF2) have functions analogous to those of the bacterial elongation factors (EF- Tu, EF Ts, and EF-G, respectively) . Eukaryotic ribosomes do not have an E site; uncharged tRNAs are expelled di rectly from the P site.
Direction of ribosome movement (a)
The polypeptide remains attached to the tRNA of the most recent amino acid to be inserted. This associa tion maintains the functional connection between the information in the mRNA and its decoded polypeptide output. At the same time, the ester linkage between this tRNA and the carboxyl terminus of the growing polypep tide activates the terminal carboxyl group for nucle ophilic attack by the incoming amino acid to form a new peptide bond (Fig. 27-29) . As the existing ester linkage between the polypeptide and tRNA is broken during peptide bond formation, the linkage between the polypep tide and the information in the mRNA persists, because each newly added amino acid is still attached to its tRNA. The elongation cycle in eukaryotes is quite similar to that in bacteria. Three eukaryotic elongation factors
Proofreading on the Ribosome The GTPase activity of EF-Tu during the first step of elongation in bacterial cells (Fig. 27-28) makes an important contribution to the rate and fidelity of the overall biosynthetic process. Both the EF-Tu-GTP and EF-Tu-GDP complexes exist for a few milliseconds before they dissociate. These two intervals provide opportunities for the codon-anticodon interactions to be proofread. Incorrect aminoacyl-tRNAs normally dis sociate from the A site during one of these periods. If the GTP analog guanosine 5' -0-(3-thiotriphosphate) (GTPyS) is used in place of GTP, hydrolysis is slowed, improving the fidelity (by increasing the proofreading intervals) but re ducing the rate of protein synthesis. Guanosine 5' -0-(3-thiotriphosphate) (GTPyS)
s II
0 II
0 II
o-
o-
o-
-o- P-O-P-O-P-O-C H2
I
I
I
OH
OH
� 09�
Protein Metabolism
I nd u ced Va riati o n i n t h e G e n et i c Cod e : No n s e n s e S u p p ress i o n When a mutation produces a termination codon in the interior of a gene, translation is prematurely halted and the incomplete polypeptide is usually inactive. These are called nonsense mutations. The gene can be re stored to normal function if a second mutation either ( 1 ) converts the misplaced termination codon to a codon specifying an amino acid or (2) suppresses the ef fects of the termination codon. Such restorative muta tions are called nonsense suppressors; they generally involve mutations in tRNA genes to produce altered (suppressor) tRNAs that can recognize the termination codon and insert an amino acid at that position. Most known suppressor tRNAs have single base substitutions in their anticodons. Suppressor tRNAs constitute an experimentally in duced variation in the genetic code to allow the reading of what are usually termination codons, much like the naturally occurring code variations described in Box 27-1 . Nonsense suppression does not completely disrupt normal information transfer in a cell, because the cell usually has several copies of each tRNA gene; some of these duplicate genes are weakly expressed and account for only a minor part of the cellular pool of a particular tRNA. Suppressor mutations usually involve a "minor" tRNA, leaving the major tRNA to read its codon normally. For example, E. coli has three identical genes for tRNATYr , each producing a tRNA with the anticodon
(5') GUA. One of these genes is expressed at relatively high levels and thus its product represents the major r tRNATY species; the other two genes are transcribed in only small amounts. A change in the anticodon of the tRNA product of one of these duplicate tRNATYr genes, from (5 ' ) GUA to (5')CUA, produces a minor tRNA1Yr species that will insert tyrosine at UAG stop codons . This insertion of tyrosine at UAG is carried out ineffi ciently, but it can produce enough full-length protein from a gene with a nonsense mutation to allow the cell to survive. The major tRNA1Yr continues to translate the genetic code normally for the majority of proteins. The mutation that leads to creation of a suppressor tRNA does not always occur in the anticodon. The sup pression of UGA nonsense codons generally involves the tRNATrp that normally recognizes UGG. The alteration that allows it to read UGA (and insert Trp residues at these positions) is a G to A change at position 24 (in an arm of the tRNA somewhat removed from the anti codon) ; this tRNA can now recognize both UGG and UGA. A similar change is found in tRNAs involved in the most common naturally occurring variation in the ge netic code (UGA Trp; see Box 27-1) . Suppression should lead to many abnormally long proteins, but this does not always occur. We understand only a few details of the molecular events in translation termination and nonsense suppression.
The process of protein synthesis (including the characteristics of codon-anticodon pairing already de scribed) has clearly been optimized through evolution to balance the requirements for speed and fidelity. Im proved fidelity might diminish speed, whereas in creases in speed would probably compromise fidelity. And, recall that the proofreading mechanism on the ri bosome establishes only that the proper codon-anti codon pairing has taken place, not that the correct amino acid is attached to the tRNA. If a tRNA is suc cessfully aminoacylated with the wrong amino acid (as can be done experimentally) , this incorrect amino acid is efficiently incorporated into a protein in re sponse to whatever codon is normally recognized by the tRNA.
coded amino acid. Mutations in a tRNA anticodon that allow an amino acid to be inserted at a termination codon are generally deleterious to the cell (Box 27-4) . In bacteria, once a termination codon occupies the ribosomal A site, three termination factors, or re lease factors-the proteins RF- 1 , RF-2 , and RF-3contribute to (1) hydrolysis of the terminal peptidyl tRNA bond; (2) release of the free polypeptide and the last tRNA, now uncharged, from the P site; and (3) dis sociation of the 70S ribosome into its 30S and 50S sub units, ready to start a new cycle of polypeptide synthesis (Fig. 2 7-3 1 ) . RF-1 recognizes the termination codons UAG and UAA, and RF-2 recognizes UGA and UAA. Ei ther RF -1 or RF-2 (depending on which codon is pres ent) binds at a termination codon and induces peptidyl transferase to transfer the growing polypeptide to a wa ter molecule rather than to another amino acid. The re lease factors have domains thought to mimic the structure of tRNA, as shown for the elongation factor EF-G in Figure 27-30b. The specific function of RF-3 has not been firmly established, although it is thought to release the ribosomal subunit. In eukaryotes, a single release factor, eRF, recognizes all three termination codons .
Stage 4: Termi nation of Polypeptide Synthesis Requires a Special Signal
Elongation continues until the ribosome adds the last amino acid coded by the mRNA. Termination, the fourth stage of polypeptide synthesis, is signaled by the pres ence of one of three termination codons in the mRNA (UAA, UAG, UGA) , immediately following the final
=
27.2 Protein Synthesis
� 09�
FIGURE 27-31 Termination of protein synthesis in bacteria. Ter m i nation occurs i n response t o a term i nation codon i n t h e A site. F i rst, a release factor, RF (RF-1 or RF-2, depend i n g on which term i nation codon i s present), b i nds to the A site. Th is leads to hydrolysis of the ester l i n kage between the nascent polypeptide and the tRNA in the P site and release of the completed polypeptide. F i n a l l y, the m R NA, deacylated tRNA, and release factor leave the r i bosome, wh ich dis soc i ates i nto its 3 05 and 50S subun its, a i ded by r i bosome recyc l i ng factor ( R RF), I F-3, and energy provided by E F-G-med iated GTP
1
hydrolysis. The 3 05 s u b u n i t complex with I F-3 i s ready to beg i n another cycle o f translation (see F i g. 2 7-2 5 ) .
polypeptidyl-tRNA link hydrolyzed
Energy Cost of Fidelity in Protein Synthesis Syn thesis of a protein true to the information specified in its mRNA requires energy. Formation of each aminoacyl tRNA uses two high-energy phosphate groups. An additional ATP is consumed each time an incorrectly activated amino acid is hydrolyzed by the deacylation activity of an aminoacyl-tRNA synthetase, as part of its proofreading activity. A GTP is cleaved to GDP and P; during the first elongation step, and another during the translocation step. Thus, on average, the energy derived from the hydrolysis of more than four NTPs to NDPs is required for the formation of each peptide bond of a polypeptide. This represents an exceedingly large thermody namic "push" in the direction of synthesis: at least 4 X 30.5 kJ/mol 1 22 kJ/mol of phosphodiester bond en ergy to generate a peptide bond, which has a standard free energy of hydrolysis of only about - 2 1 kJ/mol. The net free-energy change during peptide bond synthesis is thus - 10 1 kJ/mol. Proteins are information-containing polymers. The biochemical goal is not simply the forma tion of a peptide bond but the formation of a peptide bond between two specified amino acids. Each of the high-energy phosphate compounds expended in this process plays a critical role in maintaining proper align ment between each new codon in the mRNA and its as sociated amino acid at the growing end of the polypeptide. This energy permits very high fidelity in the biological translation of the genetic message of mRNA into the amino acid sequence of proteins. =
� GDP �J P; +
RRF
di�o�a� components
� (§)
Ribosome recycling leads to dissociation of the translation components. The release factors dissociate from the posttermination complex (with an uncharged tRNA in the P site) , and are replaced by EF-G and a protein called ribosome recycling factor (RRF; Mr 20,300) . Hydrolysis of GTP by EF-G leads to dissocia tion of the 50S subunit from the 30S tRNA-mRNA com plex. EF-G and RRF are replaced by IF 3 , which promotes the dissociation of the tRNA. The mRNA is then released. The complex of IF-3 and the 30S subunit is then ready to initiate another round of protein syn thesis (Fig. 27-25) . -
Rapid Translation of a Single Message by Poly somes Large clusters of 10 to 1 00 ribosomes that are very active in protein synthesis can be isolated from both eukaryotic and bacterial cells. Electron micro graphs show a fiber between adjacent ribosomes in the cluster, which is called a polysome (Fig. 2 7-32 ). The connecting strand is a single molecule of mRNA that is being translated simultaneously by many closely spaced ribosomes, allowing the highly efficient use of the mRNA. In bacteria, transcription and translation are tightly coupled. Messenger RNAs are synthesized and trans lated in the same 5'�3' direction. Ribosomes begin
� 09�
Protein Metabolism
(b) Direction of translation
Ribosomes
FIGURE 27-32 Polysome. (a) Four ri bosomes translating a eu karyotic
polysome from the s i l k gland of a s i l kworm larva. The m RNA is being
mRNA molecule simultaneous ly, moving from the 5 ' end to the 3' end
translated by many ribosomes simultaneously. The nascent polypep
and synthesizing a polypeptide from the amino term inus to the car
tides become longer as the ribosomes move toward the 3 ' end of the
boxyl term i n us. (b) Electron m icrograph and explanatory diagram of a
m R NA. The final product of th is process is s i l k fibroin.
RNA
FIGURE 27-33 Coupling of transcription and translation in bacteria. The m RNA is translated by ri bosomes while it is sti l l being transcribed from DNA by RNA polymerase. Th is is possible because the mRNA in
3' ..{' 5 ' .,.
bacteria does not have to be transported from a nucleus to the cyto plasm before encountering ri bosomes. In th is schematic diagram the ri bosomes are depi cted as smal ler than the RNA polymerase. In reality 6 X 1 0 ) are an order of magnitude larger than
the ri bosomes (M, 2 . 7
the RNA polymerase (M, 3. 9 X 1 05 ) .
translating the 5 ' end of the mRNA before transcription is complete (Fig. 27-33). The situation is quite differ ent in eukaryotic cells, where newly transcribed mRNAs must leave the nucleus before they can be translated. Bacterial mRNAs generally exist for just a few min utes (p. 1 049) before they are degraded by nucleases. In order to maintain high rates of protein synthesis, the mRNA for a given protein or set of proteins must be made continuously and translated with maximum efficiency. The short lifetime of mRNAs in bacteria allows a rapid ces sation of synthesis when the protein is no longer needed. Stage 5: N ewly Synthesized Polypeptide Chains Undergo Folding and Processing
In the final stage of protein synthesis, the nascent polypeptide chain is folded and processed into its biologically active form. During or after its synthesis, the polypeptide progressively assumes its native conforma tion, with the formation of appropriate hydrogen bonds and van der Waals, ionic, and hydrophobic interactions. In this way the linear, or one-dimensional, genetic message in the mRNA is converted into the three dimensional structure of the protein. Some newly made
Direction of translation
proteins, bacterial, archaeal, and eukaryotic, do not at tain their final biologically active conformation until they have been altered by one or more processing reac tions called posttranslational modifications. Amino-Terminal and Carboxyl-Terminal Modifica tions The first residue inserted in all polypeptides is N-formylmethionine (in bacteria) or methionine (in eukazy otes) . However, the formyl group, the amino-terminal Met residue, and often additional amino-terminal (and, in some cases, carboxyl-terminal) residues may be removed enzy matically in formation of the final functional protein. In as many as 50% of eukazyotic proteins, the amino group of the amino-terminal residue is N-acetylated after translation. Carboxyl-terminal residues are also sometimes modified. Loss of Signal Sequences As we shall see in Sec tion 27.3, the 15 to 30 residues at the amino-terminal end
2 7 . 2 Protein Synthesis
coo
I
+
H3N-C-H
H3N-C-H
II
�
CH2-0-P-O-
I
o-
y
Phosphoserine coo-
I
+
H3N-C-H
I
0
I
0
II
O=P-o -
I
o-
1
H-C -0-P-o-
1
CH3
(a)
I
+
0
I
coo
o-
Phosphotyrosine
Phosphothreonine
+
coo
I
H3N-C-H
I
CH2
I
CH
- ooc
/ "
coo -
r-Carboxyglutamate
(b)
Methyllysine
Dimethyllysine coo +
I
H3N-C-H
I
CH2
I
CH2
I
C=O
I
0
I
CH3
some proteins are enzymatically phosphorylated by ATP ( Fig. 2 7-34a) ; the phosphate groups add negative charges to these polypeptides . The functional signifi cance of this modification varies from one protein to the next. For example , the milk protein casein has many phosphoserine groups that bind Ca2 + . Calcium, phos phate, and amino acids are all valuable to suckling young, so casein efficiently provides three essential nu trients. And as we have seen in numerous instances, phosphorylation-dephosphorylation cycles regulate the activity of many enzymes and regulatory proteins. Extra carboxyl groups may be added to Glu residues of some proteins. For example, the blood-clotting protein prothrombin contains a number of y-carboxyglutamate residues (Fig. 27-34b) in its amino-terminal region, intro duced by an enzyme that requires vitamin K. These car boxyl groups bind Ca2 + , which is required to initiate the clotting mechanism. Monomethyl- and dimethyllysine residues (Fig. 27-34c) occur in some muscle proteins and in cy tochrome c. The calmodulin of most species contains one trimethyllysine residue at a specific position. In other proteins , the carboxyl groups of some Glu residues un dergo methylation, removing their negative charge. Attachment of Carbohydrate Side Chains The carbohydrate side chains of glycoproteins are attached covalently during or after synthesis of the polypeptide. In some glycoproteins, the carbohydrate side chain is attached enzymatically to Asn residues (N-linked oligosaccharides) , in others to Ser or Thr residues CO linked oligosaccharides) (see Fig. 7-29) . Many proteins that function extracellularly, as well as the lubricating proteoglycans that coat mucous membranes, contain oligosaccharide side chains (see Fig. 7-27) . Addition of lsoprenyl Groups A number of eukary otic proteins are modified by the addition of groups derived from isoprene (isoprenyl groups) . A thioether bond is formed between the isoprenyl group and a Cys residue of the protein (see Fig. 1 1-1 4) . The isoprenyl groups are derived from pyrophosphorylated intermedi ates of the cholesterol biosynthetic pathway (see Fig. 2 1-35) , such as farnesyl pyrophosphate (Fig. 2 7-35) . 0
0
(c)
Trimethyllysine
Methylglutamate
FIGURE 27-34 Some modified amino acid residues. (a) Phosphory lated amino acids. (b) A carboxyl ated amino acid. (c) Some methy lated amino acids.
II
II
:")
-o- P-0- P-0-C H2
6-
y @-sH Ras protein
of some proteins play a role in directing the protein to its ultimate destination in the cell. Such signal sequences are eventually removed by specific peptidases. Modification of Individual Amino Acids The hy droxyl groups of certain Ser, Thr, and Tyr residues of
� 09J
G
Farnesyl pyrophosphate
PP;
- S -CH2
Farnesylated Ras protein
FIGURE 27-35 Farnesylation of a Cys residue. The thioether l i n kage is shown i n red. The Ras protein is the product of the ras oncogene.
�09�
Protein Metabolism
Proteins modified in this way include the Ras proteins , products of the ras oncogenes and proto-oncogenes, and G proteins (both discussed in Chapter 1 2) , and lamins, proteins found in the nuclear matrix. The iso prenyl group helps to anchor the protein in a membrane. The transforming (carcinogenic) activity of the ras oncogene is lost when isoprenylation of the Ras protein is blocked, a finding that has stimulated interest in iden tifying inhibitors of this posttranslational modification pathway for use in cancer chemotherapy. Addition of Prosthetic Groups Many proteins require for their activity covalently bound prosthetic groups. Two examples are the biotin molecule of acetyl GoA carboxylase and the heme group of hemoglobin or cytochrome c. Proteolytic Processing Many proteins are initially synthesized as large, inactive precursor polypeptides that are proteolytically trimmed to form their smaller, active forms. Examples include proinsulin, some viral proteins, and proteases such as chymotrypsinogen and trypsinogen (see Fig. 6-38) . Formation of Disulfide Cross-Links After folding into their native conformations, some proteins form in trachain or interchain disulfide bridges between Cys residues. In eukaryotes, disulfide bonds are common in proteins to be exported from cells. The cross-links formed in this way help to protect the native conforma tion of the protein molecule from denaturation in the ex tracellular environment, which can differ greatly from intracellular conditions and is generally oxidizing.
producing peptidyl-puromycin (Fig. 2 7-36 ) . How ever, because puromycin resembles only the 3' end of the tRNA, it does not engage in translocation and dis sociates from the ribosome shortly after it is linked to the carboxyl terminus of the peptide . This prema turely terminates polypeptide synthesis. Tetracyclines inhibit protein synthesis in bacteria by blocking the A site on the ribosome, preventing the binding of aminoacyl-tRNAs. Chloramphenicol inhibits protein synthesis by bacterial (and mitochondrial and chloroplast) ribosomes by blocking peptidyl transfer; it does not affect cytosolic protein synthesis in eukaryotes. Conversely, cycloheximide blocks the peptidyl trans ferase of 808 eukaryotic ribosomes but not that of 708 bacterial (and mitochondrial and chloroplast) ribosomes. Streptomycin, a basic trisaccharide, causes misreading of the genetic code (in bacteria) at relatively low concen trations and inhibits initiation at higher concentrations. CH3 CH3
'
/
OH
OH
0
OH
Tetracycline
-o- I I I I I
NH-C-CHC}z
0 2N
CH-CH OH
0
CH2
OH
Chloramphenicol
Protein Synthesis Is Inhibited by Many Antibiotics and Toxins
Protein synthesis is a central function in cellular physiol ogy and is the primary target of many naturally occurring antibiotics and toxins. Except as noted, these antibiotics inhibit protein synthesis in bacteria. The differences be tween bacterial and eukaryotic protein synthesis, though in some cases subtle, are sufficient that most of the compounds discussed below are relatively harmless to eukaryotic cells. Natural selection has favored the evolu tion of compounds that exploit minor differences in order to affect bacterial systems selectively, such that these biochemical weapons are synthesized by some microorganisms and are extremely toxic to others. Be cause nearly every step in protein synthesis can be specifically inhibited by one antibiotic or another, antibi otics have become valuable tools in the study of protein biosynthesis. Puromycin, made by the mold Streptomyces al boniger, is one of the best-understood inhibitory an tibiotics. Its structure is very similar to the 3 ' end of an aminoacyl-tRNA, enabling it to bind to the riboso mal A site and participate in peptide bond formation,
H
OH
H
Streptomycin
Several other inhibitors of protein synthesis are no table because of their toxicity to humans and other mammals. Diphtheria toxin (Mr 58,330) catalyzes the ADP-ribosylation of a diphthamide (a modified
27.2 Protein Synthesis
P site peptidyl-tRNA
A site puromycin
histidine) residue of eukaryotic elongation factor eEF2, thereby inactivating it. Ricin CMr 29,895) , an extremely toxic protein of the castor bean, inactivates the 60S sub unit of eukaryotic ribosomes by depurinating a specific adenosine in 23S rRNA.
S U M M A R Y 27. 2 •
•
•
�'"'"'!
tr 1 1 1 rt·r r
t
(a)
•
P rote i n S y n t h e s i s
Protein synthesis occurs on the ribosomes, which consist of protein and rRNA. Bacteria have 70S ribosomes, with a large (50S) and a small (30S) subunit. Eukaryotic ribosomes are significantly larger (80S) and contain more proteins. Transfer RNAs have 73 to 93 nucleotide residues, some of which have modified bases. Each tRNA has an amino acid arm with the terminal sequence CCA(3 ') to which an amino acid is esterified, an anticodon arm, a Tlj!C arm, and a D arm; some tRNAs have a fifth arm. The anticodon is responsible for the specificity of interaction between the aminoacyl tRNA and the complementary mRNA codon. The growth of polypeptides on ribosomes begins with the amino-terminal amino acid and proceeds by successive additions of new residues to the carboxyl-terminal end. Protein synthesis occurs in five stages. 1. Amino acids are activated by specific aminoacyl tRNA synthetases in the cytosol. These enzymes catalyze the formation of aminoacyl-tRNAs, with simultaneous cleavage of ATP to AMP and PPi. The fidelity of protein synthesis depends on the accuracy of this reaction, and some of these enzymes carry out proofreading steps at separate active sites. 2. In bacteria, the initiating aminoacyl-tRNA in all proteins is N-formylmethionyl-tRNAtMet . Initiation of protein synthesis involves formation of a complex between the 30S ribosomal subunit, mRNA, tM GTP, fMet-tRNA et, three initiation factors, and the 50S subunit; GTP is hydrolyzed to GDP and Pi. 3. In the elongation steps, GTP and elongation factors are required for binding the incoming aminoacyl-tRNA to the A site on the ribosome. In the first peptidyl transfer reaction, the fMet residue is transferred to the amino group of the incoming aminoacyl-tRNA. Movement of the ribosome along the mRNA then translocates the dipeptidyl-tRNA from the A site to the P site, a process requiring hydrolysis of GTP. Deacylated tRNAs dissociate from the ribosomal E site.
(b) FIGURE 27-36
G 09�
Disruption of peptide bond formation by puromycin.
(a) The antibiotic puromycin resembles the ami noacyl end of a charged tRNA, and it can bind to the ri bosomal A site and partici pate in peptide bond formation (see Fig. 2 7-1 3d). The product of this reaction, i nstead
of being translocated to the P site, dissociates from the ri bosome, caus ing premature cha i n term ination. (b) Peptidyl puromycin.
4. After many such elongation cycles, synthesis of the polypeptide is terminated with the aid of release factors. At least four high-energy phosphate equivalents (from ATP and GTP) are required to generate each peptide bond, an energy investment required to guarantee fidelity of translation.
i j 1 oo
Protein Metabo lism
5. Polypeptides fold into their active , three dimensional forms. Many proteins are further processed by posttranslational modification reactions. •
Many well-studied antibiotics and toxins inhibit some aspect of protein synthesis.
27.3 Protein Ta rgeti ng a n d Deg radation The eukaryotic cell is made up of many structures, com partments, and organelles, each with specific functions that require distinct sets of proteins and enzymes. These proteins (with the exception of those produced in mitochondria and plastids) are synthesized on ribosomes in the cytosol, so how are they directed to their final cellular destinations? We are now beginning to understand this complex and fascinating process. Proteins destined for secretion, integration in the plasma membrane, or inclusion in lysosomes generally share the first few steps of a pathway that begins in the endoplasmic reticulum. Pro teins destined for mitochondria, chloroplasts, or the nucleus use three separate mechanisms. And proteins destined for the cytosol simply remain where they are synthesized. The most important element in many of these tar geting pathways is a short sequence of amino acids called a signal sequence, whose function was first pos tulated by Gunter Blobel and colleagues in 1 970. The signal sequence directs a protein to its appropriate location in the cell and, for many proteins, is removed during transport or after the protein has reached its final destination. In proteins slated for transport into mito chondria, chloroplasts, or the ER, the signal sequence is at G u nter B lobel the amino terminus of a newly
Human influenza virus A Human preproinsulin Bovine growth
�� Bee promellitin
Posttranslational Modification of Many Eu karyotic Proteins Begins in the Endoplasmic Reticu l u m
Perhaps the best-characterized targeting system begins in the ER. Most lysosomal, membrane, or secreted proteins have an amino-terminal signal sequence ( Fig. 2 7-:3 7 ) that marks them for translocation into the lumen of the ER; hundreds of such signal sequences have been determined. The carboxyl terminus of the signal sequence is defined by a cleavage site, where protease action removes the sequence after the protein is im ported into the ER. Signal sequences vary in length from 1 3 to 36 amino acid residues, but all have the following features: (1) about 1 0 to 1 5 hydrophobic amino acid residues; (2) one or more positively charged residues, usually near the amino terminus, preceding the hy drophobic sequence; and (3) a short sequence at the carboxyl terminus (near the cleavage site) that is rela tively polar, typically having amino acid residues with short side chains (especially Ala) at the positions closest to the cleavage site. As originally demonstrated by George Palade, pro teins with these signal sequences are synthesized on ribosomes attached to the ER. The signal sequence itself helps to direct the ribosome to the ER, as illustrated by steps CD through ® in Figure 2 7-38 . CD The targeting cleavage site
� � � � � �� � � �� � � � � � �� •
� � � � � � � � � � � � � � � �� � � � � � � � � � � •
� � � � � � � � � � � � � � � � � � � � � � � � � � ,j. � � �
Drosophila glue protein
synthesized polypeptide. In many cases, the targeting capacity of particular signal sequences has been con firmed by fusing the signal sequence from one protein to a second protein and showing that the signal directs the second protein to the location where the first pro tein is normally found. The selective degradation of proteins no longer needed by the cell also relies largely on a set of molecular signals embedded in each pro tein's structure . In this concluding section we examine protein tar geting and degradation, emphasizing the underlying sig nals and molecular regulation that are so crucial to cellular metabolism. Except where noted, the focus is now on eukaryotic cells.
� � � � � � � � � � � � � � � & � � & � � � fu � •
� � � � � � � � � � � � � & � � � � � � � � � � � •
FIGURE 27-37 Amino-terminal signal sequences of some eukaryotic
the polar and short-side-chain residues im mediately preced i ng (to the
proteins that direct their translocation into the ER. The hydrophobic
left of, as shown here) the cleavage sites (indicated by red arrows).
core (yellow) is preceded by one or more basic residues (blue) . Note
2 7 . 3 Protein Targeting and Degradation
� 0� 1
Signal sequence
I
Ribosome cycle
SRP cycl
Cytosol
Ribosome
Endoplasmic reticulum
receptor
S�al peptidase
ER lumen
FIGURE 27-38 Directing eukaryotic proteins with the appropriate sig
sequence, i n h i b iting elongation by sterically blocking the entry of
nals to the endoplasmic reticulum. This process involves the SRP cycle
a m i noacyl-tRNAs and i n h i b iting peptidyl transferase. Another protein
and translocation and cleavage of the nascent polypeptide. The steps
subunit b i nds and hydrolyzes GTP. The SRP receptor is a heterodimer
are described in the text. SRP is a rod-shaped complex conta i n i ng a
of a (M, 69,000) and f3 (M, 30, 000) subunits, both of which bind and
300 nucleotide RNA (7SL-RNA) and six different proteins (combined
hydrolyze multiple GTP molecules during th i s process.
M, 3 2 5,000) . One protein subu n it of SRP bi nds d i rectly to the signal
pathway begins with initiation of protein synthesis on free ri bosomes. ® The signal se quence appears early in the synthetic process, because it is at the amino terminus, which as we have seen is synthesized first. ® As it emerges from the ribosome, the signal se quence-and the ribosome it self-are bound by the large George Pa lade signal recognition particle (SRP) ; SRP then binds GTP and halts elongation of the polypeptide when it is about 70 amino acids long and the signal sequence has com pletely emerged from the ribosome. @ The GTP-bound SRP now directs the ribosome (still bound to the mRNA) and the incomplete polypeptide to GTP-bound SRP receptors in the cytosolic face of the ER; the nas cent polypeptide is delivered to a peptide transloca tion complex in the ER, which may interact directly with the ribosome. @ SRP dissociates from the ribo some, accompanied by hydrolysis of GTP in both SRP and the SRP receptor. @ Elongation of the polypeptide
now resumes, with the ATP-driven translocation com plex feeding the growing polypeptide into the ER lu men until the complete protein has been synthesized. (j) The signal sequence is removed by a signal peptidase within the ER lumen; @ the ribosome dissociates and is recycled. G lycosylation Plays a Key Role i n Protein Ta rgeting
In the ER lumen, newly synthesized proteins are fur ther modified in several ways . Following the removal of signal sequences, polypeptides are folded, disulfide bonds formed, and many proteins glycosylated to form glycoproteins. In many glycoproteins the linkage to their oligosaccharides is through Asn residues. These N-linked oligosaccharides are diverse (Chapter 7) , but the pathways by which they form have a com mon first step . A 14 residue core oligosaccharide is built up in a stepwise fashion, then transferred from a dolichol phosphate donor molecule to certain Asn residues in the protein ( Fig. 2 7-39 ). The transferase is on the lumenal face of the ER and thus cannot cat alyze glycosylation of cytosolic proteins. After transfer,
[i 0 �
Protein Meta bolism
1
• N-Acetylglucosamine (GlcNAc)
CH3
CH3
e Mannose (Man)
CH3
e Glucose (Glc)
tunicamycin
5
GDP
5
GDP-Man
\__ �
I I I I
UMP + UDP.j.
2
\__®�
®
CH3 n Dolichol phosphate
UDP-GlcNAc
(n
=
9-22)
Endoplasmic reticulum 4 Dolichol-®-Man
:
4 Dolichol-® 3 3
Dolichol-®-Glc Dolichol-®
Cytosol
mRNA
3' FIGURE 27-39
Synthesis of the core oligosaccharide of glycoproteins.
The core ol igosaccharide is b u i lt up by the successive addition of monosaccharide units. (!), Q) The first steps occur on the cytosolic face
Tunicamycin
@ Translocation moves the incomplete oligosaccharide across the membrane (mechanism not shown), and @ completion of the core
of the ER.
ol igosaccharide occurs with i n the l u men of the ER. The precursors that
N-Acetylglucosamine
contribute additional mannose and gl ucose residues to the growing ol igosaccharide i n the l u men are dol ichol phosphate derivatives. I n the first step in the construction of the N- l i nked oligosaccharide moiety of a glycoprotei n,
(0, ®
the core oligosaccharide is transferred from
dol ichol phosphate to an Asn res i d ue of the protei n with i n the ER l u men . The core ol igosaccharide is then further modified i n t h e E R a n d the Golgi complex in pathways that differ for different proteins . The five sugar residues shown su rrounded by a beige screen (after step
0l
Uracil
are reta i ned in the fi nal structure of a l l N- l i n ked ol igosaccharides .
@ The released dol ichol
pyrophosphate is again translocated so that
the pyrophosphate is on the cytosol i c face of the ER, then
® a phos-
phate is hydrolytica l l y removed to regenerate dol ichol phosphate.
Fatty acyl side chain
the core oligosaccharide is trimmed and elaborated in different ways on different proteins, but all N-linked oligosaccharides retain a pentasaccharide core derived from the original 14 residue oligosaccharide. Several antibiotics act by interfering with one or more steps in this process and have aided in elucidating the steps of protein glycosylation. The best-characterized is tuni camycin, which mimics the structure of UDP-N acetylglucosamine and blocks the first step of the process (Fig. 27-39, step (D) . A few proteins are 0glycosylated in the ER, but most 0-glycosylation oc curs in the Golgi complex or in the cytosol (for proteins that do not enter the ER) .
OH
OH
Tunicamine
Suitably modified proteins can now be moved to a variety of intracellular destinations. Proteins travel from the ER to the Golgi complex in transport vesicles ( Fig. 27-40) . In the Golgi complex, oligosaccharides are 0-linked to some proteins, and N-linked oligosaccharides are further modified. By mechanisms not yet fully un derstood, the Golgi complex also sorts proteins and sends them to their final destinations. The processes
2 7 . 3 Protei n Targeting and Degradation
FIGURE 27-40 Pathway taken by proteins destined for lysosomes, the .
plasma membrane, or secretion. Proteins are moved from the ER to the
· -
- ..
.
.. . '":' . .... . • ,
cis side of the Golgi complex in transport vesicles. Sorting occurs pri marily in the trans side of the Golgi complex.
that segregate proteins targeted for secretion from those targeted for the plasma membrane or lysosomes must distinguish among these proteins on the basis of structural features other than signal sequences, which were removed in the ER lumen. This sorting process is best understood in the case of hydrolases destined for transport to lysosomes. On arrival of a hydrolase (a glycoprotein) in the Golgi com plex, an as yet undetermined feature (sometimes called a signal patch) of the three-dimensional structure of the hydrolase is recognized by a phosphotransferase , which phosphorylates certain mannose residues in the oligosaccharide (Fig. 27-4 1 ) . The presence of one or more mannose 6-phosphate residues in its N-linked oligosaccharide is the structural signal that targets the protein to lysosomes. A receptor protein in the mem brane of the Golgi complex recognizes the mannose 6phosphate signal and binds the hydrolase so marked. Vesicles containing these receptor-hydrolase complexes
NH
I
0
ll
0
o
o-
...
Lysol1 .•
+
II o- p- o- P-o-1 UridineI I I
!:...Secretory granu1 Trana)>Ort vesicles
H
H
UDP N-Acetylglucosamine (UDP-GlcNAc)
0
II
0-P1 0
H
H
GlcNAc
l'
0
II
O-P-D- CH2
I
o-
FIGURE 27-41 Phosphorylation of mannose residues
on
lysosome-targeted
H H
0-jOligosaccharide� N
enzymes.
N-Acetylgl ucosamine phosphotransferase rec ogni zes some as yet u n identified structural feature of hydrolases destined for lysosomes.
"\
/� _L__
Hydrolase
residue
I
•r 1
•f�leX ' ��
O-iOiigos acch arid� N
CH3
pho 1 hodar
�
H
M anno
C=O
.."'"''\ I/Trans sid.e
H
H
Mannose 6-phosphate residue
� 1 0�
� 0� 1
Protein Metabolism
bud from the trans side of the Golgi complex and make their way to sorting vesicles. Here, the receptor-hydrolase complex dissociates in a process facilitated by the lower pH in the vesicle and by phosphatase-catalyzed removal of phosphate groups from the mannose 6-phosphate residues. The receptor is then recycled to the Golgi complex, and vesicles containing the hydrolases bud from the sorting vesicles and move to the lysosomes. In cells treated with tunicamycin (Fig. 27-39, step (j)) , hydrolases that should be targeted for lysosomes are instead secreted, confirming that the N-linked oligosac charide plays a key role in targeting these enzymes to lysosomes. The pathways that target proteins to mitochondria and chloroplasts also rely on amino-terminal signal se quences. Although mitochondria and chloroplasts con tain DNA, most of their proteins are encoded by nuclear DNA and must be targeted to the appropriate organelle. Unlike other targeting pathways, however, the mito chondrial and chloroplast pathways begin only after a precursor protein has been completely synthesized and released from the ribosome. Precursor proteins des tined for mitochondria or chloroplasts are bound by cy tosolic chaperone proteins and delivered to receptors on the exterior surface of the target organelle. Special ized translocation mechanisms then transport the pro tein to its final destination in the organelle, after which the signal sequence is removed. Signal Sequences for N uclear Transport Are Not Cleaved
Molecular communication between the nucleus and the cytosol requires the movement of macromolecules through nuclear pores. RNA molecules synthesized in the nucleus are exported to the cytosol. Ribosomal pro teins synthesized on cytosolic ribosomes are imported into the nucleus and assembled into 60S and 40S riboso mal subunits in the nucleolus; completed subunits are then exported back to the cytosol. A variety of nuclear proteins (RNA and DNA polymerases, histones, topoiso merases, proteins that regulate gene expression, and so forth) are synthesized in the cytosol and imported into the nucleus. This traffic is modulated by a complex sys tem of molecular signals and transport proteins that is gradually being elucidated. In most multicellular eukaryotes, the nuclear enve lope breaks down at each cell division, and once division is completed and the nuclear envelope reestablished, the dispersed nuclear proteins must be reimported. To allow this repeated nuclear importation, the signal sequence that targets a protein to the nucleus-the nuclear localization sequence, NLS-is not removed after the protein arrives at its destination. An NLS, un like other signal sequences, may be located almost any where along the primary sequence of the protein. NLSs can vary considerably, but many consist of four to eight amino acid residues and include several consecutive basic (Arg or Lys) residues.
Nuclear importation is mediated by a number of proteins that cycle between the cytosol and the nucleus (Fig. 2 7-42 ), including importin a and {3 and a small GTPase known as Ran (Ras-related nuclear protein) . A heterodimer of importin a and {3 functions as a soluble receptor for proteins targeted to the nucleus, with the a subunit binding NLS-bearing proteins in the cytosol. The complex of the NLS-bearing protein and the im portin docks at a nuclear pore and is translocated through the pore by an energy-dependent mechanism. In the nucleus, the importin {3 is bound by Ran GTPase, releasing importin {3 from the imported protein. Im portin a is bound by Ran and by CAS (cellular apoptosis susceptibility protein) and separated from the NLS bearing protein. Importin a and {3, in their complexes with Ran and CAS, are then exported from the nucleus. Ran hydrolyzes GTP in the cytosol to release the im portins, which are then free to begin another importa tion cycle. Ran itself is also cycled back into the nucleus by the binding of Ran-GDP to nuclear transport factor 2 (NTF2) . Inside the nucleus, the GDP bound to Ran is re placed with GTP through the action of Ran guanosine nucleotide exchange factor (RanGEF; see Box 12-2) . Bacteria Also Use Signal Sequences for Protein Targeting
Bacteria can target proteins to their inner or outer membranes, to the periplasmic space between these membranes, or to the extracellular medium. They use signal sequences at the amino terminus of the proteins (Fig. 2 7-43) , much like those on eukaryotic proteins targeted to the ER, mitochondria, and chloroplasts. Most proteins exported from E. coli make use of the pathway shown in Figure 2 7-44. Following translation, a protein to be exported may fold only slowly, the amino-terminal signal sequence impeding the folding. The soluble chaperone protein SecB binds to the pro tein's signal sequence or other features of its incom pletely folded structure . The bound protein is then delivered to SecA, a protein associated with the inner surface of the plasma membrane. SecA acts as both a re ceptor and a translocating ATPase. Released from SecB and bound to SecA, the protein is delivered to a translo cation complex in the membrane, made up of SecY, E , and G , and is translocated stepwise through the mem brane at the SecYEG complex in lengths of about 20 amino acid residues. Each step is facilitated by the hy drolysis of ATP, catalyzed by SecA. An exported protein is thus pushed through the membrane by a SecA protein located on the cytoplasmic surface, rather than being pulled through the membrane by a protein on the periplasmic surface. This difference may simply reflect the need for the translocating ATPase to be where the ATP is. The transmembrane electrochem ical potential can also provide energy for translocation of the protein, by an as yet unknown mechanism. Although most exported bacterial proteins use this pathway, some follow an alternative pathway that uses
I
(a)
I
1 ..:! 1 0�
2 7 . 3 Protein Targeting and Degradation
(b)
Cytosol
Nuclear p.rotein
�NLS
p
20 h
Destabilizing
Ile, Gin
�
Tyr, Glu
�
30 min IO min
Pro
�
Leu, Phe, Asp, Lys
�
Arg
�
Modified from Bachmair, A., Finley, D.,
of a protein is a function of its amino-terminal
7 min
3 min
2 min
& Varshavsky, A. ( 1986) In vivo half-life residue. Science 234, 179-186.
* Half-lives were measured in yeast for the ,a-galactosidase protein modified so that in each experiment it had a different amino-terminal residue. Half-lives may vary for differ
conditions: renal diseases, asthma, neurodegenerative dis orders such as Alzheimer's and Parkinson's diseases (asso ciated with the formation of characteristic proteinaceous structures in neurons) , cystic fibrosis (caused in some with resultant loss of function; see Box 1 1-3) , Liddle's syndrome (in which a sodium channel in the kidney is not degraded, leading to excessive Na + absorption and early onset hypertension)-and many other disorders. Drugs designed to inhibit proteasome function are being devel oped as potential treatments for some of these conditions. In a changing metabolic environment, protein degradation is as important to a cell's survival as is protein synthesis, and much remains to be learned about these interesting pathways.
•
S U M M A RY 27. 3
ent proteins and in different organisms, but this general pattern appears to hold for all organisms. •
Although we do not yet understand all the signals
mechanism involves a peptide signal sequence, synthesized protein.
residue that remains after removal of the amino-terminal •
on
half-life
(Table
2 7-9) .
which binds the signal sequence as soon as it
These
appears on the ribosome and transfers the entire
amino-terminal signals have been conserved over bil
ribosome and incomplete polypeptide to the ER.
lions of years of evolution, and are the same in bacterial
Polypeptides with these signal sequences are
protein degradation systems and in the human ubiquiti
moved into the ER lumen as they are synthesized;
nation pathway. More complex signals, such as the de
once in the lumen they may be modified and moved
struction box discussed in Chapter 12 (see Fig. 12-46) ,
to the Golgi complex, then sorted and sent to
are also being identified.
lysosomes, the plasma membrane, or transport
Ubiquitin-dependent proteolysis is as important for
vesicles.
the regulation of cellular processes as for the elimina tion of defective proteins. Many proteins required at
In eukaryotic cells, one class of signal sequences is recognized by the signal recognition particle (SRP) ,
olytic processing of the amino-terminal end, has a pro influence
After synthesis, many proteins are directed to
generally found at the amino terminus of a newly
found. For many proteins , the identity of the first Met residue, and any other posttranslational prote
Prote i n Ta rgeti n g a n d D e g ra d a t i o n
particular locations in the cell. One targeting
that trigger ubiquitination, one simple signal has been
found
1
cases by a too-rapid degradation of a chloride ion channel,
Stabilizing
Source:
� 0�
•
Proteins targeted to mitochondria and chloroplasts
only one stage of the eukaryotic cell cycle are rapidly
in eukaryotic cells, and those destined for export in
degraded by the ubiquitin-dependent pathway after
bacteria, also make use of an amino-terminal signal
completing their function. Ubiquitin-dependent de
sequence .
struction of cyclin is critical to cell-cycle regulation (see Fig. 12-46) . The E 2 and E3 components of the ubiquiti
•
signal sequence that, unlike other signal sequences,
nation pathway (Fig. 27-47) are in fact two large fami
is not cleaved once the protein is successfully
lies of proteins . Different E2 and E 3 enzymes exhibit
targeted.
different specificities for target proteins and thus regu late different cellular processes. Some E2
and E 3
•
Not surprisingly, defects in the ubiquitination path way have been implicated in a wide range of dis ease states.
An inability to degrade certain proteins that
Some eukaryotic cells import proteins by receptor-mediated endocytosis.
enzymes are highly localized i n certain cellular compart ments, reflecting a specialized function.
Proteins targeted to the nucleus have an internal
•
All cells eventually degrade proteins , using specialized proteolytic systems. Defective proteins and those slated for rapid turnover are generally degraded by an ATP-dependent system. In eukaryotic
activate cell division (the products of oncogenes) can lead
cells, the proteins are first tagged by linkage
to tumor formation, whereas a too-rapid degradation of
to ubiquitin, a highly conserved protein.
proteins that act as tumor suppressors can have the same
Ubiquitin-dependent proteolysis is carried out by
effect. The ineffective or overly rapid degradation of cellu
proteasomes, also highly conserved, and is critical
lar proteins also appears to play a role in a range of other
to the regulation of many cellular processes.
� � 11
Protein Metab o l ism
Schimmel, P. & Beebe, K. (2004) Molecular biology-genetic code
Key Terms
seizes pyrrolysine . Nature 431, 257-258.
Stadtman, T.C. ( 1 996) Selenocysteine . Annu. Rev Biochem. 65, 83-100.
Terms in bold are defined in the glossary.
aminoacyl-tRNA
1066
aminoacyl-tRNA
codon
1094 1 094 release factors 1094 polysome 1095 suppressor
1066 1066
synthetases translation
nonsense
1066
1067 1069 termination codons 1069 reading frame
termination
posttranslational modification
initiation codon
open reading frame (ORF)
1 069 1070 1072
anticodon wobble
translational
1072 1 073
frameshifting RNA editing
initiation
1088
Shine-Dalgarno sequence 1088 aminoacyl (A) site 1089 peptidyl (P) site 1 089 exit (E) site 1089 initiation complex 1089 elongation 1091 elongation factors peptidyl transferase
translocation
1091 1091
1 091
1096
1 098 tetracyclines 1098 chloramphenicol 1098 cycloheximide 1098
puromycin
streptomycin 1098 diphtheria toxin 1098 ricin 1099 signal sequence 1 1 00 signal recognition particle (SRP) 1 10 1 peptide translocation complex 1 10 1 tunicamycin 1 102 nuclear localization sequence (NLS) 1 104 coated pits 1 106 clathrin 1 106 dynamin 1 106 ubiquitin 1 107 proteasome 1 1 08
Further Reading
Vetsigian, K., Woese, C., & Goldenfeld, N. (2006) Collective evolution and the genetic code . Proc_ Natl. Acad. Sci USA 103, 1 0,696-1 0,701 _ Xie, J.M. & Schultz, P.G. (2006) Innovation: a chemical toolkit for proteins-an expanded genetic code . Nat. Rev. Mol. Cell Biol. 7, 775-782. Yanofsky, C. (2007) Establishing the triplet nature of the genetic code Cell 128, 8 1 5-818. Yarus, M., Caporaso, J.G., & Knight, R. (2005) Origins of the genetic code: the escaped triplet theory. Annu. Rev Biochem. 7 4, 1 79-198.
Protein Synthesis Ban, N., Nissen, P., Hansen, J., Moore, P.B., & Steitz, T.A. (2000) The complete atomic structure of the large ribosomal subunit at 2.4 angstrom resolution. Science 289, 905-920 . The first high-resolution structure of a major ribosomal subunit.
Bjork, G.R., Ericson, J.U., Gustafsson, C.E.D., Hagervall, T.G., Jonsson, Y.H., & Wikstrom, P.M. ( 1 987) Transfer RNA modifica tion. Annu. Rev Biochem. 56, 263-288. Chapeville, F., Lipmann, F., von Ehrenstein, G., Weisblum, B., Ray, W.J., Jr. , & Benzer, S. ( 1 962) On the role of soluble ribonu cleic acid in coding for amino acids. Proc. Natl Acad Sci USA 48, 1086-1092. Classic experiments providing proof for Crick's adaptor hypothesis and showing that amino acids are not checked after they are linked to tRNAs.
Dintzis, H.M. ( 1 96 1 ) Assembly of the peptide chains of hemoglobin. Proc Natl. Acad Sci. USA 47, 247-2 6 1 . A classic experiment establishing that proteins are assembled beginning at the amino terminus .
Giege, R., Sissler, M., & Florentz, C. ( 1 998) Universal rules and idiosyncratic features in tRNA identity. Nucleic Acid Res. 26,
5017-5035.
Genetic Code Ambrogelly, A., Palioura, S., & Soli, D. (2007) Natural expansion of the genetic code. Nat Chem Biol. 3, 29-35. Blanc, V. & Davidson, N.O. (2003) C-to-U RNA editing: mechanisms leading to genetic diversity. J. Biol. Chem. 278, 1395-1398. Crick, F.H.C. ( 1 966) The genetic code: III. Sci Am. 215 (October) , 55-62. An insightful overview of the genetic code at a time when the
code words had just been worked out.
Hohn, M.J., Park, H.S., O'Donoghue, P. , Schnitzbauer, M., & Soli, D. (2006) Emergence of the universal genetic code imprinted in an RNA record. Proc. Natl. Acad. Sci USA 103, 18,095-18,100. Klobutcher, L.A. & Farabaugh, P.J. (2002) Shifty ciliates: frequent programmed translational frarneshifting in Euplotids.
Cell 1 1 1 , 763-766. Levanon, K., Eisenberg E., Rechavi G., & Levanon, E.Y. (2005) Letter from the editor: adenosine-to-inosine RNA editing in Alu repeats in the human genome. EMBO Rep _ 6, 831-835_
Gray, N.K. & Wickens, M. ( 1 998) Control of translation initiation in animals . Annu. Rev. Cell Dev Biol 14, 399-458 .
lbba, M. & Soli, D. (2000) Arninoacyl-tRNA synthesis . Annu. Rev Biochem. 69, 6 1 7-650. Kapp, L.D. & Lorsch, J.R. (2004) The molecular mechanics of eukaryotic translation Annu. Rev. Biochem_ 73, 657-704_ Korostelev, A., Trakhanov, S., Laurberg, M., & Noller, H.F. (2006) Crystal structure of a 70S ribosome-tRNA complex reveals functional interactions and rearrangements. Cell 126, 1 065-1077. Moore, P.B. & Steitz, T.A. (2003) The structural basis of large ribosomal subunit function. Annu Rev. Biochem. 72, 813-850. Peske, F., Rodnina, M.V., & Wrntermeyer, W. (2005) Sequence of steps in ribosome recycling as defined by kinetic analysis_ Mol Cell 18, 403-41 2. Poehlsgaard, J. & Douthwaite, S. (2005) The bacterial ribosome as a target for antibiotics. Nat Rev. Microbial 3, 870-881 . Rodnina, M.V. & Wintermeyer, W. (2001) Fidelity of aminoacyl tRNA selection on the ribosome: kinetic and structural mechanisms.
Maas, S., Rich, A., & Nishikura, K. (2003) A-to-! RNA editing: recent news and residual mysteries. J. Biol. Chem 278, 139 1-1394.
Annu_ Rev. Biochem_ 70, 4 1 5-435.
Neeman, Y., Dahary, D., & Nishikura, K. (2006) Editor meets silencer: crosstalk between RNA editing and RNA interference . Nat. Rev_ Mol_ Cell Biol. 7, 9 1 9-93 1 .
Microbial. Mol Biol. Rev. 64, 202-236 .
Nirenberg, M . (2004) Historical review: deciphering the genetic code-a personal account. Trends Biochem Sci. 29, 46-54_
DeMartino, G.N. & Gillette, T.G. (2007) Proteasomes: machines for all reasons. Cell 129, 659-662.
Woese, C.R., Olsen, G.J., Ibba, M., & Soli, D. (2000) Arninoacyl tRNA synthetases, the genetic code, and the evolutionary process .
Protein Targeting and Secretion
Problems
� � 11
Hartmann-Petersen, R., Seeger, M., & Gordon C. (2003) Transferring substrates to the 26S proteasome. Trends Biochem. Sci. 28, 26-3 1 .
(b) What amino acid sequence could be coded by the mRNA in (a) , starting from the 5' end? (c) If the complementary (nontemplate) strand of this
Higgins, M.K. & McMahon, H.T. (2002) Snap-shots of clathrin
DNA were transcribed and translated, would the resulting amino acid sequence be the same as in (b)? Explain the biolog
mediated endocytosis. Trends Biochem. Sci. 27, 257-263.
Liu, C.W., Li, X.H., Thompson, D., Wooding, K., Chang, T., Tang, Z., Yu, H., Thomas, P.J., & DeMartino, G.N. (2006) ATP binding and ATP hydrolysis play distinct roles in the function of 268 proteasome. Mol. Cell 24, 39-50.
Luzio, J.P., Pryor, P.R., & Bright, N.A. (2007) Lysosomes: fusion and function. Nat. Rev Mol. Cell Biol. 8, 622-632 . Mayor, S. & Pagano, R.E. (2007) Pathways of clathrin-independent endocytosis. Nat. Rev. Mol. Cell Biol. 8, 603-6 12 . Neupert, W. ( 1 997) Protein import into mitochondria. Annu. Rev. Biochem. 66, 863-9 1 7. Pickart, C.M. & Cohen, R.E. (2004) Proteasomes and their kin: proteases in the machine age. Nat Rev. Mol. Cell Biol 5, 1 77-187. Royle, S.J. (2006) The cellular functions of clathrin. Cell Mol Life Sci 63, 1823-1 832. Schatz, G. & Dobberstein, B. ( 1 996) Common principles of pro tein translocation across membranes. Science 271, 1 5 1 9-1525.
Schekman, R. (2007) How sterols regulate protein sorting and traf fic Proc Natl Acad Sci USA 104, 6496-6497.
Smalle, J. & Vierstra, R.D. (2004) The ubiquitin 268 proteasome proteolytic pathway. Annu Rev. Plant Biol 55, 555-590.
Stewart, M. (2007) Molecular mechanism of the nuclear protein im port cycle. Nat Rev. Mol. Cell Biol 8, 1 95-208.
Problems
ical significance of your answer. 5. Methionine Has Only One Codon Methionine is one of two amino acids with only one codon. How does the sin gle codon for methionine specify both the initiating residue
and interior Met residues of polypeptides synthesized by E. coli? 6. Synthetic mRNAs The genetic code was elucidated with polyribonucleotides synthesized either enzymatically or chem ically in the laboratory. Given what we now know about the ge netic code, how would you make a polyribonucleotide that could serve as an mRNA coding predominantly for many Phe residues and a small number of Leu and Ser residues? What other amino acid(s) would be coded for by this polyribonu cleotide, but in smaller amounts? 7. Energy Cost of Protein Biosynthesis Determine the minimum energy cost, in terms of ATP equivalents expended, required for the biosynthesis of the {3-globin chain of hemoglo bin (146 residues) , starting from a pool including all necessary amino acids, ATP, and GTP. Compare your answer with the di rect energy cost of the biosynthesis of a linear glycogen chain of 1 46 glucose residues in (a1�4) linkage, starting from a
sequences that can code for the simple tripeptide segment
pool including glucose, UTP, and ATP (Chapter 1 5) . From your data, what is the extra energy cost of making a protein, in which all the residues are ordered in a specific sequence, com pared with the cost of making a polysaccharide containing the same number of residues but lacking the informational content of the protein? In addition to the direct energy cost for the synthesis of a protein, there are indirect energy costs-those required for the cell to make the necessary enzymes for protein synthesis. Compare the magnitude of the indirect costs to a eukaryotic cell of the biosynthesis of linear (a1�4) glycogen chains and the biosynthesis of polypeptides, in terms of the enzymatic machinery involved.
Leu-Met-Tyr. Your answer will give you some idea about the number of possible mRNAs that can code for one polypeptide.
8. Predicting Anticodons from Codons Most amino
1 . Messenger RNA Translation Predict the amino acid se quences of peptides formed by ribosomes in response to the following mRNA sequences, assuming that the reading frame begins with the first three bases in each sequence. (a) GGUCAGUCGCUCCUGAUU (b) UUGGAUGCGCCAUAAUUUGCU (c) CAUGAUGCCUGUUGCUAC (d) AUGGACGAA 2 . How Many Different mRNA Sequences Can Specify
One Amino Acid Sequence? Write all the possible mRNA
3. Can the Base Sequence of an mRNA Be Predicted
from the Amino Acid Sequence of Its Polypeptide Prod uct? A given sequence of bases in an mRNA will code for one
and only one sequence of amino acids in a polypeptide, if the reading frame is specified. From a given sequence of amino acid residues in a protein such as cytochrome c, can we pre dict the base sequence of the unique mRNA that coded it? Give reasons for your answer. 4. Coding of a Polypeptide by Duplex DNA The template strand of a segment of double-helical DNA contains the sequence
(5') CTTAACACCCCTGACTTCGCGCCGTCG(3 ') (a) What is the base sequence of the mRNA that can be transcribed from this strand?
acids have more than one codon and attach to more than one tRNA, each with a different anticodon. Write all possible an ticodons for the four codons of glycine: (5')GGU, GGC, GGA,
and GGG. (a) From your answer, which of the positions in the anti codons are primary determinants of their codon specificity in the case of glycine? (b) Which of these anticodon-codon pairings has/have a wobbly base pair? (c) In which of the anticodon-codon pairings do all three positions exhibit strong Watson-Crick hydrogen bonding? 9. Effect of Single-Base Changes on Amino Acid Se
quence Much important confirmatory evidence on the ge netic code has come from assessing changes in the amino acid sequence of mutant proteins after a single base has been changed in the gene that encodes the protein. Which of the
� � 11
Protein Metabolism
following amino acid replacements would be consistent with the genetic code if the replacements were caused by a single base change? Which cannot be the result of a single-base mu tation? Why? (a) Phe�Leu (e) Ile�Leu (b) Lys�Ala (f) His� Glu (c) Ala�Thr (g) Pro� Ser (d) Phe� Lys 10. Basis of the Sickle-Cell Mutation Sickle-cell hemoglo bin has a Val residue at position 6 of the f3-globin chain, instead
of the Glu residue found in normal hemoglobin A. Can you pre dict what change took place in the DNA codon for glutamate to account for replacement of the Glu residue by Val? 1 1 . Proofreading by Aminoacyl-tRNA Synthetases The isoleucyl-tRNA synthetase has a proofreading function that ensures the fidelity of the aminoacylation reaction, but the histidyl-tRNA synthetase lacks such a proofreading function. Explain. 1 2 . Importance of the "Second Genetic Code" Some aminoacyl-tRNA synthetases do not recognize and bind the anticodon of their cognate tRNAs but instead use other struc tural features of the tRNAs to impart binding specificity. The tRNAs for alanine apparently fall into this category. (a) What features of tRNAAia are recognized by Ala-tRNA
synthetase? (b) Describe the consequences of a c � G mutation in the third position of the anticodon of tRNAAla. (c) What other kinds of mutations might have similar effects? (d) Mutations of these types are never found in natural populations of organisms. Why? (Hint: Consider what might happen both to individual proteins and to the organism as a whole.) 13. Maintaining the Fidelity of Protein Synthesis The chemical mechanisms used to avoid errors in protein synthesis are different from those used during DNA replication. DNA polymerases use a 3' �5· exonuclease proofreading activity to remove mispaired nucleotides incorrectly inserted into a
growing DNA strand. There is no analogous proofreading func tion on ribosomes and, in fact, the identity of an amino acid at tached to an incoming tRNA and added to the growing polypeptide is never checked. A proofreading step that hy drolyzed the previously formed peptide bond after an incor rect amino acid had been inserted into a growing polypeptide (analogous to the proofreading step of DNA polymerases) would be impractical. Why? (Hint: Consider how the link be tween the growing polypeptide and the mRNA is maintained during elongation; see Figs 27-29 and 27-30.) 14. Predicting the Cellular Location of a Protein The gene for a eukaryotic polypeptide 300 amino acid residues
long is altered so that a signal sequence recognized by SRP oc curs at the polypeptide's amino terminus and a nuclear local ization signal (NLS) occurs internally, beginning at residue 1 50. Where is the protein likely to be found in the cell?
1 5 . Requirements for Protein Translocation across a
Membrane The secreted bacterial protein OmpA has a pre
cursor, ProOmpA, which has the amino-terminal signal se quence required for secretion. If purified ProOmpA is denatured with 8 M urea and the urea is then removed (such as by running the protein solution rapidly through a gel filtra tion column) the protein can be translocated across isolated bacterial inner membranes in vitro. However, translocation be comes impossible if ProOmpA is first allowed to incubate for a few hours in the absence of urea. Furthermore, the capacity for translocation is maintained for an extended period if ProOmpA is first incubated in the presence of another bacter ial protein called trigger factor. Describe the probable function of this factor. 16. Protein-Coding Capacity of a Vll'al DNA The 5,386 bp
genome of bacteriophage cf>Xl 74 includes genes for 10 pro teins, designated A to K, with sizes given in the table below. How much DNA would be required to encode these 10 pro teins? How can you reconcile the size of the cf>X174 genome with its protein-coding capacity? Number of
Number of amino
amino
Protein
acid residues
Protein
acid residues
A B c D E
455 120 86 152 91
F G H
427 1 75 328 38 56
J
K
Data Analysis Problem 17. Designing Proteins b y Using Randomly Generated
Genes Studies of the amino acid sequence and corresponding
three-dimensional structure of wild-type or mutant proteins have led to significant insights into the principles that govern protein folding. An important test of this understanding would be to design a protein based on these principles and see whether it folds as expected. Kamtekar and colleagues (1 993) used aspects of the ge netic code to generate random protein sequences with defined patterns of hydrophilic and hydrophobic residues. Their clever approach combined knowledge about protein structure, amino acid properties, and the genetic code to explore the factors that influence protein structure. They set out to generate a set of proteins with the simple four-helix bundle structure shown at the top of page 1 1 13 (right) , with a helices (shown as cylinders) connected by segments of random coil (pink) . Each a helix is amphipathic the R groups on one side of the helix are exclusively hydropho bic (yellow) and those on the other side are exclusively hydrophilic (blue). A protein consisting of four of these helices separated by short segments of random coil would be expected to fold so that the hydrophilic sides of the helices face the solvent.
Problems
� � 11
the degenerate codon NTN, where N can be A, G, C, or T. They
filled each N position by including an equimolar mixture of A, G, C, and T in the DNA synthesis reaction to generate a mix ture of DNA molecules with different nucleotides at that posi tion (see Fig. 8-35) . Similarly, to encode random polar amino acid sequences, they began with the degenerate codon NAN
An
amphipathic a helix
Four-helix bundle
(a) What forces or interactions hold the four a helices to
and used an equimolar mixture of A, G, and C (but in this case, no T) to fill the N positions. (e) Which amino acids can be encoded by the NTN triplet? Are all amino acids in this set hydrophobic? Does the set include all the hydrophobic amino acids? (f) Which amino acids can be encoded by the NAN triplet? Are all of these polar? Does the set include all the po lar amino acids?
ment to be an amphipathic helix, with the left side hydrophilic and the right side hydrophobic. Give a sequence of 1 0 amino acids that could potentially fold into such a structure. There are many possible correct answers here. (d) Give one possible double-stranded DNA sequence that could encode the amino acid sequence you chose for (c) . (It is an internal portion of a protein, so you do not need to in clude start or stop codons.) Rather than designing proteins with specific sequences, Kamtekar and colleagues designed proteins with partially ran dom sequences, with hydrophilic and hydrophobic amino acid residues placed in a controlled pattern. They did this by taking
(g) In creating the NAN codons, why was it necessary to leave T out of the reaction mixture? Kamtekar and coworkers cloned this library of random DNA sequences into plasmids, selected 48 that produced the correct patterning of hydrophilic and hydrophobic amino acids, and expressed these in E. coli. The next challenge was to determine whether the proteins folded as expected. It would be very time-consuming to express each protein, crystallize it, and determine its complete three-dimensional structure. Instead, the investigators used the E. coli protein processing machinery to screen out sequences that led to highly defective proteins. In this initial screening, they kept only those clones that resulted in a band of protein with the expected molecular weight on SDS polyacrylamide gel electrophoresis (see Fig. 3-18) . (h) Why would a grossly misfolded protein fail to produce a band of the expected molecular weight on electrophoresis? Several proteins passed this initial test, and further explo ration showed that they had the expected four-helix structure. (i) Why didn't all of the random-sequence proteins that passed the initial screening test produce four-helix structures?
advantage of some interesting features of the genetic code to construct a library of synthetic DNA molecules with partially
Ueferenee
gether in this bundled structure? Figure 4-4a shows a segment of a helix consisting of 1 0 amino acid residues. With the gray central rod as a divider, four of the R groups (purple spheres) extend from the left side of the helix and six extend from the right. (b) Number the R groups in Figure 4-4a, from top (amino terminus; 1 ) to bottom (carboxyl terminus; 1 0) . Which R groups extend from the left side and which from the right? (c) Suppose you wanted to design this 10 amino acid seg
random sequences arranged in a particular pattern. To design a DNA sequence that would encode random hy drophobic amino acid sequences, the researchers began with
Kamtekar, S., Schiffer, J.M., Xiong, H., Babik, J.M., & Hecht, M.H. ( 1 993) Protein design by binary patterning of polar and non polar amino acids. Science 262, 1680-1685.
The fundamental problem of chemical physiology and of embryology is to u n derstand why tissue cel l s do not a l l express, a l l the ti me, a l l
p o te ntia l iti es i n herent i n their ge nom e.
the
-Franc;ois jacob and jacques Monad, article in journal of Mo l ecular Biology, 7 96 7
Regulation of Gene Expression 28.1
Principles of Gene Regulation
28.2
Regulation of Gene Expression in Bacteria
28.3
Regulation of Gene Expression in Eukaryotes
1116
O
1 1 26 1 1 36
f the 4,000 or so genes in the typical bacterial genome , or the perhaps 29 ,000 genes in the human genome, only a fraction are expressed in a cell at any given time. Some gene products are present in very large amounts: the elongation factors required for pro tein synthesis, for example, are among the most abun dant proteins in bacteria, and ribulose 1 ,5-bisphosphate carboxylase/oxygenase (rubisco) of plants and photo synthetic bacteria is, as far as we know, the most abun dant enzyme in the biosphere. Other gene products occur in much smaller amounts; for instance, a cell may contain only a few molecules of the enzymes that repair rare DNA lesions. Requirements for some gene products change over time. The need for enzymes in certain metabolic pathways may wax and wane as food sources change or are depleted. During development of a multi cellular organism, some proteins that influence cellular differentiation are present for just a brief time in only a few cells . Specialization of cellular function can dramat ically affect the need for various gene products; an ex ample is the uniquely high concentration of a single protein-hemoglobin-in erythrocytes. Given the high cost of protein synthesis, regulation of gene expression is essential to making optimal use of available energy. The cellular concentration of a protein is deter mined by a delicate balance of at least seven processes, each having several potential points of regulation: 1.
Synthesis of the primary RNA transcript (transcription)
2.
Posttranscriptional modification o f mRNA
3.
Messenger RNA degradation
4.
Protein synthesis (translation)
5.
Posttranslational modification of proteins
6.
Protein targeting and transport
7.
Protein degradation
These processes are summarized in Figure 28-1 . We have examined several of these mechanisms in previous chapters. Posttranscriptional modification of mRNA, by processes such as alternative splicing patterns (see Fig. 26-22) or RNA editing (see Figs 27-10, 27-12) , can affect which proteins are produced from an mRNA transcript and in what amounts. A variety of nucleotide sequences in an mRNA can affect the rate of its degrada tion (p. 1 048) . Many factors affect the rate at which an mRNA is translated into a protein, as well as the posttranslational modification, targeting, and eventual degradation of that protein (Chapter 27) . Of the regulatory processes illustrated in Figure 28-1 , those operating at the level of transcription initiation are the best documented and these are a major focus of this chapter; other mechanisms are also considered. Researchers continue to discover complex and some times surprising regulatory mechanisms, leading to an increasing appreciation of the importance of posttran scriptional and translational regulation, especially in eukaryotes. For many genes, the regulatory processes are elaborate and redundant and can involve a considerable investment of chemical energy. Control of transcription initiation permits the syn chronized regulation of multiple genes encoding prod ucts with interdependent activities. For example, when their DNA is heavily damaged, bacterial cells require a coordinated increase in the levels of the many DNA re pair enzymes. And perhaps the most sophisticated form of coordination occurs in the complex regulatory cir cuits that guide the development of multicellular eu karyotes, which can involve many types of regulatory mechanisms.
� � 11
Reg u l ation of Gene Exp ression
DNA ----.i
Gene
Transc•iption
Primary transcript Posttranscr�ptional processing
[\ 1 __/mRNA
Nucleotides
degradation
Mature mRNA � Translation
Protein (inactive)
Posttransl�tional processing
Amino acids
!V
• • • G
Modified protein (active)
1 FIGURE 28-1
Protein targeting and transport
Seven processes that affect the steady-state concen
tration of a protein. Each process has several potential poi nts of regu lation.
We begin by examining the interactions between proteins and DNA that are the key to transcriptional regulation. We next discuss the specific proteins that influence the expression of specific genes, first in bacte rial and then in eukaryotic cells. Information about post transcriptional and translational regulation is included in the discussion, where relevant, to provide a more complete overview of the rich complexity of regulatory mechanisms.
28.1 Principles of Gene Reg ulation Genes for products that are required at all times, such as those for the enzymes of central metabolic pathways, are expressed at a more or less constant level in virtually every cell of a species or organism. Such genes are often referred to as housekeeping genes. Unvarying expres sion of a gene is called constitutive gene expression.
For other gene products, cellular levels rise and fall in response to molecular signals; this is regulated gene expression. Gene products that increase in concentra tion under particular molecular circumstances are referred to as inducible; the process of increasing their expression is induction. The expression of many of the genes encoding DNA repair enzymes, for example, is induced by a system of regulatory proteins that re sponds to high levels of DNA damage. Conversely, gene products that decrease in concentration in response to a molecular signal are referred to as repressible, and the process is called repression. For example, in bacteria, ample supplies of tryptophan lead to repression of the genes for the enzymes that catalyze tryptophan biosynthesis. Transcription is mediated and regulated by protein DNA interactions, especially those involving the protein components of RNA polymerase (Chapter 26) . We first consider how the activity of RNA polymerase is regu lated, and proceed to a general description of the pro teins participating in this regulation. We then examine the molecular basis for the recognition of specific DNA sequences by DNA-binding proteins. RNA Polymerase Binds to DNA at Promoters
RNA polymerases bind to DNA and initiate transcription at promoters (see Fig. 26-5) , sites generally found near points at which RNA synthesis begins on the DNA tem plate. The regulation of transcription initiation often en tails changes in how RNA polymerase interacts with a promoter. The nucleotide sequences of promoters vary con siderably, affecting the binding affinity of RNA poly merases and thus the frequency of transcription initiation. Some Escherichia coli genes are transcribed once per second, others less than once per cell genera tion. Much of this variation is due to differences in pro moter sequence. In the absence of regulatory proteins, differences in promoter sequence may affect the fre quency of transcription initiation by a factor of 1 ,000 or more. Most E. coli promoters have a sequence close to a consensus (Fig. 28-2 ). Mutations that result in a shift away from the consensus sequence usually decrease promoter function; conversely, mutations toward con sensus usually enhance promoter function. Although housekeeping genes are expressed consti tutively, the cellular concentrations of the proteins they encode vary widely. For these genes, the RNA polymerase-promoter interaction strongly influences the rate of transcription initiation; differences in promoter sequence allow the cell to synthesize the appropriate level of each housekeeping gene product. The basal rate of transcription initiation at the pro moters of nonhousekeeping genes is also determined by the promoter sequence, but expression of these genes is further modulated by regulatory proteins.
2 8 . 1 Principles of Gene Regu lation
� j 11
RNA start site
DNA 5 ' --------k � �P el_e_ m_e_ n_ t __
FIGURE 28-2
�
-35 region
GACA ----�� TT_
� �
__
-10 region
LI
__ __
�
I
�
N�1� 7-- �-T_ AAT_L A_ T_
__ __ _
__
--
�
N �5� -9 ��-------------
__
mRNA
Consensus sequence for many f. coli promoters. Most base substitutions in the
-
\.f'VV"+
1 0 and
-35 regions have a negative effect on promoter function. Some promoters also incl ude the UP (upstream
promoter) element (see Fig. 2 6-5). By convention, DNA sequences are shown as they exist in the nontem plate strand, with the 5' term i n us on the left. Nucleotides are numbered from the transcription start site, with positive nu mbers to the right (in the di rection of transcription) and negative numbers to the left. N indicates any nucleotide.
Many of these proteins work by enhancing or interfer ing with the interaction between RNA polymerase and the promoter. The sequences of eukaryotic promoters are more variable than their bacterial counterparts (see Fig. 26-9). The three eukaryotic RNA polymerases usually require an array of general transcription factors in order to bind to a promoter. Yet, as with bacterial gene expres sion, the basal level of transcription is determined by the effect of promoter sequences on the function of RNA polymerase and its associated transcription factors. Transcri ption I n itiation Is Regulated by Proteins That Bind to or near Promoters
At least three types of proteins regulate transcription initiation by RNA polymerase: specificity factors alter the specificity of RNA polymerase for a given promoter or set of promoters; repressors impede access of RNA polymerase to the promoter; and activators enhance the RNA polymerase-promoter interaction. We introduced bacterial specificity factors in Chap ter 26 (see Fig. 26-5) , although we did not refer to them by that name. The u subunit of the E. coli RNA poly merase holoenzyme is a specificity factor that mediates promoter recognition and binding. Most E. coli promot ers are recognized by a single u subunit (M 70,000) , r u70. Under some conditions, some of the u70 subunits are replaced by one of six other specificity factors. One notable case arises when the bacteria are subjected to heat stress, leading to the replacement of u70 by u32 (Mr 32 000) . When bound to u32, RNA polymerase is di rected to a specialized set of promoters with a different ,
consensus sequence ( Fig. 2 8-3 ) . These promoters control the expression of a set of genes that encode pro teins, including some protein chaperones (p. 1 43) , that are part of a stress-induced system called the heat shock response. Thus, through changes in the binding affinity of the polymerase that direct it to different promoters, a set of genes involved in related processes is coordinately regulated. In eukaryotic cells, some of the general transcription factors, in particular the TATA-binding protein (TBP; see Fig. 26-9) , may be considered speci ficity factors. Repressors bind to specific sites on the DNA In bac terial cells, such binding sites, called operators, are generally near a promoter. RNA polymerase binding, or its movement along the DNA after binding, is blocked when the repressor is present. Regulation by means of a repressor protein that blocks transcription is referred to as negative regulation. Repressor binding to DNA is regulated by a molecular signal (or effector) , usually a small molecule or a protein, that binds to the repressor and causes a conformational change. The interaction be tween repressor and signal molecule either increases or decreases transcription. In some cases, the conforma tional change results in dissociation of a DNA-bound re pressor from the operator (Fig. 2 8-4a) . Transcription initiation can then proceed unhindered. In other cases, interaction between an inactive repressor and the signal molecule causes the repressor to bind to the operator (Fig. 28-4b) . In eukaryotic cells, the binding site for a repressor may be some distance from the promoter; binding has the same effect as in bacterial cells: inhibit ing the assembly or activity of a transcription complex at the promoter. RNA start site
DNA 5'
FIGURE 28-3
I TNTCNCCCTTGAA
N l3-15
l I CCCCATTTA I N7 I mRNA
.f"VV'-+
Consensus sequence for promoters that regulate expression of the f. coli heat shock genes.
This system responds to temperature i ncreases as well as some other environmental stresses, resulting in the induction of a set of proteins. B i nding of RNA polymerase to heat shock promoters is mediated by a spe cial ized
u
subunit of the polymerase,
32 u ,
which replaces
70
u
in the RNA polymerase i n itiation complex.
� � 11
Regu lation of Gene Expression
Negative regulation
Positive regulation
(bound repressor inhibits transcription)
(bound activator facilitates transcription)
(a) DNA
Promoter Molecular signal causes dissociation of regnlatory protein from DNA ignal
I
molecule
�
1
5' J'+ 3' mRNA
5' V'+ 3' mRNA
(b)
d)
•
Molecular signal causes binding of regulatory protein to DNA
1
5' V'+ 3' mR. 'A
5' ...f'-+ 3' mRNA
FIGURE 28-4
Common patterns of regulation of transcription initia
signal and transcription proceeds; when the signal is added, the activa
tion. Two types of negative regulation are i l l ustrated. (a) Repressor
tor di ssociates and transcription is inhibited. (d) Activator binds in the
(pink) binds to the operator in the absence of the molecular signal; the
presence of the signal; it dissociates only when the signal is removed.
external signal causes dissociation of the repressor to permit transcrip
N ote that "positive" and "negative" regu lation refer to the type of
tion. (b) Repressor binds in the presence of the signal; the repressor
regulatory protein involved: the bound protein either fac i l i tates or i n
dissociates and transcription ensues when the signal is removed. Posi
h ibits transcription. In either case, addition of the molecular signal
tive regulation is mediated by gene activators. Again, two types are
may increase or decrease transcription, depending on its effect on the
shown. (c) Activator (green) binds in the absence of the molecular
regulatory protein.
Activators provide a molecular counterpoint to re pressors; they bind to DNA and enhance the activity of RNA polymerase at a promoter; this is positive regula tion. Activator-binding sites are often adjacent to pro moters that are bound weakly or not at all by RNA polymerase alone, such that little transcription occurs in the absence of the activator. Some eukaryotic activators bind to DNA sites, called enhancers, that are quite dis tant from the promoter, affecting the rate of transcrip tion at a promoter that may be located thousands of base pairs away. Some activators are usually bound to DNA, enhancing transcription until dissociation of the activator is triggered by the binding of a signal molecule (Fig. 28-4c) . In other cases the activator binds to DNA only after interaction with a signal molecule (Fig. 28-4d) . Signal molecules can therefore increase or decrease transcription, depending on how they affect
the activator. Positive regulation is particularly common in eukaryotes, as we shall see. Many Bacterial Genes Are Clustered and Regulated in Operons
Bacteria have a simple general mechanism for coordi nating the regulation of genes encoding products that participate in a set of related processes: these genes are clustered on the chromosome and are transcribed together. Many bacterial mRNAs are polycistronic multiple genes on a single transcript-and the single promoter that initiates transcription of the cluster is the site of regulation for expression of all the genes in the cluster. The gene cluster and promoter, plus additional sequences that function together in regulation, are called an operon ( Fig. 28-5 ) . Operons that include
2 8 . 1 Prin ciples of Gene Regulation
Activator binding site DNA
I
"'
11
Repressor binding site (operator)
I Promoter W$/M I I
Regulatory sequences
FIGURE 28-5
� �
A
B
c
Genes transcribed as a unit
Representative bacterial operon. Genes A, B, and C are
transcri bed on one polycistron i c m RNA. Typ ical regulatory sequences include binding sites for proteins that either activate or repress tran scription from the promoter.
two to six genes transcribed as a unit are common; some operons contain 20 or more genes. Many of the principles of bacterial gene expression were first defined by studies of lactose metabolism in E. coli, which can use lactose as its sole carbon source . In 1 960, FranEnol- 1 -o-carboxy fndole-3-glycerol � phosphate anthranilate phenylaminoC 02 PRPP PP1 1-deoxyribulose Glyceraldehyde phosphate 3-phosphate H.20
l-Serme
(Fig. 2 8-20) . When tryptophan is abundant it binds to
overlaps the promoter, so binding of the repressor
the Trp repressor, causing a conformational change that
blocks binding of RNA polymerase.
permits the repressor to bind to the
trp operator and in hibit expression of the trp operon. The trp operator site
Once again, this simple on/off circuit mediated by a repressor is not the entire regulatory story. Different cellular concentrations of tryptophan can vary the rate of synthesis of the biosynthetic enzymes over a 700-fold range. Once repression is lifted and transcrip tion begins, the rate of transcription is fine-tuned by a second regulatory process, called transcription atten
uation, in which transcription is initiated normally but before the operon genes are tran
is abruptly halted
scribed. The frequency with which transcription is at tenuated is regulated by the availability of tryptophan and relies on the very close coupling of transcription and translation in bacteria. The
Trp repressor. The repressor is a dimer, with both sub
trp operon attenuation mechanism uses signals 1 62 nucleotide leader region at the 5' end of the mRNA, preceding the initiation codon of the first gene (Fig. 2 8-2 1a) . Within the leader lies a region known as the attenuator, made up of sequences 3 and 4. These sequences base-pair to
units (gray and l ight b l ue) bi nding the DNA at hel ix-tu rn-hel i x motifs
form a G=C-rich stem-and-loop structure closely followed
(PDB ID 1 TRO) . Bound molecules of tryptophan are in red.
by a series of U residues. The attenuator structure acts as
encoded in four sequences within a
FIGURE 28-20
�
Leader peptide Met- Lys - Ala - lle - Phe - Val --
mRNA """'GUUCACGUAAAAAGGGUAUCGACAAOGAAGCA A A .� . GAAA .:::l"
}�
'lJCGIJAC�
_ "OOdUACCACUUA-oGUGA GGGCAG AA UCCUUCAOOOGGUGGuUG,_;
2
�
(stop)-Ser
13 9
-
0
162
�Met-Gln -Thr-+
uuubUUGAACAAAAUUAGAGAAUAACiAUGCAAACAl TrpE polypeptide
�UACCCAGCCCGCCUAAUGAGCGGGCUU 3
- Thr- Arg- T'P - Trp
4
Site of transcription attenuation
End of leader region (trpL)
(a)
Completed leader peptide
MRAIF v�
RNA �.-/ polymerase
4
UUUU 3 '
A U A U G C A C -G G- C c -o C-G C-G o-c A- u U UUUUU C AGAUACC
I
1 10
3:4 Pair (attenuator)
When tryptophan levels are high, the ribosome quickly translates sequence 1 (open reading frame encoding leader peptide) and blocks sequence 2 before sequence 3 is transcribed. Continued transcription leads to attenuation at the terminator-like attenuator structure formed by sequences 3 and 4.
A
A G A C - G - 100 G- C U>-- A A A u 90 - c c c A A C -G U ·A U
U
A-U
U- A - 1 1 0 G--c c u 80 -G C A A C-G o�- c o� c G- C C-G A C A C u
4
When tryptophan levels are low, the ribosome pauses at the Trp codons in sequence 1. Formation of the paired structure between sequences 2 and 3 prevents attenuation, because sequence 3 is no longer available to form the attenuator structure with sequence 4. The 2:3 structure, unlike the 3:4 attenuator, does not prevent transcription.
2:3
(b) F IGURE 28-21
Transcriptional attenuation in the trp operon. Tran
Pair
(c) complementary, as are sequences 3 and 4. The attenuator structure
scription is in itiated at the begi nning of the 1 62 nucleotide mRNA
forms by the pairing of sequences 3 and 4 (top). Its structure and func
leader encoded by a DNA region cal led trpL (see Fig. 28-1 9) . A regu
tion are similar to those of a transcription terminator (see Fig. 2 6-8).
latory mechanism determi nes whether transcription is attenuated at
Pairing of sequences 2 and 3 (bottom ) prevents the attenuator structure
the end of the leader or continues i nto the structural genes. (a) The trp
from forming. Note that the l eader peptide has no other cel l u lar func
mRNA leader (trpL). The attenuation mechanism in the trp operon i n
tion. Translation of its open reading frame has a purely regulatory role
volves sequences 1 to 4 (h ighl ighted). (b) Sequence 1 encodes a small
that determines which complementary sequences (2 and 3 or 3 and 4)
peptide, the leader peptide, containing two Trp res idues (W); it is trans
are paired. (c) Base-pai ring schemes for the compl ementary regions of
l ated immed iately after transcription begins. Sequences 2 and 3 are
the trp m R NA l eader.
� 1 3�
Regulation of Gene Expression
a transcription terminator (Fig. 28-2 1b) . Sequence 2 is an alternative complement for sequence 3 (Fig. 28-2 1 c) . If sequences 2 and 3 base-pair, the attenuator structure cannot form and transcription continues into the trp biosynthetic genes; the loop formed by the pairing of se quences 2 and 3 does not obstruct transcription. Regulatory sequence 1 is crucial for a tryptophan sensitive mechanism that determines whether sequence 3 pairs with sequence 2 (allowing transcription to con tinue) or with sequence 4 (attenuating transcription) . Formation of the attenuator stern-and-loop structure depends on events that occur during translation of reg ulatory sequence 1 , which encodes a leader peptide (so called because it is encoded by the leader region of the rnRNA) of 1 4 amino acids, two of which are Trp residues. The leader peptide has no other known cellu lar function; its synthesis is simply an operon regulatory device. This peptide is translated immediately after it is transcribed, by a ribosome that follows closely behind RNA polymerase as transcription proceeds. When tryptophan concentrations are high, concen trations of charged tryptophan tRNA (Trp-tRNATrp) are also high. This allows translation to proceed rapidly past the two Trp codons of sequence 1 and into sequence 2 , before sequence 3 i s synthesized by RNA polymerase. In this situation, sequence 2 is covered by the ribosome and unavailable for pairing to sequence 3 when sequence 3 is synthesized; the attenuator structure (sequences 3 and 4) forms and transcription halts (Fig. 28-2 lb, top) . When tryptophan concentrations are low, however, the ribo some stalls at the two Trp codons in sequence 1 , because
E. coli
charged tRNATrp is less available. Sequence 2 remains free while sequence 3 is synthesized, allowing these two sequences to base-pair and permitting transcription to proceed (Fig. 28-2 1b, bottom). In this way, the propor tion of transcripts that are attenuated declines as trypto phan concentration declines. Many other amino acid biosynthetic operons use a sim ilar attenuation strategy to fine-tune biosynthetic enzymes to meet the prevailing cellular requirements. The 15 amino acid leader peptide produced by the phe operon contains seven Phe residues. The leu operon leader peptide has four contiguous Leu residues. The leader peptide for the his operon contains seven contiguous His residues. In fact, in the his operon and a number of others, attenuation is suffi ciently sensitive to be the only regulatory mechanism. Induction of the 505 Response Requires Destruction of Repressor Proteins
Extensive DNA damage in the bacterial chromosome triggers the induction of many distantly located genes. This response, called the SOS response (p. 1001) , pro vides another good example of coordinated gene regula tion. Many of the induced genes are involved in DNA repair (see Table 25-6) . The key regulatory proteins are the RecA protein and the LexA repressor. The LexA repressor CMr 22,700) inhibits transcrip tion of all the SOS genes (Fig. 2 8-22), and induction of the SOS response requires removal of LexA. This is not a simple dissociation from DNA in response to binding of a small molecule, as in the regulation of the lac operon
chromosome
poiB
dinB
uurB
() 11) Damage to
DNA produces ingle- trand gap \
FIGURE 28-22
SOS response in f. coli. See Table 2 5-6
lexA
for the functions of many of these proteins. The LexA protein is the repressor i n this system, which has an op· erator site (red) near each gene. Because the recA gene is not entirely repressed by the LexA repressor, the nor mal cel l contains about 1 ,000 RecA monomers.
G)
When DNA is extensively damaged (such as by UV l ight), DNA repl ication is halted and the n u mber of sin gle-strand gaps i n the DNA i ncreases.
0
RecA protein
b i nds to this damaged, single-stranded DNA, activating the protein's coprotease activity.
®
While bound to
DNA, the RecA protein fac i l itates c leavage and inacti vation of the LexA repressor. When the repressor is in activated, the 505 genes, i n c l ud i ng recA, are i nduced; RecA levels increase 50-
to
1 00-fold.
recA
+ - - Replication - - ->
polE
1
dinE
uvrB
28.2 Regu lation of Gene Expression in Bacteria
described above. Instead, the Lex.A repressor is inacti vated when it catalyzes its own cleavage at a specific Ala-Gly peptide bond, producing two roughly equal pro tein fragments. At physiological pH, this autocleavage re action requires the RecA protein. RecA is not a protease in the classical sense, but its interaction with Lex.A facil itates the repressor's self-cleavage reaction. This func tion of RecA is sometimes called a coprotease activity. The RecA protein provides the functional link be tween the biological signal (DNA damage) and induc tion of the SOS genes. Heavy DNA damage leads to numerous single-strand gaps in the DNA, and only RecA that is bound to single-stranded DNA can facilitate cleavage of the Lex.A repressor (Fig. 28-22, bottom) . Binding of RecA at the gaps eventually activates its co protease activity, leading to cleavage of the Lex.A re pressor and SOS induction. During induction of the SOS response in a severely damaged cell, RecA also cleaves and thus inactivates the repressors that otherwise allow propagation of certain viruses in a dormant lysogenic state within the bacterial host. This provides a remarkable illustration of evolu tionary adaptation. These repressors, like Lex.A, also un dergo self-cleavage at a specific Ala-Gly peptide bond, so induction of the SOS response permits replication of the virus and lysis of the cell, releasing new viral parti cles. Thus the bacteriophage can make a hasty exit from a compromised bacterial host cell.
f3 operon 5 ' [
r;o
L10 \L71Ll2J
/3
[3'
(3'
ft
7
str
a
operon 5 ' 1
operon 5 ' [
812
f I
Synthesis of Ribosomal Proteins Is Coordinated with rRNA Synthesis
In bacteria, an increased cellular demand for protein synthesis is met by increasing the number of ribosomes rather than altering the activity of individual ribosomes. In general, the number of ribosomes increases as the cellular growth rate increases. At high growth rates, ri bosomes make up approximately 45% of the cell's dry weight. The proportion of cellular resources devoted to making ribosomes is so large , and the function of ribo somes so important, that cells must coordinate the syn thesis of the ribosomal components: the ribosomal proteins (r-proteins) and RNAs (rRNAs) . This regula tion is distinct from the mechanisms described so far, because it occurs largely at the level of translation. The 52 genes that encode the r-proteins occur in at least 20 operons, each with 1 to 1 1 genes. Some of these operons also contain the genes for the subunits of DNA prirnase (see Fig. 25-1 3) , RNA polymerase (see Fig. 26-4) , and protein synthesis elongation factors (see Fig. 27-28)-revealing the close coupling of replication, transcription, and protein synthesis during cell growth. The r-protein operons are regulated primarily through a translational feedback mechanism. One r-protein encoded by each operon also functions as a translational repressor, which binds to the mRNA transcribed from that operon and blocks translation of all the genes the messenger encodes (Fig. 2 8-23). In general, the r-protein that plays the role of repressor also binds directly to an rRNA. Each translational re pressor r-protein binds with higher affinity to the appro priate rRNA than to its mRNA, so the rnRNA is bound and translation repressed only when the level of the r protein exceeds that of the rRNA. This ensures that translation of the mRNAs encoding r-proteins is re pressed only when synthesis of these r-proteins exceeds that needed to make functional ribosomes. In this way, the rate of r-protein synthesis is kept in balance with rRNA availability. FIGURE 28-23
84
Translational feedback in some ribosomal protein
operons. The r-proteins that act as translational repressors are shaded pink. Each translational repressor blocks the translation of a l l genes i n that operon b y b i nd i ng t o the i ndicated site o n the m R NA . Genes that
813
811
84
a
I L17LJ3'
encode subunits of RNA polymerase are shaded yel l ow; genes that en code el ongation factors are blue. The r-proteins of the large (505) ri bo somal subunit are desi gnated L 1 to L34; those of the smal l (305)
-
810 operon 5 ' 1
13'
87 I EF-G I EF-Tul
� 1 3�
subun it, 5 1 to 52 1 .
-- L4
-
810
L3
I
S8
t
'
� 1 3�
'
Reg ulation of Gene Exp ression
The mRNA binding site for the translational repres
sis is halted. Amino acid starvation leads to the binding
sor is near the translational start site of one of the genes
of uncharged tRNAs to the ribosomal A site; this triggers
in the operon, usually the first gene (Fig. 28-23) . In
a sequence of events that begins with the binding of an
other operons this would affect only that one gene, be
enzyme called
cause in bacterial polycistronic mRNAs most genes have
ribosome. When bound to the ribosome, stringent factor
stringent factor (RelA protein) to the
independent translation signals . In the r-protein oper
catalyzes formation of the unusual nucleotide guanosine
ons, however, the translation of one gene depends on
tetraphosphate (ppGpp; see Fig. 8-39) ; it adds py
the translation of all the others. The mechanism of this
rophosphate to the 3' position of GTP, in the reaction
translational coupling is not yet understood in detail.
GTP + ATP
However, in some cases the translation of multiple genes
---)-
pppGpp + AMP
seems to be blocked by folding of the mRNA into an
then a phosphohydrolase cleaves off one phosphate to
elaborate three-dimensional structure that is stabilized
form ppGpp. The abrupt rise in ppGpp level in response
both by internal base-pairing "(as in Fig. 8-23) and by
to amino acid starvation results in a great reduction in
binding of the translational repressor protein. When the
rRNA synthesis, mediated at least in part by the binding
translational repressor is absent, ribosome binding and
of ppGpp to RNA polymerase.
translation of one or more of the genes disrupts the
The nucleotide ppGpp, along with cAMP, belongs
folded structure of the mRNA and allows all the genes to
to a class of modified nucleotides that act as cellular
be translated.
second messengers (p. 298) . In
Because the synthesis of r-proteins is coordinated
E. coli, these two nu
cleotides serve as starvation signals; they cause large
with the available rRNA, the regulation of ribosome pro
changes in cellular metabolism by increasing or decreas
duction reflects the regulation of rRNA synthesis. In
ing the transcription of hundreds of genes. In eukaryotic
responds to cellular growth rate and to changes in the
multiple regulatory functions. The coordination of cellu
availability of crucial nutrients , particularly amino acids.
lar metabolism with cell growth is highly complex, and
E. coli, rRNA synthesis from the seven rRNA operons
The regulation coordinated with amino acid concentra tions is known as the stringent response
( Fig. 28-24) .
cells, similar nucleotide second messengers also have
further regulatory mechanisms undoubtedly remain to be discovered.
When amino acid concentrations are low, rRNA synthe-
The Fu nction of Some m RNAs Is Regulated by +
Small RNAs in Cis or in Trans A s described throughout this chapter, proteins play an important and well-documented role in regulating gene expression. But RNA also has a crucial role-one that is becoming better recognized as more examples of regula tory RNAs are discovered. Once an mRNA is synthesized, its functions can be controlled by RNA-binding proteins, as seen for the r-protein operons just described, or by an
5'
3'
RNA. A separate RNA molecule may bind to the mRNA "in trans" and affect its activity. Alternatively, a portion of
�---.-----+-- Stringent
factor (RelA protein)
GTP + ATP
(p)ppGpp + AMP I I I I
RNA polymerase
the mRNA itself may regulate its own function. When part of a molecule afiects the function of another part of the same molecule, it is said to act "in cis." A well-characterized example of RNA regulation in trans is seen in the regulation of the mRNA of the gene rpoS (RNA polymerase sigma factor) , which encodes one of the seven E. coli sigma factors (see Table
if',
26-1).
The cell uses this specificity factor in certain stress situa tions, such as when it enters the stationary phase (a state
of no growth, necessitated by lack of nutrients) and if' is
FIGURE 28-24 Stringent response in f. coli. Th is response to amino acid starvation is triggered by binding of an uncharged tRNA in the ri bosomal A site. A protein cal l ed stringent factor binds to the ribosome
needed to transcribe large numbers of stress response genes. The
if' mRNA is present at low levels under most
conditions but is not translated, because a large hairpin
and catalyzes the synthesis of pppGpp, which is converted by a phos
structure upstream of the coding region inhibits ribosome
phohydrolase to ppGpp. The signal ppGpp reduces transcription of
binding
some genes and increases that of others, in part by binding to the f3
one or both of two small special-function RNAs, DsrA
subunit of RNA polymerase and altering the enzyme's promoter speci ficity. Synthesis of rRNA is reduced when ppGpp levels i nc rease.
(Fig. 28-25 ) . Under certain stress conditions,
(downstream region A) and RprA (Rpos regulator RNA A) , are induced. Both can pair with one strand of the hair-
28.2 Regulation of Gene Expression in Bacteria
(a)
and numerous examples of RNA-mediated regulation in
rpoS
mRNA
5'
®
G 1 3�
eukaryotes.
Ribosomebinding site
iii
3'
Regulation in cis involves a class of RNA structures 3'
known as
riboswitches. As described in Box 26-3 , ap
tamers are RNA molecules , generated in vitro, that are capable of specific binding to a particular ligand. As one
D"A 5'
might expect, such ligand-binding RNA domains are also present in nature-in riboswitches-in a significant number of bacterial mRNAs (and even in some eukary otic mRNAs) . These natural aptamers are structured domains found in untranslated regions at the
5' ends of
certain bacterial mRNAs. Binding of an mRNA's ri boswitch to its appropriate ligand results in a conforma tional
change
in the
mRNA,
and transcription is
inhibited by stabilization of a premature transcription
(b)
termination structure, or translation is inhibited (in cis) rpoS
mRNA
by occlusion of the ribosome-binding site Ribosome binding site
(Fig. 28-26) .
In most cases, the riboswitch acts in a kind of feedback loop. Most genes regulated in this way are involved in the synthesis or transport of the ligand that is bound by the riboswitch; thus, when the ligand is present in high
Ribosome bind ing site
5'
FIGURE 28-25 Regulation of bacterial mRNA function in trans by sRNAs. Several sRNAs (small RNAs)- DsrA, RprA, and OxyS-are
Stabilization of a
(a}
i nvolved i n regulation of the rpoS gene. All req u i re the protein Hfq, an
poly(U)
RNA chaperone that fac i l itates RNA-RNA pa i ring. Hfq has a toroid
terminator
structu re, with a pore in the center. (a) DsrA promotes translation by
transcription termina tor structure aborts transcription.
pairing with one strand of a stem-loop structure that otherwise blocks the ribosome-binding site. RprA acts in a s i m i lar way. (b) OxyS blocks tra nslation by pairing with the ri bosome-binding site.
pin in the
us
Blockage of the
( b)
ribosome-binding site blocks translation.
"\."-------- 3'
mRNA, disrupting the hairpin and thus al
lowing translation of rpoS. Another small RNA, OxyS (oxidative stress gene S) , is induced under conditions of oxidative stress and inhibits the translation of rpoS, prob ably by pairing with and blocking the ribosome-binding site on the mRNA. OxyS is expressed as part of a system
(c)
Regulation of intron splicing in fungal and
that responds to a different type of stress (oxidative dam
plant introns.
age) than does rpoS, and its task is to prevent expression of unneeded repair pathways. DsrA, RprA, and OxyS are
all relatively small bacterial RNA molecules (less than 300 nucleotides) , designated sRNAs (s for small; there are of course other "small" RNAs with other designations in eu karyotes) . All require for their function a protein called
3' 5 '-- GUACGG
�
5' splice site
FIGURE 28-26 Regulation o f bacterial mRNA function i n cis by riboswitches. The known modes of action are i l l ustrated by several
Hfq, an RNA chaperone that facilitates RNA-RNA pairing.
different riboswitches based on a widespread natural aptamer that
The known bacterial genes regulated in this way are few
bi nds th iamine pyrophosphate. TPP b i n d i ng to the aptamer leads to a
in number, just a few dozen in a typical bacterial species.
conformational change that produces the varied results i l lustrated i n
However, these examples provide good model systems
parts (a), (b), and (c) i n the different systems i n which the aptamer is
for understanding patterns present in the more complex
uti l i zed.
� 1 3�J
Regulation of G e n e Expression
concentrations, the riboswitch inhibits expression of the genes needed to replenish this ligand. Each riboswitch binds only one ligand. Distinct ri boswitches have been detected that respond to more than a dozen different ligands, including thiamine py rophosphate (TPP, vitamin B ) cobalamin (vitamin B 1 2)
1 ,
,
flavin mononucleotide, lysine , S-adenosylmethionine (adoMet) , purines , N-acetylglucosamine 6-phosphate, and glycine. It is likely that many more remain to be dis covered. The riboswitch that responds to TPP seems to be the most widespread; it is found in many bacteria, fungi, and some plants. The bacterial TPP riboswitch in hibits translation in some species and induces prema ture transcription termination in others (Fig. 28-26) .
FIGURE 28-27 Salmonella typhimurium, with flagel l a evident.
The eukaryotic TPP riboswitch is found in the introns of certain genes and modulates the alternative splicing of those genes (see Fig. 26-22) . It is not yet clear how common riboswitches are. However, estimates suggest that more than 4% of the genes of Bacillus
subtilis are
regulated by riboswitches . A s riboswitches become better understood, re searchers are finding medical applications. For example, most of the riboswitches described to date in
�
cluding the one that responds to adoMet, have b en found only in bacteria. A drug that bound to and acti vated the adoMet riboswitch would shut down the genes encoding the enzymes that synthesize and transport adoMet, effectively starving the bacterial cells of this es sential cofactor. Drugs of this type are being sought for use as a new class of antibiotics . •
The pace of discovery of functional RNAs shows no
signs of abatement and continues to enrich the hypoth esis that RNA played a special role in the evolution of life (Chapter 26) . The sRNAs and riboswitches ' like ri bozymes and ribosomes, may be vestiges of an RNA world obscured by time but persisting as a rich array of biological devices still functioning in the extant bio sphere. The laboratory selection of aptamers and ri bozymes with novel ligand-binding and
enzymatic
functions (see Box 26-3) tells us that the RNA-based activities necessary for a viable RNA world are possible. Discovery of many of the same RNA functions in living organisms tells us that key components for RNA-based metabolism do exist. For example, the natural aptamers of riboswitches may be derived from RNAs that billions
�ote the
of years ago, bound to cofactors needed to pro
enzymatic processes required for metabolism in the RNA world.
Some Genes Are Regu lated by Genetic Recom bination
nent targets of mammalian immune systems. But
Sal monella cells have a mechanism that evades the im mune response : they switch between two distinct flagellin proteins (FljB and FliC) roughly once every 1 ,000
generations ,
using
a process
called
phase
variation. The switch is accomplished by periodic inversion of a segment of DNA containing the promoter for a flagellin gene. The inversion is a site-specific recombination re action (see Fig. 25-4 1 ) mediated by the Hin recombi nase at specific 14 bp sequences (hix sequences) at either end of the DNA segment. When the DNA segment is in one orientation, the gene for FljB flagellin and the gene
encoding
a
repressor
(FljA)
are
expressed
(Fig. 2 8-28a) ; the repressor shuts down expression of the gene for FliC flagellin. When the DNA segment is
inverted (Fig. 28-28b) , the jljA and jljB genes are no longer transcribed, and the .fiiC gene is induced as the repressor becomes depleted. The Hin recombinase , encoded b y the
hin gene i n the DNA segment that
undergoes inversion, is expressed when the DNA segment is in either orientation, so the cell can always switch from one state to the other. This type of regulatory mechanism has the advan tage of being absolute: gene expression is impossible when the gene is physically separated from its pro moter (note the position of the jljB promoter in Fig.
28-28b) . An absolute on/off switch may be important in
this system (even though it affects only one of the two flagellin genes) , because a flagellum with just one copy of the wrong flagellin might be vulnerable to host anti bodies against that protein. The
Salmonella system is
by no means unique. Similar regulatory systems occur in some other bacteria and in some bacteriophages , and recombination systems with similar functions have
We turn now to another mode of bacterial gene regula
been found in eukaryotes (Table 28-1 ) . Gene regula
tion, at the level of DNA rearrangement-recombination.
tion by DNA rearrangements that move genes and/or
Salmonella typhimurium, which inhabits the mam
promoters is particularly common in pathogens that
malian intestine, moves by rotating the flagella on its cell
benefit by changing their host range or by changing
(Fig. 2 8-27 ) . The many copies of the protein flagellin CMr 53,000) that make up the flagella are promi-
immune systems.
surface
their surface proteins, thereby staying ahead of host
28.2 Regu lation of Gene Exp ression in Bacteria
I
G 13�
Inverted repeat (hix)
D A
IH
hin
/ Promoter for FljB and repressor K----1 fljB I
Promoter
/ for FliC 1
fliC
"'\/'+ hin mRNA
f1jB and f1jA mRNA
!
Hin recombi.nase (a)
!
FljB flagellin
!
FljA protein .,, (repressor)
Transposed segment
I F-FI
.rv
lun
I�
f1jB
fljA
El
..r\./\..
FIGURE 28-28
1
fliC mRNA
Fli
Hin recombinase
Regulation of flagellin genes in Salmonella: phase
variation. The products of genes fliC and fljB are different flagel l i ns.
I
J\./"'+
hin mRNA
(b)
fii
1
flageUin
the fljA gene) that represses transcription of the fliC gene. (b) I n the op
posite orientation only the fliC gene is expressed; the fljA and fljB
The hin gene encodes the recombi nase that catalyzes inversion of the
genes cannot be transcribed. The i nterconversion between these two
DNA segment conta i n i ng the fljB promoter and the hin gene. The re
states, known as phase variation, also requi res two other nonspecific
combination s ites ( inverted repeats) are cal led hix (yellow). (a) In one
DNA-binding proteins (not shown), HU and FIS.
orientation, fljB is expressed along with a repressor protein (product of
TABLE 28- 1 System
Recombinase/ recombination site
Type of recombination
Phase variation (Salmonella)
Hinlhix
Site-specific
Host range (bacteriophage J.L)
Alternative expression of two fiagellin genes allows evasion of host immune response.
Ginlgix
Site-specific
Alternative expression of two sets of tail fiber genes affects host range.
Mating-type switch (yeast)
HO endonuclease, RAD52 protein, other proteins/MAT
Nonreciprocal gene conversion*
Alternative expression of two mating types of yeast, a and a, creates cells of different mating types that can mate and undergo meiosis.
Antigenic variation (trypanosomes) t
Varies
Nonreciprocal gene conversion*
Successive expression of different genes encoding the variable surface glycoproteins (VSGs) allows evasion of host immune response.
Function
*In nonreciprocal gene conversion (a class of recombination events not discussed in Chapter 25), genetic information is moved from one part of the genome (where it is silent) to another (where it is expressed). The reaction is similar to replicative transposition (see Fig. 25-45). 1
Trypanosomes cause African sleeping sickness and other diseases (see Box 22-3). The outer surface of a trypanosome is made up of multiple
copies of a single VSG, the major surface antigen. A cell can change surface antigens to more than 100 different forms, precluding an effective defense by the host immune system.
� 1 3�
Regulation of Gene Expression
S U M M A RY 2 8.2 •
•
•
•
•
•
Regulation of Gene E x p r e s s i o n i n Ba cteria
In addition to repression by the Lac repressor, the E. coli lac operon undergoes positive regulation by the cAMP receptor protein (CRP) . When [glucose] is low, [cAMP] is high and CRP-cAMP binds to a specific site on the DNA, stimulating transcription of the lac operon and production of lactose-metabolizing enzymes. The presence of glucose depresses [cAMP] , decreasing expression of lac and other genes involved in metabolism of secondary sugars. A group of coordinately regulated operons is referred to as a regulon. Operons that produce the enzymes of amino acid synthesis have a regulatory circuit called attenuation, which uses a transcription termination site (the attenuator) in the mRNA. Formation of the attenuator is modulated by a mechanism that couples transcription and translation while responding to small changes in amino acid concentration. In the SOS system, multiple unlinked genes repressed by a single repressor are induced simultaneously when DNA damage triggers RecA protein-facilitated autocatalytic proteolysis of the repressor. In the synthesis of ribosomal proteins, one protein in each r-protein operon acts as a translational repressor. The mRNA is bound by the repressor, and translation is blocked only when the r-protein is present in excess of available rRNA. Posttranscriptional regulation of some mRNAs is mediated by sRNAs that act in trans or by riboswitches, part of the mRNA structure itself, that act in cis. Some genes are regulated by genetic recombination processes that move promoters relative to the genes being regulated. Regulation can also take place at the level of translation.
28.3 Regulation of Gene Expression in
Eukaryotes Initiation of transcription is a crucial regulation point for gene expression in all organisms. Although eukaryotes and bacteria use some of the same regulatory mecha nisms, the regulation of transcription in the two systems is fundamentally different. We can define a transcriptional ground state as the in herent activity of promoters and transcriptional machinery in vivo in the absence of regulatory sequences. In bacteria, RNA polymerase generally has access to every promoter and can bind and initiate transcription at some level of efficiency in the absence of activators or repressors; the
transcriptional ground state is therefore nonrestrictive. In eukaryotes, however, strong promoters are generally inac tive in vivo in the absence of regulatory proteins; that is, the transcriptional ground state is restrictive. This funda mental difference gives rise to at least four important fea tures that distinguish the regulation of gene expression in eukaryotes from that in bacteria. First, access to eukaryotic promoters is restricted by the structure of chromatin, and activation of tran scription is associated with many changes in chromatin structure in the transcribed region. Second, although eukaryotic cells have both positive and negative regula tory mechanisms, positive mechanisms predominate in all systems characterized so far. Thus, given that the transcriptional ground state is restrictive, virtually every eukaryotic gene requires activation in order to be tran scribed. Third, eukaryotic cells have larger, more com plex multimeric regulatory proteins than do bacteria. Finally, transcription in the eukaryotic nucleus is sepa rated from translation in the cytoplasm in both space and time. The complexity of regulatory circuits in eukaryotic cells is extraordinary, as the following discussion shows. We conclude the section with an illustrated description of one of the most elaborate circuits: the regulatory cas cade that controls development in fruit flies. Transcriptionally Active Chromatin Is Structurally Distinct from Inactive Chromatin The effects of chromosome structure on gene regulation in eukaryotes have no clear parallel in bacteria. In the eukaryotic cell cycle, interphase chromosomes appear, at first viewing, to be dispersed and amorphous (see Figs 12-43, 24-25) . Nevertheless, several forms of chro matin can be found along these chromosomes. About 10% of the chromatin in a typical eukaryotic cell is in a more condensed form than the rest of the chromatin. This form, heterochromatin, is transcriptionally inac tive. Heterochromatin is generally associated with par ticular chromosome structures-the centromeres, for example. The remaining, less condensed chromatin is called euchromatin. Transcription of a eukaryotic gene is strongly re pressed when its DNA is condensed within heterochro matin. Some, but not all, of the euchromatin is tran scriptionally active. Transcriptionally active chromosomal regions are characterized not only by a more open chro matin structure but also by the presence of nucleosomes with particular compositions and modifications. Tran scriptionally active chromatin tends to be deficient in histone H l , which binds to the linker DNA between nucleosome particles, and enriched in the histone variants H3.3 and H2AZ (see Box 24-2) . Histones within transcriptionally active chromatin and heterochromatin differ in their patterns of covalent modification. The core histones of nucleosome particles (H2A, H2B, H3, H4; see Fig. 24-27) are modified by
28.3 Regulation of Gene Exp ression in Eu karyotes
�1 3�
methylation of Lys or Arg residues, phosphorylation of
tissues where the genes are expressed than in those
Ser or Thr residues, acetylation (see below) , ubiquitina
where the genes are not expressed. The overall pattern
tion (see Fig. 27-47) , or sumoylation. Each of the core
suggests that active chromatin is prepared for transcrip
histones has two distinct structural domains. A central
tion by the removal of potential structural barriers.
domain is involved in histone-histone interaction and the wrapping of DNA around the nucleosome. A second, lysine-rich amino-terminal domain is generally posi tioned near the exterior of the assembled nucleosome
Chromatin Is Remodeled by Acetylation and N ucleosomal Displacement/Repositioning
particle; the covalent modifications occur at specific
The transcription-associated structural changes in chro
residues concentrated in this amino-terminal domain.
matin are generated by a process called
The patterns of modification have led some researchers
chromatin re modeling. The remodeling involves enzymes that
to propose the existence of a histone code, in which
promote the changes described above . Some enzymes
modification patterns are recognized by enzymes that
covalently modify the histones of the nucleosome. Oth
alter the structure of chromatin. Modifications associ
ers use the chemical energy of ATP to reposition nucle
ated with transcriptional activation-primarily methyla
osomes on the DNA (Table 28-2) . Still others alter the
tion and acetylation-would be recognized by enzymes
histone composition of the nucleosomes.
that make the chromatin more accessible to the tran
The acetylation and methylation of histones figure
scription machinery. Indeed, some of the modifications
prominently in the processes that activate chromatin for
are essential for interactions with proteins that play key
transcription. As noted above, the amino-terminal do
roles in transcription.
mains of the core histones are generally rich in Lys and
5-Methylation of cytosine residues of CpG se DNA in transcriptionally active chromatin tends to be
H3 is methyl 4 ated (by specific histone methylases) at Lys in nucleo 36 somes near the 5' end of the coding region and at Lys
undermethylated. Furthermore, CpG sites in particular
throughout the coding region. These methylations facili
genes are more often undermethylated in the cells of
tate the binding of histone
quences is common in eukaryotic DNA (p. 292) , but
TABLE 28-2
Arg residues. During transcription, histone
acetyltransferases (HATs),
Some Enzyme Complexes Catalyzing Chromatin s Oligomeric structure
Enzyme complex*
(number of polypeptides)
Source
Activities
Yeast
GCN5 has type A HAT activity
Histone modification
GCN5-ADA2-ADA3
3
SAGAIPCAF
>20
Eukaryotes
Includes GCN5-ADA2-ADA3; acetylates residues in H3 and H2B
NuA4
At least 12
Eukaryotes
Esai component has HAT activity; acetylates H4, H2A, and H2AZ
SWIJSNF
�6; total Mr 2 X 1 06
Eukaryotes
Nucleosome remodeling; transcriptional activation
ISWI family
Varies
Eukaryotes
Nucleosome remodeling; transcriptional repression; transcriptional activation in some cases (NURF)
SWR1 family
�12
Eukaryotes
H2AZ deposition
1
Eukaryotes
Deposition of H3.3 during transcription
Histone movement/replacement enzymes that require ATP
Histone chaperones that do not require ATP
HIRA
*The abbreviations for eukaryotic genes and proteins are often more confusing or obscure than those used for bacteria. The complex of GCN5 (general control nonderepressible) and ADA (alteration/deficiency activation) proteins was discovered during investigation of the regulation of nitrogen metabolism genes in yeast These proteins can be part of the larger SAGA complex (SPF, ADA2,3, GCN5, acetyltransferase) in yeasts. The equivalent of SAGA in humans is PCAF (p300/CBP-associated factor). NuA4 is nucleosome acetyltransferase of H4; ESA1 is essential SAS2-related acetyltransferase. SWI (switching) was discovered as a protein required for expression of certain genes involved in mating-type switching in yeast, and SNF (sucrose nonfermenting) as a factor for expression of the yeast gene for sucrase. Subsequent studies revealed multiple SWI and SNF pro teins that acted in a complex. The SWI/SNF complex has a role in the expression of a wide range of genes and has been found in many eukaryotes, including humans. ISWI is imitation SWJ; NURF, nuclear remodeling factor; SWR1, Swi2/Snf2-related ATPase 1; and HIRA, histone regulator A.
� 1 3�
Regu lation of Gene Expression
enzymes that acetylate particular Lys residues. Cytosolic
of multiple activator proteins. One important reason for
(type B) HATs acetylate newly synthesized histones be
the apparent predominance of positive regulation seems
fore the histones are imported into the nucleus. The sub
obvious: the storage of DNA within chromatin effec
sequent assembly of the histones into chromatin after
tively renders most promoters inaccessible, so genes are
replication is facilitated by histone chaperones: CAFI for
silent in the absence of other regulation. The structure
H3 and H4, and NAPl for H2A and H2B (see Box 24-2) .
of chromatin affects access to some promoters more
Where chromatin is being activated for transcrip
than others, but repressors that bind to DNA so as to
tion, the nucleosomal histones are further acetylated by
preclude access of RNA polymerase (negative regula
nuclear (type A) HATs. The acetylation of multiple Lys
tion) would often be simply redundant. Other factors
residues in the amino-terminal domains of histones H3
must be at play in the use of positive regulation, and
and H4 can reduce the affinity of the entire nucleosome
speculation generally centers around two: the large size
for DNA. Acetylation of particular Lys residues is criti
of eukaryotic genomes and the greater efficiency of pos
cal for the interaction of nucleosomes with other pro
itive regulation.
teins. When transcription of a gene is no longer
First, nonspecific DNA binding of regulatory pro
required, the extent of acetylation of nucleosomes in
teins becomes a more important problem in the much
that vicinity is reduced by the activity of histone deacetylases (HDACs) , as part of a general gene-si
larger genomes of higher eukaryotes. And the chance
lencing process that restores the chromatin to a tran
domly at an inappropriate site also increases with
that a single specific binding sequence will occur ran
scriptionally inactive state. In addition to the removal of
genome size. Specificity for transcriptional activation
certain acetyl groups, new covalent modification of his
can be improved if each of several positive-regulatory
tones marks chromatin as transcriptionally inactive. 9 For example, Lys of histone H3 is often methylated in
form a complex in order to become active. The average
heterochromatin.
number of regulatory sites for a gene in a multicellular
proteins must bind specific DNA sequences and then
There are five known families of enzyme complexes
organism is probably at least five. The requirement for
that actively move or displace nucleosomes, hydrolyzing
binding of several positive-regulatory proteins to spe
ATP in the process, three of which are particularly im
cific DNA sequences vastly reduces the probability of
portant in transcriptional activation (Table 28-2 ; see the
the random occurrence of a functional juxtaposition of
table footnote for an explanation of the abbreviated
all the necessary binding sites. In principle, a similar
names of the enzyme complexes described here) .
strategy could be used by multiple negative-regulatory
SWI/SNF, found in all eukaryotic cells, contains at least
elements, but this brings us to the second reason for the
six core polypeptides that together remodel chromatin
use of positive regulation: it is simply more efficient. If
so that nucleosomes become more irregularly spaced,
the -29,000 genes in the human genome were nega
and stimulate the binding of transcription factors. The
tively regulated, each cell would have to synthesize, at
complex includes a component called a bromodomain
all times , this same number of different repressors (or
near the carboxyl terminus of the active ATPase sub
many times this number if multiple regulatory elements
unit, which interacts with acetylated histone tails .
were used at each promoter) in concentrations suffi
SWI/SNF i s not required for the transcription o f every
cient to permit specific binding to each "unwanted"
NURF, a member of the ISWI family, remodels
gene. In positive regulation, most of the genes are usu
gene.
chromatin in ways that complement and overlap the ac
ally inactive (that is, RNA polymerases do not bind to
tivity of SWI/SNF. These two enzyme complexes are cru
the promoters) and the cell synthesizes only the activa
cial in preparing a region of chromatin for active
tor proteins needed to promote transcription of the sub
transcription. Some members of a third family, SWRl ,
set of genes required in the cell at that time. These
are involved in deposition of the H2AZ histone variant in
arguments notwithstanding, there are examples of neg
transcriptionally active chromatin.
ative regulation in eukaryotes, from yeasts to humans,
In the other families of chromatin remodelers , some
as we shall see.
are required to reorder nucleosomes within chromatin when genes are being silenced. The net effect of chro
DNA-Binding Activators and Coactivators Facilitate
matin remodeling is to make a segment of the chromo
Assembly of the General Transcription Factors
some more accessible and to "label" (chemically modify) it so as to facilitate the binding and activity of transcrip tion factors that regulate expression of the gene or
To continue our exploration of the regulation of gene expression in eukaryote s , we return to the interactions
genes in that region.
between promoters and RNA polymerase II (Pol II) , the
Many Eu karyotic Promoters Are Positively Regulated
mRNAs. Although many (but not all) Pol II promoters
As already noted, eukaryotic RNA polymerases have lit
with their standard spacing (see Fig. 26-9) , they vary
tle or no intrinsic affinity for their promoters; initiation
greatly in both the number and the location of additional
of transcription is almost always dependent on the action
sequences required for the regulation of transcription.
enzyme responsible for the synthesis of eukaryotic include the TATA box and Inr (initiator) sequences,
28.3 Regu lation of Gene Expression in E u karyotes
These additional regulatory sequences are usually called enhancers in higher eukaryotes and upstream activa tor sequences (UASs) in yeast. A typical enhancer may be found hundreds or even thousands of base pairs upstream from the transcription start site, or may even be downstream, within the gene itself. When bound by the appropriate regulatory proteins, an enhancer in creases transcription at nearby promoters regardless of its orientation in the DNA. The UASs of yeast function in a similar way, although generally they must be posi tioned upstream and within a few hundred base pairs of the transcription start site. An average Pol II promoter may be affected by a half-dozen regulatory sequences of this type, and even more-complex promoters are quite common (see Fig. 1 5-23, for example) . Successful binding of active RNA polymerase II holoenzyme at one of its promoters usually requires the action of other proteins ( Fig. 28-29) , of four types: ( 1 ) transcription activators, which bind t o enhancers or UASs and facilitate transcription; (2) chromatin modi fication and remodeling proteins, described above; (3) coactivators; and (4) basal transcription fac tors (see Fig. 26-10, Table 26-2) , required at every Pol II promoter. The coactivators act indirectly-not by bind ing to the DNA-and are required for essential commu nication between the activators and the complex composed of Pol II and the basal (or general) transcrip tion factors. Furthermore, a variety of repressor pro teins can interfere with communication between the RNA polymerase and the activators, resulting in repres sion of transcription (Fig. 28-29b) . Here we focus on the protein complexes shown in Figure 28-29 and on how they interact to activate transcription. Transcription Activators The requirements for acti vators vary greatly from one promoter to another. A few activators are known to facilitate transcription at hun dreds of promoters, whereas others are specific for a few promoters. Many activators are sensitive to the binding of signal molecules, providing the capacity to activate or deactivate transcription in response to a changing cellu lar environment. Some enhancers bound by activators are quite distant from the promoter's TATA box. How do the activators function at a distance? The answer in most cases seems to be that, as indicated earlier, the interven ing DNA is looped so that the various protein complexes can interact directly. The looping is promoted by certain nonhistone proteins that are abundant in chromatin and bind nonspecifically to DNA. These high mobility group (HMG) proteins (Fig. 28-29; "high mobility" refers to their electrophoretic mobility in polyacrylamide gels) play an important structural role in chromatin re modeling and transcriptional activation. Coactivator Protein Complexes Most transcription requires the presence of additional protein complexes. Some major regulatory protein complexes that interact with Pol II have been defined both genetically and bio-
(a)
G 1 3�
Transcription
HMG proteins
Preinitiation complex (PIC)
DNA Enhancers
Transcription activators
Enhancers FIGURE 28-29 Eukaryotic promoters and regulatory proteins. RNA polymerase I I and its associated basal (general) transcription factors
form a preinitiation complex at the TATA box and l n r site of the cognate promoters, a process fac i l itated by transcription activators, acting through mediator. (a) A composite promoter with typical sequence elements and protein complexes found in both yeast and higher eu karyotes. The carboxyl-term i na l domain (CTD) of Pol II (see Fig. 2 6-1 0) is an important point of i nteraction with medi ator and other protein comp lexes. The histone modification enzymes catalyze methylation and acetylation; the remodeling enzymes alter the content and place ment of nucleosomes. For the transcription activators, DNA-b inding domains are shown i n green, activation domains i n pink. The i nterac tions symbo l i zed by blue arrows are di scussed in the text. (b) Eukary otic transcriptional repressors function by a range of mechanisms . Some bind directly to DNA, displacing a protein complex requi red for activation; others i nteract with various parts of the transcription or ac tivation complexes to prevent activation. Possible poi nts of i nteraction are indicated with red arrows.
chemically. These coactivator complexes act as interme diaries between the transcription activators and the Pol II complex. The principal eukaryotic coactivator consists of 20 to 30 or more polypeptides in a protein complex called mediator (Fig. 28-29) ; many of the 20 core polypep tides are highly conserved from fungi to humans. An additional complex of four subunits can interact with mediator and inhibit transcription initiation. Mediator binds tightly to the carboxyl-terminal domain (CTD) of
� 14�
Regu lation of Gene Expression
the largest subunit of Pol II. The mediator complex is required for both basal and regulated transcription at promoters used by Pol II, and it also stimulates phos phorylation of the CTD by TFIIH (a basal transcription factor). Transcription activators interact with one or more components of the mediator complex, with the precise interaction sites differing from one activator to another. Coactivator complexes function at or near the promoter's TATA box. Additional coactivators, functioning with one or a few genes, have also been described. Some of these op erate in conjunction with mediator, and some may act in systems that do not employ mediator. TATA-Binding Protein The first component to bind in the assembly of a preinitiation complex (PIC) at the TATA box of a typical Pol II promoter is the TATA binding protein (TBP). The complete complex in
cludes the basal transcription factors TFIIB, TFIIE, TFIIF, TFIIH; Pol II; and perhaps TFIIA. This minimal PIC, however, is often insufficient for the initiation of transcription and generally does not form at all if the promoter is obscured within chromatin. Positive regulation, leading to transcription, is imposed by the activators and coactivators. We can now begin to piece together the sequence of tran scriptional activation events at a typical Pol II promoter (Fig. 28-:JO). The exact order of binding of some com ponents may vary, but the model in Figure 28-30 illus trates the principles of activation as well as one common path. Many transcription activators have significant affin ity for their binding sites even when the sites are within condensed chromatin. The binding of activators is often the event that triggers subsequent activation of the pro moter. Binding of one activator may enable the binding of others, gradually displacing some nucleosomes. Crucial remodeling of the chromatin then takes place in stages, facilitated by interactions between acti vators and HATs or enzyme complexes such as SWI/SNF (or both) . In this way, a bound activator can draw in other components necessary for further chromatin remodeling to permit transcription of specific genes. The bound activators interact with the large mediator complex. Mediator, in turn, provides an assembly surface for the binding of first TBP (or TFIID), then TFIIB, and then other components of the PIC including RNA poly merase II. Mediator stabilizes the binding of Pol II and its associated transcription factors and greatly facilitates formation of the PIC. Complexity in these regulatory cir cuits is the rule rather than the exception, with multiple DNA-bound activators promoting transcription. The script can change from one promoter to an other, but most promoters seem to require a precisely ordered assembly of components to initiate transcrip tion. The assembly process is not always fast. At some genes it may take minutes; at certain genes of higher eu karyotes the process can take days.
Activator
.('_::t. ,/ .::S I Enhancer
�
/:----
1
DNA Mediator Modification and remodeling enzymes
'TATA
TBP
Inr
and
TFIIB
TFIIB
�-------:'ican Biology Teacher (March) 35, 125-129.
CHAPTER 2 p. 43 Linus Pauling (1939) The Nature of the Chemical Bond and the Structure of Molecules and Crystals: An Introduction to Modem Structural Chemistry, Cornell University Press, Ithaca, NY; Figure 2-9 PDB ID 1A3N, Tame, J. & Vallone, B. (1998) Deoxy human hemoglobin (primary citation not available); Figure 2-10 Adapted from Nicolls, P. (2000) Introduction: the biology of the water molecule. Cell. Mol. Life Sci 57, 987, Fig 6a (redrawn from information in the PDB and a Kinemage file published by Martinez, S.E , Huang, D , Ponomarev, M , Cramer, W.A., & Smith, J L. (1996) The heme redox center of chloroplast cytochromefis linked to a buried five-water chain. Protein (1928) Poss·tble
Sci 5, 1081); Box 2-1 J B S Haldane
Worlds, Harper and Brothers, New York and London, pp
113-126; p. 66 Jon Bertsch/Visuals Unlimited.
A , Bulliard, V., Cerutti, L., De Castro, E , Langendijk-Genevaux, P,S , Pagni, M , & Sigrist, C J.A (2006) The PROSITE database. Nucleic Acids Res 34, D227; WebLogo from http://weblogo berkeley edu, Crooks, GE , Hon, G , Chandonia, J.M , & Brenner, SE. (2004) WebLogo: a sequence logo generator,
Genome Res !4, 1188; Figures 3-30, 3-31, 3-32 Adapted from Gupta, R.S. (1998) Protein phylogenies and signature sequences: a reappraisal of evolu tionary relationships among archaebacteria, eubacteria, and eukaryotes
Microbial Mol Biol. Rev 62, 1435, Figs 2, 7, II, respectively; Figure 3-33 Adapted from Delsuc, F , Brinkmann, H , & Philippe, H (2005) Phylogenomics and the reconstruction of the tree of life. Nat. Rev. Genet 6, 366; p. 1 1 1, problem 11 See citation for Box 3-3 Figure I, document lD PDOC00270 (1958) A three-dimensional model
of the myoglobin molecule obtained by x-ray analysis. Nature 181, 662-666;
Figure 4-1 PDB ID 6GCH, Brady, K , Wei, A , Ringe, D , & Abeles, R.H. (1990) Structure of chymotrypsin-trifiuoromethyl ketone inhibitor complexes: comparison of slowly and rapidly equilibrating inhibitors
Biochemistry 29,
7600; glycine coordinates from Sybyl; p. 1 15 (Pauling) Corbis/Bettmann; (Corey) AP/Wide World Photos; Figure 4-3 Adapted from Creighton, T E (1984) Proteins, p. 166
© 1984 by W
H. Freeman and Company. Reprinted
by permission; Figure 4-4b,c PDB ID 4TNC, Satyshur, K.A., Rao, S T., Pyzalska, D., Drendel, W , Greaser, M ., & Sundaralingam, M. (1988) Refined structure of chicken skeletal muscle troponin C in the two-calcium state at 2-angstroms resolution. J.
Biol Chem 263, 1628; Figure 4-8a See
citation for Figure 4-3; Figure 4-Sb Courtesy of Hazel Holden, University of Wisconsin-Madison, Department of Biochemistry and Enzyme Institute;
Figure 4-11 PDB ID !CGD (modified), Bella, J , Brodsky, B., & Berman, H M. (1995) Hydration structure of a collagen peptide Structure 3, 893; Figure 4-12 Science Source/Photo Researchers; p. 126 Ethel Wedgwood (1906) The Merrwirs of the Lord of Joinville. A New English Version, E P Dutton and Company, New York; (Lind) Courtesy of the Royal College of Physicians of Edinburgh; Figure 4-13a PDB ID ISLK (model), Fossey, S A., Nemethy, G,, Gibson, K.D., & Scheraga, H A. (1991) Conformational energy studies of 13-sheets of model silk fibroin peptides: I Sheets of poly(Ala-Gly) chains.
Biopolymers 3!, 1529; Figure 4-13b Dr. Dennis KunkeVPhototake NYC; Figure 4-15 PDB ID IMBO; Phillips, S.E V (1980) Structure and refinement of oxymyoglobin at I 6 angstroms resolution J.. Mol. Bioi 142, 531; Figure 4-17b PDB ID 7AHL; Song, L., Hobaugh, M R, Shustak, C , Cheley, S, Bayley, H ,
& Gouaux, J.E
(1996) Structure of staphylococcal a hemolysin, a
heptameric transmembrane pore. Science 274, 1859; Box 4-5 Figure 1a,b,c George N. Phillips, Jr., University of Wisconsin-Madison, Department of Biochemistry; Box 4-5 Figure 1d PDB ID 2MBW; Brucker, E.A., Olson, J.S , Phillips, G N., Jr., Dou,
Y, & Ikeda-Saito, M
(1996) High resolution crystal
structures of the deoxy·, oxy-, and aquomet· forms of cobalt myoglobin
J..
Bioi Chem 271, 25,419; Box 4-5 Figures 2, 3a Volkman, B F., Alam, S.L., Satterlee, J.D., & Markley, J L (1998) Solution structure and backbone
dynamics of component IV-glycera dibranchiata monomeric hemoglobin-CO.
Biochemistry 37, 10,906; Box 4-5 Figure Sb,c Created by Brian Volkman, National Magnetic Resonance Facility at Madison, using MOLMOL; PDB ID IVRF (b) and IVRE (c), see citation for Box 4-5 Figures 2, 3a; Figure 4-18 PDB ID 4TNC, see citation for Figure 4-4b,c; Figure 4-l9c PDB ID lDNP, Park, H.W., Kim, S.T , Sancar, A.,
& Deisenhofer, J
DNA photolyase from Escherichia
(1995) Crystal structure of
coli Science 268, 1866; Figure 4-20 PDB
1., & Reed, G.H. 2 (1994) Structure of rabbit muscle pyruvate kinase complexed with Mn +, K+,
ID IPKN, Larsen, T.M., Laughlin, L.T., Holden, H.M., Rayment,
CHAPTER 3
p. 71 J J Berzelius (1838) Letter to G. J Mulder In H B. Vickery (1950) The origin of the word protein Yale Journal of Biology and Medic-ine 22, 387-393; Figure 3-1a Runk/Schoenburger/Grant Heilman Photography; Figure 3-1b Bill Longcore/Photo Researchers; Figure 3-1c Animals Animals; p. 72 (Dayhoff) Courtesy of Ruth E Dayhoff; Figure 3-18b Julia Cox, University of Wisconsin-Madison, Department of Biochemistry;
Figure 3-2 1b Patrick H O'Farrell, University of California Medical Center, San Francisco, Department of Biochemistry and Biophysics; Figure 3-23 PDB ID 1HGA, Liddington, R , Derewenda, Z., Dodson, E., Hubbard, R.,
228, 551; p. 94 (Sanger)
& Wilm, (1995) Electrospray mass spectrometry for protein characterization
CHAPTER 4 p. 1 13 J. C. Kendrew et a!
p. 1 Fran
pi = 1; carboxylate groups; Asp and Glu
13. Lys, His, Arg; negatively charged phosphate groups in DNA inter
H+
act with positively charged side groups in histones.
14. (a) (Glu)20 (b) (Lys-Aia)3 (c) (Asn-8er-His) 5 (d) (Asn-Ser-His)5
1
coo-
I HN' l + j-CH2-CH-NH3 N H +
2
elements of water are lost when a peptide bond
forms, so the molecular weight of a Trp residue is not the same
the Henderson-Hasselbalch equation,
pKR
=
6.0
\
H-
>
15. (a) Specific activity after step 1 is 200 units/mg; step 2, 600 units/mg; step 3, 250 units/mg; step 4, 4,000 units/mg; step 5, 15,000 units/mg; step 6, 15,000 units/mg (b) Step 4 (c) Step 3 (d) Yes. Specific activity did not increase in step 6; SDS poly acrylamide gel electrophoresis
+
[As-4]
Abbreviated Solutions to Problems
16. (a) [NaCl]
=
0.5 mM (b) [NaCl]
=
0.05 mM.
17. C elutes first, B second, A last. 18. Tyr-Gly-Gly-Phe-Leu
19.
/ Orn
Phe
Leu-Tyr-Glx-Leu-Glx-Asx-Tyr-Cys-Asn-C
Pro
t
t
Val
Pro
\
I Orn
- Leu
v
The arrows correspond to the orientation of the peptide bonds, -CO � NH-.
20. 88% , 97% . The percentage (x) of correct amino acid residues re leased in cycle n is x,jx All residues released in the first cycle are correct, even though the efficiency of cleavage is not perfect.
2 1 . (a) Y ( l ) , F (7), and R (9) (b) Positions 4 and 9; K (Lys)
is more common at 4, R (Arg) is invariant at 9 (c) Positions 5 and 1 0; E (Glu) is more common at both positions (d) Position 2; S (Ser)
22. (a) The protein to be isolated (citrate synthase, CS) is a rela
tively small fraction of the total cellular protein. Cold tempera tures reduce protein degradation; sucrose provides an isotonic environment that preserves the integrity of organelles during ho mogenization. (b) This step separates organelles on the basis of relative size. (c) The first addition of ammonium sulfate removes some unwanted proteins from the homogenate. Additional am monium sulfate precipitates CS. (d) To resuspend (solubilize) CS, ammonium sulfate must be removed under conditions of pH and ionic strength that support the native conformation. (e) CS molecules are larger than the pore size of the chromatographic geL Protein is detectable at 280 nm because of absorption at this wavelength by Tyr and Trp residues. (f) CS has a positive charge and thus binds to the negatively charged cation-exchange col umn. After the neutral and negatively charged proteins pass through, CS is displaced from the column using the washing so lution of higher pH, which alters the charge on CS. (g) Different proteins can have the same pl. The SDS gel confirmed that only a single protein was purified. SDS is difficult to remove completely from a protein, and its presence distorts the acid-base properties of the protein, including pi
23. (a) Any linear polypeptide chain has only two kinds of free
amino groups: a single a-amino group at the amino terminus, and an E-amino group on each Lys residue present. These amino groups react with FDNB to form a DNP-amino acid de rivative. Insulin gave two different a-an1ino-DNP derivatives, suggesting that it has two amino termini and thus two polypep tide chains-one with an amino-terminal Gly and the other with an amino-terminal Phe. Because the DNP-lysine product is E-DNP-lysine, the Lys is not at an amino terminus. (b) Yes. The A chain has amino-terminal Gly; the B chain has amino-terminal Phe; and (nonterminal) residue 29 in the B chain is Lys. (c) Phe-Val-Asp-Glu-. Peptide B1 shows that the amino-terminal residue is Phe. Peptide B2 also includes Val, but since no DNP Val is formed, Val is not at the amino terminus; it must be on the carboxyl side of Phe. Thus the sequence of B2 is DNP Phe-Val. Sinlilarly, the sequence of B3 must be DNP-Phe-Vai-Asp, and the sequence of the A chain must begin Phe-Vai-Asp-Glu-. (d) No. The known amino-terminal sequence of the A chain is Phe-Val-Asn-Gin-. The Asn and Gin appear in Sanger's analy sis as Asp and Glu because the vigorous hydrolysis in step (J) hydrolyzed the amide bonds in Asn and Gln (as well as the peptide bonds), forming Asp and Glu. Sanger et al. could not distinguish Asp from Asn or Glu from Gin at this stage in their analysis. (e) The sequence exactly matches that in Fig. 3-24. Each peptide in the table gives specific information about which Asx residues are Asn or Asp and which Glx residues are Glu or Gln.
10
5
1
\
Val
Phe "'--
N-Gly-Ile-Val-Glx-Glx-Cys-Cys-Ala-Ser-Val-Cys-Ser-
Leu -._,.
l
Acl . residues 20-2 1 . This is the only Cys-Asx sequence in the A chain; there is -1 amido group in this peptide, so it must be Cys-Asn:
20
15
Apl5: residues 1 4-1 5-1 6. This is the only Tyr-Glx-Leu in the A chain; there is 1 amido group, so the peptide must be Tyr-Gln-Leu: -
N-Gly-Ile-Val-Glx-Glx-Cys-Cys-Ala-Ser-Val-Cys-Ser-
10
5
1
Leu-Tyr-Gln-Leu-Glx-Asx-Tyr-Cys-Asn-C
20
15
Apl4: residues 1 4-15-16-1 7 . It has - 1 amido group, and we al ready know that residue 1 5 is Gln, so residue 1 7 must be Glu: N-Gly-Ile-Val-Glx-Glx-Cys-Cys-Ala-Ser-Val-Cys-Ser-
10
5
1
Leu-Tyr-Gln-Leu-Glu-Asx-Tyr-Cys-Asn-C
20
15
Ap3: residues 18-19-20-2 1 lt has -2 amido groups, and we know that residue 2 1 is Asn, so residue 1 8 must be Asn: N-Gly-Ile-Val-Glx-Glx-Cys-Cys-Ala-Ser-Val-Cys-Ser-
10
5
1
Leu-Tyr-Gln-Leu-Glu-Asn-Tyr-Cys-Asn-C
20
15
Apl: residues 1 7- 18-- 1 9-20-21 , which is consistent with residues 1 8 and 2 1 being Asn. Ap5pal: residues 1-2-3-4. It has -0 amido group, so residue 4 must be Glu: Leu-Tyr-Gln-Leu-Glu-Asn-Tyr-Cys-Asn-C
20
15
Leu-Tyr-Gln-Leu-Glu-Asn-Tyr-Cys-Asn-C
20
15
Ap5: residues 1 through 1 3. It has - 1 amido group, and we know that residue 14 is Glu, so residue 5 must be Gln: N-Gly-Ile-Val-Glu-Gln-Cys-Cys-Ala-Ser-Val-Cys-Ser-
ro
5
1
Leu-Tyr-Gln-Leu-Glu-Asn-Tyr-Cys-Asn-C
15
20
Chapter 4
1. (a) Shorter bonds have a higher bond order (are multiple rather than single) and are stronger. The peptide C-N bond is stronger than a single bond and is midway between a single and a double bond in character. (b) Rotation about the peptide bond is diffi cult at physiological temperatures because of its partial double bond character.
2. (a) The principal structural units in the wool fiber polypeptide (a-keratin) are successive turns of the a helix, at 5 .4 A intervals; coiled coils produce the 5.2 A spacing. Steaming and stretching
the fiber yields an extended polypeptide chain with the {3 confor mation, with a distance between adjacent R groups of about 7.0 A. As the polypeptide reassumes an a-helical structure, the fiber shortens. (b) Processed wool shrinks when polypeptide chains are converted from an extended f3 conformation to the native a-helical conformation in the presence of moist heat. The structure of silk-,6 sheets, with their small, closely packed amino acid side chains-is more stable than that of wool.
3. -42 peptide bonds per second
4. At pH > 6, the carboxyl groups of poly(Glu) are deprotonated; repulsion among negatively charged carboxylate groups leads to
Abbreviated Solutions to Problems
unfolding. Similarly, at pH 7, the amino groups of poly(Lys) are protonated; repulsion among these positively charged groups also leads to unfolding.
5. (a) Disulfide bonds are covalent bonds, which are much stronger than the noncovalent interactions that stabilize most proteins. They cross-link protein chains, increasing their stiffness, me chanical strength, and hardness (b) Cystine residues (disulfide bonds) prevent the complete unfolding of the protein
6. (a) Bends are most likely at residues 7 and 1 9 ; Pro residues in the cis configuration accommodate turns well. (b) The Cys residues at positions 13 and 24 can form disulfide bonds. (c) External surface: polar and charged residues (Asp, Gin, Lys) ; interior: nonpolar and aliphatic residues (Ala, lie); Thr, though polar, has a hydropathy index near zero and thus can be found either on the external surface or in the interior of the protein.
7. 30 amino acid residues; 0.87 8. Myoglobin is all three. The folded structure, the "globin fold," is a motif found in all glob ins. The polypeptide folds into a single domain, which for this protein represents the entire three dimensional structure.
9. The bacterial enzyme is a collagenase; it destroys the connective tissue barrier of the host, allowing the bacterium to invade the tissues. Bacteria do not contain collagen. 10. (a) The number of moles of DNP-valine formed per mole of pro tein equals the number of amino termini and thus the number of polypeptide chains. (b) 4 (c) Different chains would probably run as discrete bands on an SDS polyacrylamide gel. 1 1 . (a); it has more amino acid residues that favor a-helical struc ture (see Table 4-1 ) .
[As-s]
chaperones for proper folding; these are not present in the study buffer. (7) In cells, HIV protease is synthesized as part of a larger chain that is then proteolytically processed; the protein in the study was synthesized as a single molecule. (c) Because the en zyme is functional with Aba substituted for Cys, disulfide bonds do not play an important role in the structure of HIV protease . (d) Model l · it would fold like the 1-protease. Argument for: the covalent structure is the same (except for chirality) , so it should fold like the L-protease. Argument against: chirality is not a trivial detail; three-dimensional shape is a key feature of biological molecules. The synthetic enzyme will not fold like the 1-protease. Model 2: it would fold to the mirror image of the 1-protease . For: because the individual components are mirror images of those in the biological protein, it will fold in the mirror image shape . Against: the interactions involved in protein fold ing are very complex, so the synthetic protein will most likely fold in another form. Model 3. it would fold to something else. For: the interactions involved in protein folding are very com plex, so the synthetic protein will most likely fold in another form. Against: because the individual components are mirror images of those in the biological protein, it will fold in the mirror image shape. (e) Model l . The enzyme is active, but with the enantiomeric form of the biological substrate, and it is inhibited by the enantiomeric fmm of the biological inhibitor. This is consistent with the D-protease being the mirror image of the L-protease. (f) Evans blue is achiral; it binds to both forms of the enzyme . (g) No. Because proteases contain only L-amino acids and recog nize only 1-peptides, chymotrypsin would not digest the D-protease. (h) Not necessarily. Depending on the individual enzyme, any of the problems listed in (b) could result in an inactive enzyme.
1 2 . ( a ) Aromatic residues seem t o play an important role i n stabiliz ing amyloid fibrils. Thus, molecules with aromatic substituents may inhibit amyloid formation by interfering with the stacking or association of the aromatic side chains (b) Amyloid is formed in the pancreas in association with type 2 diabetes, as it is in the brain in Alzheimer's disease. Although the amyloid fibrils in the two diseases involve different proteins, the fundamental structure of the amyloid is similar and similarly stabilized in both, and thus they are potential targets for similar drugs designed to disrupt this structure.
13. (a) NFKB transcription factor, also called RelA transforming factor. (b) No You will obtain similar results, but with additional related proteins listed. (c) The protein has two subunits. There are multiple variants of the subunits, with the best-characterized being 50, 52, or 65 kDa. These pair with each other to form a variety of homodimers and heterodimers. The structures of a number of different variants can be found in the PDB. (d) The NFKB transcription factor is a dimeric protein that binds specific DNA sequences, enhancing transcription of nearby genes One such gene is the immunoglobulin K light chain, from which the transcription factor gets its name.
14. (a) Aba is a suitable replacement because Aba and Cys have approximately the same sized side chain and are similarly hy drophobic However, Aba cannot form disulfide bonds so it will not be a suitable replacement if these are required (b) There are many important differences between the synthesized protein and HIV protease produced by a human cell, any of which could result in an inactive synthetic enzyme: (l ) Although Aba and Cys have similar size and hydrophobicity, Aba may not be similar enough for the protein to fold properly. (2) HlV protease may re quire disulfide bonds for proper functioning (3) Many proteins synthesized by ribosomes fold as they are produced; the protein in this study folded only after the chain was complete. (4) Pro teins synthesized by ribosomes may interact with the ribosomes as they fold; this is not possible for the protein in the study (5) Cytosol is a more complex solution than the buffer used in the study; some proteins may require specific, unknown proteins for proper folding. (6) Proteins synthesized in cells often require
Chapter 5
1. Protein B has a higher affinity for ligand X; it will be half saturated at a much lower concentration of X than will protein A 1 09 M- 1 . 106 M - \ protein B has Ka Protein A has Ka =
=
III � acetyl-CoA + propionyl-CoA (b) Step CD transamination, no analogous reaction, PLP; ® oxidative decarboxylation, analogous lo Ute pymvatc dehydro&plete ;, .lease metabolism.
I
H
J•
tive decarboxvhoon of pyruvate to acetyl-GoA is essential to
o
o
o
10. Water-soluble hormones bind to receptors on the outer surface
BtrJ
BtrK
7 '\1
ATP
ADP
of the cell, triggering the formation of a second messenger (e.g., cAMP) inside the cell. Lipid-soluble hormones can pass through the plasma membrane to act on target molecules or receptors directly.
+Btri
1 1 . (a) Heart and skeletal muscle lack glucose 6-phosphatase. Any glucose 6-phosphate produced enters the glycolytic pathway,
Glutamate ATP� BtrJ
/ ADP
1
and under 02-deficient conditions is converted to lactate via pyruvate.
(b) In a "fight or flight" situation, the concentration of
glycolytic precursors must be high in preparation for muscular activity. Phosphorylated intermediates cannot escape from the cell, because the membrane is not permeable to charged species, and glucose 6-phosphate is not exported on the glucose
Abbreviated Sol utions to P roblems
be expressed in different cells than the SUR gene. The mRNA
transporter The liver, by contrast, must release the glucose nec essaJy to maintain blood glucose level; glucose is formed from
hybridization results are consistent with the putative SUR eDNA
glucose 6-phosphate and enters the bloodstream.
actually encoding SUR. (g) The excess unlabeled glyburide
12. (a)
competes with labeled glyburide for the binding site on SUR. As
Excessive uptake and use of blood glucose by the liver, lead
a result, there is significantly less binding of labeled glyburide,
ing to hypoglycemia; shutdown of amino acid and fatty acid catabolism
(b)
so little or no radioactivity is detected in the 140 kDa protein.
Little circulating fuel is available for ATP require
{h) In the absence of excess unlabeled glyburide, labeled 140
ments. Brain damage results because glucose is the main source
kDa protein is found only in the presence of the putative SUR
of fuel for the brain.
eDNA Excess unlabeled glyburide competes with the labeled 125 1-labeled 1 40 kDa protein is detected. This
13. Thyroxine acts as an uncoupler of oxidative phosphorylation
glyburide, and no
Uncouplers lower the P/0 ratio, and the tissue must increase
shows that the eDNA produces a glyburide-binding protein of
respiration to meet the normal ATP demands. Thermogenesis
the same molecular weight as SUR-strong evidence that the
could also be due to the increased rate of ATP utilization by
cloned gene encodes the SUR protein. (i) Several additional
the thyroid-stimulated tissue, as increased ATP demands
steps are possible, such as: ( 1 ) Express the putative
are met by increased oxidative phosphorylation and thus
SUR eDNA
in CHO (Chinese hamster ovary) cells and show that the trans
respiration.
formed cells have ATP-gated K+ channel activity. (2) Show that
14. Because prohormones are inactive, they can be stored in quan
HIT cells with mutations in the putative SUR gene lack ATP
tity in secretory granules. Rapid activation is achieved by enzy
gated K+ channel activity. (3) Show that experimental animals
matic cleavage in response to an appropriate signal.
15.
.,
1 AS-291
or human patients with mutations in the putative
In animals, glucose can be synthesized from many precursors
SUR gene
are
unable to secrete insulin.
(see Fig. 14-15) In humans, the principal precursors are glycerol from triacylglycerols and glucogenic amino acids from protein.
16. The oblob mouse, which is initially obese, will lose weight. The OB!OB mouse will retain its n01mal body weight.
17.
Cha pter 24 1.
4 6 . 1 X 1 0 nm; 290 times longer than the T2 phage head
2.
The number of A residues does not equal the number of T
BMI = 39.3 . For BMI of 25, weight must be 75 kg; must lose
residues, nor does the number of G equal the number of C, so
43 kg = 95 lbs
the DNA is not a base-paired double helix; the M 1 3 DNA is single-stranded.
18. Reduced insulin secretion. Valinomycin has the same effect as opening the K+ channel, allowing K+ exit and consequent hyperpolarization.
3. Mr = 3 8
4. The exons contain 3 bp/amino acid
19. The liver does not receive the insulin message and therefore con neogenesis, increasing blood glucose both during a fast and after a glucose-containing meal. The elevated blood glucose triggers
sequence, and/or in other noncoding DNA.
5.
type 2 diabetes? Are other, equally effective treatment options, with fewer adverse effects, available? Without intestinal glucosidase activity, absorption of glucose from dietary glycogen and starch is reduced, blunting the usual rise in blood glucose after the meal The undigested oligosaccha
the same number of positive and negative supercoils .
7.
relaxed, so the topoisomerase does not cause a net change.
(d) 460; gyrase plus ATP reduces the Lk in increments of 2. (e)
Type 2 dia
(c) Individuals
{f) 460; nucleosome binding does not break any DNA strands
9. A fundamental structural unit in chromatin repeats about every 200 bp; the DNA is accessible to the nuclease only at 200 bp in tervals. The brief treatment was insufficient to cleave the DNA at
(d) Iodine, like chlorine
every accessible point, so a ladder of DNA bands is created in
(the atom it replaces in the labeled glyburide) , is a halogen, but
which the DNA fragments are multiples of 200 bp. The thickness
it is a larger atom and has slightly different chemical properties
of the DNA bands suggests that the distance between cleavage
It is possible that the iodinated glyburide would not bind to SUR
sites varies somewhat. For instance, not all the fragments in the
If it bound to another molecule instead, the experiment would (e) Although a protein has been "purified," the "purified" prepa ration might be a mixture of several proteins that co-purify un der those expe1imental conditions. In this case, the amino acid sequence could be that of a protein that co-purifies with SUR. Using antibody binding to show that the peptide sequences are present in SUR excludes this possibility {f) Although the cloned
I topoisomerases increase the Lk of un
and thus cannot change Lk
with type 1 diabetes have deficient pancreatic {3 cells, so gly
result in cloning of the gene for this other, incorrect protein
464; eukaryotic type
derwound or negatively supercoiled DNA in increments of 1 .
betes results from decreased sensitivity to insulin, not a deficit of duce the symptoms associated with this disease.
u = - 0 067; >70% probability
8. (a) Undefined; the strands of a nicked DNA could be separated and thus have no Lk (b) 4 76 (c) 4 76; the DNA is already
Closing the ATP-gated K+ channel would depolarize the
insulin production; increasing circulating insulin levels will re
(c) Decreases; in the presence of ATP, (d) Doesn't change; this assumes that
neither of the DNA strands is broken in the heating process_
gases released cause intestinal discomfort.
{b)
Be
6. For Lk to remain unchanged, the topoisomerase must introduce
rides are fermented by bacteria in the large intestine, and the
membrane, leading to increased insulin release.
{b)
gyrase underwinds DNA
attributable to the drug? How does this frequency compare with
buride will have no beneficial effect.
Doesn't change; Lk cannot change without break
by definition, no Lk.
Some things to consider: What is the frequency of heart attack
22. (a)
(a)
comes undefined; a circular DNA with a break in one strand has,
insulin in the blood.
21.
5,000 bp.
ing and re-forming the covalent backbone of the DNA.
insulin release from pancreatic {3 cells, hence the high level of
the number of individuals spared the long-term consequences of
X 1 92 amino acids = 576 bp.
The remaining 864 bp are in introns, possibly in a leader or signal
tinues to have high levels of glucose 6-phosphatase and gluco
20.
8
X 1 0 ; length = 200 J.Lm; Lk0 = 55,200; Lk = 5 1 ,900
lowest band are exactly 200 bp long.
10.
A right-handed helix has a positive Lk; a left-handed helix (such as Z-DNA) has a negative Lk. Decreasing the Lk of a closed cir cular B-ONA by underwinding it facilitates formation of regions of Z-ONA within certain sequences. (See Chapter 8, p. 281, for a description of sequences that permit the formation of Z-ONA.)
1 1 . (a) Both strands must be covalently closed, and the molecule
gene does encode the 25 amino acid sequence found in SUR, it
must be either circular or constrained at both ends. {b) Forma
could be a gene that, coincidentally, encodes the same sequence
tion of cruciforms, left-handed Z-ONA, plectonemic or solenoidal
in another protein In this case, this other gene would most likely
supercoils, and unwinding of the DNA are favored.
(c) E. coli
Gs-3�
Abbreviated Solutions to Problems
DNA topoisomerase II or DNA gyrase. (d) It binds the DNA at a point where it crosses on itself, cleaves both strands of one of the crossing segments, passes the other segment through the break, then reseals the break. The result is a change in Lk of - 2 .
12. Centromere, telomeres, and a n autonomous replicating sequence or replication origin 13. The bacterial nucleoid is organized into domains approximately 1 0,000 bp long. Cleavage by a restriction enzyme relaxes the DNA within a domain, but not outside the domain. Any gene in the cleaved domain for which expression is affected by DNA topology will be affected by the cleavage; genes outside the domain will not. 14. (a) When DNA ends are sealed to create a relaxed, closed circle, some DNA species are completely relaxed but others are trapped in slightly under- or ove1wound states. This gives rise to a distri bution of topoisomers centered on the most relaxed species. (b) Positively supercoiled (c) The DNA that is relaxed despite the addition of dye is DNA with one or both strands broken DNA isolation procedures inevitably introduce small numbers of strand breaks in some of the closed-circular molecules. (d) Ap proximately -0. 05. This is determined by simply comparing na tive DNA with samples of known a-. In both gels, the native DNA migrates most closely with the sample of u = -0 049
' 15. (a) In nondisjunction, one daughter cell and all of its descen dants get two copies of the synthetic chromosome and are white; the other daughter cell and all of its descendants get no copies of the synthetic chromosome and are red This gives rise to a half white, half-n�d colony_ (b) In chromosome loss, one daughter cell and all of its descendants get one copy of the synthetic chro mosome and are pink; the other daughter and all its descendants get no copies of the synthetic chromosome and are red This gives rise to a half-pink, half-red colony (c) The minimum func tional centromere musl be smaller than 0 .63 kbp, since all frag ments of this size or larger confer relative mitotic stability. (d) Telomeres are required to fully replicate only linear DNA; a circular molecule can replicate without them. (e) The larger the chromosome, the more faithfully it is segregated. The data show neither a minimum size below which the synthetic chromosome is completely unstable, nor a maximum size above which stability no longer changes (f)
10
� Q) ..., 466-467, 466f
molecular, 948
Gq, 432 G, (stimulatory), 424-427, 424f
in ATP hydrolysis, 502-503, 502f, 504f
alteration of, 312-313, 313f
defintion of, 273
in carbohydrate metabolism, 575t
adenylyl cyclase and, 426
evolutionary divergence of, 34-35
of electrochemical gradient, equation
self-inactivation of, 426-427
exons in, 952, 1035
Ras-type, 425b, 440, 44lf
for, 720
in enzymatic reactions,
23-24, 186-187, 187-188,
! 87f, 188t, 191-192
Ras-type, 425b, 440, 44lf
in membrane transport, 396
G protein-coupled receptor(s), 422, 422f, 423, j3-adrenergic receptor as prototype of, 423-431
See
also standard free-energy change free-living bacteria, nitrogen-fixing, 856-857 FRET (fluorescent resonance energy transfer), 435b-436b
homologous, 34
heptahelical, 424
housekeeping, 1 1 16
serpentine, 424
immunoglobulin, recombination of, 1014-1016,
G protein-coupled receptor kinases (GRKs) , 431 'Y turns, 121
fructose, 235, 236s, 237s, 238
GABA (-y-aminobutyric acid), 878
light activation of, 784-785, 785f fructose 1 ,6-bisphosphate, 532s, 533s in Calvin cycle, 779, 780f cleavage of, 533-534, 534f conversion of to fructose 6-phosphate in
1015f, 1016f introns in. See introns
fructokinase, 545
fructose 2,6-bisphosphatase, 588
homeotic, 1 1 48, 1 1 50-1 1 5 1 , 1 15 1 f
evolutionary significance of, 467
G tetraplex, 282
fructose 1 ,6-bisphosphatase, 556
functionally related, identification of, 328 gap, 1147, 1 150
423-431 , 467-468
in protein synthesis, 1095 vs standard free-energy change, 493-494
jumping, 1 004, 1013
receptor for, as ion channel, 410
naming conventions for, 976
G-actin, 176, 1 76f
orthologous, 34, 325
gag, 1051, 1051f
pair-rule, 1147
frameshifting and, 1072
gag-pol, frameshifting and, 1072
GAL genes, regulation of,
maternal, 1147, 1 1 48-1150, 1 1 48f, 1 149f mutation of. See mutations
1 141-1 142
o-galactitol, 546s
paralogous, 34, 325 pattern-regulating, 1 147-1152 segment polarity, 1147- 1 1 48, 1 150
galactokinase, 545
segmentation, 1147
in glycolysis, 529f, 530
galactolipids, 352f
size of, 948, 948f
phosphorylation of fructose 6-phosphate
galactosamine, 240, 240s
gluconeogenesis, 553t, 556
to, 532
galactose, 237, 237s, 238
regulation of, 585-586, 587f fructose 2,6-bisphosphate (F26BP), 587, 587s, 793, 793f in regulation of glycolysis and gluconeogenesis, 587-588, 587f
conversion of to glucose ! -phosphate, 554f
of cloned genes, 312, 3!2f, 313f constitutive, 1 1 16
oxidation of, 240-241 , 240f
definition of, 3 1 5
galactose metabolism genes, regulation of, galactosemia, 545
fructose 1 ,6-bisphosphate aldolase, 533
j3-galactosides,
fructose ! -phosphate, 545s
Galapagos finches, beak evolution in,
fructose 6-phosphate, 532, 532s in Calvin cycle, 779, 780f, 78lf conversion of fructose 1 ,6-bisphosphate to, in gluconeogenesis, 553t, 556 conversion of glucose 6-phosphate to, 532, 533f
lac operon and, 1 1 19-1 121
1 1 52b- 1 1 53b Gal4p acidic activation domain of, 1142-1143 in yeast two-hybrid analysis, 329 -y-aminobutyric acid (GABA), 878 receptor for, as ion channel, 410
phosphorylation of, to fructose 1 ,6-bisphosphate, 532 in sucrose synthesis, 793, 793s, 798f, 799 fructose !-phosphate aldolase, 545 j3-o-fructuranose, 239
stability, 4 77 gene expression, 1 1 16
epimers of, 237s
1 141-1 142, 1 14lf
in sucrose synthesis, 793, 793f
See also
protein function functional classification of, 35
in signaling, 440
of esterification, 493t of glycolytic reactions in erythrocytes, 553t
transcription of, 1035 functional analysis of, 324-329.
small, 440
ganglioside(s), 256, 350f, 353f, 354, 355f, 829 functions of, 354-355
induction of, 1 1 16 regulated, 1116. See also gene regulation repression of, 1 1 16 gene inactivation studies, 324 gene products inducible, 1116 repressible, 1 1 16 gene regulation, 1 1 15-1 1 54 acidic activation domain in, 1142-1143 activators in, 1 1 1 7-1 1 18, 1 1 1 7f antigenic variation in, 1 135t catabolite repression in, 1126 chromatin in, 1 1 36-1 138
lysosomal degradation of, 355, 355f
coactivators in, 1139, 1 139f
structure of, 354s
in development, 1 146-1 151
synthesis of, 829
gene silencing in, 1 1 45-1146, 1 146f
ganglioside GM2, 353f
DNA-binding domains in, 1 1 2 1-1 124,
gene regulation in, 1 146-1 151
gangliosidosis, 356
effectors in, 1 1 17
pattern-regulating genes in, 1 147-1152
gap genes, 1147, 1 150
enhancers in, 1117, 1139
GAPs (GTPase proteins), 426b
in eukaryotes, 1 136-1154
fruit fly development of
genome of, 949, 950t life cycle of, 1 147, 1 147f F-type ATPase. See
also ATP synthase(s)
in membrane transport, 399, 399f
in Tay-Sachs disease, 356, 356f
gas constant (R), 49lt
1 1 22f-1 124f
steps in, 1 140
gases, solubility of, 47, 47t
histone in, 1 1 36-1 1 38
gas-liquid chromatography, 364f, 365
hormonal, 456-457, 1 143-1 144, 1 144f
jtz, 1 150, 1 1 50f
gastric ulcers, 260, 260f
host range, 1 135t
fucose, 240s
gastrin, 675
inducers in, 1 120- 1 1 2 1
fumarase, 628
gastrointestinal tract, 676f
induction in, 1 1 16
fumarate, 628
GATC sequences
insulin in, 440, 441f, 606, 1 144
glucogenic amino acids in, 557t
in mismatch repair, 994-996, 994f-996f
oxidation of succinate to, 628
in replication, 986
fumarate hydratase, 628
mating-type switch in, 1 135t mRNA concentration in, 1 049-1050
Gaucher's disease, 356
mRNA in, 1 132-1134
fumaric acid, !5s
GCN5-ADA2-ADA3, 1 137t
negative, 1117, 1 1 18f
functional genomics, 35
GDGT (glycerol ctialkyl glycerol tetraether),
functional groups, 12f, 13, 13f fungi, cellulase in, 247, 247f
352, 353f GDP (guanosine 5' -diphosphate)
furanoses, 239, 239f
in {3-adrenergic pathway, 424, 424f
jushi tarazu, 1 1 50, 1 150f
in olfaction, 466-467, 466f
fusion proteins, 313, 387
in vision, 463-464, 464f
futile cycles, 583, 822 triacylglycerol cycle as, 822
gel electrophoresis
See electrophoresis gene(s), 271, 948, 948. See also protein(s) bacterial, 952
g
G (free energy) See free energy (G) 'Y light chains, immunoglobulin, 172
operators in, 1 1 1 7 operons in, 1 119-1 1 2 1 regulation of, 1 126-1 127, 1 1 27f
phase variation in, 1134, 1 135f
positive, 1 118, 1 1 18f, 1 138 in eukaryotes, 1 138 principles of, 1 1 1 5-1 1 25 in prokaryotes, 1 126-1136
proline-rich activation domains in, 1143
mapping of, 976f
protein-protein interaction domains in, 1 124-1 125
naming conventions for, 976
recombinational, 1 134, 1 135t
caretaker, 477
regulons in, 1127
chromosome population of, 949
repression in, 1 1 16
I n d ex
repressors in, 1026, 1029, 11 17, 1 1 18!, 1 122, 1 140-1 14 1
translational, 1131-1 132, 1 144- 1 1 45, 1 148
yeast, 949, 950t
glucono-.5-lactone, 240s
sequencing of, 323, 323f
glucopyranose, 239f
genomic library, 315
glucosarnine, 240, 240s
riboswitches in, 1 133-1 134
genomic mapping, for E. coli, 976f
glucose, 236s, 532s
RNA interference in, 1145-1 146, 1 146f
genomics, 303, 315
second messengers in, 1 132
a form of, 238f, 239
applications of, 35-36, 335-338
{3 form of, 238f, 239
signaling in, 1 132, 1 143-1 144
comparative, 35-36, 326, 328, 328f
blood levels of, 921-922
site-specific recombination in, 1004, 1010-1013,
functional, 35
101 1!, 1012f
808 response in,
1001, 1002t, 1 1 30-1 1 3 1 , 1 130f
specificity factors in, 1 1 1 7 stringent factor in, 1132, 1 132f stringent response in, 1132, 1 1 32f subunit mixing in regulatory proteins
in diabetes, 930
geometric isomers, 15
reference ranges for, 927t
geranyl pyrophosphate, in cholesterol synthesis,
regulation of, 914, 9 14f, 922-930 See also
832f, 834, 834f
glucose metabolism
gerany!geranyl groups, membrane attachment of, 380, 380f
blood tests for, 241 , 241b-242b body stores of, 927t
germination, seed, triacy!glycerols in, 663, 663f
in cellulose synthesis, 795-796
ghrelin, 932f, 937, 937f
conversion of amino acids to, 688--{)89, 688f
TATA binding protein in, 1 138, 1 139, 1140
G, (inhibitory G protein), 431
conversion of glucose 6-phosphate to, in
transcription activators in, 1139, 1 142-1 144
Gibbs free energy (G), 490. See also free
in,
1 125
transcriptional attenuation in, 1 127-1128, 1 127f-1 129f translational repression in, 1131-1 132, 1 131f, 1 1 40-1 1 4 1 , 1 148
gluconeogenesis, 553t, 556 degradation of See glycolysis
energy (G) Gibbs, J Willard, 22
anaerobic. See fermentation
Gilbert, Walter, 292
epimers of, 237s
Gilman, Alfred G , 424, 425, 425f
hexokinase catalysis of, 212, 212f
translational repressor in, 1131-1132
Gleevec, 476b
lac operon and, 1 126-1 127, 1 127f
upstream activator sequences in, 1140
globin(s), 155, 155f. See also hemoglobin;
membrane transport of. See glucose transporters
in yeast, 1 14 1-1 142, 1 141f gene silencing, by RNA interference, 1145-1 146, 1 1 46f gene therapy, 335-336 gene transfer, lateral, 104 general acid-base catalysis, 193, 193f general recombination. See homologous genetic recombination general transcription factors, 1030-1031, 1031f, 1032t genetic code, 1066-1074
myoglobin
in muscle contraction, 918-919, 918f, 919! in myocytes, control of glycogen synthesis from,
structure of, 138 nuclear magnetic resonance studies of,
581-582 oxidation of See glucose oxidation
133-134, 133f, 134f x-ray diffraction studies of, 132b-133b,
phosphorylation of, 241 , 532 as reducing sugar, 241, 24lf
132f-133f globosides, 350f, 353f, 354, 355f globular proteins, 123, 129-136
regulation of, 914, 914f, 922-930, See also glucose metabolism
{3 turns in, 1 2 1 , 121f
in starch synthesis, 791 , 791f
diversity of, 129
storage of, 922, 923f
folding of, 128, 129-135, 130f
in glycogen, 244, 246, 922, 923f
base composition in, 1067
functions of, 129-136
in starch, 244, 245-246
base sequences in, 1067
hydrophobic interactions in, 130, 130f
structure of, 9s, 212s, 213s, 236, 237s, 238-239
codons in, 1066-1067, 1066f
in large proteins, 1 3 1-138, 135f, 136f
synthesis of, 9 1 5
cracking of, 1066-1069
myoglobin as, 129-1 3 1 , 130f
triacy!glycerol conversion t o , 663, 663f
degeneracy of, 31 1f, 1069, 1070t
polypeptide chain arrangement in, 123
UDP. See UDP-glucose
expansion of, 1085b-1087b
small, structure of, 129-136
overlapping, 1066f
in small proteins, 129-135, 131t
reading frames in, 1067, 1067f second, 1 083-1084 triplet (nonoverlapping), 1066!, 1067
structure of, 128, 129-138, 130f
3-phosphate, 535f
glucagon, 587, 922, 923 cascade mechanism of, 604f
universality of, 1 066f, 1069, 1070t
in cholesterol regulation, 842, 842f
variations in, 1070b-107lb, 1094b
in fatty acid mobilization, 926
wobble and, 1072 genetic counseling, for inborn errors of metabolism, 356 genetic defects
in glucose regulation, 925-926, 926f glucocorticoids, 359, 359f, 359s, 906t, 908 See also
in amino acid catabolism, 694t, 696-698, 697f
glucogenic amino acid, 688 glucokinase, 599, 914
treatment of, 687f genetic diseases
genetic map, of E. coli, 976f genetic mutations. See mutations genetic recombination. See also DNA recombination functions of, 1004-1005 homologous, 1003-1005 site-specific, 1004, 1010-1013, 101 1f, 1012f genetics, overview of, 27-29 genome, 3, 33
also glucose metabolism
amino acid metabolism in, 9 1 5 amino acids in, 557, 557t, 915 fructose 1 ,6-bisphosphate to fructose 6-phosphate conversion as, 553t, 556 glucose 6-phosphate to glucose conversion as, pyruvate to phosphoenolpyruvate conversion as, 553-557, 553t, 554f, 555f carbohydrate synthesis and, 552, 552f in chloroplast, 793, 793f
in fasting/starvation state, 926-928, 927f
evolution of, 33-36 mapping of, 317-324, 322f sequencing of, 33-35, 35t, 3 1 7-324, 322f, 323f
in germinating seeds, 798-799
glycolysis and See also glycolysis
fructose 2,6-bisphosphate in, 587-588, 587f opposing pathways of, 552, 553, 553f, 583f regulation of, 557-558, 582-594
in liver, 914, 925-926, 927f, 927t
by mapping, 3 1 7-324, 322f
in muscle, 916-917
polymerase chain reaction in, 317
regulation of, 582-594, 587f, 589f, 822-823
shotgun, 322
918f, 919f
neuronal, 920, 920f
pancreas in, 922-926, 923t, 924f
in starvation, 926-928, 927f, 928f in well-fed state, 922, 923f ATP yield from, 733t
cellular, to carbon dioxide, 516 energy-coupled reactions in, 23f, 24 neuronal, 920, 920f
553t, 556
bacterial, 949, 950t
eukaryotic, 949-951 , 950t
in muscle, 918-919,
glucose oxidation, 24, 240-241, 240f
bypass reactions in
citric acid cycle and, 557, 927f, 928
sequencing of, 323, 323f
glucagon in, 925-926 insulin in, 922-924, 923f, 923t
annotated, 34
components of, 323, 323f, 952, 952f
epinephrine in, 928-929, 928t
in liver, 914, 915f, 923f, 925-928, 927t
gluconeogenesis, 551-558, 552, 582-583, 595. See
practical applications of, 330-338
in diabetes mellitus, 929-930
regulation of, 584-585, 585f gluconate, 240s
genetic engineering, 304. See also cloning
in adipose tissue, 916-917, 9 1 6f in brain, 920, 920f
kinetic properties of, 584-585, 585f
genetic counseling for, 356
protein misfolding in, 145-148
in cancerous tissue, 539, 540-541 glucose metabolism, 922-930
in fasting state, 926-928, 926f, 927f, 928f
in glucose regulation, 924, 924f
gene therapy for, 335-336 inborn errors of metabolism in, 356
glucose catabolism, 913t
cortisol in, 929
under steroid synthesis of, 844-845, 844f
in fatty acyl-CoA dehydrogenase, 661 , 662 in urea cycle, 686-687
urine tests for, 241 utilization of, 527-528 glucose carbon, in formation of glyceraldehyde
glycolysis and, 582-594
in,
synteny in, 325, 325f
sequential reactions
viral, 947, 949, 949t, 950t
in well-fed state, 922, 923f
556-557, 556t
pentose phosphate pathway of, 558-563, 560f.
See also pentose phosphate pathway glucose 6-phosphatase, 556 hepatic metabolism of, 914, 914f hydrolysis of glucose 6-phosphate by, 596, 597f glucose ! -phosphate, 599 conversion of galactose to, 554f glycolysis of, 596, 597f, 598b, 599t
in starch synthesis, 791 glucose 6-phosphate, 212s, 240f, 241 , 532, 569, 575t, 599, 914, 914f conversion of to fructose 6-phosphate, 532, 533f to glucose in gluconeogenesis, 553t, 556 fate of, 914, 914f in glycolysis, 563, 563f hepatic metabolism of, 914, 914f
�-18
I ndex
glucose 6-phosphate
glyceraldehyde 3-phosphate dehydrogenase, 5 1St,
(continued)
hexokinase catalysis of, 212 hydrolysis of, by glucose 6-phosphatase, 596, 597f
light activation of, 785, 785f
insulin regulation of, 922
reaction mechanism of, 536, 536f
nonoxidative recycling of pentose phosphates to, 560-563, 56lf, 562f, 563f
synthesis of, 441-442, 442f, 600f control vs regulation of, 5S1-582 regulation of, 582-594
glycerol, 346s in archaebacteria membrane lipids, 352, 353f
in pentose phosphate pathway, 563, 563f, 914 glucose 6-phosphate dehydrogenase (G6PD),
storage of, 595, 595f structure of, 245f, 246, 247-24S, 249f, 25lt
535, 575t, 778, 779f, 7S2-7S3
sugar nucleotide in, 596-Q01
chiral forms of, 350, 350f
glycogen granule, in hepatocyte, 595, 595f
in galactolipids, 352f
glycogen phosphorylase, 224-226,
544, 922
in phospholipids, 349, 350, 350f, 35lf
allosteric modification of, 227
deficiency of, 559
structure of, 346s, 350s
aJb forms of, 223f, 224, 603
light inactivation of, 7S5-786
in triacylglycerol synthesis, 820f
breakdown of glycogen by, 553f, 595-596,
51St,
559
glucose tolerance test,
in triacylglycerols, 345f, 346-348, 346f, 348f
930
glucose transporters, 60S
glycerol dialkyl glycerol tetraethers (GDGTs) ,
defects in, in diabetes, 394b
in glycogen breakdown, 224-225, 227
352, 353f
erythrocyte (GLUT!), 391-393, 39lf, 393t
glycerol kinase,
intestinal (GLUT2), 393, 393t, 403,
glycerol 3-phosphate
403f, 924
in diabetes,
phosphorylation of, 224-226, 233f
403, 403f
types of, 393t glucose-alanine cycle,
in lipid synthesis, S20, 820f, S22-823, S24, 826f glycerol 3-phosphate dehydrogenase,
715,
681, 68lf, 915
glucosylcerebroside, 353f, 354
glycerol 3-phosphate shuttle,
phosphorylation of, 224-225 primer for, 601
732, 732f 557, 822-S23, 822f, S23f. See
glycerophospholipid(s), 349, 350-352, 350f, 3 5 l f
GLUTl transporter, 391-393, 39lf, 393t GLUT2 transporter, 393, 393t, 403, 403f, 584-5S5, 585f, 924
See also triacy]glycerol(s)
in diabetes, 394b 77, 453s, 698-699, 857, 861
glutamate, 75s,
ammonia released by, 677-QSO, 6S0f biosynthesis of proline and arginine from, 861-863, 862f
605 605
glycogen synthase kinase 3 (GSK3), 441, 442f, 447,
fatty acids in, 350
447f,
605
effects of, on glycogen synthase activity,
nomenclature of, 350, 350s, 35lf
605, 605f
structure of, 350, 350s
insulin activation of, 605, 606, 606f
synthesis of, S20-S22, 820f head group attachment in, S24, S26f
glycogenesis, glycogenin,
transport of, 830 glycine,
regulation of, 605-606, 605f, 606f glycogen synthase a, glycogen synthase b,
head groups of, 349, 824, S26f, S27, 829
GLUT4 transporter, 393t, 394, 441-442, 442f
598b-599b, 599t
glyceroneogenesis,
also glucose metabolism
glucuronate, 240f, 240s, 250, 250s
allosteric and hormonal, 604f, 617f
glycogen synthase, 441, 442f, 600, 922
820, S20f
929
regulation of, 224, 225f, 603 glycogen storage diseases, 598-599,
synthesis of, 822, S22f
394b
Na +-glucose syrnporter,
glucosuria,
interconvertible fmms of, 603
650, 820, 820f
in carbohydrate synthesis, 79S, 799f
muscle (GLUT4) , 393t, 394b, 441-442, 442f
595f, 597f covalent modification of, 223f, 225-226
595 601
and glycogen particle, 6 1 6f
75, 75s, 692, 864
biosynthetic pathway of, 857
in a helix, 1 1 9, 1 2 1 , 12lf, 122f
structure of, 601 , 60lf
catabolic pathways for, 69Sf
in {3 sheet, 12lf
sugar residues in glycogen and, 601
in nitrogen metabolism, 674
in {3 turn, 12lf
glycogenolysis,
properties of, 73t, 77
biosynthesis of, 863f, 864
glycogen-targeting subunits,
titration curve for, 81, 8lf
as buffer, 80, 80f
glycolate pathway, 787-7S9, 787f
in collagen, 124f, 125
glycolipids,
L-glutamate dehydrogenase, 51St,
679
oxidative deamination catalyzed by, 6SO, 6SOf
degradation of to pyruvate, 692-Q94, 692f, 693f
lipid(s)
595
252, 256-257, 257f, 348. See also
glutamate synthase, reaction of, S57
in photosynthesis, 7S7f, 788, S06f
as glycoconjugates,
glutamate-oxaloacetate transaminase
pK. of, 79-80, 80f
neutral, 350f, 353f,
as precursor of porphyrins, S73, 874f
synthesis of, 829, 83lf
(GOT) , 67Sb glutamate-pyruvate transaminase (GPT), 67Sb
properties of, 73t
glutaminase,
receptor for, as ion channel, 410
680-6Sl glutamine, 75s, 77, 686, 6S7s, 698-699, 857, 861, S94f
ammonia transported in bloodstream as, 6SO-BS1 , 6SOf
glycobiology, 257
properties of, 73t, 77
glycoconjugates,
680, 857
allosteric regulation of, 857-858, 858f in nitrogen metabolism, 857-859 reaction of, 857 subunit structure of, 857-85S
1 143
glutaredoxin,
888 876
polysaccharide and disaccharide hydrolysis in,
235, 252, 252-257 glycolipids, 252, 256-257, 257f glycoproteins, 252, 255-256, 257f proteoglycans, 252-255, 253f
glycogen, 236, 245-248, polysaccharide (s)
246, 25lt. See also
body stores of, 927t
559, 559f
595f, 597f
244. See also polysaccharide(s)
hydrolysis of, 246
isomers of, 236-237, 236f glyceraldehyde 3-phosphate,
533, 533s
in Calvin cycle, 779, 780f, 7Slf in formation of, 535f
glucose carbons
in glycolysis, 529f, 530
oxidation of, to 1 ,3-bisphosphoglycerate, 535-536, 536f synthesis of, 773, 778, 782f, 7S3, 797f
glucose !-phosphate
dehydration of 2-phosphoglycerate to phospho enolpyruvate in, 538 oxidation of glyceraldehyde 3-phosphate to 1 ,3-bisphosphoglycerate in, 535-536, 536f phosphoryl transfer from 1 ,3-bisphosphoglycerate to ADP in, 531-532
metabolism of, 594-602
catalysis of, 1 9 1
payoff phase of, 529f, 530
2-phosphoglycerate in, 537-53S, 537f
granular form of, 246
glyceraldehyde , 236, 237s, 545s
regulation of, 557-55S, 5S2-594 of glucose !-phosphate, 596, 597f,
conversion of 3-phosphoglycerate to
601, 60lf in hepatocytes, 246
opposing pathways of, 552, 553, 553f, 583f
ATP and NADH in, 535-538, 536f, 537f
glucose removal from, 246
glycated hemoglobin, 242b
See also gluconeogenesis
fructose 2,6-bisphosphate in, 587-588, 5S7f
in limiting oxygen concentration, 539
glycogenin priming of sugar residues in,
721 , 877
gluconeogenesis and.
glucose 6-phosphate in, 562f, 563, 563f
glucose storage in, 244, 246
metabolism of, S77f
543, 552f free-energy changes of, in erythrocytes, 553t
59Sb-599b, 599t
branch synthesis of, 60 l f
in glycolysis, 542-543
in cell protection against oxygen derivatives,
glycogen and starch degradation in, 544 monosaccharides in, 545, 554f
glycogen phosphorylase in, 553f, 595-596,
biosynthesis of, 877f
glycans,
788, 806f
864
degradation of
amino acids as precursors of, S76-S77
glutathione peroxidase,
feeder pathways for, 543-546, 552f
biosynthesis of, in bacteria, 792
glutamine-rich domains, glutathione,
in chloroplast, 793f
reaction mechanism of, 693f
in nitrogen metabolism, 674
See also
ATP formation coupled to, 530-531
692, 864
glycine decarboxylase complex, 7S7f,
proposed reaction mechanism for, 879f
glucose metabolism
titration curve for, 79-8 1 , 79f glycine cleavage enzyme,
glycine synthase,
glutamine synthetase, 227,
glycolysis, 528-543, 650f, 922, 923f,
in secondary structures, 121, 122f
catabolic pathways for, 698f
859
252 354, 355f
transport of, 830
biosynthetic pathway of, 857-S59
glutamine aminotransferase,
606
in,
phosphoryl transfer from phosphoenolpyruvate 596, 597f
glycogen breakdown in, 595-596, 597f, 653f
glycogenin in, 601, 60lf, 616f
to ADP in, 538
phosphorylated hexoses in, 531 preparatory phase of, 529f, 530
phosphoprotein phosphatase 1 in, 606, 607f
ATP in, 531-535, 533f, 534f, 535f
sugar nucleotide UDP-glucose in, 596-601 ,
cleavage of fructose 1 ,6-bisphosphate in,
600f, 60lf in muscle, 9 1 8-919, 9 1 8f, 919f reducing end of, 246
533-534, 534f conversion of glucose 6-phosphate to fructose 6-phosphate in, 532, 533f
Index
glycogen, starch, disaccharides, and
GSK3 (glycogen synthase kinase 3)
hexoses in, 552f
See glycogen
interconversion of triose phosphates in, 534-535, 535f fructose 1 ,6-bisphosphate in, 532 phosphorylation of glucose in, 532
heat of vaporization, 43, 44t
in olfaction, 466, 466f
heat shock gene promoters, 1028
in vision, 463-464, 464f
heat shock proteins, in protein folding, 143, 144f heavy chains, immunoglobulin, 1 7 1 , 17lf
GTPase, G, as, 426
in solid tumors, 539, 540-541
GTPase proteins (GAPs), 425b-427b guanine, 9s, 272, 273f, 275t.
gluconeogenesis and, 582-594 glycolytic flux, 578f
of water, 44-45, 44t
cGMP synthesis from, 445-446
regulation of, 539, 822 regulation of, 582-594
recombination in, 1015, 1016 helical synunetry, 139, 140, 140f
See also
helicases, 984
purine bases
in mismatch repair, 995, 995f, 996f
deamination of, 289, 290f
glycolytic pathway, glycerol entry into, 578f, 650f
guanine nucleotides, biosynthesis of, regulatory
glycomics, 256 topology of, 376, 376f
a, 1 1 7-120, 1 18f, 120f, 121-122, 122f, 123t
in splicing, 1036, 1036£, 1057 guanosine 3' ,5' -cyclic monophosphate. See cGMP
as glycoconjugates, 252
(guanosine 3' ,5' -cyclic monophosphate) guanosine 5' -diphosphate (GOP) . See GOP
ligand binding of, 373 membrane, 256, 3731.
helix
guanosine, 273s
glycoproteins, 84, 85t, 252, 255-256, 257f
See also
membrane proteins
guanosine 5' -diphosphate,3' -diphosphate (ppGpp),
1 101-1 1 04, 1 1 02f, 3731
guanosine 5' -monophosphate (GMP), 273s,
of myoglobin, 130 protein folding and, 135 double DNA, 28, 28f, 278--2 80, 279f, 280£.
298, 298s
sugar moieties of, 373
guanosine nucleotide exchange factors, 426
topology of, 375-376, 376f
guanosine nucleotide-binding proteins
glycosaminoglycans, 249-251 , 250f, 25lt
of membrane proteins, 376, 378
of small globular proteins, 13lt
298, 298s
in protein targeting, 1 101-1 104
of a-keratin, 1 23-124, 124f
of polysaccharides, 248, 249f
(guanosine 5' -diphosphate)
oligosaccharide linkage to, 255-256, 255f,
in replication, 984, 986, 986t
Helicobacter pylori, lectins and, 260, 260f, 262f
mechanisms in, 885-886, 885f
glycophorin, 373, 376, 384f
See thermogenesis
randomization of, 21
GTP (guanosine 5' -triphosphate) in ,13-adrenergic pathway, 424, 425f
phosphorylation of fructose 6-phosphate to
heat production of.
synthase kinase 3 (GSK3)
[1 -1 9]
See
See also
DNA structure supercoiling and, 954-962, 955f.
See also DNA,
supercoiling of
G protein(s) guanosine tetraphosphate (ppGpp), 298, 298s
in transcription, 1023f
glycosidases, retaining, 216
guanosine tetraplex, 282
underwinding of, 955-958, 955f
glycoside, standard free-energy changes of, 493t
guanosine 5' -triphosphate (GTP) . See GTP
unwinding of/rewinding of, 287-288, 287f, 288f,
in proteoglycans, 252-255, 253f
glycosphingolipids, 350f, 353f, 354, 355f N-,13-glycosyl bonds, nucleotide, 272 hydrolysis of, 290, 290f glycosylated derivatives of phosphatidylinositol (GPI), as lipid anchor, 379-380, 380f, 384-385 glycosylation, in protein targeting, 1 101-1 1 04, 1 1 02f
978--9 79, 979f
(guanosine 5' -triphosphate) guanylate, 273s, 275t
See also DNA replication
variations of, 280-281 , 28lf
guanylin, 446
RNA, 284-285, 284f, 285f
guanylyl cyclase, in vision, 464f, 465
triple, 282, 283f
guanylyl cyclases, 445-446, 445f
of collagen, 122f, 123t, 124-125, 124f, 126-127
guide RNA, 1073 Guillemin, Roger, 902
of DNA, 282, 283f
glyoxylate, 638-640
gulose, 237s
helix-loop-helix, 1 125, 1 125f
glyoxylate cycle, 638-640, 639f
gustation, signaling in, 467, 468f
helix-tum-helix, 1 122, 1 123f
four-carbon compound production from, 638
gustducin, 467
regulation of citric acid cycle and, 639-640, 639f, 640f glyoxysomes, 798, 798f
i3 oxidation in,
helper T cells (TH cells), 170, 170t hematocytoblasts, 158
in plants, 798, 798f
heme, 154
h
from 5-aminolevulinate, biosynthesis
H+. See hydrogen ion(s)
662f
plants and, 662-663, 663f
definition of, 154
H4 folate (tetrahydrofolate), 689, 689f
free, 154-155
glyphosate-resistant plants, 332, 333f
conversions of one-carbon units in, 690f
glypicans, 253, 253f
substrate binding to, 189f
GMP (guanosine 5' -monophosphate), 273s, 298, 298s
of, 874f
H (enthalpy) , 22, 490
haem.
See heme
hair
in oxygen binding, 154-155. See also hemoglobin-oxygen binding as source of bile pigment, 875-876, 876f structure of, 1 54-155, 155f
a-keratin in, 123-124, 124f
heme A, 7 1 1 s
Goldstein, Joseph, 841, 84lf
coiled coils in, 124f
heme
Golf, 466f, 467
permanent waving of, 125
heme C, 7 1 1 s
Goldberger, Joseph, 519
Golgi complex
hairpin loops
lectins and, 260-261
in DNA, 282, 282f
protein sorting in, 1 102-1 1 03 transport vesicles of. See transport vesicles
in replication fork, 978, 978f in RNA, 285, 285f, 1029f, 1049
GOT (glutamate-oxaloacetate transaminase), 678b
Haldane, J.B.S , 64, 184, 1 84f, 190
gout, 893-894
half-reaction, 512-513
G6PD. See glucose-6-phosphate dehydrogenase (G6PD)
standard reduction potentials of, 515t
Halobacterium salinarum, 763
GPI (glycosylated derivatives of phosphatidylinositol), as lipid anchor, 379-380, 380f, 384-385 GPR14, 337
bacteriorhodopsin in, 376, 377f, 385b halophilic bacteria, ATP synthesis in, 762-764, 763f hammerhead ribozyme, 1045, 1046f, 1048
Gq, 432 grana, 743
Hanson, Richard, 822
Grb2, 439, 44lf, 442
haptens, 171
SH2 domain of, 439, 44lf
Hartley, B.S., 205-206
green- dichromats, 465, 465
hashish, 442
green fluorescent protein (GFP), 316-317, 316f,
HAT (histone acetyltransferases), 1137-1 138
434b-436b
Hatch, Marshall, 789
green-anomalous trichromats, 465
Haworth perspective formulas, 239, 239f
GRKs (G protein-coupled receptor kinases), 431
HDLs
GroEUGroES, in protein folding, 144, 144f, 145f
head group exchange reaction, in phospholipid
ground state, 186, 745
See high-density lipoproteins (HDLs)
synthesis, 827, 828f
ground substance. See extracellular matrix
heart attack, 920
group transfer reactions, 499-500
heart disease
growth factors, 472, 472f
angina in, nitrovasodilators for, 335
growth hormones, plant, 331 , 33lf
atherosclerotic, 842-844
Grunberg-Manago, Marianne, 1049, 1049f
hyperlipidemia in, 842b-843b
G, (stimulatory G protein) GSH. See glutathione
See G protein(s)
trans fatty acids and, 348, 348t heart muscle, 9 1 9-920, 9 1 9f
b, o f Complex II, 7 1 5
heme cofactors, o f cytochromes, 7 1 0f, 7 1 1 heme group, 130, 130f hemiacetals, 238, 238f hemiketals, 238, 238f hemin-controlled repressor (HCR), 1145 hemoglobin amino acids of, 9f, 10 genetic variations of, 168 glycated, 242b as oligomer, 138, 139f R-state, 160, 1 61£, 167, 1 68f sickle-cell, 168, 168f structure of, 138, 139f, 159-160, 159f, 168, 1 68f conformational changes in, 160, 161f, 162f subunits of, 159-160, 159f T-state, 160, 1 6 l f, 167, 168f hemoglobin A, structure of, 168, 1 68f hemoglobin glycation, 242b hemoglobin S, 168 hemoglobin transport of hydrogen, 166 of oxygen, 1 58-159. See also hemoglobin-oxygen binding hemoglobin-carbon dioxide binding, 166 hemoglobin-carbon monoxide binding, 158, 159, 162-165, 168 hemoglobin-hydrogen binding, 166
1-20 i
I n d ex
hemoglobin-oxygen binding, 154-170. See protein-ligand interactions
also
high-performance liquid chromatography (HPLC) , 88
bioassays for, 902-904
Hill, Archibald, 162
in carbohydrate metabolism regulation, 606-608, 608f
2,3-bisphosphoglycerate in, 167, 168f
Hill coefficient, 164, 165f, 573, 573t
Bohr effect in, 166, 166
Hill equation, 164
carbon dioxide
Hill plot, 164, ! 65f
catecholamine, 906t,
Hill reaction, 743
in cholesterol regulation, 842, 842f classification of, 906-909, 906t
in,
166
in carbon monoxide poisoning, 163-164
lipid metabolic integration with, 608
907 _ See also catecholamines
conformational changes in, 160, 1 6lf, 162f
Hill reagent, 743
cooperative, 160-165, 162f
hippurate, 686, 687, 687s
discovery of, 902-904, 903b
fetal, 167
HIRA, in chromatin remodeling, 1 137t
diversity of, 906-909, 906t
heme in, 154-155, 1 55f
his operon, 1 130
eicosanoid.
hemoglobin transport and, 158-163
histamine, 878--879
endocrine, 906, 906t
models of, 165, 165f
histidine, 9s, 75s, 77, 699, 869
endocrine glands and, 909-9 1 1 , 909f
See eicosanoids
MWC (concerted), 165, 165f
in amino acid biosynthesis, 869--872, 87lf
excitatory effects of, 431
sequential, 165, 1 65f
as buffer, 61, 6lf
in fat metabolism regulation, 608
myoglobin in, 155, 155f
conversion of, to a-ketoglutarate, 698-699, 698f
functions of, 901-902
pH in, 166, 1 66f
properties of, 73t, 77
in gene regulation, 439, 44lf, 1 143-1 144, 1 144f
quantitative description of, 155--158, 156f, 162-165
titration curve for, 8 1 , 8lf
structural factors in, 1 59-160, 159f T-state to R-state transition in, 160, 16lf, 167, 168f hemoproteins, 84, 85t
in carbohydrate and fat metabolism, 606-608
histone(s), 963, 963-968, 963f, 963t acetylationldeacetylation of, 1 137-1138 chromatin and, 963, 964f, 966b-967b, 1 1 36-1 137,
Henderson-Hasselbalch equation, 60--6 1 , 80
1 137-1138. See also chromatin
in glycogen phosphorylase regulation,
603--604,
604f, 617f
inhibitory effects of, 431--432 lectin binding of, 258
Henri, Victor, 195
in chromatin remodeling, 1 137-1 138
mode of action of, 904-906, 905f, 906t
Henseleit, Kurt, 682
in gene regulation, 1 136-1138
as neurotransmitters, 902
heparan sulfate, 253, 254f
in nuclear scaffold, 968
nitric oxide as, 906t, 909
heparin, 250s, 251, 25lf
in nucleosomes, 964f, 965f, 967f, 1 1 36-1 137
oligosaccharide moieties of, 258
hepatic enzymes, 912-916
positioning of, 965
overview of, 901-902
hepatocyte, 913
properties of, 963-964, 963t
paracrine, 906, 906, 906t
amino acid metabolism in, 914-915
types of, 963-964, 963t
carbohydrate metabolism
variant forms of, 964
in, 606--608, 608f
eicosanoid, 358--35 9, 358f peptide, 906
epinephrine cascade in, 428--429, 429f
histone acetyltransferases (HATs), 1137-1138
fatty acid metabolism in, 914-915, 915f
histone deacetylases (HDACs), in chromatin
fatty acid synthesis
in, 815
synthesis of, 906 regulation of, 909-9 1 1 release of, 909-9 1 1 , 9 1 1f
remodeling, 1 138
feedback inhibition of, 9 1 1
glucose metabolism in, 914, 9 1 5f
histone variants, 966b-967b
glycogen granules
Hitchings, George, 894, 894f
response time for, 905--906
HN (human immunodeficiency virus), as
retinoid, 906t, 908--909
glycogen in, 246
in, 595, 595f
NADPH synthesis in, 812, 812f nutrient metabolism in, 912f, 913-916 triacylglycerol recycling in, 822, 822f
sex, 359, 359s, 459s, 906t, 908
retrovirus, 1052 HN (human immunodeficiency virus) infection,
heptahelical receptors, 424
HMG proteins, 1139, 1 139f, 1 1 4lf
heptoses, 236
HMG-CoA, 666
herbicide-resistant plants, 332, 333f hereditary nonpolyposis colon cancer, 1003b hereditary optic neuropathy, Leber's, 741
steroid, 359, 359s synthesis of, 844--845, 844f
drugs for, 2 1 8-219, 1053b
in signaling, 902, 902f, 905-906, 905f. signaling; signaling proteins hormonal cascade in, 910-9 1 1 , 9 1 lf
in cholesterol synthesis, 832 HMG-CoA reductase, in cholesterol synthesis, 832,
signal amplification in, 905, 9 1 1 , 9 1 1f steroid, 359, 359f, 359s, 906t, 908
841--842
herpes simplex virus, DNA polymerase of, 992
HMG-CoA reductase inhibitors, 843, 843b
receptor for, 1 143-1 144, 1 144f
Hers' disease, 599t
HMG-CoA synthase, in cholesterol synthesis, 832
synthesis of, 844--845, 844f
Hershey, Alfred D., 278
Hoagland, Mahion, 1066
synthesis of, mitochondrial, 736-737
Hershey-Chase experiment, 278
Hodgkin, Dorothy Crowfoot, 658, 658f
target organs of, 909f
heterochromatin, 1136
Holden, Hazel, 176
heterolytic cleavage, of covalent bonds, 496, 496f
Holley, Robert W , 1066, 1 080f
heteroplasmy, 740
Holliday intermediates, 1006, 1006f
heteropolysaccharides, 244, 249-251, 25lt. See
also polysaccharide(s)
heterotrophs, 4f,
6
as earliest cells, 32
See also
response time of, 905--906 thyroid, 906t, 908
in homologous genetic recombination, 1006,
in transcription regulation, 456--457, 457f transport of, in blood, 920 in triacylglycerol synthesis, 649--650, 650f, 651f,
1006f, 1007' 1009 resolution of, 1012-1013, 1013f
821--822, 822f
in site-specific recombination, 1 009, 1010f, 101 1f
tropic, 909
heterotropic ligand binding, 162
holoenzyme, 184
heterozygosity, allelic, 168
homeobox, 1 124
hormone receptors, 904-906
hexadecanoic acid, 344t
homeobox-containing genes, 1 1 50--1 1 5 1
hormone response elements (HREs), 456,
hexokinase, 2 1 2s, 532, 575t
homeodomain, 1 123-1124, 1 124f
water-insoluble, 905
catalytic activity of, 212, 212f
homeostasis, 571
forms of, 583-584
homeotic genes, 1 148, 1 1 50-1 1 5 1 , 1 15lf
regulatory, 583-585, 604f
homing, 1063
hexokinase I, 583, 599 kinetic properties of, 584-585, 585f hexokinase II, 583, 599 hexokinase N, 568, 684, 599, 914 in glucose regulation, 924, 924f
1143, 1 143t hormone-receptor binding, 904-906, 905f. receptor-ligand binding
See also
Scatchard analysis of, 421 b, 905
in signaling, 439, 441
homocystinuria, 694t
hormones,
homogentisate dioXYgenase, 698
hormone-sensitive lipase, 649
homologous genetic recombination, 1003-1005
host range, 1 135t Housay, Bernardo, 598
functions of, 1004-1005 site-specific, 1004, 1010-1013, 1 0 1 lf, 1012f
housekeeping genes, 1 1 16
kinetic properties of, 584-585, 585f
homologs, 34, 104
regulation of, 584-585, 585f
homolytic cleavage, of covalent bonds, 496, 496f
HOX genes, 1 15 1 , 1 1 53 HOXA7, 1 1 5 1
homoplasmy, 740
HPLC (high-performance liquid chromatography), 88
hexose(s), 236 derivatives of, 240-241 , 240f phosphorylated, in glycolysis, 531 structure of, 236f
hexose monophosphate pathway, 558. See also pentose phosphate pathway
homopolysaccharides, 244-248. polysaccharide(s); starch
structure of, 245f, 246f, 24 7-248, 248f, 249f
Human Genome Project, 31 7-324, 322f, 323f
homotropic ligand binding, 162
HIF (hypoxia-inducible transcription factor), in
Hoogsteen pairing, 282, 283f
1 1 39f, 1 14lf high-density lipoproteins (HDLs), 837f, 837t, 839--840 deficiency of, 840 highly repetitive DNA, 953
in protein folding, 143, 144f
HU, in replication, 985, 985f, 986, 986t
homozygosity, allelic, 168
cancerous tissue, 539
HREs (hormone response elements), 1143, 1 143t Hsp70,
function of, 245--2 47
hexose phosphates, movement of, 799--800, 799f
high mobility group (HMG) proteins, 1 139,
See also glycogen;
Hoogsteen positions, 282, 283f hop diffusion, 384 hormonal cascade, 910-9 1 1 , 9 1 lf hormone(s)
human immunodeficiency virus (HN), as retrovirus, 1052 human immunodeficiency virus (HIV) infection, drugs for, 2 18--2 1 9 , 1053b
humoral immune system, 170. See also immune system
hunchback, 1 149f, 1 150
adrenocortical, 906t, 908
Huntington's disease, protein misfolding in, 146
autocrine, 906
hyaluronan, 250
I n dex
hyaluronate, 250s, 25lt, 255f
hyperlipidemia, 843-844, 843b
influenza
hyaluronic acid, 250, 250s, 25lt, 255f
in heart disease, 842b--843b
drug therapy for, 259-260
hyaluronidase, 250
trans fatty acids and, 347-348, 348f, 348t
selectins and, 259-260
hybrid duplexes, 289
hypertonic solutions, 52, 52f
influenza virus, lectins of, 258t, 259
hybridization. See cloning; DNA hybridization
hypochromic effect, 287
information theory, 21
hydride ion, 514
hypoglycemia, 921-922, 92lf
informational macromolecules, 14
hydrocarbons, 13
hypothalamic-pituitary axis, 909-910, 91 lf
inhibition
hydrogen, hemoglobin transport of, 166 hydrogen bonds, 10,
hypothalamus, 909, 909f, 9 1 Of
44. See also bond(s)
in body mass regulation, 931-932, 93lf
�1-21]
concerted, 872 sequential feedback, 873
directionality of, 46, 46f
hypotonic solutions, 52, 52f
inhibitory G protein, 431
examples of, 46t
hypoxanthine, from adenine deamination, 290f
inhibitory proteins, in ATP hydrolysis during
formation of, 45--46, 1 14-1 15
hypoxanthine-guanine
in ice, 44--45 , 45f
ischemia, 733, 733f
phosphoribosyltransferase, 893
low-barrier, 207
initiation codons, 1069, 1069£. See
hypoxia, 167, 530, 733-734
of nucleic acid base pairs
adaptive responses in, 733-734
in DNA, 277, 277£, 278, 279f, 280f
reactive oxygen species and, 733-734
in RNA, 284, 286f
hypoxia-inducible transcription factor (HIF),
number of, 1 14
also codons
in protein synthesis, 1088-1091, 1090f initiation complex in bacteria, 1088-1089, 1089f in eukaryotes, 1089-1091, 109lt
734, 734£
with polar hydroxyl groups, 45--46
initial velocity (rate) (V0) , 194-195, 195£
initiation factors, 1091t, 1 144
in cancerous tissue, 540
initiator sequences, 1 138-1 139, 1 139£, 1 14lf
in polysaccharides, 245f, 24 7-248, 248f properties of, 44--46 , 45f
Inman, Ross, 978
in water, 43--46, 44f--47f, 46--49, 48f, 49f
inorganic phosphate (P,) . See phosphate, inorganic
as weak interactions, 50-5 1 , 50t, 5 l f
inorganic pyrophosphatase (PP,), in plants vs.
I bands, 176, 177f
animals, 792
hydrogen donors, i n photosynthesis, 762
ibuprofen, 818, 818s
hydrogen ion(s)
ice, hydrogen bonds in, 44--45, 45f
concentration of, 55-57, 56£, 56t.
See also pH from water ionization, 54-57
icosahedral synunetry, 139-140, 139f, 140f
in anticodons, 1071-1072, 107lf
icosatetraenoic acid, 344t
biosynthesis of AMP and GMP from, 885f purine ring of, 883£
idose, 237s
hydrogen sulfide, solubility of in water,
inosinate (IMP), 883
iduranate, 250, 250s
inosine, 274s, 1073b-1074b inositol, in lipid synthesis, 826£, 827,
47, 47t
lgA, 172
hydrolases, 65
!gO, 172
hydrolysis, 65f
IgE, 172
827f, 829£ inositol 1,4,5-trisphosphate (IP3), 357-358, 432--433, 433f
of acetyl-GoA, 505, 505£, 505t
IgG, 171-172, 17lf, 1 72f
ATP. See ATP hydrolysis
IgG genes, recombination of, 1014-1016, 1 0 1 5f
in plants, 357
of 1,3-bisphosphoglycerate, 504, 504s
IgM, 172, 1 72£
Inr (initiator) sequences, 1 138-1139, 1 1 39f, 1 14lf
of disaccharides, 243-244
imatinib, 476b
insertion mutations, 993
free energy of, 501-503, 504f, 505-506, 505f,
immune system, 170-175
insertion sequences, 1013
505t, 506£
antigen-antibody interactions in, 170-175
of glucose 6-phosphate, by glucose 6-phosphatase, 596, 597f of glycosidic bonds, vs. phosphorolysis reaction,
insulin, 906, 907s
cells of, 170, 170t
amino acid sequence of, 93-94
cellular, 170
in cholesterol regulation, 842, 842f
clonal selection in, 170
in diabetes mellitus, 929
evolution of, 1014-1016
discovery of, 903b
of oxygen esters, 506£
humoral, 170
in gene regulation, 439, 441, 44lf, 1 144
of phosphocreatine, 504, 505f
integrins in, 456
of phosphoenolpyruvate, 504, 504f
oligosaccharides in, 259, 259£
of phosphorylated compounds, 504-505, 505t
in plants vs. animals, 460, 46lf
of polysaccharides and disaccharides, to
selectins in, 259, 259f
595-596
monosaccharides, 543, 552£
immunoblot assay, 174, 174f
transition state in, 2 1 1 , 2 l l f
immunodeficiencies
hydrolysis reaction, 65
drugs for, 1 053b
hydronium ions, 77
gene therapy for, 335-336
hydropathy index, 378
immunoglobulin(s) (!g) , 170.
hydrophilic compounds, 46, 46t
classes of, 172
hydrophobic compounds, 10, 46, 46t
heavy chains of, 1 7lf, 172
hydrophobic interactions, 49, 50t, 114. See
also
in amphipathic compounds, 48--49, 48f
glycogen synthase kinase 3 mediation of, 605, 606, 606f in glycogen synthesis, 441--442, 442f in lipid metabolism, 842, 842f as peptide hormone, 906
See also antibodies
recombination in, 1015, 1016
weak interactions
923t, 924f in glucose transport, 394b
immunization, viral vaccines in, 1052
of thioesters, 505, 505f
solubility of in water, 46--49, 48£, 49f
in carbohydrate and fat metabolism, 606-608 in glucose regulation, 439, 441, 922-924,
light chains of, 17lf, 172 recombination in, 1014-1016, 1015£, 1016f structure of, 17lf, 172, 1015
signal sequence of, 906, 907£ in signaling, 439--443, 441 synthesis of, 906, 907f in triacylglycerol synthesis, 821--822, 82lf in weight regulation, 934, 935£ insulin insensitivity, 935-936, 938-939 insulin pathway, 439, 441, 44lf
in globular proteins, 130, 130f
immunoglobulin A, 172
insulin receptor, 439--443, 44lf, 442f
in protein stability, 1 14-115
immunoglobulin D, 172
insulin receptor substrate-! (IRS-1), 439,
/3-hydroxyacyl-ACP dehydratase, 809, 8 l lf, 826£
immunoglobulin E, 172
/3-hydroxyacyl-CoA (3-hydroxyacyl CoA), 654
immunoglobulin fold, 172
/3-hydroxyacyl-CoA dehydrase, 654
immunoglobulin G, 171-172, 171£, 1 72£
/3-hydroxyacyl-CoA dehydrogenase, 654
immunoglobulin genes, recombination of,
f3 -hydroxy-f3-methylglutaryl-CoA.
See HMG-CoA /3-hydroxybutyrate, 666 in brain metabolism, 920
1014-1016, 1015f immunoglobulin M, 172, 1 72f IMP.
See inosinate (IMP)
importins, 1 104
44lf, 442 integral membrane proteins, 376. See
also
membrane proteins integrins, 254, 255£, 388, 455£, 465--466 intermediate, 209 intermediate filament proteins, 123-124 intermediate filaments, 9, 9f internal guide sequences, 1047, 1047f
hydroxylases, 816b
in vitro evolution (SELEX), 1058b, 1078b
intervening sequences, 952, 952f
5-hydroxylysine, 77, 78s
in vitro packaging, 308, 309£
intestinal glucose transporter (GLUT2), 393, 393t,
in collagen, 126-127
in vitro studies, limitations of, 10
403, 403f, 924
5-hydroxymethylcytidine, 274s
inborn errors of metabolism, 356
intrinsic factor, 659
3-hydroxyproline, in collagen, 126-127
indirubicin, 476b
introns, 286f, 952, 952f, 1035
4-hydroxyproline, 77, 78s, 126-127, 127s
indole-3-acetate, 450s
in collagen, 124f, 125, 126-127 hyperammonemia, 686 hypercholesterolemia, 843-844 hyperchromic effect, 288
induced fit, 153 in antigen-antibody binding, 173, 173f in enzyme-substrate binding, 192, 212, 212f inducers, 1 120-1 12 1
hyperglycemia, insulin secretion in, 922, 923£
inducible gene products, 1 1 16
hyperinsulinism-hyperammonemia
induction, 1 1 16
syndrome, 680
industrial-scale fermentation, 549f, 551
enzymatic properties of, 1047-1 048, 1047f evolutionary significance of, 1052-1053 homing by, 1053, 1054f as mobile elements, 1053, 1054£ self-splicing, 1036, 1058 enzymatic properties of, 1047-1049, 1047£ evolutionary significance of, 1058 spliceosomal, 1037, 1038f
G -22
I n dex
introns (continued) splicing of, 1034, 1 034f, 1 036-1039, 1036f-103Sf transcription of, 1035 inverted repeat DNA, 281-2S2, 2S2f ion(s) blood levels of, 921 hydride, 514 as intracellular messengers, 453-454 ion channels, 3S9f, 391, 39lf, 406-412 a helix-type, 391 Ca2 + , 406, 409-410 Clin cystic fibrosis, 40 1 , 40lf, 4 1 0 i n signaling, 453-454 current measurement in, 407, 407f defective, 410-412 in cystic fibrosis, 401 K+, 407-409, 40Sf, 45 1 , 45lf defective, diseases caused by, 412t in signaling, 451, 45lf, 453-454 ligand-gated, 406, 410 in membrane transport, 4 1 0 i n signaling, 410, 422, 4221, 450f, 45lf, 454f membrane potential and, 450, 450f Na+, 409-410 defective, diseases caused by, 412t in signaling, 451, 45lf, 453-454 neurotransmitter, 453-454 nicotinic acetylcholine receptor as, 410 operation of, 450-451 patch-clamp studies of, 407, 407f voltage-gated, 406, 407-41 0 in signaling, 4 1 0 , 422, 422f, 449-453, 450f, 451-453, 45lf ion concentration, in cytosol vs. extracellular fluid, 45lt ion gradients, 400-404, 402f-404f ion product of water (Kw) . 55, 56 ion pumps. See ATPase(s); transporter(s) ion transporters See ATPase(s); membrane trans port; transporter(s) ion-exchange chromatography, 86, S7f, S8t ionic interactions, 10, 50, 50t. See also weak interactions protein stability and, 1 14-1 15 in solutions, 46-4 7 ionization equilibrium constants for, 55 peptide, S2-S3, S3f of water, 54-57 equilibrium constant for, 55 ionization constant. See dissociation constant CKu) ionizing radiation, DNA damage from, 290 ionophores, 404 IP3 (inositol l,4,5-trisphosphate), 357-35S, 432-433, 433f, 43Sf in plants, 359 IPTG (isopropylthiogalactoside), 1 1 2 1 , 1 12ls irinotecan, 960b, 960s iron, heme, 1 54-155, 155f See also heme iron protoporphyrin IX, 7 1 1 s iron regulatory proteins, 624b iron response elements (IREs), 624b iron-sulfur centers, 623, 7 l l f i n aconitase, 623f reaction, 751 iron-sulfur proteins, 711 Fe-S centers of, 7 1 1 Rieske, 711, 716f IRP l , 624b IRP2, 624b irreversible inhibitor, 203-204 IRS-I (insulin receptor substrate-! ) , 439, 44lf, 442 ischemia, ATP hydrolysis during, inhibitory proteins in, 733, 733f islet cells, pancreatic, 923-924, 924f isocitrate, 622s formation of, via cis-aconitate, 622-623, 623f oxidation of, to a-ketoglutarate and C02, 610, 624f isocitrate dehydrogenase, 51St, 623, 624s reaction mechanism of, 6241 isocitrate lyase, 638
isoelectric focusing, 90, 90f, 91f isoelectric pH (point) (pi), 73t, 80-S l , 90t determination of, 90, 90f, 9lf isolated system, 20 isoleucine, 75, 75s, 695, 699, 865 biosynthesis of, 865, S66f-S67f catabolic pathways for, 695f, 699f, 701f conversion of, to succinyl-CoA, 699, 699f properties of, 73t, 75 isomerase, 544, 560 phosphoglucose, 532, 575t phosphohexose, 532 reaction of, 533f phosphomannose, 545 triose phosphate, 534, 575t isomerization, 497-49S isomerization reaction, 497-49S, 49Sf isomers configurational, 15-17, 15f, 16f geometric, 15 isopentenyl pyrophosphate, in cholesterol synthesis, 833, S33f, S34f isoprene, in cholesterol synthesis, 831-832, S32f, S33-834, S34f isoprenoids as lipid anchors, 379-3SO, 3S0f synthesis of, 845, S45f isopropylthiogalactoside (IPTG), 1 12 1 , 1 12ls isoproterenol, 423s isotonic solutions, 52, 52f isozyme, 532, 5S4b lSWI family, in chromatin remodeling, 1 137t
J segment, of kappa light chain, 1015-1016, 1 0 1 5f, 1016f Jacob, Fran9ois, 2S3, 1 1 19, 1 1 1 9f Jagendorf, Andre, 760 JAK-STAT pathway, 443-444, 443f leptin in, 933, 933 Janus kinase (JAK) , 443, 443f, 933, 933f jasmonate, 359, 459, 459s jellyfish, fluorescent proteins in, 434b-436b jumping genes, 1 004, 1013 junk DNA, 1060
k
K+ See potassium k (Boltzmann constant), 49lt k (rate constant), 188 activation energy and, 1S8 K. (association constant), 156 in Scatchard analysis, 42lb Kaiser, Dale, 307 kappa light chains, inununoglobulin, 171 f, 1 72, 1015-1016 kcato 198, 199t kca/Km (specificity constant) , 199, 199t Kct (dissociation constant) , 156-157, 157 in Scatchard analysis, 421 b Kendrew, John, 129, 132, 13S, 138f Kennedy, Eugene P , 620, 70S, 824, S25f Keq See equilibrium constant (Ke4) keratan sulfate, 250s, 251 a-keratin in hair, 123-124, 124f structure of, 123-124, 1 24f ketals, 23S, 23Sf ,13-keto acid, decarboxylation of, 497s a-keto acid dehydrogenase complex, branched-chain, 701 ketoacidosis, diabetic, 667, 930 ketoaciduria, branched-chain, 694t ,13-ketoacyl-ACP reductase, 809, S l lf, S26f ,13-ketoacyl-ACP synthase, 809, S l l f, S26f ,13-ketoacyl-CoA, 654 ,13-ketoacyl-CoA transferase, 297, 667 ketogenic amino acid, 688 a-ketoglutarate, 127, 127s, 623 in amino acid biosynthesis, S61-S63, S62f, S63f glucogenic amino acids in, 557t
oxidation of, to succinyl-CoA and C02, 625-626 oxidation of isocitrate to, 623-625, 624f transfer of a-amino groups to, 677, 677f a-ketoglutarate dehydrogenase, 51St, 551t, 625 ketohexoses, 237f, 23S a/,13 forms of, 239 ketone(s), 13, 513s hemiacetals and, 238, 23Sf hemiketals and, 238, 23Sf ketone bodies, 666-667, 916 conversion of amino acids to, 6S8-6S9, 6SSf in diabetes mellitus, 667 in fasting/starvation state, 667, 920f, 92S in liver, 666-667, 667f in muscle contraction, 91S, 9 1 8f, 919, 9 1 9f ketoses, 236, 236f o isomers of, 237-23S, 237f L isomers of, 237, 23S nomenclature of, 237-23S ketosis, 667, 929-930 Khorana, H Gobind, 294, 1 03Sf, 1069 kidney aquaporins of, 404-405, 406t as endocrine organ, 909f glutamine metabolism in, 6Sl Kilby, B .A. , 205-206 killer T cells, 170, 170t kinase(s), 500, 532, 627b. See also speciji.c type, e.g , hexokinase casein, 605 creatine, 510 phosphoglycerate, 536-537 protein See protein kinase pyruvate, 538, 5 75t ATP inhibition of, 579-5SO, 5S9f triose, 545 kinesins, 1 75 kinetic factors, preventing dissipation of energy, 751-752 kinetoplast, 951 Klenow fragment, 982-9S3, 9S2f Km (Michaelis constant) , 196-200, 1 97f, 199, 199t apparent, 1 9St, 203t calculation of, 197 interpretation of, 19S, 19St Kohler, Georges, 173, 173f Kornberg, Arthur, 59S, 979, 979f Koshland, Daniel, 165 Krebs bicycle, 6S4, 6S5f Krebs cycle, 615. See also citric acid cycle Krebs, Hans, 615, 6S2 Kunitz, Moses, 184 Kupffer cells, 913 Kw (ion product of water) , 55, 56
L-19 NS ribozyme, 1 047-104S, 1 048f lac operon, 1 1 19-1 1 2 1 , 1 1 1 9f, 1 1 20f, 1 122, 1 1 22f regulation of, 1 126-1 127, 1 1 27f lac promoter, 1 122, 1 122f Lac repressor, 1029, 1 122, 1 126 DNA-binding motif of, 1 122, 1 123f lactate, 500s, 547 in muscle contraction, 91S lactate dehydrogenase (LDH), 500s, 5 1 8f, 5 1 St, 547, 5S4b lactic acid fermentation, 530 in muscle contraction, 91S pyruvate in, 546-54 7 Lactobacillus bulgaricus, in fermentation, 550 lactonase, 559 lactose, 244, 244f lactose intolerance, 545 lactose transporter (lactose permease), 400t, 402, 402f lactosylceramide, 352, 353f ladderanes, 854, S54f lagging strand, 979, 979f lambda light chains, inununoglobulin, 17lf, 1015f ,\ phage vector, 305t, 307, 30S, 309f. 1012. 103Sf
I n d ex
transport of, 836�841 , 839f
Lambert-Beer law, 76b
Lineweaver-Burk equation, 197
lamella, 743
linkers, 306f, 307
lanolin, 349
linking number (Lk), 956�958, 956f, 965
lipoprotein lipase, 254f, 649
lanosterol, 834-835
linoleate, 817, 817f
liposome, 374f
large fragment, of DNA polymerase I, 982�983, 982f
very-low-density (VLDL), 837f, 837t, 838-839
in animal cloning, 333
synthesis of, 815f
lateral gene transfer, 104
linoleic acid, 344t
lithotrophs, 4f, 5
lauric acid, 344t
linolenate, 817, 8 1 7f
liver
Lavoisier, Antoine, 489
lipase(s), 346
LDH. See lactate dehydrogenase (LDH)
alanine transport of ammonia to, 681 , 681f branched-chain amino acids in, 701, 701f
hormone-sensitive, 649
LDL (low-density lipoprotein) , 837f, 837t, 839, 840�841
lipid(s), 14, 343�367. See
also
fatty acid(s)
epinephrine cascade in, 428-429, 429f
364f, 366f
glutamate release of ammonia in,
leading strand, 979f
annular, 376, 377f
Leber's hereditary optic neuropathy
attachment to membrane proteins, 253, 373,
(LHON) , 741
glycogen breakdown in, 596, 597f,
biosynthesis of, 805�845
lecithin-cholesterol acyl transferase (LCAT) , 839 lectins, 258�262, 258t, 259f�262f
677�680, 680f glyceroneogenesis in, 821f, 822�823, 823f
379�380, 380f
lecithin. See phosphatidylcholine
cholesterol synthesis in, 836 detoxification in, 916
analytic techniques for, 363�366,
LDL receptor, 840�841 , 840f
598b, 599t
acetyl-GoA in, 805�808, 806f, 807f,
glycogen in, 246
8 1 1 , 922
Leder, Philip, 1068
eicosanoid synthesis in, 8 1 7�819, 8 1 8f
ketone bodies in, 666�667, 667f
leghemoglobin, 856
fatty acid synthesis in, 805�8 1 7
metabolism in, 912f, 9 1 3�91 6
Lehninger, Albert, 620, 708
[1-n]
See also fatty
o f amino acids, 914-915, 915f
acid synthesis
Leloir, Louis, 597, 598
glyceroneogenesis m, 822�823, 822f, 823f
leptin, 930�931 , 931f�934f
insulin in, 922
leptin receptor, 931
membrane lipid synthesis in, 824-831
of glucose, 914, 9 1 5f, 923f, 925�928, 927t
Lerner, Richard, 2 1 1
subcellular localization of, 812f
of glutamine, 681
Lesch-Nyhan syndrome, 893 1 130
biosynthesis of, 865, 866f-867f
components of, 9f
liver enzymes, 912�916
dietary, intestinal absorption of, 648�649, 648f
Lk (linking number) , 956�958, 956f, 965
digestion, mobilization, and transportation of,
catabolic pathways for, 695f, 701f properties of, 73t, 75
London forces, 49
ether, 350, 352f
leukotrienes, 358f, 359, 906t, 908 eicosanoids Levinthal, Cyrus, 142
808 response,
long interspersed elements (LINEs), 952f
synthesis of, 829, 830f
See also
loops
extraction of, 363�364, 364f
in DNA, 282, 282f, 968, 968f
functions of, 805
in replication fork, 978, 978f
hepatic metabolism of, 914�915
in RNA, 285, 285f, 1029f, 1049
hydrolysis of, 365 1 130� 1 1 3 1
LHC (light-harvesting complex) , 746, 746f life, origin of, 3lf, 32, 1056�1059, 1078b evolution
See also
Lobban, Peter, 307 Lon, 1 107
648�649, 648f, 650�652, 650f, 651f
leucine zipper, 1 1 24� 1 125, 1 124f leukocyte, 170, 170t, 921, 921f
muscle and, 918, 919f triacylglycerol recycling in, 822, 822f
classification of, 365�366, 366f
leucine, 75, 75s, 695, 865
LexA repressor, in
of fatty acids, 9 1 4-915, 9 1 6f
triacylglycerol synthesis in, 820�823
Letsinger, Robert, 294
leu operon,
of carbohydrates, 606�608, 608f
membrane, 256, 257f, 349�357, 350f
See also
membrane lipids
low-barrier hydrogen bond, 207 low-density lipoprotein (LDL) , 837f, 837t, 839, 840�841
as oxidation-reduction cofactors, 361
low-density lipoprotein receptor, 840�841 , 840f
as pigments, 357, 362�363
Li-Fraumeni cancer syndrome, 477
separation of, 364f, 365
LRP receptor, 841
ligand(s), 153.
in signaling, 357
luciferase, in gene transfer studies,
See also protein-ligand interactions
binding site for, 153�154, 165
solubility of, 47, 48�49, 48f, 374, 374f
concentration of, 156�157
storage, 343�349, 350f
ligand-gated ion channels, 406, 4 1 0. See also ion channels
acids; waxes
See also fatty
transport of, 830, 836�841 , 838f, 839f lipid anchors, 253, 373, 379�380, 380f
in membrane transport, 410 in signaling, 410, 422, 422f, 450f, 451f, 454f ligand-gated receptor channels, 410 open/closed conformation of, 453, 454f
gel phase of, 380f, 381
in signaling, 451f, 453, 454f
liquid-disordered (fluid) state of,
synaptic aggregation of, 384 ligand-receptor binding ligase, 627b
See receptor-ligand binding
luteinizing hormone, 258 lyase, 627b B, 170, 170t, 921
lipid bilayer, 372, 374, 374f formation of, 374, 374f
lutein, 745s, 747
lymphocytes, 170, 170t, 921, 921f
lipid rafts and, 384�386
defective, 412t
332, 332f luciferin, activation of, 509b
recombination in, 1015�1016, 1016f functions of, 170 helper, 170, 170, 1 70t receptor for, 170
380f, 381
selectins and, 259, 259f
liquid-ordered state of, 380f, 381 lipid catabolism, in cellular respiration, 616f
T, 170, 170t, 921 antigen binding by, 170
lipid metabolism, 5 70f
light
cytotoxic, 170, 170t
in adipose tissue, 821�822, 822f, 823, 909f,
absorption of, 744�749, 746f accessory pigments in, 745f, 74 7
Lynen, Feodor, 835, 835f
916�917
lysine, 72s, 75s, 77, 695, 865
chemical changes due to, 290, 291f
in brain, 920
chlorophylls in, 745�746, 745f, 746f
cortisol in, 929
biosynthesis of, 865, 866f�867f
by DNA, 287�288
in endoplasmic reticulum, 8 1 2f, 814, 8 1 5
carbamoylation of, in Calvin cycle, 776�778,
by proteins, 76, 76b, 76f
epinephrine i n , 928�929, 928t
reaction centers in, 747�749, 748f
gene expression in, insulin and , 606�608
778, 778f catabolic pathways for, 695f
in liver, 914�915, 9 1 5f
properties of, 73t, 77
electromagnetic radiation of, 744, 744f
in muscle, 918, 918f, 919f
structure of, 72�73, 72f, 75s
photopigment absorption of, 746f
regulation of
visible
light chains, immunoglobulin, 1 7 1 f, 172 recombination in, 1015�1016, 1 0 1 5f, 1 0 1 6f light energy, harvesting of. light reaction, 742
See photosynthesis
light-absorbing pigments, of Halobacterium
salinarum,
762
light-dependent reaction, 742 light-driven electron flow, 749�759. electron flow, light-driven
light-harvesting complex (LHC), 746, 746f
lysophospholipases, 355, 355f lysosomal enzymes, targeting of, 260
xylulose 5-phosphate in, 588 lipid rafts, 384-386, 386f
lysosomes, protein targeting to, 1 103�1104, 1 103f
lipidome, 366
lysozyme, 249
lipidomics, 365�366, 366f
catalytic activity of, 2 1 3�216, 2 1 4f, 215f
lipoate (lipoic acid) , 607s, 617
reaction mechanism of, 2 1 5f
lipopolysaccharides, 256�257, 257f
See also
lysolecithin, 839s
allosteric and hormonal, 608
See also
polysaccharide (s)
structure of, 13lt lyxose, 237s
lipoprotein(s) classification of, 837t
m
light-harvesting molecule, 747�748
functions of, 837
lignin, 878
high-density (HDL), 837f, 837t, 839
M line (disk), 176, 177f
lignoceric acid, 344t
low-density (LDL) , 837f, 837t, 839
Mackinnon, Roderick, 407, 407f
Lind, James, 126, 126f
properties of, 837t
MacLeod, J.J R ,, 903b
LINEs (long interspersed elements), 952f
prosthetic groups of, 84, 85t
macrocytes, 691
� -2 4
I n dex
macromolecules informatwnal, 14 energy requirements of, 508 weak interactions in, 50-51 , 5lf macrophages, 170, 170t, 172, 172f mad cow disease, 147-148 magnesium complex, ATP and, 502, 502f magnesium ions, in Calvin cycle, 776f-778f, 777, 778, 779, 784-785, 785f major facilitator superfamily (MFS), 402-403 major groove, 279, 279f malaria, sickle-cell anemia and, 169 malate, 628 oxidation of, to oxaloacetate, 628-630 transport of, 813, 829f malate dehydrogenase, 51St, 555, 628 in C4 pathway, 789-790 malate synthase, 638 malate-aspartate shuttle, 731-732, 73lf MALDI-MS (matrix-assisted laser desorption/ ionization mass spectrometry) , 98, 263, 264f maleic acid, 15s malic enzyme in C4 pathway, 789, 789f in NADPH synthesis, 812, 812f, 813 malonyl acetyl-CoA-ACP transacetylase, 809 malonyllacetyl-CoA-ACP transferase, 81 lf, 826f malonyi-CoA, 660, 661s, 805, 805s, 814 synthesis of, 787-788, 806f, 8 1 1 maltoporin, structure of, 379f maltose, 243, 244, 244f formation of, 243, 243f structure of, 243, 243s mammalian ceU cloning, 332-334, 334f mammals fat stores in, 347, 347b, 348 signaling in, 459t mannosamine, 240, 240s mannose, 237, 237s epimers of, 237s oxidation of, 240-241 , 240f structure of, 237s mannose 6-phosphate, 26lf, 262, 262f MAP kinase kinase (MAPKK), 440-441, 44lf, 442 MAP kinase kinase kinase (MAPKKK), 440-441 , 44lf, 442 MAPK cascade, 441, 44lf in JAK-STAT pathway, 443f, 444 in plants, 460, 460f, 46lf MAPKs, 439-440, 440-441 , 44lf, 442 maple syrup urine disease, 694t, 701 mappmg denaturation, 978 genetic, of E. coli, 976f genomic, 317-324, 322f marijuana, 442 Marshall, Barry J , 260, 260f mass-action ratio (Q), 493, 574, 733 in carbohydrate metabolism, 574, 575t mass spectrometty (MS), 98-100 in amino acid sequencing, 98-100, 98b-100b, 99f, lOOf in carbohydrate analysis, 263, 264f electrospray, 98-99, 99f in lipid analysis, 365, 366f matrix-assisted laser desorption/ionization (MALDI), 98 tandem, 99, 100f maternal genes, 1147, 1 148- 1 1 50, 1 1 48f, 1 1 49f maternal mRNA, 114 7, 1 148- 1 150 mating-type switch, 1 1 35t matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS), 98, 263, 264f Matthaei, Heinrich, 1067 mature onset diabetes of the young (MODY), 593b-594b, 741 Maxam, Alan, 292 Maxam-Gilbert sequencing, 292 maximum velocity (Vmaxl, 195-198, 195f McArdle's disease, 599t McCarty, Maclyn, 278
McClintock, Barbara, 1004, 1 004f McElroy, WiUiam, 509b McLeod, Colin, 278 MCM proteins, 991 MDR1 (multidrug transporter), 400 mechanism-based inactivators, 204 mediator, 1139- 1 1 40 medicine, See also specific disorders gene therapy in, 335-336 genomics in, 36 recombinant DNA products in, 337-338, 337t megaloblastic anemia, 691 megaloblasts, 691 meiosis, 1004-1005, 1004f-1006f in eukatyotes, 1004-1005, 1004f recombination in, I 004-1 005, 1 006f MEK, 440, 44l f melanocortin, 933 a-melanocyte-stimulating hormone (a-MSH), 933 melting point of common solvents, 44t of water, 43, 44-45, 44t membrane(s), 3, 3f asymmetry of, 373, 373f common properties of, 372, 373 composition of, 370f, 372-373, 372t flexibility of, 381 fluid mosaic model of, 373, 373f fluidity of, 380f, 381 functions of, 371 lipid bilayer of, 373f, 37 4 formation of, 374 overview of, 371 permeability of, 373 plasma, 3, 3f bacterial, 6, 6f composition of, 370f, 372-373, 372t lipid rafts in, 384-386, 386f lipopolysaccharides of, 256, 257f microdomains of, 384-386, 386f neuronal, transport across, 920 permeability of, 52 protein targeting to, 1 103-1 104, 1 1 03f syndecan in, 253, 253f polarization of, 450, 450f structure of, 374 trilaminar appearance of, 37lf, 373 types of, 370f membrane dynamics, 381-389 membrane fusion, 387-388, 387f, 388f membrane glycoproteins, 256 membrane lipids, 256, 257f, 349-357, 350f, 370t, 372, 372t. See also lipid(s) abnormal accumulation of, 356 aggregations of, 374, 374f amphipathicity of, 349, 372, 384f of archaebacteria, 352, 353f in bilayer, 374, 374f classification of, 350f diffusion of, 380-833, 382f-384f catalysis of, 382-383, 382f flip-flop, 380-831 , 382f lateral, 383-384, 383f, 384f distribution of, 374, 375f ether lipids, 350, 352f in gel phase, 380f, 381 glycolipids, 252, 256, 257f, 349, 350f head groups of, 350, 824, 826f, 827, 829 in liquid-disordered state, 380f, 381 in liquid-ordered state, 380f, 381 lysosomal degradation of, 355, 355f membrane protein attachment to, 373 microdomains of, 384-386, 386f orientation of, 373, 374f phospholipids, 350, 350f in plants, 351, 352f plasmalogens, 350, 35lf in rat hepatocyte, 37lf, 372, 372t in signaling, 357-360, 358f sphingolipids, 352-354, 353f, 355f sterols, 350f, 355-357, 355f
synthesis of, 824-831 cytidine nucleotides in, 824, 825f, 826f in Escherichia coli, 825, 826f, 829f in eukaryotes, 827-829, 827f-829f head group attachment in, 824, 825f, 826f head group exchange reaction in, 827, 828f salvage pathways in, 827-829 steps in, 824-831 in vertebrates, 827-829, 828f, 829f in yeast, 827, 828f, 829f transport of, 830 See also membrane transport membrane lipopolysaccharides, 256-257, 257f membrane permeability, 52 membrane polarization, in signaling, 430f, 450-453, 450f, 45lf membrane potential CVm) , 390, 390f, 450, 450f in signaling, 449-453, 450f, 454 membrane proteins, 3, 370f, 372-373, 372t a helixes of, 376, 377f, 378 aggregation of, 384f, 851 atomic force microscopy of, 385b attachment of, 376, 377f lipid anchors in, 253, 373, 379-380, 380f, 384-386 prenylation in, 830f, 845 f3 barrel, 13 lf, 378, 391 carbohydrate linkage to, 255-256, 255f, 373 classification of, 377f functional specialization of, 370f, 372-373, 372t hydropathy index for, 378 hydrophilic interactions of, 373, 374, 374f, 377f hydrophobic interactions of, 373, 374f, 376, 377f, 378 integral, 375, 377f attachment of, 376, 377f in cell-ceU interactions/adhesion, 388-389 functions of, 387-389 proteoglycans as, 252-255, 253f structure of, 377f, 378-380 lipid attachment to, 253, 373, 379-380, 380f in lipid bilayer, 373, 373f membrane-spanning, 374-379, 376f-379f orientation of, 373, 373f, 376 peripheral, 375 structure of, 376-379, 377f topology of, 374-379, 376f-379f, 377f, 378-379 amino acid sequence and, 376f, 377f, 378-379 transbilayer diffusion of, 384f, 851 transport, 378, 389-412 See also transporter(s) topology of Trp residues in, 379, 379f Tyr residues in, 379, 379f weak interactions of, 376, 377f membrane rafts, 384-386, 386f in signaling, 449 membrane transport, 389-416 activation energy for, 390, 390f active, 395-404 primary, 389f, 395, 395f secondary, 389f, 395f, 396 active, ATP energy in, 509-51 0 aquaporins in, 404-406, 405f, 406t ATP synthases in, 399 ATP-driven, 395-400, 397f-399f Ca2 + pump in, 397-398, 397f chloride-bicarbonate exchanger in, 384, 384f, 395, 395f cotransport systems in, 395, 395f in diabetes, 394 direction of, 389f electrochemical gradient in, 389f, 390, 390f electrogenic, 396 electroneutral, 395 by facilitated diffusion, 389f See also transporter(s) free-energy change in, 396 of glucose in erythrocytes, 391-393, 39lf transporters for, 391-393, 39lf, 392f, 393t, 394f ion channels in, 389f, 406-412, See also ion channels ion gradients in, 400-404, 402f-404f
Index
ionophore-mediated, 389f,
404
kinetics of
in muscle, 918-919, 918f, 919f
f3 oxidation in, 662f
nitrogen
biochemical anatomy of, 708, 708f
See nitrogen metabolism
1-25 I
in active transport, 395-396
nucleotide, 570f
chemiosmotic theory applied to, 723f
in passive transport, 390-391, 390f,
overview of, 485-488
classes of cytochromes in, 710-7 1 1 , 7 1 l f
oxidation-reduction reactions in, 500, 500f
DNA in, 738f
regulation of, 26,
electron-transfer reactions in, oxidative phospho
391-392, 392f lectins in, 260-261 of lipids, 830
574
rylation and, 708-721 . See also electron
metabolite(s), 3, 1 3-14, 486
membrane potential in, 389f, 390
secondary,
transfer reactions, mitochondrial
13
modes of, 389f, 390f, 4 1 l t + + N a K ATPase in, 398-399, 398f
metabolite concentration, regulatory enzyme
neuronal, 920
metabolite flux, change in enzyme activity on,
passive, 389-395, 390-391 porins in,
functions of, 735-738 genetic code variations in, 1 070b-1 071 b
578-580, 578f
379, 379f
evolution of, 33, 34f from endosymbiotic bacteria, 738f, 739
response to, 574, 574f, 575t
metabolite pools, in plants,
799-800, 799f
heteroplasmy and, 740
rate of, 390, 390f, 391-392, 392f
metabolome,
homoplasmy and, 740
SERCA pump in, 397-398
metabolon,
hypoxic injury of, 734
by simple diffusion, 389f, 390
metal ion catalysis, 193-194, 213, 213f
in targeting, 1 1 02-1103. See also protein
metalloproteins,
targeting transporters in, 391-395
See also transporter(s)
membrane-bound carriers, mitochondrial electron passage through, 7 1 0-712, 710f-712f sequence of, 7 1 1-712, 712f
14, 573 637
matrix of, 708-709, 708f membranes of, 708, 708f
methane, 513s
mutations in, 738f, 739-74 1
methanol, in lipid extraction, 363-364, 364f
apoptosis and, 737-738
methanol poisoning, 202-203
disease associated with, 740-741
methionine,
standard reduction potential of, 7 1 1-712, 712t
endosymbiotic bacteria and, 738f, 739
75, 75s, 699, 865
nitrous acid and, 29lf, 294
biosynthesis of, 865, 866f-867f
menaquinone (vitamin K2), 361
conversion of, to succinyi-CoA, 699, 699f
Menten, Maud, 195, 195f
properties of, 73t, 75
Merrifield,
R.
Bruce, 101, 1 0 lf, 294
in, 720, 722b
methionine adenosyl transferase,
Meselson-Stahl experiment, 977, 977f
oxidative stress and, 720-721 , 72lf plant, alternative mechanism for NADH oxidation
synthesis of, 69lf
Meselson, Matthew, 977
lipid metabolism in, 812, 812f, 813-814
84, 85t metamerism, 1 147
689
protein targeting to, 1 104 reactive oxygen species and, 720-,72 1 , 721f
synthesis of, 69lf
mesophyll cells, in C4 plants, 789f, 790
methotrexate, 894, 895s
in respirasomes,
messenger RNA
1-methyladenine, demethylation of, 1000, 1000f
respiratory proteins and, 739t
metabolic acidosis, 57, 64b
methyladenosine, 274s
shuttle systems convey cytosolic NADH into,
metaboli c alkalosis, 57, 64b
methylamine,
metabolic control,
methylation
See mRNA (messenger RNA)
574
metabolic control analysis, 577-582,
578
applied to carbohydrate metabolism, 581-582
pKa of,
718
731-732, 731f, 732f
80, 80f
in thermogenesis, 736
in DNA mismatch repair, 994-996, 994f,
transport of fatty acids into, 650-652, 651f uncoupled, heat generated by, 736, 736f
995f, 996f
in xenobiotics, 736-737
increased flux prediction by, 579b-580b
enzyme, 223, 233f
quantitative aspects in, 579b-580b
of nucleotide bases, 292
mitochondrial DNA (mtDNA) .
5-methylcytidine, 274s, 292
(mitochondrial DNA)
metabolic fuels, body stores of, 927t metabolic pathways,
1-methylcytosine, demethylation of, 1000, 1000f
See mtDNA
mitochondrial encephalomyopathy, 740-741
25, 487-488, 570f, 913t See also specific pathways, e g , pentose
7-methylguanosine, 274s
mitochondrial inheritance, 739-740
phosphate pathway
6-N-methyllysine,
mitochondrial respiration,
77, 78s
786
methyimalonic acidemia (MMA) , 694t, 700b
mitosis, 469, 469f
in glycogen metabolism, 595-596
methyimalonyl-CoA,
mixed inhibitor, 201f, 202f, 203, 203t
vs. catabolic pathway, 487f
methyimalonyi-CoA epimerase,
anabolic
catabolic
657
657 methylrnalonyi-CoA mutase, 657 Mevacor, 842-843 mevalonate, in cholesterol synthesis, 832-833,
See glycolysis
regulation of, 487-488, 570-577 adenine nucleotides in, 575-577 enzyme activity in, 571-574, 572f
MGDG (monogalactosyldiacylglycerol) , 352f
maintenance of steady state in, 571
mice, transgenic, 334
mechanisms of, 569-608, 570f
micelles, 48-49, 48f,
near-equilibrium and nonequilibrium steps in,
Michaelis constant apparent, 203t
metabolic regulation,
574
metabolic syndrome, 938-939
MMA (methylrnalonic acidemia) , 694t mobile elements, 1 004, 1013 introns as, 1053, 1054f modulators, in protein-ligand binding, 162
374, 374f
(Km),
196-200, 197f, 199, 199t
MODY (mature onset diabetes of the young) , 593b-594b, 741 molecular biology, central dogma of,
interpretation of, 197, 198, 198t
945, 945f molecular chaperones, 143-144, 144f, 145f,
Michaelis, Leonor, 195, 195f
metabolic water, 65
Michaelis-Menten equation, 196-197, 197f
metabolism,
Michaelis-Menten kinetics, 197-200, 573
25, 486
MjtRNATY', 1 086f, 1 087b MjTyrRS, 1086f, 1 087b
832f, 833, 833f, 841 Meyerhof, Otto, 528 2+ Mg , in Calvin cycle, 776f-778f, 777
574, 574f, 575t
664, 697,
816, 816b mixed-function oxygenases, 816
in glycogen metabolism, 595-596 vs. anabolic pathway, 487f glycolytic
mixed-function oxidases,
in adipose tissue, 909f, 9 1 6-9 1 7
microinjection, of DNA, in animal cloning, 333
1 104, 1 1 06f molecular evolution, 102-106. 104f-106f
aerobic, o f vertebrates, 548b
micro-RNA (miRNA) ,
amino acid, 570f
microscopy, atomic force, 385b
amino acid substitutions
anaerobic, of coelacanths, 548b
microtubules, 9, 9f, 175-176
homologs in, 104-105
1045, 1 145
See also evolution
amino acid sequences and, 102-106,
lateral gene transfer in,
in, 104
104
ATP in, 25, 26f
Miescher, Friedrich, 278
bioenergetics and, 490-495
mifepristone,
blood in, 920-922
Miller-Urey experiment, 30-3 1 , 3 l f
molecular logic of life, 2
in brain, 920, 920f
Milstein, Cesar, 1 7 3 , 1 73f
molecular mass, 14b
carbohydrate
mineralocorticoids, 908
molecular parasites, evolution of, 1 058-1059
See carbohydrate metabolism
carbon-carbon bond reactions in, 496-497,
molecular function, of proteins, 324, 328-329
456, 456s
molecular weight, 14b
synthesis of, 844-845, 844f rninichromosome maintenance (MCM) proteins, 991
molecules.
cellular, transformations in, 495-496
Minkowski, Oskar, 903b
molten globule,
energy, 570f
minor groove,
feedback inhibition in, 26
miRNA (micro-RNA) ,
See biomolecules 143 monocistronic mRNA, 284 monoclonal antibodies, 173
folate, as chemotherapy target, 895f
mirror repeat DNA, 282, 282f
Monad, Jacques, 165, 283, 1 1 19, 1 1 19f
free radical reactions in, 498
mismatch repair, 292, 994-996, 994f-996f, 994t
monogalactosyldiacylglycerol (MGDG), 352f
glutathione, 877f
Mitchell, Peter, 707, 723, 723f
monooxygenases,
glycogen. See glycogen, metabolism of
mitochondria, 951
monophosphates, nucleoside, conversion of, to
496f, 504f
279, 279f 1045, 1 145
nucleoside triphosphates, 888
group transfer reactions in, 499-500, 499f
aging and, 739
hepatic, 9 12f, 913-916
in apoptosis, 737-738, 737f
intermediary,
ATP synthase complex in, 725f-726f
486
internal rearrangements in, 497-498, 498f lipid
See lipid metabolism
ATP synthesis in, 707-708 synthesis
816b
monosaccharides, 235, 235-241. See also
See also ATP
carbohydrate(s) abbreviations for, 243t aldose, 236, 236f
r
l_!-2 6
I n dex
monosaccharides (continued) anomeric, 239 in aqueous solutions, 238 chiral centers of, 236-237, 236f, 237f conformations of, 239, 239f D isomers of, 237-238, 237f derivatives of, 240-241, 240f enantiomers of, 236, 236f epimer, 237f, 238 families of, 236, 236f in glycolysis, 545, 554f Haworth perspective formulas for, 239, 239f hemiacetal, 238, 238f hemiketal, 238, 238f heptose, 236 hexose, 236 hydrolysis of polysaccharides and disaccharides to, 543, 552f intermediates of, 240f, 241 ketose, 236, 236f L isomers of, 237, 238 nomenclature of, 236, 237-238, 240-241 oxidation of, 240-241, 240f, 241 pentose, 236 phosphorylation of, 241 pyranose, 239, 239f reducing, 241, 24lf stereoisomers of, 236-237, 236f structure of, 237f-241f, 238-239 tetrose, 236 triose, 236, 236f moonlighting enzymes, 624 morphogens, 1147 motifs, 131-138, 136f-137f See also protein folding motor proteins, 175-179, 176f-1 79f M-protein, 177 mRNA (messenger RNA) , 271, 1021. See also RNA 5' cap of, 1034-1035, 1066f artificial, in genetic code studies, 1067 base pairing of with tRNA, 1070-1071, 1071f degradation of, 1048-1049, 1096 early studies of, 283 editing of, 1040, 1072, 1073-1074 functions of, 283-284 hairpin loops in, 1 029f, 1049 half life of, 1096 length of, 284 maternal, 1 147, 1 148-1150 monocistronic, 284, 284f polycistronic, 284, 284f polypeptide coding by, 283-284 poly(A) tail of, 1039-1040 , 1039f processing of, 1 033-1040. See also RNA processing in translation. stability of, 571 synthesis of, rate of, 571-572 a-MSH (a-melanocyte-stimulating hormone), 933 mtDNA (mitochondrial DNA) , 951 genetic code variations in, 1 070b-1 071 b mucins, 256 Mullis, Kary, 3 1 7 multidrug transporter (MDRl ) , 400 multienzyme complex(es) in oxidative phosphorylation Complex 1: NADH to ubiquinone, 712-714, 7 1 3t, 714f Complex II: succinate to ubiquinone, 715, 715f Complex III: ubiquinone to cytochrome c, 715-716, 716f, 717f Complex IV: cytochrome c to 02, 716-718, 7 1 7f, 718f electron carriers in, 712-718 substrate channeling through, 637, 637f multifunctional protein (MFP), 664 multimer, 138 multisubunit proteins, 83t, 84 muramic acid, 240f muscle alanine transport of ammonia from, 681, 68lf energy sources for, 918-919, 918f, 9 1 9f
fast-twitch, 918 heart, 919, 9 1 9f metabolism in, 918-919, 918f, 919f red, 918 in regulation of carbohydrate metabolism, 608, 608f slow-twitch, 918 structure of, 176-177, 177f white, 918 muscle contraction, 178-179, 1 78f ATP in, 509-510 fuel for, 918-919, 918f, 919f muscle fibers, structure of, 176-177, 1 77f muscle proteins, 175-179, J 76f-1 79f mutagenesis oligonucleotide-directed, 312-313, 313f site-directed, 312 mutarotation, 239 mutase, 544 phosphoglycerate, 537, 575t reaction of, 537f mutations, 29, 289, 94 7, 993. See also genetic defects alkylating agents and, 291f, 292 apoptosis and, 737-738 cancer-causing, 474-475, 477f, 637, 993, 1003b citric acid cycle, in cancer, 637-638 deletion, 993 DNA damage from, 999, IOOOf endosymbiotic bacteria and, 739 in error-prone translesion DNA synthesis, 1001-1002 in evolution, 29-30, 30f, 34-35, 1 152 in fatty acyl-GoA dehydrogenase, 661, 662 insertion, 993 in mitochondria. See mitochondria, mutations in nonsense, 1 094b oncogenic, 474-475, 477f, 637, 993, 1003b oxidative stress and, 720-72 1 , 721f radiation-induced, 290, 291f silent, 993 substitution, 993 suppressor, 1094b wild-type, 30 MutH, in DNA mismatch repair, 995-996, 995f, 996f, 1003b MutL, in DNA mismatch repair, 995-996, 995f, 996, 996f, 1 003b MutS, in DNA mismatch repair, 995, 995f, 996, 996f, 1003b MWC model, of protein-ligand binding, 165, 165f myelin sheath, components of, 372, 372t myocardial infarction, 920 myoclonic epilepsy and ragged-red fiber disease (MERRF), 741 myocyte, 918 glucose in, control of glycogen synthesis from, 581-582 myofibrils, 176, 177f myoglobin, 129-131, 130f, 155, 155f heme group in, 130, 130s in oxygen binding, 155, 157-158, 157f See also hemoglobin-oxygen binding structure of, 1 29-131 , 130f, 155, 1 55f, 159-160, 159f nuclear magnetic resonance studies of, 133-134, 133f, 134f x-ray diffraction studies of, 132b-133b, 132f-133f subunits of, 159-160, 1 59f myosin, 175-176, 175-176, 176f. See also actin-myosin entries coiled coils in, 124 in muscle contraction, 178-179, 1 78f phosphorylation of, 4 72 structure of, 175-176, 176f in thick filaments, 176, 176f, 178-179, 1 78f
myosin-actin interactions, 178-179, 1 78f myristic acid, 344t myristoyl groups, membrane attachment of, 380, 380f
n N2 See nitrogen N (Avogadro's number), 49lt Na + . See sodium ion(s) NAD+ (nicotinamide adenine dinucleotide) , 297s in Calvin cycle, 783 reduced form of See NADH NADH, 584b cytosolic, shuttle systems acting on, 731-732, 73lf, 732f dehydrogenase reactions and, 5 1 7-519, 517f, 518f oxidation of, in plant mitochondria, 720, 722b in payoff phase of glycolysis, 535-538, 536f, 537f NADH dehydrogenase, 6114, 713, 713t NADH:ubiquinone oxidoreductase, 712-713. See also Complex I in oxidative phosphorylation, 714f NADP+, 517s dehydrogenase reactions and, 516-519, 517f, 518f, 51St reduced form of See NADPH vitamin form of, deficiency of, 5 1 9 NADPH, 26f, 584b in anabolic reactions, 812 in Calvin cycle, 773, 776f, 778 in cell protection against oxygen derivatives, 559, 559f dehydrogenase reactions and, 516-519, 51 7f, 518f in fatty acid synthesis, 81 1 , 826f in glucose oxidation, 559, 560, 560f in glyceraldehyde 3-phosphate synthesis, 773, 776f, 778 in partitioning of glucose 6-phosphate, 563, 563f in photosynthesis, 782-786, 782f-785f, 812 synthesis of in adipocytes, 812, 812f in chloroplasts, 812 in cytosol, 812, 812f in hepatocytes, 812, 812f Na+-glucose symporter, 403, 403 Na +K+ ATPase, 398-3 99 , 398f, 403, 403f in membrane polarization, 450, 450f in retina, 463 in membrane transport, in neurons, 920 nalidixic acid, 960b, 960s nanos, 1 1 48-1150 naproxen, 818, 818s native conformation (protein), 29, 1 14 native protein, 29, 1 14 ncRNA (noncoding RNA), 1 146 near-equilibrium steps, in metabolic pathway, 574, 574f nebulin, 177 Neher, Erwin, 407, 407f Neu5Ac, 258-259, 262 neural transmission, steps in, 45lf neuroendocrine system, 901 neuron(s) anorexigenic, 933 gustatory, 467, 468f membrane transport in, 920 Na+ channels in, 409-410, 45lf, 452-453 olfactory, 465-467, 466f orexigenic, 932 photosensory, 462-463, 462f visual, 462-463, 462f neuronal signaling, 902, 902f neuropathy, optic, Leber's hereditary, 741 neuropeptide Y (NPY), 932 neurotransmitters biosynthesis of, from amino acids, 878-882, 879f as hormones, 902
[1-27]
I ndex
receptors for, 453--454 release of, 453--454 membrane fusion in, 388, 388f
neutral fats. See triacylglycerol(s)
nonessential amino acids, 860. amino acid(s)
nonoxidative reaction, of pentose phosphate pathway, 560-563, 561f
See hydrophobic compounds
neutral glycolipids, 350f, 353f, 354, 355f
nonpolar compounds.
neutral pH, 55
nonreducing sugars, 243, 244
neutrophilic displacement reaction, of ATP, 508, 508f
nonsense codons, 1069, 1 069f. See
newborn, PKU screening in, 698
nonsense mutations, 1 094b
Nexavar, 476b
nonsense suppressors, 1094b
NH3. See ammonia
See also
also codons
dietary deficiency of, 519 nick translation, 983, 983f, 984, 989, 990f, 994t, 997, 998f
base(s), nucleotide/nucleic acid
See also
components of, 271-274, 272f-274f depurination of, 290, 290f evolution of, 30-32, 1056-1059 flavin, 519-520, 709 bound to flavoproteins, 519-520, 520f, 520t functions of, 296-298
nonsteroidal anti-inflammatory drugs (NSA!Ds),
niacin (nicotinic acid), 519, 519s
in ATP hydrolysis, 296-297, 296f bases of, 271-274, 271-277, 272s-274s.
linkage of, 274-276, 275f metabolism of, 570f, 913t
358-359, 818, 818s
N-,8-glycosyl bonds of, hydrolysis of, 290, 290f
norepinephrine, 878, 907 as neurotransmitter vs hormone, 902
nomenclature of, 272, 272t, 273f, 274
Northrop, John, 184
nonenzymatic reactions of, 289-292, 290f, 291f
nicotinamide, 519s
NPY (neuropeptide Y), 932
nonenzymatic transformation of, 289-292
nicotinamide adenine dinucleotide (NAD+ ) , 297s
NS domains, 253-254, 253f, 254f
phosphate groups of, 271-272, 271f, 272t,
reduced form of. See NADH
273f, 296
in proteoglycans, 255f
nicotinamide adenine dinucleotide phosphate.
NSA!Ds (nonsteroidal anti-inflammatory drugs),
nicotinamide nucleotide-linked
NuA4, in chromatin remodeling, 1 137t
See NADP+
pyrimidine, biosynthesis of, 886-887, 886f, 888f
358-359, 818, 818s
dehydrogenases, 709 reactions catalyzed by, 709t
regulatory, 298, 298f
nuclear magnetic resonance (NMR) spectroscopy
as second messengers, 298, 298f
in carbohydrate analysis, 263, 264f
nicotinic acetylcholine receptor, 410
protein structure determination, 133-134,
open/closed conformation of, 453, 454f
nuclear proteins, targeting of, 1 1 04, 1 1 05f
in signaling, 453, 454f
nuclear receptors, 422, 422f, 905
synaptic aggregation of, 384 dietary deficiency of, 519 Niemann-Pick disease, 356 Nirenberg, Marshall, 1067-1068, 1067f nitric oxide (NO), 446
276, 276f 272t, 273s sugar, 596-601 formation of, 598, 600f
nucleases, 979
nucleic acid(s), 14. See
sequences of, schematic representation of, structure of, 271-274, 272f-274f, 272s,
133f, 134f
nicotinic acid (niacin), 519, 519s
regulation of, 887, 887f
nuclear localization sequence (NLS), 1104, 1 105f
nicotine, 519s defective, 412t
purine. See purine nucleotides
also DNA; RNA
in glycogen synthesis, 596-601 , 600f, 624f synthesis of, 859, 879f, 882-896
3' end of, 275
enzymes in, chemotherapeutic agents
5' end of, 275
bases of. See base(s), nucleotide/nucleic acid; base pairs/pairing
targeting, 894-896, 894f, 895f transphosphorylations, 5 1 1f
as hormone, 906t, 909
chemical synthesis of, 294, 295f
transphosphorylations between, 510-5 1 1
synthesis of, arginine as precursor in, 882, 882f
components of, 9f
variant forms of, 274, 274s, 280-281, 281f
nitric oxide (NO) synthase, 446, 909
evolution of, 30-32, 1056-1059
nitrification, 852
5' end of, 275f
nitrogen
hydrophilic backbones of, 275, 275f, 278
available, nitrogen cycle maintenance of, 852, 852f cycling of, 486, 486f enzyme fixation of, nitrogenase complex in, 852-857' 855f, 856f
nucleotide sequences amino acid sequence and, 97f, 98-100, 948, 948f determination of, 98-100
long, 276 nomenclature of, 272, 272t, 274
in evolutionary studies, 105
nonenzymatic transformation of, 289-292
schematic representation of, 276, 276f
nucleotides of, 271-277. See
also nucleotide(s)
nucleotide sugar, 791
See codons
phosphate bridges in, 274-276, 275f
nucleotide triplets
phosphodiester linkages in, 274-276, 275f
nucleotide-binding fold, 298
reduction of, to ammonia, 852-854
polarity of, 275, 275f
nucleotide-excision repair, 994t, 997-998, 997f,
solubility of in water, 47, 47t
pyrimidine bases of, 272-274, 273, 274f
excretion of, 682-687, 683f, 684f, 685f, 686f, 687f
nitrogen cycle, 852
short, 276
available nitrogen in, 752f, 852 nitrogen metabolism, 851-860 ammonia in, 857 available nitrogen in, 852, 852f
structure of, 277-287
998f, 1003b in bacteria, 994t, 997-998, 998f in humans, 998f
base properties and, 276-277, 276f
nucleus, 3, 3f
overview of, 277-280
NURF, in chromatin remodeling, 1138
in DNA, 277-283. See also DNA structure
protein targeting to, 1 104, 1 105f
biosynthetic reactions in, 859, 879f
in RNA, 284-285, 284f-286f
Niisslein-Volhard, Christiane, 1 147, 1 1 49f
enzyme fixation in, 852-857, 855f, 856f
schematic representation of, 276
nutrients, transport of, in blood, 920-921
glutamate and glutamine in, 674 glutamine synthetase in, 857-859, 858f nitrogen mustard, as mutagen, 291f, 292 nitrogenase complex, 854-857
synthesis of. See DNA replication; translation
nucleic acid probes, 311, 3 1 1f nucleic acid sequences
amino acid sequence and, 97f, 98-100, 948, 948f
enzymes of, 855f
determination of, 98-100
nitrogen fixation by, 855, 855f, 856f
in evolutionary studies, 105
nitrogen-fixing nodules in, 856, 856f nitrogen-fixing nodules, 856, 856f
0 02• See oxygen
obesity, 930-937. See
also body mass
Ochoa, Severo, 598, 1049, 1049f
nuclein, 278
octadecadienoic acid, 344t
nucleoids, 3, 3f, 6, 6f, 970
octadecanoic acid, 344t
nitroglycerin, 446
nucleophiles, in enzymatic reactions, 208f, 496, 496f
odered water, 49, 49f
nitrous acid, as mutagen, 291, 291f
nucleoside(s), 271
0-glycosidic bond, 243
nitrovasodilators, 446 N-linked oligosaccharides, 255-256, 255f, 373, 1 101-1 1 04, 1 102f
nomenclature of, 273t, 274, 275t nucleoside diphosphate kinase, 510, 627, 888 Ping-Pong mechanism of, 510f
NLS (nuclear localization sequence) , 1104, 1 1 05f
nucleoside diphosphates, 296, 296f
NMR spectroscopy.
nucleoside monophosphate kinase, 888
See nuclear magnetic
resonance spectroscopy NO.
See nitric oxide
(NO)
NO synthase, 446, 909
nucleoside monophosphates, 296, 296f conversion of, to nucleoside triphosphates, 888 nucleoside triphosphates, 296, 296f
Okazaki fragments, 979, 979f, 987-989 synthesis of, 987-988, 987f oleate, 656-657, 815, 817f synthesis of, 815, 815f oleic acid, 344t olfaction, signaling in, 465--467, 466f
oligo glucanotransferase, 596. See also debranching enzyme
oligo (a1�6) to (a�4) glucan-transferase, 596
nocturnal inhibitor, 778
hydrolysis of, 296-297, 296f
nodules, nitrogen-fixing, 856, 856f
nucleoside monophosphate conversion to, 888
oligomers, 14, 83t, 84, 138
nomenclature systems
in RNA synthesis, 508
oligonucleotide, 276
D,L, 1 7
R,S, 17 Nomura, Masayasu, 1076, 1076f noncoding RNA (ncRNA) , 1146 noncompetitive inhibitor, 201f, 202f, 203, 203t
noncovalent bonds, 1 0. See also weak interactions
nonequilibrium steps, in metabolic pathway, 574, 574f
nucleosomes, 963, 964-965, 964f, 965f, 967f in 30 nm fiber, 966, 968f
oligonucleotide-directed mutagenesis, 312-313, 313f
acetylation of, 1 137-1 138
oligopeptides, 82, 86-87
positioning of, 965
oligosaccharides, 235.
5' -nucleotidase, 892 nucleotide(s), 271
disaccharides
See also carbohydrate(s);
analysis of, 263-265, 264f
abbreviations for, 272t, 273f, 296f
chemical synthesis of, 263-265
absorption spectra of, 276, 276f
conformations of, 248, 248f
Index
1-28
oligosaccharides
in glyoxylate cycle, in plants,
(continued)
oxygenases,
798, 798f
glycoprotein linkage to, 255-256, 255f, 373,
oxidases,
lectin binding of, 1 59f-262f, 258-261, 258t N-linked, 255-256, 255f, 373, 1 1 0 1-1 104, 1 102f
oxygen-evolving complex,
816, 816b
oxytocin, 9 1 1 s
664--665 See also a oxidation in endoplasmic reticulum, 665f in peroxisomes, 664-665, 665f
nomenclature of, 243-244 0-linked, 255-256, 255f, 373, 1 102-1 103, 1 102f
of acetate, 631 , 631£
in peptidoglycan synthesis, 797f
of amino acids, 673-702. See
separation and quantification of, 263, 264f
758
water split by, 756-758, 758f
oxidation a,
816
oxygen-binding proteins, 1 54-170
816b
mixed-function, 664, 697,
1 1 01-1103, 1 102f as informational molecules, 14, 257-262, 262f
816b
mixed-function,
oxidation of malate to, 628-630
diversity of, 257-258
p
P (peptidyl) binding site, ribosomal,
also amino
structure of, 263, 264f
ATP yield from, 733t
Pace, Sidney, 1 048
synthesis of, 1 101-1 102, 1 1 02f
f3, 647. See also f3 oxidation
pair-rule genes,
of carbon, 513f
Palade, George, 1 100, l lOlf
0-linked oligosaccharides, 255-256, 255f, 373, 1 102-1103, 1 1 02f omega-3 fatty acids,
1 147, 1 150
in citric acid cycle, energy of, 630-63 1 , 630f, 630t
palindromic DNA, 281 ,
of fatty acids, 652-665.
palmitate
See also fatty
281, 282, 282f
345 omega-6 fatty acids, 345 w oxidation, 664
of glucose, 24, 558-563. See also glucose oxidation
in fatty acid synthesis, 814, 814f
06 -methy1guanine, mutation from, 999, l OOOf
of glyceraldehyde 3-phosphate to
release of, 8 1 1
desaturation of, 815, 815f
acid oxidation
06 -methylguanine-DNA methyltransferase,
1 ,3-bisphosphoglycerate, 535-536, 536f
palmitoleate, synthesis of, 815, 815f
623-625, 624f
OmpLA, structure of, 379f OmpX, structure of, 379f
of a-ketoglutarate to succinyl-CoA and C02,
w, in endoplasmic reticulum, 664, 664f
993, 1003b
palmitoy!-CoA, 814
of pyruvate to acetyl-GoA and C02, 616-617, 616f
in citric acid cycle, 637-638 one gene-one enzyme hypothesis, 624,
948 one gene-one polypeptide hypothesis, 948 open reading frame (ORF), 1069 open system , 20 operators, 1117
oxidation-reduction reactions,
his, 1 130 lac, 1 1 19-1 1 2 1 , 1 1 19f, 1 120f leu, 1 130 phe, 1 130
22, 500, 500f
dehydrogenation in, 513-514, 513f electromotive force and biologic work
in, 816b--817b
in,
pancreatic f3 cells, 923-924, 924f 512
half-reactions in, 5 1 2-513
in, 514-515, 514f, 515t
standard reduction potentials in, 515-516, 515t
regulation of, 1 1 26-1 127, 1 127f
679 oxidative decarboxylation, 616
trp, 1 127-1130, 1 128f, 1 129f
oxidative pentose phosphate pathway, 775,
optical activity,
741
17, 73
104, 325
in, 372t
177
parasites, molecular, evolution of, 1058-1059 parathyroid, 909f
See also phosphorylation
absorption spectra of, 465, 465f
eicosanoid, 358-359, 358f paralogs, 34,
paramyosin,
oxidative phosphorylation, 708-74 1.
optic neuropathy, Leber's hereditary,
676
677 paracrine hormones, 906
Paramecium, membrane components
785-786, 798
463. See also rhodopsin
pancreatic trypsin inhibitor, pancreatitis, acute,
paralysis, toxic, 410-412
oxidative deamination,
opines, 331f
in glucose regulation, 922-926 pancreatic a cells, 924, 924f
bioenergetics and, 512-521
reduction potentials
oxidation of, ATP in, 654-655, 656t
pancreas, 909f
of succinate to fumarate, 628
enzymes
operons, 1 1 19-1 121
opsins,
380, 380f
of malate to oxaloacetate, 628-630
oncogenic mutations, 474-475, 477f, 637,
palmitoleic acid, 344t palmitoyl groups, membrane attachment of,
625-626
oncogenes, 473-474, 478f
synthesis of, 808, 808f, 8 1 1 , 81lf paimitic acid, 344t
of isocitrate to a-ketoglutarate and C02,
999, lOOOf
1089
p53 mutations, 477
acid oxidation
ATP hydrolysis inhibition in, 733, 733f
Parkinson's disease, protein misfolding in, 146
ATP synthesis in, 723-732.
passive transporters,
See also
Pasteur,
ATP synthesis
Louis,
391
17, 184, 539, 569
ORC (origin replication complex), 991 orexigenic neurons, 932 ORF (open reading frame), 1069
ATP-producing pathways in, 734-735, 735f
pattern-regulating genes, 1 147- 1 1 52
organelles, 6f, 7-9
brown adipose tissue heat production in, 736
Pauling, Linus, 103, 1 1 5f, 1 17, 123, 130, 190, 2 1 1
patch-clamp technique, 407, 407f
ATP yield in, 733t
cytoskeleton and, 9-10, 9f
brown fat heat production in, 736f
PCNA (proliferating cell nuclear antigen) , 992
in plants, 774-775, 775f
cellular energy needs in, 733
PCR (polymerase chain reaction) ,
organic solvents, in lipid extraction, 363-364, 364f
chemical uncouplers of, 724, 724f
POI (protein disulfide isomerase), in protein
organotrophs, 4f,
chemiosmotic theory of,
5
folding,
707
317, 318f
144
Orgel, Leslie, 1056, 1 056f
in heart muscle, 9 19-920
PDK1 (pyruvate dehydrogenase kinase 1), 441
oriC (DNA replication origin) , 875f, 986-987
mitochondria in, 707-708
P/2e ratio,
in bacteria, 978, 978f
electron-transfer reactions of, 708-722. See
in eukaryotes, 991
also electron-transfer reactions, mitochondrial
origin replication complex (ORC),
origin-independent restart of replication, ornithine,
1009
ornithine I)-aminotransferase,
863
ornithine /)-aminotransferase reaction, 863f ornithine decarboxylase,
879, 880b--881b, 881£ 684
ornithine transcarbamoylase, orotate,
882--883 orthologs, 34, 104, 325
pentose(s), 236, 236s
endosymbiotic bacteria and, 739, 739f
conformations of, 272, 273f
oxidative stress and, 720-721 , 721£
nucleic acid, 272, 273f
photophosphorylation and, 707-708.
See also
reactive oxygen species and, 720-72 1 , 721£ oxidative photosynthetic carbon cycle,
oxidative reactions, of pentose phosphate pathway,
788-789
559-560, 560f
52
oxidative stress, role of mitochondria in, 72G-721 , 721£
osmotic pressure, 5 l f, 52
oxidoreductase ,
osteogenesis imperfecta, 128
oxygen
of, 379f ovary, 909f overweight, 930-937. See also body mass oxaloacetate, 590,
622, 813, 813f
in amino acid biosynthesis, 865, 866f--867f asparagine and aspartate degradation to, 701-702, 702f in C4 pathway, 789, 789f
glucogenic amino acids in, 557t in glyceroneogenesis, 821£
558, 721, 775,
general scheme of, 558, 560f glucose 6-phosphate in, 56G-563, 561f, 562f, 563f
osmotic lysis, 52
outer membrane phospholipase A, structure
pentose phosphate pathway, 785-786, 798, 914
regulation of, 732-735
osmolarity, 51f, osmosis, 51f,
nucleotide, 236, 236s, 271-274, 272f-274f ring numbering conventions for, 27lf, 274
photophosphorylation
oseltamivir, 259-260, 260s
52, 52f
See also antibiotics
plasmids in, 949
apoptosis and, 737-738 disease associated with, 740-741
77, 78s
penicillin
mechanism of action of, 2 1 6-218
gene mutations of, 740-741
991
729
pellagra, 519
518
glycolysis and, 563, 563f
NADPH in, 559-560, 560, 560f in NADPH synthesis, 812, 812f
cycling of, 486, 486f
nonoxidative reactions of, 560-563, 56lf
electron transfer through, 5 1 3-514
oxidative,
hemoglobin binding of, 154-170
oxidative reactions of, 559-560, 560f
See also
hemoglobin-oxygen binding partial pressure of, 158 solubility of in water, 47, 47t
reductive,
562, 775, 785-786, 798 562, 775
Wernicke-Korsakoff syndrome in, 563 pentose phosphates
oxygen concentration, limiting, glycolysis in, 539
movement of, 799--800, 799f
oxygen consumption, ATP synthesis and,
synthesis of, in Calvin cycle, 779-780, 780f-781f,
chemiosmotic coupling in, 729-730
781f, 782-783, 782f
oxygen ester, free-energy hydrolysis of, 505, 506f
PEP. See phosphoenolpyruvate (PEP)
oxygen transport, in blood, 920-921
pepsinogen,
675
I n dex
peptic ulcers, 260, 260f peptide (s) , 82.
phenylketonuria (PKU), 694t, 697
See also polypeptide(s);
protein(s)
for, 697-698, 697f phenylpyruvate, 697
naming of, 82f
pheophytin, 749
size of, 83
pheophytin-quinone reaction center,
structure of, 82, 82f, 83f synthesis of, 100--102, 101f, !02t
phosphoenolpyruvate carboxylase, in C 4 pathway, 789, 789f
secondary structures and, 1 2 1 , 122f
as catalyst in glucose metabolism, 597f
Phillips mechanism, 2 1 3-216
peptide bonds, 82f, 85, 115-116, 1 18f.
See also bond(s)
in a helix, 1 1 8f, 1 19-120
phorbol esters, 436
6-phosphogluconate dehydrogenase, 560
phosphagens, 5 1 1
phosphogluconate pathway, 558.
phosphoglucose isomerase, 532, 575t
phosphate
electric dipole in, 1 1 6f, 1 19-120
as buffer, 57f, 58-59, 59f, 61
phosphoglutamase, 544
formation of, in protein synthesis,
inorganic
2-phosphoglycerate, 213s, 537s
109 1 , 1 092f
537-538, 537f
in glucose oxidation, 24
in photosynthesis,
trans configuration of, 1 2 1f peptide group, 1 15, 1 16f
783-784, 783f
in starch synthesis, 793, 794f
peptide hormones, 906, 906t, 907f
in nucleotides, 271-272, 27lf
peptide prolyl cis-trans isomerase (PPI), in protein folding, 144 peptide translocation complex, 1 101, peptidoglycans, 25lt, 796
l lO!f
variant forms of, 274, 274f triose, interconversion of, 534-535, 535f phosphate bond, high-energy, 506
in penicillin, 2 1 6-2 1 7
phosphatidate, in triacylglycerol synthesis, phosphatidic acid, 350, 35Jf, 374, 377f, 821
peptidyl (P) binding site, ribosomal, 1089 peptidyl transferase, 1091
phosphatidic acid phosphatase, in triacylglycerol
permanent waves, 125
See also transporter(s)
pernicious anemia, 659, 691
phosphatidylcholine, 350, 35lf, 352, 354s, 815,
phosphatidylethanolamine, 350, 35lf
{3 oxidation in, 662-663, 662f
in lipid synthesis, 824, 826f, 827, 828f
plants and, 662-663, 663f
membrane distribution of, 374, 377f
lipid metabolism in, 812f
to 2-phosphoglycerate, 537-538 P, exchange for, 783-784, 783f, 784f synthesis of, 775, 776-778, 777f phosphoglycerate kinase, 536-537, 779f phosphoglycerate mutase, 537, 575t 3-phosphoglyceric acid, 504s
See glycerophospholipids
phosphoglycerides, 350f
2-phosphoglycolate, 786, 787f
in glycolate pathway, 787-789, 787f, 788f
phosphohexose isomerase, 532
synthesis of, 820--823, 820f
peroxisome proliferator-activated receptors
phosphatidylglycerol, 350, 35Jf
(PP�) , 660-661 , 936-937, 937f
in lipid synthesis, 824, 826f
pertussis toxin, 427b
to glyceraldehyde 3-phosphate, 775, 777f,
reaction of, 537f
817f, 827, 839s membrane distribution of, 374, 377f
peroxisome(s), 662
conversion of
3-phosphoglycerate kinase, 778
synthesis, 821, 82lf
permeability transition pore complex, 737
in amino acid biosynthesis, 863-864, 863f
in starch synthesis, 793
synthesis of, 820f, 821, 824 in triacylglycerol synthesis, 821 , 821f
perilipin, 649
enolase catalysis of, 213, 2 1 3f 3-phosphoglycerate, 504s, 537-538, 537s
in glycolate pathway, 787f, 788
82 1 , 82lf
structure of, 796, 796f
dehydration of, to phosphoenolpyruvate, 538
778, 782f
phosphate translocase, 731
bacterial synthesis of, 796, 797f
permeases, 391.
conversion of 3-phosphoglycerate to,
in cells, 502t
properties of, 1 1 5- 1 1 6
reaction mechanism of, 533f phosphoinositide 3-kinase (PI-3K) ,
phosphatidylinositol(s), 357-358
441--442' 442f
Perutz, Max, 138, 138f
membrane distribution of, 374, 377f
phospholipase, 355, 355f, 365
PFK-1 . See phosphofructokinase-! (PFK-1)
synthesis of, 826f, 827�29, 827f, 828f, 829f
phospholipase A
pH, 55-57, 56f, 56t
in eicosanoid synthesis, 817, 818f
in yeast, 827, 828f, 829f
of aqueous solutions, 55-57, 56f, 56t of blood, 62-63
See also pentose
phosphate pathway
phosphatase, 627b
cis configuration of, 1 2 1 , 121f
phosphofructokinase-2 (PFK-2) , 588 phosphoglucomutase, 596
Phillips, David, 2 1 3
titration curves of, 82�3
phosphofructokinase-! (PFK-1), 532, 533, 574, 575t regulation of, 585-587, 586f, 587f
749-751, 750f
q, angle,
i n triacylglycerol synthesis, 82lf, 823, 823f, 824, 9 1 7
ionization behavior of, 82-83
standard free-energy changes of, 493t
phosphoenolpyruvate carboxykinase, 554s, 555, 9 1 7
newborn screening for, 698 phenylalanine in, alternative catabolic pathways
amino acid residues in, 77, 78s, 82
phosphatidylinositol 4,5-bisphosphate (PIP2), 350,
outer membrane, structure of, 379f phospholipase C, 357-358, 365, 432, 443f
35lf, 357-358
phospholipid(s), 349. See also lipid(s)
buffering and, 59--63, 60f, 6lf
membrane distribution of, 374, 377f
enzymatic activity and, 56-57, 63f, 68
in plants, 359
head groups of, 349, 824, 826f, 827, 829
enzyme, 204, 204f
in signaling, 359
lysosomal degradation of, 355, 355f
functional importance of, 56, 57 in hemoglobin-oxygen binding, 166, 166f
phosphatidylinositol kinase, 826f, 827, phosphatidylinositol pathway, 432--433, 433f
isoelectric, 73t, 80-81
phosphatidylinositol 4·phosphate, membrane phosphatidylinositol 3,4,5-trisphosphate (PIP3) ,
neutral, 55
in titration curve, 58-59, 58f, 59f, 79-80, 79f pH optimum, 63 phagocytosis, 172, 172f
genomics/proteomics in, 335-337 phase variation, 1 134, 1 135f
in lipid synthesis, 824, 826f, 827, 828f
steps in, 824
membrane distribution of, 374, 377f
in vertebrates, 827--829, 828f, 829f
phosphocreatine, 504s, 876, 918s cellular concentration of, 502t
phosphodiester linkages, in nucleic acids,
phenotype, 947
in yeast,
827, 828f, 829f
transport of, 830 phospholipid bilayer, 374, 374f formation of, 374, 374f
hydrolysis of, 504, 504s in muscle contraction, 918, 9!8f
phe operon, 1 130
head group attachment in, 824, 825f, 826f
salvage pathways in, 827-829, 828f
phosphatidylserine, 827
phosphoanhydrides, 297f
See also under drug and specific drugs
pharmaceuticals
825, 826f, 829f
827, 828f
in signaling, 433f, 441443
standard free-energy changes and, 493t
cytidine nucleotides in, 824, 825f, 826f
in Escherichia coli,
head group exchange reaction in,
357-358
scale for, 56-57, 56t
See membrane lipids
in eukaryotes, 827-829, 827f�29f
distribution of, 374, 377f
measurement of, 56-57
membrane.
synthesis of, 82W3!
827f, 829f
Henderson-Hasselbalch equation for, 60--6 1 determination of, 90, 90f
phospholipid head group attachment, 824, 826f phospholipid head group exchange reaction, 827, 828f
274-275, 275f
phenotypic functions, of protein, 324
phosphodiesterase, in vision, 463, 464f
phosphomannose isomerase, 545
phenylacetate, 686, 687s
phosphoenolpyruvate (PEP), 213s, 537s, 538
phosphopantetheine, 80f, 808
phenylacetyl-CoA, 686, 687s
acetate as source of, 638
phosphopentose isomerase, 560
phenylacetylglutamine, 686-687, 687s
dehydration of 2-phosphoglycerate to, 538
phosphoporin E, structure of, 379f
phenylalanine, 75-76, 75s, 695, 869
enolase catalysis of, 2 1 3
phosphoprotein phosphatase I, 603
biosynthesis of, 869, 87lf
in gluconeogenesis, 553-557, 553t, 554f,
catabolic pathways for, 695f, 696f, 697f alternative, 697-698, 697f degradation of, to acetyl-GoA, 695-696, 695f
in glyceroneogenesis, 82lf,
in glycogen metabolism, 606, 607f phosphoprotein phosphatase 2A, 588, 589f
555f, 926
823
in glyoxylate cycle, in plants, 798, 798f
phosphoproteins, 84, 85t phosphorarnidite method, of DNA synthesis, 294, 295f
genetic defects in, 696-698, 697f
hydrolysis of, 504, 504f
properties of, 73t, 75-76
synthesis of, from pyruvate, 553-556, 554f
5-phosphoribosylarnine, 883
transfer of phosphoryl group from, to
5-phosphoribosyl-1-pyrophosphate
phenylalanine hydroxylase, 697, 869 role of tetrahydrobiopterin
in,
697, 697f
ADP, 538
1-29
(PRPP) , 861
�-30 =
I ndex
phosphorolysis, 544 of glycogen and starch, 544 of glycosidic bonds, vs. hydrolysis, 595-596 phosphorus, covalent bonds of, 499-500, 499f
photolithography, 326, 326f
PI-3K-PKB pathway, 441-442, 442£
photolyases, 520
pili, 6£
DNA, 994t, 998-1000, 999f
Ping-Pong mechanism, 200, 200£
reaction mechanism of, 999f
pioglitazone (Aetas), 808s, 824, 936 PIP2. See phosphatidylinositol
photon, 744
phosphorus-oxygen bond, 499-500, 499f phosphoryl group
absorbed, energy conversion of, 747-749, 748f
ATP and, 508
ATP synthesis by, 759-761, 759£, 760£, 798f
function of, in glycolysis, 529f, 531
central photochemical event in, 749-759,
phosphoryl group transfer, 499-500, 508f
P,-triose antiporter, 783-784, 784f pituitary
chemiosmotic theory of, 707
chemical basis for, 501-503, 502f from 1,3-bisphosphoglycerate to ADP, 536-537
chloroplasts in, 707-708
anterior, 909, 909£, 910f
general features of, 742-744
posterior, 909, 909f, 9 1 0f pituitary hormones, 9 1 1 s
light absorption in, 744-749, 746f
from inorganic polyphosphate, 502t, 5 1 1
oxidative phosphorylation and, 707-708
from phosphoenolpyruvate t o ADP, 538
also pigments
phosphorylase b kinase, 603
absorption of visible
primary and secondary, 745f
phosphorylase phosphatase, 224, 233£ of, 504, 504f, 505-506, 505£, 505t, 506£ ranking of, 507f
in titration curve, 58-59, 59£ pK3 (relative strength of acid/base) , 58£
light by, 746f
of amino acids, 73t, 79-81 , 79f-8lf
photorespiration, 786-790, 787f, 788£, 789f
phosphorylated compounds, free-energy hydrolysis
See protein kinase A (PKA)
of R groups, 83
stoichiometry of, 760 photopigrnents, 465, 465f. See
PKA.
pK. (relative strength of acid), 58, 59f
phosphorylase kinase, 224, 233f
phosphorylation. See
See also
oxidative phosphorylation
phosphorylase, 627b phosphorylase a phosphatase, 603
357-358 in signaling, 433£, 442-443
750f-758f
ATP in, 501-5 1 1
4,5-bisphosphate (PIP2) PIP3 (phosphatidylinositol 3,4,5-trisphosphate),
photophosphorylation
effects of chemical environment on, 80, 80f in Henderson-Hasselbalch equation, 60-61
in C4 plants, 789-790, 789f photosensory neurons, 462-463, 462f
of R groups, 73t
photosynthesis, 742-764, 773-786
in titration curve, 58f, 79-8 1 , 79£
also autophosphorylation
action spectrum for, 747, 747f
PKB. See protein kinase B (PKB)
of acetyl-CoA carboxylase , 814, 814f
ATP
PKC. See protein kinase C (PKC)
of amino acid residues, 224-226
c2 cycle in, 789
PKG (protein kinase G), 445-446
of ATPase transporters, 397-400, 398f
in C4 plants, 789-790
PKU. See phenylketonuria (PKU)
bioenergetics and, 501-5 1 1
in CAM plants, 790
consensus sequences in, 225-226, 226f
carbon fixation in, 774, 775-778, 794f.
of cyclin-dependent protein kinases, 4 70-4 73,
in, 782-786, 782f-785f
plant(s)
See also
470f, 471£, 473f
electron flow in, 742-743
in DNA repalr, 471, 472-473, 473f
C4, photosynthesis in, 789-790
carbon-assimilation reactions in, 742-743, 743f,
in DNA replication, 979-980, 980f
C02 assimilation in, 752, 752f, 775-780
in enzyme regulation, 224-226, 226f, 226t,
See also
of fructose 6-phosphate to fructose-! ,6 bisphosphate, 532 in gene regulation, 1 144
also Calvin cycle
dark reactions of, 783
cell structure in, 6f
in evolution, 32, 34f, 761-764, 763f
cell wall synthesis in, 795-796
glycolate pathway in, 787-789, 787£
cloning in, 330-332, 330f-333f
light energy for, chlorophyll absorption of,
of glucose, 532
carbohydrate metabolism in, 773-786, 797-800, 798£. See
Calvin cycle
227f, 233£
C4 pathway in, 789-790 CAM, 790
783, 784-786, 785f
in enzyme cascades, 420, 420f, 441, 441£
aquaporins in, 404 C3, 776
Calvin cycle
desaturases in, 815, 817£
DNA in, 951
745-747, 745£, 746£
of glycogen phosphorylase, 223f, 224-226
light-dependent reactions in, 742-743, 743f
ethylene receptor in, 460, 460£
in heart muscle, 918
NADPH
gluconeogenesis in, 792£, 793, 793£
multiple, 225-226, 226f
photophosphorylation and, 742-744. See
oxidative, 708-741
See also oxidative
phosphorylation
also
photorespiration and, 786-790, 787f, 788f, 789£
P,-triose antiporter in, 783-784, 784f
in protein targeting, 1 103, 1 103f
in,
782-786, 782f-785f
photophosphorylation
posttranslational, 1 096f, 1097 proton gradient
in,
759-760, 781£
reductive pentose phosphate cycle in, 775
respiration-linked, 537
starch synthesis
of retinoblastoma protein, 472, 473£
79lf, 793
in,
783-784, 791-792,
in,
756
state transitions
of rhodopsin, 464£, 465
sucrose synthesis in, 244, 783-784, 792-794, 792£, 793£
in signaling, 439-446. See also signaling in bacteria, 457-458, 458f
in j3-adrenergic pathway, 423-431,
water in, 65 photosynthetic carbon reduction cycle, 774
424f,
428f-430f, 429t
growth hormones of, 330-331 , 33lf inumme response
in, 460, 46lf
leguminous, symbiotic relationship of nitrogen-fixing bacteria and, 856, 856f membrane components in, 372t membrane lipids of, 351f, 352
reversibility of, 226 in RNA processing, 1049
glycolate pathway in, 787-789, 787£ glycolysis in, 793, 793f
metabolite pools in, 799, 799f mitochondria in, alternative mechanism for NADH oxidation
in, 720, 722b
mitochondrial respiration in, 786 NADPH synthesis in, 812
photosynthetic organisms, diversity of, 761
organelles in, 774-775, 775£
photosynthetic reaction center, in purple
osmotic pressure in, 52
by j3-adrenergic receptor kinase, 431
bacteria, 376
by cAMP, 431-432
photosystem, 747
by cGMP, 445-446, 445!
photosystem
I/11, 752-754
pentose phosphate pathway in, 775, 785-786, 798 photochemical reaction centers in, acting in tandem, 752-754, 752f, 753£
by G-protein-coupled receptor kinases , 431
cytochrome b6j complex links of, 755-756, 755f
photorespiration in, 786-790, 787£, 788£, 789£
in IP3/diacylglycerol pathway, 432-433, 443f
integration of, in chloroplasts, 752-754, 752£
in JAK-STAT pathway, 443-444, 443f
suprarnolecular complex of, 754-755, 754f
photosynthesis in See photosynthesis signaling in, 359, 819, 906
multivalent adaptor proteins in, 446-449
phototrophs, 4f, 5
in PI-3K-PKB pathway, 441-442, 442f
phycobilin, 746
plant glyoxysome, J3 oxidation in, 663, 663f
vascular, 359
in plants, 458-460
phycobiliprotein, 746
plant peroxisome, J3 oxidation in, 663, 663£
by protein kinase A, 424f, 428-429, 429t, 431
phycobilisome, 747f
plant substances, biosynthesis of, from amino
of receptor tyrosine kinases, 439-443,
phycoerythrobilin, 745s
440f-443f
phylloquinone (vitamin K a , 361, 362s, 753
substrate-level, 537
phytanic acid, a oxidation of, 664-665, 665f
in sucrose synthesis, 793, 794f
phytol, 745-746
in transcription, 1032, 1 144
P,
phosphorylation potential
(LlGp),
502
phosphotyrosine phosphatases (PTPases), 449 phosphotyrosine-binding domains, 446-447
photochemical event, central, in photophosphorylation, 749-759, 750f-758f photochemical reaction centers, 747, 749-751
See phosphate, inorganic
pi (isoelectric point) , 73t, 80--8 1 , 90t determination of, 90, 90f pigments
See also photopigrnents
accessory, 747
in light absorption, 745f, 747
acids, 878, 878£ plasma, 921, 92lf plasma lipoproteins, transport of, 836-841, 839f plasma membrane, 3, 3f. See
also membrane(s)
bacterial, 6, 6f Ca2 + pump, 397-398, 397£ composition of, 370f, 372-373, 372t lipid rafts in, 384-386, 386£ lipopolysaccharides of, 256, 257f microdomains of, 384-386, 386£
bile, heme as source of, 875-876, 876f
neuronal, transport across, 920
bacterial types of, 749-751 , 750£, 751£
in color vision, 465, 465£
permeability of, 52
Fe-S, 751
light-absorbing, of Halobacterium
protein targeting to, 1 1 03-1 1 04, 1 103£
in plants, acting in tandem, 752-754, 752£, 753£
salinarum. 762
syndecan in, 253, 253f
Index
proline, 75, 75s, 698-699, 861
plasma proteins, 921
poly(A) tail, 1039-1040, 1039f
plasmalogens, 350, 35lf, 829, 830f
polyunsaturated fatty acids (PUFAs) , 345
in a helix, 1 19, 12lf
double bond of, 829, 830f
Pompe's disease, 599t
in ,8 sheet, 1 2 1 , 12lf
synthesis of, 829, 830f
Popj'ak, George, 835, 835f
in ,8 turns, 1 2 1 , 12lf
porins, 379, 708, 708f
biosynthesis of, 861-863, 862f
plasmid vectors, 307-308, 307f, 309f plasmids, 6, 307-308, 949, 950f
_1·31j
in collagen, 124f, 125, 126-127
,8-barrel structure of, 379, 379f, 391 porphobilinogen, 873
conversion of, to a-ketoglutarate, 698-699, 698f
plasmodesmata, 789-790
porphyrias, 873, 875b
properties of, 73t, 75
Plasrrwdiumjalciparum, inhibition of, 559
porphyrin(s), 873
antibiotic resistance-coding, 949
plastids, 774-753, 775f
proline-rich activation domains, 1143 prolyl 4-hydroxylase, 127
glycine as precursor of, 873, 874f
evolution of, 33, 34f
promoters, 1025-1028, 1 025f, 1027f, 103lf,
porphyrin ring, 154, 155f
1 1 16-1 1 1 8
plastocyanin, 753
Porter, Rodney, 172
plastoquinone, 362s
porters. See also transporter(s)
plastoquinone (PQ.J, 753
positive-inside rule, 379
platelet, 921, 92lf
posterior pituitary, 909, 909f
platelet-activating factor, 350, 35lf
posttranslational modifications, in protein
synthesis of, 829, 830f
synthesis, 1075t, 1076, 1096-1098
platelet-derived growth factor receptor, 449
expression vectors and, 3 1 2 , 312f specificity factors of, 1025, 1 1 17 proofreading
See also
protein synthesis
in transcription, 981-982, 98lf, 1024 in translation, 1081-1083, 1093-1094 pro-opiomelanocortin (PMOC), 906, 907f
PLC (phospholipase C), 432
potassium, blood levels of, 921
propionate, 657
plectonemic supercoiling, 961, 962f
potassium ion channels, 407--409, 408f, 451, 45lf
Propionibacterium jreudenreichii, in
PLP.
See pyridoxal phosphate (PLP)
fermentation, 551
ATP-gated, 924
P/0 ratio, 729
defective, diseases caused by, 412t
poisons
in glucose metabolism, 924, 924f
ion channels and, 410--412 translation inhibition by, 1098-1099
pol, 105 1 , 105lf
propionyl-CoA carboxylase, 657
structure of, 379f
proplastid, 775
extracellular fluid, 45lt
pol II. See RNA polymerase II and related
entries
Polanyi, Michael, 190
oxidation of, 657, 660f
in signaling, 451 , 45lf, 453--454 potassium ion concentration, in cytosol vs.
frameshifting and, 1072
propionyl-CoA, 657
potassium ion transport, Na +K+ ATPase in,
propranolol, 423s proproteins, 227 prostaglandin(s), 358f, 359. See also eicosanoid(s) synthesis of, 817, 818f
398-399, 398f
polar lipids, transport of, 830
potential energy, of proton-motive force, 720
prostaglandin E1, 431, 459s
polarity
PPARs (peroxisome proliferator-activated
prostaglandin G2, 8 1 7
of amino acids, 74
receptors), 660-661 , 936-937, 937f
prostaglandin H2, 817, 818f, 8 1 9
in embryonic development, 1147
ppGpp (guanosine tetraphosphate), 298, 298s
prostaglandin H2 synthase, 8 1 7
hydrophilicity/hydrophobicity and, 46--49, 46t,
PP, (inorganic pyrophosphatase), in plants vs.
prostaglandin inhibitors, 818-819, 8 1 8 s , 907
47f, 47t, 48f
prosthetic groups, 84, 85t, 184
animals, 792 PPI (peptide prolyl cis-trans isomerase), in protein
polio virus, icosahedral symmetry of, 140, 140f polyacrylamide gel electrophoresis (PAGE) , 88-89, 89f. See also electrophoresis
heme as, 154 posttranslational addition of, 184, 1098
folding, 144 PPK-1 (polyphosphate kinase-!), 5 1 1 PPK-2 (polyphosphate kinase-2), 5 1 1
protease(s) in amino acid sequencing, 95-96, 96t regulation of, 227
polyadenylate polymerase, 1 039f, 1040
Prader-Willi syndrome, 937
polycistronic mRNA, 284, 284f
pravastatin (Pravachol) , 842b-843
protease inhibitors, 218-219, 2 1 9f, 1052
polyclonal antibodies, 173
pRb (retinoblastoma protein) , 472, 473f
proteasomes, 3, 471, 1 1 08
polylinkers, 306f, 307
prebiotic chemistry, 30-31
protein(s), 14, 82.
polymerase chain reaction, in DNA fingerprinting,
prednisolone, 359, 359s
See also gene(s); specific proteins
prednisone, 359, 359s
allosteric, 162
polymerase chain reaction (PCR), 317, 318f
prenylation, 830f, 845
amino acid composition of, 84, 85t
polymorphic protein, 93
preproinsulin, 906, 907f
polynucleotide(s), 276
pre-replicative complexes (pre-RCs) , 991
320b-32lb
synthetic, in genetic code studies, 1067 polynucleotide kinase, 305t
preribosomal rRNA (pre-rRNA), processing of,
See also
amino acid(s) amphitropic, 375 body stores of, 927t bound water molecules in, 50-51, 5lf
1042, 1043f
polynucleotide phosphorylase, 1049, 1067
pre-steady state, 195
catalytic, 25
polypeptide(s), 82. See also peptide(s)
primary structure, of proteins, 92, 93-100
cellular concentration of, regulation of.
size of, 83
primary systemic amyloidosis, 146
vs. proteins, 82
primary transcript, 1034
polypeptide chain elongation, in protein synthesis, 1076, 1091-1 094
See also protein synthesis,
elongation in polyphosphate, inorganic, 502t, 5 1 1 , 5 1 1 s as phosphoryl donor, 502t, 5 1 1
See gene regulation conformation of, 113-1 1 4 conjugated, 84, 85t
splicing of, 1 038f primases, 985, 986t, 987-988, 989t
crude extract of, 85
primer
culling of, 259
in DNA replication, 980f, 98lf, 984, 1051
degradation of, 1 107-1109
in RNA replication, 1051
denaturation of, 140-142, 141-142, 14lf
polyphosphate kinase-! (PPK-1 ) , 5 1 1
primer terminus, 980, 98lf
enzyme. See enzyme(s)
polyphosphate kinase-2 (PPK-2) , 5 1 1
priming, 605, 605f
enzyme degradation of, in amino acid catabolism,
polysaccharide(s), 14, 235, 244-252.
See also
carbohydrate(s) in cell communication, 252-257, 253f classification of, 244-245, 25lt
of glycogen synthase kinase 3 phosphorylation,
674-677, 676f evolution of, 31-32, 3lf, 136-138.
605, 605f
See also evolution
primosome, 987 replication restart, 1009
evolutionary significance of, 1058
conformations of, 248, 248f
prion diseases, 147-148, 148f, 149f
fibrous, 123-128. See also fibrous proteins
in extracellular matrix, 249
prion protein (PrP), 148
flavoprotein, 519-520, 5 1 9-520, 520f, 520t
folding of, 24 7-248, 248f
probes
fuel storage in, 244-252 functions of, 245-247, 25lt, 252
folding of
See protein folding
fluorescent, 434b-436b
functional classification of, 35
nucleic acid, 311, 3 l lf
functions of.
See protein function
fusion, 313, 387
glycoconjugate, 252-257, 253f
procarboxypeptidase A, 676
heteropolysaccharides, 249-251
procarboxypeptidase B, 676
G. See G protein(s)
homopolysaccharides, 244-248
processivity, of DNA polymerases, 980
globular, 123, 129-136.
hydrolysis of, 246, 543, 552f
prochiral molecules, 629
molecular size of, 25lt
proenzymes, 227
as glucose source, 927t, 928
molecular weight of, 245
progesterone, synthesis of, 844-845, 844f
half-life of, 572, 572t, 1 107
repeating unit in, 25lt
programmed cell death, 477--478, 478L See
homologous, 34, 104
structure of, 244-245, 245f, 246f, 247-248, 248f, 249f, 25lt weak interactions in, 24 7-248
See also
globular proteins
immune system, 170-175
also apoptosis
inhibitory, in ATP hydrolysis during ischemia,
prohormones, 906 proinsulin, 906, 907f
poly(A) site choice, 1040
prokaryotes, 3. See
also bacteria
polysomes, 1095, 1096f
proliferating cell nuclear antigen (PCNA), 992
733, 733f intermediate filament, 123-124 iron-sulfur, 7 1 1
! . 1-32
Index
L
protein(s)
motifs (folds) in, 131-138, 1 36f-137f
(continued)
Fe-S centers of, 7 1 1 f isoelectric point of, 73t, 80-81 , 90t determination of, 90, 90f membrane
See membrane proteins
protein structure, 1 1 3-14S
oligosaccharides and, 256
a helix and, 1 17-1 19, 1 1 Sf, 120f, 121
patterns in, 136-13S, 136f-137f
amino acid sequences and, 2Sf, 29, 102
protein disulfide isomerase in, 144
analysis of, 93--!00. See
also amino acid
sequencing
representation of, 130f
misfolded, 1 45-148
rules for, 135-136
f3 conformation and, 121-122, 121f, 122£
in mitochondrial electron-transfer chain, 713t
secondary structures in, 131-136,
classification of, 136-13S, 136f-137f
molecular weight of, 83t
covalent, 93-100
135f-137f, 14S
estimation of, 89, 90f
database for, 1 1 3£, 136-138, 136f-137f
steps in, 142-143, 142f
motor, 1 7&-179, 176f-179f
thermodynamics of, 143, 143f
multifunctional, 664
protein function, 71f, 153--179
multimeric, 138
See also protein
free energy of, 1 1 4 functional correlates of, 1 13, 123, 129, 140-141 , 324-325
ligand interactions
multisubunit, 83t, 84
amino acid sequence and, 93
glycoproteins and, 256
naming conventions for, 976
analysis of, 324-329
helical symmetry in, 139, 140, 140f
native, 29, 1 14
comparative genomics in, 325, 326,
nuclear, targeting of, 1 104, 1 105f
key concepts for, 1 13 ligand binding and, 158
-32S, 328f
oligomeric, 83t, 84, 138
DNA microarrays in, 325-326, 327f
orthologous, 34, 104
epitope tagging in, 316f, 317, 32S
motifs (folds) in, 131-13S, 136f-137f. See
overview of, 71
gene inactivation in, 324
oxygen-binding, 154-170
protein chips in, 32S
paralogous, 34
protein tags in, 32S
phosphoproteins, 85t
two-dimensional gel electrophoresis in, 325
overview of, 1 13-1 1 7
phosphorylation and dephosphorylation
yeast two-hybrid analysis in, 329, 329f
primary, 92f, 93-100
of, 573f
catalytic
plasma, 921 polypeptide chains in, 83--84, 83t
See also
polypeptide(s) posttranslational processing of, 1075t, 1076, 1096-109S
See also protein synthesis; protein
synthesis,
See enzyme(s)
133f, 134f
quaternary, 92f, 123, 138-- 1 40, 139f, 140£ Ramachandran plots for, 1 17, 1 1 7f, 122f
expression patterns and, 324-325
representations of, 130f
levels of, 324
rotational symmetry in, 139-140, 139f
molecular, 324, 32S-329
secondary, 92f, 1 1 7-122, 1 1 8£, 120f-122f stability of, 1 14-1 1 5 supersecondary, 131-13S
proteolytic activation of, 227, 227f
principles of, 153-154
tertiary, 92f, 123-13S . See
protomeric, 138
structural correlates of, 1 13, 123, 129,
three-dimensional, 29, 29f, 1 1 3-148
regulatory
DNA-binding domains of, 1 1 2 1-1124
also tertiary structure
weak interactions and, 50-5 1 , 5lf, 1 14-115
324-325
See also gene regulation
See
also secondary structure
multiple, 624b-625b phenotypic, 324
RAG, 1015-1016, 1016f
See
also quaternary structure
conformational changes and, 154
noncatalytic, 154
proproteins, 227
nuclear magnetic resonance studies of, 1 33-- 1 34, oligosaccharides and, 256
cellular, 324, 325-329
polymorphic, 93
also
protein folding
protein kinase(s), 224.
See also specific types
AMP-activated, 576
x-ray diffraction studies of, 129, 132b-133b, 132f-133f
renaturation of, 141f
autoinhibition of, 447, 447f
protein superfarnilies, 138
respiratory, 739t
f3-adrenergic receptor, 430f, 431
protein synthesis, !00-102, lOlf, 102t, 107&-1099
mitochondrial gene encoding of, 739t ribosomal, 1076t
Ca2+/calmodulin-dependent, 437, 437t cAMP-dependent
synthesis of, rRNA synthesis and, 1 1 3 1-1132, 1 1 3 1f, 1 1 32f
See protein kinase A (PKA)
aminoacyl-tRNA binding in, sites of, 10S9, 10S9f
cGMP-dependent, 445-446
aminoacyl-tRNA formation in, 1081-1 0S4,
consensus sequences for, 225-226, 226t
scaffold, in chromatin, 96S, 96Sf
cyclin-dependent, 469-473, 470f, 47lf
separation/purification of, 8&-92
G protein-coupled, 431
dialysis in, 85
in,
85-8S, S6f, S8t
J OS2f-1084f
in cell cycle regulation, 469-4 73
Rieske iron-sulfur, 7 1 1 , 716f
column chromatography
amino acid activation in, 1075, 1075t, IOSJ-1084,
His-specific, 457, 458f
I OS2f-1 084f codons in, 1066-1067, 1068--1074
See also codons elongation in, 1075t, 1076, 1091-1094,
phosphorylation by, 224-226, 441, 44lf
1 091- 1094
electrophoresis in, 88-89, 88-90, S9f-91f
receptorlike, in plants, 460, 460, 46lf
aminoacyl-tRNA binding in, 1091
for enzymes, SSt, 91-92, 91f
in signaling, 429t, 431 , 437, 437t, 439-446,
fractionation in, 85-8S, S6f
446-449, 447f
isoelectric focusing in, 90, 90f
substrate specificity of, 225, 226t
protocols for, 88t signaling
See signaling proteins See protein structure
structure of synthesis of transport of
transporter(s)
insulin receptor as prototype of, 439-443, 440f-443f
in rafts, 449
as universal electron carrier, 5 1 6
protein kinase A (PKA), 428
See protein-ligand interactions
protein catabolism, in cellular respiration, 616f protein chips, 32S protein disulfide isomerase (PDI), in protein folding, 144 protein domains, 135
See also
assisted, 143-145, 144f, 145f chaperones in, 143-144, 144f, 145f chaperonins in, 144, 144f, 145f domains and, 135, 135f energy for, 1 14-1 15 errors in, 145-14S in globular proteins, 124-125, 129-135, 130f, glycoproteins and, 256 143
428f, 429f
IMet-tRNAIMet in, 10SS frarneshifting in, 1072 inhibition of, 1 09S-1 099 initiation of, 1075t, 1076, 1 088-1091 in bacteria, 1088-- 1OS9, 1 089f in eukaryotes, I OS9-1091, 1 090f initiation complex in, 1089, 1089£, 1090£ initiation factors in, 109lt, 1 144 Shine-Dalgarno sequences in, 1089-1090, 1090f mRNA degradation in, 1096 overview of, 1075-1076, 1075t polypeptide release in, 1 075t, 1076
enzymes/proteins regulated by, 42S, 429t, 431
polysomes in, 1095, 1096£
inactivation of, 424f, 42S, 428f
posttranslational modifications in, 1075t,
protein kinase B (PKB)
tertiary structure
131-135
AKAPs and, 431-432
measurement of, by FRET, 434b-436b
protein families, 138 protein folding, 29, 29f, 1075t, 1076
activation of, 42S, 428f, 429f, 441, 4245 in f3-adrenergic pathway, 424, 428-429,
Protein Data Bank (PDB), 1 1 3f, 129
in,
evolutionary significance of, 1 078b
442, 449
uncoupling (thermogenin), 736
molten globule
tyrosine-specific, 439, 439-443, 440f-443f
platelet-derived growth factor receptor as,
trifunctional, 654
protein binding.
errors in, 1081-10S3
442, 449
See protein synthesis See membrane transport;
peptide bond formation in, 109 1 , 1092f
in transcription, 1032 epidermal growth factor receptor as,
in supramolecular complexes, 29
direction of, 1OSS, 1 088f elongation factors in, 1091
activation of, 441, 442f in signaling, 441-442, 442f protein kinase C (PKC), 357-358, 433 activation of, 357-358 protein kinase G (PKG), 445-446
protein kinases, in cancer treatment, 475b-476b
protein moonlighting, 624b--{)25b
1096-1098, 1976 amino acid modifications, 1097, 1 097f amino-terminaVcarboxyl-terminal modification, 1096 carbohydrate side chain attachment, loss of signal sequences, 1096-1097 prosthetic group
addition,
1098
proteolytic processing, 1098 proofreading in, 1 0Sl-1083, 1 093-1094
protein phosphatases, 224-226
protein folding in, J075t, 1076, 1096
protein sequences. See amino acid sequences;
rate of, 142, 1065
nucleic acid sequences protein sorting, 1 103- 1 1 04
I097
isoprenyl group addition, 1097-109S, ! 097f
regulation of
See gene regulation
ribosome as site of, 1 06&-1 066, 1076
ribozyme-catalyzed, 3lf, 32, 1056-1059, 1078b
proto-oncogenes, 473-474, 474f
RNA world hypothesis and, 3lf, 32, 1057-1059
protoporphyrin, 154, 873
rRNA synthesis and, 1 131-1 132, 1 13lf, 1132f
proximal His, 168
energy remaining, 531
simultaneous, 1095, 1096f
PRPP (5-phosphoribosyl-1 -pyrophosphate) , 861
fate of, 530, 530f
in glyceroneogenesis, 82lf, 823f
in glycolysis, 529f, 530, 922, 923f, 925, 926f
steps in, 1075-1076, 1075t
Prusiner, Stanley, 148
hepatic metabolism of, 915, 915f
termination of, 1075t, 1076, 1 094, 1095f
pseudoinosine, 274s
in lactic acid fermentation, 546-54 7
thermodynamics of, 1095
pseudouridine, 1045
oxidation of, to acetyl-GoA and C02,
transcription coupled with, 1095-1096, 1096f
psicose, 237s
'I' angle,
transcriptional. See transcription translational.
See translation
616-617, 6 1 7
secondary structures and, 1 2 1 , 122f
phosphoenolpyruvate synthesis from, 553-556, 554f
PTB domains, 447
translocation in, 1091-1093, 1093f protein tagging, 3 1 6-317, 316f, 328 protein targeting, 1 100-1 109
PTEN, 442
sequential reactions in gluconeogenesis with,
P-type ATPases, 396-397, 397f, 449 P-type Ca2 + pump, 397-398, 397f
synthesis of, 915, 915f
to chloroplasts, 1 104
puffer fish poisoning, 410, 412s
in endoplasmic reticulum, 1 1 00-1 1 0 1 , 1 10lf
pulsed field gel electrophoresis, 310
glycosylation in, 1 101-1 104, 1 103f
556-557, 556t pyruvate carboxylase, 553-554, 575t, 632, 634s biotin in, 554, 554f, 633, 634f, 635f reaction mechanism of, 634f
in cloning, 310
in Golgi complex, 1 102-1 103, 1 103f
pumilio, 1 149-1 150, l l49f
lectins in, 260-261
purine(s), 272
to lysosomes, 1 103-1104, 1 103f
pyruvate decarboxylase, 547, 547, 55lt pyruvate dehydrogenase, 551t, 618 pyruvate dehydrogenase complex, 616
biosynthesis of, 869-872, 87lf
to mitochondria, 1 104
degradation of, 892-893, 892f
to nucleus, 1 104, 1 1 05f
ring atoms of, 883f
peptide translocation complex in, 1101, 1 10 l f t o plasma membrane, 1 103-1 1 04, 1 103f receptor-mediated endocytosis in, 1 1 06-1 107
purine bases. See
acetyl-GoA produced by, 635-636, 636f coenzymes of, 617, 6 1 7f
also base(s), nucleotide/
in decarboxylation and dehydrogenation of pyruvate, 619, 634f
nucleic acid anti form of, 280-281, 280f
enzymes of, 618-619
signal recognition particle in, 1101, 1 10lf
Chargaffs rules for, 278
reaction catalyzed by, 616f
transport mechanisms in, 1 102-1 103, 1 103f
chemical properties of, 276-277
See also membrane transport
structure of, 618f pyruvate kinase, 538, 575t
deamination of, 289-290, 290f
protein turnover, 572
hydrogen bonds of, 277, 277f
protein tyrosine kinases. See tyrosine kinases
loss of, 290, 290f
protein-ligand interactions, 153-154
nucleic acid, 272-274, 272t, 273s, 274s
ATP inhibition of, 579-580, 589f regulation of, 925
allosteric, 162, 162f
nucleotide, 271-274, 272f-274f
binding equilibrium in, 156
recycled, salvage pathway in, 893
binding sites for, 153, 162, 170
structure of, 9s, 271-274, 272f-274f, 272t,
complementary, 170-175
pyruvate phosphate dikinase, in C4 pathway, 789, 789f PYY3_36, 932f, 937
276-277
q
conformational changes in, 154, 16lf, 162, 162f
syn form of, 280-281 , 280f
cooperative binding in, 160-165, 162f
tautomeric forms of, 276, 276f
Q (coenzyme Q) , 710, 710s
weak interactions of, 277, 277f
Q (mass-action ratio) , 493
enzyme.
See enzyme(s)
graphical representations of, 1 56f, 157f heterotropic, 162
in carbohydrate metabolism, 574, 575t
purine nucleotides
Q cycle, 716, 7 1 7f
biosynthesis of
homotropic, 162
de novo, 883-885, 884f, 886f
in immune system, 170-175
regulation of, 885f, 886-887
induced fit and, 153
redox reactions of, 716 quadruplex DNA, 282 quantum, 744
catabolism of, 892, 892f
ligand concentration and, 156-157
puromycin, 1098
models of
purple bacteria, photosynthetic reaction
MWC (concerted) , 165, 165f
quaternary structure
sequential, 165, 165f
of proteins, 92f, 123, 138-140, 139f, 140f
pyranoses, 239, 239f
modulators in, 162
rotational symmetry and, 139-140,
conformations of, 239, 239f
of oxygen-binding proteins, 154-- 1 70
See also
hemoglobin-oxygen binding
helical symmetry and, 139 of a-keratin, 123-124, 124f
center in, 376
139f, 140f
pyridine nucleotides, 517 pyridoxal phosphate (PLP), 677, 695f
principles of, 153-154
in glycogen phosphorylase reaction, 596
protein structure and, 158
in transfer of a-amino groups to
quantitative descriptions of, 155-158, 157f, 162-165
R (gas constant) , 49lt
a-ketoglutarate, 677, 677f, 679f pyrimidine(s), 272
R groups, 72, 73t, 74--77
regulation of, 154
catabolism of, 892, 893f
aromatic, 73t, 75-76, 75f
reversibility of, 153
degradation of, 892-893, 893f
ionization behavior of, 83
specificity of, 153
pyrimidine bases, 272, 272f
protein-protein interactions, analytic techniques for, 325-329
See also base(s),
recycled, salvage pathway in, 893
proteoglycan aggregates, 254
pK. of, 73t, 83 polar uncharged, 73t, 75f, 77
pyrimidine dimers
proteoglycans, 250, 252-255, 253f
photolyase repair of, 998-999, 999f
proteolysis, 1 107-1109, 1 108f
radiation-induced formation of, 290, 29lf
ATP-dependent, 1 107
886f, 888f
ubiquitin-dependent, 1 107-1109, 1 1 08f proteolytic enzymes, regulation of, 227, 227f proteome, 14, 100, 324, 572
ionizing, DNA damage from, 290 ultraviolet, absorption of, by DNA, 287-288 chemical changes due to, 290, 29l f radicals, 496
pyrophosphoryl transfer, 508f
prothrombin, 227, 362
pyrrolysine, 1 085b
protomers, 84, 138
pyruvate, 500s, 537s, 538
b6j complex, 755f
proton gradient in ATP synthesis, 724, 725f, 726, 726f conservation of, in mitochondrial electron transfer reactions, 718-720, 720f in electron flow and phosphorylation, 759-760 proton hopping, 5 1 , 5lf, 54f, 55 proton pumps. See ATPase(s); transporter(s) proton transfer, in acid-base catalysis, 192-193, 193f proton-motive force, 720, 720f
Racker, Efraim, 725, 725f electromagnetic, 7 44, 744f
pyrophosphatase, inorganic, 508f pyrophosphoryl group, ATP and, 508
applications of, 335-338
racemic mixture, 17 radiation
regulation of, 887, 887f in plants vs. animals, 792
proteomics, 303, 324
proton flow, through cytochrome
positively charged (basic) , 73t, 75f, 77
pyrimidine nucleotides, biosynthesis of, 886-887,
in protein activation, 227, 227f
negatively charged (acidic) , 73t, 75f, 77 nonpolar aliphatic, 73t, 74-75, 75f
nucleotide/nucleic acid
free, 498, 499f radioimmunoassay (RIA) , 903-904, 904f
alternate fates for, 590, 590f
Raf-1, 440, 44lf
in amino acid biosynthesis, 865, 866f-867f
rafts. See lipid rafts; membrane rafts
amino acid degradation to, 692-694, 692f,
RAG proteins, 1015-1016, 1 0 1 6f Ramachandran plots, 117, 1 1 7f, 122f
693f, 694t under anaerobic conditions, 547-551 .
See also
fermentation conversion of to phosphoenolpyruvate in gluconeogenesis, 553-557, 553t, 554f, 555f decarboxylation and dehydrogenation of, 619, 619f
bacterial flagella rotation by, 739, 739f
glucogenic amino acids in, 557t
energizes active transport, 730-731 , 730f
in gluconeogenesis, 927f, 928
Ran GTPase, 1 104 rancidity, 348 Ras, 425b, 440, 44lf mutations in, 474
ras oncogene, 4 74, 477 Ras protein, binary switches in, 425b-427b
rate constant (k), 188
rate equation, 188, 196-197, 197f
1-34
I ndex
platelet-derived growth factor receptor as,
rate-limiting step, 187 rational drug design, 204 Rayment, Ivan, 176
replicative transposition, 1014, 1 0 1 4f
in rafts, 449
Rb gene, 474-475
replication restart primosome, 1009 replicative forms, 949
442, 449 receptor-ligand binding, 421b
replicators, 991
R2C2 complex of protein kinase, 428, 428f
equilibrium constant for, 421b
replisomes, 984, 989
reaction. See chemical reaction(s)
saturation in, 421 b
repressible gene products, 1 1 16
reaction centers, chlorophyll funneled to absorbed
Scatchard analysis for, 420, 421b
energy to, by excitation transfer, 747-749, 748f
in signaling, 4 1 9-420, 420f, 421b
reaction coordinate diagram, 23f, 24, 186-187, 187f
receptorlike kinases, in plants, 460, 461f
reaction equilibria, 186-188
receptor-mediated endocytosis, 840-841 , 840f,
reaction intermediates, 187
See also specific enzymes reactive oxygen species (ROS), 715, 720-72 1 , 72lf hypoxia and, 733-734, 734f
1 140-1 1 4 1 , 1 144-1 145
recognition sequences, 305-306, 305t
DNA-binding motif of, 1 122, 1 123f
recombinant DNA, 304
SOS response and, 1 130-1 1 3 1
recombinant DNA technology, 304-325
transcription activators a s , 1 140- 1 1 4 1 translational, 1131-1 1 32, 1 131f,
applications of
reading frame, 1067, 1 067f
in eukaryotic gene regulation, 1131-1132, Lac, 1029, 1 122, 1 126
1 106- 1 1 07, 1 1 06f
reaction mechanisms, 208-209, 208f-209f, 209f.
repression, 1 1 16 repressors, 1029, 1 1 17, 1 1 18f
agricultural, 330-332
1 144-1145, 1 148
frameshifting and, 1072
legal, 3 1 9-321
Reshef, Lea, 822
open, 1069
medical, 335-338
respirasomes, 718
RecA, 1007, 1008f
pharmaceutical, 335-337 cloning and, 304-31 4
in SOS response, 1 130- 1 1 3 1
See also cloning
respiration, 615 alternative pathways of, in plants, 722b
RecBCD emyme, 1007, 1007f
DNA libraries and, 3 1 5-31 7 , 3 1 5f, 3 1 6f
bicarbonate buffer system in, 62--{33
receptor(s)
genome sequencing and, 3 1 7-324
cellular, 615
acetylcholine.
See acetylcholine receptor
Southern blotting, 319, 319f
adhesion, 422, 422f
recombinase, 1 0 1 0-1 0 1 1 , 1 0 1 l f
adrenergic, 423
recombination. See DNA recombination
affinity for, 419-420, 420f
homologous genetic, 1003-1005
ANF, 444
recombination signal sequences, 1015-1016, 1 0 1 6f
bacterial chemoreceptor, 457-458
recombinational DNA repair, 1004-1009, 1 006f,
J3-adrenergic, 423-431 , 457-458
1009-1010, 1012-1013, 10 12f, 1013f
stages in, 615, 6 1 6f mitochondrial electron transfer in, 708-741 . See
also electron-transfer reactions, mitochondrial respiratory proteins, mitochondrial genes encoding, 739t response coefficient (R), 579b-580b, 581
desensitization of, 430-431 , 430f
recoverin, 465
response elements, 571
in rafts, 449
red blood cells See erythrocytes red dichromats, 465
response regulator, 458
structure of, 424, 424f cannabinoid, 442 definition of, 170. See
red muscle, 9 1 8
restriction endonucleases, 304-307, 304f, 305t, 306f
red-anomalous trichromats, 465
DNA library creation, 3 1 5
desensitization of, 420, 420, 420f, 430-43 1
redox pair. See conjugate redox pair
recognition sequences for, 305-306, 305t
epidermal growth factor, 449
redox reactions. See oxidation-reduction
also specific types
erythropoietin, 443, 443f ethylene, 460, 460f
reducing end,
Fas, 477f, 478
reducing equivalent, 514, 710
G protein-coupled. See G protein-coupled recep-
reducing sugars, 241, 24lf
tor(s)
243
reduction potential
ghrelin, 932f
and affinity for electrons, 514-515,
glycine, 4 1 0
514f, 515t
guanylin, 446
standard
type I, 305 type II, 305, 305t
reactions
See standard reduction potential
type III, 305 restriction fragment length polymorphisms (RFLPs) , in DNA fingerprinting, 319 restriction-modification system, 292, 305 reticulin, 261 reticulocytes, translational regulation
in,
1145
hormone, 422, 422f, 904-906, 1 1 43-1 144, 1 144f
reductive pentose phosphate cycle, 775
insulin, 439-443, 440f-443f
Refsurn's disease, 665
1 1-cis-retinal, 15s, 463, 465
LDL, 840-841 , 840f
regulated gene expression, 1116
all-trans-retinal, 15s
leptin, 931, 933
regulators of G protein signaling, 426b
retinal cones, 462-465, 462f
LRP, 841
regulatory emymes, 220-227
retinal, 361, 361s, 463, 465
in color vision, 465, 465f
melanocortin, 932
allosteric, 220-222, 221f-222f
retinal rods, 462-465, 462f
neurotransmitter, 453-454
complex, 227
retinoblastoma, 474-475
nicotinic acetylcholine, 410
covalent modification of, 220, 223f, 224-227,
defective, 412t
226f, 226t, 227f
open/closed conformation of, 453, 454f
functions of, 220, 221-222
retinoblastoma protein (pRb), 472, 473f retinoic acid, 360, 361s, 908-909 retinoid hormones, 906t, 908-909
in signaling, 453, 454f
kinetics of, 222, 222f
retinol (vitamin A), 361, 361s, 908-909
synaptic aggregation of, 384
proteolytic cleavage and, 226-227, 227f
retrohorning, 1053, 1054f
NPY, 932
unique properties of, 220
nuclear, 422
regulatory proteins. See also gene regulation and
specific proteins, e g promoters
olfactory, 465-467 peroxisome proliferator-activated, 936-937, 936f
DNA-binding domains of, 1 121-1124
platelet-derived growth factor, 449
regulatory sequences, 948, 948f
rhodopsin, 463, 465
regulons, 1127
as signal amplifier, 905
relative molecular mass (M,), 14b
retrotransposons, 1 052-1053, 1 053f retroviral vectors, 333, 334f retroviruses, 218, 1050-1053, 1 050f antiviral agents for, 2 1 8-219 evolutionary significance of, 1 052-1053
HN as,
218, 1052, 1 052f
oncogenic, 1051-1052, 1052f
steroid (nuclear) , 422, 422f, 905
relaxed-state DNA, 954
retrovirus-like transposons, 952f
sweet taste, 467
release factors, 1076, 1094-1095, 1095f
reverse cholesterol transport, 838f, 840
T-cell, 170
Relema, 259-260, 260s
reverse transcriptase, 305t, 1050-1051, 1050f
receptor agonists, 423
renaturation, of proteins, 141-142, 141f
receptor antagonists, 423
repetitive DNA, 952f, 953
receptor channels, ligand-gated. See ligand-gated
replication, 945. See also DNA replication;
receptor channels
RNA replication
receptor emymes, 422, 422f, 439-446
HN,
1052, !052f
reversible inhibitor, 201-203, 201f RF-1 , 1094, 1 095f RF-2, 1 094, 1 095f
replication factor A (RFA) , 992
RFA (replication factor A), 992
guanylyl cyclase, 445-446, 445f
replication factor C (RFC), 992
RFC (replication factor C), 992
in signaling, 422, 422f
replication fork, 978, 979f, 987-989,
RFLPs (restriction fragment length
tyrosine kinase, 439-444, 44lf with tyrosine kinase activity
See receptor
tyrosine kinases receptor guanylyl cylases, 422
987f, 988f
rhamnose, 240s
stalled, 989-99 1 , 990f
Rhodobacter sphaeroides, 749, 751£ Rhodopseudomonas viridis, 749, 75l f
in eukaryotes, 992
receptor His kinase, 457, 458f
damage from, 1 00 1 , 1001f
receptor potential, 467
repair of, 1 004-1007, 1006f, 1012f, 1013, 1013f.
receptor tyrosine kinases, 422, 439-444 epidermal growth factor receptor as, 442, 449 insulin receptor as prototype of, 439-443, 440f-443f
polymorphisms), 319
in bacteria, 978, 979f, 987-989, 987f, 988f
See also DNA repair replication origin
photoreaction center of, 376, 75lf rhodopsin, 463, 463f, 464f, 465 absorption spectra of, 465, 465f activation of, 463
in bacteria, 978, 979f
phosphorylation of, 464f, 465
in eukaryotes, 991-992
structure of, 463f
I 058-- 1059
self-generated, 31-32, 3lf
rhodopsin kinase, 465
parasitic,
rtbofuranose, 272, 273f
phosphodiester linkages in, 274-275, 275f
rtbonuclease
postranslational processing of
See RNA processing
telomerases
in,
1053--1055, 1055f
RNA transcripts
denaturation of, 14�142, 141f
preribosomal, processing of, 1042, 1043f
complex, 1040, 1 042f
renaturation of, 141-142, 141f
as primordial catalyst, 3lf, 32
primary, 1034
structure of, 131t
rtbosomal
splicing in,
See rRNA (ribosomal RNA)
I 038f
rtbonucleic acid (RNA) . See RNA
SELEX analysis of, 1058b, 1078b
processing of
ribonucleoside 3' -cyclic monophosphates, 274
self-replicating, 31-32, 31£, 1056-- 1 059
of unknown function, 106lb
rtbonucleoside 3' -monophosphates, 274
small, 1 133
RNA tumor viruses, 1051-1052, 1052f
rtbonucleotide(s), 272t, 273-274, 273f
small interfering, 1145
RNA viruses, 1056
See also
nucleotide(s)
small nuclear, 1037, 1045, 1061b
as precursors of deoxyrtbonucleotides, 888-890, 888f, 889f, 910f reduction of, 888-890, 888f
oncogenic, 1051-1052
small nucleolar, 1043, 1044f, 1045, 1061b, 1 146
RNA world hypothesis, 3 1 £, 32, 1057-1059
small temporal, 1145
RNA-dependent DNA polymerases, 1050-1051' 1 050f
splicing of, 1034, 1 034f, 1036-- 1 039, 1 036f-1038f
rtbonucleotide reductase, 870, 888, 888f
See RNA processing
RNA-dependent RNA polymerases, 1056
See also splicing
proposed mechanism of, 888-89 8 , 889f
structure of, 284-286, 284f-286f
RNA-DNA hybrtds, denaturation of, 288
regulation of, 888, 910f
synthesis of, 284, 1022-1030
RNase P, 285f, 1043f, 1045, 1 048
ribose, 9s, 236s, 237s
See also
Roberts, Richard,
transcrtption
conformations of, 272
I 035
transfer. See tRNA (transfer RNA)
rod cells, 462-465, 462f
ribose 5-phosphate, 780, 780f, 781£
translation of, 29f
Rodbell, Martin, 424, 425, 425f, 435f
ribose 5-phosphate isomerase, 780f
TUF, 1061b
ROS (reactive oxygen species), 715
rtbose phosphate pyrophosphokinase, 861
turnover of,
ribosomal (r) proteins, 1076t, 1 1 3 1-1 132, 1 131f
weak interactions in, 277, 277f, 284
synthesis of, rRNA synthesis and, 1 13 1-1 132, 1 132f ribosomal RNA. See rRNA (ribosomal RNA) ribosomes, 3, 1076-- 1 079 aminoacyl-tRNA binding sites on, 1089, 1 089f
I 034
rosettes, in cellulose, 795, 795f rosiglitazone (Avandia), 808s, 824, 936
RNA aptamers, 1058b
Rossman fold, 518, 518f
RNA enzymes, 1033-1 034, 1036-1039,
rotational catalysis, 728-729
1046f-1048f, 1047-1049, 1056
in ATP synthesis, 728--729, 729f, 730f
RNA interference (RNAi) , 1 145-1 146, 1 146f
rotational symmetry, 139-140, 139f, 140f
RNA polymerase(s) , 986t
Rous, F Peyton, 1 052
I 052,
I 052f
bacterial, 5f, 1076-1079, 1077f
DNA-dependent, 1022-1023, 1023f, 1 1 16-1 1 1 7
Rous sarcoma virus,
discovery of, 1065--1 066
promoter binding of, 1025-1 028, 1027f
rRNA (ribosomal RNA), 272, 1021, 1076-1078,
eukaryotic, 6f, 1079
RNA-dependent, 1056
1 076t_ See also RNA
proteins in, 1 076t
u subunit of, 1024, 1024f, 1 1 17
preribosomal, processing of, 1042-1044, 1043f
recycling of, 1095
specificity factors in, 1024, 1024f, 1 1 1 7
processing of, 1042-1044
as site of protein synthesis, 1065-- 1 066,
structure of, 1023s
structure of, 1076--1 078, 1076t, 1079f
in transcription, 1022-1023, 1023f, 1 1 16-1 1 1 7
synthesis of, protein synthesis and,
1076--1 079 structure of, 1076-- 1 079, 1077f
in bacteria, 1022, 1023f
subunits of, 1 076-1079, 1077, 1077f, 1079
in eukaryotes, 1030-1033, 1030f, 1031f, 1 032t RNA polymerase holoenzyme, 1024, 1025f
synthesis of, rRNA synthesis and,
RNA polymerase
1 13 1-1 132, 1 132f riboswitches, 1 133-1 134 ribothymidine, 273f
carboxyl-terminal domain of, 1030, 1031£
ribozymes, 1034, 1046f, 1047-1049, 1078b
promoter binding of, 1 1 38-- 1 1 39 regulation of,
self-replicating, 1056--1059, 1057f ribulose, 237s ribulose 1 ,5-bisphosphate, 775, 782, 782f oxygen incorporation in, 786, 787f regeneration of, 778--780, 780f-782f, 782 ribulose 1 ,5-bisphosphate carboxylase/oxygenase (rubisco), 776-778.
I 032-1033
structure of, I 030, I 03lf
1057-1059
See also rubisco
ribulose 5-phosphate, 560s, 780, 780f-782f ribulose 5-phosphate kinase, light activation of,
167, 168f RU486, 456, 456s rubisco, 776-778 activation of, 778, 784-785
in c3 plants, 789 in c4 plants, 789-790,
TATA box and, 1030, 1030f
in CAM plants, 790
transcription factors and, 103�1031 , 1031f
catalytic activity of
RNA polymerase lll, 1030 1025f, 1028f
with oxygen substrate, 786--787, 787f evolutionary significance of, 786--787
RNA probe, 3 1 1 , 3 1 1£
in photorespiration, 786--787
RNA processing, 1033-1049
reaction mechanism, 777f
5' cap in, 1034-1035, 1066f
in bacteria,
1033-1034, 1035, 1042, 1043f
regulation of, 778, 785 structure of, 776, 776f rubisco activase, 778
ricin, 1099
editing in, 1014, 1073
RuvA protein, 1007
rickets, 359, 360f
enzymatic, 1033-1034, 1036-- 1 039, 1046f-1048f,
RuvB protein, 1007
1047-1049
Rieske iron-sulfur protein, 711, 716f
in eukaryotes, 1033-1034, 1035-1036, 1035f,
rifampicin, 1033
1039--1040, 1043, 1043f
Rinaldo, Piero, 700b RNA, 14
789f
with C02 substrate, 776--778, 776f-778f
RNA polymerase, u subunit of, 1025-1028,
differential, 1040, 104lf
785, 785f
R-state, in hemoglobin-oxygen binding, 160, 16lf,
I, 1030
RNA polymerase II, 1030-1033, 1030f
RNA world hypothesis and, 31f, 32,
1 13 1-1 132, 1 132f RS system of stereochemical nomenclature, 1 7 , 74
of miRNA, 1 045, 1046f
See also nucleic acids
s
S See entropy (S)
5' cap of, 1034-1035, 1066f
of mRNA, 1033-1040
26S proteasome, 1108, 1 108f
base pairs in, 277, 277f, 284-285,
polyadenylate polymerase in, 1039f, 1040
SAA protein, 146-- 1 4 7
polynucleotide phosphorylase in, 1049
saccharides. See carbohydrate(s); sugar(s) Saccharomyces cerevisiae. See yeast
285f, 286f catalytic, 31f, 32, 1033-1 034, 1 036-1039, 1 046f-1048f, 1047-1049, 1056-1059, 1078b in cis/trans, 1 132-1134 degradation of, reverse transcriptase 1050-1051
in,
development, SELEX method in, 1058b, 1078b
poly(A) site choice in, 1040
poly(A) tail addition in, 1039-1040, 1 039f
Sakmann, Bert, 407, 407f
rate of, 1049
salicylate, 818, 818s
rtbozymes in, 1034, 1036-- 1 039, 1046f-1048f,
Salmonella typhimurium, 1 135f
1047-1049 of rRNA, 1042-1044 of snoRNA, 1045
gene regulation in, 1 134 lipopolysaccharides of, 257, 257f salts, dissolution of, 46--48, 47f
early studies of, 283-284
of snRNA, 1045
salvage pathway, 882
editing of, 1073-- 1 074
splicing in, 1034, 1034f, 1 036-1039,
Samuelsson, Bengt, 358, 358f
in evolution, 3 1-32, 3 l f functions of, 283-284
I 036f- 1 038f
alternative patterns of, 1040, 1041£
Sandhoffs disease, 356 Sanger, Frederick, 93-94, 94f, 292
gene-encoding, 952f
RNA replicase, 1056
Sanger sequencing, 292--294, 293f
guide, 1073
RNA replication, 1050-1059, 1050f
sarcomere, of muscle fiber, 176, 1 77f, 178
hairpin loops in, 1029f, 1049 hydrolysis of, 275, 275f
evolutionary significance of, 31-32, 3lf, 1056-1059, 1078b
sarcoplasmic reticulum, of muscle fiber, 176, 177f
messenger. See mRNA (messenger RNA)
homing in, 1053, 1054f
satellite DNA, 953
micro, 1045, 1145
introns in, 1052-1053, 1054f
saxitoxin, 410, 412s
noncoding, 1146
retrotransposons in, 1 052-1053, I 052f
scaffold proteins, in chromatin, 968, 968f
nucleotides of, 272t, 273-274, 273f. See also
reverse transcrtptase in, 105�1051, 1050f
Scatchard analysis, 420, 421, 421b, 905
RNA replicase in, 1056
Schally, Andrew, 902
nucleotide(s)
�-3 6
_
I ndex
Schultz, Peter, 2 1 1
properties of, 73t, 77
in insulin regulation, 439-443, 440f-443f
SCOP database, 136-138
in proteoglycans, 252-253, 253f
integration in, 420, 420f, 454 lipids in, 357-359
serine dehydratase, 692
scrarnblases, 382f, 383
in mammals, 459t
reaction mechanism of, 693f
scrapie, 148-149
serine hydroxymethyltransferase,
scurvy, 126b-127b
membrane potential in, 450, 450f
reaction mechanism of, 693f
SDs (segmental duplications), 952f
membrane rafts in, 449
serotonin, 453s, 459s, 878
SecA/B chaperones, 1 1 04, 1 1 06f second messengers, 431-438, 467-468. See
also
receptor for, as ion channel, 410 serpentine receptors, 424. See
signaling; signaling proteins
also G protein-
coupled receptor(s)
second messengers
membrane polarization in, 430f, 450-453, 450f, 45lf
692, 864
SDS. See sodium dodecyl sulfate (SDS)
neuronal, 902, 902f
in olfaction, 465-467, 466f overview of, 4 1 9-423
calcium as, 433f, 436-437, 437f, 437t
serum albumin, 649-650, 916
phosphatidylinositol in, 826f, 827, 827f, 829f
cAMP as, 431-432
serum amyloid A (SAA), 146-147
phosphorylation in, 440f-443f, 442-443
seven transmembrane segment receptors. See G
in plants, 359, 458-460, 458f-46lf, 459t,
in f3-adrenergic pathway, 424f, 426-427,
protein-coupled receptor(s)
428f, 429f diacylglycerol as, 432, 443f
severe combined immunodeficiency, gene therapy for, 336-337
in gene regulation, 1 132
sex hormones, 359, 359s, 459s, 906t, 908
IP3 as, 432-433, 443f
steroid, 359, 359s
mechanism of action of, 431-432
synthesis of, 844-845, 844f
nucleotide, 298, 298f
819, 906 protein interactions in, 446-449. See
also
signaling proteins protein kinases in. See protein kinase(s) proteoglycans/oligosaccharides in, 252-255, 257-262
secondary metabolites, 13
SH2 domain, 439, 443f, 444, 447-448, 447f
in proteolysis, 1 109
secondary structure(s), 92f, 1 1 7-122, 1 1 8f,
Shafrir, Eleazar, 822
receptor desensitization in, 420, 420f, 42lf,
120f-122f
a helix as, 1 1 7-120, 1 1 8f, 120f, 122f, 123t
Sharp, Phillip, 1035
430-431 , 44lf
shellfish poisoning, 410
receptor enzymes in, 422, 422f, 439-446
amino acids in, 1 2 1 , 122f
Shine, John, 1088
receptor-ligand binding in, 420, 420f, 421b
f3 conformation as, 120-12 1 , 120f-123f, 123t
Shine-Dalgamo sequence, 1088-1089
second messengers in, 431-438, 467-468.
f3 tum as, 1 2 1 , 1 2 l f, 122f, 123t
shivering thermogenesis, 919
bond angles in, 12 1-122, 122f
Shoemaker, James, 700b
of fibrous proteins, 1 1 7-122, 1 1 8f, 120f-122f, 123t
short tandem repeats (STRs), in DNA
of globular proteins, 130, 1 3 1 -136, 13lt, 135f-137f motifs in, 1 3 1-138, 136f-137f
fingerprinting, 3 1 9b-321b shuttle vectors, 310
See also
protein folding
sialic acid, 240, 240s, 25S...259, 262, 354s in gangliosides, 354, 354s
See also second messengers signal amplification in, 420, 420f, 429, 442, 905, 9 1 l f signal transduction in, 420f, 422f signal variety in, 420t signal-receptor affinity in, 420, 420f specificity in, 419, 420f steps in, 45lf
in protein folding, 131-136, 135f-1 37f, 148
sialoadhesins, 262
Ramachandran plots for, 1 17, 122f
sickle cell disease, 168-169, 1 68f
steroid hormones in, 359, 359s
representations of, 130f
sickle cell trait, 168
steroid receptors in, 422, 422f
siglec-1 , 261-262
termination of, 442
supersecondary, 1 3 1 - 1 38, 136f-137f
See also
protein folding secondary systemic amyloidosis, 147 secretin, 675 sedoheptulose 1 ,7-bisphosphatase, light activation of, 785, 785f sedoheptulose 1 ,7-bisphosphate, in Calvin cycle, 780, 780f, 78lf sedoheptulose 7-phosphate, in Calvin cycle, 780f seed germination gluconeogenesis in, 79S... 799 triacylglycerols in, 663, 663f segment polarity genes, 1 147, 1 150
