Hymenoptera: Evolution, Biodiversity and Biological Control

Andrew D. Austin & Mark Dowton (Editors) HYMENOPTERA Evolution, Biodiversity and Biological Control © CSIRO 2000 All...

Author: Andrew Austin | Mark Dowton | A. Austin | M. Dowton

300 downloads 2159 Views 11MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form

DOWNLOAD PDF

Andrew D. Austin & Mark Dowton (Editors)

HYMENOPTERA Evolution, Biodiversity and Biological Control

© CSIRO 2000 All rights reserved. Except under the conditions described in the Australian Copyright Act 1968 and subsequent amendments, no part of this publication may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic, mechanical, photocopying, recording, duplicating or otherwise, without the prior permission of the copyright owner. Contact CSIRO PUBLISHING for all permission requests. National Library of Australia Cataloguing-in-Publication entry International Hymenopterists Conference (4th :, 1999 : Canberra, A.C.T.). Hymenoptera : evolution, biodiversity and biological control. Bibliography. Includes index. ISBN 0 643 06610 1 (hardback). ISBN 0 643 09008 8 (eBook). 1. Hymenoptera – Congresses. I. Austin, Andrew. II. Dowton, Mark. III. International Society of Hymenopterists. 595.79 Available from: CSIRO PUBLISHING

150 Oxford Street (PO Box 1139) Collingwood VIC 3066 Australia Tel: Fax: Email: Web site:

+61 3 9662 7500 +61 3 9662 7555 [email protected] http://www.publish.csiro.au

Front cover: Microplitis demolitor (Braconidae) SEM (original by P.C. Dangerfield) Set in Adobe Minion, Copperplate and Frutiger Typeset by Desktop Concepts P/L, Melbourne Printed in Australia by Ligare

Foreword

The idea for this book originated from discussions held among members of the organising committee for the Fourth International Hymenoptera Conference, held in Canberra in January 1999. It was thought that an up-to-date account of current research being undertaken on this important group of insects was timely given the rapid progress that has occurred in numerous areas during the last 10 years. Further, the conference and symposia that comprised the scientific program attracted many of the best international researchers in their fields. In all, approximately four-fifths of the papers and posters presented at the conference appear in this volume, although many have been substantially modified in scope and content compared with the original conference presentations. All of them have been extensively refereed using the guidelines that generally apply to the scientific journals published by CSIRO Publishing. The editors have organised the papers into related topics and an overview of these are given in the first section ‘The Hymenoptera – An Introduction’. As a compendium of current reviews and research papers, we hope this volume will stimulate interest among students of the Hymenoptera, researchers from related disciplines, and those who simply wish to learn more about this fascinating group of insects. Andrew D. Austin & Mark Dowton

iii

This Page Intentionally Left Blank

Acknowledgements

The production of this book would not have been possible without the help and financial support of the International Society of Hymenopterists and delegates that attended the Fourth International Hymenoptera Conference held in Canberra in January 1999. The editors would particularly like to thank the following people and organisations who contributed in various ways to the development and production of this book: John LaSalle and Paul DeBarro who acted as conference symposium organisers; CSIRO Entomology and the Australian Quarantine & Inspection Service for sponsoring plenary speakers at the conference; John Jennings and Nick Stevens for their editorial assistance and helpful ideas; Jim Whitfield, John LaSalle, Bob Matthews and Peter Bailey for their constructive comments on several sections; The Department of Applied & Molecular Ecology, The University of Adelaide and the Department of Biology, Wollongong University for access to facilities used by the editors; Emily Shephard, Image and Copy Centre, The University of Adelaide for assistance with illustrations; the numerous people who referred manuscripts, and the authors for their cooperation and patience when the editors insisted on last minute changes.

v


Contents

Foreword

iii

Acknowledgements

v

Part 1 The Hymenoptera – an introduction

3

Andrew Austin and Mark Dowton

Part 2 – Development and Physiology The effects of life history on development of the Hymenoptera

11

M. R. Strand Molecular basis of developmental alteration in Heliothis virescens (F.) larvae parasitised by Cardiochiles nigriceps Viereck

17

Francesco Pennacchio, Patrizia Falabella, Paola Varricchio, Rocco Sordetti, S. Bradleigh Vinson, Franco Graziani and Carla Malva Protection by immune disguise: a new lesson from a parasitoid wasp

23

Ulrich Theopold, Dongmei Li, Wanja Kinuthia and Otto Schmidt Host defence manipulation by parasitoid wasps and the problem of assessing host specificity

29

Otto Schmidt, Sassan Asgari, Markus Beck and Ulrich Theopold Two genetically distinct Venturia canescens strains display different reproductive strategies

38

Markus Beck, Ulrich Theopold and Otto Schmidt The response of Cardiochiles nigriceps Viereck (Hymenoptera: Braconidae) larvae to conspecific competitors

46

S. Bradleigh Vinson and Ahmed Kamal Mourad Hypopharyngeal gland funtion, glandular cell senescence and gland reactivation in bees

50

Carminda da Cruz-Landim, Rosiléia Ana Cassia da Costa and Regina Lúcia Morelli Silva de Moraes

Part 3 – Molecular Phylogenetics Molecular systematics of the Chalcidoidea using 28S-D2 rDNA

59

B. Campbell, J. Heraty, J.-Y. Rasplus, K. Chan, J. Steffen-Campbell and C. Babcock

vii

Contents viii

Hymenoptera: Evolution, Biodiversity and Biological Control

Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera): a simultaneous molecular and morphological analysis

74

D. L. J. Quicke, M. G. Fitton, D. G. Notton, G. R. Broad and K. Dolphin Molecular evolution in social wasps

84

J. Schmitz and R. F. A. Moritz Rearrangement of the hymenopteran mitochondrial genome is accelerated relative to orthopteroid insects

90

Mark Dowton, Andrew D. Austin and Paul K. Flook Phylogeny of microgastroid braconid wasps, and what it tells us about polydnavirus evolution

97

James B. Whitfield Evolutionary transitions in Aphidiinae (Hymenoptera: Braconidae)

106

Paul T. Smith and Srinivas Kambhampati Genetic structure of the cypress seed chalcid Megastigmus wachtli (Torymidae) within its Mediterranean distribution

114

J. Y. Rasplus, E. Carcreff, J. M. Cornuet and A. Roques Systematics of the ant genus Camponotus (Hymenoptera: Formicidae): a preliminary analysis using data from the mitochondrial gene cytochrome oxidase I

131

Seán G. Brady, Jürgen Gadau and Philip S. Ward

Part 4 – Systematics Can braconid classification be restructured to facilitate portrayal of relationships?

143

Robert A. Wharton Higher-level phylogeny of the Aulacidae and Gasteruptiidae (Hymenoptera: Evanioidea)

154

John T. Jennings and Andrew D. Austin Monophyly and relationship of the genus Coelopisthia Förster (Chalcidoidea: Pteromalidae)

165

Hannnes Baur A preliminary phylogeny for the Baeini (Hymenoptera: Scelionidae): endoparasitoids of spider eggs

178

Muhammad Iqbal and Andrew D. Austin Hymenopteran orbicular sensilla

192

Hasan H. Basibuyuk, Alexandr P. Rasnitsyn, Mike G. Fitton and Donald L. J. Quicke Karyology of parasitic Hymenoptera: current state and perspectives Vladimir E. Gokhman

198

Contents ix

Morphology and biogeography of the north African Ceramius maroccanus-complex (Vespidae: Masarinae): contribution of morphometric analyses to taxonomic decisions Volker Mauss

207

Some problems with the Australian tiphiid wasps with special reference to coupling mechanisms Graham. R. Brown

210

Historical review and current state of the world genera classification of oak gall wasps (Hymenoptera: Cynipidae, Cynipini) George Melika and Warren G. Abrahamson

218

Australian Hymenoptera in the Spinola collection: a list of species M. Generani and P. L. Scaramozzino

231

Part 5 – Biology, Ecology and Behaviour New insights into the foraging behaviour of parasitic wasps Michael A. Keller and Brigitte Tenhumberg

247

The biology of perreyiine sawflies (Hymenoptera: Pergidae) of the Perreyia genus-group Carmen Flores, Jesús Ugalde, Paul Hanson and Ian Gauld

258

Megastigmus transvaalensis (Hussey) (Hymenoptera: Torymidae) in California: methods of introduction and evidence of host shifting E. E. Grissell and K. R. Hobbs

267

Biology of an extant species of the scolebythid genus Dominibythus (Hymenoptera: Chrysidoidea: Scolebythidae), with description of its mature larva Gabriel A. R. Melo

281

Defense adaptations in velvet ants (Hymenoptera: Mutillidae) and possible sources of selection pressure for such Donald G. Manley

285

Introduction and spread of four aculeate Hymenoptera in Italy, Sardinia and Corsica (Hymenoptera: Sphecidae, Chrysididae) Guido Pagliano, Pierluigi Scaramozzino and Franco Strumia

290

Biological notes and larval morphology of Donquickeia (Hymenoptera: Braconidae: Doryctinae) Angélica Maria Penteado-Dias

296

Part 6 – Biodiversity Driving Miss DAISY: the performance of an automated insect identification system I. D. Gauld, M. A. O'Neill and K. J. Gaston

303

Contents x


Data warehousing architecture and tools for Hymenoptera biodiversity informatics Norman F. Johnson and Luciana Musetti

313

Preliminary study of pteromalid diversity in China: taxonomic and geographic variation Hui Xiao, Da-Wei Huang and Steven L. Heydon

320

The family Braconidae in China (Hymenoptera) Chen Xuexin, He Junhua and Ma Yun An annotated list of Encyrtidae (Hymenoptera: Chalcidoidea) of Tbilisi (Georgia) George. O. Japoshvili

328

339

Part 7 – Biological Control Predictive and empirical evaluation for parasitoids of Bemisia tabaci (biotype ‘B’), based on morphological and molecular systematics J. A. Goolsby, M. A. Ciomperlik, A. A Kirk, W. A. Jones, B. C. Legaspi, Jr. , J.C. Legaspi, R. A Ruiz, D. C. Vacek and L. E. Wendel

347

Which factors govern the host preference of aphid parasitoids when offered host races of an aphid species? Anja Hildebrands, Thomas Thieme and Stefan Vidal

359

Size and asymmetry as quality control indicators in Trichogramma spp. (Hymenoptera: Trichogrammatidae) D. M. Bennett, S. Hewa-Kapuge and A. A. Hoffmann

371

The effects of two new insecticides on the survival of adult Trichogramma pretiosum Riley in sweet corn B. C. G. Scholz and M. P. Zalucki

381

Field observations on selective food plants in habitat manipulation for biological control of potato moth by Copidosoma koehleri Blanchard (Hymenoptera: Encyrtidae) L. R. Baggen, G. M. Gurr and A. Meats

388

Understorey management for the enhancement of the leafroller parasitoid Dolichogenidea tasmanica (Cameron) in Canterbury, New Zealand orchards N. A. Irvin, S. D. Wratten and C. M. Frampton

396

Impact and control of introduced Vespula wasps in New Zealand Jacqueline R. Beggs

404

Taxonomic relationships of parasitoids: poor indicators for their suitability or effectiveness as biological control agents D. P. A. Sands

410

Natural population of Aenasius advena Compere (Chalcidoidea: Encyrtidae) and its host preference in Bangladesh Badrul A. Bhuiya, Shafique H. Chowdhury and S. M. Humayun Kabir

417

Contents xi

Studies on Eretmocerus sp. (Hymenoptera: Aphelinidae) – a promising natural enemy of the castor whitefly Trialeurodes ricini (Hemiptera: Aleyrodidae) Seeba Balan and R.W. Alexander Jesudasan

421

Part 8 – Hymenoptera in Education Developing life science instructional materials using a parasitic wasp, Melittobia digitata Dahms (Hymenoptera: Eulophidae): a case study Robert W. Matthews

427

Part 9 – Medical Effects of Hymenoptera Review of bee and wasp sting injuries in Australia and the USA N. R. Levick, J. O. Schmidt, J. Harrison, G. S. Smith and K. D. Winkel

437

Part 10 – Future Research Hymenopteran research – future directions into the next millennium Mark Dowton and Andrew Austin

451

Indexes Index to authors

457

Index to hymenopteran names

458

Index to other animal names

466

Index to plant and micro-organism names

468


PART

1

Introduction


The Hymenoptera: An Introduction Andrew D. Austin1 and Mark Dowton1,2 1

Department of Applied & Molecular Ecology, Waite Campus, The University of Adelaide, P.M.B. 1 Glen Osmond, S. A. 5064 Australia (email: [email protected]) 2

Australian Flora and Fauna Research Centre, Department of Biology, Wollongong University, Wollongong, N. S. W. 2522 Australia (email: [email protected])

The insect order Hymenoptera is one of the dominant life forms on earth, both in terms of number of species and in the diversity of life styles that have evolved within the group. The Hymenoptera contain the vast majority of socially organised insects and parasitoids, as well as a great variety of specialist predators and herbivores. They have emerged as the most speciose group in many studies on terrestrial biodiversity and they are pre-eminent as biological control agents of pest insects. The number of hymenopteran species is unknown and, at present, is almost impossible to estimate with any accuracy. Even the number of described species has not been accurately calculated given that many families do not have available check-lists or catalogues (but see for example Johnson 1992; Bolton 1995; Noyes 1998). LaSalle and Gauld (1993) and Gaston (1993) have estimated the number of described species of Hymenoptera at >115,000 species. However, the total number (including undescribed species) could be 5–10 times this figure given that this is often the proportion of new species that are discovered following taxonomic revision of highly speciose families (Austin 1999). The major difficulty for accurately estimating total hymenopteran species comes from trying to determine the number of species for the ‘megadiverse’ regions of the world. These mostly comprise tropical or subtropical countries (i.e. Australia, India, Malaysia, Indonesia, China, Brazil, Ecuador, Peru, Columbia, Mexico, Zaire and Madagascar; McNeely et al. 1990) that with few exceptions have been poorly surveyed. In recent years, the hymenopteran fauna of Costa Rica has been particularly well-studied compared with other countries (Hanson & Gauld 1995) and this work serves as a useful foundation for future research on the fauna of Costa Rica itself, and for comparison with other regions. The true extent of species richness and biological complexity within the Hymenoptera dictates that the group should be at the centre of studies assessing arthropod diversity. These facets will only be revealed when detailed studies similar to those in Costa Rica are undertaken for other species-rich regions of the world. Gauld and Bolton (1996) identify four biological features that have been of primary importance in the evolution of the Hymenoptera. These are the ovipositional mechanism (used both for oviposition and for venom delivery), parental provision for the larva (i.e. location of food on or in which an egg is deposited), diversification of larval diet (associated with the development of a blindending gut and storage of dietary waste until pupation), and haplo-diploid sex determination. Some of these factors are obviously strongly connected but together they have resulted in a bewildering array of specialised life histories, including ecto- and endoparasitoids, hyperparasitoids,

3

Andrew D. Austin and Mark Dowton 4


gall-formers, seed feeders, pollinators (bees and fig wasps), predators (e.g. spider wasps), and eusocial species. In most cases there are major differences between the life histories of juvenile (larval) and adult stages, particularly for predatory and parasitic species. It is inevitably the larvae which are parasitic or predatory, while the adults are phytophagous (feeding on nectar or pollen) or are non-feeding. In the case of most aculeate Hymenoptera, although larval and adult life histories are very different, they are also strongly linked as the adult stage is responsible for providing the developing larvae with food. In the case of many wasps (e.g. Pompilidae, Vespidae, Sphecidae) the adult female uses a sting (modified ovipositor) to subdue prey items with a paralysing venom on which the larvae then develop in a previously constructed nest. In many respects the Hymenoptera have reached the pinnacle of evolutionary complexity within the insects. This is typified by two examples which have had far-reaching influence on the biological and species diversity of the order. These are: 1) the evolution of highly social species and the corresponding development of separate reproductive castes (Wilson 1971) – characteristics which, compared with the termites, have evolved multiple times within several aculeate lineages (i.e. within the Apidae, Formicidae and the Vespidae); and 2) the evolution of endoparasitism which, like eusociality, has evolved separately in numerous parasitic lineages (Dowton & Austin 1994). Significantly, endoparasitic Hymenoptera are challenged by the immune defences of their host and, in response, they have evolved a bewildering array of structural, behavioural, physiological, molecular and symbiotic adaptations to overcome these defences and allow the successful development of the parasitoid larva (Vinson & Iwantsch 1980; Vinson 1990). Without doubt, one of the most intriguing adaptations is the apparent mutualistic association between some ichneumonoid wasps and viruses, where the latter act to neutralise the host’s immune system (Stoltz & Whitfield 1992; Beckage 1998). Developing a comprehensive knowledge of events such as these (eusociality and endoparasitism) is important to understanding and eventually manipulating key processes in natural and agricultural systems, and the use of novel hymenopteran compounds in biotechnology. These include nutrient turn-over by ants, pollination of native plants and crops by bees, the efficiency and host specificity of parasitoids employed as biological control agents, the development of antifungal/antibacterial compounds sequestered by ants and wasps, and the incorporation of insect specific venom genes into plants. Given the extent of research currently being undertaken on the Hymenoptera it is imperative that the results of this research be brought together on a regular basis to assess current directions, and reflect on future needs and potential for new initiatives. Unfortunately, this has not happened for many years, and previous synopses have mostly concentrated on parasitic Hymenoptera (e.g. Waage & Greathead 1986; Bin 1991; Gupta 1993). However, in more recent years this has been partly balanced by the appearance of several excellent books on the biology and/or identification of the Hymenoptera (e.g. Hölldobler & Wilson 1990; Ross & Matthews 1991; LaSalle & Gauld 1993; Goulet & Huber 1993; Godfray 1994; Gauld & Bolton 1996; Quicke 1998). This volume provides a timely overview of the current research being undertaken on the Hymenoptera. It comprises a series of review and research papers by those currently working in the field and covers all major areas of hymenopteran research. The first section deals with the development and physiology of the Hymenoptera. Strand reviews the effect that life history has on early embryonic development and shows that there is substantial variability among wasp groups, particularly the parasitoids, and that they differ from the almost universally accepted pattern for Drosophila. Theopold et. al. and Schmidt et al. examine aspects of host immune

The Hymenoptera: an Introduction 5

disruption by polydnaviruses and the underlying mechanisms involved, while Beck et al. and Vinson & Mourad present new findings on behavioural aspects of host-parasitoid interactions. An understanding of the evolutionary relationships of the Hymenoptera has remained elusive, even though such knowledge impacts on conclusions reached from almost every other study of hymenopteran biology. Rasnitsyn’s (1980, 1988) morphological and fossil-based phylogenies have spawned a series of studies in the last decade of the twentieth century that critically assess his ideas. Many of these studies have used comparative DNA sequences, and in the section molecular phylogenetics, a series of chapters report on the phylogeny of the Hymenoptera from the ordinal to the species level. Dowton et al. present a comparison of gene rearrangement frequencies between the Hymenoptera and orthopteroid insects; Campbell et al. present the first molecular phylogeny for the families of Chalcidoidea; Quicke et al. report on a combined molecular and morphological analysis of ichneumonid relationships; Schmitz & Moritz examine molecular evolution among the social wasps using sequence data from multiple genes, Whitfield shows that the phylogeny of polydnaviruses tracks that of their microgastrine hosts; Smith & Kambhampati examine the molecular phylogeny of the aphidiines and the major biological transitions that have occurred within the group; Brady et al. report on a molecular study of the ant genus Camponotus; while Rasplus et al. examine intraspecific variation within a seed wasp using molecular data. Chapters comprising the systematics section represent both review and research papers that cover the full spectrum of the discipline including classification, phylogenetics, karyology, morphometrics, comparative morphology, taxonomic history and check-listing. Wharton presents a new and somewhat controversial scheme for the reclassification of braconid subfamilies; Jennings & Austin examine the phylogeny of the Aulacidae and Gasteruptiidae; Iqbal & Austin re-evaluate the relationships among the spider-parasitising Scelionidae; Gokhman reviews the role of karyology in hymenopteran systematics; Basibuyuk et al. report on the comparative morphology of orbicular sensilla and their phylogenetic potential within the order; Baur examines the relationships of the pteromalid genus Coelopisthia; Brown discusses the morphology of the coupling mechanism of thynnine wasps and impact of this character system on generic-level taxonomy; Mauss reports on the taxonomy of the masarine genus Ceramius; Melika & Abrahamson present an historical review of the classification of oak gall wasps (Cynipini); and Generani & Scaramozzino discuss the Australian Hymenoptera in the Spinola Collection and present a species check-list. As discussed above, the Hymenoptera exhibit a great diversity of life styles. In the section on biology and behaviour this theme is expanded on by Flores et al. who report on the first instance of possible mycophagy in larvae of a pergid sawfly from Costa Rica; Keller & Tenhumberg provide a detailed overview of foraging behaviour in parasitic wasps; Grissell & Hobbs provide a comprehensive account of host plant switching in a species of Megastigmus; separate accounts by Manley and Melo outline aspects of the biology of mutillids and scolebythids respectively; Pagliano et al. present an historical account of the geographic spread of four species of Sphecidae and Chrysididae introduced into Italy; and Penteado-Dias discusses the biology of a putatively phytophagous braconid from Brazil. It is increasingly clear that the challenge to catalogue and measure the species richness of Hymenoptera will be met with computer-assisted technologies. In the section on biodiversity, Johnson & Musetti discuss a framework that will bring together the fragmented but invaluable information from separate insect collections through a single web-site, while Gauld et al. report

Andrew D. Austin and Mark Dowton 6


on the development of an image-analysis system that will ultimately facilitate the ‘hands off’ sorting and identification of Hymenoptera from complex samples. Xiao et al. and Xuexin et al. present accounts of the Pteromalidae and Braconidae of China respectively, while Japoshvili provides a check-list of the Encyrtidae and their hosts from Georgia (ex USSR). The modern application of parasitoids as control agents of agricultural pests combines a detailed knowledge of the ecology of both organisms, as well as of the system which they inhabit. The section on biological control presents a diversity of studies that reflect this approach. The chapter by Goolsby et al. provides a detailed overview of contemporary taxonomic research to characterise parasitoids of Bemisia tabaci which could serve as a model for other such studies; Hieldebrands et al. describe the factors that influence host preference by aphid parasitoids; Bennett et al. assess size and asymmetry characteristics as measures of fitness in Trichogramma, while Scholz & Zulucki describe the effects of two new pesticides on the same genus; effects of habitat manipulation on parasitoid performance are assessed for two different systems by Baggen et al. and Irvin et al.; Sands discusses contentious aspects of predicting host range of parasitoids under quarantine conditions; Beggs provides an account of the control strategies being considered for the invasive environmental pest, Vespula vulgaris in New Zealand; while Bhuiya et al. and Balan & Jesudasan report on aspects of the biology of potential biocontrol agents on the Indian subcontinent. In the section on Hymenoptera in education, Matthews outlines the novel use of a species of Melittobia for biological science instruction at secondary level, while Levick et. al. review the level, treatment and recording of bee and wasp stings in Australia and USA in the section medical effects of Hymenoptera. Finally, in hymenopteran research – future directions into the next millennium, Dowton & Austin reflect on the chapters in this book as a representative overview of contemporary work on the group, and they provide a personal commentary on the research areas that are likely to be most influential during the next decade in providing a deeper understanding of the evolution of the Hymenoptera, their use as model systems in biology, and their application in environmental biology and biological control.

Acknowledgements We wish to thank John Jennings and John LaSalle for their comments on a draft of the manuscript.

References Austin, A. D. (1999) The role of species in biodiversity research – lessons from the parasitic Hymenoptera. pp. 159-165. In W. Ponder & D. Lunney (Eds), The Other 99% – The Conservation and Biodiversity of Invertebrates. Royal Society of New South Wales, Sydney. Beckage, N. E. (1998) Parasitoids and polydnaviruses. Bioscience 48: 305-311. Bin, F. (Ed.) (1991) Insects Parasitoids – Tritrophic Interaction. Redia vol. 74. Bolton, B. (1995) A New General Catalogue of the Ants of the World. Harvard University Press, Cambridge, Massachusetts. Dowton, M. & Austin, A. D. (1994) Molecular phylogeny of the insect order Hymenoptera: Apocritan relationships. Proceedings of the National Academy of Sciences, USA 91: 9911-9915.

The Hymenoptera: an Introduction 7

Gaston, K. J. (1993) Spatial patterns in the description and richness of the Hymenoptera. pp. 277-293. In LaSalle, J. & Gauld, I. D. (Eds) Hymenoptera and Biodiversity. CABI, Wallingford. Gauld, I. & Bolton, B. (Eds) (1996) The Hymenoptera. 2nd edition. Oxford University Press, Oxford and The Natural History Museum, London. Godfray, H. C. J. (1994) Parasitoids – Behavioral and Evolutionary Ecology. Princeton University Press, Princeton. Goulet, H. & Huber, J. T. (Eds) (1993) Hymenoptera of the World: An Identification Guide to Families. Research Branch, Agriculture Canada, Ottawa. Gupta, V, K. (Ed.) (1993) Studies on the Hymenoptera. A Collection of Articles on Hymenoptera Commemorating the 70th Birthday of Henry K. Townes. Contributions of the American Entomological Institute Vol. 20. Hanson, P. E. & Gauld, I. D. (Eds) (1995) The Hymenoptera of Costa Rica. Oxford University Press, Oxford and The Natural History Museum, London. Hölldobler, B. & Wilson, E. O. (1990) The Ants. Belknap Press, Cambridge, Massachusetts. Johnson, N. F. (1992) Catalog of World Species of Proctotrupoidea, Exclusive of Platygastridae (Hymenoptera). The American Entomological Institute: Gainesville. LaSalle, J. & Gauld, I. D. (Eds) (1993) Hymenoptera and Biodiversity. CABI, Wallingford. McNeely, J. A., Miller, K. R., Reid, W. V., Mittermeier, R. A. & Werner, T. B. (1990) Conserving the World’s Biological Diversity. IUCN, Gland, Switzerland; WRI, CI,WWF-US and the World Bank, Washington, D.C. Noyes, J. S. (1998) Catalogue of the Chalcidoidea of the World. Biodiversity Catalogue Database and Image Library CDROM Series. ETI Biodiversity Center, Amsterdam. Quicke, D. L. J. (1998) Parasitic Wasps. Chapman & Hall, London. Rasnitsyn, A. P. (1980) The origin and evolution of the Hymenoptera. Trudy Paleontologicheskogo Instituta Akademiya Nauk SSSR 174: 1-192 [In Russian]. Rasnitsyn, A. P. (1988) An outline of evolution of the hymenopterous insects (Order Vespida). Oriental Insects 22: 115-145. Ross, K. G. & Matthews, R. W. (1991) The Social Biology of Wasps. Comstock Publishing, Ithaca. Stoltz, D. B. & Whitfield, J. B. (1992) Viruses and virus-like entities in the parasitic Hymenoptera. Journal of Hymenoptera Research 1: 125-139. Vinson, S. B. (1990) How parasitoids deal with the immune system of their host: an overview. Archives of Insect Biochemistry & Physiology 13: 3-27. Vinson, S. B. & Iwantsch, G. F. (1980) Host suitability for insect parasitoids. Annual Review of Entomology 25: 397-419. Waage, J. & Greathead, D. (Eds) (1986) Insect Parasitoids. Academic Press, London. Wilson, E. O. (1971) The Insect Societies. Belknap Press, Cambridge, Massachusetts.


PART

2

Development and Physiology


The Effects of Life History on Development of the Hymenoptera M. R. Strand Department of Entomology, University of Wisconsin-Madison, Madison, WI 53706 USA (email: [email protected])

Introduction Two key questions in developmental biology are what factors drive changes in developmental programs, and how do these changes lead to novelties in embryogenesis, morphogenesis and adult morphology? Comparison of organisms across diverse phyla suggest that changes in developmental programs likely result from an interplay between phylogenetic history and the developmental constraints that arise within taxa, and the environment in which organisms develop. Intensive study of model organisms like Caenorhabditis, Drosophila, Xenopus, zebrafish and the mouse indicates that conserved regulatory gene families direct development of all metazoans. Comparison of these phylogenetically distant animals has also led to the suggestion that regulatory processes evolve slowly and that when species exhibit differences in embryonic development, they usually also exhibit marked differences in adult morphology (Gould 1977; Buss 1987; Thomson 1988). However, a few comparative studies between closely related species report distinct differences in embryogenesis, yet their adult stages look very similar (del Pino & Ellinson 1983; Scott et al. 1990; Wray & Raff 1990; Jeffery & Swalla 1991; Raff 1992; Wray & Bely 1994). These results suggest that changes in early development may arise in response to shifts in life history (Wray 1995). How widespread punctuated modes of developmental evolution are among taxa, and whether certain life history transformations lead to changes in early development more often than others, are unclear. The study of D. melanagaster Meigen has resulted in a greater understanding of the processes regulating insect embryogenesis than any other group of animals. In contrast, the role life history has played in shaping the developmental evolution of insects is largely unknown. We recently suggested that the Hymenoptera are especially well suited for examining how ancestry and environmental factors interact to affect development, because of the replicate shifts in life history that have arisen in this group (Strand & Grbic 1997; Grbic & Strand 1998; Strand 1999). Here, I briefly discuss the variation seen in the early development of wasps, factors that have potentially contributed to this variation, and how alterations in embryonic programming have influenced the evolution of novel traits.

Insect Embryogenesis To appreciate the diversity seen in hymenopteran development, it is important to first consider the development of insects at-large. Most insects, including D. melanogaster, lay yolky eggs that undergo syncytial cleavage and long germband development whereby all segments of the body are established near simultaneously (Sander 1983). In Drosophila, this patterning process is initiated by maternal factors localised during oogenesis that trigger transcription of gap and

11

M. R. Strand 12


pair-rule segmentation genes whose products diffuse within the syncytium to produce gradients of positional information (St. Johnston & Nusslein-Volhard 1992). By the time the blastoderm cellularises, these factors have programmed the cells in different regions of the embryo to express segment polarity and homeotic genes that define segment-specific and regional elements such as antennae or legs (Ingham 1988). The most important question from a life history perspective is whether these events are representative of insects generally. Developmental biologists have generally assumed the answer to be yes. Some differences in patterning have been documented in insects from phylogenetically more primitive groups like grasshoppers (Patel et al. 1992; Dawes et al. 1994), but studies of other holometabolous insects including beetles (Tribolium sp.), moths (Manduca sexta (L.)), other flies (Musca domestica L.) and the honeybee (Apis mellifera L.) agree well with the paradigms established in Drosophila (summarised by Tautz & Sommer 1995; Strand & Grbic 1997).

The Hymenoptera Suggest that Environmental Factors Profoundly Affect Insect Development If ancestry is the primary factor influencing developmental processes, we would predict from the results mentioned above that embryonic development of hymenopterans should proceed similarly to the honeybee and other holometabolous insects. However, if patterns in early development reflect the environment in which eggs develop, then all of the insects discussed above may appear similar to one another because their eggs all develop under similar environmental circumstances. In contrast, the conditions under which many parasitic Hymenoptera develop differ considerably from the terrestrial conditions experienced by most other insects. Modern treatments of hymenopteran phylogeny recognise that the more primitive hymenopterans traditionally placed in the suborder ‘Symphyta’ (sawflies and woodwasps e.g. Xyeloidea, Tenthredinoidea, Megalodontoidea, Cephoidea and Siricoidea) are in actuality a paraphyletic assemblage, whereas the more advanced hymenopterans in the suborder Apocrita are monophyletic (Rasnitsyn 1988; Dowton & Austin 1994; Hanson & Gauld 1995; Whitfield 1998). The Apocrita likely evolved from an ectoparasitic ancestor (Orussoidea), but thereafter free-living, ectoparasitic and endoparasitic species have arisen independently within and/or between each lineage. These replicate shifts in life history have also given rise to situations where relatively closely related species develop in very different environments. At the superfamily level, the sister group to the Aculeata, as represented by the honeybee, is the parasitic Ichneumonoidea whose species are divided into the families Braconidae and Ichneumonidae. Ecto- and endoparasitic species occur in both families. To examine whether shifts between a free-living, ecto-, and endoparasitic existence affects early development, we examined two parasitic wasps from the Ichneumonoidea in relation to the paradigms established through Drosophila and the honeybee (Grbic & Strand 1998). Habrobracon hebetor Say is a braconid ectoparasitoid that lays its eggs on larvae of certain moths, whereas Aphidius ervi Nees is a braconid endoparasitoid whose eggs develop in the hemocoel of selected aphids. Morphological characterisation revealed that H. hebetor lays yolky eggs surrounded by a rigid chorion, and that early embryogenesis proceeds in a syncytium similar to other canonical long germband insects (Fig. 1). In contrast, A. ervi undergoes a very different form of embryogenesis. Except for the first cleavage that proceeds without cytokinesis, all other cleavages are cellular (Fig. 1). Injection fluorescently conjugated dextran tracers into selected blastomeres confirmed that A. ervi undergoes holoblastic (complete) cleavage, and that molecules the size of the transcription factors regulat-

The Effects of Life History on Development of the Hymenoptera 13

ing Drosophila patterning are unlikely to freely diffuse between embryonic cells. This form of cleavage results in development of a morula stage embryo surrounded by an extraembryonic membrane. The morula ruptures from the chorion and, thereafter, undergoes morphogenesis in a manner that resembles short germband development. To compare patterning events at the molecular level, we stained H. hebetor and A. ervi embryos with antibodies that recognise conserved epitopes of Eve, Engrailed (En) and Ultrabithorax/ Abdominal-A (Ubx/Abd-A) in different insect species. Eve, a primary pair-rule gene is expressed in the Drosophila syncytium and forms a characteristic seven-stripe pattern with double segment periodicity (Frasch et al. 1987). En, which is regulated by Eve, is a segment polarity gene that specifies the posterior segmental compartments (MacDonald et al. 1986). Ubx and Abd-A are Drosophila homeotic proteins that specify the posterior thorax and abdomen (Sanchez-Herrero et al. 1985). In H. hebetor, Eve, En and Ubx/Abd-A are expressed in a largely conserved fashion to Drosophila and other long germband insects (Grbic & Strand 1998). In A. ervi, however, we were unable to detect either a pair-rule or segmental pattern for Eve expression although Eve antigen was detected in dorso-lateral mesoderm and neurons. En stripes formed sequentially in A. ervi during germband extension, resulting in a mature pattern of segmentally iterated stripes that localised to the posterior segmental compartments. Ubx/Abd-A was expressed in the posterior thorax and abdomen in the retracted germband stage (Grbic & Strand 1998). The contrasts between early development of H. hebetor and A. ervi are greater than any described previously for insects in the comparative developmental literature. Yet, rather than comparing insects from different orders, these wasps reside in the same monophyletic family. The most striking difference between H. hebetor and A. ervi is the environment in which their eggs develop; an observation suggesting that shifts in life history may induce significant alterations in early development of insects. The similarities between H. hebetor, the honeybee, and Drosophila suggest that the evolution of a parasitic life history per se does not result in significant alterations in early development. However, the shift from an essentially free-living, terrestrial existence (Habrobracon) to development within another organism (Aphidius) has favoured adaptations in Aphidius for survival in a new environment. In particular, the loss of yolk and a chorion in Aphidius would appear to be key alterations in the shift from syncytial to total cleavage, and in the corresponding alterations in expression of genes regulating anterior-posterior axis formation. If so, we would predict that differences in patterning mechanisms should also be seen between species from other higher groups. Indeed, our own studies and the descriptive embryological literature indicate that total cleavage and alterations in expression of patterning genes has arisen among endoparasitoids from other apocritan lineages. In contrast, every ectoparasitic and free-living hymenopteran examined to date undergoes syncytial cleavage and patterns of development similar to H. hebetor and the honeybee (summarised by Strand & Grbic 1997). Our comparative studies further suggest that alterations in early cleavage and embryonic patterning have also been essential preadaptations for the evolution of other traits. Among the most dramatic of these is polyembryony which is defined as the formation of multiple embryos from a single egg. In insects, polyembryony is known only from endoparasitoids in four families of Hymenoptera (Braconidae, Platygasteridae, Dryinidae and Encyrtidae) and the Strepsiptera. Detailed studies of encyrtids like Copidosoma floridanum (Ashmead) and descriptions of polyembryony in other wasp families reveal remarkable similarities in early development of all polyembryonic species. These include the oviposition of yolkless eggs, complete cleavage, and formation of a trophamnion of polar body origin (reviewed by Strand & Grbic 1997). In each polyembyronic

M. R. Strand 14

Figure 1


Embryogenesis of Habrobracon hebetor and Aphidius ervi. Confocal, fluorescent and Nomarski images of embryonic development: A) After oviposition the H. hebetor egg has a clear polarity corresponding to the dorsal-ventral and anterior-posterior embryonic axes: embryonic nuclei (arrowed) divide without cytokinesis; B) During the first few syncytial cleavages nuclei remain in the yolk (arrowed): after the tenth cleavage nuclei migrate to the periphery of the egg where they undergo two additional division cycles in the syncytium before finally forming a cellular blastoderm; C) Following germband, the germband undergoes retraction and segmentation (anterior and posterior limits of embryo marked by arrows); D) After oviposition, the A. ervi egg is lemon-shaped and does not exhibit any axial polarity (nucleus marked by arrow, chorion by arrowhead); E) The first nuclear division proceeds in a syncytium, without cytoplasmic cleavage, but subsequent cleavages result in nuclei separated by cell membranes (phalloidin staining demarcates the cell cortex underlying the cell membranes): large blastomeres (arrowed) give rise to an extraembryonic membrane while small blastomeres give rise to the future embryo; F) Later in development, the extraembryonic membrane (arrowed) surrounding the morula stage embryo ruptures from the chorion (arrowhead); G) The embryo undergoes germband extension by posterior growth followed by condensation and segmentation (extraembryonic membrane removed to facilitate viewing) (Figures A-G adapted from Grbic & Strand 1998). Scale bars: A-C = 80 µm; D-G = 7 µm.

The Effects of Life History on Development of the Hymenoptera 15

taxon, multiple embryos arise from the simultaneous proliferation of blastomeres and partitioning of these cells by ingrowth of a trophamnion. Strand and Grbic (1997) concluded that syncytial cleavage and the constraints on volume inherent in the architecture of typical insect eggs would prevent polyembryony from ever evolving in most insect groups. However, once the transition from syncytial to complete cleavage arose in monoembryonic endoparasitoids, polyembryony has arisen on several occasions. Among the genetic regulatory changes required for polyembryony is the uncoupling of pattern formation processes from early cleavage events in the egg. Analysis of C. floridanum indicates that this has occurred since blastomeres remain undifferentiated, and no patterning genes are expressed during embryo proliferation (Grbic et al. 1996a, 1966b, 1998). Freed from the constraint of early specification of cell fate, embryo proliferation can then proceed by partitioning of blastomeres over the course of the life cycle of the host. Among the ecological transitions favouring polyembryony would be host shifts toward increased size or conditions in which risks of immature mortality are high. Not surprisingly, all polyembryonic wasps are egglarval parasitoids or larval parasitoids that oviposit in young hosts. In summary, our results indicate that early development of the Hymenoptera can vary greatly among species and that departures from the paradigms established in Drosophila may occur commonly among insects whose eggs develop under conditions different from typical terrestrial species. Important future research goals include the need for quantitative analysis of developmental traits in relation to established phylogenies. This will require more rigorous comparison of embryonic and larval development of species from appropriate taxa to determine how evolutionarily labile specific traits might be. Such studies will also require additional phylogenetic information. Parasitoids arguably exhibit greater developmental variation than any other arthropodan group (Strand and Grbic 1997). As such, future comparative studies of the Hymenoptera offer a real opportunity for enhancing our understanding of insect developmental evolution.

Acknowledgements The work discussed here was conducted with support from the National Science Foundation. I also wish to thank M. Grbic for all of his input and important contributions to the work summarised in this brief review.

References Buss, L. W. (1987) The Evolution of Individuality. Princeton University Press, Princeton, New Jersey. Dawes, R., Dawson, I. Falciani, F., Tear, G. & Akam, M. (1994) Dax, a locust Hox gene related to fushi-tarazu but showing no pair-rule expression. Development 120: 1561-1572. del Pino, E. M. & Ellinson, R. P. (1983) A novel development pattern for frogs: Gastrulation produces an embryonic disc. Nature 306: 589-591. Dowton, M. & Austin, A. D. (1994) Molecular phylogeny of the insect order Hymenoptera: apocritan relationships. Proceedings of the National Academy of Sciences, USA 91: 9911-9915. Frasch, M., Hoey, T., Rushlow, C., Doyle, M. & Levine, M. (1987) Characterization and localisation of even-skipped protein of Drosophila. EMBO 6: 749-759. Gould, S. J. (1977) Ontogeny and Phylogeny. Belknap Press, Cambridge, Massachusetts. Grbic, M., Nagy, L. M., Carroll, S. B. & Strand, M. (1996a) Polyembryonic development: insect pattern formation in a cellularized environment. Development 12: 795-804.

M. R. Strand 16


Grbic, M., Nagy L. M.& Strand, M. (1996b) Pattern duplication in the polyembryonic wasp Copidosoma floridanum. Development, Genes and Evolution 206: 281-287. Grbic, M., Nagy L. M. & Strand M. R. (1998) Development of polyembryonic insects: a major departure from typical insect embryogenesis. Development, Genes and Evolution 208: 69-81. Grbic, M. & Strand, M. R. (1998) Shifts in the life history of parasitic wasps correlate with pronounced alterations in early development. Proceedings of the National Academy of Sciences, USA 95: 1097-1101. Hanson, P. E. & Gauld, I. D. (1995) The Hymenoptera of Costa Rica. Oxford University Press, Oxford. Ingham, P. W. (1988) The molecular genetics of embryonic pattern formation in Drosophila. Nature 335: 25-33. Jeffery, W. R. & Swalla, B. J. (1991) An evolutionary change in the muscle lineage of an anural ascidian embryo is restored by the interspecific hybridization with a urodele ascidian. Developmental Biology 145: 328-337. MacDonald, P., Ingham, P. & Struhl, G. (1986) Isolation, structure, and expression of evenskipped: a second pair-rule gene of Drosophila containing a homeobox. Cell 47: 721-734. Patel, N. H., Ball, E. & Goodman, C. S. (1992) Changing role of even-skipped during the evolution of insect pattern formation. Nature 357: 339-342. Raff, R. (1992) Direct-developing sea urchins and the evolutionary reorganization of early development. BioEssays 14: 211-218. Rasnitsyn, A. P. (1988) An outline of the evolution of the hymenopterous insects (Order Vespida). Oriental Insects 22: 115-145. Sanchez-Herrero, E., Vernos, I., Marco, R. & Morata, G. (1985) Genetic organisation of the Drosophila bithorax complex. Nature 313: 108-113. Sander, K. (1983) The evolution of patterning mechanisms: gleanings from insect embryogenesis and spermatogenesis. pp. 137-159. In Goodwin, B. P. (Ed.), Development and Evolution. Cambridge University Press, Cambridge. Scott, L. B., Lennarz, W. J., Raff, R. A. & Wray, G. A. (1990) The “lecitotrophic” sea urchin Heliocidaris erytrogama lacks typical yolk platelets and yolk proteins. Developmental Biology 138: 188-193. St Johnston, D. & Nüsslein-Volhard, C. (1992) The origin of pattern and polarity in the Drosophila embryo. Cell 68: 201-219. Strand, M. R. (1999) Developmental traits and life history evolution in parasitoids. pp. 139–162. In Hochberg, M. & Ives, A. R. (Eds), Parasitoid Population Biology. Princeton University Press, Princeton. Strand, M. R.& Grbic, M. (1997) The development and evolution of polyembryonic insects. Current Topics in Developmental Biology 35: 121-158. Tautz, D. & Sommer R. (1995) Evolution of the segmentation genes in insects. Trends in Genetics 1: 23-27. Thomson, K. S. (1988) Morphogenesis and Evolution. Cambridge University Press, Cambridge. Whitfield, J. B. (1998) Phylogeny and evolution of host-parasitoid interactions in Hymenoptera. Annual Review of Entomology 43: 129-151. Wray, G. A. (1995) Punctuated evolution of embryos. Science 267: 1115-1116. Wray, G. A. & Bely, A. E. (1994) The evolution of echinoderms is driven by several distinct factors. Development Supplement 97-106. Wray, G. A. & Raff, R. A. (1990) Novel origins of lineage founder cells in the direct developing sea urchin Heliocidaris erytrogama. Developmental Biology 141: 41-54.

Molecular Basis of Developmental Alteration in Heliothis virescens (F.) Larvae Parasitised by Cardiochiles nigriceps Viereck Francesco Pennacchio1,3, Patrizia Falabella1, Paola Varricchio1, Rocco Sordetti1, S. Bradleigh Vinson2, Franco Graziani3 and Carla Malva3 1

Dipartimento di Biologia, Difesa e Biotecnologie Agro-Forestali, Università della Basilicata, via N. Sauro, 85 – 85100 Potenza, Italy (email: [email protected]) 2

Department of Entomology, Texas A&M University, College Station, TX 77843-2475 USA

3

Istituto Internazionale di Genetica e Biofisica, C.N.R., via Marconi, 10–80125 Napoli, Italy

Introduction Cardiochiles nigriceps Viereck is an endophagous parasitoid of the larval stages of the tobacco budworm, Heliothis virescens (F.). Larval development and moulting of parasitised hosts are not inhibited until the last instar is attained. At that time, pupation failure and developmental arrest are observed, associated to a significant increase of host nutritional suitability for the developing parasitoid larva (Pennacchio et al. 1993). This developmental arrest of host mature larvae is induced by an alteration of ecdysone biosynthesis and metabolism. A reduced biosynthetic activity of prothoracic glands, which do not show any gross morphological degeneration (Tanaka & Vinson 1991), along with the conversion of 20-hydroxyecdysone to inactive polar derivatives have been reported (Pennacchio et al. 1994). This metabolic inactivation of 20hydroxyecdysone is partly mediated by teratocytes, cells deriving from the dissociation of the serosal membrane, which grow in size without undergoing division (Pennacchio et al. 1994). Prothoracic glands of host mature larvae are inactivated by a parasitoid-induced disruption of PTTH (prothoracicotropic hormone) signal transduction pathway (Pennacchio et al. 1997, 1998a). More precisely, an evident underphosphorylation of key regulatory proteins, such as ribosomal S6 and ß-tubulin, is observed in response to PTTH stimulation. This probably induces a reduced rate of general protein synthesis and a substantial depression of the cytoskeletonmediated transport of ecdysone precursors and intermediate metabolites (Pennacchio et al. 1997, 1998a). The major host regulatory factors actively interfering with ecdysone biosynthesis in host prothoracic glands are calyx fluid and venom of the parasitoid (Tanaka & Vinson 1991). More recently, indirect experimental evidence indicates that trascriptionally active C. nigriceps polydnavirus (CnPDV) is required to induce host prothoracic gland inactivation in vitro (Pennacchio et al. 1998b). In fact, trioxsalen addition to CnPDV preparations followed by UV irradiation, eliminated the negative effect of the virus on ecdysteroidogenesis, registered when pupally committed prothoracic glands explanted from non-parasitised larvae, are co-incubated in vitro along with CnPDV and venom. 17

F. Pennacchio et al. 18


In order to isolate the parasitoid-viral genes involved in the inactivation of host prothoracic glands, a molecular characterisation of CnPDV genome and of the expressed sequences in parasitised host larvae has been undertaken. The most recent molecular data are briefly summarised in this note, along with functional information on the possible mechanism of action of the CnPDV genes expressed in the host and targeting prothoracic glands of the tobacco budworm larvae.

CnPDV Molecular Characterisation and Analysis of the Genes Expressed in Parasitised Hosts Free viral particles were isolated from ovaries of C. nigriceps and purified on a sucrose gradient. Negatively stained nucleocapsids showed evident ‘end structures’ and a membranaceous tail-like appendage. Size fractionation of DNA extracted from viral particles indicated the occurrence of circular dsDNA molecules, approximately ranging from 3 kb to 30 kb. This genome segmentation, typical of all Polydnaviridae, is associated to non-equimolar ratios among the different DNA segments, which are integrated as provirus in the genomic DNA of both females and males and transmitted vertically through the germ line (Varricchio et al. 1999). Northern blot studies were conducted on total or polyA+ RNA extracted from H. virescens larvae, on day 4 of 5th instars, at different time intervals (12, 24 and 48 h) after parasitoid oviposition, using CnPDV genomic DNA as a probe. This experiment indicated the occurrence of 6-8 polyadenylated main transcripts of viral origin. These transcripts were present from 12 to 48 h after parasitoid oviposition, at nearly constant levels (Varricchio et al. 1999). In order to clone viral genes expressed in parasitised hosts, two libraries of CnPDV genome were prepared and screened in reverse Northern, using as probe a labelled cDNA preparation, obtained by using polyA+ RNA extracted from H. virescens larvae, 24 h after C. nigriceps parasitisation. Various genomic viral fragments were identified and further analysed. These fragments, when used as probes in Southern blot experiments, hybridised to different undigested CnPDV DNA molecules and to various HindIII and EcoRI restriction fragments of the digested viral DNA and of the digested genomic DNA, extracted from both females and males of C. nigriceps (Varricchio et al. 1999). A cDNA library was prepared by using polyA+ mRNAs extracted from parasitised host larvae and screened using the isolated viral genomic clones as probes. Several positive cDNA clones were isolated and sequenced. The sequence analysis of two of these cDNAs and of the corresponding genomic sequences, allowed us to define the structure of the isolated CnPDV genes, expressed in parasitised hosts. These genes have introns and short open reading frames coding for small putative translation products with no substantial similarity with known proteins (Varricchio et al. 1999; unpublished). The cDNAs were used as digoxigenin-labelled probe for in situ hybridisation experiments on prothoracic glands explanted from H. virescens larvae, on day 4 of final (5th) instars, 24 h after they were parasitised by C. nigriceps. Hybridisation signals were clearly evident in the outer cytoplasmic layer of prothoracic glands explanted from parasitised hosts, while no signal was detected in glands obtained from non-parasitised controls (Varricchio et al. 1999).

Alteration of PTTH Signal Transduction Pathway The PTTH signal transduction pathway in prothoracic glands of H. virescens last instar larvae parasitised by C. nigriceps is deeply impaired, due to titer reduction of proteins involved in ecdysteroid biosynthesis, associated with a lowered efficiency of cytoskeleton-mediated trans-

Molecular Basis of Developmental Alteration in Heliothis virescens (F.) 19

port of ecdysone precursors and intermediate metabolites (Pennacchio et al. 1997, 1998a). These combined alterations presumably derive from the depressed phosphorylation rate of key regulatory proteins, as described in detail above. To better define the molecular mechanisms of the parasitoid-induced alteration of the PTTH signal transduction pathway, we designed an experiment aiming at evaluating the effect, if any, of the parasitism on the level of S6 kinase activity in prothoracic glands. Cytosolic extracts of prothoracic glands explanted from parasitised host last instar larvae and from synchronous nonparasitised controls were fractionated by HPLC on an anion exchange column (Mono Q HR). S6 kinase activity of each chromatographic fraction was assessed in vitro, using as a substrate a synthetic peptide (S6-21 : AKRRRLSSLRASTSKSESSQK), corresponding to the structural domain of ribosomal S6 phosphorylated at multiple serine sites (Brandon & Masaracchia 1991), and [32P] ATP as phosphate donor. There were no substantial differences in the level of S6 kinase activity in the cytosolic extracts obtained from prothoracic glands explanted from parasitised host larvae compared to those from synchronous non-parasitised controls (Falabella et al. unpublished). This experimental evidence suggests that a possible inhibition of cAMP dependent protein kinases may be active in intact cells.

Discussion and Conclusions CnPDV typically shows a segmented genome and the circular dsDNA segments are integrated as provirus in the wasp’s genome and transmitted vertically to the progeny, through the germ line. The number of viral genes expressed in parasitised hosts is lower to that reported for the ichneumonid Campoletis sonorensis (Cameron) (Blissard et al. 1986). These genes are persistently expressed over time, at least for the intervals considered. If we take into account the number of expressed genes compared to the aggregate genome size, which is around 100 kb, and the fact that the viral genomic clones characterised hybridise with different DNA segments, it is reasonable to conclude that a remarkable genome redundancy may occur. Further study is required to assess whether each superhelix is a mosaic of unique and shared sequence, and if gene families do also occur. The gene duplication in polydnaviruses can be an important evolutionary strategy that allows the accumulation of multiple copies of important functional genes (Fleming & Krell 1993). It is reasonable to consider genome segmentation, repeated sequences, segment nesting (Xu & Stoltz 1993; Cui & Webb 1997; Webb & Cui 1998) and non-equimolar segment ratios as different ways adopted by the virus to abundantly express genes that may have relevant functional roles in parasitised hosts, where virus replication does not occur. CnPDV actively regulates the physiology of H. virescens host larvae, inducing several alterations of both immune and endocrine systems. The molecular mechanisms of these pathological syndromes are poorly investigated, not only in the experimental system considered in the present study. However, the immune suppression mechanisms and the polydnavirus genes involved are by far more deeply investigated in various model systems, with numerous recent interesting studies (Strand & Pech 1995a, 1995b; Asgari et al. 1996, 1998; Yamanaka et al. 1996; Cui et al. 1997; Strand et al. 1997). The work reported here on neuroendocrine host alterations induced by the braconid C. nigriceps is probably the first attempt at a functional genetics approach to the study of the mechanisms regulating the developmental disruption, often observed in parasitised lepidopteran larvae. As visually summarised in Figure 1, the PTTH signal transduction pathway in prothoracic glands of H. virescens last instar larvae is interrupted, due to reduced phosphorylation of regulatory


Figure 1


Proposed model for PTTH signal transduction pathway in prothoracic glands of mature Manduca sexta larvae (after Gilbert et al. 1988), which also applies to Heliothis virescens last (5th) instar larvae. Parasitism by Cardiochiles nigriceps interferes with the steps downstream the phosphorylation of key regulatory proteins controlling the protein synthesis rate and cytoskeleton-mediated transport of ecdysone precursors and intermediate metabolites. Cardiochiles nigriceps polydnavirus seems to exert a negative impact on the cAMP dependent kinase activity in prothoracic glands of host larvae.

proteins. Based on the functional and molecular studies presented here, we may hypothesise that some of the polydnavirus genes we have isolated and characterised could be involved in an inactivation mechanism of cAMP dependent protein kinases. However, further studies are required in order to more directly assess the role of the viral gene products expressed in prothoracic glands of parasitised insects. Research efforts are currently focused on the development of a suitable protocol for expressing foreign genes in prothoracic gland. This will allow us to assess more directly their role in determining the molecular alterations observed in prothoracic glands of naturally parasitised host mature larvae. It is very likely that CnPDV genes precociously expressed in parasitised tobacco budworm larvae may also play a role in the suppression of host immune response. If this is the case, then it will be interesting to compare the effects of the same genes, or even similar genes belonging to gene families, on different cell types. If a common mechanism is involved, we should expect that a conserved and basic metabolic pathway is probably affected. Such an approach could shed some light on possible common key strategies adopted by polydnaviruses for interfering with many different target tissues, eliciting an apparently unrelated array of symptoms, which concur in defining complex parasitism-induced syndrome.

Acknowledgements The work reported in this paper has been financially supported by research grants provided by M.U.R.S.T. (National Project SIDiVVAM) and EU-Regione Basilicata (P.O.P. – FESR: Metodi non convenzionali di difesa di colture di interesse agrario per la Regione Basilicata).

Molecular Basis of Developmental Alteration in Heliothis virescens (F.) 21

References Asgari, S., Hellers, M. & Schmidt, O. (1996) Host haemocyte inactivation by an insect parasitoid: transient expression of a polydnavirus gene. Journal of General Virology 77: 2653-2662. Asgari, S., Theopold, U., Wellby, C. & Schmidt, O. (1998) A protein with protective properties against the cellular defense reactions in insects. Proceedings of the National Academy of Sciences, USA 95: 3690-3695. Blissard, G. W., Fleming , J. G. W., Vinson, S. B. & Summers, M. D. (1986) Campoletis sonorensis virus: expression in Heliothis virescens and identification of expressed sequences. Journal of Insect Physiology 32: 351-359. Brandon, S. D. & Masaracchia, R. A. (1991) Multisite phosphorylation of a synthetic peptide derived from the carboxyl terminus of the ribosomal protein S6. Journal of Biological Chemistry 266: 380-385. Cui, L. & Webb, B. A. (1997) Homologous sequences in the Campoletis sonorensis polydnavirus genome are implicated in replication and nesting of the W segment family. Journal of Virology 71: 8504-8513. Cui, L., Soldevila, A. & Webb, B. A. (1997) Expression and haemocyte-targeting of a Campoletis sonorensis polydnavirus cysteine-rich gene in Heliothis virescens larvae. Archives of Insect Biochemistry & Physiology 36: 251-271. Fleming, J. G. W. & Krell, P. J. (1993) Polydnavirus genome organization. pp. 189-225. In Beckage N. E., Thompson S. N. & Federici B. A. (Eds), Parasites and Pathogens of Insects, Vol. 1 Parasites. Academic Press, New York. Gilbert, L. I., Combest, W. L., Smith, W. A., Meller, V. H. and Rountree, D. B. (1988). Neuropeptides, second messangers and insect molting. BioEssay 8: 153-157. Pennacchio, F., Vinson, S. B. & Tremblay, E. (1993) Growth and development of Cardiochiles nigriceps Viereck (Hymenoptera, Braconidae) larvae and their synchronization with some changes of the hemolymph composition of their host, Heliothis virescens (F.) (Lepidoptera, Noctuidae). Archives of Insect Biochemistry & Physiology 24: 65-77. Pennacchio, F., Vinson, S. B., Tremblay, E. & Ostuni, A. (1994) Alteration of ecdysone metabolism in Heliothis virescens (F.) (Lepidoptera, Noctuidae) larvae induced by Cardiochiles nigriceps Viereck (Hymenoptera, Braconidae) teratocytes. Insect Biochemistry & Molecular Biology 24: 383-394. Pennacchio, F., Sordetti, R., Falabella, P. & Vinson, S. B. (1997) Biochemical and ultrastructural alterations in prothoracic glands of Heliothis virescens (F.) (Lepidoptera: Noctuidae) last instar larvae parasitised by Cardiochiles nigriceps Viereck (Hymenoptera: Braconidae). Insect Biochemistry & Molecular Biology 27: 439-450. Pennacchio, F., Falabella, P., Sordetti, R., Varricchio P., Malva C. & Vinson, S. B. (1998a) Prothoracic gland inactivation in Heliothis virescens (F.) (Lepidoptera: Noctuidae) larvae parasitised by Cardiochiles nigriceps Viereck (Hymenoptera: Braconidae). Journal of Insect Physiology 44: 845-857. Pennacchio, F., Falabella, P. & Vinson, S. B. (1998b) Regulation of Heliothis virescens prothoracic glands by Cardiochiles nigriceps polydnavirus. Archives of Insect Biochemistry & Physiology 38: 1-10. Strand, M. R. & Pech, L. L. (1995a) Immunological basis for compatibility in parasitoid-host relationships. Annual Review of Entomology 40: 31-56. Strand, M. R. & Pech, L. L. (1995b) Microplitis demolitor polydnavirus induces apoptosis of a specific haemocyte morphotype in Pseudoplusia includens. Journal of General Virology 76: 283-291. Strand, M. R., Witherell, R. A. & Trudeau, D. (1997) Two Microplitis demolitor polydnavirus mRNAs expressed in hemocytes of Pseudoplusia includens contain a common cysteine-rich domain. Journal of Virology 71: 2146-2156.



Tanaka, T. & Vinson, S. B. (1991) Depression of prothoracic gland activity of Heliothis virescens by venom and calyx fluids from the parasitoid, Cardiochiles nigriceps. Journal of Insect Physiology 37: 139-144. Varricchio, P., Sordetti, R., Falabella P., Graziani, F., Malva, C. & Pennacchio, F. (1999) Cardiochiles nigriceps polydnavirus: molecular characterisation and expression in parasitised Heliothis virescens larvae. Insect Biochemistry & Molecular Biology 29: 1087-1096. Webb, B. A. & Cui, L. (1998) Relationship between polydnavirus genomes and viral gene expression. Journal of Insect Physiology 44: 785-793. Xu, D. & Stoltz, D. B. (1993) Polydnavirus genome segment families in the ichneumonid parasitoid Hyposoter fugitivus. Journal of Virology 67: 1340-1349. Yamanaka, A., Hayakawa, Y., Noda, H., Nakashima, N. & Watanabe, H. (1996) Characterisation of polydnavirus-encoded mRNA in parasitised armyworm larvae. Insect Biochemistry & Molecular Biology 26: 529-536.

Protection by Immune Disguise: a New Lesson From a Parasitoid Wasp Ulrich Theopold*, Dongmei Li, Wanja Kinuthia and Otto Schmidt Department of Applied & Molecular Ecology, Waite Campus, The University of Adelaide, P.M.B. 1 Glen Osmond, S. A. 5064 Australia (email: [email protected]) (*present address: Department of Molecular Biology, Stockholm University SE-10691 Stockholm, Sweden)

Introduction Immune protection of parasitoid wasps has been ascribed to a number of mechanisms, which include systemic mechanisms like suppression of the host’s cellular immune response and localised surface protection like egg coating with wasp maternal protein secretions. In this paper, we review recent work describing a novel mechanism of immune protection employed by the parasitoid wasp Venturia canescens Gravenhorst, which we call ‘immune disguise’. During immune disguise, the parasitoid is covered with a specific moiety of host hemolymph components thus gaining protection from further attack by the host, which fails to recognise the components as foreign. The sequestration of hemolymph components by the parasitoid shows similarities with insect hemolymph coagulation.

Proteolytic Cascades Involved in Innate Immunity The innate immune system of vertebrates comprises a number of proteolytic activation cascades, such as the complement system and the coagulation cascade, which help to establish a first line of defence against intruding micro-organisms (Cerenius & Soederhaell 1995). Searching for similar systems in arthropods, two proteolytic cascades have been identified, the prophenoloxidase-activating cascade (PPO cascade) and the coagulation cascade in the horseshoe crab, Limulus (Iwanaga et al. 1998). Both cascades are activated by molecules of microbial origin, including lipopolysaccharide, laminarin and proteoglycan. Although the PPO cascade is mostly known for its capacity to produce microbicidal compounds, it is also involved in several other reactions of the invertebrate immune system including cellular reactions (Cerenius & Soederhaell 1995). Accordingly, a cell-surface form of prophenoloxidase has been identified (Charalambidis et al. 1996). In addition to proteolytic activities, a number of protease inhibitors, which act at different levels of the PPO cascade have been isolated from hemolymph (Cerenius & Soederhaell 1995). It can be proposed that these inhibitors are involved in regulating different steps of the PPO cascade. In this scenario, induction of one type of immune response may occur at the expense of other possible responses. One such decision is between cellular and humoral immune reactions. In contrast to Limulus, little is known about the coagulation reaction of insect hemolymph, which is usually regarded as part of the hemostatic wound response. Nevertheless, just as in Limulus, microbial elicitors also seem to enhance coagulation of insect hemolymph (Duvic & Brehelin 1998). It has also been shown that the resulting coagulum acts as a trap for bacteria, which bind to fibrillar structures formed by hemocyte degranulation (reviewed by Ratcliffe & Rowley 1979). 23

Ulrich Theopold, Dongmei Li, Wanja Kinuthia and Otto Schmidt 24


The Coagulation of Insect Hemolymph Clotting in vertebrates is known to depend on the interaction between cellular components, mostly derived from platelets and soluble serum factors, the clotting factors. The factors that form the coagulum exist in an inactive form, called coagulogen and are activated through proteolytic cascades composed mostly of serine proteases. The mobilisation of the cellular coagulogen involves the release of specialised so-called alpha-granules and the formation of microparticles, small membrane vesicles, which help to attract clotting factors and aid in their activation (Dachary-Prigent et al. 1996). As mentioned above, most of our understanding on coagulation reactions in arthropods stems from studies of crustaceans and arachnids where, in some species, most factors involved in hemolymph coagulation have been identified and characterised at a molecular level (Iwanaga et al. 1998). Only a few proteins share complete sequence homology with vertebrate proteins involved in proteolytic cascades. Nevertheless, a number of domains appear to be evolutionarily conserved including serine protease- and epidermal growth factor-like domains, C-type lectinand defensin-like domains, and domains found in a number of complement proteins (Muta & Iwanaga 1996). Hemolymph clotting in insects, like in vertebrates, involves the interaction between cellular and humoral pro-coagulant activity (Bohn 1986). In several species, the humoral pro-coagulant has been identified as lipophorin, a multifunctional abundant hemolymph protein (reviewed by Bohn 1986). This was recently confirmed in locusts where coagulation could be induced by the addition of laminarin, a component of yeast cell walls, to hemolymph (Duvic & Brehelin 1998). The precipitate contained protein bands of 265 and 80 kDa, indicative of apolipohorin I and II. In that regard, insects show similarities to crustaceans, where the major protein recruited by hemolymph clotting is also a lipoprotein (Hall et al. 1995). Interestingly, a proteolytic cascade with a function in insect development, encoded by the genes of the dorso-ventral group, shows striking similarities to coagulation cascades (Muta & Iwanaga 1996). Several members of the dorso-ventral cascade are serine proteases, which are involved in the localised formation of a ligand for the toll receptor. It is tempting to speculate that this cascade might be also multi-functional like the intracellular signal transduction cascade encoded by other members of the dorso-ventral group, which are used both in development and immunity (Lemaitre et al. 1996).

Microparticles as part of the cellular coagulogen in insects We have previously shown that insect hemolymph coagulation leads to the formation of vesicles which show a number of similarities to vertebrate microparticles (Theopold & Schmidt 1997): 1) The formation of microparticles is calcium-dependent, possibly mediated by calpain, a calcium-dependent protease, which we previously identified in insects (Theopold et al. 1995). 2) Microparticles are released from the cell surface through fragmentation of filopodia, and 3) Microparticles expose negatively charged phospholipids on their surface that can be visualised by staining with annexin V (Theopold & Schmidt 1997). Due to the similarities between vertebrate microparticles and the membrane vesicles we could identify in insect, we decided to name the vesicles ‘insect microparticles’ (Theopold & Schmidt 1997).

Protection by Immune Disguise: a New Lesson From a Parasitoid Wasp 25

A Lipophorin

crosslinking activity

Hemomucin

MP surface

B Lipophorin

Hemomucin

crosslinking activity

Figure 1

egg surface

A) Hypothetical scheme of insect hemolymph coagulation involving the surface of microparticles (MP) and the interaction between hemomucin and lipophorin; B) scheme of the formation of a similar complex on the surface of Venturia eggs and larvae (for further explanations see text).

In addition to annexin V, insect microparticles from a number of species can be stained with lectins, which are specific for N-Acetyl Galactosamine (GalNAc) like Helix pomatia L. agglutinin (H.p. lectin). A protein that is labelled by H.p. lectin could be identified in a lepidopteran species (Galleria mellonella L.) and in Drosophila melanogaster Meigen. Using a hemocyte-like cell line (mbn-2 cells), we were able to purify the protein and isolate the corresponding cDNA for the Drosophila protein (Theopold et al. 1996). After its source of isolation and because it contains a typical mucin domain, the protein was named ‘hemomucin’. Pointing towards a possible role in coagulation, hemomucin could be shown to attract lipophorin, the previously identified humoral coagulant, from hemolymph (Theopold & Schmidt 1997). Figure 1A shows a hypothetical model for the role hemomucin plays as a component of insect microparticles in hemolymph



A

B

Figure 2

A) Venturia larva dissected from the chorion and stained with H.p. lectin. The first signs of staining occur at segmental borders, as shown in this larva. At a later stage, the stripe pattern is replaced by an even surface staining as described for the larva at the time of hatching from the egg shell (Kinuthia et al. 1999); B) same section as in (A) but in phase contrast.

clotting. The cross-linking activity needed for the formation of an insoluble coagulum is most likely phenoloxidase. In this context, it is interesting to note that hemomucin shows significant sequence similarity to a class of plant enzymes that are involved in the formation of alkaloid precursors by catalysing a condensation reaction between a monoterpene and an indole ring (Theopold et al. 1996). It can be speculated that hemomucin might play a role in the crosslinking reaction by attracting tyrosine derivatives which share some structural similarity with the substrates of the plant enzyme and are known as substrates for phenoloxidase.

Protection by Immune Disguise: a New Lesson From a Parasitoid Wasp 27

A Hemomucin-like Protein in a Parasitoid Wasp In addition to hemocytes and the lining of the gut, Drosophila hemomucin was also found on the surface of the egg (Theopold et al. 1996). Since mucopolysaccharides on the egg surface were implicated in immune protection (Fuehrer 1972), we propose that this expression pattern might constitute a pre-adaptation for the parasitic lifestyle. By expressing a phylogenetically conserved protein, which is also part of the immune system, on their surface, parasitoid eggs might be protected from attack by their host’s immune system. We were indeed able to identify a possible hemomucin homologue in the parasitoid wasp V. canescens (Kinuthia et al. 1999). Staining with GalNAc-specific lectins showed a pattern similar to Drosophila with strong staining of hemocytes including microparticles, the egg surface and the larval surface. In addition, similar to purified hemomucin, eggs prepared from the oviduct were able to attract lipophorin after incubation with Ephestia hemolymph (Kinuthia et al. 1999). We are thus faced with the paradoxical situation that the freshly deposited parasitoid egg uses part of the host’s humoral immune response to avoid the cellular response. The important difference between a normal coagulation reaction and the reaction on the egg surface may be the limited nature of the latter. A limited coagulation reaction, which involves the parasitoid’s hemomucin and host lipophorin, seems to protect the egg from any further cellular attack. Since we could also see H.p. lectin staining on larval surfaces and identify hemomucin in larval extracts (Kinuthia et al. 1999) (Figs 2A, 2B), the same mechanisms could explain how the larva is protected once it emerges from the eggshell. It has indeed been shown before that lipophorin inhibits hemocyte attachment (Coodin & Caveney 1992; Mandato et al. 1996) and, more recently, that lipophorin complexes derived from a coagulation reaction have inhibitory activity on hemocyte phenoloxidase and on the regulatory protease which activates phenoloxidase (Duvic & Brehelin 1998). In our model, the protection conferred by lipophorin is thus mediated through hemomucin, which is both present on the egg surface and on surfaces that are exposed to the immune system (Fig. 1B). It is possible that one of the protective proteoglycans, which were described earlier in V. canescens (Fuehrer 1972) is in fact identical with hemomucin. The crosslinking activity on the egg surface could be an ovary-specific phenoloxidase or peroxidase, activities which have both been detected in mosquitoes (Li et al. 1996).

Acknowledgements This work was supported by a grant from the Australian Research Council. U.T. is supported by an ARC Research Fellowship.

References Bohn, H. (1986) Hemolymph clotting in insects. pp. 189-207, In Brehelin, M. (Ed.), Immunity in Invertebrates. Springer-Verlag, Heidelberg. Cerenius, L. & Soederhaell, K. (1995) Crustacean immunity and complement; a premature comparison? American Zoologist 35: 60-67. Charalambidis, N. D., Foukas, L. C., Zervas, C. G. & Marmaras, V. J. (1996) Hemocyte surface phenoloxidase (PO) and immune response to lipopolysaccharide (LPS) in Ceratitis capitata. Insect Biochemistry & Molecular Biology 26: 867-874. Coodin, S. & Caveney, S. (1992) Lipophorin inhibits the adhesion of cockroach (Periplaneta americana) haemocytes in vitro. Journal of Insect Physiology 38: 853-862.



Dachary-Prigent, J., Toti, F., Satta, N., Pasquet, J. M., Uzan, A. & Freyssinet, J. M. (1996) Physiopathological significance of catalytic phospholipids in the generation of thrombin. Seminars in Thrombosis & Hemostasis 22: 157-164. Duvic, B. & Brehelin, M. (1998) Two major proteins from locust plasma are involved in coagulation and are specifically precipitated by laminarin, a beta-1,3-glucan. Insect Biochemistry & Molecular Biology 28: 959-967. Fuehrer, E. (1972) Mucopolysaccharide im weiblichen Geschlechtsapparat parasitischer Hymenopteren. Naturwissenschaften 59: 167-168. Hall, M., van Heusden, M. C. & Soederhaell, K. (1995) Identification of the major lipoproteins in crayfish hemolymph as proteins involved in immune recognition and clotting. Biochemical & Biophysical Research Communications 216: 939-946. Iwanaga, S., Kawabata, S. & Muta, T. (1998) New types of factors and defence molecules found in horseshoe crab hemolymph – their structures and functions. Journal of Biochemistry 123: 1-15. Kinuthia, W. , Li, D., Schmidt, O. & Theopold, U. (1999) Is the surface of endoparasitic wasp eggs and larvae covered by a limited coagulation reaction? Journal of Insect Physiology 45: 501-506. Lemaitre, B., Nicolas, E., Michaut, L., Reichhart, J.-M. & Hoffmann, J. A. (1996) The dorsoventral regulatory gene cassette spaetzle/toll/cactus controls the potent antifungal response in Drosophila adults. Cell 86: 973-983. Li, J., Hodgeman, B. A. & Christensen, B. M. (1996) Involvement of peroxidase in chorion hardening in Aedes aegypti. Insect Biochemistry & Molecular Biology 26: 309-317. Mandato, C. A., Diehljones, W. L. & Downer, R. G. H. (1996) Insect hemocyte adhesion in vitro – inhibition by apolipophorin I and an artificial substrate. Journal of Insect Physiology 42: 143-148. Muta, T. & Iwanaga, S. (1996) The role of hemolymph coagulation in innate immunity. Current Opinion in Immunology 8: 41-47. Ratcliffe, N. A. & Rowley, A. F. (1979) Role of hemocytes in defence against biological agents. pp. 331-414. In Gupta, A. P. (Ed.), Insect Hemocytes. Cambridge University Press, Cambridge. Theopold, U., Pinter, M., Daffre, S., Tryselius, Y., Friedrich, P., Naessel, D. & Hultmark, D. (1995) CalpA, a Drosophila calpain homolog specifically expressed in a small set of nerve, midgut and blood cells. Molecular & Cellular Biology 15: 824-834. Theopold, U., Samakovlis, C., Erdjument-Bromage, H., Dillon, N., Axelsson, B., Schmidt, O., Tempst, P. & Hultmark, D. (1996) Helix pomatia lectin, an inducer of Drosophila immune response binds to hemomucin, a novel surface mucin. Journal of Biological Chemistry 271: 12708-12715. Theopold, U. & Schmidt, O. (1997) Helix pomatia lectin and annexin V, two molecular probes for insect microparticles: possible involvement in hemolymph coagulation. Journal of Insect Physiology 43: 667-674.

Host Defence Manipulation by Parasitoid Wasps and the Problem of Assessing Host Specificity Otto Schmidt, Sassan Asgari, Markus Beck* and Ulrich Theopold** Department of Applied & Molecular Ecology, Waite Campus, The University of Adelaide, P.M.B. 1 Glen Osmond, S. A. 5064 Australia (email: [email protected]) (present addresses: *Department of Entomology, University of Wisconsin-Madison, Madison, WI 53706 USA; **Department of Molecular Biology, Stockholm University SE-10691 Stockholm, Sweden)

Introduction Hymenopteran parasitoids are increasingly used as biocontrol agents due to a seemingly inexhaustible source of wasp species known to parasitise a wide range of arthropod pests. However, the potential to reduce insect pest numbers in the field is not always realised in practice. In biological control, as in many complex experimental situations, only positive outcomes are likely to reveal testable information, which is why little is known about specific reasons of control failures. Many steps in the introduction of biological control agents are indeed a black box (Waage 1998), including some fundamental questions, like the genetic diversity and ecology of the pest insect which may not correspond to adaptive features of the introduced wasp (see Beck et al. this volume), the rearing process which may have altered essential wasp properties and the release and establishment procedures which may not be appropriate in the field (Hopper & Roush 1993). Although it was long assumed to be a main factor, the application of sophisticated diagnostic tools increasingly demonstrates the importance of genetic variation in both target pests and natural enemies. Genetic variation and genetic diversity are closely associated with important features of parasitoid host interactions, such as host adaptations and specificity. The problem is that some of the most fundamental physiological processes of how insect endoparasitoids interact with the host are not known at the molecular level. This includes two basic questions: 1) how insects recognise and react to foreign objects and distinguish them from self, and 2) how some parasites and pathogens are easily able to overcome the host defence. Recent observations on the cellular induction of humoral defence molecules revealed a cytoplasmatic signalling cascade which resembles those in vertebrates (Hultmark 1994a). In Drosophila melanogaster Meigen the transcription factors involved in the activation of immune genes belong to the rel family of gene products, involved in the mammalian acute response (Sun et al. 1991; Ip et al. 1993; Liou & Batimore 1993; Reichhart et al. 1993). This may be an indication that the intracellular regulation of extracellular immune signals has been highly conserved during evolution. Interestingly, the induction of dorso-ventral polarity in embryonic development is regulated in D. melanogaster by a cascade of cell surface (Hultmark 1994b) and transcription factors (Lemaitre et al. 1995), that are used in later stages again for the activation of defence molecules against fungal invasion (Lemaitre et al. 1996). From these and other studies it emerges that different micro-organisms elicit specific responses and that the intracellular regulation of immune defence molecules is partitioned in separate regulatory cascades. Unfortunately the progress of unravelling the intracellular regulation of immune responses is not matched with the recognition

29

Otto Schmidt, Sassan Asgari, Markus Beck and Uli Theopold 30


The Campoletis/Heliothis model Egg

Larval stages

29-36 kDa ovarian proteins

VHv1.1 (cysteine-rich virus protein)

WHv1.0 (cysteine-rich virus protein)

oviposition Figure 1

Schematic depiction of gene activity during egg and larval stages of the parasitoid Campoletis sonorensis inside the host caterpillar Heliothis virescens. Bold lines indicate viral transcripts. Thin lines indicate the presence of proteins (produced from maternal transcripts in the female wasp ovary or from viral transcripts in infected host cells). In this system the immune suppression in the caterpillar is continuous throughout wasp development and mediated by wasp genes coding for a group of ovarian proteins 29-34 kDa in size (Webb & Luckhart 1994, 1996) and polydnavirus-specific gene families (VH and WH denotes different viral plasmids) coding for Cysteine-rich proteins (Dib-Haijj et al. 1993; Li & Webb 1994). The embryonic and larval contours are a schematic representation of the two developmental stages and do not represent accurate time frames.

and signalling at the extracellular level. It is still too early to ask the question, whether secreted components used in recognition and inactivation of foreign objects in insects are in any case related to mammalian recognition molecules. Although immunoglobulin-like molecules exist (Sun et al. 1990), insects lack immunoglobulins as specific recognition molecules and with it the clonal selection that allows to distinguish ‘self’ from ‘non-self’ as well as a memory of previous encounters with micro-organisms (Hoffmann et al. 1996). If at all, any similarities to vertebrate immunity may be at the level of innate immune responses (Hoffmann 1995), which include nonclassical pathways leading to coagulation (Theopold & Schmidt 1997), phagocytosis (Foukas et al. 1998), cell attachment (LanzMendoza et al. 1996), opsonisation (Schmidt et al. 1993) and release of defence molecules (Hoffmann & Hetru 1992). The naive assumption is that the identification of key reactions relevant to host immune defence and its suppression by parasitoids, will allow us to make assessments on parasitoid virulence and host specificity by looking at the relatedness of the corresponding genes in parasitoids and respective pests. However, a prerequisite for this assumption is that parasitoids use the same pathway in the host insect to interfere with defence reactions. Recent studies on the molecular mechanisms of immune evasion and suppression by parasitoids has dramatically changed our understanding of the complexity of insect immunity and the diversity of parasitoid adaptations to overcome host defence reactions. For example, we have identified two completely different mechanisms of immune evasion and suppression in Cotesia

Host Defence Manipulation by Parasitoid Wasps 31

rubecula (Marshall)/Pieris rapae L. and Venturia canescens Gravenhorst/Ephestia kuehniella Zeller, the two parasitoids studied in our laboratory. For historical and comparative reasons, we also include the Campoletis sonorensis (Cameron)/Heliothis virescens (F.) system for discussion. In addition there are a number of other systems where the mechanism of protection are known (Beckage 1995; Strand & Pech 1995). The putative molecular mechanisms of protection of the developing wasp in the three systems are summarised and the implications for possible predictions of host specificity and their evolutionary origins discussed.

The Campoletis/Heliothis Model The hallmark of host manipulation by hymenopteran parasitoids is the presence of polydnaviruses, which are only produced in female ovary tissues and coded by provirus DNA that is integrated into the wasp genome (Stoltz & Vinson 1979; Fleming & Summers 1986, 1991; Xu & Stoltz 1991). At least two types of polydnaviruses are known as ichnoviruses and bracoviruses, depending on whether the parasitoid species belongs to Ichneumonidae or particular subfamilies of Braconidae (Stoltz et al. 1984). The viruses are expressed in host cells within a few hours after parasitisation, producing specific virus products that inactivate the host defence system (Summers & Dib-Hajj 1995). The first experimental demonstration that polydnaviruses are able to suppress the host defence system was performed in C. sonorensis, where purified ichnovirus (CsV) were injected into caterpillars and shown to suppress the encapsulation reaction similar to the situation in parasitised caterpillars (Edson et al. 1981). Molecular characterisation of circular polydnavirus-coded genes revealed a cluster of genes producing a family of cysteine-rich proteins (Dib-Hajj et al. 1993), that are involved in the suppression of the cellular defence (Li & Webb 1994). In this system the protective mechanism during the crucial time immediately after egg deposition and onset of virus protein synthesis, which in C. sonorensis takes at least 5 h (Luckhart & Webb 1996), is accomplished by calyx tissue secretions including a group of virus encoded proteins with similarity to the cysteine-rich proteins that are deposited together with the egg (Luckhart & Webb 1996; Webb & Luckhart 1994, 1996). Thus, the suppression of cellular defence functions is achieved by virus encoded genes that are expressed in the wasp ovary as maternal secretions and in virus-infected host cells and tissues (Fig. 1). Virus-mediated suppression of the host defence may require more than one gene product possibly acting in combination (Webb & Luckhart 1994) and virus expression of a complex set of genes continues for weeks while the parasitoid larvae develops inside the caterpillar hemocoel.

The Cotesia/Pieris Model Compared to the situation in C. sonorensis, the expression of circular bracovirus DNA in C. rubecula (CrV) is restricted to only two transcripts in virus-infected host hemocytes and fat body cells, which are expressed as a single intense peak between four and 12 h after egg deposition (Asgari et al. 1996). One of the two gene products was identified as an immune suppressor (CrV1), secreted into the host hemolymph from infected tissues, where it is bound to hemocytes and inactivates the endocytoskeleton by an unknown mechanism (Asgari et al. 1997). These hemocytes remain round spheres and are unable to spread on a glass surface or phagocytose micro-organisms (Asgari 1997; Asgari et al. 1997), but restore their endoskeleton after several days and subsequently regain cellular defence functions (Asgari 1997). Thus, the CrV1-mediated immune suppression is transient and, importantly, the inactivation extends through a crucial period when the wasp larvae emerge from the egg shell (Fig. 2). Since the larval cuticle constitutes a foreign surface eliciting an



The Cotesia/Pieris model Egg

Larval stages

Crp32 CrV1

Crp32-like host proteins?

................................................... oviposition Figure 2

Schematic depiction of gene activity during egg and larval stages of the parasitoid Cotesia rubecula inside the host caterpillar Pieris rapae. Bold lines indicate viral transcripts. Thin lines indicate proteins produced from maternal transcripts in the female wasp ovary (e.g. Crp32) or from viral transcripts in infected host cells (e.g. CrV1). Dotted lines indicate proteins of host origin (e.g. Crp32-like protein).

immune response, the absence of an effective cellular defence is crucial for the developing parasitoid. For the wasp, recovery of cellular host defence functions may provide a selective advantage, as it protects the parasitised caterpillar from possible hyperparasitoids and pathogens. However, the question remains, how is the larval cuticle protected against the restored host defence? A possible clue may come from a novel mechanism of surface protection employed by the parasitoid during the first hours after the egg deposition. We found that the C. rubecula egg was protected after injection into the host in the absence of polydnaviruses (Asgari & Schmidt 1994). Since the surface protection was removed after washing with a mild detergent, we concluded that the egg and possibly the viruses are covered by calyx fluid proteins that preclude encapsulation or phagocytosis by host hemocytes (Asgari et al. 1998). The observation, that antisera against purified CrVs cross-reacted with proteins on the egg surface, allowed us to identify possible candidates for protective proteins and the subsequent cloning of the coding DNA of one of these proteins (Crp32), using two independent approaches involving expression library screening as well as peptide micro-sequencing and PCR cloning (Asgari et al. 1998). The molecular mechanism of how Crp32 protects the surface remains to be uncovered. From protection experiments using recombinant Crp32 on sephadex beads it appears that the protein is protective at low surface densities, suggestive that the protein invokes local inhibition reactions rather than surface disguise. This protective feature may be relevant to future application programs using surface protective proteins in genetic improvement programs of biological control agents and biopesticides against lepidopteran pests. When Crp32-specific antibodies were used against non-parasitised caterpillar protein extracts a cross-reactive host protein of similar size was discovered in the hemolymph in low amounts


The Venturia/Ephestia model Egg

Larval stages

PI

chorion-specific

cuticle-specific mucins

lipophorin .. . ........................... .......... ..................................

oviposition Figure 3

Schematic depiction of gene activity during egg and larval stages of the parasitoid Venturia canescens inside the host caterpillar Ephestia kuehniella. Thin lines indicate proteins produced from maternal transcripts in the female wasp ovary (e.g. protease inhibitor, PI) or from embryonic or larval transcripts (e.g. mucin-like proteins). Dotted lines indicate proteins of host origin (e.g. lipophorin).

(Asgari et al. 1998). It is tempting to speculate that similar protective proteins exist in the insect hemocoel and that objects introduced into the hemolymph would eventually be covered if there is enough time to allow the protective protein to accumulate on the surface. Therefore, the suppression of the cellular host defence may provide the emerging larva enough time to accumulate the host-derived protective protein and would not be attacked after the hemocytes have recovered. The cloning of the host-specific Crp32-like protein will allow us to test this assumption.

The Venturia/Ephestia Model Although Venturia is closely related to C. sonorensis its mode of protection is different from any other known wasp system and has intrigued scientists for many decades (Salt 1938, 1964). One of the first peculiarities observed in this wasp is the presence of so-called virus-like particles (VLPs) which resemble ichnoviruses in particle morphology, particle assembly in calyx nuclei and mode of secretion, but they completely lack nucleic acids (Rotheram 1967; Bedwin 1979; Feddersen et al. 1986). Another early observation was the apparent lack of any visible inactivation of host hemocytes (Salt 1976, 1980), although a reduction of melanisation in cell-free hemolymph was known to occur in parasitised caterpillars. Another illustration that most host hemocytes remain intact is seen in cellular capsules formed around Venturia larvae in superparasitised caterpillars. Again, the fact that these capsules are not melanised confirms genetic evidence that melanisation and encapsulation are independent processes (Rizki & Rizki 1990). When Venturia eggs are treated with detergent the protection is lost but regained after incubation in VLP suspensions, suggestive that VLPs are protecting the egg surface (Feddersen et al. 1986; Schmidt & Schuchmann-Feddersen 1989). Given the mode of surface protection in C. rubecula, which covers both virus and egg, it is conceivable that the protective mechanisms in Venturia are



not specific to VLPs but involve a complex reaction that includes maternal protein secretions and egg chorion-specific components as well (see Theopold et al. this volume). The main reason that the surface protection mechanism is different from the other two systems is probably the hydropic nature of the Venturia egg. After deposition into the host hemocoel, the egg takes up hemolymph from the host increasing in size for up to five times the original volume. Obviously this requires a protective strategy that is dramatically different from the other two wasp systems. The fact that cell-free host hemolymph enters the egg requires immediate inactivation of cellular and melanotic activity and, at the same time, a protective layer against host hemocyte attack without precluding cell-free hemolymph from entering the egg shell. We are still at an early stage of understanding the complex changes that occur on the surface of the Venturia egg, but two elements of a protective mechanism are becoming evident (Fig. 3). Firstly, there is a local hemocyte inactivation around the freshly deposited Venturia egg caused by a viscous calyx fluid which contains a protease inhibitor that inactivates hemocyte spreading (M. Beck unpublished). Since hemocytes are only inactivated by highly enriched inhibitor, the effect probably disappears when calyx fluid dissipates into the hemolymph. Secondly, hemomucin-like glycoproteins (Theopold et al. 1996) found on the Venturia egg chorion react with host lipophorin to form a complex (Theopold & Schmidt 1997), which may be cross-linked by a phenoloxidase-like activity found on the egg surface (Kinuthia et al. 1999). By the time hemocytes are recovered from the protease inhibition, the surface properties of the complex resembling a limited coagulation reaction, may have formed and the egg surface subsequently not recognised or attacked as a foreign object. Several features of the described Venturia egg surface modification are worthy of note: the suppression of host hemocytes is reduced to a short period, probably affecting only local populations of hemocytes around the deposited egg. Again, this is an evolutionary advantage to the parasitoid, since it leaves the parasitised caterpillar still capable of defending against other parasites and pathogens. In this context it is however important to understand how Venturia larvae are protected. Interestingly, the Venturia embryo is covered with hemomucin-like glycoproteins that are similar to those detected on the egg surface (Kinuthia et al. 1999). Since cell-free hemolymph enters the egg and surrounds the developing larva, it is conceivable that by the time the larva hatches these glycoproteins form complexes with lipophorin similar to those observed on the egg surface. Further experiments are required to establish the molecular basis of larval protection in Venturia.

Conclusions A number of conclusions can be drawn from these examples regarding the evolution and adaptive properties of host defence manipulation and host specificity of hymenopteran parasitoids. The first is the unexpected diversity of mechanisms found in closely related wasps. This is not only a reflection on the complexity of invertebrate immune defence reactions, but also illustrates an unexpected genetic flexibility on the side of the wasp to exploit and lock into different mechanisms of host immune regulation during adaptation to a particular host range. Can we explain the genetic flexibility by the presence of a symbiotic virus in the wasp genome? Some observations suggest a larger role of the virus in addition to just being a vehicle for delivering immune suppressor gene products into the host. For example, CrV1 is coded by the circular polydnavirus genome in C. rubecula, C. congregata, and a number of other Cotesia


species (see Whitfield this volume) and is therefore considered a virus product. However, CrV1like DNAs are not detected in other closely related Cotesia spp. The relative relatedness of CrV1 DNA sequences among Cotesia spp. suggest that the virus genes should be conserved enough among Cotesia spp., indicating that the putative CrV1 genes are either deleted or have undergone rapid sequence changes to have escaped PCR detection (J. B. Whitfield pers. comm.). Since circular DNA molecules found in polydnavirus particles have been shown to undergo rapid changes in the form of DNA rearrangements (Webb & Cui 1998), it is likely that CrV1 genes are deleted in some Cotesia spp. In this context it is interesting to discuss the origin of the Crp32 gene. If the operational definition of a polydnavirus gene is its presence on a circular DNA molecule, the Crp32 is not a virus protein. However, from a functional point of view, it is tightly associated with virus particles and protects the virus. Given the degree of DNA rearrangements is it possible that Crp32 is part of a virus-derived gene but not part of the circularised genome of polydnavirus? Likewise, if we accept that virus DNA is rearranged relatively frequently in the wasp genome in such a way that DNA fragments that are not necessary may be abolished, the evolutionary outcome is that Venturia VLPs lack nucleic acids altogether.

References Asgari, S. (1997) Cotesia rubecula polydnavirus-specific gene expression in the host Pieris rapae. Ph.D Thesis, The University of Adelaide. Asgari, S., Hellers, M. & Schmidt, O. (1996) Host haemocyte inactivation by an insect parasitoid: transient expression of a polydnavirus gene. Journal of General Virology 77: 2653-2662. Asgari, S. & Schmidt, O. (1994) Passive protection of eggs from the parasitoid, Cotesia rubecula, in the host, Pieris rapae. Journal of Insect Physiology 40: 789-795. Asgari, S., Schmidt, O. & Theopold, U. (1997) A polydnavirus encoded protein of an endoparasitoid is an immune suppressor. Journal of General Virology 78: 3061-3070. Asgari, S., Theopold, U., Wellby, C. & Schmidt, O. (1998) A protein with protective properties against the cellular defense reactions in insects. Proceedings of the National Academy of Sciences, USA 95: 3690-3695. Beckage, N.E. (1995) Polydnaviruses: Potent mediators of host insect immune dysfunction. Parasitology Today 11: 368-378. Bedwin, O. (1979) An insect glycoprotein: a study of the particles responsible for the resistance of the parasitoid’s egg to the defence reaction of its insect host. Proceedings of the Royal Society London 205: 267-270. Dib-Hajj S. D., Webb, B. A. & Summers, M. D. (1993) Structure and evolutionary implications of a “cysteine-rich” Campoletis sonorensis polydnavirus gene family. Proceedings of the National Academy of Sciences, USA 90: 3765-9. Edson, K. M., Vinson, S. B., Stoltz, D. B. & Summers, M. D. (1981) Virus in a parasitoid wasp: suppression of the cellular immune response in the parasitoid´s host. Science 211: 582-583. Feddersen, I., Sander, K. & Schmidt, O. (1986) Virus-like particles with host protein-like antigenic determinants protect an insect parasitoid from encapsulation. Experientia 42: 1278-1281. Fleming, J. G. W. & Summers, M. D. (1986) Campoletis sonorensis endoparasitic wasps contain forms of C. sonorensis virus DNA suggestive of integrated and extrachromosomal polydnavirus DNAs. Journal of Virology 57: 552-562. Foukas, L. C., Katsoulas, H. L., Paraskevopoulou, N., Metheniti, A., Lambropoulou, M. & Marmaras, V. J. (1998) Phagocytosis of Escherichia coli by insect hemocytes requires both



activation of the ras/mitogen-activated protein kinase signal transduction pathway for attachment and beta(3) integrin for internalization. Journal of Biological Chemistry 273: 14813-14818. Hoffmann, J. A. (1995) Innate immunity of insects. Current Opinions in Immunology 7: 4-10. Hoffmann, J. A. & Hetru, C. (1992) Insect defensins: inducible antibacterial peptides. Immunology Today 13: 411-415. Hoffmann, J. A., Reichhart, J. M. & Hetru, C. (1996) Innate immunity in higher insects. Current Opinions in Immunology 8: 8-13. Hopper, K. R. and Roush, R. T. (1993) Mate finding, dispersal, number released and the success of biological control introductions. Ecological Entomology 18: 321-331. Hultmark, D. (1994a) Insect immunology. Ancient relationships [news]. Nature 367: 116-117. Hultmark, D. (1994b) Macrophage differentiation marker MyD88 is a member of the Toll/IL-1 receptor family. Biochemistry & Biophysics Research Communications 199: 144-146. Ip, Y. T., Reach, M., Engström, Y., Kadalayil, L., Cai, H., Gonzales-Crespo, S., Tataei, K. & Levine, M. (1993) Dif, a dorsal-related gene that mediates an immune response in Drosophila. Cell 75: 753-763. Kinuthia, W., Li, D., Schmidt, O. & Theopold, U. (1999) Is the surface of endoparasitic wasp eggs and larvae covered by a limited coagulation reaction? Journal of Insect Physiology 45: 501506.. LanzMendoza, H., Bettencourt, R., Fabbri, M. & Faye, I. (1996) Regulation of the insect immune response: The effect of hemolin on cellular immune mechanisms. Cellular Immunology 169: 47-54. Lemaitre, B., Meister, M., Govind, S., Georgel, P., Steward, R., Reichhart, J. M. & Hoffmann, J. A. (1995) Functional analysis and regulation of nuclear import of dorsal during the immune response in Drosophila. EMBO 14: 536-45. Lemaitre, B., Nicolas, E., Michaut, L., Reichhart, J. M. & Hoffmann, J. A. (1996) The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults. Cell 86: 973-83. Li, X. S. & Webb, B. A. (1994) Apparent functional role for a cysteine-rich polydnavirus protein in suppression of the insect cellular immune response. Journal of Virology 68: 7482-7489. Liou, H. C. & Baltimore, D. (1993) Current Opinions in Cell Biology 5: 477-487. Luckhart, S. & Webb, B. A. (1996) Interaction of a wasp ovarian protein and polydnavirus in host immune suppression. Developmental & Comparative Immunology 20: 1-21. Reichhart, J. M., Georgel, P., Meister, M., Lemaitre, B., Kappler, C. & Hoffmann, J. A. (1993) Expression and nuclear translocation of the rel/NF-kappa B-related morphogen dorsal during the immune response of Drosophila. Comptes Rendues de l’Academie des Sciences 316: 1218-1224. Rizki, R.M. & Rizki, T.M. (1990) Encapsulation of parasitoid eggs in phenoloxidase-deficient mutants of Drosophila melanogaster. Journal of Insect Physiology 36: 523-529. Rotheram, S. (1967) Immune surface of eggs of a parasitic insect. Nature 214: 700. Salt, G. (1938) Experimental studies in insect parasitism. VI Host suitability. Bulletin of Entomolological Research 29: 223. Salt, G. (1964) The ichneumonid parasite Nemeritis canescens (Gravenhost) in relation to the wax moth Galleria mellonella (L.). Tranactions of the Royal Entomological Society, London 116: 1-14. Salt, G. (1976) The hosts of Nemeritis canescens, a problem in the host specificity of insect parasitoids. Ecological Entomology 1: 63-67.


Salt, G. (1980) A note on the resistance of two parasitoids to the defence reactions of their hosts. Proceedings of the Royal Society London, Series B 207: 351-353. Schmidt, O., Faye, I., Lindstrom Dinnetz, I. & Sun, S. C. (1993) Specific immune recognition of insect hemolin. Developmental & Comparative Immunology 17: 195-200. Schmidt, O. & Schuchmann-Feddersen, I. (1989) The role of virus-like particles in parasitoid-host interaction of insects, pp. 91-119. In Harris, J. R. (Ed.), Subcellular Biochemistry. Plenum Press, New York. Stoltz, D. B., Krell, P., Summers, M. D. & Vinson, S. B. (1984) Polydnaviridae-a proposed family of insect viruses with segmented, double-stranded, circular DNA genomes. Intervirology 21: 1-4. Stoltz, D. B. & Vinson, S. B. (1979) Viruses and parasitism in insects. Advances in Virus Research 24: 125-171. Strand, M. R. & Pech, L. L. (1995) Immunological basis for compatibility in parasitoid-host relationships. Annual Review of Entomology 40: 31-56. Summers, M. D. & Dib-Hajj, S. D. (1995) Polydnavirus facilitated endoparasitoid protection against host immune defenses. Proceedings of the National Academy of Science, USA 92: 29-36. Sun, S. C., Lindstrom, I., Boman, H. G., Faye, I. & Schmidt, O. (1990) Hemolin: an insect-immune protein belonging to the immunoglobulin superfamily. Science 250: 1729-1732. Sun, S.-C., Lindström, I., Lee, J.-Y. & Faye, I. (1991) Structure and expression of the attacin genes in Hyalophora cecropia. European Journal of Biochemistry 196: 247-254. Theopold, U., Samakovlis, C., Erdjument-Bromage, H., Dillon, N., Axelsson, B., Schmidt, O., Tempst, P. & Hultmark, D. (1996) Helix pomatia lectin, an inducer of Drosophila immune response, binds to hemomucin, a novel surface mucin. Journal of Biological Chemistry 271: 12708-12715. Theopold, U. & Schmidt, O. (1997) Helix pomatia lectin and annexin V, molecular markers for hemolymph coagulation. Journal of Insect Physiology 43: 557-674. Waage, J. (1998) Yes, but does it work in the field? The challenge of technology transfer in biological control. Entomophaga 41: 315-332. Webb, B. A. & Cui, L. W. (1998) Relationships between polydnavirus genomes and viral gene expression. Journal of Insect Physiology 44: 785-793. Webb, B. A. & Luckhart, S. (1994) Evidence for an early immunosuppressive role for related Campoletis sonorensis venom and ovarian proteins in Heliothis virescens. Archives of Insect Biochemistry & Physiology 26: 147-163. Webb, B. A. & Luckhart, S. (1996) Factors mediating short- and long-term immune suppression in a parasitized insect. Journal of Insect Physiology 42: 33-40. Xu, D. & Stoltz, D. B. (1991) Evidence for a chromosomal location of polydnavirus DNA in the ichneumonid parasitoid Hyposoter fugitivus. Journal of Virology 65: 6693-6704.

Two Genetically Distinct Venturia canescens Strains Display Different Reproductive Strategies Markus Beck*, Ulrich Theopold** and Otto Schmidt Department of Applied & Molecular Ecology, Waite Campus, The University of Adelaide, P.M.B. 1 Glen Osmond, S. A. 5064 Australia (email: [email protected]) (present addresses: *Department of Entomology, University of Wisconsin-Madison, Madison, WI 53706 USA; ** Department of Molecular Biology, Stockholm University SE-10691 Stockholm, Sweden)

Introduction Endoparasitoids parasitise insect hosts and kill them by feeding on internal tissues to finalise embryonic and larval development. In the case of solitary endoparasitoid wasps, one parasitised host supports only the development of one wasp offspring (Quicke 1997). Therefore, it could be expected that a foraging solitary wasp prefers non-parasitised over already parasitised hosts in order to avoid inter-larval host competition. However, the fact that solitary wasps, capable of discriminating between both host types, nevertheless lay eggs into already parasitised hosts suggests that superparasitism must be considered a potentially successful reproductive strategy (van Alphen & Visser 1990; Sirot & Krivan 1997). Recently, we have discovered two genetically defined strains, designated RP and RM, in a parthenogenetic laboratory population of the solitary endoparasitoid wasp Venturia canescens Gravenhorst (Ichneumonidae) (Hellers et al. 1996). Analysis of the two strains revealed phenotypic differences in the morphology of the respective ovarian calyx tissues, which appear to affect the transport of mature eggs from the ovarioles into the oviduct (Beck et al. 1999). When adult wasps were dissected after being kept without hosts for several days, leading to an accumulation of eggs in the paired oviducts, 80% of all RP egg reservoirs contained more than 40 eggs, whereas in RM wasps such high egg numbers were found only in 12% of all egg reservoirs (Beck et al. unpublished). Consequently, RP wasps should have more mature eggs in the oviducts available for deposition than RM wasps. In this context it is intriguing that RM and RP wasps, in addition to their ovarian phenotypes, also display differences in their reproductive success. When RP wasps were separated from RM wasps and each wasp strain was allowed to parasitise host caterpillars in the absence of the other strain under identical conditions, more offspring were produced by the RP strain as compared to the RM strain (Beck et al. 1999). Surprisingly, when wasps from both strains parasitised hosts together for the same time, the relative number of offspring was reversed and RM wasps were more successful (Beck et al. 1999). The availability of eggs in the respective oviducts of RP and RM wasps might explain the observed reproductive success under conditions where both strains parasitised hosts individually, but not the result obtained when they were ovipositing into caterpillars together. Interestingly, when embryonic development and ovipositing behaviour of RP and RM wasps was studied, additional differences were observed that might provide an explanation for the number of offspring produced by each strain in a situation where they were competing for the same hosts. In order to assess the time needed by RP and RM wasps to complete embryonic development, host caterpillars parasitised once by each wasp type were dissected at distinct time periods after 38


Two Genetically Distinct Venturia canescens Strains 39

an ovipositing event. The number of larvae that had already hatched and those still inside the egg shell were recorded. This experiment revealed that offspring from the RM strain delay larval hatching from the egg shell and evidently develop slower than offspring from RP wasps (Beck et al. 1999). Moreover, when the two wasp strains were observed while foraging together on the same host patch, RP wasps immediately started to lay eggs whereas RM wasps initially remained passive and delayed egg deposition until most of the host caterpillars were already parasitised by RP wasps (Beck et al. unpublished). Obviously, RM wasps do not only develop slower than RP wasps, but also tend to lay eggs at a later point in time. It is tempting to assume that the RM strain’s delayed oviposition and slower embryonic development has a synergistic effect, postponing the moment relative to the RP strain, when embryonic RM larvae emerge from the egg shell. Since the age of rival parasitoid larvae constitutes an important factor in host competition (Fisher 1961, 1963; Marris & Casperd 1996) this finding should be of principal importance. In fact, data presented by Marris and Casperd (1996) suggest that for a short period of time, younger Venturia larvae are advantaged over older larvae when physically fighting for host supremacy. This could explain why RM wasps produce more offspring than RP wasps when both wasp types parasitise together and compete for the same hosts. Since the whole laboratory population studied in this investigation consists exclusively of parthenogenetically reproducing females, the RP and the RM strain represent two clonal lines that are reproductively separated. Moreover, since analysis of the corresponding genomes revealed a number of differences, the two lines are also genetically distinct. In addition to the allelic gene, which has been used as a diagnostic marker to isolate the two strains from a mixed laboratory culture (see Fig. 1), they differ in at least one other gene (Beck et al. unpublished). Interestingly, when genomic DNA isolated from individual RP and RM wasps was analysed by RAPD-PCR, wasps of the same strain always produced identical DNA banding patterns with each of the 23 random primers that were used (six individuals per strain were tested for each primer). However, for some primers, the resultant banding patterns differed between the strains. Closer inspection of the RP and RM strain specific DNA banding patterns revealed 90.5% monomorphic (identical in both strains) and 9.5% polymorphic (unique to one strain) scorable DNA fragments (Beck et al. 1999). Although it remains to be shown whether some of the polymorphic DNA fragments derive from coding regions, this level of polymorphism indicates that both strains possess distinct genomes with possible differences in several genes. Given that sexual recombination between these two genetically distinct strains does not occur, it could be assumed that particular gene combinations are conserved and transferred into the next generation. This would also apply to specific genes or gene combinations responsible for differences in ovarian phenotypes, reproductive success and behaviour. Considering this, it is tempting to propose that parthenogenesis has resulted in two genetically different strains leading to two distinct reproductive strategies. In order to learn more about the reproductive strategies employed by RP and RM wasps, and the reasons why both strains have been maintained in the mixed laboratory population, investigations were started to determine the outcome of host competition between the two wasp types under different parasitisation conditions. Preliminary data are presented in the present paper.

Materials and Methods Insect cultures Parthenogenetically reproducing female V. canescens were reared on final instar caterpillars of the Mediterranean flour moth, Ephestia kuehniella Zeller (Phycitidae). Moths were fed on

Markus Beck, Ulrich Theopold and Otto Schmidt 40


A)

N

TR

N B)

PHGPX

PHGPX RP

RM

M

C

C

kDa 64 50 36 30

Figure 1

Two different variants of a virus-like particle protein (VLP1) are produced by two alleles of the maternal gene vlp1, which is expressed in the ovaries of the female wasps. In one of the these variants a tandem repeated sequence (TR) is deleted. Since individual wasps in the laboratory population are homozygous for either one of the two vlp1 alleles, they are according to the allele addressed as wasps belonging to the RP (repeat plus) or RM (repeat minus) strain (Hellers et al. 1996): A) domain structure of the two allelic VLP1 variants. The C-terminus is in both alleles identical and displays homology to the antioxidant enzyme phospholipid-hydroperoxide glutathione peroxidase (PHGPX). The position of the deleted TR is indicated (TR); B) western blot analysis of wasp ovaries from individual wasps using anti-VLP1 antiserum. The different molecular weight of the two allelic VLP1 variants allows the distinction between RP and RM wasps. RP = RP wasp ovary; RM = RM wasp ovary; M = SeeBlue® pre-stained molecular weight marker from Novex (San Diego, USA).

crushed oats and V. canescens, when necessary, on a 33% water-honey solution. Both insects were maintained in the laboratory at 25˚C under a 14:10 h (light:dark) photoperiod.

SDS-PAGE and Western blots Protein extracts from wasp ovaries were electrophoretically separated by SDS-PAGE and analysed on Western blots using antiserum specific for VLP1 as described previously (Hellers et al. 1996). VLP1 is the protein encoded by the vlp1 gene. Since vlp1 exists in two alleles, two VLP1 variants of different molecular weights are expressed in the ovaries (Hellers et al. 1996). These allelic VLP1 variants can be used to distinguish the RP and RM strain. Competition experiment Two healthy looking, freshly emerged female wasps, one RP and one RM, were placed together with 25 final instar host caterpillars into a culture vessel (6 cm in diameter, 9 cm high). After 24 h the wasps were removed and their genetic identity as RP or RM wasps confirmed by Western blot analysis. Twenty-five days after the experiment commenced, offspring started to emerge.


A

B

Figure 2

Venturia canescens larvae fighting for host dominance: A) fight between two parasitoid larvae showing a younger larva attacking an older one causing an injury; B) encapsulation of a wounded larva. The injury inflicted on the larval cuticle induced host defence reactions which led to cell aggregation and encapsulation at the site of the wound. Scale bars = 300 µm.

Individual offspring were collected and their genetic identity analysed as described above, in order to determine which wasp type won the competition for host supremacy. Abbreviations used in the text and figures are: PAGE, Polyacrylamide gel electrophoresis; PCR, polymerase chain reaction; PHGPX, phospholipid-hydroperoxide glutathione peroxidase; RAPD, randomly amplified polymorphic DNA; RM, repeat minus; RP, repeat plus; SDS, sodium dodecyl sulphate.

Results and Discussion The exact mechanisms that influence the outcome of host competition in superparasitised caterpillars are not known. However, two general processes have been described in the literature involving physical combat among parasitoid larvae (Salt 1966; Marris & Casperd 1996) and physiological suppression (Fisher 1963; Vinson & Hegazi 1998). Physiological suppression seems to be mediated by the nutrient content (Vinson & Hegazi 1998) and/or the concentration of



A) Average no. of offspring

14 12 10 8 6 4 2 0

B)

RP

RM

RP (1)

RM (2)

Average no. of offspring

14 12 10 8 6 4 2 0

14 Average no. of offspring

C)

12 10 8 6 4 2 0

RP (2) Figure 3

RM (1)

Average number of RP and RM offspring when two wasps, one of each strain, were allowed to compete for 25 hosts for 24 h: A) two wasps, one of each strain, were put together with host caterpillars at the same time (RP; RM); B) one RP wasp was allowed to search and parasitise for 7 h [RP (1)], before an RM wasp was added [RM (2)]; C) reversed situation, where one RM wasp was allowed to search and parasitise for 7 h [RM (1)], before an RP wasp was added [RP (2)]. Each experiment was carried out twice. In order to determine whether the emerging wasps were offspring from the RP or the RM wasp, they were individually dissected, and the corresponding ovary samples examined by Western blot analysis (see Fig. 1) (bars = ranges).


dissolved oxygen (Fisher 1961, 1963) in the host hemolymph. Since an altered physiology in the parasitised host appears to render conditions unfavourable for the development of newly oviposited eggs (Vinson & Hegazi 1998) and younger larvae (Fisher 1963), physiological suppression affects early developmental stages more severely than older ones. Similarly, when wasp larvae physically fight with each other within the hemocoel of a superparasitised host, older larvae are usually more likely to eliminate younger ones (Vanbaaren et al. 1995). However, V. canescens can be considered as an interesting exception in this context. First instar larvae seem to be more mobile than older larvae and possess a sclerotised head capsule with a strong beak, which is less developed in later larval stages (Marris & Casperd 1996). They are able to seek out supernumerary larvae and use their mandibles to perforate the cuticle of a competitor (Fig. 2A). Any damage inflicted to the cuticle is immediately recognised as foreign and attacked by the host’s immune system (Fig. 2B), which eventually leads to the death of the injured larva (Salt 1966). When Marris and Casperd (1996) staged in vitro contests between different larval V. canescens instars, they observed that first instar larvae competing with second or third instars initiate more fights, inflict more bites, and sustain these bites for longer. From this they concluded that first instar larvae must be advantaged over second and third instars and are more likely to win a physical combat (Marris & Casperd 1996). Indeed, in vivo experiments carried out by Sirot (1996) show that the interval between ovipositions, and therefore the age difference between the first and second laid offspring, is crucial to the success rate of the superparasitising female. In fact, a substantial pay-off from superparasitism could be achieved by these females as long as the first and second ovipositions were less than three days apart (Sirot 1996). These data strongly support the idea that, dependent on the age distribution of larvae inside superparasitised caterpillars, either very old or very young larvae, may have a selective advantage. It seems that younger larvae are more likely to succeed when physically fighting against larvae just a few days older, whereas larvae too far ahead in growth suppress younger larvae physiologically (see also Vinson & Mourad, this volume). The RM strain’s reproductive success when parasitising hosts together with the RP strain at the same time (Fig. 3A), in combination with the delayed timing of oviposition and the extended developmental time (Beck et al. unpublished), suggests that the RM strain has successfully evolved mechanisms to increase the pay-off from superparasitism. Since creating a larger age difference only makes sense if competing with relatively young larvae, it appears that only a small time frame exists for the RM strain to be successful. In order to test this assumption and the initial hypothesis that the reproductive success of the RM strain is associated with changes in behaviour and development, one strain was allowed to parasitise hosts for a period of 7 h before the other strain was added. The number of offspring produced by each strain under these conditions was then analysed. When RP wasps were given a head start of 7 h, they produced more offspring than RM wasps (Fig. 3B). This outcome resembles the situation where each wasp type parasitises hosts separately (Beck et al. 1999). On the basis of our behavioural studies the simplest interpretation for this result is that RP wasps deposit eggs immediately into caterpillars and by the time RM wasps start to superparasitise caterpillars, the oldest RP larva may already be able to suppress RM larvae by physiological means. Interestingly, when RM wasps were given a head start, they were not able use this advantage, and the number of offspring for each wasp strain was about the same (Fig. 3C). When competing inside hosts, RM and RP offspring appear to have been evenly matched regarding their competitive abilities. It seems that RM wasps must have delayed egg laying, but still oviposited before the RP wasps. Only under such conditions should RM and RP parasitoid larvae be about the same age when



competing within the host and therefore have an equal probability of winning the combat. In addition, it could be imagined that during the initial 7 h RM wasps may have depleted their limited egg reserves (Beck et al. unpublished), which would preclude them from depositing eggs into hosts previously parasitised by RP wasps. Whatever the reasons for the observed differences in reproductive success, it appears that this preliminary result corresponds well to our previous observations and the information available in the literature concerning host competition in Venturia. Furthermore, the competitive abilities of both strains were not symmetrical, giving the impression that the RM strain is dependent on the RP strain in order to be reproductively successful. Therefore, this experiment can be considered as additional evidence for the co-existence of two reproductive strategies that were maintained in the laboratory population by two different strains. Since the RP and the RM strain are genetically distinct and sexual recombination does not occur (Beck et al. unpublished), the question can be raised as to whether host competition under such circumstances can be considered conspecific. This sheds new light on behavioural studies dealing with superparasitsm; in particular considering that morphological characters commonly used for taxonomic recognition of ichneumonid wasps fail to distinguish between the RP and RM V. canescens strains (P. Dangerfield, pers. comm.).

Acknowledgements We thank Paul Dangerfield for the taxonomic analysis of the two Venturia strains. This work was supported by a grant from the Australian Research Council (ARC) to OS, an ARC Research Fellowship to UT, and a Postgraduate and an Overseas Postgraduate Research Scholarship from The University of Adelaide to MB.

References Beck, M., Siekmann, G., Li, D., Theopold, U. & Schmidt, O. (1999) A maternal gene mutation correlates with an ovary phenotype in a parthenogenetic wasp population. Insect Biochemistry and Molecular Biology 29: 453-460. Fisher, R. C. (1961) A study in insect multiparasitism. II. The mechanism and control of competition for possession of the host. Journal of Experimental Biology 38: 605-628. Fisher, R. C. (1963) Oxygen requirements and the physiological suppression of supernumerary insect parasitoids. Journal of Experimental Biology 40: 531-540. Hellers, M., Beck, M., Theopold, U., Kamei, M. & Schmidt, O. (1996) Multiple alleles encoding a virus-like particle protein in the ichneumonid endoparasitoid Venturia canescens. Insect Molecular Biology 5: 239-249. Marris, G. C. & Casperd, J. (1996) The relationship between conspecific superparasitism and the outcome of in vitro contests staged between different larval instars of the solitary endoparasitoid Venturia canescens. Behavioural Ecology & Sociobiology 39: 61-69. Quicke, D. L. J. (1997) Parasitic Wasps. Chapman and Hall, London. Salt, G. (1966) Experimental studies in insect parasitism XIV. The haemocytic reaction of a caterpillar to larvae of its habitual parasite. Proceedings of the Royal Society of London, Series B 165: 155-178. Sirot, E. (1996) The pay-off from superparasitism in the solitary parasitoid Venturia canescens. Ecological Entomology 21: 305-307. Sirot, E. & Krivan, V. (1997) Adaptive superparasitism and host-parasitoid dynamics. Bulletin of Mathematical Biology 59: 23-41.


van Alphen, J. J. M. & Visser, M. E. (1990) Superparasitism as an adaptive strategy for insect parasitoids. Annual Review of Entomology 35: 59-79. Vanbaaren, J., Boivin, G. & Nenon, J. P. (1995) Intraspecific hyperparasitism in a primary hymenopteran parasitoid. Behavioural Ecology & Sociobiology 36: 237-242. Vinson, S. B. & Hegazi, E. M. (1998) A possible mechanism for the physiological suppression of conspecific eggs and larvae following superparasitism by solitary endoparasitoids. Journal of Insect Physiology 44: 703-712. Vinson, S. B. & Ahmed Kamal Mourad, A. K. (this volume) The response of Cardiochiles nigriceps Viereck (Hymenoptera: Braconidae) larvae to conspecific competitors.

The Response of Cardiochiles nigriceps Viereck (Hymenoptera: Braconidae) Larvae to Conspecific Competitors S. Bradleigh Vinson1 and Ahmed Kamal Mourad2 1

Department of Entomology, Texas A&M University, College Station, TX 77843 USA (email: [email protected]) 2

Plant Protection Department, Alexandria University, Alexandria, Egypt

Introduction Most parasitic hymenoptera are solitary individuals and as larvae require the complete resources of the host in order to develop. However, it may be advantageous for a female to oviposit more than one egg into a host (van Alphen et al. 1987; van Dijke & Waage 1987). This results in superparasitised hosts and intense intraspecific competition between the developing larvae for possession of the host (van Lenteren 1976). This competition leads to the elimination of competitors by physical attack or physiological suppression. However, little is known in regards to either of these activities (Vinson & Iwantsch 1980; Mackauer 1990).

Physiological Suppression In some super-parasitised hosts either one of the embryos fail to develop and hatch, or the embryos hatch but one of the larvae does not develop. Usually the older is the victor. Physiological suppression has been commonly reported and attributed to a number of mechanisms. These include death due to starvation or anoxia, toxins, cytolytic enzymes, or other secretions which are either released by the developing larvae and associated teratocytes or injected by the female (Mackauer 1990). Of these methods, the release of toxins has been most often cited (Silvers & Nappi 1986; Lawrence 1988). While there is a lot of data to show that female parasitoids inject factors, and larvae and their associated teratocytes release factors into the host, there is no supporting evidence that any of these factors are toxins (Vinson 1990; Beckage 1993). Further, as suggested by Vinson and Hegazi (1998) it would not make much evolutionary sense for a female to evolve the ability to produce a toxin that kills or prevents the development of her youngest progeny. While the evolution of a toxin by the larvae would provide a competitive edge, it is also difficult to see how such a toxin would only effect younger stages. Hu and Vinson (1997) showed that Campoletis sonorensis (Cameron) eggs would not develop in various in vitro media, while development would take place once the embryonic membranes were developed. Similar data was provided by Pennacchio et al. (1992) for Cardiochiles nigriceps Viereck. Vinson and Hegazi (1998) showed that embryonated eggs were able to develop in media with a range of osmotic pressures and in hemolymph from both parasitised and non-parasitised hosts, while younger eggs only showed development in non-parasitised hemolymph. Further, the development of non-embryonated and embryonated eggs singly or in pairs in diluted non-parasitised hemolymph revealed the occurrence of physiological suppression of the younger larvae in

46


The Response of Cardiochiles nigriceps Viereck Larvae to Conspecific Competitors 47

all paired cases involving a younger and older larva. This removed any adult involvement. Further, some of the paired young and paired older larvae also failed to develop. These results were not consistent with the presence of a toxin. Vinson and Hagazi (1998) offered an alternate suggestion based on several observations and the available evidence. These are: 1) that embryonated eggs are more effective in regulating the flow of ions and chemicals through the chorion and associated egg membranes than non-embryonated eggs; 2) that as an egg develops its ability to continue to develop in less than a favourable environment, represented by the media, increases; 3) that as the egg enclosed embryo develops, its nutritional needs change; 4) that the hemolymph of a parasitised host is altered and becomes different when compared to the hemolymph of non-parasitised hosts; 5) the hemolymph changes are important to the changing nutritional needs of the developing larvae, and 6) these nutritional changes in the host are regulated by and are one of the major functions of the factors that a female parasitoid injects and the developing larvae release. As a result, any eggs deposited into the hemolymph of a previously parasitised host encounters a hemolymph environment that will no longer support the development of these earlier developmental stages (Vinson & Hagazi 1998). There appear to be two important developmental changes that provide an advantage to the older larvae. This is the development of the embryonic membranes which provide the embryo with the ability to regulate the movement of factors present in the hemolymph environment in and out. Further, the embryonic membrane can alter some of these factors as they pass through the membrane; a situation not available to younger developing eggs. The second is when the embryo hatches. After hatching the embryo is now presumably able to feed and digest large molecular weight proteins which are not available to younger developmental stages. At the same time the protein content of the hemolymph of the host, in this case Heliothis virescens (F.), increases (Pennacchio et al. 1994).

Physical Combat Although the larvae of the Hymenoptera are mandibulate, the first instar of most solitary parasitoid species are considered to be strongly mandibulate (Hagen 1964). This is in contrast to gregarious species. For example, Laing and Corrigan (1987) reported that the gregarious Cotesia glomerata (L.) had poorly developed mandibles in comparison to the solitary species Cotesia rubecula (Marshall). Further, the large head and falcate mandibles typical of many first instar solitary parasitoids are lost in older larvae which become more grub-like (Hagen 1964). These older larvae not only have comparatively smaller mandibles, but are less agile and tend to lose in physical combat with first instars (Chow & Mackauer 1984). Although physical combat has been commonly reported, no one has examined the mobility of larvae. We wanted to determine if newly hatched larvae could move and, if so, could they detect the presence of other larvae and locate them? We initiated some experiments to determine if newly hatched larvae could orientate to and locate competing larvae. Although physical combat is commonly reported (Vinson & Iwantsch 1980) there has been no information regarding the ability of larvae to move and seek out these competitors.

Methods Here we report on recent studies concerning the ability of C. nigriceps to move and impact competing conspecifics (Vinson & Mourad in review). First instar larvae were obtained from dissecting earlier super-parasitised hosts. Two of these larvae were placed 5 to 10 mm apart in a

S. Bradleigh Vinson and Ahmed Kamal Mourad 48


Petri dish with insect tissue culture media and were observed to determine if they could move, the time to contact each other, and the behaviour on contact. To determine if larvae could detect and move to a conspecific, we developed a modified aquatic ‘Y’ tube that was a ditch in the form of a ‘Y’ formed out of wax. A reservoir filled with cell culture media fed the two arms of the ‘Y’, the media then flowed through the common base of the ‘Y’ and out to another lower reservoir. Flow was aided with a cotton thread that acted as a capillary from the reservoirs to the arms of the ‘Y’. We also found that the addition of the thread to the ‘Y’ ditch aided the movement of the larvae. One larva was placed in one of the arms and the other larva was placed at the base of the ‘Y’.

Results When two first instar larvae are placed within a few millimeters of each other they move towards each other and attack head to head. However, this movement required several hours. We found that this movement could be facilitated by adding a filter paper substrate. Studies using the ‘Y’ ditch revealed that within an hour significantly more of the larvae placed in the base of the ‘Y’ were found in the arm containing the restricted competitor larvae. We also observed that older larvae placed in media and exposed to a younger larvae were less able to move in a directed way and were less agile compared to the younger larvae. This along with the comparatively reduced mandibles of the older larvae placed them at a disadvantage. As a result the younger larvae generally won the encounter.

Conclusion These studies demonstrate that first instar C. nigriceps larvae can orient to, move towards, and attack conspecifics. These results also suggest that physiological suppression favours older larvae in any competition with conspecifics, while physical combat favours younger larvae. This presents a strong competitive environment that provides for a clear resolution, but does not favour either age. Thus, females electing to super-parasitise submit their larvae to a true contest that favours the survival of the fittest of the offspring.

Acknowledgements The work reported in this paper has been partially supported through a Fulbright Fellowship to AKM.

References Beckage, N. E. (1993) Endocrine and neuroendocrine host-parasite relationships. Receptor 3: 1-13. Chow, F. J. & Mackauer, M. (1984) Inter- and intra-specific competition in Aphidius smithi and Praon pequodorum (Hymenoptera: Aphidiidae). Canadian Entomologist 116: 1097-1107. Hagen, K. S. (1964) Developmental stages of parasites. pp. 168-246. In: DeBach, P. (Ed.), Biological Control of Insects, Pests and Weeds. Chapman & Hall, London. Hu, J. S. & Vinson, S. B. (1998) The in vitro development from egg to prepupa of Campoletis sonorensis (Hymenoptera: Ichneumonidae) in an artificial medium: importance of physical factors. Journal of Insect Physiology 44: 455-462.

The Response of Cardiochiles nigriceps Viereck Larvae to Conspecific Competitors 49

Laing, J. E. & Corrigan, J. E. (1987) Intrinsic competition between the gregarious parasite, Cotesia glomeratus and the solitary parasite, Cotesia rubecula (Hymenoptera: Braconidae) for their host, Artogeia rapae (Lepidoptera: Pieridae). Entomophaga 32: 493-501. Lawrence, P. O. (1988) In vivo and in vitro development of first instars of the parasitic wasp, Biosteres longicaudatus (Hymenoptera: Braconidae). pp. 351-366. In Gupta, V. K. (Ed.), Advances in Parasitic Hymenoptera Research. E. J. Brill, Leiden. Mackauer, M. (1990) Host discrimination and larval competition in solitary endoparasitoids. pp. 41-62. In Mackauer, M, Ehler, L.E. & Rolands, J. (Eds), Critical Issues in Biological Control. Intercept Ltd, Andover. Pennacchio, F., Vinson, S. B. & Tremblay, E. (1992) Preliminary results on in vitro rearing of the endoparasitoid Cardiochiles nigriceps from egg to second instar. Entomologia Experimentalis et Applicata 64: 209-216. Pennacchio, F., Vinson, S. B., Tremblay, E. & Tanaka, T. (1994) Biochemical and developmental alterations of Heliothis virescens (F.) (Lepidoptera, Noctuidae) larvae induced by the endophagous parasitoid Cardiochiles nigriceps Viereck (Hymenoptera, Braconidae). Archives of Insect Biochemistry & Physiology 26: 211-233. Silvers, M. J. & Nappi, A. J. (1986) In vitro study of physiological suppression of supernumerary parasites by the endoparasitic wasp Leptopilina heterotoma. Journal of Parasitology 72: 405-409. van Alphen, J. J. M., van Dijken, M. J. & Waage, J. K. (1987) A functional approach to superparasitism: Host discrimination needs not be learnt. Netherlands Journal of Zoology 37: 167-179. van Dijken, M. & Waage, J. K. (1987) Self and conspecific superparasitism by the egg parasitoid Trichogramma evanescens. Entomologia Experimentalis et Applicata 43: 183-192. van Lenteren, J. C. (1976) The development of host discrimination and the prevention of superparasitism in the parasite Pseudeucoila bachei Weld (Hymenoptera: Cynipidae). Netherlands Journal of Zoology 26: 1-83. Vinson, S. B. (1990) How parasitoids deal with the immune system of their host: an overview. Archives of Insect Biochemistry & Physiology 13: 3-27. Vinson, S. B. & Hegazi, E. M. (1998) A possible mechanism for the physiological suppression of conspecific eggs and larvae following superparasitism by solitary endoparasitoids. Journal of Insect Physiology 44: 703-712 Vinson, S. B. & Iwantsch, G. F. (1980) Host suitability for insect parasitoids. Annual Review of Entomology 25: 397-419. Vinson, S. B. & Mourad, A. K. (in review) The behaviour and the physical response of first instar parasitoid larvae to competitors. Entomologica Experimentalis et Applicata.

Hypopharyngeal Gland Function, Glandular Cell Senescence and Gland Reactivation In Bees Carminda da Cruz-Landim, Rosiléia Ana Cássia da Costa and Regina Lúcia Morelli Silva de Moraes Departamento de Biologia, Instituto de Biociências, UNESP, 13506-900 Rio Claro, SP, Brazil (e-mail: [email protected])

Introduction The highly eusocial bees (as is the case of Apinae and Meliponinae) have a division of labour in which the young workers undertake tasks in the nest and older workers forage in the field. The exocrine glands of these bees frequently have developmental cycles closely related to this division of labour, since the glandular products are necessary for performance of some of these tasks. As the colony functions as a ‘super-organism’ and must maintain an internal homeostasis, the age at which workers are able to perform their duties is not rigid (Moritz & Southwich 1992). This means that the secretory gland cycles can be changed according to colony requirements. The hypopharyngeal glands are one such case for which the secretory cycle is closely related to the workers’ division of labour. Hypopharyngeal glands are present in all Hymenoptera and has been reported in solitary bees, ants and wasps as having a wide variety of types, from very simple to a complex organisation, but in general their function is unknown. In Apis mellifera L. these glands are well documented as responsible for food production for the brood and queen. In this species the glands are found only in workers and are more developed during nursing activity (Cruz-Landim & Hadek 1969). At the beginning of foraging activity the gland undergoes degeneration although, according to some authors, glands which have already finished food production can be reactivated as a response to colony requirements (Browers 1983; Gracioli et al. 1999). It is also reported that after the end of the nursing phase the hypopharyngeal glands are still functional, but have changed function, to produce only enzymes (Simpson et al. 1968; Takenaka et al. 1990). In the Meliponinae, aside from being present in the workers of all species, the occurrence of hypopharyngeal glands has been reported also in males and queens. In workers, these glands have a secretory cycle similar to A. mellifera, i.e. being more developed in nurses (Cruz-Landim et al. 1986/87; Costa 1997) and undergoing regression in forager workers. Further, the electrophoretic pattern of glandular extracts from this species is similar to A. mellifera (Silva de Moraes et al. 1996; Costa 1997). The aim of the present investigation was to determine whether the morphology of glandular cells of apine and meloponine bees support the idea of glandular reactivation, and the occurrence of a second cycle of secretion after the nursing phase. Further, it aimed to compare the protein patterns of gland extracts to evaluate the possibility that the glands of forager workers return to food production in colonies under natural conditions.

50


Hypopharyngeal Gland Function, Glandular Cell Senescence and Gland Reactivation In Bees 51

Material and Methods Hypopharyngeal glands of newly emerged nurse and forager workers of A. mellifera, Melipona quadrifasciata anthidioides Latreille and Scaptotrigona postica Lepeletier collected from normal colonies, were dissected and fixed in 2.5% glutaraldehyde in 0.1M cacodylate buffer, pH 7.2. After washing in buffer, glands were post-fixed in 1% osmium tetroxide in the same buffer. The glands were then contrasted overnight with 2% alcoholic solution of uranyl acetate, dehydrated in a series of increasing concentrations of acetone and embedded in Epon Araldite. The ultrathin sections were stained with lead citrate and examined under a transmission electron microscopy (TEM). Glands of forager workers were also submitted to acid phosphatase reaction using glycerophosphate as a substrate to the enzyme. Extracts of glands of newly emerged, nursing and forager workers of S. postica were used for electrophoresis by SDS-PAGE using extracts of glands of nursing workers of A. mellifera for comparison. The age of bees was not controlled. Specimens were collected while nursing or foraging. The newly emerged workers of S. postica were collect as soon as they left the comb cell. At least ten individuals of each phase was examined.

Results and Discussion The hypopharyngeal glands of A. mellifera, M. q. anthidioides and S. postica are formed by two long bunches of secretory units connected to a main excretory duct by canaliculi coming from each glandular cell. The main excretory canals end laterally on the floor of the buccal cavity, where the secretion is discharged. Glandular cells may be classified as class III according to Noirot and Quennedey (1974), i.e. they possess an intracellular canaliculus or space for secretion collection inside the glandular cell (Beams & King 1933). In A. mellifera each secretory unit comprises several cells, although each one is independently linked to the main excretory duct by its own excretory canaliculus (Fig. 1). In M. q. anthidioides and S. postica the secretory units are unicellular (Fig. 2). Based on similar morphologies of the cells during the worker’s developmental cycle and protein product similarities (Silva de Moraes et al. 1996; Costa 1997), an attempt was made to determine the capacity of hypopharyngeal glands to re-start food production in old workers by correlating ultrastructural features with electrophoretic protein patterns of S. postica. The results indicate that hypopharyngeal gland cells have a second round of protein secretion, similar to those of A. mellifera. Later, at the beginning of the forager phase, most food secretion has been eliminated from the cell (Figs 3, 4) and is sometimes replaced by several myelin figures, indicating a post-secretory phase in the glandular cycle. However, a significant amount of rough endoplasmic reticulum is still present in the gland cells of some workers in this phase which is morphologically different from that present in nursing individuals, and a new type of secretion is evident. This is represented by larger, less electron-dense granules sometimes with a granular content (Figs 5, 6). These two types of secretion may be temporarily separated, as in A. mellifera, but in S. postica they seem to overlap. The second type of secretion has morphological features of granules that contain mucous-like substances. Treatment with the acid periodic-Schiff reacts positively in these granules, confirming their mucous-like nature. During the second secretory cycle the myelin figures are still present and some electron-dense granules around the vacuoles react positively to acid phosphatase. This indicates re-absorption of organelles and the first type of protein secretion (Fig. 7) that is no longer functional. The

Carminda da Cruz-Landim et al. 52

Figures 1-8


1) Light micrographs of a hypopharyngeal gland of an A. mellifera forager worker; 2) low magnification transmission electron micrograph of a secretory unit of M. q. anthidioides nurse worker; 3) and 4) transmission electron micrographs of cells of A. mellifera (3) and S. postica (4) from hypopharyngeal glands of an early forager showing many degenerative figures; 5) and 6) transmission electron micrographs of forager glandular cells of S. postica (5) and A. mellifera (6) showing a new type of secretion(s); 7) acid phosphatase reaction (arrows) in a glandular cell of a forager worker; 8) condition of a glandular cell in an old forager (av = autophagic vacuole; ec = excretory canal; ic = intracellular canal; mc = main canal; mf = myelin figures; mr = residual membranes; n = nucleus; nu = nucleolus; rer = rough endoplasmic reticulum; s = secretion; se = secretory cells).


Figure 9.

SDS PAGE profiles of the extracts of hypopharyngeal gland proteins (EW = newly emerged worker of S. postica; FW = forager worker of S. postica; NW1 nurse worker of A. mellifera, NW2 = nurse worker of S. postica).

presence of an extensive autophagy seems to indicate a cellular senescence. However, these cells still seem to be functional but accumulation of the first type of protein secretion is not observed to occur in them. The features mentioned above are described for cells from early forager workers. Older foragers show very degenerated gland cells. Their cell cytoplasm appears full of myelin figures, and their general appearance is of total disintegration, with the organelles being difficult to recognise (Fig. 8). The nucleus shows a high chromatin condensation and very irregular contours. This degeneration is so widespread that cell recuperation seems most improbable. It should be noted that this cell degeneration occurs along the gland, is not synchronous, that some secretory units still remain in good conditions, even in older foragers, but cells that have degenerated are fated to die. Glandular cell degeneration was observed in all three species studied, and was occasionally found among forager bees that still had well-developed glands, but these may be younger bees that have only just left the colony for foraging duties. According to the morphological results, the early foragers are finishing the first secretory phase in which they seem to be involved only or mainly in food production for the brood. Subsequently, the cells start the production of a second type of secretion, possibly digestive enzymes. In this phase the gland cells, although having undergone some autophagic degeneration and

Carminda da Cruz-Landim et al. 54


showing signs of senescence, are still active. In older foragers this condition was not observed and, although a few secretory units may appear healthy, it seems improbable that the gland could return to food secretion or produce any other kind of secretion. The contridictory reports about hypopharyngeal gland recovery could be due to a misinterpretation of several events that take place in bee colonies; for instance, the fact that some workers do not pass through all steps of the colony work division. Some forager workers with well developed glands may represent this type of individual. However, it is possible that gland development may respond to environmental conditions in the colony. In workers of A. mellifera from weak colonies, hypopharyngeal glands attain the peak of development early and remain longer in this condition. The stimulus for this glandular behaviour could be nervous or hormonal. Therefore, it appears that the glands of workers that revert to an earlier task have not recovered, but rather have remained in functional condition during the following activity of the worker. The electrophoretic results (Fig. 9) corroborate the morphological findings, indicating that although the glands of foragers remain functional, they produce different patterns of protein secretion. The electrophoretic profiles of S. postica show several similarities with A. mellifera (NW1) and among the different behavioural phases of S. postica. However, some bands are absent or very weak particularly in foragers (FW). The bands corresponding to the food production phase, between 48 and 76 kDa, are practically absent from foragers, while the low molecular weight bands are intensified and those of high molecular weight are completely absent. Therefore, although the electrophoretic results refer to total gland extracts which also contain cellular components, it seems that proteins of low molecular weight, probably enzymes, may be produced by glands of forager workers. These results corroborate the observation that the hypopharyngeal glands at different times and from different individuals produce different types of secretion. In the transition from nurse to forager, a rearrangement of the gland’s secretory apparatus may be necessary to accommodate the synthesis of new protein secretion. This is accounted for by the degenerative processes seen in the glandular cells by the end of the nurse phase. However, it is only at the end of this activity, which almost coincides with death of a worker, that the glandular cells enter in an irreversible process of degeneration. It can be assumed that final cell death occurs progressively, due to exhaustion of the secretory cellular program and that this coincides with the end of the worker’s life. For this reason the great majority of old foragers will be precluded from reassuming any secretory activity and, by consequence, acting as nurses. Only under special conditions of the colony (e.g. weak colonies) or in rare cases in large colonies, the foragers will still have functional hypopharyngeal glands. In older foragers, depending on the number of cell deaths per gland, some secretion production may still be possible, suggesting that the second type of secretion is necessary for foraging, or for processing the foraged products (mainly nectar). In summary, the morphological evidence and eletrophoretic protein patterns for S. postica, indicate that hypopharyngeal glands coming back to food production in older workers seems unlikely in colonies under normal conditions.

Acknowledgements Thanks to Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) for the financial support.


References Beams, H. W. & King, R. L. (1933) The intracellular canaliculi of the pharyngeal glands of the honeybee. Biological Bulletin 64: 309-314. Browers, E. V. M. (1983) Activation of the hypopharyngeal glands of honey bees in winter. Journal of Apicultural Research 22: 137-141. Costa, R. A. C. (1997) Morfologia e funcionamento das glândulas hipofaríngeas em operárias, rainhas e machos de Scaptotrigona postica Latreille, 1804 (Hymenoptera, Apidae, Meliponinae). Dissertação de Mestrado, IBRC, Unesp. Cruz-Landim, C. & Hadek, R. (1969) Ultrastructure of Apis mellifera hypopharyngeal gland. pp 121-130. In Proceedings of the International Union for the Study of Social Insects, University of Bern, Bern. Cruz-Landim, C., Silva de Moraes, R. L. M. & Costa-Leonardo, A. M. (1986/87) Ultra-estrutura das glândulas hipofaríngeas de Melipona quadrifasciata anthidioides Lep. (Hymenoptera, Apidae). Naturalia 11/12: 89-96. Gracioli, L. F., Silva de Moraes, R. L. M. & Cruz-Landim (1999) Electrophoretical studies on protein hypopharyngeal glands of aged Popis mellifera (Hymenoptera: Apidae): workers induced to return to brood feeding activity. Naturalia 24: 9-17. Mortiz, R. F. A. & Southwick, E. E. (1992) Bees as Super Organisms. An Evolutionary Reality. Spring-Verlag, Berlin Noirot, C. & Quennedey, A. (1974) Fine structure of insect epidermal glands. Annual Review of Entomology 19: 61-80. Silva de Moraes, R. L. M., Braga, M. R. B. & Azevedo, A. (1996) Eletrophoretical studies of the hypopharyngeal glands and of the larval food of Melipona quadrifasciata anthidioides Lep. (Hymenoptera, Meliponinae). Insectes Sociaux 43: 183-188. Simpson, J., Riedel, B. M. & Wilding, N. (1968) Invertase in the hypopharyngeal glands of the honeybee. Journal of Apicultural Research 7: 29-36. Takenaka, T., Miwa, S. & Echrigo, T. (1990) Changes of protein content and enzyme activity in hypopharyngeal glands during lifespan of honeybee workers (Apis mellifera L.). Bulletin of the Faculty of Agriculture, Tamagawa University 30: 1-7.


PART

3

Molecular Phylogenetics


Molecular Systematics of the Chalcidoidea Using 28S-D2 rDNA B. Campbell1, J. Heraty2, J.-Y. Rasplus3, K. Chan1, J. Steffen-Campbell1 and C. Babcock2 1

USDA-ARS, Western Regional Research Centre, Albany, CA 94710 USA

2

Department of Entomology, University of California, Riverside, CA 92521 USA

3

INRA-CNRS, Laboratoire de Modélisation et de Biologie Evolutive, 488 rue Croix de Lavit, F-34090 Montpellier, France

Introduction Chalcidoidea are recognised to contain somewhere on the order of 18,500 described species distributed in 20 families and 89 subfamilies (Noyes 1990; Gibson et al. 1999). Estimates of the number of species range somewhere between 60 000 and 100 000 (Noyes 1978, 1990; Gordh 1979). Ecologically and economically, they are one of the most important groups for control of other insect populations (Noyes 1978; LaSalle 1993). However, after more than 200 years of descriptive work, the taxonomy and classification of Chalcidoidea is still unresolved, frequently revised, and largely lacking a consensus in understanding of monophyly at higher taxonomic levels (Gibson et al. 1999). Monophyly of many higher taxonomic groups, including larger family groups such as Eulophidae, Aphelinidae, Pteromalidae and Eupelmidae, has not been determined (Gibson 1989, 1990, 1995; Noyes 1990; Heraty et al. 1997). As the taxon of focus becomes narrowed to either subfamilies or families with few included genera, the problem is not one of defining monophyly but of positing relationships to other groups of Chalcidoidea. New characters for the analysis of relationships are necessary to solve these problems but only after thorough surveys are undertaken to more accurately estimate the real distribution, homology and transformation of each feature (Heraty et al. 1994, 1997). Until recently, classification of Chalcidoidea has been based on morphological similarities and differences rather than on shared apomorphies. As a result, some families are generally regarded as paraphyletic, if not polyphyletic (Woolley 1988; Gibson 1989, 1990; Noyes 1990). Above the family level, inclusion of Mymarommatidae or Mymaridae in Chalcidoidea has been debated (Kozlov & Rasnitsyn 1979; Rasnitsyn 1980; Gibson 1986), with Mymarommatidae currently excluded as a separate superfamily (Goulet & Huber 1993). The number of chalcidoid families has stabilised at 20 (Goulet & Huber 1993), but disagreement still persists over placement of several subfamilies (e.g. Akapalinae, Calesinae, Chrysolampinae, Eriaporinae, Eunotinae, Philomidinae and Sycoryctinae). The inability to resolve the placement of these taxa into family-level groups using available morphological criteria clearly indicates that new additional character systems are needed. Three major groups of taxa are currently considered in the Chalcidoidea. These groups are usually referred to as the mymarid, eulophid and pteromalid lineages, with the pteromalid lineage often subdivided into chalcidid, torymid and encyrtid sub-lineages. Trichogrammatidae and Aphelinidae are usually placed in the ‘eulophid lineage’ along with Elasmidae, Eulophidae and Signiphoridae. This eulophid group has not been characterised as monophyletic based on

59

B. Campbell, J. Heraty, J.-Y. Rasplus, K. Chan, J. Steffen-Campbell and C. Babcock 60


definitive characters but rather on a preponderance of reductions (e.g. fewer antennal articles, reduced number of tarsomeres). Combined, the eulophid lineage accounts for 675 genera and 5955 nominal species of Chalcidoidea (Noyes 1978; LaSalle & Gauld 1991; Goulet & Huber 1993). Within the ‘pteromalid lineage’, problems centre around lack of resolution within Pteromalidae, which contains between 32 and 42 subfamilies (Gibson et al. 1999). This group is generally regarded as being paraphyletic or polyphyletic and the typical ‘dumping ground’ for unplaced taxa within the Chalcidoidea. Embedded within this lineage are the Eupelmidae and Encyrtidae. The three subfamilies of Eupelmidae are likely a grade taxon closely related to the pteromalid subfamily Cleonyminae according to Gibson (1990). Monophyly of Encyrtidae is demonstrated by several external (Noyes & Hayat 1994) and internal structures (Heraty et al. 1997). Most genera of Encyrtidae can be assigned to one of the two recognised subfamilies; however, the relationships among tribes within Encyrtidae are unclear (Trjapitzin & Gordh 1978; Noyes & Hayat 1994). Similar problems of classification exist for almost all higher level taxa within the Chalcidoidea. Convergence and extreme divergence of morphological traits lead to much of the taxonomic confusion. In the Chalcidoidea, a large number of similar characters are considered non-homologous, even though they have similar structure; for example, presence of antennal rami, reduced number of tarsomeres, loss of the mesofurcal bridge, presence of a linea calva on the fore wing, and enlargement of the acropleuron (Gibson 1986, 1989; Heraty et al. 1997). Some features, such as the expanded mesopleuron of the Eupelmidae and Encyrtidae, can be dismissed as being convergent on the basis of detailed morphological studies (e.g. Gibson 1989), but others such as the linea calva of Aphelinidae and Encyrtidae are structurally almost identical, causing problems with their classification. In some Aphelinidae and Encyrtidae, a peculiar socketed tooth on the mandible is extremely similar in both structure and function, but must be interpreted as being convergent within these two divergent lineages (Heraty & Schauff 1998). Each of the above features is ‘locally’ important for identification of monophyletic lineages, but at the superfamily level, or ‘globally’, they are presumed convergent. Considerable discussion exists on the classification and placement of taxa within the Chalcidoidea (cf. Bouºek 1988; Hayat 1994; Gibson et al. 1999). However, character-based phylogenetic studies have usually been confined to assessment of relationships within families, often with some reference made to characteristics of other closely related families. A few papers focus on relationships at the family level, but again these discuss relationships or characteristics of only a limited number of families (LaSalle & Noyes 1985; Bouºek & Noyes 1987). At the superfamily level, only one study has focused on a character system across a large representation of taxa (Heraty et al. 1997). Noyes (1990) presented the only ‘dendrogram’ of relationships so far (cf. Heraty et al. 1997), but this was admittedly an intuitive hypothesis and not based on synapomorphies. Some major problems facing a morphologically based phylogenetic analysis of the Chalcidoidea are simply the sheer number of taxa, the extreme diversity of form, and the tendency towards reduction of similar characters in unrelated taxa. Even complex morphological features, such as an enlarged mesopleuron and jumping mechanisms in subfamilies of Eupelmidae, some Aphelinidae, Tanaostigmatidae and Encyrtidae, may be convergent (Gibson 1989). Molecular systematics offers a different set of characteristics that may be used to assess hypotheses of monophyly. Major lineages of Hymenoptera have been surveyed using mitochondrial 16S rDNA sequences (Derr et al. 1992a, 1992b; Dowton & Austin 1994, 1995) to assess earlier hypotheses of relationships based on morphological characters and to evaluate hypotheses of

Molecular Systematics of the Chalcidoidea Using 28S-D2 rDNA 61

single or multiple origins of parasitism within Hymenoptera. Inferences of evolutionary affiliations of different studies using nucleotide sequences have been inconclusive in demonstrating relationships among sawflies but appear to be relatively congruent for relationships among Apocrita (Carmean et al. 1992; Dowton & Austin 1994, 1995). Within these analyses Chalcidoidea have been shown to be monophyletic, but this inference was based upon at most three species (Derr et al. 1992a, 1992b; Dowton & Austin 1994, 1995). Within Chalcidoidea, several studies have begun to address higher relationships but usually with only a few taxa. Different species and populations of Nasonia Ashmead and Trichomalopsis Crawford (Pteromalidae) were analysed using nucleotide sequences of the ITS2 and 28S-D2 regions of the rRNA transcript (Campbell et al. 1993). Using either Trichomalopsis as an outgroup for the ITS2 data or Melittobia Westwood (Eulophidae) as an outgroup for the more conserved 28S data, the relationships among species of Nasonia were the same (N. vitripennis (Walker) + (N. giraulti Darling + N. longicornis Darling)). These results were concordant with phylogenetic trees obtained for their cytoplasmic incompatability bacteria of the genus Wolbachia (Breeuwer et al. 1992). Relationships among several species of Trichogramma Westwood were analysed using ITS2 (Frenk et al. 1996). Machado et al. (1996) used mitochondrial 12S to analyse relationships of the subfamilies Agaoninae, Otitisellinae, Sycoryctinae and Sycophaginae (Agaonidae) with Doryctinae (Braconidae) as an outgroup. Similar results were obtained from analyses of the 28S-D2 region using more reasonable outgroups (Eurytomidae, Figitidae and Ichneumonidae) and other representatives of Agaonidae sensu Bouºek (1988) (at least two each of Epichrysomallinae, Otitisellinae, Sycophaginae, Sycoryctinae and Sycoecinae) (Rasplus et al. 1998). The results suggest that Agaonidae is not monophyletic with Agaoninae having a very distant relationship with other subfamilies currently included in Agaonidae. The D2 expansion region of 28S rDNA was shown previously to have one to six substitutional differences between species of Nasonia, 10–11 between Nasonia and Trichomalopsis (both Pteromalinae) and 42–46 between these Pteromalidae and Melittobia (Eulophidae) (Campbell et al. 1993). This degree of genetic variation was considered to provide an appropriate phylogenetic signal at the generic and family levels, and was chosen for a broader molecular phylogenetic analysis of the Chalcidoidea reported here. N.B. The authors for genera and species are given in Appendix 1.

Materials and Methods Samples Voucher specimens of almost all taxa sampled (see Appendix 1) to date are deposited in the Entomology Research Museum at the University of California, Riverside or the collection at INRA, Montpellier, France. A few specimens of species not commonly collected but easily identified do not have vouchers. Sequences for several eulophid and encyrtid taxa were provided by Donald Quicke (Imperial College, London; identified by a ‘q’ following the generic name in Fig. 1), and sequences for Uscana and Trichogramma fuentesi Torre were provided by Richard Stouthammer (Wageningen Agricultural University, The Netherlands). A goal of the taxon sampling was to obtain sequences for two or more representatives of each higher taxonomic group (tribe or subfamily). Of the 109 species analysed to date, six belong to the outgroups Cynipoidea and Scelionidae, and one species, N. vitripennis, was duplicated in the analysis from different populations (United States and France), and sequenced independently in the Campbell and Rasplus



laboratories. Eighteen of the 20 families of Chalcidoidea are represented, but only 39 (43.8%) of the 89 subfamilies.

Methods Specimens were killed and stored by freezing at –85°C or were collected into 80–100% EtOH. DNA extractions followed the methods outlined in Campbell et al. (1993). PCR was performed in 25µl reactions using a GeneAmp® Kit (Perkin Elmer Cetus, Norwalk, Conn.). The majority of samples were cloned using a plasmid vector (Invitrogen TA Cloning™ System), but 28 taxa were sequenced directly. Primer sequences for PCR amplification of the D2 expansion region of 28S rDNA and direct sequencing are: forward primer 5'-CGT GTT GCT TGA TAG TGC AGC-3', and reverse primer 5'-TTG GTC CGT GTT TCA AGA CGG-3'. Sequencing was done initially using 33P-dATP based autorads on a Genomyx thermal sequencer and later using an infrared dye system on a LI-COR 4200 automated sequencer. The universal Sp6 and T7 primers were used to sequence plasmid 28S-D2 inserts. Both top and bottom strands were completely sequenced. Nucleotide sequences were aligned initially using the ClustalW subprogram on MacVector v 6.5 (Oxford Molecular) with the majority of remaining sequences aligned manually. Gaps were treated as missing values. Phylogenetic analyses were performed on PAUP 4.0b2a (Sinauer Associates, Inc.) using the random addition sequence search algorithm with 25 replicates through three iterations beyond the point where there was no change in tree length. Each iteration was started using the seed number from the shortest tree of the previous iteration. Successive approximations character weighting (Carpenter 1988) was performed on the shortest tree using the maximum value of the rescaled consistency index and a base weight of 1000; hereafter referred to as the reweighted analyses. Successive iterations did not produce a stable result (increasing length with each iteration), and the final tree was selected after four iterations, the last three of which produced a tree of the same length (the same tree) when all characters were reweighted to unity.

Results The aligned 28S-D2 data matrix consisted of 863 bases, of which 299 were constant and 158 autapomorphic. A total of 406 informative sites were found among chalcidoids, which is more than found in the mitochondrial 16S region (217 across Apocrita; Dowton & Austin 1995). One tree was recovered from the parsimony analysis with a length of 3437 steps, consistency index of 0.274 and a retention index of 0.529 (Fig. 1). After successive weighting, a single tree of 3457 steps with a slightly lower consistency index (0.272) and retention index (0.525) was obtained. The reweighted tree was different from the most parsimonious tree, however, many of the relationships were recovered in both trees (bold lines, Fig. 1). The two major apical clades indicated in Figure 1 were recovered in both analyses but three taxonomic groups (Cleonyminae + Chalcidinae, Eucharitidae, and Eusandalum) shifted to the other of these two clades in the reweighted tree (marked by an asterisk). In all analyses (including our studies with fewer taxa or different alignments), Mymaridae are the sister group to remaining Chalcidoidea and Cales (Calesinae; currently unplaced at family level) is positioned basally. Of the genera represented by more than one species, none of the included species were misplaced into non-congeneric taxa. Forty-four species representing 18 genera were, respectively, placed as monophyletic in both unweighted and reweighted parsimony analyses. Species of six genera (Brachymeria, Eurytoma, Megastigmus, Nasonia, Podagrion and Spalangia) were sequenced


Leptopilina Xyalophora CYNIPOIDEA Diplolepis Gryon SCELIONIDAE Telenomus Trissolcus Polynema MYMARIDAE Gonatocerus 1 Gonatocerus 2 CALESINAE Cales Coccophagoides Encarsia aurantii Encarsia luteola Encarsia formosa APHELINIDAE: COCCOPHAGINAE: PTEROPTRICINI Encarsia protransvena Encarsiella Encarsia lutea Encarsia pergandiella PTEROMALIDAE: EUTRICHOSOMATINAE Eutrichosoma Coccophagus rusti APHELINIDAE: COCCOPHAGINAE: COCCOPHAGINI Coccophagus scutellaris APHELINIDAE: AZOTINAE Ablerus Eretmocerus 19 Eretmocerus 05 APHELINIDAE: APHELININAE: ERETMOCERINI Eretmocerus 01 Eretmocerus 03 Eretmocerus 02 Aphelinoidea Oligosita Uscana TRICHOGRAMMATIDAE Trichogramma fuentes Trichogramma pretiosum Tichogramma platneri Glyphomerus TORYMIDAE: TORYMINAE Podagrion 1 Podagrion 2 Tanaostigmodes TANAOSTIGMATIDAE Sycophila EURYTOMIDAE: EURYTOMINAE Eurytoma 1 Eurytoma 2 TORYMIDAE: TORYMINAE Torymus Aphytis melinus APHELINIDAE: APHELININAE: APHYTINI Aphytis yanonensis Aphelinus asychis APHELINIDAE: APHELININAE: APHELININI Aphelinus albipodus Aphelinus varipes Hockeria Psilocharis CHALCIDIDAE: HALTICHELLINAE Schwarzella 1 Schwarzella 2 EUPELMIDAE: EUPELMINAE Eusandalum PTEROMALIDAE: EUNOTINAE Eunotus Megastigmus 1 TORYMIDAE: MEGASTIGMINAE Megastigmus 2 Aenasius q ENCYRTIDAE + Metaphycus SIGNIPHORIDAE Chartocerus Copidosoma Comperiella encyrtid Ooencyrtus

*

*

10 changes

Figure 1

Cleonymus Epistenia Conura 3 Conura 1 Conura 2 Leucospis

PTEROMALIDAE: CLEONYMINAE CHALCIDIDAE: CHALCIDIDINAE LEUCOSPIDAE

Spalangia 1 PTEROMALIDAE: SPALANGIINAE Spalangia 2 Acanthochalcis CHALCIDIDAE: BRACHYMERIINAE Brachymeria 1 Brachymeria 2 Eupelmus EUPELMIDAE: EUPELMINAE Asaphes PTEROMALIDAE: ASAPHINAE Epiclerus TETRACAMPIDAE Cirrospilus Entedon Horismenus q Chrysocharis 1 Chrysocharis 2 EULOPHIDAE Henryana q Melittobia Aprostocetus q Elachertus q Deutereulophus q Elasmus ELASMIDAE Pachycrepoideus PTEROMALIDAE: PTEROMALINAE Colotrechnus PTEROMALIDAE: COLOTRECHNINAE Seres AGAONIDAE: AGAONINAE Aepocerus AGAONIDAE: OTITISELLINAE Muscidifurax Trichomalopsis Nasonia longpetiolata PTEROMALIDAE: PTEROMALINAE Nasonia giraulti Nasonia vitripennis a Nasonia vitripennis b Calosota Brasema 2 Brasema 1 Chrysomalla PERILAMPIDAE: CHRYSOLAMPINAE Dirhinus CHALCIDIDAE: DIRHININAE Rileya 1 EURYTOMIDAE: RILEYINAE Rileya 2 PTEROMALIDAE: EUNOTINAE Scutellista Obeza EUCHARITIDAE Orasema Idioporus PTEROMALIDAE: EUNOTINAE Perilampus 1 PERILAMPIDAE: PERILAMPINAE Perilampus 2

*

Single most parsimonious tree (phylogram) using the 28S-D2 region (Length 3437 steps, consistency index 0.27, retention index 0.53). Bold lines represent branches supported by both parsimony and successive approximations weighting analyses. Thin lines were supported only in the parsimony analysis. Taxonomic groups indicated by shaded bars. Asterisk indicates clades or taxa that join a different major clade in the reweighted tree.



separately as blind tests to check for sequence fidelity in the Campbell and Rasplus laboratories. The molecular data set also placed the six species representing Encarsia as monophyletic, but this clade also included Encarsiella, a relationship which is supported by another study incorporating more species of Encarsia (Babcock & Heraty unpublished). Of 12 families represented by more than one genus, three were monophyletic: Mymaridae, Trichogrammatidae and Eucharitidae. Eulophidae was monophyletic but included Elasmus (Elasmidae) grouped within the Eulophinae. The placement of Elasmus within Eulophinae rather than as a sister group of Eulophidae was proposed initially by John Noyes (pers. comm.) based on similar host characteristics. The inclusion of this and additional species of Elasmus within Eulophinae has been supported in a more complete analysis of eulophid genera using the same genetic region (Gauthier et al. 2000). Encyrtidae was also monophyletic, but included Chartocerus (Signiphoridae). We have attempted to verify the sequence of Chartocerus with that of two other species of Signiphora but have had difficulties with amplifying the region. Until the sequence is verified this placement is tentative. Of subfamilies represented by multiple genera, seven were monophyletic: Aphelininae (based only on Aphytini and Aphelinini), Haltichellinae, Cleonyminae, Brachymeriinae (sensu lato), Tetrastichinae and Entedoninae, and Pteromalinae (excluding Pachycrepoideus). The Eulophinae (Cirrospilus, Deuteroeulophus and Elachertus) was polyphyletic in the unweighted analysis but monophyletic (including Elasmus) in the reweighted analysis. Not all higher taxa were coherently resolved. None of the three genera of Eunotinae (Scutellista, Eunotus and Idioporus) grouped together. Toryminae were separated into two groups (Glyphomerus + Podagrion and Torymus) in both the unweighted and reweighted analyses. Within Eupelmidae, neither Eupelminae (Eupelmus and Brasema) or Calosotinae (Calosota and Eusandalum) formed a subfamily grouping, although Brasema formed a group with Calosota. The Coccophaginae (Aphelinidae) were split into a paraphyletic Pteroptricini (Coccophagoides, Encarsia and Encarsiella) at the base of the tree, and Coccophagini (Coccophagus) which was grouped with Eutrichosoma (Pteromalidae: Eutrichosomatinae) on both trees; the latter grouping being an unlikely hypothesis. Of three families expected to be monophyletic based on a consensus of findings from morphological studies, Torymidae (Toryminae and Megastigminae), Chalcididae (Chalcidinae, Brachymeriinae, Haltichellinae and Dirhininae) and Eurytomidae (Rileyinae and Eurytominae) were not. Also, Chrysolampinae, which are generally assigned to either Pteromalidae or Perilampidae, were not affiliated with either group. Eupelmidae were scattered across the tree and showed no affinities with Cleonyminae, Tanaostigmatidae or Encyrtidae. The various tribes of Aphelinidae also were scattered across the tree, as were the Pteromalidae. However, as might be expected for such a diverse assemblage, the latter result was not unexpected. Surprisingly, the subfamilies of Chalcididae showed no immediate common affiliation with each other, although genera within each subfamily grouped together. The higher level relationships, basically the backbone of the cladogram, are generally unstable and can change if fewer taxa or different alignments are considered. Different rearrangements usually correspond with relationships supported only in the parsimony tree (thin branches, Fig. 1), although even some of the well-supported relationships (bold branches) can change. Some relationships are very stable even with different taxa or alignments. Across different analyses, the relationship of Ablerus (Azotinae) and Eretmocerus + Trichogrammatidae remain unchanged. Also, Cales (Calesinae) and the Pteroptricini are usually placed basally, although in some analyses these are replaced as basal by Perilampus and Idioporus. Some relationships


change depending on the taxa being included. For example, a sister group relationship between Tanaostigmatidae and Encyrtidae (LaSalle & Noyes 1985) was not recovered in this analysis, but did occur in some of the earlier analyses with fewer taxa. Adding more taxa may recover this relationship. Notably, across the Chalcidoidea, the number of base changes does not always correlate with consistency of relationships. For example, the clade formed by Pteromalinae, Colotrechninae, Agaoninae and Otitisellinae has relatively few substitutional differences but the relationships remain consistent in all analyses, especially in the clade that includes Aepocerus and Nasonia.

Discussion An important goal of this study is to represent all of the terminal taxa of interest (families, subfamilies or tribes) by two or more divergent taxa, as proposed by Wheeler et al. (1993). Where we have a high degree of confidence in the relationships of closely related taxa based on morphological evidence, for example two unequivocally placed genera of the same subfamily, they should group together on trees produced by molecular evidence (cf. Patterson et al. 1993). If not, then we need to either re-evaluate our initial assumptions of relationship or quality of the molecular data. If we can accept our initial assumptions of relationships, then informative nucleotide changes are best if they are shared by all included members of a taxon (synapomorphic) and, potentially, worst if they are shared by few members of that same taxon and a distantly related taxon (homoplastic). Presumably, derived character states shared by divergent groups within a taxon are more likely to be indicative of synapomorphic changes rather than autapomorphic changes. Results from the 28S-D2 data set are encouraging and indicate that the region is appropriate for analysis of chalcidoid taxa, which may have diverged in the Upper Cretaceous or early Tertiary. Including outgroup taxa, 80% (88/110) of the species are placed into some form of realistic grouping (generic or family group taxon) based on morphological evidence. From our analysis, there was no support for the so-called eulophid or pteromalid lineages. Fourteen subfamilies are represented by only a single species and essentially remain unverified in the data set. The 28S-D2 dataset shows greatest support at the subfamily and generic levels, although five families, Mymaridae, Encyrtidae (+ Chartocerus), Eulophidae (+ Elasmus), Eucharitidae, and Trichogrammatidae are placed as monophyletic or paraphyletic with one other taxon. Based on morphological evidence, four families expected to be monophyletic (Chalcididae, Eurytomidae, Perilampidae and Torymidae) were not. Eunotinae was the only subfamily not having any of the species grouped together. In part this lack of a coherent relationship may be justified based on recent discussions on the placement of Idioporus, in which they were put into Eunotinae as a distinct tribe, but only after consideration of shared characteristics with Eriaporinae (unplaced at the family level), Aphelinidae and Eulophidae (LaSalle et al. 1997). The genera of Eulophidae were all placed into a monophyletic group with monophyly of the Tetrastichinae and Entedoninae supported, while Eulophinae were supported only in the reweighted analysis. Elasmidae are usually placed as the sister group of Eulophidae based on a similar reduction of antennal segments and a simple calcar. The association of Elasmidae with Eulophinae has not been proposed on morphological characters, but instead due to a similar habit of attacking leaf-mining Lepidoptera (Noyes pers. comm.). The results using molecular data support use of character reductions for defining Eulophidae.


Figure 2


Secondary structure model for D2 expansion segment of 28S rRNA of Psilochalcis sp. (Chalcididae: Haltichellinae). Overall structure inferred from thermodynamic folding of the full sequence of the D2 region using mfold version 2.3. Individual substructures within subdomains were confirmed by folding respective nucleotide sequences using the RNA folding program in MacDNASIS and examination of compensatory substitutions (Roussett et al. 1991). Nomenclature of subdomains and helices are according to Michot & Bachellerie (1987).

Some groups, such as Aphelinidae, Eupelmidae and Pteromalidae are not supported by morphological synapomorphies (Heraty et al. 1997; Gibson et al. 1999). Thus, absence of monophyly for these groups in an analysis using molecular data is not unwarranted, although Eupelmidae should have been grouped together at least as a paraphyletic assemblage (Gibson 1995). Generally, tribes of Aphelinidae are monophyletic except for Pteroptricini, which was paraphyletic at the base of the tree. Only Aphytini and Aphelinini were monophyletic. A sister group relationship between Eretmocerus and Trichogrammatidae was supported in all molecular analyses to date, including a separate analysis using the highly variable region synonymous to the E21 helix of 18S rRNA (Campbell & Heraty unpublished). Eretmocerus has usually been placed in the Aphelininae, recently within a separate tribe, the Eretmocerini (Hayat 1998). However, Shaffee and Rizvi (1990) proposed a classification in which Eretmocerus was closer to Trichogrammatidae, and Heraty et al. (1997) found shared characteristics of the mesofurca between the two groups. We are unaware of any morphological support for a sister group relationship between Ablerus (Azotinae) and Eretmocerus + Trichogrammatidae as inferred on the molecular tree. Azotinae is usually placed as closer to Signiphoridae (Woolley 1988), Coccophaginae (Hayat 1994) or Aphelininae (Heraty et al. 1997). Analysing the 28S-D2 data within a more restricted taxonomic range may be better for addressing relationships among some of the problematic taxa. For example, Chalcididae are a demonstrably monophyletic group sharing several derived characteristics, including a plate-like labrum, non-overlapping clypeus, reduced prepectus, lateral scutellar arch and enlarged hind


femora (Wijesekara 1997). Few systematists would doubt the monophyly of included members, yet none of the subfamilies formed a coherent ‘chalcidid’ assemblage in our molecular based analysis including all chalcidoids. However, monophyly of Haltichellinae was supported, and relationships of included genera match those based on morphological hypotheses (Wijesekara 1997). Dirhininae was represented by only one species in this analysis. The three species of Conura in our analysis are members of the side-group of species within Chalcidini and are not representative of the diversity within the tribe. Brachymeria and Acanthochalcis were previously treated as the Brachymeriinae, but were recently allocated to Chalcidinae as Brachymeriini and Cratocentrini (Boucek 1988). Recently each was elevated to subfamily status by Wijesekara (1997). Results of these analyses suggest Acanthochalcis and Brachymeria are closely related, but their relationship to Chalcidini is uncertain. An effort was made to analyse the chalcidid taxa independent of other chalcidoids, but including traditionally accepted sister groups of Eurytomidae and Leucospidae. In this analysis, the 28S-D2 sequences were aligned so that homologous base positions were matched to the greatest extent possible. This alignment was based on homology of secondary structure and substructures of rRNA synonymous to the D2 region. Secondary structures were inferred based upon thermodynamic folding using mfold v.2.3 (Zucker et al. 1999) via the mfold server (http://mfold1. wustl.edu/~mfold/rna/form1.cgi). Confirmation of certain inferred substructures using shorter sequences was made with the RNA-folding subprogram of MacDNASIS® (Hitachi Software). The overall secondary structure of the chalcidid D2 region (Fig. 2) corresponded to three subdomains inferred for Drosophila (Linares et al. 1991; Rousset et al. 1991) and aphidiines (Belshaw & Quicke 1997). The fewer number of taxa examined in this subset of the chalcidoid dataset enabled a more robust alignment of homologous nucleotide positions. These positions could be rigorously ascertained according to homology of subdomain structure and retention of certain substructures (bulges, loops, etc), which show much broader variation among all chalcidoids. Moreover, it was determined that alignment based on ‘similarity’ using ClustalW did not always align homologous positions according to secondary structure. Despite this independent rigor given to sequences of Chalcididae, Leucospidae and Eurytomidae, the same problems of non-monophyly occurred. Eurytomids were polyphyletic and the haltichellines were the sister to all other chalcids and the leucopsid. When these taxa were scored according to the morphological character matrix presented by Wijesekara (1997) a monophyletic eurytomid was sister to Leucospidae + Chalcididae, with internal arrangement of Chalcididae almost concordant with that of Wijesekara (1997) and Haltichellinae as the distal lineage. Character analysis of the morphological and nucleotide datasets provided some explanation for the different topologies generated. While the morphological dataset provided three synapomorphies supporting Chalicididae, there were zero in the nucleotide dataset. The morphological dataset provided one synapomorphy to support Leucospidae + Chalcididae and the nucleotide dataset provided zero. Conversely, the nucleotide dataset provided three molecular synapomorphies supporting Brachymeria + Acanthochalcis (Brachymeriinae sensu lato), while there were no morphological synapomorphies for this clade. Haltichellinae was supported by both datasets, as was also the Hybothoricini, suggesting that current haltichelline taxonomic groupings are probably accurate. Interestingly, when both datasets were combined a currently preferred set of relationships (except for equivocal placement of Brachymeria and Acanthochalcis) was resolved (Campbell & Heraty unpublished). The observed congruence between the molecular hypotheses generated from the 28S-D2 region and the accepted morphological-based classifications for some of the included taxa increase our faith in this region as a reasonable estimator of relationships for some families and almost all



subfamilies. However, we must regard this analysis as preliminary. Better resolution of some groups, such as Chalcididae, Eurytomidae and Torymidae, will be necessary before we can begin to accept relationships postulated for higher level taxa. Is it a case of adding more molecules (new regions), adding morphological data, or adding more taxa? Additional genes, based on the same limited sampling of taxa, are likely to duplicate inadequacies of the 28S data set. Adding morphological characters to the matrix is obviously a necessary step towards fully understanding the relationships of this group. However, less than 45% of chalcidoid subfamilies are represented in the current analysis. For Pteromalidae, only five of 32 subfamilies are included. Within some groups, representation is poor. For example, sequences of Chalcidini are based only on members of one clade, the Conura side-group, and Perilampidae is represented only by two species of the Perilampus fulvicornis-group. Other studies demonstrate that an adequate sampling of taxa is most important to provide a proper estimate of the phylogeny (Graybeal 1998; Poe 1998). Hence, future emphasis on increased taxon sampling, particularly for the Pteromalidae, Chalcididae, Eurytomidae and Torymidae may be the best approach for further resolving higher-level relationships of Chalcidoidea.

Summary Based on cladistic analysis of nucleotide sequences of the 28S-D2 expansion region we find: 1) Chalcidoidea are monophyletic, and Mymaridae are the sister group to the remaining Chalcidoidea. This relationship agrees with recent morphology-based hypotheses (Gibson et al. 1999). 2) Eulophidae (including Elasmus) are monophyletic. This is consistent with morphological data, although hypotheses of monophyly are based only on reductions or losses of characters (number of tarsal segments and flagellomeres and reduced fore tibial spur). 3) Elasmidae are closest to the Eulophinae within the Eulophidae. 4) Eretmocerus and Trichogrammatidae are sister groups. This relationship was proposed by Shafee & Rizvi (1990) without supporting character evidence, and again more recently by Heraty et al. (1997) using similar structure of the mesofurca. 5) The families Mymaridae, Eucharitidae and Trichogrammatidae, and the subfamilies Aphelininae (excluding Eretmocerini), Cleonyminae, Haltichellinae and Brachymeriinae (sensu lato) are all supported as monophyletic using more than one generic exemplar. 6) Encyrtidae is rendered paraphyletic by the genus Chartocerus (Signiphoridae) in all analyses. The Chartocerus sequence has been checked with other specimens, but an additional sequence from another genus of signiphorid is needed to verify its placement. 7) Aphelinidae is never supported as monophyletic. Aphelininae (excluding Eretmocerus) are monophyletic in all analyses, but the monophyly of the Coccophaginae (as represented by Encarsia, Coccophagoides, Coccobius and Coccophagus) is transient. No morphological evidence supports the monophyly of Aphelinidae (Gibson et al. 1999). 8) Pteromalidae are not monophyletic. However, only five of 32 subfamilies are represented. 9) Chalcididae, as represented by Brachymeriinae (Brachymeria, Acanthochalcis), Chalcidinae (Conura) and Haltichellinae (Psilocharis, Hockeria, Schwarzella), is not monophyletic. This was a surprising result considering strong morphological evidence supporting this


assemblage (Wijesekara 1997). The combination of molecular and morphological data sets resolved relationships to current consensus. 10) Agaonidae is polyphyletic in accordance with recent findings of Rasplus et al. (1998).

Acknowledgements We appreciate Dave Hawks, Jung-Wook Kim and Michael Gates (UCR) for their assistance in acquiring specimens and sequences. Numerous people have helped to supply specimens, but in particular we would like to thank Donald Quicke (Imperial College, London), John LaSalle (IIE, London), Nathan Schiff (USDA, Stoneville, MS), Molly Hunter (University of Arizona, Tucson), Les Ehler (University of California, Davis), and Tom Bellows, Dan Gonzalez, Greg Walker and Robert Luck (University of California, Riverside). We thank Anura Wijesekara (Horticulture Research and Development Institute, Sri Lanka) for insightful discussions.

References Belshaw, R. & Quicke, D. L. J. (1997) A molecular phylogeny of the Aphidiinae (Hymenoptera: Braconidae). Molecular Phylogenetics & Evolution 7: 281-293. Boucˇek, Z. (1988) Australasian Chalcidoidea (Hymenoptera): A Biosystematic Revision of Genera of Fourteen Families, with a Reclassification of Species. C.A.B. International, Wallingford. Boucˇek, Z. & Noyes, J. S. (1987) Rotoitidae, a curious new family of Chalcidoidea (Hymenoptera) from New Zealand. Systematic Entomology 12: 407-412. Breeuwer, J. A. J., Stouthamer, R., Burns, S. M., Pelletier, D. A., Weisberg, W. G. & Werren, J. H. (1992) Phylogeny of cytoplasmic incompatibility microorganisms in the parasitoid was genus Nasonia (Hymenoptera: Pteromalidae) based on 16S ribosomal DNA sequences. Insect Molecular Biology 1: 25-36. Campbell, B., Steffen-Campbell, J. D. & Werren, J. H. (1993) Phylogeny of the Nasonia species complex (Hymenoptera: Pteromalidae) inferred from an internal transcribed spacer ITS2 and 28S rDNA sequences. Insect Molecular Biology 2: 225-237. Carmean, D., Kimsey, L. S. & Berbee, M. L. (1992) 18S rDNA sequences and the holometabolous insects. Molecular Phylogenetics & Evolution 1: 270-278. Carpenter, J. (1988) Choosing among equally parsimonious cladograms. Cladistics 4: 291-296. Derr, J. N., Davis, S. K., Woolley, J. B. & Wharton R. A. (1992a) Variation and the phylogenetic utility of the large ribosomal subunit of mitochondrial DNA from the insect order Hymenoptera. Molecular Phylogenetics & Evolution 1: 136-147. Derr, J. N., Davis, S. K., Woolley, J. B. & Wharton R. A. (1992b) Reassessment of the 16S rRNA nucleotide sequence from members of the parasitic Hymenoptera. Molecular Phylogenetics & Evolution 1: 338-341. Dowton, M. & Austin, A. D. (1994) Molecular phylogeny of the insect order Hymenoptera: Apocritan relationships. Proceedings of the National Academy of Sciences, USA 91: 9911-9915. Dowton, M. & Austin, A. D. (1995) Increased genetic diversity in mitochondrial genes is correlated with the evolution of parasitism in the Hymenoptera. Journal of Molecular Evolution 41: 958-965. Frenk, J. P. M., Silva, I., Schilthuizen, M., Pinto, J. D., & Stouthamer, R. (1996) Use of DNA-based methods for the identification of minute wasps of the genus Trichogramma. Proceedings of Experimental and Applied Entomology N.E.V. Amsterdam 7: 233-237.



Gauthier, N., LaSalle, J., Quicke, D. L. J. & Godfray, H. C. J. (2000) Phylogeny of the Eulophidae (Hymenoptera: Chalcidoidea), with a reclassification of the Eulophinae and the recognition that the Elasmidae are derived eulophids. Systematic Entomology 25: 1-20. Gibson, G. A. P. (1986) Evidence for monophyly and relationships of Chalcidoidea, Mymaridae, and Mymarommatidae (Hymenoptera: Terebrantes). Canadian Entomologist 118: 205-240. Gibson, G. A. P. (1989) Phylogeny and classification of Eupelmidae, with a revision of the world genera of Calosotinae and Metapelmatinae (Hymenoptera: Chalcidoidea). Memoirs of the Canadian Entomological Society 149: 121 pp. Gibson, G. A. P. (1990). A word on chalcidoid classification. Chalcid Forum (newsletter) 13: 7–9. Gibson, G. A. P. (1995) Parasitic wasps of the subfamily Eupelminae: Classification and revision of World genera (Hymenoptera: Chalcidoidea: Eupelmidae). Memoirs of Entomology, International 5: 1-421. Gibson, G. A. P., Heraty, J. M. & Woolley, J. B. (1999) Phylogenetics and classification of Chalcidoidea and Mymarommatoidea – a review of current concepts (Hymenoptera, Apocrita). Zoologica Scripta 28: 87-124. Gordh, G. (1979) Encyrtidae. pp. 890-966. In Krombein, K. V., Hurd, B., Smith, D. R. & Burks, B. D. (Eds), Catalog of Hymenoptera in America North of Mexico. Volume 1. Smithsonian Institution Press, Washington. Goulet, H. & Huber, J. T. (1993) Hymenoptera of the World: An Identification Guide to Families. Agriculture Canada Publication 1894/E. Graybeal, A. (1998) Is it better to add taxa or characters to a difficult phylogenetic problem? Systematic Biology 47: 9-17. Hayat, M. (1994) Notes on some genera of the Aphelinidae (Hymenoptera: Chalcidoidea), with comments on the classification of the family. Oriental Insects 28: 81-96. Hayat, M. (1998) Aphelinidae of India (Hymenoptera: Chalcidoidea): A taxonomic revision. Memoirs on Entomology, International 13: 416 pp. Heraty, J. M. & Schauff, M. E. (1998) Mandibular teeth in Chalcidoidea: function and phylogeny. Journal of Natural History 32: 1227-1244. Heraty, J. M., Woolley, J. B. & Darling, D. C. (1994) Phylogenetic implications of the mesofurca and mesopostnotum in Hymenoptera. Journal of Hymenoptera Research 3: 241-277. Heraty, J. M., Woolley, J. B. & Darling, D. C. (1997) Phylogenetic implications of the mesofurca and mesopostnotum in Chalcidoidea (Hymenoptera), with emphasis on Aphelinidae. Systematic Entomology 22: 45-65. Kozlov, M. A. & Rasnitsyn, A. P. (1979) On the limits of the Serphitidae (Hymenoptera, Proctotrupoidea). Entomologicheskoe Obozrenie 58: 402–416. [in Russian] LaSalle, J. (1993) Parasitic Hymenoptera, biological control and the biodiversity crisis. pp. 197216. In LaSalle, J. & Gauld, I. D. (Eds), Hymenoptera and Biodiversity. C.A.B. International: Wallingford. LaSalle, J. & Gauld, I. D. (1991) Parasitic Hymenoptera and the biodiversity crisis. Redia 74: 315334. LaSalle, J. & Noyes, J. S. (1985) New family placement for the genus Cynipencyrtus (Hymenoptera: Chalcidoidea: Tanaostigmatidae). Journal of the New York Entomological Society 93: 1261-1264. LaSalle, J., Polaszek, A., Noyes, J. S. & Zolnerowich, G. (1997) A new whitefly parasitoid (Hymenoptera: Pteromalidae: Eunotinae), with comments on its placement, and implications for classification of Chalcidoidea with particular reference to the Eriaporinae (Hymenoptera: Aphelinidae). Systematic Entomology 22: 131-150.


Linares, A. R., Hancock, J. M. & Dover, G. A. (1991) Secondary structure constraints on the evolution of Drosophila 28S ribosomal RNA expansion segments. Journal of Molecular Biology 219: 381-390. Machado, C. A., Herre, E. A., McCafferty, S. & Berminham, E. (1996) Molecular phylogenies of fig pollinating and non-pollinating wasps and the implications for the origin and evolution of the fig-fig wasp mutualism. Journal of Biogeography 23: 531-542. Michot, B. & Bachellerie, J. P. (1987) Comparison of large subunit rRNAs reveal some eukaryotespecific elements of secondary structure. Biochimie 69: 11-23. Noyes, J. S. (1978) On the numbers and species of Chalcidoidea (Hymenoptera) in the world. Entomologist’s Gazette 29: 163-164. Noyes, J. S. (1990) A word on chalcidoid classification. Chalcid Forum (newsletter) 13: 6-7. Noyes, J. S. & Hayat, M. (1994) Oriental Mealybug Parasitoids of the Anagyrini (Hymenoptera: Encyrtidae). CAB International, Wallingford. Patterson, C., Williams, D. M. & Humphries, C. J. (1993) Congruence between molecular and morphological phylogenies. Annual Review of Ecology & Systematics 24: 153-188. Poe, S. (1998) Sensitivity of phylogeny estimation to taxonomic sampling. Systematic Biology 47: 18-31. Rasplus, J. Y., Kerdelhué, C. & Mondor, G. (1998) Molecular phylogeny of fig wasps (Hymenoptera). Agaonidae is not monophyletic. Compte Rendu de l’Académie des Sciences de Paris 321: 21-31. Rasnitsyn, A. P. (1980). Origin and evolution of hymenopterous insects. Trudy Paleontologicheskogo Instituta Akademiya Nauk SSSR 174: 1–192. [in Russian] Rousset, R., Pélandakis, M. & Solignac, M. (1991) Evolution of compensatory substitutions through G•U intermediate state in Drosophila rRNA. Proceedings of the National Academy of Sciences, USA 88: 10032-10036. Shafee, S. A. & Rizvi, S. (1990) Classification and phylogeny of the family Aphelinidae (Hymenoptera: Chalcidoidea). Indian Journal of Systematic Entomology 7: 103–115. Trjapitzyn, V. A. & Gordh, G. (1978) Review of the genera of Nearctic Encyrtidae (Hymenoptera: Chalcidoidea). II. Entomological Review 57: 437-448. Wheeler, W. C., Cartwright, P. & Hayashi, C. (1993) Arthropod phylogeny: a combined approach. Cladistics 9: 1-39. Wijesekara, A. (1997) A phylogenetic analysis of the Chalcididae (Hymenoptera: Chalcidoidea). Memoirs of the American Entomological Institute 29: 1-61. Woolley, J. B. (1988) Phylogeny and classification of the Signiphoridae (Hymenoptera: Chalcidoidea). Systematic Entomology 13: 465-501. Zuker, M., Matthews, D. H. & Turner, D. H. (1999) Algorithms and Thermodynamics for RNA Secondary Structure Prediction: A Practical Guide in RNA Biochemistry and Biotechnology. Barciszewski, J. & Clark, B. F. C. (Eds), NATO ASI Series, Kluwer Academic Publishers.


Appendix 1 List of species used in this study showing their family/subfamily placement. Agaonidae Agaoninae Seres Waterston Otitisellinae Aepocerus Mayr Aphelinidae Coccophaginae Coccophagus rusti Compere Coccophagus scutellaris Dalman Coccophagoides Girault Encarsia formosa Gahan Encarsia lutea Masi Encarsia aurantii Howard Encarsia protransvena Viggiani Encarsia luteola Howard Encarsia pergandiella Howard Encarsiella Hayat Aphelininae Aphelinus varipes Foerster Aphelinus albipodus Hayat & Fatima Aphelinus asychis Walker Aphytis melinus DeBach Aphytis yanonensis Debach & Rosen Eretmocerus Haldeman Azotinae Ablerus Howard Calesinae Cales noacki Howard Chalcididae Chalcidinae Conura Spinola Brachymeriinae Brachymeria Westwood Acanthochalcis Cameron Dirhininae Dirhinus Dalman Haltichellinae Hockeria Walker Psilochalcis Kieffer Schwarzella Ashmead


Elasmidae Elasmus Westwood Encyrtidae Metaphycus Mercet Copidosoma Ratzeburg Comperiella Howard Aenasius Walker Ooencyrtus Ashmead Zaomma Ashmead Eucharitidae Oraseminae Orasema Cameron Eucharitinae Obeza Heraty Eulophidae Entedoninae Chrysocharis Foerster Horismenus Walker Entedon Dalman Eulophinae Cirrospilus Westwood Elachertus Spinola Deutereulophus Schulz Tetrastichinae Melittobia Westwood Aprostocetus Westwood Henryana Yoshimoto Eupelmidae Eupelminae Brasema Cameron Eusandalum Ratzeburg Eupelmus Dalman Calosotinae Calosota Curtis Eurytomidae Eurytominae Eurytoma Illiger Sycophila Walker Rileyinae Rileya Ashmead


Leucospidae Leucospis F.

Tanaostigmatidae Tanaostigmodes Ashmead

Mymaridae Polynema Haliday Gonatocerus Nees

Tetracampidae Epiclerus Haliday

Perilampidae Perilampinae Perilampus Latreille Chrysolampinae Chrysomalla Foerster Pteromalidae Asaphinae Asaphes Walker Colotrechninae Colotrechnus Thomson Eunotinae Scutellista Motschulsky Eunotus Walker Idioporus LaSalle & Polaszek Eutrichosomatinae Eutrichosoma Ashmead Spalangiinae Spalangia Latreille Pteromalinae Trichomalopsis Crawford Nasonia vitripennis Walker Nasonia longicornis Darling Nasonia giraulti Darling Muscidifurax Girault & Sanders Pachycrepoideus Ashmead Cleonyminae Cleonymus Latreille Epistenia Westwood Signiphoridae Chartocerus Motschulsky

Torymidae Toryminae Torymus Dalman Podagrion Spinola Glyphomerus Foerster Megastigminae Megastigmus Dalman Trichogrammatidae Trichogramma pretiosum Riley Trichogramma platneri Nagarkatti Trichogramma fuentesi Torre Aphelinoidea Girault Oligosita Walker Uscana Girault

Outgroups Scelionidae Trissolcus Ashmead Gryon Haliday Cynipidae Diplolepis rosae (L.) Eucoilidae Leptopilina boulardi (Barbotin, Carton, & Kelner-Pillault) Figitidae Xyalophora Kieffer

Phylogeny of the Subfamilies of Ichneumonidae (Hymenoptera): a Simultaneous Molecular and Morphological Analysis D. L. J. Quicke1,2, M. G. Fitton2, D. G. Notton2,3, G. R. Broad1,4 and K. Dolphin1 1

Unit of Parasitoid Systematics, CABI Bioscience UK Centre (Ascot), Department of Biology, & 4Centre for Population Biology, Imperial College at Silwood Park, Ascot, Berkshire SL5 7PY United Kingdom (email: [email protected])

2 Department of Entomology, The Natural History Museum, London SW7 5BD United Kingdom 3

Present address: Reading Museum Service, Blagrave Street, Reading RG1 7HB United Kingdom

Introduction The Ichneumonidae is one of the most species rich families of insects and it is now widely recognised that the figure of 60 000 species world-wide (Townes 1969) is an oft-repeated underestimate (Gauld 1991). It is currently divided into some 39 subfamilies; Gauld (1997) listed 37 and Porter (1998) has recognised two more. However, despite recent advances in the systematics of the family, many of the larger polythetic groups are still poorly defined and some are undoubtedly paraphyletic or polyphyletic assemblages. To date, no morphological phylogenetic analysis of the whole family has been published. Phylogenetic analyses of some individual subfamilies and a few groups of subfamilies have been undertaken [Labeninae – Gauld 1983; ‘Oxytorinae’ (Microleptinae sensu Townes) – Wahl 1986; Ophioninae – Gauld 1985; Pimplinae (sensu lato) – Eggleton 1989; ‘Pimpliformes’ – Wahl 1990; Wahl & Gauld 1998; Campopleginae – Wahl 1991; Mesochorinae – Wahl 1993a; Labeninae – Wahl 1993b; Xoridinae – Wahl 1997] but none of these works addressed the structure of the family as a whole. Although some major groupings of subfamilies have been proposed, (Wahl 1990, 1991, 1993a; Gauld 1991, 1997) only two of these have been defined monophyletically (Wahl 1990, 1991), and many subfamilies have remained unplaced in this loose classification. Phylogenetic analyses have hitherto concentrated on morphological characters and have been restricted in their applicability at the subfamily level by extensive homoplasy (Gauld & Mound 1982). The molecular phylogeny of Belshaw et al. (1998) was the first formal analysis to include a wide sample of representative ichneumonid subfamilies. They indicated relationships for some of the ‘unplaced’ subfamilies whilst supporting some of the previously suggested groupings. Quicke et al. (1999) also used the D2 variable region of 28S nuclear rDNA in an attempt to identify the most basal extant subfamilies. With the emergence of higher level phylogenetic hypotheses for the Braconidae (Belshaw et al. 1998; Dowton et al. 1998; Dowton & Austin 1998; Dowton 1999), the lack of any reasonable phylogenetic reconstructions of their sister group, the Ichneumonidae, is conspicuous and hampers any comparative analyses of biological strategies, such as those suggested by Gauld (1988). We

74


Phylogeny of the Subfamilies of Ichneumonidae (Hymenoptera) 75

hope to redress the balance somewhat with this work using both molecular and morphological data sets. Hypotheses concerning the evolutionary transitions within the Ichneumonidae (e.g. Gauld 1988) have rested on a priori assumptions concerning biological and morphological features. It is thought that the ancestral ichneumonid was an idiobiont ectoparasitoid of xylophagous coleopterous or siricid larvae, a view that has been given some support by the molecular analysis of putatively basal subfamilies by Quicke et al. (1999). However, some molecular studies on the sister family, Braconidae, have tentatively suggested that their ancestral biology was endoparasitism (Dowton et al. 1998).

Materials and Methods The character matrix included 786 characters in total and was a combination of 123 morphological and life history characters which covered external and internal anatomy including immature stages (taken from the unpublished matrix of Fitton and Quicke) as well as existing manually aligned sequence data sets for the D2 variable region of the nuclear 28S rDNA gene (Belshaw et al. 1998; Quicke et al. 1999). Gaps were coded as missing, all characters were treated as unordered and assigned equal weight. The combined morphological and molecular character matrix, full descriptions of all the characters, and list of summary taxa for the morphological character set, can be found on the Imperial College web site [http://www.bio.ic.ac.uk/research/dlq/ ich_mat.pau and http://www.bio.ic.ac.uk/research/dlq/ morph_ch.rtf]. The 61 taxa included in this study represented 31 of the 39 or so ichneumonid subfamilies, making this the widest ranging phylogenetic study of the family to date. The morphological data referred to summary terminal taxa (usually tribes or subfamilies but sometimes groups of individual genera) to which the species sequenced belonged (details on www, see above). The names of terminal taxa shown on our trees (Figs 1-3) are given in Table 1 with their subfamily, tribal or genus-group placement as applicable. Although morphological data have been collected for all ichneumonid subfamilies and tribes, only those for which we had molecular data were included in the analyses presented here.

Phylogenetic analyses The matrix was partitioned into molecular and non-molecular components, and conflict between the partitions was investigated using the Incongruence Length Difference test (Farris et al. 1994) as implemented in the pre-release PAUP* version 4.0d61 (written by David L. Swofford). All phylogenetic analyses were conducted using PAUP* 4.0d61 as above. Three analyses were undertaken using (i) the molecular, (ii) non-molecular and (iii) combined data sets. The search strategy was as follows [details of the efficiency of this strategy will be presented elsewhere (Quicke et al. in review)]: (a) Heuristic searches were carried out using tree bisection-reconnection (TBR), 100 random addition sequence replicates and unlimited maxtrees. (b) Characters were reweighted by the maximum Rescaled Consistency Index derived from the cladograms resulting from (a), and a further heuristic analysis was carried out using the trees obtained from (a) as starting trees. (c) Using all of the resulting cladograms as starting points, and with all characters reweighted to unity, further TBR rearrangements were performed.

D. L. J. Quicke, M. G. Fitton, D. G. Notton, G. R. Broad and K. Dolphin 76


Table 1 Subfamilial and tribal placements of ichneumonid taxa sequenced for this study. The classification in this table shows only the taxa included in the simultaneous analyses. All taxa are those used for the morphological study and were chosen as far as possible to be monophyletic, without any implications as to their rank. The following were not included in the current analyses or classification: Groteini, Ganodes, Rodrigama, Sphinctini, Ankylophonini, Eclytini, Exenterini, Idiogrammatini, Claseinae, Ateleute, Lycorininae, Agriotypinae, Banchus-group, Glyptini, Townesioninae, Panteles, Olethrodotini, Scolobatini, Euryproctini, Belesica-group, Hellwigia, Skiapus, Tatogastrinae, Apolophus, Bremiella, Ischyrocnemis, Lapton, Anomalonini, Coleocentrini, Cylloceriinae, Oxytorinae, Hyperacmus, Brachyscleroma, Melanodolius-group, Phaeogenini. These taxa being those for which we have no 28S rDNA data for any included species; Pedunculinae were included within the Brachycyrtinae for the morphological character set. There is therefore no implication that they are excluded from the subfamily groups recognised above (1not including Belesica-group; 2not including Apolophus, Bremiella, Ischyrocnemis, Lapton; 3not including Brachyscleroma and Melanodolius-group; 4not including Panteles; 5not including Ganodes and Rodrigama; 6not including Ateleute). Subfamily group

Taxon

Genera with molecular data included in analyses

Ophioniformes

Campoplegini Nesomesochorini Cremastinae1 Ophioninae Gravenhorstiini Tersilochinae Paxylommatinae Atrophini Exetastes-group Mesochorinae Ctenopelmatini Perilissini Mesoleiini Pionini Metopiinae2 Neorhacodinae Tryphonini Oedemopsini Phytodietini Phrudinae3 Stilbopinae4

Venturia, Lathrostizus, Dusona Nonnus Pristomerus, indet. cremastine Enicospilus, Eremotylus, Ophion Agrypon indet. tersilochine Hybrizon Lissonota Exetastes Mesochorus Xenoschesis Perilissus, Absyrtus Alexeter Pion Exochus, Hypsicera, Colpotrochia Neorhacodes Cosmoconus, Monoblastus, Polyblastus, Grypocentrus Oedemopsis Netelia Phrudus Stilbops

Orthopelmatiformes

Orthopelmatinae

Orthopelma

Pimpliformes

Poemeniinae5 Rhyssinae Ephialtini Polysphinctini Pimplini Diacritinae Microleptinae Diplazontinae Orthocentrinae Helictinae Acaenitini Collyriinae

Neoxorides, Poemenia, Pseudorhyssa Megarhyssa Ephialtes, Tromatobia, Dolichomitus Schizopyga Apechthis, Itoplectis Diacritus Microleptes Diplazon Orthocentrus Proclitus Phaenolobus Collyria


Table 1 (continued) Subfamily group

Taxon

Genera with molecular data included in analyses

Ichneumoniformes

Eucerotinae Brachycyrtinae Ichneumoninae Cryptinae6 Adelognathinae

Euceros Brachycyrtus Crypteffigies, Alomya Dichrogaster, Nematopodius Adelognathus

Labeniformes

Labenini Poecilocryptini

Labena Poecilocryptus

Xoridiformes

Xoridinae

Xorides

(d) Finally, all of the shortest topologies recovered up to this stage were used as starting points for a final series of TBR rearrangements. In order to assess levels of support of the clades recovered, bootstrapping was undertaken using 10 random addition sequences and 100 bootstrap replicates.

Results and Discussion Figures 1–3 show the trees resulting from analyses of molecular, morphological and simultaneous analysis data sets respectively. Although there was significant conflict between the morphological and molecular data sets (partition homogeneity test, p < 0.01) the signal of neither data set was swamped by the other and the simultaneous analysis tree (Fig. 3) was better resolved than either tree produced by a single data set (Figs 1 and 2) [see Nixon & Carpenter (1996) for discussion]. Two of the groupings of subfamilies are supported by our analyses, namely the Ophioniformes (sensu Wahl 1991) and the Pimpliformes (sensu Wahl 1990). Our own overall interpretations of the major subfamilial groupings are indicated in Figure 3 and Table 1. Two of Gauld’s (1997) groupings, the Tryphoniformes and Labeniformes, both appear as polyphyletic assemblages with convergent or plesiomorphic life histories respectively. The Tryphoninae, with Stilbops and Phrudus, consistently appeared as a basal member of the Ophioniformes indicating a plesiomorphic biological strategy of ectoparasitism within this group. Placements of the Eucerotinae (obligate hyperparasitoids with planidial larvae) and of the Adelognathinae (primitively koinobiont ectoparasitoids) within the Ichneumoniformes (sensu Wahl 1993b) suggest previously unrecognised evolutionary pathways within this group that would certainly be worthy of further study. The position of Microleptes, an ‘unplaced subfamily’ in Gauld (1997), within the Diptera-parasitising clade is concordant with its biology as a parasitoid of stratiomyiid flies although this does not agree with Wahl’s (1986) findings as regards larval morphology. Besides the relocation of the Tryphoninae, changes to the large scale classificatory system are few. Orthopelma was placed by Gauld (1997) in the Labeniformes group but its appearance in our trees varies in the analyses, being placed (with weak support) as the sister group to the Ophioniformes in the simultaneous analysis. It is not surprising that the abovenamed genera (Phrudus, Stilbops, Euceros, Adelognathus, Microleptes and Orthopelma) should have affinities not in agreement with current classificatory systems, considering the vagabond nature of these taxa in previous classificatory schemes. Four of the currently recognised subfamilies are not demonstrably monophyletic on the basis of our analyses. These are the Pimplinae, Tryphoninae, Ctenopelmatinae and the Campopleginae. Aberrant elements may have been pigeon-holed in the latter three subfamilies (Netelia, Pion and



81

97 100

92

86

60

68

56 100

98

75 53

92

66 55

Figure 1

Venturia Lathrostizus Dusona Exochus Hypsicera Ophion ventricosus Ophion obscuratus Eremotylus Perilissus Absyrtus Alexeter Xenoschesis Colpotrochia Mesochorus Pion tersilochine indet. Phrudus Labena Poecilocryptus Hybrizon Pristomerus cremastine indet. Nonnus Enicospilus Agrypon Neorhacodes Cosmoconus Grypocentrus Monoblastus Polyblastus Oedemopsis Netelia Stilbops Lissonota Exetastes Ephialtes Tromatobia Schizopyga Dolichomitus Orthocentrus Proclitus Diacritus Apechthis Itoplectis Phaenolobus Collyria Neoxorides Pseudorhyssa Poemenia Megarhyssa Diplazon Euceros Brachycyrtus Nematopodius Adelognathus Crypteffigies Alomya Dichrogaster Microleptes Orthopelma Xorides

Strict consensus of the 72 most parsimonious cladograms resulting from analysis of the sequence data. Bootstrap values above 50% are indicated (Length=1228; CI=0.398; RI=0.549).


Oedemopsini Brachycyrtinae Diacritinae Adelognathinae Cryptinae

53

Campoplegini Cremastinae

61

52

Diplazontinae Orthocentrus group Microleptinae Helictes group Orthopelmatinae

Alomya Ichneumoninae Metopiinae Eucerotinae Tryphonini Ephialtini Tersilochinae Phrudinae Perilissini Ophioninae Poemeniinae Rhyssinae Pseudorhyssa Pimplini Nonnus Gravenhorstiini Mesochorinae Mesoleiini Ctenopelmatini Pionini Atrophini Exetastes -group Stilbopinae Neorhacodinae Phytodietini Collyriinae Acaenitini Polysphincta group Labenini Poecilocryptini Xoridinae Paxylommatinae

Figure 2

Strict consensus of the 170 cladograms resulting from analysis of the morphological and life-history data. Bootstrap values above 50% are indicated (Length=628; CI=0.275; RI=0.647).



78

1 00

Gauld 1997 System: ● Ophioniformes ❍ Tryphoniformes ■ Pimpliformes ■ Labeniformes ? Unplaced

10 0

99

76

84

68

89 70

97

55 59

1 00

60

86

87

55

51

100

90 75

Figure 3

Ichneumoniformes

71

Pimpliformes

84

Ophioniformes

99

Venturia ● Lathrostizus ● Dusona ● Pristomerus ● cremastine indet. ● Ophion ventricosus ● Ophion obscuratus ● Eremotylus ● Enicospilus ● Agrypon ● tersilochine indet. ● Hybrizon ? Nonnus ● XXXXXXX ● Exetastes ● Mesochorus ● XXXXXXXX ● Absyrtus ● Alexeter ● Xenoschesis ● Exochus ? Hypsicera ? Colpotrochia ? Pion ● Neorhacodes ? Cosmoconus ❍ Monoblastus ❍ Polyblastus ❍ Grypocentrus ❍ Oedemopsis ❍ Phrudus ? Netelia ❍ Stilbops ? Orthopelma ■ Neoxorides ■ Poemenia ■ Pseudorhyssa ■ Megarhyssa ■ Ephialtes ■ Tromatobia ■ Dolichomitus ■ Schizopyga ■ Diacritus ■ Microleptes ? Diplazon ■ Orthocentrus ■ Proclitus ■ Apechthis ■ Itoplectis ■ Phaenolobus ■ Collyria ? Euceros ❍ Brachycyrtus ■ Alomya ■ Crypteffigies ■ Dichrogaster ■ Nematopodius ■ Adelognathus ❍ Labena ■ Poecilocryptus ■ Xorides ■

Strict consensus of the two cladograms resulting from simultaneous analysis of all data. Bootstrap values above 50% are indicated (Length=1962; CI=0.337; RI=0.556).

Nonnus, respectively, representing the tribes Phytodietini, Pionini and Nesomesochorini). The two major tribes of the Pimplinae, the Pimplini and Ephialtini, were found not to be closely related, despite the subfamily being regarded as monophyletic by Wahl and Gauld (1998); the Perithoini and Delomeristini sensu Wahl and Gauld (1998) were not included. Our result is, however, in agreement with Finlayson’s (1967) findings based on larval morphology. Studies


utilising more taxa from these groups will be necessary to delimit more accurately the limits of the subfamilies involved. An interesting finding is the placement of Paxylommatinae (Hybrizon), a troublesome entity that has been placed variously in the Braconidae, Ichneumonidae and in its own family, the Paxylommatidae (Sharkey & Wahl 1992). It falls within the Ophioniformes lineage in our analyses, its systematic position previously having been clouded by its suite of autapomorphies. In light of this, it would be interesting to know whether it is a koinobiont endoparasitoid, as are the members of its putative sister-group, the Tersilochinae. Suggestions that it is a very basal ichneumonid on molecular considerations (Belshaw et al. 1998; Quicke et al. 1999) result from the lack of phylogenetic signal in the Hybrizon 28S gene sequence, long branch attraction, and the use in the latter paper of a reduced subset of taxa. Because of a lack of braconid morphological data for the characters used in this study, and the difficulty in rooting the cladograms with data from this gene fragment (Belshaw et al. 1998), the trees have been left unrooted. We present the trees with the Xoridinae as basal, following Quicke et al. (1999). If this is the case then our cladograms also support suggestions that the Labeninae (excluding Brachycyrtinae) are a basal subfamily (Gauld 1983). Members of both of these subfamilies possess plesiomorphic life histories. The placement of the Xoridinae and Labeninae as the sister groups to the rest of the Ichneumonidae lends support to previous a priori reconstructions of groundplan morphological and biological states within the family, namely that the ancestral ichneumonid was an idiobiont ectoparasitoid of xylophagous coleopterous or siricid larvae (Gauld 1988). We currently recognise three major groupings of subfamilies, the Pimpliformes, Ichneumoniformes and Ophioniformes, with the Orthopelmatinae, Labeninae and Xoridinae now each regarded as comprising distinct groups. Our inclusion of the Tryphoninae, Mesochorinae and Metopiinae within the Ophioniformes extends this group considerably but is supported, for example, by their putatively apomorphic, long lateral oviducts (Wahl 1993a). Maintenance of the Tryphoniformes in which Gauld (1991) also placed Eucerotinae and Adelognathinae (largely on the basis of egg form and biology) is unwarranted given that the last two subfamilies appear to be associated with the Ichneumoniformes. Further gene sequencing (both missing taxa and additional gene fragments) is required to test the above hypotheses.

Acknowledgements We are grateful to Ian Gauld and Mark Shaw for supplying specimens of several taxa for gene sequencing and to David Swofford for providing a pre-release version of PAUP*. This work was supported by a Natural Environment Research Council (NERC) grant to DLJQ and MGF and by the NERC Initiative in Taxonomy.

References Belshaw, R., Fitton, M. G., Herniou, E., Gimeno, C. & Quicke, D. L. J. (1998) A phylogenetic reconstruction of the Ichneumonoidea (Hymenoptera) based on the D2 variable region of 28S ribosomal RNA. Systematic Entomology 23: 109-123. Dowton, M. (1999) Relationships among the cyclostome braconid (Hymenoptera: Braconidae) subfamilies inferred from a mitochondrial tRNA gene rearrangement. Molecular Phylogenetics & Evolution 11: 283-287.



Dowton, M., Austin, A. D. & Antolin, M. F. (1998) Evolutionary relationships among the Braconidae (Hymenoptera: Ichneumonoidea) inferred from partial 16S rDNA gene sequences. Insect Molecular Biology 7: 129-150. Dowton, M. & Austin, A. D. (1998) Phylogenetic relationships among the microgastroid wasps (Hymenoptera: Braconidae): combined analysis of 16S and 28S rDNA genes and morphological data. Molecular Phylogenetics & Evolution 10: 354-366. Eggleton, P. (1989) The Phylogeny and Evolutionary Biology of the Pimplinae (Hymenoptera: Ichneumonidae). 295 pp. Unpublished PhD thesis, University of London. Farris, J. S., Källersjö, M., Kluge, A. G. & Bult, C. (1994) Testing significance of incongruence. Cladistics 10: 315-319. Finlayson, T. (1967) A classification of the subfamily Pimplinae (Hymenoptera: Ichneumonidae) based on final-instar larval characteristics. The Canadian Entomologist 99: 1-8. Gauld, I. D. (1983) The classification, evolution and distribution of the Labeninae, an ancient southern group of Ichneumonidae (Hymenoptera). Systematic Entomology 8: 167-178. Gauld, I. D. (1985) The phylogeny, classification and evolution of parasitic wasps of the subfamily Ophioninae (Ichneumonidae). Bulletin of the British Museum (Natural History), Entomology 51: 61-185. Gauld, I. D. (1988) Evolutionary patterns of host utilization by ichneumonoid parasitoids (Hymenoptera: Ichneumonidae and Braconidae). Biological Journal of the Linnean Society 35: 351-377. Gauld, I. D. (1991) Ichneumonidae of Costa Rica, 1. Memoirs of the American Entomological Institute 47: 1-589. Gauld, I. D. (1997) Ichneumonidae of Costa Rica, 2. Memoirs of the American Entomological Institute 57: 1-485. Gauld, I. D. & Mound, L. A. (1982) Homoplasy and the delineation of holophyletic genera in some insect groups. Systematic Entomology 7: 73-86. Nixon, K. C. & Carpenter, J. M. (1996) On simultaneous analysis. Cladistics 12: 221-241. Porter, C. C. (1998) Guía de los géneros de Ichneumonidae en ela región Neantárctica del sur de Sudamérica. Opera Lilloana 42: 1-234. Quicke, D. L. J., Lopez-Vaamonde, C. & Belshaw, R. (1999) The basal Ichneumonidae (Insecta: Hymenoptera): 28S D2 rDNA considerations of the Brachycyrtinae, Labeninae, Paxylommatinae and Xoridinae. Zoologica Scripta 28: 203-210. Quicke, D. L. J., Taylor, J. & Purvis, A. (in press) Changing the landscape: a new tree searching strategy. Systematic Biology. Sharkey, M. J. & Wahl, D. B. (1992) Cladistics of the Ichneumonoidea (Hymenoptera). Journal of Hymenoptera Research 1: 15-24. Townes, H. K. (1969) Genera of Ichneumonidae, Part 1. Memoirs of the American Entomological Institute 11: 1-300. Wahl, D. B. (1986) Larval structures of oxytorines and their significance for the higher classification of some Ichneumonidae (Hymenoptera). Systematic Entomology 11: 117-127. Wahl, D. B. (1990) A review of the mature larvae of Diplazontinae, with notes on larvae of Acaenitinae and Orthocentrinae and proposal of two new subfamilies (Insecta: Hymenoptera, Ichneumonidae). Journal of Natural History 24: 27-52. Wahl, D. B. (1991) The status of Rhimphoctona, with special reference to the higher categories within Campopleginae and the relationships of the subfamily (Hymenoptera: Ichneumonidae). Transactions of the American Entomological Society 117: 193-213.


Wahl, D. B. (1993a) Cladistics of the genera of Mesochorinae (Hymenoptera: Ichneumonidae). Systematic Entomology 18: 371-387. Wahl, D. B. (1993b) Cladistics of the ichneumonid subfamily Labeninae (Hymenoptera: Ichneumonidae). Entomologia Generalis 18: 91-105. Wahl, D. B. (1997) The cladistics of the genera and subgenera of Xoridinae. pp. 454-460. In I. D. Gauld (Ed.), Ichneumonidae of Costa Rica, 2. Memoirs of the American Entomological Institute 57: 485 pp. Wahl, D. B. & Gauld, I. D. (1998) The cladistics and higher classification of the Pimpliformes (Hymenoptera: Ichneumonidae). Systematic Entomology 23: 299-303.

Molecular Evolution in Social Wasps J. Schmitz1 and R. F. A. Moritz2 1

German Primate Centre, Primate Genetics, Kellnerweg 4, 37077 Göttingen, Germany (email: [email protected]) 2

Institute for Zoologie-Molecular Ecology, Martin-Luther-Universität Halle/Wittenberg, Kröllwitzer Str. 44, 06099 Halle/Saale, Germany

Introduction The Vespidae (Hymenoptera) include the subfamilies Masarinae, Eumeninae, Stenogastrinae, Polistinae and Vespinae. Eusociality is found in Stenogastrinae, Polistinae and Vespinae. Whereas Carpenter (1988) concluded that the eusocial subfamilies have a common ancestor not shared with the solitary vespids, we found strong evidence that the stenogastrine wasps are not closest to the Vespinae + Polistinae cluster (Schmitz & Moritz 1998). Instead, the Eumeninae are closest to Vespinae + Polistinae, supported by 34 informative nucleotide positions in a molecular data set of 28S rDNA and 16S rDNA sequences (583 nucleotide positions in total). This monophyly was confirmed by 100% bootstrap replicates. Using morphological data, Richards (1971), Spradbery (1975), and van der Vecht (1977) also suggest that the Stenogastrinae are not closest to the remaining social vespids. In the present study we further contribute to this topic with a more extensive data set (29 vespid species) including two Masarinae for the mitochondrial 16S rDNA gene.

Materials and Methods Samples For subfamily relationships we analysed rDNA sequences of eleven Vespinae [Vespa crabro (L.), V. orientalis (L.), Provespa anomala (Saussure), P. nocturna (Vecht), Dolichovespula media (Retzius), D. maculata (L.), D. sylvestris (Scopoli), D. saxonica (F.), Vespula vulgaris (L.), V. germanica (F.), V. rufa (L.)], six Polistinae (Polistes dominulus (Christ), P. saggittarius (F.), P. flavus (Cresson), Belonogaster petiolata (Degeer), B. sp. nov., B. juncea colonialis (Kohl)), six Stenogastrinae (Parischnogaster jacobsoni (Du Buysson), P. mellyi (Saussure), P. alternata (Sakagami), Liostenogaster flavolineata (Cameron), L. sp. nov., Eustenogaster calyptodoma (Sakagami & Yoshikawa)), three Eumeninae (Eumenes sp., Ancistrocerus oviventris (Wesmael), A. nigricornis (Curtis)), and two Masarinae species (Metaparagia maculata (Meade-Waldo), Pseudomasaris maculifrons (Fox)). Furthermore, we analysed two Apis species (Apis mellifera L., A. dorsata F.). Sequences can be retrieved from GeneBank under accession numbers AF066893-AF066939 and AF067145. Corresponding DNA sequences from Cotesia glomerata (L.) (Braconidae), Xylocopa virginica (L.) (Xylocopinae), and Lissonata sp. (Ichneumonidae), were retrieved from GeneBank under accession numbers U06958, L22905, and Z97906 respectively, and used as outgroups. The DNA processing has been performed as described in Schmitz and Moritz (1998). We sequenced at least two representatives of each species and could not detect any intraspecific sequence variability.

84


Molecular Evolution in Social Wasps 85

Data Analyses Sequence data were aligned by using the CLUSTAL X program (Higgins & Sharp 1989) and improved by comparison of the secondary structure of the rRNA’s (Schmitz & Moritz 1994). One disadvantage of most methods for phylogenetic reconstructions is the slowness of the algorithms, in particular with high numbers of species. Therefore, we reduced the numbers of sequences by building the 60% consensus sequences representative for each subfamily (Consensus: http://coot.embl.heidelberg.de/Alignment/consensus.html). Characters with ambiguities in the consensus sequences and also gap positions were removed from the data set. Maximum Parsimony (MP) analyses were conducted with the computer program PAUP* 4.0b2 (Swofford 1998) including all characters. Branch-and-Bound searches with collapsing zero-length branches and MULPARS option were used to find the most parsimonious trees. Bootstrap values were determined from 1000 replications. Distances (D) were measured in PAUP* 4.0b2 (Swofford 1998) by using the Kimura 3-parameter model of nucleotide substitutions. Tree reconstruction was performed by the Branch-and-Bound searches. 1000 bootstrap replications were undertaken to find the relative support for nodes. Maximum-likelihood (ML) trees were constructed with PHYLIP 3.572 DNAMLK and DNAML programs (Felsenstein 1993). Alternatively, we used the ML option in PAUP* 4.0b2 and PUZZLE 4.02 (Strimmer & von Haeseler 1996). In general, we used the estimation of transitions/transversions and frequencies from the data set with eight rate categories. Furthermore, the gamma rate heterogeneity parameters were estimated from the data set (PUZZLE 4.02). Values lower than 1 indicate a strong rate heterogeneity across sites (Strimmer & von Haeseler 1996). The molecular clock likelihood ratio tests have been done in PUZZLE 4.02. For tree-length calculation we used MacClade 3.05 (Maddison & Maddison 1992).

Results 28S rDNA The AT content of the 28S rDNAs ranges between 35% and 40%. In relative rate tests we could not detect any association between the nucleotide content and the sequence divergence. In total, 246 characters (51 informative) were used for further analyses after omitting the characters with ambiguous states in the 60% consensus sequences and gap positions of the 28S rDNA. In this data set we could detect a significant phylogenetic signal (g1 = –0.60, p < 0.05) by performing a tree-length skewness test (Hillis & Huelsenbeck 1992). The g1 value increased after removing the outgroup sequence (g1= –1.20, p < 0.01). The mean base compositions for the analysed subfamily consensus sequences were 14% A, 33% C, 33% G, and 20% T. We found no base composition heterogeneity between the various consensus sequences (p = 0.99). For the consensus sequences, the mean transition/transversion ratio was 1.74 ± 0.34, and the rate heterogeneity across sites, calculated in PUZZLE 4.02 was a = 0.86 ± 0.31 (without outgroup: a = 0.51 ± 0.26). 16S rDNA The high AT content of the investigated 16S rDNA sequences (84–87%) is characteristic for Hymenoptera. Corresponding to Schmitz and Moritz (1998) three highly variable regions were excluded (64 nt in total). For 16S rDNA 163 characters (28 informatives) remained after exclusion of characters which failed to fulfil the 60% consensus constraints and removal of gap positions. As in the nuclear data set, we detected a significant phylogenetic signal (g1 = –1.26, p < 0.01; without outgroup: g1 = –0.82, p < 0.01) in the mitochondrial data. The mean base compositions for the analysed mt DNA was 44% A, 7% C, 11% G, and 37% T. We found no base composition heterogeneity between the various mitochondrial consensus sequences (p = 0.99).

J. Schmitz and R. F. A. Moritz 86


a)

6 7

Vespinae 13

18

3

Eumeninae

26

27

Stenogastrinae

Apinae

4

b) 5

4 5

Polistinae

100

Vespinae Polistinae

71 4

Eumeninae

2 11

16

16 Figure 1

Masarinae Stenogastrinae

Xylocopa

Phylogenetic reconstruction (MP) of the relationships among subfamilies of Vespidae for a) 28S rDNA and b) 16S rDNA. Numbers above the branches indicate the inferred branchlength. Percentage bootstrap values are shown at the internodes.

The mean transition/transversion ratio was 0.42 ± 0.14 and indicates a high frequency of AT transversions. This is reported also for other wasp taxa (Dowton & Austin 1997). The rate heterogeneity across sites is α = 1.12 ± 0.80.

Phylogenetic reconstructions of 28S rDNA The genetic distances between the subfamily 60% consensus sequences were calculated in PAUP* 4.0b2 and are shown in Table 1. The phylogenetic reconstruction of the 28S rDNA consensus sequences is shown in Figure 1a. In this reconstruction, the consensus sequence of A. mellifera and A. dorsata was used as the outgroup. All three reconstruction methods (MP, ML and D) coincide in the tree topology. The monophyly of Eumeninae + (Polistinae + Vespinae) is well supported by 100% bootstrap proportions independent of the method of reconstruction. The tree-length of the most parsimonious tree shown in Figure 1 was 100 (RC = 0.68). Rearrangements of branches to


Table 1 Mean pairwise distances (PAUP* 4.0) for 28S rDNA consensus sequences (above diagonal) and 16S rDNA consensus sequences (below diagonal). Apinae/ Xylocopinae Stenogastrinae Apinae

0.191

Masarinae

Eumeninae

Polistinae

Vespinae

–

0.195

0.224

0.199

–

0.191

0.232

0.191

Stenogastrinae

0.196

Masarinae

0.184

0.184

Eumeninae

0.141

0.160

0.092

Polistinae

0.160

0.172

0.123

0.092

Vespinae

0.160

0.184

0.123

0.080

–

–

0.093

0.065 0.077

0.049

maintain the monophyly of the social wasps required 12 additional steps. However, choosing a taxon outside of the Aculeata results in a trifurcation of Apinae, Stenogastrinae and Eumeninae + Polistinae + Vespinae. In a previous study (Schmitz & Moritz 1998) we analysed a slightly supported (60% bootstrap replications) monophyly of Apinae + (Eumeninae + (Polistinae + Vespinae)) with the stenogastrine wasps as the sister group. Possible reasons for the unusual position of the bees may be homoplastic characters shared with the outgroup species Nasonia vitripennis (Walker) and the Stenogastrinae. A rate heterogeneity in the data set can cause the misinterpretation of sequence data, well known as long branch attraction. The relative rate test rejected a clock like tree at a significance level of 5%.

Phylogenetic reconstructions of 16S rDNA The phylogenetic tree of the 16S rDNA consensus sequences shown in Figure 1b, was reconstructed using the xylocopine bee X. virginica as outgroup. In this phylogenetic tree Masarinae, Eumeninae, and Polistinae + Vespinae build a monophyletic group, with a somewhat smaller bootstrap probability of about 60–70% compared to the nuclear data set. The tree-length was 67 (RC = 0.44). Four additional steps are necessary to support the monophyly of social wasps. Using solitary wasps as the outgroup will result in very strong support for the Masarinae, Eumeninae, (Polistinae + Vespinae) cluster as shown also in Schmitz and Moritz (1998). This entails, possibly due to homoplasies, that the bees are closer to Eumeninae + (Polistinae + Vespinae) than the Stenogastrinae.

Discussion The pairwise genetic distances for 28S rDNA and 16S rDNA consensus sequences are presented in Table 1. The pairwise distances of Stenogastrinae to any other Vespidae sequences turned out to be the highest. The high sequence divergence is also reflected in the phylogenetic reconstructions (Fig. 1). What are possible reasons for this finding? One could argue that the molecular data sets are randomised and therefore not representative for phylogenetic evaluations. We yielded significantly skewed MP-tree distributions (p < 0.01) indicating strong phylogenetic signals in both the 28S and 16S rDNA data. The test of rate heterogeneity in the 28S rDNA (α = 0.86 ± 0.31) and the 16S rDNA (α = 1.22±0.80) indicated some degree of substitution rate differences across sites in the nuclear data. This is not an unusual finding when rDNAs of distantly related taxa are compared (Friedrich & Tautz 1997). More critical is rate heterogeneity among lineages as shown by Carmean and Crespi (1995) and Hwang et al. (1998). Rate heterogeneity among lineages can cause the socalled long branch attraction. By including the Masarinae in the mitochondrial data we could

J. Schmitz and R. F. A. Moritz 88


show, that the phylogenetic reconstructions are not effected by attraction of Eumeninae and Polistinae + Vespinae DNA sequences. Compared to Stenogastrinae, the Masarinae also show a closer relationship to Polistinae + Vespinae. The relative rate test indicated a significant departure of the clock-like distribution of branch length for the nuclear data. However, ML reconstructions are most robust when rate heterogeneity among lineages increases (Hwang et al. 1998). In all ML trees, the Stenogastrinae remain outside of Eumeninae + (Polistinae + Vespinae). This holds also when the data are split into the two functional different rRNA structural elements, loops and double stranded regions, and reanalysed (Schmitz & Moritz 1998). Further investigations with additional sequences of conservative genes are called for to verify the position of Stenogastrinae outside of the remaining social Vespidae.

Acknowledgements We thank James M. Carpenter for providing samples of Metaparagia maculata and Pseudomasaris maculifrons. This study was supported by the Deutsche Forschung-gemeinschaft (Mo 373/41 and Mo 373/4-2).

References Carmean, C. & Crespi, J. (1995) Do long branches attract flies? Nature 373: 666. Carpenter, J. M. (1988) The phylogenetic system of the Stenogastrinae (Hymenoptera: Vespidae). Journal of the New York Entomological Society 96: 140-175. Dowton, M. & Austin, A. D. (1997) Evidence for AT-transversion bias in wasp (Hymenoptera: Symphyta) mitochondrial genes and its implications for the origin of parasitism. Journal of Molecular Evolution 44: 398-405. Felsenstein, J. (1993) PHYLIP Manual Version 3.5c. University of Washington, Seattle. Friedrich, M. & Tautz, D. (1997) An episodic change of rDNA nucleotide substitution rate has occurred at the time of the emergence of the insect order Diptera. Molecular Biology & Evolution 14: 644-653. Higgins, D. G. & Sharp, P. M. (1989) Fast and sensitive multiple sequence alignments on a microcomputer. CABIOS 5: 151-153. Hillis, D. M. & Huelsenbeck, J. P. (1992) Signal, noise, and reliability in molecular phylogenetic analyses. Journal of Heredity 83: 189-195. Hwang, U. W., Kim, W., Tautz, D. & Friedrich, M. (1998) Molecular phylogenetics at the Felsenstein Zone: Approaching the Strepsiptera problem using 5.8S and 28S rDNA sequences. Molecular Phylogenetics & Evolution 9: 470-480. Maddison, W. P. & Maddison, D. R. (1992) MacClade (v. 3.06): Analysis of Phylogeny and Character Evolution. Sinauer, Sunderland. Richards, O. W. (1971) The biology of the social wasps (Hymenoptera, Vespidae). Biological Reviews 46: 483-528. Schmitz, J. & Moritz, R. F. A. (1994) Sequence analysis of the D1 and D2 regions of 28S rDNA in the hornet (Vespa crabro) (Hymenoptera, Vespinae). Insect Molecular Biology 3: 273-277. Schmitz, J. & Moritz, R. F. A. (1998) Molecular phylogeny of Vespidae (Hymenoptera) and the evolution of sociality in wasps. Molecular Phylogenetics & Evolution 9: 183-191 Spradbery, J. P. (1975) The biology of Stenogaster concina van der Vecht, with comments on the phylogeny of the Stenogastrinae (Hymenoptera: Vespidae). Journal of the Australian Entomological Society 14: 309-318.


Strimmer, K. & von Haeseler, A. (1996) Quartet puzzling: a quartet maximum likelihood method for reconstructing tree topologies. Molecular Biology & Evolution 13: 964-969. Swofford, D. L. (1998) PAUP 4*. Phylogenetic Analysis Using Parsimony *and Other Methods. Version 4. Sinauer Associates, Sunderland, Massachusetts. Tajima, F. & Nei, M. (1984) Estimation of evolutionary distance between nucleotide sequences. Molecular Biology & Evolution 1: 269-285. van der Vecht, J. (1977) Studies of oriental Stenogastrinae (Hymenoptera Vespoidea). Tijdschrift voor Entomologie 120: 55-75.

Rearrangement of the Hymenopteran Mitochondrial Genome is Accelerated Relative to Orthopteroid Insects Mark Dowton1,2, Andrew D. Austin2 and Paul K. Flook3 1

Australian Flora and Fauna Research Centre, Department of Biology, Wollongong University, Wollongong, N.S.W. 2522 Australia (email: [email protected]) 2

Department of Applied & Molecular Ecology, Waite Campus, The University of Adelaide, P.M.B. 1 Glen Osmond, S. A. 5064 Australia 3

Zoologisches Institut, Rheinsprung 9, Basel 4051 Switzerland

Introduction Examination of a taxonomically diverse sample of mitochondrial genomes within the Metazoa suggests that genes change position rarely (e.g. Jakobs et al. 1989; Boore et al. 1995; Macey et al. 1997). This observation has led to claims that variation in mitochondrial gene organisation represent highly reliable indicators of common ancestry (e.g. Boore et al. 1995, 1998). As such, these characters could be valuable synapomorphies for a few natural groups, just as holometabolism is a useful character for defining a single node in the insect phylogeny. Such characters clearly warrant further investigation. Although sampling of mitochondrial gene orders has covered a taxonomically diverse range of metazoans, the number of taxa sampled has been restricted by the high cost of generating complete mitochondrial sequences. To circumvent this, we recently sampled one mitochondrial region spanning just four genes to assess how frequently rearrangements occur in a broad range of Hymenoptera (Dowton & Austin 1999). This region was particularly prone to rearrangement, having experienced at least five evolutionarily independent rearrangements during the last 180 Myr. Nevertheless, closely related taxa shared novel genome organisations, implying that these arrangements may be useful phylogenetic characters within the Hymenoptera (e.g. Dowton 1999). These data suggest that either gene rearrangements occur much more frequently than previously considered, or that the rate of gene rearrangement is accelerated in the Hymenoptera relative to other insect groups. To distinguish between these two possibilities, we are examining gene organisation in this region in a range of non-hymenopteran insects. In the present study, we focus on gene organisation in the orthopteroid insect orders, as previous evidence indicated that at least one rearrangement has occurred in this gene region during the evolution of these orders (Flook et al. 1995a, 1995b).

Materials and Methods Sequences spanning the junction between the 3’-end of the cytochrome oxidase II (COII) gene and the start codon of the ATPase 8 (A8) gene were generated as described (Dowton & Austin 1999). No additional hymenopteran taxa were sequenced for the present study, but a range of non-hymenopteran taxa were. These were from the insect orders Mantodea, Grylloblattodea,

90


Rearrangement of the Hymenopteran Mitochondrial Genome 91

Phasmotodea, Blattodea, Orthoptera, and Plecoptera; specific taxa are listed in Table 1. tRNA genes were identified using tRNAscan-SE (version 1.1, http://genome.wustl.edu/eddy/tRN Ascan-SE: Lowe & Eddy 1997), as described in Dowton and Austin (1999). Abbreviations used in the text and figures are: A8, ATPase 8; COII, cytochrome oxidase II; tRNAD, tRNA-aspartate; tRNAH, tRNA-histidine; tRNAK, tRNA-lysine.

Results We sequenced the junction spanning the COII and A8 genes in 13 non-hymenopteran taxa, representing most of the orthopteroid insect orders. No gene rearrangements were evident in any of the orthopteroids examined (Table 1); i.e. in all cases, the gene order is COII-tRNAK-tRNAD-A8 (Fig. 1). The only orthopteran that does not have this arrangement is the previously sequenced Locusta migratoria (L.) (Flook et al. 1995a), in which the order of the tRNA genes is reversed. Further, the general structure of this region is highly conserved in the orthopteroids, and contrasts sharply with the plasticity seen in the Hymenoptera (Fig. 1). Generally, the two taxonomic groups (Hymenoptera and orthopteroids) have similarly sized COII carboxy termini – between 17 and 24 amino acids from the primer-binding site to the stop codon. All orthopteroids examined have an incomplete stop codon for the cytochrome oxidase II gene (‘T’ in all cases) which is presumably completed (to TAA) after polyadenylation (Ojala et al. 1981). The Hymenoptera exhibit more variation, with some having complete stop codons (TAA, or rarely TAG), others incomplete. The first tRNA gene lies directly next to the stop codon in all orthopteroids sequenced, whereas this intergenic region can have as many as 138 non-coding nucleotides in hymenopteran taxa. The identity of the tRNA gene immediately downstream of the COII gene was invariably tRNAK in the orthopteroids (but not in Locusta, where it is tRNAD; Flook et al. 1995a), but can be tRNAK or tRNAD in the Hymenoptera. Further, this tRNA gene was always encoded on the mitochondrial J-strand in the orthopteroids (including Locusta), whereas this first tRNA gene is sometimes encoded on the mitochondrial N-strand in the Hymenoptera (strand nomenclature after Simon et al. 1994). The anticodon for the tRNAK gene was ‘CTT’ in all orthopteroids examined (Table 1), whereas the Hymenoptera have either ‘CTT’ or ‘TTT’, with the derived ‘TTT’ condition having multiple origins (Dowton & Austin 1999). The intergenic region between the two tRNA genes was less variable when these two groups were considered. Orthopteroids have at most three non-coding nucleotides in this region, whilst the Hymenoptera have at most eight. However, overlaps are more severe in the Hymenoptera. In the orthopteroids, overlaps are limited to at most a single nucleotide (see Table 1), whereas some Hymenoptera have as many as three nucleotide overlaps. In the latter case, production of both tRNA molecules from a single mitochondrial polycistronic transcript can only occur after polyadenylation (for a discussion see Dowton & Austin 1999). The second tRNA gene in this region is always tRNAD in the orthopteroids examined (but not in Locusta, where it is tRNAK; Flook et al. 1995a), whereas it could by tRNAD, tRNAK or tRNAH in the Hymenoptera. Further, in some Hymenoptera there is no second tRNA gene here, while in others there is a third (Dowton & Austin 1999). Interestingly, in both insect groups the second tRNA gene (and third, where it occurs) is always encoded on the mitochondrial J-strand, regardless of whether a rearrangement has occurred. Finally, the intergenic region between the A8 and neighbouring upstream tRNA gene contains no non-coding nucleotides in the orthopteroids examined, although Locusta is a notable exception (see Table 1). Locusta is the only taxon in this sample of orthopteroids that has rearranged. By comparison, Hymenoptera can have as many as

Mark Dowton, Andrew D. Austin and Paul K. Flook 92


Table 1 Genetic characteristics of the junction between the cytochrome oxidase II and ATPase 8 genes for various orthopteroid taxa. Taxa with rearranged genes are boxed; ‘aas; stop codon’ indicates the number of amino acids in the cytochrome oxidase II gene between the primer binding site and the carboxy terminus; (T) indicates that a complete stop codon can only be produced after polyadenylation of the transcription product. ‘A nts’ is the number of nucleotides between the cytochrome oxidase II gene and the first tRNA gene, ‘B nts’ is the number of nucleotides between the first and second tRNA genes, and ‘C nts’ is the number of nucleotides between the second tRNA gene and the ATPase 8 gene, as indicated in the scheme above the column titles. Negative numbers indicate overlaps, with the overlap shown in brackets; ‘ND’ indicates not determined, due to incomplete sequence data.

COI I

A

t RNA1

B

t RNA2

C

ATP ase 8

COII (aas; stop codon)

A nts

B nts

C nts

Taxon

Choeradodis rhombicollis Wood-Mason

20 (T)

0

–1 (A)

0

KD (CTT)

Grylloblatta rothi Gurney

21 (t)

0

+2

0

KD (CTT)

Pseudophasmatidae

Agatheromera crassa (Blanchard)

17 (T)

0

–1 (A)

0

KD (CTT)

Phasmatidae

Megacrania apheus (Westwood)

ND

0

–1 (A)

0

KD (CTT)

Gromphadorhina portentosa (Schaum)

20 (T)

0

0

0

KD (CTT)

Gryllotalpa gryllotalpa (L.)

18 (T)

0

–1 (A)

0

KD (CTT)

Gryllus campestris (L.)

18 (T)

0

0

0

KD (CTT)

Acheta domesticus (L.)

19 (T)

0

0

0

KD (CTT)

Eneopterus sp.

19 (T)

0

+3

0

KD (CTT)

Taxonomic affiliation

Arrangement (tRNAK anticodon)

Mantodea

Grylloblattodea Grylloblattidae Phasmotodea

Blattodea Panchloridae Orthoptera Ensifera Gryllidae


Stenopelmatidae

Penalva sp.

21 (T)

0

–1 (A)

0

KD (CTT)

Anastostamatidae

Hemideina crassidens (Blanchard)

22 (T)

0

–1 (A)

0

KD (CTT)

Cylindraustralia kochii (Saussure)

18 (T)

0

–1 (A)

0

KD (CTT)

Locusta migratoria (L.)

19 (T)

0

+3

+17

DK (CTT)

Protonemura meyeri (Pictet)

21 (T)

0

–1 (A)

0

KD (CTT)

Caelifera Cylindrachetidae Acrididae Plecoptera Nemouridae



A. Orthopteroids

COII

T

17-22 aas

stop codon

intergenic region

COII

T,TA TAA

-4, tRNA-K or D +138

17-24 aas

0

tRNA- K or D

stop intergenic region codon

-1, +3

tRNA-D or K

intergenic region

-3, +8

tRNA-D, K or H

intergenic region

0, +17

A8

intergenic region

-9, +99

A8

intergenic region

B. Hymenoptera Structural organisation of the COII-A8 mitochondrial junction in A) orthopteroids, and B) Hymenoptera. Arrows indicate direction of translation; thus rightward arrows indicate the gene is encoded on the J-strand, leftward arrows on the N-strand. Numbers in ‘intergenic regions’ refer to minimum and maximum length of non-coding nucleotides, respectively, with negative numbers indicating that the genes overlap.

Figure 1

99 non-coding nucleotides in this region, but only in taxa having a rearrangement. Taxa that retain the plesiomorphic arrangement (i.e. KD) have at most a single nucleotide here (Dowton & Austin 1999). Thus there are generally intergenic nucleotides at gene boundaries in rearranged genomes, but not in unrearranged ones. Others have suggested that the appearance of intergenic nucleotides after rearrangement is consistent with postulated mechanisms of genome reorganisation (Kumazawa & Nishida 1995; Macey et al. 1998). Following duplication of the region, one of the duplicate genes is randomly rendered non-functional by mutation. The non-functional gene then evolves without selective constraints as an intergenic region. However, it is not clear why these intergenic nucleotides should (a) be maintained over long periods of evolution, given the general drive towards minimisation of the mitochondrial genome size, and (b) accumulate at protein/tRNA boundaries, but not tRNA/tRNA boundaries. In both rearranged and non-rearranged genomes, there are at most 12, but rarely more than 10 non-coding nucleotides at the tRNA/tRNA boundary (Dowton & Austin 1999, and present study).

Discussion Previous work indicated at least one mitochondrial gene rearrangement occurred at the COII-A8 gene junction during the evolution of the Orthoptera; two representatives from the suborder Ensifera had unrearranged genomes, while three members of the suborder Caelifera had rearranged genomes (Flook et al. 1995b). The present study similarly suggested that this orthopteran rearrangement occurred some time during the evolution of the Caelifera, as we found that one basally derived caeliferan retains the plesiomorphic arrangement [Cylindraustralia kochii (Saussure)]. Present evidence suggests that this rearrangement character will be a useful synapomorphy for superfamily level relationships in the Orthoptera: Caelifera, with representatives from the Acridoidea and Pamphagoidea apparently sharing the rearrangement (Flook et al. 1995b). Consistent with this observation, recent molecular analyses of orthopteran relationships (Flook & Rowell 1998) recover the Acridoidea + Pneumoroidea + Trigonopterygoidea + Pamphagoidea as


a natural group. Future studies will focus on the arrangement of these genes in representatives from the Tetrigoidea and Eumasticoidea, which are thought to fall outside of this clade (Flook & Rowell 1998). We previously observed that the junction of the COII and A8 genes was prone to rearrangement in the Hymenoptera (Dowton & Austin 1999), contrary to expectations that mitochondrial genome organisation is highly conserved. We had some evidence that this accelerated rate of rearrangement was restricted to the hymenopteran suborder Apocrita, as three representatives from distinct symphytan lineages were not rearranged. The present study supports the contention that mitochondrial gene rearrangements are rare evolutionary events, with the Hymenoptera representing a lineage which uncharacteristically rearranges more frequently. These observations strengthen the case that the Hymenoptera represent an ideal model system for discovering the underlying mechanisms of gene rearrangement in the mitochondrial genome.

Acknowledgements This work was supported by grants from the Australian Research Council, the Linnean Society of NSW, and the Mark Mitchell Foundation.

References Boore, J. L., Collins, T. M., Stanton, D., Daehler, L. L. & Brown, W. M. (1995) Deducing the pattern of arthropod phylogeny from mitochondrial DNA rearrangements. Nature 376: 163-165. Boore, J. L., Lavrov, D. V. & Brown, W. M. (1998) Gene translocation links insects and crustaceans. Nature 392: 667-668. Dowton, M. (1999) Relationships among the cyclostome braconid (Hymenoptera: Braconidae) subfamilies inferred from a mitochondrial tRNA gene rearrangement. Molecular Phylogenetics & Evolution 11: 283-287. Dowton, M. & Austin, A. D. (1999) Evolutionary dynamics of a mitochondrial rearrangement “hotspot” in the Hymenoptera. Molecular Biology & Evolution 16: 298-309. Flook, P. K. & Rowell, C. H. F. (1998) Inferences about orthopteroid phylogeny and molecular evolution from small subunit nuclear ribosomal DNA sequences. Insect Molecular Biology 7: 163-178. Flook, P., Rowell, H. & Gellissen, G. (1995a) Homoplastic rearrangements of insect mitochondrial tRNA genes. Naturwissenschaften 83: 336-337. Flook, P. K., Rowell, C. H. F. & Gellissen, G. (1995b) The sequence, organisation, and evolution of the Locusta migratoria mitochondrial genome. Journal of Molecular Evolution 41: 928-941. Jakobs, H. T., Asakawa, S., Araki, T., Miura, K.-I., Smith, M. J. & Watanabe, K. (1989) Conserved tRNA gene cluster in starfish mitochondrial DNA. Current Genetics 15: 193-206. Kumazawa, Y. & Nishida, M. (1995) Variations in mitochondrial tRNA gene organization of reptiles as phylogenetic markers. Molecular Biology & Evolution 12: 759-772. Lowe, T. M. & Eddy, S. R. (1997) tRNAscan-SE: A program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Research 25: 955-964. Macey, J. R., Larson, A., Ananjeva, N. B., Fang, Z. & Papenfuss, T. J. (1997) Two novel gene orders and the role of light-strand replication in rearrangement of the vertebrate mitochondrial genome. Molecular Biology & Evolution 14: 91-104. Macey, J. R., Schulte, J. A., II, Larson, A. & Papenfuss, T. J. (1998) Tandem duplication via lightstrand synthesis may provide a precursor for mitochondrial genomic rearrangement. Molecular Biology & Evolution 15: 71-75.



Ojala, D., Montoya, J. & Attardi, G. (1981) tRNA punctuation model of RNA processing in human mitochondria. Nature 290: 470-474. Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H. & Flook, P. (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87: 1-51.

Phylogeny of Microgastroid Braconid Wasps, and What It Tells Us About Polydnavirus Evolution James B. Whitfield Department of Entomology, 321 Agriculture Building, University of Arkansas, Fayetteville, AR 72701 USA (email: [email protected])

Introduction One of the most remarkable interactions known within the Animal Kingdom is that between parasitoid wasps and hereditary viruses known as polydnaviruses (Whitfield 1990, 1994, 1997; Fleming 1992). It is likely to be one of the only known mutualisms between viruses and eukaryotes (Whitfield 1990; Fleming 1992). The parasitoid wasps live as larvae within the bodies of other larval insects and depend on these viruses to both suppress the immune system and alter the physiology of the host to allow their own survival (Edson et al. 1981; Beckage 1997, 1998). The polydnaviruses (PDV’s), in turn, are fully integrated into the chromosomal DNA of their wasp carriers, and are thus vertically transmitted (with 100% efficiency) in Mendelian fashion (Fleming & Summers 1986; Stoltz 1990). They are not known to exist independently of the wasps (Stoltz & Whitfield 1992), and indeed no longer possess a recognisable complete viral life cycle (Stoltz 1993). The PDV can be considered analogous to a ‘venom’ system used by the wasp against its host organisms (typically caterpillars). There is evidence, in fact, that some venom genes of wasp origin are now packaged within PDV genomes for export into host caterpillars (Webb & Summers 1990). Much of the PDV gene expression is thus targeted toward a different host (the caterpillar) than that within which the virus replicates (the wasp). Two groups of PDV’s are known and are currently treated unofficially as ‘genera’ of the Polydnaviridae (Stoltz & Whitfield 1992; Stoltz 1993). The first (the ichnovirus group) has been found only within the ichneumonid subfamily Campopleginae and a few putatively related genera. The second group comprises the bracoviruses, which have been found within only a few subfamilies of Braconidae (Stoltz & Whitfield 1992; Whitfield 1997). Both PDV groups are found only in relatively derived lineages within the two separate wasp families. While the two viral groups appear to share some characteristics of genome organisation and functional significance, they differ in gross structure and packaging, and in their sub-cellular sites of replication in the wasps (Stoltz 1993; Beckage 1998). It is therefore likely that they originated twice independently among the wasps. This paper focuses upon the evolution of the bracoviruses. Currently, this group is more promising than the ichnoviruses for evolutionary study because the phylogenetic relationships among the braconid carriers are better understood. Also, several functional PDV genes are currently under comparative study (see below). Recently, braconids carrying bracoviruses were determined to comprise a monophyletic lineage within the Braconidae (Fig. 1 in Whitfield 1997). This monophyly has subsequently been corroborated by independent analyses of 16S data (Dowton et al. 1998) and of 28S sequences (Belshaw et al. 1998; Dowton & Austin 1998). Based

97

James B. Whitfield 98


on these inferred relationships and known fossils, the common ancestor of this lineage is likely to have lived over 60 million years ago (Whitfield 1997). Thus, if the bracoviruses and wasps have been associated throughout their history in the current manner, the PDV/wasp relationship must be at least this old. The availability of the braconid phylogeny and several known polydnaviral genes allows me to explore and test hypotheses concerning the evolution of the bracovirus/wasp relationship. I hypothesise that the phylogenies of the wasps and viruses will mirror one another. That is, we expect that the phylogeny of the viruses, determined by analysis of sequence data from genes of viral origin, will be co-phylogenetic with the wasps. Several lines of indirect evidence (see below) support this hypothesis, but the expectation of co-phylogeny has never been tested directly with decisive evidence.

Indirect evidence for co-phylogeny between braconid wasps and PDV’s 1) As mentioned briefly above, it has been demonstrated that PDV’s are integrated into wasp chromosomal DNA as proviruses (Fleming & Summers 1986; Xu & Stoltz 1991),which are inherited in a Mendelian fashion (Stoltz 1990). There is no evidence that PDV’s can be transferred horizontally between parasitoids, and the PDV’s do not appear to replicate once the wasp inserts them into its host caterpillar (Stoltz 1993). 2) Braconid wasps that are known to carry PDV’s are themselves closely related and, based on current evidence, form a monophyletic lineage (Whitfield 1997). 3) All investigated members of this lineage are known to carry PDV’s (Stoltz & Whitfield 1992) including the previously unstudied Miracinae (R. Wharton pers. comm.). 4) Results from preliminary studies of relatedness among PDV’s from different wasp species using Southern blotting and comparative serology indicate that more closely related wasps carry more genetically similar PDV’s (summarised in Stoltz & Whitfield 1992). Thus, I have hypothesised that PDV’s from related wasps will be genetically related in a manner that reflects the phylogeny of their wasp carriers. Few PDV studies have directly analysed interspecific genetic variation and evolution of specific genes or viral sequences. This is primarily because so few genes of PDV origin have been characterised other than the family of omegaconotoxin-like sequences found in ichneumonids (see Dib-Hajj et al. 1993). However, within the last four years this situation has changed significantly. Our laboratory is currently investigating comparative DNA sequences of two PDV genes from a set of 20 wasp species in the genus Cotesia, as well as several outgroup genera. These genes are the early protein 1 (EP1) gene indentified and characterised originally in Cotesia congregata (Say) (Harwood & Beckage 1994; Savary et al. 1997) and the glycosylating secreted protein (CrV1) gene originally characterised from C. rubecula (Marshall) (Asgari et al. 1996, 1997). The products of both genes have been implicated in immune suppression of the host, and both genes appear to originate from the virus genome rather than that of the wasp. The goal of this study is to compare the phylogeny estimated from the two PDV genes to that estimated from mtDNA 16S and NADH1 genes, to directly test the question of co-phylogeny between the wasps and the PDV’s they carry. Below I present preliminary results from comparisons based on one of the genes of viral origin (CrV1) and the two wasp mtDNA genes, for the taxa for which our lab has so far been able to sequence both PDV and wasp genes. The ultimate goal is to compare results from all four genes for all 20+ taxa. At the end of this report I discuss some technical reasons why it has been difficult to rapidly achieve this goal.

Phylogeny of Microgastroid Braconid Wasps 99

Table 1 PCR and sequencing primers used in this study (* = developed by P. T. Smith from C. rubecula PDV sequences in Asgari et al. (1996); they are based on positions 40-59, 1143-1162, 562-581, 562-581 (reverse complement), 951-970 and 194-213, respectively, of the C. rubecula CrV1 sequence). Primer name

Sequence

Source

16S 16S B

5’-CACCTGTTTATCAAAAACAT-3’

Dowton and Austin (1994)

16S outer

5’-CTTATTCAACATCGAGGTC-3’

Whitfield (1997)

ND1-F

5’-GATAAATCAAA/TGG/T –3’

Smith et al. (1999)

ND1-R

5’-CAACCTTTTAGTGATGC-3’

Smith et al. (1999)

CrV1-F

5’-CTCCTGAGTCAATCATGTAC-3’

This study*

CrV1-R

5’-GCTAGAACATTTAGATTGCA-3’

This study*

NADH1

CrV1

CrV1-int

5’-CGTGAAGATTTGCTTTCTGA-3’

This study*

CrV1-irc

5’-TCAGAAAGCAAATCTTCACG-3’

This study *

CrV1R-II

5’-CATACTTTCATAAGTAGACT-3’

This study *

CrV1F-III

5’-CAAACGACTTCGATGAATCT-3’

This study *

Materials and Methods Either living, freshly frozen or ethanol-preserved wasps of 20 species of Cotesia and a variety of potential outgroup species of Microgastrinae were obtained from laboratory cultures, field collecting or other collaborators (many of these sources are reported in more detail in the generic study by Mardulyn & Whitfield 1999). Contributors of material to this study are identified in the Acknowledgements. DNA from whole wasps (with appendages and wings removed as voucher material) was extracted using a standard phenol/chlorophorm extraction protocol. The wasp and PDV genes were amplified using standard PCR protocols (Palumbi 1996) and the primers listed in Table 1. PCR products were purified using Promega Wizard PCR Preps, and 1/2 volume sequencing reactions were run using the ABI dRhodamine Terminator Cycle Sequencing Ready reaction kit. Sequencing reaction products were sent to the University of Florida Core Sequencing Facility to be run on an ABI 377 automated sequencer. Resulting sequences were checked, aligned using Clustal W (Thompson et al. 1994) and entered into NEXUS format using MacClade 3.07 (Maddison & Maddison 1992). All analyses reported here were run using the maximum parsimony criterion (PAUP* – Swofford 1998), and employed branch-and-bound searches to ensure finding the shortest trees. Tree comparison statistics (especially the partition metric of Penny and Hendy 1985) were calculated using Component version 2.0 (Page 1993). Corresponding branch lengths from the resulting trees were entered into Kaleidagraph 3.0.5 (Abelbeck Software 1994) for calculation of correlations.

Results Sequences from the 16S (373 aligned bp) and NADH1 (496 aligned bp) genes were obtained from 18 species of Cotesia and two outgroup species (Glyptapanteles porthetriae (Muesebeck) and Microplitis demolitor Wilkinson). Results from only six of the ingroup species are reported



Fig. 1

Comparison of the trees resulting form maximum parsimony analysis of sequence data from wasp and PDV DNA sequences (see text for details of the sequences). Phylogenetic analyses were run using PAUP*4.0 test version b1 (Swofford 1998), and tree comparison statistics were obtained using COMPONENT 2.0 (Page 1993). Wasp DNA and PDV DNA trees are identical except for one unresolved node in the PDV tree.

here, since it is for these six ingroup species that CrV1 sequences (approximately 800 bp, 349 of which have been unambiguously aligned) have also been obtained for comparison. Sequences from these six species are being deposited in GenBank, along with the mtDNA data for the outgroup species. Parsimony analysis of the 16S (100 informative sites) and NADH1 (55 informative sites) genes arrived at the same topology when only the six ingroup Cotesia and two outgroup species were analysed (Figs 1, 2) and, not surprisingly, this same tree resulted from combined analysis of the two genes (Fig. 1). The tree resulting from parsimony analysis of the CrV1 data (96 informative sites) was topologically identical to that from the wasp genes, except that the position of C. marginiventris (Cresson) relative to the other taxa was unresolved. The chance that the wasp and PDV trees would be this similar (as measured by the partition metric) by chance alone is less than .05, based on comparisons of sets of 10 000 random trees. Since the trees from the wasp and PDV gene data were topologically identical except for one unresolved node, it was possible to directly compare the corresponding branch lengths from the wasp and PDV trees, to determine if lengths tended to be correlated (i. e. whether the trees correspond in terms of inferred relative amounts of change on the branches, in addition to the topological similarity). The lengths from the 16S + NADH1 tree and those from the CrV1 tree are indeed significantly correlated (p < .05, see Fig. 3 for details). Considering the relatively small amount of data so far applied to this testing of co-phylogeny, the degree of correspondence between wasp and PDV trees is remarkable.

Discussion So far the data obtained from the wasp genes and genes of PDV origin indicate a strong degree of parallel pattern between the wasp phylogeny, as estimated from mtDNA, and the PDV


C. rubecula C. congregata C. marginiventris C. glomerata C. melitaearum C. orobenae Fig. 2

Phylograms (showing branch lengths obtained from parsimony analysis) of the three analyzed genes. Note similarity in relative lengths of corresponding branches between genes.



Fig. 3

Plots of branch lengths for corresponding branches between genes (branch lengths from Fig. 2). All are significantly correlated, and note especially the significant correlation between branch lengths from the two combined wasp genes and those from the PDV gene.

phylogeny, as estimated from CrV1. A more convincing demonstration of co-phylogeny will come from; 1) analysis of more taxa, including not only the other Cotesia species for which we have wasp sequence data, but also other outgroup genera; 2) the addition of data from the EP1 gene – so far we have alignable sequence from only three Cotesia species; and 3) data from structural virus genes, which can be demonstrably of only viral origin. Why has it been so difficult to obtain these additional data? Firstly, at the beginning of this study, the viral genes had not been sequenced from more than one species, so the design of conserved PCR primers was problematical. The redesign of these primers is still ongoing, since even the current ones will not amplify all of the taxa. Secondly, some current work in other laboratories suggests that some of the functional viral genes, including EP1 and CrV1, may be non-functional in some species (S. Asgari, M. R. Strand, pers. comm.). This may explain why some of the sequences we have already obtained but not analysed appear so divergent, and may also help to explain the difficulty in amplifying some taxa. In addition, the non-functional genes could pose some problems for phylogenetic analysis in future, in that some taxa would have a completely different pattern and rate of change in a given gene from others – this is a classic case where phylogenetic analysis using most current methods can fail (Steel et al. 1993; Lockhart et al. 1994). In summary, the current data suggests that wasp and PDV gene phylogenies will match perfectly, at least within Cotesia. Combined with the establishment of monophyly of the PDV-bearing


group of braconid wasps, the evidence certainly suggests a long-term co-phylogeny between the wasps and PDV’s. It is still too early to say this with complete confidence, however, and more work lies ahead to understand the comparative sequence data from the PDV genes.

Acknowledgements I would especially like to thank Otto Schmidt and Nancy Beckage for information concerning the PDV genes identified and characterised in their laboratories, to Don Stoltz for stimulating some of the ideas developed here, and to Paul Smith for beginning the sequencing studies of EP1 and CrV1, as well as of the Cotesia mtDNA genes. Jasa Holt provided technical assistance with PCR and sequencing, while Sassan Asgari and Mike Strand provided some useful unpublished information about PDV genes. Patrick Mardulyn provided some microgastrine 16S sequences from another project in our laboratory. Nancy Beckage, Tim Herman, Judy Pell, Don Stoltz, Mike Strand and John Ruberson provided specimens of various Cotesia species to us. This work was funded by NSF grants BSR 9111938 and INT-9605091, USDA grant 95- 01893 and grant 94-B04 from the Arkansas Science and Technology Authority.

References Abelbeck Software (1994) Kaleidagraph, version 3.0.5. Data analysis/graphics application for the Macintosh. Synergy Software, Reading, PA. Asgari, S., Hellers, M. & Schmidt, O. (1996) Host haemocyte inactivation by an insect parasitoid: transient expression of a polydnavirus gene. Journal of General Virology 77: 2653-2662. Asgari, S., Schmidt, O. & Theopold, U. (1997) A polydnavirus-encoded protein of an endoparasitoid wasp is an immune suppressor. Journal of General Virology 78: 3061-3070. Beckage, N. E. (1997) The parasitic wasp’s secret weapon. Scientific American Nov. 1997: 82-87. Beckage, N. E. (1998) Parasitoids and polydnaviruses. Bioscience 48: 305-311. Belshaw, R., Fitton, M., Herniou, E., Gimeno, C. & Quicke, D. L. J. (1998) A phylogenetic reconstruction of the Ichneumonoidea (Hymenoptera) based on the D2 variable region of 28S ribosomal RNA. Systematic Entomology 23: 109-123. Dib-Hajj, S. D., Webb, B. A. & Summers, M. D. (1993) Structure and evolutionary implications of a “cysteine-rich” Campoletis sonorensis polydnavirus gene family. Proceedings of the National Academy of Sciences, USA 90: 3765-3769. Dowton, M., Austin, A. D. & Antolin, M. F. (1998) Evolutionary relationships among the Braconidae (Hymenoptera: Ichneumoidea) inferred from partial 16S rDNA gene sequences. Insect Molecular Biology 7: 129-150. Dowton, M. & Austin, A. D. (1998) Phylogenetic relationships among the microgastroid wasps (Hymenoptera: Braconidae): combined analysis of 16S and 28S rDNA genes, and morphological data. Molecular Phylogenetics & Evolution 10: 354-366. Edson, K. M., Vinson, S. B., Stoltz, D. B. & Summers, M. D. (1981) Virus in a parasitoid wasp: suppression of the cellular immune response in the parasitoid’s host. Science 211: 582-583. Fleming, J. G. W. (1992) Polydnaviruses: mutualists and pathogens. Annual Review of Entomology 37: 401-426. Fleming, J. G. W. & Summers, M. D. (1986) Campoletis sonorensis endoparasitic wasps contain forms of C. sonorensis virus DNA suggestive of integrated and extrachromosomal polydnavirus DNAs. Journal of Virology 57: 552-562.



Harwood, S. H. & Beckage, N. E. (1994) Purification and characterization of an early-expressed polydnavirus-induced protein from the hemolymph of Manduca sexta larvae parasitized by Cotesia congregata. Insect Biochemistry & Molecular Biology 24: 685-698. Lockhart, P. J., Steel, M. A., Hendy, M. D. & Penny, D. (1994) Recovering evolutionary trees under a more realistic model of sequence evolution. Molecular Biology & Evolution 11: 605-612. Maddison, W. P. & Maddison, D. R. (1992) MacClade, Version 3. Analysis of Phylogeny and Character Evolution. Sinauer Associates, Sunderland, MA. Mardulyn, P. & Whitfield, J. B. (1999) Phylogenetic signal in the COI, 16S and 28S genes for inferring relationships among genera of Microgastrinae (Hymenoptera: Braconidae); evidence of a high diversification rate in this group of parasitoids. Molecular Phylogenetics & Evolution 12: 282-294. Page, R. D. M. (1993) COMPONENT, Version 2.0. Tree comparison software for use with Microsoft Windows. Biogeography and Conservation Laboratory, The Natural History Museum, London. Palumbi, S. R. (1996) Nucleic acids II: the polymerase chain reaction. pp. 205-247. In Hillis, D. M, Moritz, C. & Mable, B. K. (Eds), Molecular Systematics, 2nd edition, Sinauer Associates, Sunderland, MA. Penny, D. & Hendy, M. D. (1985) The use of tree comparison metrics. Systematic Zoology 34: 75-82. Savary, S., Beckage, N., Tan, F., Periquet, G. & Drezen, J.-M. (1997) Excision of the polydnavirus chromosomal integrated EP1 sequence of the parasitoid wasp Cotesia congregata (Braconidae, Microgastrinae) at potential recombinase binding sites. Journal of General Virology 78: 3125-3134. Smith, P. T., Kambhampati, S., Völkl, W. & Mackauer, M. (1999) A phylogeny of aphid parasitoids (Hymenoptera: Braconidae: Aphidiinae) inferred from mitochondrial NADH1 dehydrogenase gene sequence. Molecular Phylogenetics & Evolution 11: 236-245. Steel, M. A., Lockhart, P. J. & Penny, D. (1993) Confidence in evolutionary trees from biological sequence data. Nature 364: 440-442. Stoltz, D. B. (1990) Evidence for chromosomal transmission of polydnavirus DNA. Journal of General Virology 71: 1051-1056. Stoltz, D. B. (1993) The polydnavirus life cycle. pp. 167-187 In Beckage, N. E., Thompson, S. N. & Federici, B. A. (Eds), Parasites and Pathogens of Insects, Vol. 1: Parasites. Academic Press, San Diego. Stoltz, D. B. & Whitfield, J. B. (1992) Viruses and virus-like entities in the parasitic Hymenoptera. Journal of Hymenoptera Research 1: 125-139. Swofford, D.L. (1998) PAUP* version 4.0 b1 – Phylogenetic Analysis Using Parsimony (and Other Methods). Software and Manual. Sinauer Associates, Sunderland, MA. Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22: 4673-4680. Webb , B. A. & Summers, M. D. (1990) Venom and viral expression products of the endoparasitic wasp Campoletis sonorensis share epitopes and related sequences. Proceedings of the National Academy of Sciences, USA 87: 4961-4965. Whitfield, J. B. (1990) Parasitoids, polydnaviruses and endosymbiosis. Parasitology Today 6: 381-384. Whitfield, J. B. (1994) Mutualistic viruses and the evolution of host ranges in endoparasitoid Hymenoptera, pp. 163-176. In Hawkins, B. A. & Sheehan, W. (Eds), Parasitoid Community Ecology. Oxford University Press, Oxford.


Whitfield, J. B. (1997) Molecular and morphological data suggest a single origin of the polydnaviruses among braconid wasps. Naturwissenschaften 84: 502-507. Whitfield, J. B., & Mason, W. R. M. (1994) Mendesellinae, a new subfamily of braconid wasps (Hymenoptera, Braconidae) with a review of relationships within the microgastroid assemblage. Systematic Entomology 19: 61-76. Xu, D. & Stoltz, D. B. (1991) Evidence for a chromosomal location of polydnavirus DNA in the ichneumonid parasitoid, Hyposoter fugitivus. Journal of Virology 65: 6693-6704.

Evolutionary Transitions in Aphidiinae (Hymenoptera: Braconidae) Paul T. Smith and Srinivas Kambhampati Department of Entomology, Kansas State University, Manhattan, Kansas 66506-4004 USA (email: [email protected])

Introduction Aphidiine wasps (Braconidae: Aphidiinae) are solitary koinobiont endoparasitoids of aphids. The subfamily is currently considered to include approximately 50 genera and 400 species which are divided into four tribes: Aclitini, Aphidiini, Ephedrini and Praini (Mackauer & Stary 1967; Stary 1988). The Aphidiini is the largest of the four tribes and includes a majority of known genera and species; it is sub-divided into three subtribes, Aphidiina, Monoctonina and Trioxina. Although aphidiines are defined by a number of synapomorphies (e.g. host specialisation and presence of a flexible suture between the second and third tergites of the gaster), significant differences exist in morphology, biology and behaviour among tribes, genera and species. Because of varied interpretation of these differences, there have been disagreements concerning the phylogenetic placement of some aphidiine taxa. A number of different phylogenies have been proposed previously for aphidiines based on embryology, morphology and DNA sequences that differ in the postulated relationships among taxa [see Smith et al. (1999) for a review of the various phylogenetic proposals for aphidiines]. For example, each of the four tribes mentioned above have been suggested as being basal in independent studies of morphology (Mackauer 1961, 1968; Tobias 1967; Tobias & Kyriak 1971; Edson & Vinson 1979; Chou 1984; Gärdenfors 1986; Finlayson 1990) and DNA (Belshaw & Quicke 1997; Smith et al. 1999; Kambhampati et al. 2000). Determination of which group is basal is important because of its strong implications for ingroup character state polarisation. Recently, Smith et al. (1999) and Kambhampati et al. (2000) examined the phylogenetic relationship among aphidiine genera. Smith et al. (1999) proposed a phylogenetic tree for Aphidiinae based on 465 bp of the mitochondrial NADH1 dehydrogenase gene. Their study included 39 taxa representing 14 genera and three braconid outgroups. The length of the NADH1 dehydrogenase gene fragment was invariant among the 39 taxa and alignment of the sequence was straightforward. Smith et al. (1999) found that Praini was basal, with strong quantitative support among aphidiines included in their study. However, the study of Smith et al. (1999) did not include a potentially basal genus, Aclitus Foerster, which possesses a number of presumed plesiomorphic characters (Mackauer 1961; Takada & Shiga 1974). Kambhampati et al. (2000) proposed a phylogenetic tree for aphidiines based on DNA sequence of a portion of the mitochondrial 16S rDNA gene for 47 ingroup taxa representing 24 genera and seven outgroup taxa. Their study indicated the following relationships: Aclitus + (Praini + (Ephedrini + Aphidiini)). Although the genus Aclitus was basal, it was only represented by a single species (A. obscuripennis Foerster) and its position did not have strong quantitative support. The 106


Evolutionary Transitions in Aphidiinae (Hymenoptera: Braconidae) 107

finding of Kambhampati et al. (2000) that Praini was basal relative to Ephedrini is congruent with the results reported by Smith et al. (1999). A combined analysis of the NADH1 and 16S rDNA data partitions for 27 ingroup taxa representing 14 genera (Aclitus not included) by Kambhampati et al. (2000) indicated a topology nearly identical to that which was reported by Smith et al. (1999), but with even stronger quantitative support. In the present study we assess whether evolutionary transitions of various morphological and behavioural character states are compatible with the phylogenetic tree inferred from a combined analysis of the mitochondrial NADH1 and 16S rDNA genes by Kambhampati et al. (2000). The mapping of various characters onto the combined evidence tree indicated that many of these characters have a simple evolutionary trajectory, with either a single transition in the case of twostate characters or multiple sequential transitions in the case of multi-state characters.

Materials and Methods A list of taxa and the phylogenetic tree on which this study is based was presented by Kambhampati et al. (2000). The phylogenetic tree was inferred using maximum parsimony methods in PAUP* Ver 4d64 (written by D. L. Swofford). Branch support was assessed by bootstrapping (fast stepwise addition-10,000 replications; Felsenstein 1985) and decay index (Bremer 1994). Maclade v. 3.04 (Maddison & Maddison 1992) was used to examine the evolutionary transitions of the following characters by mapping each state onto the phylogenetic tree: A) egg shape, B) shape of first instar mandibles, C) distribution of first instar abdominal spines, D) final instar hypostomal spur, E) venom apparatus, F) shape of ovipositor sheaths, G) pupation behaviour, and H) emergence hole position. These eight characters were selected because they represent a range in morphology from egg to larva to adult, and a range in behaviour from immediately prior to pupation to immediately following pupal development.

Results and Discussion Egg shape and first instar larval structures Tremblay and Calvert (1971) examined the systematic position of aphidiines based on embryology. In their study they identified two distinct differences in egg shape associated with aphidiines, those that are prolongately oval and those that are lemon shaped. Mapping each state onto our phylogenetic tree indicated that prolongately oval eggs constitutes the plesiomorphic state, and lemon-shaped eggs, in Aphidiini, the apomorphic state (Fig. 1A). Similarly, first instar larval aphidiines were examined for differences in morphology by O’Donnell (1989). Two characters associated with the head and abdomen (i.e., mandible shape and abdominal spine distribution) were identified to each have two distinct states. With respect to mandible shape, O’Donnell (1989) found that the first instar larvae exhibited either hook-shaped mandibles or sickle-shaped mandibles; and that the abdominal spines were arranged either in a continuous or discontinuous fashion (i.e. no apparent pattern to arrangement). Our phylogenetic tree indicated two identical evolutionary lineages with respect to the two characters (Figs 1B, 1C). In this regard, hook-shaped mandibles and a continuous arrangement of the abdominal spines are plesiomorphic with a single evolutionary transition for both characters in Aphidiini to sickle-shaped mandibles and a discontinuous arrangement of the abdominal spines.

Fourth instar hypostomal spur Finlayson (1990) conducted a systematic study of aphidiines in which various cephalic structures of fourth instar larvae were examined for differences. Of particular interest is the presence/

Paul T. Smith and Srinivas Kambhampati 108


(A) Egg Shape

Prolonged, Oval Lemon Shape Equivocal

(B) 1st Instar Mandible Shape Aphidius Diaeretiella Lysiphlebus Euaphidius Pauesia Monoctonus Falciconus Paramonoctonus Lipolexis Trioxys Binodoxys Ephedrus Dyscritulus Praon Perilitis

(C) 1st Instar Abdominal Spine Distribution

Continuousl Discontinuous Equivocal

Figure 1

Sickle Shape Hook Shape Equivocal

Aphidius Diaeretiella Lysiphlebus Euaphidius Pauesia Monoctonus Falciconus Paramonoctonus Lipolexis Trioxys Binodoxys Ephedrus Dyscritulus Praon Perilitis

(D) 4th Instar Hypostomal Spur Aphidius Diaeretiella Lysiphlebus Euaphidius Pauesia Monoctonus Falciconus Paramonoctonus Lipolexis Trioxys Binodoxys Ephedrus Dyscritulus Praon Perilitis


Present Absent

A phylogenetic tree for Aphidiinae based on DNA sequence of portions of the 16S rDNA and NADH1 dehydrogenase genes. The tree shown is a majority rule consensus of two equally parsimonious trees for 27 aphidiine taxa representing 14 genera and an outgroup (monophyletic genera reduced to a single taxon name). The evolutionary transitions of the following characters were examined: A) egg shape; B) first instar mandible shape; C) first instar abdominal spine distribution; D) fourth instar hypostomal spur;


(E) Venom Apparatus

Type 2

(F) Ovipositor Sheath Shape Aphidius Diaeretiella Lysiphlebus Euaphidius Pauesia Monoctonus Falciconus Paramonoctonus Lipolexis Trioxys Binodoxys Ephedrus Dyscritulus Praon Perilitis

Curved Up

Type 1

Short, Curved Up

Type 1-basal filament attachment

Straight Curved Down Equivocal

Type 1-separate filament attachment Equivocal

(G) Pupation Behavior

Outside Inside


(H) Emergence Hole Position Aphidius Diaeretiella Lysiphlebus Euaphidius Pauesia Monoctonus Falciconus Paramonoctonus Lipolexis Trioxys Binodoxys Ephedrus Dyscritulus Praon Perilitis

Cocoon Emergence


EH at cauda EH at cornicles cap bears cornicle(s) EH between cornicles and cauda EH between thorax and cornicles Equivocal

Figure 1 (cont’d)

E) venom apparatus; F) ovipositor sheath shape; G) pupation behavior, and H) emergence hole position. These characters represent a range in morphology from egg to larva to adult and a range in behavior from immediately prior to undergoing pupation to immediately following pupal development.



absence of a hypostomal spur. Finlayson (1990) found that only a sub-set of aphidiine genera (i.e. the Trioxina) possess this structure. Since most braconids possess a hypostomal spur, Finlayson (1990) reasoned that those aphidiines that have lost this structure are more ‘derived’ (i.e. she assumed the sister group to aphidiines possessed a hypostomal spur and that possession of this character is the apomorphic condition). If Finlayson’s (1990) hypothesis of aphidiine evolution is correct, it would imply that there has been a considerable amount of convergence during the course of aphidiine evolution (e.g. egg shape, first instar mandible shape, and abdominal spine distribution). In marked contrast, our phylogenetic tree indicates that there was an initial loss and secondary acquisition of this character within a monophyletic group of genera within the Aphidiini (Fig. 1D). Although our explanation is less parsimonious than Finlayson’s (1990), it requires only one additional step and is more parsimonious when the evolutionary transitions of many other characters are considered.

Venom apparatus Braconid wasps exhibit one of two different types of venom apparatus (VA) morphology following the classification scheme of Edson and Vinson (1979). In general, the VA consists of a venom reservoir, gland filaments, and a venom duct which extends into the ovipositor. Following Edson and Vinson’s (1979) classification scheme, one VA type (Type 1) is characterised by a cone shaped reservoir surrounded by many muscles and two or more gland filaments, and is associated with ecto- or endo-parasitoids which pupate inside the host remains. The Type 1 VA can be further sub-divided based on structure (e.g. attachment site of the gland filaments and/or appearance of the venom reservoir). A second type of VA (Type 2) is characterised by a thin walled reservoir surrounded by few muscles and only two gland filaments, and is associated with endoparasitoids which pupate outside the host remains. Unlike other braconid subfamilies which are monomorphic for either type, the Aphidiinae exhibit both types. The VA classification scheme of Edson and Vinson (1979) is highly compatible with our phylogenetic tree with four evolutionary lineages being recognised (Fig. 1E). The plesiomorphic VA structure within Aphidiinae is a Type 2 structure with no apparent reservoir and is exhibited by members of the tribe Praini which pupate outside and underneath the exoskeleton of the host (Fig. 1E). The apomorphic state is a Type 1 structure and is exhibited by members of Ephedrini and Aphidiini, both of which pupate inside the host. However, the Type 1 VA of Ephedrini differs from that of Aphidiini in that the gland filaments are attached at the base of the venom reservoir and the cuticular lining of venom reservoir lacks a spiral-like appearance. Within Aphidiini, the genera Monoctonus Haliday, Falciconus Mackauer and Paramonoctonus Stary (=Monoctonina) can be further distinguished by the separate attachment of the two gland filaments to the venom reservoir and the cuticular lining of the venom reservoir lacks a spiral-like appearance (Fig. 1E).

Ovipositor sheath shape Female aphidiines exhibit variation in the shape and length of the ovipositor sheaths (3rd valvulae). The ovipositor sheaths can be sparsely or densely pubescent, but they always bear several sensory hairs at their apex. The variation in ovipositor sheath shape ranges from short to long and either straight, or curved up or down. According to Stary (1981), the ovipositor sheaths and their functional differentiation are one of the key characters in the evolution of aphidiine groups. Our phylogenetic tree indicates the presence of four evolutionary lineages with respect to shape and size of the ovipositor sheaths (Fig. 1F). The morphological features of the ovipositor sheaths


are apparent adaptive strategies in parasitoid/host interactions. For example, the downward curved ovipositor sheaths of Monoctonus, Falciconus, Paramonoctonus, Lipolexis Foerster, Trioxys Haliday, and Binodoxys Mackauer apparently work in conjunction with a pair of prongs on the last abdominal sternum to hold the attacked aphid and prevent its escape (Stary 1981).

Pupation behaviour Following the completion of larval development, aphidiines will pupate either inside the dead host (most extant species) or outside and underneath the empty exoskeleton of the host (most members of Praini). Mackauer (1961) proposed that outside pupation in Praini evolved by way of secondary loss of internal pupation and may represent an adaptation in response to hyperparasitoids. Our results indicated that this behaviour is plesiomorphic with a single transition to internal pupation among members of Ephedrini and Aphidiini (Fig. 1G). In contrast, Mackauer’s (1961) proposal would imply multiple transitions (i.e. from internal pupation in Ephedrini to external pupation in Praini and then back to internal pupation in Aphidiini). It is possible, however, that internal pupation is plesiomorphic despite which aphidiine lineage is basal. Central to this issue is the phylogenetic position of the genus Areopraon Mackauer (a rare genus currently classified in Praini not included in our study) which contains species which pupate internally and others which pupate externally or both depending on the circumstances (Stary 1970). If an internally pupating Areopraon species is basal to all other Paini, then Mackauer’s (1961) proposal of internal pupation being plesiomorphic is possible and would be the most parsimonious explanation as it implies only a single transition. However, the relationship of Areopraon to other aphidiines (including Praini) remains to be vigorously tested with cladisitc analysis. Emergence hole position Following the completion of immature development, the adult aphidiine uses its mandibles to cut an emergence hole in the cocoon (Praini) or host exoskeleton (Aclitini, Aphidiini, Ephedrini). Among the aphidiines that pupate inside the host, some species cut an emergence hole between the thorax and cornicles, some species cut an emergence hole at the level of the cornicles (in such case the cap may contain one or both cornicles), some species cut an emergence hole posterior to the cornicles (in such case the cap never contains a cornicle), and finally some species cut an emergence hole perpendicular to the longitudinal axis of the host exoskeleton (in such case the cap bears the cauda and is relatively large; Stary 1970). With respect to emergence hole position, our phylogenetic tree indicates the presence of four distinct evolutionary lineages (Fig. 1H). Of those aphidiines that cut an emergence hole in the exoskeleton of the host, there appears to be a gradual transition in emergence hole position from the cauda to a dorsal position just posterior to the thorax (Fig. 1H). In summary, our results indicated that the phylogenetic tree inferred from parsimony analysis of the mitochondrial NADH1 and 16S rDNA genes was useful with respect to tracing the evolutionary transitions of various morphological, biological, and behavioural characters in Aphidiinae. Our trees are generally compatible with a smooth transition from one character state to another and in most cases, represent the most parsimonious solution. Some characters are evolutionarily more labile than others (e.g. egg shape, mandible shape, pupation behaviour). An examination of these characters in a broader range of taxa within Braconidae may provide insights into which characters are generally more labile and which are conserved.



Acknowledgements We thank W. Völkl, R. Belshaw, J. Obrycki, and P. Stary for providing some of the specimens used in this study, and M. Mackauer for discussion of aphidiine evolution. Financial support for this study was provided by United States Department of Agriculture NRI grant 9401865 to S. K and M. M and Hatch grants H-28 and H-497 to S.K. This is proceedings/book article no. 99-296A of the Kansas Agriculture Experiment Station.

References Belshaw, R. & Quicke, D. L. J. (1997) A molecular phylogeny of the Aphidiinae (Hymenoptera: Braconidae). Molecular Phylogenetics & Evolution 7: 281-293. Bremer, K. (1994) Branch support and tree stability. Cladistics 10: 295-304. Chou, L-Y. (1984) The phylogeny of Aphidiidae (Hymenoptera). Journal of Agricultural Research (China) 33: 437-446. Edson, K. M. & Vinson, S. B. (1979) A comparative morphology of the venom apparatus of female braconids (Hymenoptera: Braconidae). Canadian Entomologist 111: 1013-1024. Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783-791. Finlayson, T. (1990) The systematics and taxonomy of final instar larvae of the family Aphidiidae. Memoirs of the Entomological Society of Canada 152: 1-74. Gärdenfors, U. (1986) Taxonomic and biological revision of Palaearctic Ephedrus (Haliday) (Hymenoptera, Braconidae, Aphidiinae). Entomologica Scandinavica Supplement 27: 1-95. Kambhampati, S., Völkl, W. and Mackauer, M. (2000) Phylogenetic relationships among genera of Aphidiinae (Hymenoptera: Braconidae) based on DNA sequence of the mitochondrial 16S rRNA gene. Systematic Biology 25: 1-9. Mackauer, M. (1961) Die Gattungen der Familie Aphidiidae und ihre verwandtschaftliche Zuordnung (Hymenoptera: Ichneumonoidea) Beiträge zur Entomologie 11: 792-803. Mackauer, M. (1968) Hymenopterorum Catalogus. Pars 3. Aphidiidae, Junk, The Hage. Mackauer, M. & Stary, P. (1967) World Aphidiidae (Hymenoptera: Ichneumonoidea). Le Francois, Paris. Maddison, W. P. & Maddison, D. R. (1992) MacClade: Analysis of Phylogeny and Character Evolution. Version 3.04. Sinauer Associates, Sunderland, MA. O’Donnell, D. J. (1989) A morphological and taxonomic study of first instar larvae of Aphidiinae (Hymenoptera: Braconidae). Systematic Entomology 14: 197-219. Smith, P. T., Kambhampati, S., Völkl, W. & Mackauer, M. (1999) A phylogeny of aphid parasitoids (Hymenoptera: Braconidae: Aphidiinae) inferred from mitochondrial NADH 1 dehydrogenase gene sequence. Molecular Phylogenetics & Evolution 11: 236-245. Stary, P. (1970). Biology of Aphid Parasites (Hymenoptera: Aphidiidae) with Respect to Integrated Control. Series Entomologica 6, Junk, The Hague. Stary, P. (1981) Biosystematical classification of Trioxys Hal. and related genera (Hymenoptera, Aphidiidae). Bollettino del Laboratoria di Entomologia Agraria “Filippo Silvestri”, Portici 38: 84-93. Stary, P. (1988) Aphidiidae, pp. 171-184. In Minks, A. K. & Harrewijn, P. (Eds). Aphids, Their Biology, Natural Enemies and Control. Vol 2B. Elsevier, Amsterdam. Takada, H. & Shiga, M. (1974) Description of a new species and notes on the systematic position of the genus Aclitus (Hymenoptera: Aphidiiidae). Kontyû 42: 283-292.


Tremblay, E. & Calvert, D. (1971) Embryosystematics in the aphidiines (Hymenoptera: Braconidae). Bollettino del Laboratoria di Entomologia Agraria “Filippo Silvestri”, Portici 29: 223-249. Tobias, V. I. (1967). A review of the classification, phylogeny and evolution of the family Braconidae (Hymenoptera) Entomologicheskoe Obozrenie 56: 646-659. Tobias, V. I. & Kyriak, I. G. (1971) Areopraon pilosum Mackauer, 1959, and problems concerning phylogeny and distribution of the family Aphidiidae (Hymenoptera). Entomologicheskoe Obozrenie 50: 11-16.

Genetic Structure Of The Cypress Seed Chalcid Megastigmus wachtli (Torymidae) within its Mediterranean Distribution J. Y. Rasplus1, E. Carcreff2, J. M. Cornuet1 and A. Roques3 1

INRA, Centre de Biologie et de Gestion des Populations, 488 rue Croix de Lavit, 34090 Montpellier, France (email: [email protected]) 2

INRA, Unités de Recherches Forestières, Pierroton, France

3

INRA, Zoologie Forestière, Ardon Olivet, France

Introduction The evergreen cypress (Cupressus sempervirens L.) is widespread in the Mediterranean region. Its natural range extends from North Iran to Crete and the Dodecanese Islands (Vidacovic 1991). This species has been introduced in the western part of the Mediterranean Basin (Western Europe and North Africa), first by the Ancient Greeks and then by the Romans (Baumann 1982). Once established, the species propagated spontaneously and spread along the Mediterranean coast. Species belonging to the cosmopolitan genus of seed chalcid Megastigmus Dalman have long been considered as important pests of commercially grown conifers. In Europe, the cypress seed chalcid Megastigmus wachtli Seitner mostly develops within the seeds of C. sempervirens. Occasionally the species can develop within seeds of introduced Californian species of Cupressus (C. ambramsiana C.B. Wolf, C. arizonica Greene, C. bakeri Jepson and C. goveniana Gordon) (Roques et al. 1999a, 1999b). Megastigmus wachtli occurs both in the natural (Canakcioglu 1959; Roques et al. 1997) and the introduced range of C. sempervirens (Ben Jamaa & Roques 1997; Guido et al. 1995; Roques & Raimbault 1986). The species is also thought to be associated with C. atlantica Gaussen, an endangered species endemic to the Atlas Mountains (Morocco) (Fernandes 1979), but wasps from this host tree show slight differences and are thought to represent different species (see below). Due to low variability among the loci analysed, it has been difficult to characterise Megastigmus populations developing on related host plants with allozyme markers (Roux & Roques 1996). Microsatellites increasingly show their potential for genetic studies of the Hymenoptera, a group where haplodiploidy is a probable cause of the low level of allozyme polymorphisms (Pamilo & Crozier 1981). Until now, these single locus co-dominant markers have been reported from social Hymenoptera (Aculeata) but never from the large and economically important parasitic wasps which include both pests and beneficial insects. For the first time we use highly polymorphic microsatellites to assess the genetic structure of populations of the cypress seed chalcid. We also compare populations associated with the evergreen cypress in its supposed native range and in areas where the cypress has recently been introduced by humans.

114


Genetic Structure of the Cypress Seed Chalcid 115

Figure 1

Geographic locations of sampling sites and number of collected individuals of the cypress seed chalcid, Megastigmus wachtli.

Material and Methods Sampling and sequencing In each sampling site (Fig. 1), 100 mature 2-year-old cones were collected in late spring on 10 different trees of C. sempervirens. The cones were stored in boxes and exposed to outdoor conditions until wasps emerged. They were then stored at -80˚C until DNA analysis. Because of the haplodiploid sex determination in Hymenoptera, only females were used for the genetic study. We collected 191 females from 10 localities. Five within the supposed natural range of C. sempervirens (Imbros and Zourva – both in Crete near Lévka Óri, Samos, Kos and Rhodes) and five in the area where the species is supposed to have been introduced (mainland Greece, France, Italy and Tunisia) (Fig. 1). We also included five specimens from Morocco developing in seeds of C. atlantica, a rare plant species localised to small patches in the Atlas Mountains and consequently difficult to sample. The isolation and characterisation of microsatellite loci followed Carcreff et al. (1998). Primer sequences and PCR conditions are detailed for each locus in Table 1. Statistical analyses For each locus and each population sample, the gene diversity was estimated by [HE = (n/n-1) (1-∑ipi2)] where pi is the frequency of allele i estimated over n chromosomes sampled at this locus in this population (Nei 1987). Gene diversity was also quantified by the number of alleles per locus (A) and observed heterozygosity (Ho). Deviation from Hardy-Weinberg equilibrium, linkage disequilibrium, differences in allele frequencies and isolation by distance were analysed using GENEPOP version 3.1a (Raymond & Rousset 1995). Population structure was analysed by FST (θ) and RST (ρ). FSTAT (Goudet 1995) was used to calculate unbiased estimates for analogues of Wright’s (1951) F-statistics : θIS, θIT, θST, following Weir and Cockerman (1984). Permutation procedures (N=1000) were used to test whether values were significantly greater than zero by permuting multilocus genotypes among samples. ρ, an estimator of RST, was calculated using RSTCALC 2.1 (Goodman 1997). This unbiased estimator is analogous to θ, and takes into

J. Y. Rasplus, E. Carcreff, J. M. Cornuet and A. Roques 116


Table 1 Characteristics of six polymorphic loci in Megastigmus wachtli. Optimal annealing temperatures (T°m) and MgCl2 concentrations (mM) are also given. Annealing temp (°C)

MgCl2 (mM)

GeneBank N°

TGCTGAGCCCCTCTATACCC AGAACCAAAAGGCGTGCG

54°C

1.2

AJ101065

(TC)11

ACCCGCTTTGCTCATCC TGTGCTGCTACACCGAGG

52°C

1.2

AJ101066

MW 22

(CA)8 TA (CA)7

CCATCCTCGAACCTTTTTACC GCTGCTGCTGCTTCTACCTC

58°C

1

AJ101067

MW 34

(AG)17 G10

CCCCGCCTCTACCAAATC TTGAAATTGCTCGGACCG

58°C

0.8

AJ101068

MW 47

(CT)13

CATGGGGTTTCAAGTGCTG CTCTAGCTTTTGCCTGAGCC

58°C

1

AJ101069

Locus

Core sequence

Primer sequences (5’ 3’)

MW 10

(CT)20

MW 21

account differences in sample size between populations and differences in variance between loci. Migration rates (Nm) were calculated as Nm = 1/4((1/θ)-1). Nm for r were calculated as for q. We compared multilocus FST/(1-FST) and RST/(1-RST) estimates over geographical distances for all pairs of populations within the natural distribution range of the species. Geographical distances between populations were the shortest distances measured on a map. Neighbour-joining (NJ) (Saitou & Nei 1987) trees were constructed using two different distances: Cavalli-Sforza and Edwards’ chord distance (DCE) (Cavalli-Sforza & Edwards 1967) and Chakraborty and Jin’s distance (DAS) (Chakraborty & Jin 1993). Bootstrap values were computed by resampling loci and are given as percent values of 2000 replications. Chakraborty and Jin’s distance, based on the proportion of shared alleles (DAS), was also used to assess relationships among individuals. NJ trees relating populations and individuals were constructed using programs written by J. M. Cornuet.

Results Variability of microsatellite loci For each of the five loci across the nine sampled populations, allele frequencies, proportions of heterozygotes and gene diversities are given in Table 2. The number of alleles detected at the five loci analysed varied from six (locus M21) to 35 (locus M34) and the number of alleles detected per population varied from one (in Greece – Locus M21; Rhodes and Samos – Locus M22; Italy – Locus M47) to 19 (for both Cretan populations at Locus M34). The mean number of alleles per locus ranged from 2.0±0.707 in Italy to 10.2±6.38 in Crete (Imbros), resulting in an overall expected heterozygosity ranging from 0.118±0.102 in France to 0.816±0.146 in Crete (Zourva). A total of 85 alleles were observed but two loci (M10 and M34) accounted for about two thirds (58 alleles) of the total. The remaining three loci show relatively lower allelic variability. The average number of alleles per locus is higher for the two Cretan populations (Table 3). When adjusted for equal population size (Ewens 1972), these two populations have significantly more alleles than all the other populations except the Moroccan population (Wilcoxon’s signed rank test, 0.028> 0.05), but differed significantly at nt3 (χ2, P 0.15. Character 13. Mandibles broadly overlap: 0) no; 1) yes. In Gasteruption, the mandibles overlap only slightly whereas they broadly overlap in the Hyptiogastrinae (Crosskey 1962). Character 14. Mandibular median teeth number: 0) one tooth; 1) two teeth; 2) three teeth (2). Character 15. Mouthparts extendible: 0) fixed; 1) extendible. Character 16. Occipital carina: 0) absent; 1) incomplete (absent medially); 2) complete. In Aulacidae, Townes (1950) distinguished between Pristaulacus and Aulacus by the latter lacking an occipital carina. Character 17. Occipital margin sculpturing: 0) sculptured; 1) smooth. Character 18. Scape in lateral view: 0) convex; 1) parallel-sided. This character was used by Crosskey (1962) to distinguish between Aulacidae and Gasteruptiidae. Character 19. Scape width relative to pedicel: 0) scape much wider than pedicel; 1) scape slightly wider than pedicel. Character 20. Subantennal groove: 0) absent; 10 present. Character 21. Dorsal tentorial pits on head: 0) absent; 1) present. Character 22. Functional abdominal spiracles: 0) other than 1 & 8; 1) 1 and 8. Character 23. Median sulcus of mesoscutum: 0) absent; 1) present.

Higher-level Phylogeny of the Aulacidae and Gasteruptiidae (Hymenoptera: Evanioidea) 161

Character 24. Mesothorax anterior face in lateral view: 0) truncate; 1) not so. Character 25. Notauli percurrent: 0) not percurrent; 1) percurrent, not Y-shaped; 2) percurrent, Y-shaped (2). This character was used by Crosskey (1962) to distinguish between Aulacidae and Gasteruptiidae. Crosskey distinguished between scutum ‘divided’ (not Y-shaped) or ‘not fully divided by prescutum’ (Y-shaped). Character 26. Prepectus: 0) absent; 1) present. Character 27. Antero-dorsal pronotal processes: 0) absent; 1) present. Jennings and Austin (1997b) described these processes in some Aulacofoenus species. Character 28. Dorso-lateral pronotal processes: 0) absent; 1) present. Jennings and Austin (1997b) described these processes in some Aulacofoenus species. Character 29. Propleural carina: 0) absent; 1) ventro-lateral. Character 30. Propleuron shape: 0) elongate; 1) not elongate. Character 31. Propodeal carina: 0) absent; 1) present. Character 32. Propodeal spiracle: 0) glabrous or almost so; 1) fringed with setae. When setae are present, they are generally long and found on both the anterior and posterior margins of the spiracle – only occasionally are the setae short. If only one or two setae are present, this was considered as state 0. Character 33. Shape of propodeum: 0) not pyramidal; 1) pyramidal. This character was used by Crosskey (1962) to distinguish between Aulacidae and Gasteruptiidae. Character 34. Fore wing discal cell number: 0) 2 cells; 1) 1 cell. Jennings and Austin (1994a, 1994b, 1997a, 1997b) figured the discal cells of many included taxa. Character 35. Fore wing plication at rest: 0) no; 1) yes. This character was used by Crosskey (1962) to distinguish between Aulacidae and Gasteruptiidae. Character 36. Fore wing vein ‘r-m’: 0) absent; 1) present. This character was used by Crosskey (1962) to distinguish between Aulacidae and Gasteruptiidae. Character 37. Fore wing vein 1-Rs+M: 0) joins at M+Cu, 1-R; 1) joins 1-M and 1-Rs; 2) fused – forms Rs+M+Cu(b). Jennings and Austin (1994b) discussed possible evolutionary pathways for this character. Character 38. Fore wing vein 2-M colour: 0) even; 1) pale apically; 2) pale basally. With state 2, the vein also becomes thinner apically. Character 39. Hind wing vein 1-Cu: 0) absent; 1) present. Character 40. Submarginal cell number in fore wing: 0) 2 or 3 cells; 1) 1 cell. This character was used by Crosskey (1962) to distinguish between Aulacidae and Gasteruptiidae. Character 41. Groove on hind coxa: 0) absent; 1) present. This character was used by Crosskey (1962) to distinguish between Aulacidae and Gasteruptiidae. Character 42. Groove on hind trochanter: 0) absent; 1) present. This character has been used by Crosskey (1962) and Jennings and Austin (1994b) to distinguish between Pseudofoenus and Eufoenus which lack a dorso-ventral groove on the hind trochanter and other hyptiogastrine

John T. Jennings and Andrew D. Austin 162


genera which have the groove. However, several described species of Eufoenus have a weak illdefined groove on either the dorso-lateral surface or restricted to the inner lateral surface. There is some doubt as to whether this is analogous to the groove in genera such as Crassifoenus, but in these species this state has been coded as 1. Character 43. Hind claw: 0) simple; 1) pectinate. These character states have been used by Townes (1950), Oehlke (1983) and others to distinguish between Aulacus and Pristaulacus (Aulacidae). In Aulacus, the claws are apparently simple, but each has a single basal tooth which is difficult to see (Townes 1950). In Pristaulacus, two or more teeth are found. Character 44. Hind tarsal segment 1: 0) without projection, symmetrical; 1) with lateral projection, highly asymmetrical. Character 45. Lateral projections on hind tarsal segments 2-4: 0) absent; 1) present. Character 46. Length of hind tarsal segments: 0) normal; 1) shortened. Jennings and Austin (1997b) have described shortened hind tarsal segments found in a small number of taxa. Character 47. Hind tibia with ventro-apical pecten of stout spines: 0) absent; 1) present. Character 48. Mid tibial notch: 0) absent; 1) present. The mid tibial notch is present in females of Crassifoenus (Jennings & Austin 1994a). Character 49. Prefemur on hind leg: 0) absent; 1) present. Character 50. Trochantellus on hind leg: 0) absent; 1) present. Character 51. Apical sternum: 0) incised; 1) not incised. Character 52. Digitus length compared with length of basiparameres (male): 0) digitus length < basiparameres; 1) digitus length ≥ basiparameres. Character 53. Metasomal insertion on propodeum: 0) low; 1) high. Character 54. Metasomal shape: 0) not sub-clavate; 1) sub-clavate. Character 55. Metasomal T1 and T2: 0) not fused; 1) fused. Character 56. Metasomal T1 longitudinal medial ridge or line: 0) absent; 1) present. Character 57. Ovipositor exsertion: 0) exserted; 1) not exserted. Of the hyptiogastrine wasps, only Hyptiogaster has exserted ovipositors (Jennings & Austin 1997a). Character 58. Ovipositor sheath margin: 0) smooth; 1) undulate or serrate. Crassifoenus species have ovipositor sheath margins that are either undulate or serrate (Jennings & Austin 1994a).

Higher-level Phylogeny of the Aulacidae and Gasteruptiidae (Hymenoptera: Evanioidea) 163

Appendix 2 Data matrix for 54 included taxa and 58 characters. Inapplicable data indicated by ‘-’. Taxon/Character

1

11111

11112

22222

22223

33333

33334

44444

44445

55555

555

12345

67890

12345

67890

12345

67890

12345

67890

12345

67890

12345

678

Schlettererius cinctipes

00010

00100

01100

21001

01001

10001

10110

01000

00000

01011

10000

110

Aulacus atriceps

11100

11000

01110

0-010

10102

00011

00010

01000

11000

00001

11101

010

Aulacus sp. 1

11100

11000

01110

0-010

10112

00011

00010

01000

11000

00001

11101

010

Aulacus sp. 2

11100

11000

01110

0-010

10102

00011

00010

01000

11000

00001

10101

010

Pristaulacus cinguiculatus

11100

01000

01110

10010

10102

00011

00010

01000

11100

00001

10101

010

Pristaulacus variegatus

11100

01000

01110

10010

10102

00011

00010

01000

11100

00001

10101

010

Pristaulacus sp. 1

11100

01000

01110

10010

10102

00011

00010

01000

11100

00001

11101

010

Gasteruption brachyurum

21110

00000

00001

20110

10110

00010

10111

10101

01000

01001

10111

010

Gasteruption fluviale

21110

00000

00001

20110

10111

00000

10111

10101

01000

01001

10111

010

Gasteruption spinigerum

21110

00000

01001

20110

10111

00000

11111

10101

01000

00001

10111

010

Gasteruption ?paradoxale

21110

00010

00001

20110

10111

00000

11111

10101

01000

01001

10111

010

Gasteruption sp. 1

21110

00100

00001

21110

10101

00010

10111

10101

01000

01001

10111

110

Aulacofoenus deletangii

21110

00100

00111

20110

10110

00010

11111

11201

01000

10000

00111

000

Aulacofoenus fallax

21110

00110

00111

21110

10110

00010

11111

11101

01000

00000

00111

000

Aulacofoenus fletcheri

21110

10111

00111

20110

10110

00000

10111

11101

01000

00000

00111

100

Aulacofoenus infumatus

21110

00100

00111

20110

10110

00010

10111

11201

01000

00000

00111

000

Aulacofoenus kurmondi

21110

00110

00111

21110

10100

00010

11111

11101

01000

10000

00111

000

Aulacofoenus marionae

21110

10110

00111

21110

10110

00000

10111

11101

01000

00000

00111

000

Aulacofoenus perenjorii

21110

00110

00111

20110

10110

00000

11111

11101

01000

00000

00111

100

Aulacofoenus thoracicus

21110

00110

00111

20110

10110

00010

11111

11101

01011

00000

00111

100

Aulacofoenus whiani

21110

00110

01111

21110

10110

00000

11111

11101

01000

00000

00111

000

Crassifoenus grossitarsis

21110

00110

11111

20110

10110

00010

11111

11111

01000

10100

00111

001

Crassifoenus houstoni

21110

00110

11111

20110

10110

00010

11111

11111

01000

10100

00111

001

Crassifoenus macronyx

21110

00110

11111

20110

10110

00010

11111

11111

01000

10100

00111

001

Eufoenus antennalis

21110

00110

00111

21110

10110

00010

11111

11101

01000

01000

00111

000

Eufoenus australis

21110

00110

00111

21110

10110

00010

11111

11101

00000 00&1000

00111

000

John T. Jennings and Andrew D. Austin 164


Taxon/Character

1

11111

11112

22222

22223

33333

33334

44444

44445

55555

555

12345

67890

12345

67890

12345

67890

12345

67890

12345

67890

12345

678

Eufoenus crassitarsis

21110

00110

00111

21110

10110

00000

10111

11101

00010

01000

00111

000

Eufoenus darwini

21110

00100

00111

21110

10110

00000

10111

11101

00011

00000

00111

000

Eufoenus extraneus

21210

00100

00111

21110

10110

00010

11111

11001

00000

01000

00111

000

Eufoenus ferrugineus

21110

00110

00111

21110

10110

00000

11111

11101

00000

01000

00111

000

Eufoenus floricolus

21110

00100

00111

21110

10110

00010

10111

11101

00000

01000

00111

000

Eufoenus inaequalis

21110

00110

00111

21110

10110

00000

11111

11101

00000

10000

00111

100

Eufoenus minimus

21110

00100

01111

20110

10110

00010

11111

11101

00000

01000

00111

000

Eufoenus patellatus

21110

00110

00111

21110

10110

00010

11111

11101

00000 00&1000

00111

000

Eufoenus pilosus

21110

00100

00111

21110

10110

00010

00111

11101

00000

00000

00111

000

Eufoenus rieki

21210

00110

00111

21110

10110

00010

10111

11101

00000

01000

00111

000

Eufoenus ritae

21110

10100

00111

21110

10110

00000

11111

11101

00000

01000

00111

000

Eufoenus spinitarsis

21110

00100

01111

21110

10110

00000

11111

11101

00011

00000

00111

000

Eufoenus sp. 1

21110

00100

00111

21110

10110

00000

11111

11101

00000

00000

00111

000

Eufoenus sp. 2

21110

00100

01111

21110

10110

00010

10111

11101

00010

00000

00111

000

Eufoenus sp. 3

21110

00100

01111

21110

10110

00010

10111

11101

00000

00000

00111

000

Eufoenus sp. 4

21110

00100

00111

21110

10110

000?0

??111

11101

00000

01000

00111

000

Eufoenus sp. 5

21110

00100

00111

21110

10110

00010

10111

11101

00000

01000

00111

000

Eufoenus sp. 6

21110

00110

00111

20110

10110

00010

11111

11001

00000

00000

00111

100

Eufoenus sp. 7

21110

10110

00111

21110

10110

00010

11111

11101

00000

00000

00111

000

Eufoenus sp. 8

21110

00110

00111

21110

10110

00000

10111

11001

00000

00000

00111

000

Eufoenus sp. 9

21110

10100

01111

21110

10110

00000

11111

11101

00011

00000

00111

000

Hyptiogaster arenicola

21110

00110

10111

21110

10100

00010

10111

11101

01000

01000

00111

010

Hyptiogaster humeralis

21111

00110

10111

21110

10110

01110

11111

11101

01000

10000

00111

010

Hyptiogaster kalbarrii

21111

00010

10121

21110

10100

01110

11111

11101

01000

00000

00111

010

Hyptiogaster pinjarregaensis

21110

00110

11111

21110

10100

00000

10111

11101

01000

01000

00111

010

Hyptiogaster rufus

21110

00010

10111

21110

10100

00000

10111

11101

01000

01000

00111

010

Pseudofoenus crassipes

21110

10110

00111

21110

10110

00010

11101

12101

00010

00000

00111

000

Pseudofoenus unguiculatus

21110

10110

00111

21110

10110

00010

10101

12101

00000

10000

00111

000

Monophyly and Relationship of the Genus Coelopisthia Foerster (Chalcidoidea: Pteromalidae) Hannes Baur Department of Invertebrates, Natural History Museum, Bernastrasse 15, CH-3005 Bern, Switzerland (email: [email protected])

Introduction The genus Coelopisthia Foerster, 1856, belongs to the subfamily Pteromalinae and is known from Europe (Askew 1980) through Middle Asia (Dzhanokmen 1978) to China (Yang 1996), and North America (Peck 1963). Twelve species are considered as valid by Noyes (1998 sub Kranophorus Graham) but examination of a large amount material from the Holarctic region revealed that there may be at least 15 species. Host records are rather scarce and include various Lepidoptera (Arctiidae, Geometridae, Noctuidae, Tortricidae) and Coleoptera (Curculionidae, Scolytidae) (Peck 1963; Graham 1969; Dzhanokmen 1978; Askew 1980; Yang 1996). A few species possibly attack their hosts as secondary parasitoids via other Hymenoptera (Ichneumonidae) (cf. Huber et al. 1996). Species of Coelopisthia have been readily recognised in the past by a combination of features (Graham 1956, 1969; Bouºek & Rasplus 1991; Bouºek & Heydon 1997) which include a protruding face at the level of the toruli, a large head with conspicuous temples, enlarged anelli with at least the second one subquadrate, reduced wing pilosity, and an almost circular gaster. Although these characters may well be diagnostic for the genus they have proved to be critical with respect to phylogenetic considerations. There are for instance many other genera within the pteromalines with which individual features are shared, e. g. enlarged anelli (Rhopalicus Foerster), a protruding face (Conomorium Masi, Diglochis Foerster), a roundish gaster (Cyclogastrella Bukowskii, Schizonotus Rutzeburg). Moreover, some species, like Coelopisthia pachycera Masi, deviate considerably from the above pattern in that the anelli are quite strongly transverse and the face is much less protruding. In the context of a revision of Holarctic species of Coelopisthia these findings thus led to open questions about monophyly and relationships. In order to determine the natural limits of the genus a cladistic analysis was performed of which the results are presented here. The study concentrated on identifying synapomorphies of Coelopisthia whereas the cladistic structure among its species was of secondary interest. It was also not intended to solve problems of monophyly and relationship of any other genera mentioned below, as these should be addressed in a more comprehensive study of the entire subfamily. N.B. The authors for genera and species are given in Appendix 1.

Materials and Methods The material examined in this study is deposited in the institutions listed in the Acknowledgements. Specimens were examined either under a stereo-microscope with a magnification up to 100 × or a scanning electron microscope (SEM). Individual parts were mounted on slides according to the method described by Noyes (1982) but with the use of Euparal instead of Canada balsam. Morphology and terminology follow Gibson (1997).

165

Hannes Baur 166

Figure 1


Strict consensus tree of 203 most parsimonious trees of a length of 67 steps (CI 0.67, RI 0.84). Taxon names abbreviated using the first three letters of genus and species name (cf. Appendix 3).

For the cladistic analysis 17 discrete morphological characters were scored for females of 44 species in 16 genera (see Appendices 1–3). These taxa could be united into 30 groups by the «search & merge» routine in MacClade (Maddison & Maddison 1992) before the analysis. Multistate characters were not polarised and treated as unordered, and multistate taxa as polymorphic. A parsimony analysis was performed using PAUP 3.1.1 (Swofford 1993). Because of the large size of the data matrix the heuristic search method was employed using random addition sequences with 50 replicates and TBR branch swapping. The search was repeated five times and always found the same set of most parsimonious trees. Consensus trees were computed with PAUP but the final trees were edited in MacClade.

Phylogenetic Analysis The selection of taxa for the ingroup and outgroup was difficult, since the phylogenetic relationships within and among Pteromalinae have not yet been investigated. Graham’s (1969) monumental revision of the species of north-western Europe is the last comprehensive treatment of the subfamily at the species level but dates from a pre-cladistic era. Although the work offers plenty of information, and the genera are apparently arranged according to some supposed relationship, no statements can be found with regard to their particular classification. The Dibrachysgroup of Wallace (1973) simply lumps several genera of Pteromalinae in a more or less artificial manner. Bouºek’s (1988) account on the Australasian fauna which I will follow here is more informative with respect to some lower levels (tribes) but covers few of the potentially useful genera. In an attempt to find a sound starting point for the analysis, exemplars of an array of genera within the tribe Pteromalini were therefore chosen for the ingroup (Appendices 1, 3). These taxa are characterised by having the postmarginal vein only about as long as the stigmal vein. Considering the rest of Pteromalinae and the probably closely related Miscogastrinae (Boucek 1988; Bouºek & Rasplus 1991) as outgroups, a reduced postmarginal vein may appear as a possible synapomorphy of those genera. There are, however, some exceptions in pteromalines: species of Meximalus Bouºek, Ptinocida Bouºek, Hemadas Bouºek (cf. Bouºek & Heydon 1997), and certain Mesopolobus Westwood (e.g. M. adrianae Gijswijt) also have a shortened postmarginal vein but are likely to be only distantly related and were not included in the analysis. Coe-

Monophyly and Relationship of the Genus Coelopisthia Förster (Chalcidoidea: Pteromalidae) 167

Figure 2

Section of strict consensus tree (Fig. 1) showing distribution of character state changes in Coelopisthia s.l. and Diglochis.

lopisthia s.l. (cf. Appendix 1) comprised 12 species of which C. pachycera, C. sp. D, and C. sp. F were tentatively placed in the genus. The latter deviate more or less from the general pattern of Coelopisthia and their position on the tree was therefore subjected to a test in the analysis. Following Yeates (1995) the choice of representatives for the other large genera consisted of a mixed sample of supposed basal and derived taxa. The same applied to the outgroup taxa with respect to the ingroup. Pachyneuron is possibly close to the ingroup and shows many derived traits, while Rhopalicus would be expected to split off at the base of Pteromalini. Janssoniella and Plutothrix are currently classified in the tribe Trigonoderini, while Rhicnocoelia belongs to the Miscogastrinae. Adult females of each species (see Appendix 1) were examined for discrete morphological characters. Males were not available for many species and were therefore excluded from the analysis. For some of the features it was not possible to define discrete states, since the underlying structure varied continuously. This led to the exclusion of much potentially useful information, sometimes to fusion of states. Some of these characters were nevertheless retained for the analysis and were broken arbitrarily into different states (marked with *). Furthermore, where characters appeared to be correlated they were treated as one character with a number of states (e. g. characters 4, 12). Eventually, a total of 17 characters were scored and are described in Appendix 2. Analysis of the reduced data matrix yielded more than 200 most parsimonious trees. This large number was probably caused by insufficient data available to resolve some of the taxa. These groups show numerous polytomies, some of them with many branches, in the strict consensus tree (Fig. 1). However, the latter is most revealing with regard to the initial questions about monophyly and relationship of Coelopisthia (Fig. 2). Diglochis appeared as the sister group of Coelopisthia s.l. based on the mouth margin being straight before its junction with the malar sulcus (2.0, Fig. 4), and the anterior part of the plicae strongly bent inwards (12.2, Fig. 10). Both character states appeared only once on the tree. It should be noted, however, that these states are independently derived in C. pachycera (12.1, Fig. 9) and some species of Diglochis (12.4, Fig. 11).

Hannes Baur 168

Figures 3–12


3) mouth margin (MM) and malar sulcus (MS) of Conomorium amplum; 4) mouth margin (MM) and malar sulcus (MS) of Coelopisthia pachycera; 5) occipital carina absent in Conomorium amplum; 6) occipital carina (OC) present in Coelopisthia extenta; 7, 8) distal edge (DE) of first left antennal anellus: 7) Dibrachys cavus; 8) Coelopisthia sp. L.; 9) anterior plica (AP) and posterior plica (PP) of Coelopisthia pachycera; 10) anterior plica and posterior plica of Coelopisthia extenta; 11) anterior plica and posterior plica of Diglochis sylvicola; 12) anterior plica and posterior plica of Cyclogastrella clypealis. Scale lines = 0.1 mm.


Coelopisthia s.l. (i. e. the above mentioned doubtfully placed species C. pachycera, C. sp. D, and C. sp. F plus the rest of the genus) is characterised by the presence of a laminate edge at the distal end of the first anellus (4.1, Fig. 8) and the particular shape of the third flagellar segment (7.1), both uniquely derived. The latter species except C. sp. D, finally shows a laterally weakly developed and medially almost effaced occipital carina (Fig. 6) as a synapomorphy.

Discussion The above results confirm to some extent the works of earlier studies (Bouºek & Rasplus 1991, Graham 1956, 1969). On the other hand there are some differences which may reflect a shift in focus. One aim of this study was then to transform earlier claims into some precise hypothesis on character state distribution and sister group relationship using cladistic methodology. This is particularly illuminating with regard to characters and the formulation of separate states. For instance Graham’s (1969) mentioning of the anelli being large is certainly true as these are larger in Coelopisthia than in many other genera and somehow ‘different’. But as discussed above, size alone was not the decisive criterion, since other and sometimes similar species shared this feature, too. What matters was the laminate edge on the distal end of the first anellus, evidently a synapomorphy of those species. Moreover, some important characters have also gone unnoticed in the past. One of them concerns the occipital carina, an autapomophy of Coelopisthia s.str. According to Graham (1956) those species show no carina but only a slight edge due to the abrupt angle by which the vertex turns into the occiput. Close examination nevertheless revealed that a weak carina was always indicated laterally below the transition from the vertex to the occiput (Fig. 6). The condition described by Graham is present in species of Conomorium where no carina was discernible (Fig. 5). The species which were initially regarded as doubtfully placed in the genus must now be considered differently. C. pachycera and C. sp. F were unified in a polytomy with Coelopisthia s.str. and therefore caused no problem. On the other hand, C. sp. D, an undescribed North African species, was shown to be the single sister taxon of the latter clade. That species differed considerably from all other species and showed many highly derived features. It might therefore be considered as belonging to a separate genus by many workers. However, it still shared two synapomorphies (4.1, 7.1) and was equally supported as the sister group on all of the trees. This and a certain discomfort with the creation of a generic name for a single species, particularly in a group where according to Grissell & Schauff (1990) about half of the Nearctic genera alone were monotypic, led to the inclusion of C. sp. D in Coelopisthia. Based on this broader concept the genus is thus characterised as follows: body generally squat; head large with conspicuous temples, more or less protuberant at level of toruli; antenna with both anelli enlarged, also the first anellus with a laminate edge at the distal end, third flagellar segment with one row of longitudinal sensilla confined to distal half; fore wing broad, wing disk slightly to very distinctly vaulted, sometimes darkened, sparsely pilose, without marginal setae; marginal and postmarginal vein slightly removed from wing margin, postmarginal vein from slightly shorter than to as long as stigmal vein; plica of propodeum with anterior part often strongly bent inwards and sometimes reaching adpetiolar strip, posterior part distinct and sometimes reaching anterior part or spiracles; median carina of propodeum effaced in the middle or irregular; gaster almost circular, broader than mesosoma. Finally, the sister group relationship of Coelopisthia and Diglochis is most interesting concerning their hosts. Species of Coelopisthia, Conomorium and Cyclogastrella are known to attack mostly

Hannes Baur 170


Lepidoptera (occasionally Coleoptera in some Coelopisthia) while Diglochis was reared exclusively from tabanid flies (Noyes 1998). The strict consensus tree suggests that there was a host switch from Lepidoptera to Diptera in the ancestor of Diglochis. How this different preferences came into existence can not be the subject of this study but probably led to the apparent differentiation of many features in those taxa (cf. Graham 1969).

Acknowledgements I am indebted to Karl Babl, Peter Eggli, and Werner Graber, Institute of Anatomy, University of Bern, Bern, Switzerland, for access to the SEM and their kind help with mounting specimens and taking micrographs. I am most grateful to my colleagues Elsa Obrecht and Christian Kropf, both of the Natural History Museum, Bern (NMBE), for useful comments on the manuscript. Finally, I thank the following persons and institutions for the loan of specimens: John S. Noyes, The Natural History Museum, London, UK (BMNH); John T. Huber, Canadian National Collection of Insects and Arachnids, Ottawa ON, Canada (CNCI); Csaba Thuróczy, Hungarian Natural History Museum, Budapest, Hungary (HNHM); Da-Wei Huang and Hui Xiao, Institute of Zoology, Chinese Academy of Sciences, Beijing, China (IZAS); Ivan Löbl, Muséum d’histoire naturelle, Geneva, Switzerland (MHNG); Stefan Schödl, Naturhistorisches Museum, Vienna, Austria (NMW); Lars-Åke Janzon, Naturhistoriska Riksmuseet, Stockholm, Sweden (NRS); Kazuaki Kamijo, Laboratory of Systematic Entomology, Hokkaido University, Sapporo, Japan (SEHU); E. Eric Grissell, National Museum of Natural History, Washington DC, USA (USNM); Zdenæk Bouºek, Flackwell Heath, UK (ZB).

References Askew, R. R. (1980) The European species of Coelopisthia (Hymenoptera: Pteromalidae). Systematic Entomology 5: 1-6. Boucˇek, Z. (1988) Australasian Chalcidoidea (Hymenoptera) – A Biosystematic Revision of Genera of Fourteen Families, with a Reclassification of Species. C.A.B. International, Wallingford. Boucˇek, Z. & Heydon, S. L. (1997) Pteromalidae. pp. 541-692. In Gibson, G. A. P., Huber, J. T. & Woolley, J. B. (Eds) Annotated Keys to the Genera of Nearctic Chalcidoidea (Hymenoptera). NRC Research Press, Ottawa. Boucˇek, Z. & Rasplus, J.-Y. (1991) Illustrated Key to West-Palearctic Genera of Pteromalidae (Hymenoptera: Chalcidoidea). Institut National de la Recherche Agronomique, Paris. Dzhanokmen, K. A. (1978) Hymenoptera III. Chalcidoidea 5. Pteromalidae. Opredelitel’ Nasekomikh Evropeyskoy Chasti SSSR57-228 [in Russian]. Gibson, G. A. P. (1997) Morphology and terminology. pp. 16-44. In Gibson, G. A. P., Huber, J. T. & Woolley, J. B. (Eds) Annotated Keys to the Genera of Nearctic Chalcidoidea (Hymenoptera). NRC Research Press, Ottawa. Graham, M. W. R. de V. (1956) A revision of the Walker types of Pteromalidae (Hym., Chalcidoidea). Part 2 (including descriptions of new genera and species). Entomologist’s Monthly Magazine 92: 246-263. Graham, M. W. R. de V. (1969) The Pteromalidae of North-Western Europe. Bulletin of the British Museum (Natural History) Entomology, Supplement 16: 1-908. Grissell, E. E. & Schauff, M. E. (1990) A Handbook of the Families of Nearctic Chalcidoidea (Hymenoptera). Entomological Society of Washington, Handbook No. 1.


Huber, J. T., Eveleigh, E., Pollock, S. & McCarthy, P. (1996) The chalcidoid parasitoids and hyperparasitoids (Hymenoptera: Chalcidoidea) of Choristoneura species (Lepidoptera: Tortricidae) in America North of Mexico. Canadian Entomologist 128: 1167-1220. Maddison, W. P. & Maddison, D. R. (1992) MacClade: Analysis of Phylogeny and Character Evolution. Version 3.07. Sinauer Associates, Sunderland, Massachusetts. Noyes, J. S. (1982) Collecting and preserving chalcid wasps (Hymenoptera: Chalcidoidea). Journal of Natural History 16: 315-334. Noyes, J. S. (1998) Catalogue of the Chalcidoidea of the World. Biodiversity Catalogue Database and Image Library CDrom series. ETI Biodiversity Center, Amsterdam. Peck, O. (1963) A catalogue of the Nearctic Chalcidoidea (Insecta: Hymenoptera). Canadian Entomologist, Supplement 30: 1-1092. Swofford, D. L. (1993) PAUP: Phylogenetic Analysis Using Parsimony. Version 3.1.1. Illinois Natural History Survey, Champain. Wallace, G. E. (1973) New Pteromalidae of the Dibrachys group (Hymenoptera: Chalcidoidea) with a key to genera. Annals of the Carnegie Museum 44: 171-181. Yang, Z. (1996) Parasitic Wasps on Bark Beetles in China. Science Press, Beijing. Yeates, D. K. (1995) Groundplans and exemplars: paths to the tree of life. Cladistics 11: 343-357.

Hannes Baur 172


Appendix 1 List of material used in the analysis. Information on each species is arranged as follows: species, number of females, distribution, depository (N = Nearctic, P = Palearctic; see acknowledgements for abbreviation of acronyms). Coelopisthia Foerster areolata Askew [>10; P – Austria, Czech Rep., Switzerland; MHNG, NMBE, NMW, ZB] sp. B = sp. indet. [>10; N – Arkansas, Tennessee; CNCI, USNM] bicarinata Girault [3; N – Maryland, Montana; USNM] sp. C = sp. indet. [3; N – Florida, Virginia; USNM] caledonica Askew [>10; P – Scotland, Switzerland; BMNH, NMBE] sp. D = sp. indet. [2; P – Algeria; MHNG] extenta (Walker) [>10; P – Germany, England, Switzerland; BMNH, NMBE, NMW] sp. F = sp. indet. [3; P – Nepal, China; CNCI, IZAS] fumosipennis Gahan [10; N – Ontario, Florida, Montana; CNCI, USNM, ZB] sp. L = sp. indet. [6; P – Japan; SEHU] pachycera Masi [>10; P – England, Italy, Switzerland; BMNH, MHNG, NMBE] suborbicularis (Provancher) [>10; N – Canada, USA; CNCI, USNM, ZB] Conomorium Masi amplum (Walker) [10; P – Italy, Switzerland; MHNG, NMBE] patulum (Walker) [9; P – Sweden, Switzerland; NMBE, NRS] sp. indet. [2; P- Morocco; MHNG] Cyclogastrella Bukowskii clypealis Bouºek [>10; P – France, Morocco, Switzerland; NMBE] simplex (Walker) [= deplanata (Nees)] [8; P – Switzerland; NMBE] flavius (Walker) [4; P – Switzerland; NMBE] Dibrachoides Kurdjumov dynastes (Foerster) [9; P – Morocco, Sweden; NMBE, NRS] Dibrachys Foerster affinis Masi [4; P – Serbia; MHNG] boarmiae (Walker) [6; P – Switzerland; NMBE] cf. braconidis (Ferrière & Faure) [7; P – Switzerland; NMBE] cavus (Walker) [6; Cosmopolitan; Switzerland; NMBE] confusus (Girault) [2; N – Wisconsin; USNM] pelos Grissell [2; N – Connecticut; USNM] Diglochis Foerster sp. A = sp. indet. [1; P – Hungary; HNHM] sp. B = sp. indet. [1; P – Hungary; HNHM] occidentalis (Ashmead) ) [2; N – Colorado; USNM] sylvicola (Walker) [8; P – Switzerland, Hungary; HNHM, MHNG, NMBE]


Duartea Boucˇek daphne (Girault) [3; N – California; BMNH, USNM] Janssoniella Kerrich sp. indet [1; P – Switzerland; NMBE] Pachyneuron Walker formosum (Walker) [>10; P – England, Switzerland; MHNG, NMBE] muscarum (L.) [5; P – Switzerland; NMBE] Plutothrix Foerster bicolorata (Spinola) [2; P – Switzerland; NMBE] obtusiclava Graham [1; P – Switzerland; NMBE] Rhicnocoelia Graham constans (Walker) [8; P – Switzerland; NMBE] Rhopalicus Foerster tutela (Walker) [>10; P – Switzerland; NMBE] Schizonotus Ratzeburg sieboldi Ratzeburg [6; P – Hungary, Switzerland; HNHM, NMBE] Stichocrepis Foerster armata Foerster [3; P – Hungary; HNHM] Systellogaster Gahan gahani Wallace [2; N – Montana; USNM] ovivora Gahan [3; N – USA, Vienna, Va; USNM] Tritneptis Girault doris Burks [4; N – Arizona; USNM] hemerocampae Girault [3; N – New Jersey, Connecticut; USNM] sp. indet = ?klugii (Ratzeburg) [6; P – Switzerland; NMBE]

Hannes Baur 174


Appendix 2 Characters and character states († and †† refer to SEM micrographs published in Bouºek & Rasplus (1991) and Huber et al. (1996), respectively; see comments in text for asterisks). 1.

*Level of toruli (frontal view with lower edge of median ocellus and of toruli equidistant to the objective): upper edge below (0); upper edge at or above (1); lower edge at or above ocular line (2).

2.

Mouth margin before conjunction with malar sulcus: straight with weak fovea above (0) (Fig. 4); curving with weak fovea above (1) (Fig. 3); curving with fovea reaching halfway along malar sulcus (2).

3.

Occipital carina: absent (0) (Fig. 5); weakly developed laterally, more or less effaced medially, curving, high (1) (Fig. 6); distinct throughout, curving, high (2) (Fig. †29); distinct throughout, straight, low (3) (Fig. †30); weakly developed medially along edge formed by vertex and occiput (4); as 1 but traceable medially, longer, and more curving (5); absent but distinct edge in the middle quarter formed by vertex and occiput (6); distinct throughout, curving, low (7).

4.

First anellus: laminate edge on distal end absent (0) (Fig. 7); laminate edge on distal end present (1) (Fig. 8).

5.

Third flagellar segment, shape: conical (0); cylindrical (1); with constricted neck at base (2).

6.

Third flagellar segment, arrangement of longitudinal sensilla: absent (0); in one row (1); in two or more rows (2).

7.

Third flagellar segment, distribution of longitudinal sensilla: distributed over distal two thirds to base (0); confined to distal half (1); confined to distal quarter (2).

8.

Micropilosity on clava: present on third segment only (0); present on all segments (1); present on second and third segment (2).

9.

Pronotal collar: bluntly ridged medially (0); sharply carinate medially (1); evenly rounded (2).

10. Position of marginal and postmarginal vein: right along wing margin (0); slightly removed from wing margin (1). 11. *Length of postmarginal vein: about as long as stigmal vein (0); distinctly longer than stigmal vein (1). 12. Plica, anterior (AP) and posterior part (PP): AP sharp, moderately curving, reaching halfway along propodeum (PPD), PP hardly traceable (0); like 0 but PP distinctly developed (Fig. 9) (1); AP sharp, strongly curving, often reaching adpetiolar strip, PP distinct, sometimes reaching AP or spiracles (Fig. 10, ††20) (2); AP and PP sharp and smoothly joining to form a moderately sinuate edge, AP sometimes forming a costula (3) (Fig. 12); like 2 but AP pointing backwards (4) (Fig. 11); AP blunt, weakly curving, PP distinct (5) (Fig. ††21); AP hardly developed, PP distinct (6); like 6 but PP almost reaching spiracles (7); AP sharp, strongly bent inwards and joining median carina at base, PP distinct (8). The above anterior and posterior parts of plica are collectively referred to as one ‘plica’ or ‘plical carina’ in all major textbooks (e. g. Graham 1969; Boucek 1988; Gibson 1997). However, close examina-


tions revealed that it consists of an anterior and a posterior part. Even where both parts form a seemingly continuous edge (Fig. 12), a small break was always detectable. On the other hand, where a cross carina known as ‘costula’ was indicated, that was formed by the anterior part of plica curving inwards. 13. Median carina of PPD: straight, distinct throughout (0) (Figs 11, 12); irregular and/or effaced medially (1) (Figs 9, 10). 14. Pilosity on callus of PPD: reaching below spiracles (0); not reaching below spiracles (1). 15. Petiole surface structure: alutaceous to weakly reticulate without median carina (0); smooth with indistinct median carina (1); smooth with strong median carina (2). 16. Proximal edge of gastral tergum one: lateral laminate borders fused medially (0); borders just touching medially (1); borders separate (2). 17. Placement of cerci on metasomal tergum eight: ventro-laterally (0); dorsally (1).

Hannes Baur 176


Appendix 3 Data matrix of character states for 44 species of 16 genera. Taxa arranged according to their appearance on the strict consensus tree (Fig. 1). Coelopisthia areolata

1 0 1 1 0 1 1 0 0 1 0 2 1 0 1 0 0

C. sp. B

1 0 1 1 0 1 1 0 0 1 0 2 1 0 1 0 0

C. sp. F

1 0 1 1 0 1 1 0 0 1 0 2 1 0 1 0 0

C. extenta

0 0 1 1 0 1 1 0 0 1 0 2 1 0 1 0 0

C. bicarinata

0 0 1 1 0 1 1 0 0 1 0 2 1 0 1 0 0

C. sp. C

0 0 1 1 0 1 1 0 0 1 0 2 1 0 1 ?

C. fumosipennis

0 0 1 1 0 1 1 0 0 1 0 2 1 0 1 0 0

0

C. sp. L

0 0 1 1 0 1 1 0 0 1 0 2 1 0 1 0 0

C. suborbicularis

0 0 1 1 0 1 1 0 0 1 0 2 1 0 1 0 0

C. caledonica

0 0 1 1 0 1 1 0 0 1 0 2 1 0 1 0 0 1

C. pachycera

1 0 1 1 0 1 1 0 0 1 0 1 1 0 1 0 0

C. sp. D

1 0 0 1 0 1 1 0 1 1 0 2 1 0 1 0 0

Diglochis occidentalis

1 0 5 0 0 0 ?

1 0 0 0 2 0 1 2 0 0

D. sp. A

1 0 5 0 0 0 ?

1 0 0 0 4 1 1 2 0 0

D. sp. B

1 0 5 0 0 0 ?

1 0 0 0 4 1 1 2 0 0

D. sylvicola

1 0 5 0 0 0 ?

1 0 0 0 4 0 1 2 0 0

Conomorium amplum

1 1 0 0 2 1 2 0 0 0 0 0 0 1 0 0 0

C. patulum

2 1 0 0 2 1 2 0 0 0 0 0 0 1 0 0 0

C. sp.

1 1 0 0 2 1 2 0 0 0 0 0 0 1 0 0 0 2 1

Cyclogastrella clypealis

2 1 0 0 0 0 ?

0 2 0 0 3 0 0 1 0 0 1

C. flavius

2 1 0 0 0 0 ?

0 2 0 0 3 0 0 1 0 0 1

C. simplex

1 1 0 0 0 0 ?

0 2 0 0 3 0 0 1 0 0 1

Dibrachys confusus

1 1 2 0 1 1 0 0 2 0 0 3 0 1 1 2 0

Dibrachoides dynastes

2 2 4 0 1 1 0 0 1 0 0 5 1 1 1 1 0

Dibrachys affinis

2 1 3 0 1 1 0 0 0 1 0 3 1 1 1 2 0

D. boarmiae

2 1 2 0 1 1 0 0 2 1 0 5 1 1 1 2 0

D. cavus

2 1 2 0 1 1 0 0 2 1 0 5 1 1 1 2 0

D. braconidis

2 1 2 0 1 1 0 0 2 0 0 5 1 1 1 2 0

D. pelos

1 1 2 0 1 1 0 0 2 1 0 5 1 1 1 2 0

Duartea daphne

2 2 7 0 1 1 0 2 2 0 0 5 1 1 1 2 0

Schizonotus sieboldi

2 2 0 0 1 1 0 0 2 1 0 3 0 1 1 1 1 1

Stichocrepis armata

0 1 0 0 1 1 0 0 2 1 0 8 1 1 1 0 0

Systellogaster ovivora

2 1 6 0 1 1 0 0 2 1 0 5 1 1 1 2 0

S. gahani

2 1 6 0 1 1 0 0 2 1 0 5 1 1 1 2 0

Tritneptis doris

0 1 0 0 1 1 0 0 2 1 0 3 1 1 1 2 0


T. hemerocampae

1 1 0 0 1 1 0 0 2 1 0 5 1 1 1 2 0

T. sp.

1 1 0 0 1 1 0 0 2 1 0 3 1 1 1 2 0

Janssoniella sp.

2 1 0 0 1 2 0 0 2 0 1 7 0 1 1 2 0

Rhicnocoelia constans

2 1 0 0 1 2 0 0 2 0 1 7 0 1 1 ?

Plutothrix bicolorata

2 1 0 0 1 2 0 0 1 0 1 7 0 1 1 2 0

P. obtusiclava

2 1 0 0 1 2 0 0 1 0 1 7 0 1 1 2 0

Rhopalicus tutela

2 1 0 0 1 2 0 0 2 0 1 6 0 1 1 2 0

0

Pachyneuron formosum

2 1 0 0 1 1 0 0 1 0 1 5 1 1 0 2 1

P. muscarum

2 1 0 0 1 1 0 0 1 0 1 5 1 1 0 2 1

A Preliminary Phylogeny for the Baeini (Hymenoptera: Scelionidae): Endoparasitoids of Spider Eggs Muhammad Iqbal and Andrew D. Austin Department of Applied and Molecular Ecology, Waite Campus, The University of Adelaide, P.M.B. 1 Glen Osmond, S. A. 5064 Australia (email: [email protected])

Introduction The Scelionidae is a highly speciose family of small parasitic wasps that exclusively oviposit into the eggs of their hosts. They have exploited most orders of insects and spiders, and show a high level of host group specificity in that most tribes of scelionids are associated with specific host groups, e.g. Orthoptera, Mantodea, Heteroptera, Embioptera, Coleoptera, Lepidoptera (Austin & Field 1997). One tribe, the Baeini, many of which are less than 1 mm in length (Fig. 1), are obligate endoparasitoids of the eggs of spiders and are the only group of scelionids to utilise this host group (Austin 1985). They are ubiquitous in most habitats and are postulated to be important regulating agents of spider populations (Austin 1984). The tribe is one of the most easily recognised groups of scelionid wasps, because of the strongly clavate antenna in females, and the often bizarre, elongate metasomal horn of some genera, viz. Odontacolus Kieffer and Ceratobaeus Ashmead (Figs 2, 3). Taxonomically, baeine wasps are well-known at the generic level (e.g. Galloway & Austin 1984), but the species are poorly documented with only 10–20% being described for Australasia (Iqbal & Austin 1997) and less than this on a world-wide basis. The monophyly of the Baeini is supported by several characters, none of which are unequivocal. These include the terminal four segments of the female antenna being fused into a compact clava, the mandible being tridentate, and the antennal scape not reaching to the level of the vertex (Austin & Field 1997). A number of genera are putatively monophyletic and have identifiable synapomorphies: for instance Baeus Haliday and Mirobaeoides Dodd are apterous, with a fusiform body and greatly reduced metanotum (Figs 1 & 8); Hickmanella Austin has long, sparse pilosity covering the body; while Odontacolus and Cyphacolus Priesner have a laterally compressed metasomal horn. However, the monophyly of most genera is questionable, particularly the two largest genera, Idris Foerster and Ceratobaeus, which comprise the majority of described species. To date, the Baeini have not been exposed to phylogenetic analysis. The present study arose from a detailed taxonomic revision of Australasian Ceratobaeus (Iqbal & Austin 2000). Previous authors have treated this genus synonymously with or as a subgenus of Idris (Huggert 1979; Johnson 1992; Masner & Denis 1996). Although Ceratobaeus is easily recognised by the development of a hump or cylindrical horn on the first metasomal tergite, it is also possible that this character has arisen independently within several lineages of Idris. This study aimed to test the monophyly of Ceratobaeus in relation to other genera of Baeini, and generate a preliminary phylogeny for the tribe that could be used to support future work on the systematics, zoogeography and host relationships of the group. Note that the authors of species referred to in the text are given in Appendix 2.

178


A Preliminary Phylogeny for the Baeini (Hymenoptera: Scelionidae) 179

Materials and Methods Material examined and terminology Specimens for SEM were cleaned in a dilute pure soap solution (5%), rinsed in distilled water and dehydrated in an alcohol series. They were then mounted on card-points with water based seccotine glue; cards were secured to SEM stubs with carbon-based plasticine (Leitz-C-Plast), coated with gold to a thickness of 300–400 angstroms, and examined under a Phillips XL30 field emission SEM using secondary electron imaging at 10 kv. The external morphology of scelionids is outlined in Masner (1979, 1980), Galloway & Austin (1984), and Masner and Denis (1996). Terminology and measurements for body parts and wing venation are detailed in Iqbal (1998) and Iqbal and Austin (2000). Abbreviations used in the text are as follows: ANIC, Australian National Insect Collection, Canberra; CNCI, Canadian National Collection of Insects, Ottawa; WARI, The University of Adelaide Collection, Adelaide. Phylogenetic analysis Exemplar taxa from all recognised baeine genera, including the type-species of some of these genera, comprised the in-group. Species of Ceratobaeus and Idris were selected to represent at least part of the apparent morphological variation evident with these two very large genera. Seventeen species of Ceratobaeus, eight species of Idris, four species each of Baeus, Mirobaeoides, Odontacolus, two species of Hickmanella, and one species each of Mirobaeus Dodd, Neobaeus Austin, Apobaeus Masner, Anabaeus Oglobin, Cyphacolus and Echthrodesis Masner, were included (voucher material in WARI). Five additional species were also included that could not be reliably placed into existing genera in an attempt to determine their phylogenetic status. These species are referred to as Genus 1–5, of which Genus 1–3 are from Australia (voucher material in ANIC, WARI), and Genus 4 and 5 are from South Africa (voucher material in CNCI and WARI). Four out-group taxa were employed separately for initial parsimony analyses. These were Sparasion L. and Nixonia Masner, which are plesiomorophic and postulated to be basal to most if not all other scelionid genera, and Embidobia Ashmead and Gryon Haliday which represent members of putative sister tribes (Masner 1976; Austin & Field 1997). Thirty-five morphological characters were selected as potentially informative (Appendix 1). Characters were scored only for females as this sex displays substantially more morphological variability than males. Males from different genera are very similar to each other and generally lack characters informative at higher taxonomic levels (Galloway & Austin 1984). Further, it has not been possible to associate the sexes for most species of Baeini. Where possible, characters were divided into binary states to avoid hierarchical linkage and the problem of scoring of nonapplicable states. The morphometric characters 32, 33, and 34 were coded using gap coding while character 35 was coded using segment coding (Chappill 1989). Gap coding was used when there were obvious gaps present in the character distribution among taxa. The procedure adopted for gap coding was as follows: measurements were undertaken for a particular character and the mean value calculated for each species. If only a single specimen was available its measurement was used in place of the mean. A graph of mean values for all taxa was then prepared, significant gaps identified in the distribution of means (see Iqbal 1998), and different states assigned to taxa by considering these gaps as boundaries to separate states. For continuous data, segment coding was adopted. The mean values of measurements were arranged in ascending order and then one standard deviation value was added to the minimum mean value in the table. All taxa equal or less than the added value were coded with the one state. This process was continued until the last mean value was assigned to a segment.

Muhammad Iqbal and Andrew D. Austin 180


PAUP (Phylogenetic Analysis Using Parsimony) version 3.1.1 (Swofford 1993) and various test versions of PAUP* 4 for Power Macintosh and UNIX (Swofford 1998) were used for all parsimony-based analyses, while MacClade 3.07 (Maddison & Maddison 1997) was employed to input the data matrix (Appendix 2) in spreadsheet format and to trace character distribution on trees. AutoDecay 2.9.8 (Eriksson 1997) was used to calculate decay values and the resulting trees were viewed and printed using TreeView 1.4 (Page 1997). Due to the large size of the data matrix only heuristic searches were undertaken, using the Random Addition Sequence and TBR branch swapping options in PAUP. Uninformative characters (constant and autapomorphic) were excluded before analysis. Characters were weighted equally irrespective of the number of states. Ten trees were held at each step to minimise the effect of ties early in the stepwise addition process. Trees were rooted using the out-group taxa discussed below, so that the in-group was always monophyletic. Bootstrap (Felsenstein 1985) and Bremer support (Bremer 1994) analysis were undertaken as a measure of tree fitness. Bootstraps were calculated by using 10 000 replicates and saving a single tree in each bootstrap using ‘fast’ swap option of PAUP* 4. This strategy was used to decrease analysis times, and is likely to have underestimate bootstrap support. As such, it is a conservative measure of clade support. To explore the effect of grouping particular species or characters, they were constrained using PAUP* and the corresponding tree lengths and topology compared.

Results Analyses using either Sparasion or Nixonia as the out-group were unsatisfactory given they reached a tree buffer overflow and so there was no certainty that the most parsimonious trees had been attained. Those derived from Embidobia as the out-group did reach a parsimonious solution (length 151 steps) but the resulting strict consensus tree (not shown here) was largely comb-like and uninformative for discussing relationships among the Baeini. The reason for this is not clear, given that the Embidobiini is the postulated sister tribe to the Baeini (Austin & Field 1997). However, possibly this genus is too derived within the tribe and convergently shares too many character states with some members of the in-group, a problem that could only be overcome by expanding the number of informative characters and/or including a wider range of taxa from the Embidobiini. Analysis of the data-set using Gryon as the out-group generated 80 shortest trees of 147 steps (CI = 0.25; RI = 0.66). The resulting strict consensus tree (Fig. 9) is relatively well-resolved but few clades are supported by unequivocal characters states and, accordingly, bootstrap and Bremer support is low for most branches on the tree. However, the results serve as a framework to discuss a number of postulated relationships and as a basis for further studies. Significantly, there is no support for the monophyly of Idris s. str. or for Idris s. l. (i.e. with the inclusion of Ceratobaeus spp.). Species of Idris s. str. fall out in several major clades resolved in this analysis, together with other baeine genera (e.g. clades 2, 4 and 12: Fig. 9), or separately in the two clades below node 7 (i.e. Idris theridii, I. seminitidus and I. helpidid). Members of Ceratobaeus are mostly contained within clade 8 which is supported by two homoplasious characters; T1 having a metasomal horn (Character 21:1) and humeral sulcus being crenulate (character 11:1). However, two species fall outside this clade: C. setosus is the sister to all reduced-winged and apterous baeines (clade 12), while Ceratobaeus sp. 1 is the sister to Idris sp. 2 + Hickmanella (clade 2). The position of C. intrudae is unclear in that this species forms a tricotomy with clades 8 and 12. Constraining all Ceratobaeus, all Idris s. str. and all Idris s. str. + Ceratobaeus (i.e. Idris s. l.)


Figures 1-8

Micrographs showing different characters in Baeini: 1) Baeus sp., female showing attachment of metasoma and aptery; 2) Ceratobaeus flavipes, female showing wing flaps and metasomal horn; 3) Ceratobaeus leai, female showing wing flaps and metasomal horn; 4) Genus 1, female showing metasomal horn; 5) Genus 3, female showing wing pads; 6) Genus 5, female showing attachment of metasoma; 7, 8) Mirobaeoides pecki: 7) female showing hind leg femoral spines; 8) male showing wing development. Scale lines: 1, 2, 4–6, 8 = 100 µm; 3 = 200 µm; 7 = 50 µm.



requires 3, 4 and 5 additional steps, respectively, indicating that none of these hypotheses can be supported over the shortest tree depicted in Figure 9. However, these analyses all resulted in a tree buffer overflow and so there is no guarantee that the shortest trees were obtained. Hickmanella (clade 3) is supported by one unequivocal character state, the frontal carina reaching the median ocellus (character 2:2), while Hickmanella + Ceratobaeus sp. 1 and Idris sp. 2 (clade 2) is supported by having five funicle segments (character 5:0) and the antennal clava segmented (character 7:0). However, these latter two states are also found independently in many of the apterous species in clade 16. Odontacolus is monophyletic but only with the inclusion of Cyphacolus sp. (clade 5) and, together, these taxa are supported by the unequivocal character state, metasomal horn compressed laterally (character 25:1). Surprisingly, the apterous taxon Genus 3 is the sister to I. pulcher + Odontacolus + Cyphacolus, but there is little or no support for this placement within the tree. All reduced-winged female Baeini, except for C. leai, Ceratobaeus sp. 2 and Genus 3, are contained within a single large clade (12), which includes seven currently recognised genera (viz. Anabaeus, Apobaeus, Baeus, Echthrodesis, Mirobaeoides, Mirobaeus and Neobaeus) as well as Genus 1, 2, 4 and 5, and I. flavicornis and Idris sp. 1. Within this group, the five basal taxa, I. flavicornis, Idris sp. 1 and Genus 2, 4 and 5 (except Anabaeus sp.) are brachypterous in that the greatly shortened wings are still membranous at least in part (as in Figs 2, 3), while those species contained within clade 16 are supported by the state of being apterous (i.e. having the wings reduced to minute sclerites (character 13:1; Figs 1, 4, 8)). Of the two genera for which multiple species have been included, Baeus and Mirobaeoides, neither are resolved as monophyletic in the strict consensus tree. However, both are monophyletic in a majority of the 80 most parsimonious trees, where M. pecki is the sister to other Mirobaeoides spp. or to Neobaeus + Baeus + Apobaeus (clade 17) , and Apobaeus is the sister to Baeus or the latter is rendered paraphyletic. Interestingly, Neobaeus is sister to these two genera (clade 18), a relationship which is supported by the metasomal laterotergites being free (i.e. not inserted into a submarginal groove) (character 31:0), however this state is reversed in Apobaeus. Significantly, Mirobaeoides is the only baeine genus known where the male is also apterous, a condition associated with it inhabiting a small oceanic island (Lord Howe Is; Fig. 8). The presence of hind femoral spines (character 29; Fig. 7) is a putative synapomorphy for Mirobaeoides (Austin 1986), however in the analysis this character is homoplasious as it also occurs in Genus 2 and 3, at the base of clades 14 and 4, respectively. Several characters previously used to diagnose genera were constrained to determine their effect on both tree length and topology. These were wing reduction in females (characters 13, 14; Figs 1–6, 8), presence of hind femoral spines (character 29; Fig. 7), presence of a metasomal hump or horn on the first metasomal tergite (characters 2–4; Figs. 2–4), and the antennal clava being fused (i.e. unsegmented clava; character 6). In all cases parsimony analysis generated trees 2-8 steps longer than the shortest tree shown in Figure 9 (Table 1). The tree which was only two steps longer resulted from constraining apterous and brachypterous species into a monophyletic clade, which is not surprising given that, except for three species, they already form a monophyletic group in the most parsimonious tree (clade 12). The longest tree of eight additional steps resulted from constraining all taxa with a metasomal hump or horn. These analyses had variable affects on tree topology but did not result in any relationships among taxa, other than those within the constrained clade, that are not discussed above. Wing reduction is often homoplasious in insects associated with soil and leaf-litter, as is the case for many baeines (Iqbal & Austin 1997). However in the most parsimonious trees obtained here, most


X31:1

Apobaeus sp. Baeus leai Baeus seminulum Baeus machodoi Baeus saliens Neobaeus novazealandensis X35:1 17 Mirobaeoides barbarae =29:1 Mirobaeoides scutellaris 2 Mirobaeoides tasmanicus =29:1 Mirobaeoides pecki =13:1 Echthrodesis sp. X35:1 16 Mirobaeus bicolor X35:1 Genus 1 =29:1 X35:1 Genus 2 Genus 4 Genus 5 Anabaeus sp. Idris flavicornis Idris sp. 1 Ceratobaeus setosus =18:0 Ceratobaeus cuspicornutus X11 :0 11 Ceratobaeus sp. 6 =34:1 =19:1 Ceratobaeus reiki 10 Ceratobaeus mirabilis 2 Ceratobaeus fasciatus Ceratobaeus cornutus =28:1 2 Ceratobaeus sp. 5 2 Ceratobaeus sp. 4 Ceratobaeus sp. 2 9 =14:1 =19:1 X11: 0 2 Ceratobaeus leai Ceratobaeus laeviventris Ceratobaeus giraulti Ceratobaeus sp. 3 Ceratobaeus sp. 7 Ceratobaeus intrudae Idris helpidid Idris seminitidus Idris theridii =15:1 Odontacolus sp. 1 50 6 2 25:1 Cyphacolus sp. =21:1 2 Odontacolus longiceps 5 =28:1 =11 :1 Odontacolus sp. 2 X4:1 2 Odontacolus sp. 3 4 Idris pulcher =1:1 =14:1 =29:1 2:2 =28:1 X8:0 Genus 3 75 Hickmanella holoplatysa =5:0 =15:1 3 3 Hickmanella intrudens =7:0 =18:0 2 2 Idris sp. 2 2 Ceratobaeus sp. 1 Idris niger Gryon sp. X7:1 X5:1 =20:1 19 X31:0 18 2

X5:0 X7:0

=1:1 X35:0 =10:1 15 =19:1 =14:1

14

2

12 =10:1

13 =18:0

7

8

2

=28:1

2

=10:1

1

Figure 9

X4:1 X8:1

=21:1 X11: 1

=13:1

Strict consensus of 80 most parsimonious trees (length 147; CI = 0.25; RI = 0.66). Bootstrap values are given above and Bremer (decay) values below the nodes (N.B. only Bremer values ≤ 2 are shown). • unequivocal synapomorphy; = homoplasy; X reversal.



Table 1 Effect of constraining particular morphological characters and species (L = tree length; N = number of trees saved; CI = consistency index; RI = retention index; RC = rescaled consistency index). Constraint

L

N

CI

RI

RC

f-ratio

Unconstrained (Gryon sp. out-group)

147

80

0.25

0.66

0.16

0.73

Ceratobaeus spp. constrained

150

o/flow

0.24

0.65

0.16

0.71

Idris spp. constrained

151

o/flow

0.24

0.66

0.16

0.41

Idris + Ceratobaeus spp. constrained

152

o/flow

0.24

0.65

0.16

0.58

Apobaeus position constrained

149

64

0.25

0.66

0.16

0.78

Wing reduction constrained

149

o/flow

0.24

0.66

0.16

0.46

Femoral spines constrained

150

57002

0.24

0.65

0.16

0.49

Unsegmented clava constrained

151

o/flow

0.24

0.65

0.16

0.53

Metasomal horn constrained

155

o/flow

0.23

0.64

0.15

0.88

Exclusion of characters 13 & 14

141

98696

0.24

0.65

0.16

0.56

apterous and brachypterous species are found within a single clade. To examine whether wing reduction (characters 13 and 14) was over-riding otherwise informative characters in the analysis, the wing reduction characters were excluded and the data matrix reanalysed. This resulted in over 98,000 shortest trees (Table 1), and the strict consensus of these was largely comb-like in structure (not shown here), particularly among the species contained within clade 12, indicating that wing reduction is not over-riding any other informative pattern. Also evident from this result is that much of the structure in the tree is reliant upon the inclusion of these characters.

Discussion Although the results presented here are preliminary in that the number of characters scored is relatively low compared with the number of taxa, they do confirm the monophyly (or near monophyly) of several of the smaller baeine genera and the polyphyly of the two largest genera, Idris and Ceratobaeus. Even though the relationships among many species included in this study would likely change with the addition of new characters and/or taxa, it also seems probable that neither of the latter two genera are ever likely to be resolved as monophyletic, given that no unequivocal synapomorphies have been yet found for them. Further, the synonymy of Ceratobaeus with Idris (sensu Huggert 1979) or its reduction in rank to subgeneric level within Idris s. l. (sensu Johnson 1992; Masner & Denis 1996) is no more tenable than recognising these genera as separate. There seems little or no advantage in making such generic-level changes until a more complete understanding of relationships within the tribe can be achieved. Hence, for the time being we would advocate that it is better to treat Idris and Ceratobaeus as separate genera for


reasons of taxonomic convenience, i.e. they are both very speciose genera and can be readily identified using existing keys (e.g. Masner 1976, 1980; Galloway & Austin 1984). The presence of a hump or horn on the first metasomal tergite is a diagnostic character for Ceratobaeus and Odontacolus/Cyphacolus, but some dorsal expansion of this tergite is also known in at least one species of Mirobaeoides (M. barbarae) and in Genus 1, 2 and 4. Given that this structure occurs independently in a number of platygastroid genera (see Austin & Field 1997), it is also likely to have evolved independently within separate lineages of Baeini. In this tribe, the presence of a metasomal horn, which acts as a recess for a longer ovipositor, has been associated with species that oviposit through the silk wall of spider egg-sacs (Austin 1985). Several relationships in this analysis seem worthy of immediate study. The position of the single representative of Cyphacolus within Odontacolus and the fact that this group is supported by a strong, unequivocal synapomorphy (i.e. laterally compression of the metasomal horn) indicates that the status of the former genus should be reconsidered. This will require an analysis including a much larger number of species, but already it seems from examination of the available Old World fauna (about 20 mostly undescribed species for both genera) that Cyphacolus represents a derived species-group within Odontacolus which is defined by strongly patterned wings, and the marginal and stigmal veins being spectral, at least in part. Also worthy of future study is the relationships among taxa in clade 17 (comprising Apobaeus, Baeus, and Mirobaeoides) with Genus 1 and 2 and, related to this, the distribution of two character states, presence of free lateral tergites and hind femoral spines. Although neither character unequivocally defines a monophyletic group in the present study, they would seem to have significant phylogenetic potential. Within the Baeini, free lateral tergites and the corresponding absence of a metasomal submarginal groove occurs only in Baeus and Neobaeus, although this state also occurs in the Telenominae and some genera of Thoronini (e.g. Masner 1972, 1980), while the presence of hind femoral spines is unique to the tribe but apparently restricted to taxa from the Australian region (including Genus 1 and 2). Interestingly, the putative plesiomorphic state of the antennal clava being clearly divided into four segments is also unique to taxa from Australia (viz. Mirobaeoides, Mirobaeus, Hickmanella, some Ceratobaeus), although a somewhat intermediate state is found in the more cosmopolitan Odontacolus (Galloway & Austin 1984). The most concerning aspect of this analysis is the dependence on two intuitively homoplasious character states for much of the topology seen within the tree generated here. These are wing reduction/aptery and the presence of a hump or horn on metasomal tergite 1. Aptery in females is a diagnostic character for several genera, viz. Anabaeus, Apobaeus, Baeus, Echthrodesis, Mirobaeoides, Mirobaeus and Neobaeus. However, wing reduction also occurs in several species of Ceratobaeus, Idris and Genus 1–5, but is unknown in Hickmanella, Odontacolus and Cyphacolus. Given that wing reduction also occurs in many platygastroid genera, e.g. Dyscritobaeus Perkins, Probaryconus Kieffer, Trimorus Foerster, Austromerus Masner & Huggert, Parabaeus Kieffer, Platygastoides Dodd (Galloway & Austin 1984; Masner & Huggert 1989; Austin & Field 1997; Austin unpublished) and is undoubtedly an adaptation for living in soil and leaf-litter and/ or is associated with island faunas, it seems very probable that this trait has evolved within several baeine lineages that have independently radiated into spider hosts that live in these habitats. However, in the absence of other informative characters, wing reduction and aptery support an unconvincing monophyletic group in the analysis conducted here. Also related to this, but representing a wider problem for the taxonomy of baeines, is what to do with the significant number of new taxa that cannot be assigned easily to any existing baeine genera (here represented by the



brachypterous/apterous species Genus 1–5)? It would not seem sensible to describe them as new genera and proliferate the number of monospecific genera in the tribe, although using current generic concepts this could be justified. An alternative strategy might be to describe them as new species-groups of Idris. This approach at least makes the descriptions formally available so the species can be assessed more widely in the future. However, it would broaden the limits of this genus to the point where it was almost synonymous with the limits of the tribe.

Acknowledgements We wish to thank Paul Dangerfield, Lubomir Masner and Mark Harvey for their help during this project. We also wish to acknowledge the assistance of CEMMSA and ICC staff at Adelaide University for help with SEM techniques and photography, respectively. We are grateful for the financial support provided by AusAID to M.I. and Adelaide University to A.D.A.

References Austin, A. D. (1984) The fecundity, development and host relationship of Ceratobaeus spp. (Hymenoptera: Scelionidae), parasites of spider eggs. Ecological Entomology 9: 125-138. Austin, A. D. (1985) The function of spider egg sacs in relation to parasitoids and predators, with special reference to the Australian fauna. Journal of Natural History 19: 359-376. Austin, A. D. (1986) A taxonomic revision of the genus Mirobaeoides Dodd (Hymenoptera: Scelionidae). Australian Journal of Zoology 34: 315-337. Austin, A. D. & Field, S. A. (1997) The ovipositor system of scelionid and platygastrid wasps (Hymenoptera: Platygastroidea): comparative morphology and phylogenetic implications. Invertebrate Taxonomy 11: 1-87. Bremer, K. (1994) Branch support and tree stability. Cladistics 10: 295-304. Chappill, J. A. (1989) Quantitative characters in phylogenetic analysis. Cladistics 5: 217-234. Eriksson, T. (1997) AutoDecay, Version 2.9.8. Computer program distributed by the author, Botaniska Institutionen, Stockholm University, Stockholm. Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using bootstrap. Evolution 39: 783-791. Galloway, I. D. & Austin, A. D. (1984) Revision of the Scelioninae (Hymenoptera: Scelionidae) in Australia. Australian Journal of Zoology, Supplementary Series 99: 1-138. Huggert, L. (1979) Revision of the west Palaearctic species of the genus Idris Foerster, s.l. (Hymenoptera, Proctotrupoidea: Scelionidae). Entomologica Scandinavica, Supplement 12: 1-60. Iqbal, M. (1998) Systematics and phylogeny of the Baeini (Hymenoptera: Scelionidae) with special reference to Australasian fauna. Ph.D. Thesis, The University of Adelaide, Adelaide, South Australia. Iqbal, M. & Austin, A. D. (1997) Species richness and endemism of baeine wasps (Hymenoptera: Scelionidae) in Australia. Memoirs of the Museum of Victoria 56: 455-459. Iqbal, M. & Austin, A. D. (2000) Systematics of Ceratobaeus Ashmead (Hymenoptera: Scelionidae) from Australasia. Records of the South Australian Museum Monographic Series 6: 1-164. Johnson, N. F. (1992) Catalog of World species of Proctotrupoidea, Exclusive of Platygastridae (Hymenoptera). The American Entomological Institute, Gainesville.


Maddison, W. P. & Maddison, D. R. (1997) MacClade: Interactive analysis of phylogeny and character evolution. Version 3.07. Computer program distributed by Sinauer Associates, Sunderland. Masner, L. (1972) The classification and interrelationships of Thoronini (Hymenoptera: Proctotrupoidea, Scelionidae). Canadian Entomologist 104: 833-49. Masner, L. (1976) Revisionary notes and keys to world genera of Scelionidae (Hymenoptera: Proctotrupoidea). Memoirs of the Entomological Society of Canada 97: 1-87. Masner, L. (1979) Pleural morphology in scelionid wasps (Hymenoptera: Scelionidae) – an aid to higher classification. Canadian Entomologist 111: 1079-1087. Masner, L. (1980) Key to genera of Scelionidae of the Holarctic region, with descriptions of new genera and species (Hymenoptera: Proctotrupoidea). Memoirs of the Entomological Society of Canada 113: 1-54. Masner, L. & Denis, J. (1996) The Nearctic species of Idris Foerster, Part 1: The mellus-group (Hymenoptera: Scelionidae). Canadian Entomologist 128: 85-114. Masner, L. & Huggert, L. (1989). World review and keys to genera of the subfamily Inostemmatinae with reassignment of the taxa to the Platygastrinae and Sceliotrachelinae (Hymenoptera: Platygastridae). Memoirs of the Entomological Society of Canada 147: 1-214. Page, R. D. M. (1997) TreeView, Version 1.4. Computer program distributed by the author, Division of Environmental and Evolutionary Biology, University of Glasgow, Glasgow. Swofford, D. L. (1993) PAUP: Phylogenetic Analysis Using Parsimony, Version 3.1.1. Computer program distributed by Illusions State Natural History Survey, Champaign. Swofford, D. L. (1998) PAUP*: Phylogenetic Analysis Using Parsimony, Version 4.0 (PPC, test). Computer program distributed by the author, Smithsonian Institution: Washington, D. C.



Appendix 1 Characters and character states employed in the phylogenetic analysis. Character 1. Attachment of metasoma to mesosoma: 0) metasoma relatively small and not broadly abutted against mesosoma, 1) metasoma sub-sessile against mesosoma, 2) metasoma sessile against mesosoma. Character 2. Frontal carina: 0) frontal carina absent or rudimentary, 1) frontal carina fine or strong but not reaching to median ocellus, 2) frontal carina reaching to median ocellus. Character 3. Sculpturing on cheek and lower frons: 0) cheek and lower frons smooth, 1) cheek and lower frons striate. Character 4. Speculum development: 0) speculum present, 1) speculum absent (i.e. frons uniformly sculptured). Character 5. Funicle segment number: 0) five or more funicle segments, 1) four funicle segments. Character 6. Antennal clava: 0) distinct antennal clava present, 1) antennal clava absent. Character 7. Antennal clava segmentation: 0) antennal clava segmented, 1) antennal clava appearing fused. Character 8. Eyes pilosity: 0) eyes with long hairs, 1) eyes with minute hairs (visible only at high magnification, > x 80). Character 9. Eye size: 0) eyes size normal, height more than half that of head, 1) eyes small, height less than half that of head. Character 10. Axillar sculpturing: 0) axillar crenulae present, 1) axillar crenulae absent. Character 11. Humeral sulcus: 0) humeral sulcus smooth, 1) humeral sulcus crenulate. Character 12. Notauli development: 0) scutum with notauli, 1) scutum lacking notauli. Character 13. Wing development: 0) wings present (i.e. brachypterous or full-winged), 1) apterous (i.e. wings reduced to tiny sclerites, no more than about twice the length of the tegula). Note that species coded (1) for character 13, are coded as missing data for character 14-18. Character 14. Degree of wing development: 0) wings fully developed, 1) brachypterous. Character 15. Wing venation: 0) wing venation tubular and clear, 1) wing venation blurred. Character 16. Bristles on submarginal vein: 0) bristles on submarginal vein absent or short, 1) bristles on submarginal vein long, reaching beyond anterior margin of wing. Character 17. Fore wing marginal fringe: 0) fore wing marginal fringe present, 1) fore wing marginal fringe absent. Character 18. Basal vein development: 0) basal vein present and pigmented, 1) basal vein absent. Character 19. Scutellum posterior margin: 0) scutellar rim with single row of foveae, 1) scutellar rim smooth. Character 20. Metanotum exposure: 0) metanotum visible medially, 1) metanotum concealed medially.


Character 21. T1 development: 0) T1 flat, 1) T1 with a broad hump or horn. Note that species coded (0) for character 26, are coded as missing data for character 22-25. Character 22. Metasomal horn length: 0) distal metasomal horn reaching to or past level of posterior margin of scutellum (in lateral view), 1) distal metasomal horn not reaching to posterior margin of scutellum (in lateral view). Character 23. Metasomal horn shape: 0) metasomal horn uniformly slender, 1) metasomal horn broad at base. Character 24. Distal metasomal horn shape: 0) distal metasomal horn convex and narrowly rounded, 1) distal metasomal horn flattened. Character 25. Metasomal horn lateral shape: 0) metasomal horn circular in cross-section, 1) metasomal horn compressed laterally. Character 26. Effect of metasomal horn on scutellum: 0) posterior scutellum rounded or straight in dorsal view, 1) posterior scutellum indented medially. Character 27. Scutum groove/indentation: 0) scutum normal, 1) scutum with medial groove or deep emargination. Character 28. Propodeal lamellae: 0) dorsal propodeal lamellae blunt, 1) dorsal propodeal lamellae sharply pointed. Character 29. Hind femoral spines: 0) distal hind femur simple, 1) distal hind femur with two spines. Character 30. T2 anterior margin sculpturing: 0) T2 anterior margin striate, 1) T2 anterior margin smooth. Character 31. Laterotergite position: 0) laterotergites free, 1) laterotergites inserted into submarginal groove. Character 32. First funicle segment (F1) length : width ratio: 0) first funicle segment ≤ 2 x as long as wide, 1) first funicle segment 3–3.5 x as long as wide, 2) first funicle segment ≥ 4 x as long as wide. Character 33. Postmarginal vein : stigmal vein ratio: 0) postmarginal vein ≤ 0.72 x as long as stigmal vein, 1) postmarginal vein 1 – 1.1 x as long as stigmal vein, 2) postmarginal vein ≥ 2 x as long as stigmal vein. Note that brachypterous species are coded as missing data for this character. Character 34. Metasoma length : width ratio: 0) metasoma ≤ 2.05 x as long as wide, 1) metasoma 2.4 – 2.85 x as long as wide, 2) metasoma 3.72 – 3.81 x as long as wide, 3) metasoma ≥ 5 x as long as wide. Character 35. T3 : T2 ratio: (measured in dorsal mid-line) 0) T3 ≤ 0.96 x as long as T2, 1) T3 0.97 – 1.85 x as long as T2, 2) T3 1.86 – 2.74 x as long as T2, 3) T3 2.75 – 3.63 x as long as T2, 4) T3 ≥ 3.64 x as long as T2.



Appendix 2 Data matrix of character states for representative species of baeine genera 1 1111111112 2222222223 33333 1234567890 1234567890 1234567890 12345 Sparasion sp.

000101-101 0100000100 0----00100 11221

Nixonia sp.

000101-101 0100000100 0----00000 11021

Embidobia metoligotomae Dodd

0100000000 0100010100 1110000000 10201

Gryon sp.

0001100100 0100010100 0----00000 10201

Anabaeus sp.

2101101001 0111----10 1000000001 10-01

Apobaeus sp.

2101101101 011-----11 0----00001 10-00

Baeus leai Dodd

2001101101 011-----11 0----00001 00-00

Baeus seminulum Haliday

2101101111 011-----11 0----00001 00-00

Baeus machodoi (Risbec)

2101101001 011-----11 0----00001 00-00

Baeus saliens (Hickman)

2101101011 011-----11 0----00001 00-00

Ceratobaeus cornutus Ashmead

01?1101?0? ?0000?0?00 1000010?00 10012

Ceratobaeus sp. 1

0101000100 0000000100 1000000000 10003

Ceratobaeus sp. 2

0110000100 0101-1—-10 1000010000 10-02

Ceratobaeus leai Dodd

0111101000 0101-1—-10 1000010000 10-03

Ceratobaeus giraulti Dodd

0001101100 1100001100 1000010000 10002

Ceratobaeus mirabilis Dodd

0000101100 1100010010 1000011000 10011

Ceratobaeus reiki Austin

0000101000 0100010010 1000010000 10032

Ceratobaeus cuspicornutus Austin

0001101000 0100010010 1000010000 10011

Ceratobaeus fasciatus Dodd

0110101100 1100010110 1000010000 10011

Ceratobaeus laeviventris Dodd

0110101100 1100010100 1000010000 10001

Ceratobaeus sp. 3

0101101100 1100000110 1000010000 10003

Ceratobaeus sp. 4

0110101100 1100000100 1000010100 10002

Ceratobaeus setosus Dodd

0110101001 0100010000 1000000000 10001

Ceratobaeus intrudae Austin

0100101000 0100010100 1000000100 10112

Ceratobaeus sp. 5

0111101100 1000010100 1000000100 10002

Ceratobaeus sp. 6

0101101000 0100010010 1000000000 10011

Ceratobaeus sp. 7

0000101100 1100010100 1100000000 10002

Cyphacolus sp.

0001101100 0000101100 1000100101 10-01

Echthrodesis sp.

1001000001 011-----10 0----00001 10-00

Hickmanella holoplatysa Austin

0201000000 0000110100 0----00100 10-02

Hickmanella intrudens (Hickman)

0201000000 0000100100 0----00000 10-02

Idris flavicornis Foerster

0100101001 0001010100 0----00000 10003

Idris helpidid (Hickman)

0101101000 0100010100 0----00000 10002

Idris niger (Hickman)

0101101100 0100000100 0----00000 10003

Idris pulcher (Dodd)

0101101101 0100000100 0----00100 10004

Idris seminitidus (Dodd)

0001101001 0000010100 0----00000 10002

Idris theridii (Hickman)

0001101001 0100010100 0----00000 10002

Idris sp. 1

0100101001 0101----00 0----00000 10-03


Idris sp. 2

0101000101 0100101000 0----00000 10002

Mirobaeoides barbarae Austin

2101000101 011-----10 1010000010 10-01

Mirobaeoides pecki (Austin)

2000000001 011-----11 0----00010 10-00

Mirobaeoides scutellaris Austin

2101000101 011-----10 0----00011 10-00

Mirobaeoides tasmanicus Dodd

2011000101 011-----10 0----00011 10-00

Mirobaeus bicolor Dodd

1001000001 011-----10 0----00000 10-01

Neobaeus novazealandensis Austin

2100000001 011-----11 0----00001 00-00

Odontacolus longiceps Kieffer

0001101100 0100010100 1000100100 10101

Odontacolus sp. 1

0111101100 0100101100 1000100100 10001

Odontacolus sp. 2

0011101101 1100010100 1000100101 10001

Odontacolus sp. 3

0100101101 1100000100 1000100101 10001

Genus 1

1001000101 011-----10 1010010000 10-03

Genus 2

1100000001 0101----10 1010010010 10-02

Genus 3

1001101101 0101----00 0----00010 10-01

Genus 4

2110101001 0101----11 1010010000 10-00

Genus 5

1100101001 0101----10 0----00000 10-00

Hymenopteran Orbicular Sensilla Hasan H. Basibuyuk1,2,3, Alexandr P. Rasnitsyn4, Mike G. Fitton2 and Donald L. J. Quicke1,2 1

Unit of Parasitoid Systematics, CABI Bioscience UK Centre (Ascot), Department of Biology, Imperial College at Silwood Park, Ascot, SL5 7PY United Kingdom (email: [email protected]) 2

Department of Entomology, The Natural History Museum, London SW7 5BD United Kingdom 3

Department of Biology, Cumhuriyet University, 58140 Sivas, Turkey

4

Palaeontological Institute Russian Academy of Sciences, Profsoyuznaya Str. 123, 117647 Moscow, Russia

Introduction The sensory systems of insects have evolved numerous specialisations that allow them to detect important features of the external environment, monitor their own internal states and provide information on position of their appendages. Considering the vast numbers of insect species and variety of habitats they successfully occupy, it is not surprising that they posses equally diverse sensory systems (Frazier 1985). However, most studies have only covered antennal sensilla, while sensilla located in other body parts have not been thoroughly investigated. Studies on the sensory systems of the Hymenoptera show this general pattern and, apart from several studies on the ovipositor sensilla, there have only been a few papers reporting sensilla from other body parts (Schmidt & Smith 1987; Navasero & Elzen 1991; Meyhöfler et al. 1997). Sensilla from other body parts may also be useful potentially for phylogenetic reconstruction. Although there has been increasing effort to reconstruct the evolutionary history of the Hymenoptera (e.g. Rasnitsyn 1988; Brothers & Carpenter 1993; Dowton & Austin 1994; Vilhelmsen 1997; Ronquist et al. 1999), there is still no one robust higher level phylogenetic hypothesis for the order (Ronquist et al. 1999). Rasnitsyn’s (1988) most comprehensive and fully resolved higher level phylogeny has recently been shown (Ronquist et al. 1999) to have no convincing support for any of its major groupings. The relationships among symphytan (Vilhelmsen 1997) and aculeate families (Brothers & Carpenter 1993) have been analysed independently and are relatively robust in comparison with the parasitoid groups. Exploration of novel character systems is essential if we are to test existing hypotheses and obtain a more stable phylogeny. In this paper, we present some preliminary findings from one novel character system, orbicular sensilla and some associated structures. The orbicula is a dorsal cuticular sclerite at the base of the membranous arolium in the distal most tarsal segment of insect legs (Figs 1–4). Phylogenetic and functional implications, especially for non-aculeate apocritans, are discussed.

Material and Methods A total of 137 species belonging to 121 genera, representing all superfamilies and most families of non-aculeate apocritans, were studied. Only one species was examined for some relatively rare taxa, but in most cases the number of species examined was three or more. Standard SEM

192


Hymenopteran Orbicular Sensilla 193

Table 1

Explanation of characters and character states.

Code

Character

States

A

Sensilla trichodea A (STA) on orbicula

0 = absent; 1 = present

B

Number of STA (when present)

0 = one; 1 = two; 2 = three or more

C

Sensilla trichodea B (STB)

0 = absent; 1 = present

D

Number of STB (when present)


E

STB (if two or more)

0 = scattered; 1 = forming a single row

F

STB

0 = simple; 1 = basally widened

G

STB

0 = without a basal spur;1 = with a basal spur

H

Sensilla campaniformia (SC)

0 = none; 1 = with encircling ridge (type A); 2 = without an encircling ridge (type B)

I

Number of SC (when present)


J

Position of SC relative to STA

0 = anterior (distal); 1 = posterior (basal)

techniques were employed on dry or ethanol preserved specimens. The identifications of orbicular sensilla are based on Frazier (1985).

Results Four types of morphologically discernible sensilla are found. Of these two are setiform, termed here sensilla trichodea A (STA) and sensilla trichodea B (STB), and the other two are dome-like sensilla, sensilla campaniformia A (SCA) and sensilla campaniformia B (SCB). Variations in these and associated structures are summarised in Tables 1 and 2. We have not specifically investigated intraspecific variation but there appears to be no major variation in several cases we have examined. STA arise from a flexible socket with the hair trunk gradually tapering towards the tip (Figs 1–4). STB can be differentiated from the STA in usually being shorter and more slender, positioned posterior to the STA and usually with a less pronounced socket (Figs 1–3). STB are usually simple cylindrical hairs with an irregular distribution but, in some cases, they are arranged into a single transverse row (Figs 2–3) and may be basally compressed and widened (Fig. 2). Some taxa additionally possess a spur on the sensilla socket (Fig. 2). Of the two types of sensilla campaniformia, SCA are usually in the shape of a rounded dome encircled by a pronounced cuticular ridge (Fig. 1); their number and placement are variable. SCB, however, usually have no distinct encircling ridge but consistent in number and are always located laterally (Fig. 2).

Discussion The orbicular sensilla are arguably all mechanoreceptors (McIver 1985). In one eulophid, they have been suggested as having a role in detecting vibration produced by its leaf miner host (Meyhöfer et al. 1997). However, the presence of orbicular sensilla in early phytophagous lineages (Basibuyuk et al. 2000), as well as in males, suggest that they must have other roles. It is most likely that they evolved primarily to monitor the state of stress caused by locomotive behaviour. Host detection, in this context, can be seen as a secondary role assumed after the evolution of parasitism.

Hasan H. Basibuyuk, Alexandr P. Rasnitsyn, Mike G. Fitton and Donald L. J. Quicke 194


Table 2 Orbicular sensilla and associated structures in the non-aculeate apocritan Hymenoptera. Symbols: (—) not applicable; (?) state is unknown due to unavailability of data; (x?) a specified state with question mark shows our best judgement but not absolutely certain (see Table 1 and text for explanation of characters). A

B

C

D

E

F

G

H

I

J

Stephanidae

0/1

1

0/1

2

0

0

0

0/1

1

0

Trigonalidae

1

1/2

1

2

0

0

0

1

1

0

Megalyridae

0/1

2

1

2

0

0

0

1

0

0

Evanioidea

1

1

1

2

0

0

0

0

—

—

Ibaliidae

1

1

1

2

0

0

0

0

—

—

other Cynipoidea

1

1

0/1

1/2

1

1

0?

0

—

—

Megaspilidae

1

2?

0/1

2?

0

0

0

0

—

—

Ceraphronidae

1

0

0/1

2?

0/1

?

0

0

—

—

Diapriidae

1

0

1

1

1

1

0

2

1

0

Heloridae

1

1

1

2

0

0

0

0

—

—

Vanhorniidae

1

1

1

2

1

?

0

0

—

—

Pelecinidae

1

1

1

2

0

0

0

0

—

—

Proctotrupidae

0/1

1?

1?

1/2

0

?

0

0

—

—

Roproniidae

1

1

1

2

0

0

0

0

—

—

Monomachidae

1

1

1

2

0

0

0

0?

—

—

New Zealand fam n.

1

0

1

1

1

1

1

2?

?

?

Scelionidae

1

1

0/1

0/2

0

?

0

0/2

1

0

Platygastridae

0?

—

1?

1

1

1

0

0

—

—

Chalcididae

1

0

1

2

0

1

0

2

1

1

other Chalcidoidea

1

0

1

1/2

1

1

1

2

1

1

Mymarommatidae

1

0

1

1

1

?

?

?

?

?

Braconidae

1

1/2

1

2

0

0

0

1

1

1

Ichneumonidae

1

1/2

0/1

0/1/2

0

0

0

1

1/2

0/1

Variation in the number, shape, position and arrangement of orbicular sensilla and associated structures are found to be particularly informative for relationships of several microhymenoptera. Most basal lineages of Apocrita have two STA and a change in number is considered to be derived. Presence of a single STA with a well-developed socket and collar is a putative synapomorphy for the Chalcidoidea, Diapriidae, Mymarommatidae, the undescribed New Zealand family of Proctotrupoidea and possibly the Ceraphronidae (Figs 2, 4). Arrangement of the STB into a single transverse row (Figs 2–4) supports a larger putative clade comprising the Chalcidoidea (except Chalcididae), Mymarommatidae, Ceraphronidae,


Figures 1-4

Orbicular sensilla in various Hymenoptera: 1) Megalyra fasciipennis (Megalyridae), scale bar = 10 mm; 2) Gastracanthus pulcherrimus (Pteromalidae), scale bar = 8 mm; 3) Callaspidia defonscolombei (Figitidae), scale bar = 7 mm; 4) Coptera occidentalis (Diapriidae), scale bar = 3 mm. B = basal spur; SCA = sensilla campaniformia A; SCB = sensilla campaniformia B; STA = sensilla trichodea A; STB = sensilla trichodea B.

Cynipoidea, Diapriidae, Platygastridae, Vanhorniidae and the undescribed New Zealand family of Proctotrupoidea. STB are laterally compressed and widened basally (Fig. 2–4) in the Chalcidoidea, Cynipoidea, Diapriidae, Platygastridae and the undescribed New Zealand family of Proctotrupoidea, suggesting another clade within the above larger grouping. A spur is present at the base of each STB in the Chalcidoidea (except Chalcididae) and in the undescribed New Zealand family of Proctotrupoidea (Fig. 2), and a similar structure, but situated far from the sensillum, is also present in some Cynipoidea.

Hasan H. Basibuyuk, Alexandr P. Rasnitsyn, Mike G. Fitton and Donald L. J. Quicke 196


SCB are present in almost all members of the Chalcidoidea (Fig. 2) and Diapriidae (Fig. 4), and in some Scelionidae and possibly in the New Zealand family of Proctotrupoidea. However, its presence in the new family has yet to be confirmed. Several recent investigations of novel character systems have suggested alternative relationships among parasitic taxa (e.g. Basibuyuk & Quicke 1997, 1999; Quicke et al. 1998; Gibson 1999), but no single character system is likely to verify the ‘true’ relationships. A formal parsimony analysis including all the new findings is needed to evaluate these alternative hypotheses and is currently in preparation.

Acknowledgements We wish to thank the staff of electron microscopy and photographic units, NHM, London for their assistance. Kees van Achterberg, Nando Bin, Barry Bolton, John LaSalle, Massimo Olmi, Andy Polaszek, Frank van Veen and Annette Walker donated some of the material studied. This work was supported in part by a Leverhulme Trust research grant to DQ and MF and by the NERC Initiative in Taxonomy.

References Basibuyuk, H. H. & Quicke, D. L. J. (1997) Hamuli in the Hymenoptera (Insecta) and their phylogenetic implications. Journal of Natural History 31: 1563-1585. Basibuyuk, H. H. & Quicke, D. L. J. (1999) Grooming behaviours in the Hymenoptera (Insecta): potential phylogenetic significance. Zoological Journal of the Linnean Society 125: 349-382. Basibuyuk, H. H., Quicke, D. L. J., Rasnitsyn, A. P. & Fitton, M. G. (2000) Morphology and sensilla of the orbicula, a sclerite between the tarsal claws in Hymenoptera. Annals of the Entomological Society of America 93: 625-636. Brothers, D. J. & Carpenter, J. M. (1993) Phylogeny of Aculeata: Chrysidoidea and Vespoidea (Hymenoptera). Journal of Hymenoptera Research 2: 227-304. Dowton, M. & Austin, A. D. (1994) Molecular phylogeny of the insect order Hymenoptera: Apocritan relationships. Proceedings of the National Academy of Sciences, USA 91: 99119915. Frazier, J. L. (1985) Nervous system: sensory system. pp. 287-356. In Blum, M. S. (Ed.), Fundamentals of Insect Physiology. John Wiley and Sons, New York. Gibson, G. A. P. (1999) Sister-group relationships of the Platygastroidea and Chalcidoidea (Hymenoptera) – an alternate hypothesis to Rasnitsyn (1988). Zoologica Scripta 28: 125-138. McIver, S. B. (1985) Mechanoreception. pp. 71-132. In Kerkut, G. A. and Gilbert, L. I. (Eds), Comprehensive Insect Physiology Biochemistry and Pharmacology, Volume 6. Pergamon Press, Oxford. Meyhöfler, R., Casas, J. & Dorn, S. (1997) Mechano- and chemoreceptors and their possible role in host-location behavior of Sympiesis sericeicornis (Hymenoptera: Eulophidae). Annals of the Entomological Society of America 90: 208-219. Navasero, R. C. & Elzen, G. W. (1991) Sensilla on the antennae, foretarsi and palpi of Microplitis croceipes (Cresson) (Hymenoptera: Braconidae). Proceedings of the Entomological Society of Washington 93: 373-347. Quicke, D. L. J., Wyeth, P. , Fawke, J. D., Basibuyuk, H. H. & Vincent, J. (1998) Manganese and zinc in the ovipositors and mandibles of hymenopterous insects. Zoological Journal of the Linnean Society 124: 387-396.


Rasnitsyn, A. P. (1988) An outline of evolution of the hymenopterous insects (Order Vespida). Oriental Insects 22: 115-145. Ronquist, F., Rasnitsyn, A. P., Roy, A., Eriksson, K. & Lindgren, M. (1999) Phylogeny of the Hymenoptera: A cladistic reanalysis of Rasnitsyn’s (1988) data. Zoologica Scripta 28: 13-50. Schmidt, J. M. & Smith, J. B. (1987) The external sensory morphology of the legs and hairplate system of female Trichogramma minutus Riley (Hymenoptera: Trichogrammatidae). Proceedings of the Royal Society of London Series B 232: 323-366. Vilhelmsen, L. (1997) The phylogeny of lower Hymenoptera (Insecta), with a summary of the early evolutionary history of the order. Journal of Zoological Systematics and Evolutionary Research 35: 49-70.

Karyology of Parasitic Hymenoptera: Current State and Perspectives Vladimir E. Gokhman Botanical Garden, Moscow State University, Moscow 119899 Russia (email: [email protected])

Introduction Recent progress in molecular genetics provides substantial independent information on phylogenetic and taxonomic relationships of various insect groups. However, more traditional methods of contemporary taxonomy, such as chromosomal analysis, still have an important role to play in entomological research. This is because karyological techniques have certain advantages in studying taxonomic structure of many insect taxa, including those of parasitic wasps. First, karyotypic features of many groups of parasitic Hymenoptera are relatively diverse and stable, thus offering an important source of knowledge valuable for making taxonomic decisions, especially at lower levels. Second, most chromosomal characters are in fact morphological and may therefore be studied and analysed similarly to those of external morphology. Finally, karyotyping may be effectively used for detecting sibling species and population polymorphisms as a rapid and inexpensive screening method. The last detailed review of the karyology of parasitic Hymenoptera was published by Gokhman & Quicke (1995). Since that time, however, chromosomes of several dozen additional species have been examined. Moreover, new conclusions have been forthcoming on the basis of accumulated karyological information (Gokhman 1997a). In this paper I will present a brief overview of the current state and perspectives of chromosome studies in parasitic wasps.

Historical Review There are two conditions necessary for a successful karyotaxonomic study: 1) the presence of a considerable number of dividing cells in a certain tissue, and 2) the possibility for reliable identification of the individuals examined. Chromosomes of parasitic wasps from laboratory stocks have been traditionally investigated using immature stages (mostly prepupae or early pupae), but this method can be hardly applied to natural populations of parasitic Hymenoptera, because it is very difficult to locate these stages in nature as well as to recognise their taxonomic position in the absence of adults. However, prepupae and pupae of certain phytophagous Hymenoptera, such as Cynipidae, may be easily identified by their galls or after rearing adults from those galls. Thus, it is not surprising that the first data on chromosomes of the parasitic Hymenoptera were obtained more than 100 years ago by Henking (1892) who examined meiosis in the cynipid Diplolepis rosae (L.). He observed nine bivalents in D. rosae, and this information has been confirmed by modern cytogenetics (Stille & Dävring 1980). Unfortunately, results of many karyological studies of parasitic wasps made at the beginning of the century were unreliable, mainly because the histological protocols of the time were largely 198


Karyology of Parasitic Hymenoptera: Current State and Perspectives 199

unsuitable for karyotyping purposes. These dubious results were often omitted in later reviews, e.g. in that by Crozier (1975) who cited chromosome numbers for only 20 parasitic wasps karyotyped after 1932, whereas about 40 species were examined prior to this time. Even the advent of more progressive cytological methods in the early 1930’s, such as squash techniques, had no considerable impact on the number of wasp species studied. Furthermore, an apparent uniformity of chromosome number in the parasitic Hymenoptera (e.g. Dodds 1938) also inhibited karyological research for this group of insects. Even several decades later Crozier (1975) wrote: ‘The Parasitica are characterised by highly restricted variation in chromosome number within major groups and by a much smaller overall range of chromosome number than the Symphyta and Aculeata. However, the sample available was both small and unrepresentative’. Contrary to Crozier’s evaluation, Goodpasture (1974) in his pioneering Ph.D. thesis, ‘Cytological data and classification of the Hymenoptera’, demonstrated considerable karyotypic diversity in 21 species of parasitic wasps. For example, he found n = 4, 5 and 6 in different members of the genus Monodontomerus Westwood (Torymidae). Regretfully, much of Goodpasture’s data, except those on Torymidae and Cynipidae (Goodpasture 1975a, 1975b; Goodpasture & Grissell 1975), remained unpublished. Several papers appeared during the next decade (Hunter & Bartlett 1975; Hung 1982, 1986) which contained additional karyotypic information for several chalcidoid species belonging to the families Chalcididae, Encyrtidae and Trichogrammatidae. A new period of chromosomal research in the parasitic Hymenoptera is associated with the transition from squash to air-drying preparation techniques. As mentioned above, it was the use of immature stages of parasitic wasps for karyotyping which imposed considerable restrictions on the process of chromosomal investigation in natural populations of parasitic Hymenoptera. Using air-drying techniques for making chromosome preparations from ovaries of adult females, it has been possible to examine more than 90 species of Ichneumonidae, mainly belonging to the subfamily Ichneumoninae (Gokhman 1985 onwards). However, many other authors (Sanderson 1988; Dijkstra 1986; Dijken 1991; Baldanza et al. 1991a, 1991b, 1994) used immature stages for the karyological investigation of chalcidoids and cynipoids. The total number of species reached 190 after a detailed review was published by Gokhman and Quicke (1995). A further 60 species have been added during the last four years (Baldanza 1996; Quicke & Gokhman 1996; Gokhman & Kolesnichenko 1996, 1997, 1998a, 1998b, 1998c; Abe 1998; Quicke pers. comm.; Gokhman unpublished), including the first chromosome records for several major taxa, such as the Megaspilidae (n = 9), Figitidae (n = 11) and Dryinidae (n = 5), the ichneumonid subfamilies Ctenopelmatinae (n = 11 and 12) and Metopiinae (n = 11; Figs 1, 2), and the braconid groups Agathidinae (n = 11) and Cheloninae (n = 6). Therefore, about 250 species have been studied to date, which is approximately five times more than in 1975, but this is still minute when compared to the 50 000 described species of parasitic Hymenoptera world-wide (LaSalle & Gauld 1991). Nevertheless, a number of conclusions can be made even on the basis of this restricted sample.

Karyology of Parasitic Wasps: Recent Update and New Hypotheses The haploid number in the parasitic Hymenoptera ranges from 3 in Brachymeria intermedia (Nees) (Chalcididae), Encarsia protransvena viggiani (= transvena auct.) (Aphelinidae) and Aphidius sp. (Braconidae) (Hung 1986; Baldanza 1996, pers. comm.; Quicke pers. comm.) to 21 in Perithous scurra (Panzer) (Ichneumonidae) (Gokhman & Kolesnichenko 1997) and Chrysis viridula L.

Vladimir E. Gokhman 200

Figures 1–4


Karyograms of parasitic wasps: 1) Triclistus podagricus (Gravenhorst) (Ichneumonidae: Metopiinae), mitosis, 2n = 22; 2) same individual, first metaphase of meiosis, n = 11; 3) Aptesis puncticollis (Thomson) (Ichneumonidae: Cryptinae), mitosis, 2n = 16; 4) Aphidius matricariae Haliday (Braconidae: Aphidiinae), mitosis, 2n = 14. Scale bar = 10 µm.

(Chrysididae: Quicke & Gokhman 1996), its frequency distribution being apparently bimodal with peaks at 5 and 11 (Fig. 5). However, the latter mode may change to 10 if identical chromosome numbers are scored only once per genus (Fig. 6) according to the ‘genus-karyotype’ approach developed by Crozier (1975) in order to avoid uneven sampling errors. Since the first peak comprises derived members of the parasitic Hymenoptera, such as many Chalcidoidea, n = 10 or 11 were suggested to be the norm for all parasitic wasps (e.g. Gokhman & Quicke 1995). Recently, however, a karyotypic study of several less specialised groups, such as the Gasteruptiidae, Pimplinae (Ichneumonidae), Doryctinae, Opiinae and Alysiinae (Braconidae), demonstrated that the members of these groups (with a few exceptions) have n = 14–17 (Quicke & Gokhman 1996; Gokhman & Kolesnichenko 1997, 1998a), and thus the initial haploid number is probably closer to those values. Therefore, an independent parallel reduction in chromosome number is common in various lineages, e.g. in the Ichneumonidae and Braconidae having respective modes at n = 11 and 10. A similar number also occurs in some less advanced Chalcidoidea (for example, in the Eurytomidae n = 9–10), as opposed to the majority of chalcidoids with n = 5–6. Even in the high-numbered taxa there are several species with low haploid numbers, e.g. Alysia manducator (Panzer) (Braconidae) with n = 11 and Polysphincta tuberosa (Gravenhorst) (Ichneumonidae: Pimplinae) with n = 9, the other Alysiinae and Pimplinae having n = 16–17 and 14–21, respectively. Moreover, similar situations may be observed in some genera and species groups, and in these cases low n values are considered as synapomorphies. Specifically, the ichneumonid genera Patrocloides Heinrich (n = 8) and Pseudoamblyteles Heinrich (n = 9) are synapomorphic for their lower chromosome numbers, as opposed to the other members of the subtribe Ichneumonina with n = 10–17 (Gokhman 1997a). Similarly, two closely related cynipid


60 Chrysidoidea

50

Ceraphronoidea

40

Evanioidea Proctotrupoidea s.l.

30

Cynipoidea

20

Chalcidoidea Ichneumonoidea

10 0 2

3

4

5

6

7

8

9 10 11 12 13 14 15 16 17 18 19 20 21 22

Haploid chromosome number Figure 5

Histogram of haploid chromosome numbers for parasitic Hymenoptera.

35 Chrysidoide

30

Ceraphronoidea Evanioidea

25

Proctotrupoidea s.l.

20

Cynipoidea

15

Chalcidoidea Ichneumonoidea

10 5 0 2

3

4

5

6

7

8

9 10 11 12 13 14 15 16 17 18 19 20 21 22

Haploid chromosome number Figure 6

Histogram of haploid chromosome numbers for parasitic Hymenoptera, each n value occurring in a genus being represented only once.

species, Andricus kashiwaphilus Abe (n = 5) and A. mukaigawae (Mukaigawa) (n = 6) are synapomorphic for their n values, since all other members of the genus Andricus have n = 10 (Abe 1998). Chromosome numbers are known for all superfamilies of the parasitic Hymenoptera except Stephanoidea, Megalyroidea and Trigonalyoidea. However, in many others, such as Evanioidea and Ceraphronoidea, only one or two species have been examined. The Ichneumonoidea (n = 3–21; Fig. 3), Cynipoidea (n = 5–11) and Chalcidoidea (n = 3–12) are the best studied, the first group occupying the whole range of n values found in the parasitic wasps. The Chrysidoidea almost have as wide a variation in chromosome number (n = 5–21) as the Ichneumonoidea, although karyotypes of only six species have been investigated to date. Chrysidoids therefore



represent a very divergent group where variation for n values in all families examined have n values which do not over lap (Bethylidae 10–14, Chrysididae 19–21, Dryinidae 5) (Gokhman & Kolesnichenko 1998b). These data also demonstrate that the apparent problem concerning numerical aspects of chromosomal evolution in higher hymenopterans postulated by Crozier (1975: ‘The most puzzling aspect of the overall karyotypic evolution of the Hymenoptera is the occurrence of low chromosome numbers in the Parasitica followed by the reappearance of high number in aculeates’) is now largely resolved. Groups with well studied karyotypes belong to the Ichneumonoidea, Cynipoidea or Chalcidoidea, namely Ichneumonidae (n = 8–21), Braconidae (n = 3–17), Cynipidae (n = 5–10), Aphelinidae (n = 3–11), Pteromalidae (n = 5–7), Torymidae (n = 4–6) and Trichogrammatidae (n = 5). Again, although chromosome numbers are now studied in 23 wasp families, as compared to eight listed by Crozier (1975), this is less than half of all known parasitic families. Karyological data obtained for separate tribes and lower taxa may also be of use in parasitic Hymenoptera taxonomy (see Gokhman 1997a for examples), although chromosome studies usually provide the most valuable information for taxonomic research at the species level. Except for a few unpublished cases of cryptic species detected in the Aphidiinae (Braconidae: Quicke pers. comm.), eight groups of sibling species belonging to the families Ichneumonidae, Encyrtidae, Pteromalidae and Torymidae are known to date (summarised by Gokhman & Quicke 1995). Recently, however, a further two such species groups were discovered in the Pteromalidae and Cynipidae. Chromosomes of 10 members of the Pteromalidae have been studied (Gokhman & Quicke 1995; Gokhman unpublished), all of them having n = 5 except for a local population (perhaps sibling species) of Nasonia vitripennis (Walker) from California with n = 6 (Goodpasture 1974). This family therefore has highly restricted variation in chromosome number. For example, although different karyotypes do occur in N. vitripennis which normally has n = 5, two other species belonging to the same complex, namely N. longicornis Darling and N. giraulti Darling, have the same n value. Moreover, karyotypes of the three Nasonia species studied under routine and differential (C-) staining appear to be very similar, if not identical (but see Gokhman & Westendorff 2000). Recent study of a species complex found in the pteromalid Anisopteromalus calandrae (Howard), represents a highly convincing example of using karyological methods for detecting sibling species (Gokhman et al. 1998). Anisopteromalus calandrae is widely known as an effective cosmopolitan parasitoid of stored-product pests. It has been thoroughly studied (see Gokhman et al. 1998 for review) but the presence of sibling species was previously not suspected. Recently, the karyotype of this species from a laboratory population maintained at the Imperial College (Silwood Park, U.K.) (Gokhman & Quicke 1995) was investigated. All individuals examined invariably showed a haploid number of seven, the value found only among chalcidoids in the aphelinid Encarsia tricolor Foerster (Baldanza et al. 1994). Therefore, populations of A. calandrae from other regions were likely to have other chromosome numbers. Karyological investigation of the laboratory stock originated from an indoor population from Moscow has revealed n = 5. Subsequent analysis demonstrated that the two populations were reproductively isolated from each other. They also appeared to differ in some morphological details and ecological attributes, thus supporting the proposal that they represent two distinct sibling species.


The example of the A. calandrae species complex shows that chromosomal investigation may be of taxonomic use even in groups presumed to be karyologically uniform and well-studied by other methods. It also demonstrates that cytogenetic information often has some prognostic features. Specifically, if an unusual karyotype is found in a particular taxon at the species level, other populations of this group should be intensively studied because they may well differ in chromosomal characters, thus making possible the detection of sibling species. A similar situation is known for A. mukaigawae s.l. (Abe 1998, see above), but two host races previously revealed in this complex appear to have different chromosome numbers, n = 5 and 6. Thus, the two races have acquired the status of sibling species differing in host range, shape of unisexual galls and karyotype structure. Again, n = 10 was previously found in all members of the Cynipoidea except for Diplolepis species (Cynipidae) with n = 9. Recently, however, karyological study of the first examined member of the Figitidae, Callaspidia defonscolombei Dahlbom showed n = 11 in this species (Gokhman 1999). Karyological analysis is the only direct method for studying the number of linkage groups in various species of parasitic wasps. This is a very simple and effective technique which sometimes cannot be replaced by formal or molecular genetics methods, and therefore it should not be neglected. The history of studying the PSR (paternal sex ratio) factor in N. vitripennis provides an excellent example in this respect. In the early 1980’s a particular sex ratio distorter was discovered in N. vitripennis which caused complete male offspring and was found to be transmitted paternally. Although some microscopic preparations were made from fertilised eggs, they were unsuitable for cytogenetic purposes and showed only chromosome clumping and subsequent elimination of a haploid set from those eggs. Moreover, the PSR factor was considered extrachromosomal, despite the fact that factors of that kind in animals are not transmitted by males (Werren et al. 1987). Crossing experiments seemed to support this assumption because they involved genetic markers for all linkage groups known that time in N. vitripennis. Only after DNA sequencing of the PSR region was undertaken and revealed satellite chromosomal DNA, a thorough karyological study was initiated which demonstrated the presence of a smaller B chromosome responsible for the PSR effect (Nur et al. 1988; Werren 1991).

Future Chromosome Studies on the Parasitic Hymenoptera Despite the general progress in studies on the karyology of the parasitic Hymenoptera, there are some prospective areas which deserve more intensive research. In support of higher-level phylogenetic studies within the Apocrita, more attention could be paid to elucidating the karyology of major groups, such as Megalyroidea, Trigonalyoidea and Stephanoidea, which have not yet been examined. This also applies to phylogenetic investigations at family level for groups where there are conflicting hypotheses. For example, studies on the Chalcidoidea could profitably target information on chromosome number and other characters for families which are believed to be relatively basal, such as the Myrmaridae. Chromosomal analysis of species held as laboratory stocks may represent a useful direction for karyotaxonomic research, because of their easy availability for interpreting differences in karyological characters and because they are often of economic importance. This is perhaps also true for parasitic Hymenoptera attacking patchy hosts. It was recently suggested by Gokhman et al. (1998) that parasitoids of such hosts may have higher inbreeding rates, as proposed by Askew



(1968) for many chalcidoids, and therefore these taxa may have a larger variation in chromosomal characters. Indeed, karyotypes of Encarsia (Aphelinidae) (n = 3, 5, 6, 7, 8, 9 and 10) and Aphidius (Braconidae) (n = 3, 5, 6, and 7 – Fig. 4) (Baldanza 1996; Gokhman & Quicke 1995; Quicke pers. comm.; Gokhman unpublished) parasitising aggregated hosts (scales, whiteflies and aphids) support this assumption. Similarly, chromosome studies on the Encyrtidae or those attacking stored-product pests, may be extremely useful in solving taxonomic problems, as discussed above for the A. calandrae species complex. Modern methods of differential staining may provide important information, especially at lower taxonomic levels. For example, karyotypes of three species belonging to the genus Dirophanes Foerster (Ichneumonidae) have been studied using chromosomal C-banding, namely: D. callopus (Wesmael), D. fulvitarsis (Wesmael) and D. invisor (Thunberg). Although D. fulvitarsis and D. invisor both have 2n = 20, as opposed to D. callopus with 2n = 18, strong differences in heterochromatin distribution were found between the first two species (Gokhman 1997b). In an analogous way, Baldanza (1996) revealed notable differences between several members of the genus Encarsia having the same chromosome number with the help of the Ag-NOR banding. Karyological research can now also be incorporated into molecular studies on parasitic wasps. Study of the PSR factor in N. vitripennis is perhaps the best example of this. Another promising area of investigation involves entomopathogenic viruses associated with many species of parasitic wasps (Stoltz & Whitfield 1992). Since certain polydnaviruses may be integrated in the wasp genome, e.g. as in the braconid Chelonus inanitus (L.) (Gruber et al. 1996), the FISH (fluorescent in situ hybridisation) technique could become an important step in localising the virus on chromosomes. However, its karyotype must be examined in detail prior to such molecular studies in order to render the chromosome recognisable. Studies of this kind have been undertaken recently on C. inanitus (Gokhman & Kolesnichenko 1998c), with this braconid being the first parasitic wasp for which chromosomal localisation of a symbiotic virus can be demonstrated.

Acknowledgements I am very grateful to Fulvio Baldanza and Donald Quicke for their kind permission of citing their unpublished results, as well as to Beatrice Lanzrein and John Huber for helpful discussion. Donald Quicke, Leo Beukeboom, Petr Stary and Ulrich Schwörer also provided laboratory stocks of several parasitic wasp species for karyological studies.

References Abe, Y. (1998) Karyotype differences and speciation in the gall wasp Andricus mukaigawae (s.lat.) (Hymenoptera: Cynipidae), with description of the new species A. kashiwaphilus. Entomologica Scandinavica 29: 131-135. Askew, R. R. (1968) Considerations on speciation in Chalcidoidea (Hymenoptera). Evolution 22: 642-645. Baldanza, F. (1996) Studi citotassonomici ed analisi dei profili proteici di alcune specie del genere Encarsia Foerster (Hym.: Aphelinidae). Tesi di dottorato. Università degli studi di Napoli “Federico II”, Napoli (Portici). Baldanza, F., Gaudio, L. & Viggiani, G. (1991a) Ricerche cariologiche sull’Archenomus orientalis Silvestri (Hymenoptera: Aphelinidae), parassitoide di Pseudaulacapis pentagona (Targioni Tozzeti) (Homoptera: Diaspididae). pp. 457-461. In Atti XVI Congresso nazionale italiano di Entomologia. Bari – Martina Franca 23-28 settembre 1991.


Baldanza, F., Odierna, G. & Viggiani, G. (1991b) A new method for studying chromosomes of parasitic Hymenoptera, used on Encarsia berlesei (Howard) (Hymenoptera: Aphelinidae). Bollettino del Laboratorio di Entomologia Agraria Filippo Silvestri 48: 29-34. Baldanza, F., Odierna, G. & Viggiani, G. (1994) Studi cariologici comparati su alcune specie del genere Encarsia Foerster (Hymenoptera: Aphelinidae). pp. 153-157. In Atti XVII Congresso nazionale italiano di Entomologia. Udine 13-18 giugno 1994. Crozier, R. H. (1975) Animal Cytogenetics 3 (7). Gebrüder Borntraeger, Berlin-Stuttgart. Dijken, M. J. van. (1991) A cytological method to determine primary sex ratio in the solitary parasitoid Epidinocarsis lopezi. Entomologia Experimentalis et Applicata 60: 301-304. Dijkstra, L. J. (1986) Optimal selection and exploitation of hosts in the parasitic wasp Colpoclypeus florus (Hym., Eulophidae). Netherlands Journal of Zoology 36: 177-301. Dodds, K. S. (1938) Chromosome numbers and spermatogenesis in some species of the hymenopterous family Cynipidae. Genetica 20: 67-84. Gokhman, V. E. (1985) Chromosome sets in some Ichneumoninae (Hymenoptera: Ichneumonidae). Zoologichesky Zhurnal 64: 1409-1413. [in Russian] Gokhman, V. E. (1997a) Chromosome number and other karyotypic features of parasitic wasps as a source of taxonomic information. Boletín de la Asociacíon Española de Entomología (Suplemento) 21: 53-60. Gokhman, V. E. (1997b) Differential chromosome staining in parasitic wasps of the genus Dirophanes (Hymenoptera, Ichneumonidae). Zoologichesky Zhurnal 76: 65-68. [in Russian] Gokhman, V. E. (1999) Chromosomes of Callaspidia defonscolombei (Hymenoptera: Figitidae) Zoologichesky Zhurnal 78: 1476-1477. [in Russian] Gokhman, V. E. & Kolesnichenko, K. A. (1996) New data on karyology of the Ichneumonoidea (Hymenoptera). pp. 25-27. In Gokhman, V. E. & Kuznetsova, V. G. (Eds), Karyosystematics of the Invertebrate Animals 3. Botanical Garden, Moscow State University, Moscow. [in Russian] Gokhman, V. E. & Kolesnichenko, K. A. (1997) Chromosomes of ichneumon flies of the subfamily Pimplinae (Hymenoptera, Ichneumonidae). Folia Biologica (Kraków) 45: 139-141. Gokhman, V. E. & Kolesnichenko, K. A. (1998a) Chromosomes of parasitic wasps of the subfamily Alysiinae (Hymenoptera, Braconidae). Zoologichesky Zhurnal 77: 1197-1199. [in Russian] Gokhman, V. E. & Kolesnichenko, K. A. (1998b) First chromosome record for the family Dryinidae: the karyotype of Anteon brevicorne Dalman (Hymenoptera: Chrysidoidea). Journal of Hymenoptera Research 7: 116-117. Gokhman, V. E. & Kolesnichenko, K. A. (1998c) Karyotype of Chelonus inanitus (L.) (Hymenoptera, Braconidae). Entomologicheskoye Obozreniye 77: 663-666. [in Russian] Gokhman, V. E., Timokhov, A. V. & Fedina, T. Yu. (1998) First evidence for sibling species in Anisopteromalus calandrae (Hymenoptera: Pteromalidae). Russian Entomological Journal 7: 157-162. Gokhman, V. E. & Quicke, D. L. J. (1995) The last twenty years of parasitic Hymenoptera karyology: An update and phylogenetic implications. Journal of Hymenoptera Research 4: 41-63. Gokhman, V. E. & Westendorff, M. (2000) The chromosomes of three species of the Nasonia complex (Hymenoptera: Pteromalidae) Beiträge zür Entomologie 50: 193-198. Goodpasture, C. (1974) Cytological Data and Classification of the Hymenoptera. Unpublished Ph.D. Thesis. University of California, Davis. Goodpasture, C. (1975a) Comparative courtship behaviour and karyology in Monodontomerus (Hymenoptera: Torymidae). Annals of the Entomological Society of America 68: 391-397.



Goodpasture, C. (1975b) The karyotype of the cynipid Callirhytis palmiformis (Ashmead). Annals of the Entomological Society of America 68: 801-802. Goodpasture, C. & Grissell, E. E. (1975) A karyological study of nine species of Torymus (Hymenoptera: Torymidae). Canadian Journal of Genetics and Cytology 17: 413-432. Gruber, A., Stettler, P., Heiniger, P., Schümperli, D. & Lanzrein, B. (1996) Polydnavirus DNA of the braconid wasp Chelonus inanitus is integrated in the wasp’s genome and excised only in later pupal and adult stages of the female. Journal of General Virology 77: 2873-2879. Henking, H. (1892) Untersuchungen über die ersten Entwicklungsvorgänge in der Eiern der Insekten. III. Spezielles und Allgemeines. Zeitschrift für wissenschaftliche Zoologie 54: 1-274. Hung, A. C. F. (1982) Chromosome and isozyme studies in Trichogramma (Hymenoptera: Trichogrammatidae). Proceedings of the Entomological Society of Washington 84: 791-796. Hung, A. C. F. (1986) Chromosomes of three Brachymeria species (Hymenoptera: Chalcidoidea). Experientia 42: 579-580. Hunter, K. W., Jr., & Bartlett, A. C. (1975) Chromosome number of the parasitic encyrtid Copidosoma truncatellum (Dalman). Annals of the Entomological Society of America. 68: 61-62. LaSalle, J. & Gauld, I. D. (1991) Parasitic Hymenoptera and the biodiversity crisis. Redia 74: 315-334. Nur, U., Werren, J. H., Eickbush, D. G., Burke, W. D. & Eickbush, T. H. (1988) A ‘selfish’ B chromosome that enhances its transmission by eliminating the paternal genome. Science 240: 512-514. Quicke, D. L. J. & Gokhman, V. E. (1996) First chromosome records for the superfamily Ceraphronoidea and new data for some genera and species of Evanioidea and Chrysididae (Hymenoptera: Chrysidoidea). Journal of Hymenoptera Research 5: 203-205. Sanderson, A. R. (1988) Cytological investigation of parthenogenesis in gall wasps (Cynipidae: Hymenoptera). Genetica 77: 189-216. Stille, B. & Dävring, L. (1980) Meiosis and reproductive strategy in the parthenogenetic gall wasp Diplolepis rosae (L.) (Hymenoptera: Cynipidae). Hereditas 92: 353-362. Stoltz, D. B. & Whitfield, J. B. (1992) Viruses and virus-like entities in the parasitic Hymenoptera. Journal of Hymenoptera Research 1: 125-139. Werren, J. H. (1991) The paternal sex-ratio chromosome of Nasonia. American Naturalist 137: 392-402. Werren, J. H., Nur, U. & Eickbush, D. (1987) An extrachromosomal factor causing loss of paternal chromosomes. Nature 327: 75-76.

Morphology and Biogeography of the North African Ceramius Maroccanus-complex (Vespidae: Masarinae): Contribution of Morphometric Analyses to Taxonomic Decisions Volker Mauss Institut für Landwirtschaftliche Zoologie und Bienenkunde, Rheinische Friedrich-WilhelmsUniversität, Melbweg 42, D-53127 Bonn, Germany (email: [email protected])

Introduction The genus Ceramius comprises a monophyletic subtaxon within the Masarinae (Carpenter 1993). Twenty species exist in the Afrotropical region (Gess 1996; Gess 1997), while 13 species are reported to occur in the Palaearctic (Richards 1962; Mauss 1998). Knowledge about the taxonomy and bionomy of the Afrotropical taxa of Ceramius is extensive (e.g. Gess 1996; Gess 1997; Gess et al. 1997), while the Palaearctic species are comparatively poorly known. The following study on the Ceramius maroccanus-complex is part of a revision of the Palaearctic taxa of the genus. The C. maroccanus-complex constitutes a monophyletic subtaxon of species group 7 sensu Richards of Ceramius (Mauss 1999). It is endemic to south-western Morocco. Gusenleitner (1990) distinguished three taxa: C. m. maroccanus (Giordani Soika), C. m. rubripes Gusenleitner and C. montanus Gusenleitner. New material from Morocco which was received by the ‘Biologiezentrum des Oberösterreichischen Landesmuseums Linz’ in Austria suggests that the situation is more complicated.

Materials and Methods Dry specimens were investigated under a stereomicroscope (51 females, 52 males). All males were genitalised; male genitalia were removed after resoftening the specimens in a wet chamber and studied in 70% ethanol. Fourteen parameters of the exoskeleton of the specimens were measured using a WILD M3 stereomicroscope in monaxial position with calibrated ocular micrometer. Wing venation was examined by use of digital pictures which were analysed semiautomatically with WinBee 6.0 (cf. Schröder et al. 1999). Twenty-two lines and 34 angles in the fore wing were measured. A large number of dimensionless quotients was calculated from the measured lines of fore wing and exoskeleton. Then a discriminant analysis was calculated separately for each sex by SPSS using the dimensionless quotients and the angles of the fore wing as discriminating variables. The geographical distribution of the discriminant function scores were investigated following a method proposed by Fuchs (1998). By this method the position of each specimen within the discriminant space is represented by the colour of a symbol via the RGB-mode, while its geographical origin is indicated by plotting the symbol on a distribution map.

207

Volker Mauss 208

Figure 1


Records of members of the Ceramius maroccanus-complex in south-western Morocco (number of specimens per site is not taken into account).

Results The morphological investigation revealed that the complex consists of four taxa. They can be separated by characters of the male genitalia, especially the aedeagus and the volsella, the shape of the abdominal sternum IX of the males, and the form of the scutellum and the pronotal furrow of the females. Moreover, the taxa show differences in the integumental sculpture of various parts of the exoskeleton and in the variability of coloration. After comparing these taxa with the types or paratypes they were assigned to C. m. maroccanus, C. m. rubripes, C. montanus and an unknown taxon. The four taxa differ in their geographical distribution (Fig. 1), altitudinal dispersal and flight period. Males and females of the four taxa can be separated completely by three discriminant functions each. The discriminant function scores do not show any discernible geographical variation within the taxa and no clinal variation could be observed between them (Mauss & Schröder unpublished). Therefore, it is assumed that there is no gene flow between the taxa.

Discussion The morphological, biogeographical and morphometric analyses indicates that the C. maroccanus-complex consists of four well separated taxa. Probably no gene flow exists between the populations. Nevertheless, conclusions about the status of the four taxa can only be obtained by indirect indications of reproductive isolation mechanisms between them (cf. Willmann 1985). Such indications could be distinctive differences in characters which probably influence the

Morphology and Biogeography of the North African Ceramius Maroccanus-complex 209

mating success of individuals. Field observations of mating behaviour in some species of Ceramius (Mauss & Berger 2000) indicate that relevant characters of the males are probably the coloration of the head, the form of abdominal sternum IX and the configuration of male genitalia, among others. In the females the shape of the scutellum and possibly also of the pronotal furrow seem to be important. The four recognised taxa differ especially in these characters indicating that they are reproductively isolated. Furthermore, the more-or less sympatric occurrence of C. montanus and C. m. maroccanus or C. m. maroccanus and C. m. rubripes, respectively can be used as an additional criterion for the existence of reproductive isolation mechanisms between them (cf. Mayr 1975). For these reasons the four taxa are hypothesised to represent isolated biospecies. They are described or redescribed by Mauss (1999).

References Carpenter, J. M. (1993) Biogeographic patterns in the Vespidae (Hymenoptera): Two views of Africa and South America. pp. 139-155 In Goldblatt, P. (Ed.), Biological Relationships Between Africa and South America. Yale University Press, New Haven and London. Fuchs, S. (1998) Die Oberurseler Datenbank in Farbe. ADIZ / die biene 8: 17. Gess, F. W. (1997) Contributions to the knowledge of Ceramius Latreille, Celonites Latreille, Jugurtia Saussure and Masarina Richards (Hymenoptera: Vespidae: Masarinae) in South Africa. Journal of Hymenoptera Research 6: 36-74. Gess, S. K. (1996) The Pollen Wasps – Ecology and Natural History of the Masarinae. Harvard University Press, Cambridge, Massachusetts. Gess, S. K, Gess, F. W. & Gess, R. W. (1997) Update on the flower associations of southern African Masarinae with notes on the nesting of Masarina strucki Gess and Celonites gariepensis Gess (Hymenoptera: Vespidae: Masarinae). Journal of Hymenoptera Research 6: 75-91. Gusenleitner, J. (1990) Die bisher bekannten Nordafrikanischen Arten der Gattung Ceramius Latreille 1810 (Hymenoptera, Vespoidea, Masaridae). Linzer biologische Beiträge 22: 565570. Mauss, V. (1998) The identity and distribution of Ceramius auctus (Fabricius, 1804) Vecht, 1970 (Ceramius spiricornis Saussure, 1854 syn. nov.) and Ceramius beaumonti (Giordani Soika, 1957) Richards, 1962 (Hymenoptera, Vespidae, Masarinae). Annales de la Société Entomologique de France 34: 163-183. Mauss, V. (1999) Taxonomy, biogeography and phylogenetic position of the North African Ceramius maroccanus-complex (Hymenoptera: Vespidae, Masarinae). Entomologica Scandinavica 30: 323-348. Mauss, V. & Berger, A. (2000) Funktion von Strukturen des Exoskeletts und des Genitalapparates der Männchen verschiedener Ceramius-Arten (Hymenoptera, Vespidae, Masarinae) während der Kopulation. Mitteilungen der Deutschen Gesellschaft für allgemeine und angewandte Entomologie 12: 485-488. Mayr, E. (1975) Grundlagen der zoologischen Systematik. Parey, Hamburg. Richards, O. W. (1962) A revisional Study of the Masarid Wasps (Hymenoptera, Vespoidea). British Museum (Natural History), London. Schröder, S., Wittmann, D., Roth, V. & Steinhage, V. (1999) Automated identification system for bees. p. 427. In Schwarz, M.P. & Hogendoorn, K. (Eds), Social Insects at the Turn of the Millennium, Proceedings of the XIII International Congress of IUSSI. Flinders University Press, Adelaide. Willmann, R. (1985) Die Art in Raum und Zeit: Das Artkonzept in der Biologie und Paläontologie. Parey, Hamburg.

Some Problems with Australian Tiphiid Wasps, with Special Reference to Coupling Mechanisms G. R. Brown Museum and Art Gallery of the Northern Territory, GPO Box 4646, Darwin, NT 0801 Current Address: Department of Primary Industry and Fisheries, GPO Box 990, Darwin, NT 0801, Australia (email: [email protected])

Introduction The predominant element of Australian Tiphiidae is the Thynninae, although four other subfamilies are represented in the fauna: Tiphiinae and Diamminae each with one species, Myzininae with eight species, and Anthoboscinae with about 60 species. The Thynninae is virtually limited to Australia and South America and is most easily distinguished from all other Australian tiphiids, except Diamma bicolor Westwood, by the presence of complete sexual dimorphism including full aptery in females. Little is known of the biology of the group although almost 600 species have been described. A few species have been recorded as parasitoids of scarab larvae (e.g. Given 1953; Ridsdill-Smith 1970) while males of others are specific orchid pollinators (e.g. Adams & Lawson 1993; Bower 1996; Brown 1997). Because females are wingless, they are dependant on males to fly them to and from a food source (such as nectar) whilst remaining in copula. This results in pairs remaining in a copulatory position for prolonged periods and has favoured the development of spines, grooves and other more complex structures in both sexes. There are many problems associated with the study of this group. These include the near impossible task of rearing these wasps in the laboratory, the large number of undescribed and unrecognised higher taxa, and an estimated 2000+ undescribed species. In addition, there are numerous cryptic species that are more easily detected using biological methods, such as baiting with orchids, than by morphological characters alone. Because of the extreme sexual dimorphism in the group, pairs can only be associated by collecting them in copula. However, it appears that females will readily couple with males of other species, if conspecific males are rare or absent. This makes the association of congeneric sexes tenuous, especially if based on a single pair, but is the only method available. However, non-congeneric pairs involving described genera can be recognised on the basis of published morphological differences (e.g. Turner 1910; Brown 1998). If this misassociation of pairs is a common occurrence as suggested by the high number of miscoupled pairs in collections (Given 1954), it may be a survival mechanism that ensures an individual female is fed in preference to successful mating and fertilisation occurring. Association of the sexes could then only be reliably undertaken using morphological rather than behavioural methods. In a search for structures that may associate the dimorphic sexes of thynnines, I approached the problem with the assumption that any such structures would represent adaptations for prolonged coupling. These structures are discussed below and interpreted in relation to adaptations that enable pairs to remain in copula for prolonged periods whilst in flight and while feeding.

210


Some Problems with Australian Tiphiid Wasps 211

Materials and Methods Most specimens in Australian institutions as well as many holdings of Australian species held in overseas institutions were examined. Male genitalia were dissected from the metasoma, cleared in 10% KOH, rinsed in distilled water, dehydrated through an ethanol series, and then stored in glycerine filled vials that are attached to the pin of the original specimen.

Results and Discussion Coupling and copulatory position Typically, when females are ready to mate, they climb low plants and rest in a characteristic headup position with their antennae erect. Males are attracted from down-wind, and often fly in a zigzag manner. A male will couple with a female by curving the tip of the abdomen under, exerting the genitalia and clasping her. In this position, the male and female are both dorsum up with the male on top of the female. At some point the male genitalia become inverted along their longitudinal axis so that both are dorsum up, but facing in opposite directions, thus allowing both individuals to feed with more freedom. This rotation may simply occur from movement by the female relative to the male. Different taxa appear to have different positions before and after rotation of the male genitalia. These positions are difficult to quantify because captured pairs quickly separate, and there is only a handful of specimens in collections in which the pairs are still coupled. Some of these are illustrated in Figures 1-6.

Male genitalia and associated structures The male genitalia occur internally at the apex of the metasoma and are enclosed by the hypopygium (i.e. the last visible sternum, S8) ventrally and the epipygium (i.e. the last visible tergum, T7) dorsally. The genitalia consist of a fused pair of basiparameres with a proximal basal ring, an apical aedeagus, pairs of parameres, volsellae and, in some genera, parapenal lobes. Normally the dorsal surface is longer than the ventral surface (especially that of the basiparameres), but after the initial coupling with a female the genitalia become rotated along their longitudinal axis and thus inverted so that the dorsal surface becomes the ventral surface and vice versa. After uncoupling from the female, the genitalia appear to revert to their original orientation. The basal ring is usually short and ring-like. However, for example, in Phymatothynnus Turner it is long and narrow while in Tachynomyia Guérin it is long and curved. This increased length enables the apex of the genitalia to be exerted further than in other genera, and is assisted by the metasomal segments being relatively weakly sclerotised and therefore more flexible in allowing large genitalia to be exerted. The basiparameres have a long dorsal surface and a short ventral surface medially. When the genitalia are inverted after coupling, the now antero-ventral surface forms a ball and socket joint with the basal concavity of the hypopygium and the apex butts up against the apex of the female S6 preventing too close a coupling. The now dorsal surface is short medially and, together with the now dorso-basal margins of the parameres and volsellae, forms a concavity into which the apex of the epipygium and/or apex of the female pygidium fit (although this cavity is not species specific). In some genera such as Iswaroides Ashmead, Epactiothynnus Turner and Encopothynnus Turner, the dorso-basal angle of the basiparamere (viewed in profile) is pronounced. This is

G. R. Brown 212

Figures 1-6


Male-female coupling mechanisms (males stippled): 1) Zaspilothynnus interruptus Westwood, dorsal view, male genitalia inverted; 2) Zaspilothynnus interruptus, lateral view; 3) Rhagigaster stradbrokensis Given, dorsal view, male genitalia inverted; 4) Rhagigaster stradbrokensis, lateral view; 5) Aeolothynnus sp., dorsal view, male genitalia inverted; 6) Phymatothynnus nr monilicornis (Smith), dorsal view, male and male genitalia, ventral view of female (a = basiparameres, c = cuspis, d = digitus, e = epipygium, h = hypopygium, p = paramere, s = tergum 5, t = tergum 6, w = sternum 5, x = sternum 6, y = pygidium). Scale lines = 0.5 mm.


correlated with the presence of a transverse carina on the posterior margin of the epipygium which prevents the genitalia being moved too far dorsally when in copula. The parameres are the main grasping organs and as such their apical margins are shaped to fit against the apex of the female metasoma. The presence of setae, especially apically, increases the hold on the female. In most of the highly evolved genera such as Thynnus F., Thynnoides Guérin and Lestricothynnus Turner, there is a dense subapical internal brush of stout setae. As these setae are internal, their function may be sensory or stimulatory (although no corresponding features are found in females), rather than for grasping, particularly since some females such as those of Zaspilothynnus Ashmead and Catocheilus Guérin have highly modified pygidia to increase stability in coupling. The parameres may be narrowed where the apex of the female metasoma is modified, usually variously excavate, so that the sexes fit tightly together. This is particularly evident in Catocheilus, some Zaspilothynnus and, to some extent, in Thynnus. The volsellae are highly variable, and consist of basal cuspides and dorso-apical (when present) digiti. The cuspides probably help open the female and guide the genitalia into position. In Catocheilus the pygidium is notched laterally for reception of the cuspides. In some Rhagigasterini the cuspides each have a curved lobe which is apically setose. Their function, indicated by the presence of these setae, is probably sensory. Digiti are present in most of the more evolved genera, but may also occur in more primitive groups. They typically have a granular surface which is used to grasp the raised lip of the female S6. The granulations on the cuspides of Dimorphothynnus Turner may serve a similar purpose. The digiti are also apically setose and often vary considerably between closely related species. The parapenal lobes are probably involved in separating the female pleura for penetration by the aedeagus. This is suggested by the rounded and often enlarged apices. The aedeagus is variable in length among species and may differ significantly between closely related species. This variation may be related to the closeness of the pairs when in copula. Male hypopygium. The hypopygium (S8) has a basal concavity on the upper surface which encloses the genitalia ventrally, and an apical flat area which is especially well-developed in the more advanced Thynnini. The apical flat area is visible dorsally, and typically has an apical spine with a smaller lateral (i.e. close to the apical spine) or basal (i.e. close to the base of the hypopygium) spine. When the genital cavity is closed the hypopygium is contiguous with the epipygium and its shape somewhat reflects that of the epipygium, at least internally. The width of the apical spine and the presence of basal lobes or spines appears to be associated with the ventral (uninverted) distance between the parameres. Where a distinct angle is formed between the base of the apical spine and basal lobes, a notch is formed which guides the genitalia when moving outwards and downwards. When the genitalia are rotated along their longitudinal axis, the hypopygium is moved up and the apex may rest on the apical sterna of the female and the guiding mechanism is no longer engaged. The margins of these spines and lobes are often carinate and may serve to strengthen the hypopygium. The basal concavity supports the basiparameres in a ball and socket joint which provides mostly up and down movement (lateral movement being restricted by the shape of the epipygium). The contact area between female and male is increased and strengthened in some Rhagigaster Guérin by the presence of a subapical spine which is formed by the raised internal margins of the hypopygium. This spine may also make contact with the subgenital plate of the female during coupling to assist in penetration of the female.

G. R. Brown 214


Downward movement of the female is prevented by contact between the apical spine and S5 of the female. Where this spine is strongly developed, as in the more advanced Thynnini and some Rhagigasterini, S5 is rugose or carinate (compared with punctate in the more primitive Thynnini) and movement between the apical spine and S5 is restricted. Downward movement may be further restricted by friction between carinae on the flattened apex of the male hypopygium dorsally and the raised lip of S6 on the female. In many genera, the basal concavity of the hypopygium has a group of long erect setae. The function of these setae is unknown but it may be sensory in nature with the setae being used to determine the position of the genitalia. There are no other apparent alternative setae which may fulfil this function in those genera in which the hypopygial setae are lacking. Male epipygium. The epipygium is concave internally with an inner lip which contacts the hypopygium to close the genital cavity. In the more advanced Thynnini the hypopygium is located more posteriorly than in other tiphiid subfamilies and tribes so that much of the hypopygium is visible dorsally beyond the epipygium. In these genera the epipygium is produced posteriorly into a membranous apical plate which covers the genital cavity posteriorly. This membrane is bent upwards by the basiparameres when the genitalia are exerted. In many genera the epipygium restricts the rotation of the genitalia. In Rhagigaster the epipygium is often postero-laterally excavate for the reception of the parameres. There is some correlation between the shape of the epipygium apically and the gap between the parameres dorsally when the male genitalia is inverted so that, where the epipygium is broadly produced, the gap may also be broad. Strongly carinate lateral margins or other carinae are often present to strengthen the epipygium. The posterior margin may be transversely carinate with the carina often being further strengthened by the presence of upturned or subtuberculate postero-lateral angles. In the more advanced Thynnini the epipygium is usually variously carinate, especially longitudinally. In some genera such as Zaspilothynnus, Thynnus, Guerinius Ashmead and Oncorhinothynnus Salter, it is produced into a protruding subapical plate. This plate is often strengthened by longitudinal carinae while, posterior to this plate, the epipygium is transversely carinate, allowing some upward deflection of the sclerite, but with excess upward movement of the genitalia being prevented by the subapical plate. However, in Oncorhinothynnus the epipygium has a strongly developed median sagittal carina between the subapical plate and the apical margin. This strengthens the apical margin which is consequently unable to flex. In those genera in which the epipygium is simple and non-carinate (Eirone Westwood and some primitive Thynnini such as Phymatothynnus) the genitalia are often large compared with the size of the genital cavity opening, and the epipygium is weakly sclerotised so that it can flex when the genitalia are exerted.

Metasoma In males the metasoma is variously modified so that its flexibility and thus the movement of the female in copula is increased or decreased. In some genera (e.g. Lestricothynnus and Oncorhinothynnus) the metasomal segments are strongly sclerotised, strongly constricted, and the intersegmental muscles are large providing great flexibility. In extreme cases (e.g. Doratithynnus Turner and Zaspilothynnus) the sterna and terga may be produced into tubercles or spines. These processes are hollow and filled with muscle fibres thus extending the pulling distance of the muscle. Such modifications do not occur in the female.


Movement of the metasoma is limited in some genera, especially in the male, by modifications to S1, S2 and T1. The most flexible ventral suture is that between S1 and S2. These sterna are separated by a deep groove and are often obliquely truncate at the suture. This allows greater movement than other ventral sutures. In many Rhagigaster spp. the metasoma is longer than in other genera, and S1 and S2 are medially tuberculate near the suture. These tubercules limit downward movement. In genera that have S1 medially raised (e.g. Agriomyia Guérin) downward movement is less than in those which have S1 flat (e.g. Elidothynnus Turner). The upward movement of the metasoma is similarly restricted by modifications to T1 anteriorly and the propodeum posteriorly. In males of those genera in which T1 is wider than long, the propodeum is usually almost flat and oblique so that the two surfaces can come into contact. This is common in males of Thynnini where the females are often relatively much larger than in other tribes. The greatest flattening of the propodeum occurs in the males of Thynnus where the propodeum is almost vertically truncate. In the females of most species T1 is usually truncate anteriorly and the propodeum truncate posteriorly. A greater degree of movement is possible where the propodeum is excavate posteriorly, as in Rhagigaster castaneus Smith, but restricted where T1 is produced antero-medially, as in R. auriceps Turner. Female pygidium. The pygidium is variously modified to increase adhesion between the sexes. Modifications include lines or brushes of setae, a rugose surface, carinae, notches or grooves into which the cuspides or parameres of the male may fit, and the narrowing of the pygidium so that it can be grasped laterally. Female sternum 5. Sternite 5 is rugose or carinate in most groups where the apical spine of the hypopygium of the male is long (especially the Thynnini). Contact between S5 and the hypopygium restricts the downward movement of the female relative to the male while in copula. Female sternum 6. The margin of S6 is lipped in some genera so that it can be: 1) grasped by the digitus of the male (when present); 2) butted against by the apex of the basiparameres ventrally (when inverted); and 3) stabilised by touching the carinae on the apical flat area of the hypopygium dorsally.

Associations between structures The above modifications can be summarised as follows: 1) those which associate sexes; 2) those which are associations between the male genitalia and surrounding sclerites; 3) those which favour movement of pairs whilst in copula; or 4) those which restrict movement of pairs whilst in copula (Table 1). None of these structures appear to be restrictive enough to ensure that species are always correctly paired. More associations were found between the genitalia and the external apical sclerites of the male (Table 2). However, there is a point where too much movement will place strain on the coupling, and there must be some mechanism(s) which restrict or limit movement (Table 3). How species specific is this coupling mechanism? This study has identified some relationship between certain morphological structures in both sexes. However, it has not been possible to demonstrate a specific ‘lock and key’ mechanism that prevents pairs from different species or genera coupling. Further, there may be an alternative pheromonal or behavioural mechanism that enables females to miscouple when males of the same sex are rare or absent. The existence of such a mechanism may rely on the ability of females

G. R. Brown 216

Table 1


Morphological structures that associate conspecific pairs of thynnine wasps.

Male

Female

parameres narrow (Fig. 1)

pygidium grooved laterally (Fig. 1)

cuspis large and triangular (Fig. 2)

pygidium with lateral grooves/spines

basiparameres truncate or emarginate (Fig. 6)

S6 prominent (Fig. 6)

digitus large (Fig. 2)

S6 with lip (Fig. 2)

hypopygium dorsal carinae

S6 with lip (Fig. 2)

hypopygium with stout apical spine (Fig. 2)

S5 carinate/rugose (Fig. 2)

paramere shape and setal patterns (Figs 1, 3, 4)

pygidial shape, carinae, setae (Figs 1, 5)

Table 2 wasps.

Morphological association between the genitalia and surrounding sclerites in male thynnine

Genitalia

Sclerites

basiparameres

internal surface of the hypopygium basally

ventral margin of parameres

apical margin of hypopygium

basal angle of basiparameres

apex of epipygium

ventral margin of parameres

apex of epipygium

size of genitalia

degree of scleritisation of adjacent sclerites

internal margin of hypopygium

internal margin of epipygium

Table 3

Structures that favour increased or decreased movement whilst in copula.

Increased

Decreased

lengthening of metasoma (especially in the male)

presence of tubercles on sterna 1 and 2

presence of a ball and socket joint with the basiparamere and hypopygium of the male

shape of the propodeum and tergum 1

weakly sclerotised metasomal segments in the male

presence of longitudinal carinae on epipygium

large gap between sterna 1 and 2 transverse carinae on epipygium (especially if below a preapical plate)

to manipulate the pheromones they release to attract males of other species. However, as yet nothing is known about thynnine pheromones. One advantage to the female of a miscoupling is that it would allow her to be transported to a food source. It does not matter to the individual female if successful insemination occurs or not as unsuccessfully mated wasps produce males. However, it is unclear what benefits, if any, the males would receive from this behaviour. If such a mechanism does exist, then miscoupling could be a common occurrence within the subfamily. This has been suggested by several authors (Turner 1907, 1910; Rohwer 1910; Given 1959) and includes a number of non-conspecific type pairs as listed by Given (1954), however, more recently, only one instance of miscoupling has been confirmed (Brown 1993).


References Adams, P. B. & Lawson, S. D. (1993) Pollination in Australian orchids: a critical assessment o the literature 1882-1992. Australian Journal of Botany 41: 553-75. Bower, C. C. (1996) Demonstration of pollinator-mediated reproductive isolation in sexually deceptive species of Chiloglottis (Orchidaceae: Caladeniinae). Australian Journal of Botany 44: 15-33. Brown, G. R. (1993) A new species of Lestricothynnus with notes on miscoupling in Thynninae (Hymenoptera: Tiphiidae). Journal of the Australian Entomological Society 32: 197-199. Brown, G. R. (1997) Arthrothynnus, a new genus of orchid-pollinating Thynninae (Hymenoptera: Tiphiidae). The Beagle, Records of the Museums and Art Galleries of the Northern Territory 13: 73-82. Brown, G. R. (1998) Revision of the Neozeleboria cryptoides species group of thynnine wasps (Hymenoptera: Tiphiidae): pollinators of native orchids. Australian Journal of Entomology 37: 193-205. Given, B. B. (1953) General report on a search for parasites of Melolonthinae in Australia. New Zealand Journal of Science and Technology (B) 34: 322-340. Given, B. B. (1954) A catalogue of the Thynninae (Tiphiidae, Hymenoptera) of Australia and adjacent areas. New Zealand Department of Scientific and Industrial Research Bulletin 109: 1-89. Given, B. B. (1959) Notes on Australian Thynninae. II. The genera Dimorphothynnus, Rhagigaster and Eirone. Proceedings of the Linnean Society of New South Wales 83: 309-26. Ridsdill-Smith, T. J. (1970) The biology of Hemithynnus hyalinatus (Hymenoptera: Tiphiidae), a parasite on scarabaeid larvae. Journal of the Australian Entomological Society 9: 183-195. Rohwer, S. A. (1910) Turner’s Genera of Thynnidae with notes on Ashmeadian Genera. Entomological News 21: 345-351. Turner, R. E. (1907) A revision of the Thynnidae of Australia (Hymenoptera). Pt I. Proceedings of the Linnean Society of New South Wales 32: 206-290. Turner, R. E. (1910) Additions to our knowledge of the fossorial wasps of Australia. Proceedings of the Zoological Society of London 1910: 253-356.

Historical Review and Current State of the World Generic Classification of Oak Gall Wasps (Hymenoptera: Cynipidae: Cynipini) George Melika1 and Warren G. Abrahamson2 1

Systematic Parasitoid Laboratory, Kelcz-Adelffy St. 6, Köszeg 9730 Hungary (email: [email protected]) 2

Department of Biology, Bucknell University, Lewisburg, PA 17837 USA

Introduction The Cynipoidea includes approximately 3000 described species worldwide. Both structural and biological characteristics have been used to divide the superfamily into two groups, ‘macrocynipoids’ and ‘microcynipoids’ (Ronquist 1995). The latter group includes the Cynipidae which comprises six tribes (Ronquist 1994, 1995; Nieves Aldrey 1994; Fergusson 1995), all of which except the Aylacini are demonstrably monophyletic (Nieves Aldrey 1994; Ronquist 1994, 1995; Liljeblad & Ronquist 1998). Members of the other five tribes (Aylacini, Diplolepidini, Eschatocerini, Pediaspidini and Cynipini) induce galls while the Synergini comprises inquilines, the larvae of which are phytophagous and utilise the galls of other cynipids. Kinsey (1920) first considered the Cynipini (oak gall wasps) to be monophyletic, the members of which are associated only with Quercus or closely related genera in the Fagaceae. They are also defined by having a short pronotum and opened radial cell (Weld 1952; Ronquist 1994; Liljeblad & Ronquist 1998), synapomorphies that also occur in the Diplolepidini and Eschatocerini. The clear definition of genera is a significant problem within the Cynipidae, particularly for the Cynipini which comprises 85% (about 750–800 species) of the family, because of the presence of alternate unisexual and bisexual generations in many genera, which are morphologically different among adults. The existing keys to the world genera of Cynipini (Dalla Torre & Kieffer 1910; Weld 1952) are out of date and unreliable in that they often employed characters now known to be variable. These included the structure and location of a gall or novel host association which were more heavily weighted in the description of new genera than were morphological characteristics of the adult. For example, the North American genus Heteroecus Kinsey was established on the basis of its association with Quercus chrysolepis, thus assuming gall structure and/or host-plant association were unique features. While this is the case for many species, our research shows that different species can induce galls with similar structure, especially for those that cause catkin, bud and stem swelling-like galls. Many North American species of Callirhytis, for example C. cornigera (Osten-Sacken), C. quercusclavigera (Ashmead) and C. quercuspunctata (Bassett), induce stem swelling-like galls that are similar in size and shape, although the species can be separated on their adult morphology. Many Atrusca spp. in south-western USA and Mexico (e.g. A. brevipennata (Gillette), A. bella (Bassett), A. capronae (Weld) and A. catena (Kinsey)) induce similar leaf galls on the same species of oaks (Kinsey 1936; Weld 1960). Many European species of Andricus

218


Historical Review and Current State of the World Generic Classification of Oak Gall Wasps 219

induce catkin and bud galls in their bisexual generations that are structurally similar. Furthermore, the structure of galls caused by the same species can vary with the host oak species attacked or their geographic location. For example, galls of A. solitarius (Fonscolombe) in Europe are densely pubescent when they develop on Quercus pubescens and are smooth and glabrous on Q. robur. The unisexual leaf galls of Cynips quercusfolii L. are small with a smooth surface when development occurs on Q. petraea, but they are larger with a course irregular surface on Q. robur. Galls of A. lucidus (Hartig) on Corfu (Greece) and in Turkey are usually twice as large as those in Central Europe. Here we review the history of higher level taxonomic research on the Cynipidae and particularly the Cynipini, and in so doing outline problems associated with previous studies. We contend that the principal criteria for the diagnosis of genera and species should be characters derived from adult morphology. Accordingly, the taxonomic potential of several character systems is reviewed. N.B. Unless included in the text, the authors of genera are given in Table 1.

Historical Review of Cynipidae From the time of Linnaeus to the 1830’s, the systematics and classification of the Cynipidae was confused to the point of mixing species from different superfamilies, viz. Cynipoidea and Chalcidoidea. The generic name Cynips originated in ‘Systema Naturae’ (Linnaeus 1758) with eight described gall-inducing species. The remainder of his Cynips species were chalcid wasps. Without doubt, Linnaeus erected Cynips to accommodate gall-inducing wasps in order to separate them from ‘Tenthredo’ where they were placed originally along with other large Hymenoptera (Linnaeus 1746). Various chalcids were also placed under the name Cynips because of their morphological similarity to cynipids rather than to other ‘macro’ Hymenoptera. Later, Geoffroy (1762) erected the genus Diplolepis for the true cynipid gall-inducing wasps, with Cynips applied to parasitic species. In all editions of Linnaeus’ ‘Systema Naturae’, the genus Cynips began with gall-inducing cynipids and were followed by the parasitoids of gall inducers. Unlike Geoffroy’s use of Diplolepis, Linnaeus never used the latter name to differentiate gall-inducers from parasitoids. Fourcroy (1785), Olivier (1790, 1791) and Latreille (1805, 1810) followed Geoffroy by placing gall-inducers into Diplolepis and parasitoids into Cynips, while Fabricius (1804), Panzer (1806) and Spinola (1808) used the name Cynips for gall-inducing cynipids, and Diplolepis for chalcid parasitoids. Westwood (1829) strongly criticised the cynipid-chalcid classification, particularly the placement of chalcids and cynipids in the same genus. The keys of Foerster (1869), Mayr (1881) and Ashmead (1903) did not mention Diplolepis. Dalla Torre (1893) considered Diplolepis as a synonym to Cynips, however this was not accepted and Dalla Torre and Kieffer (1910) restored Diplolepis as a valid genus. Rohwer and Fagan (1917) synonymised Rhodites Hartig with Diplolepis, while Belizin (1961) and Kinsey (1929) considered Diplolepis a synonym of Cynips. Foerster (1869) later designated Cynips rosae L. as the type species of Rhodites. All the species inducing galls on roses were placed into this genus, while Kinsey and Ayres (1922) were the first to use Diplolepis for rose gall-inducing cynipids. Given this convoluted history, the validity of the name Diplolepis must be carefully considered and requires special study. Westwood (1840) was the first author who separated the genus Biorhiza Westwood from Cynips. Later, Hartig (1840a, 1840b) added eight new genera of gall-inducing cynipids: Andricus, Aylax

George Melika and Warren G. Abrahamson 220


Hartig, Diastrophus Hartig, Neuroterus, Rhodites, Spathegaster Hartig, Teras Hartig and Trigonaspis, as well as two genera of inquilines, Ceroptres Hartig and Synergus Hartig. Giraud (1859) erected Dryocosmus, Foerster (1869) established several other new genera from Europe, while Fitch (1859), Reinhard (1865) and Ashmead (1881, 1887, 1897a, 1897b) described 14 new genera of Cynipini from North America. Adler’s (1881) discovery of alternating generations in cynipids necessitated a taxonomic revision of genera. Mayr (1881) included a key to 29 genera of Cynipidae including 14 genera that belonged to the Cynipini and descriptions of seven new genera. Dalla Torre (1893) systematised the classification of cynipids in his ‘Catalogue Hymenopterorum – Cynipidae’. Later, Ashmead (1903) provided a key to 33 genera of Cynipini and a synopsis of world Cynipidae. ‘Das Tierreich – Cynipidae’ was completed by Dalla Torre and Kieffer (1910) and, although part of their classification has stood the test of time, a large number of taxonomic changes have subsequently been made to their work. Many of these changes to the generic classification of the Cynipini have been made by Kinsey (e.g. 1929, 1936, 1937) and Weld (e.g. 1921, 1951, 1952, 1957, 1959, 1960). However, the taxonomic approach of these two workers was antipodal: Kinsey was a ‘lumper’ at both the generic and specific levels, while Weld tended to split taxa. For instance, Kinsey’s concept of Cynips (Kinsey 1929, 1936) was treated by Weld as eight distinct genera. The current generic classification of world Cynipini follows Weld (1952). However, we consider Weld’s classification to be artificial and in need of substantial alteration, given that very little was known about the alternation of generations in North American cynipids at that time. Detailed studies of the alternation of generations for North American cynipids have been completed during the past several decades (Doutt 1959, 1960; Dailey 1969; Dailey & Sprenger 1973a, 1973b; Dailey et al. 1974; Evans 1967, 1972; Lyon 1959, 1963, 1964, 1969, 1970). This work has increased our understanding of gall-inducing cynipids and provided a solid background to establish a more natural classification for the Cynipini, particularly for taxa restricted to North America which were previously less well understood than for the Palaearctic fauna. Weld (1952) distinguished 39 genera of Cynipini. Lyon (1993) synonymised Xystoteras with Phylloteras and described Euxystoteras which differs from Phylloteras only by having simple tarsal claws. Maisuradze (1961) reported a new genus, Repentinia Belizin & Maisuradze from Azerbaijan, and Monzen (1954) described Neoneuroterus from Japan. Both genera are closely related to Neuroterus and/or Trichagalma, however their status remains uncertain as we have been unable to examine the types. Kovalev (1965) described two new genera, Belizinella and Ussuraspis, from Far East Russia which are closely related to the Nearctic Xanthoteras and Xystoteras, respectively, as well as to Trigonaspis from the Palaearctic. Later, Melika and Abrahamson (1997) described Eumayriella from eastern USA. Since Linnaeus, 74 genera of Cynipini have been described, of which 44 are currently recognised as valid.

Morphology and Classification of Cynipini The classification of cynipids has become confused in part by the use of incorrect terms for morphological structures. The nomenclature used to describe taxonomically important structures prior to the 1960’s is inconsistent (Dailey & Menke 1980). Various authors have used different terminology to define the same morphological structure and have employed the same term for different structures. As a consequence, species have been misunderstood and misidentified. Weld’s publications on oak gall cynipids are the most important for North America. Unfortunately, his terminology is seldom descriptive and sufficiently precise. Much of the most recent


Table 1 Division of the Cynipini based on the presence or absence of a basal lobe on the tarsal claws (after Weld 1952) (*genera which include species in both groups). Genera with toothed claw

Genera with a simple claw

Acraspis Mayr

Aphelonyx Mayr

Adleria Rohwer & Fagan

Bassettia Ashmead

Amphibolips Reinhard

Belonocnema Mayr

Andricus Hartig

Biorhiza Westwood

Antron Kinsey

Callirhytis Foerster

Atrusca Kinsey

Chilaspis Mayr

Besbicus Kinsey

Dryocosmus Giraud

Cynips L.

Erythres Kinsey

Disholcaspis Dalla Torre & Kieffer

Eumayria Ashmead

Dros Kinsey

Euxystoteras Lyon

Liodora Foerster

Fioriella Kieffer

Paracraspis Weld

Heteroecus Hartig

Parandricus Kieffer*

Holocynips Kieffer

Philonix Fitch

Loxaulus Mayr

Phylloteras Ashmead

Neuroterus Hartig*

(=Xystoteras Ashmead)

Odontocynips Kieffer

Trichoteras Ashmead

Parandricus Kieffer*

Trigonaspis Hartig*

Plagiotrochus Mayr

Xanthoteras Ashmead

Sphaeroteras Ashmead Trichagalma Mayr Trigonaspis Hartig* Trisoleniella Rohwer & Fagan Zopheroteras Ashmead

Genera described after 1952 Belizinella Kovalev

Belizinella Kovalev

Neoneuroterus Monzen

Eumayriella Melika & Abrahamson

Repentinia Belizin & Maisuradze

Ussuraspis Kovalev

research has followed ‘Weldian terminology’ (Dailey & Menke 1980) and, consequently, must be re-examined in light of modern concepts for the group (i.e. Menke 1993; Gibson 1985; Fergusson 1988; Ronquist & Nordlander 1989). The Cynipini can be easily distinguished from other Cynipidae by the following characters: pronotum dorsally very short, without truncation or pits; mesopleuron without longitudinal furrow; radial cell open; ventral spine of hypopygium never ploughshare-shaped (as in Diplolepidini) (Weld 1952; Eady & Quinlan 1963). With the exception of Neuroterus, the systematic arrangement of world genera is based on the presence or absence of a tooth on the tarsal claws and this divides the tribe into two groups (Table 1) (Figs 1–9). Use of this character within the Cynipini dates from Ashmead’s (1903) key to genera, although Mayr (1881), Ashmead (1885), Dalla Torre (1893) and Kieffer (1897–1901)


Figures 1–13


1-9, tarsal claws: 1) Amphibolips quercuscinerea (Ashmead); 2) Andricus quercusfoliatus (Ashmead); 3) Cynips quercusfolii L.; 4) Cynips divisa Hartig; 5) Neuroterus quercusbaccarum (L.); 6) Neuroterus tricolor (Hartig), unisexual female; 7) N. tricolor, bisexual female; 8) Belonocnema quercusvirens (Osten Sacken); 9) Sphaeroteras ocala (Weld); 10-13, mesosoma, dorsal view: 10, Andricus caputmedusae (Wachtl); 11) N. tricolor (scutellar foveae absent); 12) Loxaulus masneri Melika & Abrahamson (notauli incomplete); 13) Andricus seckendorffi (Wachtl) (notauli complete) (apl = anterior parallel line (anteroad median line); mms = median mesoscutal sulcus (median mesoscutal line); n = notaulus; pl = parapsidal line; sc = scutum (mesoscutum); scf = scutellar fovea; scl = scutellum; tsa = transscutal articulation). Scale lines: 1-8, 13 = 0.1 mm; 9 = 0.5 mm; 10 = 1.0 mm; 12 = 0.25 mm.

used the presence/absence of tarsal claws to recognise subgenera of Andricus. However, this character has been treated too simply in the past, and the term ‘basal lobe’ is more precise. In some cases the claws have a strong basal lobe, for example in Amphibolips and many Andricus. However, in numerous species, including those that Weld (1952) treated as possessing a tooth, no distinct tooth in fact occurs on the claws. Further, a number of genera are variable for this character. For instance, the majority of Neuroterus spp. have tarsal claws without a basal lobe,


however N. quercusbaccarum L., N. numismalis Olivier and N. petioliventris Hartig have a basal lobe in unisexual generations but simple claws in the alternate bisexual generations. The same is true for Callirhytis, in which both generations of the European species C. glandium (Giraud) have a basal lobe as does the unisexual generation of C. bella (Dettmer) (Nieves Aldrey 1992). One species of Trigonaspis, T. megaptera (Panzer), has a weak basal lobe, while other representatives of this genus have simple claws. The bisexual generations of the North American genus Xystoteras have a very weak basal lobe, and in Parandricus mairei Kieffer females have obvious lobed claws while the males have simple claws. In Belizinella one species, B. gibbera Kovalev, has claws with a basal lobe while other species, such as B. vicina Kovalev have simple claws (Kovalev 1965). The presence or absence of a basal lobe is a likely homoplasy and probably evolved separately in different cynipine genera. The ancestral condition is a simple tarsal claw without a basal lobe, based on its appearance in the majority of genera from the Aylacini. However, even in this tribe, Xestophanes Foerster, Diastrophus Hartig and Gonaspis Ashmead have a basal lobe. Furthermore, the tarsal claws of Synergini inquilines can be simple or lobed, as in Synergus umbraculus Olivier and Periclistus brandtii Ratzeburg. Consequently, we propose to avoid the use of this character to diagnose genera of Cynipini.

Problem characters Weld utilised a number of primary characters to separate genera in his classification. These included: 1) the completeness of the notauli (Figs 10–13); 2) the number of antennal flagellomeres; 3) the pubescence of the thorax and the shape of the scutellar foveae, and 4) the shape of the terga and their pubescence. Our analysis of these characters below shows considerable variability at both the specific and intraspecific levels, and very often their use alone is insufficient for diagnoses of genera. Completeness of the notauli. The genus Andricus is supposed to comprise species with complete notauli that distinctly reach the pronotum, however many European species have incomplete notauli (cf. Figs 10–13). For instance, notauli are absent or very indistinct over the anterior onethird to a quarter of the scutum in the unisexual females of A. lignicolus (Hartig), A. gallaetinctoriae (Olivier), the bisexual females of A. grossulariae Giraud, and A. kollari (Hartig). Moreover, the completeness of the notauli can vary intraspecifically as it does in the previous species. The bisexual females of Acraspis and Cynips were separated by Weld (1952) on the basis of the notauli. However, some specimens of A. gemula (Bassett) have obvious complete notauli and, thus, are congeneric with Cynips on the basis of this character. Number of antennal flagellomeres. The suture between the terminal flagellomeres in representatives of various genera can be distinct or very indistinct so that the number of flagellomeres appears to vary. Pubescence of thorax and shape of scutellar foveae. The pubescence of the thorax can vary strongly among species, for instance within the large genus Andricus. Typically, unisexual females are more strongly pubescent than bisexual forms. The same is true of the shape of the scutellar foveae which can vary intraspecifically, for example in Sphaeroteras ocala (Weld) where some specimens have distinct scutellar foveae while others have them completely lacking. Shape of terga and their pubescence. Both of these characters vary strongly at the intraspecific level and, thus, cannot be used for the separation of genera. The shape of the terga depends on egg production in females and consequently its shape is an artifact. Tergal pubescence can vary strongly at the specific level as, for instance, among Andricus spp.



Figures 14–24 14, metasoma in lateral view, Loxaulus huberi Melika & Abrahamson; 15-22, ventral spine of the hypopygium: 15) Cynips quercusfolii L., unisexual female; 16) Cynips longiventris Hartig, bisexual female; 17) Neuroterus quercusbaccarum (L.), unisexual female; 18) Neuroterus numismalis (Geoffroy), bisexual female; 19) Neuroterus laeviusculus (Schenck), bisexual female; 20) Andricus solitarius Fonscolombe; 21) Andricus quercusramuli (L.); 22) Sphaeroteras ocala (Weld); 23, 24, mesosoma, dorsal view: 23) Bassettia pallida Ashmead (scutum transversely rugose); 24) Loxaulus huberi Melika & Abrahamson (scutum reticulate) (hyp = hypopygium; ov = ovipositor; sas = subapical setae; vsp = ventral spine of the hypopygium). Scale lines = 0.5 mm.


Figures 25–30 25-29, propodeum: 25) Loxaulus huberi Melika & Abrahamson (with median propodeal carina); 26) Andricus quercuscorticis (L.); 27) Andricus quercusradicis (F.); 28) Andricus testaceipes Hartig; 29) Bassettia pallida Ashmead; 30) forewing, L. huberi (length = length of radial cell; w = width of radial cell). Scale lines: 25 = 0.2 mm; 26-28 = 0.25; 29 = 0.4 mm; 30 = 1.9 mm.

Informative characters Our preliminary research has shown a number of characters are not intraspecifically variable and have significant potential for distinguishing genera and/or groups of genera. These are 1) the shape of the ventral spine of the hypopygium and the direction and length of subapical setae on the spine (Figs 14–22); 2) the shape and sculpturing of the mesosoma (Figs 12, 13, 23, 24); 3) the structure of the propodeum (Figs 25–29), and 4) the shape of the radial cell and Rs of the fore wing (Fig. 30). Also potentially informative for some genera, are the ratio of lengths of the hind tarsomeres, the shape of F1, and the ratio of F1 to the scape and pedicel.



We can divide the Cynipini into several groups of genera on the basis of the shape of the ventral spine of the hypopygium and the length and direction of the subapical setae on the spine. We differentiate three principal states of the ventral spine of the hypopygium and its setae as follows: 1) ventral spine short, broadest at apex or equally broad through its entire length, the prominent portion of the spine shorter or equal to its width; subapical setae dense and long, directed backwards and reaching far beyond the apex of the spine, which in some genera form a dense truncate tuft; 2) ventral spine thin, slender, needle-like, if short then distinctly but gradually tapering to a point, prominent portion longer than broad; subapical setae long and reaching far beyond the apex of the spine, and 3) ventral spine needle-like, long; prominent portion much longer than broad; subapical setae sparse, short, directed at a nearly straight angle to the spine, usually present ventrally only, never reaches beyond the apex of the spine. The shape and sculpturing of the mesosoma are important characters for the separation of generic groups. A dorso-ventrally compressed mesosoma separates Bassettia, Callirhytis (in part, the unisexual generations only), Eumayria, Eumayriella, and Plagiotrochus (unisexual generations mainly). The scutum is transversely rugose in Bassettia, Callirhytis and Plagiotrochus; it is coarsely rugose and dull in Amphibolips, while in the other genera the scutum is reticulate or smooth and shiny. A median propodeal carina is present only in Loxaulus, Plagiotrochus, and some species of Callirhytis (sometimes a very indistinct, incomplete and fragmented median propodeal carina is visible in some specimens of Bassettia), while this characteristic is absent in all other genera. The shape of the radial cell and Rs of the fore wing are also important diagnostic characters and have been used previously by Weld (1952). In Atrusca, Belonocnema and Loxaulus the 2nd abscissa of Rs is strongly angulate, the radial cell is only 2.0–2.5 times longer than broad, the fore wing has dark spots and/or dark stripes along the veins, while all other genera have the 2nd abscissa of Rs straight or very slightly angulate, and the radial cell is more elongate, at least 2.7–3.0 times longer than broad. The only exceptions to this are three species of Holocynips, H. badia (Bassett), H. hartmanni (Weld) and H. maxima (Weld), which have a short radial cell. Additional diagnostic characters to those discussed above will need to be employed to convincingly separate genera and demonstrate their monophyly. The fact that bisexual females and males are morphologically more uniform than unisexual females makes it difficult to adequately separate genera on the former generation alone. Clearly, a stable generic classification that reflects phylogenetic relationships within the Cynipini will only be forthcoming after a comprehensive dataset is assembled which comprises informative characters from both generations.

Acknowledgements We express our deepest appreciation to A. Menke for his valuable suggestions during our work in the USNM, Washington, D. C. and R. Lyon for his suggestions on the classification of oak gallinducing cynipids. We thank J. Abrahamson, C. Abrahamson, R. Bowman, G. Csóka, R. Hammer, A. Johnson, I. Kralick, R. Peet, R. Roberts, P. Schmaltzer, A. Schotz, R. Scrafford, C. Winegarner, and M. Winegarner for field and technical assistance. We also thank D. Notton, N. Fergusson, G. McGaven, S. Schödl, L. Zombori, J. Papp, O. Kovalev, L. Djakonchuk, J. Nieves Aldrey, J. Pujade i Villar, G. Stone, Gy. Csóka, C. Thuróczy for loans and/or gifts of research material. We also thanks Ms. Eva Foki (Systematic Parasitoid Laboratory, Koszeg, Hungary) for the illustrations. Support was provided to G.M. and W.G.A. by Bucknell University’s David Burpee Endowment and the


Archbold Biological Station, to W.G.A. by N.S.F. Grant BSR-9107150, and to G.M. by the Smithsonian Institution National Museum of Natural History.

References Adler, H. (1881) Über den Generationswechsel der Eichen-Gallwespen. Zeitschrift fur wissenschaft im Zoologie 35: 151-246. Ashmead, W. H. (1881) On the cynipidous galls of Florida. Transactions of the American Entomological Society 9: 9-28. Ashmead, W. H. (1885) On the cynipidous galls of Florida with descriptions of new species. Transactions of the American Entomological Society 12: 5-9. Ashmead, W. H. (1887) On the cynipidous galls of Florida, with descriptions of new species and synopses of the described species of North America. Transactions of the American Entomological Society 14: 125-158. Ashmead, W. H. (1897a) Description of some new genera in the family Cynipidae. Psyche 8: 67-69. Ashmead, W. H. (1897b) Descriptions of five new genera in the family Cynipidae. Canadian Entomologist 29: 260-263. Ashmead, W. H. (1903) Classification of the gall-wasps and the parasitic cynipoids, or the superfamily Cynipoidea. III. Psyche 10: 140-155. Belizin, V. I. (1961) The oak gall wasps of the genus Cynips (Hymenoptera, Cynipidae). Zoologicheskij Zhurnal 40: 207-213. [in Russian] Dailey, D. C. (1969) Synonymy of Dryocosmus attractans (Kinsey) and Callirhytis uvellae Weld. Pan-Pacific Entomologist 45: 132-134. Dailey, D. C. & Menke, A. S. (1980) Nomenclatorial notes on North American Cynipidae (Hymenoptera). Pan-Pacific Entomologist 56: 170-174. Dailey, D. C. & Sprenger, C. M. (1973a) Unisexual generation of Andricus atrimentus (Hymenoptera: Cynipidae). Pan-Pacific Entomologist 49: 171-173. Dailey, D. C. & Sprenger, C. M. (1973b) Synonymy of Andricus gigas and the bisexual generation of Andricus crenatus (Hymenoptera: Cynipidae). Pan-Pacific Entomologist 49: 188-191. Dailey, D. C., Perry, T. & Sprenger C. M. (1974) Biology of three Callirhytis gall wasps from Pacific Slope Erythrobalanus oaks (Hymenoptera: Cynipidae). Pan-Pacific Entomologist 50: 61-67. Dalla Torre, de C. G. (1893) Catalogus Hymenopterorum Hucusque Descriptorum Systematicus et Synonymicus. Cynipidae. Lipsiae. Sumptibus Guilelmi Engelmann 2: 1-140. Dalla Torre, K. W. von & Kieffer, J. J. (1910) Cynipidae. Das Tierreich 24: 1-891. Doutt, R. L. (1959) Heterogeny in Dryocosmus (Hymenoptera, Cynipidae). Annals of the Entomological Society of America 52: 69-74. Doutt, R. L. (1960) Heterogeny in Andricus crystallinus Bassett (Hymenoptera: Cynipidae). PanPacific Entomologist 36: 167-170. Eady, R. D. & Quinlan, J. (1963) Hymenoptera. Cynipoidea. Handbooks for the Identification of British Insects. Royal Entomological Society, London. Vol. 8, Part I(a): 1-81. Evans, D. (1967) The bisexual and agamic generations of Besbicus mirabilis (Hymenoptera: Cynipidae), and their associate insects. Canadian Entomologist 99: 187-196. Evans, D. (1972) Alternate generations of gall cynipids (Hymenoptera: Cynipidae) on Garry oak. Canadian Entomologist 104: 1805-1818. Fabricius, I. C. (1804) Systema Piezatorum. Ordines, Genera, Species. Brunsvigae, Apud Carolum Reichard.



Fergusson, N. D. M. (1988) A comparative study of the structures of phylogenetic importance of female genitalia of the Cynipoidea (Hymenoptera). Systematic Entomology 13: 13-30. Fergusson, N. D. M. (1995) The cynipoid families. pp. 247-265. In Hanson, P. E. & Gauld, I. D. (Eds.), The Hymenoptera of Costa Rica. Oxford University Press, Oxford. Fitch, A. M. D. (1859) Fifth report on the noxious and other insects of the state of New York. Insects infesting deciduous forest trees. Annual Reports of the New York State Agricultural Society 18: 781-784. Foerster, A. (1869) Ueber die Gallwespen. Verhandlungen der Zoologische-Botanische Gesselschaft 19: 327-370. Fourcroy, A. F., de. (1785) Entomologia Parisiensis; sive Catalogus Insectorum quae in Agro Parisiensi reperiuntur; Secundum Methodum Geoffraeanam in Sectiones, Genera & Species Distributus. Pars. 2. Sectio 3. Classis Insectorum. LXXXVI. Cynips. Le Cinips. LXXXVII. Diplolepis. Le Diplolepe. Hymenoptera Parisiis, Via et Aedibus Serpentineis. pp. 379-393. Sub Privilegio Academiae. Geoffroy, L. (1762) Histoire abrÈgée des insectes qui se trouvent aux environs de Paris. Dans laquelle ces Animaux sont rangés suivant un Ordre méthodique. 2. Paris. Gibson, G. A. P. (1985) Some pro- and mesothoracic structures important for phylogenetic analysis of Hymenoptera, with a review of terms used for the structures. Canadian Entomologist 117: 1395-1443. Giraud, J. (1859) Signalements de quelques especes nouvelles de Cynipides et de leurs galles. Verhandlungen der Zoologischen-Botanischen Gesellschaft 9: 337-374. Hartig, T. (1840a) Ueber die Familie der Gallwespen. III. Zeitschrift für Entomologie 2: 176-209. Hartig, T. (1840b) Erster Nachtrag zur Naturgeschichte der Gallwespen. Zeitschrift für Entomologie 2: 322-358. Kieffer, J. J. (1897-1901) Monographie des Cynipides d’Europe et d’Algerie. Ibalynae et Cynipinae. Paris. Librairie Scientifique, A. Hermann. Kinsey, A. C. (1920) Phylogeny of cynipid genera and biological characteristics. Bulletin of the American Museum of Natural History 42: 357-402. Kinsey, A. C. (1929) The gall wasp genus Cynips: A study in the origin of species. Indiana University Studies 84-86: 1-517. Kinsey, A. C. (1936) The origin of higher categories in Cynips. Indiana University Publications. Science Series 4. Entomological Series 10: 1-334. Kinsey, A. C. (1937) New Mexican gall wasps (Hymenoptera, Cynipidae). Revue de Entomologia 7: 39-79. Kinsey, A. C. & Ayres, K. D. (1922) Varieties of a rose gall wasp (Cynipidae, Hymenoptera). Indiana University Studies 53: 142-171. Kovalev, O. V. (1965) Gall wasps (Hymenoptera, Cynipidae) from the south of the Soviet Far-East. Revue d’Entomologie de l’URSS 44: 46-73. Latreille, P. A. (1805) Histoire Naturelle, generale et particuliere, des Crustaces et des Insectes. Famille Soixante-Deuxieme. Diplolepaires; diplolepariae. Famille Soixante-Troisieme. Cinipseres; cinipsera. Paris, De l’Imprimerie de F. Dufart 3: 196-225. Latreille, P. A. (1810) Considerations Generales sur l’ordre Naturel des Animaux. Composant les Classes des Crustaces, des Arachnides, et des Insectes. Ordre V. Hymenopteres. Hymenoptera. pp. 279-437. Paris, F. Schoell. Liljeblad, J. & Ronquist, F. (1998) A phylogenetic analysis of higher-level gall wasp relationships (Hymenoptera: Cynipidae). Systematic Entomology 23: 229-252.


Linnaeus, C. (1746) Fauna Svecica. Sistens Animalia Sveciae Regni: Quadrupedia, Aves, Amphibia, Pisces, Insecta, Vermes, Distributa per Classes & Ordines, Genera & Species. V. Hymenoptera. pp. 282-297. Stockholmiae, Sumtu & literis Laurentii Salvii. Linnaeus, C. (1758) Systema Naturae per Regna tria Naturae, Secundum Classes, Ordines, Genera, Species, cum characteribus, differentiis, synonymis, locis. Classis V. Insecta. V. Hymenoptera. Tomus I. Editio Decima. pp. 553-583. Holmiae, Impensis Direct. Laurentii Salvii. Lyon, R. J. (1959) An alternating, sexual generation in the gall wasp Callirhytis pomiformis (Ashm.) (Hymenoptera, Cynipidae). Bulletin of the California Academy of Sciences 58: 33-37. Lyon, R. J. (1963) The alternate generation of Heteroecus pacificus (Ashmead) (Hymenoptera, Cynipoidea). Proceedings of the Entomological Society of Washington 65: 250-254. Lyon, R. J. (1964) The alternate generation of Callirhytis agrifoliae (Ashmead) (Hymenoptera: Cynipoidea). Proceedings of the Entomological Society of Washington 66: 193-196. Lyon, R. J. (1969) The alternate generation of Callirhytis quercussuttonii (Bassett) (Hymenoptera: Cynipoidea). Proceedings of the Entomological Society of Washington 71: 61-65. Lyon, R. J. (1970) Heterogeny in Callirhytis serricornis (Kinsey) (Hymenoptera: Cynipoidea). Proceedings of the Entomological Society of Washington 72: 176-178. Lyon, R. J. (1993) Synonymy of two genera of cynipid gall wasps and description of a new genus (Hymenoptera: Cynipidae). Pan-Pacific Entomologist 69: 133-140. Maisuradze, N. L. (1961) Notes on the gallflies (family Cynipidae) which are harmful to oaks in the Lenkoran zone. Uchenije Zapiski Azerbaijanskoho Universiteta. Serija Biologija 1: 21-30. [in Russian] Mayr, G. (1881) Die Genera der gallenbewohnenden Cynipiden. Jahresberichte der CommunalOberrealschule im I. Bezirke 20: 1-38. Melika, G. & Abrahamson, W. G. (1997) Synonymy of two genera (Eumayria and Trisoleniella) of cynipid gall wasps and description of a new genus, Eumayriella (Hymenoptera: Cynipidae). Proceedings of the Entomological Society of Washington 99: 665-674. Menke, A. (1993) Notauli and parapsidal lines: just what are they? Sphecos 24: 9-12. Monzen, K. (1954) Revision of the Japanese gall wasps with the Description of New Genus, Subgenus, Species and Subspecies. Cynipidae (Cynipinae). II. Annual Reports of the Gakugei Faculty, Iwate University 6: 24-38. Nieves Aldrey, J. L. (1992) Revision of the European species of the genus Callirhytis Foerster (Hymenoptera, Cynipidae). Graellsia 48: 171-183. Nieves Aldrey, J. L. (1994) Revision of West-European genera of the tribe Aylacini Ashmead (Hymenoptera, Cynipidae). Journal of Hymenoptera Research 3: 175-206. Olivier, M. (1790) Encyclopedie Methodique. Histoire Naturelle. Insectes. Cinips. Cynips. Paris, Panckoucke 5: 772-792. Olivier, M. (1791) Encyclopedie Methodique. Histoire Naturelle. Insectes. Diplolepe. Diplolepis. Paris, Panckoucke 6: 276-282. Panzer, W. F. (1806) Kritische Revision der Insekten Faune Deutschlands. Cynips. Diplolepis. Nurnberg, Felsseckerschen Buchhandlung. Bd. 2: 92-95. Reinhard, D. (1865) Die Hypothesen über die Fortpflanzungweise bei den eingeschlechtigen Gallwespen. Berlinger Entomologische Zeitung 9: 1-13. Rohwer, S. A. & Fagan, M. M. (1917) The type-species of the genera of the Cynipoidea, or the gall wasps and parasitic cynipoids. Proceedings of the United States National Museum 53: 357-380.



Ronquist, F. (1994) Evolution of parasitism among closely related species: phylogenetic relationships and the origin of inquilinism in gall wasps (Hymenoptera, Cynipidae). Evolution 48: 241-266. Ronquist, F. (1995) Phylogeny and early evolution of the Cynipoidea (Hymenoptera). Systematic Entomology 20: 309-335. Ronquist, F. & Nordlander, G. (1989) Skeletal morphology of an archaic cynipoid, Ibalia rufipes (Hymenoptera: Ibaliidae). Entomologica Scandinavica, Supplement 33: 1-60. Spinola, M. (1808) Insectorum Liguriae. Species Novae aut Rariores. Genuae. Sumptibus Auctoris. Tom II. Fasciculus 2: 1-25. Fasciculus 3. V. G. Cynips (Lin. Fab.) G. Diplolepis (Latr.): 157-167. Fasciculus 4. De Diplolepibus: 209-238. Weld, L. H. (1921) American gallflies of the Family Cynipidae producing subterranean galls on oaks. Proceedings of the United States National Museum 59: 187-246. Weld, L. H. (1951) Superfamily Cynipoidea. pp. 594-654. In Muesebeck, C. F. W., Krombein, K. V. & Townes, H. K. (Eds), Hymenoptera of America North of Mexico. Agricultural Monograph No. 2. United States Government Printing Office, Washington, D. C. Weld, L. H. (1952) Cynipoidea (Hym.) 1905-1950 being a Supplement to the Dalla Torre and Kieffer monograph – the Cynipidae in Das Tierreich, Leiferung 24, 1910 and bringing the systematic literature of the world up to date, including keys to families and subfamilies and list of new generic, specific and variety names. Ann Arbor, Michigan (124 pp. Privately Printed). Weld, L. H. (1957) Cynipid galls of the Pacific slope. Ann Arbor, Michigan (64 pp. Privately Printed). Weld, L. H. (1959) Cynipid galls of the Eastern United States. Ann Arbor, Michigan (124 pp. Privately Printed). Weld, L. H. (1960) Cynipid galls of the southwest. Ann Arbor, Michigan (34 pp. Privately Printed). Westwood, J. O. (1829). On the Chalcididae. The Zoological Journal 4: 3-31. Westwood, J. O. (1840) An introduction to the modern classification of Insects: founded on the natural habits and corresponding organization of the different families. (Synopsis of the Genera of British Insects) 2: 1-587. London.

Australian Hymenoptera in the Spinola Collection: a List of Species M. Generani1,2 and P. L. Scaramozzino1,2 1

Museo Regionale di Scienze Naturali, Via Giolitti 36, I-10123 Torino, Italy

2

present address: Museo di Storia Naturale e del Territorio, Università degli Studi di Pisa, Via Roma 79, I-56011 Calci, Italy (email: [email protected])

Introduction In the Hymenoptera collection of the Marquis Massimiliano Spinola, which is one of the most important at the Museo Regionale di Scienze Naturali, Torino, there are 377 specimens of Australian origin belonging to 22 families. These specimens were given to Spinola by numerous wellknown naturalists of his time, including Deyrolles, Dupont, Jekel, Reiche and Veranì. A few were also handed down from the collections of Latreille, Serville and Klug. On the pink labels (indicating Australia) on the bottom of each insect-box, Spinola marked the names he had given to each specimen. These names in litteris were later published by Casolari and Casolari Moreno (1978, 1979a, 1979b) but are nomina nuda (see ICZN 1985, Article 51D). The aim of this paper is to provide a brief synopsis of Spinola’s life, describe the Hymenoptera part of his collection which has significant historical importance, and list the material within the collection as an aid to current taxonomic studies.

Life of Massimiliano Spinola Marquis Massimiliano Spinola, count of Tassarolo, Senator of Regno Sardo (Fig. 1), belonged to one of the most noble families of Liguria. A dedicated student of the arts and sciences, he excelled above all in entomology publishing 53 works mainly on Hymenoptera, Coleoptera and Hemiptera, but also on ichthyology, e.g. the fish of the Gulf of Genoa (Gestro 1915; Vidano & Arzone 1978; Passerin d’Entrèves 1980). His life can be summarised as follows: 1780 (10 July): Massimiliano Spinola is born at Pezenas, Hérault, France. 1789: He settles in Paris with his family but the outbreak of the French Revolution forces them to flee to Genoa. 1801: He marries the Marquise Clelia Durazzo who dies of tuberculosis two years later, having given him a son, Agostino. 1805: Spinola publishes his first entomological work Faunae Ligusticae Fragmenta, Decas Ia. 1806: He publishes the first volume of his work Insectorum Liguriae species novae aut rariores and marries his cousin Maria Giulia Spinola. 1808: He publishes the second volume of Insectorum Liguriae. 1822: His second wife passes away, having given birth to three sons, Cristoforo, Massimiliano and Bendinello, and three daughters, Enrichetta, Anna and Maria. 231

M. Generani and P. L. Scaramozzino 232

Figure 1


Portrait of Marquis Massimiliano Spinola [from Passerin d’Entrèves (1980)].

1833: Jailed for political reasons at the fortress of Alessandria. After his release, Spinola spends some time under surveillance at Tassarolo castle. 1834 to 1851: Spinola devotes himself to his entomological studies and publishes most of his significant works during this time. 1841: He attends the 3rd Meeting of Italian Scientists in Florence. 1842: At the 4th Meeting of Italian Scientists in Padoa, Spinola is elected Vice-President of the Zoology Session and reads his paper on the genus Sirex Fabricius (Hymenoptera). 1846: He attends the 8th Meeting of Italian Scientists at Genoa. His heath is deteriorating and he is unable to participate actively in the meeting. 1848: Spinola is proclaimed Senator of Regno Sardo. 1853: Because of cataracts, he becomes practically blind and gives up his studies to spend the following years at Tassarolo with his children. He bequeaths his Hymenoptera collection to his grand children (of his son Agostino, who had died previously), but he keeps it himself on loan until his death. 1854: Publication of Spinola’s last scientific work. 1857 (12 November): After a cataract operation to avoid total blindness Spinola dies of a stroke.

The Hymenoptera Collection In 1858, a few months after Spinola’s death, his Hymenoptera collection was handed over by his grandchildren to Filippo De Filippis, Director of the Zoological Museum of Turin, to be sold at the best price. As no acceptable offers were forthcoming, Professor De Filippis purchased the collection for the Museum of Turin. In the 1970’s the Spinola’s collection of

Australian Hymenoptera in the Spinola Collection: a List of Species 233

Figure 2

A draw (N. 73) of Australian thynnine wasps (Tiphiidae) from the Spinola Collection, including a number of unpublished ‘new’ species recognised by Spinola.

Figure 3

The lectotype of Scolia soror Smith (Scoliidae) from the Spinola Collection showing the original label in Spinola’s hand-writing.



Table 1 Original collections or donors and localities of origin of the Australian Hymenoptera in the Spinola Collection. Donors or original collection (C)

Geographic localities

Latreille (C)

Australia, New Holland

19

Serville (C)

New Holland, Van Diemen

7

De Schmidt

New Holland

2

Deyrolles

New Holland, Sidney

73

Dupont

New Holland, Van Diemen’s Land

19

Dupont & Verani

Van Diemen’s Land

2

Jekel

New Adelaide, New Holland, Tasmania

23

Klug

New Holland

5

Rambur

New Holland

2

Reiche

New Holland, Swan River

13

Sturm

New Holland

1

Verani

New Holland, Van Diemen’s Land

11

Voyage de l’Astrolabe

Australasia

1

unknown origin

New Holland, New Adelaide, Sydney

33

Total

No. of species

130

Hymenoptera, originally arranged in 69 containers was reorganised into 139 new boxes by Dr Carlo Casolari (Figs 2, 3). The specific names, authors, the collections of origin or donor’s names, and the geographic localities where the specimens had been collected had been written by Spinola himself on labels on the bottom of each drawer. The majority of Australian specimens had been determined to specific level by Spinola himself. Unfortunately his increasingly precarious health did not allow him to complete his work and its publication. The Australian material of the Spinola collection was probably among the first to reach Europe. The donors and places of origin of the Hymenoptera in his collection are shown in Table 1. Appendix 1 provides a detailed account of the material in the collection.

Acknowledgements We wish to acknowledge with gratitude the assistance of Guido Pagliano for scientific advice and Marina Spini, librarian at Museo Regionale di Scienze Naturali of Turin, for bibliographic research.

References Casolari, C. & Casolari Moreno, R. (1978) Catalogo della collezione imenotterologica di Massimiliano Spinola. Parte 1. Bollettino dei Musei di Zoologia Università di Torino 5: 27-74. Casolari, C. & Casolari Moreno, R. (1979a) Catalogo della collezione imenotterologica di Massimiliano Spinola. Parte 2. Bollettino dei Musei di Zoologia Università di Torino 2: 19-82. Casolari, C. & Casolari Moreno, R. (1979b) Catalogo della collezione imenotterologica di Massimiliano Spinola. Parte 3. Bollettino dei Musei di Zoologia Università di Torino 4: 91-130.


Gestro, R. (1915) Res Ligusticae LXII. Ricordo di Massimiliano Spinola. Annali del Museo Storia Naturale di Genova 7: 33-53. International Commission on Zoological Nomenclature (1985) International Code of Zoological Nomenclature. Third Edition. International Trust for Zoological Nomenclature, London. Passerin d’Entrèves, P. (1980) La collezione Spinola di Tassarolo. Guide alle Mostre Temporanee Museo Regionale di Scienze Naturali, Torino. Vidano, C. & Arzone, A. (1978) Sulla collezione Spinola conservata nel Castello di Tassarolo. pp. 253-260. Atti XI Congresso Nazionale Italiano di Entomologia, Portici-Sorrento, 10-15 Maggio 1976. Yu, D. S. & Horstmann, K. (1997) A catalogue of world Ichneumonidae. Parts 1 and 2. Memoirs of the American Entomological Institute 58: 1-1558.



Appendix 1 List of Australian species of Hymenoptera in the Spinola Collection. The information provided is arranged as follows: first, the name given to the species by Spinola and the author who described it (if mentioned); in brackets, the number of the new box in which the species is stored. The complete transcription of the original labels on the bottom of the box, bears the following indications compiled by Spinola and always in the same order: 1st line, name of genus, species and author, possible synonym and supplementary notes; 2nd line, original collection or donor (sometimes missing) and the geographic locality where the material was collected; number of specimens and their sex; description and complete transcription of the labels pinned on the specimens or placed at their side. In the collection sometimes there are many series of specimens of the same species marked with their own label on the bottom of the box. Each of these series is marked with the specific name given by Spinola. When the information given on the label is identical for two or more series, they are not repeated, but only the number and sex of the specimens are shown. Illegible words on labels are shown as (......). Typical series are marked with an asterisk before the name of the species. FAMILY PERGIDAE Perga dorsalis Leach (box 11) Perga dorsalis Leach D. Deyrolles – Sidney 3 Perga ferruginea Leach (box 11) Perga ferruginea Leach D. Deyrolles – Sidney 2 Perga lewisii Westwood (box 11) Perga lewisii Westw. D. Dupont – Van Diemen 3

FAMILY GASTERUPTIIDAE Foenus gigas Spinola in Casolari & Casolari Moreno, 1979 nomen nudum (box 52) Foenus gigas m. D. Jekel 1851 – Nov. Holl. 1 FAMILY MEGALYRIDAE Megalhira fasciipennis Westwood (box 47) Megalhira fasciipennis Westwood D. Verany – N. Holl. 3 FAMILY ICHNEUMONIDAE Anomalon flavitarsus Spinola in Casolari & Casolari Moreno, 1978 nomen nudum (box 29) Anomalon flavitarsus m. D. Deyrolles – Sidney 1

Pterygophorus cinctus Leach (box 13) Pterygophorus cinctus var. 1.a Leach D. Deyrolles – Sidney 1 the same as above 3, 1, the latter with a round pink label “Pterigophorus N.lle Holl” Pterygophorus cinctus var. 2.da Leach D. Deyrolles – Sidney 3 , one with a round pink label “Pterigophorus N.lle Holl” the same as above 1 Pterygophorus cinctus var. 3.a D. deyrolles – Sidney 3

Ichneumon australis Brullè (box 16) Ichneumon australis Brullè ? D. Deyrolles – Sidney 2

Pterygophorus interruptus Leach (box 13) Pterygophorus interruptus Leach D. Deyrolles – Sidney 3

Ichneumon ischioleucos Brullè (box 16) Ichneumon ischioleucos Brull. ? D. Deyrolles – Sidney 1

Anomalon hollandiae Spinola in Casolari & Casolari Moreno, 1978 nomen nudum (box 29) Anomalon Hollandiae m. D. Verany – Nouv. Holl. 2, 2


Mesostenus luperus Brullè (box 33) Mesostenus luperus ? Br. D. Deyrolles – Sidney 2 Ophion australasiae Spinola in Casolari & Casolari Moreno, 1978 nomen nudum (box 37) Ophion australasiae m. D. Deyrolles – Sidney 2 Ophion bicallosus Spinola in Casolari & Casolari Moreno, 1978 nomen nudum (box 36) Ophion bicallosus m. D. Deyrolles – Sidney 1 specimen without abdomen Ophion dorsatus Spinola in Casolari & Casolari Moreno, 1978 nomen nudum (box 37) Ophion dorsatus m. D. Deyrolles – Sidney 1, 2 Ophion merdarius Gravenhorst (box 36) Ophion merdarius Grav. D. Jekel 1851 – Nov. Holl. 1, 2 Paniscus australasiae Spinola in Casolari & Casolari Moreno, 1978 nomen nudum (box 37) Paniscus australasiae m. D. Deyrolles – Nouv. Holl. 2, one of which with a pink label “productus Brullè” Paniscus australasiae var. D. Dupont – Van-Diemen 2, 1

Pimpla subpetiolata m. Nouv. Holl. 1, 3 Rhyssa maculipennis Spinola in Casolari & Casolari Moreno, 1978 nomen nudum (box 23) Rhyssa maculipennis m. n. sp. D. Deyrolles – Sidney No specimens *Westwoodia ruficeps Brullè (box 36) Westwoodia ruficeps Br. Coll. Serville D. Deyrolles – N. Holl. 2 Note: The type of this species does not exist at the Natural History Museum in Paris (Yu & Horstmann, 1997). The specimens in the Spinola Collection (originally from the Serville Collection) could be the missing types. FAMILY BRACONIDAE Agathis dimidiata Brullè (box 39) Agathis dimidiata Br. Coll. Serville – Van Diemen 1 Bracon argenteociliatus Spinola in Casolari & Casolari Moreno, 1978 nomen nudum (box 25) Bracon argenteo-ciliatus D. Jekel 1851 – Nouv. Holl. 1 Bracon capitator Fabricius (box 27) Bracon capitator Fab. Nouvelle Holl. 2, 1

Paniscus difficilis Spinola in Casolari & Casolari Moreno, 1978 nomen nudum (box 37) Paniscus difficilis m. – Paniscus testaceus var ! D. Deyrolles – Nouv. Holl. 1 with a pink label “productus Brullè”

Bracon dimidiatocinctus Spinola in Casolari & Casolari Moreno, 1978 nomen nudum (box 27) Bracon dimidiato-cinctus m. inedit. D. Deyrolles – Sidney 1

Pimpla crenator Fabricius (box 22) Pimpla crenator Fab. Nouv. Holl. 2

Bracon hyalinipennis Spinola in Casolari & Casolari Moreno, 1978 nomen nudum (box 27) Bracon hyalinipennis m. inedit. D. Deyrolles – Sidney 1

Pimpla subpetiolata Spinola in Casolari & Casolari Moreno, 1978 nomen nudum (box 22) Pimpla subpetiolata D. Jekel 1851 – Nov. Adelaid. 1

Bracon mutator Fabricius (box 27) Bracon mutator Fab. D. Deyrolles – Sidney 1


Bracon sericatum Spinola in Casolari & Casolari Moreno, 1978 nomen nudum (box 25) Bracon sericatum m. D. Jekel 1851 – N. Holl. 1 Bracon tasmaniae Spinola in Casolari & Casolari Moreno, 1978 nomen nudum (box 25) Bracon Tasmaniae m. D. Jekel 1851 – Tasmania 1 FAMILY CHRYSIDIDAE Chrysis lyncea Fabricius (box 51) Chrysis lyncea var. Fab. Nov. Holl. 2 specimens, one with round white label “6608” FAMILY MUTILLIDAE Mutilla dorsigera Westwood (box 62) Mutilla dorsigera Westw. D. Reiche – Swan-Riv. 1 labelled “Ephutomorpha edmondi André” (det. Zavattari) Mutilla D. Deyrolles – Sidney 1 labelled “Ephutomorpha edmondi André “ (det. Zavattari)” Mutilla rugicollis Westwood (box 62) Mutilla rugicollis Westw. D. Deyrolles – Sidney 1 labelled “Ephutomorpha rugicollis Westw.” (det. Zavattari) Mutilla sp. (=Ephutomorpha multicostata André) (box 62) Mutilla D. Deyrolles – Sidney 1 labelled “Ephutomorpha multicostata André” (det. Zavattari) Mutilla sp. (=Ephutomorpha venusta Smith) (box 60) Mutilla D. Reiche – Swan Riv. 1 labelled “Ephutomorpha venusta Smith” (det. Zavattari) *Mutilla tricarinata Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (=Mutilla tricarinata tricarinata Zavattari ) (box 63) Mutilla tricarinata m. Coll. Latr. – Nouv. Holl. 1 with four labels “Mutilla tricarinata Zav.”, “Trogaspidia tricarinata tricarinata (Zav.) B. Petersen det. 1978”, “Holotype tricarinata”, and “Holotype teste B. Petersen 1985”


FAMILY SCOLIIDAE *Scolia cyanipennis Fabricius (=Scolia soror Smith) (box 67) Scolia cyanipennis St. Farg. an Fab.? D. de Schmidt – Nouv. Holl. 2, 1, one labelled: “59”, “Cyanipennis Fab. (St. Fargeau olim)” and on a red label “Lectotype soror Smith” Scolia cyanipennis Lepell. an Fab. D. de Schmidt – N. Holl. 1, 1, the labelled: “Scolia cyanipennis foemina”, “Scolia soror f Smith”; the male with a red label “Allotype soror Smith, Betrem 1969” Scolia glabrata Hagemb. (box 67) Scolia glabrata Hagemb., Scolia cyanipennis, Le P. v.? D. Sturm – Nouv. Holl.da 1 labelled “Austroscolia varifrons det. Betrem 1969” Scolia javana Lepeletier (box 70) Scolia javana var. ? D. Reiche – Swan-Riv. 2, one labelled “Trielis anthracina Burm.” Scolia javana, var. D. Reiche – Swan-Riv. 2 Scolia sp. (=Elis tasmaniensis Saussure) (box 68) Scolia, G. Colpa, St. Farg. D. Reiche – Swan-Riv. 3 one labelled “tasmaniensis” Scolia (box 71) D. Reiche – N. Holl.de 2, one labelled “tasmaniensis” Scolia sp. (=Scolia zonata Smith) (box 71) Scolia, Capsomeris, Le Pell. ad colpas accadens Nouv. Holl.da 2, one labelled “zonata” Scolia verticalis Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 71) Scolia verticalis m. n. sp.? D. Jekel 1851 – Nov. Holl. 1 FAMILY TYPHIIDAE Diamma bicolor Westwood (box 73) Diamma bicolor Westw. D. Klug et Dupont – Nouv. Holl.da 4 Psamattra chalybea Shuckard (box 74) Psamattra chalybea Shuck. D. Verani – Nouv. Holl. 1


Thynnus annulatus (box 73) Thynnus annulatus, Thynnus melleus Westw. D. Deyrolles – Sidney 2

Thynnus rubripes Guérin (box 73) Thynnus rubripes Guér. D. Dupont – Terre de Van-Diamen 3

Thynnus femoralis Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 73) Thynnus femoralis m. n.sp.? Thynnus depressus Westw. D. Verani – Nouv. Holl.de 5

Thynnus senilis Er. (box 73) Thynnus senilis Er. D. Reiche – Swan-Riv. 2, one with a white label with a black border “9”

Thynnus festivus Erichson (box 73) Thynnus festivus Er., Aelurus abdominalis Westw. D. Verani – Nouv. Holl.de 3 Thynnus festivus (box 74) Thynnus festivus, var.? D. Deyrolles – Nouv. Holl., Sidney 2, one of which labelled “Thynnus n.sp.?, Nouv. Holl.” Thynnus flavomaculatus Latreille (box 73) Thynnus Flavomaculatus Latr 1 labelled “6497” and “Thynnus Flavimaculatus Latr. male” Thynnus gravidus Westwood (box 74) Thynnus gravidus Westw. Sidney 1 Thynnus haemorrhoidalis Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 73) Thynnus haemorrhoidalis m. n.sp.? D. Dupont et Verani – Terre de Van-Diemen 4 Thynnus obscuripennis Guérin (box 73) Thynnus obscuripennis, var. Guér. Nouv. Holl.de 2 Thynnus obscuripennis Guér. D. Dupont – Nouv. Holl.de 1 labelled “Is. .......bank, New Holland” Thynnus octomaculatus Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 73) Thynnus octomaculatus m. D. Dupont et Verani – Terre de Van-Diamen 1 Thynnus ramburi Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 73) Thynnus Ramburi m. n.sp.? D. Rambur – Nouv. Holl. 3

Thynnus trifidus (box 73) Thynnus trifidus, Agriomya maculata, Guér.? D. Rambur – Nouv. Holl. 2 Thynnus variabilis (box 73) Thynnus variabilis, var. D. Deyrolles – Nouv. Holl. Sidney 2, 1 specimens labelled “........ Deyrolles” Thynnus variabilis, Myrmecoda maculata, Latr Coll. Latr. – Nouv. Holl. de 2 Thynnus variabilis D. Reiche – Swan-Riv. 2 Thynnus variabilis, var. Sidney 3 Thynnus villosus Klug (box 73) Thynnus villosus Kl. Nouv. Holl.de 4, one labelled “” Thynnus xanthognathus Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 74) Thynnus xanthognathus m., Thynnus picipes, Wesm. D. Deyrolles – N. Holl.de Sidney 1 FAMILY POMPILIDAE Agenia ornatipennis Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 78) Agenia ornatipennis m., n.sp. D. Dupont – Nov. Holl. 2 Agenia ornatipennis m. D. Dupont – Nov. Holl. 1 Agenia croceocera (!) Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 78) Agenia crocescens m., n.sp.? (in Casolari & Casolari Moreno, 1979 as A. croceocera) D. Deyrolles – N. Holl. 2


Agenia crocescens m. (in Casolari & Casolari Moreno, 1979 as A. croceocera) D. Deyrolles – N. Holl. 1 Aporus marginatus Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 81) Aporus marginatus m. D. Veranì – Nouv. Holl. 1 Aporus marginatus m. D. Dupont – Terre de Van Diemen 2 Pompilus australasiae (box 80) Pompilus australasiae Voyage de l’Astrolabe – Australasie 1


2 labelled “Vespa tropica trisignata Pér. det. J.V.D. Vecht 1957” Polystes facialis De Saussure (box 104) Polystes facialis De Sauss. D. Deyrolles – Nouv. Holl. 1 Polystes flaveola (box 104) Polystes flaveola De Hann – Nov. Adelaida 1, 1 Polistes ……leti De Saussure (box 105) Polistes ....leti De Sauss. Coll. Latr. D. Deyrolle – Australie ………... 1, 1

Pompilus morio Dahlbom (box 80) Pompilus morio Dahlbom et Fab. D. Jekel, 1851 – Nov. Holl. 1

Paragia shuckarti Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 107) Paragia Shuckardti m., n.sp. Nouv. Holl. 2

Pompilus sericeocinctus Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 80) Pompilus sericeo-cinctus m. D. Veranì – Nouv. Holl. 3

Eumenes campaniformis Fabricius (box 109) Eumenes campaniformis Fab. Nouv. Holl. 1

Pompilus xanthocerus Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 80) Pompilus xanthocerus m. D. Veranì – Nouv. Holl. 1 (two specimens as listed by Casolari & Casolari Moreno, l. c.) Priocnemis hollandiae Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 82) Priocnemis hollandiae m. Nova Hollandia 1 Priocnemis hollandiae m. Nova Hollandia 2, 2 Priocnemis ruficeps Lepeletier (box 84) Priocnemis ruficeps Lepeletier (Pallosoma Lep.) (Les onglettes trapeus .........) Coll. Serville – Nov. Holl. 1 FAMILY VESPIDAE Vespa australis (box 103) Vespa australis D. Klug (M. B.) – Nouv. Holl

Eumenes latreillei De Saussure (box 108) Eumenes Latreillei De Saussure D. Reiche – Swan-Riv. 1, 2 Odynerus albifrons Fabricius (box 110) Odynerus G. Alastor Lep. albifrons (Vespa) Fabr. Nouv. Holl. 1 labelled “Alastor ........ de l’A. tuberculatus Sp. mais periment distincto Chepirm.. brisn. male” Odynerus atripes (box 109) Odynerus (Alastor) ?atripes (last name crossed out) Lepel. Nouv. Holl. 1 labelled “Alastor lachesis Saus.” (det. Zavattari) Odynerus clotho Lepeletier (box 109) Odynerus (Alastor) Clotho Lep.?, Vespa albifrons Fab.? D. Dupont – Van Diemen 3 Odynerus (Alastor) Clotho var. Nov. Holl. 1


Odynerus lepidus Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 110) Odynerus lepidus m., n.sp. D. Jekel – Nov. Adelaide 1, 2 damaged specimens Odynerus sp. (vernalis) (box 112) Odynerus D. Dupont – Van-Diemen 1, 1, one labelled “vernalis ?” Odynerus swanii De Saussure (box 112) Odynerus Swanii De Saussure D. Reiche – Swan-River 1, 1 Odynerus tamarinus De Saussure (box 109) Odynerus tamarinus (sic.) De Saussure D. Reiche – Swan-Riv. 1 Rhygchium ephippium Fabricius (box 109) Rhygchium vel Odynerus ephippium (Vespa) Fab. D. Klug – Nouv. Holl. 1 labelled “Abispa ephippium Fab.” (det. Zavattari) FAMILY FORMICIDAE Eciton anale Klug (box 54) Eciton (Myrmecia) anale Klug D. Klug – Nouv. Holl.de 1 Eciton duponti Spinola in Casolari & Casolari Moreno, 1979 nomen nudum (box 54) Eciton Duponti m. D. Dupont – Terre de Van Diemen 3 workers with label “com. a Emery n.6” Eciton forficatum Klug (box 54) Eciton (Myrmecia) forficatum Klug D. Klug – Nouv. Holl.de 2 workers, one with white round label “6581” and white square label “Myrmica gulosa Latr. Nova-holl.” Eciton nigridens (box 54) Eciton nigridens Nouv. Holl.de 3 workers and 1 (?), one labelled “var. picidens N. Holl.”, another with a printed white square label “529” Eciton pallidens (box 54) Eciton pallidens Nouv. Holl.de 2 workers, 2

Eciton posticum (box 54) Eciton posticum , ..... rufum, var. ? Nouv. Holl.de 3 workers Eciton rufum (box 54) Eciton rufum , Myrmecia asmiens, Klug in coll. Latr. Nouv. Holl.de 3 workers Formica ammon Fabricius (box 56) Formica Ammon Fab. Coll. Latr. – Nouv. Holl. 3 workers, one labelled “n. h.” Formica Ammon, v? Coll. Latreille – Nouv. Holl. 2 workers *Formica argentata Fabricius (box 56) Formica argentata Fab.; Formica 6-spinosa Latr. Coll. Latr. Typus – Nouv. Holl. 1 Formica australis Latreille (box 56) Formica australis Latr? Coll. Latr. – Nouv.Holl. 2 workers, 1, one labelled “Polyrhachis femorata F. Sm.” Formica carinata Fabricius (box 56) Formica carinata ? Fab. Coll. Latreille – Nouv. Holl. 1 worker Formica hastata (Latreille) (box 56) Formica hastata Latr. Coll. Latr. – Nouv.Holl. 3 workers, one specimens with two square labels, the white one “Formica hastata coll.Spin.N. Holl. N 1” , the other, orange “Polyrhachis hastata Latr.”; another specimen with two white square labels “Port Natal, M.Delagoigne” and “Polyrhachis caffrorum Forel” -Formica hastata ? Coll. Latr. – Nouv.Holl. 1 Formica herculeana (box 57) Formica herculeana, v.? D. Deyrolles – Nouv. Holl. 1 Formica intricans Kirby (box 56) Formica intricans K.by Coll. Latr. – Nouv. Holl.



1 worker, with a square white label “Camponotus intrepidus Kirby”

1,1, the labelled “I S Bowerbank New Holland” “80”

Formica metalliceps Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 57) Formica metalliceps m. n.sp.? Coll. Latr. – Nouv. Holl. 2 workers labelled “Iridomyrmex purpureus F. Sm.”

Hogardia rufescens Lepeletier (box 93) Hogardia rufescens Lep. Stizus Hogardi Latr. M. Dupont – Nouv. Holl.de 2 Hogardia rufescens Nouv. Holl.de 1

Formica sp. (=Polyrrhachis presta Mayr) (box 56) Formica Coll. Latr. – Nouv.Holl. 1 worker, on its side a square white label “Polyrrhachis presta Mayr, la patria pare sbagliata (= country of origin probably wrong)” Formica sp. (=Polyrrhachis laboriosa F. Smith) (box 56) Formica Coll. Latr. – Nouv. Holl. 1 worker , with a square white label “Polyrrhachis laboriosa F. Smith (specie africana) (= African species)” FAMILY SPHECIDAE Ammophila incana Klug (box 75) Ammophila incana Kl.? Coll. Latr. – Nouv. Hol.de 2 Bembex adelaidae Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 93) Bembex Adelaidae m. D. Jekel, 1851 – Nov. Adelaida 1,1 Bembix furcata Erichson (box 92) Bembix furcata Erich. D. Reiche – Swan-Riv. 3 females Bembix furcata Erich. D. Dupont – Isle de Van-Diemen 1,1 Crabro australasiae Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 96) Crabro australasiae m., G. Solenius Lep. D. Dupont – Isle de Van Diemen 2 Exeirus lateritius Shuckard (box 86) Exeirus lateritius Shuck. D. Reiche – Swan-Riv. 1 Exeirus lateritius Shuck. Coll. Serville – Nouv. Holl.

Larra australasiae Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 90) Larra vel Lyrops Australasiae m. D. Deyrolles – Nouv. Holl. / Sidney 2 Physoscelus australasiae Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 98) Physoscelus australasiae m. n.sp.? D. Deyrolles – Sidney 1 Physoscelus australasiae var. D. Deyrolles – Sidney 1 Pison spinolae Shuckard (box 91) Pison spinolae Shuck D. Deyrolles – Nouv. Holl 2 Pison spinolae Shuck D. Verani – Nouv. Holl.da 1, 1 Sphex distincta Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 76) Sphex distincta m. D. Deyrolles – Sidney 1 Sphex pubiventris Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 76) Sphex pubiventris m. D. Deyrolles – Sidney 2 Sphex rufipennis Fabricius (box 76) Sphex rufipennis ? D. Deyrolles – N. Holl. 1 FAMILY ANDRENIDAE Colletes (Andrena) cicalybenla Erichson (box 136) Colletes (Andrena) cicalybenla Erichs D. Deyrolles – Sidney 3 specimens


FAMILY ANTHOPHORIDAE Crocisa emarginata Latreille (box 130) Crocisa emarginata Latr. Nouv. Holl. 2, one labelled: “Thyreus n. nitidulus (F.) Det. M.A.Lieftinck 1958”; the other labelled: “D. Watermann 1850. Fulodinang(?)”, “MT” and “Thyreus himalayensis Radosz. Det. M.A.Lieftinck” Crocisa guttata Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 130) Crocisa guttata m. n.sp.? D. Jekel – Nov. Holl. 2, one, white spotted, with a white label “Thyreus lugubris Sm.Det. M.A.Lieftinck 1958, cpd. with type”, a red label “MT” and another white label “5”; the other specimen with blue spots labelled “Thyreus caeruleopunctatus (Bl.) det M.A.Lieftinck 1958”. On the label on the bottom of drawer is another label placed on “Crocisa coeruleopunctata Blan” FAMILY APIDAE Allodapes cinea Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 132) Allodapes cinea m. n.sp. D. Jekel 1851- Nouv. Holl. 1 Allodapes rufiventris Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 132) Allodapes rufiventris m. D. Deyrolle – Sidney 1 Xylocopa aestuans Fabricius ?(box 128) Xylocopa aestuans Coll. Serville – Nouv. Holl. 1 Xylocopa muscaria Olivier (box 129) Xylocopa muscaria (Apis) Oliv., – (Centris) Fab., (Lestis) Lep. female Nouv. Holl. 2 Xylocopa muscaria male, Centris bombilans Fab. Nouv. Holl. 2 FAMILY COLLETIDAE Colletes rubricollis Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 136) Colletes rubricollis m. D. Deyrolles – Sidney 2

Colletes rubricollis D. Deyrolles – Sidney 4 Colletes rufipes Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 136) Colletes rufipes m. D. Deyrolles – Sidney 1 Colletes rufiventris Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 136) Colletes rufiventris m. D. Dupont – Nouv. Holl. 2 Colletes unicolor Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 136) Colletes unicolor m. inedit. Nouv. Holl. 1 Colletes vandiemenii Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 136) Colletes vandiemenii m. D. Dupont – Isle de Van-Diemen 3, 2 Prosopis alcyone Erichson (box 132) Prosopis alcyone Erichs Nouv. Holl. 1, 2 FAMILY HALICTIDAE Halictus distinguendum Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 136) Halictus distinguendus m. n.sp. D. Jekel 1851 – Nov. Holl. 2 Halictus nigritarsus (box 135) Halictus an nigritarsus Coll. Serville – Van Diemen 1 Halictus orbitus Spinola, in Casolari & Casolari Moreno, 1979 nomen nudum (box 136) Halictus orbitus m. D. Jekel 1851- Nov. Holl. 1 FAMILY MEGACHILIDAE Megachile chrysura (box 126) Megachile chrysura D. Deyrolles – Sidney 2, 2, one labelled “Nuova Olanda”


PART

5

Biology, Ecology and Behaviour


New Insights into the Foraging Behaviour of Parasitic Wasps Michael A. Keller and Brigitte Tenhumberg* Department of Applied & Molecular Ecology, Waite Campus, The University of Adelaide, P.M.B. 1 Glen Osmond, S. A. 5064 Australia (email: [email protected]) (*present address: Department of Zoology & Entomology, The University of Queensland, Brisbane, Qld 4064 Australia)

Introduction The foraging behaviour of parasitic wasps has received considerable attention from experimental and theoretical biologists for several reasons (Godfray 1994). There is a direct link between foraging behaviour and reproductive success, so the fitness associated with behaviour can be evaluated. Also, the link between behaviour and rates of parasitism allows direct study of one of the mechanisms driving population dynamics, especially the dynamics of pests under biological control. More recently, there have been concerns about the specificity of biological control agents. Understanding the factors that influence the susceptibility of non-target organisms to parasitism has further stimulated interest in foraging behaviour (Keller 1999). In order to link behaviour with reproductive success, one must understand the factors that influence the behavioural processes of a foraging wasp. Of particular importance are the decisionmaking processes that determine where a wasp will search and how long it will do so in each location (Charnov & Skinner 1985). Until recently, theoretical foraging models have driven research into these decision-making processes and the resulting levels of parasitism. The advent of new statistical methods, in particular Cox’s Proportional Hazards Model (Cox & Oakes 1984), has revolutionised the study of foraging behaviour in parasitic wasps. In this paper, one classical foraging model that is at the foundation of modern foraging theory is reviewed. Then the use of Cox’s Proportional Hazards Model and its application to the empirical study of decision-making by parasitic wasps is described. Finally, the foraging behaviour of the parasitic wasp Cotesia rubecula (Marshall) (Braconidae) at several spatial scales is described and analysed using the Proportional Hazards Model. This analysis shows how classical foraging models can guide empirical research as well as exposing their deficiencies when applied to a real organism.

Classical Foraging Theory Two questions are at the core of understanding how a foraging individual should respond to the patchy distribution of resources (Godfray 1994). Firstly, how long should an individual forager spend searching in a given patch upon encountering it? Secondly, how should a population of competing foragers be distributed among patches of varying quality? Classical foraging theory addresses these questions from an evolutionary perspective. It is assumed that foragers act in such a way that they maximise their individual fitness. Then, given various assumptions such as the spatial distribution of patches, energetic costs associated with travelling and searching, and the fitness gain from parasitising hosts, behavioural rules governing foraging have been derived. Charnov’s Marginal Value Theorem was one of the first models to address the question of how long a forager should search within a patch (Charnov 1976). In patches where resources are

247

Michael A. Keller & Brigitte Tenhumberg 248


40.0

Fitness gain

0.0 -40

0

Travel time

40

Patch time Optimum leaving time

Figure 1

Patch time as a function of travel time and fitness gain when a forager is searching in a patchy environment as predicted by the Marginal Value Theorem (Charnov 1976). A forager should leave the patch when the instantaneous rate of gain is maximised.

depleted over time, it is assumed that the rate of resource harvest decreases monotonically over time. The costs of foraging and travelling are uniform over time. In this environment, foragers are assumed to have perfect knowledge of the distribution of resources within patches and the associated costs and benefits of searching. Several predictions follow from these assumptions (Fig. 1). In order to maximise lifetime fitness, a forager within a patch should leave it when the rate of resource harvest, calculated from the time of departure from the last patch visited, is maximised. No forager should leave a patch before this maximum is reached, but leave each patch when the instantaneous harvest rate has dropped to the average maximum that can be achieved in the environment. Foragers should spend more time in patches with abundant resources, and avoid searching in patches where the expected rate of harvest is less than the average maximum. As travel time between patches increases, the time spent foraging within a patch should also increase. Such behaviour is only possible if the forager would be omniscient. Clearly real foragers are not omniscient. Lack of prior information about the distribution of patches and resources in space limits their ability to behave in the theoretically optimal way predicted by the Marginal Value Theorem and other models. This leads to two questions: 1) which information is used by real foragers to decide how long to search in a patch, and 2) how do foragers process this information? These questions can be answered by using Cox’s Proportional Hazards Model (Cox and Oakes 1984).

Application of Cox’s Proportional Hazards Model to Behavioural Data Two seminal papers on the application of Cox’s Proportional Hazards Model to ecological data in general and the foraging behaviour of parasitic wasps in particular have led to considerable

New Insights into the Foraging Behaviour of Parasitic Wasps 249

research on the factors that influence this behaviour (Haccou & Hemerik 1985; Haccou et al. 1991). The Proportional Hazards Model is an analytical tool from statistical survival analysis. This class of statistical methods considers the likelihood of a particular type of failure occurring over time. It has been applied in medicine to the study of cancer mortality and in engineering to the longevity of car parts. In foraging behaviour, the ‘failure’ of interest is the time when a forager leaves a patch containing hosts. In practice, many similar behavioural events could be analysed, e.g. the time until the first oviposition is observed within a patch. The analytical calculations used to fit the Proportional Hazards Model are complex, but the results are easily interpreted. The model assumes that there is a survival curve which describes the decreasing number of searching wasps that remain in a patch over time. This curve describes the relationship between elapsed time and the proportion of searching individuals remaining within a patch. Normally this proportion of individuals is plotted on a logarithmic scale. The log transformation produces a linear curve if the rate of departure per individual is constant over time, i.e. if the curve exhibits exponential decay. Non-linear plots indicate the tendency to leave changes over time and these can be easily interpreted by visual inspection. The Proportional Hazards Model is used to compare survival curves when initial conditions vary. An important assumption of the Proportional Hazards Model is that the differences between the survival curves can be described by a constant proportional factor. If this assumption is invalid, then the model cannot be fitted to the data. When this proportionality among survival curves does occur, they appear to be pivoted about the starting point. The Proportional Hazards analysis produces a series of coefficients that describe how each variable, or ‘covariate’, affects the tendency of a wasp to leave the patch. The Proportional Hazards Model is considered to be non-parametric because there is no statistical curve fitting. Rather, the points along the survival curves are compared directly. One important advantage of using survival analysis is that all data can be included in the analysis, even if some individuals have not left the patch before the end of the observation. These incomplete observations are said to be censored. Observations can be censored in other ways. Using classical foraging theory as a guide, various foraging events can be considered as censoring an observation. For example, when a wasp oviposits in a host, it may reassess its perception of how many hosts are present in the patch. In survival analysis, events like these can be considered as censoring times at which the covariates used in the analysis are updated. The time spent searching until the oviposition is included in the analysis because we know that the wasp would have searched in the patch at least as long had it not oviposited. However, as it did not leave the patch, it selfcensored this portion of the observation. Such self censoring enables researchers to analyse how the leaving tendency changes as a wasp searches within a patch. Foraging theory plays an important role in this type of analysis (Haccou et al. 1991). It is used to guide behavioural scientists in hypothesising censoring points when the wasp’s tendency to continue searching within a patch may change. Note that even though circumstances may change during foraging, the covariates used in the analysis are set only at the start of the foraging period when the wasp entered the patch or when the wasp self-censors the observation by ovipositing or performing some other act. This is an important point. The Proportional Hazards Model does not indicate the factors that finally trigger patch leaving. Rather, the factors or covariates that are found to influence the leaving tendency are those which exist at the start of each measured period of searching. Some of these may change during the course of a patch visit, but these changes in covariates are not included in the analysis. Unfortunately, it is probably impossible to determine factors that finally trigger



4m Figure 2

Arrangement of plants in an experimental evaluation of the patch leaving tendencies of Cotesia rubecula. Wasps were released into the central patch of one or four plants and observed until they reached one of the six peripheral plants.

patch leaving, hence an interplay between experimental and theoretical studies is important for furthering the understanding of foraging behaviour in parasitic wasps.

The Foraging Behaviour of Cotesia rubecula The braconid wasp C. rubecula parasitises the first four instars of the cabbage white butterfly, Pieris rapae L. Its behaviour has been studied at three different spatial scales: within patches of plants, on whole plants and on leaves. These studies have revealed how various factors influence searching decisions by C. rubecula at different spatial scales. They illustrate how the Proportional Hazards Model can be used to elucidate the mechanisms underlying decision-making by C. rubecula and other parasitoids. An experiment was conducted to investigate how C. rubecula searches for hosts within patches of plants. Wasps were released into patches of 1 or 4 plants separated by 75 cm (Fig. 2). Host density was 1 or 3 hosts/plant. Nine to 13 wasps were observed for each treatment combination. Six plants with 1 host/plant were situated at equal distances around a circle 4 m away from the centre


Table 1 Results of analyses of foraging data for Cotesia rubecula using Cox’s Proportional Hazards Model. Note that coefficients (β) for each covariate analysed indicate the effect on patch leaving tendency. Negative values indicate that the leaving tendency decreases as covariate values increase and vice versa. (a) Residence time on the first plant visited in patches of one or four cabbage plants. Covariate

β

Host density

–0.54

No. of plants in patch

0.34

No. encounters with damage or hosts

0.16

Host stung? (0 = no, 1 = yes)

ns

No. of stings

ns

Rate of stinging

ns

(b) Residence time in the whole patch of one or three cabbage plants. Covariate

β

Host density

–0.90

No. of plants in patch

–0.35

No. encounters with damage or hosts

ns

No. of plant visits

ns

No. of stings

ns

Rate of stinging

ns

(c) Residence time on individual plants when searching among cabbage plants bearing 0, 1, 2 or 5 hosts/plant. Covariate

β

Host density

–0.20

Rate of Stinging (no./min.)

0.07

First plant visited? (0 = no, 1 = yes)

-0.60

Host density

-0.90

(d) Residence time on Brussels sprouts leaves (data from Vos et al. 1998). Covariate

β

Encounter with host damage

–0.84

Oviposition

ns

Host encounter

ns

Elapsed time

ns

No. of stings

ns

Past encounters with damage or hosts

ns



100

% foraging on plant

1 plant, 1 host/plant

1 plant, 3 hosts/plant

4 plants, 1 host/plant 4 plants, 3 hosts/plant

10 0

25

50

Searching time (min) Figure 3

Survival curves for patch residence times of Cotesia rubecula searching for second instar Pieris rapae on the first plant visited in patches of one or four cabbage plants. At the start, all individuals are searching on the plant, but the numbers decline over time. The percentage that continue to search until the given time are plotted on a logarithmic scale. If the numbers decay exponentially, these lines would be straight.

of the experimental plot. When the wasps arrived at the outer circle or had disappeared for at least 10 min, they were considered to have left the experimental patch. Wasps were observed continuously by two observers and their behaviour was recorded using an event recorder. In this experiment, the residence times of the wasps was considered at two spatial scales: on the first plant visited and within the entire patch. If the first plant visited was considered to be the patch, the Marginal Value Theorem predicts that the time spent searching on the plant should be shorter when there is more than one plant present within the patch because travel time to reach another plant is shorter. Likewise, if one assumes that wasps will achieve a steeper gain curve and parasitise hosts more quickly when densities are higher, then the Marginal Value Theorem predicts that wasps should search longer on plants with higher host densities. When host density is higher, some hosts appear to be more easily located than others so this assumption seems reasonable. These predictions were compared to the results of a Proportional Hazards analysis (Table 1). The behaviour of the wasps is in general agreement with the theoretical predictions. The leaving tendency of the wasps increased when patch size was 4 plants compared to single plant patches. Thus, wasps left the first plant more quickly when other plants were nearby. Also, the leaving tendency of wasps was lower, i.e. they searched longer on the plants, when the host density was higher, which is in agreement with the prediction. However, note that some wasps left the first plant soon after arriving on it (Fig. 3). This is contrary to the prediction of the Marginal Value Theorem that they should remain on the plant until an overall optimum rate of oviposition is achieved. Another factor that affected the leaving tendency on the first plant was the numbers of encounters with hosts or plant damage. As these increased, so too did the leaving tendency. When numbers of such encounters continued to increase, it was an indication that the foraging wasp had been unsuccessful at attacking a host. However, no statistical influence on the leaving tendency was detected for the


100

% Remaining in patch

1 plant, 1 host/plant 1 plant, 3 hosts/plant 4 plants, 1 host/plant

4 plants, 3 hosts/plant

10 0

50

100

Time (min) Figure 4

Survival curves for patch residence times of Cotesia rubecula searching for second instar Pieris rapae for the whole patch of one or four cabbage plants.

act of stinging a host, the rate of stinging and the numbers of times hosts were stung. The absence of an influence of stinging has been interpreted as an indication that the tendency to leave the patch is re-set each time an oviposition occurs (Vos et al. 1999; see below). When foraging by wasps in this experiment was considered at a larger spatial scale of the whole patch, similar results emerged from the Proportional Hazards analysis (Fig. 4). As density increased from 1 to 3 larvae per plant or as the number of plants in the patch increased from 1 to 4, the leaving tendency decreased. Thus wasps spent longer times within the patches that were larger or had higher host densities. However, no statistical effect was detected for four other factors: the number of encounters with feeding damage or hosts, the number of plants visited before leaving the patch, the rate of stinging, or the number of hosts stung. The absence of an effect of encounters with feeding damage or hosts is contrary to what was found when behaviour on the first plant was analysed. This suggests that factors that influence wasp behaviour are different at different spatial scales. The absence of any effects of stinging hosts was consistent with results found on the first plant. Both the size of patches and the density of hosts affected rates of parasitism (Table 2). As host density increased the number of hosts stung increased, while more hosts were stung in the larger patches. However, the percentage of hosts parasitised was greatest on single plants that bore only one host, and this percentage decreased with increased density and increased patch size. Although these results suggest that mortality due to parasitism may be inversely density-dependent, this may not be so. If there is aggregation of wasps in patches with higher host density, or there are changes in host attractiveness over time as a consequence of parasitism, the relationship between density and parasitism at the level of the population could differ from the trends observed in this experiment.



Table 2 Effects of patch size and host density on parasitism of second-instar Pieris rapae by Cotesia rubecula. Host Density (No./Plant)

n

No. Stung (Mean + 95% CI)

% Parasitised

1

1

9

0.7 + 0.38

67

1

3

13

1.6 + 0.68

54

4

1

9

1.7 + 1.09

42

4

3

9

4.4 + 1.89

37

No. Plants

Superparasitism was commonly observed. Overall, each parasitised host was stung 1.53 times. Dissections of other larvae superparasitised by C. rubecula have indicated that an egg is laid at each sting (Sassan Asgari pers. comm.). The observations in this experiment were used to test one of the assumptions of the Marginal Value Theorem, specifically the assumption that fitness gains are a monotonically decreasing function of time spent foraging in a patch. Inspection of curves illustrating the numbers of hosts parasitised versus time spent foraging in patches indicated that this was commonly not the case (Fig. 5). Note that superparasitism occurred before all hosts within the patch were parasitised. Such departures from model assumptions suggest that an alternative to the Marginal Value Theorem must explain the foraging behaviour of C. rubecula. One such model might be a countdown mechanism as proposed by Driessen et al. (1995). However, no increase in leaving tendency was indicated as the number of ovipositions increased, so this model does not apply to C. rubecula. Wasps did respond to host density. The initial leaving tendency of C. rubeucla is determined by their perception of the concentration of synomones in the patch (Thomsen 1999). When wasps forage on plants from which hosts have been removed, the leaving tendency decreases with increasing levels of plant damage. Another important conclusion derived from this experiment was that searching for hosts is not systematic. Wasps may search a plant, leave it and then return again, in some instances many times. Some wasps left the focal patch and flew away from it briefly only to return and resume searching later, also many times in some instances. An omniscient forager would not behave in this way, nor would a forager be likely to do so if it remembered where it had searched. This suggests that wasps are constrained by their perception of cues released by host insects and host plants. Variation in host activity causing differential production of kairomones, the various positions of hosts on plants, changing wind speed and direction, combined with the chaotic turbulence inherent in air flows around plants, all combine to limit a wasp’s perception of hosts. A second experiment was conducted to determine how host density affected the time spent by C. rubecula searching among plants bearing different densities of hosts (Tenhumberg & Keller unpublished). Individual wasps that had previous oviposition experience were released into patches containing 16 plants, 4 plants each bearing densities of 0, 1, 2 and 5 hosts per plant arranged in a Latin square. In a proportional hazards analysis of this experiment, three factors were shown to affect the leaving tendency of the wasp: host density, the rate of oviposition (=1/ time since last oviposition) and the first plant visited. The leaving tendency decreased as host density increased. As the rate of oviposition increased, the leaving tendency increased. Thus, successful wasps moved more quickly from one plant to another. Wasps were slower to leave the first plant visited after release than when they searched on other plants. As a result, wasps laid more

New Insights into the Foraging Behaviour of Parasitic Wasps

No. Different Hosts Stung

255

9

6

3

0 0

20

40

60

80

100

Time in Patch (min) Figure 5

Gain curves for three Cotesia rubecula that searched in patches of four cabbage plants with three second-instar Pieris rapae on each plant. Symbols indicate the times when hosts were stung. Note that the curves do not increase monotonically and that in one instance the first superparasitism occurred after the first host was stung.

eggs (mean = 0.8/plant) on the first plant than on subsequent patches (0.3/plant). This suggests that the wasps were adjusting in some way to their environment following release. The nature of such an adjustment is unknown. This study highlighted an important methodological problem in defining patch boundaries. When the wasp was considered to have left the patch when she took flight, no effect of host density on the leaving tendency could be detected (P=0.28). However, if wasps were considered to have left the patch when they flew past a line marking the mid-point between plants, then the effect of host density on the leaving tendency was found (P98% accuracy (Fig. 4) (although human experts cannot discriminate these forms on morphological features). The system also achieved high accuracies when classifying four sibling species of Colletes L. (C. hederae Schmidt & Westrich, C. succinctus L., C. perforator Smith and C. halophilus Verhoeff) and, with the aphidiine data set, accuracy was increased by approximately 25%, which is probably the best that is possible as the training sets hyperspacially intersect.

Conclusion Results obtained so far suggest that machine vision techniques are very applicable to problems of insect identification, and can deliver systems capable of accuracies approaching or exceeding that of traditional human based identification services. Whilst there are problems to be resolved, especially regarding handling large data sets and in dealing with 3-dimensional objects, machine vision technology may eventually yield rapid on-line identification services, at least for groups of organisms where there is a high user demand. For groups of visually very similar organisms, such as species of Aphidius Nees, totally reliable species identifications are unlikely to be achieved on wings alone, but the system does have potential to eliminate many species as ‘improbables’, and thus narrow the field of ‘possibles’ to one of a very few species. We envisage one of the main constraints in the future will be obtaining funding for populating both the classifier database, and the associated biological information database that actually presents the user with both an identification and some information about the organism.

Acknowledgements We thank Sondra Ward for providing technical support of the highest standard. Jon Boorman was kind enough to prepare a special key to ceratopogonids, and throughout acted as an invaluable source of information about these organisms. Wilf Powell (Rothampsted) donated reared

Driving Miss DAISY: the Performance of an Automated Insect Identification System 311

material of several Aphidiinae, John Ismay (Hope Entomological Collections, Oxford) provided source material of Culex pipiens. Africanised and non-Africanised honeybee wings and the Colletes material were supplied by Chris O’Toole (Bee Systematics and Biology Unit, Oxford). We are grateful to Jill Taber for volunteering her Christmas vacation to run a series of tests on image illumination.

References Alberch, P. (1993) Museums, collections and biodiversity inventories. Trends in Ecology & Evolution 8: 372-375. Alexander, I. (1984) WISARD – a radical step forward in image recognition. Sensor Review 17: 1507-1512. Bousouf, C., Gauld, I., Jordan, J., MacGillivray, A., Mackenzie, R., Shankleman, J., Sunman, H., Swanson, T., tenKate, K., Tomkins, R., Walden, I., Ward, H. & Yamin, F. (1996) Towards Implementation of Articles 15 and 16 of the Convention on Biological Diversity. ERM, London. Brown, K. S. (1997) Diversity, disturbance and sustainable use of Neotropical forests: insects as indicators for conservation monitoring. Journal of Insect Conservation 1: 25-42. Chalmers, N. R. (1996) Monitoring and inventorying biodiversity: collections, data and training. pp. 171-179. In di Castri, F. & Younès, T. (Eds), Biodiversity, Science and Development. Towards a New Partnership. CAB International, Wallingford. Daly, H. V., Hoelmer, K., Norman, P. & Allen, T. (1982) Computer-assisted measurement and identification of honey bees (Hymenoptera: Apidae). Annals of the Entomological Society of America 75: 591-594. di Castri, F, Robertson Vernhes, J. & Younès, T. (1992) Inventorying and Monitoring Biodiversity. Biology International, Special Issue 27: 1-28. Gaston, K. J. & May, R. M. (1992) Taxonomy of taxonomists. Nature 356: 281-282. Gauld, I. D. (1986) Taxonomy, its limitations and its role in understanding parasitoid biology. pp. 1-21 In Waage, J. & Greathead, D (Eds), Insect Parasitoids. Academic Press, London. Greenslade, P. J. N. (1985) Pterygote insects and the soil: their diversity, their effects on soils and the problems of species identification. Quaestiones Entomologicae 21: 571-585. Hawksworth, D. L. (1994)The Identification and Characterisation of Pest Organisms. CAB International, Wallingford. Holden, C. (1989) Entomologists wane as insects wax. Science 246: 754-756. House of Lords (1991) Systematic Biology Research. Report of the Select Committee on Science and Technology. HMSO, London. Janzen, D. H. (1993) Taxonomy: universal and essential infrastructure for development and management of tropical wildland biodiversity. pp 100-113. In Sandlund, O. T. & Schei, P. J. (Eds), Proceedings of the Norway/UNEP Expert Conference on Biodiversity, Trondheim, Norway. NINA, Trondheim. Lattin, J. D. & Knutson, L. (1982) Taxonomic information and services on arthropods of importance to human welfare in Central and South America. FAO Plant Protection Bulletin 30: 92-95. Lucas, S. M. (1997) Face recognition with the continuous n-tuple classifier. British Machine Vision Conference Proceedings 1: 222-231. May, R. M. (1990) Taxonomy as destiny. Nature 347: 129-130. Pankhurst, R. J. (1978) Biological Identification. Arnold, London.

I. D. Gauld, M. A. O’Neill and K. J. Gaston 312


Reid, W. V., Laird, S. A., Meyer, C. A., Gámez, R., Sittenfeld, A., Janzen, D. H., Gollin, M. A. & Juma, C. (1993) Biodiversity Prospecting: Using Genetic Resources for Sustainable Development. World Resources Institute, Washington, D. C. Tilling, S. M. (1987) Education and taxonomy: the role of the Field Studies Council and AIDGAP. pp 87-96. In Berry, R. J. & Crothers, J. H. (Eds), Nature, Natural History and Ecology. Academic Press, London. Turk, M. & Pentland, A. (1991) Eigenfaces for recognition. Journal of Cognative Neurosciences 3: 71-86. UNEP/CBD/SBSTTA/2 (1996) Report of the Subsidiary Body on Scientific, Technical and Technological Advice on the Work of its Second Meeting. Secretariat to the Convention on Biological Diversity, Montreal. Vane-Wright, R. I. (1996) Systematics and the conservation of biological diversity. Annals of the Missouri Botanical Garden 83: 47-57. Weeks, P. J. D. & Gaston, K. J. (1997) Image analysis, neural networks, and the taxonomic impediment to biodiversity studies. Biodiversity & Conservation 6: 263-274. Weeks, P. J. D., Gauld, I. D., Gaston, K. J. & O’Neill, M. A. (1997) Automating the identification of insects: a new solution to an old problem. Bulletin of Entomological Research 87: 203-211. Weeks, P. J. D., O’Neill, M. A., Gaston, K. J. & Gauld, I. D. (1999). Species-identification of wasps using principal component associative memories. Image and Vision Computing 17: 861-866. White, I. M. & Scott, P. R. (1994) Computer information resources for pest identification: a review. pp 129-137. In Hawksworth, D. L. (Ed.), The Identification and Characterisation of Pest Organisms. CAB International, Wallingford. Whitten, A. (1996) Field guides: useful tools in environmental planning and management. World Bank Environment Department, Dissemination Notes 51: 1-4. Yu, D. S., Kokko, E. G., Barron, J. R., Schaalje, G. B. & Gowen, B. E. (1992) Identification of ichneumonid wasps using image analysis of wings. Systematic. Entomology 17: 389-395.

Data Warehousing Architecture and Tools for Hymenoptera Biodiversity Informatics Norman F. Johnson and Luciana Musetti Department of Entomology, The Ohio State University, 1315 Kinnear Road, Columbus, Ohio 43212-1192 USA (email: [email protected], [email protected])

Introduction The natural history collections of the world are estimated to have some 2.5 billion specimens in their holdings (Duckworth et al. 1993). This material forms the physical documentation of much of our knowledge of biological diversity, both past and present. The intrinsic characteristics of the specimens, from morphological features to DNA sequences, are used to recognise taxa and to reconstruct their phylogenetic history. Equally important are the associated data which document the geographic and temporal distribution of taxa as well as ecological associations. Specimens in entomological collections may be preserved by one of a variety of methods: they may be individually pinned, one or more may be stored in vials, or they may be mounted on microscope slides. In each of these formats, the specimens are expected to have information relating to their collection written on a label affixed to the pin or slide, or included in the same vial. Minimally, this information includes the place at which the specimens were collected and the date or range of dates of collection. Other data commonly include the names of the collectors, the method of collection, brief notes on the habitat in which the specimens were found, and associations with other species. All of these data vary greatly in their detail and completeness. Entomological material also is somewhat restricted in that the information is usually constrained to appear on the small bits of paper attached to insect pins. The individual pieces of data associated with single specimens are of limited value themselves: the information may be anomalous or simply wrong. In the aggregate, however, these data usually are the only hard facts that we have in hand to support our ideas about the geographic distribution of a taxon, the time at which adults may be found on the wing, the habitats in which the species is likely to be found, or the hosts (plants or other arthropods) upon which the larvae feed. Voucher specimens in natural history collections allow us to reassess our understanding of the biology and distribution of taxa, even as taxonomic concepts develop and mature through time. The holdings of most collections, today, are accessible to bona fide researchers. Specimens are routinely sent on loan around the world, and some of the major museums annually host hundreds of visiting scientists. The physical accessibility of specimens is a major advance from the 19th century, when workers had to rely on incomplete or even inaccurate published descriptions as a means of recognising taxa. However, in a practical sense, this ‘accessibility’ is often a mirage. One must discover that the desired specimens actually exist before loan requests can be made or travel arranged. This discovery process is very time-consuming and expensive, involving communication with curators of the institutions known or suspected to have the material of interest and, often, personal travel to some of these museums. And at the end of the day, the

313

Norman F. Johnson and Luciana Musetti 314


material thus harvested is only a subset of the total actually available. In a practical sense, the remaining specimens, and their data, are inaccessible or non-existent. The discovery process described may well be sufficient to meet the needs of many taxonomic research projects. People know, at least generally, which institutions have large holdings in their group of interest, and resources of these collections are invariably tapped. The chances that a small collection will have a significant number of specimens of an important new taxon are rather small, and can easily be incorporated into the context of a revision at a later time. However, the specimens are more than just a source of taxonomic information. Small, regional collections are likely to be very important in filling in gaps in our knowledge of geographic distribution, seasonal phenology, and biological interactions. It is precisely these important data that we lose by focusing on only the major collections. Recent developments in information technologies offer researchers and curators the opportunity to provide real and affordable access to the specimen data that has been gathered over the years at great cost in time and funds. This ‘access’ means not only providing raw data, although this aspect is critically important, but also packaging this information in forms that facilitate interpretation and understanding. The emerging field of biodiversity informatics seeks to develop the tools for visualisation, summarisation, and generalisation of these data. Current progress in networking, databases, and geographical information systems is opening exciting new avenues for the application of specimen data beyond the fields of taxonomy and systematics. We describe here an information system that leverages World Wide Web technologies to provide real-time access to data on the taxonomy, distribution, phenology, and biology of taxa derived from both natural history collections and the published literature.

Needs A needs analysis is the first step in the development of new software applications. The target audiences must be defined: these may range from scientific researchers to governmental agencies, NGOs, and the general public. The perceived needs of these groups typically develop over time, especially as the new application is used and its potential better understood. From our perspective, at the highest level an information system should be widely accessible and platform independent, i.e. function on the widest range of hardware and operating systems. The information retrieved from the system should be as current as possible, preferably the latest information available. A wide range of visualisation and summarisation techniques should be provided to the user, but ultimately the actual data from specimens and publications must be available. Finally, the sources of all information must be documented, thus giving a relative measure of accuracy or reliability. More specifically, the kinds of tools that users will desire may be gleaned from the types of data summarisations that authors commonly use in traditional publications, especially distribution maps, graphs of seasonal flight periods, images, and keys. Typical avenues for access to data would be based upon the identity of a taxon, biogeographical region, country or author. Response time to information requests is important (the faster the better), and the speed of response to the most common query types must be optimised. We believe that World Wide Web technologies effectively address the issues of accessibility and platform independence. Relational databases are an established and proven tool for storing large amounts of information and maximising the efficiency of its retrieval. A well-designed

Data Warehousing Architecture and Tools for Hymenoptera Biodiversity Informatics 315

database system can provide for an almost infinite range of ad hoc queries, and results of common but complex queries can be extracted and stored separately to reduce response times to an absolute minimum. The common gateway interface scripts (cgi scripts) that effect the gateway between the Web and the database can also invoke auxiliary programs, such as mapping and plotting functions.

System description Hymenoptera On-Line is our implementation of such an information system. The primary target audience is the scientific community. Our goal is to provide this audience with access to the raw data as well as summarisations and visualisations of this information. The URL for access to the system (as of March 1999) is http: //iris.biosci.ohio-state.edu/hymenoptera. We describe below the basic elements and functionality of the system. More details may be obtained at http: //iris.biosci.ohio-state.edu/projects/tpp/clusters.html or from the authors. Database structure The underlying database structure is an implementation of the 1993 information model for biological collections developed by the Association of Systematics Collections (ASC 1993). We have made a number of extensions to that model, especially in the areas dealing with publications and unvouchered records. The data are stored in a total of 57 tables, which we group into seven functional clusters for the purposes of discussion. The basic idea is that the primary elements of a collection (Collecting Units) are derived from the act of collecting (Collecting Events), a unique combination of time, place, people and method. Collecting Unit Cluster. The original ASC model was devoted to natural history collections, and the Collecting Unit naturally formed the fundamental item of interest. Collecting Units may be individual specimens, groups of specimens (lots), or items derived from specimens (e.g. DNA extracts or genitalia). This idea has been somewhat expanded to incorporate more intangible constructs such as observations. Information about such units includes the number of specimens in a lot, the sex of a specimen, the life stage (e.g. egg, larva, pupa, adult), and its identification code. This code, the Collecting Unit ID, is a unique combination of collection coden (from Arnett et al. 1993) and a number. Some collections, such as Instituto Nacional de Biodiversidad and the Peabody Museum, have already provided unique identifiers for their specimens, and these codes are used when available. Collecting Event Cluster. A Collecting Unit is acquired as a result of a Collecting Event, that is, a unique combination of place, time, method and collectors. Other attributes could reasonably be used to further define an event, such as habitat or substrate. We continue to use separate tables to handle information about collecting dates, although a subsequent version of the ASC model has abandoned this in favour of a single text entry (ASC 1997). Collecting locality information leads to a small set of tables that distinguish among types of localities; store information on elevation, latitude and longitude; and place the locality within the political hierarchy of place names. Agent Cluster. The information about the entities that take actions, such as collectors or authors, is stored in the tables of this cluster. These include both people and organisations. We also have recently defined groups as separate entities, thus allowing an unlimited number of people to be associated as, e.g. authors or collectors.



Taxonomy Cluster. The system of names that are applied to organisms is surprising in its complexity. These tables distinguish between taxonomic concepts, i.e. hypotheses about the existence of species, genera, etc., and the names that are applied to these concepts. We adopt the position that taxa at all levels are real individuals in nature and that these are the entities we are interested in modelling within the database. An alternative viewpoint is that the taxonomic concepts of each individual author are entities that should be modelled separately. This, in our view, is a legitimate position, but confusion arises because the same set of taxonomic names are applied to both kinds of concepts. Our database structure incorporates only the first. The taxonomic hierarchy is embodied by a recursive relationship within a single table. The ASC model attempted to include capacity to store alternative classifications, but we have not implemented this aspect. The tables of the taxonomy cluster and those of the collecting unit cluster are connected through a determination table, i.e. the assignment of a taxonomic name to a collecting unit. Documentation Cluster. The original ASC model had only the rudiments of the database structure needed for literature and associating this with specimens. The most recent version (ASC 1997) has considerably expanded in the area of literature, but we were forced to develop our own structure independently. The Documentation cluster of tables can treat both published and unpublished sources of information. The only form of the latter that we have found necessary to incorporate at this point is data recorded on specimen labels; other possibilities, though, include field notes and letters. Different forms of publication, e.g. journal articles versus books, traditionally are cited in different manners. Hence, we have a small proliferation of tables that store data particular to these different formats. Data from the literature is associated with collecting units, localities, and taxon names through specific citation tables. Authority Cluster. This is a small set of tables that serve as authority files for static information and includes data on collecting methods, categories of types (holotypes, lectotypes, etc), and the kinds of biological associations between taxa or individuals. Integration Cluster. Some classes of information are stored outside of the database itself, some in the file system of our servers, others on computers elsewhere on the Internet. These tables provide the means to retrieve this information. For example, sequence information is stored in GenBank databases. We have implemented the capability to automatically invoke the cgi scripts used at GenBank to retrieve information on hymenopteran data.

Web interface Our fundamental window into the information stored in the database is based upon the names of organisms. The user may enter a taxonomic name directly or step through the taxonomic hierarchy until reaching the taxon of interest. The various taxa have differing amounts and types of information associated with them: the categories of information available are indicated in abbreviated form on the list of names. These include 1) taxonomic data, 2) literature on taxonomy and systematics, 3) geographic distribution, 4) collecting dates, 5) images, 6) biological associations with other taxa, and 6) connections to other databases on the Internet. This interface is highly susceptible to changes as we incorporate new options and respond to user requests, so we will not dwell on the existing functionality here. Except for the initial entry Web page, all the html pages are produced dynamically using a combination of cgi scripts (written in Perl) and stored database procedures (written in PL/SQL, the procedural language extensions to the database standard structured query language). Distribution maps are created by extracting from the database the latitude and longitude for specimens of the selected taxon and painting circles on


pre-existing base maps at these points. Graphs of collecting dates are created and displayed using external Java applets. Connections to other databases are made by mimicking the native cgi scripts of their Web gateways.

Discussion Our database is designed to store and retrieve information from two primary and overlapping sources: the published literature and the specimens in collections. Although we have limited our universe of interest to a single order of arthropods, the magnitude of a complete database of information on specimens and literature of Hymenoptera would be overwhelming. We do not propose that time and money be invested in databasing every last specimen of honey bee in every collection in the world. Clearly there are priorities and points of diminishing returns. For some topics, the goal of comprehensiveness is both desirable and achievable. For example, a complete listing of all described species of Hymenoptera is a daunting, but attainable goal. Documenting geographic distribution, on the other hand, perhaps may be best achieved by recording only new county, state or country records. A number of problems are encountered in developing such a database. The most critical bottleneck in converting specimen information from the printed label to a digitally stored form is not the keyboard strokes involved in the transcription process itself, but the exercise of geo-referencing the collecting locality. Some countries have published or on-line gazetteers that greatly facilitate this process; for others no such information is available. Labels are often insufficiently specific to allow determination of latitude and longitude. This may be because only a large geographical area is cited as the locality (e.g. very old specimens may simply record that the specimen came from ‘Brazil’); a single place name may be used several times within a political entity (e.g. there are at least three places called Sugar Grove, Ohio); or the data may be ambiguous (e.g. 60 km W of Cairns: is this 60 km on a particular road, 60 km in a straight line, is it really due west or just generally toward the west). The importance of the third type of ambiguity is scale-dependent. Most of our questions are directed at continental-scale patterns of distribution, and the different interpretations have little practical effect. However, if one is interested in fine-scale patterns, such ambiguity is critical. Finally, political instability can cause difficulties, not so much in the changes of names or boundaries of countries, but in reorganisations of political subunits within countries. Data curation is a relatively expensive process in terms of both time and funds. Curation includes both the aspects of data input as well as quality control. These costs must be included in the overall budget of an institution or individual and will compete with the expenses of necessary activities such as physical curation of specimens, acquisition of new specimens, and mailing costs. A museum may well decide that its priorities cannot include databasing. We believe that it is imperative that alternative strategies be developed to provide access to the information contained in such collections, particularly those with geographically or taxonomically important holdings. Data warehousing and collective data capture by individual researchers are examples of such strategies. Our first gateway into the databased information relies upon the user selecting a taxon and then selecting the type of information desired. However, many other avenues of entry can be envisioned. The focus of interest may be geographical: What species are known from Costa Rica? What region has more species of braconids, the Neotropics or the Oriental region? Which taxa of Hymenoptera exhibit austral disjunct distributions? Chapada dos Guimarães is a classic



collecting locality visited by H. H. Smith: what species are known from this site; what does it look like; what is its climate like? Or perhaps, the interest may be on the biological associates: What parasitoids attack the eggs of Carabidae? Science also has a social dimension: What species and genera were described by William H. Ashmead? How many of those are still considered valid? Who described the greatest number of synonyms and homonyms? All of these questions, and many more, can be addressed using our existing database structure. One of the values of recording information at the level of specimens is that it opens the possibility of using the data to model the geographic distribution of taxa. Maps with dots indicating known collecting localities and shaded areas indicating predicted distribution are a common element in the taxonomic literature. The basis upon which such shadings are made is almost never explicitly defined and, we believe, is simply arbitrarily determined by the author. It is possible, though, to use the geographic coordinates of collecting localities, and the number of specimens from each locality and, conceivably, the absence of specimens from a locality as inputs into modelling applications for which the parameters can be explicitly defined. Distribution predictions may make use of climatic variables such as precipitation and temperature, land cover, distributions of other organisms, human population density, and so on, to the satisfaction of the modeller. These have the advantage that the underlying data and assumptions are explicit and can be challenged or modified by others. With such distribution models in hand it is possible to imagine a number of interesting applications. The ultimate range of invasive species can be predicted. The search for potential biological control agents can be narrowed to match not only the targeted host, but also the climatic regime in which control is desired. Summaries of the distribution of entire groups can be used to precisely identify areas of high species richness or endemism. Observed biogeographical patterns may be quantitatively compared, i.e. is the distribution observed for one species unusual? How unusual is it? Which other species share this pattern? This is an exciting area in which to contemplate the application of data that too often lie unused in dusty collections or within unread monographs. Finally, we can see two other clear and relatively accessible applications for the database and Web gateway we have described. One is the development of a host-parasite index. In an electronic online format, newly acquired data can be easily added and existing data updated where necessary. Second, taxonomic names are, by definition, published and ‘available’. However, the literature is littered with homonyms and errors in spelling and citation of authorities. A complete nomenclature for the order is an attainable goal, one that would provide an up-to-date resource for the most basic piece of information about any taxon: its name. We do not, of course, believe that these ideas exhaust the range of applications of such databases. We stand ready to collaborate with the rest of our community in developing an exciting resource to advance our knowledge of the Hymenoptera.

Acknowledgements This material is based in part upon work supported by the National Science Foundation under Grant No. DEB-95221648.

References Arnett, R. H., Jr., Samuelson, G. A. & Nishida, G. M. (1993) The Insect and Spider Collections of the World. Second edition. Flora & Fauna Handbook No. 11. Sandhill Crane Press, Inc., Gainesville.


Association of Systematics Collections (1993) An information model for biological collections. Report of the Biological Collections Data Standards Workshop, August 18-24, 1992. URL: gopher: //kaw.keil.ukans.edu:70/11/standards/asc. Association of Systematics Collections (1997) The ASC Reference Model. URL: http:// gizmo.lbl.gov/DM_TOOLS/OPM/BCSL/ LIB/ASC.html. Duckworth, W. D., Genoways, H. H. & Rose, C. L. (1993) Preserving Natural Science Collections: Chronicle of Our Environmental Heritage. National Institute for the Conservation of Cultural Property, Inc., Washington, D. C.

Preliminary Study of Pteromalid Diversity in China: Taxonomic and Geographic Variation Hui Xiao1, Da-Wei Huang1 and Steven L. Heydon2 1

Institute of Zoology, Chinese Academy of Sciences, Beijing 100080 China (email: [email protected]) 2

Bohart Museum of Entomology, Department of Entomology, University of California, Davis, CA 95616-8584 USA

Introduction The Pteromalidae is the most morphologically variable family within the Chalcidoidea, and this variability reflects the diverse life histories of the included taxa. Pteromalidae have been associated with approximately 100 families of plants and their hosts include members of most insect orders as well as spiders (Bouºek 1988; Bouºek & Rasplus 1991). They behave as ectoparasitoids, endoparasitoids, koinobionts, idiobionts, solitary or gregarious, primary or secondary parasitoids, while a few species can be classified as predators. Pteromalidae is one of the largest families of the Chalcidoidea, containing 588 genera and 3364 valid species (Noyes 1998). It was traditionally divided into 14–19 subfamilies, but Bouºek (1988) erected 12 new subfamilies, so current classifications include up to 31 subfamilies. The taxonomy of the Pteromalidae in China has made rapid progress since the 1970’s, with the number of recorded and described species having increased greatly in recent years. This work reviews the current knowledge of the Chinese pteromalid fauna by examining its diversity at generic and subfamily levels and assessing geographical variation within the group. The data come from material in the major international collections with substantial holdings from China: viz. the Zoological Museum, Institute of Zoology, Chinese Academy of Sciences, the Biocontrol Institute, Fujian Agriculture University, the Taiwan Agricultural Research Institute, the Bohart Museum of Entomology, University of California, Davis, the Natural History Museum, London, and the National Museum of Natural History, Smithsonian Institution. N.B. The authors for genera in the text are given in Appendix 1.

Subfamily Diversity and Proportional Representation of Subfamilies We recognise 17 subfamilies of Pteromalidae from China (including Taiwan and Macao) (Table 1), and have identified 155 genera, virually all of which are recorded from China for the first time (Appendix 1). Clearly this number will increase with further collecting and research. The Chinese fauna is dominated by the Pteromalinae (65% of genera) and, to a lesser degree, the Miscogasterinae (13%) (Miscogasterini sensu Graham 1969) (Table 1). The remaining 15 subfamilies comprise only 22% of genera (34), with nine subfamilies only being represented by a single genus. A comparison of these proportions with the world pteromalid fauna is given in Table 2. These data indicate that the Chinese fauna may be depauperate for the subfamilies Diparinae and Ormocerinae, and very diverse (at least at the generic level) for Miscogasterinae and Pteromalinae.

320


Preliminary Study of Pteromalid Diversity in China: Taxonomic and Geographic Variation 321

Table 1 Summary of the Chinese pteromalid fauna showing the number genera and their proportion of the total for each subfamily.

Subfamilies Austroterobiinae

No. genera included

Proportion %

1

0.65

No. genera included

Proportion %

Pireninae

2

1.29

Subfamilies

Asaphinae

1

0.65

Cerocephalinae

3

1.94

Colotrechninae

1

0.65

Diparinae

4

2.58

Herbertiinae

1

0.65

Ormocerinae

4

2.58

Macromesinae

1

0.65

Eunotinae

5

3.23

Neodiparinae

1

0.65

Cleonyminae

8

5.16

Panstenoninae

1

0.65

Miscogasterinae

20

12.90

Spalangiinae

1

0.65

Pteromalinae

100

64.52

Storeyinae

1

0.65

Table 2 Comparison of the Chinese and world pteromalid faunas (species’ numbers are given in parentheses; *includes unpublished data from the authors; ** data from Noyes 1998).

Subfamily

Chinese genera and species*

World genera and species**

Subfamily

Chinese genera and species*

World genera and species**

Austroterobiinae

1 (2?)

1 (2?)

Miscogasterinae

20 (101)

34 (319)

Asaphinae

1 (6)

4 (20)

Neodiparinae

1 (1)

1 (3)

Cerocephalinae

2 (3)

13 (41)

Ormocerinae

4 (20)

40 (165)

Cleonyminae

8 (20)

43 (261)

Panstenoninae

1 (5)

2 (10)

Colotrechninae

1 (1)

19 (41)

Pireninae

1 (4)

17 (184)

Diparinae

3 (7)

31 (102)

Pteromalinae

100 (160)

317 (1964)

Eunotinae

5 (12)

21 (77)

Spalangiinae

1 (14)

2 (51)

Herbertiinae

1 (1)

1 (7)

Storeyinae

1 (1)

1 (1)

Macromesinae

1 (1)

1 (11)

Distribution of Subfamilies The various pteromalid subfamilies show different patterns of distribution even when this is indicated only by a relatively crude measure such as ‘presence’ or ‘absence’ at particular localities. Asaphinae, Pteromalinae, Cleonyminae, Eunotinae, Panstenoninae, Ormocerinae, Pireninae and Spalangiinae are distributed throughout China. Other subfamilies show more restricted distributions. The Diparinae and Cerocephalinae are found mainly in central and southern China, but the genus Netomocera (Diparinae) can be found as far north as Beijing. In contrast, the Macromesinae is limited to the north of China and the Miscogasterinae (Miscogasterini sensu Graham 1969) to the north and west. However, a few genera in the latter subfamily, such as Glyphognathus, Lamprotatus, Miscogaster and Stictomischus, only occur further south. Several subfamilies may have very limited distributions but more intense sampling for these rarer subfamilies is needed. The Herbertiinae is recorded only from Taiwan, Hong Kong and Hainan Island; Neodiparinae is known only from Fujian Province in south-eastern China; Storeyinae

Hui Xiao, Da-Wei Huang and Steven L. Heydon 322

Table 3


Number of pteromalid genera recorded from the provinces of China.

Provinces

No. Genera

Provinces

No. Genera

Heilongjiang (HL)

26

Anhui (AH)

5

Inner Mongolia (NM)

24

Jiangsu (JS)

8

Liaoning (LN)

18

Sichuan (SC)

39

Jilin (JL)

33

Shanghai (SH)

6

Shaanxi (SN)

42

Zhejiang (ZJ)

12

Gansu (GS)

22

Fujian (FJ)

52

Qinghai (QH)

11

Jiangxi (JX)

3

Ningxia (NX)

19

Hunan (HN)

30

Xingiang Uygur (XJ)

29

Guangdong (GD)

21

Tibet (XZ)

23

Guangxi (GX)

20

Beijing (BJ)

49

Hong Kong (HK)

6

Hebei (HEB)

53

Taiwan (TW)

34

Shanxi (SX)

13

Macao (MC)

4

Shandong (SD)

22

Hainan (HAN)

17

Henan (HEN)

30

Guizhou (GZ)

7

Hubei (HB)

21

Yunnan (YN)

56

from Sichuan Province, and Austroterobiinae from Hong Kong. Generally, there appears to be an increase in subfamily diversity from north to south through the country.

Variation of Generic Diversity in Provinces Considerable variation is found in the numbers of pteromalid genera recorded from the various municipalities, provinces and autonomous regions (Table 3; Fig. 1). Tianjin and Chongqing municipalities have no recorded pteromalids so far, seven provinces have 10 or fewer recorded genera, seven provinces have 10–20 genera, 10 provinces 20–30, three provinces 30–40, two provinces 40–50, and three provinces have greater than 50 recorded genera. Of the latter three provinces, two are in south China and one is in the north. This fact provides only weak support for the idea that there is an increase in generic diversity from north to south. Attempting to find gradients in diversity by examining records for all the provinces together is also less than satisfactory. The seven provinces with less than 10 recorded genera are all located in central-southern China, but this probably does not indicate that pteromalids are depauperate there, but rather that the region has been less intensively sampled. These provinces should be the primary focus of future surveys.

Interesting Distribution Patterns of Some Special Genera Many pteromalid genera from Australia, the Pacific region and Africa are also found in China, particularly in the south. For example, Parurios (Diparinae) was previously recorded from Australia with one additional species in India. We have recently found Parurios in Hainan, Yunnan, Fujian and Hunan, and as far north as latitude 34˚N. Grahamisia (Diparinae) was previously recorded from Africa and Sri Lanka, but is now also recorded from Hubei Province, central China. Agiommatus (Pteromalinae), known from Australia, Indonesia, Malaysia, Sri Lanka, India and Madagascar, has recently been recovered from numerous localities in southern China (Fujian, Guangxi and Guangdong Provinces) and from as far north as Hunan Province in central


Figure 1

Distribution and diversity of pteromalid genera in the provinces of China (see Table 3 for abbreviations).

China. Zolotarewskya (Cleonyminae) is recorded from Australia (Queensland), Madagascar, Singapore and Algeria, but we have also found it in northern China (Beijing). One genus, probably the undescribed taxon from Australia and referred to the Austroterobiinae by Bouºek (1988) is now known to occur in Hong Kong. The pteromalid fauna of northern China is similar to that of temperate Palaearctic Europe, but the ranges of some Palaearctic genera are found to extend into southern China. For example, Neodipara (Neodiparinae) was previously known from Europe, but we have recorded it from Fujian Province in south-eastern China. Lyubana (Pteromalinae) was described from Yugoslavia (Bouºek & Rasplus 1991) but is now known form Fujian Province and appears to be widely distributed throughout south-east Asia. In the Miscogasterinae, generic diversity appears to increase from the north-eastern towards the south-west of mainland China.

Discussion Based on the above findings, the following preliminary comments and conclusions can be made about the Pteromalidae of China: 1.

Genera characteristic of the Palaearctic region can usually be found in northern China; genera characteristic of the Oriental region predominate in southern China.



2.

Genera mainly distributed in Australia, can be found in southern China, but also in northern and central parts. This needs to be further studied.

3.

Based on the distribution of genera documented here, it is reasonable to separate the Palaearctic from the Oriental Regions in central China along the Qinling Mountains.

4.

Whilst diversity increases towards the tropics, it is not uniform across all subfamilies, with some showing a reverse trend.

5.

The seven provinces that have less than 10 pteromalid genera recorded are all located in central-southern China. This may not reflect the real situation but rather be an artefact of collecting, which should be addressed by concentrated collecting efforts in future surveys.

Although the above findings are based on an extensive amount of material, the data are still far from complete. Most regions of China have been relatively poorly sampled for Chalcidoidea, given the size of the country and diversity of habitats. Our work to date indicates that further collecting effort could be profitably focused in the Qinghai-Xizang Plateau and the downstream area of the Yangtze River. This effort should employ a wide array of collecting techniques to maximise the chalcidoid diversity in samples.

Acknowledgements The project supported by National Natural Science Foundation of China, (NSFC grant No. 39625004). We would like to thank the Chinese Academy of Sciences, which provided Da-Wei Huang the opportunity of studying at the Bohart Museum of Entomology, Department of Entomology, University of California. Space and facilities during this time were kindly provided to Da-Wei Huang by the Bohart Museum of Entomology.

References Boucˇek, Z. (1988) Australasian Chalcidoidea (Hymenoptera): A Biosystematic Revision of Genera of Fourteen Families, with a Reclassification of Species. CAB. International, Wallingford. Boucˇek, Z. & Rasplus, J.-Y. (1991) Illustrated Key to West-Palearctic Genera of Pteromalidae (Hymenoptera: Chalcidoidea). Institut National de la Recherche Agronomique, Paris. Graham, M. W. R. de V. (1969) The Pteromalidae of North-Western Europe (Hymenoptera: Chalcidoidea). Bulletin of the British Museum Natural History (Entomology) Supplement 16: 1-908. Noyes, J. S. (1998) Catalogue of the Chalcidoidea of the World (CD-product, windows version 1.0). ETI/The Natural History Museum, London.


Appendix 1 Pteromalid subfamilies and genera recorded from China. Subfamily

Genus

Subfamily

Genus

Subfamily

Genus

Asaphinae (1)

Asaphes Walker

Pteromalinae (101)

Ablaxia Delucchi

Pteromalinae (101)

Miscogasteriella Girault

Cerocephalinae (3) Acerocephala Gahan Cerocephala Westwood Cleonyminae (8)

Acroclisoides Girault

Mokrzeckia Mokrzecki

Acrocormus Förster

Nasonia Ashmead

Theocolax Westwood

Agiommatus Crawford

Norbanus Walker

Anacallocleonymus Yang

Allocricellius Yang

Notoglyptus Masi

Callocleonymus Masi

Amblyharma Huang & Tong

Oxysychus Delucchi

Cleonymus Latreille

Anisopteromalus Ruschka

Pachycrepoideus Ashmead Pachyneuron Walker

Heydenia Förster

Apsilocera Boucˇek

Notanisus Walker

Arthrolytus Thomson

Paracarotomus Ashmead

Oodera Westwood

Callimerismus Graham

Paracroclisis Girault

Zolotarewskya Risbec

Callitula Spinola

Paroxyharma Huang & Tong

Solenura Westwood

Capellia Delucchi

Peridesmia Förster

Colotrechninae (1)

Colotrechnus Thomson

Catolaccus Thomson

Pezilepsis Delucchi

Diparinae (4)

Dipara Walker

Cecidostiba Thomson

Platecrizotes Ferrière

Grahamisia Delucchi

Cheiropachus Westwood

Platneptis Boucˇek

Netomocera Boucˇek

Chlorocytus Graham

Platygerrhus Thomson

Parurios Girault

Coelopisthia Thosmon

Plutothrix Förster

Cephaleta Motschulsky

Conomorium Masi

Propicroscytus Szelényi

Eunotus Walker

Coruna Walker

Pseudocatolaccus Masi

Moranila Cameron

Cryptoprymna Förster

Psilocera Walker

Eunotinae (5)


Subfamily


Genus

Subfamily

Genus

Subfamily

Genus

Ophelosia Riley

Cyclogastrella Bukovskii

Scutellista Motschulsky

Cyrtogaster Walker

Pteromalus Swederus

Herbertiinae (1)

Herbertia Howard

Cyrtoptyx Delucchi

Pterosemigastra Girault & Dodd

Mactomesinae (1)

Macromesus Walker

Dibrachys Förster

Pterosemopsis Girault

Miscogasterinae (19)

Glyphognathus Graham

Dinarmus Thomson

Pycnetron Gahan

Neodiparinae (1)

Psychophagus Mayr

Ammeia Delucchi

Dinotiscus Ghesquicre

Rakosina Boucˇek

Drailea Huang

Dinotoides Boucˇek

Rhaphitelus Walker

Halticoptera Spinola

Eulonchetron Graham

Rhopalicus Förster

Halticopterina Erdös

Eumacepolus Graham

Roptrocerus Ratzeburg

Lamprotatus Westwood

Euneura Walker

Schizonotus Ratzeburg

Merismus Walker

Eurydinota Förster

Sphegigaster Spinola

Miscogaster Walker

Eurydinotomorpha Girault

Stenomalina Ghesquicre

Nodisoplata Graham

Gastracanthus Westwood

Synedrus Graham

Rhicnocoelia Graham

Glyptosticha Masi

Syntomopus Walker

Seladerma Walker

Gugolzia Delucchi & Steffan

Thinodytes Graham

Skeloceras Delucchi

Habritys Thomson

Tomicobia Ashmead

Sphaeripalpus Förster

Hobbya Delucchi(?)

Toxeumorpha Girault

Stictomischus Thomson

Holcaeus Thomson

Trichomalopsis Crawford

Thektogaster Delucchi

Homoporus Thomson

Trichomalus Thomson

Toxeuma Walker

Inkaka Girault

Trigonoderoides Kamijo

Tricyclomischus Graham

Ischyroptyx Delucchi

Trigonoderus Westwood

Tumor Huang

Isocyrtus Walker

Tritneptis Girault

Xestomnaster Delucchi

Kaleva Graham

Trychnosoma Graham

Neodipara Erdös

Lariophagus Crawford

Tsela Boucˇek


Subfamily

Genus

Ormocerinae (4)

Semiotellus Westwood

Subfamily

Genus

Subfamily

Genus

Lyubana Boucˇek

Uniclypea Boucˇek

Systasis Walker

Makaronesa Graham

Vrestovia Boucˇek

Ormocerus Walker

Manineura Boucˇek

Zdenekiana Huggert

Oxyglypta Förster

Meraporus Walker

Panstenoninae (1)

Panstenon Walker

Merismomorpha Girault

Pireninae (2)

Gastrancistrus Westwood

Merisus Walker

Macroglenes Westwood

Mesopolobus Westwood

Spalangiinae (1)

Spalangia Latreille

Metacolus Förster

Storeyinae

Storeya Boucek

Metastenus Walker

Austroterobiinae

Genus ?

Micradelus Walker

The Family Braconidae in China (Hymenoptera) Chen Xuexin, He Junhua & Ma Yun Institute of Applied Entomology, Zhejiang University, Huajiachi Campus, Hangzhou 310029 China (email: [email protected])

Introduction The braconid wasp fauna of China is a rich and diverse one. This is consistent with the diversity of habitats found in such a large area of the eastern Palaearctic and northern Oriental region, spanning some 25 degrees of latitude and, related to this, that the country represents one of several ‘megadiverse’ regions of the world. This is reflected in the insect fauna China in a general way, and also in its parasitic Hymenoptera, including the Braconidae. However, compared with some other regions of the world, the comprehensive study of Chinese braconids was only begun relatively recently, but has accelerated at an increasing pace. In the last 20 years the number of described species has increased 2.5 times and, including the fauna of Taiwan, represents about 1100 recognised taxa. The aim of this paper is to outline the history of taxonomic studies undertaken on the braconids of China, to document the people, institutions and taxonomic groups involved, and to provide a detailed listing of the literature as an aid to braconid and other systematists from outside the country.

Brief History of Braconids in China About 280 species belonging to 80 genera and 18 subfamilies of the family Braconidae (Hymenoptera) were listed for China in the multi-volume monograph ‘Hymenopterorum Catalogus’ (Shenefelt 1969-1978; Shenefelt & Marsh 1976). This compendium clearly shows that the majority of studies on the Braconidae of China prior to the 1970’s were undertaken mainly by foreign experts, and that those by Chinese taxonomists themselves mostly started later than this time. However, there are some notable exceptions. Professors Chu Joo-Tso, Li Feng-Swen and Chin Shin-Foon [=Zhao Shan-Huan] were among the earlier pioneers of braconid studies for the region, particularly on the natural enemies (parasitoids) of agricultural pests and their application for biological control. During the period 1933–1937, Chu published a series of papers on the parasitoids of agricultural and forestry pests, such as Parnara guttata (Bremer & Grey), Pieris rapae L., Dendrolimus punctatus Walker, and the insect pests of mulberry (e.g. Chu 1934, 1937). Li (1935) reported on the parasitoids of cotton pests, while Chin (1937) focused on the parasitoids of one of the insect pests of rice, Scirpophaga incertulas (Walker). A number of braconid species are mentioned in each of these studies. However, the earliest works on the taxonomy of Chinese braconids are Chu’s papers ‘Preliminary notes on the ichneumon-flies in Kiangsu and Chekiang Provinces, China’ (Chu 1935) and ‘Notes on Cheloninae of China...’ (Chu 1936). During the 1940’s to 1960’s, little work was undertaken on the Braconidae of China. However, two authors who published during this time deserve mentioned. One is Professor Hsich Sun-Yun

328


The Family Braconidae in China (Hymenoptera) 329

[=Xia Songyun], who continued his preliminary work on parasitic Hymenoptera attacking important pests of rice in Hunan Province, reporting many species of braconids, especially of the genus Apanteles Foerster s.l. (Hsich 1957). The other is Professor Chao Hsiu-Fu [=Zhao Xiufu], who worked on the genera Spathius Nees and Platyspathius Viereck (Doryctinae) (Chao 1957; Chao & Chen 1965) and continued these studies into the 1970’s (Chao 1977, 1978). It was during the 1970’s that research on biological control, and associated studies on braconids and other groups of parasitic Hymenoptera, began in earnest. In the early part of this decade, Chu and He published a series of four papers dealing with the identification of parasitoids of rice pests, two of them dealing with the common species of Braconidae (Chu & He 1973; Chu et al. 1976). In 1978, the ‘Atlas of Natural Enemies of Economic Insects’ was compiled by the Institute of Zoology, Academia Sinica, Zhejiang Agricultural University, etc. This was the first publication that enabled workers to identify common natural enemies in China, and it included 40 species of braconids. Soon after the book ‘Atlas of Natural Enemies of Rice Pests in Zhejiang Province, China’ edited by He (1979) was published. During this time and into the early 1980’s several other provinces put out similar publications dealing with natural enemies. Concurrently, a large number of individual papers on the biology of natural enemies appeared. In 1986 a general book ‘Atlas of Natural Enemies of Rice Pests in China’ edited by He and Pang (1986) appeared. As a result of these publications substantial information on the common species of natural enemies, both parasitoids and predators, was documented that greatly encouraged systematic studies, including those of braconids. In 1973, a meeting sponsored by the Academia Sinica was held to plan and coordinate studies on the biology and taxonomy of the fauna and flora of China. In 1986, this led to the project ‘Economic Insect Fauna of China: Hymenoptera-Braconidae’, headed by Professor He Junhua and sponsored by the Academia Sinica. In 1992 this project became a sub-project called ‘Fauna of China: InsectaHymenoptera-Braconidae (I)’ of the key project ‘Fauna of China’ sponsored by China National Science Foundation during the period of the 8th Five-Year-Plan. Since the resumption of recruiting graduate students in 1978 to undertake advanced studies on biological control and insect systematics, several students were enrolled for Masters and PhD’s to work on the systematics of parasitic Hymenoptera. Subsequently, the first Master and PhD degrees on the taxonomy of the Braconidae were conferred in 1987 and 1994, respectively at Zhejiang University. Coincident with an increased focus on the taxonomy and biology of parasitic Hymenoptera, was the growth and development of collections. The Zoological Institute of the Academia Sinica, Fujian Agricultural University, the Taiwan Agricultural Research Institute, and the Zhejiang University are the four leading institutions which have built up collections of Chinese parasitic Hymenoptera. The total number of pinned specimens in these four collections probably exceeds two million. The Shanghai Institute of Entomology, the Hunan Agricultural University in Changsa, the Northwestern Agricultural University in Xi’an, the Zhongshan University in Guangzhou, and the Henan Agricultural University in Zhengzhou also have moderately large collection of parasitic Hymenoptera.

Institutions and Individuals Currently, the following persons and institutions are involved in the study of the Braconidae in China: He Junhua and Chen Xuexin at the College of Agriculture and Biological Technology, Zhejiang University (Huajiachi Campus) in Hangzhou (previously called the Zhejiang Agricultural University from 1952 to 1998); Chao Hsiu-Fu, Chen Jiahua and Wu Zhishan at

Chen Xuexin, He Junhua & Ma Yun 330


the Fujian Agricultural University in Fuzhou; and You Lanshao at the Hunan Agricultural University in Changsa. The Parasitic Hymenoptera Research Center at Zhejiang University started as the Entomological Bureau of Zhejiang Province where Professor Chu Too-tsu begun studies on the Braconidae in the 1930’s. It now holds a collection of about 250 000 pinned specimens of parasitic Hymenoptera from all parts of China, plus as many specimens again in alcohol, and more than 600 identified species from other regions of the world. Chu was the founder of this center and served as a professor until 1981 when he passed away. He Junhua is the second professor at this institution and is still actively involved in the study of parasitic Hymenoptera, including Braconidae after he completed the monograph ‘Economic Insect Fauna of China: Hymenoptera-Ichneumonidae’ in 1993 (He 1996). Chen Xuexin is currently in charge of the sub-project ‘Fauna of China: InsectHymenoptera-Braconidae (II)’ of the project ‘Fauna of China’ which commenced in early 1998 during the 9th Five-Year-Plan.

Present Status of Each Group During the period 1987 to 1992 Chen and He published a series of papers on the genus Aleiodes Wesmael (Rogadinae). From 1992 onwards they have conducted work on rogadines supported by the National Science Foundation of China, the results of which were published in a monograph of the group which treats 19 genera and 116 species (Chen & He 1997). Quicke et al. (1997) reviewed the species of Yelicones Cameron for the East Palaearctic and Oriental regions, in which all the Chinese species were included. Two genera, Pentatermus Hedquist and Aulosaphes Muesebeck (including Aulosaphoides van Achterberg) (Lysiterminae) were reviewed by He and Chen (1995) and Chen et al. (1996b), respectively, while Chen et al. (1995) revised Acanthormius Ashmead. The large genus Macrocentrus Curtis (Macrocentrinae) has been studied by numerous Chinese authors prior to 1997 (You & Luo 1988; He & Lou 1993; He et al. 1996; Chen et al. 1997b). He and van Achterberg (1994) reviewed the Chinese species Aulacocentrum Ashmead and He et al. (1996) reported on the Chinese species of Rectizele van Achterberg. The small subfamily Sigalphinae is represented in China by two widely distributed genera, Acampsis Wesmael and Sigalphus Latreille. He and Chen (1992) studied the former genus while He and Chen (1993), He et al. (1994) and You et al. (1991) revised the latter. Only the nominal tribe of the Homolobinae, represented by the near cosmopolitan genus Homolobus Foerster, has been treated for China (Chen 1991; Chen et al. 1991; Chou & Hsu 1995). Chou and Hsu (1995) and Chen et al. (1996a) studied the small genus Charmon Haliday (Charmontine) and described four species from China. Two species of Distilirella van Achterberg (Xiphozelinae) were reported by He (1985) and Chou and Hsu (1995), and one species of Xiphozele Cameron by You et al. (1990). He et al. (1997a) described the new genus Sinoneoneurus from China which belongs to the somewhat aberrant subfamily Neoneurinae. Papp and Chou (1996) and Chen et al. (1997a) studied the Miracinae, reporting two new species of Centistidea Rohwer and Mirax Haliday, respectively. Of the three tribes of Ichneutinae, only the Ichneutini have been studied for China. He et al. (1997b) described three new species of Ichneutes Nees and one species of Pseudichneutes Belokobylskij. Chou and Lee (1991) and He and Chen (1996) studied two genera of Cenocoeliinae, Cenocoelius Haliday and Rattana van Achterberg, respectively.


The results of the above studies have been compiled into a single monographic treatment entitled ‘Fauna of China: Insecta, Hymenoptera, Braconidae (I)’, the publication of which is imminent (He et al. 2000). This work represents the first comprehensive book dealing with the systematics of Chinese braconids. It provides a general account of the morphology, biology, history of study, phylogeny and biogeography of Chinese braconids, and a key to subfamilies. The taxonomic part covers 13 subfamilies (i.e. Rogadinae, Lysiterminae, Miracinae, Neoneurinae, Ichneutinae, Adeliinae, Charmontinae, Macrocentrinae, Cenocoeliinae, Meteorideinae, Sigalphinae, Homolobinae and Xiphozelinae) and treats 49 genera (one of which is described as new) and over 296 species (77 of which are new). This work presents a major part of the sub-project of the ‘Fauna of China’ (see above). Among the remaining subfamilies not covered by He et al. (2000), little comprehensive taxonomic research has been conducted for China, with the exception of the Euphorinae, Helconinae (Bruleiini) and Alysiinae (Alysiini). There were 10 genera and 69 species of Euphorinae known from China prior to 1997. Among these, Aridelus Marshall and Streblocera Westwood have been relatively well-studied (Chao 1964, 1993; Chen & van Achterberg 1997), while Chou (1986) treated a species of Chrysopophthorus Goidanich, Papp and Chou (1995) three species of Wesmaelia Foerster from Taiwan, and Yang (1996) two species of Cosmophorus Ratzeburg from mainland China. In 1997, Chen and van Achterberg published a revision of the Euphorinae for China, which included 24 genera and 150 species. However, the Meteorini, an important group including parasitoids of many agricultural lepidopteran pests, was not included in this work and the group remains largely unworked, except for Zele Curtis which has been revised for mainland China (Chen et al. 1987) and Taiwan (Chou & Chou 1993b). The genus Meteorus Haliday has yet to be revised, however He (1982) provides notes on four common species while Wang (1984b) has described a new species. Both the Opiinae and Alysiinae, important parasitoids of pest Diptera are poorly known for China. However, the Alysiini was recently studied by Chen and Wu (1994), who cover 101 species in 19 genera, while Wharton and Chou (1983, 1985) have revised Heratemis Walker and Alloea Haliday from Taiwan. You Lanshao and colleagues have studied the microgastrine genus Apanteles s.l. (i.e. sensu Nixon 1965), and have described a number of new species and recorded others from China for the first time (e.g. You & Xiong 1983; You et al. 1985, 1987, 1994). You et al. (1988) published a list of 60 Apanteles species recorded from China and reviewed previous work on the genus. Unfortunately, they failed to include many species, even some previously described by themselves, and so the work is of only limited use. Chen et al. (1994) revised Fornicia Brullé, describing five new taxa, and Chou (1985b) described a new species of Buluka De Saeger. However, the Microgasterinae of China remains poorly studied and is in urgent need of taxonomic attention. The Helconinae of mainland China has only been studied for the subtribe Bruleiina (Bruelliini) (Chen et al. 1993), but recently Chou and Hsu (1998) have dealt with the Taiwanese species. Since Chu’s early work on Chinese Cheloninae in the 1930’s, little has been done since then on this subfamily. Tang and Marsh (1994) reviewed the species of Ascogaster Wesmael, while He et al. (1994, 1997c) described a new genus, Siniphanerotomella, and a new subgenus of Chelonus Panzer. Likewise, the Doryctinae of China are poorly known, with work on Spathius (and Platyspathius) by Chao Hsiu-Fu (1957, 1977) and on Zombrus Marshall by He and Ma (1982) being the only published studies on this subfamily. Chou (1995) has covered the species of



Cardiochilinae from Taiwan, and Chen et al. (1998) have reviewed the genus Hartemita Cameron from China, but again this group requires study. Two large subfamilies that remain poorly are the Agathidinae and Braconinae. Wang (1984a) described a species each from Gyrochus Enderlein and Isoptronotum Enderlein (Agathidinae), and Yang (1996) has described several species of Coeloides Wesmael (Braconinae). Liang-Yih Chou has been undertaking a systematic treatment of the Taiwanese fauna since the late 1970’s, and because of his work and the much smaller size of the region, the Braconidae of Taiwan is better known than that of mainland China. To present he has published a series of eight papers covering 11 subfamilies (Chou 1981-1995; Chou & Sharkey 1989; Chou & Lee 1991; Chou & Chou 1991, 1993a, 1993b; Chou & Hsu 1995, 1996, 1998; Papp & Chou 1996). In total, 440 species are known from Taiwan as follows: Agathidinae (38), Alysiinae (14), Aphidiinae (36), Betylobraconinae (1), Blacinae (10), Braconinae (28), Cardiochilinae (5), Cenoceliinae (4), Charmontinae (1), Cheloninae (27), Doryctinae (44), Euphorinae (51), Exothecinae (11), Helconinae (42), Histeromerinae (1), Homolobinae (11), Hormiinae (7), Lysiterminae (5), Macrocentrinae (4), Microgastrinae (45), Miracinae (3), Neoneurinae (1), Opiinae (11), Orgilinae (18), Pambolinae (2), Rogadinae (18) and Xiphozelinae (2) (Chou pers. comm.).

Studies on Biology, Ecology and Biological Control As discussed above, a nationwide survey of natural enemies of insect pests of major crops in China was initiated in 1978. Rice being the most important crop in China has been extensively surveyed for natural enemies and this has resulted in numerous publications. The following are pests from which braconid parasitoids have been investigated: rice stem borers [Chilo suppressalis Walker, Scrirpophage incertulas (Walker), Sesamia inferens (Walker)), rice leaf folder (Cnaphalocrocis medinalis Guenée), green rice caterpillar (Naranga aenescens Moore), rice skippers (Parnara spp.), Mycalesis gotama Moore, and rice leaf beetle (Oulema aryzae (Kuwayama)] (e.g. Hsich 1957; He 1979; He & Pang 1986). The natural enemies of major insect pests of cotton [such as Pectinophora gossypiella (Saunders) (e.g. Li 1935)], forests (such as pine caterpillars, Dendrolimus spp. and Lymantira dispar L.) (e.g. Yang 1996), citrus, apples, tea trees, and vegetables have also been moderately well-studied. Numerous studies on the biology, ecology and application of braconids in biological control have also been undertaken in China. For example, Ontsira palliatus (Cameron) has been widely studied and used extensively to control a range of hosts, mainly species of Cerambycidae (Coleoptera), including Semanelus sinoauster (Gressitt), Stromaltum lingicorna (Neumman), Monochamus alternatus Hope, Callidium villosulum Fairmaire, Xystrocera globosa (Olivier), Saperda populnea (L.) and Anoplophora chinensis Foerster, all of them being major pests of fruit trees and timber in China. Innundative release of O. palliatus has been used for many years and inoculative release has been conducted in several southern provinces. In the last decade, the cotton bollworm, Helicoverpa armigera (Hübner) has became the major pest in the cotton-cultivated area of northern China. This insect is attacked by a number of parasitoids, including five species of Microplitis, viz. M. mediator (Haliday), M. tuberculifer (Wesmael), M. erythrogaster Abdinbekova, and two undescribed species. Among them, one of the new species is dominant in attacking young larvae, and several studies have been conducted on its biology and ecology, and potential as a control agent. Leucania separata Walker is used as a host in the laboratory for this parasitoid after a set of techniques for its mass rearing were


developed, and the inoculative release of this braconid has been carried out in some provinces for several years. The following are some more important braconids that have been well investigated, some of which have been used as biological control agents. They are Cotesia glomerata (L.) and C. rubecula (Marshall) on cabbage worm (P. rapae); Cotesia plutellae (Kurdjumov) on Plutella xylostella L.; Macrocentrus cingulum Bricchke (misidentified as M. linearis (Nees)) on Onstrinia furnacalis Guenée; Bracon greeni Ashmead on Eublemma amabilis Moore; Amyosoma chinensis (Szépligeti), Bracon onukii Watanabe and Chelonus munakatae Matusmura on rice stem borers; Apanteles cypris Nixon on Cnaphalocrocis medinalis Guenée; Aleiodes narangae (Rohwer) on Naranga aenescens Moore; Bracon isomera (Cushman), B. nigrorufum (Cushman) on P. gossypiella; Habrobracon hebetor Say on Sitotroga cereatella Olivier (as well as Cadra cautella Walker and Plodia interpunctella Hübner); Aleiodes esenbeckii (Hartig) on Dendrolimus spp.; Meteorus rubens Nees on Agrotis spp.; Cotesia kariyai (Watanabe) on L. separata, and Cotesia ruficrus (Haliday) on a number of lepidopteran pests.

Acknowledgements We wish to thank Dr Kees van Achterberg, National Museum of Natural History, Leiden for his critical reading of the manuscript . The first author would also like to thank Dr Andy Austin, University of Adelaide for his help with arrangements to visit Canberra in January 1999 which was supported by a grant from China National Science Foundation (Grant No. 39810212021-Co2).

References Chao, H. F. (1957) On south-eastern Chinese braconid-flies of the subfamily Spathinae (Braconidae). Journal of Fujian Agricultural College 4: 1-18. [in Chinese with English summary] Chao, H. F. (1964) Descriptions of four new species of braconid wasps of the genus Streblocera Westwood (Hymenoptera). Acta Zootaxonomia Sinica 1: 153-162. [in Chinese with English summary] Chao, H. F. (1977) A study on Chinese braconid wasps of the tribe Spathini (Hymenoptera: Braconidae: Doryctinae). Acta Entomologia Sinica 20: 205-216. [in Chinese with English summary] Chao, H. F. (1978) A study on Chinese braconid wasps of the tribe Spathini (Hymenoptera: Braconidae: Doryctinae) [cont.]. Acta Entomologia Sinica 21: 173-184. [in Chinese with English summary] Chao, H. F. (1993) Two new species and synonyms of known species of Streblocera Westwood from Fujian province, China (Hymenoptera: Braconidae: Euphorinae). Wuyi Science Journal 10: 61-69. Chao, H. F. & Chen, J. H. (1965) A new species of the genus Spathius Nees (Hymenoptera: Braconidae) from Fujian province, China. Acta Zootaxonomia Sinica 2: 106-108. [in Chinese with English summary] Chen, X. X. (1991) A new species of the genus Homolobus Foerster from China, with a checklist of the Chinese species (Hym.: Braconidae). Entomologische Berichten 51: 47-49. Chen, X. X. & He, J. H. (1997) Revision of the subfamily Rogadinae (Hymenoptera: Braconidae) from China. Zoologische Verhandelingen 308: 1-187.



Chen, X. X., He, J. H. & Ma, Y. (1987) Five new records of species of Zele Curtis (Hymenoptera: Braconidae: Meteorinae) from China. Wuyi Science Journal 7[1990]: 94-96. [in Chinese with English summary] Chen, X. X., He, J. H. & Ma, Y. (1991) The genus Homolobus Foerster (Hymenoptera: Braconidae) of China. Acta Agriculturae Universitatis Zhejiangensis 17: 192-196. [in Chinese with English summary] Chen, X. X., He, J. H. & Ma, Y. (1994) Five new species of the genus Fornicia Brullé (Hymenoptera: Braconidae) from China. Entomotaxonomia 16: 127-134. [in Chinese with English summary] Chen, X. X., He, J. H. & Ma, Y. (1995) Hymenoptera: Braconidae. pp .256-263. In: Insects and Mushrooms of Mt. Gutian Nature Reserve, Zhejiang, China. Zhejiang Science and Technology Publishing House, Hangzhou. [in Chinese with English summary] Chen, X. X., He, J. H. & Ma, Y. (1996a) The genus Charmon Haliday (Hymenoptera: Braconidae: Charmontinae) from China. Entomotaxonomia 18: 59-64. [in Chinese with English summary] Chen, X. X., He, J. H. & Ma, Y. (1996b) The genus Aulosaphes Muesebeck (Hymenoptera: Braconidae: Lysiterminae) from China. Entomotaxonomia 18: 223-229. [in Chinese with English summary] Chen, X. X., He, J. H. & Ma, Y. (1997a) Two new species of the subfamily Miracinae (Hymenoptera: Braconidae) from China. Wuyi Science Journal 13: 63-69. Chen, X. X., He, J. H. & Ma, Y. (1997b) Hymenoptera: Braconidae. pp. 1647-1668. In Insects of the Three Gorge Reservoir Area of Yangtze River, China. Chongqing Press. [in Chinese with English summary] Chen, X. X., He, J. H. & Ma, Y. (1998) Revision of the genus Hartemita Cameron (Hymenoptera: Braconidae: Cardiochilinae) from China. Entomotaxonomia 20: 208-218. Chen, X. X., He, J. H. & van Achterberg, C. (1993) A revision of the subtribe Brulleiina van Achterberg (Hym.: Braconidae: Helconinae) from China. Zoologische Mededelingen 67: 375-395. Chen, X. X. & van Achterberg, C. (1997) Revision of the subfamily Euphorinae (Hymenoptera: Braconidae) from China. Zoologische Verhandelingen 311: 1-217. Chen, J. H. & Wu, Z. S. (1994) The Alysiini of China (Hymenoptera: Braconidae: Alysiinae). China Agriculture Press, Beijing. [in Chinese with English summary] Chin, S. F. (1937) Notes on the natural enemies of the paddy borer, Schoenobius incertellus Walker in Canton with a list its natural enemies in the world. Entomology & Phytopathology 5: 442-457. Chou, L. Y. (1981a) A preliminary list of Braconidae (Hymenoptera) of Taiwan. Journal of Agricultural Research China 30: 71-88. Chou, L. Y. (1981b) The genera of Aphidiidae (Hymenoptera: Ichneumonidae) in Taiwan. Journal of Agricultural Research China 30: 308-323. Chou, L. Y. (1985a) A new species of Neoneurinae (Hymenoptera: Braconidae) from Taiwan. Journal of Agricultural Research China 30: 477-480. Chou, L. Y. (1985b) A new species of Buluka (Hymenoptera: Braconidae) from Taiwan. Chinese Journal of Entomology 5: 85-88. Chou, L. Y. (1986) A new species of Chrysopophthorus from Taiwan (Hymenoptera: Braconidae). Chinese Journal of Entomology 6: 215-217. Chou, L. Y. (1987) The genus Aridelus of Taiwan (Hymenoptera: Euphorinae). Taiwan Agricultural Research Institute Special Publication 22: 19-39. Chou, L. Y. (1990) The Braconidae (Hymenoptera) of Taiwan, II. The genus Streblocera (Euphorinae). Journal of the Taiwan Museum 43: 89-148.


Chou, L. Y. (1995) The Braconidae (Hymenoptera) of Taiwan. V. Cardiochilinae and Orgilinae. Journal of Agricultural Research China 44: 174-220. Chou, L. Y. & Chou, K. C. (1991) The Braconidae (Hymenoptera) of Taiwan. IV. Histeromerinae. Journal of Agricultural Research China 40: 472-474. Chou, L. Y. & Chou, K. C. (1993a) A new species of Trioxys (Hymenoptera: Braconidae) from Taiwan. Chinese Journal of Entomology 13: 375-378. Chou, L. Y. & Chou, K. C. (1993b) The genus Zele of Taiwan (Hymenoptera: Braconidae). Journal of Agricultural Research China 42: 446-448. Chou, L. Y. & Hsu, T. C. (1995) The Braconidae (Hymenoptera) of Taiwan. VI. Charmontinae, Homolobinae and Xiphozelinae. Journal of Agricultural Research China 44: 357-378. Chou, L. Y. & Hsu, T. C. (1996) The Braconidae (Hymenoptera) of Taiwan. VII. Subtribe Triaspina. Journal of Agricultural Research China 45: 436-497. Chou, L. Y. & Hsu, T. C. (1998) The Braconidae (Hymenoptera) of Taiwan. VIII. Brulleiini, Diospilini and Helconini. Journal of Agricultural Research China 47: 283-314. Chou, L. Y. & Lee, P. P. (1991) The Braconidae (Hymenoptera) of Taiwan, III. Cenocoeliinae. Chinese Journal of Entomology 11: 49-57. Chou, L. Y. & Sharkey, M. J. (1989) The Braconidae (Hymenoptera) of Taiwan. I. Agathidinae. Journal of the Taiwan Museum 42: 147-223. Chu, J. T. (1934) An investigation on the parasites of Parnara guttatus Brem. from Hangchow. Entomology & Phytopathology 2: 662-663. Chu, J. T. (1935) Preliminary notes on the ichneumon flies in Kiangsu and Chekiang Provinces China. Yearbook of the Bureau of Entomology of Chekiang Province 4, 7: 32. Chu, J. T. (1936) Notes on Cheloninae of China, with description of a new species. (Hymen., Braconidae). Entomology & Phytopathology 4: 682-685. Chu, J. T. (1937) Notes on the hymenopterous parasites of the pine caterpillar Dendrolimus punctatus Walker in China. Entomology & Phytopathology 5: 56-103. Chu, J. T. & He, J. H. (1973) The identification of common parasitic wasps on the rice stem borers from China (I) – Braconidae. Utilization and Control of Animal 1973 (3): 9-14. Chu, J. T., He, J. H. & Yun, J. X. (1976) The Notes of parasitic wasps on the green rice caterpillar Naranga aenescerns Moore from China (I) – Braconidae. Kunchong Zhishi (Entomological Knowledge) 13: 145-147. He, J. H. (Ed.) (1979) Atlas of Natural Enemies of Rice Pests in Zhejiang Province, China. Zhejiang People’s Publishing House. [in Chinese] He, J. H. (1982) Four common species of Meteorus in China. Kunchong Zhishi (Entomological Knowledge) 19: 31-34. [in Chinese] He, J. H. (1985) Description of a new species of Distrilirella van Achterberg (Hymenoptera: Braconidae). Acta Agriculturae Universitatis Zhejiangensis 11: 327-329. [in Chinese with English summary] He, J. H. & Chen, X. X. (1992) The genus Acampsis Wesmael (Hymenoptera: Braconidae: Sigalphinae) from China. Entomotaxonomia 14: 217-221. [in Chinese with English summary] He, J. H. & Chen, X. X. (1993) The genus Sigalphus Latreille (Hymenoptera: Braconidae: Sigalphinae) from China. Acta Entomologica Sinica 36: 90-93. [in Chinese with English summary] He, J. H. & Chen, X. X. (1995) One new species of the genus Pentatermus Hedqvist (Hymenoptera: Braconidae: Lysiterminae) from China. Entomotaxonomia 17: 225-227. [in Chinese with English summary]



He, J. H. & Chen, X. X. (1996) One new species of the genus Rattana van Achterberg (Hymenoptera: Braconidae: Cenocoeliinae) from China. Entomotaxonomia 18: 219-222. [in Chinese with English summary] He, J. H., Chen, X. X. & Ma, Y. (1989) The braconid (Hymenoptera) parasites of Adoxophyes oana Fischer von Rosbergstamm (Lepidoptera: Tortricidae) from China. Acta Agriculturae Universitatis Zhejiangensis 15: 437-439. [in Chinese with English summary] He, J. H., Chen, X. X. & Ma, Y. (1994) Revision of the Sigalphus species from China with descriptions of two new species (Hymenoptera: Braconidae: Sigalphinae). Journal of Zhejiang Agricultural University 20: 441-448. He, J. H., Chen, X. X. & Ma, Y. (1996) Five new records of species of Macrocentrus Curtis (Hymenoptera: Braconidae) from China. Entomotaxonomia 18: 77-78. [in Chinese with English summary] He, J. H., Chen, X. X. & Ma, Y. (2000) Fauna of China: Insecta,Hymenoptera, Braconidae (I). Science Press, Beijing (in press). [in Chinese with English summary] He, J. H., Chen, X. X. & van Achterberg, C. (1994) Siniphanerotomella gen. nov., a new genus of the subfamily Cheloninae Nees (Hymenoptera: Braconidae) from China. Zoologische Mededelingen 68: 191-195. He, J. H., Chen, X. X. & van Achterberg, C. (1997a) One new genus of the subfamily Neonurinae (Hymenoptera: Braconidae) from China. Wuyi Science Journal 13: 70-75. He, J. H., Chen, X. X. & van Achterberg, C. (1997b) Five new species of the subfamily Ichneutinae (Hymenoptera: Braconidae) from China. Zoologische Mededelingen 71: 9-23 He, J. H., Chen, X. X. & van Achterberg, C. (1997c) Scarichelonus, a new subgenus of the genus Chelonus Panzer (Hymenoptera: Braconidae) from China. Zoologische Mededelingen 71: 5356. He, J. H., Chen, X. X., Zhou, Z. H. & Liu, Z. B. (1990) Two new records of species of Braconidae (Hymenoptera) parasitic on rice insect pests from China. Acta Agriculturae Universitatis Zhejiangensis 16: 217. [in Chinese with English summary] He, J. H. & Lou, X. M. (1993) Description of a new species of Macrocentrus Curtis parasitic on Cnaphalocrocis medinalis Guenée (Hymenoptera: Braconidae: Macrocentrinae). Entomological Journal of East China 2: 12-16. [in Chinese with English summary] He, J. H., Lou, X. M. & Ma, Y. (1996) Notes on Rectizele van Achterberg from China (Hymenoptera: Braconidae: Macrocentrinae). Journal of Zhejiang Agricultural University 22: 33-36. [in Chinese with English summary] He, J. H. & Ma, Y. (1982) Two common species of the genus Zombrus (Braconidae) from China. Insect Natural Enemies 4: 18-19. [in Chinese] He, J. H. & Pang, X. F. (Eds) (1986) Atlas of Natural Enemies of Rice Pests in China. Shanghai Science and Technology Publishing House. [in Chinese] He, J. H. & van Achterberg, C. (1994) A revision of the genus Auloacocentrum Brues (Hymenoptera: Braconidae: Macrocentrinae) from China. Zoologische Mededelingen 68: 159-171. Hsich, S. Y. (1957) Preliminary notes on parasitic Hymenoptera (Hymenoptera, Parasitica) attacking important pests of rice in the province of Hunan, China. Acta Entomologia Sinica 7: 295-319. Institute of Zoology of Academia Sinica, Zhejiang Agricultural University, ect. (1978) Atlas of Natural Enemies of Economic Insects. Science Press, Beijing. [in Chinese] Li, F. S. (1935) A list of the parasitic and predacious insects of cotton pests in Kiangsu and Chekiang. Entomology & Phytopathology 3: 304-307. Nixon, G. E. J. (1965) A reclassification of the tribe Microgasterini (Hymenoptera: Braconidae). Bulletin of the British Museum (Natural History), Entomology Supplement 2: 1-288.


Papp, J. & Chou, L. Y. (1995) The genus Wesmaelia Foerster of Taiwan (Hymenoptera: Braconidae: Euphorinae). Chinese Journal of Entomology 15: 345-354. Papp, J. & Chou, L. Y. (1996) The genus Mirax from Taiwan (Hymenoptera: Braconidae: Miracinae). Chinese Journal of Entomology 16: 107-115. Quicke, D. L. J., Chishti, M. J. K., Chen, X. X. & Kruft, R. A. (1997) Revision of Yelicones (Hymenoptera: Braconidae: Rogadinae) from the East Palaearctic and Oriental regions with descriptions of four new species. Journal of Natural History 41: 779-797. Shenefelt, R. D. (1969) Braconidae 1. Hymenopteroeum Catalogus 4: 1-176. Dr W. Junk N. V., 'sGravenhage. Shenefelt, R. D. (1970) Braconidae 2. Hymenopteroeum Catalogus 5: 177-306. Dr W. Junk N. V., 's-Gravenhage. Shenefelt, R. D. (1971) Braconidae 3. Hymenopteroeum Catalogus 6: 307-428. Dr W. Junk N. V., 's-Gravenhage. Shenefelt, R. D. (1972) Braconidae 4. Hymenopteroeum Catalogus 7: 429-668. Dr W. Junk N. V., 's-Gravenhage. Shenefelt, R. D. (1973) Braconidae 5. Hymenopteroeum Catalogus 9: 669-812. Dr W. Junk N. V., 's-Gravenhage. Shenefelt, R. D. (1973) Braconidae 6 Hymenopteroeum Catalogus 10: 813-936. Dr W. Junk B. V., 's-Gravenhage. Shenefelt, R. D. (1974) Braconidae 7. Hymenopteroeum Catalogus 11: 937-1114. Dr W. Junk B. V., 's-Gravenhage. Shenefelt, R. D. (1975) Braconidae 8. Hymenopteroeum Catalogus 12: 1115-1262. Dr W. Junk B. V., 's-Gravenhage. Shenefelt, R. D. (1978) Braconidae 10. Hymenopteroeum Catalogus 15: 1425-1872. Dr W. Junk B. V., The Hague. Shenefelt, R. D. & Marsh, P. M. (1976) Braconidae 9. Hymenopteroeum Catalogus 13: 1263-1424. Dr W. Junk B. V., 's-Gravenhage. Tang, Y. Q. & Marsh, P. M. (1994) A taxonomic study of the genus Ascogaster in China (Hymenoptera; Braconidae: Cheloninae). Journal of Hymenoptera Research 3: 279-302. Wang, J. Y. (1984a) Two new species of the subfamily Agathidinae from China (Hymenoptera: Braconidae). Acta Zootaxonomia Sinica 9: 151-154. [in Chinese with English summary] Wang, J. Y. (1984b) A new species of the genus Meteorus Haliday from Sichuan province (Hymenoptera: Braconidae). Acta Zootaxonomia Sinica 9: 321-323. [in Chinese with English summary] Wharton, R. A. and Chou, L. Y. (1983) The genus Heratemis Walker, with a review of the Taiwanese species (Hymenoptera: Braconidae). Journal of the Taiwan Museum 36: 7-13. Wharton, R. A. and Chou, L. Y. (1985) Revision of the species of Alloea Haliday (Hymenoptera: Braconidae, Alysiinae). Journal of Agricultural Research. China 34: 352-367. Yang, Z. Q. (1996) Parasitic Wasps on Bark Beetles in China. Science Press, Beijing. You, L. S. & Luo, H. W. (1988) New records of the genus Macrocentrus Curtis from China. Journal of Hunan Agricultural College 14: 37-38. [in Chinese] You, L. S., Quicke, D. L. & Zhou, Z. H. (1994) Notes on eighteen braconid species (Hymenoptera: Braconidae) from China. Wuyi Science Journal 11: 120-125. [in Chinese] You, L. S. & Xiong, S. L. (1983) Two new species of Apanteles Foerster (Hymenoptera: Braconidae) from China. Entomotaxonomia 5: 225-229. [in Chinese with English summary] You, L. S., Xiong Shulin & Wang, Z. D. (1988) Annotated list of Apanteles Foerster (Hymenoptera: Braconidae) from China. Entomologica Scandinavica 19: 35-42.



You, L. S., Xiong, S. L. & Zhou, Z. H. (1985) A new species of Apanteles Foerster (Hymenoptera: Braconidae) from China. Acta Zootaxonomia Sinica 10: 421-423. [in Chinese with English summary] You, L. S., Xiong, S. L. & Zhou, Z. H. (1987) On a new species of Apanteles Foerster from Yunnan province (Hymenoptera: Braconidae: Microgasterinae). Acta Zootaxonomia Sinica 12: 424426. [in Chinese with English summary] You, L. S., Zhou, Z. H. & Tong, X. W. (1990) Description of Xiphozele Cameron in Hunan and Guangxi (Hymenoptera: Braconidae). Journal of Hunan Agricultural College 16: 150-152. [in Chinese with English summary] You, L. S., Zhou, Z. H. & Tong, X. W. (1991) Two new species of the genus Sigalphus Latreille from Hunan province (Hymenoptera: Braconidae: Cheloninae). Acta Entomologia Sinica 34: 225229. [in Chinese with English summary]

An Annotated List of Encyrtidae (Hymenoptera: Chalcidoidea) of Tbilisi (Georgia) G. O. Japoshvili Institute of Zoology, Tbilisi, Republic of Georgia (email: [email protected])

Introduction Georgia is a relatively small mountainous country in the Caucasus which has a relatively rich flora and fauna. The region around the border city of Tbilisi has a particularly rich assemblage of insects. There are many species of economically important sucking insects viz. Coccoidea, Psylloidea and Aleyrodoidea, and a corresponding large number of parasitoids associated with them. The Encyrtidae is the most speciose group of parasitoids attacking scale and psyllid insects. In the Palaearctic there is aproximately 1260 described species of encyrtids, predominantly from southern regions (Trjapitzin 1989), and 248 species are known from the Caucasus (Trjapitzin & Doganlar 1997). This is a relatively rich fauna, given that only 50 species are known for Turkey, an area twice that of the Caucasus (Trjapitzin & Doganlar 1997). The aim of this investigation was to document the encyrtid species of Tbilisi, and record their insect hosts and associated host plants. The authors for all insect species are given in Table 1. The material was collected from 1994 to 1998 in different parts of Tbilisi, and voucher material is lodged in the Institute of Zoology, Tbilisi. Taxonomic concepts mostly follow Trjapitzin (1989) and Noyes and Woolley (1994).

Results and Discussion Table 1 presents a detailed list of the encyrtid species recorded from Tbilisi. Previously, there were only 20 encyrtid species recorded from Tbilisi, however the present study has expanded this to 42, including a new species, Psyllaephagus georgicus Yasnosh & Japoshvili (1999). In addition to the 22 new records, eight of these species are also new to the Caucasus. The most commonly collected species from Tbilisi were Blastothrix longipennis, B. nikolskajae, Cheiloneurus claviger, Encyrtus lecaniorum and Microterys sylvius; the other species being encountered more rarely. The extensive rearing undertaken during this study also allows a number of generalisations to be made about the host relationships of the recorded encyrtids. The majority of the 42 species have been recorded from a single host, with only five species being reared from multiple hosts (Table 1). Of the 27 host species listed, 17 only have a single species of encyrtid associated with them, while 10 have between two and five parasitoid species. For example, the coocid Sphaerolecanium prunastri has had four encyrtids reared from it at Tbilisi: Cerapterocerus mirabilis, Discodes coccophagus, Metablastothrix truncatipennis and Microterys hortulanus. Although the above results are comprehensive, given the timeframe of the study and extent of the rearings, it is also likely that additional encyrtid species and host associations will be documented for Tbilisi and the Caucasus as work continues in the future.

339

G.O. Japoshvili 340


Table 1 List of encyrtid species recorded from Tbilisi, with their insect host(s) and food plant(s) (nt = new record for Tbilisi; nc = new record for Caucasus; APH = Aphalaridae; AST = Asterolecaniidae; COC = Coccidae; DIA = Diaspididae; ER = Eriococcidae; KER = Kermesidae; PS = Pseudococcidae; PY = Psyllidae; TRI = Triozidae). Parasitoid

Host

Host Plant

Anagyrus pseudococci (Girault)

Planococcus ficus Signoret (PS)

Hedera, Ficus carica

Reference Yasnosh 1972

Anthemus funicularis (Bakkendorf)

Leucaspis loewi Colvee (DIA)

Pinus

nt/nc

Anthemus pini Ferriére

Leucaspis pusilla Löw (DIA)

Pinus

Trjapitzin 1968

Aphycoides clavellatus (Dalman)

Physokermes hemicriphus (Dalman) (COC)

Picea

nt

Blastothrix hungarica Erdös

Rhodococcus spiraeae Borchsenius (COC), Parthenolecanium persicae F. (COC)

Spiraea

Yasnosh 1972

Blastothrix longipennis Howard

Parthenolecanium corni Bouché (COC)

Acacia, Fraxinus, Cercis siliquastrum, Ulmus foliacea, Crataegus, Malus, Thelicranium australis, Corylus

nt

Blastothrix nikolskajae Sugonjaev

Parthenolecanium rufulum Cockerell (COC)

Spiraea

Yasnosh 1972

Blastothrix sp.nr nikolskaiae

Rhodococcus spiraeae

Spiraea

nt/nc

genus & sp. indet. nr Bureshiella Hoffer

Parthenolecanium corni

Cercis siliquastrum

nt/nc

Cerapterocerus mirabilis Westwood

Sphaerolecanium prunastri Fonscolombe (COC)

Prunus

nt; Japoshvili in press

Cheiloneurus claviger (Thomson)

Ceroplastes japonicus Green (COC) Rhodococcus spiraeae

Ilex, Spiraea

nt

Cheiloneurus kollari (Mayr)

Planchonia arabidis Signoret (AST)

Hedera

Yasnosh 1972

Cheiloneurus paralia (Walker)

Eriopeltis festucae Fonscolombe (COC)

Festucae, Arrenaterium elatius, Lolium

Trjapitzin 1968

Choreia maculata (Hoffer)

Eriopeltis festucae

Arrhenatherium elatius

Akhvlediani 1966

Discodes coccophagus (Ratszeburg)

Sphaerolecanium prunastri

Prunus


Encyrtus lecaniorum (Mayr)

Coccus hesperidum L. (COC)

Diospyros

nt

An Annotated List of Encyrtidae (Hymenoptera: Chalcidoidea) of Tbilisi (Georgia) 341

Epitetracnemus zetterstedtii (Westwood)

Lepidosaphes ulmi L. (DIA)

Populus tremula

Akhvlediani 1966

Hadzhibeylia physococci Myartseva & Trjapitzin

Ritsemia pupifera Lichtenstein (PS)

Ulmus foliacea

Myartseva & Trjapitzin 1981

Homalotylus quaylei Timberlake

Planococcus ficus

–

Trjapitzin 1968

Mahencyrtus coccidiphagus (Mercet)

Coccus hesperidum

Crataegus

nt/nc

Metablastothrix truncatipennis Ferriére


Prunus divaricata

nt/nc

Metaphycus asterolecanii (Mercet)

Asterodiaspis quercicola Bouché (AST) Parthenolecanium corni, Pulvinaria populi Signoret (COC)

–

Trjapitzin 1968

Fraxinus Populus transcaucasica, P. gracilis –

Yasnosh 1972

Metaphycus insidiosus (Mercet)

” ”

Metaphycus zebratus (Mercet)

Planchonia arabidis

Microterys clauseni Compere

Ceroplastes japonicus

Ilex, Laurus nobilis, Hedera

nt; Yasnosh & Japoshvili 1998

Microterys duplicatus (Nees)

Parthenolecanium corni

Cercis siliquastrum

nt

Microterys ferrugineus (Nees)

Kermes roboris Fourcroy (KER)

Quercus

nt

Microterys hortulanus (Erdös)


Prunus


Microterys sylvius (Dalman)

Rhodoccus spiraeae

Spiraea

nt

Microterys tricoloricornis (De Stefani)

Coccus hesperidum

Hedera

Yasnosh 1972

Microterys trjapitzini Jasnosh

Acanthococcus aceris Signoret (ER)

Acer

Yasnosh 1969

Monodiscodes itermedius (Mayr)

Rhizopulvinaria armeniaca Borchsenius (COC)

Herniaria

Yasnosh 1972

Prionomitus mitratus (Dalman)

Psylla crataegi Schrunk (PY)

Crataegus

nt

Pseudaphycus phenacocci Jasnosh

Phenacoccus mespili (Signoret) (PS)

–

Yasnosh 1957

G.O. Japoshvili 342


Parasitoid

Host

Host Plant

Reference

Psyllaephagus bachardenicus Myartseva

Psylla ramnicola Scott (PY) Trioza magnisetosa Loginova (TRI) Trioza magnisetosa

Rhamnus pallasii, Elaeagnus angustifolia Elaeagnus angustifolia

nt/nc; Yasnosh & Japoshvili 1999

Psyllaephagus tokgaevi Myartseva Psyllaephagus georgicus Yasnosh & Japoshrili

Crastina tamaricina Loginova (APH) Trioza magnisetosa

Tamarix Elaeagnus angustifolia

Trichomasthus albimanus Thomson

Parthenolecanium corni Luzulaspis luzulae Dufour (COC) Planchonia arabidis Eriopeltis festucae Eriopeltis festucae

Prunus divaricata

Psyllaephagus sp. nr rubriscutellatus Myartseva

Trichomasthus cyaneus (Dalman) Trichomasthus ivericus Jasnosh

Gramineae

nt/nc; Yasnosh & Japoshvili 1999 nt/nc; Yasnosh & Japoshvili 1999 nt/nc; Yasnosh & Japoshvili 1999

Trjapitzin 1968; Yasnosh 1972 Trjapitzin 1968

Festucae Acanthococcus aceris

Yasnosh 1969 Acer

Zaomma lambinus (Walker)

Adiscodiaspis tamaricicola Malenotti (DIA)

Tamarix

nt

An Annotated List of Encyrtidae (Hymenoptera: Chalcidoidea) of Tbilisi (Georgia) 343

Acknowledgements The author wishes to thank Dr V. Yasnosh, Dr V. Trjapitzin and Dr E. Kvavadze for their help and advice during this project.

References Akhvlediani, M. (1966) Materials for the fauna of chalcids (Hymenoptera: Chalcidoidea) in East Georgia. Materials for fauna of Georgia. pp. 78-84 [in Russian]. Japoshvili G.O. (in press) On the population dynamics of the plum scale Spaerolecanium prunastri Fonscolombe (Coccoidea, Coccidae) in Georgia. Proceedings of VIII ISSIS. Wye College, University of London. Myartseva, S. N. & Trjapitzin, V. A. (1981) A new genus of encyrtids (Hymenoptera) from Georgia. Zoologichesky Zhurnal 60: 621-623 [in Russian]. Noyes, J. S. & Woolley, J. B. (1994) North American encyrtid fauna (Hymenoptera: Encyrtidae): taxonomic changes and new taxa. Journal of Natural History 28: 1327-1401. Trjapitzin, V. A. (1968) On the Encyrtidae fauna of Caucasus. Proceedings, All-Union Entomological Society (Leningrad) 52: 43-125 [in Russian]. Trjapitzin, V. A. (1989) Parasitic Hymenoptera of the Fam. Encyrtidae of Palaearctics. Leningrad “Nauka”, Leningrad division [in Russian]. Trjapitzin, V. A. & Doganlar, M. (1997) A review of encyrtids (Hymenoptera, Encyrtidae) of Turkey. Revue d’Entomologie de I’URSS 86: 213-222 [in Russian]. Yasnosh, V. A. (1957) New parasites (Hymenoptera: Aphelinidae, Encyrtidae) reared from Coccoidea in Georgia, Caucasus. Revue d’Entomologie de I’URSS 36: 715-720 [in Russian]. Yasnosh, V. A. (1969) New species of Ecyrtidae (Chalcidoidea) in Georgia. Zoologichesky Zhurnal 6: 931-935 [in Russian]. Yasnosh, V. A. (1972) Chalcids (Hymenoptera, Chalcidoidea) – parasites of coccids in arid forests of Georgia. Proceedings, All-Union Entomological Society (Leningrad) 55: 217-247 [in Russian]. Yasnosh, V. A. & Japoshvili, G. O. (1998) Japanese wax scale and natural enemies in Tbilisi. Bulletin of the Georgian Academy of Sciences 157: 132-134. Yasnosh, V.A. & Japoshvili, G.O. (1999) Parasitoids of the genus Psyllaephagus Ashmead (Hymenoptera: Chalcidoidea: Encyrtidae) in Georgia with the description of P. georgicus sp. nov. Bulletin of the Georgian Academy of Sciences 159: 516-519.


PART

7

Biological control


Predictive and Empirical Evaluation for Parasitoids of Bemisia tabaci (Biotype ‘B’), Based on Morphological and Molecular Systematics J. A. Goolsby1, M. A. Ciomperlik2, A. A Kirk4, W. A. Jones3, B. C. Legaspi, Jr.3, J.C. Legaspi5, R. A Ruiz2, D. C. Vacek2 and L. E. Wendel2 1

USDA-ARS, Australian Biological Control Laboratory, 120 Meiers Rd, Indooroopilly, QLD 4068 Australia (email: [email protected]) 2

USDA-APHIS-PPQ Mission Plant Protection Centre, P. O. Box 2140, Mission, TX 78573 USA

3

USDA-ARS, Beneficial Insects Research Unit, Weslaco, TX 78596 USA

4

USDA-ARS, European Biological Control Laboratory, Montpellier, France

5

Texas A & M University, Texas Agricultural Experiment Station, Weslaco, TX 78596 USA

Introduction In support of the United States Department of Agriculture (USDA) National Research and Action Plan for Management of silverleaf whitefly, the Animal and Plant Health Inspection Service (USDA-APHIS) collaborated with USDA, Agricultural Research Service (ARS), state departments of agriculture and universities to implement biological control strategies for Bemisia tabaci (Gennadius) (Biotype ‘B’) (Homoptera: Aleyrodidae) (= Bemisia argentifolii Bellows & Perring). As the primary quarantine facility in the USA for the importation of exotic natural enemies of the silverleaf whitefly, the USDA-APHIS-PPQ, Mission Plant Protection Centre (MPPC) in Texas processed over 80 shipments of predators, parasitoids and pathogens sent by collectors world-wide from 1992–1998. During this time period B. tabaci was a serious pest of vegetables, cotton and ornamentals across the United States subtropical growing areas and in greenhouses throughout the country. MPPC imported and cultured over 56 populations of Encarsia spp. and Eretmocerus spp. (both Aphelinidae), several of which were new species. Parasitoids were categorised in quarantine using RAPD-PCR and morphologically-based systematics. Integration of the two techniques proved to be useful in capturing the maximum amount of species diversity with a minimum amount of duplication in cultures. Additionally, the two methods were integrated for identifying indigenous and imported parasitoids in field evaluation efforts. A combination of predictive and empirical evaluation methods was developed which analysed the performance of the imported parasitoid species under laboratory, caged and free release conditions. This paper discusses the evaluation of multiple species in a large-scale classical biological control program, and how it was made possible by the integration of morphological and molecular systematics. We hope this program will serve as a model for future biological control programs. Evaluations of the parasitic Hymenoptera were performed in Texas, Arizona and California during 1994–96. The work done in Texas is the primary focus of this paper. Researchers in

347

J. A. Goolsby et al. 348


Arizona and California in collaboration with MPPC (Hoelmer 1998; Hoelmer et al. 1998; Pickett et al. 1999) conducted similar work. Evaluation of the various geographic strains or species of parasitoids studied at MPPC began in quarantine with an assessment of their fecundity on selected crop plants (Goolsby et al. 1996). Promising parasitoid populations were then reared and released onto these same crops in the field in order to measure rates of parasitism under field conditions (Goolsby et al. 1998). All species approved for release were further tested using free releases in an establishment evaluation. To determine if released populations became widely established, whitefly populations were sampled periodically during 1997–98 using the ‘sentinel plant’ technique for recruitment of parasitoids.

Quarantine Methods Identification of new organisms being imported is one of the critical functions of quarantine work. Separation of natural enemies into distinct taxa should occur as cultures are initiated. Characterisation of natural enemies in quarantine often requires a blend of observations of their morphology, mating behaviour, host plant associations, etc. Taxonomic keys may be available, but are often difficult to use with live material. In the Bemisia biological control program, taxonomic keys to the Eretmocerus Haldeman and Encarsia Foerster were not available for either the indigenous or imported species. Eretmocerus species indigenous to the southern United States and south-west desert were poorly understood but, based on biosystematic studies, were determined to be a complex of species (Hunter & Rose 1996). Foreign material arriving into quarantine showed extensive diversity, especially in the genus Eretmocerus (Legaspi et al. 1996; Goolsby et al. 1998). To best handle the issues of cryptic species, species complexes, and the need to initiate pure cultures representing the maximum available diversity of natural enemies, a unique quarantine protocol was developed which integrated biosystematics and molecular techniques. Foreign collections were categorised in quarantine by plant type, site location and the macrocharacters of the parasitic Hymenoptera and Aleyrodidae. Only parasitoids reared from individuals of the B. tabaci complex met the requirements for permitting, as stated in the Environmental Assessments of the genera Eretmocerus and Encarsia (APHIS 1995). Further, the imported species must have had a biology described as uniparental, biparental or autoparasitoid. Species which displayed obligate hyperparasitism of other taxa were not considered suitable for release (Hunter et al. 1996). The requirements of the Environmental Assessments were intended to identify the parasitoid species with the most specificity to the B. tabaci complex. Species which met these criteria were acceptable for processing using our quarantine protocol. Eretmocerus and Encarsia were separated into distinct groups using the morphology of the pupae and adult females. Individuals from each unique accession were immediately characterised at the MBCC Genetics Laboratory using RAPD-PCR with primers CO4 and A10 (Black et al. 1992; Vacek et al. 1996). Detailed methodology and representative electrophoretic gel patterns for Eretmocerus and Encarsia parasitoids are contained in Legaspi et al. (1996). Cohorts of the original parental material were sent to co-operating systematists. Information from the collaborating systematists and geneticists allowed for characterisation of quarantine material while the original parental cohort was still alive. Typically, material was characterised using both methods within two to three days after acceptance into quarantine. Unique parasitoid accessions were set up in pure cultures reared on the local B. tabaci with hibiscus var. kona pink, Hibiscus rosasinensis L. as the plant host. Duplicate accessions were combined or, in the later stages of the program, processed only for reference purposes. Representatives of all the accessions were cryogenically stored at the MPPC Genetics Laboratory, and vouchered at the Texas A&M University, Department of Ento-

Predictive and Empirical Evaluation for Parasitoids of Bemisia tabaci 349

mology Collection, College Station, Texas and the USDA-ARS, Systematic Entomology Laboratory, Washington, D. C. From 1992 to 1998, 235 accessions were processed, which resulted in 56 cultures of parasitic Hymenoptera, 17 of which were determined to be distinct species (Appendix 1). Some species were widely distributed in the Old World, such as Eretmocerus mundus Mercet, and displayed the same RAPD’s banding pattern from all eighteen locations. By comparison, Eretmocerus emiratus Rose & Zolnerowich was collected from only one locality and displayed a unique banding pattern. Apart from differences in RAPD’s patterns, new species were only distinguishable from each other by minute differences in the first funicular antennal segment of the female. Screening with RAPD’s was really the only method available for distinguishing such cryptic species. Without RAPD’s, multiple cultures of widely distributed species, such as E. mundus, would have used most of the quarantine resources. These were conserved which allowed for new species to be imported later in the program. With both RAPD’s and morphological identifications available, it became apparent that unique RAPD’s patterns directly corresponded to distinct species for both Eretmocerus and Encarsia accessions. The one exception appeared to be Encarsia transvena Timberlake. This species was collected in many different geographic regions and was characterised by five separate banding patterns (Appendix 1). However, Viggiani (pers. comm.) has found some crossing incompatibility between the Spanish and Pakistan populations of E. transvena that is correlated with morphometric differences. It is possible this could reflect species level differences in the two E. transvena populations just as the RAPD’s patterns suggested. In summary, from our experience with these two genera, using RAPD’s in quarantine as a way of measuring and identifying diversity appears to be an excellent means of making preliminary separations of geographic populations or strains, and possible new species. Biological control programs may be well served if RAPD-PCR could be included as part of the protocol in the quarantine phase of the program.

Laboratory and Field Evaluation of Parasitic Hymenoptera In order to screen the full diversity of natural enemies being imported, we devised a three-tiered system of experiments, starting with laboratory tests and moving to more realistic field studies. The field experiments were divided into replicated field cage tests and free releases into long-term garden plots. The free release test, which we called ‘establishment evaluation’, provided an opportunity for ‘poor’ performing agents to demonstrate their potential in a non-agricultural setting. Establishment evaluations were conducted in garden plots in the LRGV which had a diversity of host plants with silverleaf whitefly, planted in a continuous rotation. The combination of this three-tiered system gave us both predictive and empirical data for decision-making in the action program. A total of 38 exotic and two native parasitoids were evaluated in laboratory and field experiments (Goolsby et al. 1998). Numbers of B. tabaci parasitised were counted in sleeve cages on cantaloupe melons (Cucumis melo L. cv ‘Perlita’), cotton (Gossypium hirsutum L. cv ‘Delta Pine 51’), and broccoli (Brassica oleracea L. cv ‘Patriot’). Highest attack rates were found for Encarsia nr. pergandiella (Brazil) and E. mundus (Spain) on melons; for Eretmocerus hayati Rose & Zolnerowich (Pakistan) on cotton; and for E. mundus (Spain) on broccoli. In the laboratory, these three exotic parasitoids attacked significantly greater numbers of hosts than the native species of Encarsia pergandiella Howard and Eretmocerus tejanus Rose & Zolnerowich. Selected exotic parasitoids were evaluated in the field using sleeve cages on melons, cotton and kale (Brassica



oleracea L. cv ‘Siberian kale’). Eretmocerus spp. from Spain and India performed well in all crop types. Encarsia nr pergandiella performed well on melons, but not on kale or cotton. In the establishment evaluation, 29 species/populations were released in the garden plots. During the two years of monitoring, 11 of these populations were recovered. Eretmocerus mundus and E. hayati were most commonly recovered throughout the evaluation period. Results from the laboratory, field and establishment evaluation were used to prioritise the E. mundus and E. hayati for mass rearing and development of augmentative biological control programs against B. tabaci (Goolsby & Ciomperlik 1999). Research co-operators in Arizona and California to prioritise candidates for field evaluation also used these findings. Identification of parasitoid species was critical to the field evaluation program. Morphological characters of the immature parasitoids were used to separate the two genera encountered in field samples. Native Encarsia pergandiella were distinguished from the Eretmocerus spp. by the presence of meconia in the host remains of the fourth instar whitefly. Encarsia transvena was never common in the field collection, but could be clearly identified by its black pupal skin. Pupal Eretmocerus were removed from the leaf and held in vials placed within a humiditron for emergence of the adults (DeBach & Rose 1985). Two primers, A-10 and C0-4, were used in the RAPDPCR procedure to determine the percentages of Eretmocerus spp. The second primer, CO-4, produced the most useful DNA profiles. The cost of running specimens through the RAPD’s process was the limiting factor. To overcome the cost and time limitations of RAPD’s, research was initiated to develop specific DNA probes from the satellite DNA for development into a squash blot kit. The use of this technique is discussed in the next section.

Recovery Survey of Parasitoids Using Sentinel Plants During 1997 a survey program for establishment of exotic parasitoids was implemented using ‘sentinel’ plants. Sentinel plants are pre-infested with immature whitefly and placed in field locations to sample parasitoid species composition. Plants stay in the field for two days and are then returned to the laboratory for rearing and identification of the parasitoids. This technique has two major advantages over conventional leaf sampling methods: 1) sentinel plants provide a standardised test unit across a broad range of locations and crop types, and 2) sentinels give a true measure of primary parasitism without the masking effects of hyperparasitism by the autoparasitoid, E. pergandiella. Ten sentinel locations were selected which represented a varied mix of agricultural and urban sites across the LRGV. Muskmelon var. perlita, followed by cotton in the summer months were used for sentinel plants. Plants were grown in the greenhouse until the three-leaf stage and then infested with whitefly. The root balls of the plants were placed in sealed plastic containers to retain moisture. Ten sentinel plants were placed monthly in each location for a period of two days. Plants were then returned to the laboratory for removal of plant pests and live parasitoid adults. After recovery and cleaning, each plant was first placed in a 150-mm diameter ventilated tissue culture dish and held in a reach-in environmental growth chamber at 27˚C for development of the parasitoids. Encarsia pergandiella pupae on each leaf were counted and removed prior to emergence to avoid hyperparasitism of the Eretmocerus pupae. Eretmocerus males and females were removed daily upon emergence and separated for identification. Males were slide mounted to determine if they were exotic or native. The pedicels of males of the introduced species are uniformly fuscous as compared to an amber coloration in the native E. tejanus males. This character proved to be very useful in determining the overall percentage of native versus


Table 1 Percentages and total numbers of exotic and native male Eretmocerus recovered from sentinel plants across time.

Date

Jun 97

% Exotic

1.5

% Native

98.5

N

225

141

Table 2

Aug 97

Sept 97

Oct 97

Jan 98

Feb 98

Mar 98

May 98

June 98

July 98

Aug 98

64.2

91.1

86.3

40.2

70.0

19.9

50.0

25.0

90.0

100.0

35.7

8.9

13.7

59.8

30.0

80.1

50.0

75.0

10.0

0

130

209

201

90

151

8

24

56

100

Identification of female Eretmocerus from sentinel plant recovery surveys

Technique

Date

N

E. mundus

E. hayati

E. tejanus

RAPD-PCR

Nov. 97

56

0%

64%

36%

Morphology

July 98

18

38%

62%

0%

Satellite DNA

Aug. 98

67

34%

38 %

28%

exotic Eretmocerus spp. The percentage assumes a standard female to male sex ratio of 60:40 across Eretmocerus spp. Female Eretmocerus were used for species determinations. These were made using slide mounts and keys to the imported species of Eretmocerus, RAPD-PCR, or Satellite DNA probes (Rose & Zolnerowich 1998). Species specific probes were developed from satellite DNA to allow for bulk identification of Eretmocerus specimens collected from field evaluation studies (Heilmann 1997). Specific patterns of positive and negative hybridisation distinguished E. mundus, E. hayati, and E. emiratus; however, the absence of hybridisation with any of the probes was interpreted to be the native E. tejanus. Both live pupae and adults were suitable for identification using the probe. The ability to use parasitoid pupae eliminated the need to rear adults from leaf samples for identification. Pupal Eretmocerus were affixed to a membrane for shipment to USDA-ARS (Fargo, ND) where the DNA probes were utilised. Further development of this technique is underway to detect additional species and to make a kit suitable for use in field settings. Results of the sentinel plant recovery survey showed a dramatic increase in the numbers of introduced Eretmocerus spp. (Table 1). At the beginning of the survey in June 1997, native E. tejanus represented greater than 95% of Eretmocerus spp. Three months later, during the fall of the 1997 (August- October), exotic populations began to increase, representing 85% (n = 700) of the Eretmocerus spp. recovered. Analysis of the female Eretmocerus using both morphological techniques and molecular genetics identified three species, E. tejanus, E. mundus, and E. hayati (Table 2). The two exotic species, E. mundus and E. hayati can now be considered to be widely established across the Rio Grande River flood plain. Further analysis of this data is currently underway by Jones and Goolsby.

Conclusions From 1993 to 1998, 17 species of Encarsia and Eretmocerus from 19 countries were imported and evaluated at MBCC for biological control of B. tabaci in the USA. Two introduced species, E. mundus and E. hayati are now established and changing the species complex attacking the silverleaf whitefly in Texas. Additional work is needed to quantify the impact of these biological control agents. Extensive pre-release studies were conducted that should provide a baseline



comparison for future researchers (Moomaw 1995; Legaspi et al. 1997; Riley & Ciomperlik 1997). The impact of the introduced parasitoids on non-target whitefly species should also be investigated. Other whitefly species, such as Trialeurodes abutilonea (Haldeman), Aleurocanthus woglumi Ashby and Aleurothrixus floccosus Maskell, are common in the agricultural and urban habitats where the E. mundus and E. hayati have been colonised. The silverleaf whitefly biological control program provides an opportunity to study the field specificity of entomophagous biological control agents. The integration of the morphology-based systematics and molecular techniques has optimised the efficient characterisation of natural enemies in quarantine, and allowed each new cryptic species to be fully evaluated and maintained as a pure culture. The techniques were also equally valuable in field-testing. It was possible to test multiple species simultaneously in the field and sort out species in the recovery samples by their DNA profile. Combining the use of RAPDPCR and classical systematics allowed for an increase in the numbers of individuals, which could be characterised to species in the evaluation effort. Ultimately, this led to the best possible determination of which species showed the greatest efficacy in the field. The molecular methods were only valuable when combined with classical systematics. Properly identified and curated specimens will provide the best permanent record of the species released and established. Taxonomic keys, developed as part of this program, will provide a means for other researchers, without access to molecular expertise, to identify the known world-wide diversity of Bemisia parasitoids (Rose & Zolnerowich 1997, 1998). One of the unique aspects of the Bemisia biological control program was the availability of so many species of natural enemies from intensive directed foreign explorations, combined with extensive mass rearing facilities. This unique situation provided the opportunity to evaluate, on a large scale, many different parasitoid species simultaneously, and predict which species would be most effective. Many authors have proposed that biological control become more of predictive science rather than an empirical method (Ehler 1990; Harris 1998). Despite considerable discussion of the topic few biological control programs have attempted to test the value of predictive tests. In the Bemisia biological control program we endeavoured to predict efficacy of the imported parasitoids and then test resulting hypotheses. Two species, E. mundus and E. hayati, performed significantly better in laboratory and field evaluations conducted in Texas. We predicted that these two species would be the most efficacious and selected them for augmentative biological control field evaluations. To test our predictions, the other species/populations that were not selected were reared in substantial numbers and released (Goolsby et al. 1998). The realities of an applied biological control program did not allow us to rear and release equal numbers of all the species permitted. Because of this, it was not possible to test our hypothesis as rigorously as we would have liked. However, the recoveries of the E. mundus and E. hayati across a broad geographical area suggests that the laboratory and field tests were valuable in predicting the ‘success’ of these biological control agents. If the predictive methods used in a biological control program are accurate, the time taken to identify an effective natural enemy can be shortened. Reducing the time it takes to evaluate a collection of biological control agents also has value in terms of conserving resources in a research program and reducing the short-term impact of the target pest. We hope that these results will encourage other biological control programs to develop predictive methods and test their predictions in field settings. The information gathered from the combined predictive and empirical method that we propose might further the theoretical aspects of our science, and in turn increase the likelihood of success in future biological control programs.


Acknowledgements We would like to thank the following systematists for their expertise: Mike Rose (Montana State University, Bozeman, MT), James B. Woolley and Greg Zolnerowich (Department of Entomology, Texas A & M University, College Station, TX), Mike Schauff (USDA-ARS, Systematic Entomology Laboratory, Smithsonian, Washington, D. C), John Heraty (Department of Entomology, University of California, Riverside, CA) and Ray Gill (California Department of Agriculture, Sacramento, CA). The satellite DNA probes were developed by Larry Heilmann (USDA-ARS, Fargo, ND). We also wish to thank Don Sands (CSIRO, Indooroopilly, Queensland) and Andy Austin (University of Adelaide, Adelaide, South Australia) for their helpful comments.

References APHIS – Animal and Plant Health Inspection Service, United States Department of Agriculture (1995) Field releases of nonindigenous parasitic wasps in the genus Eretmocerus and Encarsia (Hymenoptera: Aphelinidae) for biological control of whitefly pests (Homoptera: Aleyrodidae). Environmental Assessment. Riverdale, Maryland. Black, W. C. IV, DuTeau, N. M., Puterka, G. J., Nechols, J. R., & Pettorini, J. N. (1992) Use of the random amplified polymorphic DNA polymerase chain reaction (RAPD-PCR) to detect DNA polymorphisms in aphids (Homoptera: Aphididae). Bulletin Entomological Research 82: 151-159. DeBach, P. & Rose, M. (1985) Humidity control during shipment and rearing of parasitic Hymenoptera. Chalcid Forum 4: 11-13. Ehler, L. E. (1990) Introduction strategies in biological control of insects. pp. 111-130. In Mackauer, M., Ehler, L. E. & Roland, J. (Eds), Critical Issues in Biological Control. Intercept, Andover, Hants. Goolsby, J. A, Legaspi, J. C., & Legaspi, Jr, B. C. (1996) Quarantine evaluation of exotic parasites of the sweetpotato whitefly, Bemisia tabaci (Gennadius). Southwestern Entomologist 21: 13-21. Goolsby, J. A., Ciomperlik, M. A., Legaspi, Jr, B. C., Legaspi, J. C. & Wendel, L. E. (1998) Laboratory and field evaluation of exotic parasitoids of Bemisia tabaci (Biotype ‘B’) in the Lower Rio Grande Valley of Texas. Biological Control 12: 27-135. Goolsby, J. A. & Ciomperlik, M. A. (1999) Development of parasitoid inoculated seedling transplants for augmentative biological control of silverleaf whitefly (Homoptera: Aleyrodidae). Florida Entomologist 4: 532-545. Harris, P. (1998) Evolution of Classical Weed Biocontrol: Meeting Survival Challenges. Bulletin of the Entomological Society of Canada 30: 134-143. Heilmann, L. (1997) Development of species specific DNA probes for Eretmocerus species. p. 87. In Henneberry, T. J., Toscano, N. C., Perring, T. M. & Faust, R. M. (Eds), Silverleaf Whitefly: National Research, Action and Technology Transfer Plan, 1997-2001: Fifth Annual Review. United States Department of Agriculture ARS 1997-01, San Diego. Hoelmer, K. A. (1998) Comparative field cage evaluations of top-performing introduced parasitoids in desert cantaloupes. p. 68. In Henneberry, T. J., Toscano, N. C., Perring, T. M. & Faust, R. M. (Eds), Silverleaf Whitefly: National Research, Action and Technology Transfer Plan, 1997-2001: First Annual Review. United States Department of Agriculture ARS 199801, Charleston. Hoelmer, K. A., Roltsch, W. J. & Simmons, G. S. (1998) Establishment of introduced Eretmocerus species in Imperial Valley, CA. p. 70. In Henneberry, T. J., Toscano, N. C., Perring, T. M. & Faust, R. M. (Eds), Silverleaf Whitefly: National Research, Action and Technology Transfer



Plan, 1997-2001: First Annual Review. United States Department of Agriculture ARS 199801, Charleston. Hunter, M. S. & Rose, M. (1996) Courtship behavior, reproductive relationships, and allozyme patterns of three North American populations of Eretmocerus nr. californicus (Hymenoptera: Aphelinidae) parasitizing the whitefly Bemisia sp., tabaci complex (Homoptera: Aleyrodidae). Proceedings of the Entomological Society of Washington 98: 126-137. Hunter, M. S., Rose, M. & Polazek, A. (1996) Divergent host relationships of males and females in the parasitoid Encarsia porteri (Hymenoptera: Aphelinidae). Annals of the Entomological Society of America 89: 667-675. Legaspi, J. C., Legaspi, Jr., B. C., Carruthers, R. I., Goolsby, J. A., Jones, W. A., Kirk, A. A., Moomaw, C., Poprawski, T. J., Ruiz, R. A., Talekar, N. S. & Vacek, D. (1996) Foreign exploration for natural enemies of Bemisia tabaci from Southeast Asia. Subtropical Plant Science 48: 48-53. Legaspi, Jr, B. C., Legaspi, J. C., Carruthers, R. I., Goolsby, J. A., Hadman, J., Jones, W., Murden, D. & Wendel, L. E. (1997) Areawide population dynamics of silverleaf whitefly (Homoptera: Aleyrodidae) and its parasitoids in the Lower Rio Grande Valley of Texas. Journal Entomological Science 32: 445-459. Moomaw, C. (1995) Survey of the indigenous parasitoids of Bemisia tabaci in the Lower Rio Grande Valley of Texas. Masters Thesis, Department of Entomology, Texas A&M University, College Station. Pickett, C. H., Simmons, G. S., Goolsby, J. A. & Overholt, D. (1999) Fall releases of parasites into citrus. p. 83. In Henneberry, T. J., Toscano, N. C., Perring, T. M. & Faust, R. M. (Eds), Silverleaf Whitefly: National Research, Action and Technology Transfer Plan, 1997-2001: Second Annual Review. United States Department of Agriculture ARS 1999-01, Albuquerque. Riley, D. G. & Ciomperlik, M. A. (1997) Regional population dynamics of whitefly (Homoptera: Aleyrodidae) and associated parasitoids (Hymenoptera: Aphelinidae). Environmental Entomology 26: 1049-1055. Rose, M. & Zolnerowich, G. (1997) Eretmocerus Haldeman (Hymenoptera: Aphelinidae) in the United States, with descriptions of new species attacking Bemisia (tabaci complex) (Homoptera: Aleyrodidae). Proceedings of the Entomological Society of Washington 99: 1-27. Rose, M. & Zolnerowich, G. (1998) Eretmocerus Haldeman (Hymenoptera: Aphelinidae) imported and released in the United States for control of Bemisia (tabaci complex) (Homoptera: Aleyrodidae). Proceedings of the Entomological Society of Washington 100: 31-323. Vacek, D. C., Ruiz, R. A. & Wendel, L. E. (1996) RAPD-PCR identification of natural enemies of SPWF. p. 139. In Henneberry, T. J., Toscano, N. C., Perring, T. M. & Faust, R. M. (Eds), Silverleaf Whitefly: National Research, Action and Technology Transfer Plan, 1997-2001: Fourth Annual Review. United States Department of Agriculture ARS 1996-01, San Antonio.


Appendix 1 Parasitic Hymenoptera imported into the USA for biological control of Bemisia tabaci (Biotype ‘B’), 1992 to 1998.

M#

DNA Pattern

Collection Locality

Encarsia sp. nr. strenua

M92018

EN- 1

Encarsia sp. nr. strenua

M93010

Encarsia formosa

Name

Collector

Date

Tax Id

Host

Host Plant

Biology

India, Parbhani Nguyen

I-92

Woolley & Schauff

Bemisia tabaci complex

Autoparasitoid

EN- 1

India, Parbhani Nguyen

I-92

Woolley & Schauff


Autoparasitoid

M92017

EN-2

Greece, Angelohori

Kashefi

I-92

Woolley & Schauff

Trialeurodes vaporarium

Bean

Uniparental

Encarsia formosa

M92030

EN-2

Egypt, Nile Delta

Kirk & Lacey

I-92

Schauff


Lantana

Uniparental

Encarsia formosa

M94051

EN-2

Thailand, Saen Kirk & Lacey

III-94

Woolley & Schauff


Snakeweed

Uniparental

Encarsia formosa

M94089

EN-2

Italy, Borgo Corso

Kirk & Campobasso

IX-94

Woolley & Schauff

Trialeurodes vaporarium

Tomato

Uniparental

Encarsia transvena

M94017

EN-3

Taiwan, ShanHua

Legaspi, Carr., Popr.

III-94

Woolley & Johnson


Soybean/ Tomato

Autoparasitoid

Encarsia transvena

M94019

EN-4

Taiwan, ShanHua


III-94

Woolley & Johnson


Soybean/ Tomato

Autoparasitoid

Encarsia transvena

M94041

EN-5

Thailand, Chiang Mai

Kirk & Lacey

III-94

Woolley & Johnson


Poinsettia

Autoparasitoid

Encarsia transvena

M94047

EN-5

Malaysia, Kuala Lumpur

Kirk & Lacey

III-94

Woolley & Johnson


Mussaenda sp. Autoparasitoid

Encarsia transvena

M95023

EN-5

Thailand, Doi Suthep

Carruthers & Legaspi

V-95

Woolley & Johnson


uknown woody plant

Autoparasitoid

Encarsia adrianae

M94024

EN-6

Thailand, Kirk & Lacey Kampang Saen

III-94

Woolley & Johnson


Snakeweed

Autoparasitoid

Encarsia transvena

M93003

EN-7

Spain, Murcia

I-93

Woolley & Schauff


Lantana

Autoparasitoid

Encarsia spp.

Kirk & Lacey



Name

M#

DNA Pattern

Collection Locality

Encarsia transvena

M95107

EN-5

Pakistan, Multan

Encarsia transvena

M96065

EN-5

Encarsia lutea

M93064

Encarsia lutea

Collector

Date

Tax Id

Host

Host Plant

Biology

Kirk & Lacey

XI-95

Goolsby


Cotton

Autoparasitoid

Pakistan, Jalari Kirk

X-96

Goolsby


Cotton

Autoparasitoid

EN-10

Cyprus, Mazotos

Kirk & Lacey

I-93

Woolley & Johnson


Lantana

Autoparasitoid

M94096

EN-10

Italy, Testa Di Lespe

Kirk & Campobasso

IX-94

Woolley & Johnson


Eggplant

Autoparasitoid

Encarsia lutea

M94107

EN-10

Israel, Givat Haim

Kirk & Lacey

X-94

Woolley & Johnson


Cotton

Autoparasitoid

Encarsia lutea

M94115

EN-10

Israel, Ein Gedi, Kirk & Lacey Dead Sea

X-94

Woolley & Johnson


Lantana

Autoparasitoid

Encarsia lutea

M94129

EN-10

Spain, Mazarron Casas Nuevas

Kirk & Lacey

XI-94

Woolley & Johnson


Ipomea sp.

Autoparasitoid

Encarsia lutea

M96044

EN-10

Sicily, Ragusa

Kirk & Campobasso

IX-96

Johnson


Solanaceous weed

Autoparasitoid

Encarsia transvena

M94014

EN-11

Philippines, Benguet


III-94

Woolley & Johnson

Trialeurodes sp. White potato

Autoparasitoid

Encarsia transvena

M94016

EN-11

Taiwan, ShanHua


III-94

Woolley & Johnson


Poinsettia

Autoparasitoid

Encarsia nr. pergandiella

M94055

EN-15

Brazil, Sete Lagoas

Rose

II-94

Rose & Woolley


Poinsettia/ Soybean

Uniparental

Encarsia nr. hispida

M94056

EN-16

Brazil, Sete Lagoas

Rose

II-94

Rose & Woolley


Poinsettia/ Soybean

Uniparental

Encarsia sp. M95001 (parvella group)

EN-18

Dominican Ciomperlik Republic, Azua

I-95

Schauff


Tomato

Autoparasitoid

ERET-1

Spain, Murcia

I-92

Schauff


Cotton

Biparental

Eretmocerus spp. Eretmocerus mundus

M92014

Kirk , Chen & Sobhain


Eretmocerus mundus

M92019

ERET-1

India, Padappai Kirk & Lacey

I-92

Rose & Zolnerowich


Eggplant

Biparental

Eretmocerus mundus

M92027

ERET-1

Egypt, Cairo

Kirk & Lacey

I-92

Rose & Zolnerowich


Lantana

Biparental

Eretmocerus mundus

M93004

ERET-1

Spain, Murcia

Kirk & Lacey

I-93

Woolley & Schauff


Sonchus

Biparental

Eretmocerus mundus

M93058

ERET-1

Taiwan, Tainan Moomaw

XII-93

Rose & Zolnerowich


Tomato

Biparental

Eretmocerus mundus

M94085

ERET-1

Italy, Frascati

Kirk & Campobasso

IX-94

Rose & Zolnerowich


Hibiscus

Biparental

Eretmocerus mundus

M94092

ERET-1

Italy, Castel Gondolfo

Kirk & Campobasso

IX-94

Rose & Zolnerowich


Ipomea sp.

Biparental

Eretmocerus mundus

M94097

ERET-1

Italy, Testa Di Lespe

Kirk & Campobasso

IX-94

Rose & Zolnerowich


Eggplant

Biparental

Eretmocerus mundus

M94103

ERET-1

Israel, Gat

Kirk & Lacey

X-94

Rose & Zolnerowich


Kohlrabi

Biparental

Eretmocerus mundus

M94105

ERET-1

Israel, Gat

Kirk & Lacey

X-94

Rose & Zolnerowich


Sonchus sp.

Biparental

Eretmocerus mundus

M94125

ERET-1

Israel, Golan Kibutz

Kirk & Lacey

X-94

Rose & Zolnerowich


Euphorbia spp. Biparental

Eretmocerus mundus

M94120

ERET-1

Israel, Golan Kirk & Lacey Ma’Aleh Gamla

X-94

Rose & Zolnerowich


Melons

Biparental

Eretmocerus mundus

M94124

ERET-1

Israel, Negev Desert

Kirk & Lacey

X-94

Rose & Zolnerowich


Cucumber

Biparental

Eretmocerus mundus

M96028

ERET-1

Sicily, Santa Groce

Kirk & Campobasso

IX-96

Goolsby


Eggplant

Biparental

Eretmocerus mundus

M97046

ERET-1

Cyprus, Nicosia Kirk

VII-97

Goolsby


Lantana

Biparental

Eretmocerus hayati

M93005

ERET-2

India, Thirumala

Kirk & Lacey

I-93

Rose & Zolnerowich


Eretmocerus melanoscutus

M94036

ERET-3

Thailand, Chiang Mai

Kirk & Lacey

III-94

Rose & Zolnerowich


Biparental Chromolaena odorata

Biparental



Name

M#

DNA Pattern

Collection Locality

Date

Tax Id

Host

Host Plant

Biology


M94040

ERET-3

Thailand, Kirk & Lacey Kampang Saen

III-94

Rose & Zolnerowich


Cotton

Biparental


M94023

ERET-8

Thailand, Sai Noi Klong Ha Roi

III-94

Rose & Zolnerowich


Eggplant/ melon

Biparental/ Uniparental


M95097

ERET-3

Taiwan, Tainan Talekar & Jones X-95

Rose & Zolnerowich


Tomato

Biparental

Eretmocerus eremicus

M94001

ERET-4

Brawley, CA

Hoelmer

I-94

Rose & Zolnerowich


Okra

Biparental

Eretmocerus staufferi

M94002

ERET-5

College Station, TX

Stauffer

I-94

Rose & Zolnerowich


Tomato

Uniparental

Eretmocerus tejanus

M94003

ERET-6

USA, Mission, TX

Rodriquez

I-94

Rose & Zolnerowich


Cabbage

Biparental

Eretmocerus hayati

M95012

ERET-10 Pakistan, Multan

Kirk & Akey

IV-95

Rose & Zolnerowich


Eggplant

Biparental

Eretmocerus hayati

M95105

ERET-10 Pakistan, Multan

Kirk & Lacey

IX-95

Rose & Zolnerowich


Eggplant

Eretmocerus hayati

M96064

ERET-10 Pakistan, Jalari Kirk

X-96

Goolsby


Cotton

Biparental

Collector

Kirk & Lacey

Eretmocerus sp. M95098 nr. furuhashii

ERET-11 Taiwan, Tainan Talekar & Jones X-95

Rose & Zolnerowich


Tomato

Biparental

Eretmocerus sp. M95026 nr. furuhashii

ERET-11 Taiwan, Chiuju Kirk

V-94

Goolsby


Cabbage

Biparental

Eretmocerus emiratus

ERET-12 United Arab Emirates

Porter, Romadon

XI-95

Rose & Zolnerowich


Okra

Biparental

ERET-13 Ethiopia, Melka Werer

Gerling, Terefe XI-96

Goolsby


Cotton

Biparental

M95104

Eretmocerus sp. M96076

Which Factors Govern the Host Preference of Aphid Parasitoids When Offered Host Races of an Aphid Species? Anja Hildebrands1, Thomas Thieme2 and Stefan Vidal3 1

Institute for Plant Diseases and Plant Protection, University, Herrenhaeuser Str. 2, 30419 Hanover, Germany 2

BTL Biotestlabor GmbH, 18184 Sagerheide, Germany

3

Institute for Plant Pathology, University, Grisebachstr. 6, 37077 Goettingen, Germany (email: [email protected])

Introduction The evolution of complex life histories in aphids, which often involve polymorphism, is regarded as a prerequisite for the success of several aphid species in exploiting variable environments. Polymorphism within aphid species may refer to morph differentiation during different phases of their life cycle, colour polymorphism, or the ability to use different host plants (e.g. Hille Ris Lambers 1966; Moran 1992; Dixon 1996). This latter feature of aphids favours the formation of subspecies, biotypes or races, a phenomenon observed in several species (Eastop 1973). However, the transition of an aphid species to new host plants by the formation of demes may not only be advantageous with respect to the exploitation of new resources, but also with respect to lowered parasitisation of aphid populations by aphidiine braconid wasps. These wasps are able to use, beside other traits, visual or chemical cues emitted by the host plants for host location (Grasswitz & Paine 1993; Mackauer et al. 1996). Thus, new aphid/host plant associations may not fit within the searching templates of the female wasp and release the aphids, at least in part, from parasitisation pressure. Moreover, by physiologically adapting to new host plants, aphids could become less suitable for the development of parasitoid larvae. The black bean aphid Aphis fabae Scopoli is known to comprise several taxa which are barely distinguishable by morphological characters, but differ in their preferred host plants. Müller (1982) elaborated a simple biological test for the differentiation of A. fabae fabae (AFF), A. f. solanella Theobald (AFS), A. f. evonymi F. (AFE) and A. f. cirsiiacanthoidis Scopoli (AFC) by their performance on the marking of host plants Vicia faba, Solanum nigrum, Euonymus europaeus and Cirsium arvense, respectively. Thieme (1988) extended this biological test to include A. f. mordwilkowi Börner & Janisch (AFM; on Tropaeolum majus) and A. f. armata Hausmann (AFA; on Digitalis purpurea). Additionally, we used the closely related species A. rumicis L. (AR; on Rumex obtusifolius) to include a host plant which is suitable for all taxa in this context. One of the aims of the study reported here was to test the hypothesis that the morphological, physiological and/or behavioural variability in members of the black bean aphid-complex (Aphis fabae-Aggr.) affects the host acceptance behaviour of aphidiine parasitoids. We used two polyphagous species of the genus Lysiphlebus, L. fabarum (Marshall), a common parasitoid of the black bean aphid on agricultural crops (Völkl & Stechmann 1998), native to Europe and L. testaceipes Cresson. The latter species has been introduced to Europe in recent times (Stary et al. 1988) and is therefore not adapted to the aphid taxa tested. We compared the effects of visual cues of

359

Anja Hildebrands, Thomas Thieme and Stefan Vidal 360


aphid movement on the behaviour of the two parasitoid species. Additionally, we tested whether host preference was related to larval performance.

Material and Methods Insect cultures Laboratory stocks of AFA, AFC, AFE, AFM and AR, which originated from material cultured by Thieme in Rostock, and AFF and AFS, which originated from taxa collected at Hanover, were maintained either on their potted marking host plants or on potted Rumex crispus in wooden framed cages closed with plexiglas on top and fine-meshed gauze on the sides. They were kept at 21 ± 1˚C under continuous light conditions in a greenhouse. The solitary parasitoids L. testaceipes and L. fabarum were reared on the nominal species AFF under the same conditions as the aphid stocks. Lysiphlebus testaceipes originated from material of ÖRE-Bioprotect, Raisdorf, Germany. Lysiphlebus fabarum was initially reared from A. fabae mummies collected at Papenburg, Lower Saxonia. In all experiments we used mated female wasps that had no previous experience with the hosts. Host acceptance We investigated host examination and attack behaviour in experiments that were designed as dichotomous choice tests. In order to evaluate the influence of visual cues and host movement on host acceptance, experiments were repeated under dark conditions and with anaesthetised aphids, following the methodology of Michaud and Mackauer (1994). Each experiment was repeated ten times. In experiment 1 single female wasps were provided with 10 L3 nymphs of each of two host taxa in a petri-dish (5.7 cm) for 20 min (L. testaceipes) or 30 min (L. fabarum). During this time we recorded four patterns of behaviour: a) examination of the host by antennation without subsequent ovipositor contact; b) probing with the ovipositor without oviposition; c) oviposition, and d) no contact with the host. Because probing and actual oviposition could not be separated by visual inspection alone, attacked aphids were removed from petri-dishes, reared on R. crispus for 4 d and then dissected to check for parasitoid larvae. To separate aphid taxa in the dichotomous combinations, one tarsus was amputated from an aphid ahead of the experiments, alternating between the two taxa tested within the replications. In experiment 2 (host acceptance in the dark), single female wasps were provided with 10 L3nymphs of each of two host taxa for 4 h in a petri-dish in complete darkness. The experiment was set between 9.00 a.m. and 2.00 p.m., when wasps experienced their highest activity. Aphids were reared on R. crispus for 4 d and were then dissected to check for parasitoid larvae. Experiment 3 (host acceptance of immobilised aphids) was designed as in experiment 1. However, in this experiment aphids were anaesthetised by a 5 min exposure to CO2. This treatment kept the instars immobilised for about 25 min.

Host suitability One hundred larvae of each aphid taxon which had been previously attacked by L. testaceipes were maintained on R. crispus plants in separate cages. To assess the current developmental stage of the parasitoid larvae, five aphid larvae of each taxon were dissected during the following days until adult eclosion. Larval stages were determined by the characters given in Couchman & King (1977).

Which Factors Govern the Host Preference of Aphid Parasitoids? 361

L. testaceipes

L. fababarum

L. testac. on Rumex

9

Oviposition Index

8 7 6 5 4 3 2 1 0 AFC AFC AFC AFC AFF AFF AFF AFF AFM AFM AFM AFM AFA AFE AR AFS AFA AFE AR AFS AFA AFE AR AFS

Aphid Combination Figure 1

Oviposition indices (higher oviposition rate/lower oviposition rate) of Lysiphlebus testaceipes (black columns), L. fabarum (grey columns) and L. testaceipes with all aphid taxa reared on Rumex crispus (white columns) for aphid combinations with significant preference for one taxon under daylight conditions. Aphid taxa were reared on their marking host plants. Names of preferred aphid taxa are bold and underlined. AFA = Aphis fabae armata; AFC = A. f. cirsiiacanthoidis; AFE = A. f. evonymi; AFF = A. f. fabae; AFM = A. f. mordwilkowi; AR = A. rumicis; AFS = A. f. solanella. All indices shown are significant at P < 0.05 (G-test with Williams correction).

Statistical analysis The G-test for goodness-of-fit with Williams’ correction (Sokal & Rohlf 1995) was used to determine significant differences between attack rates or oviposition rates in single dichotomous choice tests. The Man-Whitney U-Test was used to compare the development time of parasitoid larvae in different aphid taxa, and mortality rates in the larval stages were compared using ANOVA and a Tukey-Test.

Results Host acceptance Both L. fabarum and L. testaceipes consistently preferred parasitising AFC, AFF and AFM in comparison to AFE, AFA, AR and AFS. However, the oviposition indices (the ratio of higher to lower oviposition rates) were higher in all but one case for L. fabarum (Fig. 1). No preferences were found when pairwise combinations of the three former or the four latter aphid taxa were offered. In this experiment all aphid taxa were reared on their marking host plants. Therefore, the observed



9 L. testaceipes

L. fabarum

8

Oviposition Index

7 6 5 4 3 2 1 0 AFC AFC AFC AFC AFF AFF AFF AFF AFM AFM AFM AFM AFA AFE AR AFS AFA AFE AR AFS AFA AFE AR AFS


Oviposition indices of Lysiphlebus testaceipes and L. fabarum for aphid combinations with significant preference for one taxon under dark conditions (see Figure 1 for further explanation).

differences in preference could have been due to an influence of some nutritional factors of the marking host plant alone. We repeated the experiment using L. testaceipes and aphid taxa which had been reared on Rumex crispus, a plant suitable for all taxa of the A. fabae-complex. Again, L. testaceipes significantly preferred the same aphid taxa as in the first experiment, the oviposition indices being significant at least at P < 0.01 (G-test with Williams correction). The preference of these parasitoids for AFC, AFF and AFM in comparison to AFA, AFE, AR and AFS corresponded with differences in the colour of these two groups, the former appearing greenish-black, the latter appearing brownish-black when reared under greenhouse conditions (elimination of UV-radiation). To test for the effects of visual cues, especially of the colour of the aphid integument, on the preference of parasitoids for particular aphid taxa, the former experiment was repeated under conditions of complete darkness. Again, both L. testaceipes and L. fabarum consistently showed the same ovipositional preferences as in the first experiment (Fig. 2). All oviposition indices for the aphid taxa AFC, AFF and AFM were significantly higher in comparison to the taxa AFE, AFA, AR, or AFS. However, especially in L. fabarum, most indices were less pronounced than in the first experiment, but still significant at P < 0.01 (G-test with Williams correction). These results suggest that visual cues may have influenced host recognition but did not affect host acceptance. The acceptance of a potential aphid taxon for oviposition may also be affected by the defensive behaviour of the host. In experiment 3 we therefore tested host acceptance of the two parasitoid


9 L. testaceipes

L. fabarum

8

Oviposition Index

7 6 5 4 3 2 1 0 AFC AFC AFC AFC AFF AFF AFF AFF AFM AFM AFM AFM AFA AFE AR AFS AFA AFE AR AFS AFA AFE AR AFS


Oviposition indices of Lysiphlebus testaceipes and L. fabarum for aphid combinations with significant preference for one taxon when aphids were anaesthetised (see Figure 1 for further explanation).

species using immobilised aphids. Again both parasitoid species preferred to lay their eggs in the aphid taxa AFC, AFF and AFM in comparison to AFA, AFE, AR and AFS, resulting in significant oviposition indices for the same taxon combinations as in experiment 1 (Fig. 3). Moreover, immobilisation of aphid larvae increased oviposition in the preferred taxa, resulting in oviposition indices that were more pronounced than in experiment 1 (compare scaling of the vertical axis in Figs 1–3). However, when attack rates (contact with the ovipositor) of female parasitoids were examined when aphids were immobilised, we found no significant differences (G-test with Williams’ correction, P > 0.05; Fig. 4). These results indicate that the two parasitoid species responded to physiological differences within the aphid taxa after contact with their ovipositor rather than to differences in their defensive behaviour.

Host suitability In experiment 4 we examined whether the differences in the preferences for certain aphid taxa shown by L. testaceipes in experiments 1–3 corresponded with a different suitability of these aphids for the development of the parasitoid larvae. Suitability of a host as an oviposition site is considered to be an important aspect of host selection by female parasitoids (Vinson 1976). The larvae of L. testaceipes developed much faster in the preferred taxa AFC, AFF and AFM, corroborating the oviposition preferences in the first experiments (Fig. 5). The total development times from the egg stage to eclosion of the adults was significantly longer in AFA ( 19.75 d), AFE (15.47 d) and AR (19.0 d) than in AFF (12.53 d), AFC (12.25 d) and AFM (14.04 d)



2,0 L. testaceipes

L. fabarum

Attack Index

1,5

1,0

0,5

0,0 AFC AFC AFC AFC AFF AFF AFF AFF AFM AFM AFM AFM AFA AFE AR AFS AFA AFE AR AFS AFA AFE AR AFS


Attack indices (higher attack rate/lower attack rate) of Lysiphlebus testaceipes and L. fabarum for aphid combinations with significant preference for one taxon in the former experiments when aphids were anaesthetised. Attack rates were not significantly different from 1 (G-test with Williams correction; P > 0.05) (see Figure 1 for further explanation).

(Mann-Whitney U-test, P < 0.001). The total developmental time for AS was somewhat, but not significantly, longer (16.0 d) than in the three most preferred taxa. Moreover, the mortality rate during the larval stages paralleled the developmental time (Fig. 6). The parasitoid larvae experienced a significantly lower mortality rate in the three taxa AFC, AFF and AFM compared to the taxa AFA and AR (Tukey-Test, P < 0.05).

Discussion Studies on host-parasitoid interactions often concentrate on the question of why some insects are accepted for oviposition and others ignored or rejected (Mackauer et al. 1996). Host acceptance by female parasitoids is governed by the quality, and host suitability by the performance of larvae (Michaud & Mackauer 1994). By using an aphid species which is known to have distinct biotypes or host races adapted to certain host plants, we tested the consequences of intraspecific host plant adaptation on the preference and performance of natural enemies. In our study the two aphidiine parasitoids L. testaceipes and L. fabarum consistently preferred to oviposit in the aphids A. f. fabae, A. f. cirsiiacanthoidis and A. f. mordwilkowi compared with A. f. armata, A. f. evonymi, A. f. solanella and A. rumicis. These preferences were not due to the colour or the defensive behaviour of the aphids nor to influences mediated by the nutritional quality of the host plant. The preferred aphid taxa were more suitable for growth of the parasitoid larvae, resulting in significantly


I

Developmental Stage

M L4 AFF AFC AFM AFS AFE AR AFA

L3 L2 L1 E 0

2

4

6

8

10

12

14

16

18

20

Days after Oviposition Figure 5

Total developmental time from oviposition to eclosion of adults for Lysiphlebus testaceipes in taxa of the Aphis fabae-complex. For the larval stages means of five dissected aphids per taxon and day are shown; for the mummy stage and the adult eclosion means of 10 mummified aphids are shown.

shorter total developmental times than in the rejected taxa. Moreover, the parasitoid larvae experienced a higher mortality when developing in the rejected taxa. Visual characteristics of host size, shape or colour are important cues for host location by aphidiine parasitoids. For example, Ankersmit et al. (1986) found that Aphidius rhopalosiphi DeStefani parasitised green coloured morphs of Sitobion avenae F. more successfully than brown morphs. Michaud and Mackauer (1994, 1995) showed that several Aphidius spp., Praon pequodorum Viereck and Monoctonus paulensis (Ashmead) used visual cues for the evaluation of the aphid hosts Macrosiphon creelii Davis (pink and green morphs) and Acyrthosiphon pisum (Harris) (green morph). Some of these parasitoid species changed their attack and host acceptance behaviour when aphids were offered under dark conditions (Michaud & Mackauer 1995), indicating that visual cues are important but not the only host signals, that are used by female parasitoids. If visual cues were responsible for the two Lysiphlebus species tested to differentiate between the members of the A. fabae-complex, we would have expected to find differences in oviposition indices when the aphids were offered under dark conditions. However, the preferences for oviposition in certain taxa were the same whether in light or dark conditions. The acceptance of a potential host may be related to its defensive behaviour such as kicking, jerking or walking during attack by a parasitoid (Klingauf 1967; Gardner et al. 1984; Völkl 1991; Weisser 1994; Michaud & Mackauer 1994, 1995). By anaesthetising aphid nymphs we were able to show that this host manipulation did not result in differences in the preference ranking of the



60

a

a

Mortality (%)

50 40 30

b

b

20

c

c

c

10

15

82

51

89

59

48

88

AFA

AFC

AFE

AFF

AFM

AR

AFS

0

Aphid Taxon Figure 6

Mortality rate of Lysiphlebus testaceipes in different taxa of the Aphis fabae-complex during their larval development. Numbers in columns give the numbers of parasitised aphids which could be used for analysis. Different letters above columns denote significant differences between the taxa (Tukey-Test, P < 0.05).

aphid taxa compared to normal host behaviour. Rather, an even more pronounced oviposition index was observed in both Lysiphlebus species in the most preferred aphid taxa. Olfactory cues from honeydew and cuticular lipids, originating from the host plants on which the aphids had been cultured, can have a stimulating effect on attack behaviour by aphidiines (Bouchard & Cloutier 1985; Sheehan & Shelton 1989; Budenberg 1990; Grasswitz & Paine 1992,1993; Battaglia et al. 1993; Liepert & Dettner 1993; Pennacchio et al. 1994). Lysiphlebus testaceipes may also perceive kairomones from cornicle waxes that stimulate oviposition during attack (Grasswitz & Paine 1992). Cornicle waxes are a mixture of wax and haemolymph (Fröhlich 1991) and contain species-specific mixtures of triglycerides (Callow et al. 1973; Greenway & Griffith 1973). However, if one or a combination of the above parameters had triggered the attack behaviour of L. testaceipes or L. fabarum, we would have expected to find different attack rates when the defensive behaviour of the aphid taxa was excluded by anaesthetising them. Contrary to our expectations, the attack indices were still all positive but not significantly different for the preferred taxa, indicating an inherent preference related to one or more factors discussed above. Moreover, these findings emphasise the importance of internal factors of the aphid taxa tested, which cannot be perceived by visual inspection or antennation alone, but may become functional when the ovipositor is inserted into the host. The ovipositor of female Aphidiinae bears numerous chemosensilla, which could serve as a tool to evaluate the chemical quality of the potential hosts. The differences in host acceptance may thus be due to different kairomones in the haemolymph of the host. Srivastava and Singh (1988) showed a stimulating effect of host haemolymph on ovi-


position behaviour of Trioxys indicus Subba Rao & Sharma on A. carccivora Koch. This effect was related to water soluble kairomones in the haemolymph. Kainoh and Brown (1994) reported the haemolymph of the larvae of Trichoplusia ni (Hübner) (Noctuidae) as an inducer of oviposition in Chelonus sp. near curvimaculatus (Cameron) (Braconidae). Artificial eggs, which were filled with 11 different amino acids, induced oviposition especially when they contained arginine, histidine and lysine. However, the highest ovipositional response was achieved, when eggs containing host haemolymph were provided, suggesting that specific mixtures of amino acids are responsible for host acceptance in this parasitoid. Biotypes of A. pisum differ in the structure of their symbionts (Srivastava 1987) resulting in the ability to synthesise different amino acids. Recent findings by Adams and Douglas (1997) suggest that this is also the case in the A. fabaecomplex, emphasising the potential role of amino acid composition in host preference behaviour of L. fabarum and L. testaceipes. The quantity of resources available for larval koinobionts is dependent on the growth and nutrient uptake of the host after its parasitisation (Mackauer 1986; Sequeira & Mackauer 1992; Harvey et al. 1995). The total time of development of L. testaceipes in A. f. fabae, A. f. cirsiiacanthoidis and A. f. mordwilkowi (12-14 d) is comparable to that reported for other aphid host species (Hight et al. 1972; Salto et al. 1983; van Steenis 1994), suggesting these three taxa are optimal hosts for this aphidiine parasitoid. In addition, the higher mortality rates experienced by parasitoid larvae in A. f. armata, A. f. evonymi and A. rumicis compared with A. f. cirsiiacanthoidis, A. f. fabae and A. f. mordwilkowi suggest that the nutritional quality of these hosts is low, since physiological defensive reactions like encapsulation could not be detected during dissections. The duration of development depends on either the nutritional quality (Sequeira & Mackauer 1992) or the quantity of resources (Wilbert 1965; Elliot et al. 1994; Harvey et al. 1994). The quantity of resources in aphids may vary according to size and, because size may be associated with oviposition preferences, we excluded host plant influences by rearing all taxa on the same host plant R. crispus. This plant species represents an alternative host for most taxa in the A. fabae-complex, whereas it is the preferred host plant of A. rumicis. However, although A. rumicis was larger in size than the other aphid taxa, the larger amount of resources in this species did not positively influence larval development of L. testaceipes. In contrast, total time of development lasted about 5 d longer than in the most preferred taxa. Therefore, quantity of resources can be ruled out as responsible for the observed differences in the development of larvae of L. testaceipes. In conclusion, patterns of host acceptance and host suitability of different members of the A. fabae-complex for L. testaceipes and L. fabarum are related to differences in the physiology of these hosts and not to visual or external chemical cues. Host plant shifts in aphid taxa may be accompanied by different physiological states. Aphidiine parasitoids which are adapted to particular aphid hosts may not be able to locate the same hosts on new host plants, or immediately adapt to the different internal host environment . If this assumption is true, not only for the parasitoid species tested in our study, but also for other species normally encountered in colonies of A. fabae, the ability to use new host plants may provide these aphid taxa with an enemy free space (Jeffries & Lawton 1984).

Acknowledgements We thank Dr. A. F. G. Dixon and an anonymous reviewer for comments on an earlier draft of this paper. A. H. was funded by the Deutsche Forschungsgemeinschaft (Vi 117/4-1) and S. V. by a travel grant (Vi 117/7-1) to Canberra.



References Adams, D. & Douglas, A. E. (1997) How symbiotic bacteria influence plant utilisation by the polyphagous aphid, Aphis fabae. Oecologia 110: 528-532. Ankersmit, G. W., Bell C., Dijkman H., Mace N., Rietstra S., Schröder J. & de Visser C. (1986) Incidence of parasitism by Aphidius rhopalosiphi in colour forms of the aphid Sitobion avenae. Entomologica Experimentalis et Applicata 40: 223-229. Battaglia, D., Pennacchio F., Marincola, G. & Tranfaglia, A. (1993) Cornicle secretion of Acyrthosiphon pisum (Homoptera: Aphididae) as a contact kairomone for the parasitoid Aphidius ervi (Hymenoptera: Braconidae). European Journal of Entomology 90: 423- 428. Bouchard, Y. & Cloutier C. (1985) Role of olfaction in host finding by aphid parasitoid Aphidius nigripes (Hymenoptera: Aphidiidae). Journal of Chemical Ecology 11: 801-808. Budenberg, W. J. (1990) Honeydew as a contact kairomone for aphid parasitoids. Entomologica Experimentalis et Applicata 55: 139-148. Callow, R. K., Greenway, A. R. & Griffith, D. C. (1973) Chemistry of the secretion from the cornicles of various species of aphids. Journal of Insect Physiology 19: 737-748. Couchman, J. R. & King, P. E. (1977) Morphology of the larval stages of Diaeretiella rapae (M’Intosh) (Hymenoptera: Aphidiidae). International Journal of Insect Morphology & Embryology 6: 127-136. Dixon, A. F. G. (1996) Aphid Ecology. Chapman & Hall, London. Elliot, N. C., French, B. W., Reed, D. K., Burd, J. D. & Kindler, S. D. (1994) Host species effects on parasitization by a syrian population of Diaeretiella rapae M’Intosh (Hymenoptera: Aphidiidae). The Canadian Entomologist 126: 1515-1517. Eastop, V. F. (1973) Deductions from the present day host plants of aphids and related insects. Symposium of the Royal entomological Society of London 6: 157-178. Fröhlich, G. (1991) Phytopathologie und Pflanzenschutz. 2. überarbeitete Auflage. Gustav Fischer, Jena. Gardner, S. M., Ward, S. A. & Dixon, A. F. G. (1984) Limitation of superparasitism by Aphidius rhopalosiphi: a consequence of aphid defense behaviour. Ecological Entomology 9: 149-155. Grasswitz, T. R. & Paine, T. D. (1992) Kairomonal effect of an aphid cornicle secretion on Lysiphlebus testaceipes. Journal of Insect Behavior 5: 447-457. Grasswitz, T. R. & Paine, T. D. (1993) Influence of physiological state and experience on the responsiveness of Lysiphlebus testaceipes (Cresson) (Hymenoptera, Aphidiidae) to aphid honeydew and to host plants. Journal of Insect Behavior 6: 511-528. Greenway, A. R. & Griffith, D. C. (1973) A comparison of triglycerides from aphids and their cornicle secretions. Journal of Insect Physiology 19: 1649-1655. Harvey, J. A., Harvey J. F. & Thompson, D. J. (1994) Flexible larval growth allows use of a range of host sizes by parasitoid wasps. Ecology 75: 1420-1428. Harvey, J. A., Harvey, J. F. & Thompson, D. J. (1995) The effect of host nutrition on growth and development of the parasitoid wasp Venturia canescens. Entomologica Experimentalis et Applicata 75: 213-220. Hight, S. C., Eikenbary, R. D., Miller, R. J. &. Starks, K. J. (1972) The greenbug and Lysiphlebus testaceipes. Environmental Entomology 1: 205-209. Hille Ris Lambers, D. (1966) Polymorphism in Aphididae. Annual Review of Entomology 11: 47-78. Jeffries, M. J. & Lawton J. H. (1984) Enemy free space and the structure of ecological communities. Biological Journal of the Linnean Society 23: 269-286.


Kainoh, Y. & Brown J. J. (1994) Amino acids as oviposition stimulants for the egg-larval parasitoid, Chelonus sp. near curvimaculatus (Hymenoptera: Braconidae). Biological Control 4: 22-25. Klingauf, F. (1967) Abwehr- und Meidereaktionen von Blattläusen (Aphididae) bei Bedrohung durch Räuber und Parasiten. Zeitschrift für Angewandte Entomologie 60: 269-317. Liepert, C. & Dettner, K. (1993) Recognition of aphid parasitoids by honeydew-collecting ants: The role of cuticular lipids in a chemical mimicry system. Journal of Chemical Ecology 19: 2143-2153. Mackauer, M. (1986) Growth and developmental interactions in some aphids and their hymenopterous parasites. Journal of Insect Physiology 32: 275-280. Mackauer, M., Michaud, J. P. & Völkl, W. (1996) Host choice by aphidiid parasitoids (Hymenoptera: Aphidiidae): host recognition, host quality, and host value. The Canadian Entomologist 128: 959-980. Michaud, J. P. & Mackauer, M. (1994) The use of visual cues in host evaluation by aphidiid wasps. I. Comparison between three Aphidius parasitoids of the pea aphid. Entomologica Experimentalis et Applicata 70: 273-283. Michaud, J. P. & Mackauer, M. (1995) The use of visual cues in host evaluation by aphidiid wasps. II. Comparison between Ephedrus californicus, Monoctonus paulensis, and Praon pequodorum. Entomologica Experimentalis et Applicata 74: 267-275. Moran N. A. (1992) The evolution of aphid life cycles. Annual Review of Entomology 37: 321-348. Müller, F. P. (1982) Das Problem Aphis fabae. Zeitschrift für Angewandte Entomologie 94: 432446. Pennacchio, F. M., Digilio, C. & Tremblay, A. (1994) Host recognition and acceptance behaviour in two aphid parasitoid species: Aphidius ervi and Aphidius microlophii. Bulletin of Entomological Research 84: 57-64. Salto, C. E., Eikenbary, R. D. & Starks, K. J. (1983) Compatibility of Lysiphlebus testaceipes (Hymenoptera: Braconidae) with Greenbug (Homoptera: Aphididae) Biotypes “C” and “E” reared on susceptible and resistent oat varieties. Environmental Entomology 12: 603-604. Sequeira, R. & Mackauer, M. (1992) Nutritional ecology of an insect host-parasitoid association: the pea aphid-Aphidius ervi system. Ecology 73: 183-189. Sheehan, W. & Shelton, A. M. (1989) The role of experience in plant foraging by the aphid parasitoid Diaeretiella rapae (Hymenoptera: Aphidiidae). Journal of Insect Behavior 2: 743-759. Sokal, R. R. & Rohlf, F. J. (1995) Biometry. 3rd Edition. Freeman & Co., New York. Srivastava, M. (1987) Nutritional physiology. pp. 99-121. In Minks, A. K. & Harrewijn, P. (Ed.), World Crop Pests, 2A. Aphids: Their Biology, Natural Enemies and Control. Elsevier, Amsterdam. Srivastava, M. & Singh, R. (1988) Bionomics of Trioxys indicus, an aphidiid parasitoid of Aphis craccivora. 26. Impact of host extract on the oviposition response of the parasitoid. Biological Agriculture and Horticulture 5: 169-176. Stary P., Lyon, J. P. & Leclant, F. (1988) Biocontrol of aphids by the introduced Lysiphlebus testaceipes (Cress.)(Hym., Aphidiidae) in Mediterranean France. Journal of Applied Entomology 105: 74-87. Thieme, T. (1988) Zur Biologie von Aphis fabae mordwilkowi Börner und Janisch, 1922 (Hom., Aphididae). Journal of Applied Entomology 105: 510-515. van Steenis, M. J. (1994) Intrinsic rate of increase of Lysiphlebus testaceipes Cresson (Hym.; Braconidae), a parasitoid of Aphis gossypii Glover (Hom., Aphididae) at different temperatures. Journal of Applied Entomology 118: 399-406.



Vinson, S. B. (1976) Host selection by insect parasitoids. Annual Review of Entomology 21: 109133. Völkl, W. (1991) Species-specific larval instar preferences and aphid defence behaviour in three parasitoids of Aphis fabae. pp. 73-78. In Polgar, L., Chambers, R. J., Dixon, A. F. G. & Hoder, I. (Eds), Behaviour and Impact of Aphidophaga. SPB Academic, The Hague. Völk, W. & Stechmann D. H. (1998) Parasitism of the black bean aphid (Aphis fabae) by Lysiphlebus fabarum (Hym., Aphidiidae): the influence of host plant and habitat. Journal of Applied Entomology 122: 201-206. Weisser, W. W. (1994) Age-dependent foraging behaviour and host-instar preference of the aphid parasitoid Lysiphlebus testaceipes. Entomologica Experimentalis et Applicata 70: 1-10. Wilbert, H. (1965) Die Größenvariabilität von Aphelinus semiflavus Howard (Hym., Aphelinidae) und ihre Ursachen. Zeitschrift für Pflanzenkrankheiten und Pflanzenschutz 72: 670-684.

Size and Asymmetry as Quality Control Indicators in Trichogramma spp. (Hymenoptera: Trichogrammatidae) D. M. Bennett, S. Hewa-Kapuge and A. A. Hoffmann Centre for Environmental Stress and Adaptation Research, La Trobe University, Bundoora, Victoria 3083 Australia (email: [email protected])

Introduction Wasps of the genus Trichogramma Westwood are effective in parasitising eggs of many lepidopteran pest species, and have been subjected to extensive use as an inundative release agent, but not always with consistent results. Overseas experience indicates that the inadequacy of mass rearing procedures (Bigler et al. 1987; Hassan & Guo 1991) and the use of inappropriate strains may have been the reason for failures in control programs. Therefore, identification of a suitable strain and determining ways in which the quality of mass reared wasp is maintained in a commercial production facility is particularly important (Wajnberg & Hassan 1994; Smith 1996). Here we consider ways of identifying quality of wasps in two species, Trichogramma nr. brassicae (Bezdenko) and Trichogramma (Trichogrammanza) carverae (Oatman & Pinto). Trichogramma nr. brassicae (previously known as T. nr. ivelae Pang & Chen) is an egg parasitoid of budworm, Helicoverpa punctigera (Wallengren) (Noctuidae) in tomatoes, and effectively controls the host toward the end of the crop season (Bentley et al. 1996). However, control during the early season is inadequate, highlighting the importance of developing a suitable wasp strain as an inundative release agent. Early field trials conducted using commercial strains of T. nr. brassicae in Australia have given mixed results, sometimes with extremely poor rates of parasitism. Trichogramma carverae is an effective control agent for light brown apple moth, Epiphyas postvittana (Walker) (Tortricidae), particularly in vineyards (Glenn & Hoffmann 1997). Field trials have indicated that high rates of parasitism are possible (Glenn & Hoffmann 1997), although variable results have been achieved commercially. An obvious quality measure potentially useful in parasitoid wasps is adult body size. Many studies have established positive associations between size and standard laboratory fitness measures (see Godfray 1994). More recently, studies have addressed the impact of size on field fitness by comparing the size distributions of wasps at emergence sites and at oviposition sites (Visser 1994; Kazmer & Luck 1995; West et al. 1996). As the ability to find hosts may depend on size, the difference between emergence and ovipositing female size distributions could give an indication of the degree of selection on size. Kazmer and Luck (1995) used this approach to show that in the egg parasitoid, Trichogramma pretiosum (Riley), host location success increased with size in smaller females but reached a plateau in larger females. Another potentially useful indicator of quality is fluctuating asymmetry. Fluctuating asymmetry refers to the absolute difference in measures taken on both sides of a bilaterally symmetrical organism and is assumed to reflect the degree of developmental buffering against environmental

371

D. M. Bennett, S. Hewa-Kapuge and A. A. Hoffmann 372


disturbances. Previous studies of fluctuating asymmetry in animals have shown that it may be associated with components of fitness (Møller 1990, 1992; Thornhill 1992; Thornhill & Sauer 1992; Harvey & Walsh 1993). We are unaware of previous studies on parasitoids linking fluctuating asymmetry to fitness, although it has been postulated (Clarke & McKenzie 1992) that asymmetry should be a good quality indicator for insects such as Trichogramma spp. that are mass reared commercially. Here the relationship between fitness and both size and asymmetry measurements is considered in T. carverae and T. nr. brassicae. We ask the following questions: 1) is size and asymmetry correlated with the successful location in the field of egg masses of E. postvittana by T. carverae? These experiments are only described briefly because details are provided elsewhere (Bennett & Hoffmann 1998); and 2) is size and asymmetry correlated with the location of H. punctigera eggs in a glasshouse by T. nr. brassicae? We focused on a glasshouse because with high background parasitism levels, it is almost impossible to examine quality control measures in this species in field tomatoes.

Materials and Methods Trichogramma nr. brassicae Strains of T. nr. brassicae were collected from H. punctigera eggs placed in tomato paddocks in Victoria and southern New South Wales. Nineteen isofemale lines were collected and combined to form a genetically heterogeneous mass-bred population. This stock was raised on Sitotroga cerealella (Olivier) (Gelechiidae) for two generations before a sample was taken from the population prior to releasing wasps into the glasshouse. Females found ovipositing on H. punctigera eggs laid on the potted tomato plants were collected for comparison with the sample of wasps taken pre-release. Using a dissecting microscope, individual wasps from both samples were mounted dorso-ventrally on slides with Hoyer’s mounting medium and held in place with a cover slip. An image analysis system (Trace) linked to a Zeiss compound microscope fitted with a Panasonic digital colour video camera (Model WV-CP610/A) was used to measure size and asymmetry. We obtained six size measurements from females. These were length of the apical antennal segment (ANL), length of the hind tibia (HTL), two indices of forewing length (FWLa, FWLb), width of the forewing (FWW), and width of the head (HDW). The wing measures are illustrated in Figure 1. All of these size measures except HDW and ANL were recorded for both sides of the body to provide asymmetry data. In addition, five meristic traits were obtained from the forewings for FA analyses. These consisted of counts of setae along the wing veins and wing margins (see Fig. 1). The asymmetry of each trait was measured as the signed (R-L) difference. FA is the absolute value of this measure. The repeatability of all FA measures was first examined using the procedure outlined in Palmer (1994). All asymmetry measures were also used to construct a total FA for each individual. Following Woods et al. (1998), this composite index involved standardising all FA measures (leading to a mean of 0 and variance of 1) prior to summing the standardised measures. This approach ensures that all traits are weighted equally when estimating the total FA of an individual.

Trichogramma carverae Parasitised eggs of E. postvittana were used to collect T. carverae from Chardonnay vines. Fourteen isofemale strains from Sunraysia founded the heterogeneous stock, which was maintained on eggs

Size and Asymmetry as Quality Control Indicators in Trichogramma spp. 373

1 2 3

S5 S4

S3 S1 S2 Figure 1

Forewing of female Trichogramma nr. brassicae showing traits measured (the head of the wasp is facing towards the bottom of the page): A) 1 = measure of wing width (FWW), 2 = measure of wing length (FWLa), 3 = measure of wing length (= FWLb); B) setal counts, along the wing veins (S1, S2) and along the wing margin (S3, S4, S5). All traits were scored on both wings to provide a measure of wing FA.

of the grain moth S. cerealella. To test effects of size and asymmetry on field parasitism, releases were conducted in 12-year old, non-irrigated Chardonnay vines with each spot release surrounded by 45 oviposition sites, each containing an E. postvittana egg mass. Prior to release, we collected and measured a sample of wasps emerging from the parasitised S. cerealella eggs. Natural parasitism in the vineyard was tested by placing a total of 120 egg masses laid on strips of plastic by the E. postvittana laboratory culture (see Glenn & Hoffmann 1997; Bennett & Hoffmann 1998), in the vines before and during the trial. During the trials these egg cards, identical to those used in the experiment as collection points, were placed in the opposite half of the vineyard to the wasp release points. As no parasitism was recorded, it can be assumed that the only Trichogramma spp. in the vineyard were the released T. carverae. Wasps ovipositing on the eggs surrounding the release points were collected and measured for size and asymmetry. We obtained six size measures from the female wasps, but these were not all identical to the traits measured on T. nr. brassicae. The traits were HTL, HDW, FWW (all as above), FWLc (similar to FWLa), hind wing length (HWL), and body length from the anterior edge of the thorax to the posterior edge of the abdomen (BDL). Repeat measures on these traits for 30 wasps

D. M. Bennett, S. Hewa-Kapuge and A. A. Hoffmann 374


Table 1 Results of separate variance t-tests on size measures on Trichogramma spp. to investigate the effects of size on fitness (avalues remain significant at the 5% level even when corrections are made for multiple comparisons with the Dunn-Sidák method (Sokal & Rohlf 1995).

Trait

Pre-release mean

Ovipositing mean t-stat (d.f.)

P (2-tail)

F-stat (d.f.)

P

7.62 (52,45)

0.007a

T. nr. brassicae HTL

0.1410

0.1409

-0.11 (79.28)

0.915

HDW

0.1742

0.2064

13.39 (79.36)

Hymenoptera: Evolution, Biodiversity and Biological Control

Genetics, Evolution and Biological Control

Plant Genome. Biodiversity and Evolution

Hymenoptera

Hymenoptera

Handbook of Biological Control: Principles and Applications of Biological Control

Hymenoptera

Biological Evolution and Statistical Physics

Biological Evolution and Statistical Physics

Evolution: Cosmic, Biological, and Social

Biological evolution and statistical physics

Evolution of Biological Diversity

Plant Genome: Biodiversity and Evolution: Lower Groups

Conservation Biological Control

Biological Control: (Cabi International)

Biological Control of Rice Diseases (Progress in Biological Control, 8)

Plant Defence: Biological Control (Progress in Biological Control)

Biological Control of Vertebrate Pests:

Biological Control: A Global Perspective

BIOLOGY AND BIOLOGICAL CONTROL KNAPWEED OF

Dynamic Models and Control of Biological Systems

Insect Control: Biological and Synthetic Agents

Theoretical Approaches to Biological Control

Biological and Biotechnological Control of Insect Pests

Regulation of Biological Control Agents

Nematodes as Biological Control Agents

Quality Control and Production of Biological Control Agents

An Ecological and Societal Approach to Biological Control (Progress in Biological Control)

Trophic and Guild Interactions in Biological Control (Progress in Biological Control)

Management, Control, and Evolution of IP Networks

Hymenoptera: Evolution, Biodiversity and Biological Control

Genetics, Evolution and Biological Control

Plant Genome. Biodiversity and Evolution

Hymenoptera

Hymenoptera

Handbook of Biological Control: Principles and Applications of Biological Control

Hymenoptera

Biological Evolution and Statistical Physics

Biological Evolution and Statistical Physics

Evolution: Cosmic, Biological, and Social

Biological evolution and statistical physics

Evolution of Biological Diversity

Plant Genome: Biodiversity and Evolution: Lower Groups

Conservation Biological Control

Biological Control: (Cabi International)

Biological Control of Rice Diseases (Progress in Biological Control, 8)

Plant Defence: Biological Control (Progress in Biological Control)

Biological Control of Vertebrate Pests:

Biological Control: A Global Perspective

BIOLOGY AND BIOLOGICAL CONTROL KNAPWEED OF

Dynamic Models and Control of Biological Systems

Insect Control: Biological and Synthetic Agents

Theoretical Approaches to Biological Control

Biological and Biotechnological Control of Insect Pests

Regulation of Biological Control Agents

Nematodes as Biological Control Agents

Quality Control and Production of Biological Control Agents

An Ecological and Societal Approach to Biological Control (Progress in Biological Control)

Trophic and Guild Interactions in Biological Control (Progress in Biological Control)

Management, Control, and Evolution of IP Networks

Recommend Documents