Kidney Research. Experimental Protocols

Kidney Research Series Editor John M. Walker School of Life Sciences University of Hertfordshire Hatfield, Hertfordshi...

Author: Tim D. Hewitson | Gavin J. Becker

68 downloads 1361 Views 5MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form

DOWNLOAD PDF

Kidney Research

Series Editor John M. Walker School of Life Sciences University of Hertfordshire Hatfield, Hertfordshire, AL10 9AB, UK

For other titles published in this series, go to www.springer.com/series/7651

Kidney Research Experimental Protocols

Edited by

Tim D. Hewitson, Ph.D. The Royal Melbourne Hospital, Melbourne, VIC, Australia

Gavin J. Becker, M.D. The Royal Melbourne Hospital, Melbourne, VIC, Australia

Editors Tim D. Hewitson Ph.D. The Royal Melbourne Hospital Parkville, VIC Australia

Gavin J. Becker The Royal Melbourne Hospital Parkville, VIC Australia

ISBN: 978-1-58829-945-1 e-ISBN: 978-1-59745-352-3 DOI: 10.1007/978-1-59745-352-3 Library of Congress Control Number: 2008927373 © 2009 Humana Press, a part of Springer Science + Business Media, LLC All rights reserved. This work may not be translated or copied in whole or in part without the written permission of the publisher (Humana Press, 233 Spring Street, New York, NY 10013, USA), except for brief excerpts in connection with reviews or scholarly analysis. Use in connection with any form of information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed is forbidden. The use in this publication of trade names, trademarks, service marks, and similar terms, even if they are not identified as such, is not to be taken as an expression of opinion as to whether or not they are subject to proprietary rights. While the advice and information in this book are believed to be true and accurate at the date of going to press, neither the authors nor the editors nor the publisher can accept any legal responsibility for any errors or omissions that may be made. The publisher makes no warranty, express or implied, with respect to the material contained herein. Printed on acid-free paper 9 8 7 6 5 4 3 2 1 springer.com

Preface

There is a growing realisation that ultimately the world will not be able to afford the expense of treating the ever-increasing number of patients with end-stage kidney disease. This has focused even greater attention on strategies to prevent and treat early kidney disease, and to slow its progression. Application of these strategies relies on clarification of the mechanisms involved, which in turn are largely dependent on experimental studies in nephrology. Does nephrology research differ from other medical research? In an age where techniques in cell biology, pathology, biochemistry, and genetics are applied so generically, it seems reasonable to assume that laboratory studies in nephrology do not differ greatly from any other field. However, the study of renal disease has a number of inherent problems, most notably the complexity of renal anatomy and physiology, and the associated plethora of different cell types found in the kidney. This has therefore meant that laboratory researchers have had to develop a number of specialised techniques. It is these problems and solutions to address them that form the basis of this book. In editing this volume we have attempted to collate both well-established and novel methods used in the study of experimental kidney disease. Part I of the book covers the preparation and culture of the main cell types used to study the mechanisms of renal disease. The three chapters in this section provide detailed guidance on cell culture methods in general and the propagation of mesangial cells (Chap. 1), tubules (Chap. 2), and fibroblasts (Chap. 3). In Part II we provide a critical review of the common animal models used to mimic the various forms of human renal disease (Chap. 4). For the purposes of our discussion, the review is organised by initiating factor; surgical, toxic, immunemediated, and metabolic injuries. The bibliography provides key examples of the use and application of these models. We hope that our emphasis on mouse techniques is useful to those seeking to take advantage of transgenic and knock-out mice. The third and final section of the book (Part III) describes a number of specific applications and techniques used in vivo and in vitro. Consistent with our emphasis on murine models, the first chapter in Part III (Chap. 5) provides detailed guidance on measuring renal function in mice. One of the major problems encountered in the study of renal disease is the fact that it often involves selective injury to the glomerular, vascular, tubular, and interstitial compartments. Protocols for in situ v

vi

Preface

hybridization and laser capture microdissection are therefore included. Chapters 8–13 cover a number of imaging techniques used to study renal pathophysiology including methods to observe leukocyte recruitment in real time, generic histochemical protocols, and applications to specifically localize tissue hypoxia and apoptosis. Chapters 14 and 15 provide in vitro designs that can be used to model the matrix contraction and glomerular stretch that occurs in progressive renal disease. Other chapters in this section detail methods for the quantitative analysis of gene expression, measurement of renal collagen, proteomics, and finally, a gene transfer strategy for targeting glomeruli. In many cases, the authors provide case studies as well as detailed protocols to illustrate their application. In editing this book, we have attempted to provide a collection of protocols useful to those with some laboratory experience in nephrology and those new to the field. We are grateful to all the authors for their generosity in sharing their expertise and experience for this book. Their technique notes in particular provide invaluable guidance for those seeking to establish these methodologies in their own laboratory. Tim D. Hewitson Gavin J. Becker

Contents

Preface ............................................................................................................... v Contributors ..................................................................................................... ix List of Color Plates........................................................................................... xiii Part I

Isolation and Propagation of Cell Populations

1

Isolation and Propagation of Glomerular Mesangial Cells.................... Paolo Menè and Antonella Stoppacciaro

1

2

Isolation and Primary Culture of Human Proximal Tubule Cells ........ David A. Vesey, Weier Qi, Xinming Chen, Carol A. Pollock, and David W. Johnson

19

3

Propagation and Culture of Renal Fibroblasts ....................................... Lauren Grimwood and Rosemary Masterson

25

Part II 4

Animal Models

Small Animal Models of Kidney Disease: A Review............................... Tim D. Hewitson, Takahiko Ono, and Gavin J. Becker

Part III

39

Techniques and Applications

5

Measurement of Glomerular Filtration Rate in Conscious Mice .......... Zhonghua Qi and Matthew D. Breyer

59

6

Laser Capture Microdissection of Kidney Tissue ................................... Robert P. Woroniecki and Erwin P. Bottinger

73

7

Quantitative Gene Expression Analysis in Kidney Tissues .................... Chris Tikellis, Philip Koh, Wendy Burns, and Phillip Kantharidis

83

vii

viii

Contents

8

In Vivo Imaging of Leukocyte Recruitment to Glomeruli in Mice Using Intravital Microscopy ...................................................... 109 A. Richard Kitching, Michael P. Kuligowski, and Michael J. Hickey

9

Using In Situ Hybridization to Localize Renal Gene Expression in Tissue Sections ..................................................................................... 119 Ian A. Darby, Alexis Desmoulière, and Tim D. Hewitson

10

Immuno and Lectin Histochemistry for Renal Light Microscopy ...... 133 Tim D. Hewitson and Lauren Grimwood

11

Immuno and Lectin Histochemistry for Renal Electron Microscopy ................................................................................ 149 Mitsuru Nakajima

12

Pimonidazole Adduct Immunohistochemistry in the Rat Kidney: Detection of Tissue Hypoxia ................................... 161 Christian Rosenberger, Seymour Rosen, Alexander Paliege, and Samuel N. Heyman

13

Identification of Apoptosis in Kidney Tissue Sections .......................... 175 Glenda Gobe

14

Cell-Populated Floating Collagen Lattices: An In Vitro Model of Parenchymal Contraction .................................. 193 Kristen J. Kelynack

15

Mechanical Stretch-Induced Signal Transduction in Cultured Mesangial Cells .................................................................... 205 Joan Krepinsky

16

Determination of Collagen Content, Concentration, and Sub-types in Kidney Tissue.............................................................. 223 Chrishan S. Samuel

17

SELDI-TOF Mass Spectrometry-Based Protein Profiling of Kidney Tissue ....................................................................................... 237 Eleni Giannakis, Chrishan S. Samuel, Wee-Ming Boon, Mary Macris, Tim D. Hewitson, and John D. Wade

18

In Vivo Transfer of Small Interfering RNA or Small Hairpin RNA Targeting Glomeruli ....................................................................... 251 Yoshitsugu Takabatake, Yoshitaka Isaka, and Enyu Imai

Index .................................................................................................................. 265

Contributors

Gavin J. Becker, M.D. Department of Nephrology, The Royal Melbourne Hospital, Melbourne, Victoria, Australia Wee-Ming Boon, Ph.D. Department of Physiology, Monash University, Clayton, Melbourne, Victoria, Australia Erwin P. Bottinger, M.D. Department of Medicine, Mount Sinai School of Medicine, New York, NY, USA Matthew D. Breyer, M.D. Division of Nephrology, Vanderbilt University, Nashville, TN, USA Wendy Burns, B.Sc. Danielle Alberti Memorial Centre for Diabetes Complications, Baker Heart Research Institute, Melbourne, Victoria, Australia Xinming Chen, Ph.D. Department of Medicine, University of Sydney, Kolling Institute, Royal North Shore Hospital, Sydney, New South Wales, Australia Ian A. Darby, Ph.D Department of Nephrology, School of Medical Sciences, RMIT University, Bundoora, VIC, Australia Alexis Desmoulière, Ph.D. Department of Physiology, Faculty of Pharmacy, University of Limoges, Limoges, France Eleni Giannakis, Ph.D. Howard Florey Institute, The University of Melbourne, Victoria, Australia and Bio-Rad Laboratories, Hercules, CA, USA Glenda Gobe, Ph.D. Molecular and Cellular Pathology, School of Medicine, University of Queensland, Brisbane, Queensland, Australia

ix

x

Contributors

Lauren Grimwood, B.Sc. (HONS) Department of Nephrology, The Royal Melbourne Hospital, Melbourne, Victoria, Australia Tim D. Hewitson, B.Sc., Ph.D. Department of Nephrology, The Royal Melbourne Hospital and Department of Medicine, University of Melbourne, Melbourne, Victoria, Australia Samuel N. Heyman, M.D. Hadassah University Hospital Mt. Scopus and The Hebrew Medical School, Medicine, Jerusalem, Israel Michael J. Hickey, Ph.D. Centre for Inflammatory Diseases, Monash University Department of Medicine, Clayton, Melbourne, Australia Enyu Imai, M.D., Ph.D. Department of Nephrology, Osaka University Graduate School of Medicine, Osaka, Japan Yoshitaka Isaka, M.D., Ph.D. Department of Advanced Technology for Transplantation, Osaka University Graduate School of Medicine, Osaka, Japan David W. Johnson, M.D. Centre for Kidney Disease Research, Department of Medicine, University of Queensland, Princess Alexandra Hospital, Woolloongabba, Queensland, Australia Phillip Kantharidis, Ph.D. Danielle Alberti Memorial Centre for Diabetes Complications, Baker Heart Research Institute, Melbourne, Victoria, Australia Kristen J. Kelynack, Ph.D. Department of Nephrology, The Royal Melbourne Hospital, Melbourne, Victoria, Australia A. Richard Kitching, M.B. Ch.B., FRACP, Ph.D. Centre for Inflammatory Diseases, Monash University Department of Medicine, Clayton, Melbourne, Victoria, Australia Philip Koh, Ph.D. Danielle Alberti Memorial Centre for Diabetes Complications, Baker Heart Research Institute, Melbourne, Victoria, Australia Joan Krepinsky, M.D. McMaster University, St. Joseph’s Hospital, Hamilton, Ontario, Canada Michael P. Kuligowski, B.Sc. Centre for Inflammatory Diseases, Monash University Department of Medicine, Clayton, Melbourne, Australia

Contributors

Mary Macris, B.Sc. (HONS) Howard Florey Institute, The University of Melbourne, Victoria, Australia Rosemary Masterson, M.B., Ch.B., Ph.D. Department of Nephrology, The Royal Melbourne Hospital, Parkville, Victoria, Melbourne, Australia Paolo Menè, M.D. Division of Nephrology, Department of Clinical Sciences University of Rome “La Sapienza”, Rome, Italy Mitsuru Nakajima, M.D. Director of Pediatrics, Hoshigaoka Koseinenkin Hospital, Osaka, Japan Takahiko Ono, M.D. Department of Molecular Medicine, School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka, Japan Alexander Paliege, Ph.D. Department of Anatomy, Humboldt University, Berlin, Germany Carol A. Pollock, Ph.D. Department of Medicine, University of Sydney, Kolling Institute, Royal North Shore Hospital, Sydney, New South Wales, Australia Weier Qi, B.Sc., M.Sc. Department of Medicine, University of Sydney, Kolling Institute, Royal North Shore Hospital, Sydney, New South Wales, Australia Zhonghua Qi, M.D., Ph.D. Division of Nephrology, Vanderbilt University, Nashville, TN, USA Seymour Rosen, M.D. Beth Israel Deaconess Medical Centre and Harvard Medical School, Pathology, Boston, MA, USA Christian Rosenberger, M.D. Charité Universitaetsmedizin, Nephrology and Medical Intensive Care, Berlin, Germany Chrishan S. Samuel, Ph.D. Howard Florey Institute, The University of Melbourne, Melbourne, Victoria, Australia Antonella Stoppacciaro, M.D. Department of Experimental Medicine and Pathology, University of Rome “La Sapienza”, Rome, Italy Yoshitsugu Takabatake, M.D., Ph.D. Department of Nephrology, Osaka University Graduate School of Medicine, Osaka, Japan

xi

xii

Contributors

Chris Tikellis, B.Sc. (HONS) Danielle Alberti Memorial Centre for Diabetes Complications, Baker Heart Research Institute, Melbourne, Victoria, Australia David A. Vesey, B.Sc., Ph.D. Centre for Kidney Disease Research, Department of Medicine, University of Queensland, Princess Alexandra Hospital, Woolloongabba, Queensland, Australia John D. Wade, Ph.D., FRACI, FRSC Howard Florey Institute, The University of Melbourne, Melbourne, Victoria, Australia Robert P. Woroniecki, M.D. Department of Pediatrics, The Children’s Hospital at Montefiore, Albert Einstein College of Medicine, New York, NY, USA

List of Color Plates

Plate 1

Fig. 3.2 Staining characteristics of sub-cultured cells (passage 3); SMA, smooth muscle actin (reproduced from ref. (11) with permission from Elsevier) ...........................................

I-1

Fig. 4.1 Interstitial accumulation of monocytesmacrophages after unilateral ureteric obstruction (UUO). Micrograph shows immunoperoxidase staining with the monoclonal antibody clone ED-1, 3 days post-UUO .......................

I-2

Plate 3 Fig. 4.2 Increased immunoperoxidase staining for fibronectin at day 8 in an acute model of Thy-1 nephritis induced by rabbit ATS. Mesangial proliferation, matrix expansion, and the formation of a small crescent are clearly seen .................................................................................

I-2

Plate 4 Fig. 4.3 Severe crescent formation in a rat model of antiglomerular basement membrane (GBM) nephritis. Day 21, periodic-acid Schiff (PAS) stain (micrograph courtesy of Dr. Toshiaki Makino, Nagoya City University, Nagoya, Japan) ..................................................................................

I-3

Plate 5 Fig. 7.1 Schematic representation summarising the quantitative RT-PCR cycle .........................................................

I-3

Plate 2

Plate 6 Fig. 10.3a Immunohistochemical staining of rat glomerular and peritubular capillaries with mouse anti-rat JG12, a mouse monoclonal antibody to the endothelial cell enzyme aminopeptidase P. b Double labelling of proliferating myofibroblasts in an experimental model of renal infection. Cell proliferation is localised using

xiii

xiv

Plate 7

Plate 8

Plate 9

Plate 10


DAB and a biotinylated antibody against bromodeoxyuridine (refer to ref. [9] for study design). Myofibroblasts are localised with a monoclonal antibody to smooth muscle actin, detected with alkaline phosphatase and Fast Red(tm). Co-localisation indicates myofibroblast proliferation, confirmed in this photograph by the presence of a mitotic figure (arrow). c and d Differential lectin labelling of tubules with biotinylated (c) PNA and (d) PHA-L using DAB as a chromogen ...........................................

I-4

Fig 14.1 Solidified fibroblast-populated collagen lattices (a) immediately after rimming with a scalpel blade (time 0) and (b) after 48 h. The comparison shows a 40% reduction in lattice diameter ...................................................

I-5

Fig. 15.2 Phosphorylated Raf-1 at Ser338 translocates to the membrane with stretch. MC are stretched for 5 min and phosphorylated Raf-1 at Ser338 visualized by immunofluorescence as outlined in Sect. 3.7. Arrows identify phosphorylated Raf-1 at cell membrane locations ........................................................................

I-6

Fig. 17.1 SELDI-TOF MS Analysis. Arrays with specific chromatographic properties (a) are equilibrated in binding buffer. Samples are applied to the array surface and incubated for 1 h (b). Arrays are washed to remove non-specifically bound proteins (c), followed by EAM application (d). The fraction of the proteome retained on the array is directly analysed by TOF-MS, resulting in a profile of proteins characterised by the m/z and signal intensities (e, f). Data is represented in spectra or virtual gel view (f). Figure adapted from ProteinChip(tm) technology training course (Bio-Rad Laboratories) .......................

I-7

Fig. 18.2 siRNA-mediated silencing of EGFP expression in the glomerular cells. siRNA targeting EGFP was transferred to the kidney of EGFP-transgenic rats via the renal artery using the electroporation method. Fluorescence micrographs of glomeruli in the siRNAtransfected (right) and contralateral (left) kidney were taken 7 days after transfection (upper panels). Sections were stained with Texas red-labeled OX-7 antibody, a marker of mesangial cells (middle panels), and the merged photos are shown in the lower panels (original magnification, ×400). In the transfected kidney, EGFP


expression was diminished substantially in almost all of the glomeruli (95%), whereas it was unchanged in the tubules. This inhibition seemed nearly complete in the mesangial cells, whereas in other glomerular cells, endothelial and epithelial cells, inhibition of EGFP expression was not observed. The reduction of mesangial EGFP expression was observed for up to 2 weeks, and had recovered completely by 3 weeks after transfection (data not shown) (reproduced from ref. (3)) ...................................

xv

I-8

Chapter 1

Isolation and Propagation of Glomerular Mesangial Cells Paolo Menè and Antonella Stoppacciaro

Abstract Cultures of glomerular mesangial cells (MC) of rodent or human origin have been extensively employed in renal research laboratories since the early 1980s. Cultured MC retain extensive analogies with the fairly undifferentiated in vivo phenotype of an intercapillary mesenchymal cell population, i.e., a myofibroblast. MC proliferating in response to mitogens and growth factors can be growth-arrested by withdrawal of serum or 3D culture in collagen gels. They synthesize an extracellular matrix that includes interstitial collagens and has analogies with the glomerular basement membrane; a prominent cytoskeleton acts as a functional contractile apparatus. Cultured MC have been extensively employed as a tool for studying pathophysiological events such as mesangial expansion, scarring, and glomerulosclerosis. Current technology for MC isolation and culture is reviewed, with emphasis on methodological issues relevant to characterization, propagation, and long-term maintenance of homogeneous clones. Keywords Mesangial cell, Mesangium, Kidney glomerulus, Tissue culture, Myofibroblast, Mesenchymal cell

1

Introduction

Mesangial cells (MC) have been recognized as one the three major cell lines of the kidney glomerulus by electron microscopy in the second half of the 20th century through the independent work of H. Latta and G. Marinozzi (1, 2). MC have a spatial organization far less specialized than the endothelial and visceral epithelial cells lining the glomerular capillary wall. In fact, they seem to “fill the gap” between adjacent capillary loops surrounded by the glomerular basement membrane (GBM) and a network of visceral epithelial cells, i.e., the podocytes. The word “mesangium” indeed describes the intercapillary space within the glomerulus, and was coined by Zimmermann in 1929 (3). Their random distribution between endothelium and podocytes is further complicated by a fairly intermediate phenotype, sharing features of fibroblasts and smooth muscle cells as well.

From: Methods in Molecular Biology, Vol. 466: Kidney Research DOI: 10.1007/978-1-59745-352-3_1, Edited by: T.D. Hewitson and G.J. Becker © Humana Press, Totowa, NJ

3

4

P. Menè, A. Stoppacciaro

The term “myofibroblast” has been often used to emphasize the uncommitted and nondifferentiated nature of this cell population (4, 5). Unlike podocytes, highly differentiated cells that express specific proteins such as nephrin, podocin, podocalyxin, NPHS1, ZO-1, etc. (6, 7), MC hardly display a mesangial-specific molecular marker. Indeed, the lack of an obvious phenotypic marker still plagues the field of MC culture, after more than 30 years of laboratory work trying to reproduce disorders that involve these cells in vivo with in vitro models (8). Elegant imaging studies and electron photomicrographs have shown that there are some 200–300 MC in an average rat glomerulus, visible as sparse nuclei embedded in narrow cytoplasms and trace amorphous extracellular matrix within a single mesangial space (1, 9). Three or fewer nuclei are generally observed in an intercapillary section of a normal murine or human glomerulus. Larger numbers of cells (hyperplasia) or more abundant cell bodies and/or extracellular matrix are the hallmark of a proliferative glomerular disorder. It seems that MC maintain direct contact with the GBM and occasionally with the overlying endothelium, thus, suggesting direct filtration of macromolecules and possibly deposition of plasma proteins in glomerular diseases (1, 4). MC have a prominent contractile apparatus, based on a network of microfilaments containing actin, myosin, and regulatory proteins. This has prompted speculation on their possible mechanical role on glomerular hemodynamics, perhaps synchronous to a similar response to angiotensin II and other vasoconstrictors in podocytes. The hypothesis has been put forward that MC contraction may impact on the glomerular ultrafiltration coefficient (Kf) in vivo by modulating hydraulic conductivity (Lp) and/or the capillary parietal area for filtration (A). Shunting of blood from capillaries narrowed by mesangial/podocyte contraction may underlie this theoretical decrease of A (1, 4, 5). Kriz and coworkers emphasized the tensile strength that a tonic contraction of MC may exert on the GBM, antagonizing the transcapillary pressure forces while holding together the entire network of capillary loops (9). MC may not only serve as the framework of the capillary tuft, but also participate in immunological or metabolic damage involving the glomerulus. Three types of structural change occur in response to mesangial damage. “Mesangiolysis” is induced by injection of anti-Thy 1.1 antiserum in a popular rat model of mesangial proliferative nephritis, with MC undergoing apoptosis and actually disappearing from the intercapillary space (10). Mesangial proliferation is often a prominent response to endothelial damage and vasculitis. Mesangial expansion occurs whenever increased matrix or other amorphous material accumulates without mitosis or migration of MC, as commonly seen in diabetes, amyloidosis, or light-chain deposition. Glomerulosclerosis is believed to result from prolonged mesangial expansion, although focal scarring of glomeruli may also be induced by podocyte injury, as in several forms of proteinuric glomerular diseases. It is unclear whether the two cell types cooperate in the deposition of an amorphous matrix or rather have independent phenotypic changes—as in the case of podocytes undergoing foot process effacement during proteinuria—eventually resulting in glomerular scarring.

1 Isolation and Propagation of Glomerular Mesangial Cells

1.1

5

Isolation and Propagation of Mesangial Cells

MC are the easiest cells to grow from glomeruli of mammals, avian species, and humans. Since 1970 at least three groups (11–13) employed standard culture techniques for mammalian cells, taking advantage of the minimal growth requirements and brisk proliferative potential of MC. When grown in one of the common media for eukaryotic cells (MEM, DMEM, Waymouth, RPMI 1640), these cells retain their in vivo phenotype as stellate, arborized elements that tend to form “hills and valleys” in monolayer culture (11–16). Homogeneous cultures of MC resemble smooth muscle cells or fibroblasts; when confluent, they tend to form a syncytium, with specialized junctions that have been examined by microinjection and lucifer yellow transfer (17). This too duplicates the in vivo setting, where an electrical continuity of MC with cells of the juxtaglomerular apparatus has been theorized (18). An unlimited number of passages in culture is common for rodent MC, while usually not more than 15 – 20 passages in culture can been obtained from human MC (14, 15, 18, 19). The reason is unclear, but probably relates to a greater adaptation to bidimensional culture on plastic surfaces, and thus phenotype transition, for rat MC. Human MC are either committed to a fixed number of divisions, or lack some substrate that ordinary culture media do not provide over the long term. Apparently, rat MC have lower requirements to support sustained proliferation, although the persistent need for substrate attachment indicates that they are not transformed in culture as certain neoplastic clones. Researchers have often emphasized the “inflammatory” conditions of tissue culture as opposed to the in vivo situation. MC (and other glomerular cells as well) are a largely quiescent population in vivo, with a slow turnover in healthy animals and individuals, unlike tubular epithelial cells of the kidney, which have a constant rate of proliferation (14, 15, 18–20). When grown in culture on a plastic surface in the presence of fetal bovine serum (FBS; a product of the platelet release reaction) MC become activated to proliferate and express phenotypic features that are different from those occurring in a healthy kidney in vivo. MC in culture undergo constant cycles of proliferation leading to exponential growth, until some sort of contact inhibition mechanism or antiproliferative mediator in the culture media halts repeated cell divisions. Moreover, loss of the normal 3D network formed by other types of glomerular cells populations (endothelial, epithelial cells) and by a structured GBM is likely to deprive the MC of cell-to-cell communication and regulatory influences, contributing to an artificial environment (6, 18, 21). Tissue culture techniques have been standardized through a 30-year routine in hundreds of laboratories throughout the world. Frozen stocks of cells circulate in many renal research units for scientific and even commercial purposes. Our own culture technique for rat cells (Table 1.1) is a modification of the method described by Striker et al. (14–25).

6


Table 1.1 Protocol for isolation of mesangial cells Four ether-anesthetized rats are exsanguinated through a midline incision after thorough disinfection of the abdomen Excise eight kidneys, which are decapsulated and placed in EBSS on ice Cut away cortical tissue from rat kidneys (or human kidneys not suitable for transplantation), mince with a razor blade to a paste-like consistency Perform sequential sieving of dispersed rat cortex through 105-µm-diameter brass or nylon filters (120-µm for human glomeruli), then collect glomeruli onto 75-µm-diameter nylon filters Wash, decapsulate glomeruli by forcing suspension 3× through a 21-gauge needle Wash, digest glomerular “cores” with collagenase for approximately 20 min Plate glomerular “cores” resuspended in 12 mL RPMI 1640 medium + 17% FBS + antibiotics + 0.1 U/mL insulin - 2 wells with 2 mL each in 3 plates Outgrowths of spindle-shaped cells at 6–36 h Characterize outgrowth at the time of first passage

2 2.1

Materials Isolation of Mesangial Cells

1. Four to eight kidneys obtained from ether-anesthetized rats (Sprague-Dawley, Wistar-Kyoto, etc.) at weaning, specimens weighing about 100–150 grams (see Note 1). 2. For human cells, 4- to 6-cm3 blocks of cortex cut with a scalpel from the cortex of kidneys not suitable for transplantation, or from the healthy segment of nephrectomy specimens (see Note 2). 3. Earle’s balanced salt solution (EBSS), 2× 100-mL bottles supplemented with 10 µg/mL ceftriaxone (Roche, Basel, Switzerland). 4. Complete set of presterilized (steam, gamma-rays, ethylene oxide, or overnight dipping in 70% ethyl alcohol) surgical instruments to excise kidneys from ether-anesthetized rats, including fine-tip tweezers, curved-tip scissors, and two stainless steel spatulas. 5. Iodopovidone and gauze to wipe abdomen prior to excision. 6. Disposable razor blades or sterile scalpels. 7. Petri dishes, 50-mm diameter, sterile. 8. 105-µm (human kidney, 120-µm)-mesh brass or nylon sieve mounted on a 250mm-diameter wooden/plastic circular frame. 9. 75-µm-mesh nylon sieve mounted on a cut-away plastic bottle neck, 50-mm diameter. 10. Plastic sterile 50-mL Falcon tubes. 11. 10-mL sterile plastic syringe with 21-gauge needle. 12. Sterile 1,000-mL manual Gilson / Eppendorf pipette tips or disposable 1,000mL plastic pipettes. 13. Collagenase: 750 U/mL Worthington type I (Worthington Biochemical, Lakewood, NJ, USA). Weigh powder and dissolve shortly before use in 2 mL Earle’s BSS.


7

14. Inverted stage light microscope, × 4 and × 10 objectives. 15. Rosewell Park Memorial Institute (RPMI) 1640 culture medium supplemented with 2 mM glutamine, 17% FBS, antibiotics (10 µg/mL ceftriaxone plus 100 µg/mL gentamicin), and 0.1 U/mL human recombinant insulin. 16. Plastic six-well sterile culture dishes.

2.2

Subculture of Mesangial Cells

1. 2. 3. 4.

Inverted stage light microscope, × 4 and × 10 objectives. Ca2+- and Mg2+-free phosphate-buffered saline (PBS) solution, pH 7.2. Trypsin solution: 0.05% trypsin in 0.02% EDTA in Ca2+- and Mg2+-free PBS. RPMI 1640 culture medium supplemented with 2 mM glutamine, 17% FBS, antibiotics (10 µg/mL ceftriaxone plus 100 µg/mL gentamicin), and 0.1 U/mL insulin. 5. Plastic six-well sterile culture dishes. 6. Plastic, disposable, individually wrapped sterile pipettes (1, 10, and 25 mL). 7. Sterilized fine long tip disposable glass micropipettes connected by a Teflon hose to a vacuum reservoir (to aspirate and remove spent culture media).

2.3 1. 2. 3. 4. 5.

Long-term Storage

9. 10.

Inverted stage light microscope, × 4 and × 10 objectives. MC cultures in early passages (passages 2–5) plated onto 75-cm2 tissue culture flasks. Ca2+- and Mg2+-free PBS solution, pH 7.2. Trypsin solution: 0.05% trypsin in 0.02% EDTA in Ca2+- and Mg2+-free PBS. RPMI 1640 culture medium supplemented with 2 mM glutamine, 17% FBS, antibiotics (10 µg/mL ceftriaxone plus 100 µg/mL gentamicin), and 0.1 U/mL insulin. Plastic 2-mL sterile polypropylene vials with rubber seal. Plastic disposable, individually wrapped sterile pipettes (1, 10, and 25 mL). Sterilized fine long tip disposable glass micropipettes connected to a vacuum reservoir (to aspirate and remove PBS washing). Dimethylsulfoxide (DMSO) stock solution. Liquid N2 storage tank.

3

Methods

6. 7. 8.

3.1

Protocol for Isolation

1. The kidneys of four to eight ether-anesthetized rats are excised with aseptic procedures after exsanguination by cutting the heart through a midline thoracoabdominal incision. Prior thorough disinfection of the skin is obtained by wiping

8

2.

3.

4.

5.


repeatedly with iodopovidone-soaked gauze. For human cells, 4- to 6-cm3 blocks of cortex are cut with a scalpel from surgical specimens. Kidneys (or fragments) are transferred to a sterile plastic 50-mL tube containing chilled EBSS supplemented with 10 µg/mL ceftriaxone (Roche), and decapsulated by traction with two fine-tip tweezers. After slicing the kidney in half vertically, cortical tissue is manually cut away, poured onto a Petri dish, and chopped into 1- to 2-mm cubes with fine-tip scissors. The kidney fragments are further minced with a razor blade into a paste-like preparation, which is then gently pressed with a spatula through a 105-µm mesh nylon or metal sieve (120 µm for human glomeruli). This glomeruli-enriched paste is collected from underneath the sieve with a second, smaller spatula repeatedly wetted with EBSS, and transferred to a 50-mL tube containing chilled EBSS. This diluted suspension is poured onto a second 75-µm filter and washed extensively with the same solution. Glomeruli and larger tubular fragments are retained on this filter, and transferred to a third 50-mL tube by gentle aspiration through a 1,000- or 5,000-µL automatic pipette tip (see Note 3). From this point on, maximum sterility must be ensured, although it is a safe habit to perform the entire procedure under a laminar hood (see Note 4). The glomerular suspension is aspirated with a 10-mL disposable syringe and force-pressed two to three times through a 21-gauge needle. This procedure will decapsulate about 75% of the glomeruli, which are then viewed on an invertedstage microscope for purity of the preparation. A yield of approximately 80% intact or fragmented glomeruli is acceptable. The glomerular suspension is then spun for 10 min at 900 × g, resuspended in a tube containing a previously prepared sterile 750 U/mL solution of Worthington type I collagenase in RPMI 1640 medium, and gently stirred at 37°C in a Dubnoff bath for 20 ± 5 min, checking digestion of the glomeruli on the microscope every 5 min. The glomerular “cores,” about half the size of the initial decapsulated tuft, are then spun again for 5 min, resuspended in 12 mL complete RPMI 1640 medium, and plated onto the middle two wells of three six-well dishes. The dishes are placed in a 37°C incubator with a controlled, humidified atmosphere of 95% air/5% CO2. Again, sterility of the media, incubator, disposable plastic ware, and laminar flow hood must be ensured throughout the procedure and all subsequent steps (see Note 4).

3.2

Protocol for Subculture and Cloning

1. After 6–12 h, the glomerular “cores” become adherent to the plastic surface, and centrifugal spreading of individual cells is immediately detectable by light microscopy (see Note 5). The medium is changed at 48 h, gently washing the dish to remove nonadherent cells, debris, and floating aggregates. Obviously, all procedures should be carried out under a laminar air flow hood ensuring maximum sterility.


9

2. After 1–2 additional days, a subconfluent array of cobblestone-like patches of cells and spindle-shaped individual cells can be observed. At 7–10 days, stellate, spindle-shaped cells generally overtake the cobblestone of epithelial cells, and each set of two wells should be subcultured into a single six-well dish (1:3 split). 3. First, spent RPMI 1640 medium is aspirated without scratching the monolayer (e.g., from the side of the gently tilted dish). The cells are washed once for 60 sec with Ca2+- and Mg2+-free PBS solution, pH 7.2, followed by application of 1 mL/well trypsin solution (0.05% trypsin in 0.02% EDTA in Ca2+and Mg2+-free PBS) for 60 sec at 37°C (returning the dishes to incubator). Gently tapping the dish with the lid on helps detachment. On the microscope, cells can be seen to round up, detach from one another, and occasionally float. Most of the trypsin solution is then aspirated, the dish is transferred to the incubator for a further 3 min, and the enzymatic digestion is stopped by adding 2 mL/well complete RPMI 1640 medium (containing serum protease inhibitors). 4. The content of each well, usually an even suspension of rounded cells or small clusters of cells, is transferred to a sterile 50-mL plastic tube, diluted 1:3 or 1:4 with fresh media depending on the desired cell density, and plated onto appropriate flasks or culture dishes. Clumps of cells can usually be broken down by repeated pipetting prior to final plating (see Note 6 and below, “mesangial hillocks”). If needed for experiments, an aliquot of the suspension can be diluted and counted on a Bürker or Thoma chamber to adjust the number of cells to be plated. 5. Dilution cloning can be useful to select out homogeneous populations derived from a single cell or a small cluster of cells. It is usually done by increasing the split ratio to 1:10 or 1:20 and plating 200 µL of the resulting cell suspension onto each well of 96-well sterile dishes. The resulting clones, viewed by inverted-stage light microscopy, can be marked and individually trypsinized, to yield cultures resulting from divisions of a single cell. Cloning rings have also been used, but this procedure suffers from the complication of silicone-sealing each ring to the bottom of large Petri dishes, and the need to sterilize the entire assembly. Nevertheless, a certain degree of clonal selection cannot be avoided with time in culture, since cells with the fastest growth tend to outnumber those that proliferate more slowly or become quiescent. Moreover, those cells that display tighter adhesion to plastic surfaces are less easily propagated, since dislodgment by trypsin is less effective during subculture (see below). Usually, time in culture favors less adhesive cell populations, which probably display dysregulated matrix synthesis. 6. After the first two subcultures, the cell lines should be checked for purity and characterized according to the protocol in Table 1.2, usually confirming that a fairly homogeneous and pure (95–98%) population of MC has been obtained. The cells should be subcultured every 3 to 5 days, depending on the speed of replication, often very high in earlier passages of human cells (passages 2–8) and later passages of rat cells (from passage 10 on). This avoids the build-up of a very packed monolayer, in which individual cells can hardly be identified. When subcultured, superconfluent monolayers tend to be released by trypsin as

10


“clumps” of cells rather than suspensions of individual elements. Upon plating, these clumps give rise to “hillocks” in subsequent cultures, that is, radial foci of clonal proliferation around a central core of fibrous, amorphous material (18–22, 25, 26). Obviously, this prevents the formation of a thin, even monolayer whenever this is required for microscopy, staining, microinjection, patch-clamp, or fluorometric recordings. On the other hand, hillocks have been useful as a model of the nodular deposition of extracellular matrix in various glomerular diseases (21, 26).

3.3

Characterization of the Cells

A unique and reliable marker of MC is yet to be identified, unlike glomerular epithelial and endothelial antigens. Therefore, establishing the mesangial origin of a cell line in culture is mostly based on exclusion criteria, as well as fulfillment of certain prerequisites (27, 28). Table 1.2 summarizes most accepted standards for a MC culture, including the lack of endothelial (factor VIII, CD34, AC-LDL binding, Weibel-Palade bodies, and angiotensin-converting enzyme activity) and epithelial markers (cobblestone morphology, “domes” of polarized cells, cilia, and various podocyte antigens, such as CD10, nephrin, podocin, NEPH1, ZO-1, podoplanin, α-actinin-4, etc.) (13–22, 27, 28, 29). Nephrotoxins such as puromycin aminonucleoside can be useful to rule out the presence of epithelial cells, most sensitive to aminoglycosides. Fibroblasts are apparently unable to grow when the media are supplemented with the d-isomer of valine only, unlike MC. Mitomycin C is reportedly toxic to MC, which can also be targeted by antisera against the Thy 1.1 epitope, constitutively expressed only by rat cells (5, 21). Markers suitable for immunofluorescence or immunoperoxidase staining include desmin, vimentin, and smooth muscle myosin and actin (SMA). It should be noted that the latter is fairly regulated by growth factors and cytokines, and may not be constitutive even in cells proliferating in response to fetal bovine serum. SMA has been often regarded as an indicator of a “myofibroblastic” phenotype, and accompanies

Table 1.2 Characterization of cultured mesangial cells Morphology: stellate, spindle-shaped, longitudinally oriented in bundles (“hills and valleys”) when confluent; no cobblestones, no “domes,” no cilia (epithelial features); no WeibelPalade bodies (endothelial features) Stains positive by immunofluorescence or immunoperoxidase: fibronectin, vimentin, Thy 1.1, cytokeratins, desmin, myosin; occasionally, -smooth muscle actin Stains negative by immunofluorescence or immunoperoxidase: Factor VIII, AC-LDL; CD45, CD10, Ia antigens, CD10, CD34 Enzymes: no angiotensin-converting enzyme Toxins: sensitive to mitomycin C, resistant to puromycin Growth: positive in d-valine-containing media Contractility by videomicroscopy: positive ANG II, vasoconstrictors


11

mesangial proliferation and/or glomerular inflammation in vivo (5, 21, 29, 30). (Cyto)keratins are usually viewed as a phenotypic marker of epithelial cells, although a number of obvious mesangial preparations stain positive (see Note 7). Another issue that has often been debated is the presence of a “mesangial phagocyte,” that is, a blood-borne bone marrow-derived cell with features of a monocyte/ macrophage or of antigen-presenting cells. A small population (< 5% of total MC in a glomerulus) that stains positive for the leukocyte common antigen, CD45, and/ or the MHC Class II Ia antigen has been initially described by Kreisberg and Karnovsky (13), and later examined through bone marrow irradiation studies by Schreiner et al. (31). The likelihood that such cells survive and proliferate in culture is minimal, particularly since cell cultures are systematically negative for leukocyte markers. Interestingly, dendritic cells have been isolated from the renal mesangium of LEW.1A rats (32). On average, only two of these antigen-presenting cells, strongly stimulating allogeneic mixed leukocyte reactions, can be seen in the whole glomerulus (32).

3.4

Protocol for Freezing/Thawing Cultured MC

1. Typically, trypsinized cell suspensions (see above) are resuspended in full serum-containing, sterile filtered media supplemented with 10% (v/v) DMSO as a cryopreservative. Cell count is best adjusted to 1×106 cells/mL, and 1-mL aliquots are frozen in sterile polypropylene vials with rubber seals. 2. Freezing in liquid N2 preserves cells for an unlimited time (see Note 8). Slow freezing is usually accomplished by holding the vials in a –80°C freezer for 24 h before transferring them to the liquid N2 storage tank (see Note 9). When thawing, the vials are simply transferred to a 37°C Dubnoff bath; immediate thawing is not harmful. Cells are then slowly (10 min) diluted to 10 mL with fresh complete medium, in order to minimize the osmotic shock due to decreasing extracellular DMSO, and plated at the desired density (typically, 1 mL frozen stock to 12 mL RPMI 1640).

3.5

Prolonged Culture

For experimental reasons, it is often necessary to maintain MC in culture for several days or weeks, examining functional features including cell viability and extracellular protein synthesis. MC synthesize and release in culture an extracellular matrix whose composition resembles the in vivo intercellular substance and also the GBM. Its spatial organization is obviously randomly distributed (18, 21). MC matrix regulates cell growth and function by binding growth factors and matrix receptors on the cells themselves (18, 21, 33). This applies to cultured MC

12


as well, because their rate of proliferation slows down whenever matrix synthesis is enhanced. This is the case of culture in high glucose media (see Note 10), often used to reproduce the diabetic microenvironment (34, 35). Indeed, long-term culture of MC has an impact on matrix synthesis and release even when ordinary media are employed. Schnaper et al. have shown that later passages (> passage 11) of human fetal MC in culture increase steady-state expression of mRNA for the α1 chains of collagen type III and IV, and laminin β1 and γ1 (36). Conversely, matrix-degrading enzymes such as interstitial collagenase (MMP-1), gelatinase A (MMP-2), tissue-type plasminogen activator (tPA), tissue inhibitor of metalloproteinases (TIMP-1), and plasminogen activator inhibitor (PAI-1) tend to decrease or disappear with time in culture. As a result, collagen type IV accumulation describes a matrix-accumulating phenotype in later passages of cultured MC, likely resulting from progressively higher levels of transforming growth factor (TGF)-β1 (36). Further evidence of a regulatory role of matrix on mesangial proliferation in culture comes from the concept of 3D cultures (37, 38). This approach, first introduced by Yaoita and Marx, uses a collagen type I gel to grow cells embedded within the extracellular matrix. In this microenvironment the cells are quiescent, as demonstrated by various functional assays. This technique more closely resembles the in vivo situation of MC, surrounded by GBM, other types of cells, and their own extracellular matrix (37–39). One drawback of this experimental setup is the low density of the cells, which complicates biochemical assays and messenger RNA (mRNA) extraction. Difficult diffusion of nutrients and test substances may also occur, due to gelification of the substrate. Savill and coworkers emphasized the absolute requirement of MC for growth factors to support not only proliferation but viability as well (40–42). Indeed, when studied after omitting serum from the culture medium, rat MC exhibit higher rates of apoptosis, consistent with growth factors acting as “survival factors.” Thus, working on serum-starved cells may provide potentially misleading results, due to MC entering a programmed cell death mode (40–42). Over the years, a number of laboratories have developed MC lines stabilized by transfection with simian virus (SV) 40 or isolated from SV-40 transgenic mice (43, 44). There is no evidence that this approach is necessary to stabilize murine cell lines or that it can prevent dedifferentiation in vitro. Since the same degree of stability can be obtained by limiting the number of passages, thawing and expanding frozen batches of the same cell preparation can yield the same results, without the complications and artifacts of viral transformation. The phenotype of cultured MC is also affected by physical forces, much like is believed to occur in vivo during glomerular hypertension or hyperfiltration, such as in remnant kidneys or in diabetes. At least three laboratories have grown MC under conditions of controlled pressure resembling the in vivo intraglomerular transcapillary pressure of 40–60 mmHg. Interestingly, increasing pressure resulted in enhanced matrix synthesis (45–47). In an effort to minimize variability in growth rates, phenotype, and biochemical responses among different cell lines, various laboratories have introduced


13

“defined” media, consisting of formulations of growth factors in controlled amounts, limiting the amount of added protein. Defined media are more expensive than supplements of raw, decomplemented FBS, and have not gained wide popularity. Indeed, an acceptable degree of stability and reproducibility can be obtained by pooling different batches of FBS and using identical amounts (typically 10–17–20%) after careful storage at –70°C. UV exposure of complete media and serum as well as repeated freezing-thawing cycles should be avoided. Preformed combinations of insulin, transferrin, and selenium salt have been popular, although no obvious advantages over conventional media have been convincingly shown.

3.6

Long-term Storage of Cultured MC Lines

Storing MC lines frozen after isolation, characterization, and clonal expansion is highly recommended, in order to minimize interassay variability. Experiments can be done on multiple batches of cells kept in culture for a short time, instead of using repeatedly subcultured populations in which dedifferentiation and chromosomal abnormalities commonly occur with time. In our opinion, frozen stocks of cells should be preferred to prolonged cultures and late passages. Pure cultures of rat or human MC can be obtained by several sources such as cell banks or even purchased. Table 1.3 lists some of the major organizations providing established cell lines of smooth muscle or MC origin. No matter what the source of cultured MC, the freezing/thawing procedures are fairly standardized.

3.7

Conclusions

About 30 years and a few thousands of papers from laboratories worldwide since the first methodological reports, the art and science of growing MC in renal research is still a matter of debate. In the age of molecular biology, genomics and proteomics, the scarcely differentiated phenotype of MC attracts undoubtedly less attention than the more fashionable podocyte. MC “are out, podocytes are in” nowadays,

Table 1.3 Sources of commercially available smooth muscle cell/MC cultures American Type Culture Collection (ATCC)—LGC Promochem: http://www.lgcpromochem-atcc. com/ Invitrogen: http://www.invitrogen.com/ European Collection of Cell Cultures (ECACC): http://www.ecacc.org.uk/ These organizations are three of the major providers of cell lines used in tissue culture work worldwide. Several other cell banks and commercial companies offer smooth muscle cells of various origin and even mesangial cells. Inquiries should be placed directly for availability and characteristics of specific cell lines

14


as suggested by a recent provocative review (8). The vast number of slit diaphragm and intrinsic podocyte proteins and their relationship with the nephrotic syndrome account for the booming interest in this peculiar cell type (6–8, 48). Yet, much has still to be learned about the role of MC in health and disease, with particular emphasis on the interaction with podocytes and endothelial cells. While it is likely that the next few years will see a shift in the focus of research from cultured cells to experimental models and human disease, MC should still remain a powerful tool for genetic manipulation, drug development, and testing (49). Time will tell whether there will be room for MC culture as a gene therapy and bioengineering tool, such as we are now seeing for artificial skin cultures from dermal fibroblasts or cartilage and bone from chondrocytes or osteoblasts.

4

Notes

1. Using young animals is critical to the success of the procedure, because cells from adult kidneys grow slowly and tend to last less in culture. 2. Kidneys from young individuals, children, or even fetal tissue are more likely to yield successful cultures than samples from mature subjects. For human tissue, a thorough microscopic evaluation should be carried out on a fragment excised from apparently healthy cortex (that is, distant from the lesion that led to nephrectomy). This can be done in parallel while performing glomerular isolation; evidence of neoplastic infiltration, necrosis or inflammatory reaction/leukocyte infiltration should halt the cell culture procedure. 3. Cutting the final 5 mm of the plastic tip with a sterile scalpel or razor blade helps picking up larger fragments. 4. FBS is the most likely source of bacterial or mycoplasma contamination. Whenever unexplained contamination of complete culture media occurs, it is advisable to run control incubations at 37°C of 4–5 mL of media in sterile Petri dishes with and without FBS. Should outgrowth of microorganisms occur over 36–72 h, the batch of FBS is returned to the producer or vacuum-filtered over Millipore filters. Foaming of serum and adhesion of growth factors to Millipore membranes is a frequent complication of this procedure, which is not advisable. 5. It is not advisable to disturb the initial attachment by removing often the culture dishes from the incubator. Dishes should be left standing for at least 24 h. 6. MC usually firmly adhere to the plastic growth substrates, although certain lines or clones tend to detach easily as a single sheet when challenged with vasoconstrictors or manipulated for biochemical experiments. Fibronectin or collagen coating of dishes is not necessary under most circumstances, at variance with epithelial or endothelial cells. In our experience, detachment occurs mostly when cells are superconfluent, and likely there is synergy of action between the mechanical forces through specialized tight junctions establishing electrical continuity of the monolayer (16). Synchronous depolarization occurs when a contractile stimulus or shear stress is applied, thus pulling the monolayer off as a single sheet of cells. A simple solution is to schedule studies on cells that are still slightly subconfluent (that is, while individual cells can still be recognized). 7. The distribution of certain markers may be fairly uneven across the population studied, occasionally within the same cell line and passage in culture. This may be due to clonal selection (see above) and the asynchronous position of cells within their growth cycle. 8. In our experience, fully functional cells can be recovered after 10 years of storage, provided that no freezing/thawing has ever occurred. Viability is up to 90%, as assessed by trypan blue or acridine orange dye exclusion. Storage of the tanks (cell repository and reservoir) and all handling are best done in a –4°C or –20°C walking refrigerator, in order to minimize cold loss. Protective clothing (hands, eyewear) is advisable.


15

9. Polystyrene/cotton wrapping (approx. 5 cm thickness per individual vial) slows initial cooling in the -80°C freezer, where vials should be kept for 24 h prior to transferring to the liquid N2 tank. This minimizes damage due to icing within the cytosol and organelles. 10. Glucose concentration is usually set at 30 mM versus control cultures at 5.5 mM; a third parallel culture should be employed to control for the effects of hyperosmolar growth conditions, using mannitol or sorbitol as an inert, nonmetabolized sugar.

References 1. Latta, H. (1973) Ultrastructure of the glomerulus and juxtaglomerular apparatus in, Handbook of Physiology (Orloff J., Berliner R.W., Geiger S.R., eds.). American Physiological Society, Washington DC, pp. 1–29. 2. Marinozzi, V. (1961) Struttura e istofisiologia del glomerulo, in Atti del II Corso di aggiornamento professionale “Nefrologia Moderna”, Rome, Italy, pp. 33–51. 3. Zimmermann, K.W. (1929) Über der Bau des Glomerulus der Menschlichen Niere. Z. Mikrosk. Anat. Forsch. 18, 520–552. 4. Latta, H. (1992) An approach to the structure and function of the glomerular mesangium. J. Am. Soc. Nephrol. 2 (suppl 10), S65–S73. 5. Johnson, R.J., Floege, J., Yoshimura, A., Iida, H., Couser, W.G., Alpers, C.E. (1992) The activated mesangial cell: a glomerular “myofibroblast”? J. Am. Soc. Nephrol. 1992; 2 (suppl 10), S190–S197. 6. Pavenstadt, H., Kriz, W., Kretzler, Μ. (2003) Cell biology of the glomerular podocyte. Physiol. Rev. 83, 253–307. 7. Johnstone, D.B., Holzman, L.B. (2006) Clinical impact of research on the podocyte slit diaphragm. Nature Clin. Pract. Nephrol. 2, 272–282. 8. Jefferson, J.A., Shankland, S.J. (2006) Glomerular disease: the podocyte is ready for prime time and may be already center stage. NephSAP 5, 331–338. 9. Kriz, W., Elger, Μ., Mundel, P., Lemley, K.V. (1995) Structure-stabilizing forces in the glomerular tuft. J. Am.Soc. Nephrol. 5, 1731–1739. 10. Baker, A.J., Mooney, A., Hughes, J., Lombardi, D., Johnson, R.J., Savill, J. (1994) Mesangial cell apoptosis: the major mechanism for resolution of glomerular hypercellularity in experimental mesangial proliferative nephritis. J. Clin. Invest. 94, 2105–2116. 11. Quadracci, L., Striker, G.E. (1970) Growth and maintenance of glomerular cells in vitro. Proc. Soc. Exp. Biol. Med. 135, 947–950. 12. Burlington, H., Cronkite, E.P. (1973) Characteristics of cell cultures derived from renal glomeruli. Proc. Soc. Exp. Biol. Med. 142, 143–149. 13. Kreisberg, J.I., Hoover, R.L., Karnovsky, Μ.J. (1978) Isolation and characterization of rat glomerular epithelial cells in vitro. Kidney Int. 14, 21–30. 14. Striker, G.E., Striker, L.J. (1985) Biology of disease. Glomerular cell culture. Lab. Invest. 53, 122–131. 15. Davies, Μ. (1994) The mesangial cell: a tissue culture view. Kidney Int. 45, 320–327. 16. Ennulat, D., Brown, S.A. (1995) Canine and equine mesangial cells in vitro. In Vitro Cell. Dev. Biol. Anim. 31, 574–578. 17. Ijima, K., Moore, L.C., Goligorsky, Μ.S. (1991) Syncytial organization of cultured rat mesangial cells. Am. J. Physiol. 260, F848–F855. 18. Menè, P., Simonson, Μ.S., Dunn, Μ.J. (1989) Physiology of the mesangial cell. Physiol. Rev. 69, 1347–1424. 19. Menè, P. (2001) Mesangial cell cultures. J. Nephrol. 14, 198–203. 20. Pabst, R., Sterzel, R.B. (1983) Cell renewal of glomerular cell types in normal rats. An autoradiographic analysis. Kidney Int. 24, 626–631. 21. Rupprecht, H.D., Sterzel, R.B. (1997) Glomerular mesangial cells, in Immunologic renal diseases (Neilson E.G., Couser W.G., eds.). Lippincott-Raven, Philadelphia, pp. 595–626.

16


22. Striker, G.E., Killen, P.D., Farin, F.Μ. (1980) Human glomerular cells in vitro: isolation and characterization. Transplant Proc. 12 (Suppl 1), 88–99. 23. Menè, P., Dunn, Μ.J. (1986) Contractile effects of TxA2. and endoperoxide analogues on cultured rat glomerular mesangial cells Am. J. Physiol. 251 (Renal Fluid Electrolyte Physiol. 20): F1029–F1035. 24. Menè, P., Dubyak, G.R., Abboud, H.E., Scarpa, A., Dunn, Μ.J. (1988) Phospholipase C activation by prostaglandins and thromboxane A2 in cultured mesangial cells. Am. J. Physiol. 255 (Renal, Fluid and Electrolyte Physiol. 24): F1059–F1069. 25. Men è, P., Pugliese, F., Faraggiana, T., Cinotti, G.A. (1990) Identification and characteristics of a Na-. /Ca2+ exchanger in cultured human mesangial cells Kidney Int. 38, 1199–1205. 26. Sterzel, R.B., Lovett, D.H., Foellmer, H.G., Perfetto, Μ., Biemesderfer, D., Kashgarian, Μ. (1986) Mesangial cell hillocks. Nodular foci of exaggerated growth of cells and matrix in prolonged culture. Am. J. Pathol. 125, 130–140. 27. Wilson, H.Μ., Stewart, K.N. (2005) Glomerular epithelial and mesangial cell culture and characterization. Methods Mol. Med. 107, 269–282. 28. Ardaillou, R. (1996) Biology of glomerular cells in culture. Cell Biol. Toxicol. 12, 257–261. 29. Menè, P., Fofi, C., Domenici, A., Stoppacciaro, A. (2005) Immunophenotyping glomerular cells in renal biopsies, a novel approach to the diagnosis of kidney diseases. J. Am. Soc. Nephrol. 16, 816A. 30. Elger, Μ., Drenckahn, D., Nobiling, R., Mundel, P., Kriz, W. (1993) Cultured rat mesangial cells contain smooth muscle alpha-actin not found in vivo. Am. J. Pathol. 142, 497–509. 31. Schreiner, G.F., Unanue, E.R. (1984) Origin of the rat mesangial phagocyte and its expression of the leukocyte common antigen. Lab. Invest. 51, 515–523. 32. Gieseler, R., Hoffmann, P.R., Kuhn, R., Fayyazi, A., Stojanovic, T., Schlemminger, R., Peters, J.H. (1997) Enrichment and characterization of dendritic cells from rat renal mesangium. Scand. J. Immunol. 46, 587–596. 33. Ballermann, B.J. (1989) Regulation of bovine glomerular endothelial cell growth in vitro. Am. J. Physiol. 256 (Cell Physiol. 25), C182–189. 34. Pricci, F., Pugliese, G., Menè, P., Romeo, G., Romano, G., Galli, G., Casini, A., Rotella, C.Μ., Di Mario, U., Pugliese, F. (1996) Regulatory role of eicosanoids in extracellular matrix overproduction induced by long-term exposure to high glucose in cultured rat mesangial cells. Diabetologia 39, 1055–1062. 35. Menè, P., Pugliese, G., Pricci, F., Di Mario, U., Cinotti, G.A., Pugliese, F. (1997) High glucose inhibits capacitative Ca2+. influx in cultured rat mesangial cells by a protein kinase C-dependent mechanism. Diabetologia 40, 521–527. 36. Schnaper, H.W., Kopp, J.B., Poncelet, A.C., Hubchak, S.C., Stetler-Stevenson, W.G., Klotman, P.E., Kleinman, H.K. (1996) Increased expression of extracellular matrix proteins and decreased expression of matrix proteases after serial passage of glomerular mesangial cells. J. Cell. Sci. 109:2521–2528. 37. Yaoita, E. (1989) Behavior of rat mesangial cells cultured within extracellular matrix. Lab. Invest. 61, 410–418. 38. Marx, Μ., Daniel, T.O., Kashgarian, Μ., Madri, J.A. (1993) Spatial organization of the extracellular matrix modulates the expression of PDGF-receptor subunits in mesangial cells. Kidney Int. 43, 1027–1041. 39. Floege, J., Radeke, H.R., Johnson, R.J. (1994) Glomerular cells in vitro versus the glomerulus in vivo. Kidney Int. 45, 360–368. 40. Marx, Μ., Dorsch, O. (1997) pp60c-src is required for the induction of a quiescent mesangial cell phenotype. Kidney Int. 51, 110–118. 41. Mooney, A., Jobson, T., Bacon, R., Kitamura, Μ., Savill, J. (1997) Cytokines promote glomerular mesangial cell survival in vitro by stimulus-dependent inhibition of apoptosis. J. Immunol. 159, 3949–3960. 42. Mooney, A., Jackson, K., Bacon, R., Streuli, C., Edwards, G., Bassuk, J., Savill, J. (1999) Type IV collagen and laminin regulate glomerular mesangial cell susceptibility to apoptosis via beta(1) integrin-mediated survival signals. Am. J. Pathol. 155, 599–606.


17

43. Vicart, P., Schwartz, B., Vandewalle, A., Bens, Μ., Delouis, C., Panthier, J.J., Pournin, S., Babinet, C., Paulin, D. (1994) Immortalization of multiple cell types from transgenic mice using a transgene containing the vimentin promoter and a conditional oncogene. Exp. Cell. Res. 214, 35–45. 44. Sraer, J.D., Delarue, F., Hagege, J., Feunteun, J., Pinet, F., Nguyen, G., Rondeau, E. (1996) Stable cell lines of T-SV40 immortalized human glomerular mesangial cells. Kidney Int. 49, 267–270. 45. Mattana, J., Singhal, P.C. (1995) Applied pressure modulates mesangial cell proliferation and matrix synthesis. Am. J. Hypertens. 8:1112–1120. 46. Singhal, P.C., Sagar, S., Garg, P. (1996) Simulated glomerular pressure modulates mesangial cell 72 kDa metalloproteinase activity. Connect. Tissue Res. 33, 257–263. 47. Mertens, P.R., Espenkott, V., Venjakob, B., Heintz, B., Handt, S., Sieberth, H.G. (1998) Pressure oscillation regulates human mesangial cell growth and collagen synthesis. Hypertension 32, 945–952. 48. Mundel, P., Reiser, J., Kriz, W. (1997) Induction of differentiation in cultured rat and human podocytes. J. Am. Soc. Nephrol. 8, 697–705. 49. Rodriguez-Barbero, A., L’Azou, B., Cambar, J., Lopez-Novoa, J.Μ. (2000) Potential use of isolated glomeruli and cultured mesangial cells as in vitro models to assess nephrotoxicity. Cell. Biol. Toxicol. 16, 145–153.

Chapter 2

Isolation and Primary Culture of Human Proximal Tubule Cells David A.Vesey, Weier Qi, Xinming Chen, Carol A. Pollock, and David W. Johnson

Abstract Primary cultures of renal proximal tubule cells (PTC) have been widely used to investigate tubule cell function. They provide a model system where confounding influences of renal haemodynamics, cell heterogeneity, and neural activity are eliminated. Additionally they are likely to more closely resemble PTC in vivo than established kidney cell lines, which are often virally immortalised and are of uncertain origin. This chapter describes a method used in our laboratories to isolate and culture pure populations of human PTC. The cortex is dissected away from the medulla and minced finely. Following collagenase digestion, the cells are passed through a sieve and separated on a Percoll density gradient. An almost pure population of tubule fragments form a band at the base of the gradient. Cultured in a hormonally defined serum-free growth media, they form a tightly packed monolayer that retains the differentiated characteristics of PTC for up to three passages. Keywords Renal proximal tubule cells, Hormonally defined serum free medium, Percoll gradient, Polarised monolayers

1

Introduction

The kidney is a complex organ composed of at least 12 functionally distinct epithelial cell types (1). The proximal tubule cells (PTC), which, along with tubular vasculature, form greater than 80% of the renal cortex, are one of the most prominent epithelial cell types. Not only do they play important roles in fluid, amino acid and sodium reabsorption, they also contribute significantly to pathological changes within the cortical tubulointerstitium (2, 3). In order to study the function of PTC in the absence of confounding influences of other renal cell types, haemodynamics, and neural activity, methods have been developed to isolate and culture these cells. Established cell lines such as the opossum kidney-derived cell line, OK; the porcine tubular epithelial cell line, LLC-PK1; and the human tubular cell line, HK2, exhibit degrees of de-differentiation and loss of PTC-specific biochemical and transport properties (4–7). From: Methods in Molecular Biology, Vol. 466: Kidney Research DOI: 10.1007/978-1-59745-352-3_2, Edited by: T.D. Hewitson and G.J. Becker © Humana Press, Totowa, NJ

19

20

D.A. Vesey et al.

In this chapter we describe a method used in our laboratories for the isolation and culture of human PTC, based on the method of Vinay et al. (8). The cortical tissue is dissected away from the kidney section, minced finely, and digested with collagenase. Following filtration to remove undigested and fibrous tissue, cells are separated on a Percoll gradient. Proximal tubule fragments form a band near the base of the gradient. Using this method, a highly enriched population of proximal tubular fragments and cells can be obtained. Yields are typically in the order of 2 million cells per gram of original cortical tissue. Cultured in a hormonally defined serum-free media, they form confluent polarised monolayers in 5–8 days with a characteristic cobblestone appearance. Dome formation is apparent when the monolayers reach higher confluency. For experimentation, we use these cells at passage 2 when growth and differentiation characteristics are well preserved (9).

2

Materials

1. Water: water for preparation of sterile media and buffers is obtained from a Milli-Q TM water system (Millipore, Billerica, MA, USA). The feed water for this is from a reverse osmosis system. 2. Krebs–Henseleit Solution (KHS): 108 mM NaCl, 4.9 mM KCl, 2.6 mM CaCl2, 3.1 mM NaH2PO4, and 28 mM NaHCO4, adjusted to pH 7.4 and filtered sterilised with a 0.2-µm filter (see Notes 1 and 2). 3. Percoll solution (GE Health Care, Sydney, Australia). Diluted to 45% with double strength KHS before use. 4. Collagenase solution: 30 mg collagenase (Type II, 300–400 U/mg; Worthington Biochemical Company) is dissolved in 30 mL of KHS and filter sterilised with a 0.2-µm filter (see Note 3). 5. Sieve: stainless-steel tissue dissociation sieve with a mesh size of 297 µm (50mesh screen). Heat sterilised before use. 6. Centrifuge tubes: 50-mL sterile polypropylene centrifuge tubes are used throughout the procedure for washing cells. Pre-sterilised 50-mL polycarbonate centrifuge tubes are used for Percoll centrifugation. 7. Cell culture medium: Dulbecco’s Modified Eagle’s Medium (DMEM)/nutrient mixture Ham’s F-12 (DMEM/F-12) supplemented with sodium bicarbonate (Thermo Scientific, Melbourne, Australia). 8. Penicillin/streptomycin: a stock solution of penicillin/streptomycin (5,000 U/mL/5,000 µg/mL) is obtained from Sigma (Sydney, Australia) and is added to culture media at 5 mL per litre. 9. Defined medium supplements: insulin–transferrin–selenium supplement (Cambrex, Melbourne, Australia) is used at 1 mL per litre. The final concentration of insulin, transferrin, and selenium are 5 µg/mL, 5 µg/mL, and 5 ng/mL, respectively. 10 ng/mL epidermal growth factor, 50 nM hydrocortisone, 5 pM triiodothyronine, and 50 µM prostaglandin E1, all from Sigma, are made up as

2 Isolation and Primary Culture of Human Proximal Tubule Cells

21

stock solutions and stored at –80°C before addition to the medium at the final concentrations indicated.

3 3.1

Methods PTC Isolation

All procedures were performed using aseptic techniques. Segments of macroscopically and histologically normal renal cortex (5–10 g) were obtained aseptically from the normal pole of adult human kidneys removed surgically because of small (15,000×g for 10 min at 4°C to pellet RNA (see Note 10). The supernatant is decanted or removed with a clean pipette tip, carefully, so as to not loosen the RNA pellet. When most of the supernatant has been removed, 800 µL of 70% ethanol is gently added per tube and the tubes left at room temperature for 5–10 min to allow the diffusion of salts out of the RNA pellet. The samples are then centrifuged again but this time for 5 min at 7,000×g to avoid compacting the pellet and making it difficult to redissolve. All traces of the supernatant are removed and the RNA allowed to air dry for 3–5 min. Over drying should be avoided as this makes it difficult to redissolve the RNA (see Note 11). 3. When dissolving the RNA, there are essentially two options. Dissolving the RNA in formamide is the best option for long-term storage. The RNA dissolves well, and can be quantitated and used in most downstream applications, except where the proportion of RNA volume to reaction volume is appreciable (>5%). In this case the RNA is precipitated and redissolved in sterile water (see Note 12). Typically we would dissolve tissue sample RNA in a volume of between 2 and 5 µL/mg tissue.

3.4

Tissue Culture Cells

3.4.1

Cell Culture Experiments

Tissue culture cells are treated as per standard protocols dictated by each experiment. The NRK52E rat proximal tubular cells are seeded in 1× DMEM supplemented with 10% serum and antibiotics. The next day the medium is replaced with DMEM containing 2% serum with the treatment, for example 10 ng/mL transforming growth factor (TGF)-β1. At the desired time point, cells are harvested as described below. Typically from a confluent monolayer of cells we would obtain 8–16 µg RNA per well of a 12-well plate, or 15–40 µg per well of a 6-well plate.

3.4.2

Harvesting Cells

1. Tissue culture medium is removed from 6- or 12-well plates by vacuum and the cell monolayers washed once with ice-cold PBS. 2. Cells are lysed by the addition of 0.8 mL TrizolTM directly to each well as the plates are sitting on ice. An alternative protocol is to use the Solution D method (3) (see Note 13).

90

C. Tikellis et al.

3. An optional step at this point is to scrape the cells. In our experience this may marginally increase the yield of RNA. Smaller volumes of TrizolTM can be used but will affect RNA purity and yield (see Note 3). 4. The lysed cells in TrizolTM are aspirated from each well using a 3-mL syringe with a 21-gauge needle and transferred to clean 1.5-mL microfuge tubes. The gDNA is sheared by passing the lysate through the syringe three to five times. This step is important as it affects the viscosity of the sample. At the end of each group of treatments a new syringe is used. All samples are kept on ice till the next step. 5. Samples can be stored at −20°C at this stage for up to 3–4 weeks without compromising RNA quality.

3.4.3

RNA Extraction from Cultured Cells

1. The method is similar to that described above for extraction of RNA from tissue homogenates with some modifications. The entire process is carried out in microfuge tubes. 2. To isolate RNA, 160 µL chloroform/isoamyl alcohol is added to each tube containing cell lysate, the samples are vortexed for 15 s and left on ice 5 min. Samples are then centrifuged at >14,000×g for 7 min at room temperature and the upper aqueous phase carefully removed to new tubes (see Note 8). 3. To precipitate RNA, 480 µL isopropanol is added to each tube, the tubes briefly vortexed, and left at –20°C overnight (see Note 9). Samples are then centrifuged at >14,000×g for 10 min at 4°C (see Note 10) to pellet the RNA precipitate. Very carefully decant the supernatant or remove it with a clean pipette tip. The RNA pellet from a well of a 12-well plate is very small and easy to lose. When most of the supernatant has been removed, 800 µL of 70% ethanol is gently added per tube and the tubes left at room temperature for 5 min to allow the diffusion of salts out of the RNA pellet. 4. The samples are then centrifuged again but this time for 5 min at 7,000×g to avoid compacting the pellet and making it difficult to redissolve. All traces of the supernatant are removed and the RNA allowed to air dry for 3–5 min (see Note 11). 5. The volume to redissolve the RNA depends on downstream applications. Typically we dissolve RNA from tissue culture cells at 10 µL/well of a 12-well plate, or 25 µL/well of a 6-well plate.

3.5

Quantitation of RNA

1. For quantitation of RNA the protocols are fairly standard, with access to a quartz cuvettes and a spectrophotometer required. A dilution of RNA is made in water depending on the cuvette volume (see Note 14) and the absorbance 260 and 280 nm is measured to establish concentration and purity of RNA (see Note 15).

7 Quantitative Gene Expression Analysis in Kidney Tissues

91

2. The concentration of RNA in the sample is calculated based on the formula that an absorbance of 1 at 260 nm is equivalent to 40 µg RNA when measured in water (see Note 16).

3.6

Storage of RNA

All RNA samples are stored at –80°C. At this temperature, samples are relatively stable for a number of years for use with QRT-PCR (see Note 17).

3.7

DNase Treatment of RNA Samples

All current methods of RNA purification result in preparations that are contaminated with gDNA to a varying extent (see Note 18). To remove gDNA the RNA is digested with RNase-free DNase. An optional step would involve the addition of an RNase inhibitor to the sample during the DNA digestion. 1. Typically, 6 µg of RNA is incubated for 20–30 min at 37°C with 1 µL of RNasefree DNase-I (see Note 19) in 1× reaction buffer in a volume of 10 µL as per the DNA-free kit from Ambion. 2. Inactivation reagent (2 µL) is added to each reaction and the samples are mixed and left at room temperature for 2–3 min with occasional mixing (see Note 20). 3. Samples are centrifuged at >14,000×g for 2 min at RT to pellet the inactivation beads and the sample is removed to fresh, labelled tubes for storage at – 80°C (see Note 21).

3.8 cDNA Synthesis Step A standard cDNA synthesis reaction is carried out as follows. The reagents can be purchased from a single manufacturer as a kit or as individual components. We have opted for the later. 1. Mix and briefly centrifuge each component before use. 2. Make up the following Master Mix: DNase treated RNA (see Note 22) Random hexamers (50 ng/µL) Water Final volume

1.8 µL 2.0 µL 6.2 µL 10 µL

3. Mix and centrifuge briefly (pulse) to pellet droplets.

92

C. Tikellis et al.

4. Incubate samples at 70°C for 5 min followed by 1 min on ice (see Note 23). 5. The following reaction mix is prepared, adding each component in the indicated order. The volumes shown are per cDNA reaction (see Note 24): 5× RT Buffer 10 mM dNTP mix 0.1 M DTT Super RNase-InTM(20 U/µL) MMulV (200 U/µL) Water Final mix volume

4 µL 2 µL 2 µL 0.1 µL 1 µL 0.9 µL 10 µL

6. Add 10 µL of reaction mix (step 5 above) to each RNA/primer mix from step 4 above. 7. Gently mix by tapping at the bottom of the tube and then centrifuge briefly (pulse). Incubate at room temp (25°C) for 10 min. 8. Transfer the tubes to 37°C and incubate for 50–60 min. 9. Terminate the reactions by incubating 70°C for 10 min and finally store cDNA at –20°C.

3.9 Quantitative Real-Time PCR 3.9.1

Background

QRT-PCR measures the degradation of a fluorescent-labelled oligonucleotide (referred to as a probe) in real time, concomitant with PCR amplification (5). The probe has a reporter dye at the 5′ end and a quencher dye at the 3′ end (5), and is designed to anneal between the 5′ and 3′ oligonucleotides sites. When the probe first anneals it is intact and thus no fluorescence is emitted. However, during PCR, the probe is cleaved by the 5′ nucleolytic activity of AmpliTaq GoldTM DNA polymerase (ABI), resulting in the separation of the reporter and quencher dyes and subsequently resulting in an energy transfer from the quencher dye to the reporter dye. This process is repeated in every cycle, resulting in the increase in fluorescence, which is measured by the machine. Thus, the accumulation of PCR products is directly monitored by measuring the increase in fluorescence (Fig. 7.1). In the past a passive reference dye (TAMRA) was included in the reaction mixture and acted as an internal control (normalising the reporter dye signal) and correcting for any fluctuations in fluorescence caused by changes in volume or concentration. ABI now produces MGB (Μ, minor binding groove) probes that contain a non-fluorescent quencher (Q) at the 3′ end instead of TAMRA. The major advantage of these MGB probes is that it allows for a more accurate measure of reporter fluorescence (R). A second advantage of MGB probes is that they have a higher melting temperature (Tm), enabling the design and use of shorter probes.

7 Quantitative Gene Expression Analysis in Kidney Tissues Fig. 7.1 Schematic representation summarising the quantitative RT-PCR cycle (see Color Plate 5)

93

Polymerization Forward Primer

R

M Q

5⬘ 3⬘ 5⬘

5⬘ 3⬘ 5⬘

Reverse Primer

Strand Displacement R M Q

5⬘ 3⬘

3⬘ 5⬘

Cleavage R M Q 5⬘ 3⬘

3⬘ 5⬘

Polymerization Completed R

M Q

5⬘ 3⬘

3⬘ 5⬘

5⬘ 3⬘

3⬘ 5⬘

In our laboratory we have standardised on the ABI 7500 Fast PCR platform for a number of reasons. These reasons include the “fast” nature of the amplification reaction (40 min) due to thinner plastic ware and PCR block enhancements, and also the reduced reaction volume, which saves on consumable costs. The work described below was carried out on this platform.

3.9.2

Probe and Primer Design

Probes and primers are selected from cDNA sequences such that intronic sequences are avoided. Where possible, primers are designed to span one or more introns so that only cDNA sequences are amplified during the PCR reaction. Probe/primer design is facilitated with the use of Primer Express software that is part of the Applied Biosystems package. The software automatically sets parameters to favour a standard set of reaction conditions for multiplexing. Briefly:

94

C. Tikellis et al.

1. Probe/primer amplicons are designed to be no longer than 100 bp. 2. Probes are designed such that they do not contain runs of more than three consecutive Gs, contain no Gs at the 5′ end, they are selected from the DNA strand with more Cs than Gs, and the Tm must be between 68 and 70°C. 3. Primers are designed with no runs of more than three consecutive Gs, no more than two GCs in the last five nucleotides at the 3′ end, and the Tm must be between 58 and 60°C. 4. Once potential probe and primer sequences are identified, the resulting amplicon is BLASTed against sequence databases to determine the specificity to the gene of interest (see Note 25) before ordering. We purchase all our probes from ABI. 5. Primers and probes should be made up to a stock solution and working solutions aliquoted and stored at – 20°C (see Note 26).

3.9.3

PCR Reaction Setup

RT-PCR reactions contain 500 nM of forward and reverse primers, 50 nM each of FAM/MGB cDNA probe and VICTM/MGB 18S ribosomal probe, in 1× Taqman Fast Universal Master mix (ABI). Each sample is run and analyzed in triplicate. 1. A master mix consisting of all the reaction components is made up for each probe. Below is the recipe used in our laboratory and includes the 18S probe as our internal endogenous control. Water makes up the remainder of the volume: 18S probe (ABI kit) Specific probe (1 µM stock) Forward primer (10 µM stock) Reverse primer (10 µM stock) TaqMan Fast Universal Master Mix Water Final volume

0.35 µL 0.625 µL 0.625 µL 0.625 µL 6.25 µL 4.025 µL 12.5 µL

2. 12-µL aliquots of the above master mix are added to each well of the PCR plate depending on the number of cDNA samples to be analysed. 3. Finally 0.5 µL (up to 1 µL) of cDNA prepared in Sect. 3.8 above is added to the corresponding wells of the PCR plate. 4. The plate is sealed with adhesive optical covers that are compatible with the ABI 7500 Fast PCR machine (ABI) and inserted into the PCR block for the run to begin. 5. The real-time PCR machine is set according to the dyes being used and this setup should never be altered unless different dyes are used with different probes. We have standardised on the dyes mentioned above to avoid changing the setup on the machine in normal use (see Note 27). 6. When the run has completed, the plate is removed and data is saved for analysis as described below.


3.9.4

95

Quantitative Real-Time PCR

The amplification plots generated by the PCR machine are analysed using the ABI 7500 Fast Real-Time PCR Sequence Detection Software. The amplification of the test gene is compared against the endogenous control. An example of the data generated is shown for kidney RNA in Fig. 7.2. The amplification curves of a gene that is in high abundance, 18S in this example, appear at an earlier cycle number indicated by the curves on left side of the plot. In contrast the curves on the right side are those of angiotensin-converting enzyme (ACE), whose expression in these samples is lower than 18S and hence the curves appear at a higher cycle number. 1. To analyse the amplification curve of a sample, the threshold line (arrow heads on right, Fig. 7.3) is positioned in the linear phase of the exponential curve of PCR amplification. The threshold line can also be set automatically by the software. 2. This threshold line is set above background fluorescence and the fluorescence emitted by the no-template controls (NTC) (see Note 28). 3. Where the fluorescence of a particular sample rises significantly above background and crosses the threshold, a cycle number (Ct) is then recorded (Fig. 7.3). Therefore, if a given sample contains more cDNA for the gene of interest it will result in an earlier emission of fluorescence rising above the threshold and thus recording a lower Ct.

Fig. 7.2 A screen capture of an amplification plot for a typical quantitative real-time PCR (QRTPCR) experiment using the ABI 7500 FAST machine. The amplification curves are typical of multiplexing reactions. In this case the curves to the left are the endogenous 18S gene, while those on the right are for ACE gene expression

96

C. Tikellis et al.

Fig. 7.3 Amplification curves for a FAM- and a VICTM-labelled probe. A threshold line is set in the linear phase of the curve and a cycle number is derived from where the linear curve crosses the threshold line

3.9.5

Optimisation of Probe and Primer Concentrations

For results to be valid, optimisation of each probe and primer combination needs to be conducted prior to their use in the quantitation of gene expression levels in cDNA samples. 1. Probes and primers are tested at the standard concentrations of 50 nM and 500 nM respectively, as recommended by ABI. 2. Optimisation of probe and primer concentrations is conducted by increasing the concentration of probes and primers by 1.2-, 1.5-, and 2-fold in an optimisation experiment. 3. If no increase in Ct value is observed at the standard concentrations, these concentrations are accepted as appropriate for the system and samples employed in the study. However, changes in Ct values imply that the reagents are limiting for the template being used and need to be adjusted. It is important that the reagents be in excess. The standard concentrations are used in our laboratory and have consistently been shown to be adequate for most genes we have studied to date.


3.9.6

97

Housekeeping Genes for Normalisation

The debate still rages concerning which housekeeping gene is the best to use to normalise gene expression data for RNA quality and input, and variation in the efficiency of cDNA synthesis (see Note 29). This issue was highlighted in a recent publication by de Kok et al. (6) who analysed 13 different housekeeping genes and identified the HPRT gene as the best for use in tumour tissues. Laboratories with a gene profiling background have often used the mean expression of a combination of genes to normalise their data. The endogenous housekeeping gene used in our laboratory and by many others in the field is 18S. The reasons are that 18S is expressed in all cell types and is highly conserved amongst many different species. The primers and probe for 18S are available commercially (ABI) in a ready-to-use mixture. Optimisation experiments for using 18S in multiplex PCR are critical since the gene is abundantly expressed in all cells. There is potential danger when using an excess 18S probe/ primer mix, which can lead to the exhaustion of the reaction components and thus effecting amplification of the target gene. It is therefore essential that competitive and non-competitive reactions be conducted to establish conditions that avoid this problem (see Sect. 3.9.8). The choice of 18S as the housekeeping gene is often criticized because of the high level of expression. Although 18S is abundantly expressed, unlike GAPDH or β-tubulin, diseases such as diabetes do not affect the expression of this gene. This needs to be established in each laboratory with respect to the housekeeping gene used and the sorts of samples and diseases under investigation. To establish the validity of 18S in our experiments it was crucial to determine whether the expression level of this gene was altered between sample groups. For example, below is the data for rat kidney cDNA where the expression of ACE was investigated. The ACE probe is labelled with a fluorescent FAM dye. The PCR reactions were multiplex reactions with 18S (labelled with fluorescent VIC dye) as the endogenous housekeeping gene. A comparison was made between cDNA samples from control and diabetic rat kidney samples (Table 7.1). Note the 18S values in both groups. The mean 18S cycle number for the control and diabetic kidney 13.28 versus 13.52 respectively, indicating a similar level of expression between the two groups. To confirm that there is no significant difference in the 18S Ct values between the groups, it is recommended that one-way variance analysis be performed. In contrast the difference in the mean ACE expression between the two groups is about 1.8 cycles, which is a significant difference (p = 0.0042). Thus we can conclude that the expression of ACE is reduced in diabetic kidney compared with control.

3.9.7

Multiplexing

Multiplexing allows the amplification and measurement of both the gene of interest and the endogenous control gene in the same reaction. The probe reporter dye is typically labelled with FAM and the endogenous control probe is labelled with VICTM. Each dye emits fluorescence at different wavelengths when excited by the laser.

98

C. Tikellis et al.

Table 7.1 Comparison of 18S–VIC and ACE–FAM cycle number values between control and diabetic rat kidney samples Group Control Control Control Control Control Diabetic Diabetic Diabetic Diabetic Diabetic Diabetic

ACE–FAM 28.66 30.24 29.6 28.4 28.7 30.3 30.3 31.93 31.71 31.02 30.08

18S–VIC 12.44 13.38 14.38 12.93 13.29 13.72 13.25 13.49 13.62 13.18 13.85

Mean ACE–FAM 29.12

Mean 18S–VIC 13.28

30.89

13.52

Kidney samples from six different animals were analysed in each group

Table 7.2 Comparison of ∆Ct values in multiplexing versus non-multiplexing reactions Non-multiplexing Multiplexing

FAM (Ct)

VIC (Ct)

Ct

28 29

11 12

17 17

To ensure reproducibility and to generate accurate data, competitive (multiplexing) and non-competitive (non-multiplexing) reactions must be carried out with the VICTM-labelled endogenous control probe. The Ct values are extrapolated from the amplification plot (Fig. 7.2) for both probes, and the difference in Ct (∆Ct) is calculated by subtracting the VIC Ct from the FAM Ct. When the ∆Ct values for multiplexing versus non-multiplexing are identical (or within 0.8 of a cycle), multiplexing experiments are valid (Table 7.2) because the reactions for each probe do not interfere with one another.

3.9.8

Relative Efficiency

The relative efficiency of PCR amplification is used to demonstrate equal amplification efficiencies of both the FAM-labelled probe and the 18S probe in multiplex reactions over different initial template concentrations. This is carried out by varying the amount of template cDNA in the PCR reaction, determining the ∆Ct values for these reactions, and finally plotting ∆Ct versus total cDNA concentration. A line of best fit is then drawn and the value of the slope should be < 0.1, which demonstrates that varying the initial template amount does not significantly alter the ∆Ct value (Fig. 7.4). This ensures accurate and reproducible results in multiplexing reactions.


99

20

∆Ct

17.5

15

12.5

10

100

50

25

12.5

6.25

3.125

cDNA (ng) Fig. 7.4 Relative efficiency plot for ACE amplification. The ∆Ct value is shown for each of the starting concentrations of cDNA

3.9.9

Quantitation Gene Expression by RT-PCR

QRT-PCR is a fully quantitative method for determining cDNA levels of specific genes that correspond to mRNA level of those genes in the original sample. The method used to obtain relative gene expression data is the comparative Ct method previously described by Livak (7). In this method a “calibrator” sample is used as a baseline for comparison of the level of gene expression for every unknown sample. In the case study outlined below the calibrator group is the control group. The calculations first involve the subtraction of the 18S Ct value from the Ct value of the FAM probe resulting in the differential Ct or ∆Ct value. The average ∆Ct value is then calculated for the calibrator group and this is subtracted from the ∆Ct value of every sample, including the ∆Ct values of the calibrator group. The resulting value is the ∆∆Ct, and this value is used in the equation, 2–∆∆Ct to derive the fold induction (FI) value. All means, standard error of means, and statistics are calculated using this value.

3.10

Case Studies

3.10.1

Case Study with RNA from Rat Kidney

A case study is outlined here to demonstrate a practical use for QRT-PCR. RNA was isolated and cDNA was synthesised as described above. The aim was to compare ACE mRNA levels in diabetic rat kidney to control rat kidney. The ACE probe is labelled with FAM fluorescent dye. The 18S probe is used as the endogenous

100

C. Tikellis et al.

Table 7.3 Comparison of the FI reveals that ACE mRNA levels in diabetic rat kidney are significantly reduced (mean FI, 0.4±0.2; p< 0.01) as compared with ACE mRNA levels in control rat kidney (mean FI, 1.09±0.44) Group

ACE–FAM

18S–VIC

∆Ct

∆∆Ct

FI

Mean FI

STDV

SE

Control Control Control Control Control Diabetic Diabetic Diabetic Diabetic Diabetic Diabetic

28.66 30.24 29.6 28.4 28.7 30.3 30.3 31.93 31.71 31.02 30.08

12.44 13.38 14.38 12.93 13.29 13.72 13.25 13.49 13.62 13.18 13.85

16.22 16.86 15.2 15.46 15.43 16.53 17.1 18.44 18.09 17.84 16.23

0.38 1.02 –0.64 –0.38 –0.41 0.69 1.26 2.6 2.25 2 0.39

0.77 0.49 1.56 1.30 1.33 0.62 0.42 0.16 0.21 0.25 0.76

1.09

0.44

0.20

0.40

0.20

0.08

housekeeping gene and is labelled with VIC fluorescent dye. FI in each case is calculated and shown in Table 7.3. ACE expression in diabetic kidney is significantly reduced (0.4±0.2; p 20,000 Da). Larger proteins require additional laser energy to “fly”, hence the laser settings should be adjusted accordingly and increased during data acquisition within the higher mass range. Data subsequently generated can be represented in spectra or virtual gel view. A summary of the array processing/data acquisition method is shown in Fig. 17.1.

3.9

Data Analysis

Once data has been collected, prepare spectra for biomarker assessment by performing the following: baseline subtraction, calibration, noise definition, and normalisation.

17 Protein Profiling in the Kidney

245

a

b

c

d

e 2500

3000

3500

4000

Intensity

15 10

spectra view

5 0 virtual gel view

f

Mass (Da)

Fig. 17.1 SELDI-TOF MS Analysis. Arrays with specific chromatographic properties (a) are equilibrated in binding buffer. Samples are applied to the array surface and incubated for 1 h (b). Arrays are washed to remove non-specifically bound proteins (c), followed by EAM application (d). The fraction of the proteome retained on the array is directly analysed by TOF-MS, resulting in a profile of proteins characterised by the m/z and signal intensities (e, f). Data is represented in spectra or virtual gel view (f). Figure adapted from ProteinChip™ technology training course (Bio-Rad Laboratories) (see Color Plate 9)

246

3.9.1

E. Giannakis et al.

Baseline Subtraction

Baseline “noise” is a combination of electronic and chemical (EAM) noise and is controlled by the baseline subtraction function. Generally, the default settings are sufficient to stabilise the baseline, however, to ensure the baseline closely follows the spectrum, the fitting width values can be reduced.

3.9.2

Calibration

In order to ensure reliable mass accuracy, it is important to calibrate each spectrum. Create a calibration equation using standards that span the appropriate mass range combined with the corresponding matrix used for sample analysis. Apply the calibration equation to relevant spectra.

3.9.3

Noise Definition

Define the area in which local noise will be calculated. Typically the EAM portion of the spectra is excluded from the calculation; hence local noise is usually defined from ∼1,500 Da onwards.

3.9.4

Normalisation

Normalisation by total ion current is commonly employed for profiling studies. It involves linearly scaling the intensities to account for slight variations between spectra. The EAM portion of the spectrum is excluded from such calculations; hence the lower m/z limit is set to ∼1,500 Da onwards.

3.9.5

Biomarker Analysis

Peak clustering tools are used to search the spectra for potential biomarkers. Clustering tools group peaks of the same molecular weight across all samples and display the differences in expression between sample groups in the form of scatter or box and whiskers plots. P values are also ascertained to display the statistical significance in protein expression between groups (Fig. 17.2). Clusters with P values < 0.05 should be inspected manually to ensure that the software is not clustering on noise and the peak has been correctly labelled with the centroid function in the centre of the peak, and not to the side of the peak.

17 Protein Profiling in the Kidney 10000

247 15000

20000

15

Control

7.5 0

Intensity

15 7.5

Control

0 15 7.5

UUO 0 15 7.5

UUO

0

a 10000

15000

20000

Control

Intensity

Control

UUO

UUO

b 6

P = 0.01

Intensity

5 4 3 2 1 0

c

Control

UUO

Fig. 17.2 SELDI-TOF MS analysis of kidney tissue from healthy mice (control) and mice with unilateral ureteric obstruction (UUO). SELDI-TOF MS analysis of normal tissue and tissue from kidneys in which the ureter has been obstructed for 3 days (a, b). Data is represented in both spectra and virtual gel view. A potential biomarker upregulated in the disease group is highlighted and represented in a scatter plot (c), which displays the expression differences between sample groups

248

E. Giannakis et al.

3.10

Purification and Identification of Biomarkers

As a first step in the biomarker purification process, it is initially recommended to perform retentate chromatography with the ProteinChip™ array used to discover the biomarker. Retentate chromatography involves applying the sample containing the peak of interest to every spot on an array. Each spot is then washed with a buffer of increasing stringency, for example if the biomarker was identified on Q10 arrays using pH 9 buffer, the following buffers can be used during the washing procedures: Spot A: pH 9, Spot B: pH 8, Spot C: pH 7, etc. This approach will determine when the peak of interest elutes from the surface. These conditions can then be replicated on spin columns. As an extra confirmatory step, it is recommended to analyse the eluant on an array to ensure the elution fraction contains the peak of interest. It may be necessary to complete several column runs, particularly if the protein of interest is not present in high concentrations. Elution fractions can subsequently be pooled/ concentrated using a vacuum concentrator or freeze drier and electrophoresed on a 1D sodium dodecyl sulphate (SDS) polyacrylamide gel electrophoresis (PAGE) gel. After excising the band and eluting the protein from the gel, it is recommended to analyse a fraction of the sample on a NP20 array to confirm the band is the correct molecular mass (see Note 12). Once purified, standard sequencing methodologies such as Edman degradation, peptide mass fingerprinting or tandem mass spectrometry (matrix-assisted laser desorption ionisation [MALDI]-TOF/TOF) can be employed to determine the identity of the unknown protein.

4

Notes

1. It is important to employ a standard operating procedure for collection and handling of tissue to ensure that differences detected between sample groups are a reflection of the phenotypes being examined rather than a consequence of variations introduced during tissue processing. 2. Use consumables with low protein binding plastics such as polypropylene. Ensure the same consumables are utilised throughout the duration of the study. 3. Most common buffers, salts, and non-ionic detergents are compatible with the SELDI-TOF MS system, however, certain chemicals should be avoided. EDTA will strip metal ions from IMAC surfaces. High concentrations of ionic detergents such as SDS will suppress ionisation. DTT and PEG can also be problematic and hence should be avoided. 4. Subjecting samples to several freeze–thaw cycles can generate degradation products/oxidative modification (+16 Da mass shift) and alter the resulting profile. 5. It is critical to ensure that all samples are identical in regards to protein concentration and the final buffer constituents. The protein concentration affects peak number and intensity. The final buffer constituents of the sample (pH, salt concentration, etc.) affect the binding stringency and resulting profiles. 6. For each new experiment it is important to initially determine the optimal protein concentration by performing a series of titrations in replicates. The conditions that yield the highest peak count and reproducibility should be selected. In general it is recommended to use protein extracts within a concentration range of 50–2,000 µg/mL. As the capacity of the array varies

17 Protein Profiling in the Kidney

7. 8.

9.

10. 11. 12.

249

for each chip type, depending on the surface chemistry, it can be advantageous to optimise the protein concentration for each type of array. During chip handling use non-latex powder-free gloves such as nitrile. Latex contamination can generate a series of peaks complicating spectra analysis. Sample addition: if processing large numbers of samples, it is advisable to dispense samples in a 96-well polypropylene plate using the same format that will be applied to the bioprocessor. After equilibrating arrays, the samples can simply be transferred from the plate into the bioprocessor using a multichannel pipette. Samples should be incubated on the array for a minimum of 60 min to ensure the reaction has reached equilibrium, this will improve reproducibility. It is also advisable to randomise samples to reduce systematic bias and include replicates to assess assay reproducibility. Washing arrays with 1 mM HEPES, pH 7.2 buffer is conducted to remove contaminants such as detergent and salts. Detergents create a series of low molecular weight peaks that can complicate data interpretation. The presence of salts e.g. Na+ and K+ can lead to the generation of salt adducts that can interfere with data analysis and decrease sensitivity. Ensure that the EAM drying time does not exceed 20 min, extended incubations can decrease peak intensity and negatively influence assay reproducibility. Use a 2-µL calibrated pipette for matrix addition. Ensure the method of EAM application, including drying time, is consistent as this can affect the assay reproducibility. During development of the purification strategy it is beneficial to screen various arrays to determine if the biomarker binds to other surfaces. This may provide another means of separating and enriching for the protein of interest.

Acknowledgments This work was supported in part by a National Health & Medical Research Council (NHMRC) R.D.Wright/National Heart Foundation of Australia (NHFA) Career Development Fellowship to C.S.S and an Ian Potter Foundation grant to the Howard Florey Institute.

References 1. Janech, M.G., Raymond, J.R., and Arthur, J.M. (2007). Proteomics in renal research. Am. J. Physiol. Renal Physiol. 292: F501–F512. 2. Bonventre, J.V. (2002). The kidney proteome: A hint of things to come. Kidney Int. 62: 1470–1471. 3. Issaq, H.J., Veenstra, T.D., Conrads, T.P., and Felschow, D. (2002). The SEDLI-TOF MS approach to proteomics: protein profiling and biomarker identification. Biochem. Biophys, Res. Com. 292: 587–592. 4. Wiesner, A. (2004). Detection of tumor markers with ProteinChip technology. Curr. Pharm. Biotechnol. 5: 45–67. 5. Tang, N., Tornatore, P., and Weinberger, S.R. (2004). Current developments. In: Seldi Affinity Technology. Mass Spectrometry Reviews. 23: 34–44. 6. Fung, E.T., Yip, T.T., Lomas, L., Wang, Z., Yip, C., Meng, X.Y., Lin, S., Zhang, F., Zhang, Z., Chan, D.W., and Weinberger, S.R. (2005). Classification of cancer types by measuring variants of host response proteins using SELDI serum assays. Int. J. Cancer. 115: 783–789.

Chapter 18

In Vivo Transfer of Small Interfering RNA or Small Hairpin RNA Targeting Glomeruli Yoshitsugu Takabatake, Yoshitaka Isaka, and Enyu Imai

Abstract Small synthetic interfering RNA duplexes (siRNAs) can selectively suppress gene expression in somatic mammalian cells without the nonselective toxic effects associated with double-stranded RNA (dsRNA). However, in vivo delivery of siRNA targeting the kidney has been described in only a few reports. We have found that injection of synthetic siRNAs via the renal artery, followed by electroporation, can be therapeutically effective in silencing the expression of specific genes in the glomerulus. Here we provide details of an experimental protocol showing that 1) delivery of siRNA targeting enhanced green fluorescent protein (EGFP) to the kidney in the transgenic “green” rat reduces endogenous EGFP expression, mainly in the glomerular mesangial cells, and that 2) delivery of siRNA targeting transforming growth factor (TGF)-β1 to the kidney significantly suppresses messenger RNA (mRNA) and protein expression of TGF-β1, thereby ameliorating the progression of matrix expansion in experimental glomerulonephritis. In addition, we describe the application of vector-based RNA interference (RNAi) (small hairpin RNA [shRNA]), which also inhibits TGF-β1 expression in vivo. Keywords: Electroporation, Enhanced green fluorescent protein; RNA interference; Small interfering RNA; Small hairpin RNA

1

Introduction

RNA interference (RNAi) is initiated by the introduction of double-stranded RNA (dsRNA) into the cell and leads to the sequence-specific destruction of endogenous RNA [1]. RNAi-induced gene-specific silencing has proven successful in Caenorhabditis elegans and plants. However, the use of long dsRNA in vertebrates is problematic because they induce a generalized suppression of protein synthesis and cell death by activating the interferon pathway. Tuschl et al. made a crucial breakthrough, finding that small synthetic interfering RNA duplexes (siRNAs) can selectively silence the expression of complementary genes in somatic mammalian cells without the nonselective toxic effects associated with long dsRNAs [2]. These observations in mammalian cells not only permitted the next generation of From: Methods in Molecular Biology, Vol. 466: Kidney Research DOI: 10.1007/978-1-59745-352-3_18, Edited by: T.D. Hewitson and G.J. Becker © Humana Press, Totowa, NJ

251

252

Y. Takabatake et al.

genetic research to occur, but also allowed the development of new therapeutic approaches. An important step in realizing the potential of RNAi as a therapeutic tool is determining whether this mechanism can be triggered in vivo. Recently, we developed an electroporation-mediated siRNA transfer system targeting the kidney, whereby siRNA is injected via the renal artery, then electric pulses are applied using tweezers-type electrodes [3]. This system allows us to deliver siRNA mainly to the glomeruli, a region central to the inflammatory response in the initiation and progression of various kidney diseases. To prove the therapeutic application of transfected siRNA in an animal disease model, we targeted transforming growth factor (TGF)-β1, a potent cytokine that plays an important role in the fibrogenic phase of various diseases, including glomerulonephritis. Also, we examined the efficacy of a siRNA-producing DNA-based vector system (small hairpin RNA [shRNA]). Here, we provide details of the protocol used to conduct siRNA or shRNA transfer via the renal artery.

2

Materials

2.1

2.1.1

siRNA-Mediated Inhibition of Enhanced Green Fluorescent Protein (EGFP) Expression in Glomeruli Preparation of siRNA Targeting EGFP

1. siRNAs (21 nucleotides long) targeting EGFP and the scrambled genes were chemically synthesized as 2′ bis (acetoxyethoxy)-methyl ether-protected oligonucleotides, deprotected, annealed, and purified by Dharmacon Research (Lafayette, CO, USA). The strands of siRNA targeting EGFP are 5′-P. GGCUACGUCCAGGAGCGCACC-3′ (sense) and 5′-P.UGCGCUCCUGGACGUAGCCUU-3′ (antisense) [4]. Aliquots of 20 µM siRNA solution in 1× annealing buffer (100 mM KOAc, 30 mM HEPES-KOH pH 7.4, and 2 mM MgOAc) can be stored at –20°C.

2.1.2 1. 2. 3. 4. 5.

Transfer of siRNA Targeting EGFP Via the Renal Artery

siRNA dilution buffer: nuclease-free phosphate-buffered saline (PBS). Catheter: 24-gauge (cat no. SR-OT2419CW; Terumo, Tokyo, Japan). Injection needle: 26-gauge (Terumo). Syringe: 1 mL and 2.5 mL with lock system (Terumo). Animals: individuals of the “green” transgenic rat line SD-TgN (act-EGFP) Osb4 8 [5], weighing approximately 200 g (Japan SLC, Inc., Hamamatsu, Japan) (see Note 1).

18 In Vivo Transfer of siRNA to the Kidney

253

6. Pentobarbital: 50 mg/mL (Dainippon Sumitomo Pharma, Osaka, Japan). 7. Shaver (commercial). 8. Povidone–iodine solution. 9. Papaverine hydrochloride: 40 mg/mL (Dainippon Sumitomo Pharma). 10. “Pillow”: fold a paper towel into a pad measuring approximately 5×20×3 cm and wrap with aluminum foil. 11. Aneurysm clip: Sugita aneurysm clip (cat nos. 07-940-01 or 07-940-96; Mizuho-ika Kogyo, Tokyo, Japan). 12. Forceps for aneurysm clip (cat nos. 07-941-01 or 07-942-01, straight type; Mizuho-ika Kogyo). 13. Other anatomical instruments, including scissors and retractor. 14. Surgical glue: Aron Alfa A “Sankyo” (Toagosei, Tokyo, Japan). 15. Cotton swab. 16. Ampicillin sodium (cat no. 012-20162; Wako, Osaka, Japan): dissolved in PBS at a concentration of 20 mg/mL. 17. Skin stapler (Igarashi-ika Kogyo, Tokyo, Japan). 18. [Optional] Oval-shaped tweezer-type electrodes; 15×10 mm, specifically ordered from BTX (San Diego, CA, USA). 19. [Optional] Electric pulse generator (Electro Square Porator T820M; BTX). 20. [Optional] Switch box (MBX-4; BTX). 21. [Optional] Graphic pulse analyzer (Optimizor 500; BTX).

2.1.3

Assessment of EGFP Expression in the Glomeruli

1. Syringe: 20 mL. 2. Four percent (w/v) paraformaldehyde (PFA) solution (pH 7.4). Store at 4°C. Use within 1 week after preparation. 3. Ten percent (also 20% and 30%) sucrose in PBS: dissolve 10 g (or 20 or 30 g) of sucrose in 100 mL of PBS and autoclave at 105 ° C for 1 min. Store at 4°C. 4. OCTTM compound (Tissue-Tek ΤΜ, Sakura Finetek USA, Inc., Torrance, CA, USA). 5. Liquid nitrogen. 6. Wash buffer (TBST): 20 mM Tris-HCl (pH 7.5), 137 mM NaCl, and 0.1% Tween 20 (v/v). 7. Blocking solution: 5% (v/v) normal horse serum in TBST. 8. Primary antibody: clone OX-7 (gift from Dr. Ken-ichi Isobe and Prof. Seichi Matsuo, Nagoya University, Nagoya, Japan) (see Note 2). Dilute in blocking solution at 1:100 just before use. 9. Texas red-conjugated anti-mouse IgG (Vector Laboratories, Inc., Burlingame, CA, USA). Dilute in blocking solution at 1:200 just before use. 10. Mounting medium: PermaFluor ΤΜ Aqueous Mounting Medium (cat no. 434990; Thermo ELECTRON Corp.).

254

2.2


siRNA-Mediated Inhibition of TGF-b1 in the Glomeruli

2.2.1 2.2.1.1

Preparation of siRNA or siRNA Expression Vector Targeting TGF-b1 siRNA

1. siRNAs (21 nucleotides long) targeting TGF-β1 and the scrambled genes are chemically synthesized as 2′ bis (acetoxyethoxy)-methyl ether-protected oligonucleotides, deprotected, annealed, and purified by Dharmacon Research. The strands of siRNA targeting TGF-β1 are 5′-P.GUCAACUGUGGAGCAACACdTdT3′ (sense) and 5′-P.GUGUUGCUCCACAGUUGACdTdT-3′ (antisense) [3]. Aliquots of 20 µM siRNA solution in 1× annealing buffer (100 mM KOAc, 30 mM HEPES-KOH pH 7.4, and 2 mM MgOAc) can be stored at –20°C.

2.2.1.2

siRNA Expression Vector

1. A pair of oligodeoxynucleotides (64 nucleotides long), encoding shRNAs targeting TGF-β1 and with a BamHI or HindIII site are synthesized by Bex (Tokyo, Japan). The sequences of the oligodeoxynucleotides are shown in Fig. 18.3a. 2. siRNA expression vector featuring the human U6 RNA pol III promoter: pSilencer 2.0-U6 siRNA expression vector (0.1 mg/mL; Ambion, Inc., Austin, TX, USA). 3. 5× Annealing buffer: 0.5 M Tris-HCl (pH 7.4) and 0.35 M MgCl2. 4. TE: 10 mM Tris-HCl and 1 mM EDTA (pH 8.0). 5. 4× Ligation buffer: 200 mM Tris-HCl (pH 7.6). 6. Ligation enzyme: solution I in the DNA Ligation Kit Ver. 2.1 (Takara, Shiga, Japan). 7. Plasmid DNA purification kit: High Purity Maxiprep ΤΜ Plasmid Purification Kit (Marligen Biosciences, Urbana Pike Ijamsville, MD, USA). 8. [Others] LB plate, competent Escherichia coli cells (JM109).

2.2.2

Animals and Induction of Thy-1 Nephritis

1. Sprague-Dawley (SD) rats (Japan SLC, Inc.), weighing approximately 200 g (see Note 1). 2. Pentobarbital: 50 mg/mL (Dainippon Sumitomo Pharma). 3. Monoclonal antibody (mAb) 1-22-3 (kind gift from Dr. H. Kawachi of Niigata University) (see Note 3).


255

2.2.3

Transfer of siRNA or siRNA Expression Vector Targeting TGF-b1 Via the Renal Artery (See Sect. 2.1.2)

2.2.4

Assessment of TGF-b1 Expression in the Glomeruli

1. Sieving mesh: pore sizes 125 µm, 180 µm, and 75 µm (Bunsekifurui, Tokyo, Japan). 2. Tissue grinder (1 mL Dounce Tissue Grinder; Wheaton Science Products, Millville, NJ, USA). 3. Lysis buffer: 50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1%(v/v) Nonidet-P40, 10% (v/v) glycerol, 1 mM PMSF, 1 µg/mL aprotinin, 1 µg/mL leupeptin, and 0.5 mM sodium orthovanadate. 4. 3× Laemmli buffer. 5. 15% Sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis (PAGE) gel. 6. 10× SDS-PAGE running buffer: 250 mM Tris, 1.92 M glycine, and 1% (w/v) SDS in 1 L distilled water. Store at room temperature. Dilute with distilled water just before use. 7. 1× Transfer buffer: 25 mM Tris, 192 mM glycine, 20% methanol in 1 L distilled water. Adjust pH to 8.3. Store at 4°C. 8. Polyvinylidene difluoride membrane (Hybond-P PVDF Membrane; Amersham Biosciences). 9. TBST: 20 mM Tris-HCl (pH 7.5), 137 mM NaCl, and 0.1% Tween 20 (v/v). 10. Blocking solution: 5% (v/v) bovine serum albumin in TBST. 11. Primary antibody: polyclonal antibody against TGF-β1 (Promega, Madison, WI, USA). 12. Secondary antibody: horseradish peroxidase-conjugated goat anti-rabbit IgG (Dako, Glostrup, Denmark). 13. Chemiluminescent reagent: SuperSignal West Pico Chemiluminescent Substrate (Pierce, Rockford, IL, USA). 14. X-ray film: Hyperfilm ΤΜ (Amersham Biosciences). 15. BCA ΤΜ protein assay reagent (Pierce).

3

Methods

We usually use electroporation when transfecting siRNA, antisense oligodeoxynucleotides (ASODN) or DNA vectors (including siRNA expression vectors) via the renal artery because electroporation increases the transfection efficiency, especially for DNA vectors [6], but we and other groups have demonstrated that a substantial amount of siRNA or ASODN can be successfully transfected into the glomeruli without electroporation (data not shown), with hydrodynamic pressure as one of the

256


main driving forces. Electroporation devices are very costly, and the electrode must be specially ordered. Therefore, we recommend that this protocol is first attempted without electroporation; here we have described the protocols that are related to electroporation as being optional.

3.1

3.1.1

siRNA-Mediated Inhibition of EGFP Expression in the Glomeruli Preparation of siRNA Targeting EGFP

1. Dilute 50 µg of siRNA solution for EGFP and the scrambled gene in 500 µL of nuclease-free PBS, respectively. Store the solution at room temperature until transfection and use within several hours (see Note 4).

3.1.2

Transfer of siRNA Targeting EGFP Via the Renal Artery

1. Fill two or more 1-mL syringes with PBS. Attach the 26-gauge needle to one syringe. Expel the air from the syringes. 2. Remove the flashback chamber of a 24-gauge catheter and flush with PBS (keep the chamber off hereafter). 3. Fill the 2.5-mL syringe with the siRNA solution and expel the air carefully. 4. Anesthetize EGFP-transgenic rats via intraperitoneal injection of pentobarbital (50 mg/kg). 5. Shave the hair around the rats’ abdomens and disinfect with povidone–iodine or ethanol. 6. Make a midline incision from the bladder to the xiphoid process. 7. Set the retractor and place the “pillow” beneath the body. 8. Move the digestive tract downward and to your left side to reveal the left kidney and renal artery. 9. Peel off the retroperitoneum around the root of the left renal artery using a cotton swab and/or small forceps (Fig. 18.1a). 10. Expose the aorta at the level of the left renal artery and its proximal site and remove excessive connective tissue (see Note 5). 11. Drop a small amount of papaverine hydrochloride around the outcrops of the aorta to avoid vasoconstriction. 12. Move to the head side of the rat. Puncture the aorta (not the renal artery) using a 24-gauge catheter where it branches into the left renal artery using your right hand while creating some tension in the renal artery using your other hand (see Notes 6 and 7) (Fig. 18.1b). Observe for “flash back” as blood slowly fills the catheter. After insertion of both the stylet and the catheter, advance only the catheter ~5 mm further into the left renal artery and remove the needle. 13. Fill the end of the catheter hub with a small amount of PBS, using a syringe with needle to avoid infusing air (repeat this step whenever a new syringe is connected to the catheter).

Fig. 18.1 Method used to transfer the siRNA via the renal artery. a Peel off the retroperitoneum around the root of the left renal artery (dotted line). b Puncture the aorta with a 24-gauge catheter. Transverse section is also shown (aorta, arrow; catheter, arrowhead). c Advance the catheter into the left renal artery and clamp the aorta with an aneurysm clip (clamp 1; arrow). d Connect the syringe filled with siRNA solution. e Infuse the siRNA solution using a single shot. Immediately after injection, clamp at the renal hilum (clamp 2; arrow). f When you attempt the electroporation method, clamp the renal vein and artery together with catheter (clamp 3; arrow). g Sandwich the left kidney between a pair of electrodes and deliver electric pulses. h After removal of the clamp(s) except clamp 1, pipette a small amount of surgical glue onto the puncture.

258


14. Connect the 1-mL syringe filled with PBS to the catheter and inject ~500 µL of PBS. If the kidney is perfused thoroughly (i.e., if the kidney becomes yellow), the catheter is inserted properly. Disconnect the syringe. If the kidney is not perfused thoroughly (for example only the upper portion is perfused), it is likely that the catheter is inserted beyond the branching portion of the renal artery, so retract the catheter carefully and repeat the perfusion (see Note 8). 15. Clamp the aorta with an aneurysm clip proximal to the left renal artery (clamp 1) (Fig. 18.1c). 16. Repeat step 14 to completely remove the red and white blood cells. 17. Connect the 2.5-mL syringe (with lock system) filled with siRNA solution to the catheter while fixing the tube with forceps to avoid accidental removal (Fig. 18.1d). 18. Retract the catheter and syringe carefully to the greatest extent possible. 19. Infuse the siRNA solution into the left kidney using a single shot (within 1 s). 20. [Assistant] Clamp the renal artery and vein together with the retroperitoneum with an aneurysm clip at the renal hilum immediately after injection (clamp 2) (Fig. 18.1e). 21. [Optional] Clamp the renal vein together with the catheter (and renal artery) with an aneurysm clip at the proximal portion of the left renal artery (clamp 3) so that the catheter does not come out of the renal artery when the electric pulse is delivered in the next step (Fig. 18.1f). 22. [Optional] [Operator] Hold the rat on the table with both hands, because the rat will move during electroporation. [Assistant] Sandwich the left kidney between a pair of oval-shaped tweezer-type electrodes (Fig. 18.1g). Deliver electric pulses. Administer six pulses of 100 V at a rate of one pulse per second, with each pulse being 50 ms in duration. 23. Remove one or two clamps (clamp 2 and clamp 3 if applied), but not the clamp at the most proximal site (clamp 1). 24. [Operator] Place your fingers over the proximal and distal puncture sites and remove the catheter. Pipette a very small amount of surgical glue onto the puncture sites immediately after wiping the blood away using a cotton swab (Fig. 18.1h). Wait about 30 s, then remove your fingers slowly. After confirming hemostasis, remove clamp 1 (see Note 9). 25. Place 20 mg of ampicillin solution into the peritoneal cavity. 26. Suture the abdominal muscle and skin separately by using a skin stapler.

3.1.3

Assessment of EGFP Expression in the Glomeruli

1. Seven days after transfection, perfuse the rats with 20 mL of ice-cold PBS via the abdominal aorta. 2. Remove the kidneys, then slice them about 1-mm thick and immerse in icecold 4% neutral-buffered PFA solution for 4–6 h (see Note 10).


259

3. Wash the kidney sections in PBS several times and place in 10% sucrose in PBS (see Note 11). 4. Replace the 10% sucrose solution with a 20% sucrose solution ~5 h later. 5. Replace the 20% sucrose solution with a 30% sucrose solution ~5 h later. 6. The next day, embed the kidney sections in OCT ΤΜ compound on a metal block chilled in the liquid nitrogen, and then freeze the sections to -80°C. 7. Using a cryostat, section the kidney further at 4-µm thick, and then air-dry the sections on glass slides at room temperature for 1 h. 8. Wash the sections in distilled H2O three times for 5 min each. 9. Wash the sections in wash buffer for 5 min. 10. Block each section with ~100 µL blocking solution for 30–60 min. 11. Remove the blocking solution and add ~100 µL of diluted primary antibody to each section. Incubate overnight at 4°C. 12. Remove the antibody solution and wash the sections in wash buffer three times for 5 min each. 13. Add ~100 µL of Texas red-conjugated secondary antibody to each section. Incubate for 30 min at room temperature. 14. Wash the sections in wash buffer for 5 min. 15. Mount cover slips on the slides using mounting medium. Store slides at room temperature in the dark. For longer periods, store at 4°C. 16. Photograph the green fluorescence of EGFP and red fluorescence on the same film using a double exposure. Examples of the photographs are shown in Fig. 18.2.

3.2

siRNA or shRNA-Mediated Inhibition of TGF-b1 in the Glomeruli

3.2.1 Preparation of siRNA and siRNA Expression Vector Targeting TGF-b1 3.2.1.1

siRNA

1. Dilute 50 µg of siRNA for TGF-β1 and scrambled gene solution in 500 µL nuclease-free PBS, respectively. Store the solution at room temperature until transfection and use within several hours (see Note 4).

3.2.1.2

Cloning Hairpin siRNA Inserts into siRNA Expression Vector

1. Dissolve each hairpin siRNA oligonucleotide (64 nt) in TE at 250 pmol/µL. 2. Annealing: assemble 5 µL of each of the sense and antisense hairpin siRNAencoding oligonucleotides in an Eppendorf tube (total 10 µL) and heat the mixture to 90°C for 10 min. 3. Add 2.5 µL of 5× annealing buffer and incubate at 90°C for 5 min.

260


Fig. 18.2 siRNA-mediated silencing of EGFP expression in the glomerular cells. siRNA targeting EGFP was transferred to the kidney of EGFP-transgenic rats via the renal artery using the electroporation method. Fluorescence micrographs of glomeruli in the siRNA-transfected (right) and contralateral (left) kidney were taken 7 days after transfection (upper panels). Sections were stained with Texas red-labeled OX-7 antibody, a marker of mesangial cells (middle panels), and the merged photos are shown in the lower panels (original magnification, ×400). In the transfected kidney, EGFP expression was diminished substantially in almost all of the glomeruli (> 95%), whereas it was unchanged in the tubules. This inhibition seemed nearly complete in the mesangial cells, whereas in other glomerular cells, endothelial and epithelial cells, inhibition of EGFP expression was not observed. The reduction of mesangial EGFP expression was observed for up to 2 weeks, and had recovered completely by 3 weeks after transfection (data not shown) (reproduced from ref. [3]) (see Color Plate 10)

4. Cool the solution slowly to room temperature. The annealed siRNA insert can be stored at -20°C for future ligation. 5. Dilute 1 µL of the annealed siRNA insert in 100 µL nuclease-free water. 6. Ligation: assemble 20 µL of ligation mix (1 µL of pSilencer vector [linearized, 0.1 mg/mL], 0.5 µL of the diluted annealed siRNA insert, 5 µL of 4× ligation buffer, 3.5 µL of nuclease-free water, and 10 µL of solution I) and incubate at 16°C for 1 h. 7. Transform 50 µL of transformation-competent E. coli cells with 5 µL of the ligation mix. 8. Plate cells onto LB plates containing 50–200 mg/mL ampicillin overnight at 37°C.


261

9. Pick colonies, isolate the plasmid DNA, and use restriction digestion analysis to confirm the presence of the siRNA insert. 10. Purify the siRNA-expressing plasmid for transfection using the High Purity Maxiprep Plasmid Purification Kit. Store the plasmid solution at -20°C until transfection. 3.2.2

Induction of Thy-1 Nephritis

1. Anesthetize SD rats via intraperitoneal injection of pentobarbital (50 mg/kg). 2. Induce anti-Thy-1 glomerulonephritis by a single injection of 700 µg of mAb 1-22-3 via the tail vein (see Note 3). 3.2.3

Transfer of siRNA or siRNA Expression Vector Targeting TGF-b1 Via the Renal Artery

1. Twenty-four hours after induction of nephritis, transfect the siRNA (or siRNA expression vector) via the renal artery in accordance with the protocol described in Sect. 3.1.2 (see Note 4). 3.2.4

Assessment of TGF-b1 Expression in the Glomeruli

1. Four days after transfection, kill the rats. 2. After perfusion with 20 mL of ice-cold PBS via the abdominal aorta, remove the kidneys. 3. Collect the glomeruli in accordance with the conventional sieving technique using 125-, 180-, and 75-µm meshes. 4. Homogenize the collected glomeruli in 1 mL of lysis buffer using a tissue grinder on ice. Keep the lysate on ice for 20 min. 5. Centrifuge the lysate at 15,000 rpm (~20,000×g) for 20 min at 4°C. 6. Assay the protein concentration of the supernatant by using the BCA ΤΜ assay. 7. Mix the soluble lysates 1:2 with 3× Laemmli buffer and heat for 10 min at 95°C. 8. Load lysate onto a 15% SDS-PAGE gel (20 µg per lane), resolve, and transfer onto a polyvinylidene difluoride membrane. 9. Block membranes with 5% bovine serum albumin in TBST for 30 min at room temperature and then immunoblot with polyclonal antibodies against TGF-β1 in blocking buffer overnight at 4°C. 10. Wash membranes with TBST three times for 5 min each. 11. Incubate membranes with horseradish peroxidase-conjugated goat anti-rabbit IgG for 30 min. 12. Wash membranes with TBST three times for 5 min each. 13. Visualize membranes using chemiluminescence substrate in accordance with the manufacturer’s instructions. 14. Obtain X-ray films of the blots. An X-ray film for the siRNA expression vector is shown in Fig. 18.3b.

262

Y. Takabatake et al. BamHI

Hind III

U6 promoter

sense

antisense

5⬘ GATCCCGTCAACTGTGGAGCAACACTTCAAGAGAGTGTTGCTCCACAGTTGACTTTTTTGGAAA 3⬘ 3⬘ GGCAGTTGACACCTCGTTGTGAAGTTCTCTCACAACGAGGTGTCAACTGAAAAAACCTTTTCGA 5⬘

a

loop pSU6TGF-β1

DC

N

TGF-β1 12.5kD pSU6Scramble

DC

N

TGF-β1 12.5kD b Fig. 18.3 shRNA-mediated silencing of TGF-β1 expression in vivo. a Construction of the siRNA expression vector targeting TGF-β1. To overcome the shortcomings of chemically synthesized siRNA, a DNA vector-mediated mechanism to express substrates that can be converted into siRNA was developed. Here, we used an siRNA expression vector featuring the human U6 RNA pol III promoter. Two oligodeoxynucleotides containing 21-nucleotide sense and antisense sequences of siRNA for TGF-β1, a 9-nucleotide loop sequence, and a transcription termination signal of six thymidines were annealed and inserted downstream of the U6 promoter. b After transferring this expression vector (200 µg) into rat kidney, we checked for shRNA-mediated silencing of TGF-β1 expression in the glomeruli of the anti-Thy-1 nephritis model using Western blot analysis. The siRNA expression vector for TGF-β1 (PSU6 TGF-β1) efficiently inhibited expression of TGF-β1 in vivo when compared with the contralateral diseased kidney (DC, diseased control) whereas the control vector (PSU6 scramble) did not. N, normal control. (Reproduced from ref. [3] with permission)

4

Notes

1. Rats weighing approximately 200 g are appropriate for this procedure because a catheter cannot be inserted via the renal artery in rats weighing less than 150 g, and the presence of too much fat can cause difficulties with operative precision in rats weighing more than 250 g. 2. Anti CD90 (Thy1.1) antibody that is applicable for immunohistochemistry studies is commercially available (e.g., Chemicon MAB1406). 3. Thy-1 nephritis can be reportedly induced using other commercially available mAbs (e.g., the OX-7 clone).


263

4. In transferring siRNA or a DNA vector via the renal artery, we routinely use 50 µg of siRNA or 100–200 µg of a DNA vector. However our own data has shown that 5 µg of siRNA is sufficient in vivo [3]. As using a large amount of siRNA may produce an “off-target” effect, consider using a smaller amount of siRNA to minimize any nonspecific effects. 5. It is not necessary to peel off the peritoneum around the distal side of the left renal artery and the left kidney; doing so may lead to unexpected tissue damage. 6. Puncturing the renal artery directly will lead to unwanted ischemic change. 7. Keeping the bevel of the stylet downward will minimize the bleeding (Fig. 18.1b). 8. When the siRNA solution is infused with the catheter located at the distal site, siRNA will not be delivered to the whole kidney. 9. Successful hemostasis depends on any blood being completely removed. The operator and the assistant need to cooperate to ensure that this occurs. 10. Four-percent PFA can also be perfused after PBS perfusion (perfusion fixation), but the snap freezing (fresh freezing) method is not recommended because the EGFP is not fixed. 11. Immersion in the 10% and 20% sucrose solutions can be omitted without loss of quality.

References 1. Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC. (1998) Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806–811. 2. Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T. (2001) Duplexes of 21nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature. 411, 494–498. 3. Takabatake Y, Isaka Y, Mizui Μ, Kawachi H, Shimizu F, Ito T, Hori Μ, Imai E. (2005) Exploring RNA interference as a therapeutic strategy for renal disease. Gene Ther. 12, 965–973. 4. Novina CD, Murray MF, Dykxhoorn DM, Beresford PJ, Riess J, Lee SK, Collman RG, Lieberman J, Shankar P, Sharp PA. (2002) siRNA-directed inhibition of HIV-1 infection. Nat Med. 8, 681–686. 5. Ito T, Suzuki A, Imai E, Okabe Μ, Hori Μ. (2001). Bone marrow is a reservoir of repopulating mesangial cells during glomerular remodeling. J Am Soc Nephrol. 12, 2625–2635. 6. Tsujie Μ, Isaka Y, Nakamura H, Imai E, Hori Μ. (2001) Electroporation-mediated gene transfer that targets glomeruli. J Am Soc Nephrol. 12, 949–954.

Index

A Actin cytoskeleton, 4, 205–206, 209–210, 217–218 Adenine nephrotoxicity, animal model, 47–48 Adriamycin nephrotoxicity, animal model, 46 Alkaline phosphatase, immunohistochemistry, 142–143 Aminonucleoside nephrosis, animal model, 46 Animal ethics, 41–42 Animal models, see Adenine nephrotoxicity, see also Adriamycin nephrotoxicity see also Aminonucleoside nephrosis, see also Anti-GBM nephritis, see also Cisplatin nephrotoxicity, see also Diabetes, experimental, see also Folic acid nephropathy, see also Gentamicin nephrotoxicity, see also Ischemic acute renal failure, see also Mercuric chloride nephrotoxicity, see also Obesity, see also Sub-total nephrectomy, see also Streptozotocin induced diabetes, see also Thy-1 nephritis, see also UUO Anti-GBM nephritis, 49–51, 50 (Fig. 4.3), 114 Antigen retrieval, tissue sections enzyme digestion,143, 168 microwave pretreatment,125, 143–144, 190 Anti-thymocyte serum nephritis, see Thy-1 nephritis APES coated slides, see silane coated slides Apoptosis, 4, 12, 176–181, 178 (Fig. 13.3) detection of, 175–192, 177 (Fig.13.1, 13.2) Autoradiography, 129–130 Avidin-Biotin complex, immunohistochemistry, 140–142, 134 (Fig. 10.1)

B Biomarkers, 237–249

C Caspase-3, marker of apoptosis,189 Cell cultures, see fibroblast, see also mesangial cells, see also myofibroblast, see also proximal tubules Cell death see Apoptosis, detection see also Necrosis Cell stretch, see Stretch, cell culture Cisplatin nephrotoxicity, animal model, 46–47 CM10 arrays, 241–243 Collagen, measurement of total collagen concentration, 226–229, 229 (Fig. 16.2) measurement of collagen sub-types, 230–232, 233 (Fig. 16.3) lattices, 193–203 Colloidal gold, preparation, 153–154 Confocal microscopy, see imaging, confocal Contraction, collagen lattices, 193–203 Counting, cell cultures, 198 Creatinine clearance, measurement in mice, 69 Cytochemistry, see Immunocytochemistry

D db/db mouse, 54 Diabetes, experimental models, 51–53, 51 (Fig. 4.4), 52 (Fig. 4.5), 56, 67 DNA fragmentation, see Apoptosis, detection of cDNA synthesis, 91–92 DNase treatment, Polymerase chain reaction, 78, 91 265

266 Dot Blot hybridization, 127–128 Double labelling, histochemistry, 142–143, 189–190

E Electron Microscopy immuno electron microscopy, 149–156 lectin histochemistry, 156–157 transmission electron microscopy, 176–178, 177 (Fig. 13.1b), 149–150, 150 (Fig. 11.1) Electrophoresis, 213, 231, 236 Electroporation, 256–258 Embedding of tissue, in paraffin wax, 139 in resin, 155 Enhanced green fluorescent protein (EGFP), 258–259, 260 (Fig. 18.2) Erk, 210 Expression vector, construction of vector for gene silencing, 259–261

F Fibroblast characterization, 32–35, 33 (Table 3.2, Fig. 3.2) culture, 31–35, 198 isolation, 30–31, 30 (Fig. 3.1) Fibronectin, Elisa assay, 218–219 immunohistochemical staining, 49 (Fig. 4.2) 5/6 Nephrectomy, see Sub-total nephrectomy, experimental model Fixation, collagen lattices, 200 electron microscopy,152, 185 general options,135–136, 139, 185–186 in situ hybridization,124–125 light microscopy, 135–136, 185–186 perfusion, 165–167, 164 (Fig. 12.3), 166 (Fig. 12.4) Fixatives, mercuric formalin,136 methyl carnoys,136 neutral buffered formalin,136 paraformaldehyde, 136, 163, 182 paraformaldehye-lysine-periodate (PLP), 152 Folic acid nephropathy, animal model, 48 Freezing, cultured cells, 11, 35, 211 tissue, see Tissue, freezing

Index G Gene expression, quantitative real time PCR,83–107 in situ hybridization, 119–132 Gene silencing, 251–263 Gentamicin nephrotoxicity, animal model, 47 Glomerular basement membrane nephritis, see Anti-GBM nephritis Glomerular filtration rate (GFR), measurement in mice, 61–72 Glomeruli, isolation of, 7–8 Glomerulonephritis, leukocyte infiltration, 109–110

H H&E, tissue stain, 186 H50 arrays, 241–243 Histochemistry, see Electron microscopy, Immuno electron microscopy see also Immunoflurorescence see also Immunohistochemistry see also In situ hybridization Histogene, tissue stain, 75 Housekeeping genes, 97 Hydrolysis, of probe, 126 Hydroxyproline, measurement, 226–229, 229 (Fig. 16.2) Hypoxia, in situ localization, 161–174

I IMAC30 arrays, 241–243 Imaging, confocal, 216–217, 217 (Fig. 15.2) in vivo, 109–117 Immunoblot, see western blotting Immunocytochemistry, 34–35 Immunofluorescence, 34–35, 189–190, 200–201, 253 Immunohistochemistry, paraffin emebedded tissue, 141–142, 141 (Fig. 10.2), 168, 200–201 controls for, 144 Inflammation, glomerular, 109–117 Intravital microscopy, see Imaging, in vivo In situ hybridization, 119–132 Inulin clearance, see Glomerular filtration rate Ischemic acute renal failure, animal model, 45

Index L Laser capture microdissection, 73–82, 76 (Fig. 6.1) Lectin histochemistry, see Lectin staining Lectin, staining electron microscopic level, 156–157 light microscopic level, 144–146, 145 (Fig. 10.3c,d) Leucocytes, 109–117

M Mass spectrometry, 245 (Fig. 17.1) Media, for cell culture fibroblast culture, 27–28, 196 mesangial cell culture, 5, 6 (Table 1.1), 7, 11, 206 proximal tubule culture, 20, 85, 89 Mercuric chloride nephrotoxicity, animal model, 47 Mesangial cell, commercial sources, 13 (Table 1.3) characterization, 10–11, 10 (Table 1.2) culture, 9–10, 11–13, 210–211 isolation, 6 (Table 1.1), 7–8 role in glmerulosclerosis, 4 stretch, 205–221 mRen–2 rat, 53 Multiplexing, 97–98 Myofibroblast, characteristics of mesangial cells, 3–4, 194 culture, 31–32 identification in culture, 33 (Table 3.2) identification in tissue, 145 (Fig. 10.3b)

N Necrosis, 176–181, 177 (Fig. 13.2b), 178 (Fig. 13.3)

O Obesity, animal models, 53–54 Osmotic mini-pumps, insertion and use of, 63 Oxygen gradients, in kidney, 162 (Fig. 12.2)

P PAN nephropathy, see Aminonucleoside nephrosis, animal model Percoll gradient, for isolation of proximal tubules, 21

267 Periodic acid-Schiff, tissue stain, 187 Pimonidazole, 161–174, 162 (Fig. 12.1) Polymerase chain reaction (PCR), see Quantitative real time PCR Primer design, polymerase chain reaction, 93–94 Protein, total protein (bradford) assay, 240 Protein-A gold, conjugation, 153–154 Protein-chip arrays, 242–244 Proteomics, 137–249 Proximal tubule, characterization, 23 culture, 22 isolation, 21 Puromycin aminonucleoside nephrosis, see Aminonucleoside nephrosis

Q Q10 arrays, 241–243 Quantitative real time PCR, 83–107

R Raf–1, activity assay, 214–215 Real-time PCR, see quantitative real time PCR Renal function, measurement, see Glomerular filtration rate, measurement Rho-A, activation assay, 215–216 Riboporbes, use in in situ hybridization, 119–132 RNA extraction from cultured cells, 90 from tissue, 77–78, 79, 88–89 RNA interference, see Small hairpin RNA (shRNA), see also Small interfering RNA (siRNA) cRNA probe labeling, Biotin labeling,127 Digoxigenin (DIG) labeling, 127 isotopic labeling, 126 RNA quantitation, 80, 90–91

S Sectioning, paraffin embedded tissue, 125, 140 SELDI-TOF, 237–249, 247 (Fig. 17.2) Small hairpin RNA (shRNA), 251–163 Small interfering RNA (siRNA), 251–263, 260 (Fig. 18.2) Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), 231–232, 233 (Fig. 16.3), 261

268 Silane coated slides, 125, 139–140 Spontaneously hypertensive rat (SHR), 53 Streptozotocin induced diabetes, animal model, 51–52, 51 (Fig. 4.4), 52 (Fig. 4.5), 67 strain susceptibility in mice, 53 (Fig. 4.6) Stretch, cell culture, 205–221 STZ diabetes, see Streptozotocin induced diabetes, Sub-total nephrectomy, experimental model, 44, 67

T Thawing, cultured cells, 11, 35, 211 Thy-1 nephritis, animal model, 4, 48–49, 49 (Fig. 4.2), 254 Tissue, fixation, see Fixatives freezing, 75 homogenization, 87–88, 239–240 Toluidine blue, stain for resin sections, 187

Index Transforming Growth Factor Beta effect on epithelial cells,100–101 inhibition of expression, 259–262, 262 (Fig. 18.3) TUNEL, 188-190 Tyramide, signal amplification of biotinylated probes, 131

U Unilateral ureteric obstruction, see UUO Urinary inulin clearance, see Glomerular filtration rate, measurement in mice UUO, 43, 112

W Wax, see Embedding of tissue Western blotting, 212–213, 212 (Fig. 15.1a), 261

Z Zucker rat, 54

Kidney Research. Experimental Protocols

Experimental and Quasi-Experimental Designs for Research

RESEARCH AND EXPERIMENTAL DESIGN

Vision Research Protocols

Vision Research Protocols

Peptide Research Protocols. Endothelin

Peptide Research Protocols: Endothelin

Photosynthesis Research Protocols

Photosynthesis Research Protocols

Photosynthesis Research Protocols

Bone Research Protocols

Metastasis Research Protocols

Writing Clinical Research Protocols

Power analysis for experimental research

The Principles of Experimental Research

The Principles of Experimental Research

Experimental Methods in Hydraulic Research

Experimental Research in Evolutionary Computation

Fibrosis Research: Methods and Protocols

Arthritis Research: Methods and Protocols

Pain Research: Methods and Protocols

Opioid Research. Methods and Protocols

Experiments Investigating Fundraising and Charitable Contributors, Volume 11 (Research in Experimental Economics) (Research in Experimental Economics)

Experimental Rock Mechanics (Geomechanics Research Series)

Handbook of research methods in experimental psychology

Experimental Models in Serotonin Transporter Research

Experimental Models in Serotonin Transporter Research

Handbook of Research Methods in Experimental Psychology

Primer on Kidney Diseases

Diabetes and the Kidney

Kidney Research. Experimental Protocols

Experimental and Quasi-Experimental Designs for Research

RESEARCH AND EXPERIMENTAL DESIGN

Vision Research Protocols

Vision Research Protocols

Peptide Research Protocols. Endothelin

Peptide Research Protocols: Endothelin

Photosynthesis Research Protocols

Photosynthesis Research Protocols

Photosynthesis Research Protocols

Bone Research Protocols

Metastasis Research Protocols

Writing Clinical Research Protocols

Power analysis for experimental research

The Principles of Experimental Research

The Principles of Experimental Research

Experimental Methods in Hydraulic Research

Experimental Research in Evolutionary Computation

Fibrosis Research: Methods and Protocols

Arthritis Research: Methods and Protocols

Pain Research: Methods and Protocols

Opioid Research. Methods and Protocols

Experiments Investigating Fundraising and Charitable Contributors, Volume 11 (Research in Experimental Economics) (Research in Experimental Economics)

Experimental Rock Mechanics (Geomechanics Research Series)

Handbook of research methods in experimental psychology

Experimental Models in Serotonin Transporter Research

Experimental Models in Serotonin Transporter Research

Handbook of Research Methods in Experimental Psychology

Primer on Kidney Diseases

Diabetes and the Kidney

Recommend Documents