High Pressure Bioscience and Biotechnology: Proceedings of the International Conference (Progress in Biotechnology)

HIGH PRESSURE BIOSCIENCE AND BIOTECHNOLOGY

Progress in Biotechnology Volume 1 New Approaches to Research on Cereal Carbohydrates (Hill and Munck, Editors) Volume 2 Biology of Anaerobic Bacteria (Dubourguier et al., Editors) Volume 3 Modifications and Applications of Industrial Polysaccharides (Yalpani, Editor) Volume 4 lnterbiotech '87. Enzyme Technologies (Blafej and Zemek, Editors) Volume 5 In Vitro Immunization in Hybridoma Technology (Borrebaeck, Editor) Volume 6 lnterbiotech '89. Mathematical Modelling in Biotechnology (Blafej and Ottova, Editors) Volume 7 Xylans and Xylanases (Visser et al., Editors) Volume 8 Biocatalysis in Non-Conventional Media (Tramper et al., Editors) Volume 9 ECB6: Proceedings of the 6th European Congress on Biotechnology (Alberghina et al., Editors) Volume 10 Carbohydrate Bioengineering (Petersen et al., Editors) Volume 11 Immobilized Cells: Basics and Applications (Wijffels et al., Editors) Volume 12 Enzymes for Carbohydrate Engineering (Kwan-Hwa Park et al., Editors) Volume 13 High Pressure Bioscience and Biotechnology (Hayashi and Balny, Editors)

The illustration on the cover is a classical script of a Chinese character (kanji) which means "pressure". Kanji is used in a wide area of Asia including Japan.

Progress in Biotechnology 13

HIGH PRESSURE BIOSCIENCE AND BIOTECHNOLOGY Proceedings of the International Conference on High Pressure Bioscience and Biotechnology, Kyoto, Japan November 5-9, 1995

Edited by R. Hayashi

Department of Agricultural Chemistry, Faculty of Agriculture, Kyoto University, Kyoto, Japan

C. Balny

lnstitut National de la Sante et de la Recherche Medicale, INSERM U128, Montpellier, France

ELSEVIER Amsterdam Lausanne - New York - Oxford - Shannon Tokyo 1996

-

-

Published by: Elsevier Science B.V. P.O. Box 21 1 1000 AE Amsterdam The Netherlands

ISBN 0-444-82555-X 01996 Elsevier Science B.V. All rights reserved. No part of this publication may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic, mechanical, photocopying, recording or otherwise without the prior written permission of the publisher, Elsevier Science B.V., Permissions Department, P.O. Box 521,1000 AM Amsterdam, The Netherlands. No responsibility is assumed by the Publisher for any injury and/or damage to persons or property as a matter of products liability, negligence or otherwise, or from use or operation of any methods, products, instructions or ideas contained in the material herein. Because of rapid advances in the medical sciences, the Publisher recommends that independent verification of diagnoses and drug dosages should be made. Special regulations for readers in the USA - This publication has been registered with the Copyright Clearance Center Inc. (CCC), 222 Rosewood Drive, Danvers, MA 01293, USA. Information can be obtained from the CCC about conditions under which photocopies of parts of this publication may be made in the USA. All other copyright questions, including photocopying outside the USA should be referred to the copyright owner, Elsevier Science B.V., unless otherwise specified. This book is printed on acid-free paper. Printed in the Netherlands

PREFACE In the past, many conferences devoted to differem aspects of high pressure and biological science have been separately organized. Domestic symposia in Japan organized by the High Pressure Research Group in the biologically related fields have been held every year since 1989. These symposia have helded to promote the sale of high pressure preserved foods. The idea of having joint Japanese and European meetings on High Pressure and Bioscience was elaborated four years ago by a small group of scientists ; it was formalized during the First European Seminar on High Pressure and Biotechnology, a joint meeting with the Fifth Symposium on High Pressure and Food Science of Japanese Group held in La Grande-Motte, France, September 1992, organized by C. Balny, R. Hayashi, K. Heremans and P. Masson. This last Conference, together with the publication of the proceedings (High Pressure and Biotechnology, edited by C. Balny, R. Hayashi, K. Heremans and P. Masson, INSERM / J. Libbey Eurotext), stimulated further research and contact between the industry and the academic world for all aspects of the application of the high pressure parameter to biological material. The second consequence of these scientific contacts was the organization by researchers in Japan and Europe of the first International Conference on High Pressure Bioscience and Biotechnology held in Kyoto, November 1995 (Chairman, R. Hayashi) followed by the publication of the present proceedings. One aim of the editors is the same as for the publication of the proceedings of the first joint meeting : to promote the possibility of applying pressure in specific biotechnological areas, not only for food processing but also for biotechnology in general. There has been progress in the use of high pressures which has led to the manufacture of high pressure-processed foods. There has also been the development of both processes and equipment. It must be remember that R & D in the use of high pressure has been based on the principles of traditional physical chemistry and chemical technology over the past few years. Integration of the knowledge gained in this way would permit us to find many new applications for processing biological materials in the fields of medicine and pharmacy as well as food. Few pharmaceutical or biomedical applications of this technology have been reported so far. In the future high pressure might be used in the preservation of pharmaceuticals, blood derivative and transplant organs. For many years, pressure was disregarded by biochemists. There was an absence of general idea of what pressure could add to the understanding of the behavior of biomolecules. The situation is now different. There is a growing interest on the part of researchers to introduce pressure as a variable acting on biosystems. We hope that in presenting the up - to - date state of the art view of high pressure research, these proceedings will contribute to future developments. The Editors

This Page Intentionally Left Blank

EDITORS EWumaru Hayashi Claude Balny

Kyoto University, Kyoto, Japan Institut National de la Sante et de la Recherche Medicale, INSERM U 128, Montpellier, France

CO-EDITORS Shgeru Kunugi Atsushi Suzuki Katsuhiro Yamarnoto Karel Heremans Patrick Masson

Kyoto Institute of Technology, Kyoto, Japan Niigata University, Niigata, Japan Rakuno Gakuen University, Hokkaido, Japan Katholieke University Leuven, Leuven, Belgium Centre de Recherches du Service de Sante des Armees, La Tronche, Grenoble, France

This Page Intentionally Left Blank

ORGANIZING COMMITTEE R. Hayashi (Chairman) C. Balny K. Heremans S. Kunugi P. Masson A. Suzuki K. Yamamoto

Kyoto Univ., Kyoto, Japan INSERM, Monpellier, France Katholieke Univ. Leuven, Leuven, Belgium Kyoto Inst.Technol., Kyoto, Japan CRSSA, La Tronche, Grenoble, France Niigata Univ., Niigata, Japan Rakuno Gakuen Univ., Hokkaido, Japan

SCIENTIFIC COMMITTEE J.- C. Cheftel G. Demazeau J. Frank K. Gekko G. Herve D. Knorr S. Kaneshina H. Ludwig M. Nakahara A. Noguchi M. Osumi R. Winter

Univ. Monpellier, France Univ. Bordeaux, France Univ. Delft, Delft, The Netherlands Hiroshima Univ., Hiroshima, Japan CNRS, Paris, France Univ. Technol. Berlin, Berlin, Germany Tokushima Univ., Tokushima, Japan Univ. Heidelberg, Heidelberg, Germany Kyoto Univ., Kyoto, Japan Natl. Food Res. Inst. of MAFF ; Tsukuba Univ., Japan Japan Women's Univ., Tokyo, Japan Univ. Dortmund, Germany

ADVISORY COMMITTEE M. Fujimaki

H. Horikoshi S. Kimura

N. Ogasawara (deceased) Y. Okami T. Ooi K. Suzuki T. Watanabe

Emeritus Prof. of Tokyo Univ.; Former President, Ochanomizu Univ., Japan Japan Marine Science & Technol. Center, Japan Japan School Baking, Japan; Former Director, Natl. Food Res. Inst. of MAFF Emeritus Prof., Niigata Univ., Japan Inst. of Microbial. Chem., Japan Kyoto Women's Univ.; Emeritus Prof., Kyoto Univ., Japan Emeritus Prof., Ritsumeikan Univ., Japan Tokyo Metropolitan Food Technol. Res. Center ; Former Director. Natl. Food Res. Inst. of MAFF

This Page Intentionally Left Blank

xi THE CONFERENCE HAS BEEN SUPPORTED BY : The Joint Japanese & European Research Group of High Pressure Bioscience & Food Science The Japanese Society for Bioscience, Biotechnology and Agrochemistry The Japanese Biochemical Society Institut National de la Sant6 et de la Recherche Mrdicale, France French Ministry of Foreign Office, French Embassy in Japan The Commemorative Association for the Japan World Exposition (1970)

ACKNOWLEDGEMENTS : We express our gratitude and special appreciation to Ms. Setsuko Yasui, Congress secretariat, and to Dr. Hiroshi Ueno, Dr. Shogo Ozawa and Mrs. Fukuko Suzuki, Biopolymer Laboratory, Department of Agricultural Chemistry, Faculty of Agriculture, Kyoto University.

The publication of this book was partly supported by Grant-in Aid No. 80012 for the publication of Scientific Research Results, from the Ministry of Education, Science, Sports and Culture of Japan

This Page Intentionally Left Blank

...

XI11

CONTENTS

V

PREFACE

xi

ACKNOWLEDGEMENTS

I - OVERVIEWS 1

Use of high pressure in bioscience and biotechnology R Hayashi

7

Future prospects in high pressure basic bioscience C. Balny

17

Deep-sea microbial research and its aspect to high pressure biotechnology C. Kato & K. Horikoshi

JI - BIOCHEMISTRY AND MOLECULAR BIOLOGY 21

High pressure effects on the structure and mesophase behaviour of supramolecular lipid aggregates and model membrane systems R Winter

29

High pressure sensing and adaptation in the deep-sea bacterium Photobacterium species strain SS9 D.H. Bartlett, E. Chi & T.J. Welch

37

Morphological effects of pressure stress on yeasts M. Osumi, M. Sato, H. Kobori, Z.H. Feng, S.A. Ishijima, K Hamada & S. Shimada

47

Biological analogy between hydrostatic pressure and temperature H. Iwahashi, K.Obuchi, S. Fujii, K. Fujita & Y. Komatsu

x iv

53

Vacuolar acidification under high hydrostatic pressure in Saccharomyces cerevisiae F. Abe & K. Horikoshi

59

Gene expression under high pressure C. Kato & K. Horikoshi

67

Effects of hydrostatic pressure on photosynthetic activities in thylakiods M. Yuasa

73

Effect of hydrostatic pressure on the proliferation and morphology of the mouse BALB/ c cells in culture T. Naganuma, T. Mizukoshi, K. Tsukamoto, R. Usami & K. Horikoshi

79

Influence of hydrostatic pressure on expression of heat shock protein 70 and matrix synthesis in chondrocytes K. Takahashi, T. Kubo, Y. Arai, Y. Hirasawa, J. Imanishi, K. Kobayashi & M. Takigawa

83

Changes of microfilaments and microtubules of yeasts induced by pressure stress H. Kobori, M. Sato, A. Tameike, K. Hamada, S. Shimada & M. Osumi

95

Direct induction of homozygous diploidization in the fission yeast Schizosaccharomyces pombe by pressure stress K. Hamada, Y. Nakatomi, M. Osumi & S. Shimada

101

Acquisition of stress tolerance by pressure shock treatment in yeast M. Miyashita, K. Tamura & H. Iwahashi

105

High pressure denatured metalloprotein is a new NO - trapper T. Oku, K. Umezawa, T. Nishio, H. Ogihara, Y. Ichikawa, N. Takamatsu, H. Ishikawa, H. Tsuyuki & N. Yano

109

Ultrastructural effects of pressure stress to Saccharomyces cerevisiae cell revealed by immunoelectron microscopy using frozen thin sectioning M. Sato, A. Tameike, H. Kobori, S. Shimada, Z.H. Feng, S.A. Ishijima & M. Osumi

xv 113

Biological stimulation of low-power He-Ne laser on yeast under high pressure S. Kishioka, K. Tamura & M. Miyashita

I11 - HIGH PRESSURE EFFECTS ON BIOLOGICAL STRUCTURES 1. Proteins 117

Pressure - induced molten globule states of proteins P. Masson & C. ClCry

127

Pressure versus temperature behaviour of proteins: FT-IR studies with the diamond anvil cell K. Heremans, P. Rubens, L. Smeller, G. Vermeulen & K. Goossens

135

Pressure induced protein structural changes as sensed by 4th derivative UV spectroscopy R. Lange, N Bec, J. Frank and C. Balny

.

141

High pressure N M R study of protein unfolding T. Yamaguchi, H. Yamada & K. Akasaka

147

Compressibility-structure relationships of protein : Compactness of denatured ribonuclease A K. Gekko

153

Structure of pressure-induced "denatured" state of proteins N.Tanaka & S. Kunugi

157

Finite element study of protein structure under high pressure T. Yamato

163

Pressure-induced dissociation of beef liver L-glutamate dehydrogenase G. Tang & K. Ruan

167

Mechanism of pressure denaturation of BPTI B. Wroblowski, J.F. Diaz, K , Heremans & Y. Engelborghs

xvi

171

Thermal inactivating behavior of Bacillus stearothermophilus under high pressure K. Kakugawa, T. Okazaki, S. Yamauchi, K. Morimoto, T. Yoneda & K. Suzuki

2. Others 175

Effect of pressure on the phase behaviour of ester - and ether - linked phospholipid bilayer membranes S. Kaneshina, S. Maruyama & H. Matsuki

181

Kinetics and mechanisms of lamellar and non-lamellar phase transitions in aqueous lipid dispersions J. Erbes, G. Rapp & R. Winter

185

Similar characteristics of bacterial death caused by high temperature and high pressure: Involvement of the membrane fluidity T. Tsuchido, K. Miyake, M. Hayashi & K. Tamura

189

Structure and function of nucleic acids under high pressure A. Knyzaniak, P. Salanski, R.W. Adamiak, J. Jurczak & J. Barciszewski

IV - ENZYMES 195

Stabilization of thermophile enzymes by pressure D. Clark, M. M. Sun, L. Giarto, P.C. Michels, A. Matschiner & F.T. Robb

203

Enzyme stability under high pressure and temperature S. De Cordt, L. Ludikhuyze, C. Weemaes, M. Hendrickx, K. Heremans & P.Tobback

209

Catalytic properities of proteinases under high pressure S. Kunugi , Y. Kanazawa, K.Mano, A. Koyasu & T. Inagaki

215

Pressure effects on the stabililty and reactivity of methanol dehydrogenase J. Frank, N. Bec, H.A.L. Corstjens, R Lange & C. Balny

22 1

Modulation of enzyme activity and stability by high pressure : a - chymotrypsin V.V. Mozhaev, E.V. Kudryashova, & N. Bec

xvii

227

Effects of hydrostatic pressure on catalytic activity and stability of two alcohol dehydrogenases S. Dallet & M.D. Legoy

23 1

Thermodynamics of transient enzyme kinetics C. Balny

V - MICROORGANISMS 237

High Pressure inactivation of microorganisms H. Ludwig, G. Van Almsick & B.Sojka

245

Saccharides protect yeast against pressure correlated to the mean number of equatorial OH group S. Fujii, K. Obuchi, H. Iwahashi, T. Fujii & Y. Komatsu

253

Inactivation of bacterial spores in phosphate buffer and in vegetable cream treated with high pressure S. Gola, C. Fornari, G. Carpi, A. Maggi, A.Cassara & P. Rovere

26 1

Behaviour of Escherichia coli under high pressure K. Tamura, Y. Muramoto, M. Miyashita & H. Kourai

267

High pressure inactivation in foods of animal origin M.F. Patterson, M. Quinn, R.K.Simpson & A. Gilmour

273

Inactivation of HIV in blood plasma by high hydrostatic pressure T. Shigehisa, T. Nakagami, H. Ohno, T. Otake, H. Mori, T. Kawahata, M. Morimoto & N. Ueba

VI - FOOD SCIENCE 1. Reviews

279

Advantages, opportunities and challenges of high hydrostatic pressure application to food systems D. Knorr

xviii

289

Understanding the pressure effects on postmortem muscle A. Suzuki, K. Kim & Y. Ikeuchi

299

Effects of high pressure on dairy proteins : a review J.C. Cheftel, E. Dumay

2. Meats 309

Changes in myosin molecule and its proteolytic subfragments induced by high hydrostatic pressure K. Yamamoto

315

Dynamic rheological behaviour and biochemical properties of pressurized actomyosin Y. Ikeuchi, H. Tanji, K. Kim, N. Takeda, T. Kakimoto & A. Suzuki

323

The effect of high pressure on skeletal muscle myofibrils and myosin A. J.McArthur & P. Wilding

327

Effect of high pressure treatment on proteolytic system in meat N. Homma, Y. Ikeuchi & A. Suzuki

3. Milk and eggs

33 1

High pressure effects on emulsified fats W. Buchheim, M. Schutt & E. Frede

337

High pressure treatment of whey protein / polysacchride systems P. B. Fernandes & A. Raemy

343

Time-resolved turbidimetric measurements during gelation process of egg white under high pressure H. Kanaya, K. Hara, A. Nakamura & N. Hiramatsu

347

High pressure effects on the colloidal calcium phosphate and the structural integrity of micellar casein in milk K. Schrader, C.V. Morr & W. Buchheim

xix

4. Fishes 351

High pressure effects on fish lipid degradation: Myoglobin change and water holding capacity S. W ada & Y. Ogawa

357

Gelation of surimi pastes treated by high isostatic pressure T.C. Lanier

363

Effect of water-soluble protein on pressure-induced gelation of Alaska pollack surimi E. Okazaki & Y. Fukuda

369

Application of high pressurization to fish meat: Changes in physical properties of carp skeletal muscle resulting from high pressure thawing K. Yoshioka, A. Yamada & T. Maki

375

Thermal and rheological properties of pressurized carp meat N. Iso, M. Horie, H. Mizuno, H. Ogawa, Y. Mochizuki & T. Mihori

5. Plant foods 379

Effect of pressure-shift freezing on texture, pectic composition and histological structure of carrots M. Fuchigami ,N. Katoh & A. Teramoto

3 87

Technique of quality control for Sudachi (Citrus Sudachi Hort. ex Shirai) juice by high pressure treatment A. Iuchi, K. Hayashi, K. Tamura, T. Kono, M. Miyashita & S.K. Chakraborty

391

Effect of hydrostatic pressure on the sterilization of tomato juice T. Sato, T. Inakuma & Y. Ishiguro

397

High pressure treatment for Nozawunazuke (salt vegetable) preseravation T. Kuribayashi, K. Ohsawa, S. Takanami & K. Kurokouchi

xx

401

Stabilization of black truffle of Perigord (Tuber melanosporum ) by high pressure treatment A.El Moueffak, C. Cruz, M. Montury, A. Deschamps, A. Largeteau & G. Demazeau

405

Preparation of salt-free miso and its high pressure treatment for reservation K. Hayakawa, Y. Ueno, S. Kawamura, Y. Miyano, S. Kikusima, S. Shou & R Hayashi

41 1

Texture and cryo-scanning electron micrographs of pressure-shift frozen tofu M. Fuchigami & A. Teramoto

6. Sterilization

415

Combined effects of temperature and pressure on inactivation of heat-resistant bacteria T. Okazaki, K. Kakugawa, S. Yamauchi, T. Yoneda & K. Suzuki

419

Sterilization of yeast by high pressure treatment Y. Aoyama, M. Asaka, R. Nakanishi & K. Murai

423

High pressure inactivation of yeast cells in saline and strawberry jam at low temperatures C. Hashizume, K. Kimura & R Hayashi

429

Application of high pressure for sterilization of low acid food K. Kimura, M. Ida, Y. Yosida, K. Ohki & M. Onomoto

7. Technical developments

433

Comparative study of thermal and high pressure treatment upon wheat starch suspensions J.P. Douzals, P.A. MarCchal, J.C. Coquille & P. Gervais

439

Modeling of high pressure thawing J.M. Chourot, R Lemaire, G. Cornier & A. Le Bail

xxi

445

HPP strawberry products : an example of processing line P. Rovere, G. Carpi, S. Gola, G. Dall'Aglio & A. Maggi

45 1

Measurement of the gel-point temperature under high pressure by a hot-wire method K. Shimada, Y. Sakai, K. Nagamatsu, T. Hori & R Hayashi

455

Continuous high pressure system for liquid food S. Itoh, Ka. Yoshioka, M. Terakawa & I. Nagano

463

Development of a pulsatile high pressure equipment S. Itoh, K. Yoshioka, M. Terakawa & I. Nagano

8. Miscellaneous

473

Behaviour of organic compounds in food under high pressure : Lipid peroxidation E. Kowalski, H. Ludwig &B. Tauscher

479

The effect of pressure on process modelling the Maillard reaction N.S. Isaacs & M. Coulson

485

The effects of high pressure on some mechanical and physical properties of wood M.Yashiro & K. Takahashi

MI - CONCLUDING REMARKS 491

Some reflections on a high pressure conference K. Heremans

493

LIST OF PARTICIPANTS

51 1

AUTHOR INDEX

5 15

SUBJECT INDEX

This Page Intentionally Left Blank

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

An overview of the use of high pressure in bioscience and biotechnology Rikimaru Hayashi Department of Agricultural Chemistry, Faculty of Agriculture, Kyoto University, Kitashirakawa, Sakyo-ku, Kyoto 606-01, Japan

Abstract

The successful application of pressure as a parameter in bioscience and biotechnology, the background, industrial establishment, and developmental activities of high pressure food in food processing in Japan, where it is widely recognized that the most notable progress has been made, is described. It is also emphasized that such progress is naturally extended to bioscience in general.

1. INTRODUCTION Observations of the effect of high pressure on biological materials and organisms can be traced back to the last century. High pressure treatment to kill bacteria was first described in 1895 by Royer. Hite and coworkers of the University of West Virginia reported the use of high pressure for the preservation of milk in 1899. Bridgman observed coagulation of egg white by high pressure treatment in 1914. Since these reports, research on the effect of high pressure on biological materials and living organisms have continued without interruption. However, it is surprising that attempts to apply high pressure to food science almost stopped for 70 years since the pioneering attempts of Hite and coworkers until recent break-throughs in Japan, where high pressure-processed foods have been successfully released on the food markets. This article describes development activities of high pressure food,

emphasizing that such progress can be naturally extended to bioscience in general.

2. DEMAND IN JAPANESE FOOD CONDITIONS

The most common process for food sterilization and processing today is thermal treatment. Modem food industries use increasinglyelevated temperatures over temperature range traditionally used in the home kitchen for such processes. It is generally appreciated that the severe conditions to which food materials are exposed may cause alterations on the natural taste and flavor of food and destruction of food nutrients such as vitamins or may even produce toxic compounds. When we started studies on the application of high pressure processes to food science and technology in 1986, 40 years had passed since the Second World War ended. The country was highly industrialized: the urban population increased to a majority, the rural population engaged in agricultural work decreased proportionally. This industrialization raised two problems for the food industries. Ironically, urban people favor traditional foods which are fixed deeply in Japanese culture taking long years though they take modem processed foods for convenience. Many such traditional foods are cooked scrupulously making the best use of the natural taste contained in the fresh food materials. The modem way of food processing in food industries does not necessarily fit to such elaborate foods. Another noticeable point with regard to food in Japan is the fact that the country can not attain self-sufficiency in food supply. Food industries have to continuously endeavor to improve technical developments in food transportation needed to import many foods from far countries whilst maintaining good quality and reasonable price. For example, freezing of fish for transportation is not sufficient for sashimi because of taste and texture deterioration brought about by the freezing and thawing processes. Food conditions in Japan clearly needed a principally new technique for food processing. As a concept, non-heating processes for sterilization and processing of food has been strongly desired by food manufactures. The proposition to introduce high pressure-processing technology to food

industries, thus, has been a matter of concern and interest in food industries, and high pressure techniques have been accepted smoothly as an inevitable technique in modem food industries.

3. DEVELOPMENT OF HIGH PRESSURE PROCESSING

In 1992, a major breakthrough came in Japan. Meidiya Food Company released high pressure-processed jams on the food market, followed by high pressure-processed fruit jellies and sauces. These products have strong but natural tastes and flavors and vivid color, which are regarded as the prominent merits of high pressure food processing. By the end of 1995, a total of seven food companies in Japan had released high pressure food products on the market. In addition to jams, juices, ice-cream, Japanese unrefined rice wine (Nigori-sake), and rice cakes containing herbs (yomogimochi) are on the market. Icenucleation bacteria sterilized by high pressure treatment are used for food processing. In order to meet the requirements of the food industry, high pressure equipment has to be constructed. Fortunately, the ceramic industry has utilized water compression to generate high pressure at large scales, called CIP. This machine has improved so as to attain fast pressurizing and depressurizing speeds, and to ensure the safety of the food products. Industrial equipment for high pressure processing of foods is operational in several food industries" a batchwise system of 10 to 50 litercapacity is used for the treatment of packed foods and a semi-continuous system of 1-4 ton per hour-capacity for the treatment of liquid foods. Small size test machines for high pressure treatment have been installed in more than 100 food companies and governmental institutions in Japan in recent years where they are used to perform research and development for new food products. In these machines, hydrostatic pressure of 400 MPa is directly applied to foods placed in the pressure vessel at high speed under the regulated temperature without any harmful contaminants. As the first step, high pressure has been used at room temperature without changing the pressurization temperature. Subsequently, it has

been learned that the combined use of high pressure (P) and temperature (T) can be effective in developing high quality foods. In other wards, independent use of P as the traditional use of high T or low T at ambient pressure has developed for pressurization at high or low temperature (P + T ) and pre-treatment by T followed by P treatments (T--~P) or vice versa (P-->T). Pressurization at high temperature has been found to be effective at killing the heat tolerant spores of bacteria. The use of high pressure at sub-zero temperatures is also of recent interest because treatment of biological materials including food materials at low temperature has many applications; it is particularly ideal for treating medically important organs.

4. FROM FOOD SCIENCE TO BIOSCIENCE OF HIGH PRESSURE

In principle, high pressure inactivates microorganisms, denatures proteins, and gelatinizes starches. These properties of high pressure are similar to the effects given by temperature. However, unlike temperature, high pressure keeps natural flavor, color and nutrients of natural foods, in other words, the original properties of the biological material. Therefore, high pressure treatment may be applied not only to food materials but also biological materials such as organs and tissues. It is natural that high pressure technology is extended to bioscience and biotechnology in general and concern and demand for this extension are increasing under the support of successful use of high pressure in food science and technology. Water compression is not realized on the earth except 100 MPa at the bottom of the deepest sea. To understand the effects of higher hydrostatic pressure on biological systems, basic research is indispensable for further development of high pressure food science and bioscience. More observations of high pressure effects on living organisms and living matters should be accumulated by scientists in the biology-related sciences such as biochemistry, molecular biology, microbiology, cell biology and so on, in addition to agriculture, medicine, and pharmacology (see chapter 2 contributed by Dr. C. Balky). Investigations to determine physical constants under high pressure

should be continuously made though the work is unpretentious and unattractive but pains-taking. For example, such data as solubility of biologically important compounds including amino acid, sugars, and lipids in addition to various salts should be summarized in the form of an international table. These data are indispensable for understanding and further development of high pressure bioscience. Experimental high pressure equipment useful in biological research are not as common as equipment for temperature control. Easily available and small high pressure vessels for various spectroscopic studies are strongly and increasingly required. World wide exchange of knowledge in high pressure bioscience seems to be made rather smoothly: five series of symposia have been organized on the uses of high pressure processing in food in Japan with academic and industrial researchers since 1989, and that is followed by The Joint Meeting of Japan and the European Community on High Pressure Biotechnology held at La Grande Motte, France in September of 1992 and The First International Congress on High Pressure Bioscience and Biotechnology held at Kyoto, Japan in November of 1995. For further details one may refer to the Proceedings of the Symposia (see REFERENCES).

5. CONCLUSION Mankind has two fundamental factors, T and P, which offer many chances in the field of bioscience and biotechnology for new challenges because they can act on the face which is made by T and P axes not simple changing of only T. In response to the fast growing applications, basic bioscience for artificially produced high pressure and its effect on biological materials increases its importance and needs further exploration by scientists of different disciplines including biochemistry, cell biology, engineering, food science, medicine, molecular biology, pharmacology and physical chemistry. Readers of the Proceeding surely realize that high pressure research is rapidly increasing in the fields of bioscience and biotechnology and that

it will grow to produce fruitful results for human welfare in twenty first century. Bioscience under artificially-produced high pressure should be distinguished from bioscience of extreme conditions which are recent concerns of bioscientists, because extreme conditions mean natural conditions existing on the Earth. One may say that high pressure bioscience described in this article is not natural science but artificial science. This situation is similar to space medicine under no gravity. Traveling in space is brought about by artificial achievement. Bioscience of artificial environment, which is out of the Earth environment, involves very interesting subjects as pure science without considering any value.

6. R E F E R E N C E S

1 R. Hayashi (ed.), Use of High Pressure in Food (in Japanese), San-Ei Publishing Co., Japan, 1989. 2 R. Hayashi ed.), Pressure Processed Food-Research and Development (in Japanese), San-Ei Publishing Co., Japan, 1990. 3 R. Hayashi (ed.), High Pressure Science for Food (in Japanese), San-Ei Publishing Co., Japan, 1991. 4 C. Balny, R.Hayashi, K. Heremans and P. Masson (eds.), High Pressure and Biotechnology, Colloques INSERM/John Libbey Eurotext Ltd., France, Vol. 224, 1992. 5 R. Hayashi, High Pressure Bioscience and Food Science (in Japanese), San-Ei Publishing Co., Japan, 1993. 6 R. Hayashi, S.Kunugi, S. Shimada and A. Suzuki, High Pressure Bioscience (in Japanese), San-Ei Publishing Co., Japan, 1994.

R. Hayashiand C. Balny(Editors), High Pressure Bioscienceand Biotechnology 9 1996Elsevier Science B.V. All rights reserved.

Future prospects in high pressure basic bioscience C. Balny INSERM, Unit~ 128, BP 5051, 34033 Montpellier, Cedex 1, France Abstract If applied research in the field of high pressure bioscience has, up to now, mainly been t u r n e d in the direction of food science, a clear knowledge of reactions involved needs support from basic research which is aimed at an u n d e r s t a n d i n g of pressure induced phenomena in biomolecules and living cells.

1. INTRODUCTION The philosophy of the Closing Remarks of the last International Conference on "High P r e s s u r e and Biotechnology" held in 1992 at La Grande Motte (France) is still pertinent : "It seems that the best strategy in fundamental research is the random approach in which one singular topic is studied by a wide variety of techniques" [1]. However, since 1992, significant progress has been made in high pressure technology such as the adaptation of biophysical methods under high pressure conditions (X-ray structure analysis and NMR may be the most s i g n i f i c a n t examples, allowing the collection of high resolution data from high pressure experiments with proteins), the interpretation of the observed results such as the introduction of the notion of a molten globule state during protein denaturation reactions. Concerning the structure-function and structure-stability relationship in proteins, the study of mutant proteins associated with high-pressure experiments will contribute to our understanding of protein structure and behavior. From a conceptual point of view, the real progress which has been made is that the pressure parameter is now not only considered as a physical tool to investigate elementary equilibria or chemical reactions, to provide information on reaction mechanisms themselves, but may also be exploited as a potential tool to create perturbations which can, for example, modify reaction pathways (or subtrate specificity and protein structure). However, to allow an understanding of these phenomena at the molecular level, substantial effort has still to be made in the application of fundamental thermodynamics to biological problems [2]. Several monographs discuss in detail the effects of pressure on a variety of biochemical and biophysical systems, covering both the experimental and theoretical aspects of recent high-pressure studies of proteins (for a recent review, see ref. 3 and the references list in this article). Therefore, in the present paper, we will limit ourselves and stress only some characteristic

points which m u s t be study in depth for a b e t t e r u n d e r s t a n d i n g of the pressure effects on b i o s y s t e m s and their possible applications. In this context, we will p r e s e n t also some techniques which have recently been developed for the high p r e s s u r e a d a p t a t i o n of some biophysical m e t h o d s g e n e r a t i n g a n d m a i n t a i n i n g pressures up to 700 - 1000 MPa.

2. I M P O R T A N C E O F T H E E N V I R O N M E N T 2.1. Role of the t e m p e r a t u r e p a r a m e t e r in s t u d y i n g p r e s s u r e effects P r e s s u r e effects on biomolecules are governed by two m a i n principles [3] : 1 - The f u n d a m e n t a l Le Chatelier's principle which s t a t e s t h a t at e q u i l i b r i u m a s y s t e m t e n d s to m i n i m i z e t h e effect of a n y e x t e r n a l f a c t o r by w h i c h it is perturbed; 2 - The p r i n c i p l e of microscopic o r d e r i n g which s t a t e s t h a t an i n c r e a s e in p r e s s u r e a t c o n s t a n t t e m p e r a t u r e l e a d s to a n o r d e r i n g of m o l e c u l e s or a decrease in the entropy of the system.

I

~ AV, ml/mo,

3

[

Dcnature.d, AG < 0

,

,.o d r~

1-

Native, AG > 0

............ ,;..................[;i".........................I...........................~ ......................... - 20

0

20

40

q~ I

.

60

Temperature, o C

F i g u r e 1. P r e s s u r e - t e m p e r a t u r e t r a n s i t i o n d i a g r a m of p r o t e i n d e n a t u r a t i o n (Figure a d a p t e d fi~om Ref. 5).

The co n s eq u ence is t h a t the effects of p r e s s u r e and t e m p e r a t u r e on biochemical reactions are antagonistic. This is clear if we consider some elementary reactions such as the ionisation of dissociable groups. For example, the pK of a Tris buffer is very sensitive to the t e m p e r a t u r e b u t a l m o s t independent of the pressure. This difference exists also if we consider reaction rates : by lowering the temperature, the velocity of a reaction decreases (positive enthalpy AH$) whereas, by increasing the pressure, the velocity of a reaction increases or decreases, depending of the sign of the activation volume AV$ [4]. These two p a r a m e t e r s m u s t , in all cases, be t a k e n into a c c o u n t w h e n considering protein denaturation, since the native conformation of a protein exists only over a rather limited range of both pressure and temperature. The region of stability of a native structure has a curved boundary when plotted on a temperature-pressure diagram, which can be used to select useful t reat m ent s for biotechnological applications, mainly in food biochemistry where controled denaturation of proteins is achieved (see Figure 1). As in the case of the effect of p r e s s u r e on p r o t e i n s , the effect of t e m p e r a t u r e m a y be r e v e r s i b l e or n o n r e v e r s i b l e , b u t the f u n d a m e n t a l difference b e t w e e n p r e s s u r e - and temperature-induced processes relates to the fact that no changes in covalent bonding have been observed to occur using the pressure effect. 2.2. Water The solvation of biological material is essential in most studies and one way to attain this is to use high pressure. Protein volume in solution is the sum of several components including a contribution due to the solvation of peptide bonds and amino acid side chains, which contributes negatively to the total volume. At high pressure, the solvation shell of proteins becomes more ordered and an increase in protein-water interactions may be a characteristic feature of pressure-induced denaturation. As an example we can mention the role of water in the inactivation of enolase by high hydrostatic pressure. In the transition state of the dissociation, the previously buried interfaces of pressure-dissociated subunits of this dimeric protein become hydrated, which is favored by pressure [6]. The other aspect concerns the physical properties of w at er u n d e r high pressure. According to the phase diagram of water, at high pressure (up to 200 MPa), a subzero t e m p e r a t u r e (down to - 20~ ) region exists where water remains liquid. Application of such low-temperature, high-pressure conditions allows rapid freezing of biological materials by a rapid decompression of the medium. Improved high-pressure biotechnological processing methods should result from the possibility of operating in the liquid water phase under such conditions at temperature below 0~ However, the thermodynamics of these promising processes are still not well known when biological materials are in the water phase.

2.3. Osmotic p r e s s u r e As mentioned by G. Hui Bon Hoa, the osmotic stress technique through the addition of osmolytes of different sizes is an interesting way of perturbing solvation of proteins and of probing the role of loosely-bound water in the free energy changes associated with protein-protein binding. A recent example is given in the case of the specificity of cleavage of restriction endonucleases,

l0 which is found to be d r a m a t i c a l l y reduced at elevated osmotic pressure. Application of hydrostatic pressure counteracts the effect of osmotic pressure a n d r e s t o r e s the n a t u r a l selectivity of the e n z y m e s for t h e i r canonical recognition sequences. These results indicate that the solvation by water plays an important role [7]. The use of both osmotic- and h y d r o s t a t i c - p r e s s u r e techniques has been neglected for many years, the combination of these two approaches permits the study of the role of water in many biochemical processes, such as substrate binding, p r o tein- pr ot e i n interactions, allosteric effects and conformational changes, catalysis, protein stability, and ion channel formation. (see Ref. 7 and the paper of G. Hui Bon Hoa in these Proceedings).

2.4. Pressure and enzyme reactions :viscosity problems The e x p e r i m e n t a l value which reflects the pressure dependency of the velocity of an enzyme reaction is the activation volume (AV$), the slope of the curve of In k v e r s u s pressure (k being the rate constant) multiplied by a factor [4,8]. This simplest formulation is derived by analogy with the t r e a t m e n t of chemical reactions, where the transition state theory of Eyring postulates that between two successive complexes, there is a labile complex (transition state). Here also, the thermodynamics of these process must be reanalyzed to give a better description of biological reactions. Some experiments carried out with model s y s tem show t h a t the t r a n s i t i o n state theory is an oversimplified i n t e r p r e t a t i o n . A t r e a t m e n t which may approach the real s i t u a t i o n more closely is provided by Kramers' theory, which includes the viscosity of the medium ; an important factor when applications are considered. In addition, according to this theory, the variation of viscosity with pressure must introduce curvature in I n k as a function of pressure. Preliminary results obtained from viscosity experiments are, therefore, a way of discovering the still unknown p a r a m e t e r s which affect the i n t e r c o n v e r s i o n of i n t e r m e d i a t e s reflecting intramolecular protein motions. 2.5. New experimental media Recent years have witnessed a development of the ideas and methods of micellar enzymology. The systems of reversed micelles appear to be very useful in f u n d a m e n t a l biochemistry because they help to mimic the behavior of enzymes in cell membranes. These micelles contain the biological material in a w a t e r phase solubilized in an apolar organic solvent (octane) using an amphiphilic s u r f a c t a n t (AOT : Aerosol OT) (see Figure 2). They also have potential uses in biotechnology such as, for example, protein extraction. Both f u n d a m e n t a l and applied biochemistry face the problem of m o d u l a t i n g the enzyme activity in the micelles, and one way is to use high pressure in these systems, with a low content of water [9]. The other point concerns thermostability. We have studied the case of achymotrypsin solubilized in reversed micelles of AOT, where the problem of the thermostability of this enzyme remains. Application of high pressure in the range 0.1 - 150 MPa stabilizes the enzymes against thermal inactivation at all d e g r e e s of h y d r a t i o n (this p a r a m e t e r is equal to the ratio b e t w e e n the concentrations of water and surfactant). One can assume t hat application of pressure increases the structural order of surfactant aggregates which would

11 decelerate enzyme inactivation. However, using different physical methods such as NMR or infrared spectroscopies adapted to the conditions of high pressure, studies at the molecular level are necessary [10].

Figure 2. Schematic p r e s e n t a t i o n of enzyme-containing reversed micelles formed by surfactant (Aerosol OT) in a non-polar solvent. 1 : non-polar solvent ; 2 : water ; 3 :Aerosol OT ; 4 : enzyme. 3. HIGH-PRESSURE, A WAY TO APPROACH PROTEIN STRUCTURE ANALYSIS P r e s s u r e acts on the secondary, t e r t i a r y and q u a t e r n a r y s t r u c t u r e of proteins and a classical image of local pressure-induced changes is obtained clearly from X-ray structure analysis. However other methods permit access to other local or global pressure-induced changes in protein structure : at the level of secondary structure by using vibrational spectroscopy, at the level of tertiary structure by using NMR spectroscopy, X-ray analysis or UV-vis and fluorescence spectroscopies and at the level of quaternary structure by using NMR and fluorescence spectroscopies or electrophoresis [3]. Among these methods, we must point out that recent development in Fourier transform i n f r a r e d spectroscopy can give detailed information on p r e s s u r e - i n d u c e d changes in the secondary structure of proteins, from characteristic shifts in the band frequencies in spectra [11]. However, major advances in determining structural changes in proteins a c c o m p a n y i n g p r e s s u r e - i n d u c e d d e n a t u r a t i o n h a v e b e e n o b t a i n e d by combining h i g h - r e s o l u t i o n NMR t e c h n i q u e s with high p r e s s u r e . In an

12 excellent recent review, J. Jonas et al. analysed both the potentialities of this approach and technical progress in this field. They discuss, in particular, several features of NMR probe design which are essential for biochemical applications of this technique : high resolution, high sensitivity, wide pressure and temperature ranges, large sample volume, reliable RF feedthroughs and suitability for superconducting magnets [12]. An example of the potential of this approach is given by the study of the dissociation of a dimeric Arc repressor protein using phase-sensitive two-dimentional correlated s p e c t r o s c o p y (COSY) and n u c l e a r O v e r h a u s s e r effect e n h a n c e m e n t spectroscopy (NOESY) [13]. A study of the unfolding of ribonuclease A using 1H NMR at 400 MHz in the temperature range 7.5 to 40~ is presented by one group at Kobe University in these Proceedings. For membranes, systematic high-pressure NMR studies have been made on model phospholipid membranes, in particular for studies of the gel-state which is highly ordered in contrast to the liquid-crystalline state [12]. Special attention must be given to circular dichroism spectroscopy which has been developed by a Japanese group (see the paper of S. Ozawa et al. in these Proceeding). This technique, which gives i m p o r t a n t information for protein conformation studies, is very difficult to adapt for high pressure experiments (depolarization of the surface of the windows problems under pressure). At present, data on model molecules seem reliable up to 200 MPa. 3. 1. Protein cristallization Protein crystallization can be achieved under pressure ; this was first observed with glucose isomerase. However, the role of high pressure is not yet clear since, for example, the crystallization of egg-white lysozyme is strongly inhibited by hydrostatic pressure. It seems that sudies up to now have not included any systematic t h e r m o d y n a m i c investigation. However, kinetic models have been proposed to understand how pressure may act on protein self-assembly (see Ref. 14). 3.2. The molten globule states This particular point will be discussed in detail in these Proceedings by P. M a s s o n . This p h e n o m e n o n is very i m p o r t a n t w h e n we c o n s i d e r mild d e n a t u r i n g of proteins under conditions where they undergo a transition toward partially unfolded states called molden glogule states. Pressure induced these states with particular emphasis on hydration changes that are involved in the formation of these folding/unfolding intermediates. An interesting example is given in the study of the denaturing effect of pressure on the structure of human butyrylcholinesterase under pressure. It has been found that the hydrodynamic volume of the enzyme swells when pressures around 150 MPa are applied and that the fluorescence intensity of a bound dye (ANS) is increased by pressure between 50 and 150 MPa. These observations indicate that pressure denaturation of the protein is a multi-step process and that the observed transient pressure-denatured states have the characteristics of "highly ordered" molten globule states [15]. These lines of evidence are of primary importance for a better understanding of the proteindenaturation process.

13 M o r e o v e r , p r e s s u r e d e s t a b i l i z e s h y d r o p h o b i c bonds, w h i c h i n d u c e s dissociation of oligomeric structures. This effect often accurs at pressures below 200 MPa where, after pressure release, the reverse transition may be slow, showing an hysteresis phenomenon. It is the "conformational drift" due to a long-living matastable intermediate state [16,17].

3.3. Compressibility A considerable body of e x p e r i m e n t a l work indicates t h a t proteins are flexible structures, and in particular that they are compressible. The pionner work of K. Gekko's group has led to the d e t e r m i n a t i o n of the a d i a b a t i c compressibility by m eans of sound velocity m e a s u r e m e n t s , giving complem e n t a r y i n f o r m a t i o n on the flexibility or rigidity of prot ei n molecules in solution and on f l e x i b i l i t y - s t r u c t u r e r e l a t i o n s h i p s . The c o m p r e s s i b i l i t i e s measured are in the range 30 - 200 ml.mo1-1 which correspond to about 0.3 % of the total protein volume. As an application of this technique, a method for e s t i m a t i n g hydration terms has been proposed. Recent results concern the compactness of thermally a n d c h e m i c a l l y d e n a t u r e d r i b o n u c l e a s e A, as r e v e a l e d by v o l u m e and compressibility. It has been found t hat the confor-mation of the d e n a t u r e d ribonuclease resulting from thermal denaturation is greatly different from that brought about by guanidine hydrochloride denaturation. As a conclusion, it is s u g g e s t e d t h a t t her e are some molten globule like i n t e r m e d i a t e s in the denaturation processes [18]. 4. NEW FIELDS 4.1. High hydrostatic pressure as an agent for increasing the activity and the stability of enzymes In this laboratory, V. V. Mozhaev et al. have shown that elevated hydrostatic pressure can be used to increase the catalytic activity and thermal stability of model proteins [19]. For ~-chymotrypsin, an increase in p r e s s u r e at 20~ results in an exponential acceleration of the hydrolysis rate, reaching a 6.5 fold increase in activity at 470 MPa. The acceleration due to high pressure becomes more p r o n o u n c e d at high t e m p e r a t u r e because of a s t r o n g t e m p e r a t u r e dependence of the activation volume of the reaction. At 50~ under a pressure of 360 MPa, the activity is more than 30 times greater t han the activity at normal conditions (20~ and atmospheric pressure). Elevated hydrostatic pressure has also been found effective in increasing the stability of ~-chymotrypsin agai ns t t h e r m a l d e n a t u r a t i o n . For example, at 55~ the enzyme is a l m o s t i n s t a n t a n e o u s l y i n a c t i v a t e d at a t m o s p h e r i c pressure whereas under a pressure of 180 MPa, the activity is retained during several minutes. Additional stabilization can be achieved in the presence of glycerol. This pressure modulation of reaction rates is extremely promising for b i o t e c h n o l o g i c a l a p p l i c a t i o n . (See the p a p e r of V.V. M o z h a e v in t h e s e Proceedings).

14 4.2. P r o t e i n purifications Among affinity separation techniques, immunoaffinity seems to be the most suitable for protein separation because it is easy to get specific antibodies against any given protein. The main problem concerns desorption which often requires drastic conditions at atmospheric pressure (low pH, chaotropic ions, high salt concentration, etc.). Studies using high-pressure to disrupt antigenantibody complexes are currently in progress. This could be a clean method since, during the process, no extra compounds have to be added. However, the antigen-antibody interactions are specific and strong. Only preliminary results have been obtained, but it seems that a complete study will be necessary to allow unambiguous interpretation of the results obtained where, in addition to the pressure effect, other factors must be explored such as the temperature. It is an interesting approach, for which a better understanding of pressure effects on chemical and biochemical bonds is necessary since the published data available are from model systems, sometimes far removed from the complexity of biochemical problems [20].

5. SPECIAL EQUIPMENT There can be no real progress in high p r e s s u r e basic science w i t h o u t special equipment. Depending on the biophysical method used, many systems have been developed. If UV-vis absorption or fluorescence spectroscopies working up to 500 MPa are now nearly "routine" methods, some others are as yet only at the development stage. Among them, we may mention : fast kinetic equipment, electrophoresis, NMR spectroscopy (which use a compressed liquid as a pressure transmitter), and the diamond anvil cell which uses a direct mechanical compression. For the first t h r e e m e t h o d s , the classical s y s t e m for h i g h p r e s s u r e d e t e r m i n a t i o n s is composed of generation, control and m e a s u r e m e n t parts. The real innovation is at the cell level where various mechanical designs have been proposed. However, the commercialisation of these systems is not yet possible because the of the reliability. One main problem concerns the nature of the alloys used to construct the cells, regarding the mechanical constraints both at high p r e s s ur e and at various t e m p e r a t u r e s . A collaboration with specialists in hard materials is required. 6. CONCLUSIONS : CURRENT PROGRESS AND FUTURE PROSPECTS Mainly using special equipment, real progress has been made in barobiochemical science, in the field of structure-function relationships. These systems have permitted the first direct in situ observation under pressure, together with a very good control of other parameters such as the temperature and the nature of the medium. This is real progress since, for many years, it was only possible to record pressure effects after decompression to atmospheric conditions. Second, it is the diversity of the biophysical methods which have p e r m i t t e d the collection of m a x i m u m data. It may be in the field of NMR specctroscopy that the most interesting results will be obtained.

15 However, there are at least two problems which remain to be solved. The first is technological : i t is not yet possibble to have a versatile circular dichroism apparatus for protein studies at high pressure, if we except the real first a t t e m p t p r e s e n t e d at this Conference by S. Ozawa and applied to ribonuclease conformation change. The second concerns the thermodynamic t r e a t m e n t of the pressure effects on biosystems. We must keep in mind that the basic thermodynamic analysis that we use comes from applications in chemistry, and sometimes from perfect gases. The absence of an adequate theory is a major difficulty in the treatment of the data, but we can hope that by collection as much information as possible, the situation will soon improve. 7. ACKNOWI~EDGMENTS

The author is grateful to DRET (grant N 94/5) for financial support and t h an k s Drs. V. V. Mozhaev, K. Heremans, J. Frank, P. Masson, R. Lange, K. Ruan and N. Klyachko for helpful discussion. Part of the work discussed in this paper was performed in the framework of COST project D6 and INTAS 9338 project. 8. REFERENCES

1 C. Balny, R. Hayashi, K. Heremans and P. Masson (eds.), High Pressure and Biotechnology, John Libbey Eurotext/INSERM, Montrouge, France, vol. 224, 1992. 2 V.V. Mozhaev, K. Heremans, J. Frank, P. Masson and C. Balny, Trends Biotechnol., 12 (1994) 493. 3 V.V. Mozhaev, K. Heremans, J. Frank, P. Masson and C. Balny, Proteins: Structure, Function, and Genetics, 24 (1996) 81. 4 C. Balny, P. Masson and F. Travers, High Pres. Res., 2 (1989) 1. 5 S.A. Hawley, Biochemistry, 10 (1971) 2436. 6 M . J . Kornblatt, J. A. Kornblatt and G. Hui Bon Hoa, Arch. Biochem. Biophys., 306 (1993) 495. 7 C.R. Robinson and S. G. Sligar, Proc. Natl. Acad. Sci. USA, 92 (1995} 3444. 8 C. Balny and P. Masson, Food Rev. Inter., 9 (1993) 611. 9 V.V. Mozhaev, N. Bec and C. Balny, Biochem. Mol. Biol. Inter., 34 (1994) 191. 10 R. V. Rariy, N. Bec, J-L. Saldana, S. N. Nametkin, V. V. Mozhaev, N. L. Klyachko, A. V. Levashov and C. Balny, FEBS Letters, 364 (1995) 98. 11 P. T. T. Wong and K. Heremans, Biochim. Biophys. Acta, 956 (1988) 1. 12 J. Jonas and A. Jonas, Ann. Rev. Biophys. Biolmol. Struct., 23 (1994) 318. 13 S. Samarasinghe, D. M. Campbell, A. Jonas and J. Jonas, Biochemistry, 31 (1992) 7773. 14 M. Gro[~ and R. Jaenicke, Eur. J. Biochem., 221 (1994) 617. 15 C. Clery, F. Renault and P. Masson, FEBS Letters, 370 (1995) 212. 16 G. Weber, Biochemistry, 25 (1986) 3626. 17 K. Ruan and G. Weber, Biochemistry, 27 (1988) 3295.

15 18 Y. Tamura and K. Gekko, Biochemistry, 34 (1995) 1878. 19 V. V. Mozhaev, R. Lange, E. V. Kudryashova and C. Balny, Biotech. Bioeng. (1996) (in press). 20 E. Gavalda, P. Degraeve and P. Lemay, Enz. Microbiol. Techno., (1996) (in press)

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

17

Deep-sea microbial research and its aspect to high pressure biotechnology Chiaki Kato and Koki Horikoshi The DEEPSTAR Group, Japan Marine Science and Technology Center, 2-15 Natsushima-cho, Yokosuka, 237, Japan Abstract We have isolated several microorganisms that are adapted to living in the extremes of the deep-sea environment characterized as high hydrostatic pressure. They include barophilic bacteria, which are able to grow at high hydrostatic pressure, but that are unable to grow at atmospheric pressure, and barotolerant bacteria, which are able to grow almost same ability in both high pressure and atmospheric pressure conditions. A new application field, high pressure biotechnology, will be developing from the deep-sea microbial research in the future.

1. I N T R O D U C T I O N The deep-sea bed is a unique environment that experiences extremely high pressures and low temperatures. Microorganisms living there have developed particular characteristics that allow them to thrive at such extremes. In studies aimed at improving our understanding of microbial adaptation to the deep-sea environment, we have isolated and characterized a number of microorganisms from samples of deep-sea mud obtained by the manned submersible Shinkai 6500. This vehicle, which is operated by the Japanese Marine Science and Technology Center (JAMSTEC), has the ability to submerge to a depth of 6500 m [1 ]. The typical deep-sea adapted microorganisms, barophilic bacteria, which can grow only at high pressure, not at normal atmospheric pressure, and the another high pressure adapted microorganisms, barotolerant bacteria, which can grow in both high and atmospheric pressures, have been isolated from the samples [2]. Such microorganisms could prove to be useful for new biotechnology applications such as high-pressure bio-reactor.

18

2. DEEP-SEA BAROPHILIC AND BAROTOLERANT BACTERIA In 1957, ZoBell and Morita [3] were among the first researchers who attempted to isolate microorganisms that were specifically adapted to the high pressures associated with the deep-sea environment - they called them barophilic bacteria. However, it was only in 1979 that Yayanos et al. [4] were able to isolate barophilic bacteria, thanks to technical support and the development of procedures for investigating deep-sea environments. We are keen to isolate new deep-sea adapted microorganisms and to characterize them for their possible application to high-pressure biotechnology. Several barophilic and barotolerant bacteria have been isolated from samples of deep-sea mud that were collected using sterilized mud samplers on the submersible Shinkai 6500 [2,5]. The isolated bacteria (Table 1) were grown in pressure vessels under a range of hydrostatic pressures (0.1-80 MPa) and temperatures (4-15~ The optimal pressure for growth of barophilic strains was about 50 to 70 MPa at 10~ however that of barotolerant strains was 0.1 to 30 MPa. None of these strains was able to grow at temperatures above 20~ under any pressure conditions. The growth-rate profiles of these barophilic and barotolerant strains indicate that their response to pressure is greatest near their upper temperature limit (15~ for growth. The growthrate profiles of barophilic strains at 4~ were similar to the profiles of barotolerant strains [2,5]. Table 1. The list of deep-sea adapted microorganisms isolated in our laboratory. Bacterial strains

Properties

Barophilic bacteria DB5501 Optimalgrowth at 50MPa and 10~ DB6101 Optimalgrowth at 50MPa and 10~ DB6705 Optimalgrowth at 50MPa and 10~ No growth at atmospheric pressure. DB6906 Optimalgrowth at 50MPa and 10~ No growth at atmospheric pressure. DB 172F Optimalgrowth at 70MPa and 10~ No growth at atmospheric pressure. DB 172R Optimalgrowth at 60MPa and 10~ No growth at atmospheric pressure.

Source

Ref.

SurugaBay depth at 2485m Ryukyu Trench depth at 5110m Japan Trench depth at 6356m

2 2 2

JapanTrench depth at 6269m

2

Izu-BoninTrench depth at 6499m

5

Izu-BoninTrench depth at 6499m

5

Barotolerant bacteria DSK1 Optimalgrowth at 0.1MPa and 10~ Japan Trench depth at 6356m DSS 12 Optimalgrowth at 30MPa and 8~ RyukyuTrench depth at 5110m

2 2

We have also found that barotolerant bacteria display a similar response profile to the barophilic organisms [2]. Indeed, even Escherichia coli responds in a similar way to variations in temperature and pressure [6], perhaps

19 implying that the same response mechanisms are widely conserved. At present, there are not enough data to draw any general conclusions about bacterial growth under high pressure, but it is possible that bacterial growth rates may be stimulated by high pressure near their maximum temperature for growth. From a comparison of the DNA sequences encoding 16S ribosomes, it was shown that the barophilic and barotolerant strains we isolated belong to the P r o t e o b a c t e r i a , gamma subgroup. It is interesting to note that the 16S ribosomal DNA sequences of the barophilic strains DB6906, DB172F, DB 172R, and the psychrophilic barotolerant strain DSS12 [5] show the highest homology of all, indicating that these strains are very closely related. The relationship between the isolated strains and some strains of the gamma Proteobacteria are shown in Fig. 1 in the form of a phylogenetic tree that uses the neighbor-joining method [7]. The barophilic and barotolerant strains isolated from the deep-sea environment have been separated into one of the sub-branches in the gamma subgroup; the barophilic microorganisms reported by Liesack et al. [8] (strains WHB 46-1 and WHB 46-2) are also included in the sub-branch containing the strains isolated in our laboratory. These data suggest that the high-pressure-adapted bacteria may belong to a new bacterial genus in the gamma subgroup of the Proteobacteria. E. coli

S.

marcescens

WHB46-2

P. shigelloides WHB46-1

Pr. vulgaris DSSI2 DBI72F "~. DBI72R

I

DB6906

V. anguillarum DB6101

DB5501

A. hydrophila DB6705

S ~ alga

DSKI |

!

0.02 Knue

Fig. 1. Unrooted phylogenetic tree showing the relationships of isolated barophilic strains within the Proteobacteria gamma subgroup, as determinedby a 16S ribosomalDNA sequence comparison, using the neighbor-joiningmethod.

20 Molecular-genetic analysis of high-pressure-adaptation mechanisms of such microorganisms is been carried out. We have reviewed about the gene and protein expression influenced by high pressure [9]. We believe that the new discovery field of high-pressure biotechnology will develop from such basic studies. 3. FUTURE APPLICATIONS The deep-sea environment is a source of unique microorganisms with great potential for biotechnological exploitation. Very few studies concerning the isolation and characterization of deep-sea microorganisms have been carried out, and we think that investigations in this field may lead to many new discoveries. In this article, we have described the characterization of unique deep-sea adapted microorganisms that display barophily and barotolerance. These microorganisms may be very useful in new applications of biotechnology. For example, the genes and proteins from deep-sea barophilic bacteria are adapted to high-pressure conditions, so they could be used for the development of high-pressure bioreactors, for example. Based on these new discovers, further work aimed to developing commercial applications for these deep-sea microorganisms is in progress. 4. REFERENCES

1 S. Takagawa, K. Takahashi, T. Sano, Y. Mori, T. Nakanishi and M. Kyo, OCEANS, 3 (1989) 741. 2 C. Kato, T. Sato and K. Horikoshi, Biodiv. Conserv., 4 (1995) 1. 3 C.E. Zobel and R. Y. Morita, J. Bacteriol., 73 (1957) 563. 4 A.A. Yayanos, A. S. Dietz and R. Van Boxtel, Science, 205 (1979) 808. 5 C. Kato, N. Masui and K. Horikoshi, J. Mar. Biotechnol., in press. 6 R.E. Marquis, Adv. Microbiol. Physiol., 14 (1976) 159. 7 N. Saitou and M. Nei, Mol. Biol. Evol., 4 (1987) 406. 8 W. Liesack, H. Weyland and E. Stackebrandt, Microb. Ecol., 21 (1991) 191. 9 D.H. Bartlett, C. Kato and K. Horikoshi, Res. Microbiol., 146 (1995) 697.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology

9 1996 Elsevier Science B.V. All rights reserved.

21

High pressure effects on the structure and mesophase behaviour of supramolecular lipid aggregates and model membrane systems Roland Winter University of Dortmund, Department of Physical Chemistry, Otto-Hahn-Strafie 6, D-44227 Dortmund, Germany Abstract

Lipids, which provide valuable model systems for membranes, display a variety of polymorphic phases, depending on their molecular structure and environmental conditions. By use of X-ray and neutron di~action, infrared and fluorescence depolarization spectroscopy, calorimetry and volumetric measurements, the temperature and pressure dependent structure and phase behaviour of several lipid systems, differing in chain configuration and headgroup structure have been studied. Hydrostatic pressure has been used as a physical parameter, because high pressure is an important feature of certain natural membrane environments (e.g., marine biotopes), and because the high pressure phase behaviour of biomolecules is also of considerable biotechnological interest [1]. An understanding of the energetics of these lipid assembfies and of the various lipid phase transitions should help in assessing the role of such molecules in natural membranes. 1. INTRODUCTION Lipid bilayers, which constitute the basic structural component of biological membranes, exhibit a rich lyotropic and thermotropic phase behaviour [2]. Due to the large hydrophobic effect, most phospholipid bilayers associate in water already at extremely low concentrations (.

IL,(IO0)

Q)

D O P E

bar_

Pn3m[ Im3m I/All Hll

(/) 1-r I--

0

,

I

0.01

~

I

0.02

,

I

.

0.03 s[A -1]

~

I

0.04

,

0.05

0

i

I

,

0.01

,

L

0.02 s[A -~3

~

i

0.03

,

0.04

Figure 3. SAXS patterns a) of DOPE/water, which has been pressure-cycled between the L~ and Hn phase, and b) of egg-PE/water, which has been pressure-cycled between 30 and 450 bar at 62 ~ (s = (2/2)sinO, 2 wavelength of radiation, 20 scattering angle).

24 energy than either the lamellar Lc~ or Hu phase, as the cubic phases have low curvature energies and do not suffer the extreme chain packing stress of the HII phase [ 10,21,22]. As a second example, the monoacylglycerides monoolein (MO, C18:1c9) and monoelaidin (ME, C18: l t9) are chosen, because they have received considerable interest due to their importance as intermediates in lipid digestion and their applications in food industry. For both systems, a temperature-pressure phase diagram has been determined [23], and drastic differences in phase behaviour are found for the two systems (see Fig. 4). In MO-water dispersions, the cubic phase Pn3m extends over a large phase field in the T, p-plane. At temperatures above 95 ~ the H~I phase is found. In the lower temperature region, a crystalline lamellar phase is induced at higher pressures. The phases found in ME-water include a lamellar crystalline L c phase, the L~ gel phase, the La phase, and two cubic phases belonging to the crystallographic space groups Im3m and Pn3m~ Obviously, even small changes in lipid chain configuration can lead to drastic changes in phase behaviour. The stability of the lamellar phases of ME at lower temperatures over the cubic and inverted hexagonal phase, as compared to MO, can be qualitatively explained by simple molecular packing arguments [23]. Compared to ME, the MO molecule is more wedge-shaped, thus leading to an increased tendency of the molecules to aggregate into structures with negative curvatures. I00

80L) F--

..I-

i00

~', ~

80

60

Pn3m

0,U%

40

I--

l

00

60~,i-I

,

Im3m

L

40 P ~ 20~ --''x

20

monoelaidin

Pn3m

monoolein

L. LI3

t

500

p [bar]

I000

l(;

500 p [bar]

i000

Figure 4. T, p- phase diagram of monoolein (MO) and monoelaidin (ME) in excess water. According to the Gibbs phase rule, binary lipid mixtures may exhibit an even more complex phase behaviour with extensive phase coexistence regions. Here we focus on one class of system only: phospholipid/fatty acid mixtures. Fatty acids are known to affect important membrane properties, such as permeability and fusion. It is assumed that hydrogen bonded complexes are formed between the phospholipid and fatty acid molecules, which act as spacers, thus reducing the crowding of the relatively bulky phospholipid headgroups [24]. This change in the steric balance of the bilayer results in the non-bilayer phases being energetically favoured over the fluid lamellar phase, immediately that the chain-melting transition occurs. For the palmitic chain system DPPC/PA (1:2), the low temperature phase is a lamellar phase, but the high temperature fluid phase is an inverted hexagonal one. For the system DMPC/MA

25 (1:2), however, also an isotropic phase of cubic symmetry is observed at higher temperatures. From the combined results of high pressure DTA, X-ray and neutron diffraction experiments, a phase diagram has been constructed for these systems (Fig. 5). At the gel to fluid phase transition of DMPC/MA the change of monolayer curvature is probably that large that the Ha/cubic phases become more stable than the La-phase. The L~-phase is observed under nonequilibrium conditions, however. In the system DPPC/PA, with about 2.5 A longer chain length of the lipid molecules, the larger splay of the 'molten' hydrocarbon chains in the fluidlike state probably leads to such a large spontaneous (intrinsic) curvature that can only be adopted by the inverted hexagonal structure.

100 f 90

Hr[

DMPC/MA

/

80 70 c) o 60

100

/

50 4O

40

Lp

30201 0

I

500

~

Lp

30

MA - L~ ,

DPPC/PA

80 70 o o 60 I--50

l

HE

90

I

i000

p [bar]

~

,

t

1500

20

I

0

500

p [bar]

~

I

I000

Figure 5. T, p-phase diagrams of aqueous dispersions a) of DMPC/MA (1:2) - we encounter further metastable phases, such as a further cubic phase, upon cooling the sample, in particular at elevated pressures -, and b) ofDPPC/PA (1:2) in excess water. 2.3 The effect of cholesterol on the high pressure phase behaviour of phospholipids Not only the nature of pure phospholipid barotropic phase transitions, but also how they are affected by the incorporation of other species (ions, local anesthetics, steroids etc.) interacting with these membranes, has attracted considerable attention (see, e.g., [4] and references therein), recently. Here, we will focus on the effects of incorporating cholesterol into phospholipid bilayers, only. Cholesterol is an integral component of mammalian cell membranes with concentrations up to about 50 mol%. We investigated static and dynamic properties of unilameUar vesicles of the common phospholipid DPPC (Tin ~ 41.5 ~ containing different amounts of cholesterol. Incorporation of more than about 5 mol% cholesterol is sufficient to suppress the pretransition, and the main transition is abolished by 50 tool% of the sterol. We used the fluorescence depolarization technique for the study of the physical state of the membrane. It utilizes the fluorescence anisotropy elicited from the probe molecule TMA-DPH embedded in the lipid bilayers [15]. The steady-state fluorescence anisotropy rss has been analyzed in terms of a structural order parameter S = of the fluorophore, which reflects the average order parameter of the lipid bilayer at the position of the fluorophore (0 _ S _ 1). The rss data of TMA-DPH in DPPC/cholesterol mixtures as a function of temperature, pressure and sterol concentration are presented in Figs. 6. rss of

26 TMA-DPH in the La phase is significantly lower than that in the gel phase of DPPC, due to the greater static and/or dynamic molecular disorder present in the fluid-like phase of the bilayer; rss is about 0.30 in the gel phase and 0.17 in the fluid phase of pure DPPC, corresponding to a marked difference in the order parameter S of 0.83 and 0.45, respectively. Increase of pressure in the fluid phase leads to an about 20 % decrease of the population of gauche conformes per kbar [25]. The incorporation of cholesterol into the DPPC bilayer reduces the disorder in the liquid-crystalline state, as can be deduced from the observed larger steady-state anisotropy values. The rigid ring system of cholesterol significantly enforces the orientational ordering of the acyl chains in their fluid-like state. Contrary to the behaviour for T>Tm, the rss values slightly decrease for T A S D

781 ' GTAAATTGGCTGACTAATTTAGGTTTTTCAGGAATCGGACAGTAATTATGTCGCAAGAAT 781"

GTAAATTGGTTGACCAATTTAGGTTTTTCAGGAGTCGGACAGTAATTATGTCTCAAGAAT #1//#2

Fig. 1. Homology of the asd promoter regions between the barophilic strain DB6705 and the barotolerant strain DSS12. /; transcription start points. The accession numbers of these asd sequences deposited in DDBJ, EMBL, and GenBank nucleotide sequence data bases are D49539 for asd of strain DB6705 and D49540 for asd of strain DSS 12. The asd sequences containing the promoter region are very similar between these strains, and the similarity of the deduced amino acid sequenced of the asd gene products is 96.2%. The 5' ends of the mRNA from both strains were localized at the same point by primer extension analysis, and two transcriptional starting points were detected which differed by just 1 base (Fig. 1). The 1st transcript (#1) is a minor transcript, and the 2nd transcript (#2) is a major transcript in the barophilic strain DB6705, however similar amounts of both of these transcripts were found in the barotolerant strain DSS 12. We observed that the 2nd transcript was clearly regulated by elevated hydrostatic pressure in both strains, however, the 1st transcript was constitutively produced, independent of pressure conditions, in strain DSS 12. These results suggest that the difference between the barophilic and barotolerant strains in relation to asd expression under high pressure conditions may result from

62 differences between their RNA polymerases. It is possible that asd gene expression in the barophile is primarily controlled by a single RNA polymerase whose activity on the secound promoter is enhanced at high pressure, whereas asd expression in the barotolerant strain is mediated by two different RNA polymerase species, only one of which directs increased asd transcription at high pressure. Consistent with this possibility at least two RNA polymerases which differ in optimal temperature for enzyme activity have been detected in the barotolerant strain DSS12 [Nakasone et al., unpublished results]. These RNA polymerases may be responsible for the pressure-dependent and pressure-independent gene expression observed in this strain. 3. G E N E EXPRESSION A D A P T E D E. COLI

IN

ATMOSPHERIC

PRESSURE

Because of the genetic similarity between E. coIi and deep-sea bacteria, we hypothesized that E. coli could share with many deep-sea bacteria common mechanisms for regulating gene expression at high pressure. To test this possibility, we used promoters from E. coli, encoded on plasmids to analyze the effect of pressure on expression of a reporter gene, the chloramphenicol acetyltransferase (CAT) gene [15]. The results are summarized in Table 1. Table 1. Comparison of CAT activity encoded by various plasmids in E. coli JM109 grown at 0.1 MPa, 30 MPa, and 50 MPa. Plasmid Vector

Gene

pTSI

pBR322

antitet-CAT

pTS2

pBR322

tet-CAT

pTS3

pBR322

pTS4 pTS5 pACYCI84

Enzyme activity(unit/mg) 0.1MPa 30MPa 50MPa 1481

2498

2.3

3.8

253

512

1294

2.0

5.1

amp-CAT

183

231

399

1.3

2.2

pUCI3

Iac-CAT

127

11944

471

94 . 0

3.7

pKK223-3

tac-CAT

121

587

10973

4.8

90.5

cat-CAT

12103

7303

13529

0.6

I.I

pACYCI84

645

Ratio* 30/0.1MPa 50/0.1MPa

*; The ratio of the specific enzyme activity (unit/mg of protein) at 30 MPa compared with 0.1 MPa (30/0.1 MPa), and at 50 MPa compared with 0.1 MPa (50/0.1 MPa). Gene expression initiated from the lac promoter region, on plasmid pUC13, and from the tac promoter region, on plasmid pKK223-3, was enhanced greatly by growth at 30 MPa and 50 MPa, respectively, in the absence of the inducer isopropyl-13-D-thiogalactopyranoside (IPTG) [Table 1; 16,17]. In

63 contrast, promoters on plasmid pBR322, and pACYC184 were unaffected at high pressure, although elevated pressure did increase plasmid copy number [16]. The lac and tac promoters are activated in the presence of IPTG, whereas the other promoters, which were unaffected by high pressure, function in the absence of interaction with a allosteric effector molecule. IPTG enhances expression of the lac and tac genes by binding to the repressor protein, LacI, and releasing it from the repressor binding site on the DNA just downstream of the transcription start point [18]. The transcription start point of lac and tac promoters induced by high pressure or IPTG are the same. Therefore, induction of gene expression by pressure must be related to induction by IPTG. High pressure may release the repressor protein bound to the DNA by causing a structural change in the DNA and/or the repressor protein itself. Royer [19] reported that a pressure of around 200 MPa induced the repressor protein, LacI, to change from a tetramer to a dimer in vitro. The LacI protein binds its operator DNA target with high affinity as a tetramer, but displays poor DNA binding characteristics when present in the dimer form. As shown in Table 1, gene expression regulated by the lac and tac promoters was maximum at 30 and 50 MPa, respectively, and these pressure levels were low compared with Royer's report. These differences could be explained by differences in the concentration of LacI protein. Two alternative interpretations also exist. One is that the observed effects relate entirely to a change in plasmid supercoiling that incidentally interferes with the LacI binding site. Another is that the lacI promoter may be inactive at these high pressure. Recently, we observed that detectable amounts of stable lacI transcript and LacI protein were present in E. coli cells grown under several pressure conditions [Sato et al., unpublished results]. Therefore, the first hypothesis may be correct. A more detailed study of pressure effects on plasmid supercoiling is now in progress. In other work, we have demonstrated that the formation of plaques by ~, phage in E. coli is prevented at 30 MPa hydrostatic pressure [20]. When phage infects E. coli, the phage binds to an outer membrane protein, LamB [21]. The ~, receptor, LamB, is expressed from the malB region which is composed of two operons, maIEFG and malKlamB, transcribed divergently from an inter-operon regulatory interval [22-24]. Both operons of the maIB region are positively controlled by the malT gene product through its interaction with an inducer, maltose [25]. Using promoter fragments derived from the malB region, we showed that gene expression initiated from both promoters (pmaIK-lamB and pmaIEFG) is repressed by elevated hydrostatic pressure (Table 2). High pressure repressed gene expression directed by the maIB regulatory interval even in the presence of inducer, thereby preventing the synthesis of the ~, receptor protein. Nakashima et al. [26] reported that, in E. coli, the amounts of outer membrane proteins, OmpF and OmpC are

64 reduced under high pressure, and that this is not the result of effects on the amounts of the regulatory proteins, EnvZ and OmpR. The extent of expression of another OM protein designated OmpX was also found to be reduced under high pressure culture conditions. Since the N-terminal amino acid sequence of OmpX is identical to that of the ~, phage receptor protein, LamB, it seems likely that OmpX is LamB. These observations lead us to conclude that prevention of plaque formation by phage ~, under high pressure conditions is due to a paucity of the k receptor protein, LamB. Our findings suggest that high pressure affects gene expression directed by the maIB regulatory interval, and this causes a decrease in the quantity of ~, receptor protein, LamB. In a previous study by Marquis and Keller [27], binding of the Lac repressor of E. coli to ]3-galactosides was pressure-sensitive in vivo. Thus, it is possible that binding of the positive regulatory protein, MalT, to maltose also may be pressure-sensitive. This might be one of the mechanisms by which high pressure acts to repress expression of the maIB region. Table 2. Effect of pressure on gene expression in both directions from the maIB operon in E. coli*. Promoter

Inducer**

0.1MPa

Enzyme activity(unit/mg) 10MPa 20MPa 30MPa

40MPa

pmalKlamB

+ -

173.9 20.5

64.8 14.8

26.7 15.9

10.9 25.1

10.8 9.3

pmalEFG

+ -

326.4 27.5

205.1 22.4

57.2 27.9

17.9 37.9

18.3 16.9

*; Data from Ref. 20. **" +, Inducer was present at 0.2% for maltose. -, no inducer. Finally, just as asd gene expression was examined in the deep-sea bacteria as a function of pressure, pressure regulation of asd gene expression was also followed in E. coli. In contrast to the deep-sea bacteria, E. coli forms long filaments when incubated at high pressure rather than low pressure [28,29]. Following the same reasoning and methodology described in section 2 above, we have investigated asd gene expression in E. coli under several pressure conditions. Three different sizes of transcripts were detected at pressures up to 30MPa, but at 50MPa, these were almost undetectable [14]. Thus, lack of the ASD enzyme may be one cause of filament formation and growth inhibition at high pressure in E. coli. 4. C O N C L U S I O N S In conclusion, as shown in Table 3, we have observed three kinds of responses to pressure in studies of gene expression in high pressure adapted barophilic and barotolerant bacteria, and in atmospheric pressure adapted E.

65 coli. Gene expression in barophilic bacteria was mainly subject to high pressure-inducible regulation, however in barotolerant bacteria both high pressure-inducible and pressure-independent regulatory mechanisms were evident. In E. coli, there are three types of responses; high pressureinducible, pressure-independent, and high pressure-repressible. Recently, several groups have proposed that life might have originated in the deep-sea hydrothermal vents [30,31 ], so it seems possible that the high pressure-adapted mechanisms of gene expression could represent a feature present during the early stages of life.

Table 3. Effect of high pressure on gene expression in deep-sea adapted bacteria and atmospheric pressure adapted Escherichia coli. Gene

Barophilic isolate (DB6705)

Pressure-regulated operon

Barotolerantisolate (DSS12)

E. coli

Ref.

+

+

+a

8, 9

+

+, -y-

-

14

lac (pUC13)

+

16, 17

tac (pKK223-3)

+

16, 17

-Y-

16

cat (pACYC184)

T-

16

ompF, ompC

-

26

envZ, ompR

-Y-

26

ma/B operon

-

20

asd

tet,antitet,amp (pBR322)

lacI

-Y-

unpublished

+; high pressure-inducible gene expression, -Y-;pressure-independent gene expression, -; high pressure-repressible gene expression, a; Recombinant E. coli harboring the pressure-regulated operon from DB6705. A c k n o w l e d g m e n t s : We appreciate Dr. D. H. Bartlett for critical reading of the manuscript and many useful discussions. We thank Dr. W. R. Bellamy for assistance in editing the manuscript. We also thank the S H I N K A I 6500 and S H I N K A I 2000 operation teams, and the crews of M.S. Y O K O S U K A and N A T U S H I M A for contributing the deep-sea samples for this research.

66

5. R E F E R E N C E S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31

D.H. Bartlett, C. Kato and K. Horikoshi, Res. Microbiol., 146 (1995) 697. S. Takagawa, K. Takahashi, T. Sano, Y. Moil, T. Nakanishi and M. Kyo, OCEANS, 3 (1989) 741. C. Kato, T. Sato and K. Horikoshi, B iodiv. Conserv., 4 (1995) 1. C. Kato, N. Masui and K. Horikoshi, J. Mar. Biotechnol., in press. C. Kato, A. Inoue and K. Horikoshi, Trends in Biotechnol., 14 (1996) 6. J.W. Deming, L. K. Somers, W. L. Straube, D. G. Swartz and M. T. Macdonell, Syst. Appl. Microbiol., 10 (1988) 152. E.F. DeLong and D. G. Franks, Abstr. Am. Soc. Microbiol., (1992) 302. C. Kato, M. Smorawinska, T. Sato and K. Horkoshi, J. Mar. Biotechnol., 2 (1995) 125. C. Kato, M. Smorawinska, T. Sato and K. Horkoshi, Biosci. Biotech. Biochem., 60 (1996) 166. D. Bartlett, M. Wright, A. A. Yayanos and M. Silverman, Nature, 342 (1989) 572. D.H. Bartlett and T. J. Welch, J. Bacteriol., 177 (1995) 1008. C. Kato, T. Sato, M. Smorawinska, S. Ham and K. Horikoshi, JAMSTEC J. Deep Sea Res., 10 (1994) 453. K.H. Schleifer and O. Kandler, Bacteriol. Rev., 36 (1972) 407. C. Kato, M. Smorawinska and K. Horikoshi, Proceedings of AIRAPT & EHPRG International conference, published by World Scientific in the Conference Proceedings, in press. T.J. Close and R. L. Rodriguez, Gene, 20 (1982) 305. C. Kato, T. Sato, M. Smorawinska and K. Horikoshi, FEMS Microbiol. Lett., 122 (1994) 91. T. Sato, C. Kato and K. Horikoshi, J. Mar. Biotechnol., 3 (1995) 89. R. Ogata and W. Gilbert, J. Mol. Biol., 132 (1979) 709. C.A. Royer, Biochem., 29 (1990) 4959. T. Sato, Y. Nakamura, K. K. Nakashima, C. Kato and K. Horikoshi, FEMS Microbiol. Lett., 135 (1996) 111. S.D. Emr, J. Hedgpeth, J. M. Clement, T. J. Silhavy and M. Hofnung, Nature, 285 (1980) 82. M. Hofnung, Genetics, 76 (1974) 169. O. Raibaud, M. Roa, C. Braun-Breon and M. Schwartz, Mol. Gen. Genet., 174 (1979) 241. T.J. Shilhavy, E. Brickman, P. J. Jr. Bassford, M. J. Casadaban, H. A. Shuman, V. Schwartz, L. Guarente, M. Schwartz and J. Beckwith, Mol. Gen. Genet., 174 (1979) 249. M. Debarbouille, H. A. Shuman, T. J. Shilhavy and M. Schwartz, J. Mol. Biol., 124 (1978) 359. K. Nakashima, K. Horikoshi and T. Mizuno, Biosci. Biotech. Biochem., 59 (1995) 130. R.E. Marquis and D. M. Keller, J. Bacteriol., 122 (1975) 575. C.E. Zobell and A. B. Cobet, J. Bacteriol., 87 (1963) 710. K. Tamura, T. Shimizu and H. Kourai, FEMS Microbiol. Lett., 99 (1992) 321. O. Kandler, The archaebacteria: biochemistry and biotechnology, Portland press, London, (1992) 195. K.O. Stetter, Frontiers of life, Editors Frontiers, Gif sur Yvette France, (1993).

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

67

Effects of hydrostatic pressure on photosynthetic activities of thylakoids Mitsuyoshi Yuasa a Photosynthesis Research Laboratory, The Institute of Physical and Chemical Research (RIKEN), Wako, Saitama 351-01, Japan aAdvanced Research Laboratory, Hitachi Ltd., Hotoyama, Saitama 350-03, Japan

Abstract Effects of hydrostatic pressure on PS II isolated from spinach thylakoids were studied. Upon pressure treatment above 100 MPa, Mn-cluster of the oxygen-evolving enzyme was preferentially inactivated. This inactivation was effectively suppressed by inclusion of high concentration of sucrose in the medium. This enabled us to study the effects of ambient pressure on the electron transfer around PS II reaction center up to 200 MPa. Ambient high pressure retarded the electron transfer between QA and QB. It also retarded the charge recombination of S2QA- charge pair, but not that of Z§

- charge pair.

1. I N T R O D U C T I O N Light-driven electron transfer in photosynthetic membranes takes place in photosystems in which various electron donor and acceptor molecules are orderly arranged in a functional integrity consisting of more than twenty membrane proteins. As a means to understand the mechanism of electron transfer in such a semi-solid system, the pressure effect has been considered to be a method of certain interest. There have been several reports on the effects of pressure on photosynthetic electron transfer. Hydrostatic pressure affected the rates of charge separation and recombination in reaction centers of photosynthetic bacteria [ 1-4]. In intact cyanobacterial cells, pressure affected the transfer of excitation energy by inducing irreversible dissociation of protein components [5]. In view of the fact that photosystems have a supramolecular structure maintained by relatively weak intermolecular forces, the pressure effect is expected to appear in two types, reversible and irreversible. This has made it difficult to correctly examine the pressure dependence of electron transfer rates, unless both types of effects are successfully separated. In this communication, we report several features of pressure-induced irreversible damage on the oxygen-evolving enzyme of PS II, and some preliminary results on reversible effects of ambient pressure on the electron transfer in PS II reaction centers, which were enabled by use of a pressure protectant to suppress the irreversible damage.

68

2. MATERIALS AND METHODS Oxygen-evolving PS II membranes were prepared from spinach basically according to the method of Berthold et al. [6]. The PS II membranes were resuspended in 0.4 M sucrose, 40 mM MES-NaOH (pH 6.5) and 20 mM NaC1. Sucrose concentration was increased to 1.2 M if needed. Cross-linked PS II membranes were prepared with EDC (1-ethyl-3-(3dimethylaminopropyl)-carbodiimide) as described by Enami et al. [7]. NHzOH treatment of PS II membranes was done as described by Ono et al. [8]. A sample contained in an inner capsule was subjected to high-pressure treatment in a highpressure cell (Hikari High Pressure Co. Ltd., Hiroshima, Japan) having three sapphire optical windows. Two different types of inner capsules were used. One was a cylindrical cell made of polyethylene tubing used for pressure treatment of samples. The pressure was increased at a constant rate to an indicated level in 3 min, kept at this level for 5 min and then released in 3 min. The treated sample (1.0 mg Chl /ml) was recovered and subjected to activity measurements. The other inner capsule was a homemade one used for measurements of fluorescence kinetics under ambient high pressure. A small piece of filter paper soaked with an aliquot of sample (2.0 mg Chl/ml, supplemented with 1.2 M sucrose) was inserted into an envelope of transparent plastic film. After sealing the opening, the envelope was placed in the high-pressure cell in a close front of the optical window. Electron transfer around the PS II reaction center was induced by a short Xe flash (10 ~ts), and was monitored by fluorescence using a pulse-modulated fluorometer (PAM system, Walz, Effeltrich, Germany).

3. RESULTS AND DISCUSSION 3.1. Pressure-induced damage of the oxygen-evolving enzyme We have recently reported that the oxygen-evolving enzyme of PS II is preferentially and selectively damaged by high-pressure treatments, while other photochemical activities of both P S I and PS II are not much affected [9]. As Fig. 1 shows, both oxygen evolution and photoreduction of DCIP (2,6-dichlorophenol-indophenol) with water as electron donor became affected by pressure treatments above 100 MPa, and inactivated almost completely at 300 MPa (0 ~ or 200 MPa (23 ~ By contrast, DCIP photoreduction with DPC (1,5diphenylcarbazide) as electron donor was stimulated. These results indicate that the oxygenevolving enzyme is specifically inactivated by high-pressure treatments, while the electron transfer from Z (the secondary donor of PS II) to QB (the secondary acceptor quinone of PS II) is resistant. It is well known that tetranuclear Mn-cluster is the molecular entity of the catalyst for water oxidation in PS II [ 10]. Inactivation of oxygen evolution, therefore, is expected to involve destruction of the Mn-cluster. Table 1 shows the changes in relative intensity of the EPR signal arising from free Mn 2+ after pressure treatment of PS II membranes. Native PS II membranes exhibited no Mn signal after washing with any buffers, whereas a large part of Mn was released from pressure-treated membranes, exhibiting strong EPR signals after washing with a buffer containing EDTA. Notably, significant amount of free Mn could be released after washing with a buffer containing no EDTA. This implies that the pressure treatments not only damaged the function of the Mn-cluster but also destroyed its structure, but most of the resultant Mn atoms remained nonspecifically adsorbed on PS II proteins in an EPR silent state.

69

Fig. 1 Effects of pressure on oxygen evolution and DCIP photoreduction in normal and EDC-cross-linked PS II membranes. (A) Oxygen evolution by normal PS II after pressure treatment at 0 ~ ( 9 and 23 ~ ( I ) , and by cross-linked PS II after treatment at 0 ~ (A). (B) DCIP photoreduction by PS II membranes in the absence (solid symbols) of DPC after pressure treatment at 0 ~ ( 9 and 23 ~ (1), and in the presence (open symbols) of DPC after pressure treatment at 0 ~ ( o ) and 23 ~ (n). Open and solid triangles indicate the activity of EDC-cross-linked PS II membranes with and without DPC after pressure treatment at 0 ~ [Reprinted, with permission, from: Yuasa et al. (1995) Plant CellPhysiol.,36: 1081-1088, 9 The Japanese Society of Plant Physiologists]

~. 100 i v

8

so

c7

o 150

g 100~ '

o

~t -

50

e~ u a

O

0

100

300

400

Treatment pressure

200

( MPa )

500

Table I Release of Mn from pressure-treated PSII membranes upon washing with and without EDTA. Pressure treatments (0 ~ 5 min)

Release of Mn (%)a No wash

No treatment 300 MPa 500 MPa

0 23 33

Wash with buffer b 0 67 79

Wash with 1 mM EDTA c 0 81 90

Amount of Mn 2+ ions was estimated from the EPR signal of hyperfine lines characteristic of free Mn 2+ ions. b The buffer used was 0.4 M sucrose, 40 mM MES-NaOH (pH 6.5), 20 mM NaC1. c 1 mM EDTA was included in the sample buffer. a

A unit of PS II in oxygen-evolving membranes contains three extrinsic proteins in addition to more than twenty membrane protein components [ 10]. Of these three extrinsic proteins, the 33 kDa protein is known to stabilize the functional Mn-cluster [ 11 ]. We examined the effects of pressure treatments on the protein composition of PS II membranes by means of SDSPAGE [9]. It turned out that most of the 17 and 23 kDa extrinsic proteins were removed from the membrane after treatment at 200 MPa and above at 23 ~ for 5 min (Fig. 2). On the other hand, an appreciable amount of the 33 kDa protein was retained even after treatment at 500 MPa, although partial loss of the protein occurred above 200 MPa. These results suggest that the 33 kDa extrinsic protein no more functioned as a stabilizer of the Mn-cluster at high pressure. Presumably, high pressure caused dissociation of the 33 kDa protein from its native

70 binding site on PS II, leading thereby to destruction of the Mn-cluster, but the protein was reassociated with PS II upon releasing the pressure. Re-association of the 33 kDa protein is likely, since this protein has a high affinity for PS II [ 12]. If these considerations are true, chemical immobilization of the extrinsic proteins will protect the Mn-cluster against pressureinduced destruction. As shown in Fig. 1, EDC-cross-linked PS II in fact exhibited significant resistance to pressure treatments: higher pressures were needed for complete inactivation. Summarizing these results and considerations, we propose a scheme of pressure-induced inactivation of the oxygen-evolving enzyme as shown in Fig. 3. The initial effect of high pressure on PS II is assumed to be dissociation of the 33 kDa protein from PS II, which then facilitates the destruction of the Mn-cluster owing to the absence of the stabilizing machinery.

Fig. 2 Protein composition of PS II membranes after pressure treatment. [Reprinted, with permission, from: Yuasa et al. (1995) Plant Cell Physiol., 36:1081-1088, 9 The Japanese Society of Plant Physiologists]

Fig. 3 A scheme of pressure-induced inactivation of PS II.

71 3.2. Effects of ambient high pressure on PS II electron transfer We recently found that inclusion of high concentration of sucrose or other polyols in the medium effectively suppresses the pressure-induced inactivation of the oxygen-evolving enzyme [to be published elsewhere]. These pressure protectants enabled us to examine the effects of ambient pressure on the electron transfer in PS II by means of fluorescence. As is well established, the yield of chlorophyll fluorescence from PS II varies depending on the redox state of the primary acceptor quinone, QA [ 13], and its transient change (Fv) can be correctly monitored by use of pulse modulation fluorescence technique [ 14] with negligible or minimized photochemistry in the reaction center. Fig. 4 schematically shows the electron transfer chain around PS II reaction center. Excitation of the reaction center chlorophyll, P680, by a flash illumination results in prompt reduction of QA to QA-. The concentration of QA- decreases through three different paths. In the absence of a herbicide (DCMU), its concentration decreases owing to the forward electron transfer from QA to QB. In the presence of DCMU, its concentration decreases through recombination of S2QA- charge pair. (Note that S 2 is one equivalent oxidized state of the Mn-cluster.) In PS II depleted of the Mncluster, its concentration decreases through recombination of Z+QA- charge pair, when DCMU is present. Fig. 5 shows the effects of ambient pressure on the decay kinetics of F v after illumination with a strong single flash. The rapidly decaying component observed at 0.1 MPa (atmospheric pressure) disappeared gradually between 50 and 100 MPa, and was almost lost at 200 MPa. The low initial F v intensity immediately after flash illumination at 200 MPa may be attributed to the decrease in fluorescence yield due to the change in dielectric constant of surroundings at high pressure [ 15]. Upon releasing the pressure, these changes were largely PS II membranes photon

~

NH2OH treatment

Mn

(So~S

Z ~

,~

:

'

P68o ~

DCMU Phe ~

Z+ QA" recombination

QA

4-

J

QB Pa,~ )

$2QArecombi " nation O.1 MPa (202 MPa ~ ) 2 ms

Fig. 4 Electron transfer chain around PS II reaction center in the presence or absence of the Mn-cluster and an inhibitor, DCMU.

Fig. 5 Effects of ambient pressure on the electron transfer from QA- to QB, as monitored by fluorescence decay kinetics at 20 ~

72

PS II membranes + DCMU

A

(Sz QA- recombination) A~

1

~

p,

I...#

NHzOH-treated PS II membranes + DCMU (Z + QA- recombination)

01MPa .

0.1 MPa 100MPa 200MPa m

2s

200 m s

Fig. 6 Pressure effects on the recombination of S2Q A- (A) and Z+QA- (B) charge pairs as monitored by fluorescence decay kinetics at 20 ~ restored, indicating that the effect of ambient pressure on the electron transfer from QA- to QB is reversible. Fig. 6 shows the effects of ambient pressure on fluorescence kinetics due to S2Q A- charge recombination in DCMU-treated PS II (A), and that of Z+QA - charge recombination in NH2OH-treated PS II in the presence of DCMU (B). Obviously, S2Q Acharge recombination was reversibly retarded by ambient high pressure, whereas Z+QA recombination was immune. Based on the scheme shown in Fig. 4, these results are interpreted as indicating that the reverse electron transfer from Z to S 2 is sensitive to ambient high pressure owing probably to a pressure-induced structural modulation of the Mn-cluster.

REFERENCES 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

R.K. Clayton and D. DeVault, Photochem. Photobiol., 15 (1972) 165-175. C.W. Hoganson, M.W. Windsor, D.I. Farkas and W.W. Parson, Biochim. Biophys. Acta, 892 (1987) 275-283. M.W. Windsor and R. Menzel, Chem. Phys. Lett., 164 (1989) 143-150. N.L. Redline, M.W. Windsor and R. Menzel, Chem. Phys. Lett., 186 (1991) 204. D. Foguel, R.M. Chaloub, J.L. Silva, A.R. Crofts and G. Weber, Biophys. J., 63 (1992) 1613-1622. D.A. Berthold, G.T. Babcock and C.F. Yocum, FEBS Lett., 134 (1981) 231-234. I. Enami, T. Tomo, M. Kitamura and S. Katoh, Biochim. Biophys. Acta, 1185 (1994) 75-80. T. Ono and Y. Inoue, Biochemistry, 30 (1991) 6183-6188. M. Yuasa, T. Ono and Y. Inoue, Plant Cell Physiol., 36 (1995) 1081-1088. R.J. Debus, Biochim. Biophys. Acta, 1102 (1992) 269-352. T. Ono and Y. Inoue, Biochim. Biophys. Acta, 806 (1985) 331-340. I.Enami, M. Kitamura, T. Tomo, Y. Isokawa, H.Ohta and S. Katoh, Biochim. Biophys. Acta, 1186 (1994) 52-58. H. Dau, Photochem. Photobiol., 60 (1994) 1-23. U. Schreiber, C. Neubauer and U. Schliwa, Photosynthesis Research, 36 (1993) 65. A. Freiberg, in: Anoxygenic t-,lotosynthetic Bacteria, eds. R.E. Blankenship, M.T. Madigan and C.E. Bauer (Kluwer Academic Publishers, The Netherlands, 1995) p.385.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

73

Effect of hydrostatic pressure on the proliferation and morphology of the mouse BALB/c cells in culture T. Naganuma a,b, T. Mizukoshi c, K. Tsukamoto c, R. Usami c and K. Horikoshi b,c a Faculty of Applied Biological Science, Hiroshima University, 1-4-4 Kagamiyama, Higashi-hiroshima, 739, Japan b Deep Star Program, Japan Marine Science and Technology Center, 2-15 Natsushima-cho, Yokosuka, 237, Japan c Faculty of Engineering, Toyo University, 2100 Kujirai-nakanodai, Kawagoe, 350, Japan Abstract

The mouse BALB/c cells were cultured under hydrostatic pressures of 0.1 to 60 MPa. Proliferation activity declined with the increase of hydrostatic pressure. Sharp decline was observed at the pressure increase from 20 to 30 MPa. Cell viability was lost between 40 and 50 MPa. Cell morphology was affected by hydrostatic pressure. Cells were shortened, collapsed, or coagulated by increased pressure. Cytoskeletal F-actin was also affected by pressure. F-actin lost organization at 50 MPa, and collapsed at 60 MPa. Close association in the pressure-induced loss of proliferation activity, morphology and cytoskeletal organization was confirmed. 1. I N T R O D U C T I O N Effects of hydrostatic pressure on cytological processes have been studied with cultured cells, oocytes, embryos and protozoans [1, 2]. The studies focused mainly on cell viability and proliferation, embryogenesis, polymerization-depolymerization of cytoskeletal filaments, cytoplasmic viscosity and sol-gel transformation, etc. However, the topics were studied independently with different biological sources. Among the cytological topics, cytoskeleton and related-motility seem to have been a primary interest [2]. Microtubule has been intensively studied, probably because of availability and easy determination of assemblydisassembly. Actin filament (F-actin) was mainly studied with invertebrate

74 and yeast cells [2, 3]. The studies with vertebrates are few [2, 4], and the mammalian cells used for the studies were of epithelium origin [2]. This study aims at the coordinative pressure-induced changes in cell proliferation, cell morphology and cytoskeletal F-actin organization. This communication reports the results from a mammalian cell line of fibroblast origin, the mouse BALB/c cells.

2. M A T E R I A L S AND METHODS 2.1. Cell culture under pressure The mouse BALB/c CL.7, which is a normal embryonic fibroblast cell line (ATCC TIB 80) [5] was purchased from ATCC and maintained at 35~ in RPMI 1640 medium (GIBCO BRL) added with 5% (v/v) fetal bovine serum (GIBCO BRL). After several subculturings, the cells were seeded in fresh RPMI 1640 medium (GIBCO BRL) at a density of 103 cells/cm 2 in test tube-like culture flasks (Leyton tubes; Coastar, Cambridge, Massachusetts). The Leyton tube is about 10 cm long and 1 cm wide, and has a flat side for horizontal placement. A plastic cover slip (9 x 55 mm) is placed inside a tube, which the cells attach to and grow on. Immediately after attachment to the slip, the mouse cells were incubated at the pressures (MPa) of 0.1 (atmospheric), 10, 20, 30, 40, 50 and 60 in pressurizing vessels for 24 hours at 35~ The tubes were filled with the medium so that no air space is left.

2.2. Cell proliferation measurement Cell proliferation activity was measured as the increase in cell abundance during the 24-hr incubation. Cell abundance was estimated based on mitochondrial dehydrogenase activity. The dehydrogenase activity was determined by colorimetry of the formazan yielded from the sodium salt of 2,3-bis[2-methoxy-4-nitro-5-sulfophenyl-2H-tetrazolium-5-carboxyanilide, or XTT (Sigma) [6]. The XTT colorimetric incubation was done in RPMI 1640 without phenol red (GIBCOBRL) at 35~ at the atmospheric pressure. The results were expressed as percentage to the maximum activity (colorimetric value). 2.3. Cell m o r p h o l o g y observation Immediately after decompression, the cells were fixed for 30 min at room temperature in a fixation buffer containing 4% paraformaldehyde and 400 mM sucrose in 15 mM Na-HEPES (pH 7.6) [7]. The cell appearance was observed at this stage by phase-contrast microscopy. To increase the cell membrane permeability, the cells were further incubated in ethanol/glacial acetic acid (95:5) at -20~ for 5 min [8], rinsed in deionized distilled water, air-dried, and stored at-80~ Then the cytoskeletal F-actin was stained with 30 units/ml rhodamine phalloidin (Molecular Probes,

75 Inc., Eugene, Oregon) in PBS for 30 min at room temperature, and observed by epifluorescence microscopy.

3. RESULTS AND DISCUSSION

3.1. Cell proliferation activity There was a consistent decrease of growth activity with the increase of pressure (Figure, left column ). A sharp decrease was seen between the pressures of 20 and 30 MPa, where about 60% activity was lowered down to 18%. There was low but positive proliferation at 50 and 60 MPa. However, the proliferation could be false positive, because extracellular (leached) dehydrogenases might cause false positive XTT measurements. Thus the cell proliferation is thought to be positive only up to 40 MPa. This was confirmed by the fact that the 40 MPa-incubated cells recovered full proliferation activity after decompression, while the 50 MPa-incubated cells lost viability. Therefore, there were two breaks in cell proliferation activity. One was the sharp decline between 20 and 30 MPa; and the other was the loss of cell viability (recoverability of the growth) between 40 and 50 MPa. The loss of proliferation activity is, in other words, the blockage of cell division. Earlier observation of the blockage pressure ranged from 20 to 80 MPa, mostly from 30 to 40 MPa [1], with which our observation is in good agreement. 3.2. Cell m o r p h o l o g y The decrease of proliferation activity by pressure was associated with the change of the cell morphology (Figure, middle column ). Typically, the cultured mouse cells are elongated and >100 #m long at the atmospheric pressure. The cell morphology, as well as proliferation activity, was not visually affected at 10 MPa. The cells began to lose elongated morphology and shrink at 20 MPa. The cells became spherical ("rounding-up" [9,10]) at 30 MPa, and even smaller at 40 MPa. The "rounding-up" pressure was previously reported 2040 to 50 MPa for Amoeba cells [1, 10] and 50-70 MPa for human cells [9]. At 50 MPa, the cells were partially collapsed, and coagulated at 60 MPa. The coagulation may suggest the changes in the nature of the the cell membrane surface. The molecular structure of cell membrane is known to be affected by "physiological" pressure of 0.1-100 MPa [11].

3.3. Cytoskeletal F-aetin Cell morphology is largely based on the organization cytoskelton such as actinfilaments (F-actin). Changes in the formation and distribution of Factin under pressure was also observed by epifluorescence microscopy (Figure, right column ).

76 The types of F-actin organization that are generally observed are: stress fibers and the focal contacts; peripheral fibers; and cortical fibers. These organization was still intact at 10 MPa. Stress fiber F-actin was first affected at 20 MPa and retarded in supporting the elongated cell morphology. At 30 MPa, F-actin became accumulated in the peripheral region of the cells; stress fibers were visually disordered, and losing focal contacts. This was responsible for the "rounding-up" of the cells. Stress fibers were completely disordered at 40 MPa, as also shown with in the green monkey cells [2], while peripheral fibers were still organized. However, even the peripheral fibers began to be disturbed at 50 MPa, which might be associated with the loss of cell viability. Similar F-actin disorganization at 50 MPa was observed in yeast cells [3]. At 60 MPa, stress fibers, focal contacts and peripheral fibers were all collapsing. Even cortical fibers seemed to be disordered and F-actin collapsed at 60 MPa. Because the F-actin, as well as microtubules [2], is known to be the most dynamic bio-macromolecule that shows the "dynamic stability" through the balance between polymerization and depolymerization. Also, F-actin has essential functions in various cellular processes such as motility, muscle force generation, cell division and morphology suppot. The cells in culture are suitable for the observation of F-actin organization, and easy to maintain and manipulate. Therefore the cells in culture can serve as a model system to study the pressure effects on the kinetics and dynamism of cellular and biochemical processes.

Figures (next page)

(Left) Effect of hydrostatic pressure on the proliferation of the mouse BALB/c cells in culture.

(Middle column) Effect of hydrostatic pressure on the appearance of the mouse BALB/c cells in culture, observed by phase-contrast microscopy. Scale bar, 50 ktm.

(Right Column) Effect of hydrostatic pressure on the cytoskcletal F-actin (stained with rhodamine phalloidin) of the mouse BALB/c cells in culture, observed by epifluorescencc microscopy. Scale bar, 50 gin.

77

78 4. REFERENCES

1 F. H. Johnson, H. Eyring and M.J. Polissar, The Kinetic Basis of Molecular Biology, John Wiley & Sons, Inc., New York, 1954. 2 H.W. Jannasch, R.E. Marquis and A.M. Zimmerman (eds.), Current Perspectives in High Pressure Biology, Academic Press, London, 1987. 3 H. Kobori, M. Sato, Z.H. Feng, A. Tameike, K. Hamada, S. Shimada and M. Osumi, Program and Abstracts of International Conference on High Pressure Bioscience and Biotechnology, Kyoto (1995) 60. 4 R.R. Swezey and G.N. Somero, Biochemistry, 21 (1982) 4496. 5 P. Patek, J. Collins and M. Cohn, Nature 276 (1978) 510. 6 N.W. Roehm, G.H. Rodgers, S.M. Hatfield and A.L. Glasebrook, J. Immunol. Methods, 142 (1991) 257. 7 P. Forscher and S.J. Smith, J. Cell Biol., 197 (1988) 1505. 8 A. Sarzinski-Powitz (1992) In" Nonradioactive In Situ Hybridization Application Manual, Boehringer Mannheim, Indianapolis (1992) 44. 9 J.V. Landau, Exp. Cell Res., 23 (1961) 538. 10 J. V. Landau and L. Thibodeau, Exp. Cell Res., 27 (1962) 591.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

79

Influence of hydrostatic pressure on expression of heat shock protein 70 and matrix synthesis in chondrocytes K. TAKAHASHI, T. KUBO, Y. ARAI, Y. HIRASAWA, J. IMANISHI*, K. KOBAYASHI* and M. TAKIGAWA* * Departments of Orthopaedic Surgery and *Microbiology, Kyoto Prefectural University of Medicine, Kamigyo-ku, Kyoto 602, Japan. * *Department of Biochemistry and Molecular Dentistry, Okayama University Dental School, Shikada-cho, Okayama 700, Japan.

Abstract To investigate the influence of hydrostatic pressure (HP) on the expressions of heat shock protein 70 (HSP70), and to know the relationship between HSP70 expression and matrix synthesis, we subjected chondrocyte-like cells to HP. HSP70 were enhanced after exposure to 10 to 50 MPa of HP. 35S sulfate incorporation into the cultured cells increased after exposure to 5 MPa of HP and decreased after 50 MPa of HP.

1. I N T R O D U C T I O N Mechanical stress is known to have an important role in the control of matrix synthesis in cartilage. Certain levels of hydrostatic pressure (HP) can stimulate the synthesis of matrix by chondrocytes and can maintain matrix metabolism. However, some levels of HP can depress the turnover of matrix and may lead to cartilage degradation (1). On the other hand, heat shock protein (HSP) is produced by cells after the application of various stresses. It was reported that active synthesis of 70-kDa HSP (HSP70), correlated with the severity of osteoarthritis (OA) (2). In this study, we exposed chondrocyte-like cells to HP and examined the relationship between HSP70 expression and matrix synthesis. 2. M A T E R I A L S AND M E T H O D S

Cell culture HCS-2/8 cells (3) were seeded in plastic petri dishes in Dulbecco's modified Eagle's medium (DMEM) contains 10% fetal bovine serum The cells were maintained at 37~ in a humidified atmosphere of 5% CO2. Pressure application After reached confluence, HCS-2/8 cells were exposed to HP ranging from 1 MPa to 50 MPa. In all assays, duration of HP exposure was set to be 2 hours. The petri dishes were placed in a teflon pouch, which was filled with DMEM. The pouch was then placed in a

80 stainless steel pressurization vessel (inside size, ~65 m m X 9 0 mm), equipped with an oil pressure apparatus (Type KP5B, Hikari Koatsu, Hiroshima, Japan). Temperature was maintained at 37~

35s sulfate incorporation assay for proteoglycan synthesis Control cells and cells after HP exposure (5 and 50 MPa) were labeled for 2 hours by 3 5S sulfate. 35S sulfate incorporation was measured by using a scintillation counter, and was normalized by the total protein concentration. The statistical significance of results was evaluated by using the Student's t-test.

Northern blotting Total RNA was extracted from the control and HP (1, 5, 10, and 50 MPa) exposed cells between 30 minutes and 24 hours after HP exposure. Northern blotting was performed according to the method described previously (4). RNA loading was examined by probing for 15-actin mRNA.

Western blotting Control cells and cells exposed to 1, 5, 10, and 50 Mpa of HP. The cells were harvested at 4 and 8 hours after HP exposure and then sonicated. HSP70 was detected in Western blotting as previously described (4), and a monoclonal antibody (Amersham) was used as the primary antibody.

3. RESULTS

Effects of liP on proteoglycan synthesis in HCS-2/8 cells Exposure to 50 MPa of HP resulted significant (p 0.50)

the observed segregation ratio of mating types formed in the above hybrid, HPI11 was not significantly different from the theoretical ratio, which shows 3 h-/ h § : 1 h § : 2 h-segregation with genotype h-/ h-/ h+. This also suggests that the variant JY1-V1 is a homozygous diploid with an h-/ h - m a t i n g type. For the mechanism of polyploidization by pressure stress, we suggested previously that in the budding yeast S. cerevisiae, at low pressure magnitude of 1 0 0 - 1 5 0 MPa, cytoskeletal elements including microtubules and microfilaments, which are strongly related to nuclear division apparatus or cell polarity in the cells, were completely disrupted, which resulted in the promotion of polyploidation (tetraploid and diploid). Until now, the effect of pressure stress on the induction of diploidization in S. p o m b e has been unclear, but as suggested previously, it is possible that pressure stress may impose severe damage on cytoskeletal elements and make them unable to maintain normal nuclear division as in the budding yeast S. cerevisiae. This is currently under investigation.

4.

REFERENCES

1 D. G. Hoover, C. Metric, A. M. Papineau, D. F. Farkas and Knorr, Food Technol. 43, 99-407 (1989). 2 S. Shimada, M. Andou, N. Naito, N. Yamada, M. Osumi and R. Hayashi, Appl. Microbiol. Biotechnol. 40, 1 2 3 - 1 3 1 (1993). 3 M. Sato, H. Kobori, S. Shimada and M. Osumi, FEMS Microbiol. Lett. 131, 11-45 (1995). 4 K. Hamada, Y. Nakatomi and S. Shimada, Curr. Genet. 22, 371-376 (1992). 5 D. Broek, R. Bartlett, K. Crawford and P. Nurse, Nature 349, 388-393 (1991).

100 6 S. Moreno, A. Klar and P. Nurse, Meth Enzymol. 194, 795-823 (1991).

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology

101

9 1996 Elsevier Science B.V. All rights reserved.

Acquisition of stress tolerance by pressure shock treatment in yeast Mitsuo Miyashitaa, Katsuhiro Tamura *a, and Hitoshi lwahashi b aDepartment of Chemical Science and Technology, Faculty of Engineering, The University of Tokushima, 2-1 Minamijosanjima-cho, Tokushima 770, Japan bNational Institute of Bioscience and Human Technology, Agency of Industrial Science and Technology, 1-1 Higashi, Tsukuba, Ibaraki 305, Japan Abstract

Pressure shock treatment induced heat shock protein (hspl04) and tolerance against various stresses such as high temperature, high pressure and high concentration of ethanol in yeast. The optimum pressures which induced maximal tolerance against these stresses were in the range of 50 - 75 MPa and depended on the type of stress. 1. INTRODUCTION When the cells from different organisms are exposed to mild heat shock, they acquire resistance to subsequent various stresses that would normally be lethal, a phenomenon called acquired stress tolerance [1-5]. Stress tolerance can be induced by various treatments, such as the heating of cells, and the treatment of cells with chemicals, for example, ethanol [4, 5]. These treatments can also induce a small set of proteins called heat shock protein (hsp).

Many hsps are also

formed constitutively and are essential at normal growth temperatures. However, the function of most other hsps is unknown. In Saccharomyces cerevisiae it has been shown that the induction of heat shock protein hsp 104, which is not expressed during growth at normal temperature, is required for acquired thermotolerance to prolonged heat treatments. Another factor potentially important for acquired thermotolerance in yeast is the trehalose. It has been reported that the thermotolerance of yeast is increased even in the absence of hsp 104 when trehalose is accumulated in yeast cells [6-8]. And trehalose induces thermal stability of proteins extracted from yeast cells [7]. It is well known that hydrostatic pressure acts as astress to some organisms and the effects of hydrostatic pressure are similar to those of temperature.

However, the acquisition of stress

tolerance in yeast as a result of pressure shock treatment and its mechanism has not been cleared. We report the effects of high pressure on the induction of heat shock proteins and tolerance to various stresses such as, high temperature, high pressure and high concentration of ethanol in yeast.

102 20 15 "~ 10 .. r~

5

01

0

I

I

25

50

I

75

I

100

]" 125

Pressure / MPa Figure 1. Stress tolerance of pressure-shocked yeast cells. Symbols:O" incubated for 10 min at 51 ~ (thermotolerance); 9 " incubated for 60 min at 150 MPa (barotolerance); IN 9incubated for 60 rain in medium containing 14%(w/w) ethanol (ethanol tolerance). 2. MATERIALS AND METHODS

Stress tolerance of pressure-shocked yeast The yeast Saccharomyces cerevisiae IFO 10149 was grown at 30~ in YPD medium containing (g/l) glucose, 20; polypeptone, 20; and yeast extract, 10. Cultures in the logarithmic phase of growth were used. Logarithmic phase cells were suspended in fresh YPD medium and incubated at 30 ~ for 30 min under various pressures and were subjected to high temperature (51~ for 10 min), high concentration of ethanol (14%(w/w) for 60 min), and high pressure (150 MPa for 60 min).

Survivals were determined by standard dilution plate counts on YM agar containing

(g/l) glucose, 10; agar, 20; polypeptone, 5; yeast extract, 3; and malt extract, 3. Colonies were counted after incubation for 3 days at 37~

All experiments were carried out at least three

times and mean values were calculated.

Measurement of trehalose. Trehalose levels in cells were measured by trehalase (a, ot-trehalose glucohydrolase, [EC 3.2.1.28], Sigma) treatment and following Somogi-Nelson method [9]. Yeast cells were harvested by centrifugation at 1000 x g for 5 minutes, washed twice with distilled water, suspended with the same volumes of distilled water, and incubated in a boiling water bath for one hour. The cell suspensions in part were assessed for protein content and the residual suspensions were centrifuged. The supernatants were added to the reaction mixture containing 3 ~ units of trehalase and 50 mM of sodium acetate buffer at pH 5.7. The reaction mixture was incubated at 37~ overnight. Glucose hydrolyzed from trehalose was measured as a reducing sugar using SomogiNelson method [9].

103

Figure 2. Induction of hsp 104 protein by pressure shock treatment. Lanes A (control,30~ 30 min), B (heat shock, 43~ 30 min) and C (pressure shock, 75MPa, 30 min) are normalized for the protein concentrations. Table 1 Induction of heat shock protein (hspl04)

Western blotting analysis of the heat shock proteins Proteins from yeast cells were incubated at 30~

,

,,

control heatshock pressureshock (30~ (43~ (75 MPa, 30~ Area 25 128 88 Percentage(%) 3.1 15.3 10.6

under 75 MPa for

30 min, were separated by SDS-PAGE electrophoresis using a SDS-10% polyacrylamide slab gel. After the electrophoresis, gels were stained with C o o m a s s i e brilliant blue G-250.

Table 2 Induction of trehalose control heatshock pressureshock (30~ (43~ (75 MPa, 30~ HLC method ND 53.8 ND Enzyme method ND 40 ND ~g / mg of proteins ND: not detected

Destained gels were blotted onto a nitrocellulose

membrane

by

electrotransfer. The membranes were reacted with anti-hsp 104 antiserum and were subsequently visualized using the immunoperoxidase method (Vectastain ABC kit).

The protein amounts

were then estimated using a densitometer. 3. RESULTS AND DISCUSSION

Stress tolerance of pressure-shocked yeast To study the effect of pressure shock on yeast, we evaluated the stress tolerance of cells after pressure shock treatment. Figure 1 shows the results of tolerance against three types of stresses: thermotolerance, barotolerance and ethanol tolerance of the yeast after incubation for 30 min under various pressures at 30~

In the thermotolerance (51~

10 min), only a few percent of

the yeast cells incubated at 0.1 MPa survived under such a severe condition. However, for the cells incubated under moderate pressures, the maximal tolerance against high temperature was induced in the cells incubated at 75 MPa. The survivals then gradually decreased with increasing

104 pressure. On the other hand, the optimum shock pressure was 60 MPa for ethanol tolerance and 50 MPa for barotolerance. These differences in the optimum shock pressures suggest that high pressure, high temperature and high concentration of ethanol affect pressure-shocked yeast cells in different manners. In the case of heat shock treatment, the tolerance against high temperature, high pressure and high ceoncentration of ethanol became maximum at 43~

Western blotting analysis of the heat shock proteins and the determination of trehalose To investigate whether heat shock protein analogs cause the induction of stress tolerance of pressure-shocked yeast, proteins separated from the pressure-shocked yeast cells were analyzed using SDS-10% polyacrylamide slab gel electrophoresis. The proteins obtained were blotted onto a nitrocellulose membrane and incubated with anti-hsp104 antiserum.

They were

subsequently visualized using immunoperoxidase method. Figure 2(I) shows that heat shock proteins were apparently induced by pressure shock treatment in the yeast cells. In Fig. 2(II), hsp 104 bands are separated and the results assayed using a densitometer are shown in Table 1. These results indicate that acquirement of resistance to subsequent stress that would normally be lethal is dependent on the heat shock proteins. As shown in Table 1, pressure shock treatment in yeast for 30 min at 75 MPa induced 3.4 times as much hsp 104 as that of the control and this amount of hsp 104 was nearly two-thirds compared with that induced by heat shock treatment for 30 min at 43~

Therefore, pressure shock treatment is sufficiently effective to induce heat

shock proteins in yeast, although it is not as powerful as heat shock treatment.

This finding

suggests that although the effects of high hydrostatic pressure and high temperature in yeast are tightly linked physiologically, the response of yeast to high temperature and high pressure are not necessarily the same. We also examined the amount of trehalose accumulation in pressureshocked yeast cells.

However, we did not find any trehalose in the pressure-shocked cells

(Table 2). Accordingly, the molecular mechanisms by which the yeast cells acquire the stress tolerance seem to be different in heat shock and pressure shock. REFERENCES

1 2 3 4 5 6 7 8 9

K. Watson and R. Cavicchioli, Biotechnol Lett, 5 (1983) 683. Y. Komatsu, S. C. Kaul, H. Iwahashi and K. Obuchi, FEMS Microbiol Lett., 72 (1990) 159. H. Iwahashi, S. C. Kaul, K. Obuchi and Y. Komatsu, FEMS Microbiol Lett., 80 (1991) 325. J. Plesset, C. Palm and C. S. McLaughlin, B iochem. B iophys. Res. Commun, 108 (1982) 1340. K. Tanji, T. Mizushima, S. Natori and K. Sekimizu, Biochim. Biophys. Acta, 1129 (1992). C. De Virgilio, P. Piper, T. Boller and A. Wiemken, FEBS Lett., 288 (1991) 86. C. De Virgilio, T. Hottiger, J. Dominguez, T. Boller and A. Wiemken, FEBS Lett., 219 (1994) 179. T. Hottiger, C. De Virgilio, M. N. Hall, T. Boiler and A. Wiemken, FEBS Lett., 219 (1994) 187. M. J. Somogyi, J. Biol. Chem., 195 (1952) 19.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

105

High pressure denatured metalloprotein is a new NO-trapper

T.Oku a, K.Umezawa b, T.Nishio a, H.Ogihara b, Y.Ichikawa a, N.Takamatsu a, H.Ishikawa b, H.Tsuyuki b and N.Yano b Department of Biological Chemistry a, and Food Science and Technology b, College of Bioresource Sciences, Nihon University, 3-34-1, Shimouma, Setagaya, Tokyo 154, Japan

Abstract The trapping of nitric oxide (NO) and nitrite (NO2) reduction were examined using cytochrome c, which had been denatured under pressure (0.1500MPa), in 10% isopropanol at 60~ A reducing agent and electron donor were used in the NO2- reduction system. ESR and UV-vis. studies have shown that denatured cytochrome c rapidly forms an iron-nitrosyl (Fe"-NO) complex. Cytochrome c was shown to have a high NO2- reducing activity and the rate of NO2-reduction to NH4+ was faster at low pH. The reduction mechanism is proposed to be NO2 ---~ NO--* NH4+. This reaction is a net 6-electron, 8-proton process. These results suggest that high pressure denatured cytochrome c can be used as an NO-trapper. 1. I N T R O D U C T I O N Nitrite is commonly used as a curing agent in meat processing and is converted into nitric oxide (NO) under acid and reducing conditions ~. Purplish-red myoglobin and hemoglobin forms red NO-(nitrosyl or nitroso) complexes with nitric oxide which subsequently form pinkish NO-hemochrome complexes '~ when heated. The conversion and removal of nitrite is, therefore, an area of interest in the meat processing process. It is also an area of interest in the environmental sciences since nitric oxide, which is derived mainly from nitrite ~ (NO2-) and nitrate ~' (NO3-) by reduction in nature, is a precursor of acid rain", a destroyer of ozone and a suspected carcinogen ~. In 1992 nitric oxide was selected as "The Molecule of the Year" by the journal Science 6~and for the past 5-6 years diverse lines of evidence have shown that NO mediates in immune system responses, a variety of cell functions such as vascular smooth muscle relaxation, inhibition of platelet aggregation and 9 " 7) neurotransm~sslon. Recently we described the conversion of NO2-into N H 4 + via NO using

106 gamma-irradiated and heat denatured metalloprotein "'. This report describes the properties of high pressure denatured cytochrome c and its potential as an NO-trapper and as a model for nitrite reductase.

2. MATERIALS AND METHODS Horse heart cytochrome c purification. Horse heart cytochrome c was obtained from the Sigma Chemical Company (St. Louis, Mo., U.S.A.) and further purified by passage through a Bio-gel P 10 column (2.5 • 50cm) in 1% NaC1. Cytochrome c containing fractions were pooled, dialyzed at 5~ for 4 days and lyophilized. Polyacrylamide gel electrophoresis and electrospray ionizingmass spectrometry (ESI-MS) of purified cytochrome c. SDS-PAGE was performed in 17% acrylamide/0.2% SDS gels using a discontinuous Trisglycine buffer system according to the method of Laemmli 9~and protein bands visualized by staining with Coomassie Brilliant Blue R-250. A JOEL JMX-SX 120A mass spectrometer equipped with an ion spray interface and a mass range of 500-1500amu/e was used to analyze 0.1% acetic acid solutions of cytochrome c (0.1mg/ml).

Denaturation of cytochrome c. High pressure denaturation of cytochrome c in an aqueous solution was performed at 0.1-500MPa in 10% isopropanol at 60~ The procedure was repeated three times. Reduction of nitrite by denatured cytochrome c. A reaction mixture consisting of 1.5ml of 0.2M buffer (0.75mmole, pH3-9), 2ml of 0.01M sodium nitrite (20/zmole), 2.5ml of 0.003M methyl viologen (7.5 /1 mole), 2.5ml of 50/z M cytochrome c, and 1.5ml of 0.96M sodium dithionite (0.36 lz mole) dissolved in an aqueous solution of 0.29M sodium bicarbonate, was incubated at 30~ At timed intervals lml aliquots of the reaction mixture were removed and vortexed vigorously until the methyl viologen was completely discolored. Determination of nitrite and ammoniumn ions. Determination of NO2-and NH4§ formed in the reaction mixture were performed using diazoreaction and HPLC. Spectrometric measurement of iron-nitrosyl complex. Optical and ESR spectra of iron-nitrosyl complexes were obtained using a Milton Roy 3000 spectrophotometer and a JOEL FE3A X-band spectrometer.

107 3. R E S U L T S AND D I S C U S S I O N P u r i f i c a t i o n , s p e c t r o p h o t o m e t r i c p r o p e r t i e s and m o l e c u l a r weight of c y t o c h r o m e c. Purified cytochrome c displayed a single band on SDSPAGE with an estimated molecular mass of 12.5kDa. The absorption maxima of purified cytochrome c were 409nm (~ band) and 529nm in the oxidized form and 415nm( y band), 520nm (/3 band) and 549nm ( a band) in the reduced form. These absorption characteristics are in accord with those of oxidized and reduced cytochrome c l~ The molecular mass of cytochrome c determined by ESI-MS was 12,356.6Da agreeing closely with that (12,360Da) calculated from the amino acid sequence ''). Nitrite reduction and ammonium ion f o r m a t i o n by high p r e s s u r e denatured cytochrome c. Fig.1 shows the results of the reduction of NO2 to NH4+ by high pressure denatured cytochrome c in the presence of reducing agent and an electron donor. The rate of NO2 reduction to NH4+ was higher using high pressure denatured cytochrome c compared with that of purified cytochrome c and purified cytochrome c in isopropanol. This suggests that denatured cytochrome c can be efficiently used as a substitute for nitrite reductase 4).

100~

E ao 0 +

"* 60

imlsggmmiDnsgmBDq

40 "~

20 ,o~

'~ Z

OI

0

30

60 Time (min.)

90

120

Fig.1 NO2" reduction and NH4+ formation using purified and high pressure denatured cytochrome c purified cytochrome c 9 --C]- NO2", ..n.. NH4+ purified cytochrome c in 10% isopropanol 9 ~ NO2", --O- NH4+ purified cytochrome c treated with high pressure in 10 % isopropanol" --~-- NO2", ..,A,. NH4+

108 Detection of iron-nitrosyl c o m p l e x . Optical absorption due to the formation of Fe"-NO complex was observed at around a wavelength of 570nm. A characteristic ESR of the Fe"-NO complex of high pressure denatured cytochrome c was observed near 3,300G. Reaction mechanism of nitrite r e d u c t i o n . From the above results the reaction mechanism of NO2- reduction by high pressure denatured cytochrome c in the presence of reducing agent and an electron donor is proposed as NO2---~NO--~NH4+. This reaction is a net 6 electron, 8 proton reduction process as in the case of nitrite reductase ~ and feredoxin nitrite reductase ~,'~) A ckno wledge m en ts

Our thanks are due to Dean S. Kadota of College of B ioresource Sciences and Nihon University for purchasing ESI-MS. The authors are indebted to Professor R. Hayashi of Kyoto University and Professor K. Gekko of Hiroshima University for their valuable advices with high pressure treatment. Thanks are given to Chief M. Sato of Institute Liaison Section of Nihon University for his smooth administration of ESI-MS and Assistant J. Kaneko of Nihon University for her skilled technical assistance in ESI-MS. We thank Mr. David C. Watson of the National Research Council of Canada for reading the manuscript. 4. R E F E R E N C E S

1 S.H.Lee and R.G.Gassens, J. Food Sci., 41 (1976) 969. 2 T.Kakutani, H.Watanabe, K.Arima and T.Beppu, J. Biol. Chem., 89 (1981) 453,463. 3 J.-P. Rosso, P. Forget and F. Pichinoty, Biochem. Biophys. Acta, 321 (1973) 443. 4 J.M.Jouany, Pollut. Atmos., 89 (1981) 35. 5 P.N.Magee, Adv. Cancer Res., 10 (1967) 163. 6 D.E.Koshland, Jr., Nature, 2 5 8 (1992) 1861. 7 E.Culotta. and D.E.Koshland, Jr., Nature, 258 (1992) 1862. 8 T. Oku, T. Nishio, M. Kondo, H. Sato, T. Ito, K. Nishizawa, H. Seki and M. Hoshino, (in Press) 9 U.K.Laemmli, Nature, 2 2 7 (1970) 680. 10 T. Nakashima, H. Higa, H. Matsubara, A. Benson, K. T. Yasunobu, J. Biol. Chem., 2 41 (1966) 1166. 11 M.Barber and B.N.Green, Rapid Commun. Mass Spectrom., 1 (1987) 80. 12 B.J.Cardenas, J.Rivas and C.G.Moreno, FEBS Letters, 23 (1972) 131. 13 W.G.Zumft, Biochem. Biophys. Acta, 276 (1972) 363.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

109

Ultrastructural effects of pressure stress to Saccharomyces cerevisiae cells revealed by immunoelectron microscopy using frozen thin sectioning M. Sato a, A. Tameike a, H. Kobori b, S. Shimada ~, Z. H. Feng b, S. A. Ishijima" and M. Osumi b aLaboratory of Electron Microscopy, and bDepartment of Chemical and Biological Sciences, Faculty of Science, Japan Women's University, 2-8-1, Mejirodai Bunkyo-ku, Tokyo 112, Japan cplanning and Research Division, Oriental Yeast Co., Ltd. 3-8-30, Nihonbashi Honcho, Chuo-ku, Tokyo 103

Abstract Effects of hydrostatic pressure on ultrastructure of Saccharomyces cerevisiae were studied by immunoelectron microscopy using frozen thin sections. At 100 MPa bundles of the microtubules (MTs) extended in the nucleus, but spindle pole bodies were not visible. At 150 MPa the deposition of gold particles for anti a-tubulin was recognized in the nucleus, although the filamentous structure of the MTs was not seen. At 200 MPa fewer gold particles were scattered in the nucleus. These results show that elements of the nuclear division apparatus are susceptible to pressure stress. These events were reversible at below 200 MPa. 1. INTRODUCTION Study of the effects of hydrostatic pressure on Saccharomyces cerevisiae O-102 cells have revealed the impact of ultrastructural changes [1]. Transmission electron microscopy showed that membrane systems (especially the nuclear membrane) were most susceptible to pressure, and were changed after pressure treatment at 100 MPa for 10 rain. It was also demonstrated that hydrostatic pressure of 200 to 250 MPa greatly inactivated the yeast cells, but at the same time induced polyploidy at high frequency [2]. This finding suggests that the structure of cytoskeletal elements, particularly microtubules (MTs) which are related to the nuclear division apparatus, might be severely damaged by pressure stress under the same conditions. In fact, in S. cerevisiae MTs have been shown to be involved in nuclear division during mitosis [3]. The breakdown of nuclear division apparatus by pressure stress thus confirms the induction of polyploidy in S. cerevisiae. Here, we report the effects of pressure stress on ultrastructure of S. cerevisiae cells using immunoelectron microscopy (immuno EM) [4]. The change in ultrastructure of MTs in the pressure-stressed cells and their assembly during

110 the recovery period after pressure stress was investigated.

2 . Response of S. cerevisiae cells to pressure stress The mid-exponential phase cultures of S. cerevisiae O-102 cells were subjected to various magnitudes of applied pressure from 0.1 to 300 MPa for 10 rain at room temperature. The methods of high pressure treatment, immuno EM and recovery experiment were as described [4]. An immuno EM image of frozen thin sections of the cell without pressure treatment is shown in Fig. l a. Alphatubulin was identified obviously with 10 nm colloidal gold particles (*--) conjugated with goat anti rat IgG. Bundles of MTs (~--) with fine filamentous structure crossed between the two spindle pole bodies (SPBs) in the nucleus. Most of the gold particles (~-) for anti a-tubulin were localized on these bundles within the dividing nuclei. At 100 MPa bundles of MTs (~-) together with the gold particles (~-) for anti a-tubulin were visible in the nucleus, however, SPBs had disappeared (Fig. l b). At 150 MPa gold particles (~-) were seen in the nucleus, although the filamentous structure of the MTs had disappeared (Fig. lc). At 200 MPa there were fewer gold particles and they were scattered throughout the nucleus; the electron dense materials became visible in the the nuclear matrix (Fig. l d, *-). At 300 MPa most of the subcellular structure was destroyed (Fig. le). Our previous observation showed that the viability of S. cerevisiae was lost at 300 MPa [4]. The ultrastructural changes observed in this experiment would explain why the cells lost their abililty to proliferate at 300 MPa. Many electron dense materials had formed in the nucleus (Fig. l e), and these materials are assumed to be denatured proteins caused by pressure stress which were also observed in the pressurized cells of Candida tropicalis [5].

3 . Recovery of microtubules after pressure stress When the cells pressurized at 200 MPa were incubated in fresh medium for 24 h, most of them did not completely recover; sometimes the gold particles (*-) appeared in the nucleus but SPBs were rarely observed (Fig. 2a). When the cells were pressurized at 150 MPa, all the MTs disappeared, and none was seen during the 8 h recovery period. However after 24 h, gold particles (~--) were arranged in the complete assembly of MTs ( ~ ) and SPBs were also visible (Fig. 2b). Sometimes the profile of SPB was abnormal because it was compressed inside the nucleus, causing the bundles of MTs (~-) to spread out in various directions from a single SPB (Fig. 2c). This abnormal location of SPB might be brought about by breakdown of the nucleus membrane and spindle by pressure stress. All cells pressurized at 100 MPa showed normal profiles in the MTs (Fig. 2d, ~ ) . These results show that MTs were reversible. The mitotic spindles of S. cerevisiae partially or completely disappeared at the same range of pressure (200 to 250 MPa) at which formation of polyploidy was observed at high frequency [2]. The same phenomenon observed in higher eukaryotes has demonstrated the induction of polyploidy by pressure stress [6], therefore the breakdown of the mitotic spindle of S. cerevisiae by pressure stress probably facilitates the induction of polyploidy in this yeast.

111 T h e a b n o r m a l SPBs (Fig. 2) and recoverability of the d a m a g e d mitotic spindles and nuclear m e m b r a n e s also m i g h t contribute to the f r e q u e n t f o r m a t i o n of polyploidy in this yeast.

Fig. 1. Immuno EM images of frozen thin sections of the yeast treated without (a) and with hydrostatic pressure at 100 (b), 150 (c), 200 (d) and 300 (e) MPa. N, Nucleus.

112

4 . REFERENCES 1 2 3 4 5 6

S. Shimada, M. Andou, N. Naito, N. Yamada, M. Osumi and R. Hayashi, Appl. Microbiol. Biotechnol., 40 (1993) 123. K. Hamada, Y. Nakatomi and S. Shimada, Curr. Genet., 22 (1992) 371. B. Byers, In Molecular Biology of the Yeast Saccharomyces, vol. 1 (eds. J. N. Strathern, E. W. Jones and J. R. Broach) pp. 59. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY., 1981. H. Kobori, M. Sato, A. Tameike, K. Hamada, S. Shimada and M. Osumi, FEMS Microbiol. Lett., 132 (1995) 253. M. Sato, H. Kobori, S. Shimada and M. Osumi, FEMS Microbiol. Lett., 131 (1995) 11. H. Onozato, Aquaculture, 43 (1984) 91.

Fig. 2. Immuno EM images of frozen thin sections of 24 h-incubation cells after treated at 200 (a), 150 (b, c) and 100 (d) MPa by hydrostatic pressure.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology

9 1996 Elsevier Science B.V. All rights reserved.

113

Biological stimulation of low-power He-Ne laser on yeast under high pressure Shinsuke Kishioka, Katsuhiro Tamura*, and Mitsuo Miyashita Department of Chemical Science and Technology, Faculty of Engineering, The University of Tokushima, Minamijosanjima-cho, Tokushima 770, Japan Abstract The aim of this study was to find out the effect of Low-power He-Ne laser on the growth of yeast (Saccharomyces cerevisiae) cells under pressurized conditions. Laser was found to be able to retard the growth inhibitory effect of hydrostatic pressure thus stimulating the growth of yeast cells under moderate pressure of 50 MPa, a pressure that normally inhibits their growth. 1. I N T R O D U C T I O N Laser radiation has been widely and variedly used in medicine and biology. High-power radiation of laser can destroy normal and neoplastic tissues. On the other hand, low-power HeNe laser is widely used in the field of medicine for the treatment of postsurgical headaches, posttherapeutic neuralgia (PTN), failure of skin ulcers to heal, rheumatic arthritis, and bronchial asthma. It is known that the irradiation of low-power visible monochromatic red light such as He-Ne laser often stimulates metabolic systems in various cells and accelerates the growth [1 ]. Irradiation of laser caused stimulation of DNA synthesis in cell and enhanced cell division rate [2,3]. We studied the effect of low-power visible monochromatic red light, He-Ne laser, on the growth of yeast cells under high pressures up to 150 MPa. Hydrostatic pressure usually retards the growth of cells under moderate pressures up to 50 MPa. We used a low-power He-Ne laser to retard the effects of hydrostatic pressure on the growth of yeast. 2. M A T E R I A L S AND M E T H O D S

The yeast Saccharomyces cerevisiae IFO 10149 was grown at 30~ in YPD medium containing (g/l) glucose, 20; polypeptone, 20; and yeast extract 10. Cultures in the logarithmic phase of growth were used. Logarithmic phase cells were suspended in fresh YPD medium and incubated for 0 - 120 min under various pressures at 25~ (room temperature), and then irradiated with He-Ne laser (8.5 mW, wavelength 632.8 nm, Senko Medical Instrument Mfg.). A high pressure vessel (130x130x130 mm) with optical windows was used for the irradiation of laser under high pressures up to 150 MPa (Fig. l). Optical power of laser was measured by ADVANTEST Optical power multimeter Q8221 type. The viable cell numbers were determined by counting colonies on YM agar medium containing (g/l) glucose, 10; agar, 20; polypeptone, 5; yeast extract, 3; and malt extract, 3, after incubation for 3 days at 30~ and comparing with those of the non-irradiated controls.

114

Figure 1. High pressure system with He-Ne laser. 1. High pressure pump, 2. Bourdon gauge, 3. High pressure vessel, 4. Inner sample cell, 5. Sapphire window, 6. He-Ne laser system, 7. Optimical power meter.

Table 1

The time course of dose at the inlet surface of inner sample cell Time / min Dose / 104 J m -2

20

40

60

80

100

120

4.60

9.20

13.79

18.38

22.99

27.59

3. RESULTS It is known that maximum biomass in yeasts is accumulated at the wavelength of 632.8 nm of He-Ne laser [2]. The dose of the laser at the inlet surface of the inner sample cell which contains yeast suspension is shown in Table 1. Figure 2 shows the numbers of viable cells of irradiated and non-irradiated yeasts at various pressures of 0.1 to 120 MPa. At atmospheric pressure, yeast cells irradiated with He-Ne laser showed pronounced growth enhancement which was much higher than that of the non-irradiated controls. The difference in number of viable cells between irradiated and non-irradiated ones increased with increase in irradiation time from 20 up to 120 min. At 50 MPa, the growth of non-irradiated yeasts was found to be inhibited, however, the viable cell numbers of irradiated ones were increased. The rate of increase in number of viable cells corresponded to that of the non-irradiated ones at 0.1 MPa. At 100 MPa, the viable cell numbers became constant regardless of the period of irradiation, although they were higher than those of the non-irradiated yeasts. The effect of laser irradiation completely disappeared at pressures higher than 150 MPa. Figure 3 shows viable cell numbers of irradiated and non-irradiated yeasts after 120 minutes at various pressures (A) and the differences between them (B). The number of non-irradiated cells decreased monotonously along with increase in pressure, but irradiated ones drew a gentle slope. The

115

2.5

2.5 0.1 MPa

50 MPa

2.0 o

Z

2.0

1.5

Z

1.5

Z

Z 1.0

Ip _o

0.5 0.0

,

0

,IL lw

t

!

20

40

1.0 0.5 "

irradiated non-irradiated I 60

I 80

------(3---.--irradiated non-irradiated ,qw

I 100 120

I 20

0.0

I 80

I 100 120

2.5

2.5

150 MPa

1O0 MPa

2.0

-----0

1.5

2.0 . irradiated non-irradiated

Z

Z

Z 1.(~ lw,

-,

0.5 0.0

I 60

Time / rain

Time / min

Z

I 40

0

t 20

t 40

t 60

t 80

Time / min

t I 100 120

9

irradiated non-irradiated

1.5 1.0 0.5 o.o 0

20

~ 40

~

60

~

80

t

..

100 120

Time / min

Figure 2. The effects of low-power He-Ne laser irradiation on the growth of yeast cells under various pressures. The data at 150 MPa overlapped completely.

difference between the numbers of irradiated and non-irradiated cells was maximum at 50 MPa. These results suggest that a low-power He-Ne laser stimulates the growth of yeast cells most effectively at 50 MPa, a pressure under which yeast cells normally can grow no longer. The results of experiments performed to investigate the effect of laser irradiation on the growth of yeast cells at 50 MPa for various periods of times ranging from 20 to 120 min are depicted in Fig.4. Without irradiation, the growth of yeast cells was found to be ceased at 50 MPa. However, they did not loss their viability. The growth was also completely ceased when the irradiation was stopped after exposure for 20, 40 or 60 minutes and the number of viable cells became constant up to 120 minutes as shown by each dashed line. These results suggest that we can obtain desired number of viable cells by changing irradiation time at 50 MPa, a pressure that normally inhibits their growth. On the other hand, at 0.1 MPa (atmospheric pressure) the dashed lines of 20, 40 or 60 minutes' irradiation overlapped each other on the solid line of 120 minutes' irradiation (the figure is not shown). Therefore, irradiation of yeast cells for a period exceeding 20 minutes had virtually no effect on their growth at atmospheric pressure.

116

2.5

0

irradiated

1.0/

2.0 1.5

0.6

Z ~ 1.0 2:

~

0.5 0.0

/

~

o

120min

,,

o.4

0.2

0

50

~,

150

100

Pressure / MPa

0.0

0

50 1O0 Pressure / MPa

150

Figure 3.

The effects of low-power He-Ne laser irradiation ( 120 min) on the growth of yeast cells under various pressures.

2,5

"

50 MPa

2~I 1

J

0.5 0.0

0

I

20

I

40

I

60

I

Figure 4. The effects of low-power HeNe laser irradiation on the growth of yeast cells at 50 MPa. Irradiation time: O , 0 min (nonirradiated) ; A , 20 min ; V , 40 min ; ~ , 60 min ; Q), 120 min (full time) . :irradiated, :non-irradiated.

I

80 100 120

Time / min 4. R E F E R E N C E S 1 T.I. Karu, Photobiology of Low-power Laser Therapy, Harwood Academic Publishers, 1989. 2 T. I. Karu, IEEE J. Quantum Electronics, QE-23 ,(1987) 1703. 3 J. S. Kana, G. Hutschenreiter., D. Haina and W. Waidelich, Arch. Surg., 116 (1981) 293.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

117

Pressure-induced molten globule states of proteins P. Masson and C. Cl6ry Centre de Recherches du Service de Sant6 des Arm6es, Unit6 de Biochimie, 24, av. des Maquis du Gr6sivaudan, 38702 La Tronche c6dex, France

Abstract Under mild denaturing conditions proteins undergo transitions toward partially unfolded states called "molten globules". Moderate pressures can inactivate enzymes and cause protein denaturation without extensive conformational changes. Several lines of evidence indicate that pressure in the range 0.5 - 1.5 kbar can induce molten globule transitions. In this paper, the subject of pressure-induced molten globule states is reviewed. This is followed by practical considerations on gel electrophoresis under hydrostatic pressure. This technique is used to detect increase in hydrodynamic volume of proteins that accompanies molten-globule transitions. High pressure electrophoresis and measurements of ANS binding were applied to cholinesterases. Results indicate that pressure denaturation of these enzymes is a multistep process ; intermediates have characteristics of molten globules.

1. I N T R O D U C T I O N In the past few years, growing attention on protein folding/unfolding [1, 2, 3] and emerging applications of high pressure in biotechnology [reviewed in : 4, 5, 6, 7, 8] have renewed interest in high pressure effects on the structure and functions of proteins. The purpose of this overview is to discuss the effects of moderate pressures on proteins. In this respect we will present results dealing with the pressure dependence of hydrodynamic parameters of proteins with special reference to denaturation of cholinesterases (EC. 3.1.1.7 and 8) as model proteins.

2. M O L T E N GLOBULES INTERMEDIATES

AS

PROTEIN

FOLDING/UNFOLDING

The intrinsic stability of proteins is the result of a delicate balance between stabilizing and destabilizing interactions [9, 10, 11]. Thus, the native conformation of

118 proteins is marginally stable and protein unfolding occurs by changing the environmental conditions. Unfolding transitions can be either reversible or irreversible and even for small single-domain proteins, the existence of folding intermediates has been recognized [12]. Among the intermediates, the existence of a native-like folding state which does not have the typical amino acid tight packing of native state was predicted in the early 1970s by Ptitsyn and his co-workers [13]. These authors introduced the concept of "molten globule" (MG), but the term "molten globule", which specifies that this intermediate is compact but liquidlike and fluctuating, was proposed by Ohgushi and Wada [14]. Actually, the first MG state was discovered in 1981 by studying acid-induced denaturation states of model ct-lactalbumins [15]. It appears now that the MG state is an equilibrium denatured state for proteins submitted to mild denaturing conditions such as low temperatures, low concentrations of guanidinium chloride, or moderate pressures. Also it is now well accepted that the MG state is a major kinetic intermediate of protein folding. It is also becoming clear that there is a structural continuum of MG states from "highly ordered" MG states that are less ordered than the native state [16] to "pre-molten globule" states that are more ordered than the unfolded state [17]. However, the mechanisms responsible for the conformational stability of the MG states are still unclear. Indeed, the thermal unfolding of MG states indicates that there are two types of MG : the first one shows cooperative thermal unfolding that can be approximated by a two-state transition, whereas the second one shows gradual unfolding. Recent results suggest that a combined mechanism of the two-state and gradual transitions would provide a better description of unfolding transitions of MG states [18]. Molten globules have the following characteristics : they are compact denatured states that retain most of the secondary structure of folded states, but have a disordered tertiary structure with largely flexible side-chains, and high mobility of loops and ends of the polypeptide chain [19, 20, 21 ]. Their hydrodynamic radius is 10-20 % greater than that of native conformations. Proteins in the MG state have also an increased hydrophobic surface as evidenced by : a) increased binding of hydrophobic probes such as ANS (8-amino-l-naphtalene sulfonate)[22], bis-ANS or cis-parinaric acid ; b) increased quenching of tryptophan fluorescence by acrylamide ; c) tendency to aggregate. Enzymes in MG state are inactive. The compactness of MG can be estimated by determining adiabatic compressibility using ultrasonic velocimetry [23, 24]. The energetics of MG states can be directly determined by differential scanning calorimetry [25].

3. PRESSURE-INDUCED DENATURATION OF PROTEINS Hydrostatic pressure is a unique tool for obtaining thermodynamic and structural information on conformational and structural equilibria of macromolecules. Indeed, unlike other perturbants, pressure acts only on interatomic distances of molecular and macromolecular assemblies. Therefore, pressure affects the structure of folded polypeptide chains by altering inter and intramolecular weak interactions responsible for stability of native forms, but in the pressure range of most biochemical and biophysical studies (0.1 MPa to 1500 MPa, i.e., 1 bar to 15 kbar), pressure does not affect the primary structure of proteins. The extent and the reversibility of functional

119 and structural pressure-induced changes depend on both the pressure range, the rate of compression and the exposure time under pressure. Pressures of magnitude less than 3 kbar (300 MPa) can induce dissociation of oligomeric assemblies [26] and partial denaturation of proteins. Although moderate pressures do not affect significantly the tertiary structure of proteins, they may cause inactivation of enzymes. The fact that moderate pressures do not disrupt secondary structures is due to the absence of effect of pressure on hydrogen bonds that are the stabilizing interactions of secondary structure. On the other hand, desorganization of tertiary structure presumably results from pressure-induced disruption of hydrophobic interactions. Unfolding of polypeptide chains occurs in general at pressures higher than 3 kbar that can be over 10 kbar. Hawley showed by electrophoresis under pressure that pressure denaturation of small single-chain proteins obeys apparently the simple two-state model [27]. However, change in intrinsic fluorescence of proteins and of ANS binding with pressure demonstrated that pressure denaturation is not an all-or-none transition but a complex phenomenon involving several steps and leading to a plurality of pressure-denatured protein states [28]. Complex denaturation processes involving stable intermediates have been probed by electrophoresis under pressure [29, 30]. However, major advances in study of pressure-induced denaturation of proteins can be obtained by spectroscopic methods, among them high-pressure NMR is becoming one of the most informative tool [31, 32]. In a previous study, we investigated the pressure denaturation of human butyrylcholinesterase (BuChE, EC.3.1.1.8) tetramer by Fourier transform-infra red spectroscopy up to 11 kbar. We observed no significant change in secondary structure below 3 kbar [33]. Yet, the enzyme was irreversibly inactivated above 2 kbar [34] and fourth derivative UV spectra corresponding to absorption of aromatic amino acids provided evidence for pressure-induced change in the environment of aromatic residues [35], which in turn reflects slight conformational changes. Unfolding started above 3 kbar and was complete at 8 kbar. Upon releasing the pressure, there was no return to the native conformation and fluorescence measurements under pressure indicated formation of aggregates of irreversibly denatured BuChE. Moreover, although this enzyme is a tetramer, it is not dissociated by pressure. The molecular basis for this resistance to pressure is not completely elucidated. However, the four subunits appear to be held together by their C-terminus which contains an array of tryptophan residues on the apolar ridge of a helical segment. These residues may form a "tryptophan zipper" whose stability is strengthened by pressure [35]. So, numerous lines of evidence argue for complexity of pressure denaturation and multiplicity of pressure-denatured states of proteins.

4. TEMPERATURE, SOLVENT AND COSOLVENT EFFECTS The effects of pressure can be modulated by other environmental parameters : temperature, pH, solvent and chemical composition of the medium, in particular salts and low molecular weight additives acting as osmolytes. Temperature changes induce simultaneous changes in energy and volume, but as a general rule, the effects of temperature on weak interactions are opposite to those of pressure [36]. The combined effects of pressure and temperature on protein structure can be represented by pressure-temperature denaturation transition maps of constant free energy difference [37]. So, pressure, e.g., up to 2 kbar, may increase thermal

120 stability of mesophile enzymes [38] and macromolecular assemblies [39]. Enzymes from extreme thermophiles have been found to be pressure stabilized against thermal inactivation [40], but this cannot be generalized [41]. Although the importance of water in pressure-induced denaturation of proteins has long been recognized [42], the influence of solvent has not been intensively investigated. Yet, high-pressure studies can be performed in heavy water instead of water as buffer solvent. Indeed, heavy water has been found to shift the pressure denaturing threshold toward high pressures [43, 44]. The protective effect of heavy water presumably reflects the strengthening of hydrophobic interactions in the presence of heavy water. Regarding organic solvents, there is indication that pressure/thermal denaturation of proteins may be retarded in neat non polar solvents [45] and in reversed micelles [46].

5. M O L T E N PROTEINS

G L O B U L E S AS P R E S S U R E - D E N A T U R E D

STATES

OF

The nature of pressure-denatured states of proteins has long been badly characterized. There are now numerous evidence that denatured states of proteins induced by pressures lower than 3 - 4 kbar are more compact than denatured states induced by heat or chemical denaturants. These pressure-denatured states do not show a well organized tertiary structure, their secondary structure is essentially unaltered and they have the ability to bind hydrophobic probes. Thus, they display characteristics of molten globules [26]. However, few data on molecular dimensions of pressure-denatured states of proteins have been reported to date. Measurements of diffusion coefficients by light scattering under pressure showed that the hydrodynamic radius, RH, of bovine serum albumin passes through a shallow minimum and above 1 kbar increases monotonously with pressure [47]. A more complex pressure dependence of hydrodynamic radius has been found for lysozyme 9initially RH is independent of pressure, but between 1.2 kbar and 2.3 kbar it decreases by approximately 3%, then RH increases and eventually reaches a plateau beyond 4 kbar [48]. Such a behavior is not clear and would suggest that the initial response of proteins to pressure is a contraction. The following size expansion at higher pressures corresponds to penetration of water into the protein structure.

6. INVESTIGATION OF MOLECULAR SIZE OF PRESSURE-DENATURED PROTEINS Among hydrodynamic methods, size exclusion chromatography (FPLC) has proven to be a convenient tool to evaluate with accuracy molecular dimensions of proteins conformers, solvent-induced changes of protein Stokes radii and to provide evidence for MG state [49]. However, chromatographic techniques are difficult to adapt to high pressure. On the other hand, polyacrylamide gel electrophoresis which has long been used to estimate size of proteins [50] and to characterize their denatured states [51] has also been successfully adapted to high pressure [for a review, see 52]. So, gel electrophoresis under hydrostatic pressure is ideally suited to the study of

121 pressure-induced MG state, as it gives a measure of changes in the hydrodynamic volume of proteins. In our laboratory, monitoring the pressure-induced changes in hydrodynamic radius of proteins is achieved by electrophoresis under pressure in multiple capillary gel rods of different acrylamide concentrations [52]. The mobility (m) of proteins in polyacrylamide gels is related to the acrylamide concentration (% T) according to the empirical Ferguson relationship (1)

log m = log Yo- KRT

where Yo is the mobility at T - 0% and KR is the retardation coefficient. The ordinate intercept Yo depends on the charge, size and shape of the protein ; KR depends on the size [50]. Assuming sphericity of the protein, KR may be related to the protein molecular radius (R) according to the equation, KR1/2 = c (R + r) (2) where c is an experimental constant and r the radius of the polyacrylamide fiber. Since R>> r, it follows 9 KR ~ c 2 (3Vh/4Jt) 2/3

(3)

where Vh is the hydrodynamic volume. The values of KR have also been found to depend on protein conformation [53] and to vary with pressure [52]. So, any change in KR can be related to changes in conformation and hydrodynamic volume (AVh). K~ 2 AV h ~ c-37-,2-. . AK R 2n

or

KR,p

KR,O

....

Vh,p

)2/3 (4)

Vh,o

where subscripts P and 0 refer to values at pressure P and at atmospheric pressure, respectively. We used this electrophoretic technique to investigate the effect of moderate pressures, lower than 3 kbar, on the structure of different cholinesterases. Pressureinduced overall conformational changes of these enzymes have been detected by construction of Ferguson plots at different pressures and measuring KR changes as a function of pressure. As shown in Fig. l, replot of KR against pressure for human BuChE indicates that KR was almost constant at pressures up to 1.25 kbar. Above this pressure threshold, KRincreased up to about 1.5 - 1.75 kbar and then decreased. This transient increase in KR suggested to us that human BuChE had undergone a transition toward a conformational state whose hydrodynamic radius is about 20% greater than that of the native enzyme. As we pointed out, swelling of protein structure is one of the characteristics of the MG transition. To test the hypothesis of a pressure-induced MG transition and to examine the contribution of hydration changes to human BuChE volume change, electrophoreses were performed in the presence of osmolytes at high concentration (2 M sorbitol, 1 M sucrose, 0.5 M glycine in buffers). Under these conditions, KR did not significantly

122 change up to 3 kbar, suggesting that osmolytes counteracted the pressure-induced swelling of the enzyme [62]. In addition, the enzyme was still fully active at 3 kbar, whereas in the absence of osmolytes it was irreversibly inactivated beyond 2 kbar. The protective effect of cosolvents may be interpreted in terms of preferential hydration, i.e., preferential exclusion of polyols or osmolytes from the protein surface [54]. The presence of the osmolyte shell increases the tension of the enzyme surface and strips water molecules off the enzyme hydration layer, which in turn counteracts the denaturing effect of pressure. It should be mentioned that the stabilizing effect of osmolytes against pressure induced-dissociation of oligomeric proteins [55, 56, 57] and denaturation of single-chain proteins [58] is well documented. To rule out possible artifactual effects due to change in buffer viscosity and change in polyacrylamide gel sieving properties with pressure, we studied the pressure dependence of KR of different wild-type, mutant, and chemically-modified cholinesterases which exhibit stability differences [34]. In addition, we studied the pressure dependence of the fluorescence intensity of ANS in the presence of these cholinesterase species. As shown in Fig. 1, monomer and dimer recombinant wild-type human ac6tylcholinesterase (ACHE, EC.3.1.1.7) behave exactly like the tetramer of wild-type human BuChE. On the other hand, monomer and dimer of recombinant Drosophila AChE did not exhibit any pressure dependence of KR up to 2.5 kbar. This behavior was unexpected since Drosophila AChE shows sequence homology with vertebrate cholinesterases that suggests similar folding [59]. However, the active site gorge of Drosophila AChE displays some differences that explain specific catalytic properties and sensitivity to inhibitors. Thus, certain amino acid residues lining the active site gorge of cholinesterases could be involved in the pressure sensitivity of these enzymes.

0.5

0/

-

0.4

BuChE

0.3 m

ad

rHuACIaE

Abr-~--..~" 0.2 \

0.1

rDrosophila AChE .,

0

t

0.5

I

1

I

1.5

t

2

I

2.5

P R E S S U R E (kbar)

Figure 1. Variation of the retardation coefficient, KR, of different cholinesterases with pressure in 8.26 mM Tris/0.1 M glycine pH 8.3 at 10~ human serum BuChE tetramer ; m, recombinant human AChE dimer ; A, recombinant human AChE monomer ; X, recombinant Drosophila AChE dimer ; +, recombinant Drosophila AChE monomer.

123 To test this hypothesis, we investigated the effect of pressure on KR of cholinesterases that have been modified in their active site gorge : a) human BuChE whose active site serine (S198) was irreversibly phosphonylated by an organophosphate (soman), b) human AChE mutants carrying point mutations either at the rim (D74N) or at the bottom (E202Q) of the active site. The methyl phosphonyl BuChE did not exhibit transient KR increase around 1.5 kbar, suggesting that it was insensitive to pressure in this pressure range. It should be remembered that in previous studies we found this phosphonyl conjugate more resistant to urea and pressure than the native enzyme [60, 34]. Moreover Raman spectroscopy revealed significant differences in secondary structure between the two enzyme forms [61]. Similarly, KR of AChE mutants was found to be pressure invariant in the pressure range applied, thus confirming our hypothesis. These results were corroborated by ANS fluorescence data. Indeed, the relative intensity of fluorescence of ANS bound to cholinesterases was found to be pressure dependent in a complex way. Binding of ANS to wild-type human AChE increases transiently with pressure up to 1.25 kbar, then drops and increases again beyond 1.5 kbar. This pattern indicates that low pressures in the range of 1 kbar promoted solvent exposure of patches of hydrophobic residues, which is consistent with the hypothesis of MG intermediates. On the other hand, there was no enhancement of ANS binding to the E202Q mutant up to 2.5 kbar and only a small increase to the D74N mutant. The fluorescence increase of ANS observed beyond 1.5 kbar for wild-type AChE presumably corresponds to the beginning of the highly cooperative unfolding of the polypeptide chain. Interestingly, we should point out that the pressure corresponding to the first fluorescence peak (1.25 kbar) did not coincide with the pressure giving the maximum values of KR (~1.75 kbar). Such a shift has already been observed during the pressure denaturation of human BuChE [62], suggesting that pressure induces the sequential formation of at least two MG states. Moreover, spectra were recorded overnight after the release of pressure; they did not reveal any time evolution, indicating complete irreversibility of the transition native state -> MG state. ANS binding and electrophoresis data support the view that denaturation of cholinesterases by moderate pressures is a multistep process consisting of at least two MG intermediates. Moreover, the fact that a chemical modification or single mutations of amino acids located down the active site or close to the rim of the active site gorge increased the stability of modified / mutated enzymes indicates that these amino acids play a key role in the conformational stability of cholinesterases. This in turn suggests that the active site gorge of these enzymes is flexible and hence very sensitive to environmental conditions. Thus, it may be hypothesized that the MG transition of cholinesterases is initialized by conformational / hydration changes occuring in this region.

7. CONCLUSIONS AND PROSPECTS Results on model enzymes presented in this paper and recent studies reviewed by [31] show that pressure is a powerful tool which can provide unique insights into the mechanisms of protein denaturation [63]. In this respect, molten globules may now be regarded as transition states in protein folding/unfolding processes [64]. Thus, characterization and conditions of generation of sub-transition states of proteins, e.g.,

124 "highly ordered" molten globule states should be achieved by fine pressure tuning. Applications in the field of protein engineering could come out in a very near future. For example, high pressure-assisted refolding of proteins appears to be a promising method to get E. coli expressed functional recombinant enzymes [65]. Possible medical applications can also be considered. Indeed, pressure inactivate viruses [66] without loss of the immunogenicity [67]. Therefore, pressure may be used for the preparation of killed vaccines. Moreover, since pressure-induced partial unfolding of viral proteins may uncover buried antigenic sites, pressure inactivation procedures could be particularly suitable for poorly immunogenic viruses. Lastly, limited or complete proteolysis of proteins under pressure is another promising field of research [6, 68]. Potential applications are production of low antigenic proteins and protein hydrolysates without allerginicity and improved digestibility [69].

8. ACKNOWLEDGEMENTS This work was supported by a grant from la Direction des Recherches et de la Technologie (DRET 94/5). The authors are grateful to Dr. A. Shafferman for providing recombinant human ACHE, and Pr. D. Fournier for providing recombinant Drosophila ACHE.

9. R E F E R E N C E S

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

T.E. Creighton, Biochem. J., 270 (1990) 1. R. Jaenicke and J. Buchner, Chemtracts, Biochem. Mol. Biol., 4 (1993) 1. K.A. Dill, S. Bromberg, K. Yue, K.M. Fiebig, D.P. Yee, P.D. Thomas and H.S. Chan, Prot. Sci., 4 (1995) 561. R. Hayashi, in : Engineering and Food 2, Spiess, W.E.L. and Schubert, H., Eds, Elsevier appl. sci., Amsterdam, (1989) pp 815-826. C. Balny, R. Hayashi, K. Heremans and P. Masson High Pressure and Biotechnology , John Libbey Eurotext Ltd, Paris, London, XXXV+ 565 p. (1992) S. Kunugi, Prog. Polym. Sci., 18 (1993)805. V.V. Mozhaev, K. Heremans, J. Frank, P. Masson and C. Balny, TIBTECH, 12 (1994) 493. B. Tauscher, Z. Lebensm. Unters. Forsch., 200 (1995) 200, 3. C.N. Pace, TIBS, 15 (1990) 14 and TIBTECH, 8 (1990) 93. R. Jaenicke, Eur. J. Biochem., 202 (1991) 715. C.O. FdgS.in, Biochim. Biophys. Acta, 1252 (1995) 1. P.S. Kim and R.L. Baldwin, Annu. Rev. Biochem., 59 (1990) 631. O. Ptitsyn, Cur. Opin. Struct. Biol., 5 (1995) 74. M. Ohgushi and A. Wada, FEBS, 164 (1983) 21. D.A. Dolgikh, R.I. Gilmanshin, E.V. Brazhnikov, V.E. Bychkova, G.V. Semisotnov, S. Venyaminov, S. Yu and O.B. Ptitsyn, FEBS Lett., 136 (1981) 311. C.M. Dobson, Curr. Biol., 4 (1994) 636.

125 17 O.B. Ptitsyn, V.E. Bychkova and V.N. Uversky, Phil. Trans. R. Soc. London Ser. B., 348 (1995) 35. 18 I. Nishii, M. Kataoka and Y. Goto, J. Mol. Biol., 250 (1995) 223. 19 H. Christensen and R.H. Pain, Eur. Biophys. J., 19 (1991) 221. 20 O. Ptitsyn, Adv. Prot. Chem., 47 (1995) 83. 21 O. Ptitsyn in" Protein Folding, Creighton, T.E. Ed., Freeman & Co, N.Y., (1992) pp 243. 22 G.V. Semisotnov, N.A. Rodionova, O.I. Razgulyaev, V.N. Uversky, A.F. Gripas and R.I. Gilmanskin, Biopolymers, 31 (1991) 119. 23 B. N61ting and S.G. Sligar, Biochemistry, 32 (1993) 12319. 24 T.V. Chalikian, V.S. Gindikin and K.J. Breslauer, J. Mol. Biol., 250 (1995) 291. 25 D. Xie, V. Bhakuni and E. Freire, E. Biochemistry, 30 (1991) 10673. 26 J.L. Silva and G. Weber, Annu. Rev. Phys. Chem., 44 (1993) 89. 27 S.A. Hawley and R.M. Mitchell, Biochemistry, 14 (1975) 3257. 28 T.N. Li, J.W. Hook, H.G. Drickamer and G. Weber, G., Biochemistry, 15 (1976) 5571. 29 P. Masson, D.M. Arciero, A.B. Hooper and C. Balny, Electrophoresis, 11 (1990) 128. 30 L. Erijman, A.A. Paladini, G.H. Lorimer and G. Weber, G. J. Biol. Chem., 268 (1993) 25914. 31 J. Jonas and A. Jonas, Annu. Rev. Biophys. Biomol. Struct., 23 (1994) 287. 32 J. Zhang, X. Peng, A. Jonas and J. Jonas, Biochemistry, 34 (1995) 8631. 33 C. Cl6ry, K. Goossens, G. Hui Bon Hoa, K. Heremans, C. Balny and P. Masson, in 9Stability and Stabilization of Enzymes, van den Tweel et al., Eds., Elsevier, Amsterdam, (1993) pp 255. 34 P. Masson, P. Gouet and C. Cl6ry, J. Mol. Biol., 238 (1994) 466. 35 P. Masson and C. Cl6ry, in Enzymes of the cholinesterase family, Balasubramanian, A.S., Doctor, B.P., Taylor, P. and Quinn, D.M., Eds., Plenum Press, N.Y. (1995) pp 113. 36 W. Kauzmann, Adv. Prot. Chem., 14 (1959) 1. 37 S.A. Hawley, Biochemistry, 10 (197 l) 2436. 38 S. Makimoto, H. Nishida and Y. Tanigushi, Biochim. Biophys. Acta, 996 (1989) 233. 39 A. Goldbeck, M.D. Leichner, J. Witz, E. Nordmeier and K. Ibel, Eur. Biophys. J., 20 (1991) 151. 40 D.J. Hei and D.S. Clark, Appl. Environ. Microbiol., 60 (1994) 932. 41 J. Konisky, P.C. Michels, D. Clark, Appl. Environ. Microbiol., 61 (1995) 2762. 42 H. Wu, Chinese J. Physiol., 5 (1931) 321 (reprinted in 9Adv. Prot. Chem., 46 (1995) 6. 43 K. MUller, H.D. Liidemann and R. Jaenicke, R. Biophys. Chem., 16 (1982) 1. 44 P. Masson and C. Balny, Biochim. Biophys. Acta, 1041 (1990) 223. 45 J. Kim and J.S. Dordick, Biotechnol. Bioengn., 42 (1993) 772. 46 R.V. Rariy, N. Bec, J.L. Saldana, S.N. Nametkin, V.V. Mozhaev, N.L. Klyachko, A.V. Levashov and C. Balny, FEBS Lett., 364 (1995) 98. 47 B. Nystr6m and J. Roots, J. Chem. Phys., 78 (1983) 2833. 48 B. Nystr6m and J. Roots, Makromol. Chem., 185 (1984) 1441. 49 V.N. Uversky, Biochemistry, 32 (1993) 13288. 50 D. Rodbard and A. Chrambach, Anal. Biochem., 40 (1971) 95. 51 T.E. Creighton and D. Shortle, J. Mol. Biol., 242 (1994) 670. 52 P. Masson in 9High Pressure Chemistry and Physics, a practical approach, Isaacs, N.S., Ed. Oxford univ. press, in press, 1995.

126 53 D.P. Goldenberg and T.E. Creighton, Anal. Biochem., 138 (1984) 1. 54 S.N. Timasheff, Annu. Rev. Biophys. Biomol. Struct., 22 (1993) 67. 55 C.F.S. Bonafe, M. Villas-Boas, M.C. Suarez and J.L. Silva, J.L.J. Biol. Chem., 266 (1991) 13210. 56 M.J. Kornblatt, J.A. Kornblatt and G. HuiBonHoa, Arch. Biochem. Biophys., 306 (1993) 495. 57 A. Oliviera, L.P. Gaspar, A.T. Da Poian and J.L. Silva, J. Mol. Biol., 240 (1994) 184. 58 P. Cioni and G.B. Strambini, J. Mol. Biol., 242 (1994) 291. 59 J. Massouli6, L. Pezzementi, S. Bon, E. Krejci and F.M.Vallette, Prog. Neurobiol., 41 (1993) 31. 60 P. Masson and J.L. Goasdou6, Biochim. Biophys. Acta, 869 (1986) 304. 61 D. Aslanian, P. Grof, F. Renault and P. Masson, Biochim. Biophys. Acta, 1249 (1995) 37. 62 C. Cl6ry, F. Renault and P. Masson, FEBS Lett., 370 (1995) 212. 63 Mozhaev, V.V., Heremans, K., Frank, J., Masson, P. and Balny, C. (1996) Prot. : Struct. funct. Genet., in press. 64 G.J.A. Vidugiris, J.L. Markley and C.A. Royer, Biochemistry, 34 (1995) 4909. 65 Q. Zong, P.A. Osmulski, L.P. Hager, Biochemistry, 34 (1995) 12420. 66 E. Jurkiewicz,M. Villas-Boas, J.L. Silva, G. Weber, G. Hunsmann and R.M. Clegg, Proc. Natl. Acad. Sci. USA, 92 (1995) 6935. 67 J.L. Silva, in : High Pressure Chemistry, Biochemistry and Materials science, NATO ASI Series, Winter, R. and Jonas, J. Eds, Kluwer, Dordrecht, The Netherlands (1993) pp. 561. 68 E. Dufour,G. Herv6, T. Haertl6, Biopolymers, 35 (1995)475. 69 T. Nakamura, H. Sado and Y. Syukunobe, Milchwissenschaft., 43 (1993) 141.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

127

Pressure versus Temperature Behaviour of Proteins" FT-IR studies with the Diamond Anvil Cell K. Heremansa, P. Rubens a, L. Smellerb, G. Vermeulena and K. Goossens ~ aDepartment of Chemistry, Katholieke Universiteit Leuven, Celestijnenlaan 200 D, B-3001 Leuven, Belgium blnstitute of Biophyscis, Semmelweis Medical University, H-1444 Budapest, P.O.Box 263, Hungary.

Abstract

Pressure effects on the transformation of macromolecular food components are studied, in-situ, in the diamond anvil cell with Fourier-Transform InfraRed (FT-IR) spectroscopy. Pressure and temperature-induced phenomena in proteins, polysaccharides, bacterial cells and spores can be studied, For proteins, the infrared spectra point to stronger inter-molecular interactions in the temperature-induced in contrast to the pressure-induced gels.

I. INTRODUCTION

At the beginning of this century it was shown that one can cook an egg by subjecting it to high pressure [1]. It is now clear that these observations are the consequence of the unique behaviour of proteins [2-4]. The phase diagram for the conditions under which the native and the denatured conformation occur reflects the importance of the role of the change in heat capacity and compressibility between the native and the denatured state. These quantifies reflect the change in energy and volume fluctuations respectively of the protein in the solvent [5]. A molecular interpretation of these phenomena is based on the fact that pressure affects mainly the volume of a system thus damping the molecular fluctuations. Temperature effects are known to affect both the kinetic energy and the volume of the system. In this paper we illustrate some of the consequences of phase diagram for the denaturation of proteins. We first discuss the difference between the temperature and pressure denaturation of proteins and search for the molecular basis of the correlation between the denaturation temperature and pressure for the homologous a-amylases. The gel formation of ovalbumin is studied as a function of both temperature and pressure and

128 we show the important role of the protein concentration in determining the pressureinduced melting of the heat-induced gels as reported by Doi and coworkers [6]. In the last section we report on the pressure and temperature effect of proteins in emulsions and in the adsorbed state. The emphasis in this paper is on the use of FT-IR spectroscopy. This allows the analysis of aspects which are different and complementary to those of other techniques such as fluorescence and NMR spectroscopy. In addition to frequency shifts which allow the determination of denaturation pressure and temperature, analysis of the amide r band allows an in-situ observation of the changes of the secondary structure of the proteins. This provides a global view of the protein which is equivalent with the results that are obtained with the circular dichroism technique. However, for technical reasons the latter technique is not easily accessible for high pressure studies.

2. MATERIALS AND METHODS 2.1. High Pressure Infrared Spectroscopy with the Diamond Anvil Cell Proteins are dissolved in D20 or buffer solution and mounted in a stainless steel gasket of a diamond anvil cell. The mini-cell from Diacell Products, Leicester, UK, which has a rated maximum of about 50 kbar is quite convenient. Pressure is obtained from the ruby fluorescence with a Spex Raman spectrometer. The ruby technique has the advantage that it allows easier inspection of the sample under the microscope. Infrared spectra were obtained with a Bruker IFS66 FT-IR spectrometer equipped with a liquid nitrogen cooled MCT detector. The infrared light was focussed on the sample by a NaC1 lens [7]. 350 interferograms were coadded after registration at a resolution of 2 cm-1. The time between the registration of a spectrum at each pressure is about 15 min. 2.2. Analysis of the amide I' band of the infrared spectra The determination of the secondary structure of a protein from the analysis of the amide I' bandshape of the infrared spectrum, may be done by several approaches. First one may compare the specvmn with a database of the amide bands of several proteins with known secondary structure from X-ray data. This approach, sometimes called factor analysis, was developed for Raman spectroscopy [8]. For the analysis of the pressureinduced changes one would need a data set of reference proteins as a function of pressure. This is an impossible task since it implies a knowledge of all possible physical effects on the protein. Another complication is the pressure-reduced H/D exchange. The second approach is curve fitting of the amide r band. Since the bands are rather featureless, Fourier self-deconvolufion is often used to obtain resolution enhancement. The advantage of this procedure is that shifts in the band frequencies are allowed which are independent of any assumptions about the assignments of the subcomponents. In many instances, the assignments are not unequivocal [9].

129 We have therefore developed a method to determine the secondary structure of proteins and peptides as a function of pressure [10]. Although the method of selfdeconvolution combined with band fitting has been applied before by Susi & Byler [11], we apply it for the first time to pressure- and temperature-induced effects in proteins and peptides. Our method does give new information from an analysis of the frequency shifts as well as the changes in the area of the subcomponents of the amide I band on the effect of pressure and temperature on proteins. Fourier self-deconvolution, a mathematical technique of bandnarrowing, was performed either with the Brt~er software or with our own developed software [12]. The deconvolution and noise reduction factor to be used, depend on the quality of the spectral data. A Blackman-Harris apodization function was usecL In general we determine the deconvolution factor which gives the smallest errors in the determination of the individual components of the amide I' band and that gives the smallest residuum for the overal fitting procedure. The fractional composition in secondary structure was calculated from a fit of the Gaussian curves of the deconvolved specmun with a program developed in our laboratory that fits all the parameters simultaneously in contrast to Susi & Byler [11 ] who perform the fitting of the parameters consecutively. The initial values for our fitting were obtained from the second derivative of the deconvolved specmun. We have often observed that there is a systematic difference in the result of the fitting between a protein under ambient conditions in the temperature cell and the diamond anvil cell. This may be attributed to the fact that, at the lowest pressure that is needed to contain the liquid in the metal gasket, a few hunderd bars, the very slow H/D exchange is considerably enhance4 This induces small changes in the amide F band which are easily detected by the fitting procedure. Although this may affect the determination of the secondary structure in solution, it does not have a strong effect on the determination of the pressure-induced changes in secondary structure. Despite these restrictions, our approach allows a detailed analysis and comparison on the molecular level of the temperature- and pressure-induced changes in the secondary structure.

3. RESULTS AND DISCUSSION

3.1. Temperature and pressure-induced denaturation in a-amylases ~-amylases are a class of enzymes that catalyze the hydrolysis of starch and related carbohydrates. The enzyme from Bacillus lichemformis is the most thermostable although the organism itself is mesophilic [13]. We have explored the correlation between the temperature and pressure stability in three a-amylases with the aim to explain this in terms of the secondary structure of the proteins. The effect of temperature and hydrostatic pressure on the stability of three a-amylases from Bacillus species is studied with FT-IR to detect temperature and pressure reduced changes in the amide I' ban4 The spectra of all enzymes show a transition between 80 and 86~ At high temperature, the amide band becomes broad and shapeless. The most significant effect,

130 however, is the occurrence of new bands at 1614 cm -a and 1685 cm -~ which are assigned to aggregates linked with intermolecular [3-sheets [14, 15]. The high temperature spectra of the enzymes from B. lichemformis and from B. amyloliquefaciens have a high intensity band at 1655 cm -1 suggesting that there is still a certain amount of a-helical structure in the conformation of the protein. In contrast, at high temperature the most intense band of the enzyme from B. subtilis is at 1641 cm-~. This may be correlated with the formation of unordered structure. Thus for the a-amylase of B. subtilis the intramolecular [3-sheet is transformed into unordered structure and intermolecular 13-sheet structure.

Table 1. Temperature and Pressure Stability of a-amylases from Bacillus species as determined from the changes in the frequencies of the tyrosine sidechains with FT-IR in D20. Enzyme

tl/2 (~

Pl/2 (kbar)

B. subtilis

80

7.5

B. amyloliquefaciens

82

6.5

B. licheniformis

86

11.2

The infrared spectra reveal no changes in the amide I' band profile up to 1.5 kbar. The band begins to broaden at 5 kbar. At higher pressures the amide I' band in the spectum of the B. subtillis enzyme shows a decrease of the 1635 cm -1 and the 1655 cm-1 bands while a shoulder developes at 1645 cm 1 due to the formation of unordered stucture. In the spectra of a-amylase of B. amyloliquefaciens and B. licheniformis the band at 1655 cm-~ decreases in intensity. A broad band at 1645 cm-1 developes due to formation of unordered structure. The frequency due to the tyrosine ring vibrations was also used to determine the transition pressure and temperature. The position of this band is influenced by the formation of the hydrogen bonding of the OH group and this can be used as a probe for the denaturation. The temperature and pressure stability of the three enzymes expressed as the midpoint of the transition, determined from the frequency of the tyrosine band, is shown in Table 1. Similar results are obtained from the analysis of the amide I' banct For the temperature the following sequence is observed: B. subtilis < B. amyloliquefaciens < B. lichemformis. The pressure stability, however, shows the sequence: B. amyloliquefaciens < B. subtilis < B. lichemformis. We assume that the switch in stablility for the B. subtilis enzyme is correlated with the difference in secondary structure of this enzyme.

131 3.2. Pressure effect on heat-induced gels of ovalbumin Doi and coworkers [6] observed that heat-induced gels of egg ovalbumin melt at high pressure. A heat-induced gel containing 7% ovalbumin in 10 mM phosphate buffer (pH 7.0) melted completely at 600 MPa when treated for 20 rain at 20~ After pressure release, the gel reformed, suggesting that the effect is reversible. In our experiments we compare two solutions of albumin from chicken egg at two different concentrations. In a first experiment we pressurized to 10 kbar a solution containing 70 mg/ml protein in a phosphate buffer with a composition similar to that used by Doi et al. [6]. Except for the broadening of the band, no visible changes occured in the amide I' band suggesting a small effect of pressure on the protein. While still under pressure, the solution was then heated at 80~ during 20 minutes. Again the specmun, recorded after heat treatment, showed no dramatic changes in the amide I' band. In a second series of experiments the solution was first heated during 20 minutes at 80~ followed by pressure treatment at 14 kbar. After the heating, the amide r band showed a broadening of the bands at 1655 cm -1 and 1635 cm-~ as shown in Figure 1. Neither low nor high frequency bands were observed as is usually the case for heat treated proteins [14, 15]. This suggests that no intermolecular hydrogen bonding takes place. The pressurization caused, besides the broadening of the amide r band, no further changes in the spectrum. These experiments were repeated at a protein concentration of 150 mg/ml in Bis-Tris buffer at pD 7.0. In the first experiment the solution was first pressunzed at 10 kbar. The two bands that were present in the amide I' band at ambient conditions disappeared and we observed the formation of a broad shapeless amide r band with a maximum around 1645 crn-1 due to the formation of unordered structure. In a second step the same solution, while still under pressure, was heated again for 1 hour at 95~ Except for the broadening of the amide r band, no visible changes occured. In another set of experiments, the solution was first heated at 95~ for 1 hour. As shown in Fugure 2, the specmun shows two new bands at 1614 cm -1 and 1685 cm -1 typical for the formation of intermolecular 13-sheet. Parallel with the occurrence of the intermolecular sidebands there was a broadening of the amide r band with a maximum around 1635 cm -1 which is assigned to intramolecular 13-sheet. When this solution is pressurized to 13 kbar, a decrease in the intensity of the intermolecular sidebands and the formation of a broad shapeless center of the amide r band with its maximum around 1635 crn-~ is observect The fact that we do not observe changes in the infrared spectrum in solutions of low protein concentration (70 mg/ml) explains why Doi et al. [6] observed a pressure-induced melting of the heat-induced ovalbumin gels. At this concentration the spectra do not show the formation of the bands typical for intermolecular hydrogen bonding observed in many heat-denatured proteins [14, 15]. These gels are not stabilized by intermolecular hydrogen bonding and they are sensitive to changes in external conditions. At higher concentration (150 mg/ml), the proces of gel formation goes parallel with the formation of intermolecular 13-sheet. These gels are stronger and will only melt partially under high

132 pressure as observed from changes in the amide I' band. The heat-induced gels (150 mg/ml) show intermolecular hydrogen bonding in the amide F band. We conclude that these gels melt only partially under pressure because of the partial disappearance of the bands typical for intermolecular hydrogen bonding, This is similar to the behaviour that we have observed in a number of other proteins. It should be pointed out that pressure used in our experiments is considerably higher than used by Doi et al. [6].

f~

f J ~

/

/

/

/

\

/

~~\

/ =~ ~

1600

1625

1650

1675

/ ,

\

f~" ~

/~/

\ ~-~

~

\

Ap \

~\

I.O 1/)

At

1700

Wavenumber (cm-1)

Figure 1. Effect of heating (At) followed by a 10 kbar treatment (Ap) on the amide I' band of ovalbumin at 70 mg/ml.

1600

1625

1650

1675

1700

Wavenumber (cm -1)

Figure 2. Effect of heating (At) followed by a 13 kbar treatment (Ap) on the amide I' band of ovalbumin at 150 mg/ml.

The conclusion of our experimems is that pressure-induced melting of heat-induced gels is only possible for gels with weak intermolecular interactions. At higher protein concentrations, when intermolecular hydrogen bonding is strongly stabilizing the gel network, no melting of the heat-induced gels can be observe& It would of considerable interest to make a systematic study of the gels of this protein with theological techniques and to correlate the gel strength with the formation of mtermolecular hydrogen bonds as observed from the infrared spectra of whey protein concentrate [16, 17].

3.3. Proteins in emulsions and the adsorbed state Relatively few pressure studies have been performed on mixed lipid-protein systems or on systems in which proteins are present at interfaces. Buchheim and Abou E1-Nour [18] observed the induction of milkfat crystallization in the emulsified state by high pressure. Karbstein et al. [19] observed that emulsions of soybean oil, with whey protein

133 as emulsifiers, are stable at pH 7 up to 6 kbar. Such type of emulsions are an opporttmity to follow simultaneously changes in the physical state of the lipids as well as the denaturation of the proteins. An oil~eavy water (D20) emulsion of 30% soybean oil with 5% whey protein concentrate as an emulgator shows dearly separated infrared bands for the lipid and the protein in the infrared specmnn. Increasing the temperature of the emulsion shows the appearance of the bands at 1614 and 1685 cm-~ typical for intermolecular hydrogen bonding. This suggests that the protein is forming intermolecular aggregates while being at the interface between oil and water. A further analysis is in progress to find out whether the protein has the same conformation as in solution. The effect of pressure shows transitions in the lipids as well as in the protein. Both transitions occur between 2 and 3 kbar. For the lipids this could coincide with a partial transformation to the gel phase of the saturated lipids since it is tmlikely that the majority of the unsaturated lipids in soybean oil would undergo such a transformation at such low pressures. For the protein it coincides with the pressure at which 13-1actoglobulin denatures. Here also further analysis will show whether the protein undergoes a different conformational change at the interface as compared to the free solution. The results presented in this, as well as in other papers, has shown that protein unfolding is in many cases followed by intermolecular interactions. This makes a detailed analysis of protein denaturation a difficult process to analyse. Infrared spectroscopy is an ideal tool for the study of these aggregation processes since new bands occur which can be assigned with confidence to intermolecular antiparallel 13-sheet formation. We have found that it is possible to reduce the intensity of this band when chymotrypsinogen is adsorbed on silica-gel beads that have 6 nm pores. Several tests were performed to ascertain the adsorption of the protein to the surface. Increasing the temperature shows that the bands that can be assigned to intermolecular hydrogen bonding are considerably reduced for the protein that is adsorbed compared to the protein that is free in solution. Further analysis will show whether the absorbed protein has the same conformation as that in solution. Although these experiments are preliminary in nature, this approach shows that it is possible to separate the folding from the aggregation.

4. CONCLUSIONS The results of experiments presented in this paper show that infrared spectroscopy is a powerful tool for the study of a number of aspects related to pressure- and temperatureinduced phenomena in proteins. It is possible to relate the correlation between pressure and temperature stability with the secondary structure of proteins. Pressure effects on heat-induced gel formation can easily be monitored from the presence of intermolecular hydrogen bonds. In oil/water emulsions it is possible to monitor pressure-induced changes in the lipids as well as in the protein on the same sample.

134 Acknowledgement. This research is supported by the Research Fund of the Leuven University, by the National Fund for Scientific Research (N.F.W.O.) and by the European Union (AIR1-CT92-0296) and from a COST D6 action.

5. REFERENCES

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19

P.W. Bridgman, J. Biol. Chem., 19 (1914) 511. K. Suzuld, Rev. Phys. Chem. Japan., 29 (1960) 91. S.A. Hawley, Biochemistry, 10 (1971) 2436. A~ Zipp and W. Kauzmann, Biochemistry, 12 (1973) 4217. ~ Cooper, Proc. Nat. Aca~ Sci. USA, 73 (1976) 2740. E. Doi,/k Shimizu, H. Oe and N. Kitabatake, Food Hydrocolloids, 5 (1991) 409. P.T.T. Wong, Can. J. Chem., 69 (1991) 1699. 1LW.Williams, Methods in Enzymology, 130 (1986) 311. M, Jackson and H.H. Mantsch, Crit. Rev. Biochem. mol. Biol., 30 (1995) 95. L. Smeller, K. Goossens and K. Heremans, Vibrational Spectr., 8 (1995) 199. H. Susi and D.M~ Byler, Methods in Enzymology, 130 (1986) 290. L. Smeller, K. Goossens and K. Heremans, Applied Spectr., 49 (1995) 1538. C. Weemaes, S. De Cordt, K. Goossens, M Hendrickx, K. Heremans and P. Tobback, Biotechnology and Bioengineering. 50 (1996) in press. A~H. Clark, D.H.P. Saunderson and/k Suggett, Int. J. Peptide Protein Res., 17 (1981) 353. A~A Ismail, H.H. Mantsch and P.T.T. Wong, Biochim. Biophys. Acta, 1121 (1992) 183. J. Van Camp and A. Huyghebaert, Food Chemistry, 54 (1995) 357. K. Heremans, J. Van Camp and A~ Huyghebaert, in Food proteins and their applications, A~ Paaraf and S. Damodaran (eds.) in press. W. Buchheim and A~M~Abou E1-Nour, Fat-Science Technology, 94 (1992) 369. H. Karbstein, H. Schubert, W. Scigalla and H. Ludwig, in Balny, C., Hayashi, IL, Heremans, K. & Masson, P. (eds.) High Pressure and Biotechnology, INSERM/ Libbey, (1992) 345.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology

9 1996 Elsevier Science B.V. All rights reserved.

135

Pressure induced protein structural changes as sensed by 4th derivative UV spectroscopy R. Lange ~, N. Bec ~, J. Frank b and C. Balny ~

alNSERM U 128, BP 5051, 34033 Montpellier, France bKluyver Laboratory for Biotechnology, University of Delft, 2628 BC Delft, The Netherlands

Abstract We have elaborated and optimised a fourth derivative UV spectroscopic method based on a variable spectral shift. The selective enhancement of this method permits to quantify the local dielectric constant in the vicinity of aromatic amino acids. The method was applied to the study of pressure reduced structural changes of two proteins which are characterised by the dominant spectral contribution of tyrosine (ribonuclease A) and tryptophan (methanol dehydrogenase). At high pressure (400 MPa), Ribonuclease is in a partially unfolded molten globule like state which is characterised by a local dielectric constant of ~ = 59. Methanol dehydrogenase proved to be extremely stable towards high pressure. The cohesion of the quaternary structure of this protein appears to be reinforced by high pressure.

1. INTRODUCTION In theory, one of the easiest ways to study the effect of pressure on the threedimensional structure of proteins in solution, is UV spectroscopy. Indeed, between 250 and 300 nm, protein spectra are dominated by the contributions of phenylalanine, tyrosine and tryptophan. Since the spectra of these chromophores depend on the polarity of their environment, a pressure reduced spectral change of the protein can potentially help to characterise conformational changes. In practice, this task is however rather difficult because of overlapping individual electronic transitions which are broadened by their vibronic structure [ 1]. The problem can be overcome by taking the second or fourth derivative of the spectra [2,3 ]. Especially the fourth derivative method ensures a selective enhancement of spectral bands with narrow bandwidth and allows thus to obtain more information about spectral details such as shoulders, whereas abstraction is made of the broader bands arising from other chromophores and of eventual baseline shifts [4 ].

136

i

n

:: !"~

288

tyr

286 L,,.,, -

:

;. ~ ~i

'"~

!

:

i:

!l.:i'.," "!i

""

,,. _Y ._ [ c c | "-" 50 •

1800

B: Plot of

Conditions: 1. before pressurization 2. treated with 8M urea 3. decompression to 1 bar treated with 2.1 kbar

~

4-)

450

0-

500

Wave Iength

550

6O0

(nm)

Figure 3. Fluorescence spectra of 10 r M bis-ANS in the presence of GDH.

hysteresis suggested the conformational drift of monomers upon dissociation which was first described by King & Weber[3] and well discussed elsewhere[7]. Conformational drift of free monomers upon dissociation was also revealed partly by the observations that fluorescence properties of bis-ANS, a common hydrophobic probe which can bind to GDH [8], in the presence of GDH underwent changes of a blue shift of 10nm and a 3-fold increase in fluorescence yields under high pressure relative to those before compression. The opposed changes in the same system caused by concentrated urea 0ike 8M), which can dissociate and unfold GDH[1], were observed (Fig. 3). One explanation consistent with these results is that changes of fluorescence properties of bis-ANS exposed to pressure resulted from the more exposed hydrophobic surfaces o f monomers upon p ressure-induced dissociation and probably a conformational change of separated monomer. In addition, the observed properties of separated

166 Table 1 A. Temperature effect on the dissociation of GDH T(~ P1/2 (kbar) AGass, (kcal/mol) 10 1.22 -48.0 18 1.41 -50.0 27 1.50 -52.2

AVass.(ml/mol) 290 304 309

B. Substrate effect on the GDH dissociation at 10~ P1/2 (kbar) AGass~ (kcal/mol) A Vass. (ml/mol) none 1.23 -48.0 291 40mM Ala 1.48 -49.5 263 40mM Glu 1.56 -50.0 286 P1/2: pressureatthe midpoint of spectral changes; AGass. 9 standard free energy upon subunit association; A Vass. 9standard volume change upon subunit association

monomers suggested a probable folding intermediate upon pressure-induced dissociation. Raising temperature increased the half-dissociation pressure P1/2 (table 1, A), indicating an improved stability which displayed similarly in other systems studied [4,7]. The change in enthalpy of association ( ~ H ) and the entropic component (T~S) were derived from the relation between them and the dissociation constant (cf. eq 12 in ref. 4). The positive A H value of +22kcal/mol suggested a large enthalpy of dehydration of the subunit interfaces and thus adverse contribution to the association[7]. The increasing entropic contribution(T/\S=+74.2kcal/mol at 27~ should compensate the unfavorable effect of A H and thus be the driving force responsible for the stability of GDH as a hexamer under physiological conditions. Substrate effects upon protein stability against high pressure were also studied. The small variations in standard free energies,~(AG), and the volume changes upon the association of monomers occurred simultaneously upon the binding of saturating Glu or Ala to the protein and were combined to promote the stability of native hexamers (Table 1, B). 4. A C K N O W L E D G E M E N T S This work was supported by a grant of Chinese National Scientific Foundation to K.C.R. G.Q.T now is in Kyoto Inst. of Tech., Dept. of Polym. Sci. & Eng., Japan, and he thank Professor S. Kunugi for helpful suggestion and encouragement in writing this paper. 5. R E F E R E N C E S E. L. Smith, B. M.Ausen, K. M. Blumenthal and J. F. Nyc, in The Enzymes (3rd, P.D. Boyer, ed.), 11 (1975) 293, Academic Press, New York. A. A. Paladini and G. Weber, Biochem., 25 (1981) 3632. L. King and G. Weber, Biochem., 25 (1986) 3632. K. Ruan and G. Weber, Biochem., 28 (1989) 2144. J. L. Silva, E. W. Miles and G. Weber, Biochem., 25 (1986) 5781. L. Erijiman and G. Weber, Biochem., 30 (1991) 1595. G. Weber, Protein Interactions, Chapman and Hall, New York, 1992. G. K. Radda, in Fluorescence Techniques in Cell Biology (A. A. Thaer and M. Sernetz, eds.), 261, Springe-Verlag, Berlin, 1973.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology

9 1996 Elsevier Science B.V. All rights reserved.

167

Mechanism of pressure denaturation of B PTI. B. Wroblowski, J. F. Diaz, K. Heremans and Y. Engelborghs. Laboratorium voor Chemische and Biologische Dynamica, Katholieke Universiteit Leuven, Celestijnenlaan 200D, B-3001 Leuven, Belgium.

Abstract We have performed a 800 ps molecular dynamics (MD) simulation of bovine pancreatic trypsin inhibitor (BPTI) in water coupled to a pressure bath at 1, 10000, 15000 and 20000 bar, which reproduces quite well the experimental behaviour [ 1]. The protein keeps its globular form, but adopts different conformations with only small reductions in volume. Some residues in the hydrophobic core become exposed and parts of the secondary structure is denatured between 10 and 15 kbar.

1. I N T R O D U C T I O N

Conformational changes are one of the major keys in the regulation of the function of proteins. These changes range from local transitions to global folding and unfolding. At 1 bar, the usual denaturing variables of a protein in solution are the temperature and/or changes in the solvent. The main disadvantage of using temperature as perturbing variable is that it simultaneous changes volume and thermal energy, which makes it difficult to separate the effects. Pressure as perturbing variable produces effects caused only by the change in volume. The most plausible interpretation [2] for the denaturation of proteins under high pressure is that at high pressure proteins are infiltrated by water and the hydrogen bonds of the protein become destabilized by the infiltrating water. That leads to a loss of protein secondary structure and finally to unfolding. MD simulations can be used to study the conformational freedom of proteins in solvent at atmospheric pressure [3] and the behaviour of proteins and water at high pressure [4, 5, 6]. A comparison of MD simulations at high and low pressure can give microscopic insight into the pressure induced denaturation, which is complementary to the results obtained by experimental methods. Because FT-IR experiments have shown that unfolding of BPTI starts at 8 kbar and continues up to 14 kbar [1], we have performed a MD simulation (all together 800 ps) of BPTI under different pressures (from 1 bar to 20 kbar). This work presents the first MD simulation that shows the events involved in the early stages of the unfolding of the protein under high pressure and the related changes in the solvent structure.

168

0.25 1 bar

10 kbar

15 kbar

20 kbar

A

0.20 0.15

0.10

0.05 200

I

I

I

400

600

800

Tim~s) 0.30 1 bar

il 0 k b a r

15 kbar

20 kbar

B

0.25 0.20 0.15 0.10 0.05 200

!

I

I

400

600

800

Time(ps)

Figure 1.-Fractions of a-helix (A) and ~-sheet (B) during the MD simulation as given by the DSSP algorithm [18].

2. MATERIAL AND METHODS The starting structure of BPTI (4PTI) was obtained from the PDB [7].Its energy was minimized in vacuum with the steepest descent method [8], and then placed in a truncated octahedral 55.58 A wide box of 2525 SPC water molecules [9] leading to 8149 atoms. Their energy was minimized (500 steps) and atom velocities assigned following a maxwell velocity distribution at 100 K. The system was warmed up to 300 K in five steps of 1 ps, while restraining the position of the protein atoms harmonically to their initial positions. Then 200 ps of free MD

169 simulation was performed using constant pressure (1 bar) and temperature (300 K). The pressure of the system was increased in eight steps of 1 ps (to 5, 10, 50, 200, 500 bar and 1, 5, and 10 kbar) to reach a pressure of 10 kbar, while restraining the position of the protein atoms to their final positions at 1 bar. Then a free molecular dynamics simulation was performed for 600 ps at a constant temperature of 300 K, increasing the pressure by 5 kbar every 200 ps to final 20 kbar. Compressibility factors of water at different pressure were taken and extrapolated from Hobbs [ 10]. The calculations were performed using 4D/210, Indy Silicon Graphics workstations and DEC Alpha 3000 workstations. The simulation was done using the GROMOS 87 package [11]. The data were analyzed using the programs WHATIF [12], DSSP[ 13] and SIMLYS [ 14].

3. R E S U L T S We observed a high pressure induced conformational transition that involves the exposition to water of some of the residues of the hydrophobic core. The unfolding starts at 10 kbar with loss of ~-structure and continues at 15 kbar with loss of helical structure (figure 1).

lO 10 kbar m

m

T

W

-2 -4 - 6

-8

--20

I

I

I

I

I

I

I

I

I

I

-lg

-16

-14

-12

-10

-8

-6

--4

-2

0

Distance ( A

)

Figure 2. Best plane projection of the r.m.s deviation between the structures of every 10th ps, (the solid circles indicate the points were the pressure is raised to the indicated value) during the MD simulation of BPTI.

170 The high pressure conformation fulfils known facts about the behaviour of proteins at high pressure [2]. BPTI retains its globular form, while changing to a high pressure conformation with a negligible change in volume. The hydrophobic core becomes infiltrated by water leading to a breakage of internal hydrogen bonds. Our explanation is, that the different compressibilities of water and protein disturb the balance of the hydrophobic~ydrophilic interactions in the protein. In the pressures range in which the conformational change takes place, the water density approaches that of the protein. The results is an increased hydrophilicity of the solvent since the same volume is occupied now by a larger amount of water molecules. That allows the solvent to interpenetrate the protein. The constant pressure segments of the simulation, except the one at 15 kbar, lead to a 'stable' end conformation (figure 2). The area covered by each of those conformations decreases with pressure. The conformational change induced in the protein by 15 kbar is not completed after 200 ps. The increase up to 20 kbar leads to a state with reduced conformational freedom of the protein. The change of the water structure is in agreement with experimental data and other MD simulations. The hydrogen bond network changes from one similar to ice Ih to one similar to Ice VI. The system does not freeze, probably due to the increased diffusion constant and mobility of the SPC model [9]. This is the first MD simulation of a protein under high pressure that reproduces at least qualitatively experimental data. That allows us to describe, at microscopical level, events involved in the high pressure induced conformational transitions. A full quantitative agreement could not be obtained due to the lack of long term equilibration in the MD simulation.

4. R E F E R E N C E S

1. K.Goossens, L.Smeller, J.Frank and K.Heremans, Eur. J. Biochemistry, in press. 2. J.L Silva and G.Weber, Annu. Rev. Phys. Chem. 44 (1993) 89. 3.W.F. van Gunsteren and H.J.C. Berendsen, J. Mol. Biol, 176 (1984) 559. 4. D.B. Kitchen, L.H. Reed, and R.M. Levy, Biochemistry 31 (1992) 10083. 5. R.M.Brunne and W.F. van Gunsteren, FEBS Lett 323 (1993) 215. 6. F. H. Stillinger and A. Rahman, J. Chem. Phys. 61 (1974) 4973. 7. J.J. Birktoft and D.M. Blow, J.Mol.Biol. 68 (1972) 187. 8. M. Levitt and S. Lifson, J. Mol. Biol. 46 (1969) 269. 9. H.J.C. Berendsen, J.P.M. Postma, W.F. Van Gunsteren and J. Hermans, Intramolecular forces. (Pullman, B. ed.) pp.331, Reidel, Dordrecht. 1981 10. Hobbs, P.V. Ice Physics, Clarendon Press Oxford (1974) 61. 11. W.F van Gunsteren and H.J.C. Berendsen. Program system GROMOS 87. Distributed by: Biomos biomolecular software b.v., University of Groningen. 12. G. Vriend, J. Mol. Graph. 8 (1990) 52. 13. W. Kabsch and C. Sander, Biopolymers 22 (1983) 2577. 14. P. Krtiger, M. Ltike, A. Szameit, Comput Phys. Commun. 62 (1991) 371.

R. Hayashi and C. Balny (Editors), High Pressure Bioscienceand Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

171

Thermal inactivating behavior of Bacillus stearothermophilus under high pressure Koji Kakugawa% T a k a s h i O k a z a k P , S h i n y a Y a m a u c h P , Kyozo Morimoto ~, Tatsuo Yoneda% and Kanichi Suzuki b aHiroshima Prefectural Food Technology Research Center, 12-70 H i j i y a m a h o n m a c h i , M i n a m i k u , H i r o s h i m a 732, J a p a n b D e p a r t m e n t of Applied Biological Sceience H i r o s h i m a University, 1-4-4 K a g a m i y a m a , H i g a s h i - H i r o s h i m a 739, J a p a n

ABSTRACT

T h e e f f e c t of h i g h p r e s s u r e on t h e r m a l i n a c t i v a t i o n of B a c i l l u s stearothermophilus spores was i n v e s t i g a t e d . The time for the spore decrease from 10 ~ to 102 spores/ml was w i t h i n 30min by h e a t i n g at l l 0 ~ and was within 10min at 100~ However, under the pressurized conditions (at 400MPa), the spores did not decrease to the value below 102 spores/ml even w h e n they were h e a t e d at 120~ for 50min. 1. I N T R O D U C T I O N

Spores of Bacillus genus produce high h e a t r e s i s t a n t spores, and those spores often spoil h e a t sterilized foods. Therefore, m a n y studies on t h e r m a l sterilization of foods as well as on p r e s s u r i z e d t r e a t m e n t of t h e r m a l r e s i s t a n t spores, h a v e conducted. However, very few studies have reported on the effects of t e m p e r a t u r e combined with pressure on sterilization behavior of h e a t r e s i s t a n t spores. For food s t e r i l i z a t i o n processes, it is d e s i r e d to r e d u c e t h e r m a l conditions, i.e. h e a t i n g t e m p e r a t u r e and time, from the s t a n d p o i n t of the quality of products. T h e o b j e c t i v e of t h i s s t u d y is to i n v e s t i g a t e t h e i n a c t i v a t i n g b e h a v i o r of B.stearothermophilus s p o r e s u n d e r c o m b i n e d c o n d i t i o n s of t e m p e r a t u r e a n d pressure. 2. M A T E R I A L S A N D M E T H O D

Spores of B.stearothermophilus IAM1035 were used as the t e s t specimen. The D121oc value and Z value were 2.3min and 7.4~ in 1/15M phosphate buffer(pH7.0), so they have efficient h e a t r e s i s t a n c e . D i a g r a m of the high p r e s s u r e a p p a r a t u s u s e d in this s t u d y is s h o w n in Fig.1. After t h e v e s s e l was p r e s s u r i z e d at the pressures r a n g i n g from 0.1MPa to 400MPa, it was h e a t e d in an oil b a t h for 5min to 60min at the t e m p e r a t u r e s ranging from 50~ to 120~ After heating, the vessel was cooled in a w a t e r b a t h at 25~ and the p r e s s u r e was released u n t i l n o r m a l

172

Fig.1

S c h e m a t i c d i a g r a m of e x p e r i m e n t a l a p p a r a t u s ( 1 " p r e s s u r e vessel ; 2"thermocouple ; 3:silicon rubber tube ; 4:sample ; 5:pressure gauge ; 6:pressure pump)

400

~" 100

f

o

75 ~

50

~

25

0.1 0

I

0

I

I

1

200 400 600 H e a t i n g T i m e (s)

I. 800

Fig.2 An e x a m p l e of t e m p e r a t u r e and p r e s s u r e c h a n g e of a s a m p l e d u r i n g h e a t i n g at 100~ for 10min u n d e r 400MPa one. T e m p e r a t u r e a n d p r e s s u r e h i s t o r i e s at 1 0 0 ~ for 10min, for example, is shown in Fig.2. Survival spore n u m b e r s in the treated suspensions were m e a s u r e d by counting the colony n u m b e r which grew on a s t a n d a r d agar plate.

3.

RESULTS

AND

DISCUSSION

Survival curves of the spores at 113~ u n d e r pressures ranging from 0.1MPa to 400MPa are shown in Fig.3. The survival curves did not obey the first order rate equation. Additionally, the spores considerably died under the pressurized condition more t h a n 150MPa. Though the death rate increased with the increase of pressure, the difference was not significant between 300MPa and 400MPa. Survival curves of the spores at t e m p e r a t u r e s r a n g i n g from 50~ to 100~ at 4 0 0 M P a are s h o w n in Fig.4. T h e s p o r e s c o n s i d e r a b l y d e c r e a s e d at t h e t e m p e r a t u r e m o r e t h a n 60~ w h e n the p r e s s u r e was applied. W h e n the t e m p e r a t u r e was 50~ significant decrease was not observed even at 400MPa.

173

10 7

107

10 6

0

>

I0

10 6

5

105

.,~

104

~

>

104 m

10 3

10 3

10 2

Fig.3

o~

.v.-q

10 2

Influence of p r e s s u r e on survival curves of B . s t e a r o t h e r m o p h i l u s spores d u r i n g h e a t i n g at 113~ ( 9 :O.1MPa A "IOOMPa V "150MPa n .200MPa @ "300MPa ~ : 4 0 0 M P a ) 107 G'--

lOJ

\

m 10 5 o

> 10 4

90oc E

m 10 3

100

102 lO 1

Fig.4

,

,

,

,

I

10

,

,

,

,

I

20

,

,

,

,

l

,

,

i

,

I

30 40 Time(min)

,

i

i

i~I~,

50

,

,

,

60

C o m b i n e d effect of t e m p e r a t u r e a n d p r e s s u r e on s u r v i v a l curves of B. stearothermophilus d u r i n g h e a t i n g u n d e r 4 0 0 M P a

It is k n o w n t h a t the spores of B.stearothermophilus do not die at the t e m p e r a t u r e below 100~ u n d e r n o r m a l pressure. 1) However the p h e n o m e n o n t h a t the spores died even at t e m p e r a t u r e r a n g i n g from 60~ to 100~ u n d e r 4 0 0 M P a shows t h a t p r e s s u r e c o n t r i b u t e d m a i n l y to the d e a t h . This r e s u l t was s i m i l a r to the case of B.subtilis spores t h a t died at t e m p e r a t u r e r a n g i n g from 35~ to 65~ u n d e r 400MPa, t h o u g h the spores was not i n a c t i v a t e d at 100~ u n d e r n o r m a l pressure. 2) The influence of p r e s s u r e on the survival curves of the spores at high t e m p e r a t u r e are s h o w n in Fig.5. Little decrease of viable spores was observed

174

107 106( ~_ 105 104 103 102 10 ~ 10 ~

0.1MPa ,

1

~

!

L

I

I

l

y

\

o--,

106 o

105 .~ 104 lo ~ OZ 102~ 101 ~10~ 106~ 105~ 104~ 103~, 102~ 101~ 10~ 0

A

I

,

I

I

400MPa

10

2O

3O

40

50

Time(min) Fig.5

Influence of pressure on survival curves of B.stearothermophilus spores during heating at t e m p e r a t u r e s r a n g i n g from 100~ to 120~ (C) "100~ A .ll0~ V .120~

d u r i n g h e a t i n g for 5 0 m i n at t e m p e r a t u r e s below 110~ at n o r m a l p r e s s u r e (0.1MPa). The time for the spore decrease from 106 to 102 spores/ml was within 30min by heating at l l 0 ~ and was within 10min at 100~ However, u n d e r the p r e s s u r i z e d conditions (at 400MPa), the spores did not decrease to the value below 102 spores/ml even when they were heated at 120~ for 50min. When the spores were kept at 120~ for a few minutes after h e a t i n g at 120~ for 10min, the alive spores were not detected (data not shown). T h i s r e s u l t i n d i c a t e s t h a t d e p r e s s u r i z a t i o n a f t e r a p p r o p r i a t e p r e s s u r i z e d h e a t t r e a t m e n t is effective for reducing the complete inactivation time of h e a t r e s i s t a n t spores. 4.REFERENCES

1 J a i r u s R.D.David and R.L.Merson, J. Food Sci., 55 (1990) 488. 2 Okazaki T. and Suzuki K., Nippon Shokuhin Kogyo Gakkaishi, 42 (1994) 536.

R. Hayashi and C. Balny (Editors), High Pressure Bioscienceand Biotechnology 9 1996Elsevier ScienceB.V. All rights reserved.

175

Effect of p r e s s u r e on t h e p h a s e b e h a v i o r of e s t e r - a n d e t h e r - l i n k e d phospholipid bilayer membranes Shoji Kaneshina, Shoji Maruyama and Hitoshi Matsuki Department of Biological Science and Technology, Faculty of Engineering, The University of Tokushima, Minamijosanjima, Tokushima 770, Japan Abstract

The temperature-pressure phase diagrams for dipalmitoylphosphatidylcholine (DPPC) and dihexadecylphosphatidylcholine (DHPC) bilayer membranes were constructed in the pressure range up to 200 MPa. The DPPC and DHPC membranes exhibited similar phase behavior for the main transition. However, the most surprisingly difference between DPPC and DHPC lies in the pretransition. The pressure-induced, interdigitated gel ( L~I ) phase was found in the DPPC membrane at high pressures above 100 MPa. In contrast, the DHPC membrane exists in the L~I phase at low temperature below 33.6 ~ and ambient pressure. The ripple gel phase of DHPC membrane disappeared at high pressure above 130 MPa. 1. I N T R O D U C T I O N

Pressure studies of lipid bilayer membranes have been initiated at first in the interest of a more complete understanding of pressure-anesthetic antagonism [16]. The succeeding high-pressure studies have been performed with various physical techniques including volumetry [7], X-ray diffraction [8], Raman spectroscopy [9], neutron diffraction [10,11], light transmission [12,13], and 2H-NMR [14]. These measurements have revealed phase behaviors ofbilayer membranes of dipalmitoylphosphatidylcholine (DPPC), which is one of the most extensively studied diacylphospholipids. In addition to liquid crystal, ripple gel and lamellar gel phases, a new pressure-induced gel phase, in which the lipid hydrocarbon chains from opposing monolayers are fully interdigitated, has been observed [10-14]. Some disagreements are still remaining on the temperature-pressure phase diagram of DPPC bilayer membranes. In addition to the diacyl-phospholipids, dialkyl-phospholipids and alkyl-acylphospholipids have been widely found in mammalian cell and organella membranes [15]. In contrast to diacyl-phospholipids, relatively few studies of the properties of dialkyl-phospholipids have been reported [16-19]. NMR, X-ray diffraction and differential scanning calorimetry (DSC) studies revealed that in the gel phase of the ether-linked dihexadecylphosphatidylcholine (DHPC), the bilayers are fully chain interdigitated. However, the effect of pressure on the phase behavior of DHPC bilayer membranes is still unknown. The present study demonstrates the temperature-pressure phase diagrams of bilayer membranes for the ether-linked DHPC as well as the ester-linked DPPC.

176 2. EXPERIMENTAL

Synthetic DPPC, 1,2-dipalmitoyl-sn-glycero-3-phosphocholine, and DHPC, 1,2-

di-O-hexadecyl-sn-glycero-3-phosphocholine, were obtained from Sigma. These

molecules differ only in the ester-linkage and ether-linkage between polar head groups and hydrocarbon chains. Multilamellar vesicles of these phospholipids were prepared by suspending each lipid in water at 2.0 • 10 -3 mol kg -1, using a Branson model 185 Sonifier at a temperature several degrees above the main phase transition. The phase transitions of these lipid bilayer membranes under ambient pressure were observed by a MicroCal MCS differential scanning calorimeter. The heating rate was 0.75 K min -1. The phase transitions under various pressures were observed by an optical method. The general arrangement of the high pressure apparatus has been described in detail previously [20]. The sudden change in transmittance accompanying the phase transition was followed at 540 nm. The heating rate at a given pressure was 0.67 K min -1. 3. RESULTS AND DISCUSSION An example of the phase transition measurements is shown in Figures 1 and 2 for diacylphospholipid DPPC and dialkylphospholipid DHPC bilayer membranes, respectively. Two kinds of endothermic transitions were clearly observed on the DSC thermograms for both lipid bilayer membranes. The light transmittance also changed suddenly at two transition temperatures, that is, the pretransition t e m p e r a t u r e Tp and the main transition t e m p e r a t u r e Tm. Two transition temperatures by both methods were 34.1 and 41.2 ~ for DPPC, and 33.6 and 44.4 ~ for DHPC, respectively, which are in good agreement with previously published data [9-12, 16-19]. The main transition from the ripple gel. (P~') phase to the liquid crystal (La) phase for the DHPC bilayer membrane is similar to that for the DPPC bilayer membrane. The most significant difference between DPPC and DHPC membranes lies in the pretransition. known that the DHPC membrane . It . has been . . p , undergoes thermotropic pretranmtion between the mterdxgltated gel (L~I) and phases [18,19], while the DPPC membrane undergoes the pretransition between the lamellar gel (LB') and PB' phases [21]. As is seen from Figures 1 and 2, the ' pretransition in DHPC membrane from the L~I phase to the P~' phase is accompani e d with a decrease in transmittance, while in DPPC membrane the pretransition from the L ' phase to the P~' phase is accompanied with an increase in transmittance, although the DSC thermogram for the pretransition is endothermic for both lipid membranes. Phase transition temperatures for DPPC and DHPC bilayer membranes were determined by the optical method at various pressures. Both transition temperatures increased with an increase in pressure. The temperature (T) - pressure (P) phase diagram of DPPC and DHPC bilayer membranes are shown in Figures 3 and 4, respectively. With respect to the phase diagram of DPPC bilayer membrane (Figure 3), both temperatures of the main- and pre-transition increase with an increase in pressure, but the slope of phase boundary for the pretransition is smaller than that for the main transition. A pressure-induced phase, which can be assigned as the LBI phase, was observed beyond 100 MPa. A triple point among L~', P~' and L~I phases was found at 100 MPa and 45 ~ The slope of the phase boundary between L~' and L~I phases is negative. The phase diagram of DPPC bilayer membrane has

177

l l/I/l/l/l/~

(a)

t/t/t/Ht//

tit/t|

.~ttt~

L~'

PlY'

Lo,

(b)

,S 10

i

I

2o

3o

I I

rp

I1

,r~

4o

I

5o

60

Temperature / ~

Figure 1. Phase transitions of DPPC vesicles observed by (a) DSC method and (b) optical method. Tin: main-transition temperature, Tp: pre-transition temperature.

(a)

tttttt A ~~ LI31

PI~'

L~

(b)

f I

I

10

20

I

I

30 40 Temperature / ~

I

50

60

Figure 2. Phase transitions of DHPC vesicles observed by (a) DSC method and (b) optical method. Tin: main-transition temperature, Tp: pre-transition temperature.

178 80

70 -

oO

L~,

60

so

~-

40

30

20

0

,

50

i

1O0

i

150

.

200

Pressure / MPa

Figure 3. Phase diagram of DPPC bilayer membrane. The concentration of DPPC was 2.0 mmol kg-1. Phase transitions: (@) L~' or L~I -, P~', (iX) L~' -* L~I, (O) P~' -, La. 90

80

0o

7O

60 E ~-

50

40

30

0

I

I

I

50

1 O0

150

200

Pressure / MPa

Figure 4. Phase diagram of DHPC bilayer membrane. The concentration of DPPC was 2.0 mmol kg-1. Phase transitions" (iX) L~I -* P~', (O) P~' or L~l -* La.

179 been constructed by several authors. There are some disagreements between their results. The phase diagram measured by the methods of Raman spectroscopy [9], light transmittance [12] and 2H-NMR [14] has a positive slope of phase boundary between L B' and LBI phases, whereas the phase diagram by the neutron diffraction has a neg/ttive slope [10,11]. The slope of phase boundary is expressed by the Clapeyron-Clausius equation (dT/dP = AV/AS), using the volume (AV) and entropy (AS) changes of phase transition. It is well known that the L~I phase of DPPC bilayer membrane can be induced by the addition of ethanol, glycerol and several surface-active small molecules [22-27]. Ohki and co-workers [27] have measured the specific volume of DPPC vesicle dispersion in the absence and presence of ethanol as a function of temperature by the method of scanning density meter, and revealed that the volume change accompanied by the transition from the L ' phase to the L I phase is negative. Consequently, the slope of phase boundary between L~ and..~LI phases in the DPPC bilayer membrane should be negative, since the t r a n s m o n from the L ' phase to the L~I phase accompanies with the negative volume change [27] and thee endothermic change by the DSC measurement [26]. In contrast, the DHPC bilayer m e m b r a n e exists in the L~I phase at low temperature below T Dunder ambient pressure [16-19]. As shown in Figure 4, the temperature of pretra'nsition from the LBI phase to the PB' phase increases linearly with an increase in pressure. The slope 'of the phase boundary between L~I and P~' phases is larger than that for the main transition. The values of dT/dP for the pretransition and the main transition were 0.316 and 0.242 K MPa -1, respectively. Therefore, the P~' phase disappeared by the pressure above 130 MPa. A triple point among L~I, PB' and La phases was found at 130 MPa and 74.5 ~ At high pressures above 130 MPa, only a main transition from the L~I phase to the L a phase was observed. Let us compare two phase-diagrams for DPPC and DHPC bilayer membranes. With respect to the m a i n t r a n s i t i o n , both lipids exhibit almost the same thermodynamic characteristics. The main transition temperatures for DPPC and DHPC bilayer membranes were 41.2 and 44.4 ~ respectively, and the values of dT/dP were 0.244 and 0.242 K MPa -1, which were almost the same. In other words, the main transition is hardly affected by the difference between the ester and ether linkages ofphospholipids. However, the most surprisingly difference between DPPC and DHPC lies in the pretransition. The dT/dP value for the pretransition of DHPC bilayer membrane, 0.316 K MPa -1, is significantly large compared with that for DPPC membrane, 0.140 K MPa -1. As mentioned before, the L~I phase of DPPC bilayer can be induced by a variety of surface-active small molecules [22-27]. All of these molecules can displace water from the interfacial region and do not extend too deeply into the bilayer interior. These small molecules anchor to the interface by virtue of their polar moiety, with the non-polar part of the molecule intercalating between the lipid acyl chains. The DPPC bilayers respond to the addition of surfaceactive small molecules by forming the L~I phase, resulting in the decrease in the bilayer volume. The L~I phase can be also induced by pressure itself because the volume of a system can be reduced by pressure. The substitution of an ether linkage for an ester linkage of phospholipid brings about the appearance of the L I phase at ambient pressure. As you can see from Figures 3 and 4, the shape of the T~-Pdiagram of DHPC is corresponding to the phase diagram for the DPPC bilayer membrane in the regions of elevated pressures. Therefore, we may say that the substitution of an ether linkage for an ester linkage of DPPC is comparable to the compression of the DPPC bilayer membrane.

180 4. R E F E R E N C E S

1 2 3 4 5 6 7 8 9

10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27

J . R . Trudell, D. G. Payan, J. H. Chin and E. N. Cohen~ Biochim. Biophys. Acta, 373 (1974) 436. A.G. MacDonald, Biochim. Biophys. Acta, 507 (1978) 26. D.B. Mountcastle, R. L. Biltonen and M. J. Halsey, Proc. Nat. Acad. Sci. USA, 75 (1978) 4906. H. Kamaya, I. Ueda, P. S. Moore and H. Eyring, Biochim. Biophys. Acta, 550 (1979) 131. W. MacNaughtan and A. G. MacDonald, Biochim. Biophys. Acta, 597 (1980) 193. S. Kaneshina, H. Kamaya and I. Ueda, J. Colloid Interface Sci., 93 (1983) 215. N.I. Liu and R. L. Kay, Biochemistry, 16 (1977) 3484. J. Stamatoff, D. Guillon, L. Powers and P. Cladis, Biochem. Biophys. Res. Commun., 85 (1978) 724. P. T. T. Wong and H. H. Mantsch, Biochemistry, 24 (1985) 4091. L. F. Braganza and D. L. Worcester, Biochemistry, 25 (1986) 2591. R. Winter and W. C. Pilgrim, Ber. Bunsenges. Phys. Chem., 93 (1989) 708. S. K. Prasad, R. Shashidhar, B. P. Gaber and S. C. Chandrasekhar, Chem. Phys. Lipids, 43 (1987) 227. S. Kaneshina, K. Tamura, H. Kawakami, and H. Matsuki, Chem. Lett., (1992) 1963. D. A. Driscoll, J. Jones and A. Jones, Chem. Phys. Lipids, 58 (1991) 97. H. K. Mangold and F. Paltauf (Eds.), Ether Lipids: Biochemical and Biomedical Aspects, Academic Press, New York, 1981. M . J . Ruocco, D. J. Siminovitch and R. G. Griffin, Biochemistry, 24 (1985) 2406. M.J. Ruocco, A. Makriyannis, D. J. Siminovitch and R. G. Griffin, Biochemistry, 24 (1985) 4844. P. Laggner, K. Lohner, G. Degovics, K. Muller and A. Schuster, Chem. Phys, Lipids, 44 (1987) 31. J. T. Kim, J. Mattai and G. G. Shipley, Biochemistry, 26 (1987) 6592. S. Kaneshina, K. Tamura, T. Isaka and H. Matsuki, in: Y. Taniguchi, M. Senoo and K. Hara (Eds.), High Pressure Liquids and Solutions, Elsevier Science B. V., Amsterdam, 1994, p. 95. M. J. Janiak, D. M. Small and G. G. Shipley, J. Biol. Chem., 254, (1979) 6068. R. V. McDaniel, T. J. McIntosh and S. A. Simon, Biochim. Biophys. Acta, 731 (1983) 97. T. J. McIntosh, R. V. McDaniel and S. A. Simon, Biochim. Biophys. Acta, 731 (1983) 109. S. A. Simon and T. J. McIntosh, Biochim. Biophys. Acta, 773 (1984) 169. P. Nambi, E. S. Rowe and T. J. McIntosh, Biochemistry, 27 (1988) 9175. E. S. Rowe and T. A. Cutrera, Biochemistry, 29 (1990) 10398. K. Ohki, K. Tamura and I. Hatta, Biochim. Biophys. Acta, 1028 (1990) 215.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

181

Kinetics and mechanisms of lamellar and non-lamellar phase transitions in aqueous lipid dispersions J. Erbes a, G. Rapp b and R. Winter a aUniversity of Dortmund, Institute of Physical Chemistry I, D-44221 Dortmund, Germany bEMBL Outstation at DESY, D-22603 Hamburg, Germany

Abstract

By using the pressure-jump relaxation technique in combination with time-resolved synchrotron X-ray diffraction, the kinetics of different lipid phase transformations at conditions close to and far from equilibrium were investigated. We studied the inter-lamellar LtJLa-transition of dielaidoylphosphatidylcholine (DEPC), the Hii/La-transition of eggphosphatidylethanolamine (egg-PE), and the La to cubic phase transformation of monoelaidin in excess water. The time constants for completion of the transitions vary from seconds to several minutes, dependent on the direction of the transition, the symmetry and topology of the structures involved, and also on the pressure-jump amplitude. In several cases, also intermediate structures can be detected under non-equilibrium conditions.

1. INTRODUCTION Aqueous dispersions of lipids, in particular the phosphatidylcholines, provide valuable models for the investigation of biophysical properties of membranes. They exhibit a rich lyotropic, barotropic and thermotropic phase behaviour. Although most lipids exist in lamellar bilayer phases, certain lipids, including monoacylglycerides, phospholipid/fatty acid mixtures and natural derived lipid mixtures, such as egg-phosphatidylethanolamine, can form non-bilayer hexagonal (HII) or cubic liquid-crystalline phases as well [1-3]. Most of the cubic liquid-crystalline phases are now known to consist of bicontinuous regions of water and hydrocarbon, which can be described by infinite periodic minimal surfaces. It is assumed that non-lamellar lipid structures are also of biological relevance. They probably play an important functional role in some cell processes as local and transient intermediates [2,4], such as in membrane fusion, pore formation, and fat digestion. Although the static structure and thermodynamic properties of these model membrane systems are rather well established, considerable lack of knowledge exists regarding the understanding of the kinetics and mechanisms of lipid phase transformations. We used the synchrotron X-ray diffraction technique to record the temporal evolution of the structural changes after induction of the phase transition by a pressure-jump across the phase boundary. Besides using pressure to trigger these phase transitions, pressure-dependent studies on the structure and phase behaviour of biomolecules are also of biological and biotechnological relevance.

182 2. EXPERIMENTAL The small- and wide-angle X-ray diffraction experiments were performed at beam line X13 of the EMBL outstation at DESY, which is described elsewhere [5,6]. For the investigation of the high pressure phase behaviour and structure of lipid systems, w C 0 / as well as the kinetics of lipid phase transitions using the pressure-jump technique, we built a high pressure X-ray cell. Fig. 1 illustrates the cross-sectional view of the essential parts. Pressure-jumps were obtained by computer controlled opening of an air operated valve x between the high pressure cell and a liquid reservoir container. With the pressure-jump ,, ,, \ \ \ \ \ ~ _ \ \ apparatus rapid ( < 5 ms) and variable amplitude pressure-jumps (up to 1 kbar) are possible. In relaxation kinetic measurements, the pressure-jump trigger has been shown to offer Figure 1. Cross-sectional view of the high pressure X-ray cell (bs: beryllium-window several advantages over the temperature jump and sample; o: O-Ring; c: high-pressure approach: 1) pressure propagates rapidly so connection; w: thermostating jacket; v: that sample homogeneity is less of a problem, high-pressure vessel; n: closure nut; x: X- 2) pressure-jumps can be performed bidirectional, i.e. in the pressurization and in the ray beam). depressurization direction, and 3) the amplitude of the pressure-jump can be easily and repeatedly varied to a level of high accuracy (here + 5 bar), thus also allowing to sum up sets of diffraction data to improve the counting statistics in the case of fully reversible phase transformations. /

/

3. EXPERIMENTAL RESULTS 3.1. Lameilar L# to lamellar L a phase transition First we present pressure-jump experiments carried out in dielaidoylphosphatidylcholine (DEPC)/water dispersions to study the L~/La-transition. Selected SAXS diffraction patterns collected after a pressure jump from 250 to 70 bar at 15 ~ are depicted in Fig. 2. The equilibrium transition pressure at that temperature is 160 bar. An intermediate structure is clearly observable. The first order Bragg reflection of the initial L~ phase vanishes in the course of the pressure-jump (5 ms). The first diffraction pattern collected (with an X-ray exposure time of 30 ms) after the pressure-jump exhibits a Bragg peak of a new lamellar phase L x with a 6 A smaller d-spacing, which decreases with time. This intermediate phase vanishes after 1.5 s. The phase transformation is complete after about 2 s. In equilibrium measurements, no such intermediate

i

0.01

--

0.02

sty,-1]

Figure 2. Selected diffraction patterns of DEPC in excess water after a pressure jump from 250 to 70 bar at 15 ~

183 lamellar structure is detectable. Interestingly, the pressure-jump amplitude has a significant influence on the lifetime and d-spacing of the intermediate structure. In the pressurization (La--, L~) direction, the lifetime of the intermediate L x phase is found to be significantly longer. Wide-angle diffraction data give evidence that the hydrocarbon chains in the L x phase are fluid. 3.2. Lamellar La to inverted hexagonal H n phase transition Dispersions of egg-phosphatidylethanolamine in excess water spontaneously form a lamellar L~, La and an inverted hexagonal H n phase with increasing temperature. We present data of a pressure-jump experiment across the HiffLa-transition of egg-PE. The d-spacings and the intensities of the (10) Bragg peak of the H n phase and the (001) peak of the La phase are presented in Fig. 3.

a)

b)

Hn =

~ o

"7.0.8

=i -..'0.6

63

~ ~9

z

. ,.,,,

62

~ ~49 ~

;'

i'

; t[sl

6

"

0.2 |

0

,

,

i

|

,

2

,

3

i

4

|

i

5

9

6

t[sl

Figure 3. a) d-spacings and b) intensities of the first order Bragg reflections of the La phase and the H a phase of egg-PE in excess water after a pressure-jump from 230 to 390 bar at 62~ After the pressure-jump, the d-spacing of the hexagonal structure (hexagonal lattice constant a = 2d/v~) shifts from 62.3 ,~ to 63.0 ,~ in approximately 1 s. This shift of 4.4 ,~/kbar is comparable with the pressure dependence of the d-spacing observed in equilibrium measurements. The d-spacing of the La phase, which is observed after a lag period of 250 ms, does not change in the course of the phase transformation, which takes about 4 s in total. The relative intensities of the Bragg peaks reveal a two-state process for this Hn/L atransition at the experimental time resolution. Depressurization experiments show that the transition is reversible and a similar rate for completing the LJHii-transition has been found. Interestingly, T-jump experiments on 1-stearoyl-2-oleoyl-phosphatidylethanolamine dispersions reveal an intermediate thin La phase in the course of the La/Hn-transition [7].

184 4. SUMMARY Generally, as found for laser temperature jump induced phase transitions [7], the results show that the relaxation behaviour and the kinetics of lipid phase transformations drastically depend on the topology and symmetry of the lipid phases, as well as on the applied jump amplitude. i) The symmetry-homologous lameUar chain melting LJLa-transition of DEPC/H20 appears to be highly cooperative with total transition time in the order of 2 s. A transient intermediate lamellar phase occurs. Its structure and lifetime drastically depends on the amplitude of the p-jump. The transition proceeds as two-state at low p-jump amplitudes. ii) The symmetry-heterologous Hrt/L a inverted hexagonal to lamellar transition of egg-PE appears to be two-state, with no evidence for intermediate structures or phases being observed, at least at the sensitivity and resolution of these experiments. The behaviour on pressurization and depressurization is fully reversible. A fast relaxation component causes an initial increase of the hexagonal lattice spacing, followed by a coexistence of both phases up to 4 s, where the Hrt phase disappears. The diffraction lines of the different phases remain sharp throughout the transition, indicating a high degree of long range order within the phase domains. iii) The lamellar L~ to cubic lm3m transition in monoelaidin dispersions (data not shown), which involves a major change in symmetry, occurs within 600 s. An intermediate cubic structure of space group Pn3m is formed. The occurence of metastable cubic phases is a rather often observed phenomenon [8,9]. In most cases the rate of the transition is probably limited by the transport and redistribution of water into and in the new phase, rather than being controlled by the required time for a rearrangement of the lipid molecules. The turtuosity factor of the different structures, especially in cases where the pore diameters are small, is likely to control the different kinetic components.

5. REFERENCES 1 G. Cevc and D. Marsh, "Phospholipid Bilayers" (John Wiley & Sons, New York, 1987). 2 J. M. Seddon, Biochim. Biophys. Acta 1031 (1990) 1. 3 R. Winter, A. Landwehr, T. Brauns, J. Erbes, C. Czeslik and O. Reis, in: Proceedings of the 23rd Steenbock Symposium on "High Pressure Effects in Molecular Biophysics and Enzymology" (Madison, U.S.A., 1994). 4 G. Lindblom and L. Rilfors, Biochim. Biophys. Acta 988 (1989) 221. 5 G. Rapp, A. Gabriel, M. Dosi~re, M.H.J. Koch, Nucl. Instr. & Meth. 357 (1995) 178. 6 J. Erbes, C. Czeslik, W. Hahn, R. Winter, M. Rappolt and G. Rapp, Ber. Bunsenges. Phys. Chem. 98 (1994) 1287. 7 P. Laggner, M. Kriechbaum, and G. Rapp, J. Appl. Cryst. 24 (1991) 836. 8 C. Czeslik, R. Winter, G. Rapp and K. Bartels, Biophys. J. 68 (1995) 1423. 9 M. Caffrey, Biochemistry 26 (1987) 6349.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

185

Similar characteristics of bacterial death caused by high temperature and high pressure: Involvement of membrane fluidity Tetsuaki Tsuchido ~, Kayoko Miyake b, Makoto Hayashi b, and Katsuhiro Tamura r ~Department of Biotechnology, Faculty of Engineering, Kansai University, Suita 564, Japan bPackaging Research Institute, Dai Nippon Printing Co., Ltd., Sayama 591-10, Japan CDepartment of Chemical Science and Technology, Faculty of Engineering, The University of Tokushima, Tokushima 770, Japan Abstract We confmned our previous finding that the thermal death of Escherichia coli was affected by the holding temperature prior to heat treatment as well as growth temperature. The cell death caused by hydrostatic pressure at 150 MPa was also found to depend upon the pressurization temperature as well as growth temperature. The light scattering study on extracted membrane lipids suggested that the gel-liquid crystalline phase transition is involved in the temperature-dependency of both cellular sensitivities, implying a role of the membrane fluidity.

1. INTRODUCTION The mechanisms of bacterial death by heat and pressurization remain to be resolved, although several studies have been reported [1-4 as reviews]. We have shown that the holding temperature prior to heat treatmentin combination with the growth temperature affects the heat resistance of E. coli cells (preincubation effect) [5], and suggested that the membrane fluidity is involved in the bacterial death process. In fact, the functions and structures of membranes have been shown to be damaged by heat [6-8]. High hydrostatic pressure also kills bacterial cells and the membranes of bacterial cells and yeast cells have been reported to be damaged by high pressure [9, 10]. The purpose of this study is to examine whether membrane fluidity is involved in the death mechanism in pressurized cells of E. coli, similar to heated cells.

186 2. MATERIALS AND METHODS

E. coli W3110 cells were cultivated at either 15 or 37~ to logarithmic growth phase in M9 minimal medium supplemented with glucose [5,6]. The cells were harvested and washed with 50 mM Tris-10 mM MgC12 buffer (pH 8.0) (TM buffer). Washed cells were incubated for 30 min at various temperatures in TM buffer. The preincubated cells were heated at 50~ for 15 min in TM buffer by a 10-fold dilution method, as described previously [5]. For pressurization, the washed cells were treated at various temperatures in a hydrostatic pressurization apparatus (Kobe Steel, Ltd.). To measure the phase transition temperature of membrane lipids, a high pressure vessel with optical windows described previously [11] was employed. Viability was assayed by colony counting as described previously [5]. The plate medium used was M9 supplemented with glucose plus 1% agar. The plates were incubated at 37~ for 2 d and the numbers of colonies were counted. The membrane lipids were extracted from cells by the method of B ligh and Dyer [12]. The lipids were dried up in nitrogen gas and then liposomes were prepared from the lipids by sonication. The phase transition temperatures of the lipids were measured at atmospheric pressure and 100MPa by raising the temperature [11].

3. RESULTS AND DISCUSSION 3.1. Thermal death

We confmned our previous finding [5] that the cells of E. coli W3110 strain incubated at ~37~ prior to heating had higher resistance, when evaluated by viability of cells after heated at 50~ for 15 min, than the cells preincubated at 0~ (the preincubation effect). However, this effect could not be seen at temperatures above 2022~ (Figure 1). On the other hand, the heat resistance of cells grown at 15~ was almost constant, irrespective of preincubation temperature. 10 100

O.--O . . . . . .

-O"

f

.•-0-

~-~

- - - O - - - -0- . . . .

0.1

I_

0 "

9

I0

,

!

20

"0-

"~" "-" 9

,

0.1

0.01

'!

30

l

' 40

l'reinculmlion temperature (*(3) Figure 1. Effect of preincubation temperature on the heat resistance of E. coll. Viability after heating at 50~ for 15 min is showri as percentage of the unheated count.O, 15oCgrown cells; O , 37~ cells. Adapted from Katsui et al.[5] by permission of Society for General Microbiology.

.

0 I0 20 30 40 Preincub:dion temperature (~ Figure 2. Effect of pressurization temperature on the pressure resistance of E. coli. Viability after treatment at 150MPa for 10 min is shown as percentage of the untreated count. See the legend to Figure 1 for symbols.

187 A similar situation has been observed with unsaturated fatty acid-requiring mutant of E. coli, K1060 (5). The viability obtained after heating oleic acid-grown K1060 cells at 50~ for 45 min was constant at above 15~ of preincubation temperature, while decreased gradually at temperatures lower than 15~ On the other hand, linolenic acid-grown cells had almost constant resistance at preincubation temperatures tested, except for 0 to 4~

3.2. Death by high pressure treatment The E. coli W3110 cells grown at 37~ died by pressurization at 150MPa at 0 and 37~ for 10 min similarly (Figure 2). More of the cells grown at 15~ died by pressurization at 0~ than by that at 37~ The temperature corresponding to the sensitization-starting point was about 20~ whereas no substantial change in the temperature dependence of pressure resistance was observed with cells grown at 37~

3.3. Fatty acid compositions The fatty acid composition of bacterial cells is known to change with the growth temperature [13]. We reported that the unsaturated fatty acid content increased with lowering of the growth temperature in W3110 strain [5]. The ratio of saturated to unsaturated fatty acids was 0.81 and 1.32 for 15~ cells and 37~ cells, respectively. In the K1060 strain, oleic acid and linolenic acid were incorporated into the cells. Such an increase in the unsaturated fatty acid content and an increase in the number of double bonds in unsaturated fatty acid incorporated should lower the phase transition temperature and therefore increase the inherent fluidity of the membrane lipids.

3.4. Phase transition temperature and the involvement of membrane fluidity Sinensky [14] indicated that the gel-liquid crystalline phase transition temperatures of the membranes of E. coli cells gi'own at 15 and 37~ were about 0 and 22~ respectively. Overath et al. [ 15] reported that those temperatures for K1060 cells grown with oleic acid and linolenic acid were about 4 and 15~ respectively. For the heat resistance of cells, these phase transition temperatures were found to correspond to the temperatures where the viability started to change, as shown in Figure 1 for W3110 strain. Since the-'phase separation of membrane lipids occurs below these transition temperatures, lowering of temperature below this level should result in an increase in gel-phase area in the membranes. This may be the reason why the heat sensitivity increased with decreasing preincubation temperature below the above points where the viability started to change. For the synthetic lipids, increasing hydrostatic pressure has been indicated to raise the phase transition temperature by approximately 20~ every 100MPa [16]. We measured the transition temperature of membrane lipids extracted from cells grown at 15~ and at 37~ at atmospheric pressure and 100MPa. As a consequence, at atmospheric pressure, the temperatures was below 15~ which was the lowest tested temperature, for the former cells and about 20~ for the latter, in accord with

188 Sinensky's data [14]. At 100MPa, the transition temperature was about 25~ for cells grown at 15~ but no transition was observed with cells grown at 37~ in the range of tested temperatures between 15 to 45~ This suggests that cells which have membranes rich in gel-phase are more sensitive than cells having membranes rich in liquid-crystalline phase. Although we can not compare here the temperature where the viability of pressurized cells started to change with the phase transition temperature, the findings obtained suggest that the membrane fluidity may be involved in the bacterial resistance to not only heat but also high hydrostatic pressure. Although whether the resultant membrane damages were a direct cause of cell death was unclear, both at a high temperature and high pressure, any event relating to the membrane structure may be involved in any process of the injury pathway toward cell death.

4. REFERENCES

1 T. Tsuchido, J. Antibacterial Antifungal Agents, Jpn., 18 (1990) 75. 2 T. Tsuchido, Jpn. J. Freezing Drying, 39 (1993) 61. 3 C.E. ZoBell, High Pressure Effects on Cellular Processes (A.M. Zimmerman, ed.), p. 85, Academic Press, New York, 1970. 4 D.G. Hoover, C. Metrick, A.M. Papineau, D.F, Farkas and D. Knorr, Food Technol., 43, [3] (1989) 99. 5 N. Katsui, T. Tsuchido, M. Takano and I. Shibasaki, J. Gen. Microbiol., 122 (1981) 357. 6 N. Katsui, T. Tsuchido, R. Hiramatsu, S. Fujikawa, M. Takano and I. Shibasaki, J. Bacteriol., 151 (1982) 1523. 7 T. Tsuchido, N. Katsui, A. Takeuchi, M. Takano and I. Shibasaki, Appl. Environ. Microbiol., 50 (1985) 298. 8 T. Tsuchido, I. Aoki and M. Takano, J. Gen. Microbiol., 135 (1989) 1941. 9 R.Y. Morita, Bacteriol. Rev., 39 (1975) 144. 10 M. Osumi, N. Yamada, M. Sato, S. Kobori, S. Shimada and R. Hayashi, High Pressure and Biotechnology (C. Balny, R. Hayashi, K. Heremans and P. Masson, eds.), p. 9, John Libbey Eurotext, Montrouge, 1992. 11 K. Tamura, Y. Kaminoh, H. Kamaya and I. Ueda, B iochim. B iophys. Acta, 1066 (1991) 219. 12 E.G. Bligh and W.J. Dyer, Can. J. Biochem. Physiol., 37 (1959) 911. 13 A.G. Marr and J.L. Ingraham, J. Bacteriol., 84 (1962) 1260. 14 M. Sinensky, Proc. Natl. Acad. Sci. U. S. A., 71 (1974) 522. 15 P. Overath, H.U. Schairer and W. Stoffel, Proc. Natl. Acad. Sci. U. S. A., 67 (1970) 606. 16 K. Heremans, Annu. Rev. Biophys. Bioeng., 11 (1982) 1.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

189

Structure and Function of Nucleic Acids Under High Pressure Andrzej Krzyzaniak l, Piotr Satafiski 2, Ryszard W. Adamiak l, Janusz Jurczak 2'3 and Jan Barciszewski 1 z Institute of Bioorganic Chemistry of the Polish Academy of Sciences, Noskowskiego 12, 61704 Poznafi, Poland, 2Institute of Organic Chemistry of the Polish Academy of Sciences, Kasprzaka 44, 01-224 Warszawa, Poland, 3Department of Chemistry, Warsaw University, Pasteura 1, 02-093 Warszawa, Poland.

Abstract

We have studied effects of high pressure on structure and function of synthetic and natural DNA and RNA. An analysis of circular dichroism (CD) spectra identified that at pressure of 6kbar, polyd(CG) changes its B conformation to Z-DNA form. Synthetic oligoribonucleotides (CG)6 and (AU)6 change their conformation from A to Z-RNA at 6 kbar and in the presence of high salt (5M NaC1) concentration, but not at high pressure only. Heterodimer of DNA-RNA responds to high pressure slightly changing its original A-like conformation. We suggested that high pressure effects the nucleic acids structure through their dehydration, of which the first step is a change of water structure itself. Detailed inspection of the CD spectra of tRNA before and after pressure treatment suggests some changes in its conformation. What is more interesting, high pressure catalyses charging specific amino acid to its cognate tRNA. Such obtained aminoacylated tRNA molecule, is fully active active in ribosomal poly(U) directed polyphenylalanine synthesis.

1. I N T R O D U C T I O N

Hydrostatic pressure is an emerging physical parameter in biological studies and biotechnology. It efficiently perturbates an equilibrium and rate processes. Recently high pressure is very useful technique in structural biology, aimed at establishing relationships between structure and function of biological macromolecules. It is known that pressure dependence of reaction velocity is due entirely to the activation volume of the reaction, assuming that the reacting molecule is not subject to denaturation by the increased pressure [ 1]. Up to now many studies have been concentrated on conformational changes of proteins at high pressure but only few dealed with nucleic acids. We were interested in studies of effects of high pressure on structure and function of nucleic acids. We analyzed conformation of poly d(CG), r(GC)6, r(AU)6, heteroduplexes of d(GC)3(AT)g*r((AU)3(GC)3) as well as native

190 transfer ribonucleic acid by means of circular dichroism (CD). It is well known that DNA occurs in three different conformations B, A and Z-DNA [20]. For all of them, the crystal structures are known and CD data on structure in solution have been accumulated. Those three crystal structures differ one from another significantly by a water content [2]. In the B conformation, 10 base pairs show up one complete turn of the helix and in the A conformation, 12 base pairs generates one helical turn. The left handed Z-DNA form has been found for oligodeoxynucleotides with alternating purines and pirymidines sequences [3]. In this conformation the purine nucleosides occur in syn conformation but the sugar-phosphate backbone forms a zig-zag what makes DNA helix left-handed [3]. On the other side, RNA occurs mainly in the A conformation as a consequence of the presence of 2'-OH group which has a capacity to form hydrogen bonds through water molecule with 02 or N3 atoms of the same nucleoside [4]. Although the crystal structure of the Z form of RNA is not known up to now, there are NMR and CD data available which characterize such structure in solution [5,6]. It is known that conformation of DNA and RNA with alternating purines and pirymidines can be effected by many different factors as high salt, organic solvents, temperature and chemical modification. In this paper we will summarize results on application of high pressure to studies of structure and function of nucleic acids obtained in our laboratory. 2. HIGH PRESSURE EFFECT ON THE STRUCTURE OF OLIGONUCLEOTIDES

One of the best methods presently available for analysis of conformational changes of nucleic acids in solution is circular dichroism (CD) spectroscopy [3]. B-DNA to Z-DNA conformational change can be traced with negative Cotton effect at 295 nm [21 ]. Poly d(CG) exposed to high pressure of 6 kbar for 19 hours switch the from B to Z form [7]. The conformation of polydeoxynucleotide induced with high pressure is identical to that one caused by salt or alcohol at high concentration [8,9]. The high pressure effect on DNA is completely reversible after 5 hours sample handling at an atmospheric pressure and room temperature. At 10 kbar, however, there is almost no B-Z DNA change. Most probably at these conditions water forms VI-like form of ice, which is considerably different from that one formed at atmospheric pressure [ 10] and it limits changes of conformation of DNA. RNA molecules occurs in the A conformation due to the presence of 2'-OH group [4]. ZRNA has been observed in solution of 2.85M MgC12 or 6M NaC10 4 and 42 C. In studies of pressure effects on RNA, we have used two synthetic oligoribonucleotides r(GC)6 and r(AU)6. After 18 hours pressurization at 6 kbar two changes have been noticed in their CD spectra: firstly, a maximum of the CD spectrum was shifted to higher wavelengths, and secondly, new CD peak appeared in the spectrum beyond 300 nm. A shift in the Cotton effect indicates changes of structure of nucleic acid and its interaction with solvent. The last one is probably due to light scattering and/or aggregation of the oligoribonucleotides. We have observed similar effects for r(AU)6 [11]. Interestingly, the CD spectra of both oligoribonucleotides measured after high pressure treatment resemble very much those of r(GC)3 obtained in the presence of 5M NaC1 [6] or poly r(GC) in 6M NaC10 4 [5]. From these data one can clearly see, that high pressure alone does not induce the Z RNA conformation of the oligoribonucleotide duplexes. Therefore we have checked influence of high pressure on RNA conformation in the high concentrated salt solution. Exposure of r(CG)6 to high pressure of 6 o

191 2.5

kbar in the presence of 5M NaC1 shows a positive Cotton effect at about 295 nm. No CD ,._, 1.5 band above 300 nm indicates that RNA aggregation is significantly reduced with high "~ 0.5 .. t . . ' ~ ' A t,,, o 0 salt. The effect of high pressure on CD spectra 43.5 of r(AU)6 observed at 295 nm is similar to that of (GC)6, although less pronounced [11 ]. One -1.5 240 260 280 300 320 220 should also notice that at lower wavelength wavelength [nm] (230 nm), a new peak appeared which is much higher then that one in spectra of the Z-RNA form [5,6]. Comparing the CD spectra with B those already known for oligoribonucleotides 2 we concluded that high pressure at high salt concentration induces the left handed Zconformation of RNA. To understand contribution of ribose residue to this process, we analyzed CD spectra of 2'-0_ 8). A more profound kinetic analysis was performed with [E]=15 mg/ml at pH 8.6. At 55~ (Tref), the rate constant at 1 bar was lower than any of the rate constants at the elevated pressures. That is to say, at Tref, BSA was more stable at 1 bar than at the higher pressures. This ranking of HT- and HP/T- stability must be specified with respect to T, since the activation energies are different (see 2.5). According to the isokinetic temperatures calculated from the Arrhenius plots, this ranking would reverse at 78~ when the HT stability is compared to the HP/T stability at 750 bar, and at 89~ when the HT stability is compared to the HP/T stability at 5300 bar. E a decreased with increasing pressure. The HT- and HP/T- stabilities increased with rising Ca 2+ concentration, and this increase was most pronounced at the lower Ca ion concentrations. From 10% upwards, the enzyme stability increased with rising ethanol concentration. This is contrary to literature [3,4,6], where the currently adopted vision is that mono-alcohols and other more hydrophobic solvents destabilize proteins due to interaction with the protein hydrophobic moieties, which are more readily accessible in the denatured state. The protective effect of ethanol was more pronounced if the HT-contribution to the HP/T treatment was higher. Protein stability was increasing with rising ethylene glycol concentration. According to Gray [6], ethylene glycol appears to be in an intermediate position between the polyols of three carbons and longer, which generally stabilize proteins, and more hydrophobic "cosolvents", which generally destabilize. Like with ethanol, the protective effect was more pronounced if the HT-contribution to the HP/T treatment was higher. BSA stability was found to be proportional to the trehalose or polyalcohol concentration. This is in agreement with numerous other literature reports [e.g. 2,3,11]. Similarly to what was observed with ethanol and ethylene glycol, the protective effect was more pronounced if the HT-contribution to the HP/T treatment was higher. The here discussed dependence of HT-stability of BSA is in accordance with earlier observations for B.licheniformis m-amylase [2]. A more profound kinetic analysis was performed with BSA in the presence of 15% glycerol. At 55~ (Trcf), the rate constant at 1 bar was lower than any of the rate constants at the elevated pressures. That is to say, at Trc f, BSA with 15% glycerol was more stable at 1 bar than at the higher pressures. This ranking of HT- and HP/T- stability must be specified with respect to T, since the activation energies are different. E a decreased with increasing pressure.

206

Table

1. H T -

and

[E] 0.25 - 30 mg/ml

pH: 4 - 1 0 ([E]: 1 and 15 mg/ml)

HP/T-

stability

of BSA,

as influenced

HT-stability (1 bar) - at 0.25, 1 and 5 mg/ml: effect not pronounced - from 5 mg/ml on (5, 15, 30 mg/ml): stability 1' with 1' [E] - stability highest in alkaline conditions (pH > 8.5) - at pH 8,6 ([E] = 15 mg/ml): n= 1 assumed k55< (k55 = 2.9 10 -4 rain ~)

b

~' m e d i u m c o m p o s i t i o n HP/T-stability (0.75 - 5.3 kbar) [8] - at 0.25 and 1 mg/ml: effect not pronounced - from 1 mg/ml on (1, 5, 10, 15, 20, 30 mg/ml): stability 1' with 1' [E] - stability highest in alkaline conditions (pH _>8) - at pH 8;6 ([E] -- 15 mg/ml): n =l assumed k55 (k55, 750 bar = .001069 min l , and k 1' with

?P) )_t

Ca : 0 - 300 ppm ( [ E ] : 1 and 15 mg/ml) ethanol: 0-30% ([E]=I 5 mg/ml)

ethylene glycol: 0-45% ([E]=I 5 mg/ml) trehalose: 0 - 400 mg/ml ([E] 1 and 15 mg/ml) polyalcohols: glycerol: 0-45%, mannitol: 022.5%, sorbitol: 0-30% ([E]=I 5 mg/ml)

Ea > (E a 64 kcal/mol) - stability $ with 7" [Ca 2.] - stronger stability increase per [Ca 2+] increment at the lower [Ca 2+]

- stability 1" with 1" [trehalose]

Ea (Ea 750 bar= 5 1 kcal/mol,and Ea$ with ~P) - stability $ with 1" [Ca z*] - stronger stability increase per [Ca 2+] 9 2+ increment at the lower [Ca ] - from 10% upwards: stability $ with 1" [ethanol] - stabilisation more pronounced if contribution of HT 1' - stability $ with $ [ethylene glycol] - stabilisation more pronounced if contribution of HT - stability $ with $ [trehalose] - stabilisation more pronounced if contribution of HT 1" general trends: - stability 1" with 1' [polyalcohol] - stabilisation more pronounced if contribution of HT 1' - at 15% glycerol: n=l assumed** k55 (k55.750 bar-- 4.5 10 .5 min 1, and k 1" with

-

- at 15% glycerol: n--1 assumed*

k55 < (k55 = 1.8 10 .5 min 1)

l"e) Ea > Ea (Ea = 64 kcal/mol) (Ea 750 bar=60 kcal/mol,and Ea$ with ~P) " The kinetic H T experiments were conducted at constant temperature (see 2.2), so that isothermal' plots of log(A/A0) as a function of heating time could be made. These plots can give indications on the value of the reaction order n. If a linear plot was obtained, n was assumed to be 1. If a biphasic plot was obtained, n was estimated by regression with the general nth order model (eq.2). With the used HP equipment, no kinetic isothermal/isobaric experiments could be performed (see 2.5). For lack of experimental indications on the value of n, it was either assumed to be equal to 1 or estimated by regression with the general nth order model, by analogy with the experimentally supported values for the corresponding HT-inactivation.

207

3.2 Influence of medium composition on the stability of polyphenoloxidase (Table 2) The pH is a generally important factor, whereas EDTA, benzoic acid and glutathione are specifically relevant to PPO. EDTA is a PPO inhibitor because it chelates copper, which is an essential element of the PPO active center. Benzoic acid is a competitive inhibitor because it is structurally analogous to the PPO substrates and binds to the active center [9]. Glutathione is a reductive agent converting o-quinones (product of the PPO enzymatic reaction) back to (colorless) diphenols, thus preventing the formation of brown complexes [9]. Table 2. HT- and HP/T- stability of PPO, as influenced by medium composition HP/T-stability (5.5 kbar) HT-stability (1 bar) n=l assumed" pH: 5.5---~6.5---~7.5 n = 1 assumed' k55 > k55 (at resp. pH levels: .095---~.072--~.083 (at resp. pH levels" .031---~.027---~.034 min 1) min -l) E a > Ea (at resp. pH levels: 70---~76---~83 (at resp. pH levels: 38---~32--+39 kcal/mol) kcal/mol) n=l assumed" glutathione: .005 M n = 1 assumed' k55 (.352min -1) > k55 (.082 min -1) Ea ( 56 kcal/mol) > E a ( 27 kcal/mol) n r 1 assumed EDTA" .005 M n>l n (1.822) > n (0.488) k55 ( .529 min IAU l-n***) > k55 ( .019 min 1AU 1-n***) Ea(76 kcal/mol) > Ea ( 17 kcal/mol) n r 1 assumed benzoic acid: .005 M n > l n (2.227) > n (0.604) k55 ( .189 min 1 AU l-n***) > k55 ( .013 min -1 AU 1-n***) Ea ( 89 kcal/mol) > Ea ( 36 kcal/mol) "and "': refer to notes under Table 1 *** Since n~l, the dimension ofk is time -1 Activity units 1-". ,4.

The influence of pH on HT- and HP/T-stability was analogous. The pH affected only slightly the rate constants and the activation energies. At Tref (55~ PPO was more stable at 5.5 kbar than at atmospheric pressure. For pH 5.5, 6.5 and 7.5 respectively, the isokinetic temperatures were 48, 50 and 51 ~ This means that e.g. for pH 6.5, at T < 50~ PPO would be more stable (lower k) at atmospheric pressure than at 5.5 kbar. Both under HT and under HP/T, k55 was increased by glutathion. Hence, one can conclude that at 55~ glutathione considerably lowers PPO resistance to HT and HP/T. Again, this stability ranking is to be specified with respect to temperature because the Ea's in the absence and presence of glutathion are different. The calculated isokinetic temperatures were 72 and l l l ~ respectively for HT- and HP/T- inactivation. In the presence of glutathione and at 55~ PPO stability was higher at 5.5 kbar than at 1 bar. Based on the calculated isokinetic T, this order would however reverse below 45~ With EDTA, the order of thermal inactivation was higher than 1. The reaction had a biphasic progress, i.e. an initial fast phase is followed by a slower phase. In general, this feature can have several causes. One possibility is the existence of two subfractions with different stability. Since EDTA chelates copper, and the copper in the active

208 center might influence the PPO stability, it is possible that EDTA indeed generates two subpopulations with different stability. Biphasic behaviour can be described using biphasic models, consisting of two terms, but here the kinetic analysis was confined to the general nth order model (eq.2). Simulation of the reaction progresses (see 2.5) in the absence and presence of EDTA, respectively, suggested that at Tref (55~ the HT- stability was lowered by EDTA. Similarly, a simulation suggested that also the HP/T-stability was decreased by EDTA. With regard to the comparison between the HT- and HP/T-stability in the presence of EDTA, simulation strongly suggested that at Tref, the PPO stability was higher at 5.5 kbar than at 1 bar. With benzoic acid, the order of thermal inactivation was higher than 1. Since benzoic acid binds to the PPO active center, the biphasic behaviour might be due to the coexistence of two fractions with different stabilities. It is possible that the fraction with benzoic acid bound is more stable [11]. The kinetic analysis was confined to regression with the nth order model (eq.2), and a simulation indicated that at Tref(55~ the PPO stability towards HT would be increased by benzoic acid. However, the Ea's differ, and according to the Arrhenius plots the ranking of the rate constants should reverse around 40~ A simulation of the HP/T- induced inactivations in the presence and absence of benzoic acid, respectively, suggested that (at 55~ also the HP/T-stability of PPO was improved by benzoic acid. This trend is in accordance with the possible mechanism explained above. With regard to the comparison between the HT- and HP/T-stability of PPO in the presence of benzoic acid, simulation indicated that at Tref, the PPO stability was higher at 5.5 kbar than at 1 bar.

Acknowledgement This research has been supported by the Flemish Institute for the promotion of scientifictechnological research in industry (IWT), the Belgian National Fund for Scientific Research (NFWO), and the European Commission as part of the AIR1-CT92-0296 project. 4. REFERENCES 1. Cheftel, J.-C. IAA 108 (3), 141-153, 1991. 2. De Cordt, S., Hendrickx, M., Maesmans, G. and Tobback, P. Biotechnol. Bioeng. 43, 107114, 1994. 3. Gekko, K. and Koga, S. J. Biochem. 94, 199-205, 1983. 4. Gerlsma, S.Y.J. Biol. Chem. 243 (5), 957-961, 1968. 5. Gould, G.W. and Sale, A.J.H.J. Gen. Microbiol. 60, 335-346, 1970. 6. Gray, C.J. Biocatalysis 1, 187-196, 1988. 7. Knorr, D. Food Technol. 47 (6), 156-161, 1993. 8. Ludikhuyze, L., Weemaes, C., De Cordt, S., Hendrickx, M. and Tobback, P. Submitted for publication in Appl. Biochem. Biotechnol., 1996. 9. McEvily, A.J., Iyengar, R. and Otwell, W.S. Crit. Rev. Food Sci. Nutr. 32 (3), 253273, 1992. 10. Tauscher, B. Z. Lebensm. Unters. Forsch. 200, 3-13, 1995. 11. Timasheff, S.N. and Arakawa, T. 1989. "Protein structure: a practical approach", Creighton, T.E. (ed.), p.331-344, IRL Press at Oxford University Press, 1989. 12. Van Loey, A., Hendrickx, M., Ludikhuyze, L., Weemaes, C., Haentjens, T., De Cordt, S. and Tobback, P. J. Food Prot., in press, 1996.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

209

Catalytic properties of proteinases under high pressure S.Kunugi, Y.Kanazawa, K.Mano, A.Koyasu and T.Inagaki Department of Polymer Science and Engineering, Kyoto Institute of Technology, Matsugasaki, Sakyo, Kyoto, 606 Japan. Abstract Effect of much higher pressure on thermolysin was investigated with regard to the proteinase activity on protein substrates, the intrinsic Trp fluorescence during and after the pressure incubation, limited proteolysis by subtilisin, autolysis, and residual activity after prolonged incubations. Though thermolysin is known to perform a remarkable pressure-induced activation at 100 or 150 MPa, it was revealed to be not a balo-tolerant protein, more sensitive to much high pressure treatment than did subtilisin.

1.INTRODUCTION We have studied the pressure dependence of several enzymatic reactions (Kunugi, 1992, 1993; Kabata et al., 1994) and found that the pressure affected enzymes in characteristic manner depending on the type and the structure of enzyme proteins, or depending on the nature of the scissile bond of the substrate and the type of the substrate-enzyme interactions. Among them, thermolysin was activated drastically by pressure (Fukuda & Kunugi, 1984). Considering this result, the proteolysis by thermolysin at high pressure was examined and the facilitated proteolysis was observed for some proteins (Hayashi et al., 1987). At the later stage we have studied the effect of much higher pressure on the proteinase reaction of this enzyme and found that the proteolysis by thermolysin is not always facilitated by increasing pressure. It depended on the (tertiary) structure of substrate proteins and the optimum pressure was relatively low when compared with the result of another proteinase, subtilisin. Thus here we report the result of the study on the catalytic and structural properties of thermolysin in higher pressure range ( < 400 MPa).

210 2.EXPERIMENTAL Thermolysin and subtilisin (Carlsberg) were obtained from Daiwa Kasei (Osaka, Japan) and Sigma (St.Louis, Mo. USA), respectively. Fua-Gly-OLeuNH 2 was kindly donated from Prof.N.Nishino of Kyushu Inst. Tech. (Kitakyushu, Japan). Other substrates and reagents were commercially available. High-pressure incubation vessel was made by Yamamoto Suiatsu Kogyou (Toyonaka, Japan). High pressure fluorescence was measured by using a combination of high pressure optical cell from Hikari Koatsu (Hiroshima, Japan) and a spectrofluorometer of Shimadzu RF-5000 (Kyoto, Japan). Spectrophotometric assay under high pressure was done using an equipment made by Unisoku (Hirakata, Japan). Degree of digestion was measured by absorbance (280 nm) of TCA-supernatant of the reaction solution. The reaction time was 1 h for casein and 3 h for BSA. Densitogram of PAGE was taken Shimadzu flying spot scanner CS-9000.

Fig.1. Non-specific digestion of casein and BSA by thermolysin or subtilisin under various pressure conditions. [enzyme]/[protein] = 0.1 mg/10m (in 1 ml). pH 6.5, 30~

Fig.2. Effect of pressure on the modification of amino groups of BSA by TNBS. o, 0.1 MPa;, 200 MPa,, 400 MPa; ,0.1 MPa for 2h + 400 MPa. pH 9.0, 40~

211 3.RESULTS AND DISCUSSIONS Figure 1 contains the results of proteolytic digestion of BSA and casein by thermolysin and subtilisin at various pressures. The degree of proteolysis is presented in the relative values to those at atmospheric pressure. The degree of digestion was much higher for casein at this pressure value. Apparently, the proteolysis of BSA is much facilitated, for both thermolysin and subtilisin, at elevated pressure, but the maximum value was obtained at 100 MPa for thermolysin, much lower than the value of 300 MPa for subtilisin. The difference between BSA and casein will be explained by considering well defined tertiary structure of the former protein. The elevated pressure will deform or denature this protein, much accessible or preferable for the proteolytic enzyme. The deformation of BSA tertiary structure under high pressure was also known from the results of pressure effect on the modification of amino groups of this protein by trinitrobenzene sulfonic acid (TNBS) as shown in Fig.2. The effect of pressure on the caseinolysis is relatively small. The pressure dependence of hydrolytic catalysis by these two proteinases towards synthetic small peptide substrates have been studied and the activation volume for kcat and kcat/Km parameters were measured as -35 and -65 ml/mol (thermolysin)(Fukuda & Kunugi, 1984), respectively and -8 and +4 ml/mol (subtilisin)(Kunugi et al., unpublished results), respectively. These values can not reasonably explain the highly different results of the proteolysis under higher pressure. Therefore we have measured the effect of pressure and pressure treatment on the intrinsic (Trp) fluorescence of these two proteinases. The results are shown in Fig.3. Open symbols are the (relative) fluorescence intensity observed at the indicated pressure (not corrected for the volume contraction of the sample solutions) and closed circles are the values measured after the incubation at the indicated pressure for 20 min. TLN

STN

9: 1,0 ,...,

" e~ 9

0

1.0

.--1 L:J

>,

r--< ,_J 'LtJ

,_1

0

100

200

PRESSURE (MPa)

300

400

0

100

200

PRESSURE (M

300

400

Pa)

Fig.3. Fluorescence intensity of intrinsic Trp of thermolysin (left) and subtilisin (right) measured at the indicated pressure (o) and after incubation at the indicated pressure for 20 min (e).

212

Fig.4. Effect of pressure on the limited proteolysis of thermolysin by subtilisin at various pH. Residual activity (relative) was shown against reaction time and pH. a. residual peptidase activity measured against FuaGlyLeuNH 2. b, residual esterase activity measured against FuaGlyOLeuNH 2.

lO0~

lO0, i

0

.

0

80

0

0

8O

60

6O

40

4O

9

2O

9

9

i

o

.

1

.

.2

O0

9

.

. 3

Time(h)

9

4

9

9

o ....

2;

'

~ '

;o'

~o

Time(h)

Fig.5. Effect of pressure on the autolytic process of thermolysin and the residual activity after incubation at 0.1 MPa (a) and 300 MPa (b). o, Fraction of main thermolysin band at 34.4 KDa, o, Fraction of subtilisin-nicking band at 14.4 KDa. l Residual peptidase activity after incubation at indicated pressure.

213 Clearly subtilisin suffered from little irreversible change in fluorescence up to at least 300 MPa, and even at 400 MPa the residual change in the fluorescence is very small. In contrast to this, thermolysin showed considerable irreversible change in fluorescence at 300 MPa or higher and this started to some extent even at 200 MPa. Although thermolysin showed a remarkable pressure activation, it underwent irreversible change in structure at much lower pressure than did subtilisin. As for the combination of these two proteinases, Fontana's group reported very interesting results (Vita et al., 1985). When a small portion of subtilisin is incubated with thermolysin solution, relatively stable fragment (Ser5-Thr224) of the enzyme peptide was formed, which was named thermolysin-S. This thermolysinS showed fairly reduced but certain endo-peptidase activity. The hydrolytic process of thermolysin by subtilisin was found to be accelerated by performing the process under high pressure (Fig. 4), still in limited manner. This result will also be explained as that the deformation or relaxation of the higher order structure of thermolysin caused by pressure made it easier for subtilisin to access and to attack on the specific peptide bond. Poly(acrylamide) electrophoresis analysis indicated that both the specific nicking and the further less specific digestions of the enzyme were accelerated by increasing pressure and hence the apparent reduction of the activity was accelerated. Though thermolysin is an endoprotease and it does not hydrolyze a normal alkyl esters such as amino acid methyl ester, it can cleave ester bonds of depsipeptide type esters from acylamino acid and e.g., leucic acid amide. Thermolysin-S showed almost comparably reduced activity for this "ester"ase reaction, but the reduction of the activity under high pressure showed a slightly different features for these two types of hydrolytic reactions. Specific and non-specific digestion of thermolysin can be caused by autolytic reaction. The effect of pressure on the autolytic processes of thermolysin was then examined by SDS-PAGE method and the catalytic assay. Under "low" calcium ion conditions (containing EDTA), where thermolysin is know to perform autolytic reaction very well, the autolysis occurred very quickly and the most of the process was completed before incubating at high pressure (after column chromatography). Under "high" calcium ion conditions (0.01M), autolysis did not proceeded much further even under elevated pressure, as shown in Fig.5. as the integration values of the scanning of the PAGE results. Both at 0.1 MPa (a) and 300 MPa (b), the fraction of the main band of the intact thermolysin reached about 80% of the total bands after certain time periods and the process seemed to be somewhat accelerated by giving elevated pressure. The change in the apparent activity of thermolysin during the incubation was measured (m). The half life was around 60 h under atmospheric pressure and it became much less than 1 h at 300 MPa. However, this inactivation was not directly related with the amount of the autolytic degradation. Without reducing much of the molecular weight, thermolysin lost its activity and the disactivation is highly accelerated by giving high pressure. The extent of acceleration seemed much larger than that for the autolytic reaction.

214 Thus it is now clear that thermolysin is relatively balo-labile protein, though it showed remarkable pressure-activation of the catalysis at relatively lower pressure (100 or 150 MPa). There seems to be unconscious acceptance that thermostable proteins are generally balo-stable and that there is some parallelism between thermostability and balostability. Actually there have been some experimental results which indicated such a correlation (Dallet and Legoy, 1995). However, the present example of thermolysin indicated that this is not always true.

4.REFERENCES 1 S.Dallet, and M.D.Legoy, (1995) Abstract for Enzyme Engineering XIII, P#26 (to be published as Ann.New York Acad.Sci., also contained in this proceeding) 2 M.Fukuda, and S.Kunugi, (1984) Eur.J.Biochem., 142, 565-570. 3 R.Hayashi, Y.Kawamura, and S.Kunugi, (1987) J.Food Sci., 52, 1107-1108. 4 H.Kabata, A.Nomura, N.Shimamoto, and S.Kunugi, (1994) J.Mol.Recognition, 7, 25-30. 5 S.Kunugi, (1992) in High Pressure and Biotechnology, C.Balny,R.Hayashi, K.Heremans and P.Masson Ed. John Libbey Eurotext Ltd., pp129-137. 6 S.Kunugi, (1993) Progress in Polymer Science, 18, 805-838. 7 C.Vita, D.Dalzoppo, and A.Fontana, (1985) Biochemistry, 24, 1798-1806.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

215

Pressure effects on the stability and reactivity of methanol dehydrogenase J. F r a n k a, N. Bec b, H.A.L. Corstjens a, R. Lange b and C. Balny b. aDeli~ University of Technology, Kluyver Laboratory of Biotechnology, D e p a r t m e n t of Biochemical Engineering, J u l i a n a l a a n 67, NL-2628 BC Delft, The N e t h e r l a n d s bINSERM U128, Site CNRS, Route de Mende, F-34033 Montpellier, France

Abstract Methanol dehydrogenase (MDH) is a key enzyme in the degradation of m e t h a n e and methanol by methylotrophic bacteria. It is an oligomeric protein with an a2~ 2 s t r u c t u r e (66 and 10 kDa respectively) and pyrroloquinoline quinone (PQQ) as the redox cofactor, non covalently bound to the large (zsubunit. The n a t u r a l electron acceptor for methanol dehydrogenase is a special type of cytochrome c. The MDH / cytochrome c L couple is an interesting model system to study the interaction and stability of proteins. The interaction of the two proteins can be followed either by the kinetics of electron transfer between the two proteins or by changes in the circular dichroism spectrum. A method based on capillary electrophoresis is presented to determine binding constants of proteins, w h i c h is suitable to investigate complex formation between m u t a n t proteins which are no longer capable to transfer electrons. Both proteins are r e m a r k a b l y resistant against d e n a t u r a t i o n by p r e s s u r e . Cytochrome CL, a small monomeric protein (19 kDa), is stable up to 1200 M P a . MDH retains its native structure and activity up to 500 MPa, accompanied by a reversible red shift of the 4th derivative absorption spectrum. At p r e s s u r e s above 700 MPa a transition to a denatured state occurs, which is not seen in the presence of cytochrome %. Application of pressure in the presence of 6 M u r e a leads to an irreversible and stable change in the 4th derivative absorption spectrum and a concomitant loss of most of the enzymatic activity. No evidence supporting subunit dissociation was obtained.

1. I N T R O D U C T I O N Methanol dehydrogenase (MDH) is a key enzyme in the microbial metabolism of methanol and m e t h a n e by methylotrophic bacteria [1]. Most MDH's are tetrameric enzymes with subunits of 66 and 10 kDa a r r a n g e d in a n

216 a2~ 2 structure [2] with non-covalently bound PQQ (2,7,9-tricarboxy-lH-pyrrolo[2,3-f]quinoline-4,5-dione) as a redox cofactor [3]. Electrons derived from the oxidation of methanol are transferred to an acidic cytochrome c (cytochrome cL, 19 kDa) and then to other components of the electron transport chain [4,5]. The published X-ray structures of several MDH's [see 6 for a review] reveal t h a t the a-subunit is a superbarrel composed of eight four-stranded antiparallel ~-sheets which are stacked radially around a pseudo eight-fold s y m m e t r y axis running through the centre of the subunit. The two a-subunits have a spherical shape and interact via a large p l a n a r interface. The small ~-subunits are extended, mostly a-helical structures, lying, isolated from each other, across the a-subunits. The function of the ~-subunit is not clear at present, its p r e s u m e d role in the interaction with cytochrome c L having been ruled out by the finding t h a t cytochrome c L interacts specifically with the a - s u b u n i t [5]. In spite of the fact that our s t r u c t u r a l knowledge of MDH has m u c h improved in recent years m a n y questions concerning the precise n a t u r e of the interaction of MDH with cytochrome c L and the forces that held together the subunits of MDH r e m a i n unsolved. This paper presents some approaches that may be of value for a better understanding of the forces and the conformational dynamics that are involved in the stability of MDH and its interaction with cytochrome c L.

2. T H E STABILITY OF M E T H A N O L D E H Y D R O G E N A S E MDH is a stable protein that only slowly looses its enzymatic activity w h e n stored at 4 ~ This is most probably due to the chemical reactivity of the PQQ cofactor that is usually in the semiquinone form. All attempts to reversibly remove the cofactor or to reversibly dissociate the subunits have been unsuccesful so far. Release of PQQ or dissociation appears to be invariably accompanied by irreversible denaturation. Since m a n y oligomeric proteins are known to be dissociated by hydrostatic pressures in the range of 100-200 MPa [7] the effect of pressure on MDH was explored. A convenient way to follow pressure induced changes is by means of 4th derivative UV spectroscopy [8] and since the spectrum of MDH is largely dominated by that of tryptophan, optimal conditions for t h a t amino acid were applied. As shown in Figure 1, hydrostatic pressures up to 450 MPa induce a red shift of 0.9 nm in the spectrum of MDH indicating that the tryptophan residues are pushed into a more apolar environment. This may be explained by a s s u m i n g that w a t e r molecules are forced out of the interface between the two a-subunits. Another possible explanation for this phenomenon may be that the interaction of some of these residues with the so called tryptophan docking motif (this is a s t r u c t u r e located on each blade of the superbarrel structure of the a-subunit interacting with a tryptophan on an opposed blade) is enhanced. Dissociation of MDH is unlikely since this most probably results in an increased exposure of tryptophan to the polar solvent causing a blue shift of the spectrum. F u r t h e r evidence for the high stability of MDH against pressure was obtained from FTIR studies in the

217 diamond anvil cell showing that MDH is stable up to 700 MPa. I n t e r e s t i n g l y , this p r e s s u r e limit seems to be shifted to higher p r e s s u r e s in the presence of cytochrome c L.

0.06

0.04

t

0.04 ~

"o 0.02 1 ~-"0 0.00 -0.02 -0.04 t -0.06

0.02

"-o "~ ~" 0 0.00

t

/

-0.02 t

284

t

t

288 292 wavelength (nm)

Figure 1. Reversible changes in the 4th derivative absorption s p e c t r u m of MDH upon application of p r e s s u r e at 30 ~ Before and after application of pressure ( - - ) ; 450 M P a ( ..... )

t

284

'

'

t

288 292 wavelength (nm)

Figure 2. Irreversible changes in the 4th derivative absorption spectrum of MDH w h e n p r e s s u r e is applied in the presence of 6 M u r e a at 30 ~ Ambient p r e s s u r e (. . . . ); 450 M P a (. . . . ); after d e p r e s s u r i s a t i o n ( ..... )

Complete dissociation of MDH, with release of PQQ, occurs in 6 M urea, pH 7.0 at 60 ~ but not at 30 ~ Exposure of MDH, dissolved in 6 M u r e a pH 7.0, to 450 MPa results in a blue shift as depicted in Figure 2, leading to a lower a n d broader m a x i m u m after d e p r e s s u r i s a t i o n . Concomitantly, the a r o m a t i c CD s p e c t r u m and the enzymatic activity are lost. However, we did not obtain evidence that this change is due to a complete unfolding of the protein. Gel electrophoresis of the pressurised protein revealed t h a t its molecular m a s s h a d not changed and the fact that PQQ was still present [9] f u r t h e r supports the apparently intact state of the protein. Moreover, considerable s e c o n d a r y s t r u c t u r e was still observed in the far-UV CD s p e c t r u m s u g g e s t i n g that pressure in the presence of urea induces a "molten globule" like state.

3. INTERACTION OF M D H WITH CYTOCHROME C L 3.1 Interaction studied with kinetic m e t h o d s The interaction of MDH with cytochrome c L from Methylophaga marina as a function of t e m p e r a t u r e and p r e s s u r e has been studied by stopped flow kinetic methods [10]. F r o m the p r e s s u r e dependence of the observed reaction rate at

218 -5 ~ (measured up to 200 MPa under conditions where complex formation is the rate limiting step) a value of 145 ml.mol 1 for the activation volume AV* can be calculated. The activation volume decreases to 62 ml.mo1-1 at 17 ~ and remains essentially constant up to 32 ~ F u r t h e r m o r e , a break in the A r r h e n i u s plot for complex formation is observed at 15 ~ which suggests a change in conformation of one or both of the proteins. This is confirmed by differential CD-spectroscopy of the protein mixture and is further substantiated by the pressure dependence of the break of 4 K.GPa 1. Investigation of cytochrome c L and MDH with CD-, absorbance- and FTIR - spectroscopy h a s revealed that the break in the A r r h e n i u s plot is due to a change in conformation of MDH r a t h e r t h a n cytochrome c L. The change of AV* as a function of t e m p e r a t u r e might therefore reflect the change in conformation of MDH, although at present it is not possible to distinguish between the contributions of solvation and conformational changes. Therefore the interaction needs to be further investigated as a function of solvent conditions, t e m p e r a t u r e and pressure, in addition to studies with specific m u t a n t proteins prepared by site-directed mutagenesis. 32, P r o t e i n interactions studied w i t h ~ t y capillary electrophoresis Free zone capillary electrophoresis is a rapidly developing technique with a n interesting potential to study molecular interactions in free solution [11]. Basically, one of the reactants is dissolved in the background electrolyte and its influence on the migration behaviour of the other reactant is studied. A s s u m i n g that the two reactants have a different electrophoretic mobility a relation can be derived for the mobility of the injected reactant as a function of the concentration of the reactant in the background electrolyte. The equilibrium between the protein in the background electrolyte (B) and the injected protein (I) is characterised by the association constant Ka: [BI] Ka = [B][I]

(1)

The total concentration of I, [I]o, is the sum of the concentrations of free [I] a n d bound I, [BI] and the electrophoretic mobility g of I is the weighted sum of the mobilities of free, gi, and bound I, g~: [II [BII g = go [-~o + g ~ [I]---o-

(2)

The mobility of the complex BI is roughly equal to that of B when the m o l e c u l a r mass of B is much larger than that of I, gB. If we further a s s u m e that [B]>>[I], so that [B] can be considered to be constant, equation 3 is obtained after substitution of equation i in equation 2: g =

Ka [B]gB + gI 1+ K a [B]

(3)

219 The advantage of this approach resides in the flexibility to control the composition of the electrolyte. A major drawback is however the fact that m a n y proteins tend to adsorb to the negatively charged capillary wall which is generally made of fused silica. This necessitates a pH well above the isoelectric points of the proteins or a suitable coating of the capillary wall. Although the MDH/cytochrome c L system fulfils most of the requirements for this type of analysis, MDH has significant interaction with the capillary wall at pH values that are of physiological interest. To test the feasibility of affinity capillary electrophoresis a set of comparable, but acid proteins, methylamine dehydrogenase (160 kDa) and its natural electron acceptor amicyanine (10 kDa), isolated from Thiobacillus v e r s u t u s [12] was used. Figure 3 shows the effect of increasing concentrations of methylamine dehydrogenase on the mobility of amicyanine. Fitting of the mobility data with equation 3 gives an association constant of 2-105 M -1, a value that compares well with literature data [13]. 14 1 I~M

3 #M 8~

7

0.4 ~D O o

Figure 2. The Barotolerance Values Versus the Mean Number of the Equatorial OH Groups of t heS ugars. Cel Is we re pressurized under 150 MPa at 4 ~ for 1 hr with 1 mol/1 of each sugar.Symbols 1, with altrose; 2, fructose; 3, m annose; 4, galactose; 5, glucose; 6, sucrose; 7, trehalose. Error bars indicates tandard deviation f r o m thr ee ( altrose w as tw o) independent experiments.

Figure 3. T he Thermotolerance Values Versus the Mean Number of the Equatorial OH Groups of the Sugars. Ce lls were heated at 51 ~ for 10 min with 1 mol/1 of each sugar. The numbe rs in t he figure denote the same number as in Fig. 2.

0.2

x: 0.0

-

i

i

i

i

3 4 5 6 7 8 Mean number of Equatorial OH Groups

versus the m e a n n u m b e r of the equatorial O H g r o u p s o f the sugars (Fig. 3, c u r v e fitting; y = 0 . 1 3 x - 0 . 3 1 , R 2 = 0 . 9 8 . ) similar to Fig. 2. A l t h o u g h a similar linear relationship were observed for barotolerance values and t h e r m o t o l e r a n c e values with sugars in the same c o n c e n t r a t i o n , b a r o t o l e r a n c e values were at m a x i m u m over 50 times h i g h e r than the t h e r m o t o l e r a n c e values with the same sugars.

250 On the other hand, pre-heat shocked cells showed 0.11% + 0.06 and 5.4 % + 0.41 as barotolerance and thermotolerance values, respectively.

4. DISCUSSION

We have succeeded in correlating our in vivo observations with that of the in vitro observations [11-13]; that is, sugars could protect not only proteins against thermodenaturation correlated to their mean number of equatorial OH groups but also protect cells against both hyperthermia and hydrostatic pressure stress as well. Hottiger et al. have reported that glucose, sucrose, and trehalose are protein stabilizers against elevated temperatures, and trehalose is superior to the other sugars, polyalcohols, and amino acids [17].Our results support this report and answer the question why trehalose shows the most potent effect of thermoprotectant by acting as a protein stabilizer. Trehalose has a higher mean number of equatorial OH groups among the well known sugars. Concerning the thermotolerance studies in yeast, trehalose is thought to play an important role as a thermoprotectant [18].We have previously reported that lethal hydrostatic pressure stress on yeast cells had an analogous effect on the viability after lethal heat stress [19-22]. These results suggest that the cells were injured by hyperthermia and hydrostatic pressure stress on a molecular basis, that is, the injury by hyperthermia and hydrostatic pressure stress can be protected by macromolecular stabilizers by improving water structurization. Furthermore, it raises the possibility that sugars may have the ability to prevent not only thermo-denaturation but also hyperbaric denaturation of proteins or disruption of other macromolecules correlated to their mean number of equatorial OH groups in vitro. Pre-heat shock treatment on yeast cells induces various stress tolerances that include thermotolerance [23] and barotolerance [16,24] The studies of yeast cells during hyperthermia, heat shock proteins (hsps) induced by pre-heat shock treatment are thought to protect cells by repairing or digesting denatured proteins [23,25-26] In this report, heat shock treatment elevated the barotolerance values only ten times, from 0.01% to 0.11%, but elevated the thermotolerance values over 500 times, from 0.01% to 5.4%. On the other hand, 1 mol/1 trehalose elevated the barotolerance values over 3000 times, but elevated the thermotolerance values only 60 times. Low temperature at pressurization would be one of the causes of these differences. These results suggest that this protection manner of sugars and heat shock treatment may be suited for pressure and heat resistance, respectively. Protection of the former may be done by trehalose and on the latter by hsps in

251 natural yeast cells. The studies of barotolerance and comparison with thermotolerance could help to reveal and understand the mechanism of multiple stress tolerance in yeast cells.

5. A C K N O W L E D G M E N T S

We special thank Drs. Uedaira and Dr. Sunil C. Kaul for their valuable comments and criticism.

6. REFERENCES

10 11 12 13 14 15 16

F. H. Johnson, H. Eyring, and M. J. Polissar, in "The kinetic basis of molecular biology" John Wiley & sons. Inc., NY, 1954. G. N. Somero, Ame. Zool., 30, 123-135 (1990). K. E. Bett and J. B. Cappi, Nature, 207, 620-621 (1965). E. M. Stanley and R. C. Batlen, J. Phys. Chem., 73, 1187-1192 (1969). J. F. Back, D. Oakenfell, and M. B. Smith, Biochemistry, 18, 5191-5200 (1979). J. H. Crowe, L. M. Crowe, and D. Chapman, Science, 223, 701-703 (1984). J. H. Crowe, L. M. Crowe, J.F. Carpenter, and C.A.Wistrom, Biochem. J., 242, 1-10 (1987). J. H. Crowe, L. M. Crowe, A. Rudolph, C. Womersley, and L. Appel, Archi. Biochem. Biophys., 242, 240-247 (1985). C. D. Virgilio, P. Piper, T. Boiler, and A. Wiemken, FEBS Lett., 288, 86-90 (1991). A. Wiemken, Leeuwenhoek, 58, 209-217(1990). H. Uedaira and H. Uedaira, Bull. Chem. Soc. Jpn, 53, 2451-2455 (1980). H. Uedaira and H. Uedaira, J. Sol. Chem., 14, 27-34 (1985). H. Uedaira, M. Ishimura, S. Tsuda, and H. Uedaira, Bull. Chem. Soc. Jpn., 63, 3376-3379 (1990). E. S. Baker and J. Jonas, J. Phys. Chem., 89, 1730-1735 (1985). D. Masland, in "High Pressure Effects on Cellular Processes" ed. by M. Zimmerman, Academic Press, NY, 1970, pp. 259-312. Y. Komatsu, K. Obuchi, H. Iwahashi, S. C. Kaul, M. Ishimura, G. M. Fahy, and W. F. Rall, Biochem. Biophys. Res. Comm., 174, 1141-1147

252

17 18 19 20 21 22 23 24

25 26 27

(1991). T. Hottiger, C.D. Virgilio, M.N. Hall, T. Boller, and A. Wiemken, Eur. J. Biochem., 219, 187-193 (1994). P.W. Piper, FEMS Microbiol. Rev., 11,336-356 (1993). Y. Komatsu, S. C. Kaul, H. Iwahashi, and K. Obuchi, FEMS Microbiol. Lett., 72, 159-162 (1990). H. Iwahashi, S. C. Kaul, K. Obuchi, and Y. Komatsu, FEMS Microbiol. Lett., 80, 325-328 (1991). H. Iwahashi, S. Fujii, K. Obuchi, S. C. Kaul, A. Sato, and Y. Komatsu, FEMS Microbiol. Lett., 108, 53-58 (1993). H. Iwahashi, K. Obuchi, S. Fujii, and Y. Komatsu, Cell. Mol. Biol., 41, 763-769, (1995). S. Lindquist, Annu. Rev. Biochem., 55, 1151-1191 (1986). K. Obuchi, H. Iwahashi, S. C. Kaul, H. Uedaira, M. Ishimura, and Y. Komatsu, Y., in "High Pressure and Biotechnology" eds. by C. Balny, R. Hayashi, K. Heremans, and P. Masson, Colloque INSERM/John Libbey Eurotext, France. 1992, 224, pp. 77-81. Y. Sanchez, J. Taulien, K. A. Borkovich, and S. Lindquist, EMBO J., 11, 2357-2364 (1992). E. A. Craig, B. D. Gambill, and R. J. Nelson, Microbiol. Rev., 57, 402414 (1993). S. Fujii, K. Obuchi, H. Iwahashi, T. Fujii, and Y. Komatsu, Biosci. Biotech. Biochem. 60, 476-478 (1996).

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

253

Inactivation of bacterial spores in phosphate buffer and in vegetable cream treated with high pressures S. Goba C.Fomaria G. Carpia, A. Maggia A. CassarS,a and P. Rovereb aStazione Spefirrentale lndustria Conserve Athentari, V.Tanara 31/a,43100-thm-a,Italy bre,,WaPak Processing Systerrs I~g~on AB-Ruben Rausing gata,Lund,Sweden Abstract Spores of four types of Bacillus sp. in phosphate buffer (pH 7) were treated with high pressures. Bacillus cereus spores (4x105 / ml) were partially inactivated using a 9 kbar treatment for 10 min at 20 ~ C. Total spore inactivation was obtained at 20 ~ C after a double treatment (2 kbar for 1 n ~ followed by 9 kbar for 1 min). Total inactivation of Bacillus licheniformis and Bacillus stearothermophilus spores was reached after 8 kbar treatment for 3 rain at 60 and 70 ~ C, respectively. Bacillus coagulans spores were partially inactivated by a 9 kbar treatment for 5 min at 70 ~ C. Truffle cream (aw 0.98 ; p H 6.8 ) containing 8.4 x 10 2 spores / g of Clostridium sporogenes P. A. was preheated at 80~ and treated at 6, 7, 8 and 9 kbar for 5 and 10 rain at 80 ~ C. Treatments of 8 and 9 kbar for 10 rain completely reduced the number of inoculated spores of C. sporogenes and all Bacillus spores (4.2 xl 04/g) naturally present in the product. Eight out of ten samples treated at 8 and 9 kbar for 10 min and incubated at 30 ~ C for 30 days were microbially sterile while two were not. High pressure treatments were not sufficient to completely destroy C. sporogenes spores in truffle cream.

1. INFROI~CTION High pressure is currently applied rminly to acid products (jam, fruit dressings, fruit juices) to improve their sensory characteristics. Acid products can be contaminated by non spore-forming bacteria (lactic acid bacteria), moulds and yeasts ; t h e s e microorganisms are inactivated by high pressure at levels between 3 - 5 kbar [1 - 4]. q-he application of high pressure to low acid foods (meat, fish and vegetables) is more problematic because, in this case, also bacterial spores must be inactivated. Bacterial spores are very resistant to high pressure "combined pressure - heat treatments are needed to inactivate different types of spores. Spores have proven pressure resistance (Gould and Sale [5], Sale et al. [6], Tlmson and Short [7]). ] h e last two authors suggest that bacterial spores are lax)re resistant to pressure than vegetative cells because spore proteins are protected against solvation and excessive

254 ionization by dipicolinic acid. Gould [8] suggests the possibility of a highly viscous glassy state existing within the core of the spore and contributing to resistance and dormancy. Sapru and Labuza [9] use the polymer glass -transition theory to gain infomaation about the high heat resistance of bacterial spores. The objective of this paper was to study the pressure resistance of four strains of Bacillus spores in phosphate buffer and that of Clostridium sporogenes spores inoculated in truffle cream. 2. MATERIALS AND METHODS 2.L Microbial slrains 'Ihe following swainswere u~cl for the tests" -BacilluscereusS.S.L C.A. / DA 1isohted fromwheat nr_al; -Bacillus licheniformisS. S. I. C.A. / D A2 isohted fromsp~s; -BacilluscoagulansS.S .I.C.A. / 1881isohted fromtormto- ba.wa:ttuna sauce; -Bacillusstearothermophilus S. S. I. C. A. / T460 isohted fromcanned peas; -Clostridiumsporogenes,putaefactive anaerobe 3679 ATC C 7955. Sportdation was obtained by hdividually inoculating the aerobic strains nto T S A and anaerobic swainhto BeefExtract Infusion [10]and incubating the phtes at opt~mm growth t e ~ m r e ~ for 10 21 days, xeslx~tively. 'Ihe spoles were then colkxzted with stenqe disnqP,d water, centrifuged twr,e at 31300rpm for 15 rrin, suspended in phosphate bufferat pH 7 and p a s t ~ at 80~ C for 15 nin.

2.2. Culture media Tryptone Soy Agar (Biogenetics) (TSA) was used for Bacillus spore count, qhe plates were inoculated and incubated at growth temperatures optimum for the bacilli taken into consideration :30 ~ C for 3 days for the two mesophilic strains, 45 ~ C for 4 days for B.coagulans and 55 ~ C for 4 days for B. stearothermophilus. M 5 medium [11] was used for C. sporogenes spore count : the plates were inoculated and incubated in anaerobic jar at 30 ~ C for 4 days. 2.3. High Pressure treatments of Bacillus spores 105-106 Bacillus spores / ml suspended in 10 ml phosphate buffer at two pH values (7 and 5), packed under vacuum in polythene pouches which were subsequently heat- sealed, were subjected to different treatments with an ABB - QFP 6 pilot press [12]. qhe tests were carried out at 20,50,60,70 ~ C at pressures between 2 and 9 kbar for 1, 3, 5, 10 min. Moreover, a double treatment was perfom'ed :the first at 2 kbar (for 1,5 and 10 mm) and then at 3 , 4 or 5 kbar for 1 rr~, the second at 9 kbar for 1 rain. 2.4. Observation at Scanning Electron Microscope(S. E. M.) B. cereus spores treated at 3 and 5 kbar for 5 rain at 20 ~ C were photographed using S. E. M. Stereo Scan 200 (Cambrigde) after ethanol dehydration (levels of 75, 85,95 and 99.8 %), 12 hours for each level, treatment with Critical Point Dryer (mod. CPD 0.30, Balzers) and gold rretallizing with Coating Unit PS 3 mod. ST2 M. 2.5. Truffle cream samples. Frozen black truffle (Tuber aestivum) was thawed and washed. A cream was obtained by mixing the minced (3 mm t r a c e r - plate) truffle (70 %) with seed oil

255 (30%) under vacuum in a refrigerated cutter (10 ~ C). The cream (aw 0.98, pH 6.8) was inoculated with C. s p o r o g e n e s spores (840 cfu/g), splitted (20/g) and packed in plastic pouches (PE). q-he pouches, heat sealed under vacuum, were stored at 3 ~ C until use.

2.6. High pressure treatments of truffle cream. High pressure processing was carded out by pre - heating the samples to 80 ~ C in a themaostatic bath. qhe sarrples were then pressurized using a ABB-QFP 6 pilot press [12]. Truffle cream samples were HP-treated at 6, 7, 8 and 9 kbar for 5 and 10 mm. qhe press and the pressure media were each time conditioned to the same temperature (80 ~ C ) o f the incoming samples, qhe temperature of the truffle cream increased during pressurization. After the HPP treatments, the samples were quickly cooled using a 15 ~ C water bath; three samples were immediately analyzed and five for each treatment were incubated at 30 ~ C for sterility test. 2.7. Sterility test 5 sarrples of each HPP matrix point were incubated at 30 ~ C for 30 days ; at the end of storage, the sulphite-reducing clostridium spores were counted (M 5 medium) on each sample. 3. RESULTS ANDDEC~SSION

3.1. Bacillus spores in phosphate buffer. "Ihe behaviour of B. cereus spores during the different treatments (from 5 to 9 kbar for 1, 5 and 10 minutes at 20 ~ C) is reported in Figure 1 : significant reduction of spores (3 decimal reductions, D) was obtained only with treatments at 7 and 8 kbar for 10 n m or at 9 kbar for 5 min ; 1 n ~ at 9 kbar was not sufficient to decrease initial spore number.

Figure 1. Behaviour of B a c i l l u s cereus spores HP treated at 20 ~ C.

Subsequent treatments (2 kbar for 1 min and 9 kbar for 1 min) caused complete destruction o f 4 x l 0 5 spores/ml of B. c e r e u s , whereas treatments at 5 kbar for 1 min and subsequently at 9 kbar for 1 min were less effective. If the pressure level of the first treatn-ent is lower than 3 kbar, spore inactivation is higher. "Ibis behaviour was observed also by other research workers [6, 13].

256 Combined high pressure-terrperature treatments proved very effective causing spore reductions (2 - 3 D) also at 5 - 6 kbar and 50 - 60 ~ C. Complete destruction of 5.0x105 spores/g was obtained at "9 kbar x 5 min at 50 ~ C, 8 kbar x 3 n ~ at 60 ~ C or 7 kbar x 3 min at 70 ~ C. Pressure caused spore morphological changes: lengthening and flattening at 3 kbar and breaking at 5 kbar could be observed at the S. E. M. (Figures 2, 3).

Figure 2. S.E.M. image of Bacillus cereus

spores treated at 3 kbar for 5 n ~ at 20 ~ C in phosphate buffer, pH7.

Figure 3. S.E.M. image of Bacillus cereus

spores treated at 5 kbar for 5 ~ n at 20 ~ C in phosphate buffer, pH7.

257 qhe other three strains were inactivated only by combined high pressure-heat treatments. Since temperature increases by about 3 ~ C / 1,000 bar during pressurization, the r m x i m u m t e l ~ e r a t u r e reached during the most severe treatment (9 kbar for 5 n ~ at 70" C) was 95" C. qhis temperature applied for 5 min did not cause any spore inactivation because therrml resistance expressed as decimal reduction time at 95 ~ C was 9.5,6.8 and 1215 n ~ for B. licheniformis, B. coagulans and B.stearothermo-philus, respectively. Treatments at 9 kbar for 5 min at 50 ~ C or 8 kbar for 3 min at 60 ~ C or 7 kbar for 1 rnln at 70 ~ C remarkably reduced the number of B. licheniformis spores (Figure 4). "Ihe spores of the two mesophilic Bacillus were more sensitive to pressure than those of the two therrr~philic. B. stearothermophilus was more sensitive to pressure than B. coagulans, which is less heat resistant. In fact, B. stearothermophilus spores were completely destroyed (5 D) by 7 kbar for 5 rnm or by 8 kbar for 3 min at 70 ~ C (Figure 5), while B. coagulans spores were significantly inactivated (4 D) only by 9 kbar for 5 min at 70 ~ C.

3.2. C. sporogenes in truffle c r e a m On the basis of these results we studied the effects of combined high pressure heat treatments on C. sporogenes P. A. 3679 spores inoculated in truffle cream. This strain is normally used as a test organism to determine heat processing time for canned low acid foods. Treatments at 6 - 7 kbar for 5 and 10 min and at 8 - 9 kbar for 5 min at 80 ~ C were not sufficient to completely destroy the C. sporogenes spores. Treatments of 8 - 9 kbar for 10 n ~ at 80 ~ C caused complete destruction of 840 spores / g (Table 1).

258 Bacillus spp. spores (4.2 x 104/g) naturally present in the cream were already inactivated by 6 kbar for 5 min at 80" C. The results of the sterility test reported in Table 1 showed that the survivors generally do not grow in the cream in 30 days: probably these spores have lost their capacity to germinate and grow. Of ten samples treated at 8 and 9 kbar for 10 rnm at 80 ~ C eigth can be considered microbially sterile, the remaining two also commercially sterile but not safe because there is a real possibility of C. botulinum growth. For this mason, further investigations will be carded out using other HPtemperature combina-tions. These preliminary results allow the possibility of sterilizing low acid foods with HPheat treaments to be foreseen.

Table 1 Behaviour of HP treated Clostridium sporogenes P. A. inoculated in truffle cream samples non incubated and incubated at 30 ~ C for 30 days.

kbar x min

C. sporogenes P.A.

C. sporogenes P.A. (cfu / g)

(cfu / g)

after 30 days at 30 ~ C (5 samples)

ref.

8.4 x 102

spoiled

6x5

40

0- 27- 30- >106- 19

6 x 10

22

0- 60- 2- 15- 18

7x5

5

0-0-0-4-16

7x10

3

0-0-1--5-2

8x5

11

8x10

0

0-0-0-1-0

9x5

2

0-0-5-1-5

0

0-0-4-0-0

9x10 .

.

.

0-

11 - 1 0 - 4 -

25

.

4. REFERENCT~ 1 2 3 4 5 6 7

D. Knolr, A. Bottcher,I-[ Domerburg,M. Eshtiaghi,E Oxen,& Richwin and I. Seyderhelm ia" I-figh pressure and Biotechnobgy", C. Balny, R. Hayashi,K. Herermns and P. Masson (eds,) CoIloque INSERM/J.Llbbey Eurotext Ltd,vol. 224 (1992)211. HI Ogawa, K Fukuhisa and H. fiakurmto,h" I-fighpmsane and Biotechnology", C. Balny, R. Hayashi,K. Herermns and P. Masson. (eds.) Colloque INSERM/J. L~bey Eurotext Ltd, vol. 224 (1992)269. G.DalrAglio,S.Gohand G.Carpi,IndustriaConserve,67 (1992)23. S.Gola,L.Dahiefi,D.CacaceandG.Dall'Aglio,IndustriaConserve,67 (1992)41. G.W. GouldandA.J.I-tSale,J. G e n ~ b b l . , 6 0 (1970) 335. A. Sale,G. W. Gould and W.A. Hamqton,J.Gen_ML-mbbl.,60(1970) 323. A.J.R Tn-mn and AJ. Short,Bbtechnol. Bioeng,7 (1965) 139.

259 8 9 10 11 12 13

G.W.Gould, h "Metabofism and Dry O r g Y " , A. C. Leopold (ed.), Comstock Publishing ComellUniv~ ~ . thaca, 1986. V.Sapru and T.P. Labuza,J. Food Sci.,58 (1993)445. NationalFood Processors Association," Laboratory Manual for Food Canners and Processors" 31ded,voL1 (1968) 18, AviPublishingCo.,Westport,Connectizut (USA). A. Casohfi, h " ~ i n g s of 4th International Cong~,ss of Food Science and Technobgy" Spain,vot 3 (1974)86. S. Gola,L.Pahiefi, D. Cacace and G. DallAglio,IndustriaConserce,67 (1992)417. I. Hayakawa,T. Kanno,K. Yoshiyarmand Y. Fu~,J.Food Sci.,59(1994) 164.

This Page Intentionally Left Blank

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

261

Behaviour of Escherichia coli under high pressure Katsuhiro Tamura *a, Yoshihisa Muramoto a, Mitsuo Miyashita a and Hiroki Kourai b aDepartment of Chemical Science and Technology, bDepartment of Biological Science and Technology, Faculty of Engineering, The University of Tokushima, Minamijosanjima-cho, Tokushima 770, Japan

Abstract Escherichia coli was cultivated under hydrostatic pressures up to 40 MPa (400 bar), and the

elongation of E. coli cells and the partition of the cells between an aqueous phase (physiological saline) and oil phase (n-hexadecane) were observed.

The partition coefficients were used as

measures of hydrophobicity of the surface of the cells and correlated with the susceptibility to an antimicrobial agent (dodecylpyridinium iodide). This agent is lethal to the cells and the effect of pressure on its concentration for a lethal effect on E. coli was determined. A good correlation was found between the hydrophobicity of the cells and their death rate on treatment with this reagent.

1. I N T R O D U C T I O N The maximum pressure for growth of E. coli is about 50 MPa (500 bar). E. coli cells cultivated at pressures of 10- 30 MPa, which correspond to those at 1000 - 3000 m depth in the sea, show various interesting features, such as elongation of the cells [1].

In this paper we discuss the

elongation of E. coli cells and the effects of pressure on the hydrophobicity of the cell surface of E. coli.

Hydrophobicity has been shown to be correlated with drug susceptibility in many

bacteria at atmospheric pressure [2], so we investigated the effect of an antimicrobial agent (dodecylpyridinium iodide) on E. coli cells cultivated at high pressures.

To evaluate the

hydrophobicity of the cell surface of E. coli, we measured the partition coefficient of the cells between water and oil phases. In general, the drug susceptibilities of Gram-positive bacteria to dodecylpyridinium iodide are fairly high, whereas those of Gram-negative bacteria are very low [2].

Marshall et al.

262 reported that the adsorption of microorganisms to surfaces is important for their behavior in natural habitats [3,4]. The hydrophobicities of bacterial cell surfaces have been measured by use of a two-phase partition system [5], by hydrophobic interaction chromatography [6] and by a salt aggregation method [7].

2. EFFECTS OF ETHANOL ON THE G R O W T H AND ELONGATION OF E. COLI UNDER HIGH PRESSURE

The size and shape of E. coli incubated in the presence of ethanol or under high pressure were examined by optical microscopy (Fig. 1) [ 1]. In the absence of ethanol, high pressure induced E. coli cell elongation. At 40 MPa, the cell length became seven times as much as that of control cells. When the pressure was released at a rate of 20 MPa/min and the suspension was allowed to stand for a few hours at ambient pressure, the cell shape returned to normal. In the presence of 2%(w/w) ethanol, the elongation due to increased pressure was almost abolished

10

E

8

c-t-

O

6 4

0 1 0

I

I

10

20

I _

30

I

40

Pressure I MPa

Figure 1. Effects of pressure and ethanol on the cell length of E. coli. Ethanol concentration (%w/w)" O , 0" ~ , 2" 0,4; A,6. Figure 2. SEM photographs of E. coli cultivated for 18 h at 0.1 MPa (A) and 30 MPa (B). (7000 x).

263 above 30 MPa.

Ethanol also induced cell elongation, and 4%(w/w) ethanol induced further

increase in the length of cells in pressurized cultures. This effect of ethanol reached a peak at about 20 MPa, above which the plots crossed and the effect of ethanol disappeared.

At an

ethanol concentration of 6%(w/w), pressure had no effect on the cell length. Figure 2 shows SEM photographs of E. coli cells cultivated for 18 h at atmospheric pressure and 30 MPa [8]. When the cells were incubated under high pressure, cell division was retarded and the cell length became abnormally longer.

3. CHANGES IN H Y D R O P H O B I C I T Y OF THE CELL SURFACE OF B A C T E R I A INCUBATED UNDER HIGH PRESSURE

When bacterial cells are well shaken in a mixture of water and oil, the cells are partitioned into the two phases according to the hydrophobicity of the cell surface.

The higher the

hydrophobicity of the cell surface, the more bacterial cells shift into the oil phase. Figure 3(B) is an example of gram positive bacteria, Bacillus cereus.

In this case, more cells

are partitioned into the oil phase side. Accordingly, we can say that the hydrophobicity of the bacterial cell surface is relatively high. On the other hand, gram negative bacteria such as E. coli shown in Fig.3(A) are around oil-

water interface but do not shift into the oil phase. From these results, we can conclude that the hydrophobicity of the cell surface of E. coli is low. In order to quantitatively

evaluate

the

hydrophobicity of the cell surface, partition coefficients of bacterial cells between the water and oil phases were used. In the two-phase system, the amount of cells that moved from the aqueous phase to the oil phase depended on the cell concentration in the aqueous phase.

Figure 3. Microphotographs of bacteria at oil - water interface in the n-hexadecane - physiological saline systems. (A) E s c h e r i c h i a coli and (B) B a c i l l u s cereus.

264 Thus the hydrophobicity of the bacterial cell surface seems to be related to the partition of cells between n-hexadecane and physiological saline in a similar manner to the hydrophobicity of a chemical compound. The partition coefficient is given as K = (C I - CA) [ CAn

(1)

where C I and C A are the concentrations of E. coli cells in the aqueous phase before and after partition, (C I - CA) is the concentration of cells moved to the oil phase and n is the association number in the oil phase.

This partition coefficient is an index of the hydrophobicity of the

surface of E. coli cells. A higher value of the coefficient indicates a higher hydrophobicity. From equation (1) (2)

log (C I - CA) = log K + n log C A

where log K is a common logarithm of the partition coefficient.

There was a good linear

relationship between log (C I - C A) and log C A at various pressures and the slopes of the lines were about one (n= 1). This result suggests that bacterial cells in the oil phase do not associate, but behave individually. The log K values can be estimated from the plots of log (C i - C A) vs. log C A [8]. The values of log K in stationary phase cells are plotted against pressure in Fig.4. In general, the hydrophobicities of the cell surface are lower in the stationary phase than in the exponential phase [2]. Table shows the logarithm of the

1.0

partition coefficients at atmospheric pressure for twenty kinds of gram

0.5

negative and gram positive bacteria. We can use these values as an index of the hydrophobicity of the cell surface of these bacteria.

Since

large

high

values

mean

hydrophobicity, gram positive bacteria

have

a

higher

hydrophobicity than gram negative

v

o --

0.01 -0.5 -1.0 I 0

I 10

I 20

30

Pressure / MPa

bacteria. Also, the hydrophobicity of the exponential phase cells is higher than that of the stationary phase cells.

Figure 4. Partition coefficients (hydrophobicity) of bacterial cells cultivated at high pressures. I I , S. aureus; Q , B. cereus; (~ , E. coli; [-], K. pneumoniae; A , p. mirabilis.

265

T a b l e 1 Hydrophobicities of cell surface of bacteria (ref. 2) Hydrophobicity (log K) Bacteria

Stationary phase cells")

No

1 2 3 4 5 6 7 8 9 10 11

(Gram negative bacteria) Pseudomonas aeruginosa ATCC 27583 Pseudomonas aeruginosa ATCC 10145 Pseudomonas aeruginosa IFO 3080 KlebsieUa pneumoniae ATCC 4352 KlebsieUa pneumoniae ATCC 13883 Proteus rettgerl NIH 96 Proteus vulgaris OX 19 RIMD Proteus vulgaris ATCC 13315 Proteus mirabilis IFO 3849 Escherichia coli IFO 3301 Escherichia coli K 12 OUT 8401

12 13 14 15 16 17 18 19 20

(Gram positive bacteria) Bacillus subtilis IFO 3134 Bacillus subtilis ATCC 6633 Bacillus subtilis var. niger OUT 4380 Bacillus cereus IFO 3001 Bacillus megaterium IFO 3003 Staphylococcus aureus ATCC 25923 Staphylococcus aureus IFO 12732 Staphylococcus epidermidis ATCC 12228 Micrococcus lysodeikticus NCTC 2665

Exponential phase ceils b~

-

1.68

-

1.40

-

1.80

-

1.21

-

1.85

-

1.41

-

1.37

-

0.81

-

1.14

-

1.18 - 1.17 - 1.19

1.10

- 0.96 - 0.94

-0.81 -0.85 -0.80 - 0.61 - 0.68 - 0.79

-0.81 - 0.89 - 0.99 - 0.65 - 0.87 - 0.56 - 0.76 - 0.74 - 0.31

-0.72 - 0.77 - 0.97 - 0.85 - 0.69 - 0.37 - 0.24 - 0.30 - 0.67

-

-

1.55

a) Cells incubated in nutrient broth for 18 h at 37~ b) Cells incubated in nutrient broth for 2 - 3 h at 37~

4. D E A T H

RATE

OF

E. COLI

INCUBATED

UNDER

HIGH

PRESSURE

BY

ANTIMICROBIAL

R e s u l t s for the t i m e c o u r s e o f d e a t h o f E. coli cells on d r u g d a m a g e f o l l o w e d a first o r d e r reaction.

D e a t h b y h e a t i n g also f o l l o w e d this order, e x p r e s s e d as k = 2.303 (log N O - log N) / t

(3)

w h e r e N O is the initial v i a b l e cell n u m b e r , N is the v i a b l e cell n u m b e r a f t e r t r e a t m e n t , t is the t r e a t m e n t t i m e ( m i n ) , and k is the c o n s t a n t for the rate o f death. Fig.5.

T h e c o n s t a n t s are s h o w n in

P r e s s u r e a c c e l e r a t e d the d e a t h at l o w e r p r e s s u r e s : E. coli c u l t i v a t e d at 10 M P a w e r e

sterilized m o r e easily than those cultivated at a t m o s p h e r i c pressure.

H o w e v e r , at higher pressures

the effect o f p r e s s u r e on cell d e a t h d e c r e a s e d , b e c o m i n g a l m o s t the s a m e to that at a t m o s p h e r i c p r e s s u r e at a b o u t 30 M P a .

T h e pattern o f the c u r v e in Fig.5 is v e r y s i m i l a r to that o f E. coli in

266 Fig.4 and the correlation between log K (hydrophobicity of the cell surface) and k (death rate constant) can be s h o w n by the

0.06 '7, C

E

linear

relationship, log K = - 1.65 + 12.0 k (correlation coefficient: R = 0.96).

0.04

c-

o to

0.02

This similarity suggests that the drug ~- 0.00

susceptibility shown by the death rate

c-

of E. coli cells cultivated at high

a

pressures can be directly correlated with the hydrophobicity of their cell

-0.02

0

I

20

Pressure / MPa

surface. 5. A C K N O W L E D G E M E N T

I

10

Figure 5. First order death rate constants of E. coli cells cultivated for 18 h at various pressures at 37~

The work was supported in part by a Grant-in-Aid for Scientific Research (No. 04808045) from the Ministry of Education, Science and Culture of Japan. 6. REFERENCES

1 K. Tamura, T. Shimizu and H. Kourai, FEMS Microbiol. Lett., 99 (1992) 321. 2 H. Kourai, H. Takechi, K. Muramatsu and I. Shibasaki, J. Antibact. Antifung. Agents, 17 (1989) 119. 3 K. C. Marshall, R. Stout, and R. Mitchell, J. Gen. Microbiol., 68 (1971) 337. 4 K. C. Marshall, R. Stout, and R. Mitchell, J. Microbiol., 17 (1971) 1413. 5 K. E. Magnussen and G. Johansoon, FEMS Lett., 2 (1977) 225. 6 C. J. Smyth, P. Jonsson, E. Olsson, O. S6derlind, J. Rosengren, S. Hjert6n and T. WadstrOm, Infect. Immun., 22 (1978) 462. 7 M. Lindahl, A. Faris, T. Wadstrtim, and S. Hjert6n, Biochim. Biophys. Acta, 677 ( 1981 ) 471. 8 K. Tamura, Y. Muramoto and H. Kourai, Biotech. Lett., 15 (1993) 1189.

30

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

267

High pressure inactivation in foods of animal origin M. F. Pattersona, b, M. Quinna, R. Simpson a and A. Gilmoura, b aDepartment of Food Science (Food Microbiology), Queen's University of Belfast bFood Science Division (Food Microbiology), Department of Agriculture for Northern Ireland, Newforge Lane, Belfast BT9 5PX, UK. Abstract Various factors can affect the response of vegetative bacteria to pressure. In general, Gram negative bacteria such as Yersinia enterocolitica and Salmonella spp. were found to be more pressure sensitive than Gram positive bacteria such as Listeria monocytogenes and Staphylococcus aureus, when treated in phosphate buffered saline at 20 ~ C. Some strains of Escherichia coli 0157:H7 were found to be relatively resistant to pressure. Further studies on the effect of substrate on pressure resistance were carried out on St. aureus, S. enteritidis and one of the resistant E coli O157:H7 strains. There was greater survival of the E. coli and S. enteritidis in ultra hightemperature treated (UHT) milk compared to poultry meat, while there was greater recovery of St. aureus in poultry meat than in the milk. There was evidence, assessed by differential plating using trypticase soy agar with and without additional NaC1, that sublethally injured E. coli O157:H7 cells were present at pressures significantly lower than were required for death. The simultaneous application of pressure with mild heating (up to 60 ~ C) significantly increased the death of E. coli O157:H7 in poultry meat and UHT milk compared to either treatment alone. The variation in results obtained with different organisms, between strains of the same organism and in different substrates should be recognised when recommendations for the pressure processing of foods are being considered. 1. INTRODUCTION The number of reported cases of food poisoning continues to rise in most countries around the world. Many of theses cases are associated with foods of animal origin such as poultry meat and dairy products. If high pressure processing of such foods is to be accepted then further information is needed on the response of pathogens to high pressure treatment in the foods, so that the process can be optimised for microbiological safety and quality. The microbiological inactivation achieved by high pressure depends on a number of interacting factors including the microbial species, the strain variation within a species, the effect of substrate and the ability of the organism to survive sub-lethal injury caused by pressure. These aspects are discussed below. In addition the use of high pressure applied simultaneously with elevated temperature was investigated as a method of inactivating the more pressure resistant microorganisms.

268 2. RESULTS AND DISCUSSION

2.1. Variation in pressure sensitivity between microbial species In phosphate buffered saline (PBS), a pressure of 275 MPa for 15 rain at 20 ~ C resulted in more than a 105 reduction in numbers of Yersinia enterocolitica NCTC 11174 (Figure 1). However, treatments of 350 MPa, 450 MPa, 450 MPa, 700 MPa and 700 MPa for 15 rain were needed to achieve a similar reduction in Salmonella typhimurium NCTC 74, S. enteritidis PT4 (laboratory isolate from liquid egg), Listeria monocytogenes NCTC 11994, Escherichia coli O157:H7 NCTC 12079 and Staphylococcus aureus NCTC 10652. The unexpected pressure resistance of the E. coli O157:H7 was investigated further using different stains of this pathogen. II S. t~l~imunum 9$. enter~lis

O-

co/i 0157:H7 NCTC 12079

I ' E.

-1-

Figure 1. Inactivation of pathogens in phosphate uffered-saline (pH 7.0, 20~ after 15 min treatment at various pressures. No - initial number, N - number of survivors. Plating medium = TSAYE.

-2-

'• Z

-3-"

4-741

,

,

l

,

Pressure (MPa)

2.2. Variation in pressure sensitivity between different stains of the same species The pressure sensitivity of six strains of E. coli O157:H7 ( NCTC 12079, ATCC 43888, ATCC 43894 and three clinical isolates, H631 (obtained from a child with Haemolytic Uremic Syndrome), H2822 and H1071) was investigated. Table 1. Pressure inactivation of E. coli 0157:H7 strains after 15 rain in PBS (pH 7.0, 20~ No - initial number; N - number of survivors.

Strain

'log 500

NCTC 12079 ATCC 43888 ATCC 43894 H 1071 H 631 H 2822

-2.53 - 1.99 - 1.79 -4.20 -4.67 -3.56

MPa

(N/No)

MPa

600

-4.48 -5.1 7 -2.87 -7.04 -7.10 -6.32 ii

700

MPa

-5.63 -7.61 -5.07 > -8.00 > -8.00 -7.93 ,,

269 There was obvious variation in pressure sensitivity between the different strains (Table 1), with the clinical isolates tending to be more sensitive than isolates from the culture collections. Variation in pressure resistance between different stains has also been reported for L. monocytogenes [ 1]. 2.3. Effect of substrate on the sensitivity of microornanisms to pressure To date many investigations of the effect of pressure on microorganisms have been carried out in buffers such as PBS. This substrate is readily available, easy to inoculate and used in many investigations, so allowing for comparisons to be made between different published studies. However, it is known that PBS can undergo significant changes in pH during pressurisation [2]. This is likely to affect the survival of microorganisms as well as the pressure treatment. In addition, it is thought that low water activity, sucrose, sodium chloride, and possibly other food constituents, may have a 'protective' effect on microorganisms [3, 4]. For these reasons it is of more value to investigate microbial inactivation in the foods of interest rather than in model systems. Figures 2 and 3 show the response of E. coli O157:H7 (NCTC 12079), St. aureus and S. enteritidis to pressure treatment (700 MPa) in irradiation-sterilised poultry meat and ultra high-temperature treated (UHT) milk respectively. The substrate during the pressure treatment had a significant effect on the recovery of the pathogens. The UHT milk allowed greater survival of the E. coli and S. enteritidis, while there was greater recovery of St. aureus in poultry meat compared to UHT milk. In all cases, inactivation was greater in PBS than in either of the foodstuffs (data not shown). This variation in inactivation obtained in different substrates has been reported elsewhere. L. innocua was more pressure resistant in liquid UHT dairy cream than in minced beef [5, 6] S. typhimurium and L. monocytogenes were more pressure sensitive in buffer than in strained chicken or UHT milk respectively [7, 8].

~.

-3-

z

.4-

z

Figure 2. Pressure inactivation 700 MPa) of pathogens in poultry meat treated at 20~ No = initial number, N = number of survivors, Plating medium = TSAYE

-g'4-

4-7-8

0

10

1

T i m e (mln)

I

2O

25

30

270

~' Z

I E.coli O157:H7 NCTC 12079 9 S.oureus 9Sal.enteritidis

..3

0

I

5

9

I

10

i

i

15 20 Time (rain)

'

i

26

Figure 3. Pressure inactivation (700 MPa) of pathogens in UHT milk treated at 20~ No = initial number, N - number of survivors. Plating medium = TSAYE

I

30

2.4. Recovery and survival of pressure-injured bacteria As with all physical preservation techniques, high pressure may not kill cells outright but may injure a proportion of the population. The main site of damage in microorganisms is thought to be the cell membrane which becomes more permeable after pressure treatment. Shigehisa et al., [9] reported that treatment of E. coli and St a u r e u s at pressures up to 600 MPa for 10 min at 25 ~ C resulted in leakage of cytoplasmic RNA. Ultraviolet absorption spectra and acridine orange staining suggested that the E. coli cell membranes became permeable and leaked cytoplasmic RNA at lower pressures than those of St. aureus, agreeing with findings that E. coli was more pressure sensitive than St aureus. Evidence of damaged cells can also be obtained by comparing bacterial counts on non-selective agar with those obtained on selective agar. Compounds such as sodium chloride can act as selective agents and inhibit the growth of cells with membrane damage [10]. The use of differential plating, consisting of trypticase soy agar containing 0.6% yeast extract (TSAYE) and TSAYE + 3% NaCI was used to assess injury in E. coli O157:H7 after treatment in UHT milk at various pressures for 15 min. (Figure 4). There was no significant difference in counts below 300 MPa. At 400 MPa and above, counts were significantly lower on the salt medium, indicating the presence of injured cells. The fact that pressure can cause microbial injury has important implications for the storage of pressure treated foods. Carlez et al [11] reported that, although P s e u d o m o n a s spp. could not be detected immediately after minced meat was pressure treated (400 MPa, 20 rain.), the organisms were detected after 6 days storage at 3 ~ C. After this initial lag, the growth rate of the recovered organisms was similar to that of the controls. Metrick et al. [7] also reported that recovery of S a l m o n e l l a spp., assessed by ability to grow on a selective medium, was possible from strained-chicken baby food but not from phosphate buffer.

271

0

"

9TSAYE SAYE + 3% NaCI

Figure 4. Effect of plating medium on the recovery of E. coli O157:H7 NCTC 12079 after 15 min treatment in UHT milk at 20~ No - initial number, N - number of survivors.

4-7.8-

"

i

~

I

i

Pressure ( M P a )

0

m 9

,m

A

A

-1 ~"

-2-

\

\

\

\

-4-

\

\

\ N_

\

\

-~ \

~.

-~

10~

=2o0c

\

\

o4ooc

*so~

.~*c 60~

Figure 5. Effect of pressure and temperature, applied simultaneously, on the survival of E. coli O157:H7 NCTC 12079 after 15 min treatment in UHT milk. No = initial number, N - number of survivors. Plating medium = TSAYE.

-70

I

100

--

'P

200

I

300

9

400

"1"

600

I

S00

9

700

Pressure ( M P a )

2.5 C o m b i n e d effect of pressure and t e m p e r a t u r e on the inactivation of pathogens Previous work has shown that certain strains of E. coli O157:H7 were relatively resistant to pressure treatment at 20 ~ C. The application of pressure at different temperatures was therefore investigated as a method to increase the inactivation of this pathogen in UHT milk (Figure 5). The combination treatment acted synergistically and resulted in greater inactivation than either treatment alone. For example, pressure treatment of 400 MPa at 50 ~ C resulted in a 104 fold inactivation compared to < 10 fold inactivation achieved when the pressurisation was carried out at 20 ~ C.

272 3. REFERENCES

1. M.F. Patterson, M. Quinn, R. Simpson and A. Gilmour, A. J. Food Prot., 58, (1995) 524. 2. J.J. MacFarlane, J.J. in Meat Science 3, R. Lawrie, ed., Elsevier Applied Science Publishers, London. 3. D. Knorr, A. Bottcher, H. Dornenburg, M. Eshtiaghi, P. Oxen, A. Richwin, and I. Seyderhelm, in High Pressure and Biotechnology, C. Balny, R. Hayashi, K. Heremans and P. Masson, eds., Colloque INSERM/J. Libbey and Co. Ltd. London 224 (1992) 211. 4. A. Maggi, P. Rovere, S. Gola, and G. Dall'Agilo, Ind. Conserv., 68, (1994) 232. 5. A. Carlez, J-P. Rosec, N. Richard and J-C. Cheftel, Lebensm. Wiss. Technol., 26, (1993) 357. 6. J. Raffalli, J-P. Rosec, A. Carlez, E. Dumay, N. Richard, N. and J-C. Cheftel, Sci. Aliments, 14, (1994) 349. 7. C. Metrick, D.G. Hoover and D. F. Farkas, J. Food Sci., 54, (1989) 1547. 8. M.F. Styles, D.G. Hoover and D.F. Farkas, J. Food Sci., 56, (1991) 1404. 9. T. Shigehisa, T.,Ohmori, A. Saito, S. Taji, S. and R. Hayashi, Int. J. Food Microbiol., 12, (1991) 207. 10. J.L. Smith and D.L. Archer, J. Ind. Microbiol., 3, (1988) 105. 11. A. Carlez, J-P. Rosec, N. Richard and J-C. Cheftel, Lebensm. Wiss. Technol., 27, (1994) 48.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

273

Inactivation of HIV in blood plasma by high hydrostatic pressure T. Shigehisa a, T. Nakagami a, H. Ohno a, T. Otake b, H. Mori b, T. Kawahata b, M. Morimotob and N. Ueba b aResearch and Development Center, Nippon Meat Packers, Inc., Tsukuba, Ibaraki 300-26, Japan bOsaka Prefectual Institute of Public Health, Osaka, Osaka 537, Japan

Abstract The present paper describes (1) inactivation of bacteria, a parasite Trichinella spiralis and enveloped viruses of HCMV and HSV-1, and leakage of enzymes from lysosomes; these phenomena probably occur due to the membrane-conformational alteration induced by high hydrostatic pressure (HHP), and (2)inactivation of HIV to MT-4 cells by HHP; drastic inhibition at 350 MPa for 10 min at 25~ and more than 5-log reduction at 400 MPa. The longer the duration of HHP at 300 MPa, the lower the remaining infective titer of HIV-1. Even at 400 MPa, however, H H did not alter biological activities of plasma proteins except that of factor VIII.

1. O V E R V I E W OF T H E A U T H O R S ' P R E C E D I N G S T U D I E S

High hydrostatic pressure (HHP) treatment induces a number of irreversible changes in food ingredients and concomitants like heat, depending on the magnitude of the pressure; i.e. denaturation of proteins, inactivation of enzymes, physicochemical alteration of starch, textural improvement of meat, inactivation of microorganisms and so forth [1]. The authors examined the effects of HHP on meat-r elated areas as well as other biological phenomena. 1 . 1 . B a c t e r i c i d a l effects of H H P First, we examined whether the HHP treatment could destroy bacteria associated with meat and meat products [2]. Since various species of bacteria can be found on and in the meat, we inoculated each of various species of bacteria, including those which deteriorate meat and meat products as well as pathogens, into aseptically prepared pork slurries, pressurized them for 10 min at room temperature, and

274 enumerated the surviving cells after resuscitation treatments. All the test bacteria were killed by HHP. Based on the pressure sensitivities, the bacteria examined seemed to be divided into two groups" the bacteria which were inactivated at pressures higher than 300-400 MPa and those at higher than 500-600 MPa. "lhe former comprised all gram-negative bacteria including Campylobacter, Pseudomonas, Salmonella, Yersinia and E. coli. ]he latter comprised all gram-positive bacteria including Micrococcus, Staphylococcus and Enterococcus. To illustrate such differences in pressure sensitivities, E. coli and S. aureus were selected as representatives of pressure-labile gram-negative bacteria and pressure-stable gram-positive bacteria, respectively. After the HHP treatment, these bacteria were stained with acridine orange (AO), observed under a fluorescence microscope, and examined for UV absorption spectra of centrifugal supernatant fluid of the supporting media. E. coli cells without the HHP treatment were stained in orange fluorescence, but those pressurized in green. The ratio of the green cells increased as the pressure increased (Fig. 1). It was also noted that the pressurized E. coli leaked A260 substance and the higher the pressure, the more the leakage. With S. aureus, however, HHP induced neither appearance of the green fluorescent cells nor leakage of A260 substance. Since AO complex of double-helix 100 m

Q

50

(P om

0

1

2

3

4

5

6

x 100 MPa Pressure applied

Fig. 1. Effects of high hydrostatic pressure (HHP) on acridine orange (AO) staining of E. coli (circles) and S. aureus (triangles). After each cell suspension in PBS was subjected to the pressure for 10 min at 25~ the cells were fixed with methanol, stained with AO in acetate buffer, pH 4.0, and observed under a fluorescence microscope. Mean ratios of green fluorescent cells to all the cells observed are plotted against the pressure. Reprinted from: T. Shigehisa et al., Int. J. Food Microbiol. 12 (1991) 207.

275 nucleic acid emits green and that of single-stranded one orange and since E. coli leaked A260 substance, it is obvious that E. coli became permeable and leaked cytoplasmic RNA at lower pressure than S. aureus. Such difference in the pressure sensitivity may relate to different membrane constructions of these bacteria; namely, the cell-waU structure of gram-negative microorganisms is more complicated than that of gram-positive ones, and the former seems to be more susceptible to such environmental changes caused by the HHP treatment. There are several possible mechanisms by which bacteria are inactivated on exposure to the pressure; a primary site of injuries induced by HHP may be a membrane. In consequence of such a hypothesis, the authors examined the effects of HHP on other biomembranes, using lysosome [3, 4], Trichinella spiralis [5, 6] and viruses [7]. 1 . 2 . E f f e c t s o f H H P on o t h e r b i o m e b r a n e s of l y s o s o m e s , Trichinella

spiralis and v i r u s e s Meat is prepared by holding carcasses for a few days to weeks at chilling temperatures. Such a process is known as conditioning. Without the conditioning, the muscle cannot become meat, being tender and palatable, smelling good and enhancing our appetite. Although the mechanisms of the conditioning have not fully been explained yet, such lysosomal enzymes as cathepsins and calpain are believed to contribute toward the conditioning. Lysosomes were prepared from bovine fiver, suspended in an isotonic buffer, pressurized, and subfractioned by centrifugation, qhe enzyme activities of the supematant and the residue were determined. It was observed that HHP at 100 to 200 MPa induced destruction of lysosome membranes and leakage of the lysosomal enzymes [4], and that pressurized meat became tender and palatable in a shorter period than did normally conditioned meat [3]. T. spiralis causes trichinellosis, an important food-borne zoonosis. To prevent trichineUosis, treatment of meat by heating, freezing and drying have been widely used to date. The authors showed that the HHP treatment at higher than 200 MPa kills T. spiralis larvae and is a useful alternative to conventional treatments [5]. Histochemical and morphological studies [6] by using hematoxylin-eosin (HE), periodic acid-Schiff (PAS) and Azan staining showed the followings: (1) slight histochemical changes in HE and PAS staining of the larvae pressurized at lower than 200 MPa, (2) blue staining of all tissues of the larvae pressurized at 300 MPa, suggesting that acidophilic tissue degenerated and became basophilic, and (3) decrease and/or distortion of PAS-positive staining of the larvae pressurized at 300 MPa, suggesting that glycogen and/or glycoprotein may have been decomposed. Virologically, viruses are classified on the basis of nucleic acids, DNA or RNA, and of morphology of the viral particles. From the morphological viewpoint, viruses are divided into two categories" nonenveloped and enveloped ones. As the nonenveloped viruses known are polyovirus, hepatitis A virus (HAV), etc. and as

276 enveloped viruses, human cytomegalovirus (HCMV), HSV (human simplex virus), human immunodeficiency virus (HIV), human T cell leukemia virus (HTLV), hepatitis B virus (HBV), etc. The envelopes of the viruses are originated from the membrane of their host cells and requisite for the viruses to infect target cells. Two enveloped viruses (AD 169 strain of HCMV and Seibert strain of HSV-1) and a nonenveloped virus, polyovirus, were selected, pressurized, and then determined for plaque formation units [7]. HCMV and HSV-1 were inactivated by HHP at more than 300 MPa. At more than 400 MPa, the infective titers of HSV-1 and HCMV reduced by more than 7 and 4 logs, respectively (Fig. 2). However, the nonenveloped virus, polyovirus, was not inactivated even at 600 MPa.

|

A

9 ~)~

HSV-1

a 7

HCMV

6 5 4 3

3

2

2

e

1

~ID4-4D-tD 0

1

2

3

4

6

II

x 100 MPa Pressure applied

0

1

2

3

4

S

t

x 100 MPa Pressure applied

Fig. 2. Effects of high hydrostatic pressure ( H H ) on herpes simplex virus type 1 (HSV-1) and human cytomegalovirus (HCMV). qhe virus suspensions were subjected to HHP at 100 to 600 MPa for 10 min at 25~ The infectivities of HSV-1 and HCMV were evaluated by plaque assay. Reprinted from: T. Nakagami et al., J. Virol. Methods, 38 (1992) 255.

The HSV-1 particles were examined by negative-contrast electron microscopy [7]. The HSV-1 particles without the HHP treatment were scarcely disrupted, but those treated by HHP at 300 MPa were mostly disrupted. After allowing adsorption of the pressurized HSV-1 to Vero cells for an hour at 37~ the cells were examined by making ultrathin sections, qhe binding of most virions of untreated HSV-1 to the cell surface was observed, whereas no virion bound to the cell surface after HHP at 300 MPa. These results show that the HHP treatment may have caused configurational change in biomembranes, killing such microorganisms as bacteria [2] and T. spiralis [3, 4], leakage of endogenous enzymes from lysosomes [6] and reduced infectivities of

277 enveloped viruses, HCMV and HSV-1 [7]. The authors were prompted to examine the effect of HHP on infectivity of an enveloped-RNA-virus HIV [8].

2. E F F E C T S O F H H P ON I N F E C T I V I T Y O F HIV HIV causes acquired immunodeficiency syndrome (AIDS) [9], and transmitted from human to human by transfusion with infected but unsterilized blood, by sexual intercourse, etc. HIV infects CD4+-T leukocytes and macrophages, disturbs the immune system, and causes human death. Research on and development of vaccines, monoclonal antibodies, such chemicals as reverse-transcriptase inhibitors like AZT and DDI, protease inhibitors, antisense DNAs, ribozymes as well as gene therapies have intensively been carried out. However, no absolutely effective therapy has been established yet. HIV (a IIIB strain) suspended in 10% FCS was treated at room temperature at various pressures for 10 min or for various durations, qhe infective titers of HIV were assessed by a usual method. 6

m

.

mm

r

5

r~

4

n

.

A 200MPa 0

B

0

Z [.. 0

u

Z

3

~

-2

m

2

o~

>

o1111

~'q

-1

0

1

0

I

l

I

I

J

1O0

200

300

400

500

Pressure

(MPa)

I

I0

i

100

tOO0

Time (min)

Fig. 3. Effects of high hydrostatic pressure (HHP) on human immunodeficiency virus type 1 (HIV-1). Suspensions of the virus (a III B strain) containing 10% fetal calf serum were subjected to HHP at 100 to 500 MPa for 10 min (A) and for 10 to 1,000 min (B) at 25~ qhe infective titers of H1V-1, calculated as a tissue culture infectious dose (TCID), were assessed in MT-4 cells. *: Below the lowest detectable titer of the assay (log TCIDs0/mI12% protein, no sucrose) was clearly heterogeneous, with "expanded beads" set in a dense matrix of closely packed 20-40 nm particles. Corresponding heat-set gels (T-gels) (87~ 45 min) displayed a regular network of 50-100 nm particles aggregated into fine branched strands. Similar pH 7.0 solutions of B-Lg isolate containing 12% w/w protein, with or without 10% w/w polyol (sucrose, glucose or sorbitol), were pressurized or heated as indicated above [33]. All solutions were almost fully gelled immediately after processing, but P-gels (in contrast to T-gels) underwent progressive syneresis and exudation during storage at 4~ The loss of liquid exudate (30% of total weight after 1 h, 45% after 24 h, in the absence of polyol) was reduced in the presence of polyol. 12 or 17% of the initial protein went to the exudate in soluble form, but the protein concentration of the remaining P-gel fraction increased from an initial 12% to 14 or 18% (with or without polyol, respectively). The rigidity (at 10% compression) of "residual" P-gels was about half that of T-gels (in the absence of polyol) or even lower (with polyol). The rigidity and elasticity index of these P-gels decreased in the following order: no polyol >_ sucrose > sorbitol > glucose. These two mechanical characteristics increased during storage at 4~ in parallel to exudation.

305 The protein solubility of the pressurized B-Lg isolate solutions (gel plus exudate) was determined in the following dissociating solutions 950 mM K phosphate buffer, pH 7.0, without (A) or with (B) 0.5% SDS (without (B) or with (C) 10 mM DTT). In the case of pressurization without polyol, protein solubility exceeded 90% in solution A after 0.6 h storage at 4~ and decreased to 38-60% in solution A or B after 23-144 h, indicating an extensive aggregation of B-Lg. The presence of 10% polyol (specially glucose) enhanced protein solubility. Protein solubility in solution C was high at all times, showing that pressure-induced aggregation and insolubilization of B-Lg were largely due to the formation of intermolecular S-S bonds [33]. When pressurization was carried out at 40~ instead of 25~ protein solubility in solutions A and B dropped to 10%, showing a synergistic effect of temperature and high pressure on the aggregation of B-Lg. Thus, pressurization of B-Lg isolate (12% protein solution) at 450 MPa and 25~ for 15 min, followed by pressure release, induces the immediate formation of a soft gel (with easily solubilized protein constituents). During subsequent chilled storage (20-24 h), intermolecular (hydrophobic ?) interactions and S-S bonds accumulate, and the solubility of protein constituents decreases. This leads to a more rigid and elastic gel network, and to gel syneresis and exudation phenomena. Both steps are partially inhibited by the presence of 10% polyol, glucose exerting a greater "baroprotective" effect than sorbitol or sucrose. When CaCI2 or EDTA was added to B-Lg isolate solutions (5-10 mmoles/kg) before pressurization, it was observed (after 20-24 h at 4~ that both chemicals reduced exudation and protein loss, increasing gel rigidity without changing significantly the elasticity index [33]. Microscopy confirmed that protein aggregation was greater, probably as a result of enhanced hydrophobic interactions at higher ionic strength. Calcium ions were clearly of limited importance in pressureinduced gelation of B-Lg (the initial B-Lg isolate containing only 0.4 g/kg calcium). Van Camp and Huyghebaert [34] prepared gels by pressure processing at 2030~ (usually at 400 MPa, 30 min), or heat processing (80~ 30 min), solutions of a whey protein concentrate in water or in various buffers. At initial protein concentrations of 9 to 18%, P-gels had weaker networks than T-gels, as measured by penetration. Liquid exudation was observed for P-gels, representing 10-20% of the total weight of the initial solution, depending on protein concentration. A minimum pressure of 200 or 400 MPa, combined to a minimum protein content of 16 or 11%, respectively, were necessary for gel formation. Increasing protein concentration, pressure or time generated stronger P-gels. In the pH 4 to 9 range, P-gels were formed at or above pH 6, with a similar gel strength and a coarse texture. Exudation was minimal at pH 8 or 9. Pressure-sensitive buffers (pH 6 or 7 phosphate) reduced the strength of P-gels as compared to Tris and bis-Tris), probably due to the lowering of pH (and the absence of SH/S-S exchange reactions ?) under pressure. At similar pressures and protein contents, P-gels were also obtained from an haemoglobin protein concentrate, but not from a blood plasma or an egg white concentrate. The same P-gels and T-gels of whey protein concentrate (at 11 to 18% protein in 50 mM phosphate buffer, pH 7.0) were compared using various rheological methods [35]. Exudation for P-gels was close to 18% w/w. Non destructive oscillatory rheology indicated that both the elastic storage modulus G' and the viscous loss modulus G" increased with protein concentration (as expected) and were higher for T-gels (80~ 30 min) than for P-gels (400 MPa, 30 min, 20-30~ The higher elasticity of T-gels must reflect a greater number and strength of protein-protein interactions. Creep methods (small sample deformation measured for 10 min after an

306 initial stress, results given as compliance - strain/stress ratio) confirmed the lesser elasticity of P-gels, reflecting a greater ability of polypeptide strands to rearrange between cross-links. Relaxation measurements after large deformation (17 to 33% compression) indicated a faster force decay for P-gels than for T-gels, due to an easier rupture and/or rearrangement of bonds. Stress-strain relationship up to 33% deformation was close to linear for all gels, revealing no fragmentation or excessive compaction during measurement. The "compression modulus" (stress/strain slope) was lower for P-gels than for T-gels, but increased more with protein concentration for P-gels. SEM at magnifications of 500 and 2000 revealed the greater porosity of P-gels, as compared to the compactness of T-gels, thus supporting rheological data. The mechanical properties and microstructure of T- or P-gels from B-lactoglobulin isolate or mixed B-Lg isolate/xanthan solutions were studied at pH 6.85-7.0, at 7 to 17% (w/w) protein, with or without 0.9% (w/w) xanthan [36]. With T-gels, xanthan markedly decreased gel rigidity above 10% protein, and reduced elasticity index and relaxation time (as measured after compression) below 12% protein, thus enhancing the viscous component of the gels. Mixed T-gels containing 14.7-16.4% protein displayed a spread-like creamy texture similar to that of protein-based fat substitutes. A minimum protein concentration of 7.5% was necessary for the formation of P-gels of B-Lg isolate (at 450 MPa). Pressure-induced gelation of B-Lg isolate alone resulted in the previously mentioned sponge-like texture prone to exudation, and to a protein content of gels (13-22%) higher than in the corresponding initial solutions (9-17% protein). These characteristics were prevented by xanthan. Xanthan also increased the elasticity index and the relaxation time of P-gels. SEM indicated that T-gels from B-Lg isolate alone contained protein aggregates linked together into fine strands below 10% protein, and into coarse strands around 15% protein. Xanthan increased the size of aggregates promoting their separation into distinct spherical particles (1-2 lxrn). The specific structure with thick "pillars" and large pores (up to 100 ~tm) observed in P-gels of B-Lg isolate alone was prevented by xanthan. Mixed P-gels and T-gels had similar characteristics, in contrast to P-gels and T-gels of B-Lg isolate alone. Mixed protein/polysaccharide gels prepared by pressure processing solutions containing 12% protein (from B-Lg isolate) and 0.l-l% polysaccharide (high methoxy pectin, low methoxy pectin or alginate) confirm that the presence of small amounts of given polysaccharides efficiently reduces the porosity and increases the water-holding capacity of P-gels of B-Lg [Dumay et al., in preparation]. CONCLUSIONS A basic challenge in the study of pressure effects on proteins at low or moderate temperature is to understand the mechanisms of pressure unfolding, dissociation/ aggregation, hydration and/or gelation under pressure or after pressure release. Little is precisely known concerning the influence of pressure on the various types of protein-protein and protein-water interactions. The reversible dissociation of electrostatic and ionic interactions due to the electrostriction (alignment and volume reduction) of neighboring water molecules is generally accepted. The reversible disruption of hydrophobic interactions (additional hydrophobic surfaces cause more water to assume a tightly packed structure) appears to depend both on the alkyl or aryl nature of the hydrophobic aminoacids involved, and on the pressure level. Hydrogen bonds are apparently reinforced (reversibly) under pressure, since gelatin or agarose gels, with a network stabilized primarily by hydrogen bonds, do not melt

307 under pressure unless the temperature is raised well above their melting point at atmospheric pressure. In addition to NMR or FFIR spectroscopy under pressure, the following approaches may be used for comparing the bonds and interactions involved in pressure or heat-induced aggregation and gelation phenomena: 1) determine the solubility of protein constituents of gels or aggregates in solutions known to disrupt different types of interactions ; 2) promote gel formation in the presence of bond-forming or -breaking agents (Ca 2§ SDS, etc) ; 3) investigate the temperature dependence of rheological properties for solutions or gels containing one or several different macromolecules. Results obtained with pressure-induced gels of l~-Lg are not so different from those resulting from mild heat processing or slow heating rates, and therefore do not fully support the claim of a specific gelation mechanism. This may be due to the fact that the energy required for sample compression to 500 MPa is much smaller than that necessary for heating to 80~ Another challenge that remains to be met concerns the practicality of applying cosily high pressure processing to protein-rich foods or to food proteins, especially in the dairy field. Some potential applications may be listed 9 low temperature "pasteurization" of raw milk, dairy creams [5], fresh curds, dairy spreads, cheese sauces or cheeses prepared from raw or heated milk ; low temperature enzyme inactivation and stabilization of fermented dairy products such as yoghurts [37] or cheeses [32] ; modification of the enzyme activities of lactic acid bacteria [38] ; enhancement of the functional properties of dairy proteins, e.g. water holding capacity, viscosity, emulsifying properties, hydrophobic ligand binding ; stabilization of emulsions by low temperature gelation [39] ; enhancement of fat crystallization for accelerated tempering of dairy cream, butter or ice cream mix [40, 41] ; freezing of dairy products (by fast pressure release) without destabilization of dairy constituents or structures ; improved rennet or acid coagulation of milk ; preparation of dairy gels and emulsions with novel textures and low microbial load (possibly through combined pressure/heat processing) ; high pressure enzyme reactors for preparing protein hydrolyzates (faster operation, lower allergenicity and microbial load, less bitter peptides, more biologically active peptides) ; enhancement of SH/S-S interchange reactions for the covalent binding of cysteine and peptides. REFERENCES

1 2 3 4 5 6 7 8

B.H. Hite. Bull. West Virginia University Agricultural Experiment Station, 58 (1899) 15. M.F. Styles, D.G. Hoover and D.F. Farkas. J. Food Sci., 56 (1991) 1404. M.F. Patterson, M. Quinn, R. Simpson and A. Gilmour. J. Food Protection, 58 (1995) 524. J.C. Cheftel. Food Science and Technology International, 1 (1996) 1. J. Raffalli, J.P. Rosec, A. Carlez, E. Dumay, N. Richard and J.C. Cheftel, Sciences des Aliments, 14 (1994) 349. D.G. Schmidt and W. Buchheim. Milchwissenschaft, 25 (1970) 596. Y. Shibauchi, H. Yamamoto and Y. Sagara. In "High Pressure and Biotechnology", C. Balny, R. Hayashi, K. Heremans and P. Masson (eds), INSERM/ John Libbey Eurotext, Montrouge, p 239 (1992). D.E. Johnston. In "High Pressure Processing of Foods", D.A. Ledward, D.E. Johnston, G.R. Earnshaw and A.P.M. Hasting (eds), Nottingham University Press, Nottingham, chapter 8, p 99 (1995).

308 9

K. Schrader, C.V. Morr and W. Buchheim. Paper presented at the "International Conference on High Pressure Bioscience and Biotechnology", Kyoto, November 5-9 (1995). 10 S. Desobry-Banon, F. Richard and J. Hardy. J. Dairy Sci., 77 (1994) 3267. 11 S.K. Lee, S.G. Anema, K. Schrader and W. Buchheim. Milchwissenschaft, 51 (1996) 17. 12 D.E. Johnston, B.A. Austin and R.J. Murphy. Milchwissenschaft, 47 (1992) 760. 13 D.E. Johnston and R.J. Murphy. In "Food Macromolecules and Colloids", E. Dickinson and D. Lorient (eds), Royal Soc. Chemistry, London, p 134 (1995). 14 T.A.J. Payens and K. Heremans. Biopolymers, 8 (1969) 335. 15 K. Ohmiya, T. Kajino, S. Shimizu and K. Gekko. J. Dairy Res. 56 (1989) 435. 16 K. Ohmiya, T. Kajino, S. Shimizu and K. Gekko. Agric. Biol. Chem. 53 (1989) 1. 17 J.E. Matsuura and M.C. Manning. J. Agric. Food Chem., 42 (1994) 1650. 18 E. Dumay, M. Kalichevsky and J.C. Cheftel. J. Agric. Food Chem., 42 (1994) 1861. 19 E. Dufour, G. Hui Bon Hoa and T. Haertlr. Biochem. Biophys. Acta, 1206 (1994) 166. 20 N. Tanaka and S. Kunugi. Poster presented at the "International Conference on High Pressure Bioscience and Biotechnology", Kyoto, November 5-9 (1995). 21 I. Hayakawa, J. Kajihara, K. Morikawa, M. Oda and Y. Fujio. J. Food Sci., (1992) 288. 22 S. Funtenberger, E. Dumay and J.C. Cheftel. Lebensm. Wiss. Technol., 28 (1995) 410. 23 R. Hayashi, Y. Kawamura and S. Kunugi. J. Food Sci., 52 (1987) 1107. 24 M. Okamoto, R. Hayashi, A. Enomoto, S. Kaminogawa and K. Yamauchi. Agric. Biol. Chem., 55 (1991) 1253. 25 T. Nakamum, H. Sado and Y. Syukunobe. Milchwissenschaft, 48 (1993) 141. 26 E. Dufour, G. Herv6 and T. Haertlr. Biopolymers, 35 (1995) 475. 27 R.W.G. Van Willige and R.J. Fitzgerald. Milchwissenschaft, 50 (1995) 183. 28 K. Ohmiya, K. Fukami, S. Shimizu and K. Gekko. J. Food Sci., 52 (1987) 84. 29 D.E. Johnston, B.A. Austin and R.J. Murphy. Milchwissenschaft, 48 (1993) 206. 30 D.E. Johnston, R.J. Murphy and A.W. Birks. High Pressure Res., 12 (1994) 215. 31 K. Kumeno, N. Nakahama, K. Honma, T. Makino and M. Watanabe. Biosci. Biotech. Biochem., 57 (1993) 750. 32 H. Yokoyama, N. Sawamura and N. Motobayashi. Method for ripening cheese under high pressure. US Patent N ~ 5180596 (1993). 33 J.C. Cheftel, E. Dumay, S. Funtenberger, M. Kalichevsky and D. Zasypkin. Presented at the Symposium "High Pressure Effects on Foods", IXth World Congress of Food Science and Technology, Budapest, August 2 (1995). 34 J. Van Camp and A. Huyghebaert. Lebensm. Wiss. Technol., 28 (1995) 111. 3 5 J. Van Camp and A. Huyghebaert. Food Chem., 54 (1995) 357. 3 6 D. Zasypkin, E. Dumay and J.C. Cheftel. Food Hydrocolloids. 10 (1996) in press. 37 T. Tanaka and K. Hatanaka. Nippon Shokuhin Kogyo Gakkaishi, 39 (1992) 173. 38 H. Miyakawa, K. Anjitsu, N. Ishibashi and S. Shimamura. Biosci. Biotech. Biochem., 58 (1994) 606. 39 E. Dumay, C. Lambert, S. Funtenberger and J.C. Cheftel. Lebensm. Wiss. Technol., 29 (1996) in press. 40 W. Buchheim and A.M.A. El Nour. Fat Science and Technology, 94 (1992) 369. 41 M. Schtitt, E. Frede and W. Buchheim. Kieler Milchwirtschaftliche Forschungsberichte, 47 (1995) 209.

R. Hayashi and C. Balny (Editors), High Pressure Bioscienceand Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

309

Changes in myosin molecule and its proteolytic subfragments induced by high hydrostatic pressure Katsuhiro Yamamoto Department of Food Science, Rakuno Gakuen University, Ebetsu, Hokkaido 069, Japan

Abstract Turbidities of myosin, heavy meromyosin (HMM), and $1 increased with pressure. Whereas, light meromyosin (LMM) and rod did not show turbidimetric change. Head to head association forming a cluster was observed in HMM as well as myosin. $1 aggregate was larger than that of myosin or HMM. There was no noticeable morphological change in pressurized LMM and rod. $1 was split from unpressurized myosin by chymotryptic digestion in the absence of Ca 2+. After pressurization of myosin, S 1 splitting was suppressed. Hydrophobicities of myosin, HMM, and $1 increased with pressure, while no hydrophobic changes were detected in LMM and rod.

1. I N T R O D U C T I O N

When myosin is pressurized, it forms a gel at low ionic strength [1] or forms an aggregate at high ionic strength [2, 3]. Myosin does not form a gel at high ionic strength upon pressurization at least up to 500 MPa, although heating induces gelation of myosin regardless of ionic strength. Myosin molecule consists of two distinct parts, namely, head and tail. Myosin head is a globular part and it contains actin binding site and ATPase site. The tail of myosin molecule has a fibrous structure and consists of almost 100% of helix [4], and self-association of tails at low ionic strength causes filament formation. Head to head interaction is thought to be involved in pressure-induced gelation [1] or aggregation [2,3], while pressure effect on tail portion of myosin is not well understood. In this study, we investigated biochemical and morphological changes in proteolytic subfragments of myosin in order to make clear pressure effect on myosin molecule. 2. M A T E R I A L S A N D M E T H O D S

Preparation of myosin and itsproteolytic subfragments ~ Myosin was prepared from rabbit back and white portion of hind leg muscles by the method of Offer et al [5]. HMM and LMM were prepared by chymotryptic digestion of myosin and purified according to the method of Weeds and Taylor [6] and Lowey et al [4]. $1 and rod were also prepared by the method of Weeds and Taylor [6].

310 Application of hydrostatic pressure ~ The protein solution dissolved in 0.5 M KC1 and 20 mM Tris-maleate (pH 6.0 or 7.0) at an appropriate concentration was put into a plastic tube, then the tube was firmly sealed with a plug without trapping an air bubble. The sample tube was placed in a pressure vessel filled with water. Application of pressure was done at room temperature. Transmission electron microscopy - - - T h e pressure-treated proteins were diluted to 20 t~g/ml in 0.4 M a m m o n i u m acetate and 50% glycerol (pH 7.2), then sprayed onto freshly cleaved mica and rotary shadowed with p l a t i n u m at an angle of about 6 degrees from a distance of 10 cm. The specimen was observed with a Hitachi H-800 electron microscope at 75 kV. Measurement ofhydrophobicity ~ Hydrophobicity of the protein was measured by the method according to Wicker and Knopp [7]. The pressure-treated protein was diluted to 0.5 mg/ml with 0.5 M KC1, and 8-anilino-l-naphthalenesulfonic acid was added. After 10 minutes of incubation at room temperature, fluorescence intensity was measured and expressed as hydrophobicity. The wavelengths of excitation and emission were 380 and 475 nm, respectively. S D S polyacrylamide gel electrophoresis (SDS-PA GE) ~ SDS-PAGE was carried out as previously described [8].

3. R E S U L T S A N D D I S C U S S I O N

Figure 1 shows the changes in turbidity of myosin and subfragments in 0.5 M KC1 after pressure treatment. For the pH 6 myosin, the turbidity after pressurization at 100 MPa remained at almost the same level as in the case of the unpressurized control. With increasing pressure from 200 to 500 MPa, turbidity increased, and the increase of turbidity is almost proportional to the applied pressure. Most of the turbidimetric change was completed within 2 min of pressurization, and the increase in turbidity from 5 to 30 min being little. The myosin at pH 7 did not show turbidimetric change up to 200 MPa, though the turbidity increased above 200 MPa. The turbidity of the pH 7 myosin was always lower than that of the pH 6 myosin with a specified pressure and duration. Pressure-induced change in turbidity of HMM was similar to that in myosin. At pH 6, the turbidity began to increase above 100 MPa. On the other hand, at pH 7, the turbidity remained at the same level up to 200 MPa, and the turbidity increased above 200 MPa. The increase of turbidity of HMM is more pronounced compared to myosin. In the case of S1, turbidity increase was remarkable. The turbidity of S1 after pressurization at 500 MPa was not measurable, because large aggregates were formed and they precipitated. In contrast to myosin, HMM, and S1 which contain head portion, LMM and rod did not show any noticeable turbidimetric change at least up to 500 MPa regardless of the pH. Pressure-induced morphological changes in HMM, S1, and rod are shown in Figure 2. HMM aggregated with application of pressure, like the case of myosin. With increasing pressure, the aggregates became large. S1 aggregates were quite bigger than those of myosin or HMM. A cluster of myosin aggregate is about 45 to 50 nm in diameter (Fig. 2b, bottom center), while S1 aggregate was about 200 to 350 nm. This is why S1 showed very high turbidity upon pressurization. In contrast to myosin, HMM, and S1, no notable morphological change in rod was observable after application of pressure. Pressurized rod still retained rod-like shape and dispersed separately each other in a microscopic field (Fig. 2c). LMM

311

0.4

"•

I

1

I

0.20

I

" •0.15

0.3

(c)

4

60

>o

4o

5.5

...., (X <X

2o

#x

<x <X

5

untreated

sterilized

O< /-y

0

then pressurized

Dmilk

F] UF retentate

L~-7SMUF

~SMUF

untreated

sterilized

then pressurized

m UF permeate

without CaCI2R~]lnfranatant of past. milk

Figure 1: Effect of sterilization and high pressure treatment on pH and content of dissolved Ca in milk systems and synthetic milk ultrafiltrates

a

b 1.5

1.5 f

_t0.2

0.2 o . . . .

1- f"~ 0 . 5 -

,~:-----_--------~--IV-:-i:"":-:-..........................

o. 1

,? 0.5+ . .

-l-

Q_

0 "

.

0

.~

.E (_.

. . . . .

-0.5

.E (.-

y 0 " -

=====

.

.

.

.

=.:=====

. . . . . . . . .

.

.

.

.

.

.

0.1

.........

0

-1.c: ,m t-

-0.5

. . . .

-0.1

09 ]

-0.1

-1

0

1

2

3

4

5

6

7

holding time (rain)

8

9

10

-1.5w

~

t

J

~

~

~

~

i

~ .... -0.2

0 1 2 3 4 5 6 7 8 9 10 holding time (min)

-~-100 MPa , c~

.c_

, ~-;; .

0.5

-1-

CO9

-0.5

-1.5

b

._c c(/)

-0.2 500

p r e s s u r e (MPa)

I ---5oc -o-10oc -x- 20oc ~ 40oc

.

.

,,'z,"

.

.

.

.

0.1

,-

7CL

o

0

.c_ CO9

-0.5

-0.1

-1 -1.5

0

t

t

t

I

1 O0

200

300

400

-0.2 500

p r e s s u r e (MPa)

t u r b i d i t y - - - pH I

Figure 3: Pressure induced changes in turbidity and pH-value in original skim milk (a) and U.H.T. skim milk (b) at different temperatures after 10 minutes of pressure treatment The studies have shown that application of high pressure to milk systems results in a variety of interrelated changes both for the protein and the mineral phase. This further depends on whether the original eqilibrium state has already been changed by high temperature treatments which are common in milk processing.

4. R E F E R E N C E S

1 P. Walstra, R. Jenness, Dairy Chemistry and Physics, John Wiley & Sons, New York, 1984 2 B.H. Hite, West Virginia Agricult. Exp. Station Bull No. 58 (1899) 15 3 D.G. Schmidt, W. Buchheim, Milchwissenschaft 25 (1970) 596 4 D.G. Schmidt, J. Koops, Neth.Milk Dairy J., 31 (1977) 342 5 Y. Shibauchi, H. Yamamoto, Y. Sagara, In: High Pressure and Biotechnology (C. Balny, R. Hayashi, K. Heremans, P. Masson eds.) Colloque INSERM/John Libbey Eurotext, London 224 (1992) 239 6 D.E. Johnston, B.A. Austin, R.J. Murphy, Milchwissenschaft 47 (1992) 760 and Milchwissenschaft 48 (1993) 206 7 R. Jenness, J. Koops, Neth.Milk Dairy J., 16 (1962) 153

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

High Pressure Effects on Fish Lipid Degradation: Myoglobin Water Holding Capacity

351

Change and

S. Wada and Y. Ogawa Department of Food Science and Technology, Tokyo University of Fisheries, Konan 4-5-7, Minato-ku, Tokyo 108 Japan

Abstract Changes in myoglobin (Mb) content and water holding capacity (WHC) related to lipid degradation of fish meat (red muscle) were measured during storage at 5 o C after high pressure treatment at 100MPa or 200MPa. The Mb contents of sardine and bonito decreased during storage after 200MPa to 70% and 25% residues, respectively. The production of free fatty acid (FFA) in the fish meat during storage was prohibited by the 200MPa treatment. These results suggest that lipid degradation of fish meat after high pressure treatment above 200MPa occurred on the basis of Mb degradation and loss of WHC increased the surface layer between oxygen and the fish meat.

1. I N T R O D U C T I O N To stop the lipid oxidation of fish meat is quite impo~tant for the utilization for food materials after high pressure treatment. After the treatment above 200MPa for 30 min., the lipid of the fish meat is easily oxidized during storage although no difference is observed when the extracted lipid from the fish meat is treated by high pressure [ 1] of around 100MPa to 800MPa. These phenomena are postulated to be due to the denaturation of the protein by high pressure treatment, and that the lipid is affected along with the denaturation of the protein. One reason why the lipid oxidation occun'ed with the cooperation of the denaturation of the protein is that the heme-ion in the myoglobin(Mb) of the meat is possibly activated as a catalyst and the water holding capacity (WHC) is structurally related to this reaction. Therefore, in this study, the effect of the Mb and WHC on the lipid oxidation was investigated, especially in the red meats of bonito and sardine. Furthermore, the natural antioxidant effects of rosemary and c~-tocopherol for preventing the lipid oxidation of fish meat with high pressure treatment was also investigated.

2. MATERIALS AND METHODS The very fresh samples that included the red meats of sardine (Sardinops melanostica) and bonito (Euthynnuspelamis) were obtained at Tokyo central fish market, Tukiji, in Tokyo. The fresh red meats were minced for the samples to be treated at the high pressures of 200MPa and 100MPa for 30min., respectively, using a Rikenseiki 200M-60 Pressure Instrument [2]. After the red meat was homogenized and treated by high pressure, the meat was stored in the dark at 5~ using peu'i dishes with a diameter of 8.5cm. For preventing water evaporation during

352 storage, the meat was wrapped using Saran-Wrap@, wrapping film. A portion of the 12g sample was removed from the dish for each additional analysis. Mb was measured by the absorbance method at a wavelength of 543nm [3]. The thiobarbituric acid (TBA) value of the sample for the degradation degree of the lipid was measured by the method of Sinnhuber [4]. After extraction of the sample lipid using the method of Bligh and Dyer [5], the lipid spotted on the TLC plate was developed with petroleum ether/diethyl ether / acetic acid (80:20:1 v/v) and a Shimadzu High Speed TLC scanner (CS9000) was used to determine the lipid class composition. Fatty acid composition was analyzed by GLC on a spelco wax 10 capillary column (30m x 0.25mm i.d.) with a flame ionization detector. WHC was measured by the method of pressing the sample using two plates of glass. A 0.3g portion was put between two filter papers.

3. RESULTS AND DISCUSSION 3.1. Change of Myoglobin Content Figure 1 shows the change in the content of Mb including the hemoglobin (Hb) of bonito red meat during storage at 5~ The changes in Mb at 100MPa and non-treated meats almost had the same degradation patterns during storage. However, the Mb content of the 200MPa treated meat significantly changed from 1300 mg to 950 mg during the first stage after high pressure treatment and then the content gradually decreased, similar to the curve for 100MPa alter 3 days storage.

--O--

'~'~=~ 1 2 0 0 ~ ~ " ~

Non-Pressure

--A-100MPa :2 + ,.Q

--0-200MPa

300 ('}/f

a.

.1

~

2

4 6 Storage Days

I

,

I

,

I

v

0

8

10

Figurel. Change in (Mb+Hb) Content of Bonito Red Meat during Storage at 5~C

From these results, it appeared that heme pigments in fish meat treated by high pressure above 200MPa rapidly denaturates, while the changes in the meats of non-treated and low pressure treated ones were almost the same during degradation. The Mb content of sardine red meat was 265 mg and decreased to 185 mg after 200MPa treatment. Therefore, after the 200MPa treatment, the remaining Mb content of sardine was 30%, i.e., 70% was destroyed after the treatment, and after 6 days storage, 20% remained, which means 80% was lost. The Mb content of bonito decreased 15% after the treatment, then for 3 to 6 days storage, it decreased 40%, which means 60% remained. The degree of Mb denaturation, of course, is based on the degree of denaturation of part of the globin in the pigment protein.

353 From this point of view, the decrease in Mb content by high pressure treatment was considered to depend on the degree of high pressure along with the denaturation of the globin protein.

3.2

Lipid degradation during storage

Figure 2 shows the lipid changes in free fatty acid (FFA)s and triglycefide (TG)s of the sardine and the bonito red meats. The degradation in TGs of the u'eated samples of sardine and bonito were significantly more protective than those of the non-treated ones, while the production of FFA in the treated sample was prohibited because of the lack of lipase activity. Concerning the 100MPa treatment, the production of FFA occurred almost in the same pattern as the treated and non-treated samples.

Ico

FFA

FFA
-30~ > 100MPa, -80~ However, ice pores in tofu frozen at 200MPa (liquid phase), 340MPa (ice-III), and 400 - 600MPa (iceV) were round. Histological damage in tofu frozen at 700MPa was greatest among tofu frozen under high pressure.

Figure 3. Cryo-scanning electron micrographs (low magnification) of tofu (S) frozen for 45 min under high pressure. (1) untreated; (2) 100MPa; (3) 200MPa; (4) 340MPa; (5) 400MPa; (6) 500MPa; (7) 600MPa; (8) 700MPa. Bar: 50~tm.

414

Figure 4. Cryo-scanning electron micrographs (high magnification) of tofu (S) frozen for 45 min under high pressure. (1) 100MPa; (2) 200MPa; (3) 340MPa; (4) 700MPa. Bar" 0.5pm. The pore size of frozen-thawed tofu (S and L) analyzed by a mac-scope is compared in Figure 5. Ice pores in small size tofu (S) were smaller than those in large size (L), and ice pores of the outer part (L) were smaller than those of central part (L). Also, the pore size in tofu frozen at 200MPa ~ 400MPa (L) or 600MPa (S) was smaller t h a n in tofu frozen at 100MPa, 700MPa, -30~ and -20~ 53

~ 25 S: lxlxlcm

L: 3x3x1.5cm,Outer Part

.

L: 3x3• Central Part

/.-/

~o 20 ~15 bl

N10 0

/.,v

/ / /

t l i 111

! t l i l l

~% j j j

100 200 340

Ice 'I

400 500 600 700 100 200 340 400 500 600 700 -20 -30 -80 100 200 340 400 500 600 700 -20 -30 -80

MPa,-18~ MPa,-18~ Freezer(~ MPa,-18~ Freezer(~ L III V V V VI I L IIIV V V VI I I I I L IIIV V V VI I I I

Figure 5. The pore size of frozen tofu analyzed by a mac-scope. Freezing formed ice crystals in the gel network causing it to contract. Tofu with a tight network was firmer than tofu with a loose network by cryo-SEM observation. It seemed that shrinkage of the gel, due to the growth of ice crystals, affected the firmness, while the size of the ice crystals affected the strain of frozen tofu. 4. R E F E R E N C E S

1 Y. Kanda, M. Aoki and T. Kosugi, Nippon Shokuhin Kogyo Gakkaishi, 39 (1992) 608.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

C o m b i n e d effects of t e m p e r a t u r e

415

a n d p r e s s u r e o n i n a c t i v a t i o n of h e a t -

resistant bacteria Takashi OKAZAKI a, Koji KAKUGAWA a, Shinya YAMAUCHI a, Tatsuo YONEDA ~ and Kanichi SUZUKI b aHiroshima Prefectural Food Technology Research Center 12-70 Hijiyamahonmachi, Minami-ku, Hiroshima 732, J a p a n bDepartment of Applied Biological Science, Hiroshima University 1-4-4 Kagamiyama, Higashihiroshima 739, J a p a n Abstract Survival behavior of heat resistant bacteria (Bacillus, Clostridium) were studied in the temperature range from 35~ to l l 0 ~ under the controlled pressures up to 400 MPa. The death rates of organisms at 100~ and l l 0 ~ under 400 MPa were 7.4 times and 13.6 times higher than those at normal pressure. 1. I N T R O D U C T I O N

In most of the food industries, food products have been sterilized by heating. However, the excessive t h e r m a l conditions for ensuring the safety of microbial spoilage degrade the quality of products. The recent studies on the effect of high pressure on food processing have shown that the high pressurized treatment has an advantage of sterilization and quality of foods ~). However, it has also been proved that the heat resistant organisms, such as the spores of Bacillus and Clostridium species, have some pressure resistance 2). Thus, we have investigated the thermal inactivation combined with pressure for effective sterilization of these organisms. 2. M A T E R I A L A N D M E T H O D

Organisms used in this study were Bacillus subtilis (Research Laboratory, J a p a n Canners Association No. 1403, D10~oc=13.9min), B. coagulans (ATCC7050, Di10oc=13.9 min) and Clostridium sporogenes (PA3679, D.10oc=10.8 min). A sample tube made of silicon rubber (I.D.=5mm, L= 150mm), containing spore suspension (ca. 107 spores/ml, pH7.0, 1/15M phosphate buffer) was inserted into a pressure vessel in Fig.l, followed by heating the vessel in a constant temperature bath under the controlled pressure. Temperature and pressure histories at 100~ + 400 MPa for 10 min, for example, is shown in Fig.2. The survival spore numbers of B. subtilis and B. coagulans in the treated suspension were measured by counting the colonies which grew on a standard agar plate. In the case of C.sporogenes, the spore numbers were done by using a

416 y e a s t extract starch agar.

Fig.1 Schematic d i a g r a m of experimental a p p a r a t u s 1" pressure vessel; 2" thermocuple; 3: silicon tube;4: sample; 5: pressure gauge; 6: pressure p u m p

400

100 o

~

75

v

~9

9 50 0.1

B ~

25 I

0

I

I

I

200 400 600 Heating Time (s)

I

800

Fig.2 An example of t e m p e r a t u r e and pressure histories of a sample during heating at 100~ for 10 min under 400MPa

3. R E S U L T S

AND

DISCUSSION

Survival curves for spores ofB. subtilis and B. coagulans at up to 110~ u n d e r 400MPa are shown in Fig.3. Even at moderate t e m p e r a t u r e s ranging from 35~ to 65~ B. subtilis was inactivated at 400 MPa, though the survival curves did not obey the first order rate equation. However, B. coagulans was not inactivated under

417

10 7 ~,-__.__~_o__

o> o,-.q

~

in

10e

i

25~

lO 5

50~ 70~

~

lO 4

> lO ~

or]

lO 2

101

65~

lO 0

i

0

10

4,, 110~ ,

i

,

i

20

,

i

30

,

40

i

,

i

50

v

,

60 0 , 10 Time (min) ,

,

20 '

'

3" 0

'

40 '

,

50 ,

,

60 ,

,

70

Fig.3 Survival curves for spores of Bacillus subtilis (left) and B. coagulans (right) at t e m p e r a t u r e s r a n g i n g from 25~ to 110~ u n d e r 400MPa

the s a m e conditions. It b eg an to die at the t e m p e r a t u r e s higher t h a n 100~ u n d e r 400 MPa and the survival curves obeyed the first order rate equation. Sale et al? ) reported t h a t B. coagulans spores decreased from 100% to 0.0037% at 3000 atm. (ca.300 MPa) at 70~ and B. subtilis spores were 1250 times more r e s i s t a n t t h a n B. coagulans spores at the s a m e conditions. While in this result, B. coagulans spores decreased in ca. 1/10 of initial spore n u m b e r even at 400 MPa + 70~ for 60 min and B. subtilis spores died considerably at 400 MPa + 65~ O ur result disagreed with their report. Survival curves for spores ofB. coagulans (110~ and C. sporogenes (110~ at the p r e s s u r e s r a n g i n g from 0.1 M P a to 400 M P a are s h o w n in Fig.4. P r e s s u r e influenced so m u c h the inactivation of these bacteria. T h o u g h the d e a t h ra te s of both o r g a n i sm s at 100 M P a were slightly s m a lle r t h a n those at n o r m a l pressure,

lO 7

lg o>

,,--4

~

IOOMPa

105

IOOMPa

104 I03

%

....200MPa

"~.

102

101

lO~o

400MPa~ i

10

,

aOOMPa I

20

,

400MP~a 300MPa

i

30

O.1MPa !

0

10

20

30

40

Time (min) Fig.4 Survival curves for spores of B. coagulans (left) and Clostridium sporogenes (right) at pressures ran g in g from 0.1MPa to 4 0 0 M P a at 110~

418 their rates remarkably increased at more t h a n 200 MPa. The survival curves obeyed the first order rate equation at all pressure ranges. It is indicated t h a t the survival curves ofB. subtilis spores obeyed the first order rate equation at more than 100~ under 100 MPa to 400 MPa. 4) On the other hand, K a k u g a w a et al. ~) showed t h a t the

Table 1 Rate constants of various bacterium spores under pressure Death rate constants Pressure (MPa) 0.1 200 400

B. subtilis 4) 105~

B. c o a g u l a n s 110~

C. sporogenes ll0~

3.4• .2 ( - ) 5.6• .2 ( - ) 1.0• * 1.4x 10-1(2.5) 2.5x 10-1(7.4) 4.8x 10-1(8.6)

5.5• .2 ( - ) 2.7x 10-1(4.8) 7.7•

* The ratio of the death rate constant u n d e r pressure / normal pressure survival curves ofB. stearothermophilus spores did not obey the first order equation even at the temperatures ranging from 100~ to 120~ under 100 MPa to 400 MPa. Thus, the types of the survival curves are dependent on species of organisms. The death rates ofB. coagulans and C. sporogenes at l l 0 ~ under 400 MPa were 8.5 times and 13.6 times higher t h a n those at normal pressure, respectively (Table 1). The d e a t h rate ofB. subtilis spores (105~ at 400 M P a was 7.4 times higher t h a n the value at n o r m a l p r e s s u r e 4). As the r e s u l t of the combined t r e a t m e n t of t e m p e r a t u r e and p r e s s u r e , it will be possible to reduce the conditions of t h e r m a l sterilization (heating time and the temperature). On the basis of the results of this study, we have developed a high pressure-temperature experimental apparatus. The pressure-chamber is 100 m m I.D. x 300 m m height. We have been investigating the inactivating behavior of spores in real size foods by using the apparatus.

4. R E F E R E N C E S 1 Y a s u m o t o M., H a y a m i z u M., I n a k u m a T., High P r e s s u r e Bioscience and Food Science( Sanei shuppan), (1993) 213. 2 K i n u g a s a H., Takeo T., F u k u m o t o K., I s h i h a r a M., Nippon Nogeikagaku Kaishi, 66(1992)707. 3 Sale, A.J.H., Gould, G.H., and Hamilton, W.A.,J. Gen. Microbiol., 60(1970) 323. 4 0 k a z a k i T. a n d Suzuki K., Nippon S h o k u h i n Gakkaishi, 41(1994) 536. 5 K a k u g a w a K., O k a z a k i T., Y a m a u c h i S., Morimoto K., Yoneda T. and Suzuki K., ( in submission )

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

419

Sterilization of yeast by high pressure treatment Y.Aoyama, M.Asaka, R.Nakanishi and K.Murai Laboratory of Biological Chemistry, Toyo Institute of Food Technology, 23-2-4, Minamihanayashiki, Kawanishi-shi, Hyogo 666, Japan Abstract Sterilization of yeast by high pressure treatment was studied in comparison with that by heat treatment. Saccharomyces cerevisiae, Candida tropicalis, Candida parapsilosis and the yeast isolated from digestive tract (Japanese traditional fermented food, ika-siokara) were tested. The pressure survival curves of these yeasts showed to be sigmoidal. Considering D-values obtained from the regression analysis of survival curves, pressure stability of yeasts had a good correlation with heat stability. Z-values of yeasts ranged from 80 to 100 MPa for high pressure treatment, 5 to 7~ for heat treatment. A larger z-value means a weaker pressure effect. 1. I N T R O D U C T I O N Many attempts have been made to apply high pressure treatment for food processing because of it's retaining food's nutrients and taste recently [1-3]. Although there are many works about high pressure sterilization, the sterilization effect is still not completely elucidated. Whether pressure death kinetics of microorganisms follows first order reaction has not been obvious yet [4,5]. It is important to evaluate the sterilization effect of high pressure treatment in comparison with that of heat treatment because heat treatment has been used mainly for commercial sterilization in the food industry. But there are few reports concerning with the relationship between pressure stability and heat stability of microorganism. In this study we examined sterilization of yeasts by high pressure treatment compared with that by heat treatment. The death kinetics of yeasts by pressure treatment was examined. D-values were calculated from the regression analysis of survival curves. The relationship between pressure stability and heat stability of yeasts was examined from the D-values obtained. The influence of culture conditions and growth temperature on the pressure stability of yeasts was examined. Using the z-value obtained from pressure-death-time curves, we calculated time at different pressure for the sterilization effect equivalent to 400 MPa-10min treatment.

420 2. M A T E R I A L S A N D M E T H O D S 2.1. M i c r o o r g a n i s m s

Saccharomyces cerevisiae (JCM 1499), Candida tropicalis (JCM 1541), Candida parapsilosis (JCM 1618) were obtained from the Institute of Physical and Chemical Research (Wako, Japan). The yeast isolated from ika-siokara (IS) was identified as Candida tropicalis. These were grown in potato dextrose agar and broth, YM agar and broth media (Difco, Detroit, USA) at 15, 25, 35~ They were stored in a refrigerator until use. The suspension of yeast was treated with ultrasonication for 5 rain using Bransonic cleaner (60W, 45kHz) to break clump of yeast. Ultrasonicated sample was checked with microscope and laser particle size distribution analyzer LA-500 (Horiba, Kyoto, Japan). 2.2. H i g h p r e s s u r e t r e a t m e n t and h e a t t r e a t m e n t Suspension of yeast was sealed in a plastic pouch and treated at 300, 350, 400, 450 and 500 MPa at 20% with high pressure test machine, MFP-7000 (Mitsubishi Heavy Industries, Hiroshima, Japan). The solution for suspension was 1/15 M phosphate buffer (pH 7.0) containing 5% sodium chloride. During pressurization, the t e m p e r a t u r e within high pressure vessel raised by 5 ~ because of adiabatic compression and when the pressure became constant, the temperature was kept at about 20~ Heat t r e a t m e n t was performed as follows: the suspension of yeast was injected into the same buffer as suspension of yeast in a t e s t - t u b e preheated at a given temperature. And sampling of an aliquot was carried out at a time interval. After treatment, the sample was incubated by plate-counting method for enumeration of survivor of yeasts. Potato dextrose agar medium was used, and the sample was cultured at 25~ for 3 or 4 days.

3. R E S U L T S AND D I S C U S S I O N 3.1. S u r v i v a l c u r v e s of y e a s t s Survival curves were shown to be sigmoidal at 300, 350 MPa (Fig 1). We obtained this results of experiment used the yeast isolated from ika-siokara. As to other yeasts similar results were obtained. The influence of clump of yeasts on type of survival curve was studied with ultrasonicated sample and untreated sample. The linearity was improved slightly but the curve was sigmoidal basically. The survivor curve tended to be more linear when the pressure was higher. Heat t r e a t m e n t also did not show linear curve (Fig. 2). Although the cause that these curves are sigmoidal is unclear, it seems to be due to other causes for example the heterogeneity of p r e s s u r e stability of yeast [6]. 3.2. I n f l u e n c e of c u l t u r e c o n d i t i o n s on p r e s s u r e s t a b i l i t y of y e a s t s The influence of growth t e m p e r a t u r e and culture media on pressure stability of yeasts was examined. The influence of growth t e m p e r a t u r e on the pressure stability of S. cerevisiae was shown in Fig 3. The pressure stability of the yeast cultured at 35~ was higher than that at 15 and 25~ The result obtained on heat stability test was similar. The cell size and composition of cell membrane may be concerned with the higher pressure stability of yeast grown at higher t e m p e r a t u r e [7].

421

-2 v

v -

t~

4

bO

0

0

-

0

i. . . . . .

5

I0

m3OOHPa #350t{Pa i

.

15

T i m e ( min )

H3OOHPa

-8

20

v350dPa

0

5

I0

T i m e ( min )

15

20

Figure 1. Survival curves for the yeast isolated from ika-siokara in 1/15 M phosphate buffer (pH 7.0) containing 5% sodium chloride at 300, 350 MPa. Left" untreated sample Right" ultrasonicated sample

o

2

mlS~ 92 5 ~

~i 2~z~o

9

c~b0oi

.,4

~

435~

0

nN).o~c 6

.

-

,,!

0

.52.5"C |

5

10

i

1,5

T i m e ( rain)

20

Figure 2. Survival curves for the yeast isolated from ika-siokara in 1/15M phosphate buffer (pH 7.0) containing 5% sodium chloride at 50, 52.5~

__ 1 1

j

300

350

Pressure

i

400

(HPa)

450

Figure 3. Pressure-death-time curves (z-values) for S.cerevisiae grown at different temperature.

422

Table 1 Pressure-time combination giving sterilization effect equivalent to 400 MPa-10min treatment at ambient temperature (z-value = 80 MPa)

r'0. 863 t~

m

,~ 400

t~

Pressure I

eL,

S.cerevisiae

(lilPs) '

& IS

.0 C.tropicalis 0 C.parapsilosis

200

50

55 Teupera

60

ture(~)

65

Figure 4. Scatter plot of the pressure and temperature corresponding D-value to lmin, respectively (relationship between pressure stability and heat stability of yeasts).

300 350 400 450 600

Duration time (uin) 178 42 I0 2.4 0. 66

3 . 3 . R e l a t i o n s h i p b e t w e e n p r e s s u r e s t a b i l i t y and h e a t s t a b i l i t y of y e a s t Considering that the pressure and temperature corresponding D-value to 1 minute represent pressure stability and thermal stability, respectively, the relationship between pressure stability and heat stability of yeasts was evaluated (Fig.4). The pressure stability of yeasts had high correlation with the thermal stability (correlation coefficient" 0.853). The z-values of yeasts ranged 80 to 100 MPa for high pressure treatment, 5 to 7~ for heat treatment. There is not a good correlation in z-values between pressure sterilization and heat sterilization. A larger z-value means a weaker pressure effect. In case of z-value equal to 80 MPa , the relation of pressure to time for sterilization effect equivalent to 400 MPa-10min treatment at ambient temperature were shown as Table 1. For application of high pressure treatment in food processing, operation condition at lower pressure is desirable from the viewpoint of equipment cost. However, a longer time treatment is required to sterilize yeasts at lower pressure. Also elevation of pressure by 80 MPa is more difficult than that of temperature by 5~ So, high pressure treatment at ambient temperature is more unfavorable than heat treatment. REFERENCES

1 C.Balny,R.Hayashi,K.Heremans and P.Masson (eds.) High Pressure and Biotechnology, John Libbey Eurotext Ltd., France, 1992. 2 D.G.Hoover, Food Tech., No.6 (1993) 150. 3 Y.Horie, K.Kimura, M.Ida, Y.Yoshida and K.Ohki, Nippon Nogeikagaku Kaishi, 66 (1992) 713. 4 C.Hashizume, K.Kimura and R.Hayashi, Biosci.Biotech.Biochem., 59, (1995), 1455. 5 Y.Ishiguro, T.Sato, T.Okamoto, H.Sakamoto, T.Inakuma and Y.Sonoda, Nippon Nogeikagaku Kaishi, 67 (1993) 1707. 6 0 . C e r f , J.Appl. Bacteriol.,42 (1977) 1. 7 R.Hayashi(eds.) High Pressure Science for Food,San-Ei Pub.Co.,Japan,1991.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

423

High pressure inactivation of yeast cells in saline and strawberry jam at low temperatures Chieko Hashizume b, Kunio Kimura b, and Rikimaru Hayashi' 'Department of Agricultural Chemistry, Faculty of Agriculture, Kyoto University, Sakyo-ku, Kyoto 606, Japan ~leidi-Ya Food Factory Co., 3-1-13, Nishigawara, Ibaraki, Osaka 567, Japan Abstract

Combined treatment with high pressure and low temperature effectively inactivated Saccharomyces cerevisiae. When S. cerevisiae was suspended in 0.85% NaCI solution and treated with pressure of 120 - 300 MPa at -20 to 50~ the inactivation rates showed pseudo-first order kinetics. The regression analysis demonstrates that pressurization at sub-zero temperatures enhances the pressure effect similar to what observed at higher temperatures. The effects of additives, i.e. sugars and salts, on pressure inactivation of yeast were also examined. The presence of additives showed more effective pressure inactivation at sub-zero temperatures. The practical use of high pressure under sub-zero temperature was demonstrated on strawberry jam where complete sterilization of jam was achieved.

I. INTRODUCTION Highly efficient sterilization techniques have been sought in order to preserve flesh flavors and colors for pressure-treated foods. It was realized that S. cerevisiae (IFO 0234) was effectively inactivated when it was pressurized under sub-zero temperatures [ 1]. In this study, we have further examined the pressure-inactivation of S. cerevisiae at sub-zero temperatures by measuring the inactivation rates in 0.85% NaCI solution as well as in the presence of various additives, i.e. sucrose. Strawberry jam is an excellent sample for examining the changes in flavor and color during the food processing. We examined the pressure-inactivation of yeast under sub-zero temperature in the presence of strawberry jam in order to seek some industrial applications.

2. MATERIALS and METHODS

Preparation of yeast samples. Saline suspension of Saccharomyces cerevisiae (IFO 0234) obtained in its stationary phase was prepared as follows: the cell number was adjusted to 8.0 x 1 0 6 . 1 . 0 x 1 0 7 cells/ml with sterilized 0.85% NaCI or the solutions containing NaCI, sucrose, glycerol or sodium citrate. Jam inoculated by the yeast was prepared by adding the yeast into heat-processed

424 strawberry jam which contained 50% of strawberry fruit. The cell number was adjusted to 10 6 - 10 7 / g , and the brix of the jam was adjusted to 40 ~ The samples thus prepared were sealed in polyethylene bags and pressurized.

Pressure treatment. A hand-type pressure pump (Type KP5B, Hikari Koatsu Co., Japan), using kerosene as a pressure medium, was used. Before pressurization, the vessel (inside size ~ 25 x L 75 mm ) was placed in a temperature-controlled water bath filled with 70% ethanol and the bath temperature was taken as the pressurization temperature during the experiments. The pressure between 120 and 400 MPa was applied to the samples in the temperature range of -20 and 50~ The suspension of yeast cells with additives was pressurized for 20 min each. The inoculated jam was pressurized for 30 min each. The time to attain maximum pressure and to release the pressure was approximately 2 min and 30 s, respectively.

Colony counting. After pressurization, surviving cells were counted after the incubation of 10-fold serial dilutions on YM agar culture plates (Difco Lab., USA). Considering the delay of cell growth by pressure stress, the plates were incubated at 28~ for more than 7 days. The reproducibility of data was confirmed by duplicated or triplicated experiments.

A

B

_--,6 E ~5 t~

~4 o~ >

,-3

~2 0

0

10

20

30

40

0

10

20

30

40

P r e s s u r i z i n g Time (min)

Fig. 1. First order kinetics of inactivation ofSaccharomyces cerevisiae. A: Pressurization at constant temperature and various pressures, 210 MPa (C)), 240 MPa (Q), 250 MPa (A) and 270 MPa (&). B: Pressurization at constant pressure (180 MPa) and various temperatures,-20~ (C)),- 10~ (O), 0~ (A), 5~ (&), 25oC (I-l), and 40~ ( I ) . Lines were obtained by the least-squares method.

425

Regression analysis of inactivation rate. The inactivation rate (k), obtained by least-squares method, was expressed as the logarithmic decrease in the surviving cells per min. Regression analysis of the inactivation rate with a function of pressure and temperature was done by an equation of the second degree (see ref. 2 for details):

3. RESULTS and DISCUSSION

Regression analysis of the inactivation rate of yeast. Figure 1 shows the logarithmic decrease of the surviving cells vs. pressurization time. They followed pseudo first order kinetics. Regression curves in Fig. 2 were obtained based on the lines in Fig. 1. The correlation factor (R) was 0.927 with 43 of measured inactivation rates. A B

o

,

2 --Q~-2

3

[]

[]

-4 I

-20

I

I

I

I

0 20 Temperature (~

I

,I

40

I

0

i

100 200 Pressure (MPa)

I

300

Fig. 2. Temperature (A)- and Pressure (B)- dependent curves obtained by regression analysis for the inactivation of S. cerevisiae. A: curve 1 (O), 0.1 MPa; curve 2 (O), 120 MPa; curve 3 (A), 150 MPa; curve 4 (&), 180 MPa; curve 5 (I-1), 210 MPa; curve6 (11), 240 MPa; curve 7 (~), 270 MPa. B: curve 1 (O),-20~ curve 2 (V), 50~ curve 3 (1), 40~ curve 4 (O),-10~ curve 5 (A), 0~ curve 6 (&), 5~ curve7 (l-q), 25~ Symbols show experimentally measured data.

Figure 2 indicates that the inactivation rate depends on both pressure and temperature, including sub-zero temperatures. Figure 2A shows the temperature dependence of the yeast inactivation at given pressures, while Fig. 2B showing the pressure dependence at given temperatures. The profiles of the curves have exponential shapes, which means a slight shitt in temperature or pressure causing a significant change in the inactivation rate. In these experiments carried out at sub-zero temperatures, water is in the form of liquid or Type I ice [3]. However, the effects of freezing and thawing on the yeast inactivation were disregarded

426 since the number of surviving cells remained almost the same after cells had been frozen at -20~ for 180 min under ambient pressure and then thawed at room temperature. Furthermore, the effects of freezing and thawing on the inactivation rate may be eliminated because the temperature-dependent inactivation lines shown in Fig. 2A and Fig. 3 are continuous without any discrepancy between above and below the freezing point.

400 [

,

,

. . . . . . . . . . . . . . . . . . . . . . . .

~_ 200 a. 1 0 0

-20

0 20 Temperature (~

40

Fig. 3. Temperature-pressure diagram of the inactivation rate ofS. cerevisiae. Numbers in the figure show log k. See the text for the dotted lines.

Figure 3 summarizes the inactivation rate in the relation to temperature and pressure. The elliptical curves resemble the pressure denaturation of spherical proteins [4]. The similarity between the pressure-dependent denaturation curve of protein and the curve of the pressure inactivation rate of microorganisms may imply that the inactivation of microorganisms is due to interference with some critical life processes such as enzyme reactions. Figure 3 also indicates that only 190 MPa is required to obtain the inactivation rate of 1 per min at -20~ while 320 MPa is needed to reach the same rate of inactivation at 20~ as shown by the dotted lines. This means that the pressure sterilization is achieved under much lower pressure at the temperatures lower than the room temperature or above.

Effects of additional substances on the yeast inactivation. Figure 4 shows the effects of sodium chloride, sucrose, glycerol, or sodium citrate on the inactivation of yeast by pressurization at 25~ or-20~ No changes in surviving cell numbers were observed when 0.5 M or higher sodium chloride was added and pressurized at 25~ while a sharp decline was observed by pressurization at -20~ (Fig. 4A). An increase in surviving cells as observed when cells were pressurized with increasing concentrations of sucrose at 25~ while little change in survival of cells was observed when cells were pressurized at -20~ in the presence of sucrose (Fig. 4B). These results show that both sodium chloride and sucrose do not protect the yeast cells against pressure at sub-zero temperatures, but they protect from the inactivation at room temperature. Glycerol and

427 sodium citrate gave identical effects at both 25~ and-20~ yeast, showing a slight protective effect (Fig. 4C, 4D).

on the pressure inactivation of

!

>

0

"~

0

|

o

i

|

0.z

i

|

n

!

,.

0.4 0.6 NaCladded(M)

I

0.8

/

,"

J

Glycerol added (M)

I

0

02

0.4 0.6 0.8 Sucrose added (M)

o

o.i Sodium citrate added (M)

0.2

Fig. 4. Effect of sodium chloride (A), sucrose (B), glycerol (C) and sodium chloride (D) on the S. cerevisiae. Pressurization at 260 MPa for 20 min at 25~ (O) and at 150 MPa for 20 min at-20~ (0).

The diverse effects of added substances on the inactivation of various microorganisms by pressure treatment have been reported [5]. As shown in Fig. 4, the effects of pressure on the inactivation vary among added substances depending on the temperature. The effects of sodium chloride are of special interest since it enhances the inactivation of S. cerevisiae at low temperatures, particularly below 0~ At present, it is difficult to explain the reason why and how added substances can enhance or weaken the pressure inactivation of microorganisms. This is mainly due to the limited data [6] available for physical or chemical properties of added substances under high pressure, e.g., solubility, viscosity, freezing point, dielectric constants and so on, which should be all concerned in the high pressure inactivation of microorganisms. Further study is desired to clarify the detailed relationships between the strains of microorganisms and added substances for the effective pressure sterilization of food.

Effects of high pressure on jam inoculated by yeast. Figure 5 shows the logarithmic change of survival cell numbers of yeast cells per initial cell numbers after strawberry jams were pressurized for 30 min at deferent pressures in the temperature range from-20 to 25~ The effect of pressure was enhanced more at lower temperatures in the range of-10 to 25~ giving 104.9reduction at-10~ while 10 reduction at 25~ when pressurized at 300 MPa. Thus, the effect of pressure on yeast cells was enhanced at lower temperatures, but the greatest reductions were shown at -10~ Slight increase in survival number at-20~ is probably due to the protective effect of sucrose whose concentration is increased by the ice formation.

428

,i,•J

I

-

'

0 =

-2

.

Z .

Z ~-4 O .d

m

m

-6

,=

. ~ p -f~,

0

~,

,

_~

.

.

.

200 300 Pressure (MPa)

.

.

.

.

400

Fig. 5. Inactivation ofS. cerevisiae in strawberry jam. Pressurization for 30 min at-20~ (~), -IO~ (~r), Ooc (A), IOoC(11) and 25~ (0).

From these results, it is shown that the pressurization at low temperature is effective to yeast inactivation and practical food sterilization. We can expect that the pressure sterilization is achieved with much lower pressure at lower temperatures than at room temperature. Furthermore, the flesh flavors and colors, which are the most great advantage of high pressure treatment, could be maintained well by the treatment at low temperatures. To probe the possibilities of pressure treatment for various foods is an important theme for food industries. 4. REFERENCES 1 C. Hashizume, K. Kimura, and R. Hayashi, Biosci. Biotech. Biochem., 59, 1355-1458, 1995. 2 K. Sonoike, T. Setoyama, Y. Kuma, and S. Kobayashi, in "High Pressure and Biotechnology", Colloques INSERM, Vol. 224, ed. by C. Balny, R. Hayashi, K. Heremans and P. Masson, John Libbey Eurotext Ltd., France, 1992, pp. 297-301. 3 P.W. Bridgman, Proc. Amer. Acad Art andSci., 47, 441-558 (1912). 4 S.A. Hawley, Biochemistry, 10, 2436-2442 (1971). 5 K. Takahashi, H. Ishii, and H. Ishikawa, in "High Pressure Bioscience and Food Science" (in Japanese ), ed. by R. Hayashi, San-Ei Pub. Co., Japan, 1993, pp. 244-249. 6 N.S. Isaacs, in "Liquid Phase High Pressure Chemistry", by N. S. Isaacs, John Wiley & Sons Ltd., New York, 1981, pp. 63-135.

R. Hayashi and C. Balny (Editors), High Pressure Bioscience and Biotechnology 9 1996 Elsevier Science B.V. All rights reserved.

429

Application of high pressure for sterilization of low acid food Kunio Kimura, Masao Ida, Yasuhiro Yosida, Kunihito Ohki and Mizuko Onomoto

Meidi- Ya Food Factory Co., 3 - 1 - 1 3 , Nishigawara, Ibaraki, Osaka 567, Japan Abstract The bactericidal effects of high pressure treatment combined with heat were examined using B. lichenifarmis spores and C/. sporogenes spores. After exposure to 500 MPa or more for 15 rain at ~ C , the number of B. lichenifarmis spores suspended in corn cream soup decreased drastically. The inactivation rate for the combined treatment exhibited 7 log cycles. However, exposure to the same pressure at room temperature did not cause significant change in spore numbers. After CI. sporogenes spores suspended in 1/15 M phosphate buffer solution was exposed to 7(I) MPa at ~)~ for 20 rain, the inactivation rate reached 7 log cycles. The inactivation rate for the: spores suspended in beef consomme fell slightly, to 6 log cycles, after the treatment of 700 MPa at ~)~ ~,)r30 rain.

1. I N T R O D U C T I O N To produce low acid food, there is necessary to sterilize the food by a method whereby spores of Cl. botulinum can be sufficiently eliminated. However, it is known that a high hydrostatic pressure treatment at room temperature can not kill bacterial spores. On account of this obstruction, the application of pressure processing method under the present condition is confined to acid foods such as jam, juice and so on in which there is not any fear of the multiplication of spore-forming bacteria. For those who want to produce low acid food using the pressure processing method, therefore, the most important problem is to establish a pressure treatment method whereby the bacterial spores which include Cl. botulinum spores can be eliminated. In order to solve this problem, we have examined the bactericidal effects of a high pressure combined with heat ( i . e . , pressurization under elevated temperatures) for two spore-forming bacteria.

2. M E T H O D S

2.1. Test specimens B. licheniformis ( Stock Culture No. 1203 of Japan Canners Association) sporulated by using a Shaeffer medium and Cl. sporogenes (IFO 142~?, 9ATCC 7 ~ 5 ) s p o r u l a t e d by using a modified GAM agar medium (Nissui) supplemented with yolk were used as the test specimens. The heat tolerances of these strains were determined. The results are as follows. B. licheniformis " D~0~ : 0.81 min (TRT,0s.c, .:~ = 7 . 2 9 min), Z = 7.21 ~ Ct. sporogenes " D,~0o~ = 1.04 min (TRT ,~,.c ,.=G = 6 . 2 4 min), Z = 9. 16 ~

430

2.2. Preparation of test samples A concentrated spore solution of B. licheniformis was suspended in a corn cream soup, while a concentrated spore solution of Ct. sporogenes was suspended in a 1/15 M phosphate buffer solution (pH 6.8) and a beef consomme as the testing solutions. Twenty gram portions of these solutions were packed in polyethylene bags (65 • 1133 mm) and heat sealed. Before testing, they were heated to ~cfC for 15 rain to kill the vegetative cells. The samples were stored below 5~ during the testing period except for the pressure treatment time. 2 . 3 . Test procedures Pressure treatment was performed by using a laboratory-scaled pressurization apparatus (Kobe Steel, Ltd., cylinder : 03 m m r • 180 ram) at a treating temperature o f ~ C or ~"fC under a treating pressure of from 400 to 700 MPa for up to 30 rain. At the initiation of the pressurization, an increase ( 5 to 6% ) in temperature was observed due to adiabatic compression. Thus, 5 to 6 min were required to return to the temperature setup. After the completion of the pressure treatment, the survivors in each sample were counted using the agar plate dilution method. As the culture media, an eugon agar medium(DIFCO) and a modifided GAM agar medium(Nissui) were used respectively for B. licheniformis and

Cl. sporogenes. 10 ~ ~

-

'

-

'

~

~

,--, 10-'

]0_2 Z

--" 10 a

N

10 s

~: 10 -~ O9

10-" ND

0

400 500 600 700 PRESSURE ( MPa )

Fig. 1. E f f e c t of Temperature and pressure on High Pressure S t e r i l i z a t i o n of ~ //c/7e/7/fo/,~/s Inoculated into Corn Cream Soup. B. //c/7e/7/forzws spo r es in co rn cream soup were pressurized to 400--(00 MPa for 15 min at room t e m p e r a t u r e ( O ) 60~ (jll~) and

80~ (1).

N : I n i t i a l count, 1.81 x 10 ~ ND: < 5.52 x 10 -8

3. RESULTS (1) The effect of combined high pressure / high temperature sterilization on B. licheniformis spores inoculated into corn cream soup is shown in Fig. 1. When the treating pressure was increased to 703 MPa at room temperature, the survivor count of B. licheniformis scarcely showed any change. In the case of the high pressure treatment combined with heat, on the other hand, the survivor rate was remarkably decreased with an increase in pressure. Treatment at 0ff'C was superior in the bactericidal effect to treatment at CffC. Namely, the survivor rate achieved by treatment at 9::ffC and 7C30 MPa for 15 rain was at the level of 10-s, while the one achieved by treatment at 03'0 and 5C0 MPa for 15 rain was less than 10-7. (2) The effect of combined high pressure / high temperature sterilization on Ct. sporogenes spores inoculated into 1/15 M phosphate buffer solution and consomme is shown in Fig. 2-A and Fig. 2-B respectively. The survivor rate of CI. sporogenes spores observed after the completion of the pressure treatment of 7D~) MPa was lower than the one

431 observed after the completion of the pressure treatment of 600 MPa. Also, the survivor rate was decreased as the treatment time was further increased. In the case of the 1/15 M phosphate buffer solution, a survivor rate less than 10 -7 was achieved by using the high pressure treatment combined with heat (8(YC, 7(/3 MPa) for 20 min or longer. In the case of consomme, on the other hand, the bactericidal effect was somewhat lower than that in case of the 1/15 M phosphate buffer solution. That is, a survivor rate of less than 10 -6 could be achieved by using the high pressure treatment combined with heat (80~ 700 MPa) for 30 rain. When treated at 80~ and 600 MPa, the survivor rate remained at a level of 10-4 to 10 -s even though the treatment was performed for 30 min. 10 ~

O

10" c

"-" 10-'

-~ 10-'

10-2

~. 10 - 2

z

',\

,,, 10-'
,,

3 ....................,,,...i.... ~ . . ' ~ . . . - . - . - . i - . - . . - -

-

-. ~< ~ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

500MPa

: ~ .... ~ . . _

\

2

l

.........................."....................................................................................

E

..................

i

"• - 6 0 0 M P a

,

/

i".

i

1

i

t

0

J

t

I

I

5

I

i

i

I

10

i

t

i

i

i

15

t

i

i

J

20

"

25 (min.)

S a m p l e = 10^6 ATCC 11778 spores Figure

2. S t e r i l i z a t i o n

e f f e c t s of d i f f e r e n t

the treatment

t i m e at 50~

on ATCC 11778 spore counts (log) .

.

.

.

.

.

.

.

I

.

.

.

.

.

.

.

.

I

"

'

'

'

1

. . . .

I

''~

.

.

.

.

.

.

................................ ]................................................. i...................i...........................................

i