Handbook of Animal Models of Infection: Experimental Models in Antimicrobial Chemotherapy

HANDBOOK OF ANIMAL MODELS OF INFECTION

This Page Intentionally Left Blank

HANDBOOK OF ANIMAL MODELS OF INFECTION Experimental Models in Antimicrobial Chemotherapy Edited by

Oto Zak Formerly Head of Infectious Diseases Research Department Pharmaceuticals Division CIBA-GEIGY Limited Basel, Switzerland Merle A. Sande Professor and Chairman Department of Internal Medicine School of Medicine Salt Lake City, Utah USA

Academic Press San Diego London Boston New York Sydney Tokyo Toronto

This book is printed on acid-flee paper. Copyright 9 1999 by ACADEMIC PRESS, except Chapter 26, which is a US government work in the public domain and is not subject to copyright All Rights Reserved. No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information storage and retrieval system, without permission in writing from the publisher. Academic Press 24-28 Oval Road, London NW 1 7DX, UK http://www.hbuk.co.uk/ap/ Academic Press a division of Harcourt Brace & Company 525 B Street, Suite 1900, San Diego, California 92101-4495, USA http://www.apnet.com ISBN 0-12-775390-7 Library of Congress Catalog Card Number: 98-89455

A catalogue record for this book is available from the British Library

Typeset by Phoenix Photosetting, Chatham, Kent, UK Printed in Great Britain by The Bath Press, Bath, Avon, UK 99 00 01 02 03 B P 9 8 7 6 5 4 3 2 1

Contents

List of Section Editors

ix

List of Contributors

xi

Preface

xix

Introduction: The Role of Animal Models in the Evaluation of New Antibodies

xxi

12.

13.

O. Zak, M. A. Sande, 7-. O'Reilly INTRODUCTORY BACKGROUND TO ANIMAL MODELS OF INFECTION

1. 2. 3. 4.

5.

6.

7.

8.

9.

10.

11.

Modes of Action of Antibiotics and Bacterial Structure: Bacterial Mass Versus their Numbers 105 V. Lorian Activity of Antibiotics Against Adherent/Slowgrowing Bacteria Reflecting the Situation in vivo 117 L Foley, M. R. W. Brown

1

O. Zak Early History of Animal Models of Infection 3 A. Contrepois, A.-M. Moulin General Methodologies for Animal Models 9 M. S. Rouse, W. R. Wilson Ethics Committees in E u r o p e ~ A n Overview 13 P. de Greeve, W. de Leeuw Animal Care and Use Committees--An American Perspective 19 T. Allen, R. Crawford Ethical Aspects of the Use of Animal Models of Infection 29 D. B. Morton The Impact of General Laboratory Animal Health on Experimental Models in Antimicrobial Chemotherapy 49 A. K. Hansen Non-invasive Monitoring of Infection and Gene Expression in Living Animal Models 61 R R. Contag, A. B. Olomu, C. H. Contag Considerations for Working Safely with Infectious Disease Agents in Research Agents 69 ]. Y. Richmond, E Quimby Analysis of Genetic Susceptibility to Infection in Mice 75 E. Busckman, E. Skamene Formulation of Compounds and Determination of Pharmacokinetic Parameters 83 R. M. Cozens Methods for Obtaining Human-like Pharmacokinetic Patterns in Experimental Animals 93 L. Mizen

BACTERIAL INFECTION MODELS

14.

15. 16.

17. 18. 19.

20.

21.

22. 23. 24.

25.

C. Carbon, B. Fantin, 7-. O'Reilly The Mouse Peritonitis/Sepsis Model N. Frimodt-Moller, ]. D. Knudsen, E Espersen Murine Thigh Infection Model S. Gudmundsson, H. Erlensd6ttir Mouse Subcutaneous Cotton Thread Model ]. Renneberg Infection after Ionizing Radiation L Brook,, T. B. Elliott, G. D. Ledney Intra-abdominal Abscess I. Brook Mouse Peritonitis Model Using Cecal Ligation and Puncture M. Skroti, ]. C. Peyton, H/[.G. Ckeadle Murine Models of Peritonitis Involving a Foreign Body E Espersen, N. Frimodt-Moller Rat Polymicrobial Peritonitis Infection Model H. Dupont, P. Montravers Murine Thigh Suture Model ]. D. Pietsck, H. C. Polk, ]r Animal Models of Melioidosis D. De Shazer, D. E. Woods Low Inoculum Model of Clean Wound Infection A. B. Kaiser, D. S. Kernodle Translocation of Gut Bacteria During Trauma L. Magnotti, D.-Z. Xu, E. A. Deitch

125

127

137

145 151 163

173

183

189 195 199

205

213

vi

CONTENTS

26.

27.

28. 29.

30.

31. 32. 33.

34.

35. 36.

37.

38. 39. 40. 41. 42.

43. 44.

45.

46. 47.

Mouse Models of Campylobacterjejuni Infection S. Baqar, E. E Burg III, J. R. Murphy Suckling Mouse Model of Enterotoxigenic Escherickia coli Infection M. Duchet-Suchaux Rabbit Model of Shigellosis M. E. Etheridge RITARD Rabbit Model for Studying Vibrio cholerae and Other Enteric Infections P. Panigrahi, J. G. Morris Jr Mouse Model of Helicobacter priori Infection P. Ghiara, G. del Giudice, R. Rappuoli Animal Models of Helicobacter (ferrets) R. P. Marini, J. G. Fox Hamster Model of Syphilis J. D. Alder Guinea-pig Model of Acquired and Congenital Syphilis V. Wicker, K. Wicker The Guinea-pig Model of Legionnaires' Disease P. H. Edelstein Murine Models of Tuberculosis L M. Orme Beige Mouse Model of Disseminated Mycobacterium avium Complex Infection M. H. Cynamon, M. S. DeStefano The Armadillo Leprosy Model, with Particular Reference to Lepromatous Neuritis D. M. Scollard, R. W. Truman Models of Leprosy Infection in Mice B. Ji, L. Levy Hamster Model of Lyme Arthritis R. E Schell, S. M. CaUister Rabbit Model of Bacterial Conjunctivitis M. Motschmann, W. Behrens-Baumann Murine Model of Bacterial Keratitis K. A. Kernacki, J. A. Hobden, L. D. Hazlett The Rabbit Intrastromal Injection Model of Bacterial Keratitis R. J. O'Callaghan, L. S. Engel, J. M. Hill Gerbil Model of Acute Otitis Media B. Barry, M. Muffat-Joly Bacterial Otitis Externa in the Guinea-pig Model S. A. Estrem Otitis Media: The Chinchilla Model D. M. Haje k, Z. Yuan, M. K. Quartey, G. S. Giebin k A Guinea Pig Model of Acute Otitis Media T. G. Takoudes, J. Haddad Jr Tissue Cage Infection Model W. Zimmerli

48. 223 49. 241 50. 255 51. 261 52. 265 53. 273 285 54. 291

55.

303

56.

315

57. 58.

321 59. 331 60. 337 347

61.

353 62. 361 63. 367 375

385

64.

65.

389 66. 403

67. 409

Rat Model of Bacterial Epididymitis H. G. Schiefer, C. ]antos Mouse Model of Mycoplasma Genital Infections D. Taylor-Robinson, P. M. Furr Mouse Model of Ascending Urinary Tract Infection W. J. Hopkins Mouse Model of Ascending UTI Involving Short and Long-term Indwelling Catheters D. E. Johnson, C. V. Lockatell Rat Bladder Infection Model T. Matsumoto Rabbit Model of Catheter-associated Urinary Tract Infection D. W. Morc k, M. E. Olson, R. R. Read, A. G. Buret, H. Ceri Subclinical Pyelonephritis in the Rat G. Findon Models of Acute and Chronic Pyelonephritis in the Rat G. Findon Rat Model of Chronic Cystitis D. ]. Ormrod, T. E. Miller Mouse Pneumococcal Pneumonia Models E. Azoulay-Dupuis, P. Moine Animal Models of Gram-negative Bacillary Experimental Pneumonia M. S. Rouse, ]. M. Steckelberg Models of Pneumonia in Ethanol-treated Rats M.J. Gentry, L. C. Prekeim Pneumococcal Pneumonia and Bacteria in a Cirrhotic Rat Model L. C. Prekeim, G. L. Gorby, M.J. Gentry Rat Model of Chronic Pseudomonas aeruginosa Lung Infection H. K. Jokansen, N. Hoiby Hamster Model of Mycoplasma Pulmonary Infections K. Ishida, M. Kaku, ]. Skimada Murine Models of Pneumonia Using Aerosol Inoculation J. Leggett Experimental Models of Infectious Arthritis T. Bremell Experimental Group B Streptococcus Arthritis in Mice L. Tissi Rat Model of Bacterial Osteomyelitis of the Tibia T. O'Reilly, J. T. Mader Hematogenous Osteomyelitis in the Rat S. A. Hienz, C. E. Nord, A. Heimdakl, E P. Reinholt, J.-L Flock

419

427

435

441 447

453

463

469 475 481

495

501

509

517

527

533

539

549

561 577

CONTENTS

Rabbit Model of Bacterial Osteomyelitis of the Tibia ]. T. Mader, M. E. Shirtliff 69. Arthroplasty Model in Rats J. Renneberg, K. Piper, M. Rouse 7O. Arthroplasty Model in Rabbits N. S. Soe-Nielsen, J. Renneberg 71. Mouse Model of Streptococcal Fasciitis S. Sriskandan, J. Cohen 72. Rabbit Model of Bacterial Endocarditis A. Lefort, B. Fantin 73. Infant Rat Model of Acute Meningitis U. Vogel, M. Frosch Adult Rat Model of Meningitis 74. G. C. Townsend, W. M. ScheM 75. Rabbit Model of Bacterial Meningitis J. Tureen, E. Tuomanen 76. Escherichia coli Brain Abscess Method in Rat J. M. Nazzaro, E. A. Neuwelt

vii

88.

68.

MYCOTIC INFECTION MODELS

III

77. 78.

79.

80.

81.

82.

83.

84.

85. 86. 87.

581 593 89. 599 90. 605 91.

611

Rat Models of Ascending Pyelonephritis Due to Candida albicans M. Okkawa, M. Takashima, T. Nishikawa, S. Tokunaga Rat Model of Candida Vaginal Infection E de Bernardis, R. Lorenzini, A. Cassone Murine Models of Candida Vaginal Infections P. L. Fidel Jr, J. D. Sobel Sporotrichosis A. Polak-Wyss

727

735

741 749

619 627 631

PARASITIC INFECTION MODELS

IV

92. 639 93.

647

C. Carbon, B. Fantin, 7-. O'Reilly Rodent Models of Candida Sepsis 649 v. /o& P. Y ~ i A Generalized Candida albicans Infection Model in the Rat 657 A. Schmidt Experimental Oropharyngeal and Gastrointestinal Candida Infection in Mice 663 A. M. Flattery, G. K. Abruzzo, C. G. Gill, J. G. Smith, K. Bartizal Paw Oedema as a Model of Localized Candidiasis 667 G. Findon Murine Model of Allergic Bronchopulmonary Aspergillosis 673 P. Dussault, M. Laviolette, G. M. Tremblay Experimental Pulmonary Cryptococcal Infection in Mice 681 M. F. Lipscomb, C. R. Lyons, A. A. Izzo, J. Lovchi k, J. A. Wilder Experimental Pulmonary Cryptococcus neoformans Infection in Rats 687 D. L. Goldman, A. Casadevall Rat Model of Invasive Pulmonary Aspergillosis 693 A. C. A. P.. Leenders, E. W. M. van Etten, L A. ]. M. Bakker-Woudenberg Rabbit Model of Candida Keratomycosis 697 M. Motsckmann, W. Behrens-Baumann Experimental Candida Endocarditis 709 M. R. Yeaman, ]. Lee, A. S. Bayer Rabbit Model of Cryptococcal Meningitis 721 I. R. Perfect

94. 95.

96.

97.

98. 99. 100.

101.

102.

103. 104. 105. 106.

R. Kaminsky Malaria W. Peters, B. L. Robinson Animal Models of Cutaneous Leishmaniasis V. Yardley, S. L. Croft Animal Models of Visceral Leishmaniasis S. L. Croft, V. Yardley Animal Models of Acute (first-stage) Sleeping Sickness R. Brun, R. Kaminsky Animal Models of CNS (second-stage) Sleeping Sickness C. Gichuki, R. Brun Animal Models of Trypanosoma cruzi Infection M. M. do Canto Cavalheiro, L. L. Leon Animal Models of Toxoplasma Infection K. Janitschke Animal Models of Coccidia Infection A. Haberkorn, G. Greif Animal Models of Trichomonas vaginalis Infection with Special Emphasis on the Intravaginal Mouse Model S. E Hayward-McClelland, K. L. Delgaty, G. E. Garber Animal Models of Cryptosporidium Gastrointestinal Infection D. S. Lindsay, B. L. Blagburn, S.J. Upton Animal Models of Entamoeba histolytica Infection S. L. Stanley Jr, T. Zhang, K. B. Seydel Animal Models of Giardiasis R. C. A. Thompson Schistosomosis G. C. Coles Animal Models for Echinococcosis T. Romig, B. Bilger Intestinal Worm Infections S. S. Johnson, E. M. Thomas, T. G. Geary

755

757

775 783

789

795

801 811 821

839

851

859 867 873 877 885

viii

CONTENTS

VIRAL INFECTION MODELS

897

118.

E. R. Kem

107.

108.

109.

110.

111.

112.

113.

114.

115.

116.

117.

Animal Models for Central Nervous System and Disseminated Infections with Herpes Simplex Virus E. R. Kern Animal Models of Herpesvirus Genital Infection: Guinea-Pig N. Bourne, L. R. Stanberry Animal Models of Herpes Skin Infection: Guinea-pig M. B. McKeough, S. L. Spruance Animal Models of Ocular Herpes Simplex Virus Infection (Rabbits, Primates, Mice) B. M. Gebhardt, E. D. Varnell, ]. M. Hill, H. E. Kaufman Animal Models for Cytomegalovirus Infection: Murine CMV E. R. Kern Animal Models for Cytomegalovirus Infection: Guinea-Pig CMV D. L Bernstein, N. Bourne Animal Models for Cytomegalovirus Infection: Rat CMV E S. Stals Human Cytomegalovirus Infection of the SCID-hu (thy/liv) Mouse G. W. Kemble, G. M. Duke, E. S. Mocarski Animal Model for Ocular Human Cytomegalovirus Infections in SCID-hu Mice D. J. Bidanset, M. del Cerro, E. S. Lazar, O. M. Faye-Petersen, E. R. Kern Animal Models for Varicella Zoster Infections: Simian Varicella K. F. Soike Varicella Zoster Infection of T cells and Skin in the SCID-hu Mouse Model ]. E Moffat, A. M. Arvin

119. 899 120. 907

911

121. 122.

919 123. 927 124. 935 125. 943

126. 127.

951 128. 957 129.

963

973

130.

131.

The Mouse Model of Influenza Virus Infection R. W. Sidwell The Ferret as an Animal Model of Influenza Virus Infection C. Sweet, R. J. Fenton, G. E. Price The Cotton Rat as a Model of Respiratory Syncytial Virus Pathogenesis, Prophylaxis and Therapy G. A. Prince Animal Models for Coxsackievirus Infections C. J. Gauntt Animal Models for HBV Infections-Transgenic Mice J. D. Morrey, R. W. Sidwell, B. A. Korba Animal Models for Hepatitis B Infections-Duck Hepatitis T.. Shaw, C. A. Luscombe, S. A. Locarnini Woodchuck Model of Hepatitis B Virus Infection B. C. Tennant Animal Models of Papillomavirus Infections N. D. Christensen, J. W. Kreider Adult Mouse Model for Rotavirus R. L. Ward, M. M. McNeal Animal Models for Lentivirus Infections m Feline Immunodeficiency Virus M. ]. Burkhard, E. A. Hoover Animal Models of HIV Infection: SIV Infection of Macaques K. K. A. Van Rompay, N. L. Aguirre The SCID-hu Thy-Liv Mouse: an Animal Model for HIV- 1 Infection C. A. Stoddart Animal Models for HIV Infection: hu-PBLSCID Mice D. E. Mosier Chimpanzee Model of HIV- 1 Infection P. N. Fultz

An eight page colour plate section appears between pages 576 and 577.

981

989

999 1005

1009

1021

1033 1039 1049

1055

1061

1069

1077 1085

Section Editors

Oto Zak Rheinparkstrasse 1/14, CH-4127 Birsfelden, Switzerland Claude Carbon Hopital Bichat, Henri Huchard, F75018 Paris, Cedex 18, France Bruno Fantin Unite de Medicine Interne, H6pital Beaujon, 100 bd du General-Leclerc, 92118 CHICHY Cedex, France Terence O'Reilly Novartis Pharma Research, K125.1.05, Basel, C H 4002, Switzerland

Ronald Kaminsky Swiss Tropical Institute, Socinstrasse 57, Postfach, Basel C H 4002, Switzerland Present address:

Novartis, Centre de Recherche Sant8 Animale SA, CH 1566, St-Aubin, Switzerland Earl Kern Dept of Paediatrics 8: Division of Clinical Virology, University of Alabama at Birmingham, 309 Bevill Biomedical Research Building, 845 19th Street South, Birmingham, Alabama 35294-2170, USA

This Page Intentionally Left Blank

List of Contributors

G. K. Abruzzo Merck 8: Co Inc, Rahway, NJ 07065-0900, USA N. L. Aguirre California Regional Primate Research Center, Davis, CA 95616-8542, USA J. D. Alder Scriptgen Pharmaceuticals, Waltham, MA 02451, USA T. Allen Animal Welfare Information Center, Beltsville, MD 20705, USA A. M. Arvin Stanford University School of Medicine, Stanford, CA 94305-5208, USA E. Azoulay-Dupuis Hopital Bichat-Claude Bernard, 75877 Paris Cedex 18, France I. A. 1-M. Bakker-Woudenberg Erasmus Medical Centre, 3015 GD Rotterdam, The Netherlands S. Baqar

D. I. Bidanset University of Alabama at Birmingham, Birmingham, AL 35294-2170, USA B. Bilger Universit~it Hohenheim (Parasitologie), D-70599 Stuttgart, Germany ._

B. L. Blagburn College of Veterinary Medicine, Alabama 36849-5519, USA

N. Bourne Children's Hospital Medical Center, Cincinnati, OH 45229-3039, USA T. Bremell Sahlgren University Hospital, S-413 45 Gothenburg, Sweden I. Brook Armed Forces Radiobiology Research Institute, Maryland, MD 20889-5603, USA M. R. W. Brown Aston University, Birmingham B4 7ET, UK

Naval Medical Research Center, Bethesda, MD 208895607, USA

R. Brun

B. Barry H6pital Bichat-Claude Bernard, 75877 Paris Cedex 18, France

A. G. Buret University of Calgary, Alberta, Canada T2N 1N4

K. Bartizal

E. E Burg

Merck & Co Inc, Rahway, NJ 07065-0900, USA A. S. Bayer Harbor-UCLA Research and Education Institute, Torrance, CA 90509, USA D. I. Bernstein Children's Hospital Medical Center, Cincinnati, OH 45229-3039, USA W. Behrens-Baumann

Universit/itsklinik fiir Augenheilkunde, D-39120 Magdeburg, Germany

Swiss Tropical Institute, CH-4002 Basel, Switzerland

Naval Medical Research Center, Bethesda, MD 208895607, USA M. I. Burkhard College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA E. Buschman McGill University Health Centre, Montreal, Canada S. M. Callister Gundersen Luther Medical Center, LaCrosse, WI 54601, USA

xii

A. Casadevall Albert Einstein College of Medicine, Bronx, NY 10461, USA A. Cassone Istituto Superiore di Sanita, Rome 00161, Italy H. Ceri University of Calgary, Alberta, Canada T2N 1N4 W. G. Cheadle Veterans Affairs Medical Center and University of Louisville School of Medicine, Kentucky 40292, USA

LIST OF CONTRIBUTORS

M. del Cerro University of Rochester School of Medicine, Rochester, NY 14642, USA G. Del Giudice IRIS Chiron Vaccines, 53100 Siena, Italy M. M. do Canto Cavalheiro Rua Geraldo Martins 249 ap. 802 Icarai, Niteroi, Brazil E. A. Deitch University of Medicine and Dentistry, Newark 071032714, USA

N. D. Christensen The Jake Gittlen Cancer Research Institute, Hershey, PA 17033-0850, USA

K. G. Delgaty University of Ottawa, Ottawa, Canada K1H 8M5

J. Cohen Hammersmith Hospital, London W12 0NN, UK

M. Duchet-Suchaux Institut National de la Recherche Agronomique, 37380 Nouzilly, France

G. C. Coles University of Bristol, Bristol BS40 5DU, UK

G. M. Duke Aviron, Mountain View, CA 94043, USA

C. H. Contag Stanford University School of Medicine, Stanford, CA 94305 5208, USA

H. Dupont Hopital Bichat, 75877, Paris, France

P. R. Contag Xenogen Corporation, Alameda, CA 94501, USA

R Dussault Centre de pneumologie de l'H6pital Laval, Universit~ Laval, Quebec City, Canada G 1V 4G5

A. Contrepois INSERM U158, h6pital Necker, 75015 Paris, France R. M. Cozens Novartis Pharma AG, CH-4002 Basel, Switzerland R. Crawford Animal Welfare Information Center, Beltsville, MD 20705, USA S. L. Croft London School of Hygiene & Tropical Medicine, London WC 1E 7HT, UK M. Cynamon Veterans Affairs Medical Center, New York, NY 13210 2716, USA E de Bernardis Istituto Superiore di Sanita, Rome, 00161 Italy R de Greeve Inspectorate for Health Protection, 2500 BC, The Hague, The Netherlands W. de Leeuw Inspectorate for Health Protection, 2500 BC, The Hague, The Netherlands

R Edelstein University of Pennsylvania Medical Center, Philadelphia, PA 19104-4283, USA T. B. Elliott Armed Forces Radiobiology Research Institute, Maryland, MD 20889-5603, USA L. S. Engel Louisiana State University Medical Center, New Orleans, LA 70112-1393, USA H. Erlendsd6ttir Landspitalinn (University Hospital), 101 Reykjavic, Iceland E Espersen Statens Serum Institut, DK 2300 Copenhagen, Denmark S. A. Estrem University of Missouri, Columbia, Missouri 55212, USA M. E. Etheridge Johns Hopkins University, Baltimore, MD 21205, USA B. Fan tin

Hopital Beaujon, 92118 Clichy Cedex, France

D. De Shazer University of Calgary Health Sciences Centre, Calgary, Canada T2N 4N1

O. M. Faye-Petersen University of Alabama at Birmingham, Birmingham, AL 35294-2170, USA

M. DeStefano SUNY Health Science Center, New York, NY 13210, USA

R. J. Fenton Glaxo-Wellcome Research & Development, Stevenage, UK

LIST OF C O N T R I B U T O R S

P. L. Fidel Jr Louisiana State University Medical Center, New Orleans, LA 70112-1393, USA

xiii

D. L. Goldman Albert Einstein College of Medicine, Bronx 10461, USA

G. Findon University of Auckland, Auckland, New Zealand

G. L. Gorby Section of Infectious Diseases, Veterans Affairs Medical Center, Omaha, NE 68105, USA

A. M. Flattery Merck 8: Co Inc, Rahway, NJ 07065-0900, USA

G. Greif Bayer AG, D-51368 Leverkusen, Germany

1. I. Flock Karolinska Institute, S-141 86 Huddinge, Sweden

S. Gudmundsson Landspitalinn (University Hospital) and Directorate of Health, 101 Reykjavic, Iceland

I. Foley University of Warwick, Coventry, CV4 7AL, UK 1. G. Fox Massachusetts Institute of Technology, Cambridge, MA 02139-4307, USA N. Frimodt-M611er Statens Serum Institut, DK-2300 Copenhagen, Denmark M. Frosch Institut for Hygiene & Mikrobiologie, 97080 Wtirzburg, Germany P. N. Fultz University of Alabama at Birmingham, Birmingham, AL 35294-2170, USA P. M. Furr Imperial College School of Medicine, London W2, UK G. E. Garber University of Ottawa, Ottawa, Canada K1G 8LG C. 1. Gauntt University of Texas Health Science Center, San Antonio, TX 78284-7758, USA T. G. Geary Pharmacia and Upjohn Co, Kalamazoo, MI-49001, USA B. M. Gebhardt LSU Eye Center, Louisiana State University Medical Center School of Medicine, New Orleans, LA 70112-2234, USA M. 1. Gentry Section of Infectious Diseases, Veterans Affairs Medical Center, Omaha, NE 68105, USA E Ghiara IRIS Chiron Vaccines, 53100 Siena, Italy

A. Haberkorn Hindenburgstrasse 168, D-42117 Wuppertal, Germany 1. Haddad Jr College of Physicians and Surgeons, Columbia University, New York, NY 10032-3784, USA D. M. Hajek University of Minnesota, Minneapolis, MN 55455, USA A. K. Hansen Department of Pharmacology and Pathobiology, Royal Veterinary and Agricultural University, Copenhagen, Denmark S. E Hayward-McClelland University of Ottawa, Ottawa, Canada K1G 8M5 L. D. Hazlett Wayne State University School of Medicine, Detroit, MI 48201, USA A. Heimdahl Karolinska Institute, S-141 86 Huddinge, Sweden S. A. Hienz Karolinska Institute, S-141 86 Huddinge, Sweden J. M. Hill

LSU Eye Center, Louisiana State University Medical Center School of Medicine, New Orleans, LA 70112-1393, USA 1. A. Hobden Wayne State University School of Medicine, Detroit, MI 48201, USA N. Hr Rigshospitalet, DK-2200 Copenhagen, Denmark

G. S. Giebink University of Minnesota, Minneapolis, MN 55455, USA

W. 1. Hopkins University of Wisconsin Medical School, Madison, WI 53792, USA

C. Gichuki Kenya Trypanosomiasis Research Institute, PO Box 362, Kikuyu, Kenya

E. A. Hoover College of Veterinary Medicine, Colorado State University, Fort Collins, Colorado, USA

C. G. Gill Merck & Co Inc, Rahway, NI 07065-0900, USA

K. Ishida Institute of Medical Science, Kawasaki 216, Japan

xiv

LIST OF CONTRIBUTORS

A. A. Izzo University of New Mexico School of Medicine, Albuquerque, New Mexico 87131, USA

J. W. Kreider The Jake Gittlen Cancer Research Institute, Hershey, PA 17033-0850, USA

K. Janitschke Robert Koche Institut Berlin, D-13352 Berlin, Germany

M. Laviolette Centre de pneumologie de l'H6pital Laval, Universite Laval, Quebec City, Canada G 1V 4G5

C. lantos Medizinische Mikrobiologie, Klinikum der Justus Liebig Universit~it, D-35392 Giessen, Germany B. li Faculte de Medecine Pitie-Salpetriere, 75634 Paris Cedex 13, France H. K. Johansen Rigshospitalet, DK 2200, Copenhagen, Denmark D. E. Johnson Dept of Veterans Affairs Medical Center, Baltimore, MD 21201, USA S. S. Johnson Pharmacia and Upjohn Co, Kalamazoo, MI-49001, USA V. Joly Hopital Bichat-Claude Bernard, 75877 Paris Cedex 18, France A. B. Kaiser Vanderbilt University Medical Center, Nashville, TN 37232-2358, USA

M. Kaku Institute of Medical Science, Kawasaki 216, Japan R. Kaminsky Swiss Tropical Institute, CH-4002 Basel, Switzerland H. E. Kaufman LSU Eye Center, Louisiana State University Medical Center School of Medicine, New Orleans, LA 70112-2234, USA G. W. Kemble Aviron, Mountain View, CA 94043, USA E. R. Kern University of Alabama at Birmingham, Birmingham, AL 35294-2170, USA K. A. Kernacki Wayne State University School of Medicine, Detroit, MI 48201 USA D. S. Kernodle Vanderbilt University School of Medicine, Nashville, TN 37232-2358, USA J. D. Knudsen Statens Serum Institut, DK 2300 Copenhagen, Denmark B. A. Korba Georgetown University, Rockville, MD USA

E. S. Lazar University of Rochester School of Medicine, Rochester, NY 14642, USA G. D. Ledney Armed Forces Radiobiology Research Institute, Maryland, MD 20889-5603, USA J. Lee Harbor-UCLA Research and Education Institute, Torrance, CA 90509, USA A. C. A. P. Leenders Bosch Medical Centre, 's-Hertogenbosch, The Netherlands A. Lefort Hopital Beaujon, 92118 Clichy Cedex, France J. Leggett Providence Portland Medical Center, Portland, OR 972132967, USA L. L. Leon Funda~ao Oswaldo Cruz-Instituto Oswaldo Cruz, Rio de Janeiro, Brazil L. Levy Hadassah University Hospital, Jerusalem, Israel D. S. Lindsay Virginia-Maryland Regional College of Veterinary Medicine, Virginia 24061-0442, USA M. E Lipscomb University of New Mexico School of Medicine, Albuquerque, New Mexico 87131, USA S. A. Locarnini Victorian Infectious Diseases Reference Laboratory, North Melbourne, Australia C. V. Lockatell University of Maryland School of Medicine, Baltimore, MD 21201, USA R. Lorenzini Istituto Superiore di Sanita, Rome 00161, Italy V. Lorian The Bronx-Lebanon Hospital Center, Bronx, NY 10456, USA J. Lovchik University of New Mexico School of Medicine, Albuquerque, New Mexico 87131, USA

LIST OF CONTRIBUTORS

xv

C. A. Luscombe University of New Mexico Cancer Research & Treatment Center, Albuquerque, NM 87131-5266, USA

D. B. Morton University of Birmingham, Edgbaston, Birmingham B15 2TT, UK

C. R. Lyons University of New Mexico School of Medicine, Albuquerque, New Mexico 87131, USA

D. E. Mosier Scripps Research Institute, La Jolla, CA 92037, USA

J. T. Mader University of Texas Medical Branch, Galveston, TX 77555-0792, USA L. Magnotti University of Medicine and Dentistry, Newark 071032714, USA R. P. Marini Massachusetts Institute of Technology, Cambridge, MA 02139-4307, USA T. Matsumoto University of Occupational & Environmental Health, Kitakyushu, 807-8555, Japan M. B. McKeough University of Utah, Salt Lake City, UT 84132, USA M. M. McNeal Children's Hospital Medical Center, Cincinnati, OH 45229-3039, USA T. E. Miller University of Auckland, Auckland, New Zealand L. Mizen Smithkline Beecham Pharmaceuticals, Collegeville, PA 19426-0989, USA E. S. Mocarski Stanford University, Stanford, CA 94305-5124, USA J. E Moffat Stanford University School of Medicine, Stanford, CA 94305-5208, USA P. Moine Centre Hopitalier de Bicetre, 94274 Le Kremlin-Bic&re Cedex, France P. Montravers Centre Hospitaliar, Universitaire d'Amiens, 80054 Amiens Cedex 01, France D. W. Morck University of Calgary, Alberta, Canada T2N 1N4 1-D. Morrey Institute for Antiviral Research, Logan, UT 84322-5600, USA J. G. Morris Jr University of Maryland School of Medicine, Baltimore, MD 21201-1192, USA

M. Motschmann Universit~itsklinik for Augenheilkunde, D-39120 Magdeburg, Germany A.-M. Moulin INSERM U 158, h6pital Necker, 75015 Paris, France M. Muffat-Joly H6pital Bichat-Claude Bernard, 75877 Paris Cedex 18, France J. R. Murphy University of Texas, Houston, USA I. M. Nazzaro Boston University Medical Center, Boston, MA 02118, USA E. A. Neuwelt Oregon Health Sciences University, Portland, OR 97201, USA T. Nishikawa Kanazawa University, Kanazawa 921, Japan C. E. Nord Karolinska Institute, S-141 86 Huddinge, Sweden R. J. O'Callaghan Louisiana State University Medical Center, New Orleans, LA 70112-1393, USA M. Ohkawa Kanazawa Municipal Hospital, Kanazawa 921, Japan A. Olomu Stanford University School of Medicine, Stanford, CA 94305 5208, USA M. E. Olson University of Calgary, Alberta, Canada T2N 1N4 T. O'Reilly Novartis Pharma Ltd, Basel, Switzerland CH-4002 I. M. Orme Colorado State University, Fort Collins, CO 80523, USA D. 1. Ormrod University of Auckland, Auckland, New Zealand P. Panigrahi University of Maryland School of Medicine, Baltimore, MD 21201-1192, USA J. R. Perfect Duke University Medical Center, Durham, NC 27710, USA W. Peters CABI Bioscience, St Albans, Herts AL4 0XU, UK

xvi

LIST OF CONTRIBUTORS

I. C. Peyton Veterans Affairs Medical Center, Kentucky, 40292, USA

W. M. Scheld University of Virginia, Charlottesville, VA 22908, USA

J. D. Pietsch Price Institute of Surgical Research, Department of Surgery, University of Louisville School of Medicine, Kentucky 40292, USA

R. Schell University of Wisconsin, Madison, WI 53706, USA

K. Piper Mayo Graduate School of Medicine, Rochester, MN 55905, USA A. Polak-Wyss Spitzenrainweg 45, 4147 Aesch, Switzerland

H. G. Schiefer Medizinische Mikrobiologie, Klinikum der lustus Liebig Universit~it, D-35392 Giessen, Germany A. Schmidt Bayer AG, D-42096 Wuppertal, Germany D. M. Scollard GWL Hansen's Disease Center, Baton Rouge 70894, USA

H. C. Polk, lr Price Institute of Surgical Research, Department of Surgery, University of Louisville School of Medicine, Kentucky 40292, USA

K. B. Seydel Washington University School of Medicine, St Louis, MO 63110-1093 USA

L. C. Preheim Section of Infectious Diseases, Veterans Affairs Medical Center, Omaha, NE 68105, USA

T. Shaw Victorian Infectious Diseases Reference Laboratory, North Melbourne, Australia

G. E. Price University of Birmingham, Edgbaston, Birmingham B15 2TT, UK

J. Shimada Institute of Medical Science, Kawasaki 216, Japan

G. A. Prince Virion Systems Inc., Rockville, USA M. K. Quartey University of Minnesota, Minneapolis, MN 55455, USA F. Quimby College of Veterinary Medicine, Cornell University, USA R. Rappuoli IRIS Chiron Vaccines, 53100 Siena, Italy R. R. Read University of Calgary, Alberta, Canada T2N 1N4 E P. Reinholt Karolinska Institute, S-141 86 Huddinge, Sweden J. Renneberg Department of Medicine, Laegemiddelstyrelsen, 2700 Bronshoj, Denmark J. Y. Richmond Center for Disease Control, Atlanta, GA 30333, USA B. L. Robinson CABI Bioscience, St Albans, Herts AL4 0XU, UK T. Romig Universit~it Hohenheim (Parasitologie), D-70599 Stuttgart, Germany M. S. Rouse Mayo Clinic, Rochester, MN 55905, USA M. A. Sande Utah School of Medicine, Salt Lake City, USA

M. E. Shirtliff University of Texas Medical Branch, Galveston, TX 77555-1115, USA M. Shroti Veterans Affairs Medical Center and University of Louisville School of Medicine, Kentucky 40292, USA R. W. Sidwell Institute for Antiviral Research, Logan, UT 84322-5600, USA E. Skamene McGill University Health Centre, Montreal, Canada J. G. Smith Merck 8: Co Inc, Rahway, NJ 07065-0900, USA J. D. Sobel Wayne State University School of Medicine, Detroit, MI, USA N. See-Nielsen University of Copenhagen, 2900 Hellerup, Denmark K. F. Soike Tulane Regional Primate Research, Covington, LA 70433, USA S. L. Spruance University of Utah, Salt Lake City, UT 84132, USA S. Sriskandan Hammersmith Hospital, London W12 0NN, UK F. S. Stals St Laurentius Zickenhuis, 6043 CV Roermond, The Netherlands

LIST OF CONTRIBUTORS

xvii

L. R. Stanberry Children's Hospital Medical Center, Cincinnati, OH 45229-3039, USA

E. W. M. van Etten Erasmus Medical Centre, 3015 GD Rotterdam, The Netherlands

S. L. Stanley lr Washington University School of Medicine, St Louis, NO 63110-1093, USA

K. K. A. Van Rompay California Regional Primate Research Center, Davis, CA 95616-8542, USA

J. M. Steckelberg Mayo Clinic, Rochester, MN 55905, USA

E. D. Varnell LSU Eye Center, Louisiana State University Eye Center School of Medicine, New Orleans, LA 70112-2234, USA

C. A. Stoddart Gladstone Institute of Virology & Immunology, San Francisco, CA 94141-9100, USA C. Sweet University of Birmingham, Edgbaston, Birmingham B15 2TT, UK M. Takashima Kanazawa University, Kanazawa 921, Japan T. G. Takoudes College of Physicians and Surgeons, Columbia University, New York, NY 10032-3784, USA D. Taylor-Robinson Imperial College School of Medicine, London W2, UK B. C. Tennant College of Veterinary Medicine, Ithaca, NY 14853-6401, USA E. M. Thomas Pharmacia and Upjohn Co, Kalamazoo, MI-49001 USA R. C. A. Thompson Murdoch University, Murdoch WA 6150, Australia L. Tissi University of Perugia, 06100 Perugia, Italy S. Tokunaga Maizuru Kyosai Hospital, Maizuru, Japan G. C. Townsend University of Virginia, Charlottesville, VA 22908, USA G. M. Tremblay Centre de pneumologie de l'H6pital Laval, Universite Laval, Quebec City, Canada G1V 4G5 R. W. Truman GWL Hansen's Disease Center, Baton Rouge 70894, USA

U. Vogel Institut for Hygiene & Mikrobiologie, 97080 Wiirzburg, Germany R. L. Ward Children's Hospital Medical Center, Cincinnati, OH 45229-3039, USA K. Wicher David Axelrod Institute, Albany, NY 12201-0509, USA V. Wicher David Axelrod Institute, Albany, NY 12201-0509, USA 1. A. Wilder University of New Mexico School of Medicine, Albuquerque, New Mexico 87131, USA W. R. Wilson Mayo Clinic, Rochester, MN 55905, USA D. E. Woods University of Calgary Health Sciences Centre, Calgary, T2N 4N1 Canada D. Z. Xu University of Medicine and Dentistry, Newark 071032714, USA V. Yardley London School of Hygiene &,Tropical Medicine, London WC 1E 7HT, UK M. R. Yeaman St John's Cardiovascular Research Centre, Torrance, CA 90509, USA P. Yeni Hopital Bichat-Claude Bernard, 75877 Paris Cedex 18, France Z. Yuan University of Minnesota, Minneapolis, MN 55455, USA

E. Tuomanen St Jude Children's Hospital, Memphis, TN 38105-2794, USA

O. Zak Rheinparkstrasse, CH 4127 Birsfelden, Switzerland

J. Tureen San Francisco General Hospital, San Francisco, CA 94110, USA

T. Zhang Washington University School of Medicine, St Louis, MO 63110-1093, USA

S. 1. Upton Kansas State University, Manhattan, Kansas 665056, USA

W. Zimmerli University Hospital, CH-4031 Basel, Switzerland

This Page Intentionally Left Blank

Preface

The development and testing of new antimicrobial agents has taken on new importance and urgency as we began to lose our currently available drugs for treating infections caused by highly drug-resistant microorganisms. Today, we have no antibiotics active in vivo for the treatment of infections due to some strains of Enterococcus faecium. The spread of highly resistant clones of Streptococcuspneumoniae around the world is dramatically changing the therapeutic approach to the treatment of infections caused by this organism. The appearance in Japan and then in the USA of vancomycin-resistant strains of Staphylococcus aureus has shaken the medical world. It is clearly apparent that, without new therapeutic strategies and drugs, the number of untreatable infections will increase markedly during the next 10 years. It is indeed conceivable that we will witness the end of the antibiotic era as we know it today. This problem is not restricted to more common bacterial infections, but also includes multi-drug-resistant Mycobacterium tuberculosis and Plasmodium falciparum. Furthermore, emerging infections present new therapeutic needs: adequate treatments for chlamydial infection and for Hantavirus and Filovirus infections are lacking. However, developing new therapeutic strategies for the treatment of microbial infections is a complicated and expensive activity. The standard approach has been to screen large numbers of compounds for their in vitro activity against a series of reference organisms followed by determination of activity against a large number of clinical isolates. Next, candidate compounds possessing an appreciable antimicrobial activity are selected and their properties are delineated using many different in vitro tests (e.g. stability, protein binding, solubility, etc.), and their pharmacokinetic properties and toxicity profile using in vivo systems. Today, with the genomic sequences of many organisms available, screening based on molecular techniques (e.g. determination of novel genes expressed in vivo by genomic or proteomic techniques) should facilitate identification of new targets. Then, with genetic approaches to determine the suitability of the target (e.g. determination of the virulence mutant organisms) to provide a "proof of concept", followed by production and characterization of recombinant protein(s), rational drug design based upon in vitro screening of compounds against isolated target pro-

teins may facilitate the discovery of new inhibitors by the use of a molecularly defined target methodology. This approach has been beautifully illustrated by the discovery of the protease inhibitors of the human immunodeficiency virus. However, no matter how sophisticated drug screening and development may be, the final essential step in development of new antimicrobial therapies prior to testing in man is evaluation of the drug for its antimicrobial efficacy and toxicity in animal models of infection. Thirteen years ago we published a three-volume text elucidating in detail a series of experimental models for evaluating antimicrobial chemotherapy in vivo. We felt that having this information in one series would save investigators time and effort in formulating an approach to test a new potential therapeutic agent or combination of agents for in vivo efficacy and to position the therapy for specific infections where it might have a therapeutic promise. The series has accomplished these goals and, while it has a limited readership, those active in the field of research and development of antimicrobials have found it extremely useful. Therefore, we have decided to update the series by publishing a new edition. For that we have chosen a onevolume strategy, a handbook format. This book is divided into five parts, the first covering general methodology and followed by parts describing experimental bacterial, mycotic, parasitic and viral infections. We have attempted to include many new models that have been developed within the last decade or that were omitted for various reasons in the first edition. For most part they are sophisticated models that allow for well-targeted use of new agents. We hope this update will be as useful as the last edition proved to be. Lastly, we would like to extend our appreciation to the staff at Academic Press who have been involved in this project: Dr Lilian Leung, Emma White and Dr Tessa Picknett; their enthusiasm and dedication to this project, and patience with us, is most appreciated. Oto Zak and Merle A. Sande, Editors Claude Carbon, Bruno Fantin, Ronald Kaminsky, Earl R. Kern and Terence O'Reilly, Section Editors

This Page Intentionally Left Blank

Introduction: The Role of Animal Models in the Evaluation of New Antibiotics Oto Zak, Merle Sande and Terence O'Reilly

Two milestones in the history of antimicrobial chemotherapy are directly attributable to experiments conducted in animal models of infection. The first resulted from the surprising observation that a dyestuff, sulphonamidocrysoidine (Prontosil), although devoid of antibacterial activity in vitro, was effective against a pneumococcal infection in mice (Domagk, 1935). This finding furnished the very first proof that (1) systemic bacterial infections could be cured by drugs and (2) in vivo testing was an indispensable component of antimicrobial drug research. The second was penicillin. In retrospect, there seems to have been a fair chance of this antibiotic becoming available to patients much earlier than it did: Fleming only used it for differentiating cultures and in a few cases as a local antiseptic; he apparently gave no thought to the possibility that it might also be systemically effective. Not until the 1940s, at the suggestion of Florey and Chain, was the substance partially purified and shown to exert potent therapeutic activity, first in the mouse and afterward in humans (Abraham, 1980). It is hardly conceivable that any new antibiotic could have been developed since then without thorough verification at an early stage of its antimicrobial efficacy (and toxicological innocuity) in models of infection in laboratory animals. Testing in vivo has come to be recognized as the essential link between in vitro sensitivity testing and clinical studies. Indeed, it is essential that new agents shown to be of interest following in vitro evaluation should exhibit sufficient activity in vivo to justify their continued clinical development. Guidelines for the clinical evaluation of antiinfective drugs specifically place experimental evaluation of new compounds (or novel combinations or therapeutic modalities) in animals as prerequisites for clinical trials (Beam et aL, 1992, 1993). Specifically, indications of pharmacokinetic properties of new molecules, including possible metabolism, pharmacodynamic attributes (i.e. determination of the interactions of drug, host and infecting microbe, e.g. determination of possible postantibiotic effects) and determination of efficacy in animal models mimicking human disease are required, and indeed may assist in the planning of clinical trials of new antibiotics or combinations (Beam et aL, 1992, 1993). However, it must be emphasized that a direct extrapolation of data obtained

from animal models of infection may not be possible and instead the data obtained should guide the initiation of clinical research. Given this, the researcher using experimental models should bear in mind the nature of clinical infection and treatment when designing studies for the evaluation of anti-infectives. Since 1960 far more than 1000 different animal models for experimental chemotherapy have been described. Depending on their purpose, nature and predictive value, they can be assigned to various categories (Zak, 1980); each has its justification at some point in the development of an antibiotic or therapeutic strategy. The basic antimicrobial screening models are the in-vivo test systems most frequently used in the early evaluation of new antibiotics. The best known model in this category is that of acute septicemia in mice, and it is, so far, the simplest and most inexpensive test, allowing a rough estimate of whether or not an antibiotic is likely to be effective in vivo. The relevance of the results obtained in this model to clinical chemotherapy is, however, limited by its many inherent drawbacks (Miller, 1971; Bergeron, 1978; Barza, 1978; Zak, 1980; Zak and Sande, 1982), e.g. the too rapidly fatal course of infection in mice not being a characteristic of human disease, the sensitivity of the test to the size of the inoculum, the prophylactic rather than therapeutic regimens used in this test, etc. Ex-vivo models appear to simulate human infections somewhat more closely than do screening tests. This category comprises models in which foreign bodies, e.g. fibrin clots or dialysis sacks, are implanted into animals and infected. Other variants use perforated rubber or plastic tubing, small spiral springs or perforated balls, which are infected after they have been surrounded by granulation tissue and filled with edematous ("tissue") fluid. The effects of antibiotics in these tests are then evaluated in vitro, e.g. by determination of the antibiotic concentrations reached or the bacterial counts in samples of the foreign bodies or the fluid. A number of models used in the evaluation of antibiotics belong to the category described as monoparametric/polyparametric models. They differ from the screening models in that, instead of waiting for the ultimate therapeutic effects to appear (cure or death), only one single, or

xxii

O. Zak, M. Sande and T. O'Reilly

preferably many, parameter(s) is examined during the experiment. The determination of serial bacterial counts in the blood or tissues during treatment, or studies of the influence of antibiotics on the morphology of bacteria in the body cavities, can be included in this category. Both ex-vivo and monoparametric models are frequently used during the more advanced secondary phase of the evaluation of a new antibiotic. In general they are very helpful in differentiating the properties of various antibiotics, although their main merit is in providing data on the effects of antibiotics that would be impossible to study in humans, whether for ethical or technical reasons, e.g. the effects of subtherapeutic doses or very short treatment regimens. Many of the drawbacks of screening models, however, also apply to the ex-vivo and monoparametric test systems and especially to their use in small rodents. Experimental infections belonging to the category of discriminative models are designed to simulate human infection as closely as possible. They permit the potential therapeutic effects of new or already established drugs and drug combinations to be differentiated and delimit the indications in which they might be effective in humans. These systems are also suitable for investigating the interactions between the host and the drug or microorganism. The ideal model of this type should exhibit the features listed in Table 1.

Table 1 Features of the ideal discriminative animal model (adapted from Zak, 1980; modified from Harter and Petersdorf, 1960)

Technique of infection

Simple

Causative organism Route of entry Spread in the body

Identical or at least similar to situation in humans

Tissue involvement Severity, course, and duration of disease

Predictable Reproducible Amenable to analysis

Susceptibility to chemotherapy

Measurable Reproducible

Several models seem to satisfy these criteria adequately, a few examples of which include endocarditis in rabbits or rats, pneumonia in immunosuppressed guinea-pigs or dogs, osteomyelitis in rabbits or rats, various' models of urinary tract infection in rats and pigs, meningitis in rabbits, eye infections, oral candidiasis in rats, and cryptococcal infection in guinea-pigs or rabbits. Investigations using these or other discriminative models have undoubtedly made a significant contribution to our knowledge of the pathogenesis of various types of meningitis (Scheld, 1981, 1986) or the value of specific antibiotics in specific infections, and they have been most helpful in establishing the

guiding principles for the use of antimicrobial agents. As was recently noted by Sande (1981), many questions can be more clearly answered with the aid of these models than in humans, e.g.: 9 When is a bacteriostatic drug as good as a bactericidal drug? 9 When is the rate of bacterial killing important? 9 How important is a high bactericidal titer in serum? 9 What is the optimal dosing interval? 9 How important are postantibiotic effects? Results obtained in discriminative models of infection have often provided the impetus for the initiation of clinical trials or have confirmed and explained observations made in humans. For example, studies in animal models of endocarditis due to Streptococcus viridans, sensitive, relatively resistant or tolerant to penicillin, demonstrated that penicillin given alone was less efficacious against the resistant and tolerant strains than against the susceptible strains. A combination with aminoglycosides (e.g. streptomycin), on the other hand, was equally effective against all streptococci tested and markedly accelerated the rate at which the cardiac vegetations were cleared of bacteria (Zak et aL, 1982). Clinical trials conducted by Wilson et aL (1978, 1981) showed that 2 weeks of therapy with this regimen was as effective as 4 weeks with penicillin alone. Recommendations for changes of therapeutic regimens have also resulted from findings made in animal models, e.g. the use of vancomycin combined with rifampicin, with or without gentamicin, in the treatment of endocarditis due to methicillin-resistant Staphylococcus epidermidis (Drake and Sande, 1986; Vazquez and Archer, 1980). Finally, it is worth bearing in mind that had the model of bacterial meningitis been used to test the efficacy of cephalothin in this infection, therapeutic failures might not have been needed to reveal the agent's inferior activity in patients' cerebrospinal fluid (CSF). Cephalothin penetrates poorly into the CSF of rabbits with meningitis, and much of the drug is in the desacetyl form, which is not effective against meningococci or pneumococci (Ernest and Sande, 1982). In short, animal models of infection are the best means presently available of estimating the efficacy of and tolerability to an antibiotic before its administration to humans and of finding new approaches to the treatment of infections. The technical advantages of using animal models are no less important: studies can be performed in groups of animals large enough to bear statistical analysis; they provide reproducible results; and they permit individual effects to be examined separately through variation of the parameters (Zak, 1982). On the other hand, it cannot be denied that even the best animal model is not free of limitations, and investigators have to be as cognizant of these as of the merits of the model.

INTRODUCTION: THE ROLE OF ANIMAL MODELS IN THE EVALUATION OF NEW ANTIBIOTICS

Perhaps the greatest limitation in the use of animal models for studying chemotherapy, and perhaps the single most ignored parameter, is the difference between the pharmacokinetic characteristics of antibiotics in most animals used for infectious disease models and those occurring in humans. The predominant differences lie in the faster elimination of drugs by small animals as compared to humans (e.g. O'Reilly et al., 1996; Craig, 1998). Although the in-vitro potency of an antimicrobial remains a critical predictor of eventual efficacy, the in-vivo efficacy of a particular agent can be dramatically affected by the pharmacokinetics (metabolism and elimination of antimicrobials from the body) and pharmacodynamics (antimicrobial action of drugs in vivo) of the agent. A general background to pharmacokinetics/pharmacodynamics can be found in several sources, and the background to particular issues concerning antimicrobials has been recently reviewed (e.g. Craig, 1998; O'Reilly et al., 1996). Consideration of these pharmacokinetic differences has led some researchers to obtain antibiotic pharmacokinetic profiles more similar to those expressed by humans by adapting the antimicrobial dosing regimens to compensate for the faster elimination of compounds by animals. Impairment of renal function to reduce antibiotic elimination rates, fractional administration of decreasing doses of antibiotics at various time intervals, and continuous infusion have all been used to mimic human pharmacokinetics of antimicrobial agents in small animals. However, the use of such protocols is limited in experimental evaluations of antibiotics as they require knowledge of the pharmacokinetic profiles of antibiotics in humans. They may retain value in the evaluation of new compounds with unknown human pharmacokinetics when the agents are administered in regimens similar to the regimens of standard compounds with established human pharmacokinetic profiles. The focus of this book is to combine the collected experience of the world's leading investigators in the area of experimental anti-infective chemotherapy. Many previous reviews of the use of animal models for the evaluation of infection have appeared (for a list, see O'Reilly et al., 1996). We have selected topics ranging from the ethical considerations of using animals for experimentation to the practical aspects of utilizing the various discriminative models. We have attempted to encompass models of most of the agents that infect humans where chemotherapy has been employed. Each section emphasizes not only the contributions of the model but also the pitfalls in design and in the interpretation of results. It should be noted, however, that the models presented in this book may not be suitable for the exploration of the mechanisms of pathogenesis during infection. Although the use of transgenic mice for such studies has proved valuable (for a review, see Kaufmann, 1994; Kaufmann and Ladel, 1994), the use of infected transgenic mice for the evaluation of host response during the antimicrobial treatment of infection has not received much attention.

xxiii

It is hoped that this contribution will assist the new investigator in better planning experiments by avoiding many of the mistakes already made by others.

References Abraham, E. P. (1980). Fleming's discovery. Rev. Infect. Dis., 2, 140-141. Barza, M. (1978). A critique of animal models in antibiotic research. &and. ]. Infect. Dis., 14 (Suppl.), 109-117. Beam, T. R., Gilbert, D. N., Kunin, C. M. (1992). General guidelines for the clinical evaluation of anti-infective drug products. Clin. Infect. Dis., 15 (Suppl. 1), $5-$32. Beam, T. R., Gilbert, D. N., Kunin, C. M., the European Working Party (eds) (1993). European Guidelines for the Clinical Evaluation of Anti-Infective Drug Products. European Society of Clinical Microbiology and Infectious Diseases. Bergeron, M. G. (1978). A review of models for the therapy of experimental infections. Stand. ]. Infect. Dis., 14 (Suppl.), 189-206. Craig, W. A. (1998). Pharmacokinetic/pharmacodynamic parameters: rationale for antibacterial dosing of mice and men. Clin. Infect. Dis., 26, 1-10. Domagk, G. (1935). Ein Beitrag zur Chemotherapie der bakteriellen Infektionen. Deutsch. Med. Wschr., 61,250-153. Ernst, J. D., Sande, M. A. (1982). Selected examples of failure of in vitro testing to predict in vivo response to antibiotics. In: Action of Antibiotics in Patients (ed. Sabath, L. D.), pp. 68-73. Hans Huber, Berne. Harter, D. H., Petersdorf, R. G. (1960). A consideration of the pathogenesis of bacterial meningitis: review of experimental and clinical studies. Yale ]. Biol. Med., 32, 280-309. Kaufmann, S. H. (1994). Bacterial and protozoal infections in genetically disrupted mice. Curr. Opin. Immunol., 6, 518525. Kaufmann, S. H., Ladel, C. H. (1994). Application of knockout mice to the experimental analysis of infections with bacteria and protozoa. Trends Microbiol., 2, 235-242. Miller, A. K. (1971). In vivo evaluation of antibacterial chemotherapeutic substances. Adv. Appl. Microbiol., 14, 151-183. O'Reilly, T., Cleeland, R., Squires, E. (1996). Evaluation of antimicrobials in experimental animal infections. In: Antibiotics in Laboratory Medicine, 4th edn (ed. Lorian, V.), pp. 599-759. Williams & Wilkins, Baltimore. Sande, M. A. (1981). Animal models in the evaluation of antimicrobial agents (guest editorial). Infect. Dis., 4(11), 4-20. Scheld, W. M. (1981). Pathophysiological correlates in bacterial meningitis. J. Infect., 3 (Suppl. 1), 5-19. Scheld, W. M. (1986). Experimental animal models of bacterial meningitis. In: Experimental Models in Antimicrobial Chemotherapy, vol. 1 (eds Zak. O., Sande, M. A.). Academic Press, London. Vazquez, G. J., Archer, G. L. (1980). Antibiotic therapy of experimental Staphylococcus epidermidis endocarditis. Antimicrob. Agents Chemother., 17, 280-285. Wilson, W. R., Geraci, J. E., Wilkowski, C. J., Washington, J. A. II (1978). Short-term intramuscular therapy with procaine penicillin plus streptomycin for endocarditis due to viridans streptococci. Circulation, 57, 1158-1161.

xxiv

Wilson, W. R., Thompson, R. L., Wilkowski, C. J., Washington, J. A. II, Giulliani, E. R., Geraci, J. E. (1981). Short term therapy for streptococcal infective endocarditis: combined intramuscular administration of penicillin and streptomycin. jr. A. M. A., 245,360-363. Zak, O. (1980). Scope and limitations of experimental chemotherapy. Experientia, 36, 479-483. Zak, O. (1982). Usefulness and limitations of animal models in the study of opportunistic nonbacterial infections. In: Infections in Cancer Patients (ed. Klastersky, J.), pp. 25-45. Raven Press, New York.

O. Zak, M. Sande and T. O'Reilly

Zak, O., Sande, M. A. (1982). Correlation of in vitro antimicrobial activity of antibiotics with results of treatment in experimental animal models and human infection. In: Action of Antibiotics in Patients (ed. Sabath, L. D.), pp. 55-67. Hans Huber, Berne. Zak, O., Sande, M. A., Wilson, W. R. (1982). Penicillin or penicillin plus streptomycin therapy of viridans streptococcal experimental endocarditis. 22nd Interscience Conference on Antimicrobial Agents and Chemotherapy, Abstract No 839.

Section I

Introductory Section I

Background to Animal Models of Infection Introductory Background to Animal Models of Infection

This Page Intentionally Left Blank

Chapter I Chapter 1

Early History of Animal Models of Infection Early History of Animal Models of Infection A. Contrepois andA.-M. Moulin

A. Contrepois and·A.-M. Moulin

The formation of the concept of specific infection has been a complex process dependent on a series of discoveries and the identification and microbiologThe formation ofof theanatomopathological concept of specific infection has been mechanisms, well as on clinical andofepidemiological aical complex process as dependent a series discoveries and phenomena. In the development of a medical discipline the identification of anatomopathological and microbiologsuch mechanisms, as infectious pathology, be outlined, and can epidemiological ical as well as various clinical steps among which In onethe of the most crucial quest for animal phenomena. development ofisathe medical discipline models. These models were established after a long historisuch as infectious pathology, various steps can be outlined, cal development infections. among which oneinofthe theunderstanding most crucial is of thehuman quest for animal models. These models were established after a long historical development in the understanding of human infections.

Clinical investigation and necropsy findings Clinical investigation and necropsy Some nosological entities still acknowledged today findings

were identified very early, on the sole basis of clinical signs, such as smallpox and measles; were differentiated the Some nosological entItles they still acknowledged todaybywere Arab physician Razi, as early as the 10th century. But at the identified very early, on the sole basis of clinical signs, such turn of the 19th century in western Europe, the anatomoas smallpox and measles; they were differentiated by the clinical methodRazi, enabled a as new of correlations Arab physician as early the system 10th century. But at the between lesions turn of the 19th discerned century in during westernautopsy Europe,and the symptoms anatomoobserved in the live patienta (Ackerknecht, Foucault, clinical method enabled new system 1967; of correlations 1976; Gelfand, Maulitz, 1987).autopsy and symptoms between lesions1980; discerned during One ofinthe of the doctrine of anatomoobserved thefirst live founders patient (Ackerknecht, 1967; Foucault, clinical specificity wasMaulitz, Pierre Bretonneau in France (Foster, 1976; Gelfand, 1980; 1987). 1970). grasp ofofthe One Bretonneau's of the first founders the concept doctrine of of specificity anatomoderived from his detailed study of two diseases, diphtheria clinical specificity was Pierre Bretonneau in France (Foster, and typhoid fever. He grasp showedofthat various of sortsspecificity of diphBretonneau's thetheconcept 1970). theria in from fact constituted sameofentity, quite distinct from derived his detailedthe study two diseases, diphtheria -the andthe ulcerative conditions of andvarious typhoidother fever.inflammatory He showed that various sorts of diphthe throat. Similarly, he separated typhoid from the undiftheria in fact constituted the same entity, quite distinct from ferentiated fevers by pointing out the characteristic -the various mass other of inflammatory and ulcerative conditions of lesions in theSimilarly, small intestine. He recognized both diseases to the throat. he separated typhoid from the undifbe contagious. that on heart ferentiated massDuring of fevers by period, pointingthe outresearch the characteristic valve provides a fascinating example the conlesionsdiseases in the small intestine. He recognized bothofdiseases to struction of new entities 1996). In 1806, be contagious. During that (Contrepois, period, the research on heart Nicolas Corvisart in France described,example as wellofasthe clinical valve diseases provides a fascinating consigns and symptoms, outgrowths or soft "vegetations" struction of new entities (Contrepois, 1996). In 1806, observed on the cardiac valves. The Englishman Allan Nicolas Corvisart in France described, as well as clinical Burns wrote in 1809 about a "concretion of an irregular signs and symptoms, outgrowths or soft "vegetations" form, friable and cardiac of granular in the heart. on the valves. structure" The Englishman Allan observed According to Friedrich Kreysig of Germany, valve Burns wrote in 1809 about a "concretion ofcardiac an irregular alterations were linked to "blood clots" in the heart cavity; form, friable and of granular structure" in the heart. According to Friedrich Handboo k of Anirnal Models of Kreysig Infection of Germany, cardiac valve alterations were linked to "blood clots" in the heart cavity; ISBN 0-12-775390-7 Handbook ofAnimal Models ofInfection

ISBN 0-12-775390-7

coagulation occurred before the clots adhered to the membrane. In 1819 inoccurred Paris, ThSophile Laennec coagulation before the clots greatly adheredimproved to the clinical observation techniques, and information gained membrane. through percussion auscultation enabled him improved to analyse In 1819 in Paris, and Theophile Laennec greatly new cardiac symptoms which he to gained lesions clinical observation techniques, and correlated information observedpercussion during autopsy. In 1835, Jean-Baptiste through and auscultation enabled him Bouillaud to analyse namedcardiac "endocardium" internal heart new symptomsthewhich he membrane correlated oftothelesions (describedduring by Bichat in 1800) called the inflammation of observed autopsy. In and 1835, Jean-Baptiste Bouillaud this membrane "endocarditis". In 1841, Bouillaud named "endocardium" the internal membrane of isolated the hearta category ofby"typhic At the the generic (described Bichat endocarditis". in 1800) and called thetime, inflammation of termmembrane "typhus" "endocarditis". or "typhoid fever" covered several febrilea this In 1841, Bouillaud isolated syndromes, usually accompanied and delirium. category of "typhic endocarditis".byAtstupor the time, the generic In 1852, the Englishman William Senhouse term "typhus" or "typhoid fever" covered several Kirkes febrile described cases ofaccompanied endocarditisbyphenomena were syndromes,inusually stupor and which delirium. related to the consequences of the release of fragmented In 1852, the Englishman William Senhouse Kirkes cardiac vegetations varying sizephenomena into the blood stream, described in cases ofofendocarditis which were and which blocked a vessel far from the heart. This related to the consequences of away the release of fragmented local lesion was theofmorbid to by cardiac vegetations varyingphenomenon size into the referred blood stream, Rudolph "embolism" in from 1858.the According to and whichVirchow blocked as a vessel far away heart. This some authorswasin the the morbid 1860s, the symptoms referred (temperature local lesion phenomenon to by peak, shivering, enlargement) wereAccording due to the Rudolph Virchowspleen as "embolism" in 1858. to "intoxication" by a "morbid poison" present in the some authors induced in the 1860s, the symptoms (temperature blood continuously in thewere abnormal peak, and shivering, spleen produced enlargement) due toendothe cardium. "intoxication" induced by a "morbid poison" present in the Around 1860, the microscopic the blood and continuously produced in observations the abnormalofendothrombi cardium. gradually revealed the existence of numerous "small granulations" vegetations on the valve. At Around 1860, thein microscopic observations of that the time, it was difficult for doctorsthe to say anythingofmore about thrombi gradually revealed existence numerous the nature of these granulations. "small granulations" in vegetations on the valve. At that time, it was difficult for doctors to say anything more about the nature of these granulations.

From "miasmatic diseases" to the germ theory From "miasmatic diseases" to the Until germmicroscopes theory were notably improved in the

1830s, microscopic observations were hardly relevant to substantiate newmicroscopes nosological were entities. Muscaridine wasininvestigated Until notably improved the 1830s, at that time by the Italian Agostino Bassi, whotoshowed by microscopic observations were hardly relevant substantiinoculation experiments into healthy silkworms that a "parate new nosological entities. Muscaridine was investigated asitic causeAgostino of the disease 1970). By at thatfungus" time bywas thethe Italian Bassi,(Foster, who showed by 1840 the theory that someinto human diseases mightthat be caused experiments healthy silkworms a "parinoculation by "microparasites" was to some extent "in(Foster, the air".1970). By asitic fungus" was the cause of the disease 1840 the theory that some human diseases might be caused Copyright 9 1999Academic Press by "microparasites" was to some extent "ininthe All rights of reproduction anyair". form reserved Copyright © 1999 Academic Press All rights of reproduction in any form reserved

4

Although difficult to understand today, a basic distinction was made between contagious diseases, transmissible through close contact between one individual and another, and infection carried by miasmas disseminated through the air from a focus (Delaporte, 1986). Syphilis illustrated the former, malaria the latter. In fact, most diseases associated the two modes of propagation. The germ theory unified the understanding of infection by focusing on a single phenomenon: the actual presence of living germs, which are responsible for the disease. The germ theory rested on the assumption that the active agent of the diseases was a contagium vivurn, reminiscent of Bassi's parasitic fungi. According to Jacob Henle in 1840, a human epidemic would start with germ dissemination in the air (Foster, 1970). The germs could infect a host, multiply, and in turn produce further germs that could spread either by direct contact between persons or by indirect transfer through the air or another means. The germ theory received a major impetus from the study of "fungi" or "parasites", easily visible under the microscope. Thus various "granules", "virus", "ferments", "bacteria" were described (Bulloch, 1938). But, as the new microscopes suddenly enhanced the power of the senses, this knowledge acquired a new meaning. In 1869, during an endocarditis autopsy, the Norwegian Emmanuel Winge noticed "on the aortic valves, grey feltlike masses, resembling pebbles, which were easily detached". Under the microscope, these masses were made up of a fine network of "fibrinous filament". With greater magnifying power, these filaments "appeared to be entangled with microorganisms". Winge admitted that they were "parasitic" organisms which, having entered the bloodstream through a plantar excoriation, were transported to the heart through the veins (Contrepois, 1996). Although not questioning the existence of "parasites", some authors expressed reservations and were inclined to believe that these microorganisms were the result and not the cause of endocarditis--a general debate at the time on the meaning of microorganism findings. How could one prove that microorganisms were crucial for the emergence of the disease? Animal models were decisive in that respect. Returning to the endocarditis, the problem was posed in the following way: in order to give a solid base to Winge's hypothesis, it was necessary to prove that the "germs" had grown in the vegetations on the valves during the patient's lifetime, that they were not just secondary putrefaction agents. It was also important to find out if the infectious agent was the same in all cases. Although all attempts had been inconclusive thus far, in order to prove the case, doctors tried very hard to reproduce the disease (Contrepois, 1995a).

Experimental physiology and experimental pathology Physiology, in the time ofFrangois Magendie in France and Johannes Miiller in Germany, in the early 19th century,

A. Contrepois and A.-M. Moulin

evolved from being a study concerned with organs and other parts serving the animal s o u l - - a discipline closely associated with a n a t o m y - - t o a study of the processes of living bodies (Holmes, 1974, Albury, 1977; Maulitz, 1978; Pickstone, 1981; Lenoir, 1982; Lesch, 1984; Fye, 1987; Geison, 1987; Jacyna, 1988). One consequence of this new concern with living processes and experimental control was that most of the new life sciences were based to an unprecedented extent on experiments on living animals (Rupke, 1987; Tansey, 1989; Cunnigham and Williams, 1992). During the 19th century, Claude Bernard's and Karl Wunderlich's physiological medicine was based on the notion that diseases are the result of a disturbance in the normal functioning of an organ or system of organs, with a wide range from normal to pathological (Wunderlich, 1845; Bernard, 1865). They were generally opposed to the defenders of specific disease entities and a specific cause of disease.

First experimental "infections" The supporters of animal experimentation assumed that there were phenomena which were common to both humans and animals (Bynum, 1990). Experimental pathology was present throughout the 17th and 18th centuries. The Italian Giorgio Baglivi, for example, tried to develop different kinds of "fevers" in order to "better know the essential cause of these fevers". He experimented on dogs and injected in veins different "liquors" until symptoms appeared. The Frenchman Antoine Deidier tried to reproduce the symptoms of plague by injecting animals with the bile of plague victims (Lancereaux, 1872). In the last three decades of the 19th century, experimental pathologists tried to further their knowledge of "spontaneous diseases", by comparing "induced pathological phenomena" with "natural morbid phenomena" (Lancereaux, 1872). Between 1865 and 1868, Jean Antoine Villemin in Paris inoculated tuberculous matter from human cases into rabbits, and showed that the rabbits developed the characteristic tubercles and that the disease, once produced, could be transmitted to other rabbits (Villemin, 1866). But the question of the transmission of tuberculosis in humans was not resolved before the bacilli were discovered by Koch in 1882. Other researchers tried to transmit human infective diseases to animals, with varying levels of success. Confusion often arose because an animal might die from an intoxication of the putrid material rather than from the infection. Between 1863 and 1870, Joseph Davaine in France produced an infectious septicaemia and established the bacilli of anthrax as the cause of the disease. At the same period, Johannes Orth in Germany claimed that he had transmitted human erysipelas to rabbits. Edwin Klebs went further and induced septicaemia with artificial cultures of micrococci from septic infections. Pasteur's demonstration that a pure culture of the anthrax bacillus in an artificial medium would cause anthrax in an experimental animal put the

EARLY HISTORY OF ANIMAL MODELS OF INFECTION

5

finishing touches to the work of Davaine and Koch on the aetiology of that disease (Foster, 1970).

Similarly, different types of bacteria could produce the same disease. This departed somewhat from the theory that a specific germ existed for each infectious disease. Unlike tuberculosis, or cholera (bacilli discovered by Koch in 1884), certain infectious diseases could be caused by a number of different bacteria. This was first recognized in the case of pneumonia, pleurisy, meningitis, angina, septicaemia and endocarditis. This fact encouraged clinicians to distinguish between specific and non-specific infectious diseases. When Koch in 1879 became confident that "the comma bacilli are the constant companions of the choleraic process, and that they are present nowhere else", he aimed to demonstrate that the bacillus was the cause of cholera. Koch recognized the importance of transmitting the disease to experimental animals using a pure culture, as he had done with the tubercle bacillus, but no animals were naturally susceptible to cholera and he had not been able to produce the disease in experimental animals (as was also the case with the leprosy bacillus, discovered by Hansen in 1874, and the typhoid bacillus, discovered by Eberth in 1880).

Medical bacteriology and infectious pathology Pathogenic germs, particularly bacteria, gradually began to be better known in the 1880s thanks to the work of different scientists and doctors across Europe, particularly Robert Koch and others in Germany, and Louis Pasteur and his team in France (Foster, 1970; Baldry, 1976). The microscopic observation of necroptic lesions was no longer at the forefront; what was crucial was to track the microorganisms responsible for the disease in the "live" patient. This new attitude to the disease gave rise to a new clinical pract i c e - - a different kind of interaction with the patient's body, "inhabited" by microscopic germs which circulated and grew inside it. These had to be tracked down by taking samples of blood, urine and pus, and adding them to the culture media. Close collaboration started between laboratory work and medical diagnosis. The affirmation of the presence of pathogenic germs in the blood and their culture in an appropriate medium marked the birth of "medical bacteriology". It was important to detect microorganisms in the blood because the blood was "the main canal of the body", and could distribute germs throughout the organism far from the original focus. Besides, the idea of "cultivating" blood was closely related to the concept of autonomous, live, pathogenic germs which can therefore multiply and be cultivated. The development of the medical practice of sterile sampling evolved as much from new technical and material possibilities as from an increased knowledge of human pathology and medical bacteriology. This was the real birth of "infectious pathology". For example, the invention of an easily sterilizable syringe was a great improvement (Contrepois, 1995b). Sampling for bacterial cultures was gradually standardized in the 1890s and was a good example of the match between a theoretical "revolution" (i.e. the germ theory) and technical innovation (L6wy, 1993). Koch introduced the technique of making thin smears of bacteria containing fluid on glass slides, fixing and staining them, and examining them under high-powered oilimmersion lenses (Brock, 1995). From 1880 onwards, new germs were sought and new diseases identified. Koch considered that to prove that a bacterium was the specific cause of a disease, it was necessary to isolate it in pure culture (in solid medium) and show that it produced the disease in question when injected in animals. In this way, animal models became crucial for the assessment of the germ as a cause of disease.

Specific and non-specific infections The idea that the same germ did not always provoke the same disease was gradually accepted in the 1880s-1890s.

The example of the experimental animal model of infective endocarditis In 1876, Edwin Klebs in Germany developed experimental surgical techniques with the main objective of studying the circulatory consequences of valvular insufficiency (Klebs, 1876). Two years later, Ottomar Rosenbach, a student of Julius Cohnheim, examined the possibility of reproducing endocarditis in animals as well as its likely after-effects (Rosenbach, 1878). He established the first endocarditis animal model: he mechanically induced an injury in a rabbit's aortic valves by pushing a stylet into the carotid artery straight through the left ventricle. When the instrument was carefully sterilized, at autopsy the perforation was either still visible or healed but there was no trace of infective endocarditis. However, when the instrument was covered with septic matter, vegetations and fibrinous deposits formed around the wound. Experimental endocarditis, therefore, was a result of the combination of the physiological model elaborated by Klebs, himself inspired by the Bernardian animal model of experimental physiology, and the infectious animal model of Henle, Koch and Pasteur, which was injected with a pure microorganism in order to observe how an infectious disease was transmitted. Separately the methods were ineffective but together they produced remarkable results. Indeed, the injection of pathogenic germs into the blood was not sufficient to produce the disease. The valves, for their part, had to be damaged, at least slightly, for the bacterial graft to be possible. On the other hand, it seemed that only certain bacteria could be grafted on to the valves. Other doctors, such as Vladimir Wyssokowitsch (1886), Arnold Netter (1886), or Anton Weichselbaum (1885), considerably improved the model. In his experimental model, once the valvular lesion was produced following

A. Contrepois and A.-M. Moulin

6

Rosenbach's technique, Wyssokowitsch injected cultures of specific bacteria into the vein of a rabbit's ear (following Winge's theory). This model, standing squarely at the crossroads of physiological and bacteriological experimental approaches, was very close to the one which is still in use today.

Other non-specific experimental infections

Candida albicans from vaginal thrush was reported by Winckel (1866). But when the fungus was injected into the blood, no vaginal lesion was observed. Colpe (1894)isolated a yeast from the vagina of a patient and directly inoculated it into the rabbit's genital tract. Attempts have also been made to develop a reliable animal model for acute and chronic osteomyelitis. Rodet (1885) and Lexer (1894, 1896) produced experimental bone abscesses in rabbits by intravenous injection of Staphylococcus aureus.

As was the case for infective endocarditis, the aetiological agents of bacterial meningitis were isolated in the last decade of the 19th century. At that time, lumbar puncture in humans was first used both by Heinrich Quincke (Germany) and Walter Wynter (England) in 1891. This technique allowed investigators to establish the bacterial aetiology of human meningitis: pneumococci (cultivated in 1886 by Fraenkel), meningococci (by Weichselbaum in 1887) and Haemophilus influenzae (by Richard Pfeiffer in 1892). Pure germ cultures of various species were inoculated through different routes in animals--mostly rabb i t s - a t the end of the 19th and at the beginning of the 20th centuries. Anton Weichselbaum in 1887 used the subdural inoculation of purulent "meningitic fluid" from deceased patients into animals to provoke experimental meningitis (Weichselbaum, 1887). Experimental meningitis was not always observed after intranasal inoculation (von Lingelsheim and Leuchs, 1906), via the intraperitoneum (Cantani, 1896; von Lingelsheim and Leuchs, 1906), subdural (Bettencourt and Franca, 1904) or intrathecal route (Councilman et al., 1898; Flexner, 1906, 1907) and, in general, meningitis did not occur after injection of bacteria into the intravascular compartment (Wollstein, 1911; Austrian, 1918; Amoss and Eberson, 1919; Idzumi, 1920). Ultimately, the intracisternal route of inoculation, first utilized in 1913 (Dixon and Halliburton), appeared to be the most reliable method for producing experimental meningitis in animals. In the same period, Haymann (1912-1913) demonstrated that the introduction of various bacteria into the middle-ear cavity of guinea-pigs resulted in middle-ear effusion. This effusion was produced experimentally by Beck (1919) in dogs by mechanically obstructing the eustachian tube. Subsequently, a number of investigators reported methods for creating mechanical tubal obstruction in dogs, cats and squirrel monkeys in order to study different aspects of the otitis inflammatory process. In the early 20th century, experimental pneumonias were almost exclusively pneumococcal and were created using direct tracheal or bronchial instillations (Nungester and Jourdonais, 1936). Concerning the early experimental infections of the urinary tract, a mechanical factor of obstruction was acknowledged as also playing a major role in predisposing the infected kidney to severe damage, as demonstrated by Guyon and Albarran in 1890 (Brewer, 1911), and later by Lepper (1921). The first successful infection of rabbits with the yeast

Specific experimental infections Syphilis was the leading venereal disease of the 19th century. Geoffroy Saint Hilaire, a member of the famous zoologist's family, repeatedly tried to inoculate monkeys in order to obtain an experimental disease and observe the results of various modes of treatment and prophylaxis. The many attempts at self-inoculation were provoked by the failure of inoculation in animals (Moulin, 1991). In 1875, Klebs observed a spiral-shaped microorganism in the exudate of a human chancre and for the first time transmitted syphilis to the monkey. In 1881, Haensell transferred syphilis to the rabbit; eye infection resulted in acute keratitis. In 1903, Elie Metchnikoff and Emile Roux successfully inoculated syphilis in both monkeys and apes. Finally, in 1905 Schaudinn and Hoffmann isolated and identified the causative agent, Treponema pallidum, from a human chancre. Rabbit infection inoculated into the testicles imperfectly mimics primary and secondary stages of human syphilis, but much of our current knowledge has emanated from this experimental model (Brown and Pearce, 1920, 1921). The aetiological agent of leprosy was first described in 1874 by Armauer Hansen. Mycobacterium leprae is almost the only bacillus causing disease in humans that has not been successfully cultured. Hansen attempted--without success--to transmit leprosy to a variety of animal species (Hansen, 1880). Other investigators attempted to establish the disease in animals, but their efforts were also unsuccessful (Neisser, 1879). Only recently the tattoo inoculated into the plantar sole has become an interesting model, but the immunological peculiarities of the animal (close to immunological deficiencies) once again provided a model that was very far from the human disease. It is well-known that Pasteur reported the successful transmission of rabies to rabbits in May 1881 and demonstrated by this transmission that the "virus" (never seen by Pasteur) existed in the spinal cord as well as the saliva without one being able to cultivate it. During the next months he enriched the knowledge of the disease with new techniques. He maintained the "virus" by serial passages in rabbits in the laboratory. He developed the technique of intracerebral inoculation which, unlike subcutaneous inoculation, invariably caused infection. He also demonstrated that human brain tissue from rabies cases also contained the "virus" and

EARLY HISTORY OF ANIMAL MODELS OF INFECTION

7

took the first step towards developing an effective vaccine (Moulin, 1991).

Austrian, C. R. (1918). Experimental meningococcus meningitis. Bull. Johns Hopkins Hosp., 29, 183-185. Baldry, P. (1976). The Battle against Bacteria. University Press, Cambridge. Beck, K. (1919). Ueber mittelohrver/inderungen bei experimenteller l~ision der tube. Z. Ohrenheilk. , 78, 83-108. Bernard, C. (1865). Introduction to the Experimental Medicine. Translated by Copley Greene, H. New York. New York, Dover Books, 1957 (original French edition Paris, 1865). Bettencourt, A., Franca, C. (1904). Ueber die meningitis cerebrospinalis epidemica und ihren specifischen erreger. Z. Hyg. Infektionskr., 46, 463-516. Brewer, G. E. (1911). The present state of our knowledge of acute renal infections. J.A.M.A., LVII, 179-187. Brock, T. D. (1995). Robert Koch: A Life in Medicine, p. 94. Sc. Tech. Publishers, Madison, Wisconsin. Brown, W. H., Pearce, L. (1920). Experimental syphilis in the rabbit. Primary infection in the testicle.J. Exp. Med., 31,475-498. Brown, W. H., Pearce, L. (1921). Experimental syphilis in the rabbit. VI. Affections of bone, cartilage, tendons, and synovial membranes.J. Exp. Med., 33,495-514. Bulloch, W. (1938). The History of Bacteriology, pp. 178-201. University Press, Oxford. Bynum, W. F. (1990). "C'est un malade": animal models and concepts of human diseases. J. Hist. Med. Allied Sci., 45,397-413. Cantani, A. Jr. (1896). Wirkung der influenzabacillen auf das centralnerven-system. Z. Hyg. Infektionskr., 23, 265-282. Colpe, J. (1894). Hefezellen als krankheitserreger im weiblichen genitalcanal. Arch. Gynaekol. , 47, 635-645. Contrepois, A. (1995a). Notes on the early history of infective endocarditis and the development of an experimental model. Clin. Infect. Dis., 20, 461-466. Contrepois, A. (1995b). The birth of blood culture. Rev. Praticien, 45, 942-947. Contrepois, A. (1996). Towards a history of infective endocarditis. Med. Hist., 40, 25-54. Councilman, W. T., Mallory, F. B., Wright, J. H. (1898). Epidemic Cerebrospinal Meningitis and its Relation to other Forms of Meningitis. A Report of the State Board of Health of Massachusetts. Wright and Potter, Boston. Cunnigham, A., Williams, P. (1992). The Laboratory Revolution in Medicine, pp. 1-13. University Press, Cambridge. Delaporte, F. (1986). Disease and Civilization. The Cholera in Paris, 1832. MIT Press, Cambridge, Massachusetts. Dixon, W. E. and Halliburton, W. D. (1913). The cerebrospinal fluid I. Secretion of the fluid.J. Physiol. (Lond.), 47, 215-242. Flexner, S. (1906). Experimental cerebrospinal meningitis and its serum treatment. J.A.M.A., 47, 560-566. Flexner, S. (1907). Concerning a serum-therapy for experimental infection with Diplococcus intracellularis.J. Exp. Med., 9, 168-185. Foster, W. D. (1970). A History of Medical Bacteriology and Immunology, pp. 5-8. Heinemann, London. Foucault, M. (1976). The Birth of the Clinic: An Archaeology of Medical Perception. Translated by Sheridan, A. M. Tavistock, London (original French edition, Paris, PUF, 1963). Fye, W. B. (1987). The Development of American Physiology: Scientific Medicine in the 19th Century. Baltimore. Geison, G. L. (1987). Physiology in the American Context 1850-1940. Bethesda, Maryland. Gelfand, T. (1980). Professionalizing Modern Medicine: Paris Surgeons and Medical Science and Institutions in the 18th Century. Greenwood Press, Westport, Connecticut.

Conclusions Up to this very day, all infectious diseases affecting humans are far from having appropriate animal models and, even in those cases where such infections are possible, the symptoms observed in animals and the course of the disease are often different from those encountered in humans (L6wy, 1992, 1995). The bacterial shifts required to make infectious diseases subject to laboratory investigation have reduced the messy clinical reality of an infectious disease, with its wide range of symptoms and individual manifestations, with its regional, seasonal and environmental variations, and often unpredictable outcomes, to the relatively predictable model diseases of laboratory animals infected with specified amounts of standardized and pure bacterial cultures grown on ever more precisely composed substrates under well-controlled conditions (Amsterdamska, 1998). By manipulating bacteria in test tubes and on Petri dishes and by injecting them into animals, bacteriologists and experimental pathologists at the turn of the century were able to study various properties of pathogenic microorganisms, the host's induced immunity and some immunological reactions and pathological changes accompanying individual infection, and the therapeutic efficacy of serum therapy and, later, antimicrobial agents. In all these studies, infectious disease was an artificially transmitted individual e v e n t - - t h e uniform result of an interaction between an increasingly well-characterized microorganism and an increasingly well-controlled animal host (Amsterdamska, 1998). The relationship between human infectious disease and its animal model and the similarities and dissimilarities in symptoms, provide an insight into the remote past of species and their divergences from each other and may give some clues to the history of infectious disease throughout evolution. The study of human immunodeficiency virus (HIV) animal models today provides us with a good example of these speculations and the difficulties involved.

References Ackerknecht, E. H. (1967). Medicine at the Paris Hospital 1794-1848. John Hopkins Press, Baltimore. Albury, W. R. (1977). Experiment and explanation in the physiology of Bichat and Magendie. Studies Hist. Biol., I, 47-131. Amoss H. L., Eberson, F. (1919). Experiments on the mode of infection in epidemic meningitis. J. Exp. Med., 29, 605-618. Amsterdamska, O. (1998). Standardizing epidemics: infection, inheritance, and environment in prewar experimental epidemiology. In: Transmission: Human Pathologies between Heredity and Infection (eds Gaudilli~re, J. p., L6wy, I.) Harvard Amsterdam (in press).

8

Hansen, G. A. (1874). Undersegelser angaende spedalskhedens arsager. Nors k Magazin Laegevidenskaben , 3, 1-88. Hansen, G. A. (1880). Studien fiber Bacillus leprae. Virchow's Arch. (Cell Pathol.), 79, 32-42. Haymann, L. (1912-13).Arch. Ohrenheilk, 90, 267. In: Friedmann, I. (1955). The comparative pathology of otitis media: experimental and human. I. Experimental otitis of the guinea pig. ]. LaryngoL Otol., 69, 27-50. Holmes, F. L. (1974). Claude Bernard and Animal Chemistry: The Emergence of a Scientist. Cambridge, Massachusetts. Idzumi, G. (1920). Experimental pneumococcus meningitis in rabbits and dogs. J. Infect. Dis., 26, 373-387. Jacyna, L. S. (1988). The laboratory and the clinic: the impact of pathology on surgical diagnosis in the Glasgow Western Infirmary, 1875-1910. Bull. Hist. Med., 62, 384-406. Klebs, E. (1876). Ueber operative Verletzungen der Herzklappen und deren Folgen. Prager Med. Wochenschr., 1, 29-36. Lancereaux, E. (1872). De la maladie expdrimentale comparde ~ la maladie spontande, pp. 5-6. Parent A., Paris. Lenoir, T. (1982). The Strategy of Life: Teleology and Mechanism in 19th Century German Biology. Dordrecht, reprinted Chicago (1989). Lepper, E. (1921). The production of coliform infection in the urinary tract of rabbits.J. Pathol Bacteriol., 24, 192-204. Lesch, J. (1984). Science and medicine in France: the emergence of experimental physiology, 1790-1855. Cambridge, Massachusetts. Lexer, E. (1894). Zur experimentellen erzeugung osteomyelitischer herde. Arch. Klin. Chir., 48, 181-200. Lexer, E. (1896). Experimente fiber osteomyelitis. Arch. Klin. Chir., 53,266-277. L6wy, I. (1992). From guinea pigs to man: the development of Haffkine's anticholera vaccine. J. Hist. Med. Allied Sci., 47, 270-309. L6wy, I. (1993). Medicine and change. In Medicine and Change: Historical and Sociological Studies of Medical Innovation (ed. L6wy, I.), pp. 1-20. INSERM, Paris. L6wy, I. (1995). Whose body? The experimental body and 20th century medicine. Workshop on the body in twentieth century medicine, Manchester, 1995. Maulitz, R. (1978). Rudolph Virchow, Julius Cohnheim and the program of pathology. Bull. Hist. Med., 52, 162-182.

A. Contrepois and A.-M. Moulin

Maulitz, R. (1987). Morbid Appearances: the Anatomy of Pathology in the early 19tk century. University Press, Cambridge. Moulin, A.-M. (1991). Le dernier langage de la mddecine. Histoire de l'immunologie de Pasteur au SIDA, pp. 37-38. PUF, Paris. Neisser, A. (1879). Zur aetiology der lepra. Breslauer Artz. Z., 1, 200-202. Netter, A. (1886). De l'endocardite vSg&ante d'origine pneumonique. Arch. Physiol., 106-161. Nungester, W. J., Jourdonais, L. F. (1936). Mucin as an aid in the experimental production of lobar pneumonia.J. Infect. Dis., 59, 258-265. Pickstone, J. V. (1981). Bureaucracy, liberalism and the body in post-revolutionary France: Bichat's physiology and the Paris School of Medicine. Hist. Sci., 19, 115-142. Rodet, A. (1885). l~tude physiologico-pathologique exp&imentale sur l'ost~omySlite infectieuse. C. R. Acad. Sci., 99, 569-571. Rosenbach, O. (1878). Ueber artificielle Herzklappenfehler. Arch. Exp. Patkol. Pkarmak. , 9, 1-30. Rupke, N. A. (1987). Vivisection in Historical Perspective. London. Tansey, E. M. (1989). The Wellcome physiological research laboratories 1894-1904: the Home Office, pharmaceutical firms, and animal experiments. Med. Hist., 33, 1-41. Villemin, J. A. (1866-1867). Etude sur la tuberculose: preuves rationnelles et expdrimentales de sa spdcificitd et de son inoculabilitd, Bulletin de l'Acad~mie de mSdecine, f. 32, p. 152, Paris. von Lingelsheim, J. M. and Leuchs, S. A. (1906). Tierversuche mit dem Diplococcus intracellularis (meningococcus). Klin. Jahrb., 15,489-506. Weichselbaum, A. (1885). Zur Aetiologie der akuten Endokarditis. Wien. Med. Wochenschr., 35, 1241-1246. Weichselbaum, A. (1887). Ueber die aetiologie der akuten meningitis cerebrospinalis. Fortschr. Med., 5,573-583. Winckel, F. (1866). Ueber die bedeutung pflanzlicher parasiten der scheide bei schwangeren. Berl. Klin. Wochenschr., 3, 237-239. Wollstein, M. (1911). Influenzal meningitis and its experimental production. Am. J. Dis. Child., 1, 42-58. Wunderlich, K. (1845). Das Verh~iltniss der physiologischen Medicin zur ~irtzlichen Praxis. Arch. Physiol. Heilkunde , 4, 1-13. Wyssokowitsch, V. (1886). Beitr~ige zur Lehre von der Endocarditis. Arch. Pathol. Anat. Phys., 103, 301-332.

Chapter 2

General Methodologies for Animal Models M. S. Rouse and W. R. Wilson

The ideas in this chapter are provided as a framework upon which to build a detailed protocol to be used to conduct investigations in infectious diseases using animal models. The resources we have listed were chosen because they provide basic information that we believe is a good foundation for experimental design and yet encourage adaptation to different investigators' interests or needs. When designing an experiment using an animal model, one may focus on the similarities of the animal model to the human disease; however, one must also be aware of the inherent differences between animal models and making observations in humans. We want to design experiments that capitalize on these similarities and avoid unknowingly having differences influence the experimental data or its interpretation. One must be aware of the many limitations of using laboratory animals to model infectious processes. Laboratory animals often have a limited genetic diversity; one must recognize that observations made in a group of nearly isogenic hosts with a single or few strains of a specific pathogen may not represent the actual disease process seen in genetically diverse hosts (patients) with a genetically diverse group of pathogens (naturally acquired). This may be further complicated by clinical designations of groups of closely related bacterial species such as viridans streptococci or coagulasenegative staphylococci. Some laboratory animals do not tolerate antimicrobial therapy well and the host response to a particular antimicrobial or carrier agent may influence or obscure the results of the experiment. The reader is referred to Chapter 9 for a more detailed discussion of this topic. Many animals must be surgically or medically altered to reproduce a disease s t a t e - - t h i s is both good and bad. We can closely control the alteration so that all laboratory animals are altered equally, but one must acknowledge and understand how any such alterations may influence the disease process being studied. Using animals as research subjects also offers several advantages over similar studies in humans. Small mammals have accelerated life cycles. This can be used to reduce the time and cost of compiling experiments. We can observe large numbers of identical subjects easily; this allows us to generate adequate data to perform meaningful statistical analysis. We can closely control many important variables in each experiment, such as the timing of onset of infection Handbook of Animal Models of Infection

ISBN 0-12-775390-7

and treatment; this allows us to eliminate confounding influences that are part of making experimental observations in humans. The pathophysiology of many infectious processes is very similar to the human disease; we can observe infectious processes associated with significant morbidity and mortality in animals that would be unacceptably dangerous to human subjects. Animal models may be the only effective method of study for conditions which are uncommon in human beings. Models of infection in animals are often used to compare the efficacy of novel antimicrobial compounds to that of currently available antibiotics, to study pathogens with novel patterns of antimicrobial resistance, or to study the pathophysiology or prevention of specific infection. These data may then be used to design further studies, often as a prelude to human studies. Animal models of infection are important tools used to study different aspects of infectious diseases because they provide all the factors involved in the complex host-pathogen interactions. The host immune response, the pharmacokinetics of antimicrobial exposure and pharmacodynamic response, and the influences on the host of any bacterial toxins are important aspects of infections that are not currently part of any in vitro testing systems. Key to the success of any research endeavor is organization. The scientific method requires that prior to an experiment, a hypothesis is clearly articulated (with the hypothesis in the form of the null hypothesis), an experimental test of the hypothesis is designed, the experiment is performed (with accurate record-keeping), and then the experimental results are compared with the hypothesis. This basic idea is worth repeating here because it has been our observation that many challenges experienced doing an animal experiment are related to departing from this basic concept. Animal experiments start out as a question. Information to consider when developing a hypothesis includes the current literature on the topic, and in vitro activity, and in vivo pharmacokinetics (if known) of antimicrobials studied. Comprehensive literature searches can be performed in little time and are a prerequisite to designing an animal model of infection experiment. Published information on a specific animal model is an efficient way of becoming aware of specific problems, issues, and concerns other investigators have experienced doing similar experiments. Copyright 9 1999Academic Press All rights of reproduction in any form reserved

10

The electronic environment available in most research institutions provides ready access to current literature on the topic being investigated. Electronic mail is an efficient low-cost mode of communication among the global community of scientists and is a valuable resource for almost any research laboratory. The internet may also be a source of specific information. Bear in mind that information published on web sites is often not subject to peer review, but none the less these are sources of information that may be helpful. Knowledge of the in vitro activity of antimicrobials being studied, the mechanism of antimicrobial activity, and any mechanisms of resistance among the bacteria being studied is needed to design a hypothesis-driven protocol. If the study is of community-acquired pathogens, I prefer to perform susceptibility testing in our laboratory with a collection of clinical isolates from our institution. This is useful if one is studying an organism with a specific antimicrobial susceptibility to determine the frequency of the specific antibiogram. If the focus of the experiment is a particular species, knowing the in vitro activity of the antibiotics to be studied will allow one to pick an organism with a susceptibility pattern representative of the collection for study in vivo. Issues that need to be considered when designing an experiment to test the hypothesis should include the ethical considerations regarding the use of laboratory animals, proper care and use of animal subjects, an understanding of the pathophysiology of the infection in humans, pathophysiology of the specific organism in the specific animal host used, pharmacology of any medications used in human and animal subjects, technical expertise in any medical or surgical procedures on the animal subjects, biosafety responsibilities of working with infectious agents, availability of any support services that may be needed, and costs of materials and services needed. The lay press regularly debates ethical considerations regarding the use of animals for medical research. Primary ethical considerations regarding the use of laboratory animals for medical research are a sense of stewardship for the animals being used and respecting institutional and legal regulation of the care and use of laboratory animals. Is each experiment designed to test the hypothesis? Is the statistical analysis strong enough to justify the use of animal subjects? Are the physical needs of the animals included in the protocol? Virtually every modern country in the world has legal regulation of the care and use of animals used for medical research. It is important that all investigators using laboratory animal subjects work within the guidelinesset forth by our governments and scientific community. These guidelines not only contribute to the scientific merit of the research, but also promote good will and trust among fellow researchers. One needs to understand the clinical features of an infection in order to model it. Few animal models are exact duplicates of human infection. Investigators need to know what features of the human infection are or are not present

M . S . Rouse and W. R. Wilson

in the model used and how this affects the interpretation of the results. Studies to document similarities and differences between the pathophysiology of an infection in humans and in the model being used should be part of any animal model of infection protocol. This may be histological studies to compare features of the modeled infection with the human infection, blood chemistry studies, radiological studies, or microbiological studies. Knowledge of the pathophysiology of the specific organism in the specific animal host will help determine which animal species to use in the infection model. In general, we prefer to use the smallest practical species that models the important features of the infection being studied. The smallest species available is however not always the most appropriate. We previously used mice to model group A streptococcal necrotizing fasciitis; this was attractive for many reasons, one of which was the availability of effective isolation boxes for housing the mice. There is now evidence suggesting that mice are less susceptible to the pathology associated with group A streptococcal pyrogenic exotoxin than rabbits (Dinges and Schlivert, 1997). Rabbits may be more appropriate to model this infection. Conversely, we have performed clinical trials with a mouse model of Haemophilus influenzae type b pneumonia, comparing the efficacy of clarithromycin with other antimicrobials. One of the clarithromycin metabolites produced in humans acts synergistically with clarithromycin against H. influenzae in vitro. This metabolite is not produced in rodents or lagomorphs. We chose to co-administer the metabolite in our trials in mice, resulting in ratios of the antibiotic and the metabolite in mice serum similar to that in humans. The decision of which species to use depends on how well the selected species used models the pathophysiology or the infection being modeled. The pharmacology in human and animal subjects of any medications used in the study needs serious consideration when performing clinical trials of antimicrobials in animals. Small animals metabolize most pharmaceuticals more rapidly than humans. This may influence the outcome of treatment that depends on the concentration of antibiotics in serum. If the aim of the study is the influence of pharmacokinetics on outcome of an infection, the pharmacokinetics can be altered, for example using computer-controlled infusion pumps. If the aim of the study is to compare the antimicrobial efficacy of two or more antimicrobials in an animal with an accelerated metabolic rate, a more frequent dosing schedule may better imitate treatment in humans and may be more appropriate. Pharmacokinetic differences may be further complicated by the use of antimicrobial formulations of two compounds where optimal antimicrobial activity depends on the ratio of the two compounds in situ. Another difficulty can be choosing a route of administration of medication. Repeated intravenous access can be a challenge, as can be oral administration with some animal species. We approach this dilemma by using an alternative route of administration that produces similar pharmacokinetics. Serum concentration of the compounds is often the

GENERAL METHODOLOGIES FOR ANIMAL MODELS

priority in most models and needs to be monitored. Pharmacokinetic differences between human and animal models may be the most perplexing aspect of a study design and data interpretation. Chapters 10 and 11 provide a detailed discussion of pharmacokinetics in animal models of infection. Expertise at working with animals (handling and surgical manipulations) can be gained by experience, most easily from others who have that experience. There are many investigators actively using animal models of infectious diseases who are willing to share their experience with other scientists. Many of these people have kindly contributed to this text. The European Network for the Study of Experimental Infections and the European Society for Clinical Microbiology and Infectious Diseases hosts the International Symposium on Infection Models in Antimicrobial Chemotherapy. This organization is a rich source of information for anyone designing, performing or interpreting the results of experiments using animal models of infection. Read their publications, participate in scientific conferences where they are presenting, ask them questions. Scientists using animal models of infections need to understand the basic care of any laboratory animal being utilized. Laboratory animals may become ill from a variety of veterinary maladies. Preventing and recognizing illnesses if they arise is important because they may influence the results of an experiment or they may spread throughout the animal housing facility, possibly wasting valuable laboratory resources. Information on the care and use of laboratory animals can be found in this handbook. Each investigator is responsible for the biological containment of pathogenic bacteria and of infected animals. These responsibilities need to be addressed specifically in each protocol. Biological containment can be a challenge when infected animals are housed in the same room with animals from several different laboratories. The availability of any support services utilized in an experiment needs to be considered in the design of the experiment. Rarely are patient care facilities available for animal studies, especially infected animal studies. Expertise in several areas besides infectious diseases is required to complete an experiment modeling an infectious disease. Colleagues in other medical and surgical specialties can also be a valuable source of information on the design and interpretation of animal models of infection. I urge you to consult with them if their expertise may be helpful to you. Communication skills to convey ideas to funding sources, the scientific community, and regulatory agencies are needed. Technical expertise in handling animals, performing laboratory analysis, and performing statistical analysis are important. A team approach is the obvious answer, but it requires management skills to coordinate the efforts of the research team. Management of costs of materials and services used for each experiment needs to be addressed in the protocol. Two aspects of laboratory finances that continue to astound are the high cost of biomedical supplies and the variability of

11

the cost of some research supplies. Imagination and regular assessment of how laboratory resources are utilized are the only recommendations I can offer to deal with this issue. Ideas such as autoclaving non-sterile pipette tips for less than the cost of sterile pipette tips, or reducing polymerase chain reaction (PCR) mixture volumes to save on the cost of expensive enzymes need to be solicited from the lab staff. The variability of the cost of graphics presentations is often greater than 10-fold between different vendors. We value the work of graphics professionals depicting our scientific data in an attractive manner, but excellent presentations can also be prepared with a desktop computer. Statistical analysis must be designed prior to collection of data to avoid bias in the decision of which statistical methods to employ. The experimental protocol needs to specify what type of descriptive statistics will be used and what statistical tests of hypothesis will be used to allow the investigator to choose statistical methods based on statistical principles without knowledge of any experimental results. How many animals do I need to use in the study? What endpoint (mortality, infection site sterility, or actual quantitation of bacteria at the infection site) do I study? The answers are a balance of what type of data best addresses the hypothesis, what differences (if they exist) are clinically significant enough to detect, and what resources one intends to dedicate to addressing the hypothesis. One obvious pitfall to avoid is choosing to measure continuous data when nominal data best address the hypothesis in order to conserve resources. The investigator must also decide on what differences are clinically significant. Some issues I consider when deciding what is clinically significant are the extent to which resolving the infection is influenced by factors other than the independent variable and resources available. When several factors contribute to the resolution of an infection, small differences may not be significant enough to warrant use of lab resources to detect. As examples, an immune response significantly augments antimicrobial activity in situ in pneumococcal pneumonia, or some bone infections are treated with aggressive surgical intervention along with appropriate antimicrobials. Conversely, if resolution of the infection is primarily a function of antimicrobial activity, small differences may have more clinical significance, i.e., as in experimental endocarditis, where an immune response may be less important than bactericidal antimicrobial therapy in resolving the infection. It is also important to discuss what the investigators feel is clinically significant and why, in any reports or manuscripts. Determining the actual number of subjects needed is not complicated after one has resolved the aforementioned concerns. The reference I use most often is the CRC handbook of tables for probability and statistics (Cochrane and Cox, 1957). Tables of sample sizes needed to provide specific power to reject the null hypothesis given the variability of the data of different types of data are listed. But how can we design the statistical analysis when we need to know the variability of the data? You must estimate the variability. Review prior experience--yours and o t h e r s - - a n d esti-

12

mate the variability. There is a certain joy in being asked by a statistician for your best guess of variability upon which statistical analysis will be based. When the data are collected, tests of hypothesis can be done. One method of comparing our experimental observations with our hypothesis is by statistical analysis. We regularly rely on current literature and the services of a professional statistician for information on statistical analysis. Prospective clinical trials in animals are designed to address a specific hypothesis with the lowest number of specimens needed to test the hypothesis adequately: the sample size is limited. Continuous data is the type of data often generated in animal models of infections for chemotherapy and is compared by hypothesis testing. I will offer some considerations on the analysis of this type of data that are generalizations intended to be a starting point for designing statistical analysis. Detailed analysis needs to be individualized for each protocol. Descriptive statistics for relatively small amounts of data are some measure of central tendency and variability. The mean or median is often used to describe data. I prefer the median as it is less influenced by data extremes (outliers) and biological data is frequently non-gaussian. There are several measures of variability commonly u s e d - - r a n g e , standard deviation, or estimate of percentiles. The range gives no information on the distribution of data in the sample; the standard deviation is designed to give a measure of distribution, but only if the data is symmetrically distributed within the range and that is rare in biological systems. I prefer the estimate of percentiles as a measure of variability of continuous non-gaussian data as it provides a measure of variability that reflects distribution, whether gaussian or non-gaussian. Another valuable descriptive statistic is the "eyeball statistic," a scattergram of the raw data. Simply looking at a graphical depiction of the data to give a different perspective than just knowing the numbers can provide valuable insight. We often use scattergrams along with tables in presentations to display the data. Tests of the hypothesis for continuous, non-gaussian data among two samples with a single independent variable are limited. Wilcoxon's signed-rank test is appropriate. This non-parametric analysis offers the advantage of accommodating continuous measurements from sterile cultures to

M . S . Rouse and W. R. Wilson

death from infection, with little power of detection lost if the data are evenly distributed. If bacterial quantification is an endpoint, sterile cultures can be accommodated in this test by assigning them all an equal value less than the lowest positive culture result. Subject mortality is not uncommon when modeling infectious diseases: if mortality is not associated with an independent variable, it is probably not statistically significant. If mortality is associated with an independent variable, it may be due to lack of clinical efficacy or secondary to toxicity (physiological or an alteration of normal flora in the host) or of the compound or its solvent. These observations need to be addressed when they occur. Another dilemma often encountered is extreme variability of a few data points (outliers). This is understandable when a test system involves one biological system living within another biological system, but data cannot be excluded from analysis except for sound scientific reasons. Designing monitors into a protocol such as surveillance cultures, therapeutic monitoring of antimicrobial levels, radiological exams, or other appropriate test results can be very helpful when interpreting data. Another test of hypothesis stressed by professional statisticians is worth mentioning: consider the data and conclusions and decide "does this make sense?" If your conclusions do not pass the "non-sense test", an inappropriate test (laboratory or statistical) may have been used or you may have a very novel observation. There is no right design of any animal model of infection experiment. All approaches have strengths and limitations that we need to understand to insure that our data and data analysis specifically address the query in an unbiased manner.

References Cochran, W. G., Cox, G. M. (1957). Experimental Designs, 2nd edn, pp. 24-25. John Wiley, New York, NY. Dinges, M. M., Schlivert, P. M. (1997). Comparison of mouse and rabbit models of human toxic shock syndrome. In Abstracts of the 97tk Annual Meeting of the American Society for Microbiology, abstract B-406. American Society for Microbiology.

Chapter 3

Ethics Committees in Europe - - A n Overview P. de Greeve and W. de Leeuw

Introduction In Europe, over the last few decades, the public attitude towards the use of animals in procedures has evolved. As a result, legislation aimed to protect laboratory animals has been issued on a national as well as on an international level. The first European legislative document aimed to protect laboratory animals, the Convention for the Protection of Vertebrate Animals used for Experimental or other Scientific Purposes (ETS 123), was issued in 1986 by the Council of Europe. The Council of Europe was set up in 1949 to enable the governments of European states to co-operate: to achieve a greater unity between its members for the purpose of safeguarding and realizing the ideals and principles which are their common heritage and facilitating their economic and social progress. Amongst these ideals and principles, respect for animals is undoubtedly one of the obligations on which the dignity of the European citizen is based. Even in the 1960s the Committee of Ministers realized that the promotion of human rights and fundamental freedom advocated in the organization's statute was inextricably linked to recognition of the intrinsic value of animals. At present, in most member states public concern for animal welfare is so strong that governments are under pressure to take legislative action. In 1986, after several years of consultation, the then 26 member states of the Council of Europe agreed on the Convention ETS 123. The fundamental principle of this Convention reads as follows:

while accepting the need to use animals for scientific and other purposes, everything possible should be done to limit the use with the ultimate aim of replacing experiments, in particular by alternative methods. The Convention applies to any animal intended for use in any experimental or scientific procedure where that procedure may cause pain, suffering, distress or lasting harm. It does not apply to any non-experimental agricultural or clinical veterinary practice. The Convention contains several provisions aimed at replacing, reducing and refining animal use. ..

Handbook ofAnimal Modelsof Infection ISBN 0-12-775390-7

The Council of Europe cannot impose rules on its member states, but it can achieve its objectives backed by the following legal instruments: recommendations--often referred to as soft l a w - - a n d conventions--treaties concluded between states. The member states are not legally obliged to sign a convention. However, once a state has signed and ratified--its parliament has approved the i n s t r u m e n t - - a n d the convention has become effective, the State will be legally bound under international law to implement that convention. Although the Convention has not added much to the national legislation that already existed in some member states in 1986, adoption of the Convention was a great step forward. Indeed, this Convention represents a series of principles and regulations, which after eight years of research and negotiations were finally found acceptable by governmental experts, delegates from animal welfare organizations, scientific researchers and representatives of" directly concei'ned industries, These principles and regulations constitute a European-wide accepted basis for improvements. The second European document is the Directive for the Protection of Vertebrate Animals used for Experimental and other Scientific Purposes (86/609/EEC), which was inspired by the Convention. However, the spirit of the two texts appears to be different in that the Convention gives priority to important principles such as animal rights and human needs whereas the main concern of the Directive is to harmonize national laws in order to avoid any distortion in the internal market. According to the Convention and the Directive, member states have established procedures whereby experiments themselves or the details of persons conducting them are notified in advance to the authority. In addition, each animal experiment must be especially declared and justified to, or specifically authorised by, the responsible authority, if the animal will or may experience severe pain which is likely to endure. Member states have implemented these provisions in various ways. In many institutions an animal care and use committee, an animal care committee or an animal procedure committee has to advise the authority on the admissibility of the animal experiment. Such a committee primarily considers the design of animal experiments themselves and their Copyright 9 1999Academic Press All rights of reproduction in any form reserved

14

execution, including the care and accommodation of animals before, during and immediately after the experiment. In addition, some committees will also provide advice on ethical aspects of the use of laboratory animals.

Current situation With respect to this overview, an enquiry has been made into the current situation in the member states of the Council of Europe by posing the following questions: 9 Is animal experimentation to be justified by a (scientific) committee? 9 Is animal experimentation to be justified by an ethical review committee? 9 If so, is there a legal basis for such a committee and is any detailed information on the organization of such a committee available?

P. de Greeve and W. de Leeuw

experiments and to specific species and numbers of animals. This authority, set up according to the Animal Experiments Act, is headed by a board of 11 members. This board consists of representatives of research organizations, the government, the pharmaceutical industry, animal protection organizations and representatives of organizations combating diseases. A member of the Animal Ethics Committee set up by the Animal Welfare Act is also a member of the Board of the Animal Experiments Inspectorate. This Animal Ethics Committee has stated that in principle basic research must be of real or essential benefit. The Board can refuse to give a licence to perform experiments that are n o t - - i n the wording of the law--considered to be of real or essential benefit. This, obviously, is a rather vague statement, but it is a legal basis for taking into account ethical considerations when deciding on an application for a licence to perform animal experiments.

Finland Belgium

In Belgium (Odberg, personal communication) in 1994, the Deontological Committee was created. This committee comprises 19 people, appointed on the basis of their expertise in the field of animal experiments, alternative methods, animal welfare and protection or ethical assessment. On request or on its own initiative, this national committee could provide the Minister with recommendations on animal experiments or the use of alternatives. Currently, a provision is in preparation providing local ethical review committees with a legal base. Animal experiments must be approved by these committees before experiments can be undertaken.

Czech Republic

In the Czech Republic (Sovjak, personal communication), experiments on live animals have to be approved by a professional (scientific) committee. A legal basis for approval is provided by the Animal Protection Act 246/1992 and it is further elaborated in the proposed regulations concerning protection of vertebrate animals in experiments. The provisions of the European Convention ETS 123 as well as of the European Directive 86/609/EEC will be implemented. It is expected that these regulations will enter into force on 5 February 1997. From that time, animal experimentation must be justified by an ethical review committee.

Denmark

In Denmark (Kjaersgard, personal communication), a licence to perform experiments on animals is given by the Animal Experiments Inspectorate to specific types of

In Finland (Rantam~iki, personal communication), according to the Statute on Animal Experimentation, establishments performing animal experiments must form a committee of animal experimentation. A prime function of the Committee is to handle all experimental plans and to decide unanimously on the classification of the animal experiment. There are two classes of animal experiments depending on the degree of suffering, pain or distress which might be imposed on the animal. The local committee has the right to give the experimenter the licence to perform experiments that cause minor suffering, distress or pain. If an experiment might cause severe distress, suffering or pain, then the committee sends the application to the Provincial State Office, which has the authority to grant licences for these types of experiments. There is also special legislation regulating experiments with transgenic animals: the Gene Technology Act and, in particular, the Gene Technology Decree. According to this legislation, the Board for Gene Technology and the Advisory Board for Biotechnology were set up, both focusing particularly on the ethical considerations of biotechnology.

France

In France (Mahouy, personal communication) authorization is given to those responsible for experiments and who perform experiments on animals. There is no legal obligation to submit research projects and protocols for experiments on animals to a scientific or ethical committee. However, in practice, most experiments must be assessed and endorsed by a scientific committee, since most are financed by ministries or major research bodies. Most experiments performed in the industry must either fulfil the regulatory requirements or be carried out in accordance

ETHICS COMMITTEES IN EUROPE--AN OVERVIEW

with good laboratory practice. Even though they are not legal instruments, ethical committees are increasingly being set up on the initiative of scientists. In general, they include one or two persons who are not in the employ of the establishment and who are not scientists (lay persons).

Germany In Germany (Wille, personal communication), the authorities responsible under the regulations are responsible for implementing the Animal Protection Act and any regulations adopted on the basis thereof. This Animal Protection Act demands ethical justification of proposed experiments. Accordingly, each authority has appointed one or more committees to assist the authority responsible in deciding whether to authorize experiments on animals. These committees include participants with a knowledge of veterinary medicine, medicine or any other natural science. They also include members proposed by animal protection organizations. At committee meetings, the scientific and ethical aspects of animal experiments are discussed. The results of a questionnaire which was completed in 1994 showed that most committees work well together with little resentment between scientists and animal welfare representatives. Ethical aspects have increased in the judgement of applications in recent years; 0-5% of applications are rejected; 2-68% were returned to the scientists for improvement; 2-38% were recommended to be allowed with restrictions, and 18-96% are recommended for approval without any restrictions (Gruber and Kolar, 1997).

Greece In Greece (Kostomitsopoulos, personal communication), the national legislation aiming to protect laboratory animals is in accordance with the Convention ETS 123 and the European Directive 86/609/EEC. Animal experiment committees are not required in Greek law. In each prefecture, the Veterinary Directorate is responsible for the scientific and mainly the ethical consideration of experimental procedures. If necessary, the Veterinary Directorate can ask for the opinion of other scientists who are experts in the field concerned. In some cases (for example, in hospitals or institutions), where scientific committees exist because of intramural regulations, these are not specifically for animal experiments.

Italy In Italy (Guaitani, personal communication), all projects involving experiments on live vertebrate animals must be punctually justified by the scientists responsible for submitting the proposals. Detailed information on the scientific background of each project, its objectives, treatment and

15

procedures, animal species, number of staff involved and their experience and education and veterinarian in charge have to be supplied to the Veterinary Department of the Italian Ministry of Health. It must also be documented that valid alternatives to the use of living animals are not available. A special Commission of the Ministry of Health revises all experimental projects. The approval is in force for 3 years. One year before the end, the scientist responsible for the project has to submit a request for renewal. Research projects involving cats, dogs or primates require special authorization. All projects involving painful procedures or stress to animals (e.g. experiments without anaesthesia) need a special permit. A Special Commission at the National Institute of Health (Istituto Superiore di Santa, Roma) is in charge of the critical revision of such projects, their approval or rejection. Following this approval the Italian Ministry of Health authorizes the exemption (in deroga) of such projects from the respective Articles of the Law (Decrato Legge 116). At present, Institutional Ethical Committees are neither defined nor requested by law. However, many statements in law suggest the need for ethical consideration in study planning and in issuing protocols. In many institutes, on a voluntary basis, Institutional Animal Care and Use Committees and Ethical Committees provide consultation and advice on all ethical aspects of proposed projects and procedures, including suggestions for revision, before submitting to the Ministry of Health. The above-mentioned Special Commission may be considered to be the official National Ethical Committee. It was constituted by special decree of the Ministry. Representatives of animal protection leagues also participate in this committee. This commission is responsible for review and official approval of these special projects and for their acceptance from an ethical point of view.

The Netherlands In The Netherlands, research plans must be recommended by an ethical review committee, which has to consider the potential benefit from experiments and whether this justifies the distress caused to the animals which are to be used. If an ethical review committee has given a negative recommendation to the licensee, that animal experiment may not be conducted unless the central animal experiments committee has reversed a previous negative recommendation. The structure of an ethical review committee is defined in the Experiments on Animals Act 1996, which requires there to be at least seven members, including equal numbers of experts in animal experiments, alternative methods, animal welfare and ethical assessment. Three participants, including the chairperson, should not be employed by any licence-holder applying to the committee. Ethical review committees must be recognized by the Minister, who will be

16

advised by the Central Committee on Animal Experimentation. All committees are required to submit an annual report to the Minister. For several years now, training courses have been organized for members of ethical review committees. In 1996 an association of ethical review committees was founded. In 2000, the functioning of the ethical review committees will be evaluated by the Inspectorate. If any biotechnological techniques are to be used, a second piece of legislation applies. Based on the assumption that biotechnology applications in animals yield problems, irrespective of how inconvenient their purpose may be, the Animal Health and Welfare Act prescribes an ethical review to assess the acceptability to society of the application. No animal experiment involving biotechnology may be conducted without a licence issued by the Minister of Agriculture, Nature Management and Fisheries. Before the Minister decides, he or she will be advised on each licence application by the national Committee on Animal Biotechnology. A licence will only be issued if the Minister is of the opinion that the biotechnological techniques concerned do not have unacceptable consequences for the health or welfare of animals and there are no ethical objections to the actions. The licensing procedure is public. The committee's recommendations contribute to public opinion and give greater structure to the public debate that may take place in the context of the licensing.

P. de Greeve and W. de Leeuw

fled by the national Advisory Committee to the General Director of Veterinary Services. There is not an ethical review committee on a national level.

Slovenia In Slovenia (Pogacnik, personal communication), the Law on Animal Health contains a chapter dealing with animal experiments. The provisions are elaborated in detail in the Directive on the Conditions for Issuing Licences for Experiments on Animals for Scientific and Research Purposes. In one of the institutions which is most involved in animal experiments, an Animal Experiments Board operates. This board includes an ethics committee whose members are recognized domestic and foreign experts. The Committee considers every request of the Board for research work and later controls all research papers and postgraduate theses which use animals or parts of animals in experiments. A research project can only be approved with the consent of the ethics committee. New legislation is in preparation which will contain the provisions of the European Convention ETS 123. This legislation will include the founding of a National Ethics Committee to deal with all projects which include the use of animals in experiments. Research projects will then only be approved with the consent of this committee.

Norway Sweden In Norway (Tore Wie, personal communication) all animal experiments are approved by the responsible local laboratory animal science specialist under the surveillance of the Norwegian Animal Research Authority (NARA). NARA consists of seven members, representing the scientific community and the Norwegian animal welfare organization as well as the judiciary. NARA is more or less in itself an ethical review committee.

Poland In Poland (Pisula, personal communication) experiments to be carried out on animals are discussed by local scientific committees. In some scientific institutions, ethical committees were appointed in order to assess experiments carried out on animals. At present there is no legal basis for ethical committees, but a proposal for such legislation has been already submitted to the Polish parliament.

In Sweden (Stagh, personal communication), according to the Animal Protection Act (1988), all experiments using animals are subject to ethical review. The care and accommodation before, during and immediately after experiments is to be considered. This review is made by local committees. These include laypeople, research workers and representatives of the personnel who handle laboratory animals. Decisions made by a local ethical committee approving or recommending the rejection of animal experiments may not be appealed against. Decisions to approve experiments are valid for not more than3 years. Local ethical committees report to the National Board for Laboratory Animals decisions relating to animal experiments in which animals may suffer severe pain which is likely to endure, or to animal experiments which are of fundamental importance from an ethical point of view.

Switzerland Portugal In Portugal (Gouveia da Veiga, personal communication), in accordance with the Act for the protection of animals used for experimental or other scientific purposes, each project which includes animal experimentation must be justi-

In Switzerland (Bernard-Summermatter, personal communication) the Swiss Academy of Medical Sciences and the Swiss Academy of Sciences formulated Ethical

Principles and Guidelines for Scientific Experiments on Animals which serves as a code of conduct for all scientists and members of allied professions practising in

ETHICS C O M M I T T E E S IN EUROPE m AN OVERVIEW

Switzerland. In addition, there are academic bodies at the different universities. They have to approve experiments on animals at their institutes before a cantonal authorization can be requested. The academic body will not support experiments on animals which violate the ethical principles and guidelines of the Swiss Academy of Science. The Swiss parliament has also decided to create in the near future a new ethical committee to evaluate and to inform the Federal Council and the general public about the developments in gene technology, especially about genetically modified animals and plants, biodiversity and sustainable development. This committee will adopt a position on special projects related to gene technology.

United Kingdom

In the United Kingdom (Richmond, personal communication), the Animals for Scientific Procedures Act 1986 does not formally require that research institutions establish Ethical Review Committees. The Animals of Scientific Procedures Inspectorate reviews project licences applications, and performs a cost-benefit analysis before advising the Secretary of State whether and under what conditions programmes of work should be licensed. In April 1995, designated establishments were invited to consider the benefit of one of the local review processes outlined by the department. Five methods were identified: 1. ethics committees and wider consultation. 2. animal care and use committees. 3. named veterinary surgeon providing an ethical perspective. 4. project refinement reviews. 5. awareness-raising activities to encourage researchers to consider more thoroughly the 3Rs and other welfare and ethical aspects. As mentioned above, an ethical review process is n6t mandatory but correct management structures and communications are required to ensure the welfare of laboratory animals, and licence applicants must consider the justification for using animals in their projects. The Animals Procedures Committee (a national advisory body) has been reviewing the working of the domestic legislation in the 10th year of its operation. Any improvements in practice are likely to be achieved without new legislation being drafted.

Concluding remarks Based on the replies, it can be concluded that in each of the countries mentioned above, animal experimentation needs to be justified by a scientific committee.

17

Furthermore, in several countries, the debate on the ethical justification of animal experimentation has begun. In about half of these countries there is a legal basis for some form of ethical review. In some others legislation is in preparation. Ethical review committees have to decide whether an experiment using animals may be performed only after a decision has been made that this experiment is justified, weighing the social, scientific or educational value against the potential effect on the welfare of the animal. These committees should not be made up of scientists alone, as their judgement on the ethical justification might be biased. It is important that in the near future much effort is put into training members of ethical committees. In addition, more effort must be invested in the development of practical decision models for the ethical evaluation of animal experiments by ethical review committees. This will improve the quality and transparency of the ethical review procedures. In Europe, the ethical review of animal experimentation has become an essential part of education and training courses for future scientists.

Transgenic animals In the context of this textbook, the development of genetically modified animals needs to be addressed. Transgenic technology has evolved rapidly and has given rise to public concerns about the ethics of transgenic animal development. Scientists stress the advantages of biotechnology techn i q u e s - t h e creation of better animal models which eventually may lead to a decrease in the number of animals used. However, the general public is very concerned about these techniques, because of their potential to alter nature radically. Due to the ethical, economical and legal aspects involved and to the heightened public concern, the question of whether genetic modification in general requires specific regulation has been given great consideration by the Council of Europe and the European Union. At the Council of Europe, the Parliamentary Assembly in its Recommendation 1213 on developments in biotechnology and the consequences for agriculture called for the elaboration of a new legal instrument covering the field of biotechnology, including transgenic animals. Replying to this recommendation and in the light of the opinions communicated by two committees competent respectively in the field of animal protection and bioethics, the Committee of Ministers on 7-11 September 1995 agreed to envisage holding a conference with representatives of all relevant professions and interest groups, in particular representatives of the world of science and ecology, law, industry, consumers, the health field and protection of animals. The committee also wishes to associate the European Union and the European Patent Office with such a conference. The con-

18

P. de Greeve and W. de Leeuw

clusion of this conference, which would be preceded by studies involving various aspects, could prepare the way for determining the need to draw up a new Convention covering bioethical aspects of biotechnology. At the moment, I N T E R N A T I O N A L CONFERENCE ON ETHICAL ISSUES ARISING FROM THE APPLICATION OF BIOTECHNOLOGY, is scheduled to take place in oviedo (Spain) on 16-19 May 1999. The European Union has issued a number of regulations and directives that are of importance for the creation or use of genetically modified animals. The main goal for the directives is to harmonize national legislations; this is of great importance for the realization of a true internal market. On 21 November 1991, the European Commission set up a Group of Advisers on the Ethical Implications of Biotechnology (GAEIB). The GAEIB's terms of reference are: 9 to identify and define the ethical issues raised by biotechnology 9 to assess, from an ethical point of view, the impact of the Community's activities in the field of biotechnology 9 to advise the Commission, in the exercise of its power, on the ethical aspects ofbiotechnology and to ensure that the general public is kept properly informed The GAEIB is strictly speaking an advisory body, but can also decide to investigate an issue on its own initiative. On 21 June 1995, the GAEIB met in Brussels. According to the minutes of this meeting,some of the participants considered that it would be sufficient to adapt existing directives to cover transgenics. Others felt that the significant changes brought about by the genetic modification of animals generated a need for special legislation. In May 1996, on a request from the European Commission, the GAEIB adopted an opinion concerning the ethical implications of the genetic modification of animals. Extract: Genetic modification of animals may contribute to human well-being and welfare, but is acceptable only when the aims are ethically justified and when it is car-

ried out under ethical conditions (..). In view of the consequences this technology may have for the health of humans and animals, for the environment and society, a policy of great prudence is required (..). The scope of this policy should apply to: 9 9 9 9

the making of genetically modified animals the use and care of these animals the release of these animals putting genetically modified animals and their products onto the market (including import/export) (..).

Licensing bodies in all member states should have the task of assessing research projects and applications in the light of the ethical principle of prudence. There should be appropriate and understandable information for the public about genetic modification of animals and their products.

References Ausems, E. I. (1994). Development and application of European legislation: the European Convention for the protection of vertebrate animals used for experimental and other scientific purposes. In Welfare and Science, Proceedings of the Fifth FELASA Symposium 8-11 June 1993, Brighton UK 1994 (ed. Bunyan, J.), pp. 234-242. Royal Society of Medicine Press, London. Council of Europe. (1986). European Conventionfor the Protection of Vertebrate Animals Usedfor Experimental and other Scientific Purposes (ETS 123) Strasbourg. European Commission. (1986). Directive for the Protection of Vertebrate Animals used for Experimental and other Scientific Purposes (86/609/EEC). Off J C Eur Comm 1986; L 358: 1-29. European Commission. (1991). Group of Advisers to the European Commission. On the Ethical Implications of Biotechnology (GAEIB). Luxembourg: Office for Official Publications of the European Communities, 1996 ISBN 92-827-7350-7. Gruber, Fr. P., Kolar, R. (1997). Animal test advisory commissions: ethics committees in Germany. In Animal Alternatives, Welfare and Ethics (eds van Zutphen, L. F. M., Balls, M.), pp. 373-376. Elsevier Science, Amsterdam.

Chapter 4

Animal Care and Use Committees: An American Perspective T. Allen and R. Crawford

Tke views expressed by the autkors do not necessarily represent positions or policies of tke US Department of Agriculture or any agency tkereof and skould not be interpreted as suck.

Introduction The Animal Welfare Act (AWA) (1966)is the primary federal law that governs the use of animals in research, testing, and teaching in the USA. Originally passed by Congress in 1966 and amended in 1970, 1976, 1985, and 1990, the AWA provides the basis for the regulatory authority given to the United States Department of Agriculture (USDA) to insure the welfare of covered animals used in regulated activities. The Act includes all warm-blooded vertebrates, as defined by the Secretary of Agriculture, but specifically exempts all farm animals used in food or fiber research or production. Rats of the genus Rattus, mice of the genus Mus, and all birds are administratively exempted at this time by the Secretary of Agriculture. With the passage of the 1985 Improved Standards for Laboratory Animals Act, sponsored by Senator Robert Dole and Representative George Brown, the provisions of the AWA were greatly expanded. The primary purpose of the new law was succinctly stated by Senator Dole in his remarks introducing the amendment. He said: Mr President, the farm bill contains legislation dealing with the humane treatment of animals. The main thrust of the bill is to minimize pain and distress suffered by animals used for experiments and tests. In so doing, biomedical research will gain in accuracy and humanity. We owe much to laboratory animals and that debt can best be repaid by good treatment and keeping painful experiments to a minimum. (Congressional Record, 1985). The new law redefined humane care to include such factors as sanitation, ventilation, and housing. The USDA was directed to establish regulations to give dogs the opportunity for exercise and to set standards relating to a physical environment adequate to promote the psychological wellbeing of non-human primates. Not unexpectedly, the regulations greatly expanded the powers of the laboratory Handbook of Animal Models of Infection ISBN 0-12-775390-7

animal veterinarian and stressed the need to minimize pain and distress through adequate veterinary care and the proper use of anesthetics, analgesics, tranquilizers, and euthanasia. The principal investigator was also obligated to consider alternatives to any procedure likely to cause pain or distress. USDA considers alternatives in the spirit of the 3Rs of Russell and Burch (1959)--reduction in the numbers of animals used, refinement of techniques to minimize pain or distress, or replacement with non-animal techniques. To insure that the new regulations were being followed, the law also called for the establishment of Institutional Animal Care and Use Committees (IACUC). The IACUC was given broad powers to oversee all aspects of an institution's animal care and use program, including approval or disapproval of animal use protocols, development of training programs for animal care and use personnel, inspection of all animal areas, review of the animal care program, and investigation of any alleged problems. The development of the IACUC also allowed USDA to begin "enforced self-regulation." Under this concept, the institution is responsible for ensuring compliance with the AWA regulations and reporting any problems to USDA. To insure that the IACUC is performing its duties, USDA inspects all facilities at least once each year. The new law also established an information service (the Animal Welfare Information Center) at USDA's National Agricultural Library to assist both researchers and IACUCs in complying with provisions of the regulations. Finally, the law provided for severe penalties for any IACUC member who released proprietary information or other trade secrets garnered in the course o f l A C U C activities. Although the AWA regulations are the only federal regulations governing the welfare of animals in research, the Guide for the Care and Use of Laboratory Animals (NRC, 1996) is a widely used reference on animal care and use. However, researchers receiving funding from the US Public Health Service (PHS) are obliged to follow the animal care standards found in the Guide and must assure the PHS that they are doing so. Unlike the AWA, the Guide covers all species of animals used in biomedical research. By and large, the standards found in the Guide and the AWA regulations have been harmonized. Because of the legal burden placed upon IACUCs, it is important to understand the organization and make-up of Copyright 9 1999 Academic Press All rights of reproduction in any form reserved

20

the committee, the regulations they are required to follow, the processes involved in review and inspection of the institution's policies and physical plant, the process of protocol review, common IACUC problems, and finally, a look at special issues in infectious disease research.

Organization Under the 1985 amendments, each institution must designate an Institutional Official (IO), who has the authority legally to commit on behalf of the research facility that the regulations of the AWA will be followed. The IACUC, which is appointed by the chief executive officer, reports directly to the IO. Although the IACUC is responsible for evaluating the animal care program, it is the IO who has ultimate legal responsibility for insuring compliance with the regulations and proper functioning of the IACUC. Under both the AWA and the Guide, the IACUC has final authority to disapprove any activity involving the care and use of animals. However, activities approved by the IACUC may be subject to further scrutiny by the institution (USDA, 1995b; NRC, 1996).

Membership The AWA provides that, at a minimum, each IACUC shall be composed of the chairman, a veterinarian, and an unaffiliated member. The unaffiliated member, as the name implies, has no affiliation with the institution and can receive only minimal compensation (e.g., travel expenses, meals) from the institution. If the committee is composed of more than three members, not more than three members can be from the same administrative unit. By contrast, the Guide requires that an IACUC consist of at least five members. Of these five people, one must be a practicing scientist experienced in research involving animals, one must be a non-scientist, and one must not be affiliated with the institution. A survey of 477 research facilities in 1995 found that most IACUCs consisted of 7 members with a range from 3 to 50 members (Borkowski, 1996).

The veterinarian

The veterinarian must be trained and experienced in laboratory animal science and medicine, and must have direct or delegated responsibility for the animal care program and activities involving animals. The veterinarian should also help determine the institution's goals for its animal care program, develop training programs to insure humane treatment of animals, and promote the use of alternatives to animals whenever possible (Van Hoosier, 1987; Schwindaman, 1994).

T. Allen and R. Crawford

T h e non-affiliated m e m b e r

The role of the non-affiliated member (NAM) has recently been the subject of much study in the USA. The inclusion of NAMs on animal care committees was a hard-fought victory for advocates of laboratory animals (Stevens, 1986). Under both the AWA and the Guide, the role of the NAM is to "provide representation for general community interests in the care and treatment of animals" (USDA, 1995b; NRC, 1996). Members of animal protection groups wanted the NAM to have a background in animal protection efforts and thought that the NAM would provide greater accountability from researchers. However, the NAM is appointed by the chief executive officer with little input from the community and oftentimes has no background in animal welfare or animal protection. One of the reasons for this hesitancy to appoint animal protectionists is the underlying fear that s/he may be obstructive or damaging to the actions of the committee (Levin and Stephens, 1995). In the industrial sector, the whole issue of the NAM is clouded by the possibility that trade secrets or other proprietary information could be made public. However, Congress recognized this possibility and provided for serious criminal penalties for release of trade secrets by anyone on the IACUC (USDA, 1995b). Many observers agree that the NAM brings an unbiased view to the IACUC, and insures that animal use is essential. By providing public accountability, the NAM serves as "the built-in integrity factor to counter negative public perception or prevent the real potential for conflict of interest" (Theran, 1997).

Federal requirements for IACUC activities The primary functions of an IACUC are to review and inspect all aspects of an institution's animal care and use program, including all animal facilities, review animal use protocols, review and investigate complaints about animal use, and make recommendations to the IO (USDA, 1995b; NRC, 1996). The purpose of these reviews and inspections is to provide a mechanism that insures compliance with all regulations and policies and allows for interaction between the IACUC and institutional staff members. The IACUC becomes a group of individuals rather than a faceless inhouse regulatory body, which serves to lessen the sometimes adversarial nature of the review process.

R e v i e w of the animal care program

At least once every 6 months, the IACUC must conduct a thorough review of the institution's program for humane care and use of animals using the AWA regulations and the Guide as the basis. Evaluation of the program should

ANIMAL CARE AND USE COMMITTEES: AN AMERICAN PERSPECTIVE

concern itself with how these activities are administered, implemented, and documented. It will necessarily focus on record-keeping and review of written procedures and policies. The programs that should receive a thorough evaluation include all IACUC procedures and policies, methods for protection of personnel that may report deficiencies in animal care or treatment, procedures for filing of semiannual and annual reports to USDA, the facility's program of veterinary care, the occupational health program for animal care personnel, and finally, the facilities training program for all personnel involved in the use of animals (McLaughlin, 1993).

Facility inspections As with the program review, facility inspections must be completed once every 6 months by the IACUC. This is the opportunity for the IACUC to see first-hand not only the structures and equipment of the animal facility, but also the physical manifestation of the written policies of the animal care program. By observing the animals in their daily quarters, the IACUC can most readily determine if the institutional animal care policies are promoting the welfare of the animals. Another compelling reason is that the inspection insures that the facility is complying with all federal regulations and guidelines. Members of the IACUC tour the facility's animal rooms, feed and bedding preparation areas, necropsy rooms, cage wash areas, and any other rooms used in the animal program. If animals are routinely transported to laboratories or are maintained in satellite facilities, these areas must also be inspected. In addition to examining the animals, animal care personnel should be questioned about the daily and weekly animal husbandry routine. Facilities housing dogs and non-human primates have to meet special requirements concerning the well-being of these animals. It is imperative that the IACUC pay special attention to the implementation of these requirements for exercise in dogs and environmental enrichment for non-human primates. During the inspection process, the IACUC member should take detailed notes documenting, as needed, minor and significant deficiencies, or outstanding innovations that have improved animal welfare. These notes will be used in the preparation of the report to the IO. After the program review and facility inspection, a detailed report is generated noting any significant or minor deficiencies, the probable reason for the deficiency, and plans for corrective actions, including a timetable for completion of these actions. The report should also note outstanding aspects of the program and facilities. Significant deficiencies--those that pose an immediate threat to the health or safety of the animals m must be corrected within a reasonable time frame. Any failure to adhere to the plan that results in a significant deficiency remaining uncorrected must be reported to the USDA and any federal

21

agency that has provided funding for a project. The final report must be approved by a majority of the IACUC and must include any dissenting viewpoints.

IACUC review of protocols Both the AWA and the PHS Guide mandate the review of animal research protocols by the animal care and use committee before any research may begin. The AWA also requires the IACUC to review all approved protocols on an annual basis. The IACUC must review and approve, require modifications to a proposal in order to secure approval, or disapprove any protocol which it receives. The institution is given leeway in determining the most appropriate means of complying with these requirements (Dresser, 1989). The regulations and guidelines do not specify the frequency of meetings for IACUCs, leaving this to the needs of each institution. Animal care committees at large institutions may meet every week while smaller institutions may be able to function with bimonthly meetings. The AWA mandates very specific criteria that must be met before an IACUC may grant approval to new proposals or changes in existing protocols (Schwindaman, 1994; USDA, 1995b). Those criteria include: 9 procedures involving animals will avoid or minimize pain or distress to the animals 9 an investigator must consider using alternatives to procedures that might cause pain or distress to animals. Further, the investigator must provide, at a minimum, a literature review that focuses on alternative methods, and discuss, in a written narrative, why alternatives can or cannot be used. The narrative must also include a list of the databases searched and the keywords used in the search strategy, and any other sources consulted 9 the investigator must provide written assurance that the proposed activities are not unnecessarily duplicative 9 if painful or distressful procedures are unavoidable, the procedures must: be performed with appropriate anesthesia, analgesia, or sedativeS, unless withholding them can be scientifically justified involve a veterinarian in the planning (review by a veterinarian on the IACUC after the protocol has been submitted is not acceptable; the veterinarian should be consulted before the protocol is submitted) never use paralytics without anesthesia 9 animals that experience severe or chronic pain that cannot be relieved will be euthanized at the end of the experiment or, if appropriate, during the experiment 9 the animals' living conditions must be appropriate for the species and must contribute to their health and comfort 9 any medical care required by the animals will be provided by a qualified veterinarian, i.e. a veterinarian trained in laboratory animal medicine

22

9 people who will be performing any procedures on animals will be qualified and trained to perform the procedures 9 any procedures that involve surgery will include appropriate pre- and postoperative care. All survival surgeries must use aseptic technique, including the use of sterile gloves and masks. Operative procedures that penetrate or expose a body cavity or procedures that result in permanent impairment of physical or physiological functions (major procedures) must be performed in a dedicated surgical facility that is maintained in aseptic condition. Rodents are exempted from this requirement. Minor surgical procedures must be performed aseptically but do not require a dedicated site 9 use of an animal in more than one major operative procedure, from which it is allowed to recover, is prohibited unless it can be justified scientifically, is necessary for the health of the animal, or unless special permission is obtained from the USDA 9 use of professionally recognized methods of euthanasia, unless a different method can be scientifically justified. The guidelines developed by the American Veterinary Medical Association in 1993 are generally recognized as the currently accepted standard 9 identification of the species to be used and the number of animals requested 9 the scientific rationale for using animals, and the reasons for using the requested species and the number of animals 9 a complete description of the procedures involving animals 9 a complete description of the methods that will be used to minimize pain and discomfort to that which is unavoidable and necessary to the collection of scientifically valuable data

The animal use protocol review form While federal regulations give rather specific requirements for what an IACUC must consider for approval or disapproval of animal use protocols, the actual method for collecting that information has been left to the scientific community. However, the protocol review form is the key to the entire process for it provides the IACUC members with the information necessary for them to perform their jobs (Prentice et al., 1991). A successful review form should be regarded as a dynamic document that can change with the institution's experiences and evolving regulatory, professional, and societal standards (Prentice et al., 1991). A well-designed review form challenges the scientist to examine and justify, both scientifically and ethically, all aspects of a procedure that affects the wellbeing of the animals (Russow, 1995). A sample protocol review form is shown in Figure 4.1 at the end of this chapter.

T. Allen and R. Crawford

To assist the scientist and the members of the IACUC, each institution should develop policies or standard operating procedures on common painful experimental procedures that carry a "high ethical cost," so that everyone involved in the review process has a common point of reference and consistent decisions are rendered. This also leads to a more efficient IACUC as time is not spent resolving the same conflicts time and again. Some of these procedures would include the use of complete Freund's adjuvant, death as an endpoint, tumor burdens, food and water deprivation, and LD50 studies for both toxicology and infectious disease studies (Dresser, 1987). Institutional guidelines may require that alternative methods be used for particularly painful procedures, may list criteria for euthanizing animals during a painful procedure, or may provide guidance as to monitoring animals for symptoms of pain or distress.

The protocol review process Contrary to public perception, the animal care and use committee is not an animal welfare committee. IflACUCs were required to approve protocols based solely on animal welfare issues, most protocols would be rejected. The primary purpose of protocol review is to promote the welfare of animals without compromising valid scientific objectives that might benefit other animals and humankind. Protocol review is a moral and ethical evaluation that necessarily requires the evaluation of the science involved (Prentice et al., 1990, 1992). Without addressing the validity of the proposed scientific objectives and methods, the IACUC can't decide if the ethical cost weighed against the potential benefits is morally justifiable (Russow, 1995). It would appear that the Public Health Service Policy on Humane Care and Use of Laboratory Animals (PHS, 1996) provides the IACUC, as an appropriate institutional review board, with a legal basis for considering scientific merit of a proposed research activity. According to this document, "procedures involving animals should be designed and performed with due consideration of their relevance to human or animal health, the advance of knowledge, or the good of society" (OPRR, 1991; Prentice et al., 1992). The review process will be different at different institutions depending upon the needs of the facility. A committee may delegate review of protocols to a review team or may require all members of the IACUC to review the form. Regardless of the process used, the AWA and PHS Guide require that all members of the committee have full access to the protocol review form. Federal regulations and guidelines allow the designated reviewers to approve, require modifications to, or disapprove a protocol. But any member of the IACUC may request full committee review. Approval by the full committee requires that a quorum be present and that a majority vote to approve (USDA, 1995b; NRC, 1996). Because IACUCs are asked to review a broad

ANIMAL CARE AND USE COMMITTEES: AN AMERICAN PERSPECTIVE

range of activities, many of which may be outside the expertise of the committee, the use of consultants is allowed. However, the consultants do not have voting privileges unless they are members of the IACUC. During the review process, the members of the IACUC should carefully assess the information provided by the scientist on the animal protocol form. If for any reason a reviewer is not satisfied with the information provided by the scientist, s/he may submit questions to the scientist asking for clarification or additional information. Typical reasons for a protocol being sent back to a scientist include: 9 lack of justification for the species or number of animals requested 9 criteria for alleviation of pain or distress, or use of euthanasia during an experiment inadequately addressed 9 consideration of alternatives not addressed 9 lack of assurance that the proposed procedure is not unnecessarily duplicative 9 incomplete description of proposed activities, postprocedural care, or endpoints not clearly defined

Consideration of alternatives Animal welfare regulations require that an investigator performing procedures that are painful or distressful to the animal provide assurance that no alternatives exist to the painful procedure. To provide this assurance the investigator must provide, at a minimum, a written narrative that describes the literature databases searched (e.g., Medline, EmBase, Biosis Previews, AGRICOLA, PREX), the keywords or strategy used to retrieve information, and a brief description of why alternatives are or are not available. The IACUC must satisfy itself that alternatives were adequately considered, must discuss the use of alternatives during meetings and note the discussion in its minutes. These must be made available to USDA inspectors (USDA, 1989). Stokes and Jensen (1995) have developed guidelines to assist IACUCs in reviewing protocols for alternatives. Some institutions have developed animal alternatives committees (James et al., 1995; Holden, 1997) or appointed librarians familiar with this type of searching (Keefer and Westbrook, 1996) to help the IACUC with this aspect of protocol review. Smith (1994) has written a method paper on searching for alternatives that is an overview of this type of searching. To assist both investigators and IACUCs, the 1985 amendment to the Animal Welfare Act established the Animal Welfare Information Center (AWIC) within USDA's National Agricultural Library. AWIC provides literature-searching services and produces numerous publications and workshops on animal welfare and the use of alternatives in research, testing, and teaching. As mentioned previously, the law provides for an annual review of protocols by the IACUC. The investigator should

23

use this review as an opportunity to reexamine the literature for alternatives that may have been developed since the prior review.

Expedited review of animal use protocols Under the AWA the principal investigator is required to provide the animal care and use committee with a written description of all activities that involve the care and use of animals that are covered by the regulations. If a full committee review is not apparently necessary or is not requested, then an expedited review of the protocol may be made. For an expedited review, the committee chairman designates at least one member of the IACUC who is qualified to conduct the review to review the protocol. This designated individual is to review the protocol and has the authority to: approve the protocol, require modifications to the protocol, or request a full committee review of the protocol. If a full committee review is requested, approval may be granted only after review, at a convened meeting of a quorum of the IACUC, and with approval vote of a majority of the quorum present. No member of the IACUC may participate in a protocol review or approval, or be part of a quorum, if that member has a conflicting interest in the protocol, except to provide requested information to the IACUC. The IACUC member making the expedited review does not have the authority to disapprove a protocol. Disapproval or suspension of a protocol may only be done by a majority vote of a quorum at a convened meeting of the IACUC. . _

Problems with IACUC review In a 1995 audit of 26 research facilities, the Inspector General of the USDA found that IACUCs, in general, were not meeting the standards of the Animal Welfare regulations. This was attributed to the fact that committee members are not always aware of their responsibilities and duties. Consequently, the audited institutions could not insure that pain or distress were minimized or that repetitive experiments were not being performed. The audit also showed that facilities were not adequately addressing the use of alternatives to painful procedures and were allowing research activities to begin before the proposals had been reviewed by the IACUC (USDA, 1995a). Part of the problem was the lack of federal oversight of committee activities. While USDA inspectors routinely visited the institutions, the inspections focused on the conditions of the animal facilities and not on the policies and programs of animal care and review. The Inspector General recommended that USDA send official notices to animal care committees informing them of their legally mandated responsibilities (USDA, 1995a).

24

T. Allen and R. Crawford

I. Non-technical synopsis A brief, narrative description of the proposal or idea that is easily understood by non-scientists I1. Background A. Background This should include a brief statement of the requirement or need for the information being sought

B. Literature search This search must be performed to prevent unnecessary duplication of previous experiments. A search of the scientific literature (MEDLINE, EmBase, AGRICOLA, AWlC, etc.) is highly recommended. 1. Literature source(s) searched 2. Date and number of search 3. Key words of search 4. Results of search: provide a narrative description of the result of the literature search

II1. Objective or hypothesis In non-technical terms, state the objective of this protocol, or the hypothesis to be accepted or rejected IV. Materials and methods A. Experimental design and general procedures Provide a "complete description of the proposed use of animals." This section should succinctly outline the formal scientific plan and direction for experimentation. It is critical that reviewers of this protocol are able to follow your reasoning and calculations for the number of animals required, and can verify that the experimental design clearly supports the number of animals requested

B. Laboratory animals required and justification 1. Non-animal alternatives considered: were alternatives to animal use considered? 2. Animal model and species justification 3. Laboratory animals: a. Genus and species b. Strain/stock c. Source/vendor d. Age e. Weight f. Sex g. Special considerations: specialized requirements for the animals, e.g. SPF 4. Total number of animals required 5. Refinement, reduction, replacement: does this protocol have any provisions that would qualify it to be identified as one that refines, reduces, or replaces (3 Rs) the use of animals?

C. Technical methods These should be presented in sufficient detail, documented or referenced, so that the IACUC can adequately review the procedure and obtain a clear understanding of what is to be done and how the animal will be handled, and make a reasonable determination as to whether this proposed use of laboratory animals is in compliance with federal regulations, guidelines, and law 1. Prolonged restraint: describe and justify in detail any prolonged restraint (greater than 3 hours) intended for use during the study. Also describe habituation procedures for the prolonged restraint 2. Surgery: a. Procedure: describe in detail any planned surgical procedures b. Pre- and postoperative provisions: detail the provisions for both pre- and postoperative care, including provisions for post-surgical observations 3. Animal manipulations: any injections, sampling procedures, or other manipulations of the animals necessary for the execution of the study must be described a. Injections b. Biosamples: cerebral taps, blood sampling, etc. List amounts taken and method for sampling c. Animal identification: microchip, tattoo, ear tags, cage cards, etc d. Behavioral studies: fully describe any intent to use aversive stimuli, food or water deprivation, etc., that would impact upon the animals in this study e. Other procedures: EKGs, radiology, aerosol exposure, etc. 4. Adjuvants: list any adjuvants and your plan for their use. Provide dosages and route 5. Study endpoint: what is the projected endpoint or termination of the study for the animals? You should insure that unnecessary pain or distress is prevented by carefully considering "When is the experimental question answered?" so that the animals can be removed from the study as soon as feasible. Explain the plan for the disposition of surviving animals. You must specifically address and justify any proposed use of death as an endpoint.

ANIMAL CARE AND USE COMMITTEES: AN AMERICAN PERSPECTIVE

25

6. Euthanasia: explain the plan for euthanasia of the animals at the completion of the study and who will perform the procedure. The current AVMA guidelines for euthanasia must be followed 7. Pain: if a procedure involves pain or distress, the PI must consult with the attending veterinarian a. USDA (form 18-3) pain category: this information is reported by the organization to the USDA on USDA form VS 18-23. The PI or primary user should estimate the number of animals that will be counted in each pain category. i. no pain - number of animals: % (column C on USDA form) ii. alleviated pain - number of animals: % (column D) ~. iii. unalleviated pain or distress - number of animals: % (column E) b. Pain alleviation: the attending veterinarian should be able to provide assistance in completing this section of the proposal i. anesthesia/analgesia/tranquilization" describe the methods or strategies planned to alleviate pain or distress. Provide agent, dosage, route and site, indication, etc. ii. paralytics: no use of paralytic agents without anesthesia is allowed. c. Alternatives to painful procedures: i. source(s)searched: e.g., AGRICOLA, MEDLINE, PREX, etc. ii. date of search iii. key words of search" e.g. pain, surgery, simulation, cell line iv. Results of search: provide a narrative description of the results of the alternative literature search d. Painful procedure justification" procedures causing more than transient or slight pain that are unalleviated must be justified on a scientific basis in writing by the PI. The pain must continue for only the necessary period of time dictated by the experiment, and then be alleviated, or the animal humanely euthanized. The PI must consult with the attending veterinarian or his or her designee in the planning of both alleviated and unalleviated painful procedures, and state it here D. Veterinary care Attending veterinary care of lab animals receives particular emphasis in the AWA. 1. Attending veterinary care: will the animals be observed daily or more frequently, and by whom? What is the plan if the animal becomes ill or debilitated during the study and requires supportive therapy? Will the animal be euthanized if it becomes critically ill or comatose, and by whom (study endpoint adjustment)? Justification for not providing supportive care for clinically ill animals is necessary 2. Enrichment strategy: written justification for restricting enrichment programs or activity programs of dogs, cats, or nonhuman primates must be provided E. Data analysis List the statistical test(s) planned or the strategy intended to evaluate the data

V. Biohazard/safety Provide a list of any potential biohazards associated with this proposal, e.g., viral agents, toxins, radioisotopes, oncogenic viruses, chemical carcinogens, etc. Explain any safety precautions or programs designed to protect personnel from biohazards, and any surveillance procedures in place to monitor potential exposures

Figure 4.1 Sample animal protocol form to be submitted to an institutional animal care and use committee. Compiled following a form used by the US Department of Defense.

Special issues in infectious disease research Appropriate animal numbers

One of the primary responsibilities of the IACUC is to insure that the fewest animals possible that will yield scientifically valid data are used in an experiment. Too many animals are an unethical waste of animals and an improper use of research funds. The same argument holds true for using too few animals. However, with proper planning and consultation with a biostatistician, calculating the proper number of animals can be attained. It should be noted, however, that other factors, such as ethical considerations, may also influence the number of animals in a sample size.

The scientist must provide adequate justification for the number of animals proposed for the protocol. The appropriate number of animals for a study will be determined by the variability of the parameter being studied and the statistical tests to be used in analyzing the experimental results (Festing, 1992). To use statistical formulas successfully for determining sample size, the scientist must have some idea of several parameters: the probability of accepting a false positive (alpha error) or a false negative (beta error), the smallest difference worth detecting (effect size), and the variability of experimental groups (Mann et al., 1991; Festing, 1995). Proper scrutiny of the relevant scientific literature may provide information on effect size and variability, allowing the investigator to assign precise values to these variables for use in power analysis or other methods for estimating sample size.

26

Because of the profound effect of variability on the response of animals to an experimental challenge, it is necessary to understand this source of error if animal numbers are to be minimized (Festing, 1992). To minimize withingroup variability it is imperative that animals be free of clinical or subclinical disease and not subject to environmental or dietary stress (except as part of a protocol). The use of inbred strains of laboratory animals will further reduce variability and the number of animals needed because their high degree of uniformity increases the statistical power (the probability that a statistical test will detect a difference when the difference actually exists; Festing, 1995). Erb (1996) has provided an excellent review of the actual elements of the sample size calculations, issues that determine which sample size formula to use, and methods to decrease the needed sample size when the calculated sample size is impractical to use.

T. Allen and R. Crawford

guidelines or criteria for early euthanasia of animal subjects, the IACUC can clearly minimize the pain or distress that the animal will experience. Numerous authors have outlined these criteria (Morton and Griffiths, 1985; Tomasovic et al., 1988; Hamm, 1995; Olfert, 1995). Frequently mentioned variables that should be observed include body weight, physical appearance, clinical signs such as temperature, heart rate, or bleeding, unprovoked behavior of the animal, and responses to external stimuli. In addition, the investigator should use information available from the infectious disease literature on progression of symptoms, time course of the disease and other unique features of the disease being studied to establish earlier endpoints (Soothill et al., 1992). In some studies there may be a scientifically valid reason for allowing the progression to death. However, inconvenience to the investigator or cost of alternatives are not acceptable reasons (Tomasovic et al., 1988).

Minimizing pain and distress Alternatives in antibody production US animal welfare regulations define a painful procedure as one that "would reasonably be expected to cause more than slight or momentary pain or distress in a human being to which that procedure was applied, that is, pain in excess of that caused by injections or other minor procedures" (USDA, 1995b). Investigators are required to consult with a veterinarian to insure that pain or distress is minimized. Because many infectious disease studies have the potential for causing pain in animals, the IACUC should establish guidelines for periodic monitoring of animals, set criteria for veterinary intervention to alleviate the pain through use of analgesics or euthanasia, and require training for investigators and animal care personnel to ensure that all can recognize symptoms of pain and distress. Morton and Griffiths (1985) and other authors (Soma, 1987; NRC, 1992) provide comprehensive reviews on the recognition of pain and distress in laboratory animals. The IACUC should make these available to animal use personnel.

Alternatives to death as an endpoint Because many infectious disease studies may cause irreversible pain or distress before death ensues, the investigator should strive to incorporate earlier endpoints that will satisfy the requirements of the study and spare the animal a painful death (Siems and Allen, 1989; Olfert, 1995). Also, an earlier endpoint may result in better scientific data as the death of the animal may result in postmortem changes to tissue or body fluids (Amyx, 1987a; Siems and Allen, 1989). Because these earlier endpoints may be best addressed as part of the experimental design, IACUC review of the experimental design becomes very important in infectious disease studies (Amyx, 1987b). H a m m (1995) has proposed guidelines for IACUC acceptance of death as an endpoint. By establishing clear

This has emerged as a very controversial topic in the USA. In 1997, the USDA and the National Institutes of Health were petitioned by the American Anti-Vivisection Society to ban the use of animals in the production of monoclonal antibodies (MAb) via the ascites method. Although several European countries have regulations limiting or prohibiting the use of animals for MAb production (McArdle, 1997), at this time USDA has decided not to prohibit the use of animals for MAb production, citing the need for further development and evaluation of in vitro methods. Production of antibodies in animals usually involves the use of an adjuvant or priming agent, such as Freund's complete or incomplete adjuvant or pristane, in conjunction with a selected antigen to stimulate the immune system of an animal to produce titers of antibodies. But it should be remembered that the purpose of the adjuvant is to induce antibodies, not pain (Amyx, 1987b). Both types of Freund's adjuvants are known to produce serious inflammatory reactions that may result in abscesses, granulomas or tissue necrosis. Consequently, IACUCs should always question the use of these adjuvants and should urge investigators to use alternative adjuvants such as Montanide ISA or Ribi's. These alternative adjuvants may provide immunpotentiation similar to Freund's, but without the severe pain associated with the use ofFreund's (Hanly and Bennett, 1997). The production of MAbs via induction of ascites fluid has been an important tool in immunological and infectious disease research. However, unless the mouse or other animal is carefully monitored, the potential for severe pain is very real. In 1974 Kohler and Milstein showed that MAbs could be produced with in vitro methods. With Niels Jerne they won the 1984 Nobel Prize for their in vivo and in vitro work on MAb production (McArdle, 1997). Current in vitro methods widely used in Europe and the USA include modular bioreactors, static and agitated suspension cultures, and

ANIMAL CARE AND USE COMMITTEES: AN AMERICAN PERSPECTIVE

membrane-based and matrix-based culture systems (Marx et al., 1997; Petrie, 1997). Modular bioreactors used in the USA have been found to rival the efficiency of the ascites method (Petrie, 1997). The use of these in vitro methods, besides eliminating the use of animals, has the added advantage of being free of contaminating antibodies, cytokines and similar biologically active materials. Because the primary purpose of the IACUC is to minimize pain in animals, it should always encourage the use of alternative methods of MAb production at both the institutional and laboratory level. To assist IACUCs, a comprehensive bibliography on adjuvants and antibody production is available (Smith et al., 1997).

Concluding remarks The 1985 amendments to the US AWA have had a profound effect on how scientific research is conducted in the USA. With the establishment of institutional animal care and use committees, scientists wishing to conduct research using animals must receive approval from a committee composed of their peers and a representative of the general public. This accountability, for the privilege of using live animals in scientific endeavors, is enforced by periodic, unannounced inspections by veterinarians from the USDA. Although no system of oversight is without problems, the animal care and use committee process in the USA seems to be doing its job of facilitating science while allowing for the welfare of those animals that must be used in research. However, with continuing societal concern over the use of animals in research, these committees should be advocates for alternative methods that implement the 3Rs of Russell and Burch (1959) whenever possible.

References Amyx, H. L. (1987a). Alternatives to the LD-50 in infectious disease studies. Sci. Center Animal Welfare Newslett., 9, 1-2. Amyx, H. L. (1987b). Control of animal pain and distress in antibody production and infectious disease studies. J.A.V.M.A., 191, 1287-1289. Animal Welfare Act. (1966 as amended). 7 USC 2131-2157. U.S. Government Printing Office, Washington, D.C. Borkowski, G. (1996). IACUCs: Celebrating 10 Years of Experience. http://v s247.cas,p su. ed u/iacuc/I AC UC RES. H TM. Congressional Record. (1985). December 17. U.S. Government Printing Office, Washington, D.C. Dresser, J. D. (1987). Refining the ACUC process: policies and procedures. Sci. Center Animal Welfare Newslett., 9, 3-5. Dresser, J. D. (1989). Developing standards in animal research review.J.A.V.M.A., 194, 1185-1191. Erb, H. (1996). A non-statistical approach for calculating the optimum number of animals needed in research. Lab Anita., 25, 45-49.

27

Festing, M. F. W. (1992). The scope for improving the design of laboratory animal experiments. Lab. Anim., 26, 256-267. Festing, M. F. W. (1995). Variation and experimental design. Sci. Center Animal Welfare Newslett., 18, 3-9. Hamm, T. E. (1995). Proposed institutional animal care and use committee guidelines for death as an endpoint in rodent studies. Contemp. Topics Lab. Anita. Sci., 34, 69. Hanly, W. C., Bennett, B. T. (1997). Overview of adjuvants. In Information Resources for Adjuvants and Antibody Production: Comparisons and Alternative Technologies 1990-1997 (eds Smith, C. P., Jensen, D., Allen, T., Kreger, M.), pp. 1-7. Animal Welfare Information Center, Beltsville, Maryland. Holden, F. (1997). Alternatives committee established at Indiana. Johns Hopkins Center Altern. Animal Test., 14, 6-7. James, M. L., Mininni, L. A., Anderson, L. C. (1995). Establishment of an animal alternatives committee. Contemp. Topics Lab. Anita. Sci., 34, 61-64. Keefer, E., Westbrook, F. (1996). The role of the librarian in the work of the institutional animal care and use committee.Anita. Welfare Inf. Center Newslett., 6, 9-11. Levin, L. H., Stephens, M. L. (1995). Appointing animal protectionists to institutional animal care and use committees. Anita. Welfare Inf. Center Newslett., 5, 1-2, 8-10. Mann, M. D., Crouse, D. A., Prentice, E. D. (1991). Appropriate animal numbers in biomedical research in light of animal welfare considerations. Lab. Anita. Sci., 41, 6-14. Marx, U., Embleton, M. J., Fischer, R. et al. (1997). Monoclonal antibody production: the report and recommendations of ECVAM workshop. A.T.L.A., 25, 121-137. McArdle, J. (1997). Alternatives to ascites production of monoclonal antibody production. Anita. Welfare Inf. Center Newslett., 8, 1-2, 15-18. McLaughlin, R. M. (1993). Institutional animal care and use committee review of animal care and use programs. Contemp. Topics Lab. Anita. Sci., 32, 12-15. Morton, D. B., Griffiths, P. H. M. (1985). Guidelines on the recognition of pain, distress, and discomfort in experimental animals and an hypothesis for assessment. Vet. Rec., 116, 431-436. NRC (National Research Council) (1992). Recognition and Alleviation of Pain and Distress in Laboratory Animals. National Academy Press, Washington, D.C. NRC (National Research Council) (1996). Guide for the Care and Use of Laboratory Animals. National Academy Press, Washington, D.C. Olfert, E. D. (1995). Defining an acceptable endpoint in invasive experiments. Anita. Welfare Inf. Center Newslett., 6, 3-7. Olfert, E. D., Cross, B. M., McWilliams, A. A. (eds) (1993). Guide to the Care and Use of Experimental Animals, vol. 1. Canadian Council on Animal Care, Ottawa, Ontario, Canada. OPRR (Office for Protection from Research Risks, NIH) (1991). The Public Health Service responds to commonly asked questions. ILAR News, 33, 68. Petrie, H. (1997). Modular bioreactors as an alternative to ascitic fluid production of monoclonal antibodies. A.N.Z.C.C.A.R.T. News, 10, 6. PHS (Public Health Service) (1992). Institutional Animal Care and Use Committee Guideboo k . Publication no. 92-3415. National Institutes of Health, Bethesda, Maryland: Prentice, E. D., Crouse, D. A., Rings, R. W. (1990). Approaches to increasing the ethical consistency of prior review of animal research. Invest. Radiol., 25,271-274.

T. Allen and R. Crawford

28

Prentice, E. D., Crouse, D. A., Mann, M. D. (1991). The IACUC protocol review form: one of the keys to a successful review. A.A.L.A.S. Bull., 30, 10-16. Prentice, E. D., Crouse, D. A., Mann, M. D. (1992). Scientific merit review: the role of the IACUC. I.L.A.R. News, 34, 15-19. Russell, W. M. S., Bur&, R. (1959). The Principles of Humane Experimental Technique. Special edition reprinted 1992. Universities Federation for Animal Welfare, Hertfordshire, UK. Russow, L-M. (1995). Protocol review: too much paperwork? In Current Issues and New Frontiers in Animal Research (eds Bayne, K.A.L., Greene, M., Prentice, E.D.), pp. 15-18. Scientists Center for Animal Welfare, Greenbelt, Maryland. Schwindaman, D. (1994). Federal regulation of experimental animal use in the United States of America. Rev. Sci. Tech. Off. Int. l~piz., 13, 247-260. Siems, J. J., Allen, S. D. (1989). Early euthanasia as an alternative to death in chronic infectious disease studies using a systemic Candida albicans model. Abstr. Annu. Meet. Am. Soc. Microbiol., 89, 81. Smith, C. (1994). AWIC tips for searching for alternatives to animal research and testing. Lab. Anita., 23, 46-48. Smith, C. P., Jensen, D. J. B., Allen, T., Kreger, M. D. (1997). Information Resources for Adjuvants and Antibody Production: Comparisons and Alternative Technologies 1990-1997. Animal Welfare Information Center, Beltsville, Maryland. Soma, L. R. (1987). Assessment of animal pain in experimental animals. In Effective Animal Care and Use Committees (eds Orlans, F. B., Simmonds, R. C., Dodds, W. J.), pp. 71-74. Special issue of Lab. Anita. Sci. Scientists Center for Animal Welfare, Bethesda, Maryland. Soothill, J. S., Morton, D. B., Ahmad, A. (1992). The HID-50 (hypothermia inducing dose 50): an alternative to the LD-50 for measurement of bacterial virulence. Int. J. Exp. Pathol., 73, 95-98.

Stevens, C. (1986). Institutional animal care and use committees: new advocates for laboratory animals. Advocate, 4, 16-18. Stokes, W. S., Jensen, D. J. B. (1995). Guidelines for institutional animal care and use committees: consideration of alternatives. Contemp. Topics Lab. anim. Sci., 34, 51-60. Theran, P. (1997). The SCAW IACUC survey part II: the unaffiliated member. Lab Anita., 26, 31-32. Tomasovic, S. P., Coghlan, L. G., Gray, K. N., Mastromarino, A. J., Travis, E. L. (1988). IACUC evaluation of experiments requiring death as an endpoint: a cancer center's recommendations. Lab. Anirn., 17, 31-34. USDA (U.S. Department of Agriculture) (1989). Animal welfare: final rules minstitutional animal care and use committees. Fed. Reg., 54, 36125-36131. USDA (U.S. Department of Agriculture) (1995a). Enforcement of the Animal Welfare Act. Audit report no. 33600-1-Ch., pp. 24-26. Office of Inspector General, Washington, D.C. USDA (U.S. Department of Agriculture) (1995b). Title 9 CFR Chapter 1, Subchapter A - - A n i m a l Welfare. U.S. Government Printing Office, Washington, D.C. Van Hoosier, G. L. (1987). Role of the veterinarian. In Effective Animal Care and Use Committees (eds Orlans, F. B., Simmonds, R. C., Dodds, W. 1.), PP. 101-102. Special issue of Lab. Anita. Sci. Scientists Center for Animal Welfare, Bethesda, Maryland.

Further reading PHS (Public Health Service) (1996). Public Health Service Policy on Humane Care and Use of Laboratory Animals. National Institutes of Health, Bethesda, Maryland.

Chapter 5

Ethical Aspects of the Use of Animal Models of Infection D. B. Morton

In this chapter I will first give an outline of the main theoretical and applied ethical positions on our use of animals and then focus on the theoretical and practical aspects of animal "suffering". I will then go on to illustrate where research in infection could be refined to cause less animal suffering, and so be more ethically acceptable.

Status of animals in society All uses of animals by society are coming under increasing scrutiny through the activities of animal rights and animal welfare organizations. Some associations focus on animal research (antivivisectionist groups), others on intensive farming, sports and spectacles, companion animals and wildlife. Most people would agree that animals are important and, furthermore, that humans have a moral responsibility to care for domesticated and captive (and sometimes wild) creatures--the increase in the number and membership of animal protection organizations reflects this concern (see Rupke, 1987, for a review specifically on the rise of the antivivisection movement). The advent of television has further heightened public concern as animal cruelty can now be seen for what it i s - - g r a t u itous violence, abuse or m i s u s e - - a n d is less a matter of verbal interpretation of interested parties in law courts. Partly as a result of all this, vegetarianism is increasing (from 2-3% 10 years ago to an estimated 7% today), but this is also motivated through health and financial concerns. Research into animal behaviour has played an important role in revealing the capacity of animals to experience pain, distress and fear and this too has raised our awareness of animal suffering. Consequently, our view of what is acceptable to do to animals is continually challenged and the argument that it is legal to treat animals in a particular way is no longer adequate. By the same token, the fact that animal research is legal does not mean that scientists can do anything to animals in the name of science: it depends on why the research is being done and how well it is done. I shall return to this point later.

Handbool~of Animal Modelsof Infection ISBN 0-12-775390-7

Animal rights and animal welfare Any action that humans carry out, as moral agents, can be described as being morally right or wrong either in terms of the outcome of that action (its ends or goal) or in terms of the action itself--it is right to tell the truth, it is wrong to kill. One can argue that killing is always wrong no matter what the outcome (the pacifist view), or decide that it is right depending on the circumstances - - a "just war". The two philosophical theories commonly used in such analyses are utilitarianism and deontology, and they are examples of consequentialist and non-consequentialist theories respectively, that is, the consequences of actions are or are not taken into account. An animal rightist will hold the view that it is always wrong to kill animals no matter what the circumstances or the consequences. They consider that animals, like humfitns, have an intrinsic value regardless of their utility, and so should be the object of similar, if not equal, respect in terms of taking their lives. Note that they may not deny that humans and animals have different inherent values. The argument is often turned round to state that animals have a right not to be killed. Animal rightists also believe that it is wrong to cause animals to suffer in any way and so animals have another r i g h t - - n o t to be caused pain or distress. Those who believe that animals have rights can never condone the use of animals in research as this involves killing animals as well as causing them to suffer and such people are, therefore, antivivisectionists. They might, however, find permissible the use of animals that are not sentient (i.e. not possessing the ability to experience pain) providing they are not killed. The point at which a believer in animal rights permits the use of medicines (herbal, homeopathic or allopathic) to kill other animals such as microorganisms or parasites that are causing disease is unclear, but patently they would protect all sentient living vertebrates. Regan (1983) is a modern philosopher who espouses such rights-based views. Utilitarians, on the other hand, would make a judgement solely on the outcome of any action. They believe in the greatest good for the greatest number with the least amount of harm. To return to our example again, leaders of a country might argue that a war was justified if there was an increased gain in land or wealth which would provide an Copyright 9 1999Academic Press All rights of reproduction in any form reserved

30

increased quality of life for their people. Utilitarianism could also justify killing one person to save the lives of many others, for example, using a healthy person to provide organs for transplantation to save the lives of five or six others. This would represent a greater good for a greater number of people. In terms of animal use, a utilitarian might argue that the act of killing was not morally important as the consequential benefits, say from animal research in terms of quantity and quality of life for humans (new antibiotics, vaccines, beautifying cosmetics) would be sufficient justification. Sentience (the ability to experience pain and pleasure) is a property of animals and is a key value to be considered. Consequently, causing animals to suffer without a justifiable outcome is unacceptable. Singer (1975, 1991) takes this line in the renaissance of philosophical concern for animals, following earlier utilitarian philosophers, e.g., Jeremy Bentham (1780) who said, referring to animals: "The question is not can they reason, nor can they talk, but can they suffer?" It can be seen that neither deontological nor utilitarian theories, if applied strictly, accord with modern practices. In fact, a mixture of the two is often used. We are likely to take the view that some actions are indeed inherently wrong and should be used only under extreme circumstances, such as killing of humans, but in those circumstances some calculus has to be done to ensure the benefits are significant and commensurate (as in some wars). As regards animals, there is an underlying deontological assumption that we have a duty of care to them regardless of their utility. As a result, in many countries laws determine that it is inherently wrong to cause animals to suffer. Animals deserve protection, although killing animals is usually acceptable under certain circumstances (compare killing sheep and pigs with killing whales and elephants). In practice, whilst the theme of judging the outcome is maintained, the argument is somewhat modified along the lines that one should seek to minimize any suffering: if it is acceptable to kill animals, then it should be done humanely. This approach would be typical of an animal welfarist who would find it acceptable to eat meat, keep pets, and carry out research providing the minim u m amount of suffering was inflicted. Moreover, the use of animals in research to determine the safety of a new antibiotic for a human or animal disease or to protect the environment might be considered justified outcomes, whereas the use of animals to produce a safer cigarette, a less addictive drug, or a beautifying cosmetic might not. The animal welfarist, therefore, has not only to make a judgement as to whether there is a greater good, but how much greater that good is, and whether it is offset by or commensurate with the harms done to the animals. This is called a c o s t - o r harm-benefit analysis and is the mandate of ethics committees for animal research. Singer (1975, 1991) looks at what is meant by karms and interests in detail and argues that humans should give equal consideration to equal interests in animals. Thus, as a general rule, both humans and animals would wish to avoid suffering, but what we mean by harm and measuring it can

D . B . Morton

be difficult. Furthermore, it has to be perceived in a similar way to be comparable in a cost-benefit analysis. For example, a horse and a baby would feel pain differently if given an identical slap. Not being able to eat roughage will cause more misery to a calf than to a cat. The innate senses of the animal species concerned, its natural abilities and its capacity to suffer in response to a stimulus or deprivation have all to be taken into account. This becomes extremely' relevant when trying to predict the harm caused by an experiment and critical anthropomorphism has been proposed as a useful method in such an assessment (Morton et aL, 1990). Another dilemma arises in animal research which has been termed a "tragic choice" or "necessary evil" (Smith and Boyd, 1991) and this reflects a commonly held view. If we experiment on animals we cause them to suffer (a wrong action), but if we do not, then we fail to relieve human and animal suffering (a wrong outcome; Cohen, 1986). The animal welfarist sees the force of that argument but may reserve judgement depending on the details of the research and a harm-benefit analysis, whereas an animal rightist could never agree with any animal research. How do scientists address the question: What are the morally relevant differences between humans and animals that make it acceptable for research to be carried out on animals that we would not permit on humans? Justifying it by stating that we are human and not animals is termed a speciesist argument (Ryder, 1975). Proponents of such an argument would then be challenged to say what characteristics of being human provide the moral justification. Anatomical differences such as having a tail, or humans being stronger, would not seem morally relevant. But what about our intelligence, our ability to create, to make plans for the future, to be aware of ourselves in relation to others and over time, our ability to communicate and even to hold this debate? Here we are faced by another problem, that of marginal cases. Some animals may be more intelligent, more creative and more communicative than some humans. Compare the chimpanzee with a mentally handicapped child. Or, to pose a similar dilemma, would we be causing a greater harm by using a normal chimpanzee or a human in a permanent vegetative state (from whom it had been decided to withdraw life support and who had made an advance directive consenting to such a procedure) for an experiment such as a pharmacokinetic study, or an investigation into rejection using a transgenic animal organ graft using extracorporeal perfusion? There is the added benefit of more accurate information by experimenting on humans as it removes the need to extrapolate between species. We may logically be forced into accepting that it is wrong to experiment on either or, conversely, that it is right to experiment on both (Singer, 1975; Frey, 1987, 1988). As a result of such dilemmas it has been argued that there are no absolute morally relevant differences that can separate all humans from all animals. Rather there is a continuum of differences which vary more in degree than k i n d - - a view reflected to varying extents in different religions.

ETHICAL ASPECTS OF THE USE OF ANIMAL MODELS OF INFECTION

Speciesism and different species of animals Speciesism is an anthropocentric view of human beings in relation to other animals, but it also describes differing human attitudes to different species. When we talk about animals we usually only think of mammals, but on occasions it may be possible to use the lower species in research. The issue clearly is about sentience, rather than phylogenetic order, and we should take care always to use the least sentient species. In fact, our moral concern increases the closer in terms of looks and in zoological similarity animals are to ourselves, thus primates rate higher than rats. Clearly, the ability of animals to experience pain, discomfort and distress is important and it is generally agreed that all vertebrates have this ability (Smith and Boyd, 1991) and so are normally protected by laws in most western countries. Domesticated mammals are also of concern and dogs, cats and equidae are given special consideration in UK law. Conversely, animals that are not high in public esteem may be of less concern: in the USA there is no legal requirement to keep records of the number of rats and mice used in experiments. The fact that some animals are seen as less valuable than others, or that some animals suffer less than others, is probably a matter of human perception rather than any physiological or psychological reality. Only for the higher primates (such as chimpanzees) is there good scientific evidence supporting the notion that they possess selfawareness and self-consciousness, which may make them able to suffer more than other mammals but even their suffering remains unlikely to be as great as that of normal humans. However, we should be careful not to assume that non-primate mammals do not suffer in this way, as clearly there is considerable anecdotal evidence they do.

Do animals make good models for humans or other animal species? It should be remembered that experiments are carried out on humans as well as animals, though not in such an invasive manner. We do not intend to take their lives or cause them harm. Any new medicine tried in patients for the first time is an experiment, no matter how many animal tests have been carried out beforehand. Despite the remarkable similarity between animals and humans, animal tests may get it wrong through unpredictable side-effects which may cause medicines to be withdrawn from use (e.g. thalidomide; see the rather provocative book by Sharpe, 1988). Animal tests can only give an indication that the chemical has the desired action and is not obviously toxic, but when many more humans than experimental animals are exposed to the substance, as in a clinical trial, one may start to pick up side-effects not measurable in animals, such as

31

headaches or transient nausea, or side effects which are so infrequent that they will not be detected in the small number of animals used in preliminary safety tests. Second, animal tests are inherently limited (some would say flawed) by virtue of having to extrapolate from one species to another when there are many species differences in clearance rates and metabolic routes. However, many medicines researched and developed in animals have been shown to work extremely effectively in humans and other animals --consider the medicines used in veterinary practice. Third, non-human mammals share many aspects of their physiology and biology with humans and that is why they make good animal models. But, the more the experimental animals are like humans and the closer they are genetically, the greater is our moral concern for their use in research. The Darwinian theory of evolution would support such a concept of a continuum in abilities rather than differences reflected by D N A homogeneity, thus adding provenance to our concerns based on natural attributes and mutual abilities to suffer. Fourth, and more specifically, we cannot lightly deny that they will not suffer like us in experiments, particularly as they make such good models for emotional states of suffering like pain, depression and anxiety. It is a two-way street. Animals are similar to humans in their responses to and interactions between stress and disease. For example, stress (such as transport, poor handling, poor husbandry) can predispose to disease. New medicines developed as a result of such s t u d i e s - anaesthetics, analgesics, antidepressives and some anxiolytics - - work well in both humans and animal species other than the one in which the drug was developed. Finally, our ability to create more accurate models through the advent of new genetic engineering techniques (e.g. transgenic animals bearing defective human genes) cannot fail but to heighten such concerns. In summary, humans have a duty of care to animals used in research not to cause them avoidable suffering. There must also be sufficient benefit to outweigh and so justify any animal suffering but, as judged by whom?

Applied ethics and responsible science Having decided that it is acceptable to use animals in research, that it is the only way to achieve the scientific objective, and that the scientific objective is worth achieving, one then has to decide how to carry out the work. One practical ethical framework for evaluating the conduct of experiments in animals is that put forward by Russell and Burch (1959): the Three Rs. Its principles are that one should replace animals whenever possible by using non-sentient means such as in vitro techniques and computer modelling; refine the experimental design so as to minimize any suffering; and reduce the number of animals to the minimum needed to achieve an acceptable statistical standard.

32

D.B. Morton

The use of the word "alternative" can be applied to all three Rs, but it is commonly accepted that the term applies when no animals are needed at all. A true replacement would be the use of computer modelling and permanent cell culture lines. Killing an animal for tissue would not be a replacement as an animal could still suffer as a result of its husbandry or its manner of death (it could experience fear on being removed from its cage to be killed humanely) and this would be classified as a refinement; the same would be true for procuring tissues under terminal anaesthesia. Applied ethics in animal research can be summed up in part by asking the question: is it possible to carry out this scientific procedure and cause less suffering to animals? If so, it would be unethical to cause that avoidable suffering and this means that best practice should always be the goal. Animal researchers should refine their care and use of experimental animals for moral, legal, economic and scientific reasons. Avoidable animal suffering leads to poor science, as poor animal well-being caused by poor animal health, poor care or husbandry or clumsy experimental technique will lead to animal suffering which may well modulate an animal's response to the scientific variable being investigated, thus adding to the biological variation. At best it may skew the research data minimally; at worst it may totally alter the scientific interpretation of that data. The results obtained are then not only misleading but in the long run may lead to more animals having to be used as the work may have to be repeated in order for it to be validated m a resource issue in its own right. Paying attention to animal well-being makes sense for precise, humane and economic science. Refinement can be defined as: Those methods which avoid, alleviate or minimize the potential pain, distress or other adverse effects suffered by the animals involved, or which enhance animal wellbeing. (Morton, 1995a)

psychological indices to recognize when animals are suffering and this is a prerequisite to be able to assess, measure and even separate these emotional conditions. Several general references are worth reading (Duncan and Molony, 1986; A.V.M.A., 1987; Dawkins, 1990, 1993; Smith and Boyd, 1991; I.L.A.R.AN.R.C., 1992; Townsend, 1993; Morton and Townsend, 1995; Morton, 1997). Each adverse state and its physiology will now be briefly described. These adverse states are often not clearly separated from each other: for example, animals in chronic pain or which are disabled may also be anxious and frightened (Figure 5.1). Animals are able to suffer psychologically. This is seen as abnormal behaviour, e.g. some mammals in captivity show signs of boredom and frustration (mental distress). Such signs can often be reversed through enriching the environment (or rather, making it less barren!). Refinement includes enrichment (Reese, 1991) and if we are under a moral obligation to reduce all avoidable suffering to the minimum necessary through utilizing best practice, then we must pay attention to the husbandry of animals as well as experimental procedures.

.,Oot,a.a oituitar, ..s,ress ic- f

---'---Neurochemical receptors Mental distress:

I

.ocica,n e,tion

/ Sympathetic adrenal medulla

/ fright flight

Twenty years or so ago, animal welfare was considered mainly in the light of health--absence of d i s e a s e - - a n d scientists would have concentrated on the effects of microorganisms on research (Pakes et aL, 1984). Whilst disease is still important, it is less so than before thanks to the high health standards maintained by the breeders and nowadays other areas are emerging as important to animals, particularly psychological well-being. I wish to illustrate some practical ways in which animals can suffer, how these adverse states can be recognized, and how 'As best practice' can be determined and put into effect.

Figure 5.1 Possible adverse physiological and psychological states of vertebrates can occur independently as well as concurrently. It is likely that on many occasions they will occur at the same time and the circles should therefore overlap more closely.

Animal suffering

Pain

Animal suffering is a generic term used rather loosely to refer to an animal's adverse reactions when exposed to some environmental or internal physiological or psychological disturbance. It should be possible to use physiological and

Some people deny that animals can feel pain but this view is becoming discredited as research has shown on numerous occasions that animals and humans respond to painful stimuli very similarly both physiologically and psychologically.

~

depression boredom frustration grief happiness

fight

/

ETHICAL ASPECTS OF THE USE OF ANIMAL MODELS OF INFECTION

In animals, pain is used to describe a physical, rather than a mental effect (as in humans) and involves specialized receptors (nociceptors)in the periphery of the body (e.g. skin) which respond to excessive pressure, temperature or chemical stimuli (Melzack and Wall, 1982). Nerve impulses pass from these nociceptors in afferent nerve pathways to the cerebral cortex where they are translated into the emotional feeling of pain. There are also descending nerve pathways which can modify the passage of impulses passing up the spinal cord and in this way pain tolerance and thresholds may be increased or decreased. These develop shortly after birth in some species and so, paradoxically, fetuses and neonates may experience more pain than adults (Fitzgerald, 1994). When pain does occur in experimental research it is usually an unwanted side-effect and is a consequence--rather than an objective m of the scientific procedure. For example, pain associated with various infections is incidental to the evaluation of a novel antibiotic drug. Similarly, in the production of an animal model of a human disease (e.g. arthritis), the pain is inevitable but not intended. Pain can also be produced as a result of the safety testing of new chemicals and may cause a spectrum of physical signs according to the chemical and site concerned, e.g. skin irritation, colic, cancer. On some occasions it may be the scientific objective to study pain itself but in this area of research the amount of pain is carefully controlled and is usually kept to the minim u m needed to obtain scientific data (International Association for the Study of Pain, 1979; Zimmermann, 1983).

Dystress Dystress (coined from the Greek dus, having a connotation of bad m b a d stress) is caused when an animal can no longer adapt to the stressors imposed upon it, such as excessive (high or low) temperatures or humidity, transport for long distances, restraint, inadequate or irregular food supply. The body is maintained within a narrow range of physiological parameters (homeostasis) and adapts to, or copes with, its new environment. Some environmental changes or stimuli are good (those stressors an animal can cope with: so-called eustress) and probably prevent other adverse states such as boredom and frustration. However, stressors that are severe or prolonged or repeated may eventually erode an animal's ability to cope and so cause dystress. Dystress can be increased when the animal is unable to predict or control the stressor (Wiepkemea and Koolhaus, 1993). Dystress will primarily activate the hypothalamic-pituitary-adrenal axis, ultimately leading to an increase in corticosteroid levels. Non-steroidal hormones may also be raised and these include prolactin, tumour necrosis factor and interleukins Which in turn can affect other body systems and predispose animals to disease through reduced effectiveness of the immune system (Dantzer and Kelley, 1989). Dystress may lead to poor growth and to a reduction

33

in breeding capacity (even short-term stressors such as noise and vibration are known to affect breeding). Novel and repetitive scientific procedures may stress animals but a certain level of stress is unavoidable in research. The important question is whether the experimenter can help an animal adapt to the stressors beforehand, in which case any stress is minimized and the experimental results will reflect more accurately the scientific variable under study.

Fear Fear is probably the commonest adverse effect experienced by laboratory animals and physiologically involves the sympathetic nervous system and the adrenal medulla. It results in the release of catecholamines, which are the classic hormones released in the fight and flight (and fright) reactions preparing the body for defence or aggression. These hormones are responsible for diverting blood from gut to muscle as well as increasing those processes which can help an animal's immediate physiological needs: heart rate rises, the heart pumps more efficiently, blood glucose rises.

Lasting harm Lasting harm is a term used to cover those adverse affects which may not be painful or cause dystress or indeed overt physical suffering. It refers to procedures which may damage the animal in a non-painful way, such as permanent paralysis of the nervous system, or a scientific procedure that may cause blindness, deafness or diabetes. Such adverse effects have the potential to cause fear, anxiety and chronic illness and may induce a state of mental distress.

Mental distress Distress is used to describe adverse psychological (mental) states measurable by abnormal behavioural p a r a m e t e r s - so-called stereotypic behaviours. Distress is often associated with the other adverse states described above but can occur in a more restricted sense when animals elaborate abnormal behaviours because they are unable to meet their mental (as opposed to physiological) needs. Such behaviours are usually repetitive, have seemingly no obvious function, and may be novel to that animal species or be an exaggerated form of a natural behaviour (in terms of the amount of effort or time spent carrying it out). Stereotypic behaviours vary in style and with species according to the environmental conditions an animal has previously experienced. Broadly, these behaviours reflect mental states such as boredom, frustration, torment, social isolation. Mental distres~ ~ a y involve serotonin, noradrenaline and dopamine receptors and drugs

34

classified as reuptake inhibitors have been found to reverse such stereotypies in both humans and animals. It may be important to animals for us to separate their behavioural needs from desires and freedom for them to carry out many behaviours. It seems intuitively obvious that some behaviour patterns, such as those that damage the ability of that animal to survive (fitness in the Darwinian sense) and which involve self-mutilation, are particularly unacceptable (chewing digits in monkeys, repeated gnawing leading to damage to the mouth and teethmoften called vices in the past, as if they were the fault of the animal!). Other behaviours seem less self-destructive in a physical sense but may be mentally destructive (weaving, inactivity, pacing). Such behaviours are seen in many mammals in zoos and laboratories and occur in nearly all species. Any behaviour not seen in the wild counterpart of a species should be treated with suspicion. It is not easy to determine the behavioural needs of animals but Dawkins and others have attempted to address these issues in two ways (Dawkins, 1990, 1992; Poole, 1992). Behaviours can be measured through choice experiments to determine what animals prefer by giving them a choice of two environments (e.g. to compare types of cages or bedding). These experiments have limitations in that an animal may like or dislike both but is forced to choose one; it may also not know what is good for it in the long or short term; and it may change its mind with time, experience and age. Another method is to measure how hard animals will work (e.g. lever-pressing or pecking) in order to gain access to a particular environment or enrichment. Such quantitative estimates enable one to rank environmental behaviours. Perhaps we will then be obliged to meet those that appear to be important for that species in so far as is practicable in the laboratory and within the scientific objective. In my view we should strive to meet any such needs in its normal husbandry, except for when the scientific protocol demands it.

Routine husbandry The routine husbandry of animals and their environment, because of the stressors inevitably involved, may well affect the quality of the scientific data generated (Rose, 1994). It is important, therefore, that all such details should be reported when writing up the work (Ellery et aL, 1985; Morton, 1992). Animals should be given time (4-7 days) to acclimatize to their new conditions of husbandry (e.g. new diet, indigenous diseases, handlers, noises, odours) before being used in an experiment, particularly if they have been brought in from an outside supplier. Even transporting animals very short distances, say from another building on campus can be stressful (Toth and January, 1990; Tuli et aL, 1995). These stressors raise the levels of corticosteroids, prolactin and other hormones which may affect many areas of research. For example, acclimatizing animals to a metabolic cage for 21 days before a lethality test reduced the LDs0 dose by 60 times compared with animals that had not been

D . B . Morton

acclimatized (Damon et al., 1986). There are also scientific consequences of keeping animals like rabbits in excessively confined conditions as their bones do not develop normally compared with those kept in more spacious accommodation. For example, in caged rabbits, the compact bone of the femur was half its normal thickness and other bones (vertebrae and ribs) were deformed in some way (Stauffacher, 1992). Such animals show osteopenia and osteoporosis and yet are being used in orthopaedic research to study normal bone healing!

Recognition and assessment of animal suffering The types of adverse effects that animals may suffer in a laboratory from physiological and psychological (behavioural) viewpoints have been described and we now have to address the more difficult task of recognizing when animals are showing these effects and trying to quantify them. How can one tell when animals are in pain or are suffering in any way? A good animal technician may think it is obvious but how exactly does he or she know? What are we looking for? Clearly the ability of humans to recognize adverse effects in another animal depends partly on the species and, by and large, it is easier to recognize adverse effects in larger species, particularly if they are mammals. Perhaps it is because we are more familiar with these species (e.g. pet dogs and cats) than others. (Whilst this chapter concentrates mainly on mammals, it should not be forgotten that birds, fish, reptiles and amphibia are also considered to be able to suffer and consequently are also protected by legislation.) Whilst humans too are animals, we cannot simply assume that animals suffer like humans and it is important not to become too anthropomorphic because this will be misleading. A critical anthropomorphic approach, however, takes into account the animal's biology and biography (life experience), and provides a useful starting point of what adverse effects to look for (Morton et aL, 1990). It can sometimes help to imagine what it would be like to be that animal in that given experimental situation. For example, after a knee operation one might feel pain and therefore limp, and so in a similar (experimental) operation on an animal one might look for limping as a postoperative sign of pain. Such an anthropomorphic approach has limitations, and there are sometimes important biological differences between humans and animals which make it risky to extrapolate simplistically from one to the another. On the other hand, sometimes these differences can be very helpful, e.g. the position and action of the tail: compare sick with happy dogs and pigs! One must also be aware that many laboratory animals have reversed circadian rhythms compared with humans and that their main activity period is during the night. Therefore any interference with their normal activity may be picked up better at night than during our normal human working day. We are using this factor as a test of provoked behaviour to see if inactive animals

ETHICAL ASPECTS OF THE USE OF A N I M A L MODELS OF INFECTION

are able to respond during the day by turning off the white light and observing them under red light. If the animal's nocturnal behaviour of increased activity has not started within 5-10 minutes then that animal is not normal. Recognition of the normal is of fundamental importance and the scientist, animal technician and veterinarian should all know what is normal for a healthy individual animal of the particular species, strain, sex, age and background being used. Recognition of an animal's normal behaviour in the environment or circumstances in which it is being kept is as important as other physiological aspects, such as type and volume of faeces. Methods of husbandry can profoundly affect an animal's condition and these factors should be understood. If animals are poorly socialized or housed when young they may develop a b n o r m a l behaviour patterns which become accepted as normal. Whilst it is possible to learn what is normal from books, this must always be supplemented by direct observation of animals. Pre-experiment assessment and observation are helpful, and guidance from experienced animal care staff is invaluable. To develop an understanding of what is normal researchers should gain direct experience of normal animals by working with them in an animal unit for a few days, performing routine husbandry tasks such as feeding and watering, handling the animals and cleaning cages.

Difficulties in assessment with groups of animals and with small animals As mentioned earlier, many, if not most, pet owners instinctively become accustomed to their pet animal's natural behaviours and foibles and so come to know their animals as individuals. This is not so in an experiment that could involve hundreds of laboratory rodents, but the fact that there may be many of them does not relieve us of our moral obligation to reduce suffering to a minimum in every individual experimental animal. In practice, however, it does seem difficult to observe behaviours and to recognize suffering in small animals like mice, and it is even more difficult to monitor individual animals when kept in groups. It is not easy to monitor an individual animal's dietary intake or faecal and urine output. On the other hand, it is possible to observe interactions between animals, especially when they stand out from others in the group by the very nature of their behaviour, posture or appearance.

An approach to the recognition and assessment of animal suffering using score sheets One way to assess adverse states is to examine in detail the scientific procedures involved and to score those in some way. Wallace et al. (1990) tried to do this prospectively, but

35

this approach assumes that all researchers will be equally competent on all occasions, and that all animals will react the same. An alternative approach is to look at it from the point of view of what the animal is telling us no matter what the procedure or species of animal, or who is carrying out the procedure. Many laboratories are approaching this difficult topic of the recognition and assessment of suffering using score sheets which provide a list of cardinal clinical signs encountered in that particular scientific procedure (Morton, 1990; 1995b; 1998; Morton and Townsend, 1995; Olfert, 1995). These are developed through experience and, by and large, are unique to the system of husbandry, to the specific experiment, as well as to the species, and even the breed or strain of animal being used. It is not possible to make a general score sheet for all experiments and for all species (or for all users!). One only has to consider the different potential adverse effects of a skin transplant compared with a kidney or heart transplant to appreciate the different clinical signs that might be seen (e.g. rejection of skin compared with a dependent kidney or an accessory heterotopic heart in the abdomen). Practically, it is important to develop a disciplined approach and strategy to the recognition of adverse effects in animals (Morton and Griffiths, 1985). At the beginning of an assessment, the animal should be viewed from a distance and its natural undisturbed behaviour and appearance noted. Next, as the observer approaches the cage or pen, the animal will inevitably start to take notice and interact with the observer and that interaction can be used to determine whether it is responding normally (an animal may be inquisitive or show signs of fear). Finally, a detailed clinical examination can be carried out by restraining the animal in some way and observing its appearance carefully and then making clinical measurements of body weight, body condition and temperature in addition to its behaviour, as it may have become more aggressive or fearful, and may even vocalize. Lists of clinical signs are developed by observing the first few animals undergoing a novel scientific procedure very closely. The list can then be modified with experience until a set of cardinal signs that most animals will show during that experiment and that are relevant to the assessment of suffering is determined. These key clinical signs are set out against time in a score sheet (Table 5.1). On the left-hand side are listed clinical and behavioural signs and along the top the days and time of the recorded observations. The method of scoring is that clinical signs can only be recorded as being present or absent. This is indicated by a plus or minus sign (or sometimes +/- if the observer is unsure). The convention is that negative signs indicate normality or within the normal range, and positive signs indicate compromised animal well-being. In this way, it is possible visually to scan a score sheet to gain an impression of an animal's well-being: the more plus signs, the more that animal has deviated from normality, with the inference that it is suffering more than it was earlier. Clinical treatments and other observations are also recorded. It is important to note that

36

D . B . Morton

Table 5.1

Animal score sheet (blank) for streptozotocin diabetes model

Rat No.

Animal issue no:

Date of starving:

Pre-starved weight:

Date i

Day Time I

I

I

I

I

I

I

i

From a distance Inactive i

Isolated Walking on tiptoe Hunched posture Starey coat

'

i

'

Type of breathing* Grooming

" On handling , Not inquisitive and alert Not eating Not drinking/average amount drunk (ml) Body weight (g) % Change from start Body temperature (~ Pale or sunken eyes Dehydration Diarrhoea: 0 to 3 (+m or + b ) l I

I

I

Distended abdomen/swollen .

.

.

.

.

i

vocalization on gentle palpation Nothing abnormal detected (NAD) r Given 5 ml saline s/c or p.o. Other signs noted: Loss of body condition

Signature Special husbandry requirements Animals should be kept on a grid cage with tray and cleaned twice daily, and mouse box for enrichment. Two bottles should be provided for each cage and filled twice daily. Deprivation of water overnight may be sufficient to cause death by dehydration. Autoclaved diet must be provided. Scoring details * Breathing: R = rapid; S = shallow; L = laboured; N = normal. 1-0 = normal; 1 = loose faeces on floor; 2 = pools of faeces on floor; 3 = running out on handling; +m = faeces contain mucus; +b = faeces contain blood. Humane end points and actions 1. Any animals showing signs of coma within the first 24-48 hours will be killed. 2. Any animals weighing less than the starting weight after 7 days will be killed. 3. Any animal showing tiptoe or slow ponderous gait will be killed. Inform scientist, named veterinary surgeon and animal technician in day-to-clay care if any of 1-3 above is seen. Scientific measures Animals that have to be killed should have their kidneys placed in formal saline and the pots clearly labelled.

animals can be scored at any time and would certainly be scored more than once daily during critical periods when an animal's condition could predictably give rise to concern (e.g. in the immediate postoperative period; in a study on infection at the time of bacteraemia or septicaemia).

At the bottom of the sheet there are guidance notes for the animal technicians about what they should provide in terms of husbandry and care for animals on that scientific procedure. There are also guidelines on how to score qualitative clinical signs such as diarrhoea and respiration, as

ETHICAL ASPECTS OF THE USE OF ANIMAL MODELS OF INFECTION

well as criteria by which to judge humane endpoints. If an animal has to be killed, there is guidance about what other actions should be taken, such as tissues to be retrieved and kept in formal saline; this helps ensure that the maximum information is always obtained from any animal in the study. While these sheets take time to fill in, it is not difficult for an experienced person, such as an animal caretaker, to see if an animal is unwell so the time taken can be reduced by simply scoring that the animal is normal by ticking the N A D box (nothing abnormal detected). However, if an animal is not normal, it does take time to check it and to make judgements over what actions to be taken, but is that not the price to be paid for practising humane science? In order to promote good care and good continuity of care we allocate an animal technician to be responsible for liaising with the scientists and other technical staff, and also to maintain and update the score sheets. The roles of the technician in charge are: 9 to check that the appropriate licences are in order and marry up with what the scientist intends to do that day to the animal 9 to check that the score sheet is appropriate before the experiment begins 9 to know the purpose of the experiment and its scientific objectives, and to become familiar with the scientific procedures to be carried out on the animals and the clinical signs that may occur 9 to ensure all personnel (technicians, scientists) know how to use score sheets and can recognize the clinical signs and interpret them clearly into humane endpoints 9 to check that technicians not familiar with that experiment, say doing a weekend or holiday rota, are informed about animals 9 to liaise with licensees over the experiment, e.g. timing, numbers of animals, equipment, endpoints 9 to update the score sheets based on new signs or combinations of signs observed 9 to report to the responsible persons any concerns over the animals or personnel involved Table 5.2 shows a completed score sheet. At a glance it can be seen that there are more plus signs to the right than to the left. Several other points can be noted: first, along the top, as the animal became unwell, it was scored more frequently. During day 0 (the day of the operation) it scored abnormal in one or two predictable signs as it was recovering from the anaesthetic and the surgery (low body temperature and hunched) and so the N A D box was ticked. The next day (21 June) basic observations were made of the amount of food eaten, temperature and body weight, and again the N A D box was checked. However, towards the end of that day, the coat became starey (ruffled), the body temperature rose, and its breathing became more rapid. By the next morning, there was a significant body weight loss (12%) which increased during the day to 18%ma strong

37

indication that the animal had not eaten or drunk much, if anything, or that it had diarrhoea. In fact there were so many abnormal clinical signs that it was decided to kill the animal on humane grounds before the end of the experiment. The sudden appearance of diarrhoea and the concomitant rapid weight loss and dehydration, laboured breathing, posture and lack of a red-light response all confirmed that the animal was becoming severely physiologically compromised and consequently--and an important c r i t e r i o n - - i t was not going to yield valid scientific results. Even more significantly, its temperature was now at 35.5~ - a very poor sign, and its extremities (feet and ears) were blue. In our experience, this animal would have died that night, if not sooner. This scheme of scoring clinical signs for the recognition and assessment of adverse effects on animals during scientific procedures has been shown to have several advantages: 9 Closer observation of animals is now carried out by all staff at critical times in the experiment as the sheets have indicated those times that are critical for the animal, and when the animals find their circumstances most aversive 9 Subjective assessments of suffering by staff and scientists are avoided, thereby promoting more fruitful dialogue, as evidence-based opinion becomes possible based on the clinical signs. In a sense they empower the animal technicians and help them demonstrate to less experienced persons why an animal is "not right" 9 Consistency of scoring is increased as the guidance is clear and the scoring options are limited 9 Single signs or combination of signs can be used to indicate the overall severity of the procedure, as well as alleviative therapies or scientific procedures at set points in the experiment (e.g. blood sampling) 9 The score sheets help to determine the effectiveness of any therapy intended to relieve adverse effects 9 The score sheets help to determine which experimental models cause least pain, distress and dystress by comparing alternative animal models and thus helping to refine scientific procedures 9 The score sheets help to train those inexperienced in the assessment of adverse effects As mentioned before, the score sheets are constantly being updated with further experience; it is surprising how the process never seems to stop as new staff pick up new signs, or new signs develop as the experimental model is slightly modified, or staff start to perceive patterns of adverse effects that, when taken as a whole, indicate early death or early deterioration sufficient to warrant the animal being killed on scientific grounds alone. Such information has led to better animal care as well as providing useful scientific information such as the recognition of neurological deficits, times of epileptic fits or weight loss, as well as unexpected findings such as urinary retention in a model of renal failure. Furthermore, by picking up signs of poor animal well-being early, we can implement humane

38

D . B . Morton

Table 5.2

A n i m a l s c o r e s h e e t ( c o m p l e t e d ) for h e t e r o t o p i c k i d n e y t r a n s p l a n t

Rat No.

Issue no:

HN1

Date of operation: 20 J U N E at 11.00 h

234

Preoperation weight: 2 5 0 g

,

,

Date

20

Day > surgery

20

0

Time

21

0

13.30

21

1

17.30

22

1

8.00

22

2

22

2

2

4.00

8.00

11.00

14.00

-

-/+

+

+

_

+

+

From a distance Inactive

-

I n a c t i v e ? T r y red light r e s p o n s e A Isolated

-

-

+

+

+

Hunched posture

+

+/-

-/+

+

+

Starey coat

-

Rate of b r e a t h i n g

54

,

+

+

+

+

60

64

70

40

R

R

L

T y p e of b r e a t h i n g *

On handling N o t inquisitive a n d alert

.

Eating/jelly m a s h ? a m o u n t e a t e n t

-

Not drinking

-

Bodyweight

(g)

.

. 50%

, 254

% C h a n g e f r o m start

.

,

B o d y t e m p e r a t u r e (~

35 -

i 36~5

37

.

.

.

.

.

.

.

Dehydration A

_

Coat/wet soiled

.

.

.

.

Pale e y e s a n d ears

.

.

.

.

.

?

?

?

, 221

, 215

, 205

0%

.

.

?

?

, 250

E x c e s s i v e w e t n e s s on l o w e r b o d y

Blue e x t r e m i t i e s A

?

-

6%

Sunken eyes A

.

-

, 260

-

C r u s t y red e y e s / n o s e

+

-12%

-14%

-18%

38

38

36.5

35.5

-

-

+

+ +

. -

.

.

.

.

.

.

=.

.

.

NAD

,/ ,

,

+

+ ;

.

'

'

.

. ,/

,

--/+ -

,

,

-

-

,

i

Dosing

Other

+

.

i

S w e l l i n g of graft:l: A

+

.

.

Stitches OK?/date removed

-

DIARRHOEA A

+

+

Signature Special husbandry requirements Animals should be put on a cage liner with tissue paper and a small piece of VetBed.

Scoring details * Breathing: R = rapid; S = shallow; L = laboured; N = normal. l-Eaten/jelly mash-amount? Record as 0/25/50/75/100%. :[:Swelling score: 0 = normal; 4+ = rejection and large swelling.

Humane end-points and actions 1. Weight loss of 15% or more; inform the investigator, veterinarian and technician in charge. 2. Pre-moribund state (indicating a failing graft). 3. Any major clinical sign recurs after 24 hours (marked ^, less than 35 ~

Scientific measures Take 1 ml of blood and urine, if possible; place at 4~ Place transplanted kidney into 10 ml formal saline.

endpoints sooner rather than later, which avoids animals being inadvertently lost from an experiment. In the UK, where severity limits are imposed on each scientific procedure, the score sheet can be used to indicate when such limits have been reached, or are about to be breached, or

may have to be reviewed, by a precise observation of clinical signs. The score sheet system provides a visual aid, opens up discussion between interested parties, and helps focus attention on to the animals' condition throughout the procedure s .

ETHICAL ASPECTS OF THE USE OF ANIMAL MODELS OF INFECTION

Disagreement can still occur, however, but from a scientific viewpoint a skewing of data may arise due to culling animals breaching severity limits--survivors may be a separate subgroup for some reason. In any event, the question that the scientist must ask is whether an animal deviating from normality to that degree is really going to provide sound scientific data in terms of answering the specific scientific objective? If it is not, the animal should be killed. An analysis of the score sheets can reveal patterns of recovery or deterioration and so gives a better picture of the overall effect of a procedure on the animals from start to finish. The sheet encourages all involved to observe the behaviour of animals, to recognize normal and abnormal behaviours, which will help in determining animals' responses to various procedures, and this will help to devise ways of refining experimental technique by highlighting the type and timing of any adverse effects. The scoring system has proved to be especially useful with new procedures, or when users are not always sure of what effects a procedure will have. In my experience the literature rarely records adverse effects on the animals, or how to avoid them or measure them, and I believe scientists have a moral obligation to do so (Morton, 1992). We now look more closely at ways of improving our perioperative care and in some experiments we have found that recovery is slower than it could be if we used different anaesthetics or analgesics, or intraoperative procedures such as maintaining body temperature or giving warm saline (Wadham, 1996). In the light of all this, we now have better systems of care, and we try to operate earlier in the day so that animals have maximum time under close observation when they can be given more support such as fluid therapy or special diets (e.g. jelly, fruit, vegetables). This has proven to save animals' lives as well as improving the speed of recovery, yielding scientific benefit, good science and good animal welfare.

Devising and validating humane endpoints Where signs can be objectively measured (such as body weight, heart rate, blood glucose level and body temperature), they can be fitted into bands, e.g. respiration rate raised between 5 and 25%, or 25 and 50%, or greater than 50% from normal. Body weight loss can also be banded in this way, e.g. a loss of less than 10%, or between 10 and 20%, or greater than 20%, for an individual from the start of the experiment or compared with non-experimental cohorts or compared with controls. Subjective signs, such as eye closure and pain response, are recorded to obtain an idea of the degree of abnormality. For example, the eye may be normal, half-closed or fully closed and/or an eye may be discharging or ulcerated. The overall suffering for an animal or severity of a procedure can then be assessed from the range of abnormalities as well as their magnitude. Humane

39

endpoints can then be assigned according to the parameters observed or measured. Another way of assessing the overall state of the animal from these observations is to score each sign or band category, then add them up to indicate some action depending on the final figure. Thus, one could allocate 0 for normal body weight, 1 for a loss of 5-10%, 2 for 11-20% and 3 for greater than 20%. Similarly, for the eye: normal would score 0, half-closed 1, and fully closed 2. An eye which may be discharging or ulcerated might score 3. In this way the animal would be given an overall score which can be used to assess the overall degree of deviation from normal and place it in a pain severity band. The score could also dictate action to be taken, such as seek veterinary advice, give analgesia, and, as in the recording only system, this could be linked even more closely with a particular sign, for example, whimpering or squeaking when touching the abdomen, or ulceration of an eye.

Death as an endpoint It is worth considering why animals die during experiments and why death is such a crude, inhumane and unscientific endpoint. Animals that die in coma are not suffering but what happened before that state is of concern. Ultimately death ensues because the heart stops or the brain stem is irreversibly destroyed so that respiratory and cardiac control centres fail, and is normally not a direct result of the infectious agent or whatever experimental variable is being studied. Animals may be unable to reach the water bottle or unable to eat, and this will lead to dehydration, increased viscosity of the blood and eventually to heart failure (which is what happens in the rabies potency test described below). Potentially, and probably on most occasions, death is preceded by considerable animal suffering, and so should only be used as a last resort and requires substantial justification (Tomasovic et al., 1988; Kuijpers and Walvoort, 1991; Workman et al., 1998) At the World Congress on Alternatives the following statement was agreed at the workshop (Mellor and Morton, 1997). In principle death should not be an endpoint in any experiment or test, but if death is proposed as an endpoint, it must be justified with increasingly strong arguments as the anticipated overall pre-death suffering increases. There is also the possibility of losing valuable scientific data through the death of an animal as postmortem findings, particularly histological analysis and culture counts, will be severely compromised. Even in infection studies, alternatives such as bacterial colony counts or plaque-forming units before death at set time points after infection may be more valuable. Such quantitative data can be analysed on a variation of a dose-response curve and should achieve

40

D.B.

good scientific data without wasting animal lives. Little work seems to have been done in this area and there is scope for research in order to refine and determine humane endpoints. I will now describe three examples to the implementation of humane endpoints in vaccine potency testing, in research into virulence, and in a trial of potential therapeutic agents using these score sheets.

Worked examples The first concerns rabies vaccine potency testing. This work was carried out by Klaus Cussler in order to find humane endpoints to replace that of death (Cussler, 1997). Here the object of the challenge test is to test various dilutions of the batch of rabies vaccine against a standard challenge of live rabies virus. The clinical signs for this test are well-known, as are the times of their appearance, and the data were analysed during an ongoing challenge test. The signs were grouped chronologically in five stages as shown in Table 5.3. The data were then analysed from the viewpoint of what clinical signs could be used to predict death: from what stage could an animal recover, and a t w h a t stage did death always ensue after a particular group of clinical signs (Table 5.4)? From these preliminary data it can be observed that one mouse (number 6) recovered from stage 1, but no mouse that showed clinical signs of stage 2 or beyond ever recovered. It can also be seen that if mice had been killed at stages 2 or 3, then it would have been possible to reduce the animals' suffering by approxi-

Table

5.4

Morton

5.3 Chronological appearance of clinical signs during rabies challenge tests

Table

Clinical signs

Stage

Ruffled fur Hunched back Slow movements Circular movements Trembling, shaky movements Convulsions Lameness Paralysis Prostration Death

1 2 3 4 5

After Cussler et al. (1998).

mately 3 days. The animals should possibly have been examined more frequently as it can be seen that some stages were not recorded as they probably occurred between observation periods. The second example is that described by Soothill and coworkers in 1992. In this work they were investigating the virulence of Pseudomonas aeroginosa, Stapkylococcus aureus, and S. epidermidis in mice, again using death as an endpoint. They found that the animals that became moribund or died always had a body temperature below 35~ and those that survived always had a temperature above 35~ It was possible then to use that temperature as a cut-off point. The mice also showed other clinical signs, such as reduced

Actual appearance of clinical signs during a rabies vaccine potency challenge test

Day 1

2

3

4

5

Mouse 6

7

8

9

10

8

0 0 0 0 2 5

0 0 0 0 0 0

0 0 0 0 0 0

0 0 0 1 1 1

0 0 0 1 2 4

0 0 0 1 0 0

0 0 0 2 2 4

0 0 0 1 3 4

0 0 0 1 1

0 0 0 0 0

9

-

0

0

2

5

0

5

5

1

0

10 11 12 13 14 15

-

0

0

4

-

0

-

-

3

0

-

0

0

5

-

0

-

-

-

0

-

0

0

-

-

0

-

-

-

0

-

0

0

-

0

-

-

-

0

-

0

0

-

-

0

-

-

-

0

-

0

0

-

-

0

-

-

-

0

1 2 3 4 5 6

7

0 = animal normal, no clinical sign observed. 1-5 = recognized stages of clinical signs set out in Table 5.3. - = the animal has died. After Cussler et al. (1998).

ETHICAL ASPECTS OF THE USE OF A N I M A L M O D E L S OF INFECTION

41

mobility or hunched or starey coat, and some of these recovered; the appearance of these signs indicated which mice should start to have their temperatures taken every 2 hours. This approach is even more practical today with the introduction of temperature transponders along with individual identifiers, as they would be far preferable to manual temperature-taking with a thermistor, which takes time and makes the animals sore. Finally, Townsend and Morton (1994) looked at ways of refining an experiment aimed at preventing toxic shock caused by bacterial endotoxins by the use of antibodies. The experiment was first altered by giving a dose of endotoxin that would kill the mice during the working day, instead of the traditional way of using a lower dose and seeing how many animals were alive after 4 days. Next the mice were observed carefully and scored on the basis of their appearance (hunched, starey coat and closed eyes), their behaviour (decreased activity) and clinical signs (diarrhoea, haematuria and body temperature drop). These data were treated numerically and a score of 1 was given to all the signs apart from body temperature, which was given 1 point for every degree centigrade drop below normal. The idea was that the higher the score, the more the animal had deviated from normality and that subtle partial cure effects could be recorded (Table 5.5 gives the results). It can be seen that in no case were any of the treatments successful, but there was a clear and statistically significant difference between those mice left unprotected and the control untreated group (as well as all other treatment groups). This way of handling data to try and quantify adverse effects may help in some experimental work; it should not necessarily be taken as indicating that an animal may be in more pain or distress, although this is likely to be the case (Morton and Griffiths, 1985).

Who monitors and when?

Table 5.5

Some suffering may be inevitable in an experiment and no amount of skill or following best practice can avoid it being incurred except, of course, by not carrying out the experiment. This suffering can be viewed as necessary or unavoidable to achieve that scientific objective and is the cost to the animal that is taken into account when a harm-benefit analysis is carried out. However, as far as the scientist is concerned there are also a number of factors within his or her control which can contribute to the quality of life of the animal on experiment as well as improving the science (Table 5.6). The first is careful planning of experiments to maximize the amount of valid and reliable information which can be obtained from any one animal, thus reducing the need for repetition of studies and the use of large numbers of animals. This would include allowing sufficient time to allow animals to settle into husbandry routines, their new accommodation and the experimental protocols. Second, using score sheets with clear endpoints, care protocols and standard operating procedures enables those concerned

Mean scores for mice given endotoxin and various treatments

Mean scores

n

Controls No endotoxin 50 Bg endotoxin only

1.53 + 0.108" 9.86 + 0.57

8 8

9.24 + 0.36 7.22 + 0.27

4

10.49 + 1.20 9.11 + 0.59

5 5

8.90 + 0.64 6.89 + 0.79

6 6

Prophylaxis against endotoxin with: Non-immune serum Anti-endotoxin antibody

4

Pre-incubation of endotoxin with: Normal serum Anti-endotoxin antibody

Post-endotoxin treatment with: Normal serum Anti-endotoxin antibody

* Significant differences at P MIC). Data points are mean +_SD (vertical error bars) values from four thighs.

The thighs are removed at each sampling time, and the muscle is cut from the femur and pelvic bones. The muscle is immediately homogenized in ice-cold 0.85% NaC1 in a tissue homogenizer in a volume up to 10 ml. In experiments with ~-lactams 10-50 lal of penicillinase (10 • 106U/ml) is added to the homogenate. Viable counts are determined on Mtiller-Hinton agar for staphylococci, Enterobacteriaceae and Pseudornonas and horse-blood agar for streptococci by

MURINE THIGH INFECTION MODEL

plating in duplicate 10 lal of serially 10-fold diluted samples of homogenate.

Expression of results

The counts of cfu are generally expressed per thigh (Hunter et al., 1973; Gerber et al., 1983; Vogelman et al., 1988a). For

determination of PAE (Craig and Gudmundsson, 1996) the counts of cfu/thigh (mean of three to four mice) at each time point are then graphed and the duration of PAE is calculated by the following equation: PAE = T - C - M where M represents the time serum levels exceed the MIC; T is the time required for the counts of cfu in thighs of treated mice to increase 1 log~0above the count closest to but not less than time M; and C is the time required for the counts of cfu in thighs of untreated control mice to increase 1 log~0 above the count at time zero. An example of a typical experiment involving PAE following combinations of two agents is shown in Figure 15.2. In this model efficacy of an antimicrobial agent can be defined as the change in log,0 number of cfu per thigh over the 24 hour treatment period and is calculated by subtracting the mean log,0 number of cfu per thigh from control mice just before therapy from the mean number of cfu from the two thighs of each treated mouse at the end of therapy (Vogelman et al., 1988b; Leggett et al., 1989; Valdimarsd6ttir et al., 1994). The pharmacokinetic parameters studied (including duration of time that serum levels exceeded the MIC or MBC expressed as a percentage of the 24 hour treatment period, log,0 peak serum level, lOgl0 AUC, etc) can then be correlated with efficacy by using univariate and stepwise muhilinear regression analysis (Vogelman et al., 1988b). Other indicators of efficacy can be calculated, such as E .... a measure of relative efficacy indicated by the maximum antimicrobial effect attributable to the drug, and Ps0, a measure of potency indicated by the dose producing 50% ofEma x (Leggett et al., 1989; Craig and Ebert, 1993). In-vivo synergy/antagonism has been studied in this model (Gerber et al., 1983; Fantin and Carbon, 1992; Gudmundsson et al., 1993) and induction of resistant variants of bacteria following antimicrobial exposure (Gerber et al., 1982).

Advantages and disadvantages of the model The major disadvantages of this model would include the facts that the mice need to be anaesthetized for inoculation and that the model does not represent a 'natural' infection: pyomyositis is a very rare infection indeed (Adams et al., 1985).

141

On the other hand, the model has several advantages (Craig and Gudmundsson, 1996). It is very simple and versatile. Mice are easy to handle and are relatively inexpensive. The model is very reproducible, the inoculum is accurate with low variability and, therefore, relatively few mice are needed for each data point. Marked granulocytopenia is reliably induced and thus permits study of the interactions between micro-organism and antimicrobial agent without the interference of neutrophils or an abscess. However, the model can also be used in non-neutropenic mice. Thigh muscles are easily inoculated and removed from the femur and pelvis. As an end-point most investigators have used viable bacterial counts; the number of bacteria is easily quantitated in thigh homogenates, and the results are generally easily reproducible. Other end-points, including survival, can furthermore be included. The rapid elimination of antimicrobial agents in mice permits short exposure periods after a single dose when determining in-vivo PAE in this model. Human pharmacokinetics can be simulated in this model, both by repeated injections (Gerber et al., 1986) and by inducing transient renal impairment in the mice (Fantin et al., 1990; Craig et al., 1991). Although antimicrobial concentrations can be determined in thigh homogenates, it is unlikely that they represent the exact concentration at the site of infection. Ryan and Cars (1980) compared tissue concentrations in whole muscle with those in muscle tissue fluid obtained by implantation of cotton threads under muscle fascia. The muscle concentrations of two ~-lactams were only 18-22% of the corresponding tissue fluid level. Moreover, the drug concentrations in muscle interstitial fluid closely approximated those observed in serum with only a short time lag. In their early studies, Eagle et al. (1950) used different doses of procaine penicillin to determine the serum concentration having the minimum bactericidal effect in muscle tissue. The value obtained for several different streptococci was virtually identical to the concentration that was minimally lethal in vitro. Thus, it appears that serum concentrations can be used to estimate relatively accurately the antimicrobial concentration in the interstitial fluid of muscle.

Contribution of the model to infectious disease therapy The value of animal models in evaluating optimal antimicrobial therapy is unquestioned (O'Reilly et al., 1996), but perhaps often overlooked. Animal models, particularly simple ones like the neutropenic mouse thigh infection model, offer the possibility of standardizing both the host factors that may affect outcome of infection and treatment as well as the offending organism and the therapy rendered. Animal models are suitable for investigation of complex situations that are difficult to mimic in test tubes and impos-

142

sible to control and consistently reproduce in clinical trials (Calandra and Glauser, 1986). Recent guidelines on the clinical evaluation of antimicrobials issued by the Infectious Disease Society of America in conjunction with the US Food and Drug Administration emphasize the need for animal model evaluation of new compounds or new therapeutic modalities as a prerequisite for clinical trials (Beam et al., 1992).

S. Gudmundsson and H. Erlendsd6ttir

On the other hand, the ]]-lactams do not induce a PAE against Gram-negative bacilli and furthermore exhibit a bactericidal activity that is time- but not concentrationdependent. For such drugs the major pharmacokinetic parameter predicting efficacy and determining the optimal dosage interval was demonstrated to be the time that drug concentration exceeds the MIC, implying that the most efficacious drug administration in this case involves short dosage intervals or even by continuous administration.

Dosing of antimicrobials Implication for therapy in humans

The major studies performed in the neutropenic murine thigh model during the past decade have involved determination and standardization of the PAE in vivo and determination of the association of various pharmacological variables with maximum efficacy of the drug under study (Gudmundsson et al., 1986; Vogelman et al., 1988a,b; Gudmundsson et al., 1993; Craig and Gudmundsson, 1996). These studies have confirmed the in-vitro data for the PAE, i.e. that cell-wall-active antibiotics (all four classes of ~-lactams, vancomycin) generally induce a significant PAE against Gram-positive organisms, but none or very short PAE against Gram-negative bacilli, with the exception of penicillin failing to induce a PAE against pneumococci in this model. Drugs that inhibit protein or nucleic acid synthesis (aminoglycosides, trimethoprim, tetracyclines, clindamycin, erythromycin, chloramphenicol, 6-fluoroquinolones) induce a significant PAE against both Grampositive cocci and Gram-negative bacilli. A notable exception to the general absence of a PAE after exposure of Gram-negative bacilli to ~-lactams is the induction of a clinically significant PAE by imipenem and other carbapenems against P. aeruginosa (Vogelman et al., 1988a; Craig and Gudmundsson, 1996). These data on the PAE provide theoretical rationale for either intermittent or more continuous dosing of antimicrobials, depending on the infecting organism and the drug to be used. Intermittent dosing regimens would apply primarily to drug-organism combinations that exhibit a prolonged PAE. On the other hand, more continuous dosing would be necessary for drug-organism combinations that lack a PAE. This hypothesis has been confirmed by employing the neutropenic mouse thigh model with the methodology described above (Vogelman et al., 1988b; Leggett et al., 1989; Craig and Gudmundsson, 1996). Thus, it was demonstrated that, for drugs inducing a significant PAE, serum levels needed not be maintained constantly above the MIC to achieve maximal efficacy. The major pharmacokinetic parameter predicting efficacy for such agents, e.g. aminoglycosides against Gram-negative bacilli, is the area under the concentration-time curve (AUC) and the optimal dosage interval is primarily dependent on the duration of the PAE, thus indicating that the optimal dosing regimens in terms of efficacy, cost and toxicity for these agents could include long intervals.

These observations have been of significant importance for studies on once-daily dosing of aminoglycosides. There are now dozens of clinical trials showing equal efficacy for once-daily versus two- or three-times-a-day dosing of aminoglycosides, either alone or in combination with a ~lactam antibiotic (Gilbert, 1991; Hatala et al., 1996; Munckhof et al., 1996). Although most studies have also exhibited similar toxicity, some trials have suggested a lower frequency of adverse reactions with a single daily dose of an aminoglycoside than with three-times-a-day dosing of the drug (Prins et al., 1993). These observations have furthermore been extended to febrile neutropenic patients (International Therapy Cooperative Group of the EORTC, 1993). In contrast to the current extensive information on oncedaily dosing of aminoglycosides, very limited information is available on the clinical efficacy of continuous infusion of antimicrobials (particularly ~-lactams) vs. intermittent dosing or the value of maintaining serum levels above the MIC for the majority of the dosing interval (Craig and Ebert, 1992; Mouton and Vinks, 1996). However, in a study performed approximately 20 years ago, Bodey and associates (1979) compared the efficacy of intermittent vs. continuous administration of cefamandole in combination with intermittent dosing of carbenicillin in cancer patients. A significant benefit for continuous administration of the ~-lactam antibiotic could be demonstrated in patient subgroups, such as those infected with cefamandole-sensitive organisms and those with marked neutropenia that did not improve during therapy. Similarly, Shentag and co-workers (1984) demonstrated the association between efficacy of cefmenoxime in lower respiratory tract infections in intubated patients and the time serum drug levels remained above the MIC of the offending organism.

Antimicrobial combinations

In the neutropenic murine thigh model, B-lactam-aminoglycoside combinations induce a prolonged PAE in vivo against Gram-negative bacilli as compared to the PAEs of the agents alone (Gudmundsson et al., 1993). Preliminary dosing experiments have been conducted in this model (Valdimarsd6ttir et al., 1994), where ceftazidime and

MURINE THIGH INFECTION MODEL

imipenem were administered at different dosing frequencies, singly or in combination with tobramycin, against a strain of P. aeruginosa. Dosing regimens of the two B-lactam-aminoglycoside combination that produced comparable efficacy allowed for longer dosing interval for imipenem (q12-q24 hours) than for ceftazidime (q3-q6 hours). This is probably associated with the enhancement of PAE by imipenem-tobramycin (both PAE-inducing agents) not observed with ceftazidime-tobramycin. These observations indicate that different dosing schedules may be appropriate in drug combinations as compared to the drugs as single agents. Dosage interval may possibly be prolonged and total dose reduced without loss of efficacy. However, human studies to this effect have not been performed.

Concluding remarks The model is very suitable for screening of new antimicrobial agents, particularly in regards to the association of antibacterial effect with the pharmacological variables prior to clinical trials (Craig and Ebert, 1993). Experience with aminoglycosides attests to the predictive ability of this model. Furthermore, it is simple, accurate and cheap. It needs neither special housing (except for standard animal facilities) nor special equipment, and is thus suitable for practically every researcher in the field of microbiology and infectious diseases.

References Adams, E., Gudmundsson, S., Yocum, D. E., Haselby, R. C., Craig, W. A., Sundstrom, W. R. (1985). Streptococcal myositis. Arch. Intern. Med., 145, 1020-1023. Beam, T. R., Gilbert, D. N., Kunin C. M. (1992). General guidelines for the clinical evaluation of anti-infective drug products. Clin. Infect. Dis., 15 (Suppl. 1), $5-$32. Bodey, G. P., Ketchel, S. J., Rodriguez, V. (1979). A randomized study of carbenicillin plus cefamandole or tobramycin in the treatment of febrile episodes in cancer patients.am. J. ivied., 67, 608-616. Calandra, T., Glauser, M.P. (1986). Immunocompromised animal J. ivied., 80 models for the study of antibiotic c~176 (Suppl. 5C), 45-52. Caminero, M. M., Martinez, F. F., Izquierdo, 1.I., G6mez-Lus Centelles, M. L., Prieto, J. (1993). In-vivo and in-vitro study of the postantibiotic effect of meropenem. J. Antimicrob. Chemother., 32, 917-918. Craig, W. A., Ebert, S. C. (1992). Continuous infusion of B-lactam antibiotics. Antimicrob. Agents Chemother., 36, 2577-2583. Craig, W., Ebert, S. (1993). Pharmacodynamic activities of RP59500 in an animal infection model. Abstract 205. In Programs and Abstracts of the Thirty-Third Interscience Conference on Antimicrobial Agents and Chemotherapy, New Orleans 1993. American Society for Microbiology, Washington, DC.

143

Craig, W. A., Gudmundsson, S. (1996). The postantibiotic effect. In Antibiotics in Laboratory Medicine, 4th edn, (ed. Lorian, V.), pp. 296-329. Williams and Wilkins, Baltimore, MD. Craig, W. A., Redington, J., Ebert, S. (1991). Pharmacodynamics of amikacin in vitro and in mouse thigh and lung infections. J. Antimicrob. Chemother., 27 (Suppl. C), 29-40. Eagle, H., Fleischman, R., Musselman, A. D. (1950). The bactericidal action of penicillin in vivo: the participation of the host, and the slow recovery of the surviving organisms. Ann. Intern. Med., 33, 544-571. Fantin, B., Carbon, C. (1992). In vivo antibiotic synergism: contribution of animal models. Antimicrob. Agents Chemother., 36, 907-912. Fantin, B., Ebert, S., Leggett, J., Vogelman, B., Craig, W.A. (1990). Factors affecting the duration of in-vivo postantibiotic effect for aminoglycosides against Gram-negative bacilli, jr. Antimicrob. Chemother., 27, 829-836. Gerber, A. U., Wiprachtiger, P., Stettler-Spichiger, U., Lebek, G. (1982). Constant infusions vs. intermittent doses of gentamicin against Pseudomonas aeruginosa in vitro. J. Infect. Dis., 145, 554-560. Gerber, A. U., Craig, W. A., Brugger, H.-P., Feller, C., Vastola, A. P., Brandel, 1. (1983). Impact of dosing intervals on activity of gentamicin and ticarcillin against Pseudomonas aeruginosa in granulocytopenic mice. J. Infect. Dis., 147, 910-917. Gerber, A. U., Brugger, H. P., Feller, C., Stritzko, T., Stalder, B. (1986). Antibiotic therapy of infections due to Pseudornonas aeruginosa in normal and granulocytopenic mice: comparison of murine and human pharmacokinetics. J. Infect. Dis., 153, 90-97. Giacomini, K. M., Roberts, S. M., Levy, G. (1981). Evaluation of methods for producing renal dysfunction in rats. jr. Pharmaceut. Sci., 70, 117-121. Gilbert, D. N. (1991). Once-daily aminoglycoside therapy. Antimicrob. Agents Chemother., 35,399-405. Gudmundsson, S., Vogelman, B., Craig, W. A. (1986). The in vivo postantibiotic effect of imipenem and other new antimicrobials. J. antimicrob. Chemother., 18 (Suppl. E), 67-73. Gudmundsson, S., Einarsson, S., Erlendsd6ttir, H.' Moffat, J., Bayer, W., Craig, W. A. (1993). The postantibiotic effect of antimicrobial combinations in a neutropenic murine thigh infection model. J. Antimicrob. Chemother., 31 (Suppl. D), 177-191. Hailer, I. (1987). Evaluation of ciprofloxacin alone and in combination with other antibiotics in a murine model of thigh muscle infection. Am. J. Med., 82 (Suppl 4A), 76-79. Hatala, R., Dinh T., Cook, D. 1. (1996). Once-daily aminoglycoside dosing in immunocompetent adults: a meta-analysis. Ann. Int. Med., 124, 717-725. Hunter, P. A., Rolinson, G. N., Witting, D. A. (1973). Comparative activity of amoxycillin and ampicillin in an experimental bacterial infection in mice. Antimicrob. Agents Chemother., 4, 285-293. International Therapy Cooperative Group of the EORTC (1993). Efficacy and toxicity of single daily doses of amikacin and ceftriaxone versus multiple daily doses of amikacin and ceftazidime for infection in patients with cancer and granulocytopenia. Ann. Intern. Med., 119, 584-593. Klassen, M., Edberg, S. C. (1991). Measurement of antibiotics in human body fluids: techniques and significance. In Antibiotics in Laboratory Medicine, 4th edn, (ed. Lorian, V.), pp. 230-295. Williams and Wilkins, Baltimore, MD.

144

Kunst, M. W., Mattie, H. (1978). Cefazolin and cephradine: relationship between antibacterial activity in vitro and in mice experimentally infected with Escherichia coli. J. Infect. Dis., 137, 391-402. Leggett, J., Fantin, B., Ebert, S. et al. (1989). Comparative antibiotic dose-effect relations at several dosing intervals in murine pneumonitis and thigh-infection models. J. Infect. Dis., 159, 281-292. Minguez, F. M., Izquierdo, J. I., Caminero, M. M., Martinez, F. F., Prieto, J. (1992). In vivo postantibiotic effect of isepamicin and other aminoglycosides in a thigh infection model in neutropenic mice. Chemotherapy, 38, 179-184. Mouton, J. W., Vinks, A. A. T. M M. (1996). Is continuous infusion of B-lactam antibiotics worthwhile?--efficacy and pharmacokinetic considerations. J. Antimicrob. Chemother., 38, 5-15. Munckhof, W. J., Grayson, M. L., Turnidge, J. D. (1996). A metaanalysis of studies on the safety and efficacy of aminoglycosides given either once-daily or as divided doses. J. Antimicrob. Chernother., 37, 645-663. O'Reilly, T., Cleeland, R., Squires, E. L. (1996). Evaluation of antimicrobials in experimental animal infection. In Antibiotics in Laboratory Medicine, 4th edn. (ed. Lorian, V.), pp. 604-765. Williams and Wilkins, Baltimore, MD. Oshida, T., Onta, T., Nakanishi, N., Matsushita, T., Yamaguchi, T. (1990). Activity of sub-minimal inhibitory concentrations of aspoxicillin in prolonging the postantibiotic effect against Staphylococcus aureus. J. Antimicrob. Chemother., 26, 29-38. Prins, J. M., Biiller, H. R., Kuijper, E. J., Tange, R. A., Speelman, P. (1993). Once versus thrice daily gentamicin in patients with serious infections. Lancet, 341,335-339.

S. Gudmundsson and H. Erlendsd6ttir

Rolinson, G. N. (1973). Plasma concentrations of penicillin in relation to the antibacterial effect. In Biological Effects of Drugs in Relation to Their Plasma Concentrations, (eds Davies, D. S., Prichard, B. N. C.), pp. 183-189. University Park Press, Baltimore, MD. Ryan, M., Cars, O. (1980). Antibiotic assays in muscle: are conventional tissue levels misleading as indicator of the antibacterial activity? Scand. J. Infect. Dis., 12, 307-309. Schentag, J. J., Smith, I. L., Swanson, D. J. et al. (1984). Role for dual individualization with cefmenoxime. Am. J. Med., 77 (Suppl. 6A), 43-50. Selbie, F. R., O'Grady, F. (1954). A measurable tuberculosis lesion in the thigh of the mouse. Br. J. Exp. Pathol., 35, 556-565. Stratton, C. W., Relier, L. B. (1977). Serum dilution test for bactericidal activity. I. Selection of a physiologic diluent. J. Infect. Dis., 136, 187-195. Valdimarsd6ttir, M., Einarsson, S., Erlendsd6ttir, H., Gudmundsson, S. (1994). Dosing studies ofantimicrobial combinations against P. aeruginosa in an animal model. In Recent Advances in Chemotherapy, Proceedings oft he 18th International Congress of Chemotherapy, Stockholm , 1993, (eds. Einhorn, J., Nord, C. E., Norrby, S. R.), pp. 475-476. American Society for Microbiology, Washington, DC. Vogelman, B., Gudmundsson, S., Turnidge, J., Leggett, J., Craig, W. A. (1988a). In vivo postantibiotic effect in a thigh infection in neutropenic mice. J. Infect. Dis., 157, 287-298. Vogelman, B., Gudmundsson, S., Leggett, J., Turnidge, J., Ebert, S., Craig, W. A. (1988b). Correlation of antimicrobial pharmacokinetic parameters with therapeutic efficacy in an animal model. J. Infect. Dis., 158, 831-847.

Chapter 16

Mouse Subcutaneous Cotton Thread Model J. Renneberg

Background of the model Since the first antimicrobial agents became available it has been interesting to test if the drugs are active against bacteria in an almost clinical situation. Therefore attempts have been made to develop both in-vitro and in-vivo models capable of simulating the distribution of antibiotics in blood and tissue. By the early 1940s it was already recognized that penicillin was unevenly distributed in different body fluids and tissues. Thus Florey and Turton (1946) found elimination of penicillin from infected wound exudate to be slower than from blood, a finding confirmed by Schachter (1948) using a dog lymph model and by Ungar (1950) using a turpentine injector model in rabbits. It was also found that treatment results could not be solely explained by the serum concentration of the drug used (Eagle, 1948; Eagle and Musselman, 1948; Schmidt and Walley, 1951; Eagle, 1952; Eagle et al., 1953). Such findings as these prompted the development of a number of animal and human pharmacokinetic models. As bacterial infections usually start in the interstitial fluid of soft tissues, increasing attention was paid to interstitial fluid models. Raeburn (1971) evolved the dermabrasion or skin window technique for sampling interstitial fluid and Tan et al. (1972) introduced the use of chambers placed over the dermabrasions to obtain larger amounts of fluid. Simon et al. (1973) introduced the cantharidine blister technique for antibiotics research. In 1977, the suction skin blister technique, previously developed by Kiistala and Mustakallio (1967), was adapted by Harding and Eilon (1977) for studying the pharmacokinetics of antimicrobial agents. Ryan (1979) introduced the cotton thread technique. A 20-25 cm long cotton thread is applied in surgically created subcutaneous or muscular pockets of 1-2cm in animals or humans. After administration of antibiotic the thread is pulled through the tissue at different time intervals and cut off in 1 cm pieces, which are placed in phosphate-buffered saline (PBS). The A/V ratio for this model is more than 100, peak levels are reached with no remarkable delay and the peak levels are above 70% of the serum. Ryan primarily used the model in human volunteers, whereas Hoffstedt and Walder used an improved version of the technique in a number of studies (Hoffstedt and Walder 1981a,b; Hoffstedt et al., 1982). Handbook of Animal Models of Infection ISBN 0-12-775390-7

At the same time the surgical wound infection model was developed by Russel et al. (1968) and later modified by McRipley and Whitney (1976) to test local treatment of wound infections. The back of the mouse was shaved and a superficial surgical infection was produced by a midline incision 2.3 cm long. The skin was retracted and the wound infected, usually by placing a contaminated suture diagonally in the wound. The experiments performed did not involve examination of the sutures after treatment, but only tested blood and tissue specimens for eventual bacterial growth. The mouse subcutaneous cotton thread model, which is described here, is based upon a combination of the above mentioned models.

Animal species The mouse strain BALB-c, female mice 20-25 g, have been used in this model. Other strains have been tested but have not been found to be as suitable as the BALB-c - - similarly, females are preferred. Preliminary experiments should be performed to determine the optimal bacterial inoculum to ensure infection without producing significant mortality.

Preparation of animals The animals require routine husbandry and care with no specific pretreatment. The animals should be obtained 2 weeks prior to receiving anaesthesia. After the operative procedure the animals should be kept warm for at least 4 hours.

Details of surgery Overview Under light ether anaesthesia, a small incision (4-6 mm) is made in the back of the mouse. Through this incision the Copyright 9 1999 Academic Press All rights of reproduction in any form reserved

1

4

6

J

.

Renneberg

cotton strip, after immersion in the PBS suspension of bacteria, is implanted subcutaneously; the incision is left unsutured. Previous to the treatment series the model was tested with and without bacteria. It was found that, on day zero, drug penetration into the threads was independent of the presence or absence of bacteria. The pharma-

cokinetic profile (against time) of the inoculated strips resembled that of the fibrin clot model on day 2 (acute infection site) and that of an abscess model on day 6. The thread beds were examined macroscopically and histologically on different occasions after challenge (Figures 16.1 and 16.2).

Figure 16.1 Macroscopic appearance of the thread bed. A: day 0, B: day 2, and C: day 6.

Figure 16.2 Microscopic appearance of the thread bed. A: day 0, B: day 2, and C: day 6.

MOUSE SUBCUTANEOUS COTTON THREAD MODEL

Materials required Pure cotton thread was used in 8 • 10 mm strips. Each strip absorbed 100+5gl fluid, as calculated from the difference between the wet and dry weights. Phosphate-buffered saline 0.9% and scissors are also required.

Anaesthesia Ether inhalation (we used 2% for 30 seconds) for just long enough to ensure that the animal will not move and will not feel anything for the 1-2 minutes necessary to place the strip.

Surgical and infection procedure Following the light ether anaesthesia, a 4-6 mm incision is made aseptically in the skin of the unshaved back of the mouse. A cotton strip previously immersed in a PBS suspension of bacteria is implanted through the incision under the skin upon the fascia. After implantation the bacteria in the thread should be allowed to multiply for at least 2 hours. This approach is used because all bacterial species used in the model until now showed a lag phase of around 2 hours. The incision is left open.

Postoperative care The animals should be kept in their usual surroundings after the surgical/infection p r o c e d u r e - - n o special treatment is necessary so long as the mice do not bite each others' open wounds. The antibiotic treatment is initiated after 2 hours, 2 days or 6 days depending what infection state is needed for the experiment in question. The treatment is usually continued for a period of 6 hours (at most 8 hours). During this period, blood is drawn from the retro-orbital vein and thread strips are removed at precise intervals selected according to the drug(s) to be tested.

147

(Stratton and Reller, 1977). Viable counts were made on standard blood agar plates, except in the case of Haemophilus influenzae, which was grown on haematin agar. To ascertain an appropriate strength of inoculum, different amounts of bacteria were tested in neutropenic and normal mice, cyclophosphamide being used to induce neutropenia (Vogelmann et al., 1988). It was found that an inoculum of 10 7.8 colony-forming units (cfu) per strip induced infection in normal mice whereas only 10s cfu per strip was required in neutropenic mice. For the preparation of inocula, broth cultures of the bacteria were grown overnight; the bacteria were then resuspended in PBS and adjusted to 108-9cfu/ml. The cotton strips were immersed in this suspension immediately before implantation in the mice. Where a combination of two pathogens was under study, a pool of separately grown strains was prepared and then resuspended in PBS. The inoculum was checked in each experiment by plating and counting.

Infection process The infection process is described in Figures 16.1-16.2, which show both macroscopically and microscopically that the inoculated thread piece produces an inflammation leading first to acute infection and then to chronic infection after 6 days.

Key parameters to monitor infection The infection should only be monitored by killing mice at selected intervals to count the numbers of bacteria left in the piece of thread with or without treatment. If this is done every 60 minutes (or 30 minutes) a killing curve can be produced.

Antimicrobial therapy Storage and preparation of inocula Both clinical isolates and reference strains have been used. The clinical isolates were identified by conventional methods. The reference strains were Staphylococcus aureus ATCC 25923, Streptococcus faecalis ATCC 28272, Escherichia coli ATCC 25922 and Pseudomonas aeruginosa ATCC 27853. All strains used for inoculation of the threads were grown overnight in MHB. MIC and MBC values were determined in the same medium, except in the case of netilmicin, where Ca 2+ and Mg 2+ were added to the broth

Several antibiotics have been used in the model. In each experiment the drugs were obtained from the manufacturers in dry powder form. The antibiotics tested include ampicillin and isoxazolyl penicillins (Renneberg and Walder, 1988; Renneberg and Forsgren, 1989), imipenem (Renneberg and Walder, 198%), the aminoglycosides amikacin and netilmicin (Renneberg and Walder, 198%), vancomycin (Renneberg et al., 1993), clindamicin (Renneberg et al., 1993), rifampicin (Renneberg et al., 1993) and the quinolone norfloxacin (Renneberg and Walder, 1989). From a pharmacokinetic point of view, this panel of drugs is representative of most types of antibiotics.

148

J. Renneberg

Bacterial density in the threads

Pharmacokinetic methods

The thread strips are gently removed from the mice and immersed individually in 0.9 ml PBS (pH 7.4) for immediate homogenization. The strip bed and its surroundings should be checked for bacteria using sterile cotton swabs. Viable counts of bacteria for H. influenzae were determined on haematin agar, whereas all other bacteria were quantified by plating six 10-fold dilutions of 100 lul of the solutions obtained from the homogenized strips on blood agar. After 15-18 hours of incubation at 37~ the cfu was counted, the detection limit for the viable count being 10 cfu/100 ~1.

The half-life of drugs was measured during the elimination phase using a two-compartment model (Barza, 1981; Bergeron et al., 1981). The area under the curve (AUC) was measured with a compensating polar planimeter (Keuffel and Esser, USA). The forecasting of doses of ]]-lactam antibiotics followed the heartbeat theory of Mordenti (1985).

Antibiotic penetration into the threads After removal from the mice, the thread strips were placed in 0.9 ml PBS and immediately homogenized, pH was determined in the strip bed before removal of the strips and after the strip was removed. In-vitro assays were then performed on serum and on the thread specimens. An agar well technique (Mattie et al., 1973) was used. The plates measured 12 • 12 cm and contained 125 ml diagnostic sensitivity test (DST) agar. After prediffusion for 1 hour at room temperature, 8 m m diameter wells were punched in the agar and filled either with 70 ~1 standard solution prepared in pooled mice serum, PBS, serum specimen or subcutaneous tissue fluid (STF). Samples and standards were tested at least in duplicate, usually in triplicate. Homogenized strips previously immersed in fluid containing known concentrations of antibiotics in PBS were used as standards for the STF samples, since identical results were obtained in previous experiments where standards were prepared in non-infected STF, infected STF and in PBS. The indicator strains used were Micrococcus luteus CXX, M. luteus ATCC, and M. luteus ATCC 9341, P. mirabilis ATCC 21100, a S. aureus SBL 40 and a Stapkylococcus xylosus 3329. The assay ranges for each experiment are given in the respective reports.

Measurement of protein binding to mouse serum and subcutaneous tissue fluid The binding of antibiotic to serum proteins and to infected and non-infected subcutaneous tissue fluid was quantified by means of an ultracentrifugation method (Peterson et al., 1977). The samples were centrifuged at 14 000g for 16 hours at 3~ Then antibiotic activity was measured in starting samples and in the ultracentrifuge supernatant fluid as already described. The percentage of protein binding was then calculated as follows: 1 0 0 % - [(ultracentrifuge supernatant activity/starting activity) • 100%].

Key parameters to monitor response to treatment The mice will only very seldom present systemic signs of infection. Therefore, the only measurable parameter of infection is the bacterial number in the thread pieces at certain time-points from placement of the inoculated threads and calculation of the difference in counts between animals having treatment and animals without treatment, and the histological signs of infection in the thread bed, which are required if the stage of infection is to be documented.

Pitfalls (advantages/disadvantages) of the model Advantages 9 9 9 9 9

It is a very easy model to work with. It is cheap. Results may be presented from day to day. It is easy to test large numbers of animals. It is possible to use the same model to evaluate antibiotics at different stages in the development of infection. 9 It is possible to monitor concentrations of exoenzymes from the bacteria at the site of infection. 9 It is possible to measure antibiotics and active metabolites at the site of infection.

Disadvantages 9 The mouse infection is very distant from the clinical treatment situation. 9 The thread could be seen as an in-vivo 'in-vitro model'. 9 Antibiotic pharmacokinetics in mice are completely different from those in humans. 9 The animal immune system as far as infection is concerned cannot be compared to the human system.

Contributions of the model to infectious disease therapy 9 The model has been used to show different in-vivo activity of the different isoxazolylpenicillins (Renneberg and Forsgren, 1989).

MOUSE SUBCUTANEOUS COTTON THREAD MODEL

9 The importance of free [~-lactamase activity at the site of infection of a synergistic infection with streptococci and ~-lactamase producers, when the drug of choice is penicillin G, has been shown (Renneberg and Walder, 1989b). 9 The postantibiotic effect in vivo and synergistic effect in vivo have been described (Renneberg and Walder, 1989; Renneberg et aL, 1993). 9 The model makes it possible to monitor antibiotic pharmacokinetics as well as pharmacodynamics at the site of infection (Renneberg and Walder, 1988a,b).

References Barza, M. (1981). Principles of tissue penetration of antibiotics. J. dntimicrob. Chemother., 8, (Suppl. C), 7-28. Bergeron, M. G., Beauchamp, D., Poirier, A., Bastille, A. (1981). Continuous versus intermittent administration of antimicrobial agents: tissue penetration and efficacy in vivo. Rev. Infect. Dis., 3, 84-97. Eagle, H. (1948). Speculations as to the therapeutic significance of the penicillin blood level. Ann. Intern. IVied., 28, 260-278. Eagle, H. (1952). Experimental approach to the problem of treatment failure with penicillin. Am. J. Med., 13, 389-399. Eagle, H., Musselman, A. D. (1948). The rate of bactericidal action of penicillin in vitro as function of its concentration, and its paradoxically reduced activity at high concentrations against certain organisms.J. Exper. Med., 88, 99-131. Eagle, H., Fleischmann, R., Levy, M. (1953) "Continuass" vs "discontinous" therapy with penicillin. N. Eng.J. Med. 248,481-488. Florey, M. E., Turton, E. C. (1946). Penicillin in wound exudates. Lancet, Sept. 21,405-409. Harding, S. M., Eilon, L. A. (1977). Clincal pharmacology of cefuroxime. In The Early Evaluation of Cefuroxirne, (eds. Snell, E. S. et al. ), pp. 57-68. Glaxo Research, Greenford, Middlesex. Hoffstedt, B., Walder, M. (1981a). Influence of serum protein binding and mode of administration on penetration of five cephalosporins into subcutaneous tissue fluid in humans. Antimicrob. Agents Chemother., 20, 783-786. Hoffstedt, B., Walder, M. (1981b). Penetration of ampicillin, doxycycline and gentamicin into interstitial fluid in rabbits and of penicillin V and pivampicillin in humans measured with subcutaneously implanted cotton threads. Infection, 9, 7-11. Hoffstedt, B., Walder, M., Forsgren, A. (1982). Comparison of skin blisters and implanted cotton threads for the evaluation of antibiotic tissue concentrations. Eur. J. Clin. Microbiol., 1, 33-37. Kiistala, U., Mustakallio, K. K. (1967). Dermo-epidermal separation with suction. J. Invest. Dermatol., 48, 466-477. Mattie, H., Goslings, W. R. O., Noach, E. L. (1973). Cloxacillin and nafcillin: serum binding and its relationship to antibacterial effect in mice. J. Infect. Dis., 128, 170-177. McRipley, R. J., Whitney, R. R. (1976). Characterization and quantitation of experimental surgical-wound infections used to evaluate topical antibacterial agents. Antimicrob. Agents Chemother., 10, 38-44.

149

Mordenti, J. (1985). Forecasting cephalosporin and monobactam antibiotic halflives in humans from data collected in laboratory animals. Antimicrob. Agents and Chemother., 27, 887-891. Peterson, L. R., Hall, W. H., Zinneman, H. H., Gerding, D. N. (1977). Standardization of a preparative ultracentrifuge method for quantitative determination of protein binding of seven antibiotics. J. Infect. Dis. 136, 778-783. Raeburn, J. A. (1971). A method for studying antibiotic concentrations in inflammatory exudate. J. Clin. Pathol., 24, 633-635. Renneberg, J., Forsgren, A. (1989). The activity ofisoxazolyl penicillins in experimental staphylococcal infection. J. Infect. Dis., 159, 1128-1132. Renneberg, J., Walder, M. (1988a). A mouse model for simultaneous pharmacokinetic and efficacy studies of antibiotics at sites of infection. J. Antimicrob. Chemother., 22, 51-60. Renneberg, J., Walder, M. (1988b). Mouse model for evaluation of antibiotic treatment of acute and chronic infections. Eur. J. Clin. Microbiol. Infect. Dis., 7, 753-757. Renneberg, J., Walder, M. (198%). Post-antibiotic effects of Imipenem, Norfloxacin and Amikacin in vitro and in vivo. Antimicrob. Agents Chemother., 33, 1714-1720. Renneberg, J., Walder, M. (198%). The role of beta-lactamase in mixed infections in relation to treatment with ampicillin. J. Infect. Dis., 160, 337-341. Renneberg, J., Karlsson, E., Nilsson, B., Walden, M. (1993). Interactions of drugs acting against Staphylococcus aureus in vitro and in a mouse model. J. Infection, 26, 265-277. Ryan, D. M. (1979). Implanted cotton threads; a novel method for measuring concentrations of antibiotics in tissue fluid. J. Antimicrob. Chemother., 5, 735-736. Russell, H. E., Gutekunst, D. P., Chamberlain, R. E. (1968). Evaluation of furazolium chloride in topical treatment of model infections in laboratory animals. Antimicrob. Agents Chemother., 2,497-501. Schachter, R. J. (1948) Fate and distribution of penicillin in the body. I. Circulation of penicillin in the lymph. Proc. Soc. Exp. Biol. Med., 68, 29-34. Schmidt, L. H., Walley, A. (1951). The influence of the dosage regimen on the therapeutic effectiveness of penicillin G in experimental lobal pneumonia. J. Pharm. Exp. Ther. 103, 479-488. Simon, C., Malerczyk, V., Brahmstaedt, E., Toeller, W. (1973). Cefalozin, ein neues Breitspektrum-Antibiotikum. Deutsche Med. Wschr., 51, 2448-2450. Stratton, C. W., Reller, L. B. (1977). Serum dilution test for bactericidal activity. I: Selection of a physiologic diluent. J. Infect. Dis., 126, 492-497. Tan, J. S., Troot, A., Phair, J. P., Watanakunakorn, W. (1972). A method for measurement of antibiotics in human interstitial fluid. J. Infect. Dis., 126, 492-497. Ungar, J. (1950). Penicillin in tissue exudates after injection. Lancet, Jan. 14, 56-59. Vogelman, B., Gudmundsson, S., Turnidge, J., Legget, J., Craig, W. A. (1988). In vivo postantibiotic effect in a thigh infection in neutropenic mice. J. Infect. Dis., 157, 287-298. Weinstein, L, Daikos, G. K., Perrin, T. S. (1951). Studies on the relationship of tissue fluid and blood levels of penicillin. J. Lab. Clin. Med., 38, 712-718.

This Page Intentionally Left Blank

Chapter 17

Infection after Ionizing Radiation I. Brook, T. B. EIIiott and G. D. Ledney

Background of human infection Ionizing irradiation depresses normal host defenses (Mathe, 1965) and enhances the susceptibility of the immunocompromised host to local and systemic bacterial infections (Leroy, 1947; Clapper et aL, 1954; Kaplan et aL, 1958). There is a practical need to develop effective therapeutic modalities for infections following radiation injury. Lymphatic and other tissues from Japanese patients dying from the effects of the atomic blasts at Hiroshima and Nagasaki in 1945 frequently revealed microscopic bacterial colonies of both Gram-positive and Gram-negative bacteria in tissues (Keller, 1946). In some cases of accidental whole-body exposure, infections with enteric organisms occurred and presumably added to the radiation syndrome (Miller et aL, 1951). Mortality following exposure to irradiation during the Chernobyl nuclear accident in 1986 was also associated with septicemia due to Gram-negative and Gram-positive organisms (Gale, 1987). When a combination of trauma, exposure to toxic substances and other injuries occurs in conjunction with irradiation, the risk of developing a serious infection is increased. The development of therapeutic modalities to cope with these infections is necessary, and animal models that explore the utility of these therapies are very important and useful as human experience is limited.

number of Enterobacteriaceae increased (>109 organisms per gram of stool) while the number of anaerobes stayed low (10s-104; Figure 17.1). The increase in the number of Enterobacteriaceae coincides with the appearance of endogenous Escherichia coli and Proteus mirabilis in the blood, spleen and liver of the animals and the beginning of mortality (Brook et al., 1984, 1988; Figure 17.2). As the amount of radiation increases, anaerobic bacteria (mostly Peptostreptococcus spp. and Bacteroides spp.) are also recov-

12 ~ -6 10 o !--

oo

4

^"~erobic bacteria %,

k

_~ l r l

01 0

I 1

I

I

r~

ISBN 0-12-775390-7

I

I

I I I I 5 7 Days postirradiation

I 9

I

I 11

I

I 13

I

I

Staphylococcus

I

I

/

E

/"]

t-

Handbook of Animal Models of Infection

i 3

Enterobacteriaceae

I

model

The source of most infections after a lethal dose of radiation in experimental animals is the gastrointestinal tract, which is normally colonized by aerobic and anaerobic bacteria (Brook et aL, 1984). Following sublethal to lethal y or mixed-field irradiation of B6D2F 1/J mice, a decrease occurs in the number of the aerobic and facultative anaerobic bacteria in the gastrointestinal tract of mice. That decrease starts 2 days after irradiation and is maximal at the ninth day following exposure to Cobalt-60 ],-photon irradiation (Brook et aL, 1988). However, following the ninth day, the

A

Figure 17.1 Changes in aerobic and facultative flora in ileum of mice after lethal irradiation (10.0 Gy). (Brook and Ledney, 1994a,b)

100

sepsis

"

,~

2

Background of the model Generalized

Enterobacteriaceae

"o (1) o (1) r

50

i

o~ 6

7 8 Radiation

9 10 dose (Gy)

11

Figure 17.2 Micro-organisms recovered from irradiated mice in relation to radiation dose. (Brook et al., 1986) Copyright 9 1999 Academic Press All rights of reproduction in any form reserved

152

I. Brook, T. B. Elliott and G. D. Ledney

ered from the blood (Figure 17.2). Other potential sources of serious infection in the irradiated host are exogenous organisms such as Pseudornonas aeruginosa and Klebsiella pneumoniae. Animals given y-irradiation from Cobah-60 become susceptible to colonization and systemic infections from these organisms starting 2 days after irradiation. This is associated with leukopenia and thrombocytopenia that occurs after irradiation (Figure 17.3). 12

x .~

' " ,'"

,

,

## 8

,

,

,

Susceptibility to infection was demonstrated in lethally irradiated mice by inoculating known doses of single species of bacteria to determine the LD~0~30, usually 4 days after irradiation (Madonna et al., 1989). That time interval was selected because the number of circulating neutrophilic granulocytes decrease to barely detectable numbers by 3 days after 7.0 Gy 7- or 3.5 Gy mixed20 field-irradiation (Figure 17.3). Micro-organisms are injected into the skin between the shoulders, that is z pinched to form a pocket, in mice that are lightly anes16 ~, ~ thetized with methoxyflurane.

,

o - . - . o Leukocytes ~,,-----,~ Thrombocytes

/

l

Subcutaneous model

n=S

12

~ "O _~ W o u n d m o d e l x

8

0

-,3

Exposure to ionizing irradiation can be associated with o'< concomitant wound infection, following either a vg 4 ~ 11 0~ nuclear accident or therapeutic irradiation and surgery 2 ~ ~ to manage malignancies. The potential virulence of micro-organisms that cause wound infections in irradiz o o ated hosts is enhanced by the depressed defenses of the 0 4 8 12 16 host (Kaplan et al., 1958; Mathe, 1965; Brook, 1988; Time (d) Elliott et al., 1990) (Figure 17.4). Such infections are Figure 17.3 Numbers of leukocytes and thrombocytes in therefore difficult to control by local or systemic blood in mice exposed to 6.5 Gy 6~ y-rays. Blood was therapy (Miller et al., 1952; Hammond et al., 1955a; drawn from five 15-week-old female B6D2F1/J mice. Brook, 1988). The organisms that cause most of the Reproduced from Elliott et al., 1990 with permission wound infections are skin flora organisms (staphyloTherapy for severe systemic infection due to Gram-neg- cocci and streptococci) or environmentally acquired ative bacteria in the immunocompromised host generally bacteria. involves the use of aminoglycosides in combination with 13lactam antibiotics or single-agent therapy with ceftazidime or a carbapenem (Klastersky, 1998). An additional approach to the prevention of such infection is the use of Animal species selective decontamination of the gastrointestinal tract by using agents given after radiation that spare the anaerobic Several strains of mice have been used in infection models: gut flora while inhibiting the Enterobacteriaceae (Brook B6D2F1/J (20-25 g, female, Brook and Elliott, 1989; Brook and Ledney, 1991a, 1994a); C3H/HeN (20-25g female, and Ledney, 1992b). Brook and Ledney, 1994b); C3HeB/FeJ (20-25g female, Brook et aL, 1986, 1988); CF#1 (20-25 g female, Hammond _.r '~ '-

114

o ogo O

Intra-abdominal model

Polymicrobial intra-abdominal infection involving aerobic and anaerobic bacteria such as E. coli and Bacteroidesfragilis can occur following irradiation associated with intraabdominal trauma. Studies illustrated the importance of administration of antimicrobials effective against both of these organisms in successful management of such infections (Solomkin et aL, 1984). However, treatment of mixed aerobic-anaerobic infections in irradiated hosts may be complicated by the adverse effects observed following the use of antimicrobials, which are capable of reducing the number of the anaerobic gut flora (Brook et aL, 1988). Such therapy enhanced the colonization of the intestinal tract with Enterobacteriaceae and contributed to mortality due to sepsis by these organisms.

Figure 17.4 Number of organisms recovered in infected wounds in non-irradiated and irradiated animals 5 days after irradiation. (Elliott et al., 1990)

INFECTION AFTER IONIZING RADIATION

et aL, 1955b); and CBA (18-26g, Wensinck and Renaud 1957; Klemparskaya et al., 1987). We used B6D2F1/I because it is a random-bred hybrid and C3H/HeN because of the presence of adequate numbers of Enterobacteriaceae in the intestines. Rats have also been used in several studies: SpragueDawley (250-325g, male, Taketa, 1962; 120g female, Klaines et aL, 1967). Most of our studies were done in animals aged 10-20 weeks old. It is preferable to use animals of the same age, since oral and gastrointestinal flora may vary with age. The unique endogenous bacterial flora of the mice influences the type of bacteria that causes endogenous s e p s i s - because the source of the sepsis is their own flora. It is therefore important to be aware of the established characteristic flora of the animals used for experimental models. The endogenous microbiology may vary between animal batches, and may influence the outcome of infection. There may also be differences in sensitivity to radiation among different animal batches and shipments. Because of this, a control untreated group is necessary in each experiment. Indeed, some commercial sources of mice have rid their animals of many opportunistic pathogens (i.e. Pseudomonas spp.).

Preparation of animals Because of the neutropenia and immune suppression induced by radiation, extraordinary precautions should be taken to insure the preirradiation health of the animals and the absence of any subclinical colonization or infection by potential pathogens while maintained in the facility. To insure this, the mice are held in quarantine for 2 weeks after arriving in the facility. Representative samples are examined by microbiology, serology, and histopathology to assure the absence of specific bacteria, particularly P. aeruginosa, and common murine diseases (Elliott et al., 1995). Up to 10 mice can be housed in sanitized 46 • 24 • 15cm polycarbonate boxes with a filter cover (Microlsolator, Lab Products, Inc., Maywood, NJ) on hardwood-chip bedding. They should be maintained and irradiated according to guidelines set by the USDA and public health regulations. The animal holding rooms are maintained at approximately 70~ and 50% (_+ 10%) relative humidity with a 12 hours light/dark, full-spectrum lighting cycle. Conditioned fresh air is changed at least 10 times per hour. The mice are given feed (Wayne Lab Blox, Continental Grain Co., Chicago, IL) and acidified (pH 2.5) water freely. (Acidified water is used to suppress bacterial growth in the water bottle.) It is important to note that the bedding material (which may contain micro-organisms and allergens), and the type of diet and nutrients, should be maintained throughout the experimental procedure.

15:3

Details of irradiation The irradiation source (X-ray, 7, or neutron) and dose may vary according to the experimental design and animal susceptibility. Details regarding dosemetry can be obtained from Elliott et al., 1995. End-points include: the LD50 of the specific mouse strain, the slope of the probits, and established measurement of morbidity, which are periodically repeated to assure their accuracy, as they may vary seasonally and among animal shipments. Mixed-field irradiation Studies of infection in neutron irradiated animals are important because of the apparent increase in sensitivity of the gastrointestinal tract to this type of radiation compared to gamma radiation. Mice are exposed to mixed fisson-neutron and 7-photon radiation in an exposure room of a Training Research Isotope General Atomic (TRIGA) reactor. Mice are placed in well-ventilated aluminum holders that rotate at a speed no greater than 1.5 rpm. Mice should be arranged in an arc around the reactor wall lobe and a standard length above the exposure room floor. Rotation assures that the depth-dose distribution is as uniform as possible to allow optimal dosing of critical organs. All doses are at midline tissue (MLT). At the position of irradiation, the measured ratio of the neutron dose to the total dose (neutron plus 7) measured n/(n + 7) = 0.67, delivered at a nominal dose rate of 40 cGy/min MLT. The uniformity of the radiation field should be within 3% of the dose at the center of the array. The T R I G A reactor was used as a source of radiation because the proportion of neutrons and gamma photons provided to the animals can be adjusted to meet the needs of the investigators experiment. G a m m a irradiation Mice should be placed in ventilated acrylic plastic boxes and exposed bilaterally to 7-photon radiation in a Cobalt-60 whole-body irradiation facility (Carter and Verrelli, 1973). Boxes are designed to minimize the air gap between the mouse and the plastic and are placed on a stationary platform. The MLT dose rate for mice is measured before irradiation of animals under conditions that are identical to those for irradiating mice by placing a 0.5cm 3 tissue-equivalent ionization chamber in the center of a 2.5cm diameter cylindrical acrylic mouse phantom at a known distance from the Cobalt60 source. The ratio of the dose-rate measured in the phantom to the dose-rate in free air, for this array, should be determined (Elliott et al., 1995). Exposure time is adjusted so that animals receive the desired dose at a nominal dose-rate of 40 cGy/minute. Variation of dose within the exposure field should be less than 3%. The average energy of 7 photons is 1.25 MeV. Measure-

154

ments should be in accordance with the protocol of the American Association of Physicists in Medicine for the determination of absorbed dose from high-energy photon and electron beams (American Association of Physicists in Medicine, 1983).

Radiation dose-responses Mice are given graduated doses of mixed-field or ],-photon radiation in order to determine a current relative biological effectiveness and biologically comparable, or isoeffective, doses of the two qualities of radiation. This is done for the purpose of comparing experimental results in animals given either quality of radiation.

Details of surgery (for animal wounding)

I. Brook, T. B. Elliott and G. D. Ledney

aL, 1990). The shaved skin over the inoculation site is wiped with gauze sponge that is moistened with 70% ethanol. A 0.1 ml volume of a suspension of bacteria is injected subcutaneously to form a bleb over the right medial gluteus muscle. When the liquid is absorbed after 20-30 minutes, the skin and muscle of the anesthetized mice are incised with a sterile no. 15 scalpel. The incision is approximately 12 mm long and approximately 30 ~ to the spine caudally. The exposed medial gluteus is then incised three times about 3 mm deep with the blade at different angles along the same stroke as the initial incision.

Postoperative care Animals are placed in freshly autoclaved hardwood-chip bedding and cages. They are housed in groups of four per cage.

Material required Anesthetic, hair clippers or razor, skin disinfectant, scalpel handle plus blades, forceps, a steel punch, syringes and needles.

Anesthesia Anesthesia is needed when animals undergo wounding or subcutaneous inoculation. Induction of intra-abdominal abscesses is described in Brooks' chapter on abdominal abscesses. Animals are sedated with methoxyflurane (Elliott et aL, 1990). A complete anesthesia lasts approximately 3 minutes.

Surgical procedure (wounding) Punch wound Ten minutes or 1 hour after irradiation the fully anesthetized mouse is subjected to various sizes of wound trauma. The folded panniculus carnosus muscle (twitch muscle) and overlying skin of the anterior dorsal surface between the shoulder blades (Ledney et aL, 1982) is removed by striking a steel punch with a hammer. The procedure is done on a clean disinfected Teflon-covered operating board. Various wound sizes are made according to the size of the mouse and the desired size of the wound. Wound sizes are generally 5%, 10%, 15% and 30% of the total skin surface. Immediately after trauma, the mice are placed on a clean paper towel and then transferred on to freshly autoclaved hardwood-chip bedding in clean cages.

Storage and preparation of inocula The models of sepsis and wound are amenable to endogenous (animal's own flora) or exogenous infection. The endogenous skin infection is generally caused by streptococci, staphylococci, and Gram-negative enteric bacteria (from fecal or other sources) (Brook, 1995). Exogenous bacteria used for wound infection were Staphylococcus aureus (Brook and Elliott, 1989; Elliott et aL, 1990; Brook, 1995). Escherichia coli, Klebsiella pneumoniae and Streptococcus pyogenes (Elliott et aL, 1990). Endogenous-induced sepsis is generally due to aerobic organisms and facultative anaerobic organisms (Brook et aL, 1986; Kurishita et aL, 1993; E. coli, Proteus spp., Staphylococcus spp., and Streptococcus spp.) and anaerobic organisms (Peptostreptococcus spp. and Bacteroides spp.; Brook et aL, 1988). Exogenous bacteria used to cause sepsis were P. aeruginosa (Brook and Ledney, 1991a; Geraci et aL, 1985), and K. pneumoniae (Brook and Ledney, 1991a; Brook et aL, 1990). The organisms used for systemic exogenous and wound infection should be susceptible to the antimicrobials used in the experiments. The organisms selected for inoculation are transferred from stock suspension on to Columbia sheep blood (5%) agar and incubated for 18-24 hours. Selected colonies are placed in brain heart infusion broth (BHIB) incubated at 35~ for approximately 2.5-3 hours, harvested in the logarithmic phase of growth and washed in 0.9% saline. The desired concentration of bacteria is prepared for inoculation by the desired route.

Incision muscle wound infection

Infection process

Wounding and inoculation of bacteria is done on the third day after irradiation, to fully anesthetized mice (Elliott et

Wound infection is initiated by direct injection of the bacterial suspension into the desired location (i.e. subcutaneous

INFECTION AFTER IONIZING RADIATION

155

area over muscle). Colonization of the gastrointestinal tract and subsequent sepsis is induced by oral feeding of the bacterial suspension in the desired concentration in a volume of 0.1-0.2 ml. This is given by lavage using a 20 G animal feeding tube fitted to a 1.0 ml syringe (Brook and Ledney, 1990). Subcutaneous challenge can be performed by injecting 0.2 ml in the dorsal skin fold made by pinching the skin over the shoulder and lifting the skin. The optimal time to induce these infections (wound or sepsis) is about 72-96 hours after irradiation, the time when the immune system is depressed (Figure 17.3) and the number of cfu of normal gastrointestinal flora is depleted (Figure 17.1; Brook and Ledney, 1994b).

(local or systemic) and the possibility of local bleeding (due to thrombocytopenia). For this reason, the oral route of administration of antimicrobial agents is preferred. Addition of the antibiotics to the drinking water has been tried (van der Waaij and van der Waaij, 1985; Geraci et aL, 1985); however, the altered taste of the water may reduce water consumption by the animal, which must be monitored. It is difficult to quantify the dose of antimicrobials as consumption varies among animals. Antimicrobial therapy for endogenous infection is generally begun 3 days after irradiation, generally for 10-21 days. In the case of local inoculation or feeding of bacteria therapy is started 10-72 hours afterwards (Brook and Ledney, 1991a) depending on the experimental design to allow the bacteria sufficient time to establish a true infection. The optimal delay in initiation of therapy depends on Key parameters to monitor infection the virulence of the organisms (Brook and Ledney, 1991a). Virulent organisms (such as P. aeruginosa) require earlier Mortality is the final outcome of generalized sepsis. The initiation of therapy within 10 hours after oral, and 24 hours effect of therapy in reducing death is monitored twice daily after parenteral inoculation. Earlier initiation of therapy for over a period of 30 days. Culture of heart blood or liver will endogenous therapy is not necessary, as the changes (depledocument the bacterial cause of sepsis (Brook et al., 1986). tion) in the gastrointestinal flora, and immunosuppression, Quantitative microbiology of the wounded and infected appear only at that time (Brook and Ledney, 1991a). muscle is an indicator for the efficacy of therapy. This is The length of therapy can also effect survival. Longer done by removing the gluteus medius muscle aseptically, therapy may be more optimal in some instances (Brook and weighing and homogenizing it in 0.9% NaC1 solution, and Ledney, 1992a). The survival of animals inoculated with K. performing serial dilution and plating. This should be done pneumoniae and treated with ofloxacin for 7 days was 55% at intervals from 3-7 days after bacterial challenge with or (11 of 20), as compared to 90% (18 of 20) of those treated for without therapy. Monitoring wound closure after the 21 days. Experimental design should consider varying the punch is another indicator for efficacy. length of therapy to cover the period of immunodeficiency. Morbidity, particularly after low sublethal irradiation, The dosing schedule and choice of optimal antimicrocan be assessed during the course of infection by several bial dose should be given careful consideration, because of whole-animal, cellular, and molecular assays. Body mass the different pharmacodynamics and pharmacodynetics of (weight), water and food consumption (both reduced after antimicrobials between humans and rodents, the possible irradiation and illness), and assessment of performance effects of irradiation on the pharmacokinetics, and possshow the whole-body response to treatments. Assessment of ible toxic side-effects of antimicrobials (Patchen et aL, performance includes testing the locomotor activity, grip 1993). strength, and motor co-ordination (Toth, 1997). Measurement of peak and trough serum concentration Hematological parameters such as WBC, differential can assist in the selection of the proper dose. The method counts and thrombocytes provide evidence for hematologiused is generally by bioassay using agar diffusion (e.g. for cal recovery. Measuring of proinflammatory cytokines, gentamicin) or high-pressure chromatography (for metronincluding TNF-0t, IL-I~, and IL-6, in plasma or tissue idazole). homogenates provides insight into the host response to infection at the molecular level (Neta and Oppenheim, 1988; Peterson et al., 1994). These cytokines can be quantitatively monitored by enzyme-linked immunosorbent assay Advantages/disadvantages of the (EIA).

model

Antimicrobial therapy A variety of antimicrobial agents have been evaluated in the wound, sepsis, and intra-abdominal abscess models (Tables 17.1-17.3). Antibiotics can be administered by a variety of routes (p.o., i.m., i.v., i.p.). However, the parenteral route may repeatedly expose the postirradiation immunodepressed animal to a potential source of exogenous infection

The irradiated animal model of infection satisfies the goal of simulating the difficulty in reproducing a complex scenario, bacteriological and physiological, that may occur after exposure to ionizing radiation. It produces the physiological, immunological and bacteriological events that lead to endogenous sepsis after lethal exposure to high levels of radiation. It permits infection of the nonlethally irradiated animal with pathogenic bacteria. It permits the investigator to determine or monitor

....&

o-! 25 mm) and catheter segments (i.e. the foreign bodies). The catheter used is a silicone catheter (Hedima, Glostrup, Denmark) with an internal diameter of 2.8 mm and an external diameter of 4.9 mm. We have used catheter segments from 5 mm to 20 mm long, with almost identical frequencies of infection. The length of 15 mm has been selected as it is easily accepted by the mice and also allows aspiration from the catheter (see below).

Anaesthesia Animals are anaesthetized with ether and a plastic tube with ether-soaked gauze is used for continuation of Copyright 9 1999Academic Press All rights of reproduction in any form reserved

184

F. Espersen and N. Frimodt-Moller

Figure 20.1 Procedures for establishing the murine model of peritonitis involving a foreign body. (a) Under ether anaesthesia the peritoneum is opened and the catheter inserted. (b) Suturing the abdominal wall. (c) Injection (i.p.) of S. a u r e u s in saline. (d) The mouse is sacrificed and the peritoneum is opened. The contents of the catheter are aspirated. (e) The catheter is removed. (f) The empty abscess.

MURINE MODEL OF PERITONITIS INVOLVING A FOREIGN BODY

anaesthesia (Figure 20.1). The use of ether demands that the animals are handled in a fume cupboard. As alternative anaesthesia we have used propanidid (Sombrevin, Chemical Works of Gedeon Richter Ltd., Budapest, Hungary). We have used intraperitoneal injections in the range of 20-40 mg. There are two problems with this type of anaesthesia. Firstly, the dose-response curve for anaesthesia is rather steep with a narrow range between effect and no-effect. Secondly, the animals seem to be more affected by the infective inoculum, resulting in a higher mortality, which necessitates an infective dose lower than 105 colony-forming units (cfu)/ml. This has, however, not been fully explored.

Surgical p r o c e d u r e

After induction of anaesthesia, the mouse is taped to the table as shown in Figure 20.1. An incision (- 5 mm) is made in the lateral abdominal wall, and the peritoneum is opened after skin disinfection with 70% vol./vol, alcohol. Other disinfectant such as isopropanol- or iodine-based solution can also be used. The catheter is placed inside the peritoneum, and the skin and peritoneum are closed with one suture (Figure 20.1). The animals themselves remove the suture material in less than 6 hours following the procedure, without harm to the wound closure.

185

grown on solid medium, and a few colonies were inoculated into Mueller-Hinton broth (Statens Serum Institut) and incubated overnight at 37~ Then the bacteria were harvested by centrifugation (1600g for 10 minutes) and washed three times in saline under the same conditions. They were further adjusted to an optical density of 0.3 at 540 nm using a colorimeter and diluted 1:1 in saline (corresponding to approximately 108 cfu/ml). The size of the inoculum has been adjusted based on experiments outlined in Figure 20.2. As can be seen, a challenge dose greater than 105 gives nearly 100% infection rate as defined by growth in catheter washings (see below) 3 days after challenge. Furthermore, if the inoculum is greater than 5 x 108 cfu an initial mortality is observed. With S. aureus strain E 2371, we have used infective dosages in the range of 0.5-1.0 x 108 cfu as routine. We have used six other S. aureus strains, also isolated from blood cultures, with almost identical results. However, attempts to use four coagulase-negative staphylococci were less successful as at least 1.0 x 109 cfu have to be used to obtain 80-90% infection rates, but no mortality was observed. At present no other species than staphylococci have been used in this model. Furthermore, no attempts have been made to store the inoculum using another suspension fluid than saline, or to perform the infection in immunosuppressed mice.

Infection p r o c e d u r e

% 100

Between 10 minutes and 1 hour after the surgical insertion, the mouse is infected with intraperitoneal injection of the infective inoculum in 1 ml of 0.9% saline in the opposite lateral abdominal wall (Figure 20.1). If the inoculum is introduced after 24 hours only approximately 10% of mice will develop a foreign body infection.

90807060 50 -

Postoperative care

40 30 20 10 0

The mice have been kept in cages of one to 10 each and have been allowed free access to food and water. The animals have normally returned to normal behaviour within a few hours. Postoperative analgesics have not been used, and the mice gain weight and have an unaffected food and water consumption for at least 2 weeks after infection. Later, the mice show signs of chronic infection (see below). Early mortality has been observed during the first 1-2 days.

g

.g

~.

l #

zf #

9Infection 9 rate e

Surviv rate

W #

i

8

9

Log cfu

Figure 20.2 Effect of inoculum (log cfu) on infection and survival rate (% of infected animals in groups of six to 12 mice).

Storage and preparation of inocula Characteristics of the model Staphylococcus aureus, strain E 2371, isolated from a patient

with bacteraemia, has been used mostly in this infection model, and as described earlier the bacteria were injected intraperitoneally in 1 ml of 0.9% saline. The bacteria were

We have followed the infection in animals for up to 30-40 days after challenge (Espersen et al., 1994). Briefly, a few hours after infection the catheter is covered by the

186

omentum, and 3 days later the infection becomes localized to an abscess around the catheter (Figure 20.1). The liver will enlarge after 10 days to approximately twice its size and the spleen to approximately three times. With an inoculum of 108 cfu the mice have peritoneal counts of 104-105/ml in few days, and then after 3-4 days the bacteria in the peritoneum disappear. In contrast, the bacteria will colonize the foreign body and have been found for up to 30 days. Simultaneously, blood cultures are positive (10-103/ml) for up to 3 days. Initially, we performed a similar operation and procedures in groups of mice without placement of a foreign body, and we obtained similar bacterial counts in both blood and peritoneum. Implantation of catheters without infection resulted in development of small sterile abscesses around the foreign body. If infected mice are followed for more than 30 days they start to show signs of wasting.

F. Espersen and N. Frimodt-Meller

2. Catheter washings

The catheter is removed, placed in 1 ml of 0.9% saline and vortex mixed for 10 seconds, followed by quantitative cultures.

Intracellular bacteria

After treatment of mice, smears from aspirates have been evaluated by microscopy, and by means of counting the total number of bacteria per high-power field, and the rough number of intracellular and extracellular bacteria, the ratio of intracellular to extracellular bacteria can be followed during antibiotic treatment (Espersen et al., 1994).

Antibiotic concentration

Key parameters to monitor infection and response to treatment After a few days the infection is confined to the abscess around the foreign body and the initial diffuse peritonitis and bacteraemia have disappeared. The mice have slight blood neutrophilia, but haematological parameters have not been further studied. The antibody response has been investigated and compared to similarly infected mice without a foreign body. The ELISA with S. aureus strain E 1369 (protein A-free) was used, and antibody levels had already increased by day 3 and continued to increase for up to 2 weeks after challenge (Espersen, 1990, unpublished data). The ELISA was originally used to detect antibodies in peritonitis without a foreign body (Espersen and Clemmensen, 1985), and the presence of the foreign body and subsequent development of a chronic infection did not change the antibody levels; however, the duration of high titres was not further investigated (Espersen, 1990, unpublished data).

Bacteriological evaluation

Using this model we have developed the following principles for bacteriological evaluation: 1. Catheter aspirates

When the mice are killed, and the abdomen opened, it is possible to aspirate approximately 0.05-0.15ml of fluid from the inside of the foreign body by puncturing the abscess (Figure 20.1). The cfu was obtained by serial dilutions in saline followed by plating. The lower limit of detection in aspirates is -20 bacteria per millilitre of aspirate.

Antibiotic concentrations have been measured both in blood (orbital cut-down) or in aspirate from the foreign body. The concentrations have been measured by means of bioassay using 0.02 ml aspirate applied on discs. For gentamicin and methicillin the lower concentration limits have been determined to be 0.61t.tg and 0.41t.tg, respectively (Espersen et aL, 1994).

Antimicrobial therapy Only few antimicrobial agents have yet been evaluated in the murine model of peritonitis involving a foreign body. The antibiotics can be administered by different routes in mice (s.c, i.p, p.o. and i.v.). We have only at present used s.c. administration of antibiotics in a volume of 0.1-0.5ml of 0.9% saline (Espersen et aL, 1994). The model has potential for investigations of antibiotic prophylaxis against foreign body infections, treatment of established foreign body infections and the evaluation of pathogenic parameters in these infections. So far the model has been used for antibiotic prophylaxis and for treatment using methicillin and gentamicin as model drugs. In prophylaxis, it is important to determine the endpoints, and we have chosen to use the presence or absence of bacteria as measured by means of catheter washings. A problem in prophylaxis is to determine the time-schedule for the evaluation of the result after the challenge. We have, therefore, compared two different times, i.e. three days after challenge and 14 days after challenge, by giving a dose of either methicillin and gentamicin s.c. just before the mice received bacterial challenge i.p. The results indicate that three days is an optimal time for evaluation, since nearly identical results were obtained after three and 14 days (Table 20.1). Further studies of other antibiotics for prophylaxis need to be performed.

MURINE MODEL OF PERITONITIS INVOLVING A FOREIGN BODY

Table 20.1 Prophylaxis with methicillin or gentamicin; comparison of 3 days versus 14 days for evaluation of effect

Prophylaxis

3 days

14 days

None Methicillin (50mg s.c.) Gentamicin (0.5 mg s.c.)

1/56 (2%)* 11/35 (31%) 25/35 (71%)

1/20 (0)t 6/19 (32%)l14/20 (70%)1-

187

The guinea-pig (and rat) model using a tissue cage (Zimmerli et al., 1982) has some similarities with the present model, but the tissue cage allows repetitive punctures from the foreign body, which allows the kinetics and effect to be followed in individual animals. However, the present model is easier and less expensive and will be better for large scale (screening) use.

*Cured (= no growth in catheter washings) mice/total mice (%). p < 0.05 3 days versus 14 days.

Contribution of the model to infectious disease therapy For treatment of established foreign body infections we chose to start treatment 3 days after bacterial challenge and continue the treatment, in the first study, for up to 6 days (Espersen et al., 1994). The effect was evaluated by quantitative cultures from catheter aspirates and catheter washings 6 days after challenge (Espersen et aL, 1994). We also monitored the antibiotic concentrations both in serum and in catheter aspirates. Treatment gave a significant effect for both methicillin and gentamicin with a reduction of bacterial counts of about 2 log units, but no synergism was detected. The results of the treatment were relatively poor, when considering that the local concentration of methicillin was more than the MIC of the infective strain for at least 72 hours, and nine peaks (>131Ltg/ml) was obtained for gentamicin (Espersen et aL, 1994). We investigated a range of parameters that may have caused this poor effect, but only identified an increased proportion of intracellular bacteria around the foreign body, that could have influenced the effect (Espersen et aL, 1994). However, this model needs to be further explored for treatment with other antibiotics, longer treatment periods and treatment/prophylaxis experiments using other bacteria than S. aureus.

Pitfalls (advantages/disadvantages) of the model Animal models have a range of shortcomings when compared to human infections; in mice especially, the different pharmacokinetics of antibiotics may play a role. Except for the anatomical link with continuous ambulatury peritoneal dialysis this specific model has no direct similarities to any human infections, as the foreign body does not have a function. Another problem is the large inocula used in our present studies. However, it is possible to lower the inoculum to a range that may be more clinically relevant (Figure 20.2). On the other hand this model is easy to perform, highly reproducible, inexpensive and permits relatively short-treatment periods. Also, the infection shows the same characteristics as foreign body infections in general, i.e. a low infective inoculum, a localization of the infection to the implant, development of a chronic infection and difficulty in eradicating an established infection.

The present model is new and has only been used in limited studies; consideration of its potential is, therefore, to some extent speculative.

Antimicrobial t r e a t m e n t and prophylaxis of foreign body infections

In these infections there is a need for cheap screening models, as clinical studies are difficult to perform on a large-scale basis, i.e. the diagnostic situation often necessitates the removal of the foreign body, which precludes the possibility of trials. The model can thus be an easy first line model to evaluate different t r e a t m e n t - - o r prophylactic regimens. The model also has potentials for studying the pharmacodynamics of such regimens, because of the possibility of determining of local antibiotic concentrations. Also, the high number of bacteria present in a focus and the difficulty of eradicating the infection gives potential for the study of the development of antibiotic resistance in vivo. An interesting future application could be to use the model to correlate the response with routine susceptibility testing methods, since the usual methods are not predictive of antibiotic activity in foreign-body infections (Blaser et al., 1995).

Elucidation of pathophysiological parameters of foreign body infections

The model may be useful for evaluation of different foreign bodies, different polymers and different sizes of foreign body. The model will be able to establish the minimal and 50% infective dose. Furthermore, the model may have potential for elucidating the pathogenesis in foreign-body infections, the role of biofilm and leukocytes, and it could prove of value in investigation of antibiotic penetration into cells and studies of antibiotic synergy with specific reference to foreign-body infections.

References Blaser J., Vergeres P., Widmer A. F., Zimmerli, W. (1995). In vivo verification of in vitro model of antibiotic treatment of deviceChernother.,39,1134-1139. related infecti~176

188

Blomgren, G., Lundquist, H., Nord, C. E., Lindgren, U. (1981). Late anaerobic haematogenous infection of experimental total joint replacement. J. Bone Joint Surg., 62B, 614-618. Carbon, C., Contrepois, A., Brion, N., Lamotte-Barrillon, S. (1977). Penetration of cefazolin, cephaloridine and cephamandol into intestinal fluid in rabbits. Antimicrob. Agents Chemother., 11,594-598. Christensen, G. D., Simpson, W. A., Beachey, E. H. (1985). The adhesion of bacteria to animal tissue: complex mechanisms. In Bacterial Adhesion: Mechanism and Physiological Significance, (eds Savage, D. C., Fletcher, M.), pp. 279-305. Plenum Press, New York. Dougherty, S. H. (1986). Implants infections. In Handboo k of Biomaterial Evaluation (ed. von Recum, A. F.), pp. 276-289. Macmillan, New York. Dougherty, S. H. (1988). Pathobiology of infection in prosthetic devices. Rev. Infect. Dis., 10, 1102-1117. Elek, S. D., Conen, P. E. (1957). The virulence of Staphylococcus pyogenes for man. A study of the problem of wound infection. Br. J. Exp. Pathol., 38, 573-586. Espersen, F., Clemmensen, I. (1985). Immunization of mice with the fibronectin-binding protein and clumping factor from Staphylococcus aureus: antibody response and resistance against peritoneal infection. Acta PathoL IrnmunoL Scand. Sect. C, 93, 53-58. Espersen, F., Clemmensen, I., Rhodes, J. M., Jensen, K. (1984a) Human serum and plasma increase mouse mortality in Staphylococcus aureus intraperitoneal infection. Acta Pathol. Immunol. Scand. Sect. B, 92, 305-310. Espersen, F., Clemmensen, I., Frimodt-Mr N., Jensen, K. (1984b). Effect of human IgG and fibrinogen on Staphylococcus aureus intraperitoneal infection in mice. Acta Pathol. Immunol. Scand. Sect. B, 92, 311-317. Espersen, F., Frimodt-Mr N., Corneliussen, L., Thamdrup Rosdahl, V., Skinhcj, P. (1993). Experimental foreign body

F. Espersen and N. Frimodt-Moller

infection in mice. ]. Antimicrob. Chemother., 31 (Suppl. D), 103-111. Espersen, F., Frimodt-Mr N., Corneliussen, L., Riber, U., Thamdrup Rosdahl, V., Skinhcj, P. (1994). Effect of treatment with methicillin and gentamicin in a new experimental mouse model of foreign body infection. Antimicrob. Agents Chemother., 38, 2047-2053. Gardner, W. G., Prior, R. B., Perkins, R. L. (1973). Fluid and pharmacological dynamics in a subcutaneous chamber implanted in rats. Antimicrob. Agents Chemother., 4, 196-197. Gristina, A. G. (1987). Biomaterial-centered infection: microbial adhesion versus tissue integration. Science, 237, 1588-1595. James, R. C., Maclead, C. L. (1961). Induction of staphylococcal infections in mice with small inocula introduced on sutures. Br. ]. Exp. Pathol., 42, 266-277. Malone, J. M., Moore, W. S., Campagna, G. C., Bean, B. (1975) Bacteremic infectibility of vascular grafts: the influence of pseudointimal integrity and duration of graft function. Surgery, 78, 211-216. Pfaller, M. A., Herwaldt, L. A. (1988). Laboratory, clinical, and epidemiological aspects of coagulase-negative staphylococci. Clin. Microb. Rev., 1, 281-299. Renneberg, J., Walder, M. (1988). A mouse model for simultaneous pharmacokinetic and efficacy studies of antibiotics at the site of infection. ]. Antimicrob. Chemother., 22, 51-60. Serota, A. I., Williams, R. A., Rose, J. G., Wilson, S. E. (1981). Uptake of radiolabeled leukocytes in prosthetic graft infection. Surgery, 90, 35-40. Zimmerli, W., Waldvogel, F. A., Vaudaux, P., Nydegger, U. E. (1982). Pathogenesis of foreign body infection: description and characteristics of an animal model.]. Infect. Dis., 146, 487-497. Zimmerli, W., Lew, P. D., Waldvogel, F. A. (1984). Pathogenesis of foreign body infection. Evidence for a local granulocyte defect.]. Clin. Invest., 73, 1191-1200.

Chapter 21

Rat Polymicrobial Peritonitis Infection Model H. Dupont and P. Montravers

Background of human infection Peritonitis is the most frequent cause of intra-abdominal infection. Due to the large number of organisms isolated in the bowel, this infection is by nature polymicrobial. The standard care for this life-threatening situation consists of an emergency surgical intervention and empirical antibiotic therapy. Classification of the infection, diagnosis, antimicrobial therapy and adjuvant therapy have been reviewed previously (Gorbach, 1993; Nathens and Rotstein, 1994; Wittmann et al., 1993, 1996).

Background of model Several models of peritonitis using different animal species have been described, including dogs, pigs or sheep (Browne and Leslie, 1976; Wichterman et al., 1980). The drawbacks with these large animals are linked to their cost and the limited number of individuals included in each experiment. As a consequence, the most common species used are mouse and rat (Browne and Leslie, 1976; Bartlett et al., 1978; Wichterman et al., 1980). Several rat models detailed below have been used from the beginning of the century, based upon the initial experiments of Powlowsky (1887) and Massart (1892).

female (300 g; Castillo et al., 1991). Presumably, any strain could be used, but gender may be an important parameter to consider since Weinstein et al. (1974) reported an increased toxicity of the inoculum in female Wistar rats.

Preparation of the animals No specialized housing or care is required. A model of prolonged starvation (water allowed ad lib) was evaluated by Wichterman et al. (1980) demonstrating an increased mortality in the animals that had been fasted for prolonged periods of time (_>5 days) when compared to fed animals. The bowel content can be altered by dietary manipulation. In the animals fed on a meat diet instead of the usual grain diet, a human-like flora with a high concentration of anaerobes is observed (Onderdonk "et al., 1974; Weinstein et al., 1974). Pretreatments can be applied to obtain granulocytopenic animals (busulphan and cylophosphamide; Hau et al., 1981) but these procedures do not have any specificity.

Details of surgery Overview

Animal species Sprague Dawley male rats are the most studied animals (180-490 g; Fry et al., 1985; Matlow et al., 1989; Andersson et al., 1991; Ozmen et al., 1993; Perdue et al., 1994; Montravers et al., 1994, 1997). The other strains used are Sprague Dawley female (180-300 g; Shyu et al., 1987; Scarpace et al., 1992; Kim et al., 1996), Wistar male (190-250 g; Bartlett et al., 1978; Almdahl and Osterud, 1987; Lorenz et al., 1994; Jacobi et al., 1997), Wistar female (180-280g; Weinstein et al., 1974; Bloechle et al., 1995; Refsum et al., 1996), Holtzman male (150-300g; Wichterman et al., 1980), Agouti female (Findon and Miller, 1995) and Norwegian Handbool( of Animal Models of Infection

ISBN 0-12-775390-7

The ideal model that reproduces human infection with a controlled inoculum does not exist. The models used for peritonitis can be roughly divided in three categories: direct intraperitoneal injection, bowel manipulations and peritoneal implantation. In every case, the purpose is to induce a massive and prolonged contamination of the peritoneal cavity.

Material required Anaesthetic (preferably injectable), clippers or razor, skin disinfectant, surgical slippers, forceps, syringes and needles (20-23 g), suture material. Copyright 9 1999AcademicPress All rights of reproduction in any form reserved

190

Anaesthesia

The ideal anaesthetic agent is a rapidly acting drug (< 5-10 minutes), administered intramuscularly or subcutaneously, with a short duration of action (15-30 minutes), without respiratory depression and satisfactory muscular relaxation. Inhaled agents have been used: ether (Rotstein et al., 1987; Bloechle et al., 1995; G/_irleyik et al., 1996), or halothane 2% (Edmiston et al., 1990). The intraperitoneal administration of an anaesthetic agent, although previously used (thiopental 15-60 mg/kg; Lally and Nichols, 1981; Nord et al., 1986; Marshall et al., 1988; Dunne et al., 1996; Jacobi et al., 1997), should not be recommended since the properties of the drug could affect the peritoneal response or the bacterial growth. Many drugs have been administered by intramuscular or subcutaneous route: droperidol subcutaneously at a dose of 0.2 ml (Hau et al., 1983a,b); fentanyl combined with fluanisone (1 ml/kg Hypnorm | Janssen Pharmaceuticals; Almdahl and Osterud, 1987; Olofsson et al., 1986) or with haloperidol (10mg/kg; Lorenz et al., 1994), ketamine alone (30 mg/kg i.m.; Montravers et al., 1994, 1997), or in association with xylazine (6-9mg/kg; Terhar and Dunn, 1990; Ozmen et al., 1993; Giirleyik et al., 1996; Refsum et al., 1996), or midazolam (10mg/kg i.m.; Almdahl et al., 1985; Olofsson et al., 1986).

Surgical procedure Intraperitoneal injection

The skin is disinfected with 70% vol./vol, ethanol, but other disinfectants are also applicable (isopropanolol or iodinebased solutions). Next, the puncture of the abdomen is performed with a needle of small diameter (25 G • 0.5 x 16 mm) on the median abdominal line, 0.5-1 cm below the umbilicus, perpendicular to the muscular layer. Surgical procedures

Following complete induction of anaesthesia, the animal is placed ventral side up. The abdominal skin is shaved with electric clippers. After skin disinfection (see above), a 1.5 cm midline incision is made at the median part of the abdomen. There are no major blood vessels in the region, but care should be taken to avoid any muscular damage, a source of subcutaneous haematoma. Exposure of the peritoneal cavity can be made by two incisions, first through the skin and second through the abdominal muscles. The skin incision can be made by a scalpel handle fitted with a curved-edge scalpel blade (e.g. Swann-Morton, Sheffield, UK). On the basis of our experience, we prefer to use sharp operating scissors (sharp, and sharp points, e.g. Collin, VM Tech SA, Paris, France) for the skin incision. A median 1-1.5cm muscular incision is made at the linea alba level between abdominal rectis using delicate operating scissors (sharp, blunt points, e.g. Collin). Surgical exposure of the peri-

H. Dupont and P. Montravers

toneal cavity is obtained by a gentle removal of the peritoneo-muscular layer using thumb dressing forceps (e.g. Collin).

Infection procedures

In the caecal ligation procedure, the caecum is divided carefully avoiding all blood vessels (Wichterman et al., 1980). The caecum is filled with faeces by milking stool back from the ascending colon. The caecum is then ligated just below the ileocaecal valve with a 3-0 silk ligature. Ligature at this limit allows bowel continuity to be maintained. The antimesenteric caecal surface is punctured with a needle (18-22G) and the bowel is replaced into the peritoneal cavity. In the peritoneal implantation model, the capsule previously prepared is inserted into the right lower quadrant of the pelvic cavity (Montravers et al., 1994).

Wound closure

The wound is closed in two layers. The musculoperitoneal layer is closed using interrupted nylon sutures; two stitches are placed evenly over the wound. Care should be taken to avoid any visceral puncture. The skin layer is closed using interrupted nylon sutures, two stitches are placed evenly over the wound. Metal skin clips (11 mm, e.g. Michel, Collin) can also be used, but, in our experience, their use should be restricted to the procedures in which a prolonged survival is expected (> 48-72 hours) since sutures are easier for the rats to bite though risking removal or subcutaneous abscess before the wound is fully healed.

Postoperative care

Animals recover quickly from anaesthesia (< 30 minutes). Animals should be housed individually on wire supports following surgery. Postoperative analgesics have not been reported to be routinely used. The infection becomes apparent within a few hours after challenge.

Storage and preparation of inocula Most studies have used high concentrations (107--109 cfu/ml) of Escherichia coli, Enterococcus faecalis, Bacteroides fragilis, corresponding to the organisms usually cultured from human infections (Altemeier, 1942; Fry et al., 1985; Matlow et al., 1989; Montravers et al., 1994, 1997), or from rat infections (Onderdonk et al., 1976). However, the model of peritonitis is amenable to using several different species of bacteria. In the intraperitoneal injection models, the overnight

RAT POLYMICROBIAL PERITONITIS INFECTION MODEL

broth cultures of the organisms are sedimented by centrifugation and then resuspended at the chosen concentration in isotonic saline (Fry et al., 1985) alone or associated with 10% barium sulphate (Matlow et al., 1989). In the model of intraperitoneal implantation, various inocula have been used. Faecal material from meat-fed rats (Weinstein et al., 1975; Louie et al., 1977; Barlett et al., 1981) or from humans (Nichols et al., 1979) have been used. The samples are pooled in an anaerobic chamber and mixed with an equal volume of prereduced peptone-yeastglucose broth and sterile barium sulphate (10% wt/vol.). The pooled inoculum is filtered through surgical gauze and then frozen and stored at-40~ until used. At the time of challenge, the aliquots are thawed and prepared for inoculation withoutsubculture (Weinstein et al., 1975; Louie et al., 1977; N i c h o l s e t a l . , 1979; B a r l e t t e t a l ., 1981). Aliquots of 0.5 ml of the mixture are placed into sterile gelatin capsules for intraperitoneal implantation. A double capsule obtained by the insertion of the 0.5 ml capsule (no. 1) into a 0.75 ml capsule (no. 0) permits ease in handling of the inoculum and slows its dissolution, while a single capsule dissolves immediately after peritoneal implantation (Weinstein et al., 1974). The implantation of a capsule with a calibrated inoculum has been used by our group (Montravers et al., 1994, 1997) and by Onderdonk et al. (1976). Prereduced thioglycolate broth is used for culture of the anaerobes while brain-heart medium is used for the growth of the aerobes (Montravers et al., 1994). The mixtures of strains are made when they are in log phase of growth; bacteria are diluted to obtain the number of micro-organisms for the challenge. Diluted broth cultures are combined with 2% (wt/vol.) agar (Montravers et al., 1994) or with autoclaved rat colonic contents (50% vol./vol.; Onderdonk et al., 1976) and barium sulphate (10% wt/vol.). Aliquots of 0.5 ml of the final product are placed into a double gelatin capsule (Weinstein et al., 1974).

Infection processes Many models simulating perforation have been proposed using perforation of the stomach, the caecum or the sigmoid colon (Weinstein et al., 1974; Wichterman et al., 1980; Almdahl et al., 1985), while ischaemic models obtained by vascular ligation and ileal or caecal necrosis are scarce (Wichterman et al., 1980; Nord et al., 1986, Marshall et al., 1988). The caecal ligation technique with perforation has become the reference because of its high reproducibility ( W i c h t e r m a n e t a l . , 1980). The severity of the disease and the initial mortality depends on the diameter of the needle and the number of caecal punctures. Puncturing the caecum once rather than twice with the same needle prolongs the survival of animals, while puncturing the caecum with an 18 G needle instead of a 22 G needle dramatically increases mortality (from 40-60% to 95% mortality within 48 hours).

191

Many compounds have been implanted within the peritoneum, including rat's faecal pellet (Wichterman et al., 1980), human faeces (Nichols et al., 1979), septic fibrin clots (Dunn et al., 1984b; Rotstein et al., 1987) or a gelatin capsule containing various inocula (faecal mixture, calibrated inoculum; Weinstein et al., 1975; Lally et al., 1983; Dunn et al., 1989; Ozmen et al., 1993; Montravers et al., 1994, 1997; Dunne et al., 1996). Various adjuvants have been combined with microorganisms in order to increase the severity of the disease and the local inflammatory response and to decrease the dissemination of the inoculum, such as mucin (Wichterman et al., 1980), bile (Andersson et al., 1989, 1991; Sonesson et al., 1990), blood and haemoglobin (Weinstein et al., 1974; Andersson et al., 1989) but barium sulphate is the most used (Weinstein et al., 1974, 1975; Onderdonk et al., 1974, 1976; Montravers et al., 1994, 1997). Various foreign bodies have been used to increase the severity of the disease: autoclaved tissue (Altemeier, 1942), sterile faeces (Onderdonk et al., 1976), or agar (Montravers et al., 1994, 1997).

Key parameters to monitor infection and response to treatment A systemic dissemination of infection occurs within 1-3 hours after challenge. Bacteraemia is reported within 20 minutes after peritoneal injection (Dunn et al., 1985) and within few hours after inoculation in the surgical models (Montravers et al., 1994, 1997). The signs of sepsis are apparent within 6-12 hours (decreased mobility, piloerection). Then the animals become lethargic, stop food and water intake, their eyes appear glazed with crusting exudate, and some have diarrhoea associated with abdominal distension. Neutrophilia is common (Dunne et al., 1996). A 10-25% loss of weight is observed within 1-2 days, which culminates on day 2-3 followed by a progressive improvement in survivors (Montravers et al., 1994). The first deaths due to sepsis occur within 6-12 hours depending on the severity of the disease (Dunn et al., 1985) and continue until day 4-5 (Weinstein et al., 1974). The survivors are either completely cured or have intra-abdominal abscesses, depending on the inoculum (Bartlett et al., 1978). At the time of sacrifice, a midline laparotomy is performed after skin disinfection, and the peritoneal fluid is collected by direct aspiration or after lavage from all regions of the peritoneal cavity (Montravers et al., 1994). Various counts of the organisms are reported within the peritoneal fluid depending on the concentration of the inoculum and the delay before sacrifice (Dunn et al., 1985; Montravers et al., 1997). An increased count in the peritoneal phagocytes is observed within the first 6 days of the disease that persists for at least 6 days (Montravers et al., 1997). The cytokine p r o d u c t i o n - TNF-0~ (bioassay LM cells) and IL-6 (bioassay B9 cells) - - within the peritoneal fluid probably peaks between 1 and 3 hours after inoculation followed by a progressive decline until day 3 (Montravers et al., 1997).

192

H. Dupont and P. Montravers

Antibiotic therapy

al., 1974, 1975), the reproducibility of the bacterial inocu-

A variety of antibiotic regimens have been evaluated (Louie et al., 1977; Nichols et al., 1979; Barlett et al., 1981; Montravers et al., 1994). However, peritoneal enumeration of the remaining cfu and measurement of the peritoneal concentrations of the drugs have rarely been performed. Because of the ileus, oral therapy is unsuitable. Antibiotic therapy is usually begun early after inoculation (2-6 hours), administered intramuscularly every 6-8 hours and pursued for a period of 3-12 days. Duration of treatment can dramatically affect the number of remaining organisms (Montravers et al., 1994) and the experimental design should consider varying the length of treatment. Determination of the peritoneal cfu should be done several hours after the cessation of treatment in order to allow the elimination of the antibiotic and reduce any effects of antibiotic carry-over. The dosing schedule and choice of dose should be given careful consideration, given the differing pharmacokinetics of antibiotics between humans and rats, especially for carbapenems and aminoglycosides. A gradient between plasma and peritoneal fluid is observed (Montravers et al., 1994).

lum might be questionable. The use of a gelatin capsule permits a slow dissolution and a progressive development of sepsis without overwhelming systemic toxicity (Weinstein et al., 1974). The implantation of faecal content raises the limitations stated above. The use of calibrated inocula allows specific issues on pathophysiology or antibiotic therapy to be addressed. The use of adjuvants such as bile, haemoglobin and, to some extent, barium sulphate as adjuvants has some clinical relevance since these compounds are observed in human peritonitis and could interfere with peritoneal inflammation. However, these experimental conditions drift away from clinical practice. It is recommended that care be taken in the experimental design and subsequent interpretation of data on antimicrobial effectiveness. The evaluation of new agents, or novel combinations of agents, should be performed in comparison to reference agents. In addition, the dose levels of the antibiotics should be equated with the levels attainable in humans. The rat models are apparently less used than the mouse model of peritonitis. Some advantages of the rat models include the size of the animal, allowing repeated pharmacokinetic measurements, and an easy surgical procedure.

Pitfalls (advantages/disadvantages) of the model The intraperitoneal injection is widely used because of the swiftness and the easiness of the procedure. A visceral puncture (liver, stomach, caecum, colon, bladder) during the inoculation is the most frequent complication of this technique. However, this model does not represent a model of peritonitis but rather a model of systemic infection (Dunn et al., 1985) better suited to illustrating potentially pathological events in sepsis than to showing the therapeutic benefit of a particular therapy (Natanson et al., 1994). Many models simulating perforation have been proposed but the caecal ligation technique with perforation has progressively become the reference because it is highly reproducible. The size of the inoculum depends on the diameter of the needle and the number of punctures (see above; Wichterman et al., 1980). The limitations of this model are linked to ignorance of the species and concentrations of bacteria in the caecum. In the normal faecal flora of rats, the concentration of aerobes outnumbers the concentration of anaerobes, an uncommon situation in human pathology (Weinstein et al., 1974). Lactobacilli, Staphylococcus epidermidis and Micrococcus spp. are the predominant strains, followed at a lower concentration by Enterobacteriaceae and enterococci. The animals fed lean ground beef develop a human-like faecal flora, yelding anaerobes at a higher concentration than the Enterobacteriaceae associated to the persistence of the usual rat flora (Weinstein et al., 1974). Since the various organisms cultured from these animals have rarely been identified and enumerated (Weinstein et

Contribution of the peritonitis models to infectious disease therapy Pathophysiology of peritonitis Most of the studies used the peritonitis models to study the pathophysiology of intra-abdominal sepsis. These models emphasize the pathogenic role of haemoglobin (Lee et al., 1979; Hau et al., 1983b), bile (Andersson et al., 1989, 1991), lymphatic absorption (Dunn et al., 1985; Dumont et al., 1986; Olofsson et al., 1986; Gtirleyik et al., 1996), fibrin (Dunn et al., 1984b), immunosuppression (Marshall et al., 1988), including surgical induced immunosuppression (Almdahl and Osterud, 1987), or inflammatory response (Scarpace et al., 1992; Lorenz et al., 1994; Dunne et al., 1996; Refsum et al., 1996). Various studies demonstrated the role of bacterial synergy, involving a co-operation between Enterobacteriaceae and anaerobes (Weinstein et al., 1975; Onderdonk et al., 1976; Rotstein et al., 1987), and more recently of these organisms with enterococci (Fry et al., 1985; Matlow et al., 1989; Montravers et al., 1994, 1997).

Evaluation of surgical techniques Experimental models helped in clarifying the effects of surgical procedures--prolonged survival in using open management of the peritoneal cavity (Terhar and Dunn, 1990), delayed eradication of the pathogens induced by peritoneal dialysis (Findon and Miller, 1995). Various

RAT POLYMICROBIAL PERITONITIS INFECTION MODEL

studies evaluated the effects of peritoneal lavage and demonstrated the superiority of low-dose povidione-iodide solutions and sterile normal saline (Lally and Nichols, 1981; McAvinchey et al., 1983), the poor effects of local antibiotics when used alone (Hau et al., 1983a; Lally and Nichols, 1981) and the need for combinations of antimicrobial therapy and peritoneal lavage (McAvinchey et al., 1984).

Evaluation of antimicrobial c h e m o t h e r a p y The need to treat Enterobacteriaceae and anaerobes initially demonstrated by Weinstein et al. (1975) has become a standard in human therapy and was confirmed in experimental (Louie et al., 1977; Nichols et al., 1979; Barlett et al., 1981; Nord et al., 1986) and in human studies (Gorbach, 1993; Nathens and Rotstein, 1994; Wittmann et al., 1993, 1996), demonstrating the efficacy of penicillins, cephalosporins or pefloxacin. On the other hand, the need to treat enterococci remains controversial (Montravers et al., 1994). Finally, polymicrobial peritonitis represents an interesting field in which to evaluate the effect of therapies aimed at modificating the immune system, such as granulocyte colony-stimulating factor (Dunne et al., 1996; Lorenz et al., 1994), T N F antibodies (Bagby et al., 1991), pentoxyfilline (Refsum et al., 1996), muramyl dipeptide (Dunn et al., 1989) or free radical scavengers (Castillo et al., 1991).

References Almdahl, S. M., Osterud, B. (1987). Abdominal operations: effect on subsequent experimental faecal peritonitis. Scand. ]. Gastroenterol., 22,592-594. Almdahl, S. M., Nordstrand, K., Melby, K., Osterud, B., Giercksky, K. E. (1985). Faecal peritonitis in the rat. An experimental model for evaluation of surgical and adjuvant therapies. Acta Ckir. Scand., 151,213-216. Altemeier, W. A. (1942). The pathogenicity of the bacteria of appendicitis peritonitis. Surgery, 11,374-384. Andersson, R., Tranberg, K. G., Alwmark, A., Bengmark, S. (1989). Factors influencing the outcome ofE. coli peritonitis in rats. Acta Ckir. Scand., 155, 155-157. Andersson, R., Schalen, C., Tranberg, K. G. (1991). Effect of bile on growth, peritoneal absorption, and blood clearance of Esckerickia coli in E. coli peritonitis. Arck. Surg., 126, 773-777. Bagby, G. J., Plessala, K. J., Wilson, L. A., Thompson, J. J., Nelson, S. (1991). Divergent efficacy of antibody to tumor necrosis factor-alpha in intravascular and peritonitis models of sepsis. ]. Infect. Dis., 163, 83-88. Bartlett, J. G., Onderdonk, A. B., Louie, T., Kasper, D. L., Gorbach, S. L. (1978). Lessons from an animal model of intraabdominal sepsis. Arck. Surg., 113, 853-857. Barlett, J. G., Louie, T. J., Gorbach, S. L., Onderdonk, A. B. (1981). Therapeutic efficacy of 29 antimicrobial regimens in experimental intraabdominal sepsis. Rev. Infect. Dis., 3, 535-542. Bloechle, C., Emmermann, A., Treu, H. et al. (1995). Effect of a

193

pneumoperitoneum on the extent and severity of peritonitis induced by gastric ulcer perforation in the rat. Surg. Endosc., 9, 898-901. Browne, M. K., Leslie, G. B. (1976). Animal models of peritonitis. Surg. GynecoL Obstet., 143, 738-740. Castillo, M., Toledo-Pereyra, L. H., Gutierrez, R., Prough, D., Shapiro, E. (1991). Peritonitis after cecal perforation. An experimental model to study the therapeutic role of antibiotics associated with allopurinol and catalase. Am. Surgeon, 57, 313-316. Dumont, A. E., Maas, W. K., Iliescu, H., Shin, R. D. (1986). Increased survival from peritonitis after blockade of transdiaphragmatic absorption of bacteria. Surg. Gynecol. Obstet., 162, 248-252. Dunn, C. W., Horton, J. W., Walker, P. B. (1989). Additive effect of an immunomodulator and broad-spectrum antibiotic in fecal peritonitis. Am. J. Surg., 157, 548-551. Dunn, D. L., Rotstein, O. D., Simmons, R. L. (1984). Fibrin in peritonitis. IV. Synergistic intraperitoneal infection caused by Escherichia coli and Bacteroides fragilis within fibrin clots. Arch. Surg., 119, 139-144. Dunn, D. L., Barke, R. A., Knight, N. B., Humphrey, E. W., Simmons, R. L. (1985). Role of resident macrophages, peripheral neutrophils, and translymphatic absorption in bacterial clearance from the peritoneal cavity. Infect. Immun., 49, 257-264. Dunne, J. R., Dunkin, B. J., Nelson, S., White, J. C. (1996). Effects of granulocyte colony stimulating factor in a nonneutropenic rodent model of Escherichia coli peritonitis. J. Surg. Res., 61, 348-354. Edmiston, C. E. Jr., Goheen, M. P., Kornhall, S., Jones, F. E., Condon, R. E. (1990). Fecal peritonitis: microbial adherence to serosal mesothelium and resistance to peritoneal lavage. Worm J. Surg., 14, 176-183. Findon, G., Miller, T. (1995). Bacterial peritonitis in continuous ambulatory peritoneal dialysis: effect on dialysis on host defense mechanisms. Am. J. Kidney Dis., 26, 765-773. Fry, D. E., Berberich, S., Garrison, R. N. (1985). Bacterial synergism between the Enterococcus and Escherichia coli. J. Surg. Res., 38, 475-478. Gorbach, S. L. (1993). Treatment of intra-abdominal infections. ]. Antimicrob. Ckemother., 31 (Suppl. A), 67-78. Giirleyik, E., Gtirleyik, G., Unalmiser, S. (1996). Blockade of transdiaphragmatic lymphatic absorption reduced systemic inflammatory response syndrome during experimental peritonitis: evaluation with body oxygen kinetics in rats. Eur. J. Surg., 162,729-734. Hau, T., Lee, J. T. Jr, Simmons, R. L. (1981). Mechanisms of the adjuvant effect of hemoglobin in experimental peritonitis. IV. The adjuvant effect of hemoglobin in granulocytopenic rats. Surgery, 89, 187-191. Hau, T., Nishikawa, R., Phuangsab, A. (1983a). Irrigation of the peritoneal cavity and local antibiotics in the treatment of peritonitis. Surg. Gynecol. Obstet., 156, 25-30. Hau, T., Nishikawa, R. A., Phuangsab, A. (1983b). The effect of bacterial trapping by fibrin on the efficacy of systemic antibiotics in experimental peritonitis. Surg. Gynecol. Obstet., 157, 252-256. Jacobi, C. A., Ordemann, J., B6hm, B. et al. (1997). Does laparoscopy increase bacteremia and endotoxemia in a peritonitis model? Surg. Endosc., 11,235-238. Kim, Y. M., Hong, S. J., Billiar, T. R., Simmons, R. L. (1996).

194

Counterprotective effect of erythrocytes in experimental bacterial peritonitis is due to scavenging of nitric oxide and reactive oxygen intermediates. Infect. Irnrnun., 64, 3074-3080. Lally, K. P., Nichols, R. L. (1981). Various intraperitoneal irrigation solutions in treating experimental fecal peritonitis. South. Meal. J., 74, 789-791,798. Lally, K. P., Trettin, J. C., Torma, M. J. (1983). Adjunctive antibiotic lavage in experimental peritonitis. Surg. GynecoL Obstet., 156, 605-608. Lee, J. T., Jr., Ahrenholz, D. H., Nelson, R. D., Simmons, R. L. (1979). Mechanisms of the adjuvant effect of hemoglobin in experimental peritonitis. V. The significance of the coordinated iron component. Surgery, 86, 41-48. Lorenz, W., Reimund, K. P., Weitzel, F. etal. (1994). Granulocyte colony-stimulating factor prophylaxis before operation protects against lethal consequences of postoperative peritonitis. Surgery, 116, 925-934. Louie, T. J., Onderdonk, A. B., Gorbach, S. L., Bartlett, J. G. (1977). Therapy for experimental intraabdominal sepsis: comparison of four cephalosporins with clindamycin plus gentamicin. J. Infect. Dis., 135, S 18-$24. Marshall, J. C., Christou, N. V., Meakins, J. L. (1988). Smallbowel bacterial overgrowth and systemic immunosuppression in experimental peritonitis. Surgery, 104, 404-411. Massart, J. (1892). Le chimiotactisme des leucocytes et l'immunit& Ann. Inst. Pasteur (Paris), 6, 221-272. Matlow, A. G., Bohnen, J. M., Nohr, C., Christou, N., Meakins, J. (1989). Pathogenicity ofenterococci in a rat model of fecal peritonitis.J. Infect. Dis., 160, 142-145. McAvinchey, D. J., McCollum, P. T., McElearney, N. G., Mundinger, G., Jr., Lynch, G. (1983). Antiseptics in the treatment of bacterial peritonitis in rats. Br. J. Surg., 70, 158-160. McAvinchey, D. J., McCollum, P. T., Lynch, G. (1984). Towards a rational approach to the treatment of peritonitis: an experimental study in rats. Br. J. Surg., 71,715-717. Montravers, P., Andremont, A., Massias, L., Carbon, C. (1994). Investigation of the potential role of Enterococcusfaecalis in the pathophysiology of experimental peritonitis.J. Infect. Dis., 169, 821-830. Montravers, P., Mohler, J., Saint Julien, L., Carbon, C. (1997). Evidence of the proinflammatory role of Enterococcus faecalis in polymicrobial peritonitis in rats. Infect. Immun., 65, 144-149. Natanson, C., Hoffman, W. D., Suffredini, A. F., Eichacker, P. Q., Danner, R. L. (1994). Selected treatment strategies for septic shock based on proposed mechanisms of pathogenesis. Ann. Intern. ivied., 120, 771-783. Nathens, A. V., Rotstein, O. D. (1994). Therapeutic options in peritonitis. Surg. Clin. North Am., 74, 677-692. Nichols, R. L., Smith, J. W., Fossedal, E. N., Condon, R. E. (1979). Efficacy of parenteral antibiotics in the treatment of experimentally induced intraabdominal sepsis. Rev. Infect. Dis., 1, 302-309. Nord, C. E., Edlund, C., Lahnborg, G. (1986). The efficacy of pefloxacin in comparison to gentamicin in the treatment of experimentally induced peritonitis in rats. J. Antirnicrob. Chemother., 17 (Suppl. B), 59-63. Olofsson, P., Nylander, G., Olsson, P. (1986). Endotoxin: routes of

H. Dupont and P. Montravers

transport in experimental peritonitis. Am. J. Surg., 151, 443-446. Onderdonk, A. B., Weinstein, W. M., Sullivan, N. M., Bartlett, J. G., Gorbach, S. L. (1974). Experimental intra-abdominal abscesses in rats: quantitative bacteriology of infected animals. Infect. Irnrnun., 10, 1256-1259. Onderdonk, A. B., Bartlett, J. G., Louie, T., Sullivan-Seigler, N., Gorbach, S. L. (1976). Microbial synergy in experimental intraabdominal abcess. Infect. Imrnun., 13, 22-26. Ozmen, V., Thomas, W. O., Healy, J. T. etal. (1993). Irrigation of the abdominal cavity in the treatment of experimentally induced microbial peritonitis: efficacy of ozonated saline. Am. Surg., 59, 297-303. Perdue, P. W., Kazarian, K. K., Nevola, J., Law, W. R., Williams, T. (1994). The use of local and systemic antibiotics in rat fecal peritonitis. J. Surg. Res., 57, 360-365. Powlowsky, A. D. (1887). Beitraege zur Aetiologie und Entstehungweise der akuten Peritonitis. ZentralbL Chir., 14, 881-887. Refsum, S. E., Halliday, M. I., Campbell, G., McCaigue, M., Rowlands, B. J., Boston, V. E. (1996). Modulation of TNF alpha and IL-6 in a peritonitis model using pentoxifylline. J. Pediatr. Surg., 31,928-930. Rotstein, O. D., Pruett, T. L., Wells, C. L., Simmons, R. L. (1987). The role of Bacteroides encapsulation in the lethal synergy between Escherichia coli and Bacteroides species studied in a rat fibrin clot peritonitis model.J. Infect., 15, 135-146. Scarpace, P. J., Borst, S. E., Bender, B. S. (1992). The association of E. coli peritonitis with an impaired and delayed fever response in senescent rats. J. Gerontol., 47, B 142-145. Shyu, W. C., Nightingale, C. H., Quintiliani, R. (1987). Pseudomonas peritonitis in neutropenic rats treated with amikacin, ceftazidime and ticarcillin, alone and in combination. J. Antirnicrob. Chemother., 19, 807-814. Sonesson, A., Larsson, L., Andersson, R., Adner, N., Tranberg, K. G. (1990). Use of two-dimensional gas chromatography with electron-capture detection for the measurement of lipopolysaccharides in peritoneal fluid and plasma from rats with induced peritonitis. J. Clin. Microbiol., 28, 1163-1168. Terhar, M. A., Dunn, M. M. (1990). Open peritoneal management in murine peritonitis. Am. Surgeon., 56, 451-454. Weinstein, W. M., Onderdonk, A. B., Bartlett, J. G., Gorbach, S. L. (1974). Experimental intra-abdominal abscesses in rats: development of an experimental model. Infect. Immun., 10, 1250-1255. Weinstein, W. M., Onderdonk, A. B., Bartlett, J. G., Louie, A. B., Gorbach, S. L. (1975). Antimicrobial therapy of experimental intraabdominal sepsis. J. Infect. Dis., 132, 282-286. Wichterman, K. A., Baue, A. E., Chaudry, I. H. (1980). Sepsis and septic shock--a review of laboratory models and a proposal. J. Surg. Res., 29, 189-201. Wittmann, D. H., Schein, M., Condon, R. E. (1996). Management of secondary peritonitis. Ann. Surg., 224, 10-18. Wittmann, D. H., Walker, A. P., Condon, R. E. (1993). Peritonitis, intra-abdominal infection, and intra-abdominal abscess. In Principles of Surgery (eds Schwartz, S. I., Shires, G. T., Spencer, F. C.), pp. 1449-1484. McGraw Hill, New York.

Chapter 22

Murine Thigh Suture Model J. D. Pietsch and H. C. Polk, Jr

Background of model The thigh suture model was first developed 20 years ago by McCoy at the Price Institute of Surgical Research, University of Louisville, KY (Rouben et al., 1977; Fagelman et aL, 1981). Adapted from work performed at the Lister Institute of Preventive Medicine in London (Polk and Miles, 1973), its purpose was to provide a simple, consistent, and reproducible model of surgical infection. The three essential components of surgical infection are surgical trauma, a foreign body, and defined bacterial contamination. It has been used as a model to assess the effects of non-specific immune-modulating agents such as bacillus Calmette-Gu~rin (Rouben et al., 1977; Fagelman et al., 1981), muramyl dipeptide (GallandetaL, 1981; Polk etal., 1981; Ausobsky etal., 1982; Lamont et aL, 1987), tumor necrosis factor (Hershman et aL, 1989), and y-interferon (Hershman et al., 1989), as well as the effects of single and multiple antibiotics on surgical infection (Galland et aL, 1982a). Studies on the effects of combined treatments such as muramyl dipeptide plus antibiotics (Polk et al., 1982; Gaar et aL, 1994) and surgically induced infection on immunocompromised mice (Cobb et aL, 1986; Galland et al., 1983) have also been performed. This model currently provides an accurate means to assess the systemic and local effectiveness of biological agents on the infection process.

Animal species Both outbred and inbred strains of mice have been used effectively. Outbred strains provide an inexpensive survival model and allow bacterial clearance to be quantified. Inbred strains provide a more accurate measure of specific immunological changes that occur during the infection and recovery process.

suture is required since the bacteria need a matrix to adhere to and grow on. The suture is cut into approximately 7 cm lengths. One length of suture is required for each animal. The size and density of the suture determine the amount of bacteria delivered at bacterial challenge.

Needles Small, curved French-eye needles.

Surgical instruments Needle holders, forceps, and small sharp scissors are needed. Curved tenotomy scissors are ideal to trim the suture close to the skin.

Miscellaneous Sterile Petri dishes and alcohol swabs.

Fasting This model is most effectively used in the fasted animal (Galland et aL, 1981, 1982b,c). Withholding food for 24 hours prior to the procedure will increase mortality. Fasting also tends to mimic the immunological insult that is observed clinically following major trauma, and it allows stratification of the groups so that significant differences can be observed. Mice have free access to food immediately following bacterial challenge, or up to 4 hours after challenge, depending on the effect desired.

Materials required Suture

Anesthesia

Sterile 3 - 0 or 2 - 0 cotton suture is commonly used, but other types of braided suture may also be used. Braided

Anesthesia is not necessary since there is only slight and momentary pain. The amount of stress and discomfort is

Handbool~ of Animal Models of Infection ISBN 0-12-775390-7

Copyright 9 1999Academic Press All rights of reproduction in any form reserved

196

equivalent to that of a needle stick. If anesthesia is desired, the animals may be lightly anesthetized with an inhalation agent such as halothane, metofane, or ethyl ether. These agents can be administered by placing the animal into a small covered glass jar that contains the anesthetic.

J . D . Pietsch and H. C. Polk Jr

underneath the skin. If the suture is not buried, the animal may extract it with its teeth. The mouse is returned to a clean cage. A new strand of suture is used for each animal.

Postsurgical care Bacterial challenge Many types of bacteria may be used with this model. Gramnegative bacteria have traditionally been used to mimic the clinical scenario. The bacterial challenge may be a single strain or a combined inoculation. We have found that a recently acquired hospital isolate works well. Virulence should be established, and the bacteria passaged every few weeks to ensure a consistent virulence. A baseline mortality rate of approximately 70% in untreated animals effectively assesses the positive or negative effect of treatment agents.

All infected animals are housed in isolation in a biohazard area in the animal care facility. They are given free access to food and water. Cages are covered with fabric bonnets or placed in laminar flow hoods to isolate them from any aerosol contamination. Animals are monitored frequently to accurately plot the mortality curves. Mortality in this model occurs between 1 and 7 days after bacterial challenge. Depending on the strain of bacteria used, no further deaths usually occur after these 7 days.

Infection process Preparation of inocula The bacteria used for the challenge are inoculated into tryptic soy broth or other suitable media and grown overnight in an incubator. The sutures are added to the incubating media at least 1 hour prior to the procedure. If a doseresponse challenge is desired, the incubated bacterial broth is diluted to the preferred concentrations before inserting the suture. The sutures are removed from the media at the time of the procedure and placed in a sterile Petri dish, and a small amount of broth is added to cover the sutures. Bacterial concentration of the challenge can be measured with a 1 cm strand of inoculated suture by homogenizing it in sterile saline and plating it on to sterile, nutrient-coated Petri dishes.

Surgical procedure Two laboratory workers are needed to perform the procedure. Inoculated suture is attached to the French-eye needle, and the needle is secured in the needle holder. One person uses one hand to hold the mouse securely by the nape of its neck and the other hand to extend one of the legs of the mouse. Another person then has clear access to apply the suture to the thigh muscle. The area to be sutured is wiped with alcohol for two reasons: (1) it cleans the skin and (2) it mats the hair next to the skin, which helps when trimming the suture. In a smooth, fluid motion, the needle is inserted into and passed through the thigh muscle. The needle end of the suture is then cut off flush with the skin. The opposite side of the suture is also cut flush with the skin. The skin tissue around the entrance and exit sites of the suture is gently lifted to ensure that the suture is buried

The thigh suture model can be used to measure survival and monitor the infection process. To accomplish both goals, parallel experiments should be conducted simultaneously. Two groups of animals are needed. One group is followed to record mortality and survival rates. The other group is sacrificed at specific time points to assess other parameters. Extra animals are needed for the second group to adjust for the animals that do not survive along the time course.

Recovery of bacteria This model allows for the recovery and quantification of bacteria from three major sites: (1) systemic, (2) regional, and (3) local. It is best to collect these samples after the mouse is sacrificed by cervical dislocation. The bacterial recovery should be performed in the same chronological order as the three mentioned major sites of collection. (These samples may also be collected at the time of death from sepsis within the first 15 minutes after death.) The animal is secured by all four legs to a dissection board. The chest is opened and the heart exposed. Using a heparinized syringe with a needle, blood is aspirated from the heart. Systemic blood can also be collected through the closed chest by cardiac puncture. This blood sample is used to determine systemic bacteremia. Inguinal lymph nodes can be dissected from the skin surrounding both the infected and uninfected legs. These samples provide a regional assessment of bacterial containment. Organs such as the liver and spleen can also be harvested at this time and analyzed for bacterial contamination as well as other immunological factors (Polk et aL, 1990). For local assess-

MURINE THIGH SUTURE MODEL

ment, the infected leg is retracted and an incision is made through the skin, exposing the entire muscle mass. The muscle is dissected from the bone and placed in a sterile Petri dish. This can also be done with the other, noninfected leg. The muscle then is bluntly dissected to recover the suture. The suture length is measured and then returned to the Petri dish. The blood is serially diluted and plated on to Petri dishes coated with nutrient agar. The muscle is weighed and then placed with the recovered suture in sterile saline and homogenized. The homogenate is then serially diluted and plated, as with the blood. The plates are incubated overnight and then counted for number of colony forming units.

References Ausobsky, I. R., Trachtenberg, L. S., Polk, H. C. Jr (1982). Enhancement of nonspecific host defenses against combined local bacterial challenge. Surg. Forum, 33, 46-47. Cobb, J. P., Brown, C. M., Brown, G. L., Polk, H. C. Jr (1986). Muramyl dipeptide protects decomplemented mice from surgically-induced infection. Int. J. ImrnunopharrnacoL, 8, 799-803. Fagelman, K. M., Flint, L. M., lr, McCoy, M. T., Polk, H. C. lr, Trachtenberg, L. S. (1981). Simulated surgical wound infection in mice: effect of stimulation on nonspecific host defense mechanisms. Arch. Surg, 116, 761-764. Gaar, E., Naziri, W., Cheadle, W. G., Pietsch, J. D., Johnson, M., Polk H. C. Jr (1994). Improved survival in simulated surgical infection with combined cytokine, antibiotic and immunostimulant therapy. Br. J. Surg. 81, 1309-1311. Galland, R. B., Trachtenberg, L. S., Polk, H. C. Jr (1981). Nonspecific enhancement of host defenses against infection in malnourished mice. Surg. Forum, 32, 39-40.

197

Galland, R. B., Heine, K. l., Trachtenberg, L. S., Polk, H. C. lr (1982a). Reduction of surgical wound infection rates in contaminated wounds treated with antiseptics combined with systemic antibiotics: an experimental study. Surgery, 91,329-332. Galland, R. B., Trachtenberg, L. S., Rynerson, N., Polk, H. C. Jr (1982b). Nonspecific enhancement of resistance to local bacterial infection in starved mice. Arch. Surg., 117, 161-164. Galland, R. B., Polk, H. C. Jr (1982c). Non-specifc stimulation of host defenses against a bacterial challenge in malnourished hosts. Br. J. Surg., 69, 665-668. Galland, R. B., Heine, K. l., Polk, H. C. Jr (1983). Nonspecific stimulation of host defenses against bacterial challenge in immunosuppressed mice. Arch. Surg., 118, 333-337. Hershmann, M. J., Pietsch, I. D., Trachtenberg, L., Mooney, T. H. R., Shields, R. E., Sonnenfeld, G. (1989). Protective effects of recombinant human tumour necrosis factor 0t and interferon 7 against surgically simulated wound infection in mice. Br. J. Surg., 76, 1282-1286. Lamont, P. M., Maier, K. G., Melton, L., Polk, H. C. Jr (1987). Stimulatory effects of muramyl dipeptide upon neutrophils isolated from a local bacterial infection. Br. J. Exp. Pathol., 68, 655-661. Polk, H. C., Jr, Miles, A. A. (1973). The decisive period in the primary infection of muscle by Escherichia coli. Br. J. Exp. Pathol., 54, 99-109. Polk, H. C., Jr, Calhoun, J. H., Eng., M. et al. (1981). Nonspecific enhancement of host defenses against infection: experimental evidence of a new order of efficacy and safety. Surgery, 90, 376-380. Polk, H. C. Jr, Galland, R. B., Ausobsky, M. B. (1982). Nonspecific enhancement of resistance to bacterial infection: evidence of an effect supplemental to antibiotics. Ann. Surg., 196, 436-441. Polk, H. C. Jr, Lamont, P. M., Galland, R. B. (1990). Containment as a mechanism of nonspecific enhancement of defenses against bacterial infection. Infect. Irnmun., 58, 1807-1811. Rouben, D. P., Fagelman, K., McCoy, M. T., Polk, H. C. Jr (1977). Enhancement of nonspecific host defenses against local bacterial challenge. Surg. Forum, 28, 44-45.

This Page Intentionally Left Blank

Chapter 23

Animal Models of Melioidosis D. De Shazer and D. E. Woods

Background of human infection Melioidosis, an infection of humans and animals, is caused by the Gram-negative bacterium Burkholderia pseudomallei (Leelarasamee and Bovornkitti, 1989; Dance, 1991, 1996; Yabuuchi and Arakawa, 1993; Kanai and Kondo, 1994). The disease is most common in south-east Asia and northern Australia, but sporadic cases have also been described in other regions of the world. The organism can be isolated from wet soil in endemic regions (Ellison et al., 1969; Smith et al., 1995; Wuthiekanun et al., 1995). The route of infection is probably via inhalation of dust particles or direct inoculation of contaminated soil into cuts or abrasions. The outcome of a B. pseudomallei infection can vary from asymptomatic seroconversion to fulminant septicemic melioidosis and death. Septicemia is the most common clinical presentation, as 50-70% of melioidosis patients are bacteremic on admission to the hospital (Leelarasamee, 1986). Acute or chronic infection of any organ can occur, and lesions can form on any tissue but are most commonly found in the lungs, liver, spleen, lymph nodes, skin and soft tissues and urinary tract (Dance, 1996). Latent infections can also occur in which the organism can lie dormant for as many as 26 years before recrudescence into an active infection (Mays and Ricketts, 1975; Koponen et al., 1991). B. pseudomallei appears to be an opportunistic pathogen as a relatively high number of melioidosis patients have underlying diseases such as diabetes mellitus and renal failure (Chaowagul et al., 1989; Tanphaichitra, 1989; Currie et al., 1993; Puthucheary et al., 1992; Turner et al., 1994).

B. pseudomallei. The infection of hamsters with B. pseudomallei typically results in acute septicemic melioidosis and death within 2-3 days. In 1948 Miller et al. described the use of hamsters in the experimental chemotherapy of melioidosis (Miller et al., 1948b). This animal model of melioidosis has also been used to assess the relative virulence of B. pseudomallei clinical and environmental isolates (Brett et aL, 1997) and isogenic mutants (DeShazer et al., 1997). Rats are relatively resistant to B. pseudomallei infection (Miller et aL, 1948a; Woods et aL, 1993). The LDs0 of B. pseudomallei in infant rats can be lowered significantly by i.p. injection of the diabetogenic compound streptozotocin (STZ; Woods et aL, 1993). The LDs0 of B. pseudomallei for nondiabetic infant rats is more than 1 x 108 bacteria while the LDs0 in STZ-induced diabetic infant rats is approximately 1 x 104 bacteria (Woods et aL, 1993). STZ is thought to damage pancreatic B-cell D N A through the formation of alkylating radicals (Okamoto, 1985). D N A damage activates poly (ADP-ribose) synthetase and cellular levels of N A D + are drastically reduced leading to the necrosis of insulin-producing ~-cells (Okamoto, 1985). Recent evidence suggests that the GLUT2 transporter is expressed on rodent pancreatic [3-cells and that this molecule mediates the specific uptake of STZ into these cells (Schnedl et al., 1994). The infection of infant diabetic rats with B. pseudomallei typically results in acute septicemic melioidosis and death, usually within 7 days. This animal model of melioidosis has been used in passive immunoprophylaxis studies (Brett et aL, 1994; Bryan et aL, 1994; Brett and Woods, 1996) and has been useful in assessing the relative virulence of B. pseudomallei isogenic mutants (DeShazer et al., 1997).

Background of models Animal species Hamsters are exquisitely sensitive to B. pseudomallei infection (Miller et aL, 1948a; Dannenberg and Scott, 1957; Ellison et al., 1969; Brett et al., 1997). The 50% lethal dose (LDs0) of B. pseudomallei in hamsters is approximately 10 bacteria. The LDs0 is independent of the route of infection as similar values are obtained with intraperitoneal (i.p.), subcutaneous and respiratory infections. In addition, hamsters do not display individual variation in susceptibility to Handbook of Animal Models of Infection ISBN 0-12-775390-7

We use female golden Syrian hamsters (Mesocricetus auratus) that are 6-8 weeks old and weigh 80-90 g. Male hamsters are also susceptible to B. pseudomallei infection and may be useful for those who wish to follow the development of the Straus reaction (Miller et al., 1948a). We have arbitrarily chosen 6-8-week old animals to standardize this model of infection; but Ellison et al. (1969) described the use Copyright 9 1999Academic Press All rights of reproduction in any form reserved

200

of weanling hamsters (3 weeks old), and we have found that older animals are also highly susceptible to/3. pseudomallei infection. We also use female Sprague Dawley rats (Rattus norvegicus) that are approximately 3 weeks old and weigh 30-40g. Approximately 10 pups (10-12 days) are delivered with one mother. The pups are weaned after they reach a weight of 30-40g and injected with STZ as described below. Infant male rats may also be used in this model of infection (Woods et aL, 1993). It is important to note that adult rats should not be used because diabetic adult rats are not susceptible to i.p. infection with/3, pseudomallei.

Preparation of animals The average weight of 10-20 infant rats should be determined, and 80 mg of STZ/kg of body weight should be injected i.p. for 2 consecutive days in order to induce diabetes (Woods et aL, 1993). The STZ should be dissolved in 100 mM sodium citrate, pH 4.2, filter sterilized and put into sterile Monoject | blood collection tubes (or equivalent). We inject individual infant rats with the required amount of STZ in a volume of 100 btl using a 1 ml syringe fitted with a 25G needle. The urine glucose levels of several random infant rats should be checked daily for diabetes progression. Diastix | (Bayer, Inc.) reagent strips for urinalysis (or equivalent) should be used to monitor urine glucose levels. This task can be accomplished more easily with two people as compared to one. One person should pick up the infant rat by the tail with one hand and with the forefinger and thumb at the base of the head with the other. Urination is common when rats are picked up in such a manner. The other person should hold the Diastix | strip and wet the reagent area of strip by holding it under the drops of urine. The infant rats are considered diabetic when the glucose in the urine reaches a concentration of 2 g/dl (111 mmol/l). It typically takes 2-3 days following the second STZ injection for infant rats to become diabetic. One week after the final STZ injection, the infant rats are infected with B. pseudomallei. No special preparation is required for hamsters.

D. DeShazer and D. E. Woods

ment. Other clinical and environmental isolates of/3.

pseudornallei yield similar results in animal studies (Woods et aL, 1993; Brett and Woods, 1996; Brett et aL, 1994, 1997). /3. pseudornallei is grown for 2 days on a Luria-Bertani (LB) broth base (Becton Dickinson) agar plate in a 37~ incubator. A quantity of 2 ml of TSBDC broth (BrettetaL, 1997) is inoculated with an isolated colony and incubated in a 37~ rotary shaker (250 rpm) overnight; 100111 of the saturated overnight culture is then transferred to 3ml of flesh TSBDC broth, and the culture is incubated for 4 hours until it reaches the middle to late logarithmic phase of growth. The optical density at 600nm is determined and compared with a standard growth curve to estimate the number of bacteria per milliliter of culture. The culture is serially diluted in sterile 0.85% NaC1, and aliquots of the appropriate dilutions are transferred to sterile blood collection tubes for subsequent injection of animals. The actual number of organisms in the starting culture is determined by spreading 100 ~1 portions of the appropriate dilutions in triplicate on to LB agar plates. In our hands, repeated subculture of/3. pseudomallei does not affect its virulence capacity in hamsters. Infant diabetic rats, on the other hand, should be infected with a/3. pseudomallei strain that has undergone at least one i.p. animal passage. The passage strain should be taken directly from a frozen stock and transferred to a LB agar plate as described above. It should also be noted that the media described here (LB agar and TSBDC broth) have been chosen in an attempt to standardize these animal models of infection, but other culture media have been used successfully in the past (Miller et aL, 1948a; Dannenberg and Scott, 1957).

Infection process The diluted bacterial culture in the blood collection tube is drawn up into a 1 ml syringe fitted with a 25 G needle, and 100 btl aliquots are injected i.p. into hamsters and infant diabetic rats. We typically use five animals per bacterial dilution. The range of bacterial dilutions examined will vary depending on the experiment (chemotherapy, immunotherapy, or relative virulence studies) and the animal model (hamsters or infant diabetic rats).

Details of surgery No surgical procedures are required in the hamster or infant diabetic rat models of melioidosis.

Storage and preparation of inocula The strain we commonly use for animal studies is/3. pseudomallei 1026b (Brett et aL, 1997; DeShazer et aL, 1997). This strain was isolated in Thailand from a human case of septicemic melioidosis with skin, soft tissue and spleen involve-

Key parameters to monitor infection Animal cages are checked daily, dead animals are removed and the day of death is noted. The LDs0 is calculated using the method of Reed and Muench (Reed and Muench, 1938). The LD50 of B. pseudomallei for hamsters is approximately 10 bacteria at 2 days. There are rarely noticeable differences between infected and uninfected hamsters 24 hours following infection, even with infectious doses as high as 10a bacteria. There is profound morbidity and mortality 48 hours

ANIMAL MODELS OF MELIOIDOSIS

after infection, regardless of the infectious dose. Hamsters that are alive at 48 hours usually have a moribund appearance and exhibit a purulent ocular exudate. Hamsters rarely survive longer than 3 days after being infected with B. pseudomallei. Blood drawn from hamsters at the time of death typically contains more than 103 B. pseudomallei/ml (Brett et aL, 1997). Autopsies performed on hamsters 48 hours after infection reveal no gross lesions of the lungs, liver or spleen. All these tissues, however, are positive for B. pseudomallei when cultured. Peritonitis and splenomegaly are relatively common post-mortem observations in these animals. Splenomegaly is the result of hemorrhage in the spleen. No histopathological changes are observed in any other tissue including lungs, liver and kidney. The LDs0 of B. pseudomallei for STZ-induced diabetic infant rats is approximately 1 • 104 bacteria at 7 days. Infant diabetic rats that receive an infectious dose of more than 1• bacteria typically exhibit bacteremia and death within 7 days. Autopsies performed on dead animals reveal several enlarged organs, including the liver, spleen, and kidneys. The lungs are commonly filled with inflammatory exudate. No obvious lesions are present in any organs at the time of death.

Antimicrobial therapy The mortality of septicemic melioidosis has decreased from approximately 80% to 40% with the use of the third-generation cephalosporin ceftazidime (White et aL, 1989). The current treatment of severe melioidosis involves 7-14 days of parenteral ceftazidime or amoxicillin/clavulanate followed by 12-20 weeks of oral amoxicillin/clavulanate or a combination of chloramphenicol, doxycycline and co-trimoxazole (White et aL, 1989; Suputtamongkol et aL, 1994; Rajchanuvong et aL, 1995). This treatment has reduced the overall mortality of severe melioidosis by half, but 40% mortality still represents a relatively high mortality rate. In addition, recent studies have demonstrated that ceftazidime is not bactericidal for B. pseudomallei (Sookpranee et al., 1991; Smith et aL, 1994) and does not exhibit a postantibiotic effect (Walsh et aL, 1995). New and improved antimicrobial agents for the treatment of melioidosis are clearly needed. There are no reports in the literature on the use of antimicrobial agents in the infant diabetic rat model of melioidosis. There is one published report describing experimental chemotherapy in the hamster model of melioidosis (Miller et al., 1948b). Subcutaneous (s.c.) injections of sulfadiazine, streptomycin and penicillin were used to treat hamsters infected i.p. with 1-6 x 103B. pseudomallei. Sulfadiazine treatment was effective in preventing death while streptomycin and penicillin were not (Miller et aL, 1948b). B. pseudomallei is relatively susceptible to sulfadiazine but is resistant to streptomycin and penicillin in vitro (Eickhoff et aL, 1970). Thus, there is a correlation of the activity of these antimicrobial agents in vitro and in vivo in

201

the hamster model of melioidosis. There have been no studies with newer antimicrobial agents in experimental melioidosis. The carbapenems (imipenem, meropenem, and biapenem) and ciprofloxacin demonstrate low MICs and a significant postantibiotic effect for B. pseudomallei in vitro (Walsh et aL, 1995). These antibiotics are candidates for use in treatment of human melioidosis and in the hamster and infant diabetic rat models of melioidosis. Antimicrobial agents could be administered parenterally in hamsters (s.c. and i.p.) and infant diabetic rats (s.c., i.p. and intravenously via the tail vein). The dose, frequency, and duration of antimicrobial therapy will vary depending on the antibiotic used, and each parameter may have to be optimized empirically.

Key parameters to monitor response to treatment When an infectious dose of B. pseudomallei equivalent to the LDs0 is administered, effective antimicrobial agents should decrease or prevent the death of hamsters and infant diabetic rats in 2 days and 7 days respectively. As a result, such antibiotics should significantly increase the LDs0 of B. pseudomallei for hamsters and infant diabetic rats. Treated animals may live longer than untreated animals and may even recover from B. pseudomallei infection (Miller et aL, 1948b). Morbidity and mortality of the treated animals can be monitored for weeks, as described above.

Pitfalls (advantages/disadvantages) of the models The hamster and infant diabetic rat models of melioidosis most closely resemble acute septicemic melioidosis in humans. This form of the disease is the most common clinical presentation in humans and results in 40% mortality, even with vigorous antimicrobial therapy (Leelarasamee, 1986; White et aL, 1989; Suputtamongkol et aL, 1994). These animal models of B. pseudomallei infection may be useful for identifying new antimicrobial agents for use in human cases of acute septicemic melioidosis. On the other hand, the animal models described here do not resemble other clinical manifestations of human disease, including chronic or latent melioidosis. It is also important to note that no obvious lesions can be identified in the organs of hamsters or infant diabetic rats that are infected with B. pseudomallei. Visceral lesions are relatively common in human melioidosis cases and are typically found in the lungs, liver, spleen, lymph nodes, skin and soft tissues, and urinary tract (Dance, 1996). Diabetes mellitus is a common underlying disease in melioidosis patients (Chaowagul et aL, 1989; Tanphaichitra, 1989; Puthucheary et aL, 1992; Currie et aL, 1993; Turner et

D. DeShazer and D. E. Woods

202

aL, 1994). Similarly, diabetic infant rats are susceptible to infection with B. pseudornallei, but non-diabetic infant rats are not (Woods et aL, 1993). Streptozotocin-induced diabetes mellitus in rats is similar to insulin-dependent (juvenile- onset) diabetes mellitus in humans. Recent studies suggest that the majority of melioidosis patients with diabetes have non-insulin-dependent (adult- onset) diabetes mellitus rather than insulin-dependent diabetes mellitus (Currie et aL, 1993; Turner et aL, 1994; Currie, 1995). It is clear, however, that both types of diabetes mellitus are risk factors for B. pseudornallei infection. It is currently unclear why diabetics are highly susceptible to infection with B. pseudomallei, but the infant diabetic rat model of melioidosis should be useful in studying this interesting phenomenon.

Contributions of the models to infectious disease therapy Several passive immunization studies have been conducted using the infant diabetic rat model of melioidosis (Brett et al., 1994; Bryan et al., 1994; Brett and Woods, 1996). B. pseudomallei surface antigens that are potential candidates for a melioidosis vaccine include the O-polysaccharide (OPS) moiety of lipopolysaccharide and flagella. Rabbit antisera raised against purified O-PS, flagellin protein or an OPS-flagellin conjugate passively protected diabetic rats from infection with B. pseudomallei (Brett et al., 1994; Bryan et al., 1994; Brett and Woods, 1996). The protective capacity of the specific antisera suggests that these antigens may be suitable vaccine candidates. It should be noted that this animal model is not amenable to active immunization studies, as active immunization would require a minimum of 4 weeks. At this time, the animals would be adults and would no longer be susceptible to i.p. challenge with B. pseudomallei. We have used the hamster model of melioidosis to compare the relative virulence of clinical and environmental isolates of B. pseudomallei (Brett et al., 1997). The exquisite sensitivity of hamsters to B. pseudomallei infection has allowed us to identify a new B.-pseudomallei-like organism that is relatively avirulent in hamsters (LDs0 of > 1 x 106 bacteria). This B.-pseudomallei-like organism, recently named B. thailandensis (Brett et al., in press), is antigenically, biochemically and morphologically similar to B. pseudomallei and can be isolated from the same environmental locations (Wuthiekanun et al., 1996; Smith et al., 1995; Brett et al., 1997). A phylogenetic analysis based on 16S r D N A sequences confirms that B. thailandensis is closely related to B. pseudomallei but is clearly a separate species (Brett et al., 1998). Further studies employing the hamster model of infection may aid in the identification of genetic factors responsible for the enhanced virulence of B. pseudomallei relative to B. thailandensis. Finally, we have compared the relative virulence of B.

pseudornallei 1026b and several isogenic Tn5-OT182 mutants in both animal models of melioidosis (DeShazer et aL, 1997). These studies have allowed us to identify and characterize those factors responsible for B. pseudomallei pathogenesis at the molecular level. For example, we have recently identified several B. pseudornallei Tn5-OT182 mutants that are susceptible to the bactericidal activity of 30% human serum. The serum-sensitive mutants are less virulent than the serum-resistant parental strain in both the hamster and infant diabetic rat models of melioidosis. In contrast, we found that there was no difference in the virulence of a Tn5-OT182 flagellin mutant and the wild-type parental strain in either animal model of B. ueudomallei infection (DeShazer et al., 1997). We conclude from these studies that serum resistance is an important virulence determinant while flagella and/or motility are probably not significant virulence determinants in these animal models of melioidosis. Similar studies will allow investigators to assess the relative importance of specific genetic determinants of B. pseudornallei in the pathogenesis of melioidosis.

References Brett, P. J., Woods, D. E. (1996). Structural and immunologic characterization of Burkholderia pseudomallei O-polysaccharide-flagellin protein conjugates. Infect. hnmun., 64, 2824-2828. Brett, P. J., Mah, D. C., Woods, D. E. (1994). Isolation and characterization of Pseudomonas pseudornallei flagellin proteins. Infect. Irnmun., 62, 1914-1919. Brett, P. 1., DeShazer, D., Woods, D. E. (1997). Characterization of Burkholderia pseudomallei and Burkholderia pseudomalleilike strains. Epidemiol. Infect., 118, 137-148. Brett, P. J., DeShazer, D., Woods, D. E. (1998). Burkholderia thailandensis sp. nov., description of a Burkholderia pseudomalleilike species. Int. J. Syst. Bacteriol., 48, 317-320. Bryan, L. E., Wong, S., Woods, D. E., Dance, D. A. B., Chaowagul, W. (1994). Passive protection of diabetic rats with anitsera specific for the polysaccharide portion of the lipopolysaccharide from Pseudomonas pseudomallei. Can. J. Infect. Dis., 5, 170-178. Chaowagul, W., White, N. J., Dance, D. A. et al. (1989). Melioidosis: a major cause of community-acquired septicemia in northeastern Thailand. J. Infect. Dis., 159, 890-899. Currie, B. (1995). Pseudomonas pseudomallei-insulin interaction. Infect. Immun., 63, 3745. Currie, B., Howard, D., Hguyen, V. T., Withnall, K., Merianos, A. (1993). The 1990-1991 outbreak of melioidosis in the Northern Territory of Australia: clinical aspects. Southeast Asian J. Trop. Med. Public Health, 24, 436-443. Dance, D. A. (1991). Melioidosis: the tip of the iceberg? Clin. Microbiol. Rev., 4, 52-60. Dance, D. A. B. (1996). Melioidosis. In Manson's Tropical Diseases, (ed. Cook, G. C.), pp. 925-930. W. B. Saunders, London:. Dannenberg, A. M. Jr, Scott, E. M. (1957). Melioidosis: pathogenesis and immunity in mice and hamsters. I. Studies with virulent strains of Malleomyces pseudomallei. J. Exp. ivied., 107, 153-187.

ANIMAL MODELS OF MELIOIDOSIS

DeShazer, D., Brett, P. J., Carlyon, R., Woods, D. E. (1997). Mutagenesis of Burt(holderia pseudomallei with TnS-OT182: isolation of motility mutants and molecular characterization of the flagellin structural gene.]. Bacteriol., 179, 2116-2125. Eickhoff, T. C., Bennett, I. V., Hayes, P. S., Feeley, J. (1970). Pseudomonas laseudomallei: susceptibility to chemotherapeutic agents. ]. Infect. Dis., 121, 95-102. Ellison, D. W., Baker, H. 1., Mariappan, M. (1969). Melioidosis in Malaysia. I. A method for isolation of Pseudomonas pseudomallei from soil and surface water. Am. J. Trop. Med. Hyg., 18, 694-697. Kanai, K., Kondo, E. (1994). Recent advances in biomedical sciences of Burt(holderia pseudomallei (basonym: Pseudomonas pseudomallei). Jpn. J. Med. Sci. Biol., 47, 1-45. Koponen, M. A., Zlock, D., Palmer, D. L., Merlin, T. L. (1991). Melioidosis. Forgotten, but not gone! Arch. Intern. Med., 151, 605-608. Leelarasamee, A. (1986). Epidemiology of melioidosis. Infect. Dis. Antimicrob. Agents, 38, 84-93. Leelarasamee, A., Bovornkitti, S. (1989). Melioidosis: review and update. Rev. Infect. Dis., 11,413-425. Mays, E. E., Ricketts, E. A. (1975). Melioidosis: recrudescence associated with bronchogenic carcinoma twenty-six years following initial geographic exposure. Chest, 68, 261-263. Miller, W. R., Pannell, L., Cravitz, L., Tanner, W. A., Rosebury, T. (1948a). Studies on certain biological characteristics of Malleomyces mallei and Malleomyces pseudomallei. II. Virulence and infectivity for animals. ]. Bacteriol., 55, 127-135. Miller, W. R., Pannell, L., Ingalls, M. S. (1948b). Experimental chemotherapy in glanders and melioidosis. Am. J. Hyg., 47, 205-213. Okamoto, H. (1985). Molecular basis of experimental diabetes: degeneration, oncogenesis and regeneration of pancreatic [3cells of islets of Langerhans. BioEssays, 2, 15-21. Puthucheary, S. D., Parasakthi, N., Lee, M. K. (1992). Septicaemic melioidosis: a review of 50 cases from Malaysia. Trans. R. Soc. Trop. Med. Hyg., 86, 683-685. Rajchanuvong, A., Chaowagul, W., Suputtamongkol, Y., Smith, M. D., Dance, D. A. B., White, N. 1. (1995). A prospective comparison of co-amoxiclav and the combination of chloramphenicol, doxycycline, and co-trimoxazole for the oral maintenance treatment of melioidosis. Trans. R. Soc. Trol2. Med. Hyg., 89, 546-549. Reed, L. J., Muench, H. (1938). A simple method of estimating fifty per cent endpoints. Am. ]. Hyg., 27, 493-497.

203

Schnedl, W. J., Ferber, S., Johnson, J. H., Newgard, C. B. (1994). STZ transport and cytotoxicity. Specific enhancement in GLUT2-expressing cells. Diabetes, 43, 1326-1333. Smith, M. D., Wuthiekanun, V., Walsh, A. L., White, N. J. (1994). Susceptibility of Pseudomonas pseudomallei to some newer beta-lactam antibiotics and antibiotic combinations using time-kill studies.]. Antimicrob. Chemother., 33, 145-149. Smith, M. D., Wuthiekanun, V., Walsh, A. L., White, N. 1. (1995). Quantitative recovery of Burkholderia pseudomallei from soil in Thailand. Trans. R. Soc. Trop. Med. Hyg., 89, 488-490. Sookpranee, T., Sookpranee, M., Mellencamp, M. A., Preheim, L. C. (1991). Pseudomonaslaseudomallei, a common pathogen in Thailand that is resistant to the bactericidal effects of many antibiotics. Antimicrob. Agents Chemother., 35,484-489. Suputtamongkol, Y., Rajchanuwong, A., Chaowagul, W. et al. (1994). Ceftazidime vs. amoxicillin/clavulanate in the treatment of severe melioidosis. Clin. Infect. Dis., 19, 846-853. Tanphaichitra, D. (1989). Tropical disease in the immunocompromised host: melioidosis and pythiosis. Rev. Infect. Dis., 11 (Suppl. 7), S 1629-S 1643. Turner, M. O., Lee, V. T., FitzGerald, I. M. (1994). Melioidosis in a diabetic sailor. Chest, 106, 952-954. Walsh, A. L., Smith, M. D., Wuthiekanun, V., White, N. 1. (1995). Postantibiotic effects and Burkholderia (Pseudomonas) pseudomallei: evaluation of current treatment. Antimicrob. Agents Chemother., 39, 2356-2358. White, N. J., Dance, D. A. B., Chaowagul, W., Wattanagoon, Y., Wuthiekanun, V., Pitakwatchara, N. (1989). Halving of mortality of severe melioidosis by ceftazidime. Lancet, ii, 697-701. Woods, D. E., ]ones, A. L., Hill, P. I. (1993). Interaction of insulin with Pseudomonas Fseudomallei. Infect. Immun., 61, 4045-4050. Wuthiekanun, V., Smith, M. D., Dance, D. A., White, N. J. (1995). Isolation of Pseudomonas pseudomallei from soil in north-eastern Thailand. Trans. R. Soc. Trop. Med. Hyg., 89, 41-43. Wuthiekanun, V., Smith, M. D., Dance, D. A. B., Walsh, A. L., Pitt, T. L., White, N. J. (1996). Biochemical characteristics of clinical and environmental isolates of Burkholderia pseudomallei. J. Med. Microbiol., 45,408-412. Yabuuchi, E., Arakawa, M. (1993). Burkholderia pseudomallei and melioidosis: be aware in temperate area. Microbiol. Immunol., 37, 823-836.

This Page Intentionally Left Blank

Chapter 24

Low-lnoculum Model of Clean Wound Infection A. B. Kaiser and D. S. Kernodle

Background of human infection Wound infections associated with clean and clean-contaminated operative procedures present unique challenges to both clinicians and investigators. Unlike the operative categories of contaminated and infected, infection rates with clean and clean-contaminated procedures are low (< 5%), and placebo controlled studies have required the enrollment of large numbers of subjects in order to demonstrate advantages of prophylactic antimicrobials. Demonstrating differences among two or more active regimens has proved to be even more formidable; clinical trials involving 1000-2000 enrolees are often required to achieve meaningful results (Kaiser et al., 1987; Townsend et al., 1993). These categories of risk take on increasing importance in view of the fact that over 90% of all operative procedures are identified as either clean or clean contaminated (Culver et al., 1991). In the USA alone, 400000 infections occur annually despite the almost routine use of prophylactic antimicrobials (Haley et al., 1985). Additionally, for the most part, clean and clean-contaminated surgical procedures are nonemergent, and patients and surgeons usually proceed with the understanding that wound infections are a rare and unexpected complication. When infections do occur, emotional and medical legal issues may dominate the care of the patient. Elucidating the pathophysiology of these infections has also proved difficult. Infections that develop in clean and clean-contaminated procedures arise in near sterile operative environments where the level of contaminating bacteria is low. Based upon experimental data demonstrating that adjuvants are necessary to establish infection with low inocula of bacteria (Elek and Conen, 1958), it is likely that aspects of the operative procedure (devitalized tissues, hematomas, sutures, etc.) provide a mechanism enabling low numbers of contaminating organisms to initiate infection. Analysis of these operative variables has proved to be extremely challenging in the clinical arena. Efforts to understand the pathophysiology of such infection are further complicated by the fact that infecting pathogens (primarily Stapkylococcus aureus) usually demonstrate in vitro susceptibility to antimicrobials used clinically in prophylaxis (Kernodle et al., 1990). Handboo k of Animal Models of Infection

ISBN 0-12-775390-7

In short, clinical trials have proved far too unwieldy to provide a systematic exploration of optimal prophylactic regimens or underlying mechanisms of infection.

Background of the model In the absence of a foreign body or tissue devitalization, an inoculum of 106 or more colony-forming units (cfu) is needed to establish a subcutaneous S. aureus abscess in man (Elek and Conen, 1958). Early guinea-pig models of staphylococcal skin and soft tissue infection employed similarly high inocula. However instead of abscess formation, the area of intradermal induration at the injection site 24 hours following bacterial inoculation was used as the endpoint (Miles and Niven, 1950). With this model it was demonstrated that dehydration, shock, and the local administration of adrenaline produced larger inflammatory lesions. Antibiotics were also shown to reduce lesion induration, but only if they were given prior to or within the first 2 hours following bacterial inoculation (Miles et al., 1957; Burke, 1961). Inhalation of low (12%) and high (45%) concentrations of oxygen by guinea-pigs increased and reduced lesion size respectively (Knighton et al., 1984). Although the intradermal guinea pig model has yielded important observations, its requirement for large inocula and the questionable validity of using induration size as an endpoint have made its relevance to clean surgical wound infection in man unclear. Using the finding by Ford et al. (1989) that the number of bacteria needed to establish infection in mice is reduced by the use of dextran or gelatin microbeads as an adjuvant, we have modified the guineapig model to more closely simulate the conditions associated with clean and clean-contaminated surgery, e.g.: 9 low inocula of pathogenic bacteria reliably induce infection; 9 the endpoint is consistent with the clinical definition of infection (i.e., purulent material yielding viable bacteria develops within previously healthy tissue); 9 the pharmacokinetics of prophylactic agents may be adjusted to parallel the perioperative clinical environment; and Copyright 9 1999AcademicPress All rights of reproduction in any form reserved

206

9 infections may be prevented with prophylactic antibiotics if care is taken to emulate important clinical parameters (antibiotic serum levels, inoculum size, and antimicrobial susceptibility of the bacterial pathogens).

A.B. Kaiser and D. S. Kernodle

and harvesting of guinea pigs is 4 days following inoculation.

Storage and preparation of inocula Animal species

Overview

Albino Hartley guinea-pigs of either sex, weighing 500_+50 g, have been used in all experiments involving this model.

To date, only staphylococci have been evaluated in this model although it should be suitable for other bacterial species. Stapkylococcus aureus strains are maintained at -70~ in tryptic soy broth containing 10% glycerol. After subculture to an overnight growth on tryptic soy agar, fresh bacterial colonies are suspended in phosphate-buffered saline (PBS) to achieve a standard turbidity (A6oo reading of 0.4). Serial 10-fold dilutions and twofold dilutions are used to make a range of inocula that, when combined with the adjuvant, produce an abscess from 0% to 100% of the time (determined by preliminary in-vivo studies). Each dilution is mixed in a 1:1 volume:volume ratio with dextran microbeads (Cytodex | Sigma Chemicals, St Louis, MO) that have previously been allowed to swell in PBS and have been sterilized by autoclaving.

Preparation of animals Day prior to inoculation Specialized housing is not required. Guinea pigs frequently exhibit severe colitis, Gram-negative septicemia, and death occurring 2-3 days after a single dose of some antimicrobial agents (Farrar and Kent, 1965), Therefore, two poorly absorbable antibiotics, gentamicin (801ag/ml) and polymyxin B (50 lag/ml), are added to the drinking water of the guinea-pigs 24 hours before the procedure if the study involves antimicrobial prophylaxis. This reduces mortality to less than 10%. (Antibiotic-containing water may be prepared by adding 10 vials of 80 mg gentamicin and four vials of 500000 units polymyxin B to 10 liters of autoclaved water.)

Day of inoculation 1. Sedate with i.p. sodium pentobarbital, 25 mg/kg (usually about 0.15 ml for 500mg animal), initially; then administer one third to one half doses as needed to achieve and maintain sedation. 2. Clip dorsal hair with clippers using No. 10 blade. 3. Apply depilatory to residual, clipped hair. After 5 minutes, wipe off using paper towels and warm water. Dry guinea-pigs with towel. 4. Using felt-tipped permanent marker, number animals on ears and dorsum. Draw grid on back. In our experience, well-spaced lesions can be created by designating four columns that are parallel to the longitudinal axis of the animal and three rows that are perpendicular (see Figure 24.3 below). 5. Weigh and record on worksheet.

Following inoculation

Prior to the day of inoculation Prepare microbeads as follows: add 250ml of phosphate buffered saline, pH 6.0, to 500 ml flask. Gently tap contents of a 5 g vial of Cytodex | (Sigma C-0646) into the flask, while swirling gently. Allow to soak for 1-2 hours, with gentle swirling every 10-15 minutes. Autoclave. When cool, decant excess buffer until settled beads comprise approximately 50% of the total volume and transfer to sterile 50 ml Falcon tubes. Store in refrigerator until use. (Note: it is usually best to prepare two or three 5 g Cytodex | vials simultaneously.) Make sterile phosphate buffered saline, pH 6.0, and disperse into glass (or plastic) tubes; prepare about 50 9ml tubes and 80 4ml tubes. Also prepare an extra 500ml of PBS. PBS may be autoclaved if glass tubes are used. Subculture organisms (stored in cryotubes at-70~ to tryptic soy agar (TSA) at noon on the day prior to preforming inoculations. Incubate at 35-37~

Day of inoculation Pick colonies from TSA plate and suspend in 8 ml of 0.1M PBS, pH 6.0, to achieve A600--0.4 using any spectrophotometer. Do three 10-fold dilutions and four or more twofold dilutions as needed to achieve desired inoculum sizes (Table

24.1). Transport guinea-pigs back to cage (continue antibioticcontaining water, if appropriate). Observe daily, prior to the intended time of sacrifice. The usual time of sacrifice

Decant excess buffer from the top of the gravity-packed microbeads into the 50 ml Falcon tubes. Vortex gently and mix 1:1 with dilutions A-G (Table 24.1) or as needed to

LOW-INOCULUM MODEL OF CLEAN WOUND INFECTION

Table 24.1

To prepare the bacterial inocula

207

Table 24.2

Approximate backcounts of dilutions and

suspensions 1. Pick colonies from TSA plate and suspend in 8 ml of 0.1 M PBS, pH 6.0, to achieve a cell density of approximately A600 = 0.4. Label this dilution No. 1. 2. Do three 10-fold dilutions as follows: Transfer 1 ml of dilution No. 1 into 9 ml PBS, mix and label No. 2. Transfer 1 ml of dilution No. 2 into 9 ml PBS, mix and label No. 3. Transfer 1 ml of dilution No. 3 into 9 ml PBS, mix and label A. 3. Do four or more twofold dilutions as follows: Transfer 4 ml of dilution A into 4 ml PBS, mix and label B. Transfer 4 ml of dilution B into 4 ml PBS, mix and label C. Transfer 4 ml of dilution C into 4 ml PBS, mix and label D. Transfer 4 ml of dilution D into 4 ml PBS, mix and label E. Transfer 4 ml of dilution E into 4 ml PBS, mix and label F. Transfer 4 ml of dilution F into 4 ml PBS, mix and label G. - etc., as needed for the day's experiment

No. 1 No. 2 No. 3 A B C D E F G H I J K L

M

achieve desired inoculum sizes. The Falcon tubes are maintained on ice throughout the inoculation process. (Note: to determine the total volume of bacterial dilution:microbead mix to prepare, multiply the number of times the suspension will be inoculated during the day's experiments by 0.4. For example, if suspension/3 will be used 10 times, then a final volume of 4.0ml is needed. Therefore, mix 2.0 ml of dilution/3 with 2.0 ml of microbeads.) We have established a blinded method of inoculation by color-number coding each inoculation tube on the morning of inoculation and maintaining the color-number code at a site separate from the animal laboratory. The designation site for each inoculation is outlined on the daily worksheet. The code is not broken until after lesions have been harvested.

Calculation of b a c k c o u n t

To determine the number of bacteria inoculated with each preparation, backcounts are performed by using the flame loop method and spreading 50 pl of one of the twofold dilutions (prior to mixing with dextran microbeads) to each of three blood agar plates. (An ethanol-flamed glass rod is used for bacterial dispersal upon sheep blood agar.) Incubate at 35-37~ for 18-24 hours and count colonies. The dilution to use for backcount is based upon the previously determined correlation between the number of cfu for that bacterial strain and the A600 reading that would result in approximately 200 colonies (i.e., within a range that facilitates easy counting; Table 24.2). For most strains of S. aureus, 50 btl of dilution G yields 150-200 colonies. The precise backcount of the particular dilution is determined from the mean of triplicate plating. The number of bacteria in other inocula preparations is determined by doubling/ halving the directly determined backcount in a fashion that duplicates the derivation of the various preparations by twofold dilutions.

N O P

Dilution

Mix 1:1 with microbeads

Actually inoculated

2 x 108 2 x 107 2 x 10 6 2 x 105 1 x 105 5 x 104 25 000 12 500 6250 3125 1562 781 390 195 98 49 24 12 6

1 x 108 1 x 10 7 1 X 10 6 1 x 105 5 x 104 25 000 12 500 6250 3125 1562 781 390 195 98 49 25 12 6 3

2 x 107 CFU 2 x 106 CFU 2 x 105 CFU 20 000 CFU 10 000 CFU 5000 CFU 2500 CFU 1250 CFU 625 CFU 312 CFU 156 CFU 78 CFU 39 CFU 20 CFU 10 CFU 5 CFU 2.4 CFU 1.2 CFU 0.6 CFU

Infection process (inoculation procedure) Overview

The guinea pig possesses a well-developed panniculus carnosus (skin muscle) that overlies the superficial trunk musculature (Langworthy, 1925). The infection is initiated by injecting the bacterial-strain-microbead suspension into the potential space between the fascia surrounding these two muscle groups (Figure 24.1B). The interval between bacterial inoculation and placebo or anti-infective agent administration is determined by protocol. The use of timing clocks will facilitate the process when multiple animals are inoculated on a given day, particularly in circumstances when intervals between the administration of an anti-infective agent and the inoculation of organisms exceeds 10-15 minutes. M a t e r i a l s required

Materials used on the day of bacterial inoculation include: anesthetic, hair clippers, depilatory agent, disinfectant, tuberculin syringes with 23 G needles, markers, towels, and sterile gauze. A 23 G needle is the smallest size that permits the microbeads to pass easily. Procedure

Administer antibiotic or placebo into the subcutaneous fat pad on the dorsal neck and between the shoulder blades

208

and set alarm clock for desired time of inoculation. (Inoculation may precede anti-infective agent administration if so determined by the experimental design.) Internal jugular vein and intraperitoneal sites have been used to administer prophylactic agents as required by protocol. When alarm sounds, inoculate at each of the 12 sites according to the previously prepared key. Use vortex

A . B . Kaiser and D. S. Kernodle

genie to resuspend microbeads prior to drawing up each 0.2ml aliquot into a tuberculin syringe with a 23G needle. The intermuscular space can be easily entered by advancing the needle approximately 5mm beneath the skin (Figure 24.2). A successful inoculation results in a 0.5-1.5 cm nodule palpable or observable beneath the skin (Figure 24.3).

Figure 24.2 Intermuscular inoculation into one of 12 predetermined sites on dorsum of an anesthesized guinea pig. Bevel should be up on entering skin, turned over when dispensing the suspension. If the inoculation is too shallow, the injection will encounter resistance as the inoculant is forced into the dermis; if the inoculation is too deep, a nodule will not be present.

Figure 24.1 Photomicrographs of mature intermuscular lesions 72 hours after inoculation of a Staphylococcus aureus clinical isolate recovered from a deep wound infection. (A) Brown-Brenn preparation of high-inoculum lesion (100 x ID,o staphylococci, - 300 organisms). One wall of the developing abscess cavity is pictured. A single dextran microbead (MB)is seen as well as numerous clusters and individual coccal forms of staphylococci (S), dense infiltration of fascial tissues with polymorphonuclear leukocytes (P), and associated necrotizing myositis (NM). (B) Hematoxylin-eosin preparation of Iow-inoculum lesion (2x IDs0 staphylococci, - 6 organisms). The developing abscess cavity is located beneath skin and subcutaneous tissues (SST) and within the fascial plane that separates panniculus carnosus (skin muscle, SM) and the underlying trunk musculature (TM). Central cluster of dextran microbeads (MB)is clearly identified. Reproduced from Kaiser et al., 1992, with permission.

Figure 24.3 Conclusion of the successful inoculation of 12 sites on the dorsum of an anesthesized guinea-pig. The palpable nodules can be observed at several of the skin sites.

LOW-INOCULUM MODEL OF CLEAN WOUND INFECTION

Key parameters to monitor infection and response to treatment Overview

Three to 4 days following inoculation, the guinea-pigs are sacrificed and the presence or absence of viable bacteria on material recovered from each of the inoculation sites is determined. Logistic regression is used to plot the infection rate as a function of the number of bacteria inoculated and to determine the ID50 values and statistical significance of differences between bacterial-strain-prophylactic-regimen combinations.

209

clarity of identification. Depilate. Apply liberal amount of 95% ethanol to dorsum. Using a biopsy punch and sterile technique, remove a sample of material from each of the 12 inoculation sites (Figure 24.4) and streak across blood agar plates. Care is taken to insure that microbeads are clearly visible within the material transferred to the blood agar plate from each area of inoculation. Blood agar plates are incubated at 35~ for 24 hours and the presence or absence of bacterial growth is recorded (Figure 24.5).

Histopathology (Figure 2 4 . 1 A )

For investigations into pathogenetic mechanisms, histologic sections of lesions may be prepared to evaluate enabling or preventing variables of the infecting process. M a t e r i a l s for harvesting lesions

Alcohol burners and lighter, towel, 95% ethanol, gauze, depilatory, gloves, 6 mm biopsy punches, pentobarbital, forceps/scissors, 25g needle affixed to tuberculin syringes, beakers, markers, blood agar plates (three per guinea-pig), alcohol swabs. Procedure

Sacrifice with 75mg/kg i.p. pentobarbital (usually about 0.5 ml). Identify guinea-pigs by number; renumber ears for

Figure 24.5 Blood agar plates after overnight incubation at 35~ The plates had been inoculated with material resected from each of the 12 intermuscular inoculation sites from one guinea-pig. Four sites were inoculated per plate, resulting in a heavy growth of Staphylococcus aureus in two of the four sites on each plate. Collections of dextran microbeads can be observed on the remaining sites which were not overgrown by staphylococci.

Antimicrobial therapy Overview

A variety of antimicrobial and immune-modulating agents may be employed in this model. Because pharmacokinetics of these agents in the guinea pig may differ substantially from the clinical model, and because pharmacokinetics of various agents may differ from each other, care must be taken to understand these differences and adjust the administration of anti-infective agents if necessary. For example, the cefazolin half-life in the guinea-pig is considerably shorter than that of vancomycin. Accordingly, in a protocol comparing the prophylactic efficacy of these two agents, cefazolin was redosed at 2 hours to produce a halflife virtually identical with that of vancomycin (Kernodle and Kaiser, 1993b). Figure 24.4 Removal of indurated abscess material 72 hours after intermuscular inoculation using sterile technique. The animal has been sacrificed and recurrent hair growth removed by depiliation.

D e t e r m i n a t i o n of s e r u m antibiotic levels

During separate in-vivo investigations, 0.5ml of intracardiac blood may be obtained at various intervals (e.g., 15,

210

A . B . Kaiser and D. S. K e r n 9

30, 60, 120, 180 and 240 minutes) following the subcutaneous, intramuscular, intraperitoneal, or intravenous administration of the agent to be evaluated. Serum concentrations may be determined using appropriate techniques (e.g., agar diffusion bioassay). Statistical

analysis

Multiple logistic regression is used to assess the effect of different strains of staphylococcus and other microorganisms and different prophylactic regimens on the probability of infection (Figure 24.6). Adjustment is made for the amount of the inoculum in these regression models, using the log]0 of the backcount. The IDs0 (the estimated inoculum that has a 50% probability of producing an infection) is calculated as exp(-intercept/slope of log10 backcount) from the logistic regression using data for each combination of strain and prophylactic regimen. All analyses used either PC-SAS, release 6.04 (SAS Institute, Cary, NC) or IMP | statistical discovery software (SAS Institute, Cary, NC).

% infected 100

80

9

PLACEBO ..... 9. . . CEFAZOLIN -- -r . - OFLOXACIN i

.

=

"

i CIPROFLOXACIN --~-i 60

.................... ~ ........ ~.../x..... =-..--. . . . . . . . . . . . .

..'"........

.

" .-' 9 ...'' :'

o"

:

/

:.

~

11

.:.:

O:

-':.

20

~

~

1

"y ;,/

. . .

./

,"

10 1

/

t0 2

/

/

!I ..... i ! I + i 4.

~f

t, /"t"" i

//i l"

i

/./"

/ . 9!.i

~

~

/

/! !

/~.~

..i

' /

/,' [/].// /

/

,',' ^,,,/

:_ ... .' ".

~

~ ,,,'

"

~ . ~ /

J'~

,'2L,.

i , - ,,.

.,. ,,,,~,. ~,~I~

.. .-j

Characteristics of selected mouse models of

Campylobacterjejuni

Mice

Campylobacter jejuni

Pathogenesis and immunity

There are about 20 reports on responses to C. jejuni or products derived from C. jejuni in newborn and suckling mice (references 1-18). Most have employed animals from 1-9 days old and infections have been initiated either per os or by directly injecting bacteria into the stomach (milk-filled stomachs are easily visualized in neonatal mice). BALB/c mice were the most frequently used (six studies) followed by ddY (three studies) and NMRI (two studies). Some studies do not report the strain of mouse used. In some studies the mice were subjected to manipulations besides exposure to C. jejuni in attempts to enhance the virulence of the C. jejuni infection or to test the effect of the manipulation. These included initiation of second infections, fasting, injection of endotoxin, ferric chloride or iron dextran, bismuth subsalicylate, milky water and ferric ammonium citrate. Additional studies involving dam-newborn pairs will be reviewed separately below.

The C. jejuni used for these experiments varied widely. About 122 recent clinical isolates were tested (in four reports ranging from 15 to 50 isolates per report); at least 24 laboratory adapted strains were evaluated (81116 was the most frequent and the subject of three reports, with 158432 and 12650 tied for second rank with two reports each); a limited number of mutated campylobacters were tested, usually aflagellated or non-motile; in one instance a strain with a defect in chemiotaxis was tested. The remaining reports used unique isolates. The dose of C. jejuni administered ranged from undefined through 10-101~ cfu and included challenges with 'non-culturable' organisms. The procedures used to prepare campylobacters for challenges also varied widely and included passage in various animals, culture in different solid and liquid media at differing temperatures, and in differing environments. Most studies do not report the growth phase of the organisms used for challenge. Limited studies used cell-free culture supemates as challenges in attempts to detect 'toxins'. There was no pattern to the selection and preparation of C. jejuni. Nine clinical and at least five laboratory-adapted strains were evaluated. One aflagellated mutant was tested as an immunogen. Reported challenge doses range from 10L10 l~ cfu. Some studies did not report challenge dose. There is no apparent standardization to methods for preparation or characterization of challenge bacteria.

The most frequently reported outcome was establishment of intestinal colonization following exposure to live C. jejuni. In general, colonization showed somewhat of a direct relationship to challenge dose; the duration of colonization differed for different isolates; colonization or duration of colonization was usually less for mutant organisms than for wild-type strains and non-culturable campylobacters did not colonize. Combined infection with C. parvum prolonged C. jejuni colonization. Treatments with endotoxin or bismuth reduced Campylobacter infection whereas treatments with iron enhanced. Rarely was diarrhea seen. Information on parenteral C. jejuni infection is lacking.

Seven studies were reviewed that used mice of between 3 and 7 weeks old at the time of the start of the experiments (references 3, 19-23). Most were initiated by oral introduction of bacteria and two used intraperitoneal injection. Different strains of mouse were used. In some studies the mice were manipulated; manipulations included immunizations with formalin-killed C. jejuni, treatment with iron dextran, cobra venom factor, silica, colloidal carbon and withholding of food.

Limited information is available on immunity in neonatal mice that were not co-housed with immune mothers (see below for summary of data on dam-newborn pairs). One report shows that IgM but not IgG antibodies with specificity for C. jejuni flagella reduced colonization.

W Q} .Q

In all instances where tests were made for intestinal colonization, colonization was found. Diarrhea was found for iron-treated mice and infrequently in CD-1 mice. Some challenges caused the death of exposed mice and in some conditions lethality was enhanced by iron treatment. Occasionally, parenteral C. jejuni infection was shown as was persistence of C. jejuni in gall bladders for up to 60 days. Under certain conditions C. jejuni infection was associated with elevated liver enzymes.

Ill

Following challenge or vaccination, C. jejuni specific antibodies and antibody-secreting cells at the local sites were shown. Compromise of the alternate complement pathway or macrophage function increased rates of death.

r

"1

3 D.

II

"o 3"

There are nearly 40 readily accessible reports of C.

jejuni challenge of adult mice. The majority employed oral challenge (including syringe delivery of C. jejuni to the stomach). Fewer studies were made using other routes of infection, axenic, selectively microbially colonized, or genetically athymic mice. Additional studies involve dam-newborn pairs. These will be reviewed below. Thirteen studies where C. jejuni infection was initiated by the oral route were reviewed. The reported experiments were started using mice of 8-26 weeks old or reported as 'adult' (references 23-35). BALB/c animals were used most frequently but more than 15 strains, some of undefined origin, were used. Sometimes the source and strain of mouse was not provided. For some studies the mice were manipulated; manipulations included immunizations with C. jejuni-derived material, iron dextran, ferric chloride, delivery of selected cytokines per os, anesthesia, bicarbonate, various antibiotics, and withholding of food.

For studies that used oral administration of C. jejuni, more than 20 laboratory-adapted strains of the organism were used besides numerous recent human and animal isolates. There is no readily identified pattern to the selection or preparation of C. jejunL Reported doses range from 101-1011 cfu; for some studies challenge doses were not reported. Many culture conditions including media, additives, temperature and duration were used to prepare C. jejuni inocula.

Studies made using intraperitoneal, intravenous, nasal, or intestinal introduction of C. jejuni employed a variety of strains and isolates and used challenge doses from 106-101~cfu. The methods to prepare Other studies (references 34, 36-43; see also Tables 26.3 and 26.4) have used intraperitoneal, intravenous, nasal or intestinal introduction of the C. jejuni used for challenges are, for the most part, not C. jejuni four, three, two, and one studies respectively). BALB/c comparable. was the most frequently used mouse strain. However, more than 10 strains were used among the experiments. For Studies made of axenic, some studies the mice were manipulated; monoxenic and holoxenic mice manipulations included immunizations with C. jejuni-derived have used at least 10 C. jejuni material, iron dextran, ferric chloride, strains. No single C. jejuni was anesthesia, pregnancy, and laparotomy. common across all studies. Studies have been made of C. jejuni infection of All studies of genetically axenic, monoxenic and holoxenic mice of C3H and athymic mice have used C. jejuni BALB/c strains (references 44-46). All studies used oral challenge. 45100 (a highly mouse-adapted Bicarbonate, antibiotic, withholding of food, and strain) and in addition various infection with Clostridium perenne were, at times, other campylobacters. Most challenges were applied. with 108 cfu. For some reports, procedures Limited studies used genetically athymic BALB/c used to prepare C. jejuni inocula are mice, some of which were axenic (references 47-50). Manipulations unclear. included immunization with formalin or heat-killed C. jejuni. C. jejuni 81116 was used in all Several studies (references 1, 2, 5, 10) experiments and other strains were investigated C. jejuni infection in dam-newborn pairs where either also employed in some. An natural or foster mother designs were used. Manipulations included aflagellated mutant was used. immunization with formalin-killed C. jejuni and Challenges were with 107 cfu and flagella from C. jejuni. Most experiments used were prepared on blood agar BALB/c mice. incubated at 37~

In all instances where tests were made for intestinal colonization, such colonization was found for at least some challenged mice. The fraction that became colonized and the duration of colonization, which can be more than 6 months, seem to be functions of both mouse and Campylobacter strain. Pretreatment of mice with antibiotics results in more prolonged colonization. Reports of death or diarrhea occurring after oral C. jejuni challenge of non-manipulated adult mice are rare. Pretreatment with iron caused some mice to produce soft stools following C. jejuni challenge. Occasionally, dissemination of C. jejuni to liver, spleen, kidney, mesenteric lymph nodes, and blood are reported. Hepatitis and increases in liver enzymes are reported to follow C. jejuni challenge, as is nephritis and IgA immune complex deposition in kidneys. Again, the mouse and Campylobacter strain used in the experiment may be critical to the outcome obtained.

O C (n Ili 0 0 m I(n 0 -ii

C.-jejuni-specific antibody responses including antibodies in serum, urine, and intestinal lavage fluid were reported and C. jejuni-specific IgA, slgA, IgM, and IgG were found, usually when they were searched for. Immunizations with heat-killed C. jejuni were shown to induce an antibody response to C. jejuni and an acquired resistance that reduced duration of intestinal colonization. Oral administrations of IL-5 or IL-6 both change the duration of intestinal colonization and C. jejuni-specific immune responses. Intraperitoneal, intravenous, nasal, or intestinal introduction of C. jejuni all can result in colonization of intestines with C. jejuni. Intraperitoneal, intravenous, and nasal C. jejuni challenges cause parenteral infection. Death of mice may result from intraperitoneal challenge. Diarrhea, including mucoid diarrhea, may follow intraperitoneal challenge. Comparative studies of axenic, monoxenic, and holoxenic mice show that intestinal colonization occurs for all and that a mild diarrhea may occur primarily in those animals harboring fewer non-C, jejuni bacteria. Additionally, the vigor of the C. jejuni infection (dissemination of bacteria, persistence of intestinal infection) was greater in animals with fewer concomitant bacterial colonizations. For all instances where it was evaluated, intestinal colonization with C. jejuni was demonstrated for athymic and euthymic mice. In most instances parenteral C. jejuni infection was shown. Diarrhea was commonly manifested in nu/nu mice.

O

t,,,

m

Z

"11

Ili O -I m

O Z

Intestinal colonization of newborns was found in all instances where the dams-newborns were C. jejuni-naive at C. jejuni challenge. Sometimes where the dam was Campylobacter experienced, newborns were protected from C. jejuni and protection was manifested as reduced intestinal colonization and was best against the homologous Campylobacter strain. Both C. jejuni infections of dams and some immunizations of dams with C. jejuni-derived products induced resistance that protected newborns. Some protection was manifested by suckling offspring of C. jejuni-naive mothers which were fostered fed on C.-jejuni-immune dams.

1. Abimiku and Dolby, 1987; 2. Abimiku and Dolby, 1988; 3. Coker and Obi, 1989; 4. Diker et aL, 1992; 5. Dolby and Newell, 1986; 6. Field et aL, 1981 ; 7. Hanninen, 1989; 8. Hanninen, 1990; 9. Morooka et aL, 1985; 10. Newell, 1986; 11. Newell and McBride, 1985; 12. Pang et aL, 1987; 13. Siddique and Akhtar, 1991; 14. Stewart-Tull et aL, 1984; 15. Takata et aL, 1992; 16. Ueki et aL, 1987; 17. Van De Giessen et aL, 1996; 18. Vitovec et aL, 1991; 19. Bar, 1988; 20. Coker and Obi, 1991 ; 21. Jian-Xin et aL, 1987; 22. Kita et aL, 1986; 23. Madge, 1980; 24. Baqar et aL, 1993; 25. Baqar et aL, 1995; 26. Berndtson et aL, 1994; 27. Blaser et aL, 1983; 28. Dick et aL, 1989; 29. Field et aL, 1984; 30. Gao et aL, 1988; 31. Gao et aL, 1991; 32. Kita et aL, 1990; 33. Kita et aL, 1992; 34. Stanfield et aL, 1987; 35. Wu et aL, 1991; 36. Baqar et aL, 1996; 37. Chaiyaroj et aL, 1995; 38. Field et aL, 1991; 39. McCardell et aL, 1986; 40. Merrell et aL, 1981; 41. O'Sullivan et aL, 1987; 42. O'Sullivan et aL, 1988; 43. Pancorbo et aL, 1994; 44. Fauchere et aL, 1985; 45. Lee et aL, 1986; 46. Youssef et aL, 1987; 47. Yrios and Balish, 1985; 48. Yrios and Balish, 1986a; 49. Yrios and Balish, 1986b; 50. Yrios and Balish, 1986c.

I~O bO ".4

228

of C. jejuni within a host may result in bacteria that are more virulent for that host (Field et al., 1981; Yrios and Balish, 1986a,b). An avian model of campylobacteriosis (Table 26.1) has been employed for studies of pathogenesis and immunity (Sanyal et al., 1984; Welkos, 1984), and the immunoreactive complication, Guillain-Barr8 syndrome (Li et al., 1996).

Mouse models of C. jejuni infection

S. Baqar, E. Burg and J. R. Murphy

allow a mechanistic understanding of the interactions of C.

jejuni with these immunoregulatory components. Mice are generally considered unsuitable for studies that which is focus on C. jejuni-caused watery diarrhea known to occur only in newborn mice, invasive diarrhea which occurs primarily in manipulated mice (reviewed in Table 26.1), and immunoreactive complications (existing studies are insufficient and most inappropriate in design to detect if these occur). These views are, for the most part, based on gross observations of C.-jejuni-exposed mice. The studies that have led to these negative views were not exhaustive and thus it is unclear whether further investigations might reveal macro- or microscopic equivalents of these pathologic processes. It is established that: C. jejuni may replicate in mice; infection may either kill the animals or be controlled (Baqar et al., 1996); immunizations with first C.jejuni infections or crude C.jejuni-derived products may protect against subsequent C. jejuni challenge (Baqar et al., 1995a); protection is best against homologous strains (Abimiku and Dolby, 1988; see Table 26.4); infection can be successfully treated with antibiotics (Hofand Sticht-Groh, 1984; Leeat al, 1986); and, different isolates of C. jejuni differ in innate virulence for the same inbred mouse strain (Baqar et al., 1996). Thus, direct evidence shows that the C. jejuni-mouse parasitism is a robust platform for studies of mechanisms of colonization, distribution and clearance of C. jejuni, pathology, host defenses against C. jejuni, including non-specific and immunologic mediator and effector systems, antibiotic treatment, and bacterial factors. The availability of genetically defined yet diverse mouse strains, microbiologically defined (germ-free, gnotobiotic, specific-pathogen-flee) mice and reagents and procedures should allow mechanistic studies to achieve high levels of resolution.

Table 26.2 presents selected results obtained using mouse models. In this table results are grouped for the purpose of the following discussion by age of mice and within some age groups by route of infection. The rationale for this grouping is that both factors may markedly influence the behavior of the model and the results obtained. Outstanding are the demonstrations that C. jejuni has a capacity to colonize and that a first colonization engenders a resistance to a second. This immunity is also manifested in dam-neonate pairs where some acquired resistance seems to trace to antibodies. Also notable is the finding that procedures that disrupt the mouse's defense system's homeostasis may enhance or retard the consequences of C. jejuni challenge, including the numbers of bacteria present and the duration of the infection. The table shows for some outcome measures that there is little influence of mouse strain or Campylobacter isolate. This observation may at first seem in conflict with the view expressed elsewhere in this review; that there are very significant differences that link to both mouse and Campylobacter strain. Both views are correct. Using low resolution outcome variables, such as a qualitative scoring of colonization, results are somewhat independent of mouse or Campylobacter strain. However, whenever attempts have been made to glean higher resolution, a critical dependence is found on both the mouse strain and Campylobacter strain. S e l e c t i o n and c a r e of m i c e Limited studies of histopathology have been made using the C.-jejuni-mouse model. These have shown that C. Strain jejuni can be visualized in association with various sites along the intestine (time-, mouse-, and Caml)ylobacter- Direct evidence establishes that lethality and aspects of C. strain-dependent) and inflammatory pathology may be seen jejuni infection differ following inoculation by the same in tissue sections of intestine (Gao et al., 1988, 1991). At route of identical doses of the same cloned C.jejuni into diftimes this pathology can be sufficiently severe to rate com- ferent inbred strains of mice (Baqar et al., 1996). Because parison with inflammatory bowel disease (Gao et al., 1991). these fundamental aspects of C. jejuni parasitism are clearly Additionally, under some circumstances, long-term C. mouse-strain-dependent, it is reasonable to assume that jejuni infection of mice may result in severe liver damage many outcomes of this parasitism may be functions of the (Kita et al., 1986, 1990, 1992). mouse strain used. Selection of a mouse strain for an experiOral (Baqar, 1991) and nasal (Baqar, unpublished data) ment should be based on citable information that the strain challenges of mice both trigger cytokine responses that is suitable for the intended purpose or experiments should include IL-1 and IL-6. However, significant levels of T N F be made to establish the suitability of the selected mouse 0t are seen only after nasal challenge (Baqar, unpublished strain. Information developed in recent years make it no data). A most interesting finding is that oral delivery of IL- longer acceptable to randomly select a mouse strain, espe5 or IL-6 before C. jejuni challenges alter both course of cially a random-bred strain, expose this to C. jejuni and infection and immune response to the Campylobacter from this draw wide-ranging conclusions on C. jejuni para(Baqar et al., 1993). More investigations are required to sitism.

MOUSE MODELS OF CAMPYLOBACTER JEJUNI INFECTION

Age Direct evidence obtained using BALB/c (Abimiku and Dolby, 1987), ddY (Morooka et al., 1985; Takata et al., 1992), and NMRI (Hanninen, 1989, 1990; Berndtson et al., 1994) strains of mice shows an age dependence of the parasitism; newborn mice respond to challenge differently from adults. There is evidence from studies in humans that shows increased frequency of C.jejuni in immunosuppressed individuals (Leyes et aL, 1994). Also, there is an increase in frequency of infection in older individuals (Bokkenheuser, 1970), which may be a reflection of decreased immune capacity of the elderly (Scordamaglia et al., 1991; Haeney, 1994; Caruso et al., 1996). Therefore, it should be assumed, until proven otherwise, that the age of mice will influence results. Because of the rapid maturation of immune response capacity near birth and its decline at older ages, young adult mice are the preferred subjects of most experiments. This is based on the view that their physiologic status, including immune response status, is thought to be stable and to remain so for the interval of weeks or a few months that is the time line of most experiments. The validity of these assumptions for the C.jejuni-mouse parasitism has not been formally established by experiments but they seem reasonable based on composite results of available studies.

Presence of other microbes Evidence has been presented showing that infection of mice with Cryptosporidium parvum (Vitovec et aL, 1991)or colonization with normal intestinal microbial flora (Field et aL, 1984; Yrios and Balish, 1986a,b,c) changes the consequences of concurrent or subsequent C. jejuni infection. It has also been shown that treatment of mice with selected antibiotics (Baqar et aL, 1993) before C. jejuni challenge, presumably by reducing gut colonization with non-Campylobacter microbes, exacerbates the consequences of subsequent C. jejuni infection. Changes in courses of infections and host responses to infections are well described for other facultative or obligate intracellular bacterial agents (Mackaness, 1969; Murphy 1981a,b; Crist et aL, 1984); the presence or absence and the timing of second infections with unrelated bacterial, viral or protozoal agents (Gupta and Pavri, 1987) markedly affect outcomes. These observations strongly suggest that steps should be taken to insure that the mouse's microbial environment is stable and free of unwanted know murine pathogens.

S e l e c t i o n and care of C. jejuni Strain Direct evidence shows that C. jejuni isolates differ in their virulence for mice (Baqar et al., 1996) and that the organ-

229

ism may change in virulence with in-vitro passage (Caldwell et al., 1985; Konkel et al., 1990; Ketley, 1997). Inferential evidence (Field et al., 1981) suggests that in-vivo passage may also cause changes in the bacterium (Cawthraw et al., 1996). Thus, primary considerations in selection of C. jejuni strains are knowledge of whether the strain possesses the phenotypic characteristics needed for the proposed study and assurance that the strain will be available for future confirmatory experiments. Making experiments with severalisolates may be necessary (preferably including reference strains) to find one with a desired characteristic. Because of the potential for plasticity with passage of the bacterium, steps must be taken to limit this confounder. We have chosen the approach of cloning all isolates and preparing primary and secondary seed stocks from these clones (Baqar et al., 1996). In all instances the cloned bacteria are stored frozen at ~

0

0

1

~

,

~

,

4:

,

Drug concentration (pg/ml)

o

6"" I|

~5

5-

{D3

6-

~

~ 4,

.~

MBSC

.

tll

=o_ o 3, >a E .c_ 2 ._~ _0

. . . . . .

4-

Figure 35.4 Application of the BC99 assay to the activity of isoniazid against the growth of M. tuberculosis Erdman.

3-

10

I 2

I 4 Days

I 6

0 0

BC99 . . . . . . , . 1 2 3 ' 3, 5 Drug concentration (pg/ml)

Figure 35.3 The basis of the macrophage drug screening model. By titrating drug dose versus bacterial growth one can make an estimate of the minimal serum concentration that is bacteriostatic (MBSC) and the concentration needed to establish a therapeutic effect; we arbitrarily define this as the BC99, or bactericidal concentration of the drug that destroys 2 logs [99%] of M. tuberculosis over the 8-day culture period.

In-vivo s c r e e n i n g As described above, the mouse is the small animal most commonly used in the evaluation of new antimycobacterial therapies. Its advantages include cost-effectiveness and reproducibility, but there are obvious drawbacks as well, including the need for stringent level III aoiosafety containment facilities and personnel trained in handling virulent mycobacteria, as well as issues relating to the different pharmacokinetics of drugs between rodents and humans. Dosages apart, however, one can state with some certainty that drugs that work well in mice tend also to do so in Humans.

In high-dose intravenous models most of the inoculum is taken up by phagocytes in the spleen and liver; only 1-2% can be detected in the lungs (if the lung uptake is much higher, this indicates that the inoculum was not dispersed correctly and is heavily clumped). This then grows progressively for 10-15 days in the spleen, and to a lesser extent in the liver, until acquired immunity comes into play, resulting in a "chronic" disease pattern. Thus, the drug under test can be given soon after inoculation (can it stop the progressive growth?) or after the disease has become chronic (can it decrease bacterial load at this stage?). The second model is of course more realistic; the patient is probably at this stage before diagnosis is first made. Another approach is to give "standard chemotherapy," such as isoniazid, pyrazinamide, and rifampin, for a while to bring the load down, then replace this with the new drug under test (Truffot-Pernot et al., 1991). A further model is to continue therapy until bacteria can no longer be detected, then give the new drug for a while, and then stimulate "persisting" bacilli to regrow by injecting the mouse with cortisol. This is called the Cornell model after its place of origin (McCune et al., 1966). A current vogue is to test antianaerobic drugs such as metronidazole in this model, given the possibility that surviving bacilli switch into an anaerobic mode for a while (my own experiments in this regard have been negative to date). All of these approaches take advantage of the fact that mice tolerate long-term gavage well, if handled gently and correctly. Our model of choice is to expose mice to a very low inoculum of bacilli using an aerosol generation chamber. After uptake of about 50 bacilli in the lungs the infection grows progressively at first and is then curtailed around 20 days. Laboratory strains such as Erdman attain 4-5 logs in the lungs by this time; more virulent strains such as CSU93

318

(Tennessee outbreak) and strain W (New York) can grow to between 6 and 7 logs in this time. The standard regimen we use is to start the drug under test on day 20 (when the mouse first becomes DTH-positire) and to treat mice for 30 days, harvesting animals and determining bacterial loads at 35 and 50 days. Isoniazid (25 mg/kg/day) is given as the positive control in each assay.

Drug targets: new and old Despite being the drug of choice for several decades, it is only recently that the mechanism of action of isoniazid has been determined. Early work pointed to the mycolic acid layer of the cell wall, but only recently was this narrowed down to enzymes that elongate the two fatty acid chains of the molecule. A gene encoding a major enzyme involved in this process has been designated inhA, the molecule has been synthesized, and its crystal structure has been elucidated (Banerjee et aL, 1994; Dessen et aL, 1995). Given that exposure to isoniazid is fatal to the bacillus, truncation of the mycolic acid layer probably allows the influx of protons, nitric oxide, oxygen radicals, peroxynitrite, and other noxious materials through the cell wall to damage and disrupt essential enzymatic processes. Other drugs also target the cell wall, such as ethambutol, which disrupts the arabinogalactan layer, which in turn prevents mycolic acid attachment to the terminal arabinan motif (McNeil and Brennan, 1991). A potential new target may be a rhamnose-containing linker molecule that joins the peptidoglycan layer to the outer arabinogalactan layer; if this could be blocked then bacterial construction of the wall should cease almost at the source (McNeil et aL, 1990). More conventional targets are the D N A gyrases (fluoroquinolones) and protein synthesis (rifamycins, macrolides). Unfortunately to date new drug development has been slow, a troubling thought in light of increasing drug resistance in tuberculosis isolates both here and throughout the world (Bloom and Murray, 1992).

Acknowledgments This work was supported by N I H grant AI-45239 from the DMID, NIAID. I thank the many people who have contributed to the ideas expressed above, including Pam Hair, Syndy Furney, Brian Kelly, Jason Brooks, and Alan Roberts.

References Banerjee, A., Dubnau, E., Quernard, A. et al. (1994). InhA, a gene encoding a target for isoniazid and ethionamide in Mycobacterium tuberculosis. Science, 263, 227-230.

I . M . Orme

Bloom, B. R., Murray, C. J. L. (1992). Tuberculosis: commentary on a reemergent killer. Science, 257, 1055-1064. Cooper, A. M., Dalton, D. K., Stewart, T. A., Griffin, J. P., Russell, D. G., Orme, I. M. (1993). Disseminated tuberculosis in gamma interferon gene-disrupted mice. ]. Exp. Med., 178, 2243-2247. Dessen, A., Quemard, A., Blanchard, J. S., Jacobs, W. R. Jr, Sacchettini, J. C. (1995). Crystal structure and function of the isoniazid target of Mycobacterium tuberculosis. Science, 267, 1638-1641. Flynn, J. L., Goldstein, M. M., Triebold, K. J., Koller, B., Bloom, B. R. (1992). Major histocompatibility complex class Irestricted T cells are required for resistance to Mycobacterium tuberculosis infection. Proc. Natl Acad. Sci. USA, 89, 12013-12017. Kelly, B. P., Furney, S. K., Jessen, M. T., Orme, I. M. (1996). Lowdose aerosol infection model for testing drugs for efficacy against Mycobacterium tuberculosis. Antimicrob. Agents Chemother., 40, 2809-2812. McCune, R. M., Feldmann, F. M., Lambert, H. P., McDermott, W. (1966). Microbial persistence. I. The capacity of tubercle bacilli to survive sterilization in mouse tissues.]. Exp. Med. 123, 445-468. McMurray, D. N. (1994). Guinea pig model of tuberculosis. In Tuberculosis; Patkogenesis, Protection, and Control (ed. Bloom, B. R.), pp. 135-147. ASM Press, Washington, DC. McNeil, M., Brennan, P. J. (1991). Structure, function, and biogenesis of the Cell envelope of mycobacteria in relation to bacterial physiology, pathogenesis, and drug resistance; some thoughts and possibilities arising from recent structural information. Res. MicrobioL, 142, 451-463. McNeil, M., Daffe, M., Brennan, P. J. (1990). Evidence for the nature of the link between the arabinogalactan and peptidoglycan components of Mycobacterium cell wall. J. Biol. Chem., 265, 18200-18206. Orme, I. M. (1994). Protective and memory immunity in mice infected with Mycobacterium tuberculosis. Immunobiology, 191, 503-508. Orme, I. M. (1995a). Immunity to Mycobacteria. R. G. Landes, Austin, TX. Orme, I. M. (1995b). Mechanisms underlying the increased susceptibility of aged mice to tuberculosis. Nutr. Rev., 53, $35-$40. Orme, I. M. (1997). The host response to Mycobacterium tuberculosis. In Host Response to Intracellular Pathogens (ed. Kaufmann, S. H. E.), pp. 115-130. R. G. Landes, Austin, TX. Orme, I. M., Furney, S. K., Roberts, A. D. (1992). Dissemination of enteric Mycobacterium avium infections in mice rendered immunodeficient by thymectomy and CD4 depletion or by prior infection with murine retroviruses. Infect. Immun., 60, 4747-4753. Orme, I. M., Andersen, P., Boom, W. H. (1993). The T cell response to Mycobacteriurn tuberculosis. ]. Infect. Dis., 167, 1481-1497. Rhoades, E. R., Cooper, A. M., Orme, I. M. (1995). Chemokine response in mice infected with Mycobacterium tuberculosis. Infect. Immun., 63, 3871-3877. Rhoades, E. R., Frank, A. A., Orme, I. M. (1997). Distinct phases of granuloma formation in mice aerogenically infected with Mycobacterium tuberculosis. Tubercle Lung Dis., 78, 57-66. Sarkis, G. J., lacobs, W. R. Jr, Hatfull, G. F. (1995). L5 luciferase reporter mycobacteriophages: a sensitive tool for the detection and assay of live mycobacteria. Mol. MicrobioL, 15, 1055-1067.

MURINE MODELS OF TUBERCULOSIS

319 .,.

Skinner, P. S., Furney, S. K., lacobs, M. K., Klopman, G., Ellner, 1. 1., Orme, I. M. (1994). A bone marrow derived murine macrophage model for evaluating efficacy of anti-mycobacterial drugs under relevant physiological conditions. Antirnicrob. Agents Chemother., 38, 2557-2563. Sturgill-Koszycki, S., Schlesinger, P., Chakraborty, P. et al. (1994). Lack of acidification in Mycobacterium phagosomes produced by exclusion of the vesicular proton-ATPase. Science, 263, 678-681.

Truffot-Pernot, C., li, B., Grosset, J. (1991). Activities of pefloxacin and ofloxacin against mycobacteria: in vitro and mouse experiments. Tubercle, 72, 57-64. Yajko, D. M., Madej, J. l., Lancaster, M. V. et aL (1995). Colorimetric method for determining MICs of antimicrobial agents for Mycobacteriurn tuberculosis. J. Clin. MicrobioL, 33, 2324-2327.

This Page Intentionally Left Blank

Chapter 36

Beige Mouse Model of Disseminated Mycobacterium avium Complex Infection M. H. Cynamon and M. S. DeStefano

Background of human infection In the pre-AIDS era Mycobacterium avium complex (MAC) predominantly caused pulmonary mycobacteriosis, which was difficult to distinguish radiologically from tuberculosis and was rarely associated with extrapulmonary sites or disseminated disease (Wolinsky, 1979). During the AIDS era, disseminated MAC became a frequent diagnosis in latestage HIV-infected patients, usually occurring in those patients with CD4 +T-cell counts below 50/mm 3. The portal of entry is likely to be the gastrointestinal tract, with foodstuffs and water being the source of the organisms. The syndrome is characterized by fever, chills, sweats, malaise, weight loss, abdominal pain, and diarrhea. Patients may develop anemia, secondary to bone marrow involvement, and sometimes have a striking elevation of serum alkaline phosphatase (Burman and Cohn, 1995). Diagnosis is usually made by culture of blood; however, MAC is sometimes grown from another site (e.g. bone marrow, liver, or lymph nodes). Culture of MAC from sputum or bronchoalveolar lavage fluid in HIV-infected patients usually indicates colonization rather than local or disseminated disease. A stool specimen which is acid-fast bacillus smear-positive usually suggests disseminated MAC disease; however, we have occasionally seen patients with this presentation having disseminated tuberculosis. In HIV-infected patients with advanced disseminated MAC infection the bone marrow, lymph nodes, spleen, liver, and gastrointestinal tract are frequently infiltrated with masses of mycobacteria (Hawkins et al., 1986). The central nervous system is rarely involved. It is now clear that disseminated MAC infection causes increased mortality as well as significant morbidity in HIV-infected patients (Chaisson et al., 1994; Shafran et al., 1996). MAC is relatively resistant to most antituberculosis agents (Heifets, 1991). Pulmonary disease in the pre-AIDs era was usually treated with four to five drugs, including rifampin, ethambutol, and an aminoglycoside (streptomycin or amikacin; Iseman, 1995). HIV-infected patients with disseminated MAC disease have also been treated with multidrug regimens including rifampin, amikacin, clofazamine, and ethambutol (Parenti et al., 1995; Shafran et al., 1996). Azithromycin and clarithromycin represent significant improvements for the therapy of disseminated MAC Handboo k of Animal Models of Infection

ISBN 0-12-775390-7

infection in HIV-infected patients. These agents as well as rifabutin have been demonstrated to decrease the occurrence of disseminated MAC in HIV-infected patients with CD4 +Tcell counts below 100/mm 3(Nightingale et aL, 1993; Havlir et aL, 1996; PierceetaL, 1996). Azithromycin and clarithromycin are the key agents in regimens for the treatment of MAC disease and probably for other nontuberculous mycobacterial infections (Dautzenberg et aL, 1991; Young et aL, 1991).

Background of model During the past 30 years, various animal models of MAC infection have been explored. Pigs, sheep, fowl, rabbits and goats have been used in studies by Kleeberg and Nel (1973). The pathogenicity of MAC has been explored in hens (Shaefer et al., 1970), mice and guinea-pigs (Engbaek, 1961). Several groups have worked with rabbits (Engbaek, 1961; Armstrong et all., 1967; Meissner, 1981). Brown et al. (1993) developed a model using rats immunosuppressed with cyclosporin A. Much has been accomplished using the mouse as a model for MAC infection. Pioneer work with the mouse model was done by Collins et all. (1978) and Dunbar et al. (1968). The beige (C57BL/6J bgTbgi) mouse (Jackson Laboratory, Bar Harbor, ME) model of disseminated MAC was developed by Gangadharam et aL (1983). The beige mouse is considered to be the standard strain used for studying MAC infection (Bertram et aL, 1986; Gangadharam, 1986a, 1995; Reddy et aL, 1994). Other models of disseminated MAC infection in mice have been studied, such as: C57BL/6 (Collins, 1972; Gangadharam, 1986b; Cohen et aL, 1995); interferon-gamma knockout mice (Sacco et aL, 1996); Swiss Webster, AKR, DBA/2, BDF1, CBA/N, BALB/c (Gangadharam, 1986b); nude (li et aL, 1991); MAIDS (Orme et aL, 1992); and SCID (Appelberg et aL, 1994).

Storage and preparation of inocula Primary cultures of MAC (M. kansasii or other mycobacteria) to be used for infection may be obtained from Copyright 9 1999Academic Press All rights of reproduction in any form reserved

322

clinical isolates of HIV-infected patients with disseminated MAC infection, or the American Type Culture Collection (ATCC). We have primarily studied ATCC 49602 (serotype 1) strain LPR, a clinical isolate from our medical center, and MAC 101 (provided by Lowell Young, California Pacific Medical Center Research Institute, San Francisco, CA). All procedures involving the manipulation of these BSL-2 organisms should be carried out in a biological safety cabinet, type A. Guidelines for handling BSL-2 organisms are outlined in the CDC/NIH publication. Biosafety in (US Microbiological and Biomedical Laboratories Department of Health and Human Services, 1993). Organisms are grown in modified 7H10 broth (7H10 agar formulation with agar and malachite green omitted), pH6.6, with 10% (vol./vol.) Middlebrook oleic-acidalbumin-dextrose-catalase (OADC) enrichment (Difco Laboratories, Detroit, MI) and 0.05% (vol./vol.) Tween 80 (Sigma, St Louis, MO). Broth cultures should be started from one transparent, smooth, flat colony (SmT) grown on an agar plate. The culture tube is then placed in an orbital shaker and incubated at 37~ for 3-5 days. Culture suspensions should be predominately (>95%) of the smooth, transparent, and flat (SmT) phenotype. This phenotype has been shown to be more virulent (Shaefer et al., 1970; Inderlied et al., 1993; Reddy et al., 1994) and more resistant to antimycobacterial agents (Woodley and David, 1976; Rastogi et al., 1981; Saito and Tomioka, 1988) than the smooth, domed, opaque (SmD) or rough phenotypes. After incubation, the culture is diluted in 7H 10 broth to a concentration of 10 Klett units/ml (Manostat colorimeter, Manostat, New York, NY) or approximately 5 • 107 cfu/ml. The inoculum is then titrated in triplicate on 7H10 agar plates (Difco) supplemented with 5% (vol./vol.). Middlebrook OADC enrichment. Plates are taped with Blenderm| (3M, St Paul, MN), incubated for 2-3 weeks at 37~ and then counted to determine the precise inoculum.

Animal species The beige mouse is the model that we use in our laboratory. These mice are natural-killer-cell-deficient (Roder and Duwe, 1979). The mutation affects pigment granules of the optic cup, retina and neural crest. Lysosomal granules (Vassalli et al., 1978), mast cells (Chi et al., 1978) and Type II pneumocytes are also affected. The beige trait in mice is similar to the Chediak-Higashi syndrome of human beings and the Aleutian disease of mink and cattle. Beige mice can be infected with many of the nontuberculous mycobacteria: MAC, M. kansasii, M. simiae, M. malmoense and M. genavense (Klemens and Cynamon, 1994b and unpublished observations). Same-sex mice 5-7 weeks old are allowed to acclimate for 1 week in the facility before being used in an experiment. They are housed in microisolator units (lab products, Maywood, NJ) and are randomly distributed six to a group.

M . H . Cynamon and M. S. DeStefano

Infection process The ability to infect beige mice using a variety of routes including intraperitoneal, intranasal, oral, intrarectal; and intravenous has been demonstrated (Gangadharam et al., 1989). Intravenous infection has proved to yield a consistent disseminated disease model with viable organisms recovered from spleens, lungs, livers, blood, and lymph nodes. The i.v. infection route is the most commonly used to assess chemotherapeutic agents (Bertram et al., 1986). Oral and rectal challenge results in lower levels of spleen and lung infection compared to i.v. challenge with the same number of organisms (Gangadharam et al., 1989). As early as day 1 postinoculation cfu were present in the spleen, liver and lungs. Intranasal inoculation yielded viable counts only in the lungs (Gangadharam et al., 1989). Other routes of inoculation resulted in counts in the above organs at week 2 (rectal) and week 6 (oral; Gangadharam et al., 1989). In our model, the mice are infected i.v. via a caudal tail vein. The inoculum is injected in a 0.2 ml volume using a 0.5 ml syringe with an attached 28 G 0.5 in needle to deliver a total of approximately 107 cfu/mouse. Mice are placed in a restrainer (PlasLab, Lansing, MI), which is placed in a warming box for approximately 2-3 minutes to promote the dilation of the tail veins. The inoculation procedure takes place in a BSC, as noted above. When ready for injection, the restrainer is attached to a clamp on the holding ring stand, tail facing the injector. The tail vein injecting shield (Figure 36.1) is attached by inserting the base of the restrainer into the slot at the top of the shield. The tail is placed in the groove of the shield and threaded through the small hole at the bottom of the shield and grasped underneath with the non-dominant hand. The tail may be wetted with 70% ethanol for enhancement of the veins. The needle is gently inserted into the tail vein, bevel up, and the bolus is slowly injected. The needle is withdrawn and pressure is applied at the injection site with a 4 x 4 gauze. The mouse is released from the restrainer and returned to its isolator cage. Cages should have cards indicating the number and type of mouse, sex, date of birth, inoculum, isolate identification, and a red isolation or biohazard sticker. All items involved in the inoculating procedure need to be properly decontaminated for 15-30 minutes with an appropriate disinfectant such as Lysol| I.C. T M (National Laboratories, Montvale, NJ) (diluted to a final concentration of 0.5-5.0% phenolic compounds) or hypochlorite (diluted to a final concentration of 5000-10 000 ppm of available chlorine). Each experiment consists of an early control (sacrificed 1 week postinfection at the initiation of therapy) and a late control (sacrificed at the end of therapy) group, neither of which receives any treatment. One treatment group consists of a drug known to have activity (e.g. azithromycin or clarithromycin). Treatment is started 7 days postinfection and is generally continued for 10 days in succession. In extended therapy experiments, drugs are given daily (Mon-Fri) for 4 or more weeks. All drugs are preweighed into individual tubes and reconstituted daily. Agents used

BEIGE MOUSE MODEL OF DISSEMINATED MYCOBACTERIUM AVIUM COMPLEX INFECTION

/ Figure 36.1

/

/

323

/

Technique for inoculating using injection shield (US patent no. 5 816 197).

for treatment are reconstituted to a solution or suspension not exceeding a final concentration of 20% (vol./vol.) solvent (e.g. ethanol, DMSO) and water. Solvents are added to the compounds, vortexed, and brought to final volume with water. Agents are administered in a 0.2 ml volume. Administration routes (p.o., s.c., i.v.) are determined by drug. Oral drugs (p.o.) are given using an animal feeding needle, 20 G x 40 mm, with a 0.25 mm ball at the tip attached to a 1 ml tuberculin syringe. Mice are handled using a Kevlar| glove (Lab SafetySupply, Janesville, WI) to avoid a biting hazard. Mice are weighed at the beginning and end of each experiment, and averaged by group. Mice are evaluated daily and changes in appearance or behaviour are noted. In general, it has been our experience that infected mice appear outwardly well, and continue to gain weight with these infections. There have been some exceptions where the infected control animals have succumbed to the infection (Ji et al., 1994; unpublished observations). Untreated mice develop splenomegaly, hepatomegaly (with visible lesions), and enlarged lungs. Enlargement of the spleen, although minimal, is evident at 1 week postinfection (average weight 0.12-0.14 g) and continues to increase for the duration of the experiment (average weight 0.65-0.80 g at 18-20 days postinfection). After 1 week of infection, the usual organ cell counts in the lungs of early control mice (4.5 log) is significantly less than that in the spleen (7 log). The late control mice (19 days postinfection) average 6 log and 7.8 log cfu in their lungs and spleens respectively.

At the completion of the experiment, approximately 2 days after the end of the treatment phase, mice are euthanized using CO2 inhalation. Their spleens and right lungs are asceptically removed. Spleens are placed in preweighed tubes to determine their weight. Each organ is placed in a grinding assembly (Figure 36.2) containing saline with 0.05% (vol./vol.) Tween 80. The grinding assemblies have an attachable pestle that is secured to the motor-driven homogenizer. Each sample is ground and allowed to sit for 15 min to allow for settling of aerosols. The tops of the grinding assemblies are removed and an aliquot is removed. Dilutions are made to the appropriate concentrations for plating using tubes containing double-distilled H20 (to promote red blood cell lysis) with 0.05% (vol./vol.) Tween 80. Spleen weights are used to estimate dilutions for the plating of the homogenate. In general, large spleens, such as those belonging to members of the late control group, are heavily infected and need to be diluted to 10-5, 10-6, and 10-7. Agents with good activity, such as clarithromycin or azithromycin, result in smaller spleens (0.2-0.4 g) and need to be diluted 10-3, 10-4, and 10-5. Although rifapentine and rifabutin show some activity, they produce misleadingly large spleens (0.35-0.5 g) and are diluted 10-3, 10-4, and 10-5. (Note that the lungs are less infected than the spleens in this model and usually require 10-100 times less dilution.) Each organ is plated at three different dilutions on 7H10 agar (Difco) plates containing 5% OADC enrichment. Plates are incubated for 2-3 weeks and counted to determine viable cell counts, which are expressed as counts/organ.

324

M . H . Cynamon and M. S. DeStefano

mice should be monitored initially and during the first hour for an); indicatiofls of-pain or discomfort, allergic reaction or swelling. During the first 3 days of therapy, the mice are monitored at least twice daily to note their general appearance. Any injection site is inspected for swelling or irritation. The general condition of the animals is carefully noted. Mice having an acute reaction should be euthanized immediately and the therapy should be reevaluated. Efficacy is evaluated relative to the reduction of viable organisms in the spleens and lungs of therapy groups in comparison to those in the spleens and lungs of the control (infected, but untreated) groups. Additional comparison should be made between the therapy groups and the group given a standard therapy such as clarithromycin or azithromycin. Spleen weights can be useful in evaluating the therapy's effectiveness (Ji et aL, 1994), although it should be noted that in our experience many of the rifamycins cause splenomegaly (unpublished observations).

Antimicrobial therapy

Figure 36.2 Aerosol-resistant grinding assembly (US patent no. 5 829 696).

Key parameters to monitor infection and response to treatment Observing mice for signs of infection is an important evaluation tool. Because of the subjective nature of monitoring, one often has to rely on experience to ascertain the condition of the mice. Guidelines for evaluation and regulations for the welfare of the animals are available in Guide for the Care and Use of Lab~ra'tory Animals (National Research Council, 1996). Generally speaking, mice may show some or all of the following signs of infection. Often they exhibit a hunched posture with or without difficulty ambulating. They may isolate themselves from the rest of the group in their cage. Breathing may become labored, and shivering may be apparent. There may be evidence of lack of eating and/or drinking. Signs of diarrhea may be evident, such as areas of increased wetness in the bedding, especially in the corners of the cage. It is necessary to evaluate the response of the mice to any therapy, particularly one not previously studied, when treatment is initiated. Upon introduction of a new agent,

Antimicrobial agents that have been studied in the beige mouse model of disseminated MAC infection are summarized in Table 36.1. The antimicrobial agents have been administered by various routes (s.c., p.o., i.v.). Little attention has usually been given to formulation of the antimicrobial agent when the oral route is used. We have usually begun therapy 7 days postinfection; however, a variety of pretreatment periods have been used. Determination of the spleen and lung viable cell counts is usually done several days after the completion of therapy to reduce any effects of antimicrobial carry-over during the quantitative plating. This is more of a theoretical than a real issue, because of the high dilutions used for titration of viable cell counts, a reflection of the relatively limited activity of current agents. Although daily treatment for 10 days allows for differentiation of relative activities, longer treatment periods (4-12 weeks) are useful to characterize efficacy, particularly of combination regimens, and to study the development of resistance (Bermudez et aL, 1996b; Lounis et aL, 1995). Once-weekly dosing of azithromycin with rifapentine has been found to be effective for therapy of disseminated MAC (Klemens and Cynamon, 1994a). The selection of dose and interval of administration should be carefially considered given the differing pharmacokinetics of antimicrobial agents in humans and mice. Most investigators have not carefully defined the pharmacokinetics of their study drugs in the beige mouse. Furthermore, it is unclear whether the goal should be to mimic the peak serum level or the area under the curve for agents used in this model. When an agent is to be evaluated in mice prior to the study of its pharmacokinetics in humans, it is important to evaluate several doses and to define the maximally tolerated dose. When the

Table 36.1

m

Ill m

Correlation of antimicrobial efficacy in the beige mouse model of MAC infection with clinical experience

Agents

Dosing (mg/kg daily)

Prophylaxis Azithromycin (AZI)

200

Outcome

Reference

Dosing

Outcome

Reference

Decreased incidence of bacteremia, decreased cfu in livers and spleens Significant reduction of cfu in spleens and livers

Bermudez et al., 1995

1200 mg/ week

70% efficacy

Havlir et al., 1996

Bermudez et al., 1994b

500 mg bid.

70% efficacy

Higher dose decreases incidence of bacteremia Did not decrease cfu in spleens and livers

Bermudez et al., 1995

300 mg/d

50% efficacy

Relatively good activity in spleens and lungs 200 against eight clinical isolates 200 mg/kg/week Good activity alone and in combination with RPT 20 mg/kg/wk 200 Relatively good activity in spleens and lungs against eight clinical isolates 20 Modest activity against 2/5 MAC isolates

Cynamon et al., 1994

Clarithromycin (CLARI)

200

Rifabutin

30 60

Therapy Azithromycin

Clarithromycin

Rifabutin

Ill

Clinical experience

Experimental experience

100

Rifampin (RIF)

20

Rifapentine (RPT)

20

Little activity as monotherapy in combination with CLARI did not enhance activity Modest activity against 2/5 MAC isolates

Comments

O c t~

Ill

O O m I-

Pierce et al., 1996 Nightingale et al., 1993

Reasonably good correlation between experimental data and clinical experience for CLARI, AZI and RBT in the prophylaxis setting

O "!I

O m

(/) rn

z

Ill O

600 mg/d

Good activity

Berry et al., 1993

Good correlation between experimental data and clinical experience for CLARI and AZI

O

r

Klemens and Cynamon, 1994a Cynamon et al., 1994

500 mg bid

Good activity

Chaisson et al., 1994

Klemens et al., 1994

300 mg/d

Good activity in CLARI/RBT/ EMB combination

Shafran et al., 1996

Klemens and Cynamon, 1992 Klemens et al., 1992 Klemens et al., 1994

600 mg/d

Not able to reduce, bacteremia

Kemper et al., 1994

Role in therapy unclear (Is AZI or CLARI plus RBT better than AZI or CLARI plus EMB?) CLARI/RBT interaction, Wallace et al., 1995. RBT uveitis, Shafran et al., 1994 Inactive in mice and in clinical experience

O O

"o rI11

X m

z "!1

I11 s -4 m O z

Not studied CO I'O O"1

CO 0")

Table

36.1

(Continued) Experimental experience

Clinical experience

Agents

Dosing (mg/kg daily

Outcome

Reference

KRM 1648

20

Modest activity

Ethambutol (EMB)

100

Clofazimine (CFZ)

20

Ciprofloxacin

40

Modest activity as monotherapy In combination with CLARI did not enhance activity In combination with CLARI did not enhance activity Inactive

Tomioka et aL, 1992 Bermudez et aL, 1994a Young and Bermudez, 1995 Klemens et al., 1992

Levofloxacin

200

Inactive

Bermudez et al., 1996a

Sparfloxacin

50

Modest activity

Perronne et al., 1992

Amikacin

50-100

Modest activity

Streptomycin

150

In combination with CLARI did not enhance activity Modest activity

Gangadharam et al., 1988 Klemens et al., 1992

Paromomycin

200

Modest activity

Klemens et al., 1992

Dosing

Reference

Comments

Not studied

15 mg/kg

Modest reduction in bacteremia

Kemper et al., 1994

Good correlation between experimental data and clinical experience

200 mg/d

Not active in reducing bacteremia Not adequately studied in monotherapy

Kemper et al., 1994

Good correlation between experimental data and clinical experience Data not adequate to determine correlation of experimental and clinical experience for the quinolones Data not adequate to determine correlation of experimental and clinical experience for the quinolones

Inderlied et al., 1989

Duzgunes et al., 1991 Kanyok et al., 1994

Outcome

1 g/d

Not adequately studied in monotherapy Not adequately studied in monotherapy Not adequately evaluated in monotherapy

Not adequately studied

~E O 3 3 o 3 m 3 Q.

m 0

BEIGE MOUSE MODEL OF DISSEMINATED MYCOBACTERIUM AVIUM COMPLEX INFECTION

human pharmocokinetics are known for an agent it is useful to evaluate this agent over a range of doses (usually seven to 10 times the maximally tolerated human dose for agents cleared by the kidneys). It is more difficult to define the appropriate murine dose for agents that are cleared by the liver. It is unclear whether the measurement of serum or tissue levels for various agents in mice provide useful information regarding therapeutic efficacy (e.g. azithromycin). Experience with antituberculosis therapy in mice and humans established that once-daily dosing is preferable to fractional dosing. The data are less clear for MAC therapy; however, once-daily dosing would seem most appropriate in light of the relatively long doubling time for this organism.

Pitfalls (advantages/disadvantages) of the model Apart from the previously mentioned shortcoming of differing pharmacokinetics of antimicrobials in mice and humans, the murine model of disseminated MAC is suitable for the evaluation of antimicrobials for the treatment of disseminated MAC in HIV infected patients. The murine model enables one to rapidly evaluate multiple doses and combinations of agents relatively inexpensively. The i.v. model of disseminated MAC infection may be less useful for the study of immunology, since the beige mouse is immunocompromised differently from HIV infected patients. The i.v. model probably underestimates the potential efficacy of various agents for preventive therapy of disseminated MAC in HIVinfected humans. The oral infection model is better for this purpose; however, there is still the pitfall of the requirement for relatively large inocula, which are not likely to mimic the clinical situation (Bermudez et al., 1994b, 1995). One can now use either clarithromycin or azithromycin as reference agents for the evaluation of new drugs alone or in combination to determine efficacy and the ability of the new agent to delay the emergence of resistance. It is important to evaluate new agents against several MAC isolates in the murine model to insure that a less biased reflection of an agent's potential clinical activity is obtained. The rifamycins have better activity against ATCC 49601 (serotype 1) strain LPR than they do against MAC 101 (Klemens et al., 1994). This difference led to somewhat different impressions of the potential clinical usefulness of these agents based on a myopic view of the universe of MAC organisms. Clofazamine has limited activity alone in the beige mouse model of disseminated MAC infection; however, it enhanced the activity of rifapentine when used in combination (Klemens and Cynamon, 1991). Clofazamine performed poorly when evaluated in humans with disseminated MAC infection (Kemper et al., 1994).

327

Contributions of the model to infectious disease therapy In the light of the potential problems with the beige mouse model of disseminated MAC infection as a predictor for the clinical efficacy of antimicrobial agents, it has proved to be useful for azithromycin (Cynamon et all., 1994) and clarithromycin (Fernandes et aL, 1989). In murine studies both agents had activity against eight clinical MAC isolates (Cynamon et aL, 1994). The mean log reduction in cell counts/spleen was 1.2 log, 0.75 log and 0.61 log for mice treated for 10 days with azithromycin 200 mg/kg or 100 mg/kg, and clarithromycin 200mg/kg, respectively. The mean reduction in cell counts/lung were 0.38 log for azithromycin 200 mg/kg and 0.67 log for clarithromycin 200 mg/kg. Once-weekly treatment with azithromycin 200 mg/kg alone or in combination with rifapentine 20 mg/kg for 8 weeks was effective for disseminated MAC infection in beige mice (Klemens and Cynamon, 1994a). These results are consistant with the efficacy of azithromycin in MAC prophylaxis (Havlir et aL, 1996). The correlation of activity of rifamycins in the beige mouse model of disseminated MAC infection and human disease has been less clear. Rifampin has little activity against MAC in vitro or in mice (Klemens and Cynamon, 1992). Rifabutin, rifapentine, and KRM 1648 have been found to have promising activity against some isolates in the murine system (Tomioka et aL, 1992; Klemens et aL, 1994 and to have little activity against others (Bermudez et aL, 1994a; Klemens et aL, 1994). These discordant observations may be due in part to the use by the investigators of isolates with different intrinsic susqeptibilities to rifamycins. Rifampin does not appear to be effective for the treatment of disseminated MAC infection based on a monotherapy study ofbacteremia (Kemper et aL, 1994). The therapeutic efficacy of rifabutin, rifapentine, and KRM 1648 in human disease has not been adequately studied. Rifabutin has been demonstrated to decrease by one-half the occurrence of MAC bacteremia when given at 300 mg/d to HIV-infected patients with CD4 + T-cell counts below 100/mm 3 (Nightingale et aL, 1993). Ethambutol had modest activity in both the beige mouse (Young and Bermudez, 1995) and in disseminated MAC infection in humans (Kemper et al., 1994). Several investigators have evaluated the activities of antimicrobial agents in liposome preparations. This drug delivery system would seem to be attractive to treat disseminated MAC infection in mice and humans (Cynamon et aL, 1989; Klemens et al., 1990; Duzgunes et al., 1991). Liposome-encapsulated agents have not been adequately evaluated in clinical disseminated MAC infections.

References Appelberg, R., Castro, A. G., Pedrosa, l., Silva, R. A., Orme, I. M., Minoprio, P. (1994). Role of gamma interferon and tumor necrosis factor during T-cell-independent and -dependent phases of Mycobacterium avium infection. Infect. Immun., 62, 3962-3971.

328

Armstrong, A. L., Dunbar, F. P., Cacciatore, R. (1967). Comparative pathogenicity of Mycobacterium avium and Battey bacilli. Am. Rev. Respir. Dis., 95, 20-32. Bermudez, L. E., Kolonoski, P., Young, L. S., Inderlied, C. B. (1994a). Activity of KRM-1648 alone or in combination with ethambutol or clarithromycin against Mycobacterium avium complex in the beige mouse.Antimicrob. Agents Chemother., 38, 1844-1848. Bermudez, L. E., Inderlied, C. B., Kolonoski, P., Petrofsky, M., Young, L. S. (1994b). Clarithromycin, dapsone, and a combination of both used to treat or prevent disseminated Mycobacterium avium infection in beige mice. Antimicrob. Agents Chemother., 38, 2717-2721. Bermudez, L. E., Petrofsky, M., Inderlied, C. B., Young, L. S. (1995). Efficacy of azithromycin and rifabutin in preventing infection by Mycobacterium avium complex in beige mice. Antimicrob. Agents Chemother., 36, 641-646. Bermudez, L. E., Inderlied, C. B., Kolonoski, P., Wu, M., Barbara-Burnham, L., Young, L. S. (1996a). Activities of Bay Y3118, levofloxacin, and ofloxacin alone or in combination with ethambutol against Mycobacterium avium complex in vitro, in human macrophages, and in beige mice. Antimicrob. Agents Chemother., 40, 546-551. Bermudez, L. E., Nash, K. A., Petrofsky, M., Young, L. S., Inderlied, C. B. (1996b). Effect ofethambutol on emergence of clarithromycin-resistant Mycobacterium avium complex in the beige mouse model. ]. Infect. Dis., 174, 1218-1222. Berry, A., Koletar, S., Williams; D. (1993). Azithromycin therapy for disseminated Mycobacterium avium-intracellulare in AIDS patients (abstract). In Program and Abstracts of the First National Conference on Human Retroviruses and Related Infection, Washington, DC, December 12-16, 1993, p. 106. American Society for Microbiology, Washington, DC. Bertram, M. A., Inderlied, C. B., Yadegar, S., Kolonoski, P., Yamada, J. K., Young, L. S. (1986). Confirmation of the beige mouse model for study of disseminated infection with Mycobacterium avium complex. ]. Infect. Dis., 154, 194-195. Brown, S. T., Edwards, F. F., Bernard, F. M., Tong, W., Armstrong, D. (1993). Azithromycin, rifabutin, and rifapentine for treatment and prophylaxis ofMycobacterium avium complex in rats treated with cyclosporine. Antimicrob. Agents Chemother., 37, 398-402. Burman, W. J., Cohn, D. L. (1995). Clinical disease in human immunodeficiency virus-infected persons. In Mycobacterium avium-Complex Infection: Progress in Research and Treatment (eds Korvick, J. A., Benson, C. A.), pp. 79-108. Marcel Dekker, New York. Chaisson, R. E., Benson, C. A., Dube, M. P. et al. (1994). Clarithromycin therapy for bacteremic Mycobacterium avium complex disease: a randomized, double-blind, dose-ranging study in patients with AIDS. Ann. Intern. Med., 121, 905-911. Chi, E. Y., Ignacio, E., Langunoff, D. (1978). Mast cell granule formation in the beige mouse. ]. Histochem. Cytochem., 26, 131-137. Cohen, Y., Perronne, C., Lazard, T. et al. (1995). Use of normal C57BL/6 mice with established Mycobacterium avium infections as an alternative model for the evaluation of antibiotic activity. Antimicrob. Agents Chemother., 39, 735-738. Collins, F. M. (1972). Acquired resistance to mycobacterial infections. Adv. Tuberc. Res., 18, 1-30. Collins, F. M., Morrison, N. E., Montalbine, V. (1978). Immune

M . H . Cynamon and M. S. DeStefano

response to persistent mycobacterial infection in mice. Infect. Immun., 20, 430-438. Cynamon, M. H., Swenson, C. E., Palmer, G. S., Ginsberg, R. S. (1989). Liposome encapsulated amikacin therapy of Mycobacterium avium complex infection in beige mice. Antimicrob. Agents Chemother., 33, 1179-1184. Cynamon, M., Klemens, S. P., Grossi, M. A. (1994). Comparative activities of azithromycin and clarithromycin against Mycobacterium avium infection in beige mice. Antimicrob. Agents Chemother., 38, 1452-1454. Dautzenberg, B., Truffot, C., Legris, S. et al. (1991). Activity of clarithromycin against Mycobacterium avium infection in patients with acquired immune deficiency syndrome: a controlled clinical trial. Am. Rev. Resp. Dis., 144, 564-569. Dunbar, F. P., Pejovic, I., Cacciatore, R., Peric-Golia, L., Runyon, E. H. (1968). Mycobacterium intracellulare. Maintenance of pathogenicity in relationship to lyophilization and colony form. Scand. J. Resp. Dis., 49, 153-162. Duzgunes, N., Ashtekar, D. R., Flasher, D. L. et al. (1991). Treatment of Mycobacterium avium-intracellulare complex infection in beige mice with free and liposome-encapsulated streptomycin.]. Infect. Dis., 164, 143-151. Engbaek, H. C. (1961). Pathogenicity and virulence of atypical mycobacteria for experimental animals (with particular reference to pathologic processes in joints and tendon sheaths of rabbits). Acta. Tuberc. Scand., 40, 35-50. Fernandes, P. B., Hardy, D. J., McDaniel, D., Hanson, C. W., Swanson, R. N. (1989). In vitro and in vivo activities of clarithromycin against Mycobacterium avium. Antimicrob. Agents Chemother., 33, 1531-1534. Gangadharam, P. R. J. (1986a). Animal models for nontuberculosis mycobacterial diseases. In Experimental Models in Antimicrobial Chemotherapy 3 (eds Zak, O., Sande, M. A.), pp. 1-90. Academic Press, Orlando, FL. Gangadharam, P. R. J. (1986b). Murine models for mycobacterioses. Semin. Respir. Infect., 1,250-261. Gangadharam, P. R. (1995). Beige mouse as a model for Mycobacterium avium complex disease. Antimicrob. Agents Chemother., 39, 1647-1654. Gangadharam, P. R., Edwards, C. K. III, Murthy, P. S., Pratt P. F. (1983). An acute infection model for Mycobacterium intracellulare disease using beige mice: preliminary results. Am. Rev. Resp. Dis., 127, 648-649. Gangadharam, P. R., Perumal, V. K., Podapati, N. R., Kesavalu, L., Iseman, M. D. (1988). In vivo activity of amikacin alone or in combination with clofazimine or rifabutin or both against acute experimental Mycobacterium avium complex infection in beige mice. Antimicrob. Agents Chemother., 32, 1400-1403. Gangadharam, P. R. J., Perumal, V. K., Parikh, K. et al. (1989). Susceptibility of beige mice to Mycobacterium avium complex infections by different routes of challenge. Am. Rev. Respir. Dis., 139, 1098-1104. Havlir, D. V., Dube, M. P., Sattler, F. R. et al. (1996). Prophylaxis against disseminated Mycobacterium avium complex with weekly azithromycin, daily rifabutin, or both. N. Engl. J. Med., 335,392-398. Hawkins, C. C., Gold, J. W. M., Whimbey, E. et al. (1986). Mycobacterium avium complex infections in patients with the acquired immunodeficiency syndrome. Ann. Intern. Med., 105, 184-188. Heifets, L. B. (1991). Dilemmas and realities in drug susceptibility testing of M. avium-intracellulare and other slowly growing

BEIGE MOUSE MODEL OF DISSEMINATED MYCOBACTERIUM AVIUM COMPLEX INFECTION

nontuberculous mycobacteria. In Drug Susceptibility in the Chemotherapy of Mycobacterial Infection (ed. Heifets, L. B.), pp. 123-146. CRC Press, Boca Raton, FL. Inderlied, C. B., Kolonoski, P. T., Wu, M., Young, L. S. (1989). Amikacin, ciprofloxacin and imipenem treatment for disseminated Mycobacteriurn aviurn complex infection of beige mice. Antirnicrob. Agents Chernother., 33, 176-180. Inderlied, C., Kemper, C. A., Bermudez, L. E. (1993). The Mycobacterium avium complex. Clin. MicrobioL Rev., 6, 266-310. Iseman, M. D. (1995). Pulmonary disease due to Mycobacteriurn aviurn complex. In Mycobacterium avium-Complex Infection: Progress in Research and Treatment (eds Korvick, J. A., Benson, C. A.), pp. 45-77. Marcel Dekker, New York. Ji, B., Lounis, N., Tuffot-Pernot, C., Grosset, J. (1991). Susceptibility of immunocompetent beige and nude mice to Mycobacteriurn aviurn infection and response to clarithromycin. In Program and Abstracts of 3Ist Interscience Conference on Antirnicrobial Infections and Chemotherapy, Washington DC, Abstract no. 291. li, B., Lounis, N., Truffot-Pernot, C., Grosset, J. (1994). Effectiveness of various antimicrobial agents against Mycobacterium avium complex in the beige mouse model. Antimicrob. Agents Chemother., 38, 2521-2529. Kanyok, T. P., Reddy, M. V., Chinnaswamy, J., Danziger, L. H., Gangadharam, P. R. J. (1994). In vivo activity ofparomomycin against susceptible and multi-drug resistant M. tuberculosis and M. aviurn complex strains. Antirnicrob. Agents Chernother., 38, 170-173. Kemper, C. A., Havlir, D., Haghighat, D. et aL (1994). The individual microbiologic effect of three antimycobacterial agents, clofazamine, ethambutol, and rifampin, on Mycobacterium avium complex bacteremia in patients with AIDS. J. Infect. Dis., 170, 157-164. Kleeberg, H. H., Nel, E. E. (1973). Occurrence of environmental atypical mycobacteria in South Africa. In Proceedings of the Third International Colloquium on Mycobacteria, pp. 201-214. Klemens, S. P., Cynamon, M. H., Swenson, C. E., Ginsberg, R. S. (1990). Liposome encapsulated gentamicin therapy of Mycobacterium avium complex infection in beige mice. Antimicrob. Agents Chemother., 34, 967-970. Klemens, S. P., Cynamon, M. H. (1991). In vivo activities of newer rifamycin analogs against Mycobacterium avium infection. Antirnicrob. Agents Chemother., 35, 2026-2030. Klemens, S. P., Cynamon, M. H. (1992). Activity of rifapentine against Mycobacteriurn avium infection in beige mice. ]. Antimicrob. Chemother., 29, 555-561. Klemens, S. P., Cynamon, M. H. (1994a). Intermittent azithromycin for treatment of Mycobacterium avium infection in beige mice. Antimicrob. Agents Chemother., 38, 1721-1725. Klemens, S. P., Cynamon, M. H. (1994b). Activities of azithromycin and clarithromycin against nontuberculous mycobacteria in beige mice. Antimicrob. Agents Chemother., 387, 1455-1459. Klemens, S. P., Destefano, M. S., Cynamon, M. H. (1992). Activity of clarithromycin against Mycobacterium avium complex infection in beige mice. Antimicrob. Agents Chemother., 36, 2413-2417. Klemens, S. P., Grossi, M. A., Cynamon, M. H. (1994). Comparative in vivo activities of rifabutin and rifapentine against Mycobacterium avium infection. Antimicrob. Agents Chemother., 38, 234-237.

329

Lounis, N., Ji, B., Truffot-Pernot, C., Grosset, 1- (1995). Selection of clarithromycin-resistant Mycobacterium avium complex during combined therapy using the beige mouse model. Antirnicrob. Agents Chernother., 39, 608-612. Meissner, G. (1981). The value of animal models for study of infection due to atypical mycobacteria. The Schaefer Memorial Lecture. Rev. Infect. Dis., 3, 953-959. National Research Council (1996). Guide for tae Care and Use of Laboratory Animals. National Academy Press, Washington, DC. Nightingale, S. D., Cameron, D. W., Gordin, F. M. et aL (1993). Two controlled trials of rifabutin prophylaxis against Mycobacterium aviurn complex infection in AIDS. N. Engl. J. Med., 329, 828-833. Orme, I. M., Furney, S. K., Roberts, A. D. (1992). Dissemination of enteric Mycobacteriurn avium infections in mice rendered immunodeficient by thymectomy in CD4 depletion or by prior infection with murine AIDS retroviruses. Infect. Irnrnun., 60, 4747-4753. Parenti, D., Ellner, J., Hafner, R. et al. (1995). A phase II/III trial of rifampin, ciprofloxacin, clofazimine, ethambutol, +_ amikacin in the treatment of disseminated Mycobacterium avium infection in HIV-infected individuals (abstract). In Abstracts of the Second National Conference on Human Retroviruses, p. 56. American Society for Microbiology, Washington, DC. Perronne, C., Cohen, Y., Truffot-Pernot, C., Grosset, J., Vilde, J. L., Pocidalo, I. J. (1992). Sparfloxacin, ethambutol, and cortisol receptor inhibitor RU-40555 treatment for disseminated Mycobacteriurn aviurn complex infection of normal C57BL/6 mice. Antirnicrob. Agents Chernother., 11, 2408-2412. Pierce, M., Crampton, S., Henry, D. et aL (1996). A randomized trial of clarithromycin as prophylaxis against disseminated Mycobacteriurn aviurn complex infection in patients with advanced acquired immunodeficiency syndrome. N. EngL J. ivied., 335,384-391. Rastogi, N., Fresel, C., Ryter, A., Ohayon, H., Lesourd, M., David, H. L. (1981). Multiple drug resistance in Mycobacterium avium: is the wall architecture responsible for the exclusion of antimicrobial agents? Antirnicrob. Agents Chernother., 20, 666-677. Reddy, V. M., Parikh, K., Luna-Herrera, J., Falkinham, J. O. III, Brown, S., Gangadharam, P. R. (1994). Comparison of virulence of Mycobacteriurn aviurn complex (MAC) strains isolated from AIDS and non-AIDS patients. MicrobioL Pathol., 16, 121-130. Roder, J., Duwe, J. (1979). The beige mutation in the mouse selectively impairs natural killer cell function. Nature, 278, 451-453. Sacco, R. E., Jensen, R. J., Thoen, C. O., Weinstock, J., Lynch, R. G., Dailey, M. D. (1996). Cytokine secretion and adhesion molecule expression by granuloma T lymphocytes in Mycobacteriurn aviurn infection. Am. J. PathoL, 148, 1935-1948. Saito, H., Tomioka, H. (1988). Susceptibilities of transparent, opaque, and rough colonial variants of Mycobacteriurn aviurn complex to fatty acids. Antirnicrob. Agents Chernother., 32, 400-402. Shaefer, W. B., Davis, C. L., Cohn, M. L. (1970). Pathogenicity of transparent, opaque and rough variants of Mycobacteriurn aviurn in chickens and mice. Am. Rev. Respir. Dis., 102, 499-506.

330

Shafran, S. D., Deschenes, J., Miller, M., Phillips, P., Toma, E. (1994). Uveitis and pseudojaundice during a regimen of clarithromycin, rifabutin and ethambutol. N. EngL J. Med., 330, 438--439. Shafran, S. D., Singer, J., Zarowny, D. P. et aL (1996). A comparison of two regimens for the treatment of Mycobacterium avium complex bacteremia in AIDS: rifabutin, ethambutol, and clarithromycin versus rifampin, ethambutol, clofazamine, and ciprofloxacin. N. EngL J. Med., 335, 377-383. Tomioka, H., Sato, H., Sato, K. et aL (1992). Chemotherapeutic efficacy of a newly synthesized benzoxazinorifamycin, KRM1648, against Mycobacterium avium complex induced in mice. Antimicrob. Agents Chemother., 36, 387-393. US Department of Health and Human Services (1993). Biosafety in Microbiological and Biomedical Laboratories (eds Richmond, J. Y., McKinney, R. W.). Government Printing Office, Washington, DC. Vassalli, J. D., Granelli-Piperno, A., Griscelli, E., Reich, E. (1978). Specific protease deficiency in polymorphonuclear leucocytes of Chediak-Higashi syndrome and beige mice. J. Exp. Med., 147, 1285-1290.

M . H . Cynamon and M. S. DeStefano

Wallace, R. J., Jr, Brown, B. A., Griffith, D. E., Girard, W., Tanaka, K. (1995). Reduced serum levels of clarithromycin in patients treated with multidrug regimens including rifampin or rifabutin for Mycobacterium avium-M, intracellulare infection. J. Infect. Dis., 171,747-750. Wolinsky, E. (1979). Nontuberculous mycobacteria and associated disease. Am. Rev. Respir. Dis., 119, 107-159. Woodley, C. L., David, H. L. (1976). Effect of temperature on the rate of the transparent to opaque colony type transition in Mycobacterium avium. Antimicrob. Agents Chemother., 9, 113-119. Young, L. S., Wiviott, L., Wu, M., Kolonoski, P., Bolan, R., Inderlied, C. B. (1991). Azithromycin for treatment of Mycobacterium avium-intercellulare complex infection in patients with AIDS. Lancet, 338, 1107-1109. Young, L. S., Bermudez, L. E. (1995). Animal models in antiMycobacterium avium complex drug development. In Mycobacterium avium-Complex Infection: Progress in Research and Treatment (eds Korvick, J. A., Benson, C. A., pp. 141-161. Marcel Dekker, New York.

Chapter 37

The Armadillo Leprosy Model with Particular Reference to Lepromatous Neuritis D. M. Scollard and R. W. Truman

Introduction Mycobacterium leprae is the only bacterial pathogen that infects peripheral nerves. The resulting sensory deficiencies and motor weakness are often what bring these patients to seek medical attention, at which time they present with a wide variety of skin lesions (Clements and Scollard, 1997). The mechanisms by which M. leprae localizes to peripheral nerve, and the mechanisms of subsequent nerve injury, are very poorly understood. A major reason for this is that nearly all information about nerve injury in leprosy has come from human biopsy material. The severe medical and ethical limitations on nerve biopsies have dictated that only selected sensory nerves have been studied systematically in patients with leprosy (primarily the sural and a sensory branch of the radial cutaneous nerve), sometimes with little or no clinical evidence that these particular nerves are affected in each individual. The cell-mediated immune (CMI) response of the host to M. leprae determines the type of inflammatory lesion observed in tissues of infected individuals. The human response to M. leprae is uniquely broad and comprehensive, covering the entire spectrum of CMI (Skinsnes, 1964; Ridley and Jopling, 1966). Patients with strong delayed-hypersensitivity and CMI responses to M. leprae antigens exhibit dermal granulomatous lesions similar to those of tuberculosis, and are hence termed tuberculoid. At the opposite extreme are patients who have virtually no cellular immunity to M. leprae, termed lepromatous, whose skin lesions are filled with organisms growing in macrophages and cutaneous nerves. Most patients' responses fall into a wide borderline range of patterns between these two extremes, with variable features of both polar forms (Clements and Scollard, 1997). This broad spectrum of cellular immune dysfunction in leprosy has been described in increasing detail as it involves T-lymphocytes, macrophages, and cytokine production (Krahenbuhl and Adams, 1998; Modlin and Rea, 1994). At this time, however, no unifying hypothesis explains the extraordinarily wide range of CMI to M. leprae. Nerve involvement occurs in all types of disease, although the speed of progression of clinical neuropathy varies across the spectrum. Multiple mechanisms are likely to mediate nerve injury, including the CMI of the host. Handbook of Animal Modelsof Infection ISBN 0-12-775390-7

Most evidence indicates that the most likely source of human infection is from another infected individual, but the exact means of transmission is not known (Nelson, 1998). Only approximately 5% of the human adult population appears to be susceptible to this organism. M. leprae appears to grow slowly, as determined from inoculation studies in mouse footpads (Shepard, 1960), and the incubation period in man usually ranges from 2-7 years, sometimes up to 20 years (Doull et al., 1945). The infection is curable with multidrug antimicrobial therapy, and, although W H O programmes over the last 15 years have extended the reach of this treatment and resulted in the removal of many patients from active disease registries, the new-case prevalence rates have not fallen, and millions of people continue to suffer from deformities, ostracism, and other effects of the disease. In endemic countries in Asia, Africa, and Latin America, leprosy remains a major health problem and a major burden on patients and their families.

The armadillo as an experimental leprosy model The nine-banded armadillo (Dasypus novemcinctus) is the only immunologically intact animal that exhibits a high frequency of natural susceptibility to infection with M. leprae, and its value as an immunopathologic model of leprosy and as an epidemiologic model have been reviewed previously (Storrs et al., 1988b; Kirchheimer and Storrs, 1971; Truman and Sanchez, 1993; Truman, 1994). It is now emerging as a model for neurologic aspects of M. leprae infection. A primary focus of interest has been the immunologic nonresponsiveness of the animals that develop disseminated infection (Storrs, 1971), analogous to human lepromatous leprosy. Highly susceptible armadillos develop weak reactions to killed M. leprae (Job et al., 1982, 1985a, 1987; Krotoski et al., 1993), without granuloma formation, similar to those of human lepromatous patients. Strong lepromin reactions, with granulomatous inflammation, are associated with the development of high resistance to infection in armadillos and with tuberculoid leprosy in man. Lymphocytes from resistant animals proliferate in vitro in response to M. leprae Copyright 9 1999Academic Press All rights of reproduction in any form reserved

332

antigens, while cells from susceptible animals show little or no proliferation, also comparable to leprosy in man (Kirchheimer et al., 1978; Shannon et al., 1984). Efforts to further explore mechanisms of CMI (and its defects) in armadillos have been hampered by the dependence on outbred animals and the lack of reagents to identify T-cells and their subsets and cytokines in this species. The first T-cell marker for armadillo lymphocytes has recently been demonstrated by cross-reactivity of monoclonal antibody TCRS1 (recognizing a common determinant on the human 8 chain) with a population of armadillo lymphocytes (Lathrop et al., 1997). The distribution of this lymphocyte population was comparable to that of 7,8 cells in other species. However, although 7,8 cells have been implicated in immune responses to various mycobacterial antigens, no correlation has been documented between 7,8reactive lymphocytes and M. leprae infection in armadillos. Macrophage activating factor, present in supernatants of armadillo spleen cell cultures, has been shown to activate anti-Toxoplasma activity in armadillo macrophages by a nitrate-independent mechanism, but it had no antiM. leprae activity (Adams and Krahenbuhl, 1996). This factor has not been purified or cloned. Early studies identified armadillo immunoglobulin families and specific antibody to the phenolic glycolipid-1 of M. leprae in infected armadillos (Truman et al., 1986a; Vadiee et al., 1988; Job et al., 1992), and documented the evolution of the antibody response in armadillos infected with M. leprae (Truman et al., 1986a,b; Vadiee et al., 1990; SantosArgumedo et al., 1995). Antibodies offer no protective effects against M. leprae infection in armadillos or in human leprosy, but in man their titers tend to rise with exacerbation or relapse of infection and fall with improvement, suggesting that they may provide useful markers for the effectiveness of antimicrobial treatment of experimental infection (Cho et al., 1991).

The armadillo as an epidemiologic model of leprosy Nine-banded armadillos in parts of Texas and Louisiana are recognized as highly endemic natural hosts for M. leprae. Archived serum samples collected on Louisiana armadillos during 1960 showed that sylvatic leprosy already existed among these animals before they were ever used in leprosy research, and it originated by natural means (Truman et al., 1986b). The geographic distribution of M. leprae infection among wild armadillos roughly follows the same pattern for leprosy in man (Walsh et al., 1986) and some reports suggest the possibility of zoonotic transmission (West et al., 1988; Truman et al., 1990). Enzootic leprosy in armadillos is also being studied as a population model in which to examine basic mechanisms of leprosy transmission and evaluate environmental risk factors for the infection (Truman et al., 1991).

D . M . Scollard and R. W. Truman

The armadillo as a model of leprosy neuropathy A recent study of peripheral nerves in armadillos inoculated with M. lelvrae indicated that animals that developed systemic disease in less than 2 years all had substantial M. leprae infection in at least one major peripheral nerve trunk (Scollard et al., 1996). Semi-quantitative assessment of the bacterial load along the course of the affected nerves indicated that infection was greatest distally and decreased steadily in more proximal segments, also comparable to involvement in man. Notably, this localization to peripheral nerves occurs in the natural course of experimental infection, without any additional experimental manipulation of the nerves themselves and, as with human nerve involvement, is asymmetrical (McDougall, 1997; Scollard and Truman, 1997). This model therefore appears to offer for the first time an animal model for nerve involvement in leprosy. Histopathologic evaluation revealed an interstitial neuritis, with an infiltrate composed entirely of mononuclear cells (Figure 37.1). M. leprae were found in macrophages and Schwann cells, but their greatest concentration was observed in epineural tissues.

Figure 37.1 Interstitial neuritis in armadillos after experimental M. leprae infection. A cross-section of the ulnar nerve in an infected armadillo reveals large mononuclear cell infiltrates (arrows) containing abundant acid-fast organisms. (Fite & hematoxylin; original magnification x 400).

Animal species Armadillos are small mammals of the superorder Edentata (Storrs, 1971). Lacking true teeth, they have only primitive molars and are unable to bite. They are equipped with short powerful legs and claws, which are well adapted to burrowing, and care must be taken when the animals are physically restrained in the laboratory. Armadillos have poor eyesight, but are especially sensitive to vibration. Amazingly agile, they can run rapidly. Adults weigh 3-5 kg, measure approximately 40 cm long and stand 20 cm

THE ARMADILLO LEPROSY MODEL WITH PARTICULAR REFERENCE TO LEPROMATOUS NEURITIS

from the floor. There are no established means to reliably estimate the age of individual animals, but they can be stratified into adult and subadult categories using a combination of weights and plasma progesterone concentrations (Truman et aL , 1991). The armadillo's head, shoulders and pelvic area are covered by a hard carapace that is connected in the middle by nine movable bands interspaced by folds of skin (Talmage and Buchanen, 1954), from which it derives its name, the Spanish meaning 'little armored one' (Smith and Doughty, 1984). The carapace affords good protection but also lends to poor thermal regulation (Talmage and Buchanen, 1954). The armadillo's normal core body temperature ranges from 30-35~ fluctuating with ambient conditions. Armadillos pant at 39~ and shiver at 16~ (Johansen, 1961).

Preparation of animals Armadillos exhibit polyembryony and delayed implantation. They regularly give birth to monozygotic quadruplets and delays of up to 3 years between natural mating and birth have been reported (Storrs et aL, 1988a). However, they reproduce only rarely in captivity and in most cases captive females cannibalize their young within a few days of parturition (lob et aL, 1984). There are no reliable commercial vendors and armadillos must be obtained from the wild for investigative purposes. The principal maladies associated with housing and their medical needs have been reviewed elsewhere (Truman and Sanchez, 1993). They suffer immediate, severe captive stress reactions that seem to never entirely subside; these are the single greatest source of loss for the colony. Plasma corticosteroid concentrations among indoor-housecl armadillos may equal or exceed those of free-ranging animals enduring a hard winter (Rideout et aL, 1985). Injections and bleeding are accomplished through the saphenous and subclavian veins. Armadillos respond well to most antibiotics and injectable or gas anesthetics in dosages appropriate for cats. The principal requirement for containment is a sturdy unit capable of withstanding this strong animal's constant digging and clawing (Gilbert and Giametti, 1972; Burchfield et aL, 1976). They easily burrow to depths of 2 metres and are not contained by moats. Each requires at least 1 m 2 of cage space. Usually nocturnal, armadillos react to photo-period and other environmental cues (Johansen, 1961; Smith and Doughty, 1984). Insectivorous to omnivorous in nature, a number of diets have been described for suitable maintenance of the animals (Meritt, 1973; Ramsay et aL, 1981). Menadione requirements, however, are 10-fold greater than what is usually present in most commercial carnivore diets and a source of vitamin K must be added to armadillo feed in order to maintain the animal's blood clotting ability.

333

The principal use of armadillos has been for the in-vivo propagation ofM. leprae. Wild-caught armadillos obtained from non-enzootic areas are conditioned to captivity over a 6-month period. Screening for sylvatic M. leprae infection includes histopathological examination of ear biopsies and buffy coat blood samples for acid fast bacteria (AFB), and serologic testing for M.-leprae-specific antibodies (Truman et al., 1986a). For in-vivo propagation of M. leprae armadillos are maintained at 22 ~C, to produce an internal temperature of approximately 32 ~C.

Experimental infection with M. leprae Experimental leprosy infections are initiated with bacilli derived from human biopsy material, armadillos, or nude mice. The incubation period is shortest when high doses (5 • 108 to 2 • 109) of M. leprae are delivered intravenously, although respiratory routes are also effective (Truman, unpublished observations). Bacilli rapidly become lodged in reticuloendothelial tissues, where they slowly proliferate and later disseminate predominantly to cooler regions of the body such as ears, nose, tongue, and footpads, as well as to the nasopharynx, bronchi, and lungs (Job et al., 1985b). The specific response and time course of experimental leprosy varies between individual animals; incubation periods range from 10 months to 4 years (Job et aL, 1985b). The disease produces few visual clues, and the earliest sign of successful infection is typically a sustained progressive evolution of IgM antibody to the major M.-leprae-specific antigen phenolic-glycolipid-1 (PGL-1; Truman et aL, 1986a). Usually detected 6-9 months after inoculation, its appearance corresponds with a proliferation to approximately 106 M. leprae per gram in either liver, spleen, or lymph node tissue (Jobet al., 1992). PGL-1 IgM antibody levels progressively rise with increased bacillary dissemination and the antibody continues to be detectable over the remaining course of infection. In successful lepromatous infections, AFB disseminate throughout the body and are usually detectable in ear biopsies within 1 year. Most develop heavy infections within 24 months of inoculation, with approximately 1012recoverable bacilli in the liver and spleen (Truman et al., 1986a). The late stages of infection last about 5 months and are marked by chronic hypochromic, microcytic anemia (Job et al., 1992). Marked impairment of liver and renal function is observed (Table 37.1), and a characteristic lepromatous bronchopneumonia ensues. Contributions of the model. In contrast to the mouse footpad model (Shepard, 1960), armadillos present different levels of infection, involvement of multiple organ systems and, because of their large size, permit evaluation of medications given orally in feed or by capsule as well as percutaneously or intravenously. The natural course of infection in armadillos offers unique opportunities for

334

D . M . Scollard and R. W. Truman

Table 37.1 Representative clinical values for normal armadillos and animals experimentally infected with M. leprae manifesting fully disseminated late-stage disease (ALP-IFCC, alkaline phosphatase determined by International Federation of Clinical Chemists procedure; LDH-L, lactate dehydrogenase using I-lactate reaction

Test

Fully disseminated*

Normal-~

Chemistry:~ Glucose BUN Creatinine ALP (IFCC) LDH-L ALT

78 (+ 19) 24 (+ 7.6) 0.95 (+ 0.13) 86 (+ 13.7) 3394 (+ 1220) 9.7 (+ 5.5)

81 (+ 21) 24 (+ 6.5) 0.78 (+ 0.19) 64 (+ 22.6) 740 (+ 45) 6.4 (+ 3.2)

5.1 (+ 0.8) 9.8 (+ 1.5) 29 (+ 5.6) 58.1 (+ 2.2) 19.2 (+ 0.7)

6.9 (+ 0.3) 13 (+ 0.7) 40 (+ 3) 61 (+ 2) 19.5 (+ 0.5)

Hematology** RBC (x 108/ml) Hgb (g/dl) HCT (%) MCV (mu 3) MCH (pg)

* Mean and standard deviation from sacrifice blood samples of seven animals that yielded more than 109M. leprae per gram of liver tissue. 1 Means and standard deviation from 45 naive armadillos held in captivity for 60 days. :1:Chemistries determined on Ciba-Corning autoanalyzer with reagents and procedures according to manufacturers' recommendations. ** Performed on Coulter JT-3 gated for human cell types.

studies of relapse after chemotherapy and of long-term persistence ofM. leprae. Preliminary studies on clearance of dapsone (DDS) and related compounds indicate that rates of clearance are similar to those in mice (Truman, unpublished observations). Effective antimicrobial and anti-inflammatory treatment of neuritis is a high clinical priority in leprosy, and until now no model has been available in which this could be addressed experimentally. No other animal model has the capability to specifically examine issues related directly to nerve infection. Such issues, which can be examined in the armadillo model, include (1) how well each agent penetrates peripheral nerves; (2) how effective each of the agents is in killing iV/. lel2rae in nerve; and (3) whether such killing of M. leprae in nerves is entirely beneficial or whether it induces additional neuritis. Studies are under way to assess nerve conduction during the course of experimental leprosy in armadillos, possibly offering a non-invasive means of evaluating neurologic aspects of response to antimicrobial or anti-inflammatory treatment. In addition, basic studies related to the mechanisms of localization and entry of M. leprae into peripheral nerve may offer new avenues for prevention, treatment, and assessment of neuritis in this disease. Studies in progress indicate that M. leprae is localized primarily in the vicinity of blood vessels in the epineurium (Figure 37.2; Scol-

Figure 37.2 M. leprae in an epineural endothelial cell. This small vessel, closely approximated to the epineurium in a peripheral nerve of an experimentally infected armadillo contains several bacilli (arrows)in a large cytoplasmic vacuole. (Bar = 3 Bm).

lard et al., 1999). This is consistent with earlier reports indicating that cutaneous small blood vessels are major sites of bacillary localization in the skin (Balentine et aL, 1976; Coruh and McDougall, 1979; Boddingius, 1984; Burchard and Bierther, 1985; Mukherjee and Meyers, 1987), and suggest new avenues for investigation of the mechanisms by which M. leprae preferentially localizes to peripheral nerves. It will be of interest, for example, to determine whether or not armadillo nerves contain the same isoforms of laminin which have now been shown to bind M. leprae to the basement membrane of human Schwann cells (Rambukkana et aL, 1997). The complex cellular and molecular mechanisms of the immune response to M. leprae have maximal impact on the slender peripheral nerves that are uniquely vulnerable to this pathogen, and the resulting nerve injuries are the primary cause of the debility, deformity, and stigma associated with this infection. The armadillo is the only animal model suitable for assessment of such mechanisms in vivo, and future studies may help to devise new strategies for the prevention and treatment of nerve injury in leprosy.

Acknowledgments We are grateful to Ms Renee Painter for her assistance in preparing the manuscript. Portions of this work were supported by N I A I D contract Y02-AI-0015-01.

THE ARMADILLO LEPROSY MODEL WITH PARTICULAR REFERENCE TO LEPROMATOUS NEURITIS

References Adams, L. B., Krahenbuhl, J. L. (1996). Responses of activated armadillo macrophages to challenge with M. leprae (Abstract). American Society of Microbiology, New Orleans, LA. Balentine, J. D., Chang, S. C., Issar, S. L. (1976). Infection of armadillos with M. leprae: ultrastructural studies of peripheral nerve. Arch. Pathol. Lab. Med., 100, 175-181. Boddingius, J. (1984). Ultrastructural and histophysiological studies on the blood-nerve barrier and perineural barrier in leprosy neuropathy. Arch Neuropathol. (Bed.), 64, 282-296. Burchard, P. 1., Bierther, M. (1985). An electron microscopic study of small cutaneous vessels in lepromatous leprosy. Int. J. Lepr., 53, 70-74. Burchfield, H. P., Storrs, E. E., Walsh, G. P., Vidrine, M. F. (1976). Improved caging for nine-banded armadillos. Lab. Anita. Sci. 26(2), 234-236. Cho, S. N., Cellona, R. V., Fajardo, T. T. et al. (1991). Detection of phenolic glycolipid-1 antigen and antibody in sera from new and relapsed lepromatous patients treated with various drug regimens. Int. J. Lepr., 59, 25-31. Clements, B. R., Scollard, D. M. (1997). Leprosy. In Atlas of Infectious Diseases, vol VIII. External Manifestations of Systemic Infections (eds Mandell, G. L., Fekety, R.), Churchill Livingstone, Philadelphia, PA. Coruh, G., McDougall, A. C. (1979). Untreated lepromatous leprosy: histopathological findings in cutaneous blood vessels. Int. J. Lepr., 47, 500-501. Doull, J. A., Guinto, R. C., Rodriguez, J. N., Bancroft, H. (1945). Risk of attack of leprosy in relation to age at exposure. Am. J. Trop. Med., 25, 435-439. Gilbert, B. M., Giametti, L. (1972). An environmental caging system and maintenance program for the nine-banded armadillo Dasypus novemcinctus. Lab Anita. Sci., 22,739-740. Job, C. K., Kirchheimer, W. F., Sanchez, R. M. (1982). Tissue response to lepromin, an index of susceptibility of the armadillo to M. leprae infection - - a preliminary report. Int. J. Lepr., 50, 177-182. Job, C. K., Sanchez, R. M., Kirchheimer, W. F., Hastings, R. C. (1984). Attempts to breed the nine-banded armadillo Dasypus novemcinctus in captivity: a preliminary report. Int. J. Lepr., 52, 362-364. Job, C. K., Sanchez, R., Hastings, R. C. (1985a). Effect of repeated lepromin testing on experimental nine-banded armadillo leprosy. Indian J. Lepr, 57, 716-727. Job, C. K., Sanchez, R. M., Hastings, R. C. (1985b). Manifestations of experimental leprosy in the armadillo Dasypus noverncinctus. Am. J. Trop. Med. Hyg., 34, 151-161. Job, C. K., Sanchez, R., Hunt, R., Hastings, R. C. (1987). Prevalence and significance of positive Mitsuda reaction in the nine-banded armadillo (Dasypus novemcinctus). Int. J. Lepr., 55, 685-688. Job, C. K., Drain, V., Truman, R. W., Deming, A. T., Sanchez, R. M., Hastings, R. C. (1992). The pathogenesis of leprosy in the nine-banded armadillo and the significance of IgM antibodies to PGL-1. Indian J. Lepr., 64, 137-151. Johansen, K. (1961). Temperature regulation in the nine-banded armadillo (Dasypus novemcinctus). Physiol. Zool., 34, 126-144. Kirchheimer, W. F., Storrs, E. E. (1971). Attempts to establish the armadillo (Dasypus novemcinctus) as a model for the study of leprosy, Part 1. Report of lepromatoid leprosy in an experimentally infected armadillo. Int. J. Lepr., 39, 693-702.

335

Kirchheimer, W. F., Sanchez, R. M., Shannon, E. I. (1978). Effect of specific vaccine on cell-mediated immunity of armadillos against M. leprae. Int. J. Lepr., 46, 353-357. Krahenbuhl, J. L., Adams, L. B. (1999). Mycobacterium leprae 9 as an opportunistic pathogen. In Opportunistic IntraceUular Pathogens and Immunity (ed. Friedman, H.), Plenum Publishing, New York, pp. 75-90. Krotoski, W. A., Mroczkowski, T. F. et aL (1993). Lepromin skin testing in the classification of Hansen's disease in the US. Am. J. Med. Sci., 305, 18- 24. Lathrop, G., Scollard, D. M., Dietrich, M. (1997). Reactivity of a population of armadillo lymphocytes with an antibody to human 7, 8 cells. Clin. ImmunoL ImmunopathoL, 82, 68-72. McDougall, C. (1997). Bacillary and histopathological findings in the peripheral nerves of armadillos experimentally infected with M. leprae (letter). Int. J. Lepr., 65,260. Meritt, D. A. lr (1973). Edentate diets. Part 1: Armadillos. Lab. Anirn. Sci., 23,540-542. Modlin, R. L., Rea, T. H. (1994). Immunopathology of leprosy. In Leprosy (ed. Hastings, R. C.), pp. 225-234. Churchill Livingstone, New York. Mukherjee, A., Meyers, W. M. (1987). Endothelial cell bacillation in lepromatous leprosy; a case report. Lepr. Rev., 58, 419-424. Nelson, K. E. (1998). Leprosy. In Textboo k of Public Health, 14th edn. (eds Maxcy, Rosenau and Last). Appleton-CenturyCrofts, Norwalk, CT. Rambukkana, A., Salzer, J. L., Yurchenco, P. D., Tuomanen, E. I. (1997). Neural targeting of M. leprae mediated by the G domain of the laminin-0~2 chain. Cell, 88, 811-821. Ramsey, P. R., Tyler, D. F. Jr., Waddill, J. R., Storrs, E. E. (1981). Blood chemistry and nutritional balance of wild and captive armadillos Dasypus novemcinctus. Comp. Biochem. Physiol. A Comp. Physiol., 69, 517-522. Rideout, B. A., Gause, G. E., Benirschke, K., Lasley, B. L. (1985). Stress-induced adrenal changes and their relation to reproductive failure in captive nine-banded armadillos Dasypus novemcinctus. Zoo Biol., 4, 129-138. Ridley, D. S., Jopling, W. H. (1966). Classification of leprosy according to immunity. A five-group system. Int. ]. Lepr., 34, 255-273. Santos-Argumedo, L.,. Guerra-Infante, F., Quesada-Pascual, F., Estrada-Parra, S. (1995). Identification and purification of armadillo immunoglobulins: preparation of specific antisera to evaluate the immune response in these animals. Int. ]. Lepr., 63, 56-61. Scollard, D. M., Truman, R. W. (1997). Reply to Dr McDougall (letter). Int J. Lepr, 65, 261. Scollard, D. M., Lathrop, G. W., Truman, R. W. (1996). Infection of distal peripheral nerves by M. leprae in infected armadillos: an experimental model of nerve involvement in leprosy. Int. J. Lepr, 64, 146-151. Scollard, D. M., McCormick, G. T., Allen, 1. (1997). Early localization of M. leprae to epineural blood vessels (abstr)J. Fed. Exp. Soc. Exp. BioL Med., A671, Scollard, D. M., McCormick, G. T., Allen, J. L. (1999) Localization of M. leprae to endothelial cells of epineurial and perineurial blood vessels and lymphatics. Am. J. Pathol. (In press.) Shannon, E. J., Powell, M. D., Kirchheimer, W. F., Hastings, R. C. (1984). Effects of M. leprae antigens on the in vitro responsiveness of mononuclear cells from armadillos to Concanavalin-A. Lepr. Rev., 55, 19-31.

336

Shepard, C. C. (1960). The experimental disease that follows the injection of human leprosy bacilli into foot pads ofmice.]. Exp. Med.,ll2, 445-454. Skinsnes, O. K. (1964). Immunological spectrum of leprosy. Iri Leprosy in Theory and Practice (eds Cochrane, R. G., Davey, T. F.), pp. 156-182. John Wright, Bristol. Smith, L. L., Doughty, R. W. (1984). The Amazing Armadillos. Geography of a Folk, Critter. University of Texas Press, Austin, TX. Storrs, E. E. (1971). The nine-banded armadillo, a model for leprosy and other biomedical research. Int. ]. Lepr., 39, 703-714. Storrs, E. E., Burchfield, H. P., Rees, R. 1. W. (1988a). Superdelayed parturition in armadillos: a new mammalian survival strategy. Lepr. Rev., 59, 11-15. Storrs, E. E., Walsh, G. P., Burchfield, H. P., Binford, C. H. (1988b). Leprosy in the armadillo: new model for biomedical research. Science, 183, 851-852. Talmage, R. V., Buchanen, C. D. (1954). The armadillo (Dasypus noverncinctus). A review of its natural history, ecology, anatomy, and reproductive physiology. Rice Institute Pamphlet Monograph in Biology, XLI(2), 1-135. Truman, R. W. (1994). Environmental associations for M. leprae. In Environmental Contaminants, Ecosystems, and Human Health (eds Majumdar, S. K., Miller, E. W., Brenner, F. 1.) pp. 437-449. Pennsylvania Academy of Sciences, Easton, PA. Truman, R. W., Sanchez, R. M. (1993). Armadillos: models for leprosy. Lab. Anirn., 22, 28-32. Truman, R. W., Morales, M. 1., Shannon, E. 1., Hastings, R. C. (1986a). Evaluation of monitoring antibodies to PGL-1 in

D . M . Scollard and R. W. Truman

armadillos experimentally infected with M. leprae. Int. J. Lelar., 54,556-559. Truman, R. W., Shannon, E. J., Hagstad, H. V., Hugh-Jones, M. E., Wolff, A., Hastings, R.C. (1986b). Evaluation of the origin of Mycobacteriurn leprae infections in the wild armadillo Dasypus-novemcinctus. Am. J. Trop. Med. Hyg., 35,588-593. Truman, R. W., lob, C. K., Hastings, R. C. (1990). Antibodies to the phenolic glycolipid-1 antigen of Mycobacterium leprae for epidemiologic investigations of leprosy in armadillos (Dasypus novemcinctus). Lep. Rev., 61, 19-24. Truman, R. W., Kumaresan, 1. A., McDonough, C. M., lob, C. K. (1991). Seasonal and spatial trends in the detectability of leprosy in nine-banded armadillos. Epidemiol. Infect., 106, 549-560. Vadiee, A. R., Shannon, E. 1., Gillis, T. P., Mshana, R. N., Hastings, R. C. (1988). Armadillo IgG and IgM antibody responses to phenolic glycolipid-1 during experimental infection with M. leprae. Int. J. Lepr., 56, 422-427. Vadiee, A. R., Harris, E., Shannon, E. I. (1990). The evolution of the antibody response in armadillos infected with M. leprae. Lepr. Rev., 61,215-226. Walsh, G. P., Meyers, W. M., Binford, C. H. (1986). Naturally acquired leprosy in the nine-banded armadillo, Dasyl2us novemcinctus, a decade of experience 1975-1985. J. Leukocyte BioL, 40, 645-656. West, B. C., Todd, J. R., Lary, C. H. (1988). Leprosy in six isolated residents of northern Louisiana. Arch. Intern. Med., 148, 1987-1992.

Chapter 38

Models of Leprosy Infection in Mice B. Ji and L. Levy

Introduction Although Mycobacterium leprae was the first human bacterial pathogen to be recognized, by Hansen in 1873, it has yet to be cultivated on artificial media. In the absence of a method for cultivation in vitro, "cultivation" of the organisms in the animal has proved to be an important and most useful alternative for leprosy research. Before 1960, countless efforts to develop an animal models of leprosy and to obtain multiplication of M. leprae in an animal had ended in failure. In 1960, Charles C. Shepard described (1960a, b) a method for cultivation of M. leprae in vivo. Application of the technique has proved of immense value in leprosy research and has made possible the screening of new drugs and new combined-drug regimens, and assessment of their efficacy in chemotherapy in a specific and quantitative manner, providing information of critical importance to efforts to control leprosy. Two major factors contributed greatly to Shepard's success in establishing the mouse footpad technique. First, the fact that leprosy affects predominantly the skin, nasal mucosa and peripheral nerves suggested that the temperature at which M. leprae multiplies optimally is less than 37~ (Brand, 1959); based on the demonstration by Fenner (1956) of multiplication in the footpads of mice of M. ulcerans and M. marinum, for which the optimal temperature for multiplication in vitro is lower than 37~ Shepard inoculated M. leprae recovered from skin biopsy specimens or from the sediment of nasal washings from untreated patients with lepromatous leprosy into the hind footpads of mice, in which the temperature is cooler, about 30~ at an ambient temperature of 20-25~ as compared with the 37~ of the core temperature. Second, Shepard counted the organisms inoculated and later harvested by direct microscopy, and regularly sacrificed mice in order to examine the inoculated footpads histopathologically; this permitted detection of the limited and extraordinarily slow multiplication of M. leprae in the footpads of immunocompetent (hereafter "normal") mice, which occurred after inoculation of a small number of organisms, i.e. 104 per footpad or fewer, without gross lesions. In chronological order, the subsequent important contributions to the animal models were the demonstration of the

Handbook of Animal Models of Infection ISBN 0-12-775390-7

greater susceptibility to infection by M. leprae of thymectomized and irradiated mice (Rees, 1966), nine-banded armadillos (Dasypus novemcinctus; Kirchheimer and Storrs, 1971), the congenitally athymic "nude" mouse (Colston and Hilson, 1976; Kohsaka et aL, 1976), and the neonatally thymectomized rat (Fieldsteel and Levy, 1976). Laboratory mice are convenient to work with, permit multiplication of M. leprae after inoculation of a few viable organisms, and the results of multiplication are remarkably consistent and reproducible. Although the armadillo is much more difficult to handle, it may harbor very much larger numbers of M. leprae than do normal mice; yields of 10 '2 M. leprae (approximately 300 mg wet weight of organisms) per armadillo, a million times the number of organisms yielded by a normal mouse, are not uncommon. Consequently, armadillos have primarily been used for the production of M. leprae. Because mice are widely used to screen new drugs, to test the drug susceptibility of the isolates of M. leprae and to assess the therapeutic efficacy of new drugs or regimens in clinical trials, this chapter is devoted mainly to a description of infection by M. leprae of both immunocompetent and immunodeficient mice, and the important applications of these experimental models.

Basic laboratory techniques for establishing the mouse model Recovery of M. leprae from human biopsy specimens The preferred sites for biopsy are the skin lesions with the largest bacterial indices in skin smear examination. The patient's wishes should be taken into account; in particular, biopsy from the face should be avoided. In general, a full-thickness specimen 4 - 5 m m in diameter, weighing 40-80mg, is sufficient. The biopsy specimen is trimmed free of fat, weighed, placed in a sterile Petri dish to which one or two drops of Hanks's balanced salt solution (HBSS) have been added, and minced with sharp scissors. The minced tissue is than transferred on the blades of the scissors to the piston of a ten Broeck tissue grinder of 15 ml Copyright 9 1999Academic Press All rights of reproduction in any form reserved

338

B. Ji and L. Levy

capacity, 2 ml HBSS is added and the tissue is ground until lumps of tissue can no longer be detected. The resulting tissue homogenate is transferred to a sterile test tube. An aliquot of the suspension is taken for preparation of smears for counting.

Counting acid-fast bacilli (AFB) in the tissue Microscope slides with fused ceramic circles, each about 1 cm in diameter, on their surfaces are employed for counting. The diameter of the circles must be measured on slides selected at random from each new lot; this can be done to an accuracy of 0.01 cm with the microscope by means of the vernier on the mechanical stage. To prepare smears for counting AFB, 10btl of formolmilk is first applied to each of the circles. Then, 10 btl of the suspension to be counted is added to the circle, and the liquids are immediately mixed and carefully spread over the entire area of the circle with the aid of a platinum wire that has been bent to an angle of 60 ~ . One circle is completed before the aliquot of suspension is added to the next; the wire is flamed between circles. The 10 btl volumes may be delivered with disposable capillary micropipettes or with an automatic micropipette that uses disposable, autoclavable tips. These operations are carried out on a levelling table on which the slides remain until dry. The smears are then fixed by exposure to formaldehyde fumes and controlling heating, and stained by the room-temperature acid-fast staining technique described by Shepard and McRae (1968). The AFB are counted under optimal microscope conditions, employing K6hler illumination, an 100• apochromatic oil-immersion objective and 10-12.5 • compensating oculars. The AFB are counted in fields selected every 0.5mm across the equator of each of the three circles, employing the scale on the mechanical stage; thus, if the diameter of the circle is 1 cm, about 20 fields per circle or a total of 60 fields per slide are examined. When 10 btl of suspension has been spread over a circle of diameter D, and the diameter of the oil-immersion field is d, the following formula applies, expressing D and d in the same unit of measurement: No. AFB

No. AFB counted =

ml sample

1 ml X

No. fields examined No. AFB counted

(D/2) 2 X

10 btl

(d/2) 2

x 100 • (D/d) 2

No. fields examined in which (D/d) 2 is the number of microscope fields per circle. The results of the counting may be presented as the number of organisms per milliliter of tissue suspension, per footpad, or per milligram of tissue. In a far advanced, previously untreated lepromatous leprosy patient, as many as 108M. leprae may be recovered from a skin biopsy specimen, or 106 organisms/mg of tissue. However, in most multibacillary patients, significantly fewer M. leprae are recovered.

Inoculation of mouse footpads The number of M. leprae inoculated per footpad depends upon the immunological status of the mice. Normal mice are usually inoculated with 5 x 103 to 1 • 104 organisms per footpad. Although one might theoretically inoculate nude mice with any number of AFB, it is rarely possible to inoculate more than 5 x 106 per footpad because of its small size, which limits the volume of the inoculum to 0.03ml per footpad. Moreover, the number of AFB that can be inoculated into the footpads of nude mice is also limited by the number of M. leprae that may be recovered from a skin biopsy. Very often, both hind footpads of the mouse are inoculated. Employing a 0.5 ml or 1.0 ml syringe and a sharp 27 G or 30G needle, the suspension is injected subcutaneously into the footpads. Instead of injecting a measured volume, which is difficult and time-consuming, injection of the suspension is continued until the tissues of the footpad are filled; the initial volume of the suspension in the syringe is recorded, as is the volume remaining after a group of mice has been inoculated, and the average volume per inoculum is calculated. In general, this volume is close to 0.03 ml.

Harvesting M. leprae from inoculated mouse footpads Depending upon the objectives of the inoculation, 3 - 6 months after inoculation two to four mice are sacrificed by cervical dislocation, and the inoculated feet are cleaned with soap and water with the aid of gauze squares, rinsed with sterile water and dried with sterile gauze squares. The footpads are harvested individually or as a pool. Footpad tissues are removed in three layers m s k i n and subcutaneous tissue, tendon and muscle m with a sterile scalpel and haemostat. The tissues from an individual footpad, or the pooled tissues if the footpads are pooled, are minced and homogenized, as is done for skin biopsy specimens, smears are prepared from the resulting tissue suspension and the AFB are counted. When the total volume of a suspension prepared from the tissues of a single footpad is 2.0 ml, the diameter (D) of the circle is 1.13 cm and the diameter (d) of the oil-immersion field is 0.018 cm, the lower detectability level of the counting method, i.e. detection of a single bacillus in the course of examining 60 oil-immersion fields in three circles, is 1.3 • 104 AFB per footpad. There are several ways to present the results of the harvests: the number ofM. leprae from each harvested footpad; the mean number of organisms per footpad harvested from a given group at a specific interval after inoculation; and the number of footpads showing multiplication of M. leprae as a fraction of the number of footpads harvested. Multiplication of M. leprae is defined as a yield of 105 or more organisms per footpad if the inoculum was 10a per footpad or less, or a twofold or greater increase over the number inoculated if the inoculum was 105 per footpad or more (li et aL, 1996a).

MODELS OF LEPROSY INFECTION IN MICE

Immunocompetent

(normal)

339

mouse

"O t~ Q.

model

o

10

L

Mice are readily available laboratory animals and easy to maintain. Although mice of inbred strains provide genetically uniform individuals, and although the maximum number of M. leprae harvested from BLAB/c, CBA as well as CFW mice may be greater than in A/J and C57BL mice in some experiments (Shepard and Habas, 1967), the overall influence of the inbred strain on multiplication ofM. leprae in the footpads appears to have been marginal (Shepard, 1981), and most laboratories have reported satisfactory multiplication in outbred "Swiss" mice. After inoculation of 5 x 10~ to 1 x 104 ]~//. leprae per footpad, AFB may be detectable in the inoculated footpads within 3-6 months; subsequently, the number of organisms increases gradually to a maximum of about 106 per footpad, after which the number remains constant or declines slightly (Figures 38.1, 38.2). One may thus identify the lag, logarithmic and stationary phases of the multiplication. The "doubling time" or "generation time", i.e. the average interval required for each twofold increase in the number of organisms, of M. leprae during the logarithmic phase of multiplication is 11-13 days (Levy, 1976). This is an extraordinarily long doubling time compared to that of other microorganisms, including mycobacteria. The maximum bacterial multiplication varies slightly among strains of mice and of M. leprae; the mean value is approximately 1 x 106 to 3 x 106 but never reaches 107 per footpad in normal mice. If the maximum is 107 or more, it is likely that either the counting procedure is in error or that the mice have become contaminated by mycobacteria other than 11/1.leprae. The stationary or "plateau" phase represents, in fact, the

"ID t~ Q.

*."

O O q,.

7

9 ! 9

Q.

6 .

.-O E

:~ to

9

5

9

9

=

!

=

"

=

.

;

=

9

! ,

9 !

I

i

Q.

9

~

8

~

z

~

a

E =

5

~

4

~

a

C o 0

:-

Normalmice Nude micI ~

T

]" . / "

| -

~''~"'"~ J-

1

Lower limit of detectability = 13 200 AFB per footpad

I |

'

I

Months after inoculation

Figure 38.2 Growth curves of M. leprae in the footpads of normal and nude (nu/nu) mice that had been inoculated with 5 x 103 AFB per footpad.

effects of the immune response of the mouse. Evidence for this is the failure of multiplication when normal mice are inoculated with 105 organisms per footpad or more (Shepard, 1960a, b), the resistance ofM. leprae-infected mice to a second challenge with M. leprae (Levy, 1975; Shepard et al., 1976) and the higher ceiling to multiplication in immunosuppressed rodents (Rees, 1966; Colston and Hilson, 1976; Fieldsteel and Levy, 1976; Kohsaka et al., 1976). After the plateau is reached, the number of AFB in the footpad remains relatively constant, but the proportion of viable M. leprae decreases (Welch et al., 1980). If one wishes to pass the strain to another batch of mice, subinoculation should be carried out as soon as the plateau has been reached. The same maximum multiplication of M. leprae was encountered in the immunocompetent laboratory rat (Hilson, 1965), hamster (Mesocricetus auratus; Waters and Niven, 1966), gerbil (Meriones unguiculatus; Shepard, 1960b) and mystromys (Mystrornys rnystrornys; Binford, 1968) as in normal mice, despite the much larger size of their footpads. Therefore, these animals have not been widely used for experimental work in leprosy.

9

9Lower limit of detectability = 13 200 AFB per footpad 4

Nude

mouse

model

m

|

3

0

2

4

6

8

10

12

14

Months after inoculation

Figure 38.1 Results of harvests of M. leprae from the normal mice that had been inoculated with 5 x 103 AFB per footpad. Harvests were begun 2 months after inoculation and repeated at intervals of 1 or 2 months. At each interval, eight footpads were harvested individually. Each point represents the result of harvest from a single footpad. Because some results were identical, the numbers of points at each interval may be less than eight. The lower limit of detectability of the counting method is 1.3 x 104 organisms per footpad.

In the footpads of thymectomized and whole-bodyirradiated (TR) mice, M. leprae continues to multiply to a maximum of 107-108 per footpad in the course of 2 years following inoculation with 5 x 103 organisms, and swelling of the inoculated foot has been observed in about 10% of TR mice (Rees, 1966; Rees et aL, 1967; Shepard, 1985). Because they permit multiplication from a larger inoculum of M. leprae than do normal mice, TR mice were used to detect the persisting M. leprae in a large clinical trial, a procedure that requires inocula of 10s AFB per footpad or more (Subcommittee of THELEP, 1987). However, thymectomy

B. Ji and L. Levy

340

and whole body irradiation resulted in poor survival of the mice (Shepard, 1985). M. leprae may also multiply after inoculation of larger numbers of the organisms in the footpads of neonatally thymectomized rats (NTR; Fieldsteel and Levy, 1976) and athymic (nude) rats (Colston et al., 1979), but in none of them was the multiplication ofM. leprae greater than was encountered in the TR mice. In addition, rats are much more difficult to work with than mice. Therefore, immunosuppressed or natively immunodeficient rats have rarely been used to assess the therapeutic effects in clinical trials (Gelber and Levy, 1987). On the other hand, various lines of nude mouse are commercially available in large quantities. In addition, they permit the use of larger inocula of M. leprae than do TR mice (McDermott-Lancaster et al., 1987). Consequently, since the beginning of the 1990s, the nude mouse has largely replaced the TR mouse in leprosy research. Because the nude mouse is congenitally athymic, it lacks mature T lymphocytes and is extremely vulnerable to infections by many bacteria and viruses that are regarded as non-pathogenic for normal mice. Consequently, with few exceptions (Rungruang et al., 1983), nude mice do not survive long under conventional animal-house conditions. For leprosy research, the lifespan of the nude mouse should be maintained to a similar length to the normal mouse, otherwise the advantages of using nude mice (see below) disappear. To prevent the death of nude mice from contamination by pathogens other than M. leprae, they must be bred and maintained under a germ-flee or specificpathogen-flee isolator or laminar-flow rack, and everything that comes into contact with them, including the air, must be sterile. Therefore, the husbandry of nude mice is far more difficult and demanding than that of normal or other immunodeficient mice, and requires considerable investment in terms of equipment, manpower and operational costs. In one of our experiments involving 180 female Swiss nude mice, all but 5% of the animals survived the first year, and losses during the period 12-18 months after inoculation accounted for only an additional 10% (Ji et al., 1996a); thus, under optimal conditions, the mortality of nude mice may be reduced to that of normal mice. As shown in Figure 38.2, when mice are inoculated with 5 • 103 M. leprae per footpad, the organisms multiply to the level of 106 per footpad at the same rate in both normal and nude mice. Thereafter, however, multiplication ceases in normal mice, whereas it continues in nude mice. Although it was reported that, in nude mice, the maximum multiplication is of the order of 5• 10'~ AFB per footpad, achieved 12-18 months after inoculation (McDermott-Lancaster et aL, 1987), this is not always the case. In the experiment presented in Figure 38.2, multiplication slowed gradually after the number of organisms reached 108 per footpad and virtually ceased after the number had reached 1 0 9, suggesting that in nude mice mechanisms independent from T lymphocytes may also restrict the multiplication of M. leprae. Some 10-12 months after inoculation, when the number

ofM. leprae exceeded 108 per footpad, more than 90% of the inoculated footpads were swollen (li et aL, 1996a); thereafter, the swelling gradually intensified, often ending in ulceration of the footpad. Another important feature of the process following inoculation of M. leprae into the footpads of nude mice is the dissemination of the organisms to uninoculated footpads, snout, testes, lymph nodes, tail-skin, ears, liver, spleen and tongue (Colston and Hilson, 1976; Kohsaka et aL, 1976; Chehl et aL, 1983).

Major applications of mouse models Experimental applications

Drug screening In the absence of a method for cultivating the organisms in cell-free media, M. leprae infection in the footpads of normal mice represents the only universally accepted system for screening drugs for activity against the organisms. Three methods have been employed in drug screening: (1) the continuous method; (2) the kinetic method; and (3) the proportional bactericidal method.

Continuous metkod. This was the first technique employed for demonstrating the anti-M, leprae activity of a drug in mice (Shepard and Chang, 1964). After inoculation with 5 x 103 or 1 x 104 M. leprae per footpad, the mice are divided among untreated control and treated group(s) with 10-20 mice in each. In the treated group, the drug is administered from the day of inoculation until the mice are sacrificed. If the compound to be screened is well absorbed after oral administration, it is administered either by gavage or by being incorporated into mouse chow (see below). If nothing is known of the activity of the drug against M. leprae, it is administered in the largest dosage tolerated by the mice. Multiplication ofM. leprae in the untreated control group is monitored by interval harvests. When evidence of multiplication is unequivocal, i.e. the mean number of AFB has reached 5x 105 per footpad, harvests are performed from the footpads of both control and treated mice. An active treatment is one that inhibits multiplication of M. leprae. If, on two successive occasions approximately 1 month apart, the number of AFB harvested from treated mice falls below the range of the results of four simultaneous harvests from control mice, the treatment can be stated to have been active, with a probability of 0.04. Having established that a drug is active, one may, by the same method, establish the minimal effective dosage (MED)--the smallest dosage of the drug that produces an anti-M, leprae effect. The minimal inhibitory concentration (MIC) of the drug is its concentration in the serum or plasma of mice administered the drug in the MED. This continuous method is the most sensitive method in detecting activity of treatment against M. leprae. However,

MODELS OF LEPROSY INFECTION IN MICE

341

it cannot distinguish between merely bacteriostatic and bactericidal activity. Many drugs exhibit bacteriostatic activity against M. leprae, whereas only a few are bactericidal (Shepard et aL, 1971); yet, only bactericidal drugs may be considered as potential components of multidrug regimens to be employed in treating patients and in leprosy control. Another disadvantage of the method is that it requires a rather large quantity, usually more than 10 g, of the drug. Unless the compounds are being produced commercially or are undergoing active development, the pharmaceutical firms are often unable to provide such a quantity.

Kinetic method. The method is identical to the continuous method, except that the compound to be screened is administered for only a limited period, usually beginning 60 days after inoculation, at which time the organisms are in early or mid-logarithmic phase, and continuing for 60-90 days (Shepard, 1967, 1969). The activity of the drug is assessed in terms of the "growth delay", determined by comparing the growth curves of the treated and untreated control mice. A purely bacteriostatic drug is one that inhibits multiplication of M. leprae only as long as the drug is administered; the growth curve of 3/1. leprae in mice treated by such a drug is parallel to, but lags behind that in the control mice by a period of time no greater than that during which the drug was administered. The absence of bactericidal activity is reliably demonstrated by this approach. The failure of bacterial multiplication to resume immediately following cessation of drug administration suggests that M. leprae are killed during treatment, or that prolonged bacteriostasis (also termed "bacteriopause") has occurred. Prolonged bacteriostasis may result from persistence of the drug in the tissues or within the organisms, or it may reflect the recovery of organisms that have been reversibly damaged. Thus, the

kinetic method can distinguish between purely bacteriostatic and so-called "bacteriocidal-type" activity (Shepard et al., 1971), but it cannot distinguish between purely bacteriopausal and bacteriocidal activity, unless there is total failure of resumption of bacterial multiplication after cessation of drug administration.

Proportional bactericidal method. This method may clearly identify the bactericidal activity of the treatment. Groups of mice are inoculated with serially 10-fold diluted suspensions of M. leprae, ranging from 5 • 10-' (0.5) or 1 • 10~ (1) organism to 5 • 103 or 1 • 104 organisms per footpad. Control mice are left untreated, whereas other groups of mice are treated for a period of time that varies, depending on the drug, from 1-60 days. After treatment, the mice are then held for 12 months, a period of time theoretically sufficient to permit a single surviving organism to multiply to a readily detectable level. Harvests of M. leprae are then performed from individual footpads, usually 10 per dilution ofinoculum for each drug or drug concentration. The M. leprae are considered to have multiplied (or, at least one organism to have survived the treatment)in those footpads found to contain 105 AFB or more. The proportion of viable M. leprae remaining after the treatment and the significance of differences between the groups are calculated in terms of the median infectious dose by the method of Spearmen and K~irber (Shepard, 1982). If the largest inoculum was 5 • 103 AFB per footpad, a proportion of viable M. leprae as small as 0.00006 may be measured. One may then calculate the proportion of viable M. leprae killed by the treatment by comparing the proportions of viables in treated and control mice. Application of this method is demonstrated in an experiment in which the bactericidal effects against M. leprae of single doses of several combinations of drugs were measured (Table 38.1). The

Table 38.1 Testing the bactericidal effect of various treatments against M. leprae in mice by proportional bactericidal method

Proportion of footpads showing multiplication* of M. leprae with inoculum Group no. and regimen (mg/kg) 1. 2. 3. 4. 5. 6. 7. 8. 9.

Untreated control RMP (10)1One month MDT:I: OFLO (150) + MINO (25)1OFLO (300) + MINO (50)1CLARI (100) + OFLO (150) + MINO (25)1RMP (10) + OFLO (150) + MINO (25)1RMP (10) + OFLO (300) + MINO (50)1RMP (10)+ CLARI (100) + OFLO (150) + MINO (25)1-

5• 10/10 10/10 2/10 10/10 10/10 10/10 10/10 10/10 10/10

a

5 x102

5x10'

10/10 9/10 0/10 10/10 10/10 10/10 9/10 6/10 3/10

10/10 2/10 0/10 10/10 3/10 9/10 0/10 2/10 0/10

5x10 ~ 5x10-' 3/10 0/10 0/10 1/10 2/10 0/10 1/10 0/10 0/10

2/10 -

Proportion of viable M. leprae

% of M. leprae killed

13.77 0.55 0.007 5.48w -- 6.90** 1.38w - 2.18** 3.46 0.44 0.28 0.09

96.0 99.95 49.91-1- -- 60.2:H: 84.21-1- - 90.0:H: 74.9 96.8 98.0 99.4

* >_10~M. leprae harvested per footpad. :1:A single dose of 10 mg RMP/kg plus 0.01% DDS and 0.005% CLO in the mouse diet for 30 days. w Minimum estimated value, assuming that no multiplication of M. leprae would have occurred in mice inoculated with 5 x 10-'. ** Maximum estimated value, assuming that multiplication of M. leprae would have occurred in the same proportion of footpads in mice inoculated with 5 x10 -1 as those in mice inoculated with 5 x 10~ 11 Minimum killing rate, calculated from the maximum estimated proportion of viable organisms. :i::I: Maximum killing rate, calculated from the minimum estimated proportion of viable organisms.

342

activity of a single dose of the combination O F L O - M I N O was found to be dosage-related: the combination of 300 mg O F L O plus 50mg MINO per kilogram body weight was bactericidal, whereas the combination of the same drugs in half dosage was not.

Experimental chemotherapy of nude mice with established M. leprae infection The recent discovery of three classes of drug--ofloxacin (OFLO, a fluoroquinolone), clarithromycin (CLARI, a macrolide) and minocycline (MINO, a tetracycline derivative ) - - are bactericidal against M. leprae, suggested the possibility of designing new generation of M D T regimens, which may be more effective and of shorter duration than the standard regimen (Ji et aL, 1996a,b). However, the many possible combinations of the new drugs with the components of the standard regimen--rifampicin (RMP), dapsone (DDS) and clofazimine (CLO)mcannot all the tested in clinical trials; there are simply not enough suitable patients or qualified institutes where such trials may be carried out. In addition, ethical considerations prohibit the inclusion in clinical trials of some important controls, such as RMP monotherapy or the combination of DDS-CLO, making it difficult to assess the role of each component in the tested combinations. Moreover, the long duration of the clinical trials would delay by many years the application of truly useful new regimens to the control of leprosy. Experimental chemotherapy of nude mice with established M. leprae infection provides a means of testing all possible combinations and identifying a few candidate regimens that could then be studied more efficiently in the clinical trials. A study carried out in nude mice illustrates this application (Ji et aL, 1996a). Each hind footpad of 180 female Swiss nude mice was inoculated with 7.5• 105 M. leprae; 12.5 months later, swollen footpads were observed in 155 (93.4%) of the 166 surviving mice, and the mean number of AFB per swollen footpad was found to be 4x107. The 155 mice with swollen footpads were randomly allocated to an untreated group and 12 treated groups, and treatment was begun. By 24 weeks after the beginning o f treatment, the mean number of M. leprae per footpad had increased to 3x 108 among the control mice, whereas it had remained virtually unchanged among the treated mice; the solid ratio of the bacilli, i.e. the ratio of bacilli uniformly, brightly and intensely stained by carbol-fuchsin in acid-fast staining, was declining in all treated groups, but did not differ significantly among them. These results indicated that, as often seen in clinical trials, the assessment of the therapeutic effect cannot rely upon the determination of the bacterial population size, and the solid ratio was not sensitive enough to distinguish the therapeutic effect of weak regimens from that of potent regimens in nude mice. The only reliable method that can measure precisely the bactericidal effect of the treatment is to determine the proportion of viable

B. Ji and L. Levy

M. leprae in the bacterial population before and after treatment. As is done in clinical trials (Grosset et aL, 1990; li et aL, 1993, 1994, 1996c), the proportion of viable M. leprae in each group of mice was measured at regular intervals during the experiment. AFB were harvested from four footpads (two nude mice) of each group, suspended in HBSS and counted, after which the suspensions derived from the four footpads were pooled and the numbers of AFB were counted again. The pooled suspension was then serially 10fold diluted with HBSS for subinoculation; the AFB harvested from untreated mice and from those that had received only a single dose of any treatment were subinoculated only into normal mice, whereas the AFB harvested from nude mice that had been administered more than a single dose of treatment with RMP-containing regimens were subinoculated into both normal and nude mice. The maximal inoculum for normal mice w a s 10 4 AFB per footpad, and the inocula for nude mice were 105 AFB per footpad or the maximal available inoculum, which refers to the inoculation of 0.03 ml of undiluted suspension pooled from four footpads harvested simultaneously from the same group, and they always contained more than 106 AFB per 0.03 ml. In order to obtain results from 10 inoculated footpads for each of the serially 10-fold diluted suspensions, each dilution was subinoculated into both hind footpads of six normal or 10 nude mice. Harvests of M. leprae from the subinoculated footpads were carried out 12 months later. The organisms were considered to have multiplied (i.e. the inoculum contained viable organism) if 105 AFB per footpad or more were harvested from normal mice or, among the subinoculated nude mice, a twofold or greater increase over the number of organisms inoculated. The proportion of viable organisms in the suspensions and the significance of their differences were also calculated by the method of Spearman and K/irber (Shepard, 1982). If only normal mice are subinoculated with the maximal inoculum of 104 AFB per footpad, a proportion of viable M. leprae as small as 0.00003 may be measured; if both normal and nude mice are subinoculated with the maximal inoculum of 106 AFB per footpad, the smallest proportion of viable organisms that can be measured is 0.0000003, smaller by two orders of magnitude than the minimum proportion that can be measured by subinoculation of normal mice only. Typical results of such measurements are shown in Table 38.2. In M. leprae-infected nude mice, both the mean numbers of organisms per footpad and the mean proportion of viable M. leprae are considerably larger than those usually found in human biopsy specimens; consequently, the maximum available inocula prepared from infected nude mice are at least 10 times larger than in the suspensions prepared from human biopsies, with less variation among the individual footpads than is usual among human biopsy specimens. As a result, it is possible to measure the bactericidal activity of the treatment in nude mice with greater sensitivity and greater precision than in clinical trials.

MODELS OF LEPROSY INFECTION IN MICE

343

Table 38.2 Example of the results of determining the proportion of viable M. leprae in experimental chemotherapy in nude mice No. footpads showing multiplication* of M. leprae/footpads harvested, at the inoculum of Treatment

Nude mice

(mg/kg body weight~dose)

Maximum?

Untreated control RMP (10), single dose 0.01% DDS & 0.005% CLO in mouse diet, 4 weeks WHO/MDT for 4 weeks RMP (10) + CLARI (50) + MINO (25) daily, three doses RMP (10) + CLARI (50) + MINO (25) + OFLO (50) daily, three doses RMP (10) + CLARI (100) + MINO (50) once every 4 weeks, three doses

Proportion of viable

Normal mice 105

104

10a

102

10'

10~

M. leprae

6/10 3/10 0/10 0/10

4/10 1/10 0/10 0/10

10/10 9/10

9/10 5/10 5/10 0/10 0/10 2/10

7/10 4/10 1/10 0/10

10/10 10/10

9/10 6/10 10/10 0/10 1/10 9/10

0.069 0.017 0.00087 105 AFB per footpad. Maximum available inoculum in 0.03 ml.

Clinical applications

Drug susceptibility testing Measurement of the susceptibility to drugs of strains of M.

leprae recovered from leprosy patients is one of the most important applications of the mouse footpad technique. At present, susceptibility of the organisms to the three components of the multidrug therapy (MDT) regimenwRMP, DDS and C L O - - is of interest. An active-appearing lesion is biopsied, and M. leprae are recovered from the biopsy specimen by the method already described. Normal mice are inoculated with 5• 103 to 1 • 104 AFB per footpad and divided among a number of groups of 10-20 mice each. One group is held without treatment, and the mice of the remaining groups are treated, usually beginning immediately after inoculation and continued until sacrifice. Because they are well absorbed from the gastrointestinal tract, all three drugs may be administered per os, either incorporated into the mouse diet or by gavage; the former method is generally preferred because of its greater convenience. DDS is administered in one of three concentrations-0.0001, 0.001 and 0.01 g per 100g diet--whereas CLO is usually administered in one of the two concentrations-0.001 and 0.01 g per 100g diet; some "wild" strains appear to be resistant to 0.0001 g CLO per 100 g diet. A common source of error in testing drug susceptibility of M. leprae is inadequate mixing of drugs in the diet. Because the drug-diet mixture must be as uniform as possible, it is best to add the drug in solution and mix it in the diet by means of a liquid-solid blender. If only a solid-solid blender is available, a weighed portion of the powdered drug should first be diluted by a small quantity of some inert solid, such as lactose or the powdered diet, and one should then continue to dilute the drug gradually by adding weighed amounts of the powdered diet to the blender. If no

blender is available, exhaustive mixing by hand is required. When preparing a series of drug-containing diets, one should always begin with the diet containing the smallest concentration of the drug, especially in the case of a drug such as DDS, the MIC of which is of the order of 3 ng/ml for susceptible strains ofM. leprae. In this way, one may prepare diets of progressively greater concentration without stopping to wash the blender between diets. Although RMP can be incorporated into the mouse diet, it appears to be unstable in this situation, and its potency may diminish with time. Therefore, in testing the susceptibility of M. leprae to RMP, freshly prepared suspensions of RMP are administered by an esophageal cannula (gavage) in most laboratories (Grosset et aL, 1989). Because RMP displays powerful bactericidal activity against M. leprae, in measuring drug susceptibility, RMP is administered once weekly in a dosage of 10mg/1 kg body weight (Grosset et al., 1989). Approximately 6 months after inoculation, harvests of M. leprae are performed individually from the inoculated footpads of two to four untreated mice, and repeated at intervals of 2 months until the organisms are found to have multiplied to a mean of at least 5 • 105 AFB per footpad, at which time M. leprae are harvested immediately from the footpads of all treated groups. Harvests should also be performed from treated mice if, by 12 months after inoculation, the organisms have multiplied in the control mice, but to a mean of less than 5 • 105 AFB per footpad. The criterion of multiplication of M. leprae has been carefully defined. As mentioned earlier, the lower limit of detectability ofM. leprae in the mouse footpad, based on the observation of only a single AFB, is of the order of 1 x 104; in such a situation, one cannot be certain that the organisms observed are not those inoculated. To be confident that the organisms have, in fact, multiplied, an increase to at least 105 AFB per footpad is required. Employing this criterion of multiplication, if the organisms have multiplied only in

344

B. Ji and L. Levy

Table 38.3 DDS susceptibility tests of six strains of M. leprae

No. footpads showing multiplication*/no, harvested Concentration of DDS (g/l O0 g diet) Strain no.

0

O.0001

O.O01

O.01

Interpretation

1 2 3 4 5 6

10/10 4/9 8/8 10/10 9/9 8/8

0/10 0/10 7/9 9/9 10/10 10/10

0/10 0/10 0/10 7/7 4/10 10/10

0/10 0/10 0/10 0/10 0/9 10/10

Susceptible Inconclusive Low resistance Intermediate resistance Intermediate resistance Full resistance

* > 10s M. leprae harvested per footpad.

untreated mice but in none of the treated mice, the strain is considered susceptible; whereas the strain is considered resistant if the organisms are found to have multiplied in even one treated mouse. Finally, if the organisms have not multiplied in treated mice, but have multiplied in so small a proportion of the untreated mice that the proportion is not significantly different from zero by Fisher's exact probability caculation, the susceptibility test of the strain is inconclusive. In this event, one may wish to subinoculate the organisms into new groups of mice and to repeat the susceptibility test. The degree of resistance to a drug is determined by the diet containing the largest concentration of drug that permits multiplication of the organisms. For DDS, the degree of resistance is defined as low, intermediate or high, depending on the ability of the organisms to multiply in mice given DDS in a concentration of, respectively, 0.0001, 0.001 or 0.01 g/100 g diet. Six examples of tests of the susceptibility ofM. leprae to DDS are presented in Table 38.3.

Monitoring the efficacy of antimicrobial treatment in clinical trials The most sensitive means of assessing therapeutic efficacy of an antimicrobial drug or regimen is to measure, by means of the mouse footpad technique, the rate at which the patients' M. leprae are killed during treatment. Before and at intervals during treatment; serial skin biopsies are obtained, preferably from the same lesion, and M. leprae are recovered from the biopsy specimens. Mice, usually 20 mice per specimen, are inoculated with 5 x 103 to 1 x 104 AFB per footpad (Shepard, 1981), and harvests of M. leprae are performed at intervals thereafter. The response to the treatment is often reported in terms of the duration of treatment, the time of the last specimen in which viable organisms were detected and that of the first specimen in which viable M. leprae could not be detected (Shepard, 1981). However, one may obtain more quantitative information, in terms of the decrease of the proportion of viable M. leprae, and also recognize bactericidal effect earlier by inoculating additional mice with serially diluted suspension of the organisms (Ji et al., 1996 c).

The results of a clinical trial in which bactericidal effects of a treatment were measured in terms of the proportion of viable M. leprae before and after treatment are presented in Table 38.4. Although the treatment exhibited bactericidal activity in all patients, this activity was demonstrated in two patients (cases 5 and 38) only by measurement of the proportion of viable organisms. Had only a single inoculum of 5x 103 AFB per footpad been employed, the bactericidal effect of treatment in these two patients would not have been recognized, because the proportion of footpads showing multiplication of M. leprae among footpads inoculated after treatment with 5 x 103 AFB per footpad did not differ significantly from those before treatment. These findings indicate that the titration of the proportion of viable M. leprae in the bacterial population is a sensitive and precise method for monitoring the therapeutic effect of the treatment. Because the number of M. leprae that may be inoculated into the footpads of normal mice is limited to 5x 103 to 1 x 104, inoculation of normal mice alone permits measurement of the bactericidal activity of only >99% to >99.9% of the viable organisms initially present. On the other hand, as many as 100 times more organisms may be inoculated into each footpad of nude mice, thus increases the sensitivity of the measurement by one or two orders of magnitude, permitting the demonstration of killing of 99.99-99.999% of the viable M. leprae initially present (Ji et aL, 1994). However, as compared with the population of viable M. leprae in untreated lepromatous leprosy patients, which may be as large as 10'~ ~l organisms, the employment of nude mice yields only a modest increase of sensitivity, and it is also very expensive. As a result, it is difficult to justify the use of nude mice to monitor therapeutic efficacy in a clinical trial, unless the additional information to be obtained is crucial. For example, to identify a drug or drug combination that can eliminate spontaneously occurring RMP-resistant M. leprae during the course of treatment, because the number of such resistant mutants present in a previously untreated lepromatous patient is estimated to be no greater than 104, it is important to measure the killing of more than 99.99% of the viable organisms initially present, in which case inoculation of nude mice may well be justified.

MODELS OF LEPROSY INFECTION IN MICE

345

Table 38.4 Examples of results of determining the proportion of viable M. leprae in mouse footpads before and after treatment (Ji et al., 1996c)

No. footpads showing multiplication* of M. leprae/no, footpads harvested at inoculum Case no.:/: 7 6 38 5 21

Date of biopsy

5 x 10~

5 • 102

5 x 10'

5 x 10~

Proportion of viable M. lepraew

DO D31 DO D31 DO D31 DO D31 DO D31

10/10 0/10 10/10 0/10 10/10 10/10 9/10 7/10 10/10 0/10

5/10 0/10 10/10 0/10 10/10 7/10 9/10 2/10 7/10 0/10

2/10 0/10 6/10 0/10 10/10 3/10 4/10 0/10 4/10 0/10

1/10 0/10 4/10 0/10 8/10 1/10 3/10 0/10r 0/10 0/10

0.0028 < 0.00006 0.0435 < 0.00006 0.2745 0.0055 0.0138 0.0004 0.0055 < 0.00006

% of viable bacilli killed by treatment**

> 97.9 > 99.9 98.0 97.5 > 98.9

* > 102 M. leprae harvested per footpad. 1 Case nos 7, 6, 38, 5 and 21 were treated, respectively, with 1 month of the standard multidrug regimen for multibacillary leprosy; a single dose of 600 mg RMP; 30 days of DDS and CLO components in the standard multidrug regimen for multibacillary leprosy; a single dose of 2000 mg of CLARI plus 200 mg of MINO; and a single dose of 2000 mg of CLARI plus 200 mg of MINO plus 800 mg of OFLO. :1: DO and D31 refer, respectively, to before and after treatment. w Derived from the equation 0.69/50% infectious dose (Shepard, 1982). ** Comparison of the proportion of viable M. leprae before and after treatment.

It is essential to point out that failure to demonstrate viable M. leprae by inoculation of m i c e - - e v e n nude m i c e - - a t the end of treatment should not be taken as evidence that all viable M. leprae within the hosts have been killed. Many viable organisms may still survive after 99.999% have been killed. The only available means to evaluate the long-term efficacy of treatment is to measure the relapse rate after stopping treatment. One of the criteria in confirming the diagnosis of relapse is the demonstration of viable M. leprae by mouse footpad inoculation (Ji et aL, 1997).

References Binford, C. H. (1968). The transmission ofM. leprae to animals to find an experimental model. Int. J. Lepr., 36, 599. Brand, P. W. (1959). Temperature variation and leprosy deformity. Int. J. Lepr., 27, 1-7. Chehl, S. K., Shannon, E. J., Job, C. K., Hastings, R. C. (1983). The growth of Mycobacteriurn leprae in nude mice. Lepr. Rev., 54, 283-304. Colston, M. J., Hilson, G. R. F. (1976). Growth of Mycobacteriurn leprae and M. rnarinum in congenitally athymic (nude) mice. Nature (London), 262,399-401. Colston, M. J., Fieldsteel, A. H., Lancaster, R. D., Dawson, P. J. (1979). The athymic rat: immunological status and infection with Mycobacteriurn leprae. Int. J. Lepr., 47, 679. Fenner, F. (1956). The pathogenic behaviour of Mycobacterium ulcerans and Mycobacteriurn balnei in the mouse and the developing chick embryo. Am. Rev. Tuberc., 73, 650-673.

Fieldsteel, A. H., Levy, L. (1976). Neonatally thymectomized Lewis rats infected with Mycobacteriurn leprae: responses to primary infection, secondary challenge and large inocula. Infect. Irnrnun., 14, 736-741. Gelber, R. H., Levy, L. (1987). Detection of persisting Mycobacterium leprae by inoculation of the neonatally thymectomized rat. Int. J. Lepr., 55, 872-878. Grosset, J. H., Guelpa-Lauras, C. C., Bobin, P. et al. (1989). Study of 39 documented relapses of multibacillary leprosy after treatment with rifampin. Int. J. Lepr., 57, 607-614. Grosset, J. H., Ji, B., Guelpa-Lauras, C. C., Perani, E. G., N'Deli, L. N. (1990). Clinical trial of pefloxacin and ofloxacin in the treatment of lepromatous leprosy. Int. J. Lepr., 58, 281-295. Hilson, G. R. F. (1965). Observations on the inoculation ofM. leprae in the footpad of the white rat. Int. J. Lepr, 33, 662-665. Ji, B., Jamet, P., perani, E. G., Bobin, P., Grosset, J. H. (1993). Powerful bactericidal activities of clarithromycin and minocycline against Mycobacterium leprae in lepromatous leprosy. Antirnicrob. Agents Ckernotker. , 168, 188-190. Ji, B., Perani, E. G., Petinon, C., N'Deli, L., Grosset, J. H. (1994). Clinical trial of ofloxacin alone and in combination with dapsone plus clofazimine for treatment of lepromatous leprosy. Antimicrob. Agents Chernother., 38, 663-667. Ji, B., Perani, E. G., Petinon, C., Grosset, J. H. (1996a). Bactericidal activities of combinations of new drugs against Mycobacterium leprae in nude mice. Antimicrob. Agents Chemother., 40, 393-399. Ji, B., Levy, L., Grosset, J. H. (1996b). Chemotherapy of leprosy. Progress since the Orlando Congress and prospect for the future. Int. J. Lepr., 64, 580-588. Ji, B., Jamet, P., Perani, E. G. et al. (1996c). Bactericidal activity of single dose of clarithromycin plus minocycline, with or without ofloxacin, against Mycobacteriurn leprae in patients. Antirnicrob. Agents Chemother., 40, 2137-2141.

346

Ji, B., Jamet, P., Sow, S., perani, E. G., Traore, I., Grosset, J. H. (1997). High relapse rate among lepromatous leprosy patients treated with rifampin plus ofloxacin daily for 4 weeks. Antimicrob. Agents Ckemotker., 41, 1953-1956. Kirchheimer, W. F., Storrs, E. E. (1971). Attempts to establish the armadillo (Dasypus novemcinctus Linn.) as a model for the study of leprosy. I. Report of lepromatoid leprosy in an experimentally infected armadillo. Int. J. Lepr., 39, 693-702. Kohsaka, K., Mori, T., Ito, T. (1976). Lepromatoid lesion developed in the nude mice inoculated with Mycobacterium leprae. Lepro, 45, 177-187. Levy, L. (1975). Superinfection in mice previously infected with Mycobacterium leprae. Infect. Irnmun., 11, 1094-1099. Levy, L. (1976). Studies of the mouse foot pad technique for cultivation of Mycobacterium leprae. 3. Doubling time during logarithmic multiplication. Lepr. Rev., 47, 103-106. McDermott-Lancaster, R. D., Ito, T., Kohsaka, K., GuelpaLauras, C. C., Grosset, J. H. (1987). Multiplication of Mycobacterium leprae in the nude mouse, and some applications of nude mice to experimental leprosy. Int. J. Lepr., 55, 889-895. Rees, R. J. W. (1966). Enhanced susceptibility of thymectomized and irradiated mice to infection with Mycobacterium leprae. Nature (London), 211,657-658. Rees, R. J. W., Waters, M. F. R., Weddell, A. S. M., Palmer, E. (1967). Experimental lepromatous leprosy. Nature (London), 215,599-602. Rungruang, S., Ramasoota, T., Sampattavanich, S. (1983). Study of the use of nude mice in the cultivation of M. leprae in a normal, non-specific pathogen free room at a temperature of 30-35 oC without air conditioning. Lepr. Rev., 54, 305-308. Shepard, C. C. (1960a). Acid fast bacilli in nasal excretions in leprosy, and results of inoculation of mice. Am. J. Hyg., 71, 147-157. Shepard, C. C. (1960b). The experimental disease that follows the injection of human leprosy bacilli into foot pads ofmice.J. Exp. Med., 112, 445-454.

B. Ji and L. Levy

Shepard, C. C. (1967). A kinetic method for the study of activity of drugs against Mycobacterium leprae in mice. Int. J. Lepr., 35, 429-435. Shepard, C. C. (1969). Further experience with the kinetic method for the study of drugs against Mycobacterium leprae in mice. Activities ofDDS, DFD, ethionamide, capreomycin and PAM 1392. Int. J. Lepr., 37, 389-397. Shepard, C. C. (1981). A brief review of experiences with shortterm clinical trials monitored by mouse-foot-pad inoculation. Lepr. Rev., 52, 299-308. Shepard, C. C. (1985). Experimental leprosy. In Leprosy (ed. Hastings, R. C., pp. 269-286. Churchill Livingstone, Edinburgh. Shepard, C. C., Chang, Y. T. (1964). Effect of several anti-leprosy drugs on multiplication of human leprosy bacillus in foot pads of mice. Proc. Soc. Exp. BioL Med., 109, 636-638. Shepard, C. C., Habas, J. A. (1967). Relation of infection to tissue temperature in mice infected with Mycobacterium marinum and Mycobacterium leprae.J. BacterioL, 93, 790-796. Shepard, C. C., McRae, D. H. (1968). A method for counting acidfast bacteria. Int. J. Lepr., 36, 78-82. Shepard, C. C., van Landingham, R. M., Walker, L. L. (1971). Recent studies of antileprosy drugs. Int. J. Lepr., 39, 340-349. Shepard, C. C., van Landingham, R., Walker, L. L. (1976). Immunity to Mycobacterium leprae infections in mice stimulated by M. leprae, BCG and graft-versus-host reactions. Infect. Irnrnun., 14, 919-928. Subcommittee of THELEP (1987). Persisting Mycobacterium leprae among THELEP trial patients in Bamako and Chingleput. Lepr. Rev., 58, 325-337. Waters, M. F. R., Niven, J. S. F. (1966). Experimental infection of the ear and foot pad of the golden hamster with Mycobacterium leprae. Br. J. Exp. PatkoL, 47, 86-92. Welch, T. M., Gelber, R. H., Murray, L. P., Ng, H., O'Neill, S. M., Levy, L. (1980). Viability of Mycobacterium leprae after multiplication in mice. Infect. Immun., 30, 325-328.

Chapter 39

Hamster Model of Lyme Arthritis R. F. Schell and S. M. Callister

Background of human infection

(Callister et aL, 1996; Schell et aL, 1997) should be the most helpful of the current serodiagnostic tests.

Lyme borreliosis, caused by the spirochete 13orrelia burgdorferi sensu lato (Barbour et al., 1983a; Benach et al., 1983; Johnson et aL, 1984) is the most frequently reported tickborne illness in the USA (Steere, 1989), with over 13 000 Background of model cases reported in 1996 (Centers for Disease Control and Prevention 1997). Classically, Lyme borreliosis is character- Animal models of Lyme borreliosis are extremely imporized by an expanding skin lesion (erythema migrans) tant for elucidating the mechanisms of pathogenesis and accompanied by constitutional symptoms that include development of vaccines for human and animal usage fatigue, headache, mild stiff neck, bone and muscle aches, (Schmitz et al., 1991). These models increase our knowland fever (Steere et al., 1983a, 1987). Other clinical manifes- edge and understanding of the basic infectious process and tations include mild heart conduction system blockage, assist in developing strategies to prevent infection and neurologic abnormalities, and polyarthropathies (Pachner disease in humans. Unfortunately, no single animal model and Steere, 1985; McAlister et al., 1989; Preac-Mursic et al., mimics all the pathological and clinical manifestations asso1989). Arthritis is frequently the first recognized complica- ciated with Lyme borreliosis in humans. Skin lesions that tion of Lyme borreliosis in the USA (Steere et al., 1987), resemble human erythema migrans develop in monkeys, with intermittent episodes developing in approximately rabbits and guinea pigs (Krinsky et aL, 1982; Burgdorfer, 60% of afflicted individuals (Steere et al., 1987). In severe 1984; Kornblatt et al., 1984; Philipp and Johnson, 1994). cases, chronic inflammatory Lyme arthritis can lead to Moderate or chronic progressive synovitis develops in mice and young dogs (Barthold et aL, 1990; Appel et aL, 1993), cartilage and bone erosion (Steere et aL, 1979, 1987). The diagnosis of Lyme borreliosis is based on character- while severe chronic arthritis can be induced in severe comistic clinical findings and exposure to ticks of the Ixodes rici- bined immunodeficiency mice and irradiated hamsters nus complex (Barbour et al., 1983b) in an endemic focus. It (Schmitz et aL, 1988; Schaible et aL, 1989) after infection is well recognized that tests that detect antibody responses with B. burgdorferi. Carditis, nephritis, and hepatitis can against t3. burgdorferi serve only as an adjunct to other also be detected in some of these animal models infected methods, especially the history and physical findings of the with the Lyme spirochete (Barthold et al., 1993; Philipp and patient. Unfortunately, patients often present with indis- Johnson, 1994; Munson et al., 1996). Detection of neurotinct clinical pictures and Lyme borreliosis endemic loci are borreliosis in animal models has not been reported. common throughout the USA. In addition, Lyme borreliosis symptoms may closely resemble other unrelated illnesses such as influenza, ehrlichiosis, multiple sclerosis, aseptic meningitis, and rheuma- Animal species toid arthritis. For these reasons, clinicians have and will continue to rely heavily on the ability of the laboratory to The hamster, especially inbred LSH hamsters, is an excellent model to study the immune responses to infection or detect accurately evidence of infection with t3. burgdorferi. However, the sensitivity and specificity of the testing proce- vaccination with B. burgdorferi. When adult inbred LSH dures need to be greatly improved (Bakken et aL, 1992, hamsters are injected in the hind paws with 106 B. burgdor1997). Accurate test results would greatly assist clinicians feri sensu lato, clinical manifestations of Lyme arthritis are with the clinical diagnosis of Lyme borreliosis and prevent induced. Inflammation or swelling of the hind paws can its over-diagnosis (Steere et al., 1994). The development of be detected 7 days after infection, peaks on day 10, and the borreliacidal antibody test that detects antibodies in gradually decreases. At week 1, the tibiotarsal, intertarsal, Lyme borreliosis sera that are lethal to t3. burgdorferi in vitro and interphalangeal joints show evidence of acute Handboo k of Animal Models of Infection

ISBN 0-12-775390-7

Copyright 9 1999Academic Press All rights of reproduction in any form reserved

348

inflammation. The synovial lining is hypertrophic and hyperplastic, and areas of ulceration are easily detected. Adherent fibrin protrudes into the joint spaces and is associated with inflammatory cells, especially neutrophils. The neutrophils also penetrate the subsynovial connective tissue and periarticular structures, including ligaments, tendons, tendon sheaths, fibrous capsule, and periosteum. Spirochetes (> 20 per high-power field) are readily observed in the subsynovial tissues. By week 3 after infection, the number of spirochetes has greatly decreased and the inflammatory response is resolving. A chronic synovitis characterized by hypertrophic villi, focal erosions of articular cartilage, and subsynovial mononuclear infiltrate persists for approximately 1 year. Severe destructive Lyme arthritis can also be elicited in vaccinated hamsters after challenge with different isolates of 13. burgdorferi (Lim et aL, 1994). Hamsters are vaccinated with a whole-cell preparation of formalin-inactivated 13. burgdorferi sensu stricto isolate C-1-11 in adjuvant. A severe destructive arthritis is readily evoked in vaccinated hamsters challenged with the homologous 13. burgdorferi sensu stricto isolate C-l-11 before high levels of protective borreliacidal antibody develop. Once high levels of C-l-11 borreliacidal antibody develop, hamsters are protected from homologous challenge and development of arthritis. Vaccinated hamsters, however, still develop severe destructive arthritis when challenged with other isolates of the three genomic groups of B. burgdorferi sensu lato (t3. burgdorferi sensu stricto isolate 297, Borrelia garinii isolate LV4, and Borrelia afzelii isolate BV1) despite high levels of C-I-11-specific borreliacidal antibody. Vaccines that contain whole spirochetes in adjuvant induce destructive arthritis, but this effect is not dependent on the isolate of B. burgdorferi sensu lato or the type of adjuvant. The development of severe destructive arthritis is dependent on CD4 +T lymphocytes. The hamster's propensity to develop arthritis, especially severe destructive arthritis, is an effective way to evaluate vaccines for adverse effects. In addition, the hamster mimics the vaccine response of humans to a fieldtrialed recombinant subunit vaccine (Padilla et al., 1996).

Storage and preparation of inoculum 13. burgdorferi isolates are readily available from investigator~. B. burgdorferi isolate 297 was obtained from Russell C. Johnson (University of Minnesota, Minneapolis, MN). The strain was originally isolated from human spinal fluid (Steere et al., 1983b) and has been maintained by passage in modified Barbour-Stoenner-Kelly (BSK) medium (Callister et all., 1990). The hamster-passed spirochete is grown in BSK at 32~ for 5 days. The suspension of B. burgdorferi is then adjusted with flesh BSK to contain approximately 107 spirochetes/ml. Samples of l ml are dispensed in vials, which are sealed and stored in liquid nitrogen until used.

R.F. Schell and S. M. Callister

Infection process Hamsters are mildly anesthetized with ether and challenged subcutaneously in each hind paw with 0.2 ml of BSK containing 106 viable organisms of t3. burgdorferi. Quantitation of spirochetes is performed by using darkfield microscopy. Hamsters can also be easily infected intradermally or intravenously via tongue veins. We have infected hamsters with 102-10813. burgdorferi organisms and recovered spirochetes from bladders, spleens, kidneys, and hearts cultured in BSK medium. Recovery rates varied (_< 66%) for challenge inocula of between 102 and 104 spirochetes. When hamsters are challenged with 106 spirochetes, spirochetes are recovered from all the above tissues.

Key parameters to monitor infection Assessment of arthritis

Swelling of the hind paws of vaccinated or non-vaccinated hamsters challenged with isolates of 13. burgdorferi sensu lato is used to evaluate the inflammatory response. The hind paws are measured every day for 21 days with a plethysmograph (Buxco Electronics, Sharon, CT). Measurements are obtained by mildly anesthetizing hamsters with ether, carefully dipping a hind paw into a column of mercury up to the ankle, and measuring the amount of mercury displaced (in milliliters). The mean plethysmograph value for three hamsters (six hind paws) per group is used as an index of severity of swelling from arthritis. Mercury displacement is standardized with a volume calibrator.

Recovery of spirochetes from tissues

Approximately 21 days after challenge, hamsters are killed by CO2 inhalation. The urinary bladder, spleen, kidney, and heart are removed aseptically, homogenized through a 5 ml syringe, and inoculated into 5 ml of BSK supplemented with rifampin (100 btg/ml; Sigma, St Louis, MO) and phosphomycin (100 ~g/ml; Sigma). Cultures are incubated at 32~ and examined weekly for 2 weeks by dark-field microscopy for motile spirochetes. If spirochetes are not detected, 0.5 ml of the culture is inoculated into 4 ml of BSK supplemented with antibiotics and examined weekly for another 3 weeks. If no spirochetes are detected, the culture is considered negative.

Preparation of tissues for histology

The hind legs of all vaccinated or non-vaccinated hamsters are amputated 21 days after challenge at the mid-femur, fixed in 10% neutral buffered formalin, placed in decalcifying solution (Lerner Laboratories, Pittsburgh, PA) for 18

HAMSTER MODEL OF LYME ARTHRITIS

hours, and stored in 10% formalin prior to processing. The knees and hind paws are dissected longitudinally, embedded in paraffin, cut into 6 btm sections, placed on glass slides, and stained with hematoxylin and eosin. Hind legs are randomly selected from each group of hamsters for histopathological examination.

Hamster sera Sera are obtained from hamsters with or without vaccination at various intervals after vaccination or challenge. Concomitantly, sera are obtained from non-infected normal hamsters. Hamsters are anesthetized with ether and bled by intracardiac puncture. The blood is allowed to clot and serum is separated by centrifugation at 500g, pooled, divided into 1 ml aliquots, dispensed into 1.5 ml screw-cap tubes (Sarstedt), and frozen at-20 ~ until used.

349

all BSK, serum, and complement particles. Data are acquired for 1 minute. Assay samples are then analyzed by histogram profiles of acridine orange fluorescence with FACScan LYSYS II software. Gates are established for viable and heat-killed spirochetes on the basis of their incorporation of acridine orange. Three parameters are evaluated: events per minute (number of labeled spirochetes), percentage shift in fluorescence (number of dead. spirochetes), and mean channel fluorescence (intensity of fluorescently labeled spirochetes). Borreliacidal activity is determined by a decrease in events per minute and increases in percentage shift in fluorescence and mean channel fluorescence compared with values obtained with normal serum. The borreliacidal titer is the highest dilution of immune serum that kills spirochetes compared with normal serum.

Antibody reagents Borreliacidal assay Sera from vaccinated or non-vaccinated hamsters are heatinactivated at 56 ~ for 30 minutes, diluted 1 : 10 with fresh BSK, and filter-sterilized through a 0.2 btm pore-size filter apparatus (Acrodisc, Gelman Sciences, Ann Arbor, MI). Frozen suspensions of B. burgdorferi sensu lato are thawed, inoculated into fresh BSK, and incubated at 32~ for 72 hours. Spirochetes are enumerated by dark-field microscopy and with a Petroff Hausser counting chamber, and the suspensions are adjusted to contain 105 spirochetes/ml with BSK. Samples of the spirochetal suspensions, 100 btl each, are added to round-bottomed wells of a 96-well microtiter plate (Gibco Laboratories, Grand Island, NY). Subsequently, 100 lttl of sera or twofold dilutions of sera from vaccinated or non-vaccinated hamsters and 20 btl of sterile guinea-pig complement (hemolytic titer, 200 CHs0 units per ml; Sigma) are added to each well of the microtiter plate. The plate is shaken gently and incubated at 32 ~ for 16 hours. All assays are performed in duplicate.

Hybridoma cell line 14-4-4s (ATCC HB-32) secreting murine monoclonal antibodies (MAb) recognizes a surface cell marker on hamster B lymphocytes. Hybridoma 14-4-4s is grown in Dulbecco's modified Eagle's medium at 37 ~ in a humidified atmosphere of 7.5% CO2. After 7 days, the culture supernatant is collected after centrifugation at 500 g for 10 minutes at 4~ dispensed into 12 ml aliquots, and frozen a t - 2 0 ~ until used. Unconjugated goat anti-mouse immunoglobulin, heavy- and light-chain-specific (Organon Teknika Corp., Durham, NC) is used to coat tissue culture dishes for panning and isolation of T lymphocytes. In the flow cytometric analysis of T-lymphocyte preparations, a phycoerythrin-conjugated goat anti-hamster immunoglobulin, specific for both heavy and light chains (Boehringer Mannheim Biochemicals, Indianapolis, IN), is used for the detection of B-lymphocytes. CD4 + T lymphocytes are detected with a phycoerythrin-conjugated rat anti-mouse CD4 (L3T4) antibody (Boehringer Mannheim Biochemicals). This antibody has specificity for the CD4 (L3T4) molecule on murine and hamster T lymphocytes. Phycoerythrin-conjugated goat and rat immunoglobulins are used as isotype controls.

Flow cytometry data acquisition and analysis After incubation of assay samples, 100 btl is removed and diluted 1:5 with PBS (pH 7.4) and 50 btl of acridine orange (5.4 nmol/1; Sigma) is added. Controls include samples containing normal serum with viable or heat-killed (56 ~ for 30 minutes) spirochetes in BSK and complement. The samples are then analyzed with a FACScan flow cytometry (Becton Dickinson Immunocytometry Systems, Mountain View, CA) with FACScan LYSYS II software for data acquisition. Initially, viable and heat-killed spirochetes are detected and differentiated from BSK, serum, and complement particles by using forward scatter, side scatter, and acridine orange fluorescence. Live gating is performed only on profiles of spirochetes during data acquisition to exclude

Isolation of enriched populations of T lymphocytes The isolation of enriched populations of hamster T lymphocytes by using MAb 14-4-4s has been described previously by Liu et al. (1991). Briefly, enriched populations o f T lymphocytes are isolated from the inguinal lymph nodes of hamsters 14 days after vaccination with formalin-inactivated B. burgdorferi and from those of non-vaccinated hamsters. B lymphocytes are removed from the lymph node suspensions with immunoglobulin-coated tissue culture dishes. The dishes (100 x 20 mm; Corning Glass Works) are prepared by coating the surfaces with 100btg of

3S0

nunconjugated goat anti-mouse immunoglobulin in coupling buffer (15 mM Na2CO3, 35 mM NaHCO3 [pH 9.6]) overnight at 4 ~ and washing four times with PBS before use. Single-cell suspensions of 107 immune and nonimmune lymph node cells per milliliter are incubated with MAb 14-4-4s in Dulbecco's modified Eagle's medium for 30 minutes at 4 o C. During this 30 minute incubation, the cell suspension is periodically mixed. The suspensions of cells are washed twice with PBS by centrifugation (500g for 10 minutes at 4 ~ resuspended to 107 cells/ml, poured over the immunoglobulin-coated tissue culture dishes, and incubated for 60 minutes at 4~ Non-adherent cells are then collected by gently rinsing the tissue culture dishes with cold Dulbecco's modified Eagle's medium. Enriched Tlymphocyte suspensions obtained from several tissue culture dishes are aspirated, pooled, and centrifuged at 500g for 10 minutes at 4~ After centrifugation, the supernatant is decanted and the pellet is resuspended in Dulbecco's modified Eagle's medium. The suspension is poured over another set of immunoglobulin-coated dishes and incubated for 60 minutes at 4~ This process is repeated three times. After the last panning cycle, the cells are washed twice with PBS by centrifugation (500g for 10 minutes at 4 ~ and resuspended in PBS. Cell viability is determined by trypan blue (Sigma) exclusion. Enriched Tlymphocyte preparations obtained by this method were shown to contain less than 5% B-lymphocyte contamination by flow cytometric analysis. Giemsa-stained smears of Blymphocyte-depleted lymph node cells obtained by this method showed a homogeneous population of lymphocytes with no other types of leukocyte visible.

Analysis of enriched T-lymphocyte preparations by flow cytometry Samples 100 Ill in size containing l05 lymph node cells obtained before and after panning with MAb 14-4-4s are stained for the presence of B lymphocytes or CD4 + T lymphocytes. B lymphocytes are stained with a phycoerythrinconjugated goat anti-hamster immunoglobulin, specific for both heavy and light chains (Boehringer Mannheim Biochemicals; 1 : 100), for 15 minutes at 4 ~ CD4 + T lymphocytes are stained with a phycoerythrin-conjugated rat, anti-mouse CD4 (L3T4) antibody (Boehringer Mannheim Biochemicals; 1 : 100) for 15 minutes at 4 ~ This antibody has specificity for the CD4 (L3T4) molecule on murine and hamster T lymphocytes. Samples are then washed twice with PBS by centrifugation, fixed with 1% paraformaldehyde (Sigma), and kept in the dark until analyzed by flow cytometry. Phycoerythrin-conjugated goat and rat antibodies are used as isotype controls. Other controls include unstained suspensions of lymph node cells. All samples are analyzed by using a FACScan flow cytometer (Becton Dickinson Immunocytometry Systems, Mountain View, CA) with FACScan LYSYS II software for data acquisition. Cells are detected by forward scatter, side scatter, and phy-

R.F. Schell and S. M. Callister

coerythrin fluorescence. Data from 5000 cells are acquired. Cell samples are then analyzed by means of histogram profiles of phycoerythrin fluorescence evaluated with FACScan LYSYS II software. Gates are established by using unstained samples and samples stained with the isotype control antibodies. The percentages of B lymphocytes and CD4 § T lymphocytes present in the cellular suspensions are determined by the percentage shifts in the phycoerythrin fluorescence of the stained cells.

Cell transfer and infection of hamsters Three hamsters per group are mildly anesthetized and injected subcutaneously in each hind paw with 0.4 ml of PBS containing 106 viable macrophages and/or T lymphocytes. Within 13-14 hours after the cell transfer, recipient hamsters are mildly anesthetized and infected subcutaneously in each hind paw with 0.2 ml of BSK medium containing 105 viable B. burgdorferi sensu stricto isolate 297 spirochetes. This concentration of spirochetes can readily be detected in hamsters when their tissues are cultivated in BSK medium. The viability of the spirochetes is determined by motility and dark-field microscopy.

Antimicrobial therapy Groups of B.-burgdorferi-infected hamsters are treated daily for 4 days with 2.5 mg of ceftriaxone, 2 mg of doxycycline or other antimicrobial agents at various weeks after infection. Controls include groups of hamsters infected with B. burgdorferi for 0, 1, 3, 5, 7, 9 weeks or later intervals after infection.

Key parameter to monitor response to treatment Recovery of spirochetes from tissue(s) of treated and nontreated B.-burgdorferi-infected hamsters is compared to determine the efficacy of therapy.

Pitfalls (advantages/disadvantages) of the model The compartmentalization of clinical Lyme borreliosis features that occur in animal models is beneficial for studying Lyme borreliosis. Each animal model contributes information that enhances the ability of investigators to define common pathological and immunological principles that are likely to occur in humans. Divergent findings are even more important and generally have a far greater impact on

HAMSTER MODEL OF LYME ARTHRITIS

defining mechanisms of resistance or other pathological mechanisms induced by infection or vaccination. It is imperative, then, to define the uniqueness of each animal model to obtain a broad and comprehensive picture of pathological events that might or do occur in humans. No animal model is superior to another. The quality of answers is limited only by the imagination and inventiveness of the investigator. Hopefully, the answers apply to humans and not a single animal is tested without obtaining meaningful data. The advantage of the hamster model ofLyme borreliosis is the ability to study the onset and resolution of Lyme arthritis in an immunocompetent mature animal. In addition, severe destructive Lyme arthritis can be induced in vaccinated hamsters after infection with B. burgdorferi. Most importantly, the ability of a Lyme borreliosis vaccine to induce adverse effects can be readily determined before field trials are begun in humans. A major criticism of the hamster model of Lyme borreliosis is that the murine system is better defined for determining the mechanisms of pathogenesis. Generally, these statements reflect unfamiliarity with the immunologic reagents that can be used in hamsters to separate T lymphocytes. Hamster T cells can be separated by MAb GK 1.5 into two phenotypically and functionally distinct subsets (Witte et al., 1985; Liu et al., 1991). The T-cell subset recognized by MAb GK 1.5 (L3T4a) has characteristics of helper T cells (CD4+), whereas the other cells have characteristics of cytotoxic/suppressor T cells (CD8+). Unfortunately, the identification of modulatory cytokines induced by hamster macrophages and T lymphocytes has been complicated by the unavailability of species-specific antibody reagents.

Contribution of the model to infectious therapy The hamster models of Lyme arthritis (immunocompetent mature hamsters) and severe destructive Lyme arthritis (vaccinated mature hamsters) may facilitate the development of new therapeutic options to circumvent the development of Lyme arthritis in individuals infected with B. burgdorferi.

References Appel, M. I. G., Allan, S., lacobson, R. H. et aL (1993). Experimental Lyme disease in dogs produces arthritis and persistent infection. J. Infect. Dis., 167, 651-664. Bakken, L. L., Case, K. L., Callister, S. M., Bourdeau, N. J., Schell, R. F. (1992). Performance of 45 laboratories participating in a proficiency testing program for Lyme disease serology. J.A.M.A., 268, 891-895. Bakken, L. L., Callister, S. M., Wand, P. J., Schell, R. F. (1997).

351

Interlaboratory comparison of test results for detection of Lyme disease by 516 participants in the Wisconsin State Laboratory of Hygiene/College of American Pathologists proficiency test programming. ]. Clin. Microbiol., 35, 537-543. Barbour, A. GI, Tessier, S. L., Todd, W. J. (1983a). Lyme disease spirochetes and ixodid tick spirochetes share a common surface antigenic determinant defined by a monoclonal antibody. Infect. Immun., 41,795-804. Barbour, A. G., Burgdorfer, W., Grunwaldt, E., Steere, A. C. (1983b). Antibodies of patients with Lyme disease to components of lxodes dammini spirochete.]. Clin. Invest., 72, 504-515. Barthold, S. W., Beck, D. S., Hansen, G. M., Terwilliger, G. A., Moody, K. D. (1990). Lyme borreliosis in selected strains and ages of laboratory mice.]. Infect. Dis., 162, 133-138. Barthold, S. W., deSouza, M. S., Janotka, J. L., Smith, A. L., Persing, D. H. (1993). Chronic Lyme borreliosis in the laboratory mouse. Am. ]. Pathol., 143, 959-971. Benach, ]. L., Bosler, E. M., Hanrahan, J. P. et al. (1983). Spirochetes isolated from the blood of two patients with Lyme disease. N. Engl]. Med., 308, 740-742. Burgdorfer, W. (1984). The New Zealand white rabbit: an experimental host for infecting ticks with Lyme disease spirochete. Yale]. Biol. Med., 57, 609-612. Callister, S. M., Case, K. L., Agger, W. A., Schell, R. F., Johnson, R. C., Ellingson, I. L. E. (1990). Effects of bovine serum albumin on the ability of Barbour-Stoenner-Kelly medium to detect Borrelia burgdorferi. ]. Clin. Microbiol., 28, 363-365. Callister, S. M., lobe, D. A., Schell, R. F., Pavia, C. S., Lovrich, S. D. (1996). Sensitivity and specificity of the borreliacidalantibody test during early Lyme disease: a 'gold standard'? Clin Diag. Lab. Immunol., 3,399-402. Centers for Disease Control and Prevention (1997). Lyme dise a s e - United States, 1996. Morbid. Mortal. Weekly Rep., 45, 1132-1136. Johnson, R. C., Hyde, F. W., Schmid, G. P., Brenner, D. I. (1984). Borrelia burgdorferi sp. nov.: etiologic agent of Lyme disease. Int. ]. Syst. Bacteriol., 34, 496-497. Kornblatt, A. N., Steere, A. C., Brownstein, D. G. (1984). Infection of rabbits with the Lyme disease spirochete. Yale ]. BioL Med., 57, 613-614. Krinsky, W. L., Brown, S. J., Askenase, P. W. (1982). Ixodes dammini: induced skin lesions in guinea pigs and rabbits compared to erythema chronicum migrans in patients with arthritis. Exp. ParasitoL, 53, 381-395. Lim, L. C. L., England, D. M., DuChateau, B. K. et aL (1994). Development of destructive arthritis in vaccinated hamsters challenged with Borrelia burgdorferi. Infect. Immun., 62, 2825-2833. Liu, H., Adler, J. D., Steiner, B. M., Stein-Streilein, J., Lim, L. C. L., Schell, R. F. (1991). Role ofL3T4 +and 38 +T-cells subsets in resistance against infection with Treponema pallidum subsp., pertenue in hamsters. Infect. Immun., 59, 529-536. McAlister, H. F., Klementowicz, P. T., Andrews, C., Fisher, J. D., Field, M., Furman, S. (1989). Lyme carditis: an important cause of reversible heart block. Ann. Intern. Med., 110, 339-345. Munson, E. L., DuChateau, B. K., Jobe, D. A. et al. (1996). Hamster model of Lyme borreliosis. ]. Spirochet. Tick-borne D#., 3, 15-21. Pachner, A. R., Steere, A. C. (1985). The triad ofneurologic complications of Lyme disease: meningitis, cranial neuritis and radiculoneuritis. Neurology, 35, 47-53.

352

Padilla, M. L., Callister, S. M., Schell, R. F. et aL (1996). Characterization of the protective borreliacidal antibody response in humans and hamsters after vaccination with a Borrelia burgdorferi outer surface protein A vaccine. J. Infect. Dis., 174, 739-746. Philipp, M. T., Johnson, B. I. B. (1994). Animal models of Lyme disease pathogenesis and immunoprophylaxis. Trends MicrobioL, 2, 431-437. Preac-Mursic, V., Weber, K., Pfister, H. W. et aL (1989). Survival of Borrelia burgdorferi in antibiotically treated patients with Lyme borreliosis. Infection, 17, 355-359. Schaible, U. E., Kramer, M. D., Museteanu, C., Zimmer, G., Mossman, H., Simon, M. M. (1989). The severe combined immunodeficiency (SCID) mouse: a laboratory model for the analysis of Lyme arthritis and carditis. J. Exp. Med., 170, 1427-1432. Schell, R. F., Callister, S. M., lobe, D. A., DuChateau, B. K. (1997). The borreliacidal antibody test: an alternative approach for confirming Lyme borreliosis. J. Spirocket. Tick-borne Dis., 4, 4-6. Schmitz, 1. L., Schell, R. F., Hejka, A., England, D. M., Konick, L. (1988). Induction of Lyme arthritis in LSH hamsters. Infect. Immun., 9, 2336-2342. Schmitz, 1. L., Schell, R. F., Lovrich, S. D., Callister, S. M., Coe,

R . F . Schell and S. M. Callister

J. E. (1991). Characterization of the protective antibody response to Borrelia burgdorferi in experimentally infected LSH hamsters. Infect. Immun., 59, 1916-1921. Steere, A. C. (1989). Lyme disease. N. EngL J. Med., 321,586-596. Steere, A. C., Gibofsky, A., Patarroyo, M. E., Winchester, R. J., Hardin, E. D., Malawista, S. E. (1979). Chronic Lyme arthritis: clinical and immunogenetic differentiation from rheumatoid arthritis. Ann. Intern. Med., 90, 896-901. Steere, A. C., Bartenhagen, N. H., Craft, J. E. et al. (1983a). The early clinical manifestations of Lyme disease. Ann. Intern. Med., 99, 76-82. Steere, A. C., Grodzicki, A. L., Kornblatt, A. N. et al. (1983b). The spirochetal etiology of Lyme disease. N. EnglJ. Med., 308, 733-740. Steere, A. C., Schoen, R. T., Taylor, E. (1987). The clinical evolution of Lyme arthritis. Ann. Intern. Med., 107, 725-731. Steere, A. C., Taylor, E., McHugh, G. L., Logigian, E. L. (1994). The overdiagnosis of Lyme disease. Journal of American Medical Association, 269, 1812-1816. Witte, P. L., Stein-Streilein, J., Streilein, J. W. (1985). Description of phenotypically distinct T-lymphocyte subsets which mediate helper/DTH and cytotoxic functions in the Syrian hamster. ]. Immunol., 134, 2908-2915.

Chapter 40

Rabbit Model of Bacterial Conjunctivitis M. Motschmann and W. Behrens-Baumann

Background of human infection

Background of the model

Bacterial conjunctivitis is the most common infectious disease of the eye. Nearly every person is affected sometime during their lifetime. Staphylococcus spp., Streptococcus spp. and Haemophilus spp. are infectious agents in approximately 90% of cases (Fechner and Teichmann, 1991). In immunocompetent patients bacterial conjunctivitis is a self-limiting disease, normally healing within a few days (Gigliottti et aL, 1984; Fisher, 1987). However, in clinical practice local antibiotic therapy is usual to prevent complications. The fear of visionthreatening keratitis, in particular, is in most cases the reason for this type of prophylaxis. However, an uncritical application of local antibiotics may cause sensitivity to the substance administered. This may cause problems if it is later necessary to administer the substance systemically for another acute infection (Behrens-Baumann, 1991). A further danger exists in creating cross-reactions. In addition, bacterial resistance against antibiotics is an increasing problem worldwide. For instance, gentamicin is ineffective against more than 30% of Staphylococcus epidermidis isolated from eyes with endophthalmitis (Puliafito et aL 1989). Methicillin-resistant Staphylococcus aureus also is resistant to gentamicin, tobramycin, amikacin, or erythromycin in 90% of all cases (Maple et aL, 1989). Nearly 25% of Pseudomonas aeruginosa strains are resistant to ciprofloxacin (O'Brien, 1991). A growing therapeutic concern involves the possibility of vancomycin-resistant Staphylococcus aureus species (Tomasz, 1994). On the other hand, it is also possible to treat bacterial conjunctivitis with antiseptics. In these cases the .negative side-effects of antibiotics can be avoided (BehrensBaumann, 1991). However, as yet no in-vivo data are available that demonstrate the superiority of either substance under standardized conditions. In-vitro results are not sufficient. The efficacy of a drug depends on several factors that only operate under in-vivo conditions (Dolder and Skinner, 1983).

Since the first description by Leber (1891), published more than 100 years ago, several experiments have been performed to establish a model of bacterial conjunctivitis (Table 40.1). Subconjunctival injection of a suspension of infectious agents may certainly initiate a local infection (Gasparrini, 1883; Fedukowicz, 1953). However, microbial suspension simply dropped into the conjunctival sac does not result in conjunctivitis in various species. Scarification with subsequent drops of microbial suspension does not provoke manifest infection either (N61deke, 1899; R6mer, 1899; Lange, 1924; Sereny, 1955, 1956; Trabulisi, 1965; Howcraft et aL, 1978; Srivastava et aL, 1986). This is obviously because of the natural immune response of the animal. It is only the imitation of an open injury of the conjunctiva, e.g. by a twig, with the pathogens being transferred underneath the conjunctiva, that a fulminant conjunctivitis is provoked. This method was first described by Behrens-Baumann and Begall (1993a).

Handbook of Animal Modelsof Infection ISBN 0-12-775390-7

Animal species/preparation of animals Pigmented rabbits weighing 1.8-2.7kg were used in this model. They were given Altromin rabbit chow and water ad libitum.

Infection process/details of surgery The animals were anesthetized using Ketavet and Rompun at 0.25 ml/kg body weight. To imitate an infection, the agents were dropped into the lower conjunctival fornix in four eyes (method A). To simulate a superficial scratch injury the conjunctiva

Copyright 9 1999Academic Press All rights of reproduction in any form reserved

354

M. Motschmann and W. Behrens-Baumann

Table 40.1 Animal models of conjunctivitis Animal

Infectious agent

Method

Result

Leber, 1891

Rabbit

Staphylococcus aureus

Negative

R6mer, 1899 N61deke, 1899

Rabbit

Guinea-pig

Pneumococcus Pneumococcus

Lange, 1924

White mouse

Sereny, 1955/1956

Guinea-pig

Streptococcus Pneumococcus Enterobacter

Instillation Sewing up eyelids Instillation Instillation Scarification Instillation

Instillation

Trabulisi, 1965

Guinea-pig

Enterobacter

Instillation

Howcraft et al., 1978

Guinea-pig

Srivastava et al., 1986

Staphylococcus aureus Haemophilus

Instillation Instillation

Gasparrini, 1883

Mouse Rabbit Rabbit

Negative (keratitis) Negative (keratitis) Negative Blepharitis

Pneumococcus

Fedukowicz, 1953

Rabbit

Subconjunctival injection Subconjunctival injection

Moraxella lacunata

was scarified by a scalpel 6 mm in a radial direction from the limbus corneae before dropping the agent, in suspension, into four more eyes (method B). To simulate a deeper wound, e.g. by a twig, a radial 6 mm incision of the conjunctiva was made with a pair of scissors in 12 eyes. The conjunctiva had previously been elevated by careful air-injection to prevent unintentional incision of subconjunctival tissue or the tenon capsule. A 25 G needle was inserted 3 mm beneath the edges of t h e w o u n d and 25 ~tl of inoculum was injected (method C). After instillation of the agents the eyelids were closed several times in order to achieve regular distribution of the suspension (methods A-C). Care was taken not to squeeze out any inoculum during this maneuver. In addition to general anesthesia two drops of oxybuprocaine without preservative had previously been administered in the eye for methods B and C. Some animals were also treated according to methods B and C without delivering an infectious agent in order to control the effects of the artificial injury.

Storage and preparation of inocula Haemophilus influenzae, Staphylococcus epiderrnidis and Staphylococcus aureus (ATCC 29213) were the challenge organisms used. The strains were transferred onto fresh chocolate agar (H. influenzae) or blood agar (Staphylococcus spp.) plates every two weeks, incubated at 36~ until colonies appeared, and then the plates stored at 4~ Inocula for experimental infections were prepared as follows: a colony was picked up from the agar plate and put

Negative Negative Negative

Infection Infection

into glucose or casein soybean peptone broth which was incubated for 6 hours at 36~ then the bacteria collected by centrifugation for 10 minutes at 3000 rpm. After the supernatant was removed, the bacterial pellet was resuspended in sterile saline, and the suspension subsequently diluted to give a final cell concentration of 1.05 x 103/50 lal of S. epidermidis or H. influenzae, and 1.35 • 103/50 tal of Staphylococcus spp. as determined using McFarland barium-sulfate standard density scale.

Key parameters to monitor infection A conjunctival swab was taken at the fourth and seventh day postinfection for microbiological examination. In addition, the clinical findings were monitored with regard to conjunctival hyperemia daily for 16 days. A staging of the conjunctival hyperemia was used (grade 0: white and not irritated; grade 1: slight; grade 2: moderate; and grade 3: severe conjunctival hyperemia (Figure 40.1-see colour plate). The four quadrants of the conjunctiva were assessed according to this staging. The results of each quadrant were added. The lowest score was 0 (white and smooth conjunctiva in all quadrants), and the highest was 12 (severe conjunctival hyperemia in all quadrants).

Results of microbiological examination All conjunctival swabs of eyes treated with method A were negative at the fourth day postinfection. Only one was

RABBIT MODEL OF BACTERIAL CONJUNCTIVITIS

Figure 40.2

Total amount of hyperemia -- grades of all eyes in method A-C using Haemophilus influenzae.

Figure 40.3 Total amount of hyperemia -- grades of all eyes in method A-C using Staphylococcus epidermidis.

355

356

M. Motschmann and W. Behrens-Baumann

positive at the same time in method B. In all eyes treated using method C positive findings were proved at the fourth day. However, 7 days postinfection no more infectious agents were found in any eye.

Results of clinical findings

The hyperemia scores of the four conjunctiva quadrants are shown in Figures 40.2-40.4. Haemopkilus influenzae provokes only a minimal irritation in all methods of agent inoculation, which has almost disappeared after 1 week (Figure 40.2). The results are hardly different when using Staphylococcus epidermidis (Figure 40.3). In eyes prepared according to method A (instillation of inoculum) Staphylococcus aureus does not cause a marked reaction either. Using method B (scarification/instillation) the hyperemia is rather stronger. Only in eyes treated by method C (incision/injection) does a distinct infection arise that persists for more than a week and disappears gradually afterwards (Figure 40.4). The eyes of the control group showed only a grade 2 hyperemia for about 2 days.

Antimicrobial therapy/key parameters to monitor response to treatment Using this model, several anti-infectives have been studied for therapy of experimental conjunctivitis caused by

Figure 40.4

Staphylococcus aureus (Behrens-Baumann and Begall, 1993b). At 48 hours after infection, polyvinylpyrrolidone (PVP)-iodine, bibrocathol (Noviform, NF), ethacridine (Biseptol, BS)and bacitracin + polymyxin B + neomycin (Polyspectran, PS) were applied five times per day. A total of 16 eyes (one eye per animal) were used for each substance. An additional 16 animals were given NaC1 drops and served as controls, as contralateral eyes should not be compared (Odenberger and Babicki, 1973; Immich, 1977). A conjunctival swab was taken every second day and a photograph every third day. Conjunctival hyperemia was graded 1-3 for each quadrant. Regression of hyperaemia was registered and was controlled five times in a masked fashion using the photographs. The ranking order of the substances tested in achieving regression of conjunctival hyperemia over time is demonstrated in Table 40.2, column 1. The group treated with PVP-iodine was the first to become white and not inflamed, followed by the groups receiving the other antiseptics and the antibiotic. In the control group (NaC1) the hyperemia was prolonged. The rank order was established by summarizing the mean values obtained for each group of eyes using the scoring system. Differences between the various groups were evaluated using Wilcoxon's test (Table 40.3). The ranking order of the substances in eliminating Staphylococcus aureus per time is presented in Table 40.2, column b. In the group treated with ethacridine, 12 of 16

Total amount of hyperemia -- grades of all eyes in method A-C using Staphylococcus aureus.

RABBIT MODEL OF BACTERIAL CONJUNCTIVITIS

357

Table 40.2 Substances applied five times per day and their ranking order in achieving regression of conjunctival hyperemia (A), in eliminating Staphyloccus aureus (B), and in fulfilling both criteria (C).

Substance

A

B

C

Povidone-iodine eyedrops Noviform ointment Biseptol eyedrops Polyspectran ointment NaCI 0.9% eyedrops

1 2 3 4 5

2 5 1 3 4

1 4 2 3 5

Table 40.3 Comparison of the various experimental groups using Wilcoxon's test (level of significance, p < 0.05)

Group

Significance (p)

Polyspectran/Biseptol Po lys pectran/N oviform Polyspectran/N aCI Polyspectran/PVP-iodine NaCI/Biseptol NaCI/Noviform NaCI/PVP-iodine Biseptol/Noviform Biseptol/PVP-iodine Noviform/PVP-iodine

0.933 0.939 0.314 0.289 0.394 0.556 0.054 0.819 0.342 0.664

swabs were sterile at day 4, followed by the PVP-iodine group (11 of 16 swabs). No germ could be cultured at day 6 in the ethacridine group or at day 8 in all groups, including the controls (Table 40.4). The overall rank order established by adding the values obtained for both criteria demonstrates that PVP-iodine was the most effective substance in achieving regression of conjunctival hyperemia as well as bacterial elimination (Table 40.2, column 3).

Pitfalls of the model This rabbit model mimics a bacterial conjunctivitis under standardized conditions. A small injury is necessary to establish the model. However, this procedure is only a theoretical disadvantage, because under natural conditions small injuries, e.g. by a twig, can cause bacterial conjunctivitis. Therefore this method mimics a realistic situation. Research into optimal therapy is now possible for the first time under standardized conditions without immunosuppression of the animal.

Contributions of the model to infectious disease therapy Like human conjunctivitis (Gigliotti et aL, 1984; Fisher, 1987) experimentally induced conjunctivitis in rabbits is a self-limiting disease. Our findings demonstrate that antibiotics are not superior to antiseptics in controlling bacterial conjunctivitis. In fact, PVP-iodine was the most effective substance in achieving bacterial elimination and reducing conjunctival hyperemia. This antiseptic agent acts via inhibition of the respiratory chain of the bacterium (Forth et aL, 1984). It has been successfully used in various studies (Hiti et al., 1978; Neuhann and Sommer, 1980; Auerbach et al., 1985), especially for preoperative disinfection and against Adenovirus (Apt et al., 1985; Janthure et al., 1985; Maeck et al., 1990). It is well tolerated by the corneal epithelium (MacRae et al., 1984). In conclusion, this rabbit model study demonstrates that antiseptics are as effective as antibiotics in the treatment of this standardized experimental conjunctivitis induced by Staphylococcus aureus as well as imitating a traumatic genesis. Antiseptics may therefore be sufficient to control human bacterial conjunctivitis as well.

Table 40.4 Positive cultures of Staphylococcus aureus obtained at various days following infection

Days Group

0

2

4

6

8

10

12

14

Polyspectran Biseptol Noviform PVP-iod ine NaCI

16 16 16 16 16

15 11 9 10 10

7 4 7 5 8

2 0 7 2 5

0 0 0 0 0

0 0 0 0 0

0 0 0 0 0

0 0 0 0 0

358

In purulent conjunctivitis of an immunocompetent patient an antiseptic should be applied in the first instance. If there is no improvement a conjunctival swab should be taken and an antibiotic should be prescribed. If there is still no improvement a different antibiotic can be given according to the results of the sensitivity test. This recommendation seems to be a reasonable option that takes into consideration benefits, risks and side effects as well as health costs (BehrensBaumann, 1997). In addition, antiseptics may be of beneficial value for prophylactic purposes (Isenberg et aL, 1985; Apt et aL, 1994; Kramer and Behrens-Baumann, 1997).

References Apt, L., Isenberg, S. J., Yoshimori, R. (1985). Antimicrobial preparation of the eye for surgery. Hosp. Infect. (Suppl.), 6, 163-172 Apt, L., Isenberg S. J., Yoshimori, R. et al. (1994). The effect of povidone-iodine solution applied at the conclusion of ophthalmic surgery. Am. J. OphthalmoL, 119, 701-705. Auerbach, B., Reich, E., Schuhmann, G. (1985). Polyvinyl-Jod in der Ophthalmochirurgie. Klin. Monatsbl. Augenheil k. 187, 361-362. Behrens-Baumann, W. (1991). Antibiotika und Antiseptika aus der Sicht des Ophthalmologen. Augen~'rztl. Fortb., 14, 27-31. Behrens-Baumann, W. (1997). Efficacy of selected antiinfectives in the rabbit conjunctivitis model. Hyg. Med., 22, 73-76. Behrens-Baumann, W., Begall, T. (1993a). Reproduzierbares Modell einer bakteriellen Konjunktivitis. Ophthalmologica, 2O6, 69-75. Behrens-Baumann, W., Begall T. (1993b). Antiseptics versus antibiotics in the treatment of the experimental conjunctivitis caused by Staphylococcus aureus. Ger. J. OphthalmoL, 2, 409-411. Dolder, R., Skinner F. S. (1983). Ophthalmika , 3rd edn, pp. 68-70; 123-329. Wissenschaftliche Verlagsgesellschaft, Stuttgart. Fechner, P. U., Teichmann, K. D. (1991). Medikament6se Augentherapie. In Biicherei des Augenarztes, vol. 67, pp. 182-185. Enke, Stuttgart. Fedukowicz, H. (1953). The Gram-negative Diplobacillus in hypopyon keratitis. Arch. Ophthalmol., 49, 202-211. Forth, W., Henschler, H., Rummel, W. (1984). Allgemeine und spezielle Pkarmakologie und Toxikologie, 4th edn, pp. 613-618. Wissenschaftsverlag, Mannheim. Fisher, M. C. (1987). Conjunctivitis in children. Pediatr. Clin. North Am., 34, 1447-1456. Gasparrini, E. (1883). I1 diplococco di Fraenkel, in pathologia oculare. Annali di Ottalmologia, 22, 6. (cited by Axenfeld, T. (1929). Infektionen der Conjunctiva. In Handbuck der pathogenen Mikroorganismen , 3rd edn (eds Kolle, W., Kraus, R., Uhlenhuth, P.), pp. 281-354. Urban & Schwarzenberg, Jena.

M. Motschmann and W. Behrens-Baumann

Gigliotti, F., Hendley, J. O., Morgan, J., Michaels, R., Dickens, M., Lohr, I. (1984). Efficacy of topical antibiotic therapy in acute conjunctivitis in children. J. Pediatr., 104, 623-626. Hiti, H., Haselmayer H., Hofmann H. (1978). Erfahrungen in der Therapie und Prophylaxe der Keratokonjunktivitis epidemica. Klin. Monatsbl. Augenheilk. , 174, 456-461. Howcroft, M. J., Okumoto, M., Ostler, H. B., Schachter, I. (1978). Staphylococcal infection superimposed on guinea pig inclusion conjunctivitis. Can. J. Ophthalmol., 13, 39-44. Isenberg, S., Apt, L., Yoshimori, R., Khwarg, S. (1985). Chemical preparation of the eye; comparison of povidoneiodine on the conjunctiva with a prophylactic antibiotic. Arch. OphthalmoL, 103, 1340-1342. Immich, H. (1977). Versuchsplanung und Auswertung. In Arzneimittelnebenwirkungen am Auge, (eds Hockwin, O., Koch, H. R.), pp. 189-215. Gustav Fischer, Stuttgart. Janthure, E., Blessing, J., Ehrich, W., Wigand, R. (1985). Polyvinyl-Pyrrolidon-Jod und Arginase: EinfluB auf Hornhautregeneration und antivirale Wirkung. Klin. Monatsbl. Augenheilk., 186, 25. Kramer, A., Behrens-Baumann, W. (1997). Prophylactic use of topical sub-infectives. Ophthalmologica (Suppl. 1), 68-76. Lange, B. (1924). giber die Infektion von wei~en M~iusen auf den nattirlichen Wegen durch die Haut, die Mund- und Darm-schleimhaut sowie die Augenbindehaut. Z. Hyg. Infektionskr., 102, 224-261. Leber, T. (1891). Die Entstehung der Entziindungen und die Wirkung der entziindungserregenden Sckddlickkeiten , pp. 134-136. Engelmann, Leipzig. MacRae, S., Brown, B., Edelhauser, H. (1984). The corneal toxicity of presurgical skin antiseptics. Am. ]. Ophthalmol., 97, 221-232. Maeck, C., Eckardt, C., H611er, C. (1990). Pr~ioperative Desinfektion der Konjunktiva mit PVP-Jod. Fortsckr. Ophthalmol., 87, 320-323. Maple, P., Hamilton-Miller, J., Brumfitt, W. (1989). Worldwide antibiotic resistance in methicillin-resistant Staphylococcus aureus. Lancet, 1 Mar., 537-540. Neuhann, T., Sommer, G. (1980). Erfahrungen mit Jod-Povidon zur Behandlung der Keratokonjunktivitis epidemica. Zeitsckr. Prakt. Augenheilk. , 1, 65-68. N61deke, E. (1899). Experimenteller Beitrag fiber die Bedeutung des Diplokokkus lanceolatus Fraenkel in der Pathologie des Auges. Medical dissertation, KaiserWilhelm-Universit~it, Strassburg i.E. O'Brien, T. P. (1991). Ciprofloxacin in der Behandlung der Keratitis. Paper presented at the International Symposium DOG 'Infektionskrankheiten des Auges', MOnster. Odenberger, J., Babicki, A. (1973). Alkali burns of the rabbit cornea. Ophth. Res., 5, 1-9. Puliafito, C. A., Baker, A. S., Haaf, J., Foster, C. (1989). Infectious endophthalmitis. Ophthalmology, 8, 921-929. R6mer, P. (1899). Experimentelle Untersuchungen fiber Infektionen vom Conjunctivalsack aus. Hyg. Infektionskr. , 32, 295-326. Sereny, B. (1955). Experimental shigella keratoconjunctivitis: a preliminary report. Acta Microbiol. Hung., 2, 293-296. Sereny, B. (1956). Experimental keratoconiunctivitis shigellosa. Acta Microbiol. Hung., 4, 367-376. Srivastava, K. K., Pick, J. R., Johnson, T. P. (1986). Charak-

RABBIT MODEL OF BACTERIAL CONJUNCTIVITIS

terization of a Haemophilus sp. isolated from a rabbit with conjunctivitis. Lab. Anita. Sci., 36, 291-293. Tomasz, A. (1994). Multiple-antibiotic-resistant pathogenic bacteria. N. Engl. J. Med., 330, 1247-1251.

359

Trabulisi, L. R. (1965). Experimental keratoconjunctivitis of the guinea pig by enterobacteria. Rev. Inst. Med. Trop. Sao Paulo., 7, 16-23.

This Page Intentionally Left Blank

Chapter 41

Murine Model of Bacterial Keratitis K. A. Kernacki, J. A. Hobden and L. D. Hazlett

Introduction

Mice

Bacterial keratitis

Both inbred strains of mice and outbred mice have been used in this model (Table 41.1). Outbred mice are less expensive, generally more hardy and immunologically more accurately represent the heterogeneous human population. Inbred strains of mouse, which contain a homogeneous genetic background, should be used for any studies where a precise assessment of immunological parameters is of importance. Various inbred strains of mouse have been characterized as either susceptible or resistant to corneal infection on the basis of their ability to restore corneal clarity and ocular integrity after infection (Berk et al., 1979, 1981). After infection, the cornea of a mouse with a susceptible phenotype will develop a purulent infection leading to corneal perforation and often endophthalmitis accompanied by atrophy of the whole eye (phthisis bulbi) within 7-14 days. In contrast, mice with a resistant phenotype will develop a similar purulent infection to susceptible animals; however, bacteria will be eliminated from ocular tissue, corneas will clear, and the near-normal architecture of the eye will be preserved. The phenotype of resistance and susceptibility can be attributed to many factors, including macrophage and T-cell function (Berk, 1993) and the kinetics of the inflammatory cell response (Hazlett et aL, 1992; Hobden et aL, 1995). In general, outbred mice exhibit a resistant phenotype;

Bacterial corneal infection is a highly destructive process that often leads to loss of vision. Because of the severity of the disease, initial therapy for bacterial ulcerative keratitis consists of an intensive regimen of broad-spectrum antibiotic chemotherapy (McLeod et aL, 1995). In many cases corneal transplantation is required to restore visual acuity. Approximately 30 000 bacterial corneal ulcers are treated annually in the USA (Pepose and Wilhelmus, 1992). One important risk factor in the development of bacterial ulcerative keratitis is the use of extended-wear contact lenses (Schein et aL, 1994). Other predisposing factors include corneal trauma, pre-existing ocular surface disorders, corneal surgery and immunosuppression. A variety of microorganisms have been reported to cause keratitis. These include Pseudomonas aeruginosa, Staphylococcus aureus, Streptococcus pneurnoniae, Neisseria gonorrkoeae, Moraxella catarrkalis, Haemopkilus influenza< Bacillus spp., Corynebacterium diphtheriae, and Serratia rnarcesens, as well as several anaerobic bacteria.

Mouse model Several experimental models of bacterial keratitis using mice, rabbits, rats, and guinea pigs have been described in which aspects of tissue pathology, host response, and course of infection are similar to those reported for human infections. Development and refinement of the murinescratch model of bacterial keratitis can be attributed to the work of Gerke and Magliocco (1971), Hazlett et aL (1976), and Ohman et aL (1980). Essentially all of the studies in the mouse have used various strains of P. aeruginosa as the infectious agent. Because the organism is one of the most destructive of all the ocular bacterial pathogens, the focus of this review will be on the pseudomonal model of keratitis. In theory, methods described for the pseudomonal model should be applicable for other infectious agents as well. Handbook of Animal Models of Infection ISBN 0-12-775390-7

Table 41.1

Mouse C57BL/6J C3H/HeJ DBA/2J Balb/cJ Swiss Webster Swiss ICR

Mice used for bacterial keratitis models

Inbred Ocular Phenotype strain response Black coat Agouti Grey coat Albino Albino

Yes Yes Yes Yes No

Susceptible Susceptible Resistant Resistant Resistant

Albino

No

Resistant

Source Jackson Labs* Jackson Labs Jackson Labs Jackson Labs HarlanSpraguet HarlanSprague

* The Jackson Laboratory, Bar Harbor, ME. t Harlan-Sprague Dawley, Inc., Indianapolis, IN.

Copyright 9 1999Academic Press All rights of reproduction in any form reserved

362

however animals 1 year or more of age are usually susceptible to corneal infection (Hazlett et aL, 1990). The choice of whether to use an outbred mouse or an inbred mouse with a resistant or susceptible phenotype will depend on the nature of the study. For example, a mouse with a resistant phenotype may be useful for long-term studies where the objective is to evaluate the effects of a chemotherapeutic regimen on minimizing stromal scarring. For acute studies, where the objective is to observe the efficacy of a particular antimicrobial agent with respect to bacterial clearing, a mouse with a susceptible phenotype may be desirable. An additional consideration in selection of which mouse strain to use is pigmentation of the animal. Ocular pathology, particularly in the anterior chamber, is easier to observe in an albino mouse.

K . A . Kernacki, J. A. Hobden and L. D. Hazlett

Table 41.2 Pseudomonas aeruginosa strains used to establish bacterial keratitis in mice

Strain

Source

Reference(s)

PAl03

American Type Culture Collection*

PAO1

Pseudomonas Genetic Stock Center1American Type Culture Collection American Type Culture Collection American Type Culture Collection

Ohman et al., 1980; O'Callaghan et aL, 1996 Ohman et al., 1980; Preston et aL, 1997 O'Callaghan et al., 1996 Hazlett et aL, 1976; Fleiszig et aL, 1994 Hazlett et al., 1991; Fleiszig et aL, 1994

27853 19660 PAK

* American Type Culture Collection, Manassas, VA. 1-Pseudomonas Genetic Stock Center, East Carolina University School of Medicine, Greenville, NC.

Animal care Mice for these studies are generally obtained from vendors (Table 41.1) between the ages of 5 and 6 weeks. Female mice are generally preferred because they are able to be housed in multiples. Animals are housed in caging specified by the National Research Council's Guide for the Care and Use of Laboratory Animals (1996). Animals are fed commercial rodent chow, unless they are breeders and then they are fed mouse chow. Acidified water (3.1 ml of concentrated HC1 added to 5 gallons of tap water, resulting pH 3.8) is provided ad libitum to prevent the animals from being colonized by P. aeruginosa in the drinking water. Animals are held for 1 week after arrival from the vendor before experimental use.

of approximately 1.6 at 540 nm. Cultures are then centrifuged at 6 000g for 10 minutes at 15~ The bacterial pellet is resuspended in 10 ml of sterile saline (0.85 M NaC1, pH 7.2), centrifuged again for 10 minutes and resuspended in 5 ml of sterile saline to a concentration of approximately 2 x 101~cfu/ml, using a standard curve relating viable counts to optical density at 540 nm. Depending on the infecting dose, further dilutions may be made from this stock culture. The infecting dose for ATCC strain 19660, routinely used in our studies, is 1 x 106 cfu in a total volume of 5 ~1. Others have reported using infecting doses between 103 and 108 cfu depending on the bacterial strain and the level of anesthesia (Preston et aL, 1995; Fleiszig et aL, 1994; Ohman et aL, 1980; Gerke and Magliocco, 1971).

Preparation of bacterial inoculum

Infection of mice

A variety of P. aeruginosa strains and clinical isolates (Preston et aL, 1995; Fleiszig et aL, 1994, 1996) have been used in experimental corneal infection models. Strains from culture collections are preferable to clinical isolates obtained from ocular infections. Culture collection strains are better characterized and described in the literature than clinical isolates and the virulence and viability of the organisms are assured. The more common strains and their respective sources are listed in Table 41.2. Cultures of the bacterial strains are kept frozen at-70~ in PTSB - - 0.25% trypticase soy broth (Sigma Chemical Co., St Louis, MO) and 5% peptone (Difco Laboratories, Detroit, M I ) m m i x e d with 15% glycerol. Stock cultures of P. aeruginosa used to prepare an infecting inoculum are maintained on PTSB slants (PTSB solidified with 1.7% agar (Difco)) at 4~ Fresh slants are prepared every 2 weeks using frozen stocks as an inoculum. Cultures for the infection process are grown in 25 ml of PTSB at 37~ on a rotary shaker at 150 rpm for 18 hours to an optical density

In most published studies using the murine-scratch model of infection, mice are anesthetized with isoflurane (Aerrane; Anaquest, Madison, WI) or ethyl ether. The use of ethyl ether is not recommended because it is very volatile and the vapors are explosive. The anesthetic is administered by inhalation by placing a mouse within a jar containing the anesthetic. The degree of anesthesia can be monitored by the animal's loss of equilibrium and rapid but steady respiration. The length of time required to anesthetize a mouse varies with the construction of the anesthetizing jar and with the size and strain of mouse. In general, full anesthesia (defined as a lack of voluntary muscle tone) is accomplished in less than a minute. Mice generally recover from the effects of inhalant anesthesia in less than 2 minutes after removal from the anesthetizing jar. Recently, Preston et aL (1995) described the use of an alternate method of anesthesia. They inject 0.2 ml of a mixture of 6.7mg ketamine hydrochloride and 1.3 mg xylazine/ml i.p. into mice prior to corneal wounding. Using

MURINE MODEL OF BACTERIAL KERATITIS

this method, the animals remain immobile for 15-30minutes depending on the murine strain. Using this alternate method mice could be infected with much lower doses of P. aeruginosa. These studies described the 50% infective dose of various strains to be between 3 x 102 and 1 x 105 cfu. There are advantages and disadvantages to each of these methods of anesthesia. The advantages of using the inhalant method are that the animals recover quickly after anesthesia and that the ocular surface, i.e., the tear film, remains relatively intact. The disadvantages of using inhalation anesthetics are that a larger inoculum is required to initiate infection and that the investigator needs to work quickly to wound and topically apply the bacterial inoculum. Using the injection anesthesia method, a lower bacterial inoculum can initiate disease, but the normal tear film is altered by the lack of a blink reflex while the animals are anesthetized. Following anesthesia, mice are placed beneath a stereoscopic microscope at 40• magnification and the central cornea of each mouse is scarified with three 1-mm incisions using a 26G needle (Figure 41.1). The wounds are randomly examined histologically to ensure that they penetrate the epithelial basal lamina, but extend no deeper than the superficial corneal stroma (Figure 41.2). After wounding, 5 ~1 of the bacterial suspension is topically applied to the scarified cornea using a calibrated micropipette with a sterile disposible tip. After infection, mice are placed into a holding cage to recover from the anesthesia. After recovery, they are transferred to a cage containing fresh bedding.

Key parameters to monitor infection and response to treatment Gross observation At daily intervals after infection, animals are grossly observed to ensure that animals are infected and to grade

363

Figure 41.2 Corneal surface following scarification. (A) Corneal wound that penetrates epithelial basal lamina into superficial stroma (arrowheads). (B) Corneal wound that does not penetrate epithelial basal lamina (arrow).

the progression of the disease. Two different methods of grading ocular pathology in the mouse have been described and are shown in Tables 41.3 and 41.4 (Gerke and Magliocco, 1971; Hazlett et aL, 1987, 1991). To aid in grading, eyes may be examined using a 40 x dissecting microscope or with a slit-lamp microscope. In some cases, the eyelid may be sealed after infection. To facilitate grading of sealed eyes, the eyelid may be gently swabbed with a sterile cotton swab moistened with sterile saline and then gently opened sufficiently widely to grade the ocular disease.

B. Quantitation of viable bacteria

"':::.

Figure 41.1 Diagram of the method used for scarification of the mouse cornea. Three 1-mm incisions are made to the upper right quadrant of the cornea using a sterile 26 G needle.

Examination of numbers of viable bacteria in infected ocular tissues at different time points after infection additionally provides information on the progression of the infection as well as the efficacy of antimicrobial therapy (Kernacki and Berk, 1994; Hobden et aL, 1997). Following infection, mice are sacrificed by cervical dislocation and whole eyes or corneal tissue are collected. The ocular tissue is homogenized in a sterile tissue grinder containing 1.0 ml of sterile saline (0.85 M NaC1, pH 7.2) with 0.25% bovine

364

K.A. Kernacki, J. A. Hobden and L. D. Hazlett

Table 41.3

+0 to +4 scoring system (Hazlett et aL, 1987)

Score Pathology +0 +1 +2 +3 +4

Clear or slight opacity, partially covering the pupil Slight opacity fully covering the anterior segment Dense opacity, partially or fully covering the pupil Dense opacity covering the entire anterior segment Corneal perforation or phthisis bulbi

Table 41.4 +0 to +10 scoring system Magliocco, 1971)

(Gerke and

Score Pathology +0 +1 +2 +3 +4 +5 +6 +7 +8 +9 +10

No pathology Iritis Hazy opacity in wound or central cornea Hazy opacity over entire cornea Dense opacity in central cornea with remainder of cornea hazy Same as +4 but with prominent descemetocele Dense opacity of entire cornea Dense opacity of entire cornea with ulcer Same as +7 but cornea has perforated Dense opacity of most or all of cornea with iridial prolapse Any pathology not previously described, including phthisis bulbi

serum albumin (BSA). The samples are diluted serially in the same solution and plated in triplicate on Pseudomonas isolation agar plates (Difco, Detroit, MI). The number of viable bacteria in the infected ocular tissue is determined by counting the individual colonies on the plates from the different dilutions after incubating the plates at 37~ for 18-24 hours.

P M N quantitation

Within 18-24 hours after infection, PMNs are the predominant cell infiltrating the infected cornea. The gross observation of corneal opacity is a qualitative reflection of PMN infiltration. PMN in infected corneal tissues can be quantitated by assaying the activity of myeloperoxidase (MPO), an enzyme found in high concentrations in the azurophilic granules of PMNs (Williams et aL, 1983; Kernacki and Berk, 1995). After collection of either whole eyes or corneas, the tissue is homogenized in 2.0 ml of 0.5% hexadecyltrimethylammonium bromide (Sigma Chemical, St Louis, MO) in potassium phosphate buffer (50 mM, pH 6.0). Following homogenization, samples are sonicated for 10 seconds in an ice bath. The samples are then freeze-thawed three times, after which they are sonicated one more time on ice for 10 seconds. Samples are then centrifuged at 8000g for 20 minutes. An aliquot of the resulting supernatant (0.1 ml) is mixed with 2.9 ml of potassium phosphate buffer contain-

ing O-dianisidine dihydrochloride (16.7 mg/100 ml; Sigma) and hydrogen peroxide (0.0005%). The change in extinction at 460 nm is monitored for 3 minutes. Determination of MPO activity can then be calculated. One unit of MPO activity degrades 1 mmol of peroxide/minute at 25~ The degradation of 1 mmol of peroxide has been reported to give a change in extinction of 1.13 • 10-2 minutes. The numbers of PMNs can be determined by preparing a standard curve relating PMN numbers to enzyme activity. A relatively pure population of PMNs can be collected from 2-day-infected corneal tissue by corneal disaggregation (Badenoch et aL, 1983). A pool of 10 infected corneas is placed in 10 ml of filtered sterilized phophate-buffered saline (PBS, 0.1 M, pH 7.4) containing 0.05% type IV collagenase (Sigma) and 0.25% pancreatin (Sigma). The disaggregation procedure is allowed to proceed for 45 minutes at 37~ with stirring. After the incubation procedure, the enzymes are inactivated by adding 2.0 ml of fetal calf serum. The sample is then centrifuged at 180g for 10 minutes and resuspended in 2 ml of PBS. Viable cell counts are determined by trypan blue exclusion staining. Serial dilutions of the original sample are used to produce a standard curve relating units of MPO activity to numbers of PMNs.

Histopathology

The progression of corneal infection and the effects of antimicrobial therapy can be directly determined by histopathological evaluation. The procedures used for embedding and sectioning of ocular tissues has been described (Hazlett et aL, 1992). At various time points after infection, whole eyes are enucleated from the mice and briefly washed in 0.1 M sodium phosphate buffer, pH 7.4. Eyes are then fixed intact for 3 hours at 4~ in a 1:1:1 solution of 2% osmium tetroxide, 2.5% gluteraldehyde in 0.1 M sodium phosphate buffer, and 0.2 M Sorenson's buffer, pH 7.4. After fixation, eyes are rinsed briefly with 0.1 M sodium phosphate buffer, brought to room temperature, dehydrated with a series of ethanol solutions to 100%, and then transferred to propylene oxide. Specimens are infiltrated with epon-araldite resin and propylene oxide (1 : 1 mixture for 1 hour, followed by a 3:1 mixture for 24 hours) and infiltrated with fresh resin for 1 week before embedding in fresh resin containing the polymerizing agent DMP-30. Eyes should be oriented in the resin to facilitate crosssectioning through the cornea. Sections (1.5 lttm in thickness) from the area of the central cornea are cut with an ultramicrotome and stained for 3-5minutes with a modified Richardson's stain. Sections may then be examined microscopically using standard bright-field optics.

Antimicrobial therapy There are very few studies in the literature that have

MURINE MODEL OF BACTERIAL KERATITIS

examined the effect of antimicrobial agents using experimental murine models of bacterial keratitis. Most of these studies have employed the rabbit model of keratitis. One murine study by Tanaka (1981) described the efficacy of topical treatment every 3 hours for 24 hours with antibiotic (habekain, tobramycin, and gentamicin). Likewise, this study examined the effects of intramuscular injection of the same antibiotics on the corneal response to infection. The 50% effective dose was approximately 1 btg/mouse when the drug was topically applied every 3 hours after the infection, and about 0.2 mg/mouse when the antibiotic was intramuscularly injected 1 hour after the bacterial challenge. A second study introduced the antibiotic cepharolidine into the conjunctival sac four times daily for 7 days to control P. aeruginosa growth (Miyaji, 1977).

Advantages/disadvantages of the model Advantages There are several practical advantages of using mice as a model for bacterial keratitis. Unlike rabbits and guineapigs, mice are relatively inexpensive to purchase and house. Because of this relative inexpense, a larger number of mice can be incorporated into a given study, thereby strengthening any statistical analyses performed. Because of their size, mice are also easier to handle than larger animals. Another advantage related to the mouse's size is that topical antimicrobial therapy can be achieved with smaller drop volumes (5 }.tl) than with larger animals, which require drop volumes of 20-50 btl. Furthermore, a wide variety of immunological reagents are available for studies using mice. Finally, several of the in-vitro and in-vivo observations in the mouse have been demonstrated in organ-cultured human corneas and human corneal cells (Hazlett and Rudner, 1994; Wu et al., 1995, 1996; Gupta et al., 1997).

Disadvantages

The mouse's size also serves as a disadvantage. Unlike rabbits and guinea-pigs, it is difficult to observe any gross pathology in great detail in mice without the aid of a microscope. Unlike larger animals, mice must be handled with care during late stages of the infection (usually after 5 days postinfection) because the cornea is extremely fragile and excessive handling may lead to traumatic corneal perforation.

Contributions of the model to infectious disease therapy The mouse model of P. aeruginosa keratitis has been used extensively to increase our understanding of host

365

receptor/bacterial adhesion interactions (Hazlett et al., 1987, 1991, 1993), host immune/inflammatory responses to infection (Hazlett et al., 1990, 1992; Kernacki and Berk, 1994, 1995), and the role of bacterial virulence factors in pathogenesis (Ohman et al., 1980; O'Callaghan et al., 1996). Very few investigators have used the mouse model of bacterial keratitis to examine the efficacy of antimicrobial agents. Most studies evaluating new antimicrobial agents (Hobden et al., 1992), chemotherapeutic regimens (Engel et al., 1995), or drug delivery techniques (Rootman et al., 1988) have relied on the rabbit model of bacterial keratitis. In spite of this dearth of previously published studies, the mouse model of bacterial keratitis should prove useful for evaluating the efficacy of novel antimicrobial agents or chemotherapeutic regimens, especially in circumstances where the experimental pharmaceuticals are in short supply. Finally, the genetic homology of inbred mice, the consistency of the murine immune response and its similarity to the human system, and the availability of immunological and molecular reagents make the mouse an attractive alternative to other animal species.

References Badenoch, P. R., Finlay-lones, 1-1., Coster, D. 1. (1983). Enzymatic disaggregation of the infected rat cornea. Invest. Opktkalmol. Vis. Sci., 24, 253-257. Berk, R. S. (1993). Genetic regulation of the murine corneal and non-corneal response to Pseudornonas aeruginosa. In Pseudomo~aas aeruginosa as an Opportunistic Patkogen (eds Campa, M., Bendinelli, M., Frideman, H.), Plenum Press, New York. Berk, R. S., Leon, M. A., Hazlett, L. D. (1979). Genetic control of the corneal response to Pseudomonas aeruginosa. Infect. Immun., 26, 1221-1223. Berk, R. S., Beisel, K., Hazlett, L. D. (1981). Genetic studies on the murine corneal response to Pseudomonas aeruginosa. Infect. Immun., 34, 1-5. Engel, L. S., Callegan, M. C., Hobden, I. A., Reidy, I. J., Hill, I. M., O'Callaghan, R. I. (1995). Effectiveness of specific antibiotic/steroid combinations for therapy of experimental Pseudomonas aeruginosa keratitis. Curr. Eye Res., 14, 229-234. Fleiszig, S. M. l., Zaidi, T. S., Fletcher, E. L., Preston, M. l., Pier, G. B. (1994). Pseudomonas aeruginosa invade corneal epithelial cells during experimental infection. Infect. Immun., 62, 3485-3493. Fleiszig, S. M. J., Preston, M. J., Grout, M., Evans, D. l., Pier, G. B. (1996). Relationship between cytotoxicity and corneal epithelial cell invasion by clinical isolates of Pseudomonas aeruginosa. Infect. Immun., 64, 2288-2294. Gerke, I. R., Magliocco, M. V. (1971). Experimental Pseudomonas aeruginosa infection of the mouse cornea. Infect. Immun., 3, 209-216. Gupta, S. K., Masinick, S., Garrett, M., Hazlett, L. D. (1997). Pseudomonas aeruginosa lipopolysaccharide binds galectin-3 and other human corneal epithelial proteins. Infect. Immun., 65,2747-2753.

366

Hazlett, L. D., Rudner, X. L. (1994). Investigations on the role of flagella in adhesion of Pseudomonas aeruginosa to mouse and human corneal epithelial proteins. Ophthalmic Res., 26, 375-379. Hazlett, L. D., Rosen, D. D., Berk, R. S. (1976). Experimental eye infections caused by Pseudomonas aeruginosa. Ophthalmic Res., 8,311-318. Hazlett, L. D., Moon, M. M., Strejc, M., Berk, R. S. (1987). Evidence for N-acetylmannosamine as an ocular receptor for P. aeruginosa adherence to scarified cornea. Invest. Opktkalmol. Vis. Sci., 28, 1978-1985. Hazlett, L. D., Kreindler, F. B., Berk, R. S., Barrett, R. (1990). Aging alters the phagocytic capability of inflammatory cells induced into cornea. Curr. Eye Res., 9, 129-138. Hazlett, L. D., Moon, M. M., Singh, A., Berk, R. S., Rudner, X. L. (1991). Analysis of adhesion, piliation, protease production and ocular infectivity of several P. aeruginosa strains. Curr. Eye Res., 10, 351-362. Hazlett, L. D., Zucker, M., Berk, R. S. (1992). Distribution and kinetics of the inflammatory cell response to ocular challenge with Pseudomonas aeruginosa in susceptible versus resistant mice. Ophthalmic Res., 24, 32-39. Hazlett, L. D., Masinick, S., Barrett, R., Rosol, K. (1993). Evidence for asialo GM1 as a corneal glycolipid receptor for Pseudomonas aeruginosa adhesion. Infect. Immun., 61, 5164-5173. Hobden, J. A., O'Callaghan, R. J., Hill, J. M., Hagenah, M., Insler, M. S., Reidy, J. J. (1992). Ciprofloxacin and prednisolone therapy for experimental Pseudomonas keratitis. Curr. Eye Res., 11,259-265. Hobden, J. A., Masinick, S. A., Barrett, R. P., Hazlett, L. D. (1995). Aged mice fail to upregulate ICAM-1 after Pseudomonas aeruginosa corneal infection. Invest. Opktkalmol. Vis. Sci., 36, 1107-1114. Hobden, J. A., Masinick, S. A., Barrett, R. P., Hazlett, L. D. (1997). Proinflammatory cytokine deficiency and pathogenesis of Pseudomonas aeruginosa keratitis in aged mice. Infect. Immun., 65, 2754-2758. Kernacki, K. A., Berk, R. S. (1994). Characterization of the inflammatory response induced in mice by corneal infection with Pseudomonas aeruginosa. J. Ocular Pharm., 10, 281-288. Kernacki, K. A., Berk, R. S. (1995). Characterization of arachidonic acid metabolism and the polymorphonuclear leukocyte response in mice infected with Pseudomonas aeruginosa. Invest. Ophtkalmol. Vis. Sci., 36, 16-23. McLeod, S. D., LaBree, L. D., Tayanipour, R., Flowers, C. W., Lee, P. P., McDonnell, P. J. (1995). The importance of initial management and treatment of severe infectious corneal ulcers. Ophthalmology, 102, 1943-1948. Miyaji, A. (1977). Experimental study on keratitis in mice. The influence of topical antibiotics on establishment of

K . A . Kernacki, J. A. Hobden and L. D. Hazlett

Pseudomonas aeruginosa. Nippon Ganka Gakki Zasshi--Acta Soc. Ophthalmol. Jpn., 81,560-568. Moon, M. M., Hazlett, L. D., Hancock, R. E. W., Berk, R. S., Barrett, R. (1988). Monoclonal antibodies provide protection against ocular Pseudomonas aeruginosa infection. Invest. Ophthalmol. Vis. Sci., 29, 1277-1284. National Research Council (1996). Guide for the Care and Use of Laboratory Animals. National Academy Press, Washington, DC. O'Callaghan, R. J., Engel, L. S., Hobden, J. A., Callegan, M. C., Green, L. C., Hill, J. M. (1996). Pseudomonas keratitis. The role of an uncharacterized exoprotein, protease IV, in corneal virulence. Invest. Ophthalmol. Vis. Sci., 37, 534-543. Ohman, D. E., Burns, R. P., Iglewski, B. H. (1980). Corneal infections in mice with toxin A and elastase mutants of Pseudomonas aeruginosa. J. Infect. Dis., 142, 547-555. Pepose, J. S., Wilhelmus, K. R. (1992). Divergent approaches to the management of corneal ulcers. Am. J. Ophthalmol., 114, 30-32. Preston, M. J., Fleisiz, S. M. J., Zaidi, T. S. et al. (1995). Rapid and sensitive method for evaluating Pseudomonas aeruginosa virulence factors during corneal infection in mice. Infect. Immun., 63, 3497-3501. Preston, M. J., Seed, P. C., Toder, D. S. et al. (1997). Contribution of proteases and LasR to the virulence of Pseudomonas aeruginosa during corneal infections. Infect. Immun., 65, 3086-3090. Reidy, J. J., Hobden, J. A., Hill, J. M., Forman, K., O'Callaghan, R. J. (1991). The efficacy of topical ciprofloxacin and norfloxacin in the treatment of experimental Pseudomonas keratitis. Cornea, 10, 25-28. Rootman, D. S., Hobden, J. A., Jantzen, J. A., Gonzalez, J. R., O'Callaghan, R. J., Hill, J. M. (1988). Iontophoresis of tobramycin for the treatment of experimental Pseudomonas keratitis in the rabbit. Arch. Ophthalmol., 106, 262-265. Schein, O. D., Buehler, P. O., Stamler, J. F., Verdier, D. D. (1994). The impact of overnight wear on the risk of contact lensassociated ulcerative keratitis.Arch. Ophthalmol., 112, 186-190. Tanaka, Y. (1981). Effects of habekacin, a novel aminoglycoside antibiotic, on experimental corneal ulceration due to Pseudomonas aeruginosa. J. Antibiot., 7, 892-897. Williams, R. N., Patterson, C. A., Eakins, K. E. (1983). Quantitation of ocular inflammation: evaluation of polymorphonuclear leukocyte inflammation by measuring myeloperoxidase activity. Curr. Eye Res., 2, 465-471. Wu, X., Gupta, S. K., Hazlett, L. D. (1995). Characterization of P. aeruginosa pili binding human corneal epithelial proteins. Curt. Eye Res., 14, 969-977. Wu, X., Kurpakus, M., Hazlett, L. D. (1996) Some P. aeruginosa pilus binding proteins of human corneal epithelium are cytokeratins. Curr. Eye Res., 15, 782-791.

Chapter 42

The Rabbit Intrastromal Injection Model of Bacterial Keratitis R. d. O'Callaghan, L. S. Engel and J. M. Hill

Background A model of Pseudomonas keratitis initiated by an intrastromal injection of bacteria into the rabbit cornea has been employed for many years to study ocular antimicrobial therapies (Table 42.1) and for determining mechanisms of pathogenesis (Table 42.2). The procedures used for the Pseudomonas model have been employed for developing models of pneumococcus (Johnson and Allen, 1971, 1975; Harrison et al., 1983, Johnson et al., 1991, 1992, 1995) and

Staphylococcus aureus keratitis (Kupferman and Leibowitz, 1977; Leibowitz et al., 1981; Mondino and Kowalski, 1982; Edwards and Schlech, 1985; Mondino et al., 1987a,b; Kaufman et al., 1991; Callegan et al., 1992a,b, 1994a,b,c,d, 1995; Engel et al., 1996; Moreau et al., 1997; O'Callaghan et al., 1997). There are a few reports describing the development of a rabbit intrastromal model for Serratia keratitis (Berstein and Maddox, 1973; Lyerly et al., 1981; Hume et al.,

1998), but no quantitative chemotherapeutic studies have been described. A topical route of inoculation, employing

42.1 Chemotherapy of Pseudomonas intrastromal injection model

Table

keratitis in the rabbit

Antibiotic class

Studies

13-1actams Aminoglycosides

Piatkowska, 1966; Galin et al., 1968 Fugiuele, 1968; Bohigian et al., 1971; Smolin et al., 1973, 1974; Belfort et al., 1975; Kupferman and Leibowitz, 1976; Alpren et al., 1979, Davis et al., 1979; Hobden et aL, 1988a,b, 1989; Rootman et al., 1988; Gritz et al., 1992; Engel et al., 1995

Quinolones

Galin et al., 1968; Hobden et al., 1990a, b, 1992, 1993a, b,c; O'Brien et al., 1988; Reidy et al., 1991; Gritz et al., 1992; Engel et al., 1996

Polymyxins

Fugiuele, 1968; Kupferman and Leibowitz, 1976

Table 42.2 Studies of pathogenic mechanisms for Pseudomonas keratitis

in the rabbit intrastromal injection model Pathogenic factor

Studies

Polymorphonuclear cell activity

Hobden et al., 1993a

Pseudomonas

elastase

Kreger and Gray, 1978; Gray and Kreger, 1975; Kessler and Spierer, 1984

Exotoxin A

O'Callaghan et al., 1996

Protease IV

O'Callaghan et al., 1996; Engel et al., 1997

Handboo k of Animal Models of Infection

ISBN 0-12-775390-7

Copyright 9 1999AcademicPress All rights of reproduction in any form reserved

368

bacteria adhering to contact lenses as an inoculum, has been described for producing Pseudomonas keratitis in rabbits (Brockman et aL, 1992), but this model has been used on a limited basis for chemotherapeutic (Brockman et aL, 1992) and pathogenic studies (O'Callaghan et aL, 1996). The mouse model of Pseudomonas keratitis has been employed extensively for the study of bacterial pathogenesis and for immunologic aspects of keratitis (Chapter 41); however, this model is not suited for quantitative measurements of antibiotic therapy.

Rabbits Young New Zealand white rabbits, 2-3 kg, when intrastromally injected with Pseudomonas, produce a marked inflammatory response while older rabbits (5-6kg) produce a less intense inflammatory reaction to infection (Hobden et aL, 1993a). Typical chemotherapy experiments employ rabbits weighing 2-3 kg.

R.J. O'Callaghan, L. S. Engel and J. M. Hill

sue and homogenous dispersal of the tissue allows accurate and precise determination of the number of bacteria. An Ultraturax Tissumizer (Tekmar, Cincinnati, OH) or its equivalent is recommended.

Anesthesia and medications Ketamine (100mg/ml; Aveco, Fort Dodge, IA) in 10 ml bottles, and xylazine (100 mg/ml; Miles, Shawnee, KS) in 50ml bottles, can be obtained from the Butler Company, Columbus, OH. Proparacaine (0.5%), in 15 ml bottles, can be obtained from Bausch & Lomb, Tampa, FL. Topical antibiotic ointment in 3.5g tubes, either Gentrasul (gentamicin 3 mg/ml, Bausch & Lomb) or Maxitrol (3.5 mg/ml neomycin, 10000 units/ml polymyxin B, and 0.1% dexamethasone, Alcon, Fort Worth, TX), were employed. Pentobarbital powder (Sigma Chemical Co., St Louis, MO) was dissolved in sterile water at a concentration of 100 mg/ml.

Miscellaneous

Materials required for chemotherapeutic studies Bacteriology laboratory Storage of bacterial strains is best accomplished by freezing the organisms in an ultra-low freezer (-70 o C). Preparation of the bacterial inoculum requires both solid and liquid culture media. A shaking incubator is useful for the propagation of bacteria in broth culture. Agar plates are incubated in a standard incubator of a relatively large size to accommodate the large number of plates required for chemotherapeutic determinations. Specialized media for detection of proteases and hemolysins are recommended to ensure that the bacteria maintain their virulence throughout storage and throughout infection.

Ocular inoculation and evaluation The corneal inoculation process requires an injection of 5-10btl of the test sample using a microliter syringe (Hamilton Co., Reno, NV) with a 30 G needle. Locking forceps (e.g., Graefe-type fixation forceps, Roboz Surgical Instrument Company, Rockville, MD) are used for grasping the eye when making an intrastromal injection. A biomicroscope (e.g., Topcon, Kogakukai K.K., Tokyo, Japan) is required to perform slit lamp examination (SLE) of the eyes. Changes in ocular inflammation can be further documented by photography and therefore a camera is highly desirable. A tissue homogenizer is required for bacterial enumeration because the cornea is a particularly fibrous tis-

For membranectomies, a hand-held electric cauterizer (high-temperature fine-tip cauterizer, Aaron Medical Industries, St Petersburg, FL) is essential for limiting bleeding during this surgical procedure. At the termination of the experiment, a scalpel with a no. 10 blade, surgical scissors, a hemostat, and forceps are needed for the removal of the corneas from sacrificed rabbits.

Procedures for anesthesia For general anesthesia, rabbits are injected intramuscularly with a mixture of ketamine (50 mg/kg) and xylazine (10mg/kg). Immediately prior to intrastromal injection or membranectomy, the eye is anesthetized by topical administration of two drops of proparacaine. Because the injection of ketamine and xylazine can effect iritis and possibly other types of ocular inflammation, slit-lamp examination is best performed prior to the administration of anesthesia.

Nictitating membranectomy (only for drug-delivery devices) The nictitating membrane should be removed at least 3 days prior to the initiation of infection. This surgery involves the application of general and local anesthesia followed by the cutting of the membrane. The nictitaing membrane is extended with forceps and clamped with a

THE RABBIT INTRASTROMAL INJECTION MODEL OF BACTERIAL KERATITIS

hemostat at the base. The membrane extending beyond the hemostat is then cut with a scalpel. The membrane stump is cauterized with a fine tipped cauterizing unit to avoid bleeding following the release of the hemostat. The membrane stump is treated with antibiotic ointment to prevent postoperative infection.

Bacterial strains Storage The methods used for storage of bacterial cultures and the preparation of the bacterial inoculum are critical in achieving reproducible evaluations of antibiotic effectiveness. The bacterial strain used should be well characterized, preferably obtained from the American Type Culture Collection or from research laboratories employing the intrastromal keratitis model. Strains used previously in models of keratitis are preferred. Pseudomonas aeruginosa strain ATCC 27853 and Stapkylococcus aureus strain ATCC 25923 have been used extensively in the study of antibiotic effectiveness in the rabbit intrastromal keratitis model. Upon receipt of a new strain for use in the keratitis model, a large stock of the first passage of the bacteria is grown and stored. To prepare these stock samples, the bacteria are grown on solid medium to determine that only one colony type is present. From this growth on agar, three or more isolated colonies are subcultured into liquid medium (e.g., tryptic soy broth, TSB, about 75 ml) and grown to log phase. These bacteria are mixed with sterile glycerol to a final concentration of 15%, distributed to sterile tubes, labeled with the strain and passage date, and frozen at -70 o C. Multiple aliquots of the strain from the first passage ensures that reproducible infections can be generated over long periods of time. To avoid loss of cultures due to freezer failure, a few culture tubes are stored in an alternate freezer, separate from the remainder of the tubes. Strains are also preserved by growing in a semi-solid storage agar (e.g., 0.75% tryptic soy agar, TSA, Difco Laboratories, Detroit, MI) in screw-capped test tubes whose lids are subsequently sealed with paraffin.

369

hemolytic colonies that are avoided for typical chemotherapy experiments.

Bacterial characterization Every strain of bacteria used for bacterial keratitis should be characterized in terms of its growth characteristics both in vitro and in vivo. The in-vitro analysis is needed to determine when 10~cfu/ml of log phase bacteria are present. The in-vivo growth rates are needed to select treatment times for antibiotic evaluation; most efficient antibiotic killing of bacteria is generally obtained when bacteria are growing at their maximal rate. For in-vitro growth studies, bacteria from isolated colonies are inoculated into TSB and incubated with shaking overnight. The resulting stationary-phase culture is then subcultured (a 1:100 dilution) in TSB with shaking. After 1 hour, and periodically thereafter, the optical density is determined at a wavelength of 650 nm and the number of cfu/ml is determined by plating aliquots of serial dilutions on TSA. From these data a curve of the OD~0 versus bacterial cfu/ml can be defined. The curve will indicate the OD(,50 of the culture that corresponds to 108 cfu/ml. (For Pseudomonas strains this value is about 0.2 and for Stapkylococcus the value is about 0.3.) For in vivo studies of intracorneal growth rate, groups of rabbits (e.g., five groups of two rabbits per group) are injected with bacteria in both corneas. An inoculum (10~1) of 102 cfu per cornea is used for a rapid-growing strain (e.g., Stapkylococcus) or 10~cfu per cornea for a slower-growing strain (e.g., Pseudomonas). Eyes are evaluated every 5 or 6 hours by SLE and by determining the number of cfu per cornea in a group. The experiment is ended by sacrificing the rabbits when the SLE score reaches 20. The experiment provides data for two curves, a plot of cfu per cornea with time and a plot of SLE scores with time. The cfu data indicate the times when bacteria are growing at logarithmic rates and when this rapid growth declines. The SLE data indicate initiation of ocular inflammation and tissue damage and how they progress with time.

Preparation of the bacterial inoculum Bacterial growth To prepare a bacterial inoculum, one vial of frozen bacteria is used to streak an agar plate resulting in multiple isolated colonies. The production of bacterial products related to virulence (i.e., protease or hemolysins) is determined by zones of proteolysis or hemolysis around isolated colonies on specialized agar plates. Pseudomonas and Serratia strains are grown on skim milk agar to observe production of protease. Stapkytococcus aureus is grown on sheep and rabbit blood agars to detect the action of various hemolysins. Stapkylococcus ATCC 25923 often contains some n o n -

A frozen culture is thawed, inoculated on to agar plates, and incubated overnight. Isolated colonies producing characteristic virulence factors (protease or hemolysins) are inoculated into TSB. After overnight incubation, the broth culture is subcultured (1:100 dilution) in TSB. Once the bacteria reach 10Vml, the culture is diluted in TSB to obtain 10s cfu/ml for Pseudomonas or 104 cfu/ml for Stapkylococcus. A 10 ~1 injection of these dilutions will deliver precisely 103 cfu of Pseudomonas or 10ecfu of Staphylococcus per cornea. Rabbits are randomly assigned to groups and anesthetized for injection.

370

R . J . O'Callaghan, L. S. Engel and J. M. Hill

Injection procedure The superior rectus muscle is grasped with locking forceps and held to immobilize the eye. This muscle lies just above the cornea in the center of the eye and is held by pressing the forceps against the sclera. The bacterial inoculum in a microsyringe with a 30 G needle is held with the opposite hand. The needle, with the bevel up, is inserted into the cornea, just penetrating the epithelium, about 2 - 3 m m from the corneal center, on an angle such that the needle almost parallels the corneal surface. The needle is advanced into the center of the cornea until the bevel fully penetrates the corneal tissue and the fluid is injected. The liquid will form a bleb and sometimes causes a "cracked glass" appearance of the cornea. The needle is slowly withdrawn, completing the process. Rabbits are allowed to awaken after the injection without an analgesic. The infection process does not induce stress in the rabbit until the SLE score exceeds a value of 20; experiments must be terminated before the infections reach such extremes.

Parameters to monitor during infection and for quantifying the effectiveness of the treatment SLE scoring

Other than the determination of cfu per cornea, the most important measurement to perform is SLE scoring. Rabbits should not be anesthetized for SLE scoring. The slit-lamp microscope is used to grade each of seven ocular parameters on a scale of 0 for normal to 4 for most severe in increments of 0.25. The seven parameter grades are then added to yield

a single SLE score for the eye. Two or more individuals should independently score the same eyes in a masked fashion (without knowing which, if any, treatment the eyes received). The seven parameters graded are: conjunctival chemosis (edema), conjunctival injection (redness), corneal edema, corneal infiltrate, fibrin accumulation in the anterior chamber, hypopyon formation (polymorphonuclear cell - - PMN - - accumulation in the anterior chamber), and iritis (Table 42.3). The SLE for a maximally inflamed eye is 28, but this is a theoretical value and eyes should not be allowed to advance significantly beyond a score of 20. SLE scoring is typically performed, as a minimum, before starting an experiment, at the start of chemotherapy, and 1 hour after the last application of chemotherapy (at the time of sacrifice).

Cfu p e r c o r n e a

This is the essential assay that determines the effectiveness of the chemotherapy being evaluated. Rabbits are sacrificed by anesthetizing with ketamine and xylazine, as described above for general anesthesia, and then by injecting pentobarbital (50 mg/kg) directly into the heart. After assuring the absence of heart sounds and reflex reactions, thecorne~is are harvested by cutting the tissue at the corneal-scleral junction. The corneas are transferred to a sterile Petri dish and cut into multiple pieces (10-15) using a sterile scalpel. The corneal pieces are placed into a sterile test tube containing 3.0 ml of sterile phosphate buffered saline (PBS, 0.02 M phosphate, pH 7.2, 0.15 M NaC1) at 4~ The tissue is then homogenized for 30 seconds and aliquots are serially diluted 10-fold (0.5 ml plus 4.5 ml) in sterile PBS. Samples from each dilution are plated in triplicate by pipetting 100 btl on to the surface of each agar plate (e.g., tryptic soy agar) and spread-

Table 42.3 Parameters for slit-lamp examination scoring (PMNs, polymorphonuclear cells)

Ocular site

Parameter

Scoring*

Conjunctiva

Injection

Cornea

Chemosis Infiltrate

"Redness" of tissue due to inflamed blood vessels1Edema due to capillary leakage Migration of PMN into the stroma from the limbus Fluid accumulation expressed as a percentage of total area showing thickening Size of fibrin deposit viewed by opacity of fibrinous clot Size of accumulated PMN and debris Swelling of blood vessels and overall redness

Edema

Anterior chamber

Fibrin Hypopyon

Iris

Iritis

*All scoring is based on a scale of 0 for normal to 4 for maximum change; values are assigned subjectively based on the degree of change observed. 1 Mild inflammation of the conjunctiva results from grasping of the rectus muscle during the intrastromal injection process.

THE RABBIT INTRASTROMAL INJECTION MODEL OF BACTERIAL KERATITIS

ing evenly over the surface using a sterile bent glass rod. Plates are incubated for 24 hours and the positions of all colonies are marked and counted. The plates are incubated for an additional 24-48 hours and examined again for the emergence of additional colonies; this second incubation is needed because antibiotic present in the corneal homogenate can slow the appearance of colonies. The colony counts are expressed as log values determined from the average of the three plates containing between 30 and 300 colonies.

O t h e r assays of ocular i n f l a m m a t i o n

The influx of PMNs into the cornea can be assayed in direct relationship to the amount of myeloperoxidase activity in a corneal homogenate. The homogenate prepared for quantifying the cfu per cornea can be employed for this determination, as described previously (Hobden et aL, 1993a,b; O'Callaghan et aL, 1997).

371

drug formulation produces sterile corneas, the duration of therapy is decreased to obtain a quantitative measure of the drug's effectiveness. The route of drug administration for keratitis is generally by topical drops. Iontophoresis, drug-delivery devices (e.g., collagen shields) or subconjunctival injection have also been tested using the rabbit model of bacterial keratitis (Unterman et al., 1988; Hobden et al., 1988a,b, 1989, 1990a,b; Reidy et al., 1991; Clinch et al., 1992; Hill et al., 1992a,b; Callegan et al., 1994a, 1995). Therapy is ended about 1 hour before the animal is sacrificed. If tissue is harvested any sooner after the time of drug administration, drug on the corneal surface could possibly contaminate the tissue sample. Such contamination could alter bacterial growth when determining the cfu per cornea or lead to artificially high drug concentrations found in corneal tissue.

Determination of antibiotic in ocular tissues Conditions for antibacterial therapy Typically, one decides upon the course of therapy relative to the growth curve of the bacteria within the cornea and the increase in the SLE score during infection. The most effective therapy can be obtained while bacteria are replicating logarithmically, as determined from the intracorneal growth curve. Many antibiotics that are bactericidal (e.g., fluoroquinolones, vancomycin, or cephazolin) show far less effectiveness when applied while the bacteria are in stationary phase. However, therapy should n o t begin before the injection of bacteria into the eye or very shortly after. Therapy started too soon after bacterial injection is unrealistic relative to the human condition and precedes the ocular changes associated with infection that could alter the effectiveness of a medication. Ideally, the time to start therapy is when the experimentally infected eye is most similar to the human eye when the patient first seeks medical attention. We have estimated that in the rabbit eye a SLE score between 3 and 6 is a preferred condition for initiating therapy. The total treatment time for therapy is determined by a variety of factors. The concentration of drug used in experimental therapy should match that used clinically if the drug is licensed for clinical use. Newly developed compounds are tested initially at the highest practical concentrations that are not toxic to the eye. There is value in matching the dosing schedule to that used previously for other forms of therapy. By standardizing the dosing schedule, the effectiveness of various drugs can be compared. We have treated Pseudomonas-infected corneas from 16-26hours postinfection (p.i.) and Stapkylococcus-infected corneas from 4-9 hours p.i. (early therapy), from 10-15 hours p.i. (late therapy) or from 4-15 hours p.i. (extended therapy). If a

The aqueous humor, the whole cornea or components of the cornea (corneal epithelium or stroma) can be assayed. Antibiotic can be determined by bioassay, HPLC, or immune assay (RIA or EMIT; Engel et al., 1996; Green et al., 1996). Whole corneal homogenates or stromal homogenates offer the disadvantage of high protein content and an inherent difficulty in achieving efficient drug extraction. Aqueous humor is often preferred because it can be used directly in bioassays and in immune assays. Aqueous humor is obtained by anesthetizing a rabbit and then inserting a 30 G needle through the cornea for fluid aspiration. Aqueous humor samples of 100 ~1 or more can be routinely obtained.

Assessments of the model Disadvantages

9 Intrastromal injection requires technical skill. The corneal injection procedure requires a steady hand, good vision, and depth perception. With experience, the injection process can be mastered. Injections that perforate the cornea alter the course of infection and could yield misleading information regarding the effectiveness and pharmacokinetics of the therapeutic formulation. 9 Precision of the model is dependent upon the number and quality of the bacteria in the inoculum. The model requires the inoculum to consist of a precisely determined number of bacteria in the log phase and genetically stable organisms that express key virulence factors. Assessment is best accomplished by a team of researchers that includes a bacteriologist, a pharmacologist, and an ophthalmologist.

372

9 Atypical route o f infection. The intrastromal injection of

bacteria is not analogous, in terms of the route of inoculation, to the most common forms of human bacterial keratitis. The invasion of tissue by bacteria from the corneal surface is the more natural means of initiating infection. Unfortunately, topical inoculations often fail to produce an infection or yield infections in an imprecise fashion (large variations in the number of bacteria in the tissue).

Advantages 9 PrecMonfor an in-vivo model. The experienced researcher

can demonstrate a statistically significant decrease of less than 1 log in the cfu per cornea of a treated eye relative to an untreated eye. This is possible because the bacteria grow in a manner that is highly predictable from eye to eye and from experiment to experiment. 9 Versatility. The model can be used for a variety of chemotherapeutic studies or for the analysis of pathogenic mechanisms. The killing of bacteria can be precisely determined so the effectiveness of various drugs (or drug combinations) can be compared to other drugs tested simultaneously, previously, or subsequently. Tissue can be obtained and assayed for pharmacokinetic determinations; this is of particular advantage when studying new formulations or when assessing the value of experimental drug-delivery systems. The effectiveness of anti-inflammatory agents can be determined because inflammatory changes associated with infection are reproducible and can be quantified by SLE and other means. 9 The data are applicable. Because the rabbit cornea has been a standard model for numerous ocular studies, data can be extrapolated to the therapy of human keratitis. Measurements of a drug's effectiveness in non-human primates can be bypassed in many situations.

Contributions of the model to infectious disease therapy The rabbit model of bacterial keratitis has been used extensively to determine the effectiveness of ocular antibiotics (Table 42.1). The effectiveness of experimental drug-delivery devices (Hobden et aL, 1988a,b, 1989, 1990a,b; Reidy et aL, 1991; Clinch et aL, 1992; Hill et aL, 1992a,b; Callegan et al., 1994a, 1995) and of combinations of antibiotics and anti-inflammatory drugs have also been analyzed in these models (Bohigian and Foster, 1977; Fraser-Smith and Matthews, 1988; Hobden et al., 1992, 1993b,c; Engel et al., 1995). Experiments on ciprofloxacin formulations (Hobden et aL, 1990b, 1992, 1993b,c,d; Reidy et aL, 1991; Callegan et aL, 1992a,b, 1994b; Engel et aL, 1993, 1996) and on collagen shields for drug delivery (Hobden et aL, 1988a, 1990b;

R.J. O'Callaghan, L. S. Engel and J. M. Hill

Clinch et aL, 1992; Hill et aL, 1992b; Callegan et aL, 1994a) are two examples of chemotherapeutic improvements that have been pioneered in the rabbit intrastromal model of bacterial keratitis.

Elucidation of pathophysiology Studies of experimental bacterial keratitis have demonstrated that the tissue damage that causes loss of visual acuity and blindness is mediated by a combination of bacterial and host factors. Bacterial keratitis in leukopenic rabbits is significantly less severe than that of normal, immunocompetent rabbits (Harrison et aL, 1983; Hobden et aL, 1993a). PMNs, through the action of oxidative molecules and proteases, are a prime mediator of corneal damage. Efforts to identify bacterial factors responsible for tissue damage have shown that each pathogen produces a few proteins that are very toxic to the eye (Kessler et aL, 1977; Kreger and Gray, 1978; Lyerly et aL, 1981; Kessler and Spierer, 1984; Spierer and Kessler, 1984; Johnson etaL, 1991, 1992, 1995; Callegan et aL, 1994 c; O'Callaghan et aL, 1996, 1997; Engel et aL, 1997; Moreau et aL, 1997). Studies of Pseudomonas keratitis in the rabbit model have demonstrated that proteases are vital for ocular virulence (O'Callaghan et aL, 1996; Engel et aL, 1997, 1998a,b). Such studies have led to the recognition ofPseudomonas proteases IV as an important ocular virulence factor (O'Callaghan et aL, 1996; Engel et aL, 1997, 1998a,b). In the Staphylococcus model, studies to date have demonstrated that (x-toxin, a hemolytic pore-forming toxin, mediates much of the ocular damage and inflammation (Callegan et aL, 1994c; O'Callaghan et aL, 1996; Moreau et aL, 1997; Sloop et al., 1999). Other molecules toxic to the cornea may be produced by some strains, but these toxins have not yet been identified. In the pneumococcus model, virulence has been related to the production of pneumolysin, a pore-forming toxin that activates complement (Johnson etaL, 1991, 1992, 1995). This research is making possible a search for inhibitors that can abolish the activity of toxic bacterial proteins. Such inhibitors could be used in conjunction with antibiotics and antinflammatory drugs to prevent the corneal scarring and resulting blindness mediated by bacterial keratitis.

References Alpren, T. V., Hyndiuk, R. A., Davis, S. D. (1979). Cryotherapy for experimental Pseudomonas keratitis. Arch. Ophthalmol., 97, 711-714. Belfort, R. Jr, Smolin, G., Okumoto, M., Kim, H. B. (1975). Nebcin in the treatment of experimental Pseudomonas keratitis. Br. ]. Ophthalmol., 59, 725-729. Berstein, H. N., Maddox, Y. T. (1973). Corneal pathogenicity of Serratia marcescens in the rabbit. Trans. Am. Acad. Ophthalmol., 77, 432-440.

THE RABBIT INTRASTROMAL INJECTION MODEL OF BACTERIAL KERATITIS

Bohigian, G. M., Foster, C. S. (1977). Treatment of Pseudomonas keratitis in the rabbit with antibiotic-steroid combinations. Invest. Opktkalmol. Vis. Sci., 16, 553- 556. Bohigian, G., Okumoto, M., Valenton, M. (1971). Experimental Pseudomonas keratitis. Treatment with and evaluation of carbenicillin and gentamicin in combination. Arch. Opktkalmol., 86, 432-437. Brockman, E. B., Tarantino, P. A., Hobden, J. A. et al. (1992). Keratomy model of Pseudomonas keratitis: gentamicin chemotherapy. Refract. Corneal Surg., 8, 465-468. Callegan, M. C., Hobden, J., Hill, l- M., Insler, M., O'Callaghan, R. J. (1992a). Methicillin-resistant Stapkylococus aureus keratitis in the rabbit: therapy with ciprofloxacin, vancomycin, and cefazolin. Curr. Eye Res., 11, 1111 - 1119. Callegan, M. C., Hobden, J., Hill, J. M., Insler, M., O'Callaghan, R. J. (1992b). Topical antibiotic therapy for the treatment of experimental Staphylococcus aureus keratitis. Invest. Ophthalmol. Vis. Sci., 33, 3017-3023. Callegan, M. C., Clinch, T. F., Engel, L. S., Hill, J. M., Kaufman, H. E., O'Callaghan, R. J. (1994a). Tobramycin-hydrated collagen shield and drops applied to shields (DATS) for staphylococcal keratitis. Curr. Eye Res., 13, 875-878. Callegan, M. C., Engel, L. S., Hill, J. M., O'Callaghan, R. 1(1994b). Tobramycin versus ciprofloxacin for the treatment of staphylococcal keratitis. Invest. Opktkalmol. [/is. Sci., 35, 1033-1037. Callegan, M. C., Engel, L. S., Hill, J. M., O'Callaghan, R. I. (1994c). Corneal virulence of Staphylococcus aureus: The role of 0t-toxin and protein A in pathogenesis. Infect. Immun., 62, 2478-2482. Callegan, M. C., O'Callaghan, R. l., Hill, I. M. (1994d). Pharmacokinetics in the treatment of bacterial keratitis. Clin. Pkarmacokinet. , 27, 129-149. Callegan, M. C., O'Callaghan, R. J., Hill, l-M. (1995). Ocular drug delivery: a comparison of transcorneal iontophoresis to corneal collagen shields. Int. ]. Pharm., 123, 173-179. Clinch, T. F., Hobden, 1., Hill, J. M., O'Callaghan, R. J., Kaufman, H. E. (1992). Collagen shields containing tobramycin for sustained therapy (24 hours) of experimental Pseudomonas keratitis. CLAO, 18, 245-247. Davis, S. D., Sarff, L. D., Hyndiuk, R. A. (1979). Comparison of therapeutic routes in experimental Pseudomonas keratitis. Am. ]. Opktkalmol., 87, 710- 716. Edwards, J. G., Schlech, B. A. (1985). Efficacy of topical chloramphenicol and tobramycin ophthalmic solutions in preventing severe Staphylococcus aureus keratitis in rabbits. Curr. Eye Res., 4, 821-829. Engel, L. S., Callegan, M. C., Hill, J. M., O'Callaghan, R. J. (1993). Bioassays for quantitating ciprofloxacin and tobramycin in aqueous humor. ]. Ocular Pharmacol., 9, 311-320. Engel, L. S., Callegan, M. C., Hobden, J. A., Reidy, J. J., Hill, J. M., O'Callaghan, R. 1. (1995). Effectiveness of specific antibiotic/steroid combinations for therapy of experimental Pseudomonas aeruginosa keratitis. Curr. Eye Res., 14, 229-234. Engel, L. S., Callegan, M. C., Hill, J. M., Folkens, A., O'Callaghan, R. J. (1996). The effectiveness of two ciprofloxacin formulations for experimental Pseudomonas and Staphylococcus keratitis. ]pn. ]. Opktkalmol., 40, 212-219. Engel, L. S., Hobden, J. A., Moreau, J. M., Callegan, M. C., Hill, J. M., O'Callaghan, R. 1. (1997). Pseudomonas deficient in protease IV has significantly reduced corneal virulence. Invest. Opktkalmol. [/is. Sci., 38, 1535-1542.

373

Engel, L. S., Hill, J. M., Caballero, A. R., Green, L. C., O'Callaghan, R. I. (1998a) Protease IV, a unique extracellular protease and virulence factor from Pseudomonas aeruginosa J. Biol. Chem., 273, 16792-16797. Engel, L. S., Hill, 1. M., Moreau, I. M., Green, L. C., Hobden, J. A., O'Callaghan, R. J. (1998b). Pseudomonas aeruginosa protease IV produces corneal damage and contributes to bacterial virulence. Invest. OphthalmoL [/is. Sci., 39, 662-665. Fraser-Smith, E. B., Matthews, T. R. (1988). Effect ofketorolac on Pseudomonas aeruginosa ocular infection in rabbits. J. Ocular Pharmacol., 4, 101-109. Fuguiele, F. P. (1968). Treatment of Pseudomonas infection of the rabbit cornea. Comparative study. Am. J. OphthalmoL, 66, 276-279. Galin, M. A., Davidson, R. A., Harris, L. S. (1968). Experimental corneal infections. Evaluation of nalidixic acid in Proteus and Pseudomonas keratitis. Am. J. OphthalmoL, 66, 447-451. Gray, L. D., Kreger, A. S. (1975). Rabbit corneal damage produced by Pseudomonas aeruginosa infection. Infect. Immun., 12, 419-432. Green, L. C., Callegan, M. C., Engel, L. S. et aL (1996). Pharmacokinetics of topically applied ciprofloxacin in rabbit tears. Jpn. ]. OphthalmoL, 40, 123-126. Gritz, D. C., McDonnell, P. J., Lee, T. Y., Tang-Liu, D., Hubbard, B. B., Gwon, A. (1992). Topical olfoxacin in the treatment of Pseudomonas keratitis in a rabbit model. Cornea., 11,143-147. Harrison, J., Karcioglu, Z., Johnson, M. (1983). Response of leukopenic rabbits to pneumococcal toxin. Curr. Eye Res., 2, 705-710. Hill, J. M., O'Callaghan, R. J., Hobden, J., Kaufman, H. E. (1992a). Collagen shields for ocular drug delivery. In Ophthalmic Drug Delivery Systems (ed. Mitra, A. K.), pp. 261-273. Marcel Dekker, New York. Hill, J. M., O'Callaghan, R. J., Hobden, J. (1992b). Ocular iontophoresis. In Ophthalmic Drug Delivery Systems (ed. Mitra, A. K.), pp. 331-354. Marcel Dekker, New York. Hobden, J., Reidy, J., O'Callaghan, R., Hill, J., Insler, M., Rootman D. (1988a). Treatment of experimental Pseudomonas aeruginosa using collagen shields containing tobramycin. Arch. Ophthalmol., 106, 1605-1607. Hobden, J., Rootman, D. S., O'Callaghan, R. J., Hill, J. M. (1988b). Iontophoretic application of tobramycin to uninfected and Pseudomonas aeruginosa-infected rabbit corneas. Antimicrob. Agents Chemother., 21,978-981. Hobden, J. A., O'Callaghan, R. J., Hill, J. M., Reidy, J. J., Rootman, D. S., Thompson, H. W. (1989). Tobramycin iontophoresis into corneas infected with drug-resistant Pseudomonas aeruginosa. Curr. Eye Res., 11, 1163-1169. Hobden, J. A., Reidy, J. J., O'Callaghan, R. J., Hill, J. M. (1990a). Ciprofloxacin iontophoresis for aminoglycoside-resistant Pseudomonas keratitis. Invest. Ophthalmol. Vis. Sci., 31, 1940-1944. Hobden, J. A., Reidy, J. J., O'Callaghan, R. J., Insler, M. S., Hill, J. M. (1990b). Quinolones in collagen shields for therapy of drug-resistant Pseudomonas keratitis. Invest. Ophthalmol. Vis. Sci., 31,2241-2243. Hobden, J., O'Callaghan, R. J., Hill, J. M., Hagenah, M., Insler, M. S., Reidy, J. J. (1992). Ciprofloxacin and prednisolone therapy for experimental Pseudomonas keratitis. Curr. Eye Res., 11,259-266. Hobden, J. A., Engel, L. S., Callegan, M. C., Hill, J. M., Gebhardt,

374

B. M., O'Callaghan, R. J. (1993a). Pseudomonas aeruginosa in leukopenic rabbits. Curr. Eye Res., 12, 461-467. Hobden, J. A., Engel, L. S., Hill, J. M., Callegan, M. C., O'Callaghan, R. J. (1993b). Prednisolone acetate or prednisolone phosphate concurrently administered with ciprofloxacin for the therapy of experimental Pseudomonas aeruginosa keratitis. Curr. Eye Res., 12, 469-473. Hobden, J. A., Hill, J. M., Engel, L. S., O'Callaghan, R. J. (1993c). Age and therapeutic outcome of experimental Pseudomonas aeruginosa keratitis treated with ciprofloxacin, prednisolone and flurbiprofen. Antimicrob. Agents Chemother., 37, 1856-1859. Hobden, l., O'Callaghan, R. J., Insler, M., Hill, J. M. (1993d). Ciprofloxacin ointment versus ciprofloxacin drops for the therapy of experimental. Pseudomonas keratitis. Cornea, 12, 138-141. Hume, E. B. H., Moreau, J. M., Conerly, L. L., Cannon, B. M., Engel, L. S., Stroman, D. W., Hill, J. M., O'Callaghan, R. J. (1998). Serratia marcescens Keratitis: strain-specific corneal pathogenesis in rabbits. Exp. Eye Res. Johnson, M. K., Allen J. H. (1971). Ocular toxin of the pneumococcus. Am. ]. Ophthalmol., 72, 175-180. Johnson, M., Allen, J. (1975). The role of cytolysin in pneumococcal ocular infections. Am. ]. Ophthalmol., 80, 518-521. Johnson, M. K., Hobden, J. A., Hagenah, M., O'Callaghan, R. J., Hill, J. M., Chen, S. (1991). The role of pneumolysin in ocular infections with Streptococcus pneumoniae. Curr. Eye Res., 9, 1107-1114. Johnson, M. K., Hobden, J., O'Callaghan, R. J., Hill, J. M. (1992). Confirmation of the role of pneumolysin in ocular infections with Streptococcus pneumoniae. Curr. Eye Res., 11, 1221-1225. Johnson, M. K., Callegan, M. C., Engel, L. S., O'Callaghan, R. J., Hill, J. M. (1995). Growth and virulence of a complementactivation-negative mutant of Streptococcus pneumoniae in the rabbit cornea. Curr. Eye Res., 14, 281-284. Kaufman, A. H., Darrell, R. W., Shieh, E. etal. (1991). Treatment of methicillin-resistant Staphylococcus aureus keratitis in rabbits with ciprofloxacin, norfloxacin, ofloxacin, vancomycin and cefazolin. Invest. Ophthalmol. Vis. Sci., Abstract. Kessler, E., Spierer, A. (1984). Inhibition by phosphoramidon of Pseudomonas aeruginosa elastase injected intracorneally in rabbit eyes. Curr. Eye Res., 3, 1075-1078. Kessler, E., Kennan, H. E., Brown, S. I. (1977). Pseudomonas protease, purification, partial characterization, and its effect on collagen proteoglycan and rabbit corneas. Invest. Ophthalmol. Vis. Sci., 16, 488-497. Kreger, A. S., Gray, L. D. (1978). Purification of Pseudomonas aeruginosa proteases and microscopic characterization of pseudomonal protease-induced rabbit corneal damage. Infect. Immun., 19, 630-648. Kupferman, A., Leibowitz, H. M. (1976). Quantitation of bacterial infection and antibiotic effect in the cornea. Arch. Ophthalmol., 94, 1981-1984. Kupferman, A., Leibowitz, H. M. (1977). Topical antibiotic therapy of staphylococcal keratitis. Arch. Ophthalmol., 95, 1634-1637.

R.J. O'Callaghan, L. S. Engel and J. M. Hill

Leibowitz, H. M., Ryan, W. J., Kupferman, A. (1981). Route of antibiotic administration in bacterial keratitis. Arch. Ophthalmol., 99, 1420-1423. Lyerly, D., Gray, L., Kreger, A. (1981). Characterization of rabbit corneal damage produced by Serratia keratitis and by Serratia protease. Infect. Immun., 33, 927-932. Mondino, B. 1., Kowalski, R. P. (1982). Phlyctenulae and catarrhal infiltrates: occurrence in rabbits immunized with staphylococcal cell walls. Arch. Ophthalmol., 100, 1968-1971. Mondino, B. J., Caster, A. L., Dethlefs, B. (1987a). A rabbit model of staphylococcal blepharitis. Arch. Ophthalmol, 105,409-412. Mondino, B. J., Laheji, A. K., Adamu, S. A. (1987b). Ocular immunity to Staphylococcus aureus. Invest. Ophthalmol. Vis. Sci., 28, 560-564. Moreau, J., Sloop, G., Engel, L., Hill, J., O'Callaghan, R. (1997). Histopathological studies of staphylococcal alpha-toxin effects on rabbit corneas. Curr. Eye Res., 16, 1221-1228. O'Brien, T. P., Sawusch, M. R., Dick, I. D., Gottsch, 1. D. (1988). Topical ciprofloxacin treatment of Pseudomonas keratitis in rabbits. Arch. Ophthalmol., 106, 1444-1446. O'Callaghan, R. J., Engel, L. S., Hobden, J. H., Callegan, M. C., Green, L. C., Hill, J. M. (1996). Pseudomonas keratitis: the role of an uncharacterized exoprotein, protease IV, in corneal virulence. Invest. Ophthalmol. Vis. Sci., 37, 534-543. O'Callaghan, R. J., Callegan, M. C., Foster, T. J. et al. (1997). The roles of alpha-toxin and beta-toxin during Staphylococcus corneal infection. Infect. Immun., 65, 1571-1578. Piatkowska, B. (1966). Attempts at treatment of bacterial keratitis with low temperature. Polish Med. J., 5, 461-465. Reidy, J. J., Hobden, J. A., Hill, J. M., Forman, K., O'Callaghan, R. J. (1991). The efficacy of topical ciprofloxacin and norfloxacin in the treatment of experimental Pseudomonas aeruginosa. Cornea, 10, 25-28. Rootman, D. S., Hobden, J. A., Jantzen, J., Gonzalez, J. R., O'Callaghan, R. J., Hill, J. M. (1988). Iontophoresis of tobramycin for the treatment of experimental Pseudomonas keratitis in the rabbit.Arch. Ophthalmol., 106, 262-265. Sloop, G. D., Moreau, J. M., Conerly, L. L., Dajcs, J. J., O'Callaghan, R. J. (1999). Acute inflammation of the eyelid and cornea in Staphylococcus keratitis in the rabbit. Invest. Ophthalmol. Vis. Sci., 40, 385-391. Smolin, G., Okumoto, M., Wilson, F. M. (1973). The effect of tobramycin on Pseudomonas keratitis. Am. ]. Ophthalmol., 76, 555-56O. Smolin, G., Okumoto, M., Wilson, F. M. (1974). The effect of tobramycin on gentamicin-resistant strains in Pseudomonas keratitis. Am. ]. Ophthalmol., 77, 583-588. Spierer, A., Kessler, E. (1984). The effect of 2-mercaptoacetyl-Lphenylalanyl-L-leucine, a specific inhibitor of Pseudomonas aeruginosa elastase, on experimental Pseudomonas keratitis in rabbit eyes. Curr. Eye Res., 3,645-650. Unterman, S. R., Rootman, D. S., Hill, J. M., Parelman, J. J., Thompson, H. W., Kaufman, H. E. (1988). Collagen shield drug delivery: therapeutic concentrations of tobramycin in the rabbit cornea and aqueous humor.]. Cataract Refract. Surg., 14, 5O0-5O4.

Chapter 43

Gerbil Model-of Acute Otitis Media B. Barry and M. Muffat-Joly

Background of human infection Acute otitis media (AOM) is one of the most frequent pediatric infections and the main indication for antimicrobial therapy in children. More than 90% of cases occur in children under 5 years and almost 70% of cases occur between the ages of 6 months and 3 years (Leizorovicz, 1995). The pathogenesis of AOM involves eustachian tube dysfunction and immune immaturity (Pelton, 1996). Upper respiratory tract viral infection probably triggers epithelial injury and bacterial colonization of the middle ear from the nasopharynx (Uhari et al., 1996). Pathogenic bacteria are cultured from 70% of cases of purulent AOM. Haemopkilus influenaae, Streptococcus pneumoniae and Moraxella catarrkalis are the commonest isolates. M. catarrkalis accounts for 5-15% of cases. H. influenaae and S. pneumoniae account for most cases, the predominance of each pathogen varying from one country to another (Berche et aL, 1994; ]acobs et al., 1996). Strains of H. influenaae and S. pneurnoniae responsible for AOM are those that colonize the nasopharynx, i.e., non-typable H. influenzae (85-90% of H. influenzae strains) and S. pneumoniae of non-invasive serotypes (6, 9, 14, 19 and 23). Epidemiological studies on antimicrobial resistance of these pathogens show large geographic differences. At time of writing, 25-35% of H. influenzae are beta-lactamase producers and the incidence of S. pneumoniae strains with decreased susceptibility to penicillin is still increasing (Berche et al., 1997; Manninen et aL, 1997). Acute otitis media is a self-limiting disease in up to 70-80% of cases (van Buchem et aL, 1981; Froom et al., 1997) but antibiotic treatment is usually given to prevent local and meningeal complications (Klein, 1995).

Background of the gerbil model Experimental models of bacterial or viral infection of the middle ear have been developed with rats (Daniel et aL, Handbook of Animal Models of Infection

ISBN 0-12-775390-7

1973; Grote and van Blitterswijk, 1984; Hermansson et al., 1988; Melhus et aL, 1997), guinea pigs (Friedmann, 1955; Thore et al., 1982, 1985; Ohashi et al., 1991; Egusa et aL, 1995; Kawana, 1995), BALB/c mice (Krekorian et al., 1991), ferrets (Buchman et al., 1995) and monkeys (Fujiyoshi et al., 1990), but the species most commonly used for acute otitis media are the chinchilla and gerbil. The gerbil model is based on the chinchilla models developed by Giebink et al. (1976, 1978) and was first described by Fulghum et al. (1982). These two animal species share features that make them well adapted to experimental otitis media: (1) they have a hypertrophied middle ear bulla; (2) their nearly vertical eustachian tube does not favor spontaneous middle ear infection (Daniel et al., 1982); (3) they do not harbor pathogenic strains in the external ear (Thompson et aL, 1981); (4) their middle-ear mucosa is histologically close to the human middle-ear mucosa (Chole and Chiu, 1985). Various chinchilla models have been extensively used in pathophysiological studies on infectious, inflammatory and immune processes (see luhn et aL, 1991 for a review). For example, the role of viral infection associated with bacterial infection has been reported (Giebink et al., 1980; Abramson et al., 1982; Giebink and Wright, 1983; Suzuki and Bakaletz, 1994), vaccine protection has been evaluated (Giebink et aL, 1978, 1979, 1993, 1995, 1996; Giebink, 1981; Barenkamp, 1986, 1996; De Maria et aL, 1996), and the roles of bacterial enzymes or components and mediators of inflammation in the pathogenesis of pneumococcal acute otitis media have been investigated (Carlsen et aL, 1992; Sato et aL, 1996). Chinchilla models have been also used to study the influence of antibiotics on middle ear infection (Lewis et al., 1980; Supance et aL, 1982; Reilly et aL, 1983; Hotaling et al., 1987; Kawana et aL, 1992; Rosenfeld et al., 1992; Magit et aL, 1994; Bolduc et aL, 1995; Sato et al., 1995; Alper et al., 1996; Post et al., 1996; ]auris-Heipke et al., 1997) and drugs kinetics in the middle ear (Canafax et al., 1989, 1995; lossart et al., 1994). In experimental studies to evaluate antimicrobial efficacy on AOM pathogens, the gerbil model is often used mainly for economic reasons and because of animal husbandry/ housing considerations. Copyright 9 1999Academic Press All rights of reproduction in any form reserved

376

Animal species Young adult (less than 6 months) Mongolian gerbils (Meriones unguiculatus) are always used. In our laboratory young adult females are purchased from Centre d'Elevage R. Janvier (Le Genest Saint Isle, France). At time of the experiments they are 8-9 weeks old (body weight 40-50 g).

B. Barry and M. Muffat-Joly

weeks (Fulghum et al., 1985a); higher inocula result in a high rate of lethal systemic complications (Muffat-loly et aL, 1994). When strains of non-invasive serotypes are used (types 19 and 23), inoculation of 103-4cfu/ear produces mild self-limiting disease (Fulghum et aL, 1985a; Barry et aL, 1993); the inoculum must be increased to 106-7cfu to obtain acute otitis media in over 90% of animals, but the course of the disease remains strain-dependent (Barry et al., 1995). Figure 43.1 compares the time course of bacterial counts in middle ears infected with serotype 3, 19 and 23 strains.

Preparation of animals On their arrival animals are placed in standardized transparent cages in a protected unit with slight negative pressure, filtered air and a 12-12 hours light-dark cycle (Iffa Credo, l'Arbresle, France). They are given free access to water and food (rodent diet enriched with vitamins A and D). An acclimatization period of at least 1 week is respected before experiments. All the animals are identified at the time of the experiments and are followed individually. Gerbils are not subject to spontaneous AOM, but spontaneous aural cholesteatoma can develop in aging animals (Fulghum and Chole, 1985). Otoscopic examination is recommended before use, to confirm that the ears are healthy. None of the young females used in our laboratory have presented ear abnormalities. In initial works, surgery was performed to enlarge the external auditory canal and facilitate tympanic access, 1 week before the experiments: the antero-inferior cutaneous and cartilageous part of the auricle, including the tragus, was excised and the wounds were washed with povidone iodine (Betadine| However, simply pulling up the pinna allows most of the tympanic membrane to be examined with an operating microscope, rendering surgery unnecessary.

9Sp 4241 type 3 inoculum 40 cfu/ear

7-

om

o Sp 28675 type 19

N...

~6LU

o Sp 52181 type 19 /

....

~

z~ Sp GAOl type 23 inoculum 107 cfu/ear

4-

"5

~.3.~_

~ 1d.l.

O

_~0

.-, I 0

2

I

4

I

I

I

I

6 8 10 12 Days after inoculation

I

14

I

1

Figure 43.1

Comparative time course of bacterial counts in the middle ear (ME) during pneumococcal otitis induced by either 40 ~ cfu of a serotype 3 strain or 107cfu of serotypes 19 and 23 strains. Detection limit (d.l.) for bacterial counts was 0.34 log cfu in 20 ~1 of washing fluid.

Infecting agents-- inocula The gerbil model of middle ear infection has been studied by Fulghum and co-workers with S. pneumoniae (Fulghum et aL, 1982, 1985a, 1987), type b and non-typable H. influenzae (Fulghum et aL, 1982, 1985b), M. catarrkalis (Fulghum and Marrow, 1996), E. coli (Fulghum and Beamer, 1991) and various anaerobes, alone or in polymicrobial inoculates (Fulghum et al., 1982; Fulghum and Beamer, 1991). With the three most common clinical pathogens, these authors obtained acute otitis media only with S. pneumoniae and H. influenzae; M. catarrkalis produced self-limiting inflammation with rapid bacterial clearance (Fulghum and Marrow, 1996). Similar differences in the middle-ear pathogenicity of bacterial species were observed in the chinchilla model (Fulghum et al., 1982; Fulghum and Marrow, 1996). With S. pneumoniae strains of the invasive serotype 3, a small inoculum (< 100 cfu/ear) is sufficient to consistently induce middle-ear otitis, with an acute phase lasting 2

We have only used S. pneumoniae strains isolated from human respiratory tract or systemic infections. Virulence is maintained by passage in mice. Aliquots of bacterial suspension are kept a t - 8 0 ~ On each day of experimentation a fleshly thawed pneumococcal aliquot is incubated for 6 hours at 37~ in brain-heart infusion broth (Bio-Merieux, Lyon, France) enriched with 5% horse serum (Diagnostics Pasteur). Bacterial density is determined by 10-fold serial dilutions of the culture in saline, and the pourplate colony-counting method (Columbia agar with 5% sheep blood, Bio-M~rieux). With non-typable H. influenzae strains, 10>4 cfu/ear are required to induce otitis media in 100% of gerbils (Fulghum et al., 1985b). Spontaneous resolution occurs during the second week and no bacteria are recovered after the third week (Fulghum et al., 1985b). In later studies using this model, animals were inoculated with 105-6cfu/ear (Girard et al., 1987; Clement et al., 1990; Hardy et al., 1990; Retsema et al., 1990; Swanson et al., 1991).

GERBIL MODEL OF ACUTE OTITIS MEDIA

:377

Details of the infection process

of S. pneumoniae are used (Muffat-Joly et al., 1994). Inoculation can be unilateral or bilateral.

Overview

The bacterial suspension is inoculated percutaneously into the middle ear bulla of anesthetized animals. Materials required

Skin disinfectant; Luer-lock 1 ml standard syringes and 50btl Hamilton syringes; Luer-lock sterile disposable needles: 0.45 • 10 mm (26G ~"), 0.45 x 16 mm (26G ~"), 0.3 • 13 mm (30G ~") with a transparent white lock (B-D| Microlance| 3); operating microscope providing magnifications up to 20 times; small, sharp forceps; sterile swabs. Anesthesia

For all invasive procedures animals are anesthetized by intramuscular injection in the thigh of a mixture of 40 mg/kg ketamine (Ketalar| Parke-Davis) and 13 mg/kg xylazine (Rompun@, Bayer Pharma) given in a volume of 150-200 lt.tl. Anesthesia is complete within a few minutes, stillness is ensured for at least 15 minutes, and there is no anesthesiarelated swelling of the tympanic membrane. A higher dose of ketamine (87 mg/kg) was used in the ketamine-xylazine mixture by initial authors (Fulghum et aL, 1982). Alternative anesthetics used in various reports include diethyl ether (Hardy et aL, 1990; Swanson et aL, 1991) and a ketamine (0.125 mg/g)/levopromazine (6.25 mg/g)/atropine (0.01 mg) mixture administered intraperitoneally (yon UngeetaL, 1997). Inoculation

The animal is placed on its side. The bulla corresponds to the cephalad portion of the middle-ear cavity. The posterosuperior chamber is covered by a thin bony membrane (Daniel et al., 1982). This anatomical area forms a discrete, easily palpable bump. Some authors perform surgical bone exposure before inoculation (von Unge et al., 1997), but aseptic preparation of the skin is usually sufficient. The slight convexity of the bone behind the superior part of the auricle is located with the left hand of a right-handed experimenter. Light pressure of a 0.3 x 13 mm needle attached to a 50 btl Hamilton syringe held with the right hand pierces the thin bony membrane and penetrates perpendicular to the bone. The action must be precise to limit needle penetration into the middle-ear cavity and avoid injury, in particular perforation of a large vein that runs unprotected a short distance away. Slow injection of the inoculum in a volume of 20-30 btl is then possible without resistance. Proper inoculation causes epitympanic membrane swelling without rupture, and this is verified with the operating microscope. The procedure does not induce cutaneous abscesses or bone infection at the injection point, except when very large inocula of invasive serotypes

Postoperative care

No particular housing is necessary after inoculation. Infected animals are caged in groups of four or five. They return to normal behaviour within a couple of hours after the anaesthesia has worn off. No postoperative analgesics are used.

Key parameters to monitor infection and response to treatment Animals are followed up for behavior, body weight, tympanic features and bacterial counts in middle-ear washing fluid. Leukocyte counts can also be done on the samples. Meningeal involvement can be assessed by bacterial counts in cerebrospinal fluid (CSF).

Clinical parameters

Development of acute otitis media is not necessarily accompanied by behavioral signs. Ruffled fur, prostration, inability to stand, circling, and/or spine stiffness are mostly associated with systemic complications. Body-weight loss reflects the local or systemic nature of the infection. Prior to middle-ear sampling, the presence and severity of otitis media is evaluated by otoscopic examination of the tympanum. A global scoring system ranging from 0 to 5 has been proposed by Fulghum et aL (1985b). We prefer to consider separately the presence of a retrotympanic exudate as the sign of actual infection, and examine the epitympanic membrane for thickening, inflammation and shape changes. We have opted for simple unambiguous grading, by attributing four grades to each membrane feature, as follows: thickening: 0 = none, 1 = opalescence, 2 = opacity, and 3 = opacity plus graining; inflammation: 0 = none, 1 = mild vasodilatation, 2 = frank hyperemia, and 3 = acute inflammation with intratympanic hemorrhage; shape: 0 = normally concave (or slightly retracted), 1 = flat, 2 = convex, and 3 - bulging (Barry et aL, 1996).

Bacterial density in middle-ear effusion

Middle-ear sampling is performed by transepitympanic washing. A quantity of 20 }.tl of saline is injected and withdrawn through the epitympanic membrane (0.3 x 13 mm needle attached to a 50 ILtl Hamilton syringe) under visual control with the operating microscope. With this procedure, the middle-ear effusion is diluted approximately 2.5-fold in the washing fluid. This sampling method, provided that it is well standardized by the experimenters, is satisfactory for infection/treatment monitoring and comparisons between

378

B. Barry and M. Muffat-Joly

Determination of additional markers of infection and response to t r e a t m e n t

Figure 43.2 Overview of bacterial counts in 70 gerbil middle ear (ME) samples taken 2 days after transbullar inoculation of the same S. pneumoniae serotype 19 strain (Sp 15986, inoculum: 1.4 • 107 + 0.5 • 107 cfu/ear). Chronologically ordered data for 17 sets of experiments over a 30-month period. Bars are mean + SD per group. The final cumulated mean + SD was 3.11 + 1.30 cfu in 20 ~1 of washing fluid.

experimental groups. Figure 43.2 shows the reproducibility of mean bacterial load in a large number of experiments.

Determination of antibiotic penetration in middle ear and serum

Antibiotic penetration in middle-ear effusion can be determined by bioassay or HPLC in middle-ear samples. Pharmacokinetic data for serum and middle-ear effusion are available for erythromycin and analogs (Clement et aL, 1990), clarithromycin and its 14OH metabolite (Hardy et aL, 1990), azithromycin (Girard et aL, 1996), amoxicillin (Barry et aL, 1993), ampicillin (Barry et aL, 1994), ceftriaxone (Barry et aL, 1996) and cefditoren (authors' unpublished data). Selected data are given in Table 43.1. The study by Girard et aL (1996) on azithromycin kinetics in middle ears infected by H. influenzae showed that 75% of azithromycin recovered in bulla washes was associated with local inflammatory cells. In the same conditions, the corresponding proportions for clarithromycin, roxythromycin, erythromycin and amoxicillin were 20%, 34%, 27% and 5%, respectively. For pharmacokinetic determinations in middle-ear effusion, we inoculated the animals with 40 cfu of the same serotype 3 S. pneumoniae strain. Middle-ear and serum samples were taken 3 days after inoculation, i.e., at the onset of acute otitis media, when the effusion is abundant and tympanic inflammation is mild enough to avoid blood contamination of the samples. In these conditions, the middleear disease (inflammation and bacterial density) is close to that observed in children at the acute stage. Data on drug penetration in middle ear fluid are dependent on both the stage of infection/inflammation and the sampling method (whole-bulla washing after sacrifice or non-destructive transtympanic washing), which makes it difficult to compare published data. However, data on different compounds reported by a given team are usually comparable.

Pneumococcal otitis in gerbils is frequently followed by meningeal bacterial spread, the rate and outcome of which is strain- and inoculum-dependent (Muffat-loly et al., 1994; Barry et aL, 1995). No comparable studies have been reported for H. influenzae otitis. In the longitudinal study of H. influenzae otitis in gerbils by Fulghum et aL (1985b) only one animal died, of unidentified causes. Bacterial invasion of CSF can be used as an additional marker of infection. Samples can be obtained by percutaneous suboccipital intracisternal puncture. Animals are placed ventral side down. To present the cisternal region, the nape of the neck is exposed by keeping the head bent forward, and the fur is parted in the center with an alcohol swab. Shaving is not essential. Puncture is performed with a 0.3 • 13 mm needle attached to a 1 ml disposable syringe. The needle is slowly inserted perpendicular to the spine; slight depression is maintained to permit CSF to flow into the syringe as soon as the cisterna is reached. The transparent needle lock permits the sample to be controlled. Once again, the action has to be very precise to avoid spinal-cord injury and/or blood contamination of samples. In optimal conditions, 30-40 ~1 CSF can be withdrawn. Sampling is well tolerated. Inflammatory cytokine production has not been studied in gerbil acute otitis media, but some studies have been performed in other pathological situations such as parasitic infections (Wang et al., 1992; Campbell and Chadee, 1997) and cerebral ischaemia (Saito et aL, 1996). Other animal models have been used to explore local expression of inflammatory mediators/effectors during pneumococcal acute otitis media, e.g., cytokines in the chinchilla (Sato et aL, 1996) and rat (Zeevy, 1995), products of oxidative metabolism in the chinchilla (Kawana et aL, 1991) and guinea-pig (Parks et aL, 1994, 1995, 1996), and heat shock protein in the guinea-pig (Egusa et aL, 1995).

Antimicrobial therapy Beta-lactams, macrolides and quinolones are the main antibiotic families so far evaluated in the gerbil model. Antibiotics can be administered perorally or subcutaneously. Oral administration must be cautious, because gastrointestinal disorders may occur, especially with group A penicillins. Protocols for treatment and control differ according to the objective, but only a short treatment course (1-2 days) can discriminate antibacterial activity from spontaneous bacterial clearance. Table 43.2 summarizes the results of studies by Clement et aL (1990), Girard et aL, (1987, 1993), Hardy et al. (1990, 1991), Retsema et aL (1990) and Swanson et aL, (1991) aimed at evaluating and comparing the activity of various antibiotics in the treatment of AOM induced by H. influenzae (beta-lactamase producers and non-producers) and penicillin-susceptible S. pneumo-

GERBIL MODEL OF ACUTE OTITIS MEDIA

379

Table 43.1 Pharmacokinetic data in gerbils following a single dose of various antibiotics during acute otitis media (HPLC, high performance liquid chromotography; Bio, microbiological method assay)

Serum or plasma Cmax Compound

Route

Dose

Method

Erythromycin

PO

100

Bio

100 100 12 100 100 100 50 100 50 100 25 200 25 200

Bio HPLC HPLC Bio* Biot BiolBiolBiolHPLC HPLC BiolBiolHPLC HPLC

A-69334 Clarithromycin 14OH-Clari Azithromycin Amoxicillin Ampicillin Ceftriaxone

Cefditoren

PO PO PO SC SC SC

SC

Tr~ax T,/2 A U C ~ (h) (pg/ml.h)

(l~glmO (h) 3.7 5.5 2.1 0.8 4.0 53 29 61 95 141 268 10 60 51 326

1.0

1.9

1.0 4.4 3.0 1.5 3 1.1 2.0 0.5 0.78 0.5 0.69

Middle ear effusion C~ax

"[max T,/2

(t~glml) (h)

(h)

5.3

1.8

15 9.1 3.3

2.0 1.2 0.25 0.58 17 17 15 40 25 43

1.0 3.0 3.0 24 1-2 1

2

2.3

3.7 50

2 1

>12 >12

74 42

0.5

0.88 173

0.5 0.5 0.5 0.5 0.5

0.77 488 0.73 12 0.56 103 0.68 60 0.45 453

1.0 2.1 8.9 1.7 1.4 1.6 1.5

AUCo_. (pg/ml.h) Reference 2.3 ~ Clement et al., 6.8 J

1990

5.7 t 1.3

Hardyeta/. 1990 Girard et al., 1996 Barry et al., 1993 Barry et al., 1994

63 54

1 176

t

Barry et a/.,1996

Barry, 18:1:~ unpublished data 205~: J

* Using standard curves in serum. 1 Using protein-free standard curve (bioactive equivalent concentration). :1:AUC values from 0-6 hours after injection (the uncertainty of T1/2values rules out AUC0__calculation by the extrapolation method).

niae strains of invasive serotypes. Treatment is usually started within 24 hours after inoculation, and bacterial counts are performed on whole-bulla washing fluid after sacrifice, 18-24 hours after treatment cessation. Results are reported either as the daily dose yielding bacterial eradication, or as the effective dose for 50% of animals (EDs0). In our studies conducted with non-invasive S. pneumoniae serotypes, the large inoculum, the short course of the disease and the risk of lethal meningeal complications demanded earlier treatment (2-4 hours p.i.). Animals were not killed, and bacterial counts in middle-ear washings were performed from day 2 to day 15 postinfection (Barry et al., 1993). However, treatment efficacy is optimally observed on day 2. Our main results are summarized in Table 43.3.

Advantages/disadvantages of the model With non-typeable H. influenzae and S. pneumoniae strains of invasive serotypes, the course of the infection is close to the human situation, as a small inoculum is sufficient to induce acute otitis media, and spontaneous resolution is achieved within 2 weeks. Regarding pneumococcal otitis, investigations have focused on strains belonging to non-invasive serotypes, which are the commonest etiologic agents of middle ear infection and show cross-resistance to antimicrobials, a major health problem in clinical practice. When these

strains are used in the gerbil model, a large amount of bacteria must be inoculated to obtain AOM. Bacterial density in the middle ear is maximal at the time of inoculation, which is not representative of the pathogenesis of AOM in humans. However, the model cannot be considered as a model of bacterial clearance: bacterial density first falls, then plateaus in middle ear effusion between day 2 and day 4 postinoculation, and complete clearance has not been achieved by days 7-8. In an attempt to render the animals more susceptible and therefore allow the use of a smaller bacterial challenge, preinfection leukopenia was induced from the normal count of 10000 leukocytes/ml to 2000/ml with 100 mg/kg cyclophosphamide (Endoxan| in an intramuscular injection 3 days before inoculation; a second 25 mg/kg dose given at time of inoculation maintained leukopenia at the same level for 4 days. This approach was unsuccessful, as 104-5cfu/ear were still necessary and the rate of lethal systemic complications was greatly increased (unpublished data). The high rate of otogenic meningeal complications associated with use of large inocula, although necessitating early treatment, could be of interest. Prevention of bacterial CSF involvement can be an additional marker of antimicrobial activity, and the pathogenicity of strains in the middle ear can be defined in terms of both local bacterial persistence and meningeal tropism. Meningeal involvement subsequent to otitis media has also been exploited in a model of Listeria-monocytogenes-induced rhomboencephalitis in gerbils infected via the middle ear (Blanot et al., 1997). It is noteworthy that a large number of studies in auditory

380

B. Barry and M. Muffat-Joly

Table 43.2 Evaluation of various antibiotics in the treatment of H. influenzae (Hi) and S. pneumoniae (Sp) otitis media in gerbils; data are from studies using similar protocols (treatment given perorally for 2 days) and similar criteria for treatment evaluation

Reference

Pathogen

Treatment: start; frequency

Girard et aL, 1987

Hi 54A131

Clement et aL, 1990 Hardy et al., 1990

Dose cfu in achieving untreated bacterial controls eradication (log~ear) (mg/kg/day)

Compound

MIC (lag/ml)

Treatment evaluation

day 1 q.8 hours

Azithromycin Erythromycin Amoxicillin

0.10 1.56 > 100

1 day

Hi ATCC 43095

17 hours q.12 hours

A-69334" Erythromycin A

2-4 2-4

18 hours

7.1 + 0.25

300 no effect

Hi ATCC 43095

17 hours q.8 hours

14OH-clari Clarithromycin 14OH-clari + clari

4 8

18 hours

Ampicillin

0.25

7.5 + 0.8 7.5 + 0.8 5.3 + 1.7 7.1 + 0.3 Either

300 no effect 48 + 300 96 + 300 96

ND

Retsema etal., 1990

Hi

Day 1 q.8 hours

Azithromycin Roxythromycin Erythromycin

0.78 3.12 1.56

1 day

Swanson et al., 1991

Hi ATCC 43095

17 hours q.12 hours

Temafloxacin Ciprofloxacin Ofloxacin Ampicillin

0.015 0.015 0.030 0.25

18 hours

7.4 7.4 7.4 7.4

Hardy et al., 1991

Hi ATCC 43095

17 hours q.12 hours

A-69334" Erythromycin A Ampicillin

2 1 0.25

18 hours

7.1 + 0.1 7.1 + 0.1 7.1 + 0.1

Girard et aL, 1987

Sp 02J025

Day 1 q.12 hours

Azithromycin Erythromycin Amoxicillin

0.02 0.01 0.003

1 day

Swanson et al., 1991

Sp ATCC 6303

17 hours q.12 hours

Temafloxacin Ciprofloxacin Ofloxacin Ampicillin

0.25 1 0.5 0.03

18 hours

Girard et al., 1993

Sp 02J025

Day 1 q.12 hours

Azithromycin Clarithromycin

0.19 0.02

1 day

37 > 100 > 100

ND

+ 0.1 +0.1 + 0.1 +0.1

EDso (mg/kg)

31 > 100 > 100 10 50 10-50 50 300 no effect 100

ND

4.1 6.8 103

102 5 x 103 102-10 ~ (GM 3.8 x 10~ 107-108 (GM 3 x 107)

MOUSE MODEL OF MYCOPLASMA GENITAL INFECTIONS

43:3

Antimicrobials

References

The antibiotics that have been tested in T O and BALB/c strains of mice for their efficacy in clearing mycoplasmas from the genital tract are shown in Table 49.4.

Casillo, S., Blackmore, D. K. (1972). Uterine infections caused by bacteria and mycoplasma in mice and rats. J. Comp. PathoL, 82, 477-482. Cassell, G. H., Hill, A. (1979). Murine and other small animal mycoplasmas. In: The Mycoplasmas (eds Tully, ]. G., Whitcomb, R. F.), vol. 2, pp. 235-273. Academic Press, New York. Dienes, L., Edsall, G. (1937). Observations on the L-organism of Klieneberger. Pro< Soc. Exp. BioL Meal., 36, 740-744. Franz, A., Webster, A. D. B., Furr, P. M., Taylor-Robinson, D. (1997). Mycoplasmal arthritis in patients with primary immunoglobulin deficiency: clinical features and outcome in 18 patients. Br. J. Rheumatol., 36, 661-668. Frcundt, E. A. (1983). Culture media for classic mycoplasmas. In: Methods in Mycoplasmology (eds Razin, S., Tully, J. G.) vol. 1, pp. 127-135. Academic Press, New York. Furr, P. M., Taylor-Robinson, D. (1984). Enhancement of experimental Mycoplasma pulmonis infection of the mouse genital tract with progesterone.J. Hyg., 92, 139-144. Furr, P. M., Taylor-Robinson, D. (198%). Oestradiol-induced infection of the genital tract of female mice by Mycoplasma horninis. J. Gen. MicrobioL, 135, 2743-2749. Furr, P. M., Taylor-Robinson, D. (1989b). The establishment and persistence of Ureaplasma urealyticurn in oestradiol-treated female mice. J. Med. MicrobioL, 29, 111-114. Furr, P. M., Taylor-Robinson, D. (1993a). The contrasting effects of progesterone and oestrogen on the susceptibility of mice to genital infection with Mycoplasma pulrnonis. J. Med. Microbiol., 38, 160-165. Furr, P. M., Taylor-Robinson, D. (1993b). Urogenital infections in rodents. In: Molecular and Diagnostic Procedures in Mycoplasmology (eds Tully, ]. G., Razin, S.), vol. 2, pp. 337-347. Academic Press, New York. Furr, P. M., Taylor-Robinson, D. (1993c). Mycoplasma pulmonis infection of the murine oropharynx protects against subsequent vaginal colonization. EpidernioL Infect., 111,307-313. Furr, P. M., Taylor-Robinson, D., Webster, A. D. B. (1994). Mycoplasmas and ureaplasmas in patients with hypogammaglobulinaemia and their role in arthritis: microbiological observations over twenty years. Ann. Rheum. Dis., 53, 183-187. Gourlay, R. N., Wyld, S. G. (1976). Ilsley-type and other mycoplasmas from the alimentary tracts of cattle, pigs and rodents. Proc. Soc. Gen. MicrobioL, 3, 142. McGarrity, G. l., Rose, D. L., Kwiatkowski, V., Dion, A. S., Phillips, D. M., Tully, 1. G. (1983). Mycoplasma muris, a new species from laboratory mice. Int. J. Syst. Bacteriol., 33, 350-355. M011er, B. R., Taylor-Robinson, D., Furr, P. M. (1984). Serological evidence implicating Mycoplasma genitalium in pelvic inflammatory disease. Lancet, 1, 1102-1103. Rosenstein, I. 1., Morgan, D. J., Sheehan, M., Lamont, R. F., Taylor-Robinson, D. (1996). Bacterial vaginosis in pregnancy: distribution of bacterial species in different gram-stain categories of the vaginal flora. J. Med. Microbiol., 44, 1-7. Rugh, R. (ed.) (1968). The Mouse. Its Reproduction and Development, pp. 38-39. Burgess, Minneapolis, MN. Taylor-Robinson, D. (1989). Genital mycoplasma infections. Clin. Lab. Meal., 9, 501-523. Taylor-Robinson, D. (1996). Infections due to species of Mycoplasma and Ureaplasma: an update. Clin. Infect. Dis., 23, 671-684.

Preparation and administration Antibiotics were prepared as a solution in distilled water and were given subcutaneously in a volume of 0.1 ml. The dose, frequency and duration of administration are shown in Table 49.4.

Monitoring response to therapy Since the model is one of mycoplasmal colonization, rather than disease production, the effect of antibiotic therapy that is sought is elimination of organisms from the genital tract. This is determined by taking intravaginal swab specimens at appropriate times after the conclusion of a course of therapy and undertaking quantitative estimations of the number of mycoplasmal organisms present, as described previously. In addition, the upper genital tract may be examined by taking specimens at autopsy.

Pitfalls and advantages of the model The major pitfall is the one usually ascribed to small animal models, namely the likelihood that it does not fully reflect the human situation. However, from the point of view of assessing the effect of antibiotics, the results obtained so far are in keeping with expectations, namely that tetracyclines are effective in eliminating mycoplasmas from the genital tract. The model has the obvious advantage that, if necessary, intravaginal swab specimens may be taken at frequent intervals and drugs in combination may be tested, as well as new drugs prior to clinical trials. In addition, the model has provided the opportunity to underline the importance of a competent immune system in eradicating mycoplasmas from the genital tract (Furr et al., 1994; Franz et al., 1997). This is sometimes a major problem in subjects who are hypogammaglobulinaemic. As shown in Table 49.4, oxytetracycline that was instrumental in eradicating mycoplasmas from the genital tract of immunocompetent mice failed to do so when it was administered to their nude counterparts. This model may be exploited further because it lends itself to an assessment of the exact cellular immunological defect that is important in the failure to eradicate and also allows examination of the value of administering high-titre specific mycoplasmal antibody to aid eradication, an approach that seems to have been of value in the human situation (Furr et aL, 1994; Franz et aL, 1997).

434

Taylor-Robinson, D., B~b~ar, C. (1997). Antibiotic susceptibilities of mycoplasmas and treatment of mycoplasmal infections. J. Antimicrob. Chemother., 40, 622-630. Taylor-Robinson, D., Furr, P. M. (1986). Urinary-tract infection by Mycoplasma pulmonis in mice and its wider implications. J. Hyg., 96, 439-446. Taylor-Robinson, D., Hay P. E. (1997). The pathogenesis of the clinical signs of bacterial vaginosis and possible reasons for its occurrence. Int. J. STD AIDS, 8, (Suppl. 1), 13-16. Taylor-Robinson, D., Denny, F. W., Thompson, G. W., Allison, A. C., Mfirdh, P-A. (1972). Isolation of mycoplasmas from

D. Taylor-Robinson and P. M. Furr

lungs by a perfusion technique. Med. MicrobioL ImmunoL, 158, 9-15. Tuffrey, M., Taylor-Robinson, D. (1981) Progesterone as a key factor in the development of a mouse model for genital-tract infection with Chlamydia trachomatis. FEMS MicrobioL Lett., 12, 111-115. Tully, J. G., Rose, D. L., Whitcomb, R. F., Wenzel, R. P. (1979). Enhanced isolation of Mycoplasma pneumoniae from throat washings with a newly modified culture medium. J. Infect. Dis., 139, 478-482.

Chapter 50

Mouse Model of Ascending Urinary Tract Infection W. J. Hopkins

Urinary tract infections in humans Recurrent urinary tract infections (UTI) caused predominantly by Escherichia coli are a significant urologic disease for adult women. Our current understanding of the etiology of UTIs is that uropathogenic E. coli from the intestinal flora sequentially colonize the perineum, vagina, urethra, and bladder (Stamm et al., 1991). Even in women without underlying anatomic or functional abnormalities, bacteria from the infected bladder may ascend to the kidneys, causing infection and renal scarring (Lomberg et al., 1983). To most accurately study host or bacterial factors that influence the induction of bladder or kidney infections, animal models must accurately simulate these events.

Background of model A variety of animal models have been used to define virulence factors of uropathogenic E. coli and mechanisms of host resistance to UTI (Kaijser and Larsson, 1982). In particular, intravesical inoculation of mice with uropathogenic bacteria has been used extensively as a model of unobstructed, ascending infection (Hagberg et aL, 1983). One of the most important considerations in insuring that the mouse model reflects events occurring during the infection process in humans is to insure that renal infection develops as the result of bacteria ascending from the infected bladder rather than from vesicoureteral reflux accompanying inoculation (Johnson and Manivel, 1991; H o p k i n s e t a L , 1995; Johnson and Brown, 1996). Because inoculum volumes of 50 btl and greater have been found to introduce bacteria directly into the kidney, inoculation procedures have been refined to circumvent this problem (HopkinsetaL, 1995; Johnson and Brown, 1996). We have also instituted steps in the preparation of the inoculum and animals to maintain consistency between experiments.

Animal species Female mice have typically been used to study ascending UTIs because the clinical problem of recurrent infections Handbook of Animal Models of Infection ISBN 0-12-775390-7

occurs predominantly in women. Male mice could also be used if a specific question relevant to UTIs in males was being investigated. The age of the mice generally ranges from 8-12 weeks. Many strains of inbred mice have been successfully used in this model, but susceptibility can vary in strains of different genetic backgrounds (Hopkins et al., 1996). The strains chosen for a particular study would thus be dictated by the objectives of the investigations. Mice with differing genetic make-ups could be used to define host characteristics that influence resistance to infection, whereas a single mouse strain might be utilized to test the importance of different bacterial virulence factors.

Storage and preparation of the inoculum Stocks of bacterial strains should be stored frozen at-70~ or lyophilized to provide a consistent source of bacteria for different experiments. A small aliquot of stock is used to inoculate a bacteriological medium that will promote development of virulence factors present in the bacteria being studied. For example, uropathogenic E. coli may carry genes for Type 1 or P fimbriae, and the choice of growth medium can influence which fimbrial type is expressed. Type 1 fimbriae are expressed well during growth in tryptose broth, with typical conditions being an initial 48 hour growth from stock, followed by overnight culture (Hopkins et aL, 1987). The P fimbriae are expressed better as a result of growth on colony-factor antigen agar (Evans et al., 1977). It is also possible to use bacteria from continuous cultures, but this is not recommended since there may be a lack of consistency between experiments done over several weeks or months, and, furthermore, it is possible that bacteria could lose virulence factors when repeatedly subcultured over long periods of time. The inoculum is prepared by harvesting cells either from liquid culture or from a suspension prepared by washing bacteria from solid medium. In either case, bacteria are collected by centrifugation at 9000 g for 8 minutes and then resuspended in approximately 20 ml of phosphate-buffered saline (PBS) as a means of removing residual media. This Copyright 9 1999 Academic Press All rights of reproduction in any form reserved

436

W.J. Hopkins

suspension is centrifuged as above to pellet the bacteria, after which they are resuspended in a small volume of PBS to obtain a concentrated suspension for preparing the inoculum. As a guideline, bacteria from 50-60ml of overnight liquid culture can be resuspended in 2-3 ml to give a final concentration of greater than 101~ The exact concentration of bacteria can be determined spectrophotometrically using a standard curve that relates the OD420 of the bacterial suspension in PBS to the number of bacteria per milliliter. The concentrated suspension can now be diluted to prepare an inoculum that will contain sufficient bacteria in 10 btl to induce a UTI with the bacterial strain and animals being used. A minimal dose that will infect all the animals inoculated will need to be determined empirically by testing doses that cover a range less than and greater than 1 • 108 per mouse.

Preparation of animals One potential problem with this model is that the inoculum may be voided and lost shortly after administration so that an infection does not have time to become established. This situation can be overcome by including two steps in the preparation of all animals. First, mice are taken off water for at least an hour before inoculation as a way to decrease urine output. Second, immediately prior to inoculation any residual urine is expressed from the bladder by applying gentle pressure with the thumb to the abdomen over the bladder (Figure 50.1).

Infection procedure Urinary tract infections can be induced in mice by an intraurethral or intravesical inoculation of viable bacteria and, when performed correctly, either method will avoid the problem of direct infection of the kidneys. The equipment used is the same for both types of inoculation and consists of a 50 btl Hamilton| syringe with a 30 G needle that has been cut to approximately 2 cm and fitted with a short length of polyethylene tubing (Intramedic@ PE-10, Becton-Dickinson, Parsippany, NJ). The tubing is cut 0.5 cm or 1.0 cm beyond the end of the needle for intraurethral or intravesical inoculations, respectively. To begin the inoculation, a mouse that has been anesthetized with ether or pentobarbital is placed onto its back, and its hind legs are held in place on the work surface with a scissors or hemostat handle, as shown in Figure 50.2. Grasp the papilla on one side with tissue forceps and pull it upwards slightly from the abdomen. The tubing is next inserted into the urethral opening while maintaining traction on the papilla, and advanced into the urethra (Figure 50.3). For urethral inoculation, only the 0.5 cm section of tubing extending past the end of the needle is placed into the urethra. When

Figure 50.1

Expressing urine from the mouse bladder prior to inoculation. With the unanesthetized mouse held in one hand, urine is expressed using the thumb of the opposite hand. The thumb is pressed onto the abdomen over the bladder and drawn posteriorly towards the urethral opening.

bacteria are instilled into the bladder, the 1.0 cm length of tubing is gently passed through the urethra. The tubing will slide easily through the urethra unless it encounters an obstruction, such as where the urethra passes adjacent to the pubic symphysis. In this case, withdraw the catheter 2-3 m m and advance it again while directing the tip slightly downward. Once the tubing is in place within the urethra or bladder, deliver the inoculum at a rate of less than 1 l~l/s and then remove the catheter. The mice are allowed to recover from the anesthesia but are not given water for 1 hour after inoculation to decrease urine output and thereby loss of the inoculum through voiding.

Parameters to monitor infection The intensity of a bladder or kidney infection can be quantified by determining the number of bacteria per milligram of bladder or kidney tissue. Peak infection levels generally occur by 1 day after inoculation and progressively decrease over a 2-3-week period, depending upon the bacterial strain and inbred mouse used. The organs are removed at predetermined time points and weighed to obtain a wet weight for the bladder and pool of both kidneys. The bladder can be placed into a 35 m m Petri dish and the kidneys into a sterile plastic bag (e.g., Whirlpak|

MOUSE MODEL OF ASCENDING URINARY TRACT INFECTION

Figure 50.2 Position of the mouse for inoculation. The anesthetized mouse is placed onto its back, and the handle of a hemostat is used as shown to restrict movement of the hind legs. This photograph also shows the papilla and urethral opening.

437

and kept on ice until homogenized. Tissues are homogenized in a small volume (2-4 ml) of PBS using a sterile Potter-Elvehjem tissue homogenizer, crushing in a Whirlpak| bag, or a Stomacher| homogenizer (Seward). Bladders are more effectively homogenized if they are first minced with a small scissors. Once the tissues are broken up, large pieces of debris can be removed by very low speed centrifugation and the supernatant transferred to a new sterile tube and kept cold. Aliquots of the supernatant are then serially diluted and plated on to Levine's eosinmethylene-blue (EMB) agar plates to obtain isolated colonies for counting. Plate count data are used to calculate the number of bacteria in the entire bladder and the combined kidneys, which, in turn, are used to compute the lOgl0 (cfu/mg tissue) values needed to determine the mean and standard deviation for each group of animals in the experiment. As a point of reference for infection intensities, experiments using our uropathogenic E. coli strain at an inoculum dose of 1 • 108 in BALB/c mice will result in bladder mean log,{, cfu values of approximately 3.5-4.0 one day after inoculation. The infection will gradually resolve over 14-21 days, and the mean log,0 cfu will decline to less than 1.0, with the majority of animals having cleared their infections. These values are for infections induced with a minimal number of bacteria in one mouse strain, and the infection intensities will probably be different with other uropathogens, inbred mice, and the methods used in a particular laboratory. Whether the infection will ascend to the kidneys in the absence of inoculation-associated vesicoureteral reflux is in large part dependent on the bacterial strain. It is recommended that each team of investigators develops consistent inoculation and assay procedures for their particular studies. While it is not a direct measure of infection, the intensity of inflammatory responses in the bladder and kidneys of infected animals correlates with the number of bacteria in these organs. A grading scale such as that shown in Table 50.1 can be used to assign a numerical value to each degree of inflammation. The scores for animals in experimental and control groups can then be statistically analyzed to determine the significance of a particular bacterial virulence factor or host characteristic in the pathophysiology of the infection.

Advantages/disadvantages of the model

Figure 50.3 Inserting catheter tubing into the urethra. The papilla is grasped with light pressure and lifted away from the abdomen. While the papilla is maintained in this position, tubing attached to the inoculating syringe is advanced into the urethral opening and the urethra.

The mouse model of UTI has several advantages for investigators interested in defining host or bacterial factors that affect infectivity, pathophysiology, or host defense mechanisms. Among these are the availability of inbred mouse strains with distinct genetic backgrounds. Mice with known genetic traits can be used to correlate individual genes with susceptibility to bladder or kidney colonization, pathology associated with host responses to

438

W . J . Hopkins

Table 50.1

Grade

Histopathologicai grading scale for degree of inflammation

Bladder

Kidney

Normal

Normal

Subepithelial cell inflammatory infiltration (focal and multifocal)

Focal inflammation (cellular infiltration and/or edema in the pelvis)

Edema and subepithelial inflammatory cell infiltration (diffuse)

Focal inflammation (more severe)in the pelvis to medulla with and without moderate edema

Marked subepithelial inflammatory cells with necrosis and neutrophils in and on bladder mucosal epithelium

Multifocal inflammation and cells from pelvis to medulla

Inflammatory cell infiltrate extends into muscle, in addition to criteria for grade 3

Extensive segmental inflammation and necrosis evident from pelvis to cortex

Loss of surface epithelium (necrosis with fullthickness inflammatory cell infiltration)

Diffuse tissue necrosis and inflammatory cell infiltration extending from pelvis to cortex

infection, and innate or adaptive defense mechanisms. Conversely, appropriate genetic crosses can be used to identify and map unknown genes associated with induction of bladder and kidney infections or with protective immune responses. Another benefit of using mice is that animals are usually available in sufficient numbers to obtain experimental group sizes that will be large enough to provide meaningful statistical analysis. The relatively low acquisition and housing costs of mice are an economic advantage of this model. Some disadvantages of the mouse model can be attributed to the small size of the animals. A considerable amount of expertise needs to be developed to perform bladder or urethral inoculations reproducibly. The need to use thin catheters and low volumes can pose technical problems when inoculating mice in which the external and internal anatomy can vary slightly between animals even within the same strain. There is also some limitation in the amount of tissue that is available for histologic examination, in situ immunologic or nucleic acid studies, or investigations requiring large numbers of inflammatory or immunologic cells recovered from the site of infection. The latter problem can sometimes be overcome by pooling tissue from several animals. As with any animal model, there can always be the question of how relevant the studies are to the same disease in humans. In general, the many studies conducted thus far in mice infected with human uropathogens have contributed to validating this model on the conceptual level. Over the past several years our laboratory and other investigators have recognized that earlier models of ascending UTI in the mouse had the shortcoming of artificially inducing kidney infections by inoculation-associated vesicoureteral reflux. Efforts focused at alleviating this problem have resulted in a model with better-defined inoculation conditions that will increase consistency between experiments.

Contributions of the model to infectious disease therapy Urinary tract infections in women are treated with shortterm courses of antibiotics for acute episodes and prophylactic antibiotics to decrease the incidence of recurrent infections in susceptible patients. Antibiotic therapy does, however, have significant disadvantages in that bacteria acquire resistance to specific antibiotics and patients may develop allergic reactions to an effective drug. In view of such problems, there has been an effort to develop alternative approaches to treatment or prevention. The mouse model of ascending UTI has been used to explore the feasibility of prevention strategies based on blockade of bacterial proteins required for adherence to epithelial cells lining the vagina and bladder. Experiments in which 0t-D-mannopyranoside (Aronson et aL, 1979) or globoseries analogs (Svanborg Eden et aL, 1982) mixed with the E. coli inoculum decreased the intensities of bladder and kidney infections demonstrated that inhibition of bacterial adherence mediated by Type-1 and p fimbriae, respectively, might provide an alternative method of treatment or prophylaxis. More recently, we have used this model to develop a vaginal mucosal vaccine for UTIs. A multistrain, whole-cell vaccine containing several E. coli strains was instilled into the mouse vagina as a means of increasing urogenital mucosal immunity to E. coli (Uehling etaL, 1991). Immunized mice later challenged with an E. coli UTI had lower numbers of bacteria in the bladder than controls. Vaccine efficacy demonstrated in these animal studies formed the basis for clinical trials in patients with recurrent UTIs (Uehling et aL, 1994, 1997).

References Aronson, M., Medalia, O., Schori, L., Mirelman, D., Sharon, N., Ofek, I. (1979). Prevention of colonization of the urinary tract

MOUSE MODEL OF ASCENDING URINARY TRACT INFECTION

of mice with Escherichia coli by blocking of bacterial adherence with methyl D-mannopyranoside. J. Infect. Dis., 139, 329-332. Evans, D. G., Evans, D. l., Tjoa, W. (1977). Hemagglutination of human group A erythrocytes by enterotoxigenic Escherichia coli isolated from adults with diarrhea: correlation with colonization factor. Infect. Irnmun., 18, 330-337. Hagberg, L., Engberg, I., Freter, R., Lam, J., Oiling, S., SvanborgEden, C. (1983). Ascending, unobstructed urinary tract infection in mice caused by pyelonephritogenic Escherichia coli of human origin. Infect. Imrnun., 40, 273-283. Hopkins, W. 1., Uehling, D. T., Balish, E. (1987). Local and systemic antibody responses accompany spontaneous resolution of experimental cystitis in Cynomolgus monkeys. Infect. Immun., 55, 1951-1956. Hopkins, W. J., Hall, 1. A., Conway, B. P., Uehling, D. T. (1995). Induction of urinary tract infection by intraurethral inoculation with Escherichia coli: refining the murine model. J. Infect. Dis., 171,462-465. Hopkins, W. 1., Gendron-Fitzpatrick, A., McCarthy, D. O., Haine, J. E., Uehling, D. T. (1996). Lipopolysaccharideresponder and nonresponder C3H mouse strains are equally susceptible to an induced Escherichia coli urinary tract infection. Infect. Irnmun., 64, 1369-1372. Johnson, I. R., Brown, 1.1. (1996). Defining inoculation conditions for the mouse model of ascending urinary tract infection that avoid immediate vesicoureteral reflux yet produce renal and bladder infection. J. Infect. Dis., 173, 746-749.

439

Johnson, J- R., Manivel, I. C. (1991). Vesicoureteral reflux induces renal trauma in a mouse model of ascending, unobstructed pyelonephritis.J. UroL, 145, 1306-1311. Kaijser, B., Larsson, P. (1982). Experimental acute pyelonephritis caused by enterobacteria in animals. A review. J. UroL, 127, 786-790. Lomberg, H., Hanson, L., lacobsson, B., lodal, U., Leffler, H., Svanborg EdSn, C. (1983). Correlation of P blood group, vesicoureteral reflux, and bacterial attachment in patients with recurrent pyelonephritis. N. EngL J. Med., 308, 1189-1192. Stamm, W. E., McKevitt, M., Roberts, P. L., White, N. I. (1991). Natural history of recurrent urinary tract infections in women. Rev. Infect. Dis., 13, 77-84. Svanborg Eden, C., Freter, R., Hagberg, L. et aL (1982). Inhibition of experimental ascending urinary tract infection by an epithelial cell-surface receptor analogue. Nature, 298, 560-562. Uehling, D. T., James, L. l., Hopkins, W. l., Balish, E. (1991). Immunization against urinary tract infection with a multivalent vaginal vaccine.]. Urol., 146, 223-226. Uehling, D. T., Hopkins, W. 1-, Dahmer, L. A., Balish, E. (1994). Phase I clinical trial of vaginal mucosal immunization for recurrent urinary tract infection. J. Urol., 152, 2308-2311. Uehling, D. T., Hopkins, W. J., Balish, E., Xing, Y. N., Heisey, D. M. (1997). Vaginal mucosal immunization for recurrent urinary tract infection: phase II clinical trial. J. Urol., 157, 2049-2052.

This Page Intentionally Left Blank

Chapter 51

Mouse Model of Ascending UTI Involving Short- and Long-term Indwelling Catheters D. E. Johnson and C. V Lockatell

Background of human infection Every year millions of urinary catheters, most indwelling in the urethra, are used in hospitals and nursing homes to manage urinary retention or incontinence (Garibaldi, 1981). However, bacteria can enter the bladder and cause catheter-associated bacteriuria, the most common nosocomial infection in both types of institution (Garibaldi et al., 1981; Haley et aL, 1985). In hospitals, urethral catheters are usually in place for 2-4 days (Garibaldi et al., 1981; Warren et al., 1978). Bacteriuria develops in 10-30% of catheterized patients and its complications include fever, acute pyelonephritis, bacteremia, and death (Haley et al., 1981). The prevalence of urinary incontinence among nursing home patients is estimated to be between 35% and 50% (Hing, 1981) and urinary catheters may be in place for months or years. Virtually all patients with long-term indwelling catheters (30 days or more) have polymicrobic bacteriuria, which appears to be the most common nosocomial infection in nursing home patients (Warren et al., 1982). Proteus mirabilis, one of the most common uropathogens, is frequently isolated from the urine of elderly long-termcatheterized patients (Warren et al., 1982; Mobley and Hausinger, 1989). Infection with this organism can result in serious complications, such as stone formation in the kidneys and bladder (Mobley and Hausinger, 1989) encrustation and obstruction of the catheter (Mobley and Warren, 1987), acute pyelonephritis (File et aL, 1985; Eriksson et al., 1986; Rubin et aL, 1986), fever and bacteremia (Setia et al., 1984). The portion of the urethral catheter that resides in the bladder lumen is a foreign body that provides a niche for bacterial colonization, elicits changes in bacterial attachment to uroepithelial cells (Daifuku and Stamm, 1986), reduces antibacterial leukocyte function (Zimmerli et al., 1982), and becomes a nidus for infection-induced stone formation (Mobley and Warren, 1987).

including some with foreign bodies in the bladder. Vivaldi et al. (1959) and Cotran et al. (1963) demonstrated enhanced persistence of P. rnirabilis or Escherichia coli in the urinary

tracts of rats in the bladders of which glass beads had been surgically implanted. Musher et al. (1975), Satoh et al. (1984), and Nickel et al. (1987) surgically implanted zinc discs in rat bladders to study uropathogenicity of P. rnirabilis. In all of those models the procedures for instillation of the foreign body in the animal bladders entailed incision of the bladder wall, resulting in trauma and disruption of the bladder mucosa. That disruption of the bladder mucosa in itself could result in altered bacterial adherence to the urinary tract, leading to enhanced bacteriuria, thus masking the contribution of the foreign body to infection of the urinary tract. The mouse model is in many ways analogous to patients with urinary catheters in place. The foreign body is polyethylene tubing with a lumenal and external surface similar in construction to urinary catheters. As with human urinary catheters, organisms colonizing the luminal surface of the polyethylene tubing may evade host bacterial defense mechanisms. The tube is secured in such a way as to avoid urethral or ureteral obstruction. Finally, and importantly, the only trauma to the bladder is two punctures by the suture needle as it passes into and from the bladder lumen.

Animal species This model uses the mouse CBA/J inbred (F200) substrain originating (lax Notes, 1988) in a cross of a Bagg albino female and a DBA male. Female mice 6-8 weeks of age, 20-22 g, are used. Since the anatomy of the male urethra is prohibitive to catheterization, only females are used.

Preparation of animals Background of model Many animal models have been used to study urinary tract infections (Hagberg et al., 1983; Johnson et aL, 1987) Handbook of Animal Models of Infection ISBN 0-12-775390-7

No special housing or care is required. Prior to experimental use a urine sample is obtained for culture to assure absence of bacteriuria. During handling of animals spontaneously Copyright 9 1999 Academic Press All rights of reproduction in any form reserved

442

D.E. Johnson and C. V. Lockatell

Anesthetic, sterile catheter segments, stylet, hair clippers, skin disinfectant, scalpel handle and blades, forceps, hemostats, scissors, syringes and needles, suture material and wound clips, sterile surgical drapes, 2 x binocular magnifier, heat lamp or mat, ampicillin.

solution; Wixson, 1990). A scavenging fume hood is used when anesthetizing mice with methoxyflurane. Animals respond to anesthetic within 5 minutes and remain anesthetized for 20-30 minutes. Prevention of hypothermia is particularly important with pentobarbital use. Ketamine (200 mg/kg i.m.) + xylazine (10 mg/kg i.p.) can be substituted for pentobarbital if use of a controlled substance is not desired. The anesthetized mouse is placed in a supine position and the periurethral area is swabbed with povidone iodine solution, which is rinsed off with sterile water. Several 4-mm long (containing a radiopaque strip or other black marking) and a single 25-mm-long segment of polyethylene catheter (0.28 mm i. d., 0.61 mm o.d., Clay Adams, Parsippany, NI; alternative catheters: polyurethane, Braintree Scientific, Braintree, MA and Argyle umbilical vessel catheter, Sherwood Medical, Allentown, PA) are fitted on to a metal sytlet (50 mm long, 0.25 mm o.d.; Bel-Art SMORC replacement wires, Pequannock, NI; Figure 51.1A). Catheter segments are sterilized by using ethylene oxide before insertion into the bladder and sterility is maintained by using aseptic technique while handling the catheter segments. Care is taken to ensure that the 4-mm-long catheter segment protrudes slightly past the tip of the stylet and that the 25-mmlong segment (which is kept in place on the stylet with forceps) is snug against bottom of the 4-mm-long segment. In preparation for catheterization the urethral meatus is gently grasped with forceps and pulled slightly forward parallel to the body. Use of a 2 • binocular magnifier (OptiVision, Donegan Optical Co., Lenexa, KA) aids in visualization. The end of the stylet inserted through the 4-mm-long catheter segment is gently and carefully inserted into the urethra at a slight angle then moved parallel to animal's body below the pelvic arch. The entire apparatus is advanced until the leading end is in the bladder (Figure 51.1B). No resistance should be felt during this procedure. If resistance is felt, withdraw the apparatus and recheck the positioning. The 25-mm-long catheter is then advanced along the stylet to push the 4-mm-long segments off the stylet and into the bladder (Figure 51.1C). The stylet with the 25-mmlong catheter segment is removed, leaving the 4-mm-segments free in the bladder (Figure 51.1D).

Short-term indwelling catheter model

Long-term model

Mice are anesthetized with either methoxyflurane inhalation using an open-drop nose cone or with 50 mg/kg pentobarbital intraperitoneally (0.04-0.05 ml of 25 mg/ml pentobarbital

In the long-term model a single 4-mm-long catheter is secured by a single suture within the bladder lumen. While the mice are still anesthetized, the mouse abdomen is

voided urine can be obtained. However, background contamination from the periurethral area (approximately 102--103 cfu may be cultured, usually consisting of Proteus, Enterobacter and/or Gram-positive organisms) usually yields false positive results. A more reliable method is to anesthetize the mouse with minimal handling in an anesthetic jar containing methoxyflurane. Once anesthetized, remove the mouse from the jar and continue anesthesia as needed using a nose cone. Swab the periurethral area with povidone iodine (1.0% titratable iodine) solution and gently insert a catheter (25mm long Clay Adams polyethylene PE-10 intramedic tubing i.d. 0.28 m m • o.d. 0.61mm) into the urethra to approximately half the catheter length. Approximately 10-20btl of urine may be expressed from the bladder and collected aseptically by gentle compression of the abdominal wall. While the mouse is anesthetized, shave fur from the mouse abdomen (No. 40 clipper blade) in preparation for the surgical procedure used in the long-term catheter model.

Details of surgery Overview Catheter segments are placed in the lumen of the mouse urinary bladder. In the short-term model the segments are not secured in the bladder and are expelled over time by micturition (Table 51.1). In the long-term model a single segment, secured in the bladder lumen with a suture, is retained for up to 1 year.

Materials required

Table 51.1

Retention of unsecured catheter segments in bladder lumen of CBA mice

Days between catheter insertion and examination of mice

2 3 7 14 21

No. mice with catheter segments in bladder/ no. mice examined (%)

9/10 (90) 7/10 (70) 4/9 (44) 2/7 (29) 0/10 (0)

MOUSE MODEL OF ASCENDING UTI INVOLVING SHORT- AND LONG-TERM INDWELLING CATHETERS

disinfected with povidone iodine and alcohol scrub and the bladder is exposed by a midline abdominal incision. Visualization of the 4-mm-long catheter segment through the translucent bladder wall is assisted by black catheter markings. A sterile 5-0 polypropylene suture (Prolene, Ethicon, Somerville, NI) is threaded through the bladder wall, through the lumen of the 4-mm-long bladder catheter segment (Figure 51.1E), back through the bladder wall, and through a second 4-mm-long catheter segment placed on the serosal side of the bladder, and is tied loosely (Figure 51.1F). The second catheter segment is used to prevent erosion of the suture into the serosal side of the bladder wall. To accomplish this procedure, the bladder is gently grasped with straight forceps, holding the catheter segment stable within the lumen. Exercise extreme care when passing the 5-0 prolene suture through bladder wall and catheter segment, as the catheter can easily puncture the bladder wall. A second pair of forceps is used against the serosal surface of the bladder as the prolene suture is pulled slowly through the opposite side of the bladder wall; a hemostat is attached to the free end of the suture material to guard against the suture pulling out prior to being tied in place. The urinary bladder is returned to the abdomen, muscle and fascia are closed with 5-0 gut suture (Chromic Gut, Ethicon) by using a mattress suture pattern, and the skin is closed with 9 mm stainless steel staples (Autoclip, Clay Adams, Parsippany, NI). After surgery mice are placed in a clean cage with shredded nesting material (Kimwipes) under a heat lamp to maintain a temperature of 37.4~ until they have completely recovered from anesthesia. Ampicillin (0.5 mg/ml) is added to their drinking water daily for 7 days to eliminate any microorganisms introduced during the procedure.

443

Staples are removed 7 days after surgery. Two weeks postsurgery bladders are histologically normal and mice are ready for experimental study.

Storage and preparation of inocula Clinical isolates of E. coil R mirabilis, Klebsiella pneumoniae and Candida albicans are preserved by two methods; grown on trypticase soy agar (TSA, BBL, Hunt Valley, MD) and frozen a t - 7 0 ~ and lyophilized in trypticase soy broth (TSB) with 12% sucrose on sterile inert boiling stones (R. E Cargille Laboratories, Cedar Grove, NJ). The study organism is revived from a lyophilized chip in 2 ml TSB grown static overnight at 37~ Four large (20xl50mm) TSA culture slants are inoculated from the static culture and grown overnight at 37~ the growth is harvested with 3 ml phosphate buffered saline for an inoculum of about 2 - 4 x 10~~cfu/ml. Inoculum is enumerated quantitatively using TSA spread plates inoculated with serial 10-fold dilutions.

Infection process Mice are anesthetized with 50 mg/kg pentobarbital i.p. and placed in a supine position. The periurethral area is swabbed with povidone iodine and a 25-mm-long polyethylene catheter is inserted into the urethra as previously described. A 30 G V2"hypodermic needle is inserted into the catheter opening. The neeclle is attached to a 2.1 ml 20"

B 4 mm

25 mm

t

stylet

I

mouse

I

.......:',

............

urethra

~

4 mm

~, (

,,,,...._.

suture and

~

Z7~777

77771

71 7

suture

serossl catheter

Figure 51.1 Procedure for placement of catheter segment into mouse urinary bladder. A Catheter segment fitted on to stylet. B Apparatus inserted into urethra and distal end advanced to bladder. C 25-mm-long catheter segment advanced along stylet, pushing 4-mm-long segment into bladder. D Stylet and 25-mm-long catheter segment removed, leaving 4-mmlong catheter segment in bladder.lumen. E, F After bladder is exposed by midline incision, mucosal and serosal catheter segments are secured by suture. Reproduced with permission from Johnson, D. E., Lockatell, C. V., HalI-Craggs, M. and Warren, J. W. Mouse models of short- and long-term foreign body in the urinary bladder: analogies to the bladder segment of urinary catheters. Lab. Anim. Sci., 41,452.

444

sterile Pharmaseal extension tube (Baxter Heahhcare Corp., Valencia, CA) which is connected to a 1 ml syringe within an infusion pump (Harvard Apparatus, South Natick, MA) for delivery of a 50 btl inoculum over 30 seconds. The polyethylene tubing is withdrawn from the ureter immediately after challenge, and mice are returned to their cages and cared for by the normal routine.

Key parameters to monitor infection Urinary tract infection is documented using quantitative cultures of bladder and kidney homogenates and lightmicroscopic examination of sections of bladder and kidney to assess histologic changes. Non-uropathogens are eliminated from the urinary tract within 2 days of challenge and no histologic changes are observed. Uropathogens persist in the urinary tract for 2 weeks or more and histologic changes are observed in bladder and kidney. The presence of catheter segments in the bladder prolongs persistence of the uropathogens and intensifies histologic changes. Results from urine cultures are not useful for assessing the progression of urinary tract infection. Dissemination of infection outside the urinary tract may be documented by quantitative cultures of blood and/or homogenates of liver and/or spleen. With the exception of studies with P. mirabilis, mortality is not a usual endpoint and mice with kidney counts exceeding 10s cfu/g appear normal.

Antimicrobial therapy The model provides an excellent opportunity to assess the effect of antimicrobial therapy on catheter-associated urinary tract infection. Since pharmacokinetics of antimicrobials in rodents and man differ, results from preliminary kinetic studies may be used to guide dosing schedules in mice to conform with human pharmacokinetics. Oral compounds may be added to mouse drinking water or delivered by intragastric infusion. Subcutaneous, intramuscular, and intravenous dosing routes may also be used.

Key parameters to monitor response to treatment Effective antimicrobial therapy will reduce or prevent (1) microbiological colonization and histologic changes of bladder and kidney, (2) dissemination of the challenge organism out of the urinary tract and (3) mortality (following P mirabilis challenge).

D . E . Johnson and C. V. Lockatell

Pitfalls (advantages/disadvantages) of the model As with all animal models, the goal is to mimic human infection as closely as possible. The challenge dose used to induce urinary tract infection in mice (107-109cfu/mouse) is probably higher than the dose required to induce human infection. However, urinary tract infection in mice is dose-responsive and high challenge doses are used to induce infection in a sufficient number of animals to obtain statistically significant results with a minimum number of animals. Lower doses would result in a lower percentage of animals infected, which may more closely mimic natural human infection but considerably more animals would have to be studied to answer the research question. Constant attention to the challenge volume (50btl or less), the challenge dose delivery time (30 seconds or more) and consistency (use of an infusion pump) will be helpful in avoiding induction of reflux of the challenge dose into the ureters and kidneys during the challenge process. The presence of the catheter segment in the bladder will reduce the dose required to induce urinary tract infection in mice, prolong persistence of the infecting organism in the urinary tract, increase histologic changes, and reduce antimicrobial efficacy. The shortterm model is less time-consuming to establish but has the disadvantage of elimination of catheter segments over time by normal micturition. Securing the catheter segment in the bladder lumen in the long-term model is time-consuming (15 animals per day by an experienced technician), but the segment remains in place for up to 1 year.

Contribution of the model to infectious disease therapy The model is useful in assessing the effect of an indwelling bladder catheter on: 1. microorganism uropathogenicity; 2. efficacy ofantimicrobial therapy; 3. attachment patterns of uropathogens to uroepithelial cells; 4. host response to infection including changes in antibacterial leukocyte function, host inflammatory response and specific antibody responses; 5. in vivo microbial ecology of catheter surfaces and host urinary mucosa; 6. in vivo biocompatable and antimicrobial efficacy of novel catheter formulations.

MOUSE MODEL OF ASCENDING UTI INVOLVING SHORT- AND LONG-TERM INDWELLING CATHETERS

References Cotran, R. S., Thrupp, L. D., Hajj, S. N., Zangwell, D. P., Vivaldi, E., Kass, E. H. (1963). Retrograde E. coli pyelonephritis in the rat: a bacteriologic, pathologic, and fluorescent antibody study.J. Lab. Clin. Meal., 61,987-1004. Daifuku, R., Stamm, W. (1986). Bacterial adherence to bladder uroepithelial cells in catheter-associated urinary tract infection. N. Engl. J. Meal.,314, 1208-1213. Eriksson, S., Zbornik, J., Dahnsio, H. et aL (1986). The combination of pivamoxicillin and pivmecillinam verses pivampicillin alone in the treatment of acute pyelonephritis. Stand. J. Infect. Dis., 18, 431-438. File, T., Tan, J., Salstrom, S. l., Johnson, I. (1985). Timentin verses piperacillin in the therapy of serious urinary tract infections. Am. J. Med., 79, 91-95. Garibaldi, R. A. (1981). Hospital acquired urinary tract infection. In: CRC Handboo k of Hospital Acquired Infections (ed. Wenzel R. P.), pp. 513-537. CRC Press, Boca Raton, FL. Garibaldi, R. A., Brodine, S., Matsumiya, S. (1981). Infections among patients in nursing homes. Policies, prevalence and problems. N. Engl. ]. Med., 305, 731-735. Hagberg, L., Engberg, I., Freter, R., Lam, J., Olling, S., Svanborg Eden, C. (1983). Ascending unobstructed urinary tract infection in mice caused by pyelonephritogenic Escherichia coli of human origin. Infect. Immun., 40, 273-283. Haley, R., Culver, D., White, J. W., Morgan, W. M., Emori, T. G. (1985). The nationwide nosocomial infection rate: a need for vital statistics. Am. J. Epidemiol, 121, 159-167. Haley, R. W., Hooton, T. M., Culver, D. H. et al. (1981). Nosocomial infections in US hospitals, 1975-1976: estimated frequency by selected characteristics of patients. Am. J. Med., 70, 947-959. Hing, E. (1981). Data from the National Survey; No. 51. In: Vital Health Statistics, Series 13. Pub. No. PHS 81-1712. Department of Health and Human Services, Washington, DC. lax Notes (1988). CBA Substrains Maintained at the Jackson Laboratory, No. 432. Jackson Laboratory, Bar Harbor, ME. Johnson, D. E., Lockatell, C. V., Hall-Craggs, M., Mobley, H. L. T., Warren, J. W. (1987). Uropathogenicity in rats and mice of Providencia stuartii from long-term catheterized patients.J. UroL, 138, 632-635.

445

Mobley, H. L. T., Hausinger, R. P. (1989). Microbial ureases: significance, regulation, and molecular characterization. Microbiol. Rev., 53, 85-108. Mobley, H. L. T., Warren, J. W. (1987). Urease-positive bacteriuria and obstruction of long-term urinary catheters. ]. Clin. Microbiol., 25, 2216-2217. Musher, D. M., Griffin, D. P., Yawn, D., Rossen, R. D. (1975). Role of urease in pyelonephritis resulting from urinary tract infection with Proteus. ]. Infect. Dis., 131,177-181. Nickel, J. C., Olson, M., McLean, R. J. C., Grant, S. K., Costerton, J. W. (1987). An ecological study of infected urinary stone genesis in an animal model. Br. J. Urol., 59, 21-30. Rubin, R. H., Tolkoff-Rubin, N. E., Cortan, R. S. (1986). Urinary tract infection, pyelonephritis, and reflux nephropathy. In: The Kidney (eds Brenner, B. H. and Rector, F. C.), pp. 1085-1141. W. B. Saunders, Philadelphia, PA. Satoh, M., Munakata, K., Kitoh, K., Takeuchi, H., Yoshida, O. (1984). A newly designed model for infection-induced bladder stone formation in the rat.]. Urol, 132, 1247-1249. Setia, U., Serventi, I., Lorenz, P. (1984). Bacteremia in a long-term care facility: spectrum and mortality. Arch. Intern. Med., 144, 1633-1635. Staats, J. (1985). Standardized nomenclature for inbred strains of mice, 8th listing. Cancer Res., 45,945-977. Vivaldi, E., Cotran, R., Zangwill, P., Kass, E. H. (1959). Ascending infection as a mechanism in pathogenesis of experimental non-obstructive pyelonephritis. Proc. Soc. Exp. Biol. Med., 102,242-244. Warren, J. W., Platt, R., Thomas, R. J., Rosner, B., Kass, E. H. (1978). Antibiotic irrigation and catheter-associated urinarytract infections. N. Engl. ]. Med., 299, 570-573. Warren, J. W., Tenney, J. H., Hoopes, J. M., Muncie, H. L., Anthony, W. C. (1982). A prospective microbiologic study of bacteriuria in patients with chronic indwelling catheters. J. Infect. Dis., 146, 719-723. Wixson, S. K. (1990). Current trends in rodent anesthesia and analgesia. Surgical Symposium NCAB/AALAS, Uniform Services, University of the Human Sciences, Bethesda, MD, June, 1990. Zimmerli, W., Waldvogel, F. A., Vaudaux, P., Nydegger, U. E. (1982). Pathogenesis of foreign body infection: description and characteristics of an animal model.J. Infect. Dis., 146, 487-497.

This Page Intentionally Left Blank

Chapter 52

Rat Bladder Infection Model Tetsuro Matsumoto

Background Urinary tract infection (UTI) is one of the most common infectious diseases in humans (Kunin, 1994). UTI due to Gram-negative or -positive bacteria is thought to result from bacteria ascending the urethra after colonizing the meatal region or vaginal mucosa. Once in the urinary bladder, these bacteria may pass up the ureters to infect the kidney. Animal models of UTI have been devised using mice, rats, rabbits, pigs, dogs and monkeys (Johnson and Russell, 1997). The majority of animal studies of UTI have been conducted in rats for economic and technical reasons. The effects of vaccination and antibiotic therapy, and bacterial and host factors on the development of UTI have been studied in rat models. For the bladder infection model, routes of challenge have included transurethral and direct inoculation into the bladder. Although Vivaldi et al. (1959) were able to establish ascending infection in normal rats, most investigators have had to employ manipulations to make the rat urinary bladder susceptible to infection. In this chapter, infection models of rat urinary bladder are reviewed and discussed.

or those administered immunosuppressants are used. Food and water are supplied ad libitum.

Details of surgery Overview For bladder infection, rats are inoculated with bacteria through the urethra, using polyethylene tubes or catheters, or by direct inoculation via a suprapubic incision (Johnson and Russell, 1997). Many investigators have created complicated or chronic bladder infection models by inserting artificial materials in the bladder (Miller et aL, 1987).

Materials required Urethral catheter

A polyethylene tube or urethral catheter is necessary for inoculation through the urethral meatus (Fader and Davis, 1980; Balish et aL, 1982; Issa et aL, 1992). Direct inoculation

Animal species Sprague-Dawley (175-350g), Wistar (130-250g) or Dark Agouti (DA) (180-250g) rats or hybrid rats such as DA x AS2 F1, DA • HO F1 aged 6-16 weeks are usually used (Miller, 1983). Sometimes, nude rats are used for a T-celldeficient animal model (Miller and Findon, 1988; Cornish et al. 1987). Although both male and female rats are usually used in direct infection models, female rats are preferable in transurethral inoculation model for technical reasons.

Preparation of animals

The bladder is exposed through a suprapubic incision. A bacterial inoculum is injected into the bladder using a finegauge needle.

Anesthesia Inhalation anesthesia using ether or parenteral anesthesia using pentobarbital or ketamine hydrochloride by intraperitoneal or intramuscular injection have been used.

Surgical and infection procedures Direct inoculation into the bladder

Although no specialized housing or care is required, specific-pathogen-free conditions are preferable when the immunocompromised rats such as T-cell-deficient strains Handbook of Animal Models of Infection ISBN 0-12-775390-7

After the anesthesia, the lower abdomen is shaved and cleaned with povidone-iodine or alchohol. A midline Copyright 9 1999Academic Press All rights of reproduction in any form reserved

T. Matsumoto

448

incision is made to expose the bladder. A fine-gauge hypodermic needle is used to transmurally drain and collapse the bladder and to inoculate a bacterial suspension with or without artificial materials. Transuretkral infection

A polyethylene tube or a ureteral catheter (French no. 3) is inserted into the bladder through the urethral meatus. The bacterial suspension is injected into the bladder via the tube or the catheter.

Manipulation susceptible to infection Urethral occlusion

The urethral meatus is frequently occluded by clamping to cause bacteriuria that persists for 2-4hours after the bacterial inoculation. Investigators have obstructed the urethra by using warm wax, paraffin, a metal clip or a hemostat (Fader and Davis, 1980; Balish et aL, 1982). Bladder massage

Heptinstall and Ramsden (1972) discovered that bladder massage increased vesicoureteral reflux and renal infection in rats. After transurethral challenge with bacteria, the bladder was palpated through the abdominal wall, and was gently squeezed between the fingers while the urethral meatus was compressed to prevent escape of the inoculum. Taylor and Koutsaimanis (1975) also massaged the bladder for 30 seconds after bacterial inoculation into the surgically exposed bladder of male rats and clamping of the penis. Agar beads

Reid et aL (1985) challenged rats with organisms incorporated within agar beads. Urethral obstruction was accomplished by application of a wax seal to the urethral meatus or by clamping the meatus with a hemostat. Bacteria were incorporated into agar beads (20-150 ~m in diameter); a combination of bacterial suspension, molten 2% agar, and peanut oil was vortexed and the mixture was placed in an ice bath. Reid et aL (1985) reported that there were approximately 5 x 103 agar beads in a 0.05 ml inoculum sample containing 5 • 109 bacteria. Polyacrylamide sphere

Riedasch et aL (1981) used polyacrylamide spheres for a chronic cystitis model. Heparin-coated polyacrylamide spheres were inserted under sterile conditions into the bladder by cystostomy. The bladder urine was reported to be infected by transurethral injection of bacteria.

Glass beads

Cotran et aL (1963) described how the insertion of a single glass bead into the bladder both enhanced and prolonged renal infection in rats following retrograde challenge with bacteria. They theorized that the role of the glass bead was to maintain residual urine in the bladder after micturition. Vivaldi et aL (1959) also maintained that insertion of glass beads in rat bladders enhanced renal infection following both retrograde and hematogenous infection. Glass beads may injure the bladder mucosa, making it susceptible to bladder infection, and biofilm may form around the beads following bacterial challenge. Haraoka et aL (1995) used biofilm bacteria adherent to the glass beads to create a model of persistent infection of the bladder. Glass beads, 2 mm diameter, were cultivated with bacteria for 48 hours at 37~ Bacteria multiplied and formed biofilm arround the beads in vitro. The rats were anesthetized and the bladder was exposed through a midline abdominal incision. One of the glass beads coated with biofilm was introduced into the bladder to create a persistent bladder infection, and refluxing pyelonephritis was induced by clamping the urethra. Sponge core

Miller et al. (1988) and Holmang et al. (1993) made a chronic cystitis model using polyurethane sponge. A 4 mm core of sponge was punched from polyurethane foam and sectioned into 2 mm discs. The sponge disc was placed in the lumen of an 18 G needle, which was then pushed through the surgically exposed bladder wall and angled towards the dome. The sponge was expelled from the needle by a blunt trochar and deposited in the dome of the bladder. The needle was withdrawn and the puncture wound was closed with a single suture. The sponge remained in the dome of the bladder and became partially embedded in the bladder wall over the following 2 weeks. Chronic cystitis was then established by the direct inoculation of 100 btl of saline containing bacteria into the surgically exposed bladder. Wire nidus

Davis et aL (1984, 1985, 1987) implanted wire nidus in the bladder dome. Female rats were incised in the fundus of the bladder. A 1.5 mm segment of surgical-steel wire coiled on itself was sutured into the bladder lumen with silk suture. The bladder incision was closed by a purse-string silk suture, which also anchored the stainless-steel wire inside the bladder lumen. Bacteria were inoculated through the external meatus. Bladder diverticulum

Holmang et aL (1993) made a small diverticulum in the bladder to be complicated cystitis model. The bladder was

RAT BLADDER INFECTION MODEL

exposed through a lower midline abdominal incision, punctured with a thin needle (external diameter 0.9 mm) and emptied of its urine. The bacterial suspension was injected into the bladder lumen. The puncture canal was thereafter closed with a cutgut ligature around the needle, which resulted in the development of a small diverticulum. Xylene injection

Hohlbrugger et aL (1985) injected 0.5 ml of xylene into the bladder through the urethra to fix the mucosal surface. The xylene was removed and the bladder was washed out with normal saline 10 minutes after the injection. The bacterial suspension was then inoculated. Water diuresis

The effect of water diuresis on susceptibility to UTI has been controversial. Whereas Mahoney and Persky (1963) demonstrated that, after injection of Proteus vulgar# into the bladder lumen, water diuresis reduced pyelonephritis by 47%, Freedman (1967) reported that, following bladder challenge, water diuresis increased susceptibility to Esckerickia coli bacteriuria 1-million-fold. Diabetic rats

Patients with diabetes mellitus are known to be susceptible to infectious diseases. To produce diabetes in rats, investigators dissolved alloxan monohydrate in sterile distilled water and injected 40 mg/kg body weght in a volume of 0.2 ml into each rat via the lateral tail vein. For glucose determination, 0.5 ml of serum samples were collected by venous puncture or by amputating the tips of the animals' tails 10 days after injecting alloxan (Levison and Pitsakis, 1987).

449

Occasionally, Candida albicans was also used, for a fungal infection model (Levison and Pitsakis, 1987).

Infection process

Mechanisms of adherence to the urinary mucosa by means of pill or fimbriae have been investigated. Michaels et al. (1983) observed that E. coli bacteriuria was reduced when the challenge dose was suspended in D-mannose, possibly because of inhibition of adherence of E. coli to bladder epithelium by mannose-sensitive pill. Keith et al. (1986), using isogenic mutants that either expressed type 1 fimbriae or did not, reported that an inhibition of bacteriuria was observed when the organisms lacked type 1 fimbriae. Fukushi et aL (1979), using electron microscopy to study the interaction between bacteria and the host urinary bladder, noted that the initial attachment of E. coli to the luminal membrane was followed by infolding of the membrane to envelop the organism, destruction of the membrane, apparent killing of the bacteria, desquamation of infected epithelial cells, and prompt regeneration of the desquamated epithelial layers. Bladder mucin appeared to play a protective role against bacterial infection by enmeshing and subsequently removing the infecting organisms from the urinary tract. Establishing of cystitis was associated with disruption of the mucin layer and bacterial adherence to the urothelial folds. Davis et aL (1984) observed that hyperplastic alterations, dysplasia and early lesions consistent with neoplasia occurred in rats with bladder stainless steel wire implants and multiple bacterial injections. Uchida et aL (1989) also reported that the bladder epithelial hyperplasia was induced by instillation of live E. coli into the bladder.

Pathology Postoperative care

Specific postoperative care is unnecessary.

Storage and preparation of inocula

Various bacterial species have been inoculated into the rat bladder. E. coli is the most common bacterial species used in UTI models. Other species of bacteria, such as Klebsiella

Urinary bladders are removed at each time interval after bacterial challenge, and are immediately fixed and dried. The tissues are stained with hematoxylin and eosin, Masson-Goldner, periodic-acid-Schiff or Giemsa stain by using standard techniques for light microscopy. Tissue is also fixed for electron microscopy by immersion into glutaraldehyde 2.5% cacodylate buffer at 4~

pneumoniae, Proteus mirabilis, P. vulgar& Pseudornonas aeruginosa, Serratia marcescens, Salmonella typkimurium, Stapkylococcus aureus and Enterococcus faecalis, have been

Bacterial density

also used. Bacteria were stored deep-frozen and were then cultured on blood agar or other medium for 24 hours before being prepared at a concentration of 109-10]~organisms per ml.

To determine the severity or persistency of infection and to assess antimicrobial treatment, a urine sample for bacterial count should be taken. Quantitative culture of urine samples is carried out. Urine samples are serially

4S0

diluted, small volumes of diluted samples are placed on agar plates and the bacterial colonies are counted after 24 hours.

Antimicrobial therapy and determination of antibiotic penetration into the bladder or urine The antibiotic concentration is usually measured in urine after the parenteral or oral administration of antibiotics by using bioassay or the high-performance liquid column method. Although numerous animal studies have been conducted assessing the in-vivo efficacy of antibiotic therapy for UTI, a few examples will suffice to demonstrate the utility of these models.

T. Matsumoto

Vaccination Elucidation of the pathophysiology of bacterial bladder infection

Uehling and Wolf (1969) demonstrated that the protective effect of parenteral immunization against E. coli cystitis did not correlate with levels of circulating antibody. Vesical immunization was not protective and did not induce circulating antibody. Competitive inhibition of colonization in the bladder

Reid et al. (1985) reported that Lactobacillus casei isolated from the urethra of a healthy woman prevented onset of UTI in 84% of the animals tested, that the lactobacilli appeared to exclude the uropathogens from colonizing the urinary tract within the first 48 hours after challenge, and that the net effect was a complete eradication of bacteria from the uroepithelium.

Pitfalls of the model Either intentionally or unintentionally, retrograde challenge of rats results in reflux of the inoculum from the bladder into the ureter or the kidney. Vesicoureteral reflux, which occurs naturally in rats, can be increased by numerous manipulations of the rat urinary tract. Cotran (1963) reported that reflux routinely occurred with challenge volumes of 0.2 ml and occasionally at lower volumes. Andersen and Jackson (1961), using methylene blue as a tracer, reported that vesicoureteral reflux usually occurred in the range of 0.25-0.3 ml and that a volume of 0.6 ml or more caused reflux in all animals. Fierer et aL (1971) reported that 81% of rats were bacteremic 3 minutes after challenge with 1.0 ml of E. coli suspension. Larsson et aL (1980) did not detect bacteremia in 20 rats at 15-30 minutes after intravesical E. coli challenge at volumes of 0.5 ml but did detect bacteremia with increased challenge volumes. Therefore, rat bladder infection is thought to be accompanied by renal infection when 0.5 ml or more volume is inoculated.

Contribution of the model to infectious disease therapy Profiling of antimicrobial t r e a t m e n t Parenteral or oral antibiotics are usually administered to treat UTI in humans. Bladder infection in rats has been treated experimentally with various types of antibiotic. As penicillins, cephems, aminoglycosides and fluoroquinolone antimicrobials are known to penetrate the urinary tract well, especially in the urine, these agents are suitable for treatment of UTI.

Bladder irrigation Wan et aL (1994) described a rat model of antibiotic instillation. The rat's abdomen was exposed after 1 week of bacterial inoculation and urine was aspirated from the bladder through a needle. A 1 ml of gentamicin sulfate solution (480 mg gentamicin sulfate in 10.9% NaC1) was injected back down the needle into the intact bladder. Venous blood was drawn from the inferior vena cava 30 minutes after intravesical instillation and gentamicin levels were determined using standard assay. Wan et aL reported increased absorption in 43% of the serum samples from infected rat bladders.

Conclusion Rats have usually been used for bladder infection models for economical and technical reasons. Normal rat bladder is not very susceptible to bacterial infection. Various manipulations have been used to make rats more susceptible to infection. These persistent or complicated infection models may be useful for assessing antimicrobials or other preventive treatments in recurrent or severe cystitis in humans. However, ascending pyelonephritis or bacteremia are easily caused by bladder injection of bacterial suspension.

References Andersen, B. R., Jackson, G. G. (1961) Pyelitis, an important factor in the pathogenesis of retrograde pyelonephritis. J. Exp. Med., 114, 375-384.

RAT BLADDER INFECTION MODEL

Balish, M. ]., lensen, l., Uehling, D. T. (1982) Bladder mucin: a scanning electron microscopy study in experimental cystitis. ]. Urol., 128, 1060-1063. Cornish, ]., Vanderwee, M., Miller, T. (1987) Mucus stabilization in the urinary bladder. Br. ]. Exp. Pathol., 68, 369-375. Cotran, R. S. (1963) Retrograde Proteus pyelonephritis in rats. ]. Exp. Med., 117, 813-822. Cotran, R. S., Thrupp, L. D., Hajj, S. N., Zangwill, D. P., Vivaldi, E., Kass, E. H. (1963) Retrograde E. coli pyelonephritis in the rat; a bacteriologic, pathological, and fluorescent antibody study. ]. Lab. Clin. Med., 61,987-1004. Davis, C. P., Cohen, M. S., Anderson, M. D., Gruber, M. B., Warren, M. M. (1985) Urothelial hyperplasia and neoplasia. II Detection of nitrosamines and interferon in chronic urinary tract infections in rats. ]. Urol., 134, 1002-1006. Davis, C. P., Cohen, M. S., Anderson, M. D., Reinarz, ]. A., Warren, M. M. (1987) Total and specific immunoglobulin response to acute and chronic urinary tract infections in a rat model.]. Urol., 138, 1308-1317. Davis, C. P., Cohen, M. S., Gruber, M. B., Anderson, M. D., Warren, M. M. (1984) Urothelial hyperplasia and neoplasia: A response to chronic urinary tract infections in rats.]. Urol., 132, 1025-1031. Fader, R. C., Davis, C. P. (1980) Effect of piliation on Klebsiella pneumoniae infection in rat bladders. Infect. Immun., 30, 554-561. Fierer, l., Talner, L., Braude, A. I. (1971) Bacteriuria in the pathogenesis of retrograde E. coli pyelonephritis in the rat. Am. ]. Pathol., 64, 443-454. Freedman, L. R. (1967) Experimental pyelonephritis. XIII On the ability of water diuresis to induce susceptibility to E. coli bacteriuria in the normal rat. Yale ]. Biol. Med., 39, 255-266. Fukushi, Y., Orikasa, S., Kagayama, M. (1979) An electron microscopic study of the interaction between vesical epithelium and E. coil Invest. Urol., 17, 61-68. Haraoka, M., Matsumoto, T., Takahashi, K., Kubo, S., Tanaka, M., Kumazawa, ]. (1995) Effect of prednisolone on ascending renal infection due to biofilm disease and lower urinary obstruction in rats. Urol. Res., 22,383-387. Heptinstall, R. H., Ramsden, P. W. (1972) Antibody production in urinary tract infections in the rat. Invest. Urol., 9, 426-430. Hohlbrugger, G., Lentsch, P., Pfaller, K., Maderbacher, H. (1985) Permeability characteristics of the rat urinary bladder in experimental cystitis and after overdistension. Urol. Int., 40, 211-216. Holmang, S., Grenabo, L., Hedelin, H., Hugosson, 1., Pettersson, S. (1993) Crystal adherence to rat bladder epithelium after long-term E. coli infection. Scand. ]. Urol. Nephrol., 27, 71-74. Issa, M. M., Shortliffe, L. M. D., Constantinen, C. E. (1992) The effect of bacteriuria on bladder and renal pelvic pressures in the rat. ]. Urol., 148, 559-563.

451

]ohnson, D. E., Russell, R. G. (1997) Animal models of urinary tract infection. In: Urinary Tract Infections (ed. Mobley, H. L. T., Warren, T. W.), pp. 377-403. American Society for Microbiology Press, Washington, DC. Keith, B. R., Maurer, L., Spears, P. A., Orndorff, P. A. (1986) Receptor-binding function of type 1 pili effects bladder colonization by a clinical isolate of Escherichia coli. Infect. Immun., 53,693-696. Kunin, C. M. (1994) Urinary tract infections in females. Clin. Infect. Dis., 18, 1-12. Larsson, P., Kaijser, B., Baltzer, I. M., Olbing, S. (1980) An experimental model for ascending acute pyelonephritis caused by Escherichia coli or Proteus in rats. ]. Clin. Pathol., 33, 408-412. Levison, M. E., Pitsakis, P. G. (1987) Susceptibility to experimental Candida albicans urinary tract infection in the rat. ]. Infect. Dis., 155, 841-846. Mahoney, S. A., Persky, L. (1963) Observations on experimental ascending pyelonephritis in the rat. ]. Urol., 89, 779-783. Michaels, E. K., Chimel, J. S., Plotkin, B. J., Schaffer, A. J. (1983) Effect of D-mannose and D-glucos~ On Escherichia coli bacteriuria in rats. Urol. Res., 11, 97-102. Miller, T. (1983) Genetic factors and host resistance in experimental pyelonephritis. ]. Infect. Dis., 148, 336. Miller, T. E., Findon, G. (1988) Exacerbation of experimental pyelonephritis by cyclosporin A. ]. Med. Microbiol., 26, 245-250. Miller, T. E., Lecamwasam, T. P., Ormrod, D. J., Findon, G., Cornish, J. (1987) An animal model for chronic infection of the unobstructed urinary tract. Br. ]. Exp. Pathol., 68, 575-583. Reid, G., Chan, R. C. Y., Bruce, A. W., Costerton, J. W. (1985) Prevention of urinary tract infection in rats with an indigenous Lactobacillus casei strain. Infect. Immun., 49, 320-324. Riedasch, G., Ritz, S. E., Bersch, W., Mohring, K. (1981) Antibody coating of bacteria in experimental infection of the urinary bladder. Invest. Urol., 18, 247-250. Taylor, P. W., Koutsaimanis, K. G. (1975) Experimental Escherichia coli urinary tract infection in rat. Kidney Int., 8, 233-238. Uchida, K., Samma, S., Rinsho, K., Warren, J. R., Oyasu, R. (1989) Stimulation of epithelial hyperplasia in rat urinary bladder by Escherichia coli cystitis.]. Urol., 142, 1122-1126. Uehling, D. T., Wolf, L. (1969) Enhancement of the bladder defense mechanism by immunization. Invest. Urol., 6, 520-526. Vivaldi, E., Cotran, R., Zangwill, D. P., Kass, E. H. (1959) Ascending infection as a mechanism in pathogenesis of experimental non-obstructive pyelonephritis. Proc. Soc. Exp. Biol. Med., 102,242-244. Wan, J., McGuire, E. J., Kozminski, M. et al. (1994) Intravesical instillation of gentamicin sulfate: in vitro, rat, canine, and human studies. Urology, 43, 531-536.

This Page Intentionally Left Blank

Chapter 53

The Rabbit Model of Catheter-associated Urinary Tract Infection D. W. Morck, M. E. Olson, R. R. Read, A. G. Buret and H. Ceri

Background of the model Catheterization of the urinary bladder is a common procedure in a wide variety of patients (Stamm, 1975), including severely compromised individuals under intensive care. Bacteriuria and catheter-associated urinary tract infections (UTI) are inevitable sequelae in chronically catheterized patients, where the implications in costs and patient wellbeing are enormous (Warren et al., 1981). Microorganisms gain entry into the urinary tract (UT) during the catheterization procedure, through the lumen of the catheter following insertion of the catheter, or periurethrally (Schaeffer, 1986) following catheterization. A variety of approaches have been employed to delay or prevent entry into the UT, including daily care and topical antibiotics at the urethral meatus (Burke et aL, 1981), closed drainage systems (Thornton and Andriole, 1970), antibiotic irrigation of these systems (Warren et aL, 1978), antibacterial agents in the urine bag (Maizels and Schaeffer, 1980), retrograde contamination guards (Khoury et al., 1989), antimicrobial agents impregnated in catheters (Takeuchi et al., 1993) and systemic antibiotics (Warren, 1990). Evaluation of the usefulness of these methods has been challenging. Lack of clear recommendations regarding the use of many of these strategies, including systemic antibiotics, is possibly the result of unequivocal data and conflicting data from clinical studies in which the full extent of the infection can not be assessed. Knowledge of the nature of the adherent bacteria (biofilm bacteria) on the urinary catheter and associated with adjacent tissues (Hessen and Kaye, 1989) and the potentially unique characteristics of these bacteria (Brown et al., 1988; Costerton, 1988; Costerton and Lappin-Scott, 1989) is crucial in dealing with this type of infection. Several early descriptions of catheter-associated urinary tract models are available (Goodpasture et al., 1982; Johnston et al., 1983; Nickel et al., 1985a; Murphy et al., 1986; Virtanen and Andersson, 1986; Glahn et al., 1988; Barsanti et al., 1992); however, in our hands these models are less workable than the rabbit model of catheter-associated urinary tract infection described here. This model of catheter-associated bacteriuria and urinary tract infection has allowed a more complete clinical, gross, microscopic and bacteriological assessment of the use of antibiotic therapy in a system Handboo k of Animal Models of Infection

ISBN 0-12-775390-7

modelling chronic indwelling urinary catheter situations (Olson et aL, 1989; Morck et aL, 1993, 1994). Variations of the model have been used for evaluating other aspects of catheter care (Khoury et al., 1989; Nickel et aL, 1991), but few groups use the infection model, primarily because of its complexity and the firm commitment required to make it function properly.

Animal species Although a variety of rabbit strains could be employed within this model, we have used exclusively healthy, young, male, New Zealand White rabbits. Male rabbits (4.0 kg) are used because of their relatively large urethral size (8-10 French catheters can be used) and the relative ease of catheterizing the male animal. Large rabbits are essential for success; however, they should be young, healthy and free of pasteurellosis, bordetellosis, coccidiosis and other relatively common lapin infections. Animals must be free of other disease, as complicating problems such as latent pasteurellosis are intolerable in such a costly, labour-intensive model. Correct placement of a central venous catheter (described below) is essential for success of the model and delivery of intravenous antibiotics, if required in the study.

Preparation of animals Animals should be purchased from certified suppliers that guarantee size and health status of the male rabbits. Typical quarantine should involve individual or group isolation for 14 days prior to the study and daily examination by a qualified laboratory animal veterinarian. Specialized housing is required following surgical procedures. Following surgery the rabbits are housed in Plexiglass cages, which allow maintenance of the urinary catheter and the intravenous catheter and feeding, but restrict the animal from turning and forcefully exteriorizing the catheters. Of course, all animal handling and experimental procedures must be in accordance with local guidelines and be approved by the Copyright 9 1999Academic Press All rights of reproduction in any form reserved

454

D.W. Morck, M. E. Olson, R. R. Read, A. G. Buret and H. Ceri

Figure 53.1 The specialized housing conditions required for the rabbit model of catheter-associated urinary tract infection. (A) A rabbit housed within the specially designed Plexiglass cage. (B) Eight cages set on a table, as they would be during an experiment involving the rabbit model. (C) The rear of the cages, with catheters and drainage collection bags. (D) Method of hanging collection bags beneath the table.

Aseptic placement of the Foley urinary catheter and aseptic placement of a central venous catheter in the right jugular vein are essential for the success of this model, particularly if one is interested in a controlled bacteriological challenge. General surgical principles such as skill, speed, correct tissue handling technique and strict asepsis are required for the model to proceed smoothly.

9 Sterilized 5 French infant feeding tubes (Medicraft Limited: Cat. 100-515) 9 High quality iris scissors 9 Intravenous drip sets 9 Extension sets (Baxter: Control-A-Flo Regulator with Injection Site 2C7591) 9 5% glucose and electrolytes (Travenol) 9 Urinary drainage sets (Kendall: Mono-flo 30511) 9 Specialized Plexiglass cages (Figures 53.1 and 53.3) 9 Intravenous poles 9 Acepromazine maleate 9 E s c k e r i c k i a coli WE6933 (lactose-negative, streptomycinresistant) 9 Microbiological supplies and laboratory 9 Histology supplies and laboratory 9 Electron microscopy supplies and laboratory

Materials required

Anaesthesia and preparation for surgery

institutional Animal Ethics Committee. The specialized caging, housing system and general setup of the model are illustrated in Figure 53.1.

Details of surgery Overview

9 Halothane gas anaesthesia and surgical supplies Rabbits are placed in a surgical plane of anaesthesia with 9 8 French Foley catheters (Bard Urological: Bardex All - 4 % halothane and oxygen gas (2 1/min) according to stanSilicone Foley CatheterTM--165808) dard procedures. This involves placement of the animal in a 9 Sterile lubricant "cat bag" and using an anaesthetic face mask to deliver the 9 Sterile saline halothane gas. Premedications are not used as the surgery is

THE RABBIT MODEL OF CATHETER-ASSOCIATED URINARY TRACT INFECTION

very quick and delayed recovery is undesirable. Following successful anaesthesia, the hair on the right neck, dorsal cervical region and dorsal thoracic region is clipped using a No. 40 blade. A conventional surgical scrub is performed on the area with povidone-iodine soap (3 • 70% ethanol/ water (vol./vol.; 1 x), and it is painted with povidone-iodine (1 x) in preparation for later placement of the intravenous catheter. The perineal region is draped with a sterile paediatric drape and the penis is manually externalized and painted with povidone-iodine.

455

Surgical p r o c e d u r e

Following preparation of the penis, sterile gloved hands are used to insert an 8-10 French urinary Foley catheter (tip lubricated) through the urethral meatus and urethra into the urinary bladder. Male rabbits have a urethral diverticulum and care must be taken to avoid placing the catheter tip in this diverticulum or causing urethral trauma with multiple attempts at the procedure. Fresh rabbit cadavers should be used to practise the procedure prior to attempting a

Figure 53.2 The correct surgical placement of a jugular intravenous catheter in a rabbit. (A) Making the skin incision in a properly prepared and draped animal. (B) Bluntly dissecting the jugular vein from tissues of the ventral lateral neck. (C) Isolation of the right jugular vein with two mosquito haemostats. (D) Placement of two silk ligatures around the right jugular vein. (E) Following incision of the vein with iris scissors, insertion of the catheter toward the heart. (F) Securing the catheter in place with silk ligatures (one cranial to the incision and the second caudal to the incision).

456

D . W . Morck, M. E. Olson, R. R. Read, A. G. Buret and H. Ceri

catheterization. Performing a urethral dissection on a specimen can aid the surgeon in appreciating the anatomy of the rabbit urethra. Once successfully placed in the bladder the catheter balloon is inflated with 10 ml of sterile saline solution. It is imperative to fill the balloon to this extent to prevent accidental expulsion by the animal following surgery. We have found that Bard catheters provide the best results; less expensive substitute catheters often can not survive 10 ml of balloon inflation and if deflated the catheter is very easily expelled by the conscious animal. A properly placed and properly inflated catheter can be readily palpated within the urinary bladder through the abdominal wall. For the placement of the intravenous catheter a fenestrated paediatric sterile drape is placed over the cervical operative area, and a small (1 cm) incision made in the right lateral cervical region (jugular groove) directly over the right jugular vein. The jugular vein is isolated by blunt dissection and 2 silk sutures (3-0) are placed around the vein. The vein is incised (partially) with iris scissors, and the 5 French infant feeding tube (prefilled with sterile i.v. fluids) is advanced into the vein approximately 2-4cm. Alternatively, commercially available 5-7 French central venous catheters can be used. It is crucial that the tip of the catheter is not located within the heart but is placed anterior to the chambers of the heart. The catheter is then secured in place with the two silk ligatures, one caudal to the venous

Solution bag

i.v. drip set /~

'

z,==~ ._

",--~

,,I_

I~

......

N /- /

.

l

.

.

.

.

.

incision and one cranial to the venous incision. Correct placement of an i.v. catheter is illustrated in Figure 53.2. The remainder of the catheter is tunnelled through the subcutaneous space dorsally and exited through the skin on the dorsal thoracic area of the animal. The catheter is secured to the skin using butterfly wings and 2-0 nylon monofilament suture material and a cutting needle. Excess space on this dorsal exit site can be abrogated using 4-0 polygalactin sutures and a tapered needle. The jugular surgical site is closed with a combination of 4-0 polygalactin suture material and a cutting needle, using a subcuticular pattern and/or tissue adhesive. The catheter is connected to a flow regulator and a standard intravenous drip set and bag. Intravenous glucose (5%) and electrolytes are used at a drip rate of 50-60ml. The rate is adjusted to provide a urinary output of 800-1200ml per 24 hours. The animal is placed in the specialized cage and the intravenous and urinary catheters are fixed in their respective locations at the top side edge and rear floor edge of the cage (Figure 53.3).

Infection p r o c e d u r e

The infection procedure can be conducted in any of several fashions, including allowing normal bacterial species found in and on the rabbit to induce infection in a "natural" fashion, or the more controlled inoculation of "marked" bacteria such as Escherichia coli WE6933. This microorganism is a lactose-negative and streptomycin-resistant bacterium that can be monitored through the daily quantitative culture of collection bag urine and bladder urine on McConkey agar containing streptomycin. The animals can be infected by any of several methods including: (1) a single direct placement of bacteria (108 viable cells) in the catheter drainage tube followed by restricted urinary flow for 15 minutes; (2) direct contamination of the interior of the drainage bag with similar quantities of bacteria; or (3) painting the bacterial inoculum on the urethral meatus (this typically requires daily administration for 2-3 days). Viable bacterial counts (total bacteria and lact-/strep R E. coli) can be monitored during the approximate 72-hour period required for the infection to establish.

/u~

Postoperative care

,,

Tray Urine drainage set

/ 4_ ~.

Figure 53.3 Diagram of the rabbit model of catheter-associated urinary tract infection, outlining the attachments of the intravenous and urinary drainage lines (arrows) and the positioning of the animal within the specialized Plexiglass cage.

The quality of the postoperative care in this animal model, as with most models, can be the difference between success and failure. The rabbit model of catheter-associated UTI is technically very demanding. Constant veterinary support of these animals is essential. Technical staff must monitor the animals 24 hours a day, which makes this model trying and expensive; particularly if the course of the study is chronic. The rabbits require intravenous fluids with glucose, but will feed occasionally and quality certified rabbit chow must be offered. Fluid requirements can be easily met

THE RABBIT MODEL OF CATHETER-ASSOCIATED URINARY TRACT INFECTION

through the intravenous administrations. When animals become agitated due to infection and/or blockage, tranquilization can be used (acepromazine maleate 0.1-1.0mg/kg %8 hour); this can be added to the intravenous fluid to administer the agent slowly and uniformly. The flow rates can be revised and the Foley catheter can be gently aspirated to dislodge debris.

Storage and preparation of inocula Esckerickia coli WE6933 is stored frozen (-85~

on brain-heart infusion slants. New slants are used for each inoculum preparation to avoid excessive subculture. The frozen culture is plated on tryptic soy agar and McConkey-streptomycin (100 btg/ml) agar, to confirm the markers, and is then grown for 14 hours in tryptic soy broth (TSB) at 37~ washed three times in sterile buffered saline (pH 7.2) and suspended in TSB at 1.0 • 109 viable cells per millilitre. All inocula are estimated by McFarland nephelometry and confirmed by quantitative spread plating.

Key parameters to monitor infection and response to treatment Close monitoring of the infection process is central to the success of the model. No single parameter is indicative of the state of the animal; however, the collective impression from all of the following assessments by an individual appreciative of clinical signs in animals can predict impending difficulties with animals and allow appropriate intervention. Maintaining adequate urine flow within the contaminated system is crucial for the animals to survive for the 5-8 days required to measure or establish a response to an antibiotic. Appreciation of normal rabbit behaviour is therefore imperative to determine early urinary blockage in these animals. The central parameters in evaluating response to therapy are those obtained at post-mortem examination of the animals.

Clinical signs Clinical evaluation of animals in this model is a constant procedure. Demeanour and feeding behaviour are monitored continually. Animals are checked every 1-4 hours by technical staff and daily by the laboratory animal veterinarian.

Urine parameters Urine is monitored daily for appearance (cloudiness, clots, clumps, debris), pH, specific gravity, protein content, glu-

457

cose, ketones and occult blood. These parameters, along with behavioural changes in the animals, can be the initial indicators of blockage.

Urine microbiology The daily evaluation of bacterial numbers in drainage bag urine and port urine (bladder urine) samples provide critical information on the state of infection. As illustrated in Figure 53.4, the numbers of viable bacteria rise rapidly (within 24 hours of inoculation) and any antibacterial response can be followed over time quite easily. Both total viable bacteria (cultured on a non-selective medium) and the marked Esckerickia coli (McConkey-streptomycin agar) should be quantified daily to evaluate the success of the inoculation and the involvement of autochthonous bacteria (primarily Gram-positives from the prepuce and skin) in the infection. Effect of antibiotics on the planktonic (freely floating) bacteria in the urine can be assessed in this manner within the model, but it gives no appreciation of the extent of bacterial colonization of the catheter or adjacent tissues.

Gross pathology At the termination of the experiment it is crucial to conduct a necropsy examination that is amenable to microbiological sampling. Since deflating the Foley balloon and pulling the catheter would clearly disturb biofilm structure, we remove the UT from the animal with the catheter in situ to avoid this disruption of biofilm adherent to the catheter and bacteria adherent to associated tissue adjacent to the catheter. This also allows reliable microbiological sampling from several regions within the UT. Following euthanasia with an intravenous overdose of sodium pentabarbital, the animal's ventral abdomen and perineum are clipped, washed, scrubbed, washed with ethanol and painted with povidone-iodine. A ventral midline incision is made and Allis forceps are used to manipulate the opening in the abdominal wall. A urine sample from the bladder is collected aseptically with a syringe and fine needle for quantitative bacteriology, quantification of antibiotic, etc. The kidneys and ureters are bluntly removed and the bladder and urethra are dissected to the pelvis. The pelvis is grasped with gloved hands and broken using a firm twist. The pelvic and perineal urethra, still containing the catheter, is dissected free of the carcass and the UT is placed on a sterile drape for dissection and photography. Sterile instruments (tissue forceps and scissors) are used to longitudinally split the urethra and open the urinary bladder with the catheter still in place. Gross pathology photographs can be taken at this time (Figure 53.5). Samples of urethra are taken for microbiology, histology, and electron microscopy if required.

458

D.W. Morck, M. E. Olson, R. R. Read, A. G. Buret and H. Ceri

Figure 53.4 Graphical representation of the planktonic bacteria in urine within the rabbit model of catheter-associated urinary tract infection. (A) Total viable bacteria in urine obtained from the drainage collection bag from animals on various antibiotic treatments or controls. (B) Viable E. coil WE6933 from urine obtained from the drainage collection bag from animals on various antibiotic treatments or controls. (C) Total viable bacteria in urine obtained from the drainage collection port (i.e., bladder urine) from animals on various antibiotic treatments or controls. (D) Viable E. coli WE6933 in urine obtained from the drainage collection port (i.e., bladder urine) from animals on various antibiotic treatments or controls. Modified from Morck et al., 1994.

Figure 53.5 A photograph of the urinary tract of a rabbit experimentally infected with E. coli WE6933 in the rabbit model of catheter-associated UTI. This urinary tract has been removed from the euthanized animal aseptically and with the Foley catheter still in position within the bladder.

Tissue and catheter microbiology At necropsy examination specimens of the urethral mucosa can be aseptically collected for microbiology. Samples are collected into pre-weighed sterile test tubes containing a

precisely known volume of sterile buffer, homogenized and serially diluted. A spread plate method is used to evaluate total viable bacteria and numbers of viable Escherichia coli WE6933. Plates can be read and counted at 24 hours and the number of bacteria expressed in log~0viable bacteria per weight of tissue. For catheter specimens, the Foley balloon is deflated, a 1.0 cm length of the catheter is collected from the catheter tip (within the bladder) and an identical length of catheter is collected from the urethral region. Example data for tissue and catheters recovered from rabbits infected with Escherichia coli WE6933 and treated with one of several antibiotics are shown in Table 53.1. These data suggest that, despite antibiotic treatment and subsequent elimination of bacteria in urine and on the catheter (as assessed at necropsy), some bacteria can remain viable associated with tissues and act as a focus to reinfect the urinary drainage system.

Microscopic pathology Samples for microscopic assessment for pathological abnormalities can be fixed in a variety of fashions, depending on the need. For standard histopathology we use conventional 10% neutral buffered formalin. However, if visualizing bacteria is essential and microscopic pathology of cells is not to be assessed, Carnoys fixative and methylene blue basic fuchsin staining of JB4 methacrylate (Polysciences) sections

THE RABBIT MODEL OF CATHETER-ASSOCIATED URINARY TRACT INFECTION

459

Table 53.1 Tissue microbiology in the rabbit model of catheter-associated urinary tract infection (mean log10 viable Escherichia coli WE6933 per cm 2 or per gram*); from Morck et al., 1994

Fleroxacin (20 mg/kg)

Ampicillin (10 mg/kg)

Trmp-Sulfa (10 mg/kg)

Gentamicin (2 mg/kg)

Untreated control

10

8

8

8

9

0.00 0.00 0.00 0.00 0.00 0.00

0.00 0.00 0.00 0.00 1.42 1.49

3.81 4.67 4.10 4.09 4.39 4.55

0.00 0.00 0.00 0.00 1.42 1.46

4.57 4.61 4.24 2.73 4.21 3.89

Rabbits (n value) Microbiology sample Urethral catheter exterior Bladder catheter exterior Urethral catheter lumen Bladder catheter lumen Bladder mucosa* Urethra* * From tissues obtained at post mortem.

is ideal. Fresh paraformaldehyde (4%) should be used if tissues are required for immunological labelling of components in the system (i.e. Escherichia coli WE6933). Pathological assessment of the urethra, bladder (several locations), ureters and kidneys can be performed. Histopathology scoring systems can be employed, whereby a histopathologist blinded to the study evaluates the urethra, bladder, ureter and kidney specimens for several pathological abnormalities (Morck et al., 1993, 1994). With studies employing high n values this can be a useful exercise.

Electron microscopy

Scanning electron microscopy (SEM) can be routinely used to evaluate catheters. Catheter pieces (5mm) obtained at post-mortem are placed into 5.0% glutaraldehyde in 0.1 M sodium cacodylate buffer and fixed for 48 hours at 4~ The specimens are very gently washed in three changes of buffer, and very gently dehydrated in graded series of ethanol and freon. Specimens are air-dried from freon and sputter-coated with palladium gold. Photomicrographs generated by SEM of urinary catheter surfaces from this model are shown in Figure 53.6. Blinded scoring systems for biofilm presence and bacterial counts per field of view can be employed for less subjective assessment, if necessary.

Urine antibiotic concentrations

The measurement of peak and trough urine antibiotic concentrations is important to establish the efficacy of an antibiotic or to explain the lack of efficacy of an antibiotic. Depending on the antibiotic in question, bioassays, radiometric methods or chromatographic quantification (as discussed in Section I of this textbook) can be used. Table 53.2 illustrates the peak and trough concentrations of several antibiotics evaluated using the rabbit model of catheter-associated UTI. These data, together with the minimum

Table 53.2 Urine concentrations of antibiotic in the rabbit model of catheter-associated urinary tract i n f e c t i o n values are means (#g/ml); from Morck et al., 1994

Antibiotic

Peak

Trough

Fleroxacin Ampicillin Trimethoprim-Sulfamethoxazole Gentamicin

131 629 361 22

15 103 0 0.4

inhibitory concentration (MIC), minimum bactericidal concentration (MBC) and minimum biofilm eradicating concentration (MBEC; Ceri et aL, 1996a,b,c), provide rationale for efficacy of particular antibiotics within the model. It is clear that if peak and trough concentrations of the antibiotic are not above the MBEC values one could suggest that the antibiotic may not be effective against the bacteria. MBEC may have predictive value in this model and in treatment of biofilm-associated infections (Ceri et al., 1996b).

M i n i m u m biofilm e r a d i c a t i n g c o n c e n t r a t i o n of antibiotics

The MBEC value is a new concept to many infectious disease specialists. It is a measurement of the antibiotic concentrations required to significantly alter an established biofilm composed of bacteria. Classically, MIC and MBC have been used as indicators and predictors of effective antibiotics for specific microorganisms. MBEC provides similar information, but it pertains to bacteria existing adherent to surfaces, not bacteria floating freely in nutrient-rich medium, as in the MIC and MBC assays. MBEC has been determined using modified Robbins devices (MRD; Nickel et aL, 1985b,c; Morck et al., 1994) but this device and method is cumbersome and very slow. We have developed the MBEC assay using the Calgary Biofilm Device (Ceri et aL,

460

D.W. Morck, M. E. Olson, R. R. Read, A. G. Buret and H. Ceri

Figure 53.6 Scanning electron micrographs of urinary catheter surfaces (urethral region) from the rabbit model of catheterassociated urinary tract infection. Catheter surfaces were retrieved post mortem from a control rabbit (A), a rabbit treated with 30 mg/kg fleroxacin (B), a 20 mg/kg rabbit (C), and a rabbit treated with fleroxacin 10 mg/kg (D). Note the thick bacterial biofilm present in A with numerous rod-shaped bacterial cells enveloped in extracellular glycocalyx material. In B and C bare regions of catheter surface predominated. Catheters from rabbits treated with the lowest dosage of fleroxacin (D) had surfaces covered with debris-like material, but few recognizable bacterial cells were evident. Bars equal 5.0 #m. Modified from Morck et aL, 1993.

1996a,b,c; Olson et aL, 1996), which facilitates quick determination of the MBEC. Data generated on Escherichia coli WE6933 for MIC, MBC, MRD-derived MBEC and Calgary-Biofilm-Device-derived MBEC are illustrated in Table 53.3. On the basis of these data one could suggest that the MBEC assay quickly and reliably predicts the success of the fluorinated quinolone fleroxacin in this model of catheter-associated UTI.

Antimicrobial therapy A variety of antimicrobial agents have been evaluated in the model (Olson et aL, 1989; Morck et aL, 1993; Morck et aL, 1994) and several strategies to prevent infection have also been examined (Nickel et aL, 1991; Khoury et aL, 1989).

Pitfalls (advantages/disadvantages) of the model The rabbit model of catheter-associated urinary tract infection is an excellent model for examining antibiotic chemotherapeutics in an acute or chronic indwelling catheterized patient. It provides information regarding the effects of antibiotic therapy on planktonic bacteria floating freely in the urine, but also allows microbiological assessment of the bacteria adherent to the catheter and bacteria adherent to the adjacent tissues at post-mortem examination. The model provides crucial pathological information, as well as pharmacokinetic data and pharmacodynamic properties of an antibiotic in rabbits, if used for such purposes. The model can be difficult to operate, as the animals must be dealt with as if they were intensive care patients. Adequate technical training is essential for success of the

THE RABBIT MODEL OF CATHETER-ASSOCIATED URINARY TRACT INFECTION

model. Careful evaluation of the animals by these animal care technicians and correct decisions as regards seeking advice from the veterinarian can make this model proceed in a smooth fashion. A firm commitment must be made by the investigator, the veterinarian and the technical staff in order to successfully conduct a study using this model. Those wary of extended work days should not embark on such studies.

Contributions of the model to infectious disease therapy Profiling of antibiotic t r e a t m e n t The rabbit model of catheter-associated UTI has been useful in establishing efficacy of several antibiotics (Olson et aL, 1989; Morck et aL, 1994), conducting dose-titration studies (Morck et aL, 1993), and evaluating prototypes of infection prevention methods in closed drainage systems (Khoury et aL, 1989; Nickel et aL, 1991). The data from the model was used as a theoretical basis for human treatments of uncomplicated (Iravani, 1993; Whitby et aL, 1993; Pummer, 1993) and complicated UTI (Pittman et aL, 1993; Childs, 1993; Pummer, 1993; Naber and Sigl, 1993; Cox, 1993; Gelfand et al., 1993). The model has generated specific data suggesting that fleroxacin may be useful for device-related infections of the urinary tract by susceptible bacteria (Morck et aL, 1994) and can be used to assess efficacy of antimicrobial compounds impregnated within urethral catheter materials. The potential for use in evaluating local therapy of the urinary tract, topical treatment of the urethral meatus, mechanisms of inflammation and immunity in catheter-associated urinary tract infection are enormous, but little work has been conducted on the model in these areas.

Confirmation of the i m p o r t a n c e of M B E C One of the major contributions of the rabbit model of catheter-associated UTI has been the use of the model in confirmation of the inherent resistance of biofilm bacteria and tissue-adherent bacteria to certain antibiotics. MIC data in Table 53.3 suggest that any of fleroxacin, ampicillin, trimethoprim-sulfamethoxazole or gentamicin should be useful in treating an infection in rabbits with this E. coll. However, MBEC data, coupled with in vitro studies (Korber et aL, 1993) and pharmacokinetic and pharmacodynamic information, predict that fleroxacin is a superior antibiotic within this model. These data clearly support the difference in antimicrobial susceptibility between planktonic and adherent bacterial populations in vivo and demonstrate the more precise predictability of chemotherapeutic efficacy based on MBEC values determined in vitro. The MBEC concept has led to the more extensive evaluation of antibiotics against adherent populations of bacteria (see Section I), has contributed to the development of assays

461

Table 53.3 Antibiotic sensitivities of Escherichia coli W E 6 9 3 3 - values are #g/ml; modified from Morck et aL, 1994. MIC, minimum inhibitory concentration on planktonic bacteria; MBC, minimum bactericidal concentration on planktonic bacteria; MRD, minimum biofilm eradication concentration from the modified Robbins device (MRD); MBEC, minimum biofilm eradication concentration from the Calgary Biofilm Device)

Antibiotic

MIC

Fleroxacin

Ampicillin

0.16 2.0

Trimethoprimsulfamethoxazole Gentamicin Amdinocillin

1.0 0.5 2.0

MBC 0.32 4.0 >128 1.0 32.0

MRD

MBEC

2.0 2.0 > 16.0* > 1024* >256" >256 a >32.0* 512 > 256* 256

* Experiment not continued therefore exact value not determined.

to evaluate susceptibility of adherent bacteria (Ceri et aL, 1996a,b) and has contributed to the confirmation of the complexity of interactions of bacterial communities (Shapiro, 1991) in a mammalian system.

References Barsanti, J. A., Shotts, E. B., Crowell, W. A., Finco, D. R., Brown, J. (1992) Effect of therapy on susceptibility to urinary tract infection in male cats with indwelling urethral catheters. J. Vet. Int. Med., 6, 64-70. Brown, M. R. W., Allison, D. G., Gilbert., P. (1988) Resistance of bacterial biofill~s to antibiotics: a growth-rate related effect? J. Antimicrob. Chemother., 22,777-780. Burke, J. P., Garibaldi, R. A., Britt, M. R., Jacobson, J. A., Conti, M., Alling, D. W. (1981) Prevention of catheter-associated urinary tract infections: efficacy of daily meatal care regimens. Am. J. Med. 70, 655-658. Ceri, H., Stremick, C., Olson, M. E., Read, R. R., Morck, D. W., Buret, A. G. (1996a) Antibiotic sensitivity of biofilm and planktonic human pathogens utilizing the Calgary Biofilm Device. Poster C19 Session C, Abstracts of the Proceedings of the American Society for Microbiology Conference on Microbial Biofilrns, p. 36. Ceri, H., Stremick, C., Olson, M. E., Read, R. R., Morck, D. W., Buret, A. G. (1996b) Antibiotic sensitivity of important veterinary pathogens: comparing planktonic and biofilm grown bacteria with the Calgary Biofilm Device. Poster C20 Session C, Abstracts of the Proceedings of the American Society for Microbiology Conference on Microbial Biofilms, p. 37. Ceri, H., Kao, J., Stremick, C. et al. (1996c) Biocide sensitivity of important food and water contaminants: comparing planktonic and biofilm grown bacteria with the Calgary Biofilm Device. Poster C21 Session C, Abstracts of the Proceedings of the American Society for Microbiology Conference on Microbial Biofilms, p. 37. Childs, S. (1993) Fleroxacin versus norfloxacin for oral treatment of serious urinary tract infections. Am. J. Med., 94, (Suppl. 3A), 105S-107S.

462

D . W . Morck, M. E. Olson, R. R. Read, A. G. Buret and H. Ceri

Costerton, J. W. (1988) Structure and plasticity at various organizational levels in the bacterial cell. Can. J. Microbiol., 34, 513-521. Costerton, J. W., Lappin-Scott, H. M. (1989) Behaviour of bacteria in biofilms. Am. Soc. MicrobioL News, 55,650-654. Cox, C. E. (1993) Comparison of intravenous fleroxacin with ceftazidime for the treatment of complicated urinary tract infections. Am. J. Med., 94 (Suppl. 3A), 118S-125S. Gelfand, M. S., Simmons, B. P., Craft, R. B., Grogan, J., Amarshi, N. (1993) A sequential study of intravenous and oral fleroxacin in the treatment of complicated urinary tract infection. Am. J. Med., 94 (Suppl. 3A), 126S-130S. Glahn, B. E., Braendstrup, O., Olseen, H. P. (1988) Influence of drainage conditions on mucosal bladder damage by indwelling catheters. II. Histological study. Scand. J. UroL NephroL, 22, 93-99. Goodpasture, J. C., Cianci, 1., Zaneveld, L. 1. (1982) Long-term evaluation of the effect of catheter materials on urethral tissue in dogs. Lab. Anita. Sci., 32, 180-182. Hessen, M. T., Kaye, D. (1989) Infections associated with foreign bodies in the urinary tract. In: Infections Associated with Indwelling Medical Devices (eds Bisno, A. L. and Waldvogel, F. A.), pp. 199-213. American Society for Microbiology, Washington, DC. Iravani, A. (1993) Multicenter study of single-dose and multipledose fleroxacin versus ciprofloxacin in the treatment of uncomplicated urinary tract infections. Am. J. Med., 94 (Suppl. 3A), 89S-96S. Johnston, G. R., Stevens, J. B., Jessen, C. R., Osborne, C. A. (1983) Effects of prolonged distention of retention catheters on the urethra of dogs and cats. Am. J. Vet. Res., 44, 223-228. Korber, D. R., James, G. A., Costerton, J. W. (1993) Early detection of fleroxacin incorporation and efficacy within Pseudomonasfluorescens biofilms using confocal scanning laser microscopy. Abstract P 108, Canadian Society of Microbiologists Annual Meeting. Khoury, A. E., Olson, M. E., Lam, K., Nickel, J. C., Costerton, J. w . (1989) Evaluation of the retrograde contamination guard in a bacteriologically challenged rabbit model. Br. J. UroL, 63, 384-388. Maizels, M., Schaeffer, A. J. (1980) Decreased incidence ofbacteriuria associated with periodic instillations of hydrogen peroxide into the urethral catheter drainage bag.J. UroL, 123, 841-845. Morck, D. W., Olson, M. E., McKay, S. G. et aL (1993) Therapeutic efficacy of fleroxacin for eliminating catheterassociated urinary tract infection in a rabbit model. Am. J. Med., 94(Suppl 3A), 235-305. Morck, D. W., Lam, K., McKay, S. G. et aL (1994) Comparative evaluation of fleroxacin, ampicillin, trimethoprim-sulfamethoxazole, and gentamicin as treatments of catheterassociated urinary tract infection in a rabbit model. In. J. antimicrob. Agents, 4(Suppl. 2), $21-$27. Murphy, W. M., Blatnik, A. F., Shelton, T. B., Soloway, M. S. (1986) Carcinogenesis in mammalian urothelium: changes induced by non-carcinogenic substances and chronic indwelling catheters. J. UroL, 135, 840-844. Naber, K. G., Sigl, G. (1993) Fleroxacin versus ofloxacin in patients with complicated urinary tract infection: a controlled clinical study. Am. J. Med., 94 (Suppl. 3A), 114S-117S. Nickel, J. C., Grant, S. K., Costerton, J. W. (1985a) Catheterassociated bacteriuria: an experimental study. Invest. UroL, 26, 369-375.

Nickel, I. C., Wright, J. B., Ruseska, I., Marrie, T. l., Costerton, J. W. (1985b) Antibiotic resistance of Pseudomonasaeruginosa colonizing a urinary catheter in vitro. Eur. J. Clin. Microbiol, 4, 213-218. Nickel, J. C., Ruseska, I., Wright, I. B., Costerton, J. W. (1985c) Tobramycin resistance of Pseudomonas aeruginosa cells growing as a biofilm on urinary catheter material. Antimicrob. Agents Chemother., 27, 619-624. Nickel, J. C., Grant, S. K., Lam, K., Olson, M. E., Costerton, J. W. (1991) Bacteriologically stressed animal model of new closed catheter drainage system with microbicidal outlet tube. Invest. Urol., 38, 280-289. Olson, M. E., Nickel, J. C., Khoury, A. E., Morck, D. W., Cleeland, R., Costerton, J. W. (1989) Amdinocillin treatment of catheter-associated bacteriuria in rabbits. J. Infect. Dis., 159, 1065-1072. Olson, M. E., Ceri, H., Morck, D. W., Read, R. R., Buret, A. G. (1996) The Calgary Biofilm Device: a device for the determination of biofilm sensitivity to antibiotics and biocides. Poster C74 Session C, Abstracts of the Proceedings of the American Society for Microbiology Conference on Microbial Biofilms, p. 39. Pittman, W., Moon, J. O., Hamrick, L. C., Jr et al. (1993) Randomized double-blind trial of high- and low-dose fleroxacin versus norfloxacin for complicated urinary tract infection. Am. J. Med., 94 (Suppl. 3A), 101S-104S. Pummer, K. (1993) Fleroxacin versus norfloxacin in the treatment of urinary tract infections: a multicenter, double-blind, prospective, randomized, comparative study. Am. J. Med., 94 (Suppl. 3A), 108S-113S. Schaeffer, A. J. (1986) Catheter associated bacteriuria. Urol. Clin. North Am., 13, 735-747. Shapiro, J. A. (1991) Muiticellular behavior of bacteria. Am. Soc. Microbiol. News, 57, 247-253. Stature, W. E. (1975) Guidelines for the prevention of catheterassociated urinary tract infections. Ann. Intern. Med., 82, 386-390. Takeuchi, H., Hida, S., Yoshida, O., Ueda, T. (1993)Clinical study on the efficacy of a Foley catheter coated with silverprotein in prevention of urinary tract infections. Hinyokika Acta Urol. Jpn., 39, 293-298. Thornton, G. F., Andriole, V. T. (1970) Bacteriuria during indwelling catheter drainage: II. Effect of a closed sterile drainage system.J.A.M.A., 214, 339-342. Virtanen, T. M., Andersson, L. C. (1986) Toxic catheters and diminished urethral blood circulation in the induction of urethral strictures. Eur. Urol., 12, 340-345. Warren, J. W., Platt, R., Thomas, R. J., Rosner, B., Kass, E. H. (1978) Antibiotic irrigation and catheter-associated urinarytract infections. N. Engl. J. Med., 299, 570-573. Warren, J. W., Muncie, H. L. Jr, Bergquist, E. J., Hoopes, J. M. (1981) Sequelae and management of urinary infection in the patient requiring chronic catheterization. J. Urol., 125, 1-8. Warren, J. W. (1990) Nosocomial urinary tract infections. In: Principles and Practice of Infectious Diseases (eds Mandell, G. L., Douglass, R. G., Bennett, J. E.), pp. 2205-2215. Churchill Livingstone, Edinburgh. Whitby, M., Brown, P., Silagy, C., Champak, R. (1993) Comparison of fleroxacin and amoxicillin in the treatment of uncomplicated urinary tract infections in women. Am. J. Med., 94 (Suppl. 3A), 97S-100S.

Chapter 54

Subclinical Pyelonephritis in the Rat G. Findon

Background of model Studies of patients with significant bacteriuria, who have undergone ureteric catheterization or bladder washout tests, have shown that in 30-60% of cases the infection originates in the upper urinary tract (Fairley etaL, 1971; BoutrosetaL, 1972; Eykyn et aL, 1972; Harding et aL, 1978; Busch and Huland, 1984). The same studies have demonstrated a poor correlation between upper urinary tract localization and appropriate clinical symptoms. One explanation is that microorganisms may be present in the kidney but not initiate an inflammatory response with associated symptoms. We have developed a rat model of pyelonephritis which distinguishes between lesioninducing and non-lesion-inducing infection and mimics the above situation. In the model, infection is induced in the left kidney and the non-manipulated contralateral kidney acquires a persistent microbial flora within 48 hours of the initial challenge. The bacterial invasion of the contralateral kidney is not associated with gross or histological changes within the renal parenchyma, but minor foci of inflammation are present beneath the epithelium lining the calyces. This model supports the concept of subclinical pyelonephritis and may explain the absence of symptoms in the clinically equivalent situation in humans.

special care or treatment is required either pre- or postsurgery.

Details of surgery Overview Briefly, acute pyelonephritis is induced in the left kidney of HO rats. In this strain of rats, subclinical pyelonephritis develops in the contralateral non-manipulated kidney. The animals are left for various periods after infection before autopsy and analysis of both kidneys.

Materials required Anaesthetic, hair clippers, skin disinfectant (95% ethanol), scalpel blade, scissors, forceps, sutures, glass microcapillary pipette and syringe capable of delivering 5 ~1 samples.

Anaesthesia

Animal species Adult male or female Hooded Oxford (HO) rats, 3-4 months old and weighing 200-250 g, were used to develop this model. In our experience, the HO strain readily acquires a subclinical infection in the contralateral kidney. Other strains, such as Dark Agouti, do not. Before using a specific rat strain, it would be advisable to carry out pilot experiments to assess the ability of the strain to develop subclinical pyelonephritis.

Preparation of animals Animals are housed in polycarbonate cages on untreated wood shavings and fed Diet 86 and water ad libitum. No Handbook of Animal Models of Infection ISBN 0-12-775390-7

Nembutal (pentobarbitone sodium, Techvet Laboratories, Auckland, NZ) was used as the anaesthetic for inducing the infection, but any other short-acting anaesthetic would be suitable.

Surgical procedure and induction of infection After flooding the shaved skin with alcohol, a flank incision is made on the left side of the rat, just below the rib cage, through both the skin and muscle layer. The kidney is externalized by gently pulling on the renal fat pad and 5 ~1 of the inoculum is injected into each pole of the left kidney using an SMI Micro/Pettor and a glass microcapillary, pulled to a fine point. The total inoculum contains 106 viable Escherichia coli 075. Copyright 9 1999 Academic Press All rights of reproduction in any form reserved

464

G. Findon

Wound closure

8-

The wound in the muscle layer and the skin is closed with a running suture.

7-

(a)

....

6-

9 9

000

00

5-'.

Postoperative care

(b)

9

00

00

00

000

9

00 00

9

00

000

000 00

01

00 9

4.,..,

No special postoperative care is required. Animals recover from the surgery and resume normal activities within a few hours. The animals are housed in groups of four to six animals per cage, depending on size.

3r-

"o ,I

2-

0

E

90%

Nakamura et aL, 1991

Rabbit Rabbit Rat Mouse Streptococci

Rabbit Rat Mouse

Animal species Several strains of mouse and rat have been used in this model. Mice: MRL l pr/lpr, NZW, NZB, NZB/W, NZB/W/B, DBA/I, BALB/c, C3H/Hej, C3H/HeN, C57BL/6 and Swiss (NMRI) mice. Different inbred strains can also be used (Zhao et aL, 1995a,b; Zhao and Tarkowski, 1995; Abdelnour et aL, 1997). Since Swiss mice displayed the highest occurrence of arthritis, when compared to the other mouse strains (Bremell et aL, 1991) this mouse strain has been often used.

Rigdon, 1942 Lewis and Cluff, 1965 Bremell et aL, 1994a Bremell et aL, 1991

Friedlander et aL , 1951

Rats: Sprague-Dawley rats have mostly been used (Bremell et al., 1994a; Bremell and Tarkowski, 1995). Presumably, any mouse or rat strain could be used but preliminary experiments should be performed to determine the optimal bacterial inoculum to ensure an adequate rate of infection. Sex and sex hormones did not affect the incidence or clinical course of S. aureus-induced septic arthritis (Abdelnour, 1994). The age of the animals did not seem to affect the prevalence and course of arthritis. However, in general, at the start of experiments we used 4-6-week-old mice and 6-9-week-old rats.

Preparation of animals No specialized animal housing or specific pretreatment are required when testing different bacterial virulence factors. However, when examining host factors of importance for the infection process, specialized housing and care (Wiedermann et aL, 1996) or specific pretreatment (Bremell et aL, 1994, and others) is required.

Details of bacterial inoculation Figure 64.1 Photograph of a Swiss (NMRI) mouse showing arthritis of the right wrist 28 days after i.v. injection with 1• S. aureus LS-I. Note the non-arthritic left wrist! Reproduced with permission from Bremell et aL (1991). Experimental Staphylococcus aureus arthritis in mice. Infect. Immun., 59, Figure 3.

Briefly, the mice are inoculated with bacteria in the tail vein without any need for anaesthesia. During this procedure they are held in a mini-cage with the tail outside the cage. Blood samples during the experiments are obtained from the tail vein or orbital vein under light ether inhalation or barbitural anaesthesia, or at sacrifice from the aortic branch.

EXPERIMENTAL MODELS OF INFECTIOUS ARTHRITIS

Rats are injected in the tail vein under anaesthesia (light ether inhalation or mebumal 60 mg/kg i.p.). Blood samples are obtained under anaesthesia from the tail vein or by cutting the distal end of the tail. Bacterial samples from joints are obtained at sacrifice after skin disinfection and surgical incision with a pair of scissors or a scalpel. The samples are obtained using charcoal sticks and isolated on horse blood agar plates for 48 hours. The bacterial samples are easily obtained from the talocrural and ankle joints on one side, while the limbs from the contralateral side may be used for histopathology or immunohistochemistry (see below).

541

1991) or 1 ml of S. aureus suspension in the tail vein of the rat (Bremell et al., 1994a). Intraperitoneal (i.p.) administration does not cause arthritis or osteitis at all, whereas subcutaneous (s.c.) injections give rise to arthritis in only a small proportion of the mice. Chequer-board titration showed that the optimal i.v. dose of S. aureus LS-1 was found to be 1 • 107 cfu/mouse. Lower doses failed to induce arthritis, whereas higher doses increased death rates. Other S. aureus strains may display different virulence and accordingly require different doses (Bremell et aL, 1991). In rats, i.v. doses exceeding 1 x 109 cfu/rat of S. aureus AB-1 induce high mortality rates. Doses below l xl08cfu/rat do not readily induce clinical arthritis (Bremell et aL, 1994a,b).

Storage and preparation of inocula The model has been used for studying host and bacterial virulence factors in S. aureus arthritis, but it is amenable to using different species of bacteria. We have normally used S. aureus strains LS-1 and AB-1 (Bremell et aL, 1991, 1994a). Other strains may also be used (Patti et aL, 1994; Nilsson et al., 1996). Using this model, we have not found an S. aureus strain unable to induce arthritis. However, the frequency and severity of arthritis depends on different properties of S. aureus strains as well as host factors. S. aureus strains may be characterized with regard to reactivity to catalase and coagulase, type of capsular polysaccharide (Karakawa et aL, 1985), phage type (Williams and Rippon, 1952; Parker, 1983), binding ability to extracellular matrix proteins (Patti et aL, 1994; Abdelnour et aL, 1993), toxin production, and pattern of antibiotic resistance (Bremell et aL, 1991, 1994a). The bacterial dose normally used is 1-2x 107cfu per mouse and 1 • 109 cfu per rat. The bacterium is stored in deep agar tubes, cultured on blood agar for 24 hours, reincubated on blood agar for another 24 hours and then kept frozen a t - 2 0 ~ in PBS containing 5% bovine serum albumin and 10% dimethylsulphoxide (DMSO) until use (Bremell et al., 1994a). The storage of S. aureus a t - 2 0 ~ does not affect the viability or virulence of the bacteria (unpublished results). Culturing on solid agar is superior to culturing in broth with regard to expression of bacterial cell wall proteins (Cheung and Fischetti, 1988) and capsular polysaccharides (Lee et al., 1993) important bacterial virulence factors. The frozen bacterial solution is thawed and washed in PBS. Viable counts are used to check the number of bacteria in each administered bacterial solution.

Infection process Infection is initiated by an intravenous (i.v.) injection of 0.2ml of an S. aureus suspension in PBS (phosphatebuffered saline) in the tail vein of the mouse (Bremell et aL,

Key parameters to monitor response to treatment Clinical evaluation

Mice and rats are labelled and monitored individually. Limbs are inspected visually at regular intervals, preferably by two blinded observers. Arthritis is defined as visible joint swelling or erythema of at least one joint. The overall condition was evaluated by assessment of weight, general appearance, alertness, and skin abnormalities. A clinical evaluation of arthritis was carried out using a system in which macroscopic evaluation of arthritis yields a score of 0-3 for each limb (0, normal appearance; 1, mild swelling and/or erythema; 2 moderate swelling and erythema; 3, marked swelling and erythema). An arthritic index was constructed for each animal by adding the scores from all four limbs for each animal. The arthritic index makes it possible to judge not only the prevalence but also the intensity of arthritis. The animals are examined daily during the first 3 days after inoculation and thereafter one to three times per week (Figure 64.2).

Histopathological examination

The histopathological processing includes routine fixation, decalcification, paraffin embedding, cutting and staining with haematoxylin and eosin. Tissue sections from upper extremities (elbow, wrist, carpal bones, fingers and occasionally shoulder) and lower extremities (knee, ankle, tarsal bones, and toes) are prepared. A segment of the tail may also permit the study of osteomyelitic lesions (Bremell et al., 1992). The joints are evaluated by a blinded observer with regard to synovial hypertrophy (defined as a synovial membrane thickness of more than two cell layers (Goldenberg and Cohen, 1978)), pannus formation (synovial tissue overlying joint cartilage), and cartilage and subchondral bone destruction (Figure 64.4). In addition,

542

Figure 64.2 Prevalence of arthritis at sacrifice after a single i.v. injection of 1 x l07 S. aureus LS-I. Histopathological and clinical observations parallel each other, the former being more sensitive. Peak of arthritis is seen within 15-22 days. Reproduced with permission from Bremell et aL (1992). Histopathological and serological progression of experimental Staphylococcus aureus arthritis. Infect. Immun., 60, Figure 1.

infiltration of inflammatory cells to the extra-articular space and types of invading cell can be evaluated (Figures 64.3 and 64.4).

Immunohistochemistry After sacrifice, limbs are removed and demineralized by EDTA-treatment (Jonsson et aL, 1986). The demineralized specimens are mounted on cryostat chucks, frozen in isopentane prechilled by liquid nitrogen, and kept at-70~ until cryosectioned. Sections 6 ~m thick are cut sagittally, fixed in cold acetone for 5 minutes and washed in PBS. The sections are incubated overnight in a humid atmosphere at 4~ with 50 ~1 portions of unlabelled mouse monoclonal antibodies or rat monoclonal antibodies diluted in PBS-BSA (1%). Biotin-labelled rabbit anti-Ig diluted in PBS-BSA is used as a secondary antibody. Depletion of endogenous peroxidase is performed with 0.3% H202 for 5 minutes. Binding of secondary antibodies is detected by stepwise incubation with avidin-biotin-peroxidase

T. Bremell

Figure 64.3 This picture gives an image of the local interactions between the host and the bacterium. Micrograph of an arthritic ankle in a male, 5-month-old Sprague-Dawley rat spontaneously infected with S. aureus AB-I. The bacterium displays strong binding to collagen type I1. The bacterial particles (arrowheads) adhere to the joint cartilage (C). Inflammatory cells, mainly polymorphonuclear cells (arrows) engulf the bacteria. 9Represents the joint cavity. Magnification x320. Reproduced with permission from Bremell et aL (1994a). Immunopathological features of rat Staphylococcus aureus arthritis. Infect. Immun., 62, Figure 1.

complexes (ABC; Hsu et aL, 1981) and a buffer containing 3-amino-9-ethyl-carbazole and H202 (Kaplow, 1975). All sections are counterstained with Mayer's haematoxylin. The proportion of a given cell type may be expressed as the percentage of stained cells in relation to all nucleated cells within a defined area of tissue.

Bacteriologic evaluation After sacrifice the talocrural and radiocarpal joints are aseptically dissected. In the rat the knee and elbow joints may also be used for bacterial examination. Bacterial samples from other organs such as the liver, spleen, kidneys, heart, and lungs as well as blood samples from the heart cavity are also easily accessible. Bacterial samples from the joints are obtained using charcoal sticks. The samples are transferred to agar containing 5% human blood and incubated for

EXPERIMENTAL MODELS OF INFECTIOUS ARTHRITIS

48 hours at 37~ The colony appearance is monitored and bacterial colonies are tested for catalase and coagulase activity. To avoid false-positive results due to contamination, a joint or blood sample was considered positive if more than 20 colonies of S.aureus were present (Bremell et aL, 1991). The bacteriologic examination performed as described above may underestimate bacterial growth because the method employed lacks a high degree of sensitivity and precision. However, empirical experience demonstrated that there was a good correlation (iv < 0.001) between clinical signs of arthritis and bacterial growth in affected joints in a given animal population. In order to obtain more precise results, cultures of whole homogenized organs would have been preferred. This has been performed with parenchymatous organs like heart, lung, kidney and liver. These organs are aseptically removed and homogenized for 20 minutes in a Colworth Stomacher 80 homogenizer (A.J. Seward, London, UK) in a tissue homgenizer with 10ml of PBS. Appropriate dilutions were made and 0.1 ml of tissue suspension was plated on agar plates containing 5% horse blood. After incubation for 48 hours, colonies were counted and the results were expressed as the number of cfu per organ. Bacterial binding to radiolabelled proteins, such as bone sialoprotein, collagen type II, fibronectin, vitronectin, fibrinogen, trombospondin and others, may be performed (Holderbaum et al., 1985; Ryden et al., 1989; Switalski et al., 1993; Figure 64.4). The production of staphylococcal enterotoxin A, B, C, D, and TSST-1 can be tested using an RPLA diagnostic kit (Oxoid, Basingstoke, UK).

543

Evaluation of host response In order to assess causative as well as protective mechanisms in response to the bacterial infection there is a need for careful analysis of the immunological and inflammatory pattern in the diseased subjects. A good marker of the degree of inflammation is measurement of serum IL-6 levels using the B9 bioassay (Lansdorp et aL, 1986; Aarden et aL, 1987; Brakenhoffet aL, 1987; Helle et aL, 1988). Also, serum immunoglobulin levels, measured by, for instance, the radial immunodiffusion technique (Mancini et al., 1965), will significantly increase during the S. aureus infection (Bremell et aL, 1992). The serum humoral immune response to the septicaemia and S. aureus arthritis can be monitored by measuring rheumatoid factors by diffusion-in-gel ELISA (DIGELISA) (Elwing and Nygren, 1979) as previously described (Tarkowski et aL, 1984) and anti-ssDNA antibodies by ELISA-technique (Carlsten et aL, 1990). In order to test the specific humoral immune response to the whole bacterium we have used an ELISA procedure in which wells were precoated with poly-L-lysine followed by incubation with 100 btl of 10Vml of whole, formalin-treated (4%, 20 minutes) S. aureus LS-1 cells as an antigen. Serum levels of IgG antibodies to TSST-1 were estimated by ELISA procedure using 0.Sbtg/ml of highly purified TSST-1 (Toxin Technology, Sarasota, FL) as a solid-phase coating. Analyses of white blood cells, platelets and differential counts are performed in a Sysmex analyser (K-1000, Toa Medical Electronics, Japan). Differential counts are also performed on Giemsa-stained smears. In-vivo cell mediated inflammatory responses may be measured.

(a) Induction and registration of delayed-type hypersensitivity (DTH) Rats are sensitized by epicutaneous application of 450 ~1 of a mixture of absolute ethanol and acetone (3: 1) containing 15% 4-ethoxymethylene-2-phenyloxazolone (OXA; BDH Chemicals, Poole, UK) on the shaved abdomen skin. Eleven days after sensitization all rats are challenged by topical application of 40 ~1 10% OXA dissolved in olive oil on both sides of the left ear. The right ear is exposed to olive oil only (Carlsten et al., 1986). Figure 64.4 Micrograph showing an arthritic ankle joint in a male, 6-9-week-old Sprague-Dawley rat, sacrificed 11 days after bacterial inoculation. There is synovial hypertrophy (S), pannus formation (P), bone erosion (BE) at the cartilage-synovial junction and infiltration of PMNCs and MNCs. Magnification x64. Reproduced with permission from Bremell et al. (1994a). Immunopathological features of rat Staphylococcus aureus arthritis. Infect. Immun., 62, Figure 5A.

(b) Induction and registration of T-cell-independent inflammation

T-cell-independent inflammation is induced by intradermal injection of 100 ~1 olive oil (Apoteksbolaget AB, Gothenburg, Sweden) in the left hind footpad as previously described (Josefsson et aL, 1993). The same volume of PBS is administered to the right hind footpad.

544

M e a s u r e m e n t : The thickness of ears and footpads is measured before and 24 hours after challenge using an Oditest spring caliper (Kr6plin, Hessen, Germany) as previously described (Carlsten et al., 1986). All challenges and measurements were performed under light-ether anaesthesia. The intensity of the reactions is expressed as increase of thickness times 10-3 cm. In D T H responses, antigen-sensitized CD4 + T cells extravasate at the site of antigen challenge, where they recruit a variety of other cell types, notably macrophages, with the subsequent release of inflammatory mediators and the development of oedema. The T-cell-independent inflammation is primarily a test of PMNC migration and extravasation as shown by histopathological examination of footpad swelling 24 hours after s.c. administration of olive-oil-induced inflammation. I n - v i v o depletion of T cells does not affect the magnitude of the inflammatory response to olive oil (Josefsson et al., 1992).

Therapy and immunization procedures Experimental treatment of S. aureus arthritis with cloxacillin, cloxacillin+glucocorticoids and glucocorticoids alone favours the combined use of systemic corticosteroid administration along with antibiotic therapy with regard to the course and outcome of S. aureus arthritis (Sakiniene et al., 1996). The results imply that the inflammatory response actively contributes to the joint deterioration in S. aureus arthritis. In this respect, the current use of corticosteroids to diminish sequelae in the treatment of bacterial meningitis should be mentioned (S~iez-Llorens et al., 1990). Different forms of anti-T-cell therapy, i.e. treatment with monoclonal antibodies to CD4 and the TCR, seem to reduce arthritis and mortality in severe S. aureus infection (Abdelnour et aL, 1994a,c; Bremell et aL, 1994a). Immunization with genetically modified enterotoxins, devoid of superantigen effects (Nilsson, personal communication), or with a recombinant fragment of collagen adhesin (Nilsson et aL, 1998), may have protective properties and it is possible to test this using the animal model.

Pitfalls (advantages/disadvantages) of the model The i.v. administration ofS. aureus is in accordance with the most common transmission of human S. aureus arthritis and permits the study of important virulence mechanisms of S. aureus such as factors influencing bacterial survival in the blood stream before the bacteria reach the joint and factors influencing bacterial ability to penetrate endothelium, synovium and bone and to interact with these tissues. Therapeutic approaches, e.g. antimicrobial medica-

T. Bremell

tion, vaccination and treatment with factors influencing the immune system, are easily performed. We have used treatment with monoclonal antibodies to CD4, CD8 and different V~ regions of the TCR (Abdelnour et al., 1994a,c), to the TCR (Bremell et al., 1994a) and to CD43 (Bremell et al., 1994b). Moreover, therapy with monoclonal antibodies to ICAM-1 (Verdrengh et al., 1996) and cytokines (Zhao and Tarkowski, 1995) has been used. Also, inbred animals, e.g. B-cell-deficient xid-mice (Zhao et al., 1995a) and MHCclass-II-deficient mice have been used (Abdelnour et al., 1997). All these studies increase our knowledge of host responses to S. aureus infection. As possible drawbacks of this model, as with all animal models, one may mention the small but obvious immunological discrepancies between mouse and man and some uncertainty as to whether the doses of bacteria used in rodents are equivalent to the bacterial load in human S. aureus arthritis.

Contributions of the model to infectious disease therapy Antimicrobial treatment Experimental treatment of S. aureus arthritis with antibiotics alone or in combination with different immunemodulating agents is readily performed using this model. The model offers a human-like disease where it is possible to follow the infection and the subsequent therapeutic measures from the start. Also, alternative antimicrobial therapies aiming at the neutralization of bacterial virulence factors such as the capsular polysaccharide and different adhesion molecules of the bacterial cell wall, as well as antitoxin therapies, may be tried.

Immune therapy and elucidation of the pathophysiology of S. a u r e u s arthritis This model has been used extensively for studies of host responses to the invading pathogen. It has been shown that vitamin A deficiency predisposes to S. aureus arthritis (Wiedermann et aL, 1996). The participation of T lymphocytes in the arthritic process is indicated by their appearance in the diseased synovium and by the milder course of arthritis following T-cell-targeted interventions (Abdelnour et aL, 1994a; Bremell et aL, 1994a). B cells also contribute to the pathogenesis of septic arthritis (Zhao et aL, 1995a), probably by efficient superantigen presentation. Sialophorin (CD43)-expressing cells (Bremell et aL, 1994b), complement (Sakiniene et aL, 1999) and neutrophils (Verdrengh and Tarkowski, 1997) play a protective role in early S. aureus infection. MHC class II expression seems to be necessary for the development of S. aureus arthritis.

EXPERIMENTAL MODELS OF INFECTIOUS ARTHRITIS

Moreover, different MHC class II haplotypes confer varying susceptibility to joint inflammation induced by staphylococci (Abdelnour et al., 1997). Bacterial virulence determinants include exotoxins, enzymes and different cell-wall-associated proteins. Genes that code for the expression of exoproteins and cell-wall proteins are controlled by different regulatory loci such as agr (accessory gene regulator) and sar (staphylococcus accessory regulator). These loci are important virulence determinants in the induction and progression of septic arthritis (Abdelnour et aL, 1993; Nilsson et al., 1996). There is a preferential induction of septic arthritis and mortality by superantigen-producing staphylococci (Bremell et aL, 1995). Toxic shock syndrome toxin 1 (TSST-1) contributes to the arthritogenicity of S. aureus (Abdelnour et aL, 1994b). Importantly, genetically modified enterotoxins, devoid of superantigen effects, protect against S. aureus arthritis (Nilsson et al., unpublished results). Although non-specific forces, such as hydrophobicity, seem to play some role, adhesion of bacteria is predominantly dependent upon specific interactions between bacterial surface receptors (adhesins) and ligands of the host tissue. In this regard, the collagen-adhesin-positive S. aureus strain Phillips more frequently induced arthritis, especially erosive arthritis, than its collagen-adhesin-negative mutant PH 100 (Patti et al., 1994). Additionally, vaccination with a recombinant fragment of collagen adhesin provides protection against S.-aureus-mediated septic death (Nilsson et aL, 1998). For a detailed review concerning the possibilities of vaccination against S. aureus infection see Foster, 1991. Another cell-wall factor of importance is the staphylococcal microcapsule expression (Fattom et aL, 1990). Expression of capsular polysaccharide (CP) 5 is a virulence determinant in S. aureus arthritis and septicaemia, probably by downregulatory properties of CP on the ingestion and intracellular killing capacity of phagocytes (Nilsson et aL, 1997). In conclusion, the mouse and rat animal models of S. aureus arthritis have an obvious resemblance to human disease. Using these models we are able to study the pathogenetic features of septic arthritis as well as therapeutic and prophylactic measures.

References Aarden, L. A., de Groot, E. R., Shaap, O. L., Lansdorp, P. M. (1987). Production of hybridoma growth factor by human monocytes. Eur. ]. Irnrnunol., 17, 1411-1416. Abdelnour, A. (1994). Immunopathogenesis of experimental Staphylococcus aureus arthritis. Thesis, University of G6teborg, Sweden. Abdelnour, A., Arvidsson, S., Bremell, T., Ryd6n, C., Tarkowski, A. (1993). The accessory gene regulator (agr) controls Staphylococcus aureus arthritis virulence in a murine arthritis model. Infect. hnrnun., 61, 3879-3885.

545

Abdelnour, A., Bremell, T., Holmdahl, R., Tarkowski, A. (1994a). Clonal expansion of T lymphocytes causes development of arthritis and mortality in mice infected with TSST-1producing staphylococci. Eur. ]. Irnmunol., 24, 1161-1166. Abdelnour, A., Bremell, T., Tarkowski, A. (1994b). Toxic shock syndrome toxin-1 contributes to the arthritogenicity of Staphylococcus aureus. J. Infect. Dis., 174, 94-99. Abdelnour, A., Bremell, T., Holmdahl, R., Tarkowski, A. (1994c). Role of T-lymphocytes in experimental Staphylococcus aureus arthritis. Scand. J. Immunol., 39, 403-408. Abdelnour, A., Zhao, Y.-X., Holmdahl, R., Tarkowski, A. (1997). Major histocompatability complex class II region confers susceptibility to Staphylococcus aureus arthritis. Scand. J. Irnrnunol., 46, 301-307. Brakenhoff, J. P. J., de Groot, E. R., Evers, R. F., Pannekoek, H., Aarden, L. A. (1987). Molecular cloning and expression of hybridoma growth factor in Escherichia coli. J. Immunol., 139, 4116-4121. Brancos, M. R., Peris, P., Miro, J. M. etal. (1991). Septic arthritis in heroin addicts. Sernin. Arthitis Rheum., 21, 81-87. Bremell, T., Tarkowski, A. (1995). Preferential induction of septic arthritis and mortality by superantigen-producing staphylococci. Infect. Immun., 63, 4185-4187. Bremell, T., Lange, S., Svensson, L. et al. (1990). Outbreak of spontaneous staphylococcal arthritis and osteitis in mice. Arthritis Rheum., 33, 1739-1744. Bremell, T., Lange, S., Yacoub, A., Ryd~n, C., Tarkowski, A. (1991). Experimental Staphylococcus aureus arthritis in mice. Infect. Irnmun., 59, 2615-2623. Bremell, T., Abdelnour, A., Tarkowski, A. (1992). Histopathological and serological progression of experimental Staphylococcus aureus arthritis. Infect. Immun., 60, 2976-2985. Bremell, T., Lange, S., Holmdahl, R., Ryd~n, C., Hansson, G. K., Tarkowski, A. (1994a). Immunopathological features of rat Staphylococcus aureus arthritis. Infect. Immun., 62, 2334-2344. Bremell, T., Holmdahl, R., Tarkowski, A. (1994b). Protective role of sialophorin (CD43) expressing cells in experimental Staphylococcus aureus infection. Infect. Immun., 62, 4637-4640. Carlsten, H., Nilsson, L.-fi~., Tarkowski, A. (1986). Impaired cutaneous delayed-type hypersensitivity in autoimmune MRL lpr/lpr mice. Int. Arch. Allergy Appl. Immun., 81,322-325. Carlsten, H., Tarkowski, A., Jonsson, R., Nilsson. L.-A. (1990). Expression of heterozygous lpr gene in MRL mice. II. Acceleration of glomerulonephritis, sialoadenitis and autoantibody production. Scand. J. Immunol., 32, 21-28. Cheung, A. L., Fischetti, V. (1988). Variation in the expression of cell wall proteins of Staphylococcus aureus grown on solid and liquid media. Infect. Immun., 56, 1061-1065. Curtiss, P. H., Klein. L. (1965). Destruction of articular cartilage in septic arthritis. II. In vivo studies. J. Bone Joint Surg., 47A, 1595-1604. Dinarello, C. (1991). The proinflammatory cytokines interleukin1 and tumor necrosis factor and treatment of the septic shock syndrome.J. Infect. Dis., 163, 1177-1183. Drutz, D. (1978). Hematogenous gonococcal infections in rabbits and dogs. In: Imrnunobiology of Neisseria Gonorrhoeae (ed. Brooks, B. F.), pp. 307-313. American Society for Microbiology, Washington, DC. Elwing, H., Nygren, H. (1979). Diffusion-in-gel enzymedinked immunosorbent assay (DIG-ELISA): a simple method for quantification of class-specific antibodies. J. Immunol. Meth., 31,101-107.

546

Fattom, A., Schneerson, R., Szu, S. C. et aL (1990). Synthesis and immunologic properties in mice of vaccines composed of Staphylococcus aureus type 5 and type 8 capsular polysaccharides conjugated to Pseudomonas aeruginosa exotoxin A. Infect. Immun., 58, 2367-2374. Foster, T. J. (1991). Potential for vaccination against infections caused by Staphylococcus aureus. Vaccine, 9, 221-227. Friedlander, H., Habermann, R. T., Parr, L. W. (1951). Experimental arthritis in albino rats and mice produced by alpha type streptococci. J. Infect. Dis., 88, 298-304. Goldenberg, D. L. (1989a). Bacterial arthritis. In: Textboo k of Rheumatology, 3rd edn (eds Kelly, W. O., Harris, E. D., Ruddy, S., Sledge, C. B.), pp. 1567-1585. W. B. Saunders, Philadelphia, PA. Goldenberg, D. L. (1989b). Infectious arthritis complicating rheumatoid arthritis and other chronic rheumatic disorders. Arthritis Rheum., 32, 496-502. Goldenberg, D. L., Cohen, A. S. (1978). Synovial membrane histopathology in the differential diagnosis of rheumatoid arthritis, gout, pseudogout, systemic lupus erythematosus, infectious arthritis and degenerative joint disease. Medicine, 57, 239-252. Goldenberg, D. L., Reed, J. I. (1985). Bacterial arthritis. N. EngL J. Med., 312, 764-771. Goldenberg, D. L., Chisholm, P. L., Rice, P. A. (1983). Experimental models of bacterial arthritis. J. RheumatoL, 10, 5-11. Gotschlich, E. C. (1993). Immunity to extracellular bacteria. In: Fundamental Immunology, 3rd edn (ed. Paul, W. E.), pp. 1287-1308. Raven Press, New York. Heberling, J. A. (1941). A review of two hundred and one cases of suppurative arthritis. J. Bone Joint Surg., 23, 917-921. Helle, M., Boeije, L., Aarden, L. A. (1988). Functional discrimination between interleukin-6 and interleukin-1. Eur. J. ImmunoL, 18, 1535-1540. Ho, G. (1989). Bacterial arthritis. In: Arthritis and Allied Conditions--A Textboo k of Rheumatology, l lth edn (ed. McCarty, D.J.), pp. 1892-1914. Lea & Febiger, Philadelphia, PA. Holderbaum, D., Spech, R. A., Ehrhart, L. A. (1985). Specific binding of collagen to Staphylococcus aureus. Collagen Relat. Res., 5, 261-276. H66k, M., McGavin, M. J., Switaiski, L. M. et al. (1990). Interactions of bacteria with extracellular matrix proteins. Cell Different. Devel., 32, 433-438. Hsu, S., Raine, L., Fanger, H. (1981). Use of avidin-biotinperoxidase complex (ABC) in immunoperoxidase techniques: a comparison between ABC and unlabelled antibody (PAP) procedures. J. Histochem. Cytochem., 29, 577-580. Janeway, C. A. Jr (1993). How the immune system recognizes invaders. Sci. Am., 269(3), 41-47. Jonsson, R., Tarkowski, A., Klareskog, L. (1986). A &mineralization procedure for immunohistopathological use: EDTA treatment preserves lymphoid cell surface antigens. J. Immunol. Meth., 88, 109-114. Josefsson, E., Tarkowski, A., Carlsten, H. (1992). Anti-inflammatory properties of estrogen. I. In vivo suppression of leukocyte production in bone marrow and redistribution of peripheral blood neutrophils. Cell Immunol., 142, 67-78. Josefsson, E., Carlsten, H., Tarkowski, A. (1993). Neutrophil mediated inflammatory response in murine lupus. Autoimmunity, 14, 251-257.

T. Bremell

Kaandorp, C. I. E., Krijnen, P., Moens, H. J. B., Habbema, I. D. K., van Schaardenburg, D. (1997). The outcome of bacterial arthritis - - a prospective community-based study. Arthritis Rheum., 40, 884-892. Kaplow, L. (1975). Substitute for benzidine in myeloperoxidase stains (letter). Am. J. Clin. PathoL, 63, 451. Karakawa, W. W., Fournier, I. M., Vann, W. F., Arbeit, R., Schneerson, R. S., Robbins, J. B. (1985). Method for the serological typing of the capsular polysaccharides of Staphylococcus aureus. J. Clin. MicrobioL, 22, 445-447. Kistler, G. H. (1936). Embolic Staphylococcus arthritis and endocarditis in rabbits. Proc. Soc. Exper. BioL Meal., 34, 829-831. Lansdorp, P. M., Aarden, L. A., Calafat, J., Zeijlemaker, W. P. (1986). A growth factor dependent B cell Hybridoma. Curt. Topics MicrobioL IrnmunoL, 132, 105-113. Lee, J., Takeda, S., Livolsi, P. J., Paoletti, L. C. (1993). Effects of in vitro and in vivo growth conditions on expression of type 8 capsular polysaccharide by Staphylococcus aureus. Infect. Immun., 61, 1853-1858. Lewis, G. W., Cluff, L. E. (1965). Synovitis in rabbits during bacteremia and vaccination. Bull. Johns Hopkins Hosp., 116, 175-190. Lindberg, L. (1969). Experimental staphylococcal arthritis in golden hamsters (Mesocricetuers auratus). Acta PatkoL MicrobioL ImmunoL &and., 76, 117-125. Mahowald, M. L. (1986). Animal models of infectious arthritis. Clin. Rheum. Dis., 12, 403-421. Mancini, G., Carbonara, A. O., Heremans, J. F. (1965). Immunochemical quantitation of antigens by single radial immunodiffusion. Immunochemistry, 2, 235-254. Mathews, M., Shen, F. H., Linder, A., Sherrard, D. J (1980). Septic arthritis in hemodialyzed patients. Nephron., 25, 87. Nakamura, Y., Masuhara, T., Ito-Kuwa, S., Aoki, S. (1991). Induction of experimental Candida arthritis in rats.J. Med. Vet. MycoL, 29, 179-192. Nilsson, I.-M., Bremell, T., Ryd~n, C., Cheung, A. L., Tarkowski, A. (1996). The staphylococcal accessory gene regulator (sar) controls arthritogenicity. Infect. Immun., 64, 4438-4443. Nilsson, I.-M., Lee, J. C., Bremell, T., Ryd~n, C., Tarkowski, A. (1997). The role of staphylococcal polysaccharide microcapsule expression in septicemia and septic arthritis. Infect. Immun., 65, 4216-4221. Nilsson, I.-M., Patti, J. M., Bremell, T., H66k, M., Tarkowski, A. (1998). Vaccination with a recombinant fragment of collagen adhesin provides protection against Staphylococcus aureus mediated septic death. J. Clin. Invest., 101, 2640-2649. Parker, M. T. (1983). The significance of phage typing patterns in Staphylococcus aureus. In: Staphylococci and Staphylococcal Infections (eds Easmon, C. S. F., Adlam, C.), vol 1, pp. 33-62. Academic Press, London. Patti, J. M., Bremell, T., Krajewska-Pietrasik, D. et al. (1994). The Staphylococcus aureus collagen adhesin is a virulence determinant in experimental septic arthritis. Infect. Immun., 62, 152-161. Paul, W. E. (1993). Infectious diseases and the immune system. Sci. Am., 269, 3:57-63. Pedersen, K. B., Kjems, E., Perch, B., Slot, P. (1981). Infection with RS streptococci in pigs. Acta Pathol. Microbiol. Scand. Sect. B, 89, 161-165. Rigdon, R. H. (1942). Pathogenesis of arthritis following the intravenous injection of Staphylococci in the adult rabbit. Am. ]. Surg., 55, 553-561.

EXPERIMENTAL MODELS OF INFECTIOUS ARTHRITIS

547

Ryd~n, C., Yacoub, A., Maxe, I. et aL (1989). Specific binding of bone sialoprotein to Stapkylococcus aureus isolated from patients with osteomyelitis. Eur. J. Biockem., 184, 331-336. S~iez-Llorens, X., Ramilo, O., Mustafa, M. M., Mertsola, J., McCracken, G. H. lr (1990). Molecular pathophysiology of bacterial meningitis: current concepts and therapeutic implications. J. Pediatr., 5,671-684. Sakiniene, E., Bremell, T., Tarkowski, A. (1996). Addition of corticosteroids to antibiotic treatment ameliorates the course of experimental Stapkylococcus aureus arthritis. Artkritis Rkeum., 39, 1596-1605. Sakiniene, E., Bremell, T., Tarkowski, A. (1999) Complement depletion aggravates Stapkylococcus aureus septicemia and arthritis. Clin. Exp. ImmunoL, 115, 95-102. Schlievert, P. M. (1993). Role of superantigens in human disease. J. Infect. Dis., 167, 997-1002. Sheagren, I. N. (1988). Inflammation induced by Stapkylococcus aureus. In: Inflammation: Basic Principles and Clinical Correlates (eds Gallin, J. I., Goldstein, I. M., Snyderman, R.), pp. 829-840. Raven Press, New York. Sheagren, J. N., Schaberg, D. R. (1992). Staphylococci. In: Infectious Diseases (eds. Gorbach, S. L., Bartlett, J. G., Blacklow, N. R.), pp. 1395-1400. W. B. Saunders, Philadelphia, PA. Switalski, L. M., Patti, J. M., Butcher, W. G., Gristina, A. G., Speziale, P., H66k, M. (1993). A collagen receptor on Stapkylococcus aureus isolated from patients with septic arthritis mediates adhesion to cartilage. Molec. Microbiol., 7, 99-107. Tarkowski, A., Czerkinsky, C., Nilsson, L.-A. (1984). Detection of IgG rheumatoid factor secreting cells in autoimmune MRL/1 mice: a kinetic study. Clin. Exp. ImmunoL, 58, 7-12. Thompson, R. H. S., Dubos, R. 1. (1938). Production of experimental osteomyelitis in rabbits by intravenous injection of Stapkylococcus aureus. J. Exp. Med., 68, 191-209. Tissi, L., Marconi, P., Mosci, P. et aL (1990). Experimental model of Type IV Streptococcus agalactiae (Group B Streptococcus)

infection in mice with early development of septic arthritis. Infect. Immun., 58, 3093-3100. Verdrengh, M., Tarkowski, A. (1997). Role of neutrophils in experimental septicemia and septic arthritis induced by Staphylococcus aureus. Infect. Irnmun., 65, 2517-2521. Verdrengh, M., Springer, T. A., Gutierrez-Ramos, J.-C., Tarkowski, A. (1996). Role oflCAM-1 in the pathogenesis of staphylococcal arthritis and in host defence against staphylococcal bacteriemia. Infect. Immun., 64, 2804-2807. Waldvogel, F. A. (1990). Staphylococcus aureus (including toxic shock syndrome). In: Principles and Practice of Infectious Diseases, 3rd edn (eds Mandell, G. L., Douglas, R. G. Jr, Bennett, J. E.), pp. 1489-1510. Churchill Livingstone, New York. Wang, Y., Xu, J., Xue, D. (1983). Experimental study of acute suppurative bone and joint infection. II. Suppurative arthritis. Chinese Ailed. J., 96, 907-912. Ward, J., Cohen, A. S., Bauer, W. (1960). The diagnosis and therapy of acute suppurative arthritis. Arthritis Rheum., 3, 522-535. Wiedermann, U., Tarkowski, A., Bremell, T., Kahu, H., Hanson, L.-A., Dahlgren, U. (1996). Increased susceptibility to Staphylococcus aureus arthritis in Vitamin A deficient rats. Infect. Immun., 64, 209-214. Williams, R. E. O., Rippon, J. E. (1952). Bacteriophage typing of Staphylococcus aureus. J. Hyg., 50, 320-353. Zhao, Y.-X., Tarkowski, A. (1995). Impact of interferon- T receptor deficiency on experimental Staphylococcus aureus septicemia and arthritis. J. IrnmunoL, 155, 5736-5742. Zhao, Y.-X., Abdelnour, A., Holmdahl, R., Tarkowski, A. (1995a). Mice with the xid B cell defect are less susceptible to develop Staphylococcus aureus-induced arthritis. J. Immunol., 155, 2067-2076. Zhao, Y.-X., Abdelnour, A., Kalland, T., Tarkowski, A. (199%). Overexpression of the T cell receptor V~3 in transgenic mice increases mortality during infection by enterotoxin A-producing Staphylococcus aureus. Infect. Immun., 63, 4463-4469.

This Page Intentionally Left Blank

Chapter 65

Experimental Group B Streptococcus Arthritis in Mice L. Tissi

Background of human infection Group B streptococci (GBS) are the leading cause of lifethreatening infection in neonates and young infants (Baker and Barrett, 1974; Baker and Edwards, 1995). Invasive neonatal GBS infection has either an early (usually during the first 24 hours after birth) or late (7 days after birth) onset. Early-onset disease is acquired from the mother by the ascending route in the uterus during labor or by direct contact at delivery (Baker, 1978; Gerards et aL, 1985; Dillon et al., 1987; Weisman et al., 1992). Late-onset disease may be acquired at birth from the mother or later in life from other individuals (Anthony et al., 1979; Gardner et al., 1980). The attack rates reported in the last two decades for the earlyonset infection vary from 0.7 to 3.7 per 1000 live births (Baker and Edwards, 1995). The attack rates for late-onset infection range from 0.5 to 1.8 per 1000 (Baker and Edwards, 1995). Common manifestations of GBS disease in newborns include pneumonia, septicemia, meningitis, bacteremia, and bone or joint infections (Ancona et al., 1979; Memon et aL, 1979; Lai et al., 1980; Baker and Edwards, 1995). Septic arthritis is described as a clinical manifestation of late-onset GBS disease in newborns (Ancona et aL, 1979; Memon et aL, 1979; Gardner et al., 1980; Dan, 1983; Yagupsky et aL, 1991; Baker and Edwards, 1995) and requires prolonged antibiotic treatment to insure an uncomplicated outcome. Drainage of the suppurative focus is an adjunct to antibiotic therapy. Recently, septic arthritis due to GBS has been demonstrated in adults (Small et aL, 1984; Schwartz et aL, 1991; Farley et aL, 1993) and is often associated with age and risk factors such as diabetes mellitus, cancer, cardiovascular diseases, chronic renal insufficiency, and other underlying severe illnesses (Jackson et aL, 1995). In adults also, extended antibiotic therapy together with aspiration or open drainage are necessary for successful treatment (Goldenberg and Cohen, 1976; Small et aL, 1984).

Background of model Relevant results for a better understanding of human GBS Handboo k of Animal Models of Infection

ISBN 0-12-775390-7

disease have been obtained through the study of GBS serotype (Ia/c, Ib/c, II, III, IV, V, VI) infections in adult mice (Furtado, 1976; Wennerstrom and Schutt, 1978; Baltimore et al., 1979; Fleming, 1980; Edwards and Fuselier, 1983; Poultrel and Dore, 1985; Molinari et aL, 1987; von Hunolstein et al., 1993), as well as in infant and adult rats (Ferrieri et aL, 1980; Schuit and Debiaso, 1980; Rubens et aL, 1987; Martin et al., 1988, 1992; Wessels et aL, 1989, 1992). Experimental arthritis was previously obtained with streptococci of group A and D or with GBS in rats. In such cases, articular lesions were also reproduced by inoculation of inactivated cells or bacterial sonic extracts containing high doses of rhamnose (Cromartie et aL, 1977; Spitznagel et aL, 1983). Polyarthritis was produced in mice by intravenous (i.v.) injection of the cell-wall or peptidoglycan fractions of group A streptococci (Koga et aL, 1984). Our model of GBS arthritis was first performed in a study on virulence of type IV GBS in mice; articular lesions were obtained only with live micro-organisms (Tissi et aL, 1990, 1991). The mouse model of GBS septic arthritis was used to investigate arthritogenicity of different GBS serotypes (Cornacchione et al., 1992) to compare the activity of different antibiotics (azithromycin, erythromycin, and penicillin G; Tissi et aL, 1994, 1995) and to study the protective activity of a murine monoclonal antibody in type IV GBS infection (Ricci et al., 1996).

Animal species Outbred CD-1 mice, 8-10 weeks old, weighing 20-25g, obtained from Charles River Breeding Laboratories (Calco, Milan, Italy) were used (Tissi et aL, 1990, 1991, 1994, 1995; Cornacchione et aL, 1992; Ricci et aL, 1996). No differences in results were observed between males and females. All strains of mice can be employed, but, because of the differences in susceptibility to GBS infection between mouse strains (Cornacchione et aL, 1992), preliminary experiments should be performed to determine the optimal bacterial inoculum to insure a high frequency of arthritis and a low mortality rate. Copyright 9 1999Academic Press All rights of reproduction in any form reserved

550

Preparation of animals No specialized housing, care, or specific treatment is required.

L. Tissi

i.v. injection of 1 x 107 GBS/mouse via the tail vein in a volume of 0.5 ml. At the beginning of our studies, we also injected the bacteria intraperitoneally (i.p.) but no strain of the GBS serotypes was able to induce articular lesions by the i.p. route with the exception of type VII (only at the dose of 108 cfu/mouse; unpublished results).

Storage and preparation of inocula This model can be employed with all strains of different GBS serotypes. We used both reference strains and GBS clinical isolates. Reference strains included N C T C 11079 (type II), N C T C 11080 (type III), strain 1/82 (type IV), 10/84 (type V), 118754 (type VI), and 7271 (type VII) obtained from the Czech National Type Culture Collection (Prague, Czech Republic). Clinical isolates of different GBS serotypes were obtained from the Istituto Superiore di Sanitfi (ISS) Culture Collection (Rome, Italy). All GBS strains were grown in Todd-Hewitt broth (THB, Oxoid, Basingstoke, UK) and on GBS agar base Islam (Oxoid), additioned with 5% heat inactivated horse serum or on Columbia colistin-nalidixic acid (CNA) agar (Oxoid) additioned with 5% defibrinated sheep blood. GBS and CNA agar were incubated at 37~ in anaerobic conditions. Growth of GBS on GBS agar was characterized by colonies with a typical orange carotenoid pigment. This peculiarity made cfu enumeration easy (particularly from organ homogenates). All GBS strains used in our studies were grown at 37~ in THB and samples were stored at-70~ until use. For experimental infections the organisms were cultured overnight in THB and then washed and diluted in serumfree RPMI 1640 medium (Flow Laboratories, McLean, VA). The inoculum size was estimated turbidimetrically at 540 nm in a Beckman DV-68 spectrophotometer (Beckman instruments, Fullerton, CA). The number of live bacterial cells was confirmed by enumeration of cfu on GBS or CNA agar. The desired number of bacteria was diluted in RPMI medium and injected i.v. via the tail vein in a volume of 0.5ml per mouse. Four doses were used to establish the optimal inoculum size: 109, 108, 107, and 106 cfu/mouse. The dose of 107 cfu/mouse gave a high frequency of arthritis and a relatively low mortality rate. All mice died within a few days (1-7 days) with 109 or 10~cfu/mouse, while no mice died with 106 cfu/mouse; however, arthritis was not evident. Thus, an inoculum of 107 cfu/mouse was used throughout our studies on GBS arthritis. GBS could also be diluted in THB and then injected. We used RPMI 1640 as the suspension medium because we diluted in the same medium the samples of blood or organs and joints that had been recovered from mice at selected times during infection.

Infection process As mentioned above, the infection was initiated by direct

Key parameters to monitor infection The infection was not confined to the joints. Systemic invasion occurred. The parameters for monitoring infection were death, general appearance, cfu enumeration in the blood and organs, blood cell responses, and macroscopic evaluation of articular lesions and histology.

Deaths Groups of mice (usually 20 mice) were observed at 24-hour intervals after GBS challenge and mortality was recorded. With type IV GBS, death occurred in 30-40% of mice (Tissi et aL, 1990).

Appearance Arthritis was not the only clinical feature of GBS infection. After type IV GBS infection, mice manifested neurological disorders (7.7%), panophthalmitis (9.2%), and flaccid paresis of the hind legs (4.6%; Tissi et aL, 1991). Loss of body weight was also observed and was recorded.

Blood and organ CFU Blood and organ infections were determined by cfu evaluation at different times after bacterial inoculation. Spleen, liver, kidneys, lungs, and brain were aseptically removed and placed in a tissue homogenizer with 3 ml of RPMI medium. Blood samples were obtained by retroorbital bleeding before sacrifice. Appropriate 10-fold dilutions of blood and organs were plated on GBS agar plates and incubated under anaerobic conditions. Results were expressed as the number of cfu per milliliter of blood or per whole organ. Joints were prepared by removing the skin and separating the limb below the joint. Then the joints were removed, weighed, and homogenized in 1 ml of sterile RPMI medium. Homogenization was performed by hand using a cold mortar and pestle. The joint samples were plated on GBS agar and the results were expressed as the number of cfu per milliliter of joint homogenate. Growth of type IV GBS in the organs and joints is shown in Table 65.1 and Figure 65.1.

EXPERIMENTAL GROUP B STREPTOCOCCUS ARTHRITIS IN MICE

brain started to decrease while there was a progressive increase in the kidneys and joints. During infection, high neutrophilia was observed but was not sufficient to eliminate the micro-organisms from the joints.

Table 65.1 Growth of type IV GBS in the joints of CD-1 mice

cfu recovered on postinfection days* Days

Joints

2 5 10 20

1.5 x 106+0.1 x 106 1.6x 109+0.1 xl09 5.6 x 101~ 0.5 x 101~ 7.1 x 1012+0.5 x 1012

Clinical evaluation of arthritis

* Mice were inoculated i.v. with 1 x 107 micro-organisms on day 0. Values represent the means + standard errors of three separate experiments. Ten mice per group were sacrificed at each time-point. Number of cfu per milliliter of joint homogenate is reported.

BLOOD

BRAIN

106.

106.

105.

105.

104.

104.

103-

103. 102 ~

102. 101 . . . . .

:

.- 1 0 1

106.

106.

105

105.

0 104

104.

0

103.

03.

-Q E 102. 101 . . . . .

-

.

.

SPLEEN

LUNGS

Z

551

"

102. ": 101

LIVER

KIDNEYS 10111

106.

Mice challenged with GBS were examined numerous times during day 1 after infection and then daily for 2 months to evaluate the presence of joint inflammation. Time of onset, number of joints involved, incidence, duration of arthritis, and occurrence of ankylosis were recorded. Arthritis was defined as visible erythema or swelling of at least one joint. To evaluate the intensity of arthritis, a clinical score (arthritic index) was used for each limb as determined by macroscopic inspection: 1 point, mild swelling and erythema; 2 points, moderate swelling and erythema; 3 points, marked swelling, erythema, and occasionally ankylosis. Thus, a mouse could have a maximum score of 12. The arthritis index was constructed by dividing the total score by the number of animals used in each experimental group. The incidence and severity of arthritis induced by type IV GBS are shown in Figure 65.2. This type of clinical score has been used by many authors in different mouse models of arthritis (Wolley et aL, 1993; Abdelnour et aL, 1994; Kasama et aL, 1995).

Joint pathology

105. 104.

1071

103. 102.

105]

101 100

,

,

_

_

2hld 5d 10d 15d20d

103 . . . . . . . 30d 2hld 5d 10d 15d20d

30d

Time after type IV GBS infection Figure 65.1 Growth kinetics of type IV GBS 1/82 in various organs of CD-1 mice. Mice were inoculated i.v. with 107 micro-organisms on day 0. Values are the mean cfu recovered per milliliter of blood of whole organs of mice. Standard errors, always u)

70-

,,

60-

[] saline

50-

•

S. pyogenes

403020100

0

I

I

I

I

I

I

I

I

12

24

36

48

60

72

84

96

Hours

Figure 71.1 Kaplan Meier plot showing survival pattern following intramuscular inoculation of 2 x 109 cfu Streptococcus pyogenes.

Cardiovascular abnormalities

These have been recorded in this model using invasive monitoring techniques. Systemic hypotension occurs during sepsis, coupled with a decline in heart rate which is associated with lethal outcome (D. Rees, personal communication).

Haematological anomalies

Haematological anomalies at 50 hours include thrombocytopenia (mean levels: controls 1228 × 109/1 SD 275, infected 898 × 109/1SD 153) and leukopenia due mainly to profound lymphopenia (mean levels: controls 9.68 x 109/1; infected 0.73 × 109/1). Prolongation of the partial thromboplastin time, reflecting activation of the contact system, also occurs (mean time: controls 25.1 seconds SD 3.9; infected 84.6 seconds SD 32).

Serum cytokine responses

These have been measured by ELISA from tail bleeds taken at predetermined time points during streptococcal sepsis. In early experiments, it was shown that raised interleukin-6 levels were associated with shortened survival in this model (Sriskandan et aL, 1996). Serum TNFo: and interferon-y have been detected only in mice with the highest IL-6 levels, during later stages of sepsis (Figure 71.2). Serum nitrite plus nitrate, a surrogate marker of nitric oxide production, rises 15 hours after infection (mean 1701amol/1) compared with uninfected controls (mean 75 btmol/1); levels measured by modified Griess reaction

MOUSE MODEL OF S T R E P T O C O C C A L FASCIITIS

E

80

--

60

--

607

40

EL 20 Z

--

F-

A.,.~

~m

olo

eloe

o

A m

(A) u

i

E

m

c~ E

2 -

Z LL

0 -

I I

.,.imam

:t."

o e l o

OIO

o

80 60 E E~

r- 40

(B) m=

20

o o ~

~

o

~

~

~

~

~

~===,

,,,i

o ,,i

oo,

0

24

30

C

~

,,,,-

46

.....

-

49

"-

50

Time (hours)

Figure 71.2

Detection of serum cytokines (A. TNF(z, B. interferon-y, C. IL-6) in tail blood at times shown following intramuscular infection with S. pyogenes. Each point represents a single mouse.

(c) (from cardiac puncture samples) are considerably lower than endotoxic shock models.

Histopathology

Figure 71.3 Histopathology following infection with S. pyogenes. A. Thigh muscle and fascia, x 340. B. Liver tissue from infected mouse. Apoptotic hepatocytes arrowed. x 680. C. Renal tissue from infected mouse. Dead tubular cells arrowed, x 680.

Thigh lesion Liver An infiltrate of degenerate neutrophils can be seen throughout the connective tissues of the thigh, with fibrin deposition, occasional colonies of Gram-positive cocci and some haemorrhage. Muscle fibres adjacent to inflamed fascia will be necrotic, although fibres distant from inflamed connective tissue are normal (Figure 71.3A).

Extensive fatty change can be seen throughout the liver with increased numbers of apoptotic hepatocytes displaying clumping of chromatin and dense pink cytoplasm. Bacterial colonies are not seen within the hepatic parenchyma (Figure 71.3B).

608

S. Sriskandan and J. Cohen

(A)

(B)

(D)

(c) Figure 71.4 A. Spleen tissue from normal mouse, with normal follicular architecture. B. Spleen from infected mouse showing loss of follicular margins and lymphoid depletion. C. Normal intestinal epithelium from normal mouse. D. Intestinal epithelium from infected mouse showing sloughing of mucosal cells into the lumen, x 400.

MOUSE MODEL OF STREPTOCOCCAL FASCIITIS

Kidney

Changes of acute tubular necrosis are seen in infected animals (Figure 71.3C). Spleen

Marked structural disorganization of the splenic architecture occurs; splenic tissue appears pale because of large gaps in follicles of the white pulp. Loss of follicular margins and macrophages containing chromatin-dense bodies are strongly suggestive of lymphoid depletion due to apoptosis (Figure 71.4A, B). Small bowel

Cells from intestinal crypts are shed into the small bowel lumen of infected animals. Cells at crypt bases are necrotic, without evidence of normal mitotic activity (Figure 71.4C,

D). Lung, heart

No consistent abnormality has been found in these organs.

Pitfalls (advantages/disadvantages) of the model There are a number of reasons for choosing the mouse as a model of severe streptococcal infection. Firstly, it is undesirable to induce such destructive infection in larger animals. Secondly, use of mice permits mortality studies, which are of considerable importance when assessing novel treatment modalities. Lastly, a wide range of reagents are commercially available to study immunological responses in mice; the immunology of larger animals has not been characterized to the same degree. Use of inbred murine strains such as BALB/c can facilitate study of T-cell responses to the streptococcal superantigen SPEA. The model described adequately reproduces clinical disease, in that soft-tissue infection is progressive and is associated with bacteraemia, multiorgan failure, systemic inflammatory response and death. We know that the bacterial toxin SPEA is produced systemically in this model and have been able to measure levels of SPEA in blood and localize SPEA immunohistochemically (Sriskandan et aL, 1996a). The model can therefore be used for study of other, potentially important bacterial products. A major drawback of this model is that cardiovascular function is not easily monitored without intricate invasive monitoring devices. In addition, mice are relatively insensitive to bacterial toxins; the potency of streptococcal superantigens in human and rabbit cell culture is around two logs greater than in murine cell culture. This is because of differences between human and murine H L A class II mole-

609

cules and, possibly, T-cell receptor subsets. The clinical manifestations of superantigen exposure may therefore be absent in a murine streptococcal sepsis model.

Contributions of the model to infectious disease therapy This model has not been used in extensive studies of antimicrobial therapy. Intravenous administration of penicillin at onset of infection results in complete cure; attenuation of infection severity can be achieved by delayed dosing with antibiotics. In a similar model of streptococcal myositis, Stevens et aL (1988) have shown that clindamycin administered by the intraperitoneal (i.p.) route demonstrated significantly superior efficiency to penicillin therapy, even when treatment was delayed. Novel therapeutic agents (anti-TNF monoclonal antibodies, soluble T N F receptors, IVIG, anti-SPEA and inhibitors of nitric oxide synthase) have been tested in this model but have not demonstrated any positive benefit, even when administered at the time of infection (Sriskandan et aL, 1996a, 1997). This is in spite of the fact that some of these agents are of proven benefit in endotoxic shock. This may relate to rapid clearance of agents administered as a bolus i.v., or to the overwhelming nature of the sepsis syndrome in this model. Systematic testing of potential therapies in this model is in progress, using antibiotic administration to attenuate severity. This model has been important in increasing our understanding of the pathogenesis of streptococcal soft-tissue infection and the associated sepsis syndrome. The production and localization of bacterial superantigenic toxin (SPEA) during sepsis was characterized for the first time using this model; this has been followed by detection of superantigen in serum obtained from patients using the same methodology (Sriskandan et aL, 1996b). Immunological responses to streptococcal soft-tissue infection contrast with those seen following i.v. endotoxin injection and Gram-negative infection. This raises important therapeutic issues when considering uniform approaches to management of septic shock.

References Cone, L. A., Woodard, D. R., Schlievert, P. M., Tomory, G. S. L. (1987). Clinical and bacteriologic observations of a toxic shocklike syndrome due to Streptococcuspyogenes. New Engl. ]. Med., 317, 146-149. De Azavedo, J. C. S. (1989). Animal models for toxic shock syndrome: overview. Rev. Infect. Dis., 11 (suppl. 1), $205-$209. Hoge, C. W., Schwartz, B., Talkington, D. F. et al. (1993). The changing epidemiology of invasive group A streptococcal infections and the emergence of Streptococcal Toxic Shocklike syndrome. ]. A. M. A., 269, 384-389.

610

Husmann, L. K., Dillehay, D. L., Jennings, V. M., Scott, J. R. (1996). Streptococcus pyogenes infection in mice. Microb. Pathog., 20, 213-224. Kapur, V., Maffei, J. T., Greer, R. S. etaL (1994). Vaccination with streptococcal extracellular cysteine protease (interleukin-l~ convertase) protects mice against challenge with heterologous group A streptococci. Microb. Pathols., 16, 443-450. Larkin, S. M., Williams, D. N., Ostreholm, M. T., Tofte, R. W., Posalaky, Z. (1982). Toxic shock syndrome: clinical, laboratory, and pathologic findings in fatal cases. Ann. Intern. Meal., 96, 858-864. Martin, R. A., Silva, A. T., Cohen, J. (1992). Effect of anti-TNF0~treatment in an antibiotic treated murine model of infection due to Streptococcus pyogenes. FEMS MicrobioL Lett., 79, 313-322. Michie, C., Scott, A., Cheesbrough, J., Beverley, P., Pasvol, G. (1994). Streptococcal toxic shock-like syndrome: evidence of superantigen activity and its effects on T lymphocyte subsets in vivo. Clin. Exp. Immunol., 98, 140-144. Piepmeler, E., Hammet-Stabler, C., Price, M. et al. (1995). Myositis and fasciitis associated with group A beta-hemolytic streptococcal infections; development of a rabbit model.]. Lab. Clin. Med., 126, 137-143. Seal, D. V., Kingston, D. (1988). Streptococcal necrotizing fasciitis: development of an animal model to study its pathogenesis. Br. ]. Exp. Pathol., 69, 813-831. Selbie, F. R., Simon, R. D. (1952). Virulence to mice of Staphylococcus pyogenes: its measurement and its relation to certain in vitro properties. Br. ]. Exp. Pathol., 33, 315-326. Sriskandan, S., Moyes, D., Buttery, L. K. et al. (1996a). Streptococcal pyrogenic exotoxin A (SPEA) release, distribu-

S. Sriskandan and J. Cohen

tion and role in a murine model of fasciitis and multi-organ failure due to Streptococcus pyogenes. J. Infect. Dis., 173, 1399-1407. Sriskandan, S., Moyes, D., Cohen, J. (1996b). Detection of circulating bacterial superantigen and lymphotoxin-0~ in patients with streptococcal toxic-shock syndrome. Lancet, 348, 1315-1316. Sriskandan, S., Moyes, D., Buttery, L. K. et aL (1997). The role of nitric oxide in experimental murine septic shock due to SPEA-producing Streptococcus pyogenes. Infect. Immun., 65, 1767-1772. Stevens, D. L. (1992). Invasive group A streptococcal infections. Clin. Infect. Dis., 14, 2-13. Stevens, D. L., Bryant, A. E., Yan, S. (1994). Invasive group A streptococcal infection: new concepts in antibiotic treatment. Int. J. Antimicrob. Agents, 4, 297-301. Stevens, D. L., Gibbons, A. E., Bergstrom, R., Winn, V. (1988). The Eagle Effect revisited: efficacy of clindamycin, erythromycin, and penicillin in the treatment of streptococcal myositis. J. Infect. Dis., 158, 23-28. Stevens, D. L., Tanner, M. H., Winship, J. et aL (1989). Severe group A streptococcal infections associated with a toxic shocklike syndrome and scarlet fever toxin A. N. EngL J. Med., 321, 1-7. Watanabe-Ohnishi, R., Low, D. E., McGreer, A. et aL (1995). Selective depletion of V~-bearing T cells in patients with severe invasive group A streptococcal infections and streptococcal toxic shock syndrome. J. Infect. Dis., 17, 74-84. Working Group on Severe Streptococcal Infections (1993). Defining the group A streptococcal toxic shock syndrome. Rationale and consensus definition. J. A. M. A., 269, 390-391.

Chapter 72

Rabbit Model of Bacterial Endocarditis A. Lefort and B. Fantin

Background of human infection

Details of surgery

Bacterial endocarditis remains a life-threatening infection despite the recent development of potent anti-infective agents. Diagnosis of this infection has become easier since the use of precise and objective criteria (Durack et al., 1984). Antibiotics at high doses either alone or in combination and maintained for a prolonged period are sometimes insufficient to sterilize cardiac vegetations, preventing therapeutic failures and emergence of bacterial populations resistant to the treatment. Mortality remains important, for hemodynamic and infectious reasons. Clinical trials of endocarditis are limited by the relative infrequency of the disease, the difficulties to evaluate precise parameters of therapeutic efficacy and the heterogeneity of the cases.

Overview

Background of model Since the first report in 1885 (Ribbert, 1885), several models of experimental infective endocarditis have been attempted in a variety of animals (dogs, horses, pigs, opossum, rats and rabbits; Tunkel and Scheld, 1992). Early researchers recognized the ability of valve trauma or other manipulations to facilitate colonization of cardiac valves by injected bacteria. The rabbit model, as currently used, is based upon the simple and reproducible model described by Garrison and Freedman (1970). This model, using a polyethylene catheter to induce valvular damage, was modified by Durack and Beeson (1972), Sande and Irwin (1974) and others (Gutschik and Christensen, 1978a,b).

Animal species White New Zealand female rabbits weighting 2-2.5 kg are most commonly used.

Preparation of animals No specialized housing or care nor specific pretreatment is required. Handbook of Animal Models of Infection ISBN 0-12-775390-7

To induce non-bacterial thrombotic endocarditis (NBTE), a polyethylene catheter is inserted into the right carotid artery and advanced towards the heart until the catheter crosses the aortic valve, where it is left in place.

Material required Anesthetic, syringes and needles, scalpel handle plus blades, electric clippers, skin disinfectant (ethyl alcohol), suture material, pliers, dissection pliers, clips, silk thread, catheter guide, polyethylene catheter, bounds, compresses. Hollow polyethylene catheters are usually used (external diameter 0.96 mm, internal diameter 0.58 mm), but solid cannulae are also appropriate (Tanphaichitra et al., 1974).

Anesthesia Animals are most commonly anesthetized by intramuscular injection with ketamine hydrochloride (15 mg/kg). This protocol produces transient anesthesia lasting 15-20 minutes, which corresponds to the duration necessary for surgery.

Production of sterile aortic valve vegetations The anesthetized rabbit is maintained in a dorsal position with the help of cords fixing the animal's paws to the surgical table (Figure 72.1). The skin over the neck is shaved with electric clippers, disinfected with ethyl alcohol and a 3-5 cm longitudinal incision is made along the right side of the trachea. The right carotid artery is then exposed and ligated with a silk suture. A clamp is placed on the artery 1-2 cm upstream of the ligature, demarcating a portion of the artery where the polyethylene catheter is cautiously introduced via a guide-wire. The catheter is then inserted up to the clamp and the guide can be removed (Figure 72.2). Copyright © 1999 Academic Press All rights of reproduction in any form reserved

612

Figure 72.1

A. Lefort and B. Fantin

Anesthetized rabbit in a supine position prior to surgery.

Figure 72.2 Polyethylene catheter inserted into the right carotid artery.

Before removing the clamp and inserting the catheter further, a silk thread should be placed around the cathetercontaining artery and slightly tightened. This will help prevent ebbing of blood after clamp removal. After removing the clamp, the catheter is inserted a distance of about 8 cm until resistance is met. Characteristic pulsations of the catheter are detected when the catheter is in the heart. It is then withdrawn slightly, just a few millimeters, and secured with a loop of silk suture. The tip thus remains in a position just above the semilunar cusps of the aortic valves (Perlman and Freedman, 1971a). The catheter is then tied upon itself and the skin incision is closed with silk over the free end of the catheter.

The catheter is left in situ until the death or sacrifice of the animal, as several studies have shown that withdrawal of the catheter before treatment reduces the incidence of infective endocarditis (Durack et aL, 1973), slows down bacterial multiplication within the vegetations (Heraief et aL, 1982) and facilitates eradication of organisms with therapy (Pelletier and Petersdorf, 1976). Similar catheterization can be applied to the right side of the heart, via the femoral vein, as described originally by Garrison and Freedman (1970), or via the jugular route (Archer and Fekety, 1976). However, infections of the tricuspid valve have been shown to heal more rapidly, even without treatment, and to be less virulent than left-sided infections (Perlman and Freedman, 1971b). The presence of the catheter in the right or left side of the heart provokes valvular lesions predisposing to infective endocarditis within few minutes (Durack et aL, 1973). The deposition of fibrin and platelets on these lesions leads to the formation, in 24 hours, of macroscopic aseptic vegetations characteristic of NBTE. These lesions are highly susceptible to colonization by circulating microorganisms. This surgical technique is an easy, reproducible and reliable method of producing NBTE, and does not require rigorous sterile care because rabbit serum bactericidal activity prevents local or general surgery-related infections.

Storage and preparation of inocula The ability of a microorganism to produce bacterial endocarditis depends on its adhesion properties, its virulence and its susceptibility to serum bactericidal systems. However, increasing the inoculum size of an organism can improve its

RABBIT MODEL OF BACTERIAL ENDOCARDITIS

ability to produce the disease. Thus, the size of the required inoculum varies considerably according to the various species and strains. Freedman and Valone (1979) determined the inoculum size necessary to cause infection in 50% of rabbits (IDs0). For aortic valve vegetations with the catheter in place for 2 days, the IDs0 for Staphylococcus aureus w a s 10 375+0"060, Streptococcus sanguis 10 4.67+0.52 and Escherichia coli 10629-+058.For enterococci, the IDs0 in rabbits was estimated at 5.9 x 106 cfu (Durack et al., 1977). Rabbits with right or left heart catheters in place for 2-7 days are generally 100% susceptible to inocula of at least 106 streptococci or staphylococci. They are less susceptible to infection with Escherichia coli and cell-wall-deficient bacterial forms (Freedman and Valone, 1979). The inoculum is usually prepared from an overnight culture in broth, centrifuged and resuspended in saline. Appropriate dilutions of the inoculum are administered 24 hours after catheter insertion.

Infection process Two main routes of administration have been used. In the model of Garrison and Freedman (1970), the catheter itself was filled with a suspension of Staphylococcus aureus before insertion and the vegetations became infected. However, these experiments were not reproducing the clinical situation, in which cardiac valves are colonized by circulating microorganisms. Durack and Beeson (1972) first described the production of bacterial endocarditis after a single intravenous injection of bacteria through a peripheral ear vein. This technique is currently the most frequently used and is very easy to perform. After shaving the external part of the ear and producing vasodilatation by applying ethyl alcohol, the inoculum is injected into the vein with a fine needle.

Key parameters to monitor infection The infected rabbits develop clinical and biological manifestations that are very close to those observed in humans with infective endocarditis, such as fever, weight loss, anemia, positive blood cultures, peripheral emboli and secondary septic localizations. Spontaneous mortality may rapidly occur, particularly when infective bacteria are highly virulent. However, the most reliable parameter to monitor infection is the count of colony forming units (cfu) of bacteria per gram of vegetations (for technical description see below).

Antimicrobial therapy The rabbit model of experimental endocarditis has proved to be highly valuable in evaluating the in-vivo effectiveness

613

of antibiotics for treatment as well as for prophylaxis. Many drugs have been tested, either alone or in combination. The intramuscular and intravenous routes of administration are the most commonly used. Dosage, treatment interval and duration of therapy depend on the question being studied and must be in agreement with the pharmacodynamic and pharmacokinetic properties of the antibiotic being used. If the results are to have clinical relevance, the rate of administration must produce serum concentrations close to those achieved in humans. For most antibiotics, determination of the optimal schedule of administration should be facilitated by evaluating serum levels and the half-life of the drug, which is usually shorter in rabbits than in humans. The time between bacterial seeding of the valve and initiation of antimicrobial therapy is a major factor that influences the therapeutic efficacy of various antimicrobial regimens. Early treatment of infective endocarditis enhances the apparent efficacy of antimicrobial therapy, even with drugs that are clinically ineffective (Carrisoza and Kaye, 1976). Most investigators initiate therapy when bacterial density in vegetations is maximal 24-48 hours after infection. For prophylaxis studies, the antimicrobial drug is usually administered at least 1 day after insertion of the catheter and 30minutes prior to injection of the microorganism (Durack and Petersdorf, 1973; Pelletier et aL, 1975).

Key parameters to monitor response to treatment The rabbit model of aortic endocarditis provides precise endpoints, which can be relevant in the evaluation of response to treatment: number of cfu of bacteria per unit weight of tissue (vegetation or other organ being secondarily infected), detection of resistant bacterial populations, presence or absence of positive blood cultures, incidence of death, percentage of relapse after therapy has been stopped. The most reliable parameter to evaluate therapeutic efficacy is the reduction of cfu per gram of vegetation in comparison with control animals. Determination of bacterial cfu requires the analysis of the aortic vegetations. The animals are sacrificed (by intravenous injection of 100 mg of sodium thiopental). The heart is removed and opened (Figure 72.3), being careful to preserve sterility, the vegetations are excised, weighed, homogenized, serially diluted and cultured on appropriate agar plates. The best homogenization is obtained by using an electric tissue grinder. Animals are usually sacrificed 12-48 hours after the last antibiotic injection according to serum elimination halflife, in order to avoid carry-over. However, the absence of bacteriologic relapse following therapeutic discontinuation represents the most relevant parameter for predicting therapeutic cure (Fantin et aL, 1989). In studies of prophylaxis, rabbits that had been treated prior to bacterial challenge are sacrificed 24-72 hours after injection of the microorganism.

614

Figure 72.3

A. Lefort and B. Fantin

Cardiac vegetations surrounding a transaortic catheter and located on the aortic valves.

Determination of the cfu per gram of vegetations allows the evaluation of the percentage of infected animals for each prophylactic regimen.

Pitfalls (advantages/disadvantages) of the model The rabbit model has been shown to produce infection in animals that closely mimicks the characteristics of infective endocarditis in humans. However, several differences exist between the animal and the human disease and one must be particularly careful in extrapolating the animal results to human therapy. First, the valvular trauma induced by the polyethylene catheter is pathophysiologically very different from the underlying conditions that predispose humans to infective endocarditis. Also, in most studies the catheter has been left in the heart until the animal is killed. Presence of this foreign body mimicks the clinical situation of patients with prosthetic valve endocarditis rather than infection on native valves. In addition, the size of the inoculum required to produce infection in animals and the subsequent bacteremia are much greater than the number of circulating bacteria responsible for human endocarditis. The intravenous portal of entry is relatively rare in humans. Moreover, bacteremia induced by invasive procedures in humans are often polymicrobial, whereas animals are usually infected with a single microorganism. In the experi-

mental model, no more than one or two strains of a species of bacteria are tested on animals and extrapolation to the other strains of the species must be done very cautiously. For this reason, the choice of the infective bacteria must be representative of the clinical question being elucidated. Finally, the infection induced in animals is probably more severe and more acute than the human disease, as shown by the rapid mortality of infected animals left untreated. As compared with the rat model, the rabbit model of endocarditis presents two major advantages. First, the size of the vegetations is much larger in rabbits; this is of great importance because diffusion of antibiotics through the vegetations is clearly influenced by their size. Second, the higher bacterial inoculum per vegetation in rabbits allows the selection of resistant mutant during therapy (Fantin et al., 1993). On the other hand, rabbits are more expensive and more difficult to handle than rats. For these reasons, the rabbit model is more appropriate for therapeutic studies and the rat model for prophylactic studies.

Contributions of the model to infectious disease therapy Efficacy of antimicrobial agents Evaluation of the effectiveness of various antimicrobials in the rabbit model of endocarditis is an essential pre-

RABBIT MODEL OF BACTERIAL ENDOCARDITIS

requisite that greatly influences therapeutic options in humans. Several general principles concerning endocarditis therapy have been established by using the rabbit model of endocarditis, in accordance with the very specific pathophysiological characteristics of the disease, which may influence the pharmacokinetic and pharmacodynamic properties of antimicrobial agents (Carbon, 1993). First, the treatment should be bactericidal. Bacteriostatic therapy would produce an apparent clinical cure, but bacterial growth leading to relapse of the disease would occur as soon as therapy was discontinued. Secondly, treatment should be administered for a prolonged period in order to eradicate infection. Third, therapy should be given at high doses in order to achieve a bactericidal effect. Fourth, synergistic combinations should be preferred to monotherapies. As results of time-kill methods in vitro are predictive of in-vivo effect (Scheld, 1987), optimal therapeutic regimens should be screened in vitro before evaluation in animals and subsequent extrapolation to human therapy.

Routes of administration and schedule The rabbit experimental model of endocarditis has provided essential informations about the optimal antibiotic schedules being administered according to the pharmacodynamic characteristics of antiinfective drugs (Carbon, 1991; Potel et aL, 1991). As many variables can be carefully controlled, it becomes relatively easy to determine the predictive values of in-vitro tests on the in-vivo outcome. For antibiotics with a slow bactericidal rate (i.e. with a time-dependent effect) and no or negligible postantibiotic effect (PAE), such as ]3-1actams, intervals between administrations must be short in order to maintain local inhibitory levels throughout the entire dose interval. In contrast, antibiotics with a rapid killing rate (i.e., with a concentration effect) and a PAE, such as aminoglycosides and fluoroquinolones on some organisms, can be administered at longer dosing intervals and at high doses (Carbon, 1993). Recently, simulation of human pharmacokinetics in rabbits has improved the clinical relevance of the rabbit model to optimization of schedule and dosing regimens in humans (Bugnon et aL, 1996).

Indication of synergistic/antagonist effects of antibiotic combinations The rabbit model of endocarditis has been extensively used for the evaluation of the potential consequences of antibiotic combinations (Fantin and Carbon, 1992). The benefit of selected antibiotic combinations has been demonstrated in terms of increased bactericidal activity and reduction of the emergence of resistant mutants as compared with single drug therapy (Aslangul et aL, 1997).

615

Pharmacokinetics, pharmacopharmacodynamics, tissue penetration The rabbit model represents an excellent way of studying the pharmacokinetic properties of antibiotics in vegetations (Carbon et al., 1995). To reach microorganisms, antibiotics must diffuse through layers of fibrin and platelets that separate bacteria from the bloodstream. Although equilibration between antibiotic concentrations in the serum and in the vegetations is rapid and complete with a similar elimination half-life in both compartments (Contrepois et al., 1986), significant differences in the diffusion patterns of antibiotics through vegetations have been observed by autoradiography (Cr6mieux et al., 1989). To date, three different types of diffusion have been characterized. The most frequent pattern is homogeneous diffusion through the vegetation, as observed with tobramycin, spiramycin, quinupristin, perfloxacin, sparfloxacin, amoxicillin and clavulanic acid. Diffusion may describe a gradient of decreasing concentrations between the periphery and the core of the vegetation, as observed for ceftriaxone, penicillin and dalfopristin. The third pattern of diffusion is observed with teicoplanin, which remains at the periphery of the vegetation and fails to diffuse into the core. The model of rabbit endocarditis has also generated information concerning the in-vivo pharmacodynamics of antimicrobials. This included the measure of the duration of in-vivo PAE (Hessen et al., 1989) and adaptative resistance into the vegetatiorl (Xiong et aL, 1997), the determination of the pharmacokinetic/pharmacodynamic parameter that best predicts the in-vivo activity of a given antibiotic (Fantin et al., 1995), and the value of the rate of killing and serum elimination half-life to predict the feasibility of a single daily dose of antibiotics (Potel et al., 1991).

Development of novel therapeutic approaches The model of rabbit endocarditis has provided information in the development of novel therapeutic approaches in two ways; first, in the investigation of new compounds, since the pharmacokinetic, pharmacodynamic and microbiologic parameters may be investigated for a given antimicrobial, creating understanding of the factor(s) that limit the in vivo efficacy (Belmatoug and Fantin, 1997). Second, the model has been used for the investigation of other therapeutic approaches than antibiotics, based on knowledge of the physiopathology of the disease, such as the investigation of the potential benefit of the use of human recombinant granulocyte colony-stimulating factor in rabbits with aortic endocarditis due to Pseudomonas aeruginosa, in addition to antimicrobial therapy (Vignes et aL, 1995).

616

Understanding of pathology and pathogenesis The rabbit model of endocarditis has yielded much information about the adhesive properties of different microorganisms. It has been demonstrated that the production of dextran, an exopolysaccharide produced by various strains of streptococci and enterococci, correlates both to adherence in vitro and infectivity in vivo (Scheld et aL, 1978), facilitates bacterial persistence in the vegetations, limits access of antibiotics to their bacterial targets and protects microorganisms against host phagocytic defenses (Dall et aL, 1987). The role of platelets in the pathogenesis of streptococcal endocarditis has also been well studied. Platelets act as a major promoter of the disease. On the one hand, platelets contribute to the formation of N B T E and increase the adhesion of Streptococcus sanguis to fibrin. On the other hand, activation of platelets leads to the production of microbicidal peptides, which play a protective role against colonization o f N B T E (Dankert et aL,1995; Yeaman, 1997). Several characteristics of endocardial vegetations have also been well established by the use of the rabbit endocarditis model. The heterogeneous distribution of bacteria in the vegetations, with a platelet-fibrin matrix surrounding the bacterial colonies, is an important morphological characteristic of the lesions, which can explain therapeutic failures. Histological studies have demonstrated the absence, at the early stage of the disease, of phagocytic cells in the vegetation, whereas bacterial multiplication is rapid (Durack and Beeson, 1972). Titers of bacteria in vegetations are particularly high and often exceed 108 cfu per gram (Walker and Hamburger, 1959). This could account for a reduced antibiotic activity related to that 'inoculum effect'. The metabolic activity of bacterial populations located in the core of vegetations is reduced compared with that of peripheral bacteria, as shown by autoradiography of vegetations after [3H]-L-alanine incorporation (Durack and Beeson, 1972). This may explain a reduced effectiveness of antibiotics active on rapidly dividing microorganisms, because most of the deep-seated bacteria are in the resting state (Cozens et aL, 1986). In addition, important morphological modifications of bacteria have been observed in the vegetations from rabbits with streptococcal endocarditis (Frehel et aL, 1988), similar to the reversible abnormalities observed in vitro when growth conditions are unfavorable. Altogether, these physiopathologic characteristics of the vegetation may account for the phenotypic-tolerance phenomenon, which is characterized by the lack of bactericidal activity of antibiotics in vivo despite good sensitivity in vitro. The kinetics of the production of tumor necrosis factor have been monitored during the course of rabbit endocarditis, in untreated controls and in animals receiving antibiotics with different mechanisms of action (Mohler et aL, 1994). The model provided an opportunity to study the inflammatory response during the course of a subacute infectious process. In conclusion, it is quite clear that the model of experimental endocarditis has greatly contributed to our

A. Lefort and B. Fantin

understanding of the physiopathologic process of bacterial endocarditis and of the in-vivo activity and limitations of antibiotics.

References Archer, G., Fekety, F. R. (1976). Experimental endocarditis due to Pseudomonas aeruginosa. Description of a model. J. Infect. Dis., 134, 1-7. Aslangul, E., Baptista, M., Fantin, B. et aL (1997). Selection of glycopeptide-resistant mutants of VanB-type Enterococcus faecalis BM4281 in vitro and in experimental endocarditis. J. Infect. Dis., 175, 598-605. Belmatoug, N., Fantin, B. (1997). Contribution of animal models of infection for the evaluation of the activity of antimicrobial agents. Int. J. Antirnicrob. Agents, 9, 73-82. Bugnon, D., Potel, G., Xiong Y. Q. et aL (1996). In vivo antibacterial effects of simulated human serum profiles of oncedaily versus thrice-daily dosing of amikacin in a Serratia marcescens endocarditis experimental model. Antimicrob. Agents Chemother., 40, 1164-1169. Carbon, C. (1991). Impact of the antibiotic dosage schedule on efficacy in experimental endocarditis. Scand. J. Infect. Dis., 74, 163-172. Carbon, C. (1993). Experimental endocarditis: a review of its relevance to human endocarditis.J. Antimicrob. Chemother., 31, 71-85. Carbon, C., Cr~mieux A. C., Fantin B. (1995). Pharmacokinetic and pharmacodynamic aspects of therapy of experimental endocarditis. In: Infectious Disease Clinics of North America, Infective Endocarditis (eds Wilson, W. R., Steckelberg, J. M.), pp. 37-51. W. B. Saunders, Philadelphia, PA. Carrisoza, J., Kaye, D. (1976). Antibiotic synergism in enterococcal endocarditis.J. Lab. Clin. Med., 88, 132-141. Contrepois, A., Vallois, J. M., Garaud, J. J. et aL (1986). Kinetics and bactericidal effect of gentamicin and latamoxef (moxalactam) in experimental Escherichia coli endocarditis. J. Antimicrob. Chemother., 17, 227-237. Cozens, R. M., Tuomanen, E., Tosch, W., Zak, O., Suter, J., Tomasz, A. (1986). Evaluation of the bactericidal activity of]3lactam antibiotics on slowly growing bacteria cultured in the chemostat. Antimicrob. Agents Chemother., 29, 797-802. Cr~mieux, A. C., Mazi~re, B., Vallois, J. M. et aL (1989). Evaluation of antibiotic diffusion into cardiac vegetations by quantitative autoradiography. J. Infect. Dis., 159, 938-944. Dall, L., Barnes, W. G., Lane J. W., Mills, J. (1987). Enzymatic modification of glycocalyx in the treatment of experimental endocarditis due to viridans streptococci. J. Infect. Dis., 156, 736-740. Dankert, J., Van Der Werff, J., Zaat, S. A., Joldersma, W., Klein, D., Hess, J. (1995). Involvement of bactericidal factors from thrombin-stimulated platelets in clearance of adherent viridans streptococci in experimental infective endocarditis. Infect. Immun., 63, 663-671. Durack, D. T., Beeson, P. B. (1972). Experimental bacterial endocarditis. I: Colonization of a sterile vegetation. Br. J. Exp. PathoL, 53, 44-49. Durack, D. T., Petersdorf, R. G. (1973). Chemotherapy of experimental infective endocarditis. I: Comparison of commonly

RABBIT MODEL OF BACTERIAL ENDOCARDITIS

recommended prophylaxis regimens. ]. Clin. Invest., 52, 592-598. Durack, D. T., Beeson, P. B., Petersdorf, R. G. (1973). Experimental bacterial endocarditis. III: Production and progress of the disease in rabbits. Br. J. Exp. Pathol., 54, 142-151. Durack, D. T., Starkebaum, M. K., Petersdorf, R. G. (1977). Chemotherapy of experimental streptococcal endocarditis. VI: Prevention of enterococcal endocarditis. J. Lab. Clin. Med., 90, 171-179. Durack, D. T., Lukes, A. S., Bright, D. K., the Duke Endocarditis Service (1994). New criteria for diagnosis of infective endocarditis: utilization of specific echocardiographic findings. Am. J. Med., 96, 200-209. Fantin, B., Carbon, C. (1992). In vivo antibiotic synergism: contribution of animal models. Antimicrob. Agents Chemother., 36, 907-912. Fantin, B., Pangon, B., Potel, G. et al. (1989). Ceftriaxonenetilmicin combination in single-daily-dose treatment of experimental Escherichia coli endocarditis. Antimicrob. Agents Ckemother., 33, 767-770. Fantin, B., Leclerc, R., Duval, J., Carbon, C. (1993). Fusidic acid alone or in combination with vancomycin for therapy of experimental endocarditis due to methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Ckemother., 37, 2466-2469. Fantin B., Leclercq, R., Merle, Y. et al. (1995). Critical influence of resistance to streptogramin B-type antibiotics on activity of RP 59500 (quinupristin/dalfopristin) in experimental endocarditis due to Staphylococcus aureus. Antimicrob. Agents Chemother., 39, 400-405. Freedman, L. R., Valone, J. (1979). Experimental infective endocarditis. Prog. Cardiovasc. Dis., 22, 169-180. Frehel, C., Hellio, R., Cr~mieux, A. C., Contrepois, A., Bouvet, A. (1988). Nutritionally variant streptococci develop ultrastrucrural abnormalities during experimental endocarditis. Microb. Pathog., 4, 247-255. Garrison, P. K., Freedman, L. R. (1970). Experimental endocarditis. I: Staphylococcal endocarditis in rabbits resulting from placement of a polyethylene catheter in the right side of the heart. Yale J. Biol. Med., 42, 394-410. Gutschik, E., Christensen, N. (1978a). Experimental endocarditis in rabbits. I: Techniques and spontaneous course of nonbacterial thrombotic endocarditis. Acta Pathol. Microbiol. Immunol. Scand. Sect. B Microbiol., 86, 215-221. Gutschik, E., Christensen, N. (1978b). Experimental endocarditis in rabbits. II: Course of untreated Streptococcus faecalis infection. Acta Pathol. Microbiol. Immunol. Scand. Sect. B Microbiol., 86, 223-228. Heraief, E., Glauser, M. P., Freedman, L. R. (1982). Natural history of aortic valve endocarditis in rats. Infect. Immun., 37, 127-131. Hessen, M. T., Pitsakis, P. G., Levison, M. E. (1989). Postantibiotic effect of penicillin plus gentamicin versus Enterococcus faecalis in vitro and in vivo. Antimicrob. Agents Ckemother., 33, 608-611.

617

Mohler, J., Fantin, B., Mainardi, J. L., Carbon, C. 1994. Influence of antimicrobial therapy on kinetics of tumor necrosis factor levels in experimental endocarditis caused by Klebsiella pneumoniae. Antimicrob. Agents Chemother., 38, 1017-1022. Pelletier, L. L., Petersdorf, R. G. (1976). Chemotherapy of experimental streptococcal endocarditis. V: Effect of duration of infections and retained intracardiac catheter on response to treatment. J. Lab. Clin. Meal., 87, 692-702. Pelletier, L. L., Durack, D. T., Petersdorf, R. G. (1975). Chemotherapy of experimental streptococcal endocarditis. IV: Further observations on prophylaxis. J. Clin. Invest., 56, 319-330. Perlman, B. B., Freedman, L. R. (1971a). Experimental endocarditis. II: Staphylococcal infection of the aortic valve following placement of a polyethylene catheter in the left side of the heart. Yale J. BioL Meal., 44, 206-213. Perlman, B. B., Freedman, I. R. (1971b). Experimental endocarditis. III: Natural history of catheter induced staphylococcal endocarditis following catheter removal. Yale J. BioL Meal., 44, 214-224. Potel, G., Chau, N. P., Pangon, B. etaL (1991). Single daily dosing of antibiotics: importance of in vivo killing rate, serum half life, and protein binding. Antimicrob. Agents Chemother., 35, 2085-2090. Ribbert, M. W. H. (1885). Beitrage zur Localisation der Infectionskrankheiten. Dtsch. Med. Wochenschr., 11,717-719. Sande, M. A., Irwin, R. G. (1974). Penicillin-aminoglycoside synergy in experimental Streptococcus viridons endocarditis. J. Infect. Dis., 129, 572-576. Scheld, W. M. (1987). Therapy of streptococcal endocarditis: correlation of animal models and clinical studies. J. Antimicrob. Chemother., 20 (Suppl. A), 71-85. Scheld, W. M., Valone, J. A., Sande, M. A. (1978). Bacterial adherence in the pathogenesis of infective endocarditis. J. Clin. Invest., 61, 1394-1404. Tanphaichitra, D., Ries, K., Levison, M. E. (1974). Susceptibility to Streptococcus viridans endocarditis in rabbits with intracardiac pacemaker electrodes or polyethylene tubing. J. Lab. Clin. Med., 84, 726-730. Tunkel, A. R., Scheld, W. M. (1992). Experimental models of endocarditis. In: Infective Endocarditis, 2nd edn (ed Kaye D.), pp. 37-56. Raven Press, New York. Vignes, S., Fantin, B., Elbim, C., Walker, F., Gougerot-Pocidalo, M. A., Carbon, C. (1995). Critical influence of timing of administration of granulocyte colony-stimulating factor on antibacterial effect in experimental endocarditis due to Pseudomonas aeruginosa. Antimicrob. Agents Chemother., 39, 2702-2707. Xiong, Y. Q., Caillon J., Kergueris, M. F. et al. (1997). Adaptative resistance of Pseudomonas aeruginosa induced by aminoglycosides and killing kinetics in a rabbit endocarditis model. Antimicrob. Agents Chemother., 41,823-826. Yeaman, M. R. (1997). The role of platelets in antimicrobial host defense. Clin. Infect. Dis., 25, 951-970.

This Page Intentionally Left Blank

Chapter 73

Infant Rat Model of Acute Meningitis U. Vogel and M. Frosch

Background of human infection The 1997 epidemic of meningococcal meningitis in Africa again demonstrated that bacterial meningitis continues to be a major world-wide health problem. Despite the availability of potent antimicrobial agents, adjunctive glucocorticoid therapy and vaccines (Quagliarello and Scheld, 1997), the case fatality rates are considered to be 10% and more, even in the northern hemisphere, and persistent neurological sequelae in survivors are frequent (Unhanand et aL, 1993). Causative agents of bacterial meningitis are Esckerickia coli K1, group B streptococci, Neisseria rneningitidis, Streptococcus pneumoniae and Haemopkilus influenzae, with an age-related distribution of bacterial meningitis due to a specific pathogen (Wenger et al., 1990). There have been tremendous research efforts on the pathophysiology of disease and the molecular biology of pathogenicity; however, questions of outstanding interest, e.g., how the bacteria pass the blood-brain barrier, could not be answered until now. Antibiotic therapy of the disease remains to be a matter of discussion, because resistance to standard antibiotics has become prevalent in certain parts of the world (Marton et al., 1991), and controversy exists with regard to the implementation of adjunctive corticosteroid therapy (Quagliarello and Scheld, 1997). The dramatic decline of Haemophilus influenzae meningitis, due to widespread vaccination (Adams et al., 1993), again illustrates the need for potent vaccines directed against other major causes of bacterial meningitis, e.g., against serogroup B meningococci.

Background of model In order to analyse the pathophysiology of bacterial meningitis, and to evaluate the therapeutic effects of antibiotics and immunization, efforts were made to establish suitable animal models, one of which was the infant rat model of bacterial meningitis presented in the 1970s (Smith et aL, 1973; Glode et aL, 1977; Moxon et aL, 1977; Ferrieri et aL, 1980; Rodriguez et aL, 1991). Because of the narrow host range of the causative agents of bacterial meningitis and the restricted susceptibility of hosts depending on their age Handbook of Anirnal Models of Infection

ISBN 0-12-775390-7

(Smith et aL, 1973; Glode et aL, 1977), the infant rat model proved to be an approach followed until now. The animals used in the model exhibit a disease with features that closely resemble human disease. 1. The development of bacteraemia and meningitis is frequently inversely related to age (Smith et aL, 1973; Glode et aL, 1977; Bortolussi et aL, 1978; Salit et aL, 1984). 2. Infection may be achieved by the natural route, e.g., following intranasal colonization (Moxon et aL, 1977; Salit et aL, 1984) or oral ingestion (Glode et aL, 1977; Moxon et aL, 1977). 3. Meningitis occurs as a result ofbacteraemia (Smith et aL, 1973; Moxon et aL, 1977; Ferrieri et aL, 1980; Rodriguez et aL , 1991). 4. Histopathological findings close to those demonstrated in infected humans have been reported (Smith et aL, 1973; Ferrieri et aL, 1980; Wiedermann et aL, 1986; Kaplan et al., 1989; Rodriguez et aL, 1991; Kim et aL, 1995). There are now several prototype studies and reviews (Smith et aL, 1973; Moxon et aL, 1974, 1977; Glode et aL, 1977; Bortolussi et aL, 1978; Ferrieri et aL, 1980; Salit et aL, 1984; Martin et aL, 1986; Tauber and Zwahlen, 1994; Rodriguez et aL, 1991; Kim et aL, 1995), which demonstrate an extensive knowledge of the handling of the animals. Natural infection routes have been reported (Glode et aL, 1977; Moxon et aL, 1977), as well as repeated sampling of blood and cerebrospinal fluid (CSF) from an individual animal (Ferrieri et aL, 1980; Kim et aL, 1984; Kim, 1985). The model has been used for analysing the efficacy of antibiotic treatment (Kim et aL, 1984, 1995; Kim, 1985; Kaplan et aL, 1989) and passive immunization (Greenberg et aL, 1989). Furthermore, valuable information could be drawn from studies investigating the virulence of genetically engineered mutants (Vogel et aL, 1996a).

Animal species and preparation Most workers purchase specific-pathogen-free, pregnant rats from commercial suppliers. Exact prediction of the Copyright © 1999AcademicPress All rights of reproduction in any form reserved

620

date of birth can be offered. The rats should give birth to the pups not earlier than 3 days after arrival. Wistar and Sprague-Dawley rats are most frequently used. If several litters are included in the experiments, the pups can be randomly distributed between the mothers (Rodriguez et aL, 1991). To our knowledge, the influence of sex on the course of bacterial meningitis in the infant rat has not been studied. The pups are used for infection at the age of approximately 5 days, when they weigh 10-20 g. Significant delay in the time of infection results in reduced rates of infected animals (Smith et al., 1973; Glode et aL, 1977; Ferrieri et aL, 1980; Salit et aL, 1984).

U. Vogel and M. Frosch

I n t r a p e r i t o n e a l infection

A volume of 1001~1 of a suspension of bacteria in sterile saline is injected intraperitoneally (i.p.) using a 26 G or 30 G needle attached to a tuberculin syringe. The head and hindlegs should be carefully immobilized with the index and little fingers (Figure 73.1).

Preparation of inocula Bacterial species used in the infant rat model of bacterial meningitis should be stored at-70°C in broth (e.g. tryptic soy broth or brain-heart infusion broth) with 10% glycerol. From the permanent stocks, bacteria are streaked on to appropriate agar plates for overnight growth, or an overnight broth culture is performed. Five to 10 small agarplate-grown colonies are either directly resuspended in saline and diluted further to achieve the desired infectious dose (Vogel et al., 1996a), or they are grown to midlogarithmic growth phase for another couple of hours in broth (Kim, 1985). Overnight broth cultures should be diluted in broth the next morning, in order to achieve a mid-logarithmic growth phase by continuous incubation (Saukkonen et al., 1988). Thereafter, the bacteria should be washed several times with 0.9% saline or phosphatebuffered saline (PBS). Inoculum sizes reported in the literature vary tremendously and depend on bacterial species, strain, age of animals, challenge route and aim of the study.

Figure 73.1

Intraperitoneal challenge of an infant rat with a

30 G needle connected to a tuberculin syringe.

Intranasal infection

Intranasal infection has been described in detail by Moxon et aL (1974, 1977). Briefly, 10-20~1 is slowly injected with a 23 G or 25 G needle into the anterior nares (Moxon et aL,

1974).

Infection process Five modes of challenge of infant rats with bacteria have been described: • the intraperitoneal route, which is easy to perform and which yields very reproducible results (Smith et al., 1973; Ferrieri et aL, 1980; Saukkonen, 1988). • the intranasal route (Moxon et aL, 1974, 1977), which mimics natural infection by Haemophilus influenzae and Neisseria mening#idis, both of which spread to the bloodstream from the nasopharynx; • oral infection, which mimics natural infection by E. coli K1 (Glode et aL, 1977; Moxon et aL, 1977), • subcutanous infection (Kim, 1985; Greenberg et aL, 1989); • intracisternal infection (Kim et aL, 1995).

Oral infection

Oral infection has been described as an effective and natural challenge route for the E. coli K1 meningitis in infant rats (Moxon et al., 1977). Application of 103-104 cfu via an orogastric tube resulted in bacteraemia in half of the animals (Moxon et aL, 1977). A comparison reported by Moxon et aL of the intranasal and the oral route of challenge revealed that the natural route was most effective for both H. influenzae (intranasal) and E. coli (oral). A detailed description of the technique of oral infection was provided in a separate paper by the same group. An 0.061 cm gastric tube was used, which was placed directly in the stomach (Glode et aL, 1977). There have been attempts to orally infect the pups by letting them suck on pipette tips (Ferrieri et aL, 1980); however, group B streptococcal bacteraemia at least was not achieved by this method.

INFANT RAT MODEL OF ACUTE MENINGITIS

Subcutaneous infection

Subcutaneous infection was used in studies on the group B streptococcal (GBS) and the staphylococcal infant rat model (Kim, 1985; Greenberg et aL, 1989). The variability of the blood cfu counts seemed to be unacceptably high in the GBS study (Kim, 1985). Nevertheless, the method appears to be technically simple and mimics possible natural routes of infection.

Intracisternal infection

For technical reasons, intracisternal infection is more frequently used in the rabbit model than in the infant rat model of bacterial meningitis (see Chapter 75). Nevertheless, intracisternal challenge of infant rats has been reported for GBS infection (Kim et aL, 1995). The animals were challenged by an intracisternal injection of 10 lt.tl of a bacterial suspension using a 32G needle. Bypass of the primary steps of pathogenesis, i.e., entering the blood stream, systemic spread and crossing the blood-brain barrier is achieved. Using intracisternal infection of GBS, meningitis with inflammation of the subarachnoid space and of the ventricles, as well as vasculopathy and neuritis, was efficiently induced (Kim et aL, 1995).

Repeated infection

Because of interspecies and interstrain variability in bacterial virulence for infant rats, repeated infection should be considered if there are difficulties in achieving appropriate levels of bacteraemia or meningitis. A schedule of three infections performed at 24 hour intervals gave rise to pneumococcal meningitis with one out of six pneumococcal strains tested (Rodriguez et aL, 1991).

Enhancers of infection

Iron dextran has been used to supplement meningococci with iron during systemic spread in the infant rat. Iron dextran is injected i.p. in a volume of 100 ~1 at a dosage of 250~tg/g body weight (Salit et aL, 1984). Iron dextran is given simultaneously with the application of the bacteria. In our hands, untreated animals developed a moderate meningococcal bacteraemia of 103cfu/ml 14 hours after an i.p. challenge with 105cfu. In contrast, two of three irondextran-treated animals died; the third was severely ill, with 106cfu/ml blood (unpublished data). Since bacteraemia is a prerequisite of the development of meningitis, iron supplementation has the potential to increase the rates of meningitis achieved in experimental infection. An intriguing finding by Novicki et aL (1995) points to an alternative enhancer: gonococci, which do not cause systemic infection in infant rats, were protected from the

621

bactericidal effects of infant rat serum by the presence of human complement factor Clq. Furthermore, human Clq acted as an enhancer of the systemic infection when given i.p. prior to infection (Nowicki et aL, 1995). However, the mechanism of Clq-promoted gonococcal virulence remains obscure.

Keeping animals after infection

Keeping the pups with their mothers during the course of the disease is desirable. If separation is necessary, the animals should be kept warm and given glucose-water by tube to prevent dehydration (Glode et aL, 1977). The oral route of infection is especially prone to interlitter transmission (Glode et aL, 1977), and separation should therefore be taken into consideration. Separation furthermore results in colostrum deprivation, which has been described to increase the number of bacteraemic pups (Glode et aL, 1977), and thus can be considered as a potential enhancer of infection.

Key parameters to monitor infection Monitoring of disease includes (1) sampling and analysis of body fluids, (2) post-mortem analysis of organs and tissues and (3) additional tests such as peripheral blood cell monitoring or behavioural examination of reconvalescent animals.

Sampling Sampling o f blood

Several reports on the infant rat model of bacterial meningitis demonstrated that bacteraemia is indispensable for the development of meningitis (Moxon et aL, 1977; Bortolussi et aL, 1978; Ferrieri et aL, 1980; Saukkonen, 1988). Thus, careful analysis of bacterial counts in the blood is absolutely necessary for the interpretation of meningitis in the infant rat. Several methods have been described of blood sampling, which is performed either intra vitam for repeated sampling or while animals are sacrificed. In one study, intra-uitam monitoring was performed by external jugular venipuncture (Kim et aL, 1984), and was repeated daily for 5 days (Kim, 1985). Other veins accessable for puncture are the tail veins and the lateral marginal vein of the hind leg (Saukkonen et aL, 1988). Ferrieri et aL (1980) reported repeated amputation of the pups tails to consecutively sample blood in 10-50 lttl amounts. If the pups are sacrificed by decapitation, sampling of blood is very easy and volumes of 500 lttl can be obtained (Vogel et aL, 1996a). Following sacrifice of animals with a lethal dose of ether (Ferrieri et aL, 1980) or intraperitoneal pentobarbital

622

(Rodriguez et aL, 1991), blood is obtained by cardiac puncture (Ferrieri et aL, 1980).

Sampling of cerebrospinal fluid (CSF) CSF is obtained either intra vitam, which was reported to be repeatedly possible to monitor the course of disease in an individual animal' (Kim, 1985), or immediately postmortem, e.g. following sacrifice with ether (Ferrieri et al., 1980). The unanaesthetized rat is held in an immobile position with the head flexed forward. A 30G needle is inserted into the cisterna magna through the open fontanelle, which is identified by palpation (Figure 73.2). CSF appears in the hub of the needle. The needle is then removed, and the CSF collected in the hub can be extracted using a tuberculin syringe or allowed to fill a small glass capillary tube (Saukkonen et al., 1988; Tauber and Zwahlen, 1994). Approximately 5-20~1 of CSF will be obtained by this method.

Monitoring of blood contamination of CSF. Blood contamination of sampled CSF occurs during the insertion of the needle into the cisterna magna. Therefore, most workers use 30G needles in order to minimize the trauma. The problem of blood contamination of CSF is mentioned in some reports (Glode et al., 1977); however, the definition of meningitis in the infant rat model as the detection of bacteria in the CSF occurs frequently. One should be aware that contamination of a pup's sample of 10~1 CSF with 0.01 lal blood is not visible macroscopically. However, in an animal with a level of bacteraemia of 106cfu/ml, this contamination would give rise to 10 cfu/10~tl CSF or 103cfu/ml CSE This is well within levels reported as proving bacterial meningitis in some papers. It is crucial, therefore, to monitor the blood contamination of the CSE This can be achieved by the use of Neubauer's chambers for

U. Vogel and M. Frosch

counting of the red blood cells in serial dilutions of the CSF and the blood. Nassifet aL used haemocytometers for more rapid processing of the samples (Nassif et al., 1992). We recently established the use of test strips that are commercially available for the quantitative determination of haematuria (Vogel et aL, 1996b). Serial dilutions of both CSF and blood are tested for intact erythrocytes, which give rise to coloured spots due to an enzymatic reaction (Figure 73.3). We proposed a meningitis factor, which is defined as the ratio between the total number of CFU/ml CSF and that due to blood contamination. Meningitis was assumed, when the meningitis factor was at least five (Vogel et aL, 1996b). The procedure proved to be rapid, and only minimal amounts of CSF were required for determination of the level of blood contamination.

~ii i i i i i i i i i i!!ii i i i i !i i i i i i i i~i i i i ~i i i i~!~ii i i i i i i ~i ~i~i~i~i~i i~i i i i i ~i~i i i i i i i i i i i i

:....~i!~!~i~!i~ili!i~! !i~i!!ii!~ii i~i!i~!iii~i!ii~

Figure 73.3 Use of Sangur TM test strips for the detection of blood contamination of the CSF. CSF was diluted 1:300 and 1:30000, respectively, and 10 ~1 of the diluted CSF were dropped on to the test strip fields. Coloured spots, which theoretically represent one erythrocyte, became visible after approximately 1 minute. In this example, one spot appeared in the case of a dilution of 1:30 000. Thus, approximately 106.~ red blood cells (RBC) were present per millilitre of CSF. Assuming a number of 109.4 RBC/ml, which was determined by Sangur test strips in infant rat blood (Vogel et al., 1996b), the example is indicative of blood contamination of approximately 1:800.

Intraperitoneal lavage

Figure 73.2 Sampling of cerebrospinal fluid (CSF)" a 30G needle is inserted into the cisterna magna through the fontanelle.

The peritoneal cavity is the site of the primary proliferation of bacteria if intraperitioneal challenge is applied (Saukkonen et al., 1988). The number of intraperitoneal bacteria is determined by intraperitoneal lavages with 0.5-1.0ml saline injected into the peritoneal cavity (Saukkonen et al., 1988; Vogel et al., 1996a). Following careful massage of the abdomen, approximately 100-300 lal of the fluid can be recovered and processed for plating on agar plates for the quantitative determination of bacterial

INFANT RAT MODEL OF ACUTE MENINGITIS

623

counts. Since peritoneal phagocytes are the first line of cellular defence against infection, it is informative to analyse the phagocytosis of bacteria by peritoneal phagocytes (Vogel et aL, 1996a). This can be achieved by centrifugation of 200-3001Ltl lavage fluid on to glass slides, e.g. with a Shandon cytospin 3 centrifuge (Life Sciences International, UK), and staining of the cells with appropriate dyes (Vogel et aL, 1996a).

Brain pathology

Histology of the brain and the meninges is used as a definite proof of bacterial invasion of the infant rat's central nervous system. Furthermore, the cellular response to a bacterial pathogen is analysed by histology. Although studies on H.influenzae-b-induced meningitis (Smith et aL, 1973; Moxon et aL, 1974) and on pneumococcal meningitis demonstrated the recruitment of polymorphonuclear leukocytes and monocytes in 5-day-old infant rats, conflicting results were obtained using group B streptococci as the infective pathogen (Ferrieri et aL, 1980), in which case cellular infiltration of the meninges was demonstrated exclusively in animals older than 5 days. The authors suggested that chemotaxis is impaired at the age of 5 days. Furthermore, despite the presence of bacteria in the meninges of intraperitoneally infected Wistar rats, we were not able to demonstrate cellular infiltration in the meningococcal system (unpublished data, Figure 73.4). Histology is performed on complete heads of the infant rats, which are fixed in 10% buffered formaldehyde and embedded in paraffin. Appropriate dyes are, for instance, haematoxylin and eosin (H & E) or Giemsa (Smith et aL, 1973). Alternatively, cryosections can be tried, which are very well suited for immunohistology. In our hands, however, it was difficult to maintain the structure of the brain tissue and the meninges in cryosections, resulting in large gaps between the brain tissue and the pachymeninx. Smith et aL proposed the use of a peroxidase assay of sonically treated tissue preparations to quantify the brain polymorphonuclear infiltration by a spectrophotometric assay (Smith et aL, 1974). The assay takes advantage of the fact that myeloperoxidase is present in polymorphonuclear cells but not in H. influenzae and in brain tissue. Another way to demonstrate leukocyte infiltration is scanning or transmission electron microscopy of the subarachnoid space, which has been used to study the meningeal inflammatory response in the H. influenzae model (Merchant et aL, 1981, 1982). Vasculopathy and neuronal injury was studied extensively in one study of group B streptococcal meningitis (Kim et aL, 1995).

Additional m a r k e r s of infection

To complete the understanding of bacterial meningitis in the infant rat, parameters other than brain pathology and

d PPq

..... [ 7 :i~:~:

~

........ ~.............

~"[ [}i

, ~. . . .

: ~ ~:~i',~...,=...,~ ~ ..... i~,i.......~ : ~ ~ ] ............. ~,~

Figure 73,4 Haematoxylin-and-eosin-stained sections of the brain of a 6-day-old infant rat 30 hours after experimental infection with serogroup B meningococci. (A) Detail of a section through the sagittal sinus (a), with adjacent subarachnoidal space (b) and cortex (c). The arrow indicates the presence of meningococci in the subarachnoidal space. (B) Section through the superior frontal subarachnoidal space (b), which is infiltrated by meningococci (arrow), and the adjacent cortex (c). The sections demonstrate that, in the serogroup B meningococcal meningitis of the infant rat, cellular infiltration of the subarachnoidal space is virtually absent.

brain or blood bacterial counts should be included. Some studies analysed bacterial counts in organs of secondary interest, such as spleen and liver (Smith et al., 1973). The same study also presented the use of behavioural tests to analyse cerebral dysfunction in survivors of the infection, as well as total DNA content analysis to study the severity of brain damage following infection. Clinical presentation (seizures, activity, righting) and body weight should be determined during the course of infection (Kim et aL, 1995). Using blood smears, we were able to demonstrate that the infant rat's peripheral blood cell counts rapidly reacted to meningococcal infection. Within 7 hours of a lethal infection with serogroup B meningococci, peripheral leukocyte counts declined to a third of control values, which

U. Vogel and M. Frosch

624

was accompanied by an increase of the number of normoblasts (unpublished data). Taking into account that we were not able to demonstrate meningeal inflammation in infant rats infected with meningococci, the rapid decline of peripheral leukocytes probably explains the lack of cerebral recruitment of leukocytes.

Antimicrobial therapy There are some reports in the literature demonstrating the effectiveness of antimicrobial therapy in the infant rat model of bacterial meningitis. Intraperitoneal injection of cefotaxime and latamoxef was proved to be bactericidal for E. coli K1 in both CSF and blood (Kim et al., 1984). Imipenem was equally effective against group B streptococcal sepsis and meningitis (Kim, 1985). Adjunctive corticosteroid therapy prevented CSF inflammation induced by H. influenzae or group B streptococci (Kaplan et aL, 1989; Kim et aL, 1995). However, the effectiveness of ampicillin was reduced by steroid administration (Kaplan et aL, 1989). Using the infant rat model, a beneficial effect of subinhibitory concentrations of polymyxin B, which binds to the lipid A fraction of the lipopolysaccharide molecule, has been postulated, if polymyxin B was used alone or in combination with ampicillin for the treatment of Haemophilus meningitis (Walterspiel et al., 1986). Accordingly, inactivation of H. influenzae LOS by polymyxin B also resulted in reduced meningeal inflammation in rabbits (Syrogiannopoulos et al., 1988) and in blocking of the detrimental effects of H. influenzae LOS on brain endothelial cells in vitro (Patrick et aL, 1992). Nevertheless, because of the limited number of studies on the effects of antibiotics in the infant rat model of bacterial meningitis, and the varying causative agents and therapeutical approaches used, general statements about combination therapy, pharmacodynamics, tissue penetration, etc. cannot be made in this chapter.

Pitfalls of the model and its contribution to infectious disease therapy As highlighted in the above paragraph, there have been some studies demonstrating the efficiency of antimicrobial therapy and adjuvant corticosteroid therapy in the infant rat, indicating that the model has the potential to be a test for antimicrobial therapy. However, there are several pitfalls that have to be addressed if the model is to be used for the evaluation of therapeutical approaches. 1. Challenge routes that lead to severe bacteraemia prior to meningitis often result in multiorgan failure and death, whereas intracisternal injection of bacteria simply bypasses major steps of the pathogenesis (Kim et aL, 1995).

2. To our knowledge, neither is the interaction of bacteria with the infant rat's blood-brain barrier understood nor is there a large body of evidence supporting the suggestion that the pathophysiological and pharmacological features of the infected human neonate's blood-brain barrier resemble those of the infant rat. The same holds true for the immunology of the infant rat, which has been discussed above concerning the variable recruitment of PMN to the CNS. Another example is the tremendous effect of human complement factor Clq in the infant rat model of gonococcal infection (Nowicki et aL, 1995), which demonstrates that there is a divergence of central effectors of the different hosts' immune systems. 3. The small size of the animals provides the investigator with problems in several aspects of the model, including the route of drug application and the monitoring of essential parameters such as drug concentrations in CSF and blood, bacterial load and intracranial pressure. Novel routes of drug application cannot be tested in the infant rat model of bacterial meningitis. Sophisticated methods of monitoring CSF dynamics during infection and therapy will be studied in the rabbit model (Lauritsen and Oberg, 1995) or in the adult rat (Koedel et aL, 1996), rather than in the infant rat model of bacterial meningitis. The strength of the infant rat model is its contribution to our understanding of bacterial virulence and the pathophysiology of menigitis. It is not surprising that the model's impact on antimicrobial therapy has been low, and will be restricted to the primary testing of completely new antimicrobial substances or, more generally, new concepts of treatment. Most causative agents of bacterial meningitis, like meningococci, are restricted to the human host. Therefore, recent developments in vaccine design for serogroup B meningococci were tested in primates, in order to mimic the exclusive natural host of meningococci as closely as possible (Devi et aL, 1997; Fusco et aL, 1997; Zollinger et aL, 1997). Finally, for the study of bacterial meningitis, the implementation of advances in animal models, like the use of genetically deficient or transgenic animals or the use of severely immunocompromised animals grafted with human phagocytes, is still restricted to mice (Tan et aL, 1995; Westerink et aL, 1997).

References Adams, W. G., Deaver, K. A., Cochi, S. L. et al. (1993). Decline of childhood Haemophilus influenzae type b (Hib) disease in the Hib vaccine era. J. A. M. A., 269, 221-226. Bortolussi, R., Ferrieri, P., Wannamaker, L. W. (1978). Dynamics of Escherichia coli infection and meningitis in infant rats. Infect. Immun., 22, 480-485. Devi, S. J., Zollinger, W. D., Snoy, P. J. et al. (1997). Preclinical evaluation of group B Neisseria mening#idis and Escherichia coli K92 capsular polysaccharide-protein conjugate vaccines in juvenile rhesus monkeys. Infect. Immun., 65, 1045-1052.

INFANT RAT MODEL OF ACUTE MENINGITIS

Ferrieri, P., Burke, B., Nelson, J. (1980). Production ofbacteremia and meningitis in infant rats with group B streptococcal serotypes. Infect. Immun., 27, 1023-1032. Fusco, P. C., Michon, F., Tai, J. Y., Blake, M. S. (1997). Preclinical evaluation of a novel group B meningococcal conjugate vaccine that elicits bactericidal activity in both mice and nonhuman primates. J. Infect. Dis., 175,364-372. Glode, M. P., Sutton, A., Moxon, E. R., Robbins, J. B. (1977). Pathogenesis of neonatal Escherichia coli meningitis: induction of bacteremia and meningitis in infant rats fed E. coli K1. Infect. Immun., 16, 75-80. Greenberg, D. P., Bayer, A. S., Cheung, A. L., Ward, J. I. (1989). Protective efficacy of protein A-specific antibody against bacteremic infection due to Staphylococcus aureus in an infant rat model. Infect. Immun., 57, 1113-1118. Kaplan, S. L., Hawkins, E. P., Kline, M. W., Patrick, G. S., Mason, E. O. Jr (1989). Invasion of the inner ear by Haemophilus influenzae type b in experimental meningitis. J. Infect. Dis., 159, 923-930. Kim, K. S. (1985). Efficacy of imipenem in experimental group B streptococcal bacteremia and meningitis. Chemotherapy, 31, 304-309. Kim, K. S., Manocchio, M., Bayer, A. S. (1984). Efficacy of cefotaxime and latamoxef for Escherichia coli bacteremia and meningitis in newborn rats. Chemotherapy, 30, 262-269. Kim, Y. S., Sheldon, R. A., Elliott, B. R., Liu, Q., Ferriero, D. M., Tauber, M. G. (1995). Brain injury in experimental neonatal meningitis due to group B streptococci. J. Neuropatkol. Exp. Neurol., 54, 531-539. Koedel, U., Bernatowicz, A., Frei, K., Fontana, A., Pfister, H. W. (1996). Systemically (but not intrathecally) administered IL-10 attenuates pathophysiologic alterations in experimental pneumococcal meningitis. J. Immunol., 157, 5185-5191. Lauritsen, A., Oberg, B. (1995). Adjunctive corticosteroid therapy in bacterial meningitis. &and. J. Infect. Dis., 27, 431-434. Martin, P. V., Laviotola, A., Ohayon, H., Riou, J. Y. (1986). Presence of a capsule in Neisseria lactamica, antigenically similar to the capsule of N. mening#idis. Ann. Inst. Pasteur Microbiol., 137A, 279-285. Marton, A., Gulyas, M., Munoz, R., Tomasz, A. (1991). Extremely high incidence of antibiotic resistance in clinical isolates of Streptococcus pneumoniae in Hungary. J. Infect. Dis., 163, 542-548. Merchant, R. E., Willard, J. E., Daum, R. S. (1981). Ultrastructural histopathology of experimental Haemopkilus influenzae type b. Meningitis in the infant rat. I. Leukocytes of the spinal leptomeninges. J. Submicrosc. Cytol., 13, 501-514. Merchant, R. E., Daum, R. S., Willard, J. E. (1982). Ultrastructural histopathology of experimental Haemophilus influenzae type b meningitis in the infant rat. II. Phagocytosis and lysis of microorganisms by leptomeningeal leukocytes. J. Submicrosc. Cytol., 14, 215-225. Moxon, E. R., Smith, A. L., Averill, D. R., Smith, D. H. (1974). Haemophilus influenzae meningitis in infant rats after intranasal inoculation.J. Infect. Dis., 129, 154-162. Moxon, E. R., Glode, M. P., Sutton, A., Robbins, J. B. (1977). The infant rat as a model of bacterial meningitis. J. Infect. Dis., 136 (Suppl.), S186-S190. Nassif, X., Mathison, J. C., Wolfson, E., Koziol, J. A., Ulevitch, R. J., So, M. (1992). Tumour necrosis factor alpha antibody protects against lethal meningococcaemia. Mol. Microbiol, 6, 591-597.

625

Nowicki, S., Martens, M. G., Nowicki, B. 1. (1995). Gonococcal infection in a nonhuman host is determined by human complement Clq. Infect. Immun., 63, 4790-4794. Patrick, D., Betts, J., Frey, E. A., Prameya, R., Dorovini Zis, K., Finlay, B. B. (1992). Haemophilus influenzae lipopolysaccharide disrupts confluent monolayers of bovine brain endothelial cells via a serum-dependent cytotoxic pathway. ]. Infect. Dis., 165, 865-872. Quagliarello, V. 1., Scheld, W. M. (1997). Treatment of bacterial meningitis. N. Engl. J. Med., 336, 708-716. Rodriguez, A. F., Kaplan, S. L., Hawkins, E. P., Mason, E. O. Jr (1991). Hematogenous pneumococcal meningitis in the infant rat: description of a model.J. Infect. Dis., 164, 1207-1209. Salit, I. E., Van Melle, E., Tomalty, L. (1984). Experimental meningococcal infection in neonatal animals: models for mucosal invasiveness. Can. ]. Microbiol., 30, 1022-1029. Saukkonen, K. (1988). Experimental meningococcal meningitis in the infant rat. Microb. Pathog, 4, 203-211. Saukkonen, K. M., Nowicki, B., Leinonen, M. (1988). Role of type 1 and S fimbriae in the pathogenesis ofEscherichia coli O 18 : K1 bacteremia and meningitis in the infant rat. Infect. Immun., 56, 892-897. Smith, A. L., Smith, D. H., Averill, D. R. Jr, Marino, J., Moxon, E. R. (1973). Production ofHaemopkilus influenzae b meningitis in infant rats by intraperitoneal inoculation. Infect. Immun., 8, 278-290. Smith, A. L., Rosenberg, I., Averill, D. R., Moxon, E. R., Stossel, T., Smith, D. H. (1974). Brain polymorphonuclear leukocyte quantitation by peroxidase assay. Infect. Immun., 10, 356-360. Syrogiannopoulos, G. A., Hansen, E. J., Erwin, A. L. et al. (1988). Haemophilus influenzae type b lipooligosaccharide induces meningeal inflammation. J. Infect. Dis., 157, 237-244. Tan, T. Q., Smith, C. W., Hawkins, E. P., Mason, E. O. Jr, Kaplan, S. L. (1995). Hematogenous bacterial meningitis in an intercellular adhesion molecule-l-deficient infant mouse model. J. Infect. Dis., 171,342-349. Tauber, M. G., Zwahlen, A. (1994). Animal models for meningitis. Methods Enzymol., 235, 93-106. Unhanand, M., Mustafa, M. M., McCracken, G. H. Jr, Nelson, J. D. (1993). Gram-negative enteric bacillary meningitis: a twenty-one-year experience.J. Pediatr., 122, 15-21. Vogel, U., Hammerschmidt, S., Frosch, M. (1996a). Sialic acids of both the capsule and the sialylated lipooligosaccharide of Neisseria meningitidis serogroup B are prerequisites for virulence of meningococci in the infant rat. Med. Microbiol. Immunol. Berl., 185, 81-87. Vogel, U., Steinmetz, I., Frosch, M. (1996b). Avoiding artifacts in the infant rat model for bacterial meningitis: use of Sangur test strips for the rapid quantification of blood contamination in cerebrospinal fluid. Med. Microbiol. Immunol. Berl., 185, 27-3O. Walterspiel, J. N., Kaplan, S. L., Mason, E. O. Jr, Walterspiel, J. W. (1986). Protective effect of subinhibitory polymyxin B alone and in combination with ampicillin for overwhelming Haemopkilus influenzae type B infection in the infant rat: evidence for in vivo and in vitro release of free endotoxin after ampicillin. Pediatr. Res., 20, 237-241. Wenger, J. D., Hightower, A. W., Facklam, R. R., Gaventa, S., Broome, C. V. (1990). Bacterial meningitis in the United States, 1986: report of a multistate surveillance study. The Bacterial Meningitis Study Group. J. Infect. Dis., 162, 1316-1323.

626

Westerink, M. A., Metzger, D. W., Hutchins, W. A. et aL (1997). Primary human immune response to Neisseria meningitidis serogroup C in interleukin-12-treated severe combined immunodeficient mice engrafted with human peripheral blood lymphocytes. J. Infect. Dis., 175, 84-90. Wiedermann, B. L., Hawkins, E. P., Johnson, G. S., Lamberth, L. B., Mason, E. O., Kaplan, S. L. (1986). Pathogenesis of

U. Vogel and M. Frosch

labyrinthitis associated with Haemophilus influenzae type b meningitis in infant rats. J. Infect. Dis., 153, 27-32. Zollinger, W. D., Moran, E. E., Devi, S. J., Frasch, C. E. (1997). Bactericidal antibody responses of juvenile rhesus monkeys immunized with group B Neisseria mening#idis capsular polysaccharide-protein conjugate vaccines. Infect. Immun., 65, 1053-1060.

Chapter 74

Adult Rat Model of Meningitis G. C. Townsend and W. M. Scheld

Background of human infection

Details of surgery

Bacterial meningitis is a disease characterized by the invasion of the subarachnoid space (SAS), normally a sterile space, by pathogenic bacteria. Although its incidence has declined in many industrialized countries, it remains a relatively common disease in many parts of the developing world. Morbidity and mortality remain high despite advances in diagnosis and antimicrobial therapy. Animal models have been instrumental in the study of bacterial meningitis. Research conducted using these models has enabled investigators to identify the pathogenic and pathophysiologic mechanisms responsible for the neurologic damage observed in patients with bacterial meningitis. Several animal models have been employed in the study of bacterial meningitis, including the infant rat model and the rabbit model. This chapter will review the adult rat model.

The procedures described below are primarily those described in the model defined and refined in the Scheld laboratory (Quagliarello et aL, 1986; Wispelwey et aL, 1988; Tunkel et aL, 1990).

Background of model The infant rat model and the most commonly used rabbit model of bacterial meningitis were both originally described in 1974 (Dacey and Sande, 1974; Moxon et aL, 1974). Both have provided vital information on the pathophysiology of bacterial meningitis, and the rabbit model especially has been important in examining antimicrobial therapy in bacterial meningitis. As with any animal model of a human disease, however, there are some limitations to each model. The adult rat model most commonly used was first described by Quagliarello et aL (1986). In its original description, 150g Wistar rats were used. Subsequent models have primarily employed Wistar or SpragueDawley rats, generally from 175-330 g (Lorenzl et aL, 1993; Boje, 1995b; Wispelwey et aL, 1988).

Preparation of animals No specialized housing or care nor specific pretreatment is generally required. Handbook of Animal Models of Infection

ISBN 0-12-775390-7

Materials required Anesthetic, hair clippers, skin disinfectant, 1.0 ml tuberulin syringe, catheter with 25 G needle, forceps, scissors.

Anesthesia Rats are anesthetized with intramuscular injections of ketamine (75 mg/kg) and xylazine (5 mg/kg). This is prepared by mixing three parts ofketamine with one part ofxylazine. Complete anesthesia occurs in approximately 10 minutes and lasts for about 30-60 minutes. The achievement of anesthesia is determined by the loss of corneal reflexes. Other investigators have used alternative anesthetics such as intraperitoneal thiobutabarbiturate (Lorenzl et aL, 1993).

Surgical procedure After induction of anesthesia, the dorsal surface of the animal's neck is shaved with electric clippers and cleaned with a skin disinfectant (e.g., ethanol). The animal is then placed dorsal side up on a stable platform with its neck flexed over a small roll of cotton. The hub of a flexible catheter with a 25 G butterfly needle is connected to a 1.0ml tuberculin syringe, and the needle is fitted to a "micromanipulator" directly above the animal's neck. Using this device, the operator uses a rotary knob to move the needle in the vertical plane. The cisterna magna is located by gentle probing with blunt forceps. The needle is slowly lowered through the skin at the cisterna magna until there is an abrupt drop in resistance, indicating penetration through the posterior longitudinal ligament into the SAS. At this point, the plunger of the syringe is withdrawn a short distance to decrease pressure within the syringe and the catheter tubing. If no Copyright © 1999Academic Press All rights of reproduction in any form reserved

628

cerebrospinal fluid (CSF) enters the tubing, the needle is slowly withdrawn until there is the return of CSF within the tubing. CSF is allowed to flow until approximately 75 btl of CSF is evident within the tubing; it may be necessary to withdraw the plunger of the syringe to facilitate this process. When the desired amount of CSF has been withdrawn, the tubing is clamped in two places and the tubing is cut between the forceps. The bacterial inoculum is then administered into the SAS via the tubing, after which the needle is completely withdrawn and CSF remaining within the tubing is collected. If any blood is noted in the CSF at any time, the experiment is terminated. In another model, investigators have placed the rats in a stereotaxic frame and implanted a closed cranial window (Morii et aL, 1986; Lorenzl et aL, 1993). A catheter is then placed in the cisterna magna for sampling.

Postoperative care

Animals are returned to their cages and supplied with food and water until sacrificed.

G . C . Townsend and W. M. Scheld

under study. The successful induction of meningitis is confirmed by the appearance of leukocytes in the CSF; this process generally begins approximately 2 hours after inoculation. The concentration of leukocytes within the CSF (cells4tl) is used as the primary indicator of the degree of inflammation. Blood leukocyte concentrations have also been measured. A number of other parameters have been used to assess the response to infection. The integrity of the BBB has been assessed by a variety of methods, including measurement of the percentage of systemically administered radiolabeled iodine present in the CSF (Lesse et aL, 1988), extravasation of Na+-fluorescein (Lorenzl et aL, 1993), and transfer of radiolabeled sucrose (Boje, 1995a). In one model, intracranial pressure and brain edema are measured (Koedel et al., 1995a; Lesse et aL, 1988). In addition to these parameters, response to treatment may be monitored by determination of CSF and blood bacterial concentrations. Antibiotic concentrations may be determined by high-performance liquid chromatography (Meulemans et aL, 1989).

Storage and preparation of inocula

Antimicrobial therapy

The bacteria most commonly used in these studies have been Streptococcus pneumoniae and Haemophilus influenzae; in addition to whole live bacteria, killed bacteria, bacterial components such as lipopolysaccharide and cell-wall fragments, and proinflammatory mediators such as cytokines have been used. In experiments in our laboratory involving H. influenzae, type b strain Rd-b+/O2 has been used. Strain Rd-b÷/O2 is a transformant of the Rd strain created by using donor D N A from type b strain Eagan (Hoiseth et aL, 1985) and has been used extensively in this model (Lesse et aL, 1988). The bacteria are stored a t - 7 0 ° C in skim milk. The bacteria are plated on to chocolate agar and incubated overnight at 37°C in 5% CO2. Suspensions of the bacteria are made in phosphate-buffered saline at a concentration of 108 cfu/ml.

The adult rat model of bacterial meningitis has been used almost exclusively to examine the pathophysiology of bacterial meningitis, with very little published data on its use in trials of antimicrobial therapy. In a model of Pseudomonas aeruginosa meningitis (Meulemans et aL, 1989), a single arterial dose of cefsulodin was administered after intraventricular inoculation of bacteria. CSF was sampled every 15 minutes through an indwelling ventricular cannula. Peak CSF concentrations and area under the curve (AUC) of cefsulodin were approximately three to four times greater in infected animals than in uninfected animals. In a model of pneumococcal meningitis (Strake et aL, 1996), rats were administered one of three regimens ofcefotaxime, one of two regimens of ampicillin and gentamicin, or no antibiotics, subcutaneously every 12 hours after intracisternal inoculation of S. pneumoniae in 5% hog gastric mucin. The mucin was used to facilitate the induction of meningitis, as in this model meningitis was not induced with S. pneumoniae alone; a control group of animals was administered mucin without bacteria or antibiotics. The animals were sacrificed at postinoculation day 4, then CSF was collected by intracisternal puncture. Brains were also collected, and brain homogenates were cultured. Brain tissue from animals receiving cefotaxime 25 mg/kg, no antibiotics, or mucin only was examined for histopathologic changes. Higher doses of cefotaxime (25 or 6.25 mg/kg) resulted in reduced CSF and brain concentrations of bacteria compared with infected animals that did not receive antibiotics (p < 0.05); there was complete bacterial killing in CSF and brain in animals that received cefotaxime 25 mg/kg. Lower doses of cefotaxime and both regimens of

Infection process The bacterial inoculum is drawn up in a 1.0 ml tuberculin syringe. When the SAS has been successfully entered and the desired amount of CSF has been withdrawn, approximately 50 lttl (5 x 106 cfu) of this suspension is inoculated by injection into the catheter tubing.

Key parameters to monitor infection and response to treatment CSF may be obtained for analysis at various times after inoculation, depending on the inoculum and the parameter

ADULT RAT MODEL OF MENINGITIS

ampicillin and gentamicin used were ineffective in reducing CSF and brain bacterial concentrations. Leptomeningeal inflammation was observed in brain tissue from rats receiving no antibiotics, but not in rats receiving cefotaxime or mucin only.

Pitfalls (advantages/disadvantages) of the model The adult rat model suffers from some significant drawbacks as a discriminative model of human infection. Bacteremia and subsequent invasion of the central nervous system cannot be achieved in this model by intranasal inoculation of bacteria, necessitating direct inoculation into the SAS. This obviously does not represent the hypothesized clinical scenario, in which colonization of the upper respiratory tract is followed by bacteremia and ultimately meningitis. Although the amount of CSF that may be withdrawn (approximately 50-75 btl) is greater than is possible with the infant rat model, it is still far less than may be withdrawn in the rabbit model. Despite these shortcomings, the model has some advantages over other models. The animals are less expensive to purchase and to maintain than are rabbits, and require less space for housing. As noted above, the amount of CSF that may be withdrawn is greater than is possible with the infant rat model. The procedure used is also less complex than that used in the rabbit model.

Contributions of the model to infectious disease therapy Indication of efficacy of antimicrobial agents Although great care must be taken in applying the results of animal trials to potential clinical applications, the results of the study by Strake et aL (1986) indicate that this model may be used to preliminarily assess the relative efficacies of different antimicrobial regimens and doses.

Increase in understanding of pathology and pathogenesis, host inflammatory (cytokine, cellular), and immune response The adult rat model has been used in numerous studies to examine the pathogenetic and pathophysiologic changes that occur in bacterial meningitis. Evidence from these studies supports a role for cytokines (such as interleukin-1; Quagliarello et al., 1991), platelet-activating factor (Townsend and Scheld, 1994), and nitric oxide (Boje 1995b; Buster et al., 1995; Koedel et al., 1995b).

629

References Boje, K. M. (1995a). Cerebrovascular permeability changes during experimental meningitis in the rat. ]. Pkarmacol. Exp. Tker., 274, 1199-1203. Boje, K. M. (1995b). Inhibition of nitric oxide synthase partially attenuates alterations in the blood-cerebrospinal fluid barrier during experimental meningitis in the rat. Eur. ]. Pharmacol, 272, 297-300. Buster, B. L., Weintrob, A. C., Townsend, G. C., Scheld, W. M. (1995). Potential role of nitric oxide in the pathophysiology of experimental bacterial meningitis in rats. Infect. Immun., 63, 3835-3839. Dacey, R. G. lr, Sande, M. A. (1974). Effect ofprobenecid on cerebrospinal fluid concentrations of penicillin and cephalosporin derivatives. Antimicrob. Agents Chemother., 6, 437-441. Hoiseth, S. K., Connelly, C. J., Moxon, E. R. (1985). Genetics of spontaneous, high-frequency loss of b capsule expression in Haemophilus influenzae. Infect. Immun., 49, 389-395. Koedel, U., Bernatowicz, A., Paul, R., Frei, K., Fontana, A., Pfister, H. W. (1995a). Experimental pneumococcal meningitis: cerebrovascular alterations, brain edema, and meningeal inflammation are linked to the production of nitric oxide.Ann. Neurol., 37, 313-323. Koedel, U., Bernatowicz, A., Paul, R., Frei, K., Fontana, A., Pfister, H. W. (1995b). Experimental pneumococcal meningitis: cerebrovascular alterations, brain edema, and meningeal inflammation are linked to the production of nitric oxide.Ann. Neurol., 37, 313-323. Lesse, A. J., Moxon, E. R., Zwahlen, A., Scheld, W. M. (1988). Role of cerebrospinal fluid pleocytosis and Haemophilus influenzae type b capsule on blood brain barrier permeability during experimental meningitis in the rat. J. Clin. Invest., 82, 102-109. Lorenzl, S., Koedel, U., Dirnagl, U., Ruckdeschel, G., Pfister, H. W. (1993). Imaging of leukocyte-endothelium interaction using in vivo confocal laser scanning microscopy during the early phase of experimental pneumococcal meningitis. J. Infect. Dis., 168, 927-933. Meulemans, A., Vicart, P., Pangon, B., Mohler, J., Bocquet, L., Vulpillat, M. (1989). Pharmacokinetics of cefsulodin in rat cerebrospinal fluid during experimental Pseudomonas aeruginosa meningitis. Chemotherapy, 35, 237-241. Morii, S., Ngai, C., Winn, H. R. (1986). Reactivity of rat pial arterioles and venules to adenosine and carbon dioxide: with detailed description of the closed cranial window technique in rats. J. Cereb. Blood Flow Metab., 6, 34-41. Moxon, E. R., Smith, A. L., Averill, D. R., Smith, D. H. (1974). Haemophilus influenzae meningitis in infant rats after intranasal inoculation.J. Infect. Dis., 129, 154-162. Quagliarello, V. J., Long, W. J., Scheld, W. M. (1986). Morphologic alterations of the blood-brain barrier with experimental meningitis in the rat: temporal sequence and role of encapsulation. J. Clin. Invest., 77, 1084-1095. Quagliarello, V. J., Wispelwey, B., Long, W. J., Scheld, W. M. (1991). Recombinant human interleukin-1 induces meningitis and blood-brain injury in the rat: characterization and comparison with tumor necrosis factor. J. Clin. Invest., 87, 1360-1366. Strake, J. G., Mitten, M. J., Ewing, P. J., Alder, J. D. (1996). Model of Streptococcus pneumoniae meningitis in adult rats. Lab. Anita. Sci., 46, 524-529.

630

Townsend, G. C., Scheld, W. M. (1994). Platelet-activating factor augments meningeal inflammation elicited by Haemophilus influenzae lipooligosaccharide in an animal model of meningitis. Infect. Immun., 62, 3739-3744.

G . C . Townsend and W. M. Scheld

Wispelwey, B., Lesse, A. l., Hansen, E. J., Scheld, W. M. (1988). Haemopkilus influenzae lipopolysaccharide-induced blood brain barrier permeability during experimental meningitis in the rat. ]. Clin. Invest., 82, 1339-1346.

Chapter 75

Rabbit Model of Bacterial Meningitis J. Tureen and E. Tuomanen

Background of human infection Bacterial meningitis is a medical emergency with high morbidity and mortality. For example, the mortality rate from pneumococcal infection is 20-30% despite the availability of highly bactericidal antibiotics, and over half of the survivors have severe sequelae (Schuchat et aL, 1997). The three common bacterial causes of meningitis in childhood are Streptococcus pneumoniae, Haemophilus influenzae and Neisseria meningitidis. Neonatal meningitis is more frequently caused by Escherichia coli or Group B streptococcus. With the advent of the Haemophilus type b vaccine, the incidence of disease has shifted more heavily to the pneumococcus. The increasing spread of antibiotic resistance, particularly among pneumococci to penicillin and cephalosporins, has complicated predicting effective therapy (Quagliarello and Scheld, 1997). Breakdown of the blood-brain barrier is the central pathological element of meningitis. Morphologically the barrier consists of the arachnoid membrane and tight junctions between choroid plexus epithelial cells and between endothelial cells of cerebral capillaries. During meningitis, gaps are opened between endothelial cells, pinocytotic activity increases, leukocytes are recruited to the CSF, cytochemical parameters in CSF change, and autoregulation of cerebral vascular perfusion pressure is lost. All these changes are demonstrable in the rabbit meningitis model.

fusion pressure. The ability to obtain multiple samples over time from one animal is a major advantage of the model as it allows the investigator to follow the course of disease comparing values in the same animal. This results in the use of fewer animals to document an experimental finding when compared to rodent models. The focus of the experimental effort using the rabbit model for the past 20 years has been to establish the pathophysiology of the infection, determine optimal use of antibiotics for this sequestered site and control the vigorous host inflammatory response in the closed subarachnoid space so as to minimize neuronal damage.

Animal species Several species of rabbit have been used, most frequently New Zealand White rabbits. Either sex is appropriate. For optimal handling, particularly when using the stereotaxic flames, animals should weigh between 1.8 and 2.2 kg.

Preparation of animals No specialized housing or care is required.

Placement of acrylic helmet to calvarium

Background of model The central method of the rabbit meningitis model-was developed by Drs Dacey and Sande over 20 years ago (Dacey and Sande, 1974). By using an acrylic helmet affixed to the calvarium, animals can be stabilized in a stereotaxic frame. This allows precise placement of a spinal needle into the cisterna magna, where it can remain for several hours of sequential sampling. Upon inoculation of inflammatory agents into the cisterna magna, repeated CSF sampling is undertaken to determine multiple parameters of injury: cytochemical abnormalities, intracranial pressure, cerebral edema, blood-brain barrier permeability, and cerebral per-

Handbook of Animal Modelsof Infection ISBN 0-12-775390-7

Surgical time: 10 minutes A dental acrylic helmet is affixed to the skull so as to provide a stable mechanism to hold the animal in the stereotaxic frame. The helmet is placed 24-48 hours prior to the experiment. The screws that hold the helmet to the skull penetrate the calvarium but not the dura and therefore the helmet can be left in place for up to 5 days without the appearance of a reactive inflammatory response in the underlying CSF. The animals are anesthetized with 35mg/kg ketamine i.m., 0.6 mg/kg acepromazine i.m. and 2.5 mg/kg xylazine i.m. The sites of the helmet and future cisternal punctures Copyright © 1999Academic Press All rights of reproduction in any form reserved

632

J. Tureen and E. Tuomanen

are prepared by shaving the backs of the ears (for later insertion of an intravenous line), the superior aspect of the skull between the ears, and the nape of the neck. Disinfect the area between the ears with an iodine scrub and alcohol. Identify the coronal and sagittal sutures by palpation (Figure 75.1). Make a 3 - 4 c m longitudinal incision in the skin along the sagittal suture. The incision should start behind the level of the eyes and stop in front of the ears. Spread the skin and make two incisions into the periosteum in a cross pattern along both sutures. Push the periosteum to the sides using a scalpel and a gauze pad. Drill four holes into the skull, one in each quadrant of the cross formed by the sutures (Figure 75.1). The holes should be approximately 0.7-1 cm apart, forming a rectangle. With a scalpel, clean the holes of small bone pieces and smooth the edges. Place a screw into each hole and screw down about two full turns until it is tight. Place a turnbuckle so that one arm is between the screws and the other is posterior to the rectangle (Figure 75.2). The screw hole for the bolt should be on the left side of the rabbit.

©

® eye

turnbuckle

ear

Figure 75.2

Orientation of the turnbuckle and screws in relation to the head of the rabbit. Note the turnbuckle should be placed with the anterior arm between the screws and the shaft to the left of the rabbit so as to fit the frame properly.

Sagittal suture

0

1 I

I I r

is going to attach to the frame later on (see Figure 75.3C). Several minutes after mixing, the cap gets hot as the acrylic sets. Cool it by allowing tap water to run over the top of the rabbit's head for at least 30 seconds or until the cap remains cool to touch. Allow the animal to awaken under supervision then return to cage with food/water ad libitum.

/

-->

Coronal

suture

V

screws

Figure 75.1

Placement of incisions and screws with regards to suture lines. The incision in the skin (1) is made parallel to the sagittal suture, extending from the level of the eyes to behind the ears. Two incisions are made in a cross pattern in the periosteum (2). The four screws are situated in each quadrant created by the intersection of the sagittal and coronal sutures.

Mix Fastray powder plus Fastray liquid and form a plum-sized aliquot on top of the turnbuckle. Work the material to cover all screws and the incision, the final shape being a rectangle on the top of the rabbit's skull. Make sure not to cover the opening for the bolt on the turnbuckle that

Storage and preparation of inocula Bacteria are stored frozen in bacteriological medium plus 10% vol./vol, glycerol. To prepare an inoculum of living bacteria, 100/21 of stock culture is inoculated into liquid bacteriological medium and incubated at 37°C until the mid-logarithmic phase of growth. The culture is centrifuged at 20 000g and bacteria are resuspended in pyrogen-free saline. The inoculum is adjusted to a desired concentration in 100/21. A brisk inflammatory response will occur when the concentration in CSF exceeds 105 bacteria/ml. The total volume of CSP in a rabbit is about 5 ml. Thus, as an initial recommendation, inoculation of 10~bacteria in 100/21 will initiate inflammation within several hours. Bacterial components have also been used extensively to induce a meningeal inflammatory response. The most common is lipopolysaccharide with a dose of 50 ng invoking a reproducible inflammatory response. Heat-killed pneumococci, when not encapsulated (i.e., strain R6), have also been used. The inoculum is heated to 50°C for 20 minutes, cooled and adjusted to 106 bacteria per 100/ll.

RABBIT MODEL OF BACTERIAL MENINGITIS

633

(A)

(D)

(B)

(E)

(c)

Figure 75.3 Preparation and placement of animal in sterotaxic frame. A. Placement of four screws as per Figure 75.1. B. Placement of turnbuckle as per Figure 75.2. C. Securing the turnbuckle to the skull using dental acrylic. D. Placement of rabbit in frame. E. Insertion of spinal needle into the cisterna magna.

634

Details of the surgery and infection process Anesthetize with nembutal 0.5 ml/kg i.v. and 25% urethane 3.5 ml/kg s.c. Place a catheter in an ear vein and flush with heparinized saline. The animal is ready for placement in the stereotaxic frame approximately 30 minutes after the urethane. For manipulation, the animal may require additional anesthesia, in which case nembutal (0.1-0.4 ml i.v.; 15 mg/kg) can be administered by the ear vein catheter. The specifications for making the stereotaxic frame can be obtained from the Instrument Shop, Rockefeller University, 1230 York Ave, New York, NY 10021, USA. Place the animal in the frame, stabilizing the head via the turnbuckle in the helmet (Figure 75.3D, E). Insert a 25 G V2" spinal needle into the needle holder of the frame. Stretch the skin of the nape of the neck down with one finger and palpate the spinous process of the second cervical vertebra (C2). Advance the needle at an angle approximately 0.5 cm above the spinous process of C2 so that it passes over C l. Advance the needle to a depth of 1.5 cm. Pull on a tuberculin syringe attached to the needle hub to determine when CSF flow is initiated. A reasonable initial sample size of CSF is 0.3 ml. Instill bacteria intracisternally in a volume of

100/./1. P l a c e m e n t of intravascular catheters Catheters can be used for repeated blood sampling, physiologic measurements, or measurement of cerebral blood flOW. Supplies: 2% lidocaine, povidone-iodine, scalpel, iris scissors, hemostats, curved forceps, syringe with heparinized saline, attached to PE-90 or PE-100 tubing, suture material.

Femoral artery catheter Animals should be anesthetized with urethane or another long-acting drug. With animal in supine position, shave groin bilaterally. At the midpoint of the junction of thigh and body, locate the femoral artery by palpation. Sterilize skin with povidone-iodine and infiltrate with 2% lidocaine. Make a 1-1.5 cm transverse incision over the artery and dissect with scissors to expose. The femoral artery, vein and nerve will be visible together. Free the artery and insert two 30 cm lengths of suture beneath. Place a single loose knot in the proximal suture and tie off the artery distally with the second tie. Insert curved forceps under the artery to elevate it and occlude the blood supply with the proximal tie. (This can be done either with the help of an assistant or by clamping the free ends of the suture with a hemostat and positioning to apply gentle tension.) Make an arteriotomy with the iris scissors approximately one-third the diameter of the vessel. Insert the PE tubing, remove the forceps from beneath the artery and advance gently. When the catheter enters the vessel, remove tension on the proximal tie and

J. Tureen and E. Tuomanen

advance 10cm. Tie the proximal suture securely over catheter and vessel and inspect for bleeding. Blood should withdraw freely.

Carotid artery catheter This is performed in a similar manner to the above procedure. Shave the neck in the midline and right side ventrally. Working from above the head, infiltrate with lidocaine and make a 2 cm midline incision above the thyroid cartilage. Dissect on the right side until the carotid artery is isolated. Using two sutures as above, tie off distally and occlude proximally. Perform an arteriotomy (taking care to insure that the vessel is occluded) and advance the catheter 6-8 cm until a 'pop' is felt. This occurs when the catheter crosses the aortic valve. Tie securely in place. The right carotid artery can be sacrificed because the rabbit has an intact circle of Willis.

Key parameters to monitor infection CSF m e a s u r e m e n t s • Remove 0.3 ml of CSF at each sampling time, e.g., 2, 4, and 6 hours. • Leukocyte density. • Protein, glucose, lactate concentration. • Bacterial density. • Intracranial pressure.

Brain e d e m a • Sacrifice with pentobarbital (150 mg/kg i.v.). • Rapidly remove top of cranium with hemostat and heavy scissors. • Remove brain, cut into sections and place into tared Pyrex dish, and reweigh (W,). • Vacuum dry (-50 kPa) at 110-120°C for 7 days or until stable weight is reached (W2). • Brain water content (g water/100g dry weight) = [(W]-W2)/(W2-tare)] x 100.

Blood-brain barrier permeability • Blood-brain barrier injury is measured by increased accumulation of a blood-borne marker in the brain. • Animals receive [3H]penicillin or ['25I]albumin 30 minutes before the end of the experiment. • Collect 2 ml blood from ear catheter for cpm determination in blood. • Sacrifice with nembutal i.v. 2.5 ml/kg. • Remove brain and homogenize a preweighed sample for counting of cpm.

RABBIT MODEL OF BACTERIAL MENINGITIS

Cerebral perfusion pressure Cerebral perfusion pressure (CPP) is the calculated difference between mean blood pressure (MBP) and intracranial pressure (ICP). • MBP is calculated from blood pressure measured with a pressure transducer from the femoral artery. MBP = [diastolic blood pressure + 1/3 (systolic blood pressurediastolic blood pressure)]. • ICP is measured by placing a spinal needle in the cisterna magna. When free flow of CSF is established, connect directly to a pressure transducer. A valid measurement will show variations of 1-2 m m H g with respiration. • CPP = M B P - I C E

Cerebral blood flow Performed by method ofHeymann et aL (1977). May also be measured by [C'4]-antipyrine. • Prepare animal with left ventricle and femoral artery catheter. • Connect tared, heparinized syringe to Harvard pump®; set withdrawal rate at =2.5 ml/min; connect to femoral catheter. • Begin timed withdrawal of 1.5 minutes; after 0.25 minutes, inject 105-106 labeled, 15 ittm microspheres into LV catheter over 0.25 minutes. When withdrawal complete, disconnect syringe (reference sample) and reweigh. • This may be repeated multiple times in the same animal with different fluorescent colors or different isotopes. • Sacrifice, remove brain and cut into sections to be counted. • Blood flow is calculated as a ratio between counts in tissue and counts in the reference sample. Microspheres are available from Molecular Probes, Eugene, OR (fluorescent), or Du PonffNEN Research Products, Boston, MA (radioactive).

Brain histopathology • Sacrifice with nembutal i.v. 2.5 ml/kg. • Remove brain for histopathologic analysis.

Antimicrobial and adjunctive therapy and key parameters to monitor response to treatment Response to treatment is monitored over the course of hours to days. For replacement on the frame, animals are reanesthetized each day and sampled as needed. Changes in parameters of infection as monitored above are sufficient to determine response to therapy.

635

The model is suitable for assessment of the pharmcokinetics of a drug in CSF as well as potency of antimicrobial activity. Determination of the concentration of drug and the decrease in viable bacteria over time describe this potency. This is a straightforward and common use of the model. In addition to monitoring the bacteriologic response to treatment, the model has offered the opportunity to correlate bacterial killing with the state of injury in the subarachnoid space and brain. The most important application of this possibility is the testing of adjunctive therapies directed at reducing host response to bacterial products, some of which are released transiently in large amounts as bacteria lyse and die. By comparing the improvement in CSF cytochemistry and other measures of injury, the model has tested the potential advantage of using many antiinflammatory modalities, together with antibiotics including steroids, non-steroidal anti-inflammatory agents, cytokine inhibitors, inhibitors of leukocyte transmigration, inhibitors of nitric oxide generation, etc.

Advantage and disadvantages of the model These experiments cannot be conducted using non-animal alternatives. In-vitro cultivation of the blood-brain barrier has been achieved in several laboratories but simultaneous measurement of migration of leukocytes and leakage of protein across such a monolayer has not been demonstrated. Thus, in-vitro approximation of the blood-brain barrier can provide a measure of the potential of a bacterial component to increase vascular permeability in the brain but it can not approximate the situation in the presence of leukocytes, which are important mediators of brain injury. There exist four models of meningitis in animals: rat, rabbit, piglet and monkey. The rat model has a phase of bacteremia and is therefore more useful in studies of events leading to seeding of the CSF space that can not be studied in rabbits or monkeys. On the other hand, rabbits can provide multiple CSF samples per animal, eliminating the need for many animals to construct a time course of inflammation as is the case for rats. One rabbit can give up to eight sequential samples without a change in CSF pressure, thus sparing the need to study many animals. Monkeys, piglets and rabbits are predictive of the course of disease in man; choice of the animal lower on the phylogenetic order, the rabbit, is generally recommended. General use of the model has built an extensive data base for this infection, with strong indicators that what happens in the rabbit is predictive of the outcome in children. The rabbit and the human share antigenically identical CD18 adhesion molecules on leukocytes and the blood-brain barrier, a useful cross-reactivity not shared by any other laboratory animal.

636

Contributions of the model to infectious diseases therapy Improvements in therapeutic regimens Antibiotics

The general principles guiding antibiotic therapy of meningitis have been established in the animal model. Initially, detailed study of the pharmcokinetics and pharmacodynamics of antibiotics in the CSF space were undertaken (Dacey and Sande, 1974; Tauber et aL, 1984). The need for bactericidal versus bacteriostatic antibiotics in this environment was clearly documented using the model (Scheld and Sande, 1983). As new antibiotics were developed, they were tested in the model for potential use in meningitis (i.e., imipenem, meropenem, aztreonam). Similarly, when clinical failures were encountered, for example that of cefuroxime, an explanation was sought by investigation of treatment outcome in the model. Antibiotic regimens were also developed for particularly difficult infections, such as Proteus or Listeria meningitis and ventriculitis in neonatal meningitis. More recently, the model has provided a mechanism to optimize therapy for emerging antibiotic-resistant bacteria, particularly the penicillin-resistant pneumococcus (Friedland and Istre, 1992; Friedland et aL, 1993b). Fluid management

Since the 1970s, it has been recognized that the syndrome of inappropriate secretion of antidiuretic hormone (SIADH) occurs in some children with meningitis. This led to an almost universal practice of fluid restriction in children with meningitis, sometimes to an excessive degree. Work with the rabbit model of meningitis demonstrated first that cerebral vascular reactivity (autoregulation) was abnormal in bacterial meningitis (Tureen et aL, 1990) and could result in cerebral ischemia if blood pressure was not maintained. This was further elucidated in subsequent studies, which compared fluid restriction to maintenance hydration in the rabbit and which demonstrated significantly reduced brain blood flow and increased cerebrospinal fluid lactate (a marker for cerebral anaerobic metabolism) in fluidrestricted rabbits (Tureen et aL, 1992). These findings were reinforced by a clinical study that compared these two types of fluid regimen in children with meningitis and demonstrated improved outcome in the children that were not fluid-restricted (Singhi et aL, 1995). Novel adjunctive antiinflammatory tkerapy

Work using the rabbit meningitis model demonstrated that the inflammatory burst generated by antibiotic-induced bacterial lysis was associated with tissue injury (Tuomanen et aL, 1985, 1987; Tauber et aL, 1987; Friedland et aL, 1993a). This finding was documented in pneumococcal, Haemophilus and E. coli meningitis in the animal. This

J. Tureen and E. Tuomanen

period of enhanced inflammation upon initiation of antibiotic therapy was then documented in children (Arditi et aL, 1989). These findings suggested that a rational approach to improved outcome might involve attenuation of inflammation at the time of onset of antibiotic therapy. This was tested in the model using an extensive array of antiinflammatory modalities. Administration of steroids, nonsteroidal agents, antioxidants, cytokine antagonists, and inhibitors of leukocyte trafficking dramatically enhanced outcome in the experimental meningitis model (Tauber et aL, 1985; Tuomanen et al., 1987, 1989; Tureen et aL, 1991; Pfister et aL, 1992; Granert et aL, 1994; Paris et aL, 1994). Several studies were then conducted introducing this concept into clinical care of children by the use of steroids together with antibiotics (Lebel et aL, 1988; Girgis et aL, 1989; Odio et aL, 1991; Syrogiannopoulos et aL, 1994). Days of fever and the incidence of hearing loss decreased for Haemophilus meningitis, indicating that the therapy was of tangible benefit, but the results were not uniformly dramatic. For instance, the mortality rate in most clinical studies using steroids has decreased but the degree of impact varies from mortality rates below 5% up to as high as 20%. A general recommendation for the use of steroids in clinical meningitis has been instituted by the American Academy of Pediatrics.

Increased understanding of the pathogenesis of inflammation and CNS damage The meningitis model has revolutionized understanding of the pathogenesis of meningitis. Virtually every step in the infectious process after the bacteria have entered the subarachnoid space has been defined in this model (Pfister et aL, 1994; Tunkel and Scheld, 1995). The rates of multiplication of bacteria in CSF versus blood have been defined, as well as the rates of killing and clearance in the presence of antibiotics. The influence of host physiology on disease, such as fever, neutropenia, complement deficiency, etc., have been documented. The bacterial components that induce inflammation have been identified as lipopolysaccharide and peptidoglycan/teichoic acid. The effects of these agents on generation of cytokines, leukocytosis, brain edema and blood-brain barrier abnormalities have been quantitated and dissected mechanistically. Inflammatory cytokines (interleukin-1, interleukin-6, tumor necrosis factor) have been shown to have a role in generating the inflammation of meningitis, as evidenced by a recapitulation of disease when the agents are instilled directly into the CSF (Ramilo et aL, 1990; Saukkonen et aL, 1990) and by the amelioration of inflammation when inhibitors are administered. The final common mediators of neuronal toxicity have been more difficult to define, but the model has implicated both direct effects of bacterial products (e.g., pneumolysin or teichoic acids, Tauber et aL, 1992; Friedland et aL, 1995) and side-effects of host defense systems, such as excitatory

RABBIT MODEL OF BACTERIAL MENINGITIS

amino acids (Guerra-Romero et al., 1992, 1993), radicals of molecular oxygen (Lieb et al., 1996) and nitric oxide (Koedel et al., 1995; Tureen, 1995). The development of sequelae such as hearing loss has been studied by sequentially measuring auditory evoked responses during meningitis, with the conclusion that CSF inflammation directly relates to events in the cochlea (Bhatt et al., 1991, 1993, 1994).

The pathophysiology of cerebrovascular abnormalities

The study of cerebral hemodynamics in humans is technically difficult and potentially dangerous in patients with a life-threatening intracranial disorder. Therefore, animal models have been an extremely useful means of identifying intracranial circulatory abnormalities, including loss of cerebrovascular autoregulation (Tureen et aL, 1990), cerebral ischemia (Tureen et al., 1990), and cerebral infarction (Lorenzl et aL, 1993). These abnormalities arise from multiple mechanisms, including physiologic changes (i.e. intracranial hypertension), release of cytokines (TNFo;, IL1~, PAF), the action of reactive species of oxygen and nitrogen (oxygen radical, nitric oxide, peroxynitrite), and possibly upregulation of leukocyte adhesion molecules on vascular endothelium. All these abnormalities identified in animal models have been described in humans with meningitis, and elucidation of the underlying mechanisms may permit adjunctive forms of therapy to ameliorate these adverse consequences.

References Arditi, M., Ables, L., Yogev, R. (1989). Cerebrospinal fluid endotoxin levels in children with H. influenzae meningitis before and after administration of intravenous ceftriaxone. J. Infect. Dis., 160, 1005-1011. Bhatt, S., Halpin, C., Hsu, W. et al. (1991). Hearing loss and pneumococcal meningitis: an animal model. Laryngoscope, 101, 1285-1292. Bhatt, S., Lauretano, A., Cabellos, C. et aL (1993). The progression of hearing loss in experimental pneumococcal meningitis: correlation with cerebrospinal fluid cytochemistry. ]. Infect. Dis., 167, 675-683. Bhatt, S., Cabellos, C., Nadol, J. et aL (1994). The impact of dexamethasone on hearing loss in experimental pneumococcal meningitis. Pediatr. Infect. Dis. ]., 14, 93-96. Dacey, R., Sande, M. A. (1974). Effect of probenecid on cerebrospinal fluid concentrations of penicillin and cephalosporin derivatives. Antimicrob. Agents Chernother., 6, 437-441. Friedland, I., Istre, G. (1992). Management of penicillin-resistant pneumococcal infections. Pediatr. Infect. Dis. ]., 11,433-435. Friedland, I., Jafari, H., Ehrett, S., McCracken, G. (1993a). Comparison of endotoxin release by different antimicrobial agents and the effect on inflammation in experimental Escherichia coli meningitis. ]. Infect. Dis., 168, 1342-1348.

637

Friedland, I. R., Shelton, S., Paris, M. et al. (1993b). Dilemmas in diagnosis and management of cephalosporin-resistant Streptococcus pneumoniae meningitis. Pediatr. Infect. D#. ]., 12, 196-200. Friedland, I., Paris, M., Hickey, S. et al. (1995). Limited role of pneumolysin in the pathogenesis of pneumococcal meningitis. ]. Infect. D#., 172, 805-809. Girgis, N., Farid, Z., Mikhail, I., Farrag, I., Sultan, Y., Kilpatrick, M. (1989). Dexamethasone treatment for bacterial meningitis in children and adults. Pediatr. Infect. D#., 8, 848-851. Granert, C., Raud, J., Xie, X., Lindquist, L., Lindbom, L. (1994). Inhibition of leukocyte rolling with polysaccharide fucoidin prevents pleocytosis in experimental meningitis in the rabbit. ]. Clin. Invest., 93,929-936. Guerra-Romero, L., Tauber, M. G., Fournier, M. A., Tureen, J. H. (1992). Lactate and glucose concentrations in brain interstitial fluid, cerebrospinal fluid, and serum during experimental pneumococcal meningitis. ]. Infect. D#., 166, 546-550. Guerra-Romero, L., Tureen, J., Fournier, M., Makrides, V., Tauber, M. (1993). Amino acids in cerebrospinal and brain interstitial fluid in experimental pneumococcal meningitis. Pediatr. Res., 33, 510-513. Heymann, M. A., Payne, B. D., Hoffman, J. I. E., Rudolph, A. M. (1977). Blood flow measurements with radionuclide-labeled particles. Prog. Cardiovasc. D#., 20, 55-70. Koedel, U., Bernatowicz, A., Paul, R., Frei, K., Fontana, A., Pfister, H. W. (1995). Experimental pneumococcal meningitis: cerebrovascular alterations, brain edema, and meningeal inflammation are linked to the production of nitric oxide. Ann. Neurol., 37, 313-323. Lebel, M. H., Freij, B. J., Syrogiannopoulos, G. A., McCracken, G. J. (1988). Dexamethasone therapy for bacterial meningitis. N. Engl. ]. Med., 15,964-971. Leib, S. L., Kim, Y. S., Chow, L. L., Sheldon, R. A., Tauber, M. G. (1996). Reactive oxygen intermediates contribute to necrotic and apoptotic neuronal injury in an infant rat model of bacterial meningitis due to group B streptococci. J. Clin. Invest., 98, 2632-2639. Lorenzl, S., Koedel, U., Dirnagl, U., Ruckdeschel, G., Pfister, H. W. (1993). Imaging of leukocyte-endothelium interaction using in vivo confocal laser scanning microscopy during the early phase of experimental pneumococcal meningitis. ]. Infect. Dis., 168, 927-933. Odio, C. M., Faingezicht, I., Paris, M. et al. (1991). The beneficial effects of early dexamethasone administration in infants and children with bacterial meningitis [see comments]. N. Engl. J. Med., 324, 1525-1531. Paris, M., Friedland, I., Ehrett, S. et al. (1994). Effect of Interleukin-1 receptor antagonist and soluble tumor necrosis factor receptor is animal models of infection. ]. Infect. Dis., 171, 161-169. Pfister, H. W., Koedel, U., Lorenzl, S., Tomasz, A. (1992). Antioxidants attenuate microvascular changes in the early phase of experimental pneumococcal meningitis in rats. Stroke , 23, 1798-1804. Pfister, H., Fontana, A., Tauber, M., Tomasz, A., Scheld, W. (1994). Mechanisms of brain injury in bacterial meningitis: workshop summary. Clin. Infect. D#., 19, 463-479. Quagliarello, V., Scheld, W. (1997). Treatment of bacterial meningitis. N. Engl. J. Med., 336, 708-716. Ramilo, O., Saezllorens, X., McCracken, G. J. (1990). Tumor necrosis factor-alpha cachectin and Interleukin-l-]] initiate meningeal inflammation. J. Exp. Med., 172, 497-507.

638

Saukkonen, K., Cioffe, C., Wolpe, S., Sherry, B., Cerami, A., Tuomanen, E. (1990). The role of cytokines in the generation of inflammation and tissue damage in experimental Grampositive meningitis.J. Exp. Med., 171,439-448. Scheld, W., Sande, M. (1983). Bactericidal versus bacteriostatic antibiotic therapy of experimental pneumococcal meningitis in rabbits.J. Clin. Invest., 71,411-419. Schuchat, A., Robinson, K., Wenger, J. (1997). Bacterial meningitis in the United States. N. Engl. J. Med., 337, 970-976. Singhi, S. C., Singhi, P. D., Srinivas, B. et aL (1995). Fluid restriction does not improve the outcome of acute meningitis. Pediatr. Infect. Dis. J., 14, 495-503. Syrogiannopoulos, G., Lourida, A., Theodoridou, M. et aL (1994). Dexamethasone therapy for bacterial meningitis in children: 2 versus 4 day regimen. J. Infect. Dis., 169, 853-858. Tauber, M., Doroshow, C., Hackbarth, C., Rusnak, M., Ta, D., Sande, M. (1984). Antibacterial activity of beta-lactam antibiotics in experimental meningitis due to Streptococcus pneurnoniae.J. Infect. Dis., 149, 568-574. Tauber, M. G., Khayam-Bashi, H., San&, M. A. (1985). Effects of ampicillin and corticosteroids on brain water content, cerebrospinal fluid pressure, and cerebrospinal fluid lactate levels in experimental pneumococcal meningitis. J. Infect. Dis., 151, 528-534. Tauber, M. G., Shibl, A. M., Hackbarth, C. 1., Larrick, J. W., Sande, M. A. (1987). Antibiotic therapy, endotoxin concentration in cerebrospinal fluid, and brain edema in experimental Escherichia coli meningitis in rabbits. J. Infect. Dis., 156, 456-462. Tauber, M. G., Sachdeva, M., Kennedy, S. L., Loetscher, H., Lesslauer, W. (1992). Toxicity in neuronal cells caused by cere-

J. Tureen and E. Tuomanen

brospinal fluid from pneumococcal and gram-negative meningitis. J. Infect. Dis., 166, 1045-1050. Tunkel, A., Scheld, W. (1995). Acute bacterial meningitis. Lancet, 346, 1675-1680. Tuomanen, E., Liu, H., Hengstler, B., Zak, O., Tomasz, A. (1985). The induction of meningeal inflammation by components of the pneumococcal cell wall. J. Infect. Dis., 151, 859-868. Tuomanen, E., Hengstler, B., Rich, R., Bray, M., Zak, O., Tomasz, A. (1987). Nonsteroidal anti-inflammatory agents in the therapy of experimental pneumococcal meningitis. J. Infect. Dis., 155, 985-990. Tuomanen, E., Saukkonen, K., Sande, S., Cioffe, C., Wright, S. D. (1989). Reduction of inflammation, tissue damage, and mortality in bacterial meningitis in rabbits treated with monoclonal antibodies against adhesion-promoting receptors of leukocytes. J. Exp. Med., 170, 959-969. Tureen, J. (1995) Effect of recombinant human tumor necrosis factor-alpha on cerebral oxygen uptake, cerebrospinal fluid lactate, and cerebral blood flow in the rabbit: role of nitric oxide. J. Clin. Invest., 95, 1086-1091. Tureen, J., Dworkin, R., Kennedy, S., Sachdeva, M., Sande, M. (1990). Loss of cerebrovascular autoregulation in experimental meningitis in rabbits.J. Clin. Invest., 85, 577-581. Tureen, J. H., Tauber, M. G., Sande, M. A. (1991). Effect of indomethacin on the pathophysiology of experimental meningitis in rabbits.J. Infect. Dis., 163,647-649. Tureen, J., Tauber, M., Sande, M. (1992). Effect of hydration status on cerebral blood flow and cerebrospinal fluid lactic acidosis in rabbits with experimental meningitis. J. Clin. Invest., 89, 947-953.

Chapter 76

Escherichia coli Brain Abscess Method in Rat d. M. Nazzaro and E. A. Neuwelt

Background of model The most common method of establishing brain abscesses in the laboratory is the direct inoculation of brain with bacteria using stereotactic techniques. Other techniques, such as the intracarotid artery injection of bacterial emboli to brain in dogs (Molinari, 1972; Molinari et aL, 1973) or primates (Long et aL, 1978, 1979), and brain abscess formation following systemic yeast infection in mice (Ashman and Papadimitriou, 1994), have also been described. Winn et aL (1978, 1979) reported characterization of an Esckerickia coli (E. coli) brain abscess model in rat achieved by inoculation of bacteria suspended in saline into brain. Our laboratory used this model, although in early work both moderate acute morbidity and mortality among inoculated animals were encountered (Neuwelt et al., 1984a,b). Approximately 25% of the animals demonstrated acute weight loss and systemic sepsis. Histologic examination of these animals demonstrated meningitis, ventriculitis and, in several cases, evidence of sepsis, which included septic emboli to brain and lung. In addition, 25% of the remaining inoculated animals failed to demonstrate abscess lesions (Neuwelt et al., 1984a,b). Schroeder et al. (1987) also reported similar acute mortality rates attributable to complications such as meningitis and sepsis in rats inoculated with Staphylococcus aureus (S. aureus). In subsequent work, the E. coli brain abscess model in rat has been further refined (Nazzaro et al., 1990, 1991). Several parameters used in this model, such as strain of bacterium, inoculation preparation and placement techniques, and lesion location, differ from previous studies (Winn et al., 1978, 1979; Mendes et al., 1980; Costello et al., 1983; Neuwelt et al., 1984a,b). Using the present system, histologic, quantitative culture, and permeability drug studies suggest consistent formation of viable abscesses without evidence of meningitis or systemic sepsis (Nazzaro et al., 1991, 1992).

Laboratory animals Laboratory animals used in brain abscess research include cat, dog, monkey, mouse, rabbit, and rat (Table 76.1). Concerning the rat, the most common strain used in this Handbook of Animal Models of Infection

ISBN 0-12-775390-7

work is the Sprague-Dawley, although others, including the Wistar and the Lewis, have been investigated (Table 76.2). Either male or female animals are used and they generally weigh between 250 and 400 g (Table 76.2). In our laboratory, female Sprague-Dawley rats weighing 250-800 g have been used in all work. Investigators have not addressed whether rat strain or sex affects the characteristics of the experimental brain lesions produced. However, it has been demonstrated, for example, that patterns of resistance to Candida albicans infections differs among inbred mouse strains (Ashman et aL, 1993). Also, important differences in intracerebral abscess formation, characteristics, and response to pharmacologic agents between species have been suggested (Long and Meacham, 1968; Quartey et aL, 1976; Britt et aL, 1981; Neuwelt et aL, 1984a,b).

Bacteria used to create brain abscess Several bacterial strains as well as fungal and yeast species have been used for laboratory intracerebral abscess study (Table 76.1). Strains of Staphylococcus, Streptococcus, and. E. coli have been most frequently studied. Less commonly, other infectious agents such as Pseudomonas aeruginosa, Bacteroidesfragilis, and Candida albicans have been reported (Table 76.1). In the rat, S. aureus and E. coli have been most commonly investigated (Table 76.1). In our laboratory, E. coli has been used exclusively. It is important to note that significant differences regarding the ability to establish an intracerebral abscess as well as the specific characteristics of the lesions produced often exist within a bacterial strain and thus it is imperative that the type and possibly subtype of infectious agent employed be specified. In pilot work in our laboratory, different strains ofE. coli isolated from human blood cultures were investigated for brain abscess formation before consistent lesions were established (Nazzaro, unpublished data). Lo and colleagues (1991, 1993, 1994) selected a strain of S. aureus characterized by increased vascular permeability and inflammatory response in comparison to other strains of S. aureus. Thus, the characteristics of an individual brain abscess model pertain only to the specific bacterial isolate used. Copyright © 1999AcademicPress All rights of reproduction in any form reserved

640

Table 76.1

J . M . Nazzaro and E. A. Neuwelt

Brain abscess animal studies

Study

Species

Infection

Ashman et al., 1993; Ashman and Papadimitriou, 1994 Bohl et aL, 1981 Bothe et aL, 1984; Bothe and Paschen, 1986 Britt et aL, 1981 Britt et aL, 1984 Costello et al., 1983

Mouse Cat Cat Dog Dog Rat

Enzmann et aL, 1979, 1982a,b Enzmann et al., 1986 Essick, 1919 Falconer et al., 1943

Dog Dog Cat Rabbit

Flaris and Hickey, 1992 Groff, 1934

Rat Cat

Hassler and Forsgren, 1964

Rabbit

Housmann et aL, 1983 Kretzschmar et aL, 1981 Kurzydlowski et al., 1987 Lo et al., 1991, 1993, 1994 Long and Meacham, 1968 Mendes et al., 1980

Cat Cat Dog Rat Dog Rat

Molinari, 1972; Molinari et aL, 1973

Dog

Nakagawa et al., 1990 Nazzaro et aL, 1991, 1992 Neuwelt et al., 1984a,b Obana et al., 1986 Quartey et al., 1976

Rat Rat Rat Dog Rabbit

Runge et al., 1985 Schroeder et aL, 1987 Thomas, 1942

Dog Rat Cat

Wallenfang et aL, 1979 Wallenfang et al., 1980 Winn et al., 1978, 1979

Rabbit Cat Rat

Wood et al., 1978, 1979

Monkey

Candida albicans Staphylococcus aureus Staphylococcus aureus (z-streptococcus Bacteroides fragilis Streptococcus pyogenes Staphylococcus aureus Escherichia coli Pseudomonas aeruginosa Candida albicans Streptococcus intermedius Strep tococcus-MG-intermedius Bacteroides fragilis Peptostreptococcus anaerobius Peptococcus asacchasolyticus Peptococcus prevotil (z-streptococcus Staphylococcus aureus Not known Staphylococcus aureus Staphylococcus albus Streptococcus pyogenes Pneumococcus Proteus vulgaris Bacteroides friedlanderi Anaerobic streptococci Fusiform bacilli Staphylococcus aureus Staphylococcus aureus Streptococcus haemolyticus Staphylococcus and Streptococcus Colon bacilli Pneumococcus Staphylococcus aureus Proteus vulgaris Neisseria flavescens Streptococcus zymogenes Streptococcus faecalis Staphylococcus aureus Staphylococcus aureus Streptococcus-MG-intermedius Staphylococcus aureus Staphylococcus aureus Staphylococcus aureus Escherichia coil Streptococcus faecalis Streptococcus viridans Staphylococcus aureus Escherichia coli Staphylococcus aureus Escherichia coil Escherichia coil (z-streptococcus Streptococcus pyogenes Staphylococcus aureus (z-streptococcus Staphylococcus aureus Staphylococcus aureus Streptococcus haemolyticus Pneumococcus Staphylococcus aureus Staphylococcus aureus Staphylococcus aureus Escherichia coil Staphylococcus aureus

ESCHERICHIA COLI BRAIN ABSCESS METHOD IN RAT

641

Table 76.2 Brain abscess studies in rat; strain/sex/weight of experimental animals (SD, Sprague-Dawley; W, Wistar; L, Lewis; F, female; M, male; nr, not reported)

Study

Strain

Sex

Weight (g)

Costello et al., 1983 Lo et al., 1991, 1993, 1994 Mendes et aL, 1980 Nazzaro et al., 1991, 1992 Neuwelt et al., 1984a,b Schroeder et al., 1987 Winn et al., 1978, 1979 Nakagawa et al., 1990 Flaris and Hickey, 1992

SD SD SD SD SD SD SD W W, L

F M F F F nr F M/F nr

250-300 250-390 300 250-300 250-300 250-400 300 300-400 nr

Bacteria preparation and characterization E. coli (specimen no. 6702) used in our experiments was isolated from a human blood culture in the bacteriology laboratory of the Providence Medical Center, Portland, OR, USA. Bacteria are preserved in aliquots of a 10% (vol./vol.) glycerol in normal saline (NS) solution and maintained at -70°C. The day prior to surgery, 10 ml of an inoculated trypticase soy (T. soy) broth culture is grown statically for 21 hours at 37°C and then centrifuged at 50 000g for 20 minutes. The broth is discarded and the bacterial pellet is resuspended in 2 ml of sterile NS and recentrifuged for 20 minutes at 50 000g. The supernatant is discarded and the bacterial pellet is resuspended in 0.5 ml of sterile NS. This suspension contained approximately 1.8 x 107 colonyforming units (cfu)/btl.

Bacteria c h a r a c t e r i z a t i o n for surface antigen

Bacteria used in the present abscess model are K1 surface antigen negative as tested by the latex slide agglutination test using Neisseria rneningitidis group B antisera (Difco Laboratories, Detroit, MI) or by the K1 antibody identification technique (Burroughs Wellcome Diagnostic Division, Temple Hill, Dartford, UK) with E. coli serotype 07:K1 (American Type Culture Collection, Rockville, MD) serving as the positive control for K1 identification.

9.2 mm:-5.5 mm vertical,-3.0 mm lateral, +0.02 mm AP; Paxinos et aL, 1982) is inoculated with 3 btl (5.4 x 107 cfu) of the bacteria/saline preparation through a 2 mm burr hole using a 10 btl Hamilton syringe with a 30 G needle mounted on a micromanipulator (David Kopflnstruments, Tajunga, CA). Craniectomy is accomplished with a hand held power drill using a 1 mm cutting burr. Remaining remnants of bone overlying the dura are removed with a microhook. A small opening is made in the dura with the tip of a No. 11 surgical blade. Particular care is taken during bone drilling and dural opening not to disturb the underlying brain. Immediately prior to stereotactic inoculation needle placement, care is taken to insure that there is no dripping or collection of the inoculation medium at the needle tip. Inoculations are performed using a Burleigh Inchworm injection apparatus (Burleigh Instruments, Fishers, NY) with a 90 minute total infusion time. In control animals, sterile saline is inoculated at an identical volume and rate. Five minutes after completion of the inoculation, the needle is withdrawn 0.5 mm every 5 minutes. Bone wax is applied to close the burr hole. Following saline irrigation, the skin is closed in a single layer. Animals are housed individually and have ad libitum access to food and water. Experiments are conducted 6 days after surgery. Animals should appear healthy, with a normal food and water intake, as well as normal activity and general response to the environment. Evidence of weight loss, shaking, decreased activity, and lethargy are signs of meningitis and/or systemic sepsis.

Characterization of abscess Abscess production Histopathologic e x a m i n a t i o n

Female Sprague-Dawley rats weighing 250-275 g are anesthetized with i.p. ketamine (11.6 mg/kg) and xylazine (1.16 mg/kg). Subsequently, the head is shaved with electric shears, and cleansed with antiseptic solution, and the animals are placed in a stereotactic frame (David Kopf Instruments, Tajunga, CA). The right caudate putamen (coordinates from dura at bregma = 0 and interaural =

Following pentobarbital anesthesia (50 mg/kg, i.p.) E. coliinoculated animals are perfused with 10% buffered, neutralized formaldehyde (EM Science, Cherry Hill, NJ) for histopathologic characterization. Brains are fixed in the formalin solution for at least 1 week and subsequently embedded in paraffin. Blocks of brain are sectioned at 7 lam

642

on a vibratome, mounted on glass slides and stained with hematoxylin and eosin, Mallory's aniline blue collagen, or Gram's stain. Animals inoculated only with sterile saline also have histopathologic examination.

Quantitative abscess culture analysis For quantitative culture analysis, a group of E.-coliinoculated animals are killed with i.p. pentobarbital (70 mg/kg). The brains are sectioned sagittally along the midline, homogenized in sterile NS (1:10; wt/vol.), serially diluted and cultured on T. soy culture plates. Bacterial counts are recorded following 24 and 48 hours of incubation at 37°C. To detect the presence of contaminating species, the colonies are identified as being E. coli by routine methods. As an additional control, a separate group of animals are inoculated with sterile saline, killed 6 days following surgery and analyzed for bacterial growth as described.

J.M. Nazzaro and E. A. Neuwelt

substances, is another method used to investigate the lesions produced. Low- and high-molecular-weight substances such as fluorescein, Evans blue albumin, radiolabeled drugs such as gentamicin and antigentamicin antibody have been used (Nazzaro et aL, 1991 and see below, Discussion). This work has demonstrated that consistent brain lesions are produced using the present model, and are characterized by a differential permeability to low- and high-molecularweight substances (Nazzaro et aL, 1991).

Discussion The reduction in acute morbidity and mortality rates reported here might be due to several experimental factors. These include the method of bacteria preparation, specific E. coli bacterial strain used, brain area inoculated, as well as parameters concerning the inoculation technique. Each of these factors was adjusted based on pilot work to optimize bacteria localization.

Results

Brain area inoculated

Morbidity and mortality

In the present model, the deep basal ganglion area is targeted for bacteria inoculation. This may be contrasted with previous work by this laboratory as well as others (in which direct inoculation technique was used) when the rodent abscess model of Winn et al. (1979) was used, though brain areas only 2-3 mm beneath the cortical surface were inoculated (Mendes et aL, 1980; Costello et aL, 1983; Neuwelt et aL, 1984a,b; Schroeder et aL, 1987). Such studies reported a relatively high acute mortality rate, viewed as secondary to meningitis, ventriculitis, or overwhelming sepsis. For example, Schroeder et aL (1987) reported that, in rats who received S. aureus brain inoculations 3 mm below the dura, five of 17 (29%) rats died within 4 days from such complications. Earlier work in our laboratory, in which relatively superficial brain implant coordinates were implanted with E. coli suspension, also encountered relatively high morbidity and mortality rates (Neuwelt et aL, 1984a,b). Our histologic data suggest that the transverse white matter of the corpus callosum aided in preventing backtracking of bacteria along the needle tract, thereby minimizing contamination of the subarachnoid space.

In our laboratory, systemic infection or meningitis is not associated with the described E. coli brain abscess model.

Histopathology The histopathology of the lesions produced has been described (Nazzaro et aL, 1992). Lesions are characterized by a central area of purulent material, surrounded by an area of neovascularity, necrosis, brain macrophages, and microcystic changes. More peripherally, lesions characteristically demonstrate inflammatory cells, macrophages, and early collagen fibers. In brains studied, there has been no evidence of ventriculitis, meningitis, or septic emboli.

Quantitative cultures Six days following brain inoculation with E. coli, quantitative bacterial culture analysis demonstrated 1 x 10 6 tO 4.6 × 107 cfu ofE. coli (Nazzaro et aL, 1992). There was no bacterial growth from control animals inoculated with sterile saline.

Permeability characteristics of abscess and brain adjacent to abscess Study of the permeability characteristics of experimental brain abscesses and brain around abscess to drugs and other

Inoculum injection time and volume Our total time for the brain inoculation injection is longer than in previous reports (Winnet aL, 1979; Mendes et aL, 1980; Costello et aL, 1983; Neuwelt et aL, 1984a,b; Schroeder et aL, 1987). This parameter was established through pilot work, which suggested that quicker injection times contributed to backtracking of the bacteria along the needle track during inoculation. However, according to the

ESCHERICHIA COLI BRAIN ABSCESS METHOD IN RAT

Table 76.3

643

Brain abscess rat s t u d i e s - intracerebral inoculation parameters (nr, not reported)

Injection depth* (mm)

Inoculum concentration (cfu/ld)

Inoculum volume (t2)

Injection time

Needle withdrawal time

Study

Needle gauge

(min)

(min)

Costello et al., 1983 Flaris and Hickey, 1992 Lo et aL, 1991, 1993, 1994 Mendes et aL, 1980 Nakagawa et al., 1990 Nazzaro et al., 1991, 1992 Neuwelt et al., 1984a,b Schroeder et al., 1987 Winn et al., 1978 Winn et al., 1979

27 21 27 26 27 30 30 27 27 27

2.0 5-612.5 2.0 3.0 5.5 2.5 3.0 2.0 2.0

102-107 nr 107 101-108 nr 1.8 x 107 10 s 2.4-5 x 107 104-108 108

1 20-40:1: 1 1 nr 3 1 1 0.2 1

50 0.25 30 60 30 90 30 30 nr 60

nr nr 10 nr 15 30 10 15 nr nr

* From outer cortical brain surface unless otherwise indicated. 1 From skull surface. :1:Agarose beads.

present method, total inoculum volume is also greater than that used by most other investigators using the rat. Most laboratories using direct intracerebral injection techniques in rat have reported an inoculation volume of 1 lttl. In the present E. coli brain abscess model discussed in this chapter, in order to increase number of bacteria/inoculum (see also below), 3 ltil is injected (Table 76.3).

Time taken to withdrawal needle from brain after bacterial inoculation

After bacterial inoculation into brain, the inoculating needle is left in place for 5 minutes, following which the needle is withdrawn 5 mm every 5 minutes (Table 76.2). On the basis of pilot work, the deliberate withdrawal of the injecting needle over an extended time course is employed to help insure localization of the bacterial inoculum. While several investigators do not report this variable, among those that do, 5 minutes of withdrawal time per approximately 5 mm of needle depth is followed (Table 76.2).

Specific strain of E. coli used

Suspension media for bacteria and host alterations at time of inoculation

In previous studies using E. coli and other bacteria, inoculated animals often failed to demonstrate viable bacteria in lesions when examined histopathologically or upon quantitative culture analysis within 1 week of surgery (Neuwelt et al., 1984b; Kurzydlowski et aL, 1987; Schroeder et aL, 1987). In order to circumvent such difficulties, several investigators have inoculated brain with bacteria suspended in growth medium (Quartey et aL, 1976; Wood et aL, 1978; Bohl et aL, 1981; Kretzschmar et al., 1981; Runge et aL, 1985; Lo et aL, 1991, 1993, 1994) or nutrient agarose (Wood et al., 1978; Enzmann et aL, 1979, 1986; Wallenfang et al., 1980; Britt et aL, 1981, 1984; Kurzydlowski et aL, 1987; Flaris and Hickey, 1992). In other brain abscess models, investigators have traumatized tissue prior to inoculation or have altered host defenses (Falconer et aL, 1943; Long and Meacham, 1968; Kurzydlowski et aL, 1987). Such inoculation techniques, however, may alter bacterial growth as well as the histologic and permeability characteristics of the lesions produced (Falconer et aL, 1943; Neuwelt et aL, 1989). In our laboratory, bacteria are suspended in sterile saline, and host defenses are not altered or traumatized prior to inoculation.

Acute sepsis in earlier work (Winn et aL, 1979; Neuwelt et aL, 1984a,b) may also be related, in part, to the presence of the Kl-positive surface antigen on the E. coli used in those

Bacteria number and inoculum volume

experiments. This antigen is immunochemically related to the meningococcal group-B capsular polysaccharide (Kasper et aL, 1973; Grados et aL, 1989) which is associated with increased virulence in rodent models (Wolberg and DeWitt, 1969; Howard et aL, 1981; Raffet aL, 1988) and E. coli meningitis in the pediatric population (Robbins et aL, 1974; McCracken et aL, 1976; Raff et aL, 1988). In the present model, the E. coli used were Kl-surface-antigennegative.

In the rat, E. coli, S. aureus, and streptococcal strains have most commonly been investigated (Table 76.1). Available evidence suggests that experimental brain abscess formation in rat requires an inoculum of 105-107 bacteria (Table 76.3). Whether other pathogen strains require this number at time of inoculation is not clear. Costello et al. (1983) investigated multiple infectious strains (Table 76.1), and reported that, for most strains studied, intracerebral injection of 102-107 pathogens produced infection. However, it is

J . M . Nazzaro and E. A. Neuwelt

644

unclear in that study if true abscess lesions were created, as the dependent variable measured was number of bacteria on culture analysis; histopathologic examinations of brains were not performed. Culture analyses may be contaminated by and reflect, in part, bacterial spread to other areas such as the subarachnoid space. It is noted that Costello et al. (1983) reported that the experimental animals studied were often cachectic and generally sickly in appearance, which, in our experience and that of others, is most commonly seen in settings of meningitis and sepsis.

gentamicin, there was no significant binding of the drug by antibody in brain abscess. Further, and importantly, this method with brain abscess has been applied to tumors, the results of which support the hypothesis of blood-brain barrier tumor differential permeability to low- and highmolecular-weight substances (Kroll et aL, 1994; Kroll and Neuwelt, 1998).

Acknowledgements Applicability of model The brain abscess model has been used to study multiple processes associated with these lesions. These include: the stages of abscess formation; the brain edema associated with abscess lesions; lesion response to medical therapies; the influence of steroids and host-immune-related factors on lesion characteristics and response to medical interventions; the effect of osmotic blood-brain barrier (BBB) disruption on antibiotic delivery; and the radiographic characteristics of the lesions produced. Many infectious pathogens have been studied (Table 76.1). The present model has been employed by our laboratory to study the possibility of a therapeutic drug-rescue method based on the differential permeability of the lesions produced to low- and high-molecular-weight substances (Nazzaro et al., 1991). In other words, substantial evidence suggests that CNS lesions such as brain abscesses and tumors have increased permeability to substances and drugs of low molecular weight compared to those of high molecular weight (Neuwelt, 1989). These observations suggest that advantage might be taken of this differential permeability in the delivery of therapeutic agents to brain lesions. In the case of cerebral abscess, one could administer a large intravenous dose of a low-molecular-weight antibiotic. Subsequently, antibody that is directed against the drug is administered. The antibody would inactivate (i.e., "rescue") a circulating potentially toxic drug, but not the drug that is active in the brain abscess since the antibody, because of its relatively high molecular weight, is excluded from the brain abscess. The idea of abscess differential permeability, then, might allow for a new method of elevated dosage schedules in the medical therapy of brain abscess, which have hitherto been limited by the toxicity associated with high dosages. Prevention of systemic toxicity otherwise associated with high drug dosages by intravenously administered drug-specific antibodies has been demonstrated with the cardiac glycoside digoxin (Smith et al., 1976, 1982). Indeed, the binding of systemic drug, but not drug within brain abscess, by antidrug immunoglobulin (IgG) was demonstrated in the E. coli brain abscess model (Nazzaro et al., 1991). In the E. coli abscess model we were able to demonstrate that, while 95% of the circulating systemic serum gentamicin was bound by antibody directed against

The authors wish to thank Dr Susan Kohlhepp for providing the bacteria used in these experiments, Dr Gleb Budzilovich for the preparation and review of histopathologic specimens, and Dr loel Oppenheim for further characterization of the E. coli used in this work. This work was supported by the Preuss Foundation, Veterans Administration Merit Review Grant, and the National Institutes of Health, Grant No. CA3 1770.

References Ashman, R. B., Papadimitriou, J. M. (1994). Endothelial cell proliferation associated with lesions of murine systemic candidiasis. Infect. Immun., 62, 5151-5153. Ashman, R. B., Bolitho, E. M., Papadimitriou, J. M. (1993). Patterns of resistance to Candida albicans in inbred mouse strains. Immunol. Cell Biol., 71, 221-225. Bohl, I., Wallenfang, T. H., Bothe, H., Schurmann, K. (1981). The effect of glucocorticoids in the combined treatment of experimental brain abscess in cats.Adv. Neurosurg., 9, 125-133. Bothe, H. W., Paschen, W. (1986). Regional morphology and biochemistry in experimental brain abscesses. Acta Neuropatkol. (Berl.), 69, 17-22. Bothe, H. W., Bodsch, W., Hossman, K. A. (1984). Relationship between specific gravity, water content, and serum protein extravasation in various types of vasogenic brain edema. Acta NeuropathoL (Berl.), 64, 37-42. Britt, R. H., Enzmann, D. R., Yaeger, A. S. (1981). Neuropathological and computerized tomographic findings in experimental brain abscess.]. Neurosurg., 55, 590-603. Britt, R. H., Enzmann, D. H., Placone, R. C., Obana, W. G., Yaeger, A. S. (1984). Experimental anaerobic brain abscess. ]. Neurosurg., 60, 1148-1159. Costello, G. T., Heppe, R., Winn, H. R., Scheld, W. M., Rodeheaver, G. T. (1983) Susceptibility of brain to aerobic, anaerobic, and fungal organisms. Infect. Immun., 41,535-539. Enzmann, D. R., Britt, R. H., Yeager, A. S. (1979). Experimental brain abscess evolution: computed tomographic and neuropathologic correlation. Radiology, 133, 113-122. Enzmann, D. R., Britt, R. H., Lyons B., Carroll, B., Wilson, D. A., Buxton, J. (1982a). High-resolution ultrasound evaluation of experimental brain abscess evolution: comparison with computed tomography and neuropathology. Radiology, 142, 95-102. Enzmann, D. R., Britt, R. H., Placone, R. C., Lyons, B., Yeager, A. S. (1982b). The effect of short-term corticosteroid treatment

ESCHERICHIA COLI BRAIN ABSCESS METHOD IN RAT

645

on the CT appearance of experimental brain abscesses. Radiology, 145, 79-84. Enzmann, D. R., Britt, R. H., Obana, W. G., Stuart, J., MurphyOwen, K. (1986). Experimental Staphlococcus aureus brain abscess. A. ]. N. R., 7, 395-402. Essick, C. R. (1919). Pathology of experimental traumatic abscess of the brain. Arch. Neurol. Psychiatr., 1,673-707. Falconer, M. A., McFatlan, A. M., Russell, D. S. (1943). Experimental brain abscesses in the rabbit. Br. J. Surg., 30, 245-260. Flaris, N. A., Hickey, W. F. (1992). Development and characterization of an experimental model of brain abscess in the rat. Am. J. PathoL, 141, 1299-1307. Grados, O., Ewing, W. H. (1970). Antigenic relationship between Escherichia coli and Neisseria menigitidis. ]. Infect. Dis., 122, 100-103. Groff, R. A. (1934). Experimental production of abscess of the brain in cats. Arch. Neurol. Psychiatr. (Chic.), 31,199-204. Hassler, O., Forsgren, A. (1964). Experimental abscesses in brain and subcutis. A microangiographic study in the rabbit. Acta PathoL MicrobioL Scand., 62, 59-67. Housmann, K. A., Bothe, H. W., Bodsch, W., Paschen, W. (1983). Pathophysiological aspects of blood-brain barrier disturbances in experimental brain tumors and brain abscesses. Acta Neuropathol (Berl.) Suppl., 8, 89-102. Howard, C. J., Given, A. A. (1971). The virulence for mice of strains of Escherichia coli related to the effects of antigen on their resistance to phagocytosis and killing by complement. Immunology, 20, 767-777. Kasper, D. L., Winkelhake, J. L., Zollinger, W. D., Brandt, B. L., Artenstein, M. S. (1973). Immunochemical similarity between polysaccharide antigens of Escherichia coli 07, KI(L) and Group B Neisseria meningitidis. J. ImmunoL, 110, 262-268. Kretzschmar, K., Wallenfang, T., Bohl, J. (1981). CT studies of brain abscesses in cats. Neuroradiology, 22, 93-98. Kroll, R. A., Neuwelt, E. A. (1998). Outwitting the blood-brain for therapeutic purposes: osmotic opening and other means. Neurosurgery, 42, 1083-1100. Kroll, R. A., Pagel, M. A., Langone, J. J., Neuwelt, E. A. (1994). Differential permeability of the blood-tumor barrier in intracerebral tumor-bearing rats: anti-drug antibody to achieve systemic drug rescue. Therap. ImmunoL, 1,333-341. Kurzydlowski, H., Wollenschlager, C., Venezio, F. R., Ghobrial, M., Soriano, M. M., Reichman, O. H. (1987). Reevaluation of an experimental streptococcal canine brain abscess model. ]. Neurosurg., 67, 717-720. Lo, W. D., McNeely, D. L., Boesel, C. W. (1991). Blood-brain barrier permeability in an experimental model of bacterial cerebritis. Neurosurgery, 29, 888-892. Lo, W. D., Wolny, A. C., Timan, C., Shin, D., Hinkle, G. H. (1993). Blood-brain barrier permeability and the brain extracellular space in acute inflammation. J. NeuroL Sci., 118, 188-193. Lo, W. D., Wolny, A., Boesel, C. (1994). Blood-brain barrier permeability in staphylococcal cerebritis and early brain abscess. ]. Neurosurg., 80, 897-905. Long, W. D., Meacham, W. F. (1968). Experimental model for producing brain abscess in dogs with evaluation of the effect of dexamethasone and antibiotic therapy on pathogenesis of intracerebral abscess. Surg. Forum, 19, 437-438. McCracken, G. H. Jr, Mize, S. G. (1976). A controlled study of intrathecal antibiotic therapy in Gram-negative enteric meningitis of infancy. J. Pediatr., 89, 66-72.

Mendes, M., Moore, P., Wheeler, C. B., Winn, H. R., Rodeheaver, G. (1980). Susceptibility of brain and skin to bacterial challenge. ]. Neurosurg., 52, 772-775. Molinari, G. F. (1972). Septic cerebral embolism. Stroke , 3, 117-122. Molinari, G. F., Smith, L., Goldstein, M. N., Satran, R. (1973). Brain abscess from septic cerebral embolism: an experimental model. Neurology, 23, 1205-1210. Nakagawa, Y., Shinno, K., Okajima, K., Matsumoto, K. (1990). Perifocal brain oedema in experimental brain abscess in rats. Acta Neurochir. Suppl., 51,381-382. Nazzaro, J. M., Rosenbaum, L. C., Pagel, M. A., Neuwelt, E. A. (1991). A new model of systemic drug rescue based on permeability characteristics of the blood-brain barrier in intracerebral abscess-bearing rats. ]. Neurosurg., 74, 467-474. Nazzaro, J. M., Pagel, M. A., Neuwelt, E. A. (1992). Further refinement of the Escherichia coli brain abscess model in rat. ]. Neurosci. Methods, 44, 85-90. Neuwelt, E. A. (ed.) (1989). Implications ofthe Blood-Brain Barrier and its Manipulation. Plenum Press, New York. Neuwelt, E. A., Barnett, P. A. (1989). Blood-brain barrier disruption in the treatment of brain tumors: animal studies. In: Implications of the Blood-Brain Barrier and its Manipulation (ed. Neuwelt, E. A.), vol. 2, Clinical Aspects, pp. 107-194. Plenum Press, New York. Neuwelt, E. A., Dahlborg, S. A. (1989). Blood-brain barrier disruption in the treatment of brain tumors: clinical implications. In: Implications of the Blood-Brain Barrier and its Manipulation (ed. Neuwelt, E. A.), vol. 2, Clinical Aspects, pp. 195-262. Plenum Press, New York. Neuwelt, E. A., Baker, D. E., Pagel, M. A., Blank, N. K. (1984a). The cerebrovascular permeability and delivery of gentamicin to normal brain and experimental brain abscess in rats. ]. Neurosurg., 61,430-439. Neuwelt, E. A., Lawrence, M. S., Blank, N. K. (1984b). The effect of gentamicin and dexamethasone on the natural history of the rat Escherichia coli brain abscess model with histopathological correlation. Neurosurgery, 15,475-483. Neuwelt, E. A., Enzmann, D. R., Pagel, M., Miller, G. (1989). Bacterial and fungal brain abscesses and the blood-brain barrier. In: Implications of the Blood-Brain Barrier and its Manipulation (ed. Neuwelt, E. A.), vol. 2, Clinical Aspects, pp. 263-306. Plenum Press, New York. Obana, W. G., Britt, R. H., Placone, R. C., Stuart, J. S., Enzmann, D. R. (1986) Experimental brain abscess development in the chronically immunosuppressed host. Computerized tomographic and neuropathological correlations. ]. Neurosurg., 65, 382-391. Paxinos, G., Watson, C., Emson, P. (1982). The Rat Brain in Stereotaxic Coordinates, pp. 129-149. Academic Press, New York. Quartey, G. R. C., Johnston, J. A., Rozdilsky, B. (1976). Decadron in the treatment of cerebral abscess: an experimental study. ]. Neurosurg., 45,301-310. Raft, H. V., Devereux, D., Shuford, W., Abbott-Brown, D., Maloney, G. (1988) Human monoclonal antibody with protective activity for Escherichia coli K1 and Neisseria meningitides group B infections. ]. Infect. D#., 157, 118-126. Robbins, J. B., McCracken, G. H. Jr, Gotschlich, E. C., Orskov, F., Orskov, L., Hanson, L. A. (1974). Escherichia coli K1 capsular polysaccharide associated with neonatal meningitis. N. Engl. ]. Med., 290, 1216-1220.

646

Runge, V. M., Clanton, I. A., Price, A. C. et aL (1985). Dyke Award. Evaluation of contrast-enhanced MR imaging in a brain-abscess model. Am. J. NeuroradioL, 6, 139-147. Schmidt, D. H., Butler, V. P. Jr (1971). Reversal of digoxin toxicity with specific antibodies. J. Clin. Invest., 50, 1738-1744. Schroeder, K. A., McKeever, P. E., Schaberg, D. R., Hoff, 1. T. (1987). Effect of dexamethasone on experimental brain abscess. J. Neurosurg., 66, 264-269. Smith, T. W., Haber, E., Yeatman, et al. (1976). Reversal of advanced digoxin intoxication with Fab fragments of digoxinspecific antibodies. N. Engl. J. Med., 294, 797-800. Smith, T. W., Butler, V., Haber, E.,et aL (1982). Treatment of life threatening digitalis intoxication with digoxin-specific Fab antibody fragments: experience in 26 cases. N. EngL J. Med., 307, 1357-1362. Thomas, L. (1942). A single stage to produce brain abscess in cats. Arch. Pathol., 33, 472-476. Wallenfang, T., Bohl, J., Schreiner, G. (1979). Experimental brain edema in acute and chronic brain abscess in rabbits and its morphological alterations. In: Advances in Neurosurgery 7 (eds Marguth, F., Brock, M., Kazner, E., Klinger, M., Schmiedek, P.), pp. 304-310. Springer-Verlag, Berlin.

J . M . Nazzaro and E. A. Neuwelt

Wallenfang, T., Bohl, J-, Kretzschmar, K. (1980). Evolution of brain abscess in cats: formation of capsule and resolution of brain edema. Neurosurg. Rev., 3, 101-111. Winn, H. R., Rodeheaver, G., Moore, P., Wheeler, C. (1978). A new model for experimental brain abscess in rats and mice. Surg. Forum, 29, 500-502. Winn, H. R., Mendes, M., Moore, P., Wheeler, C., Rodeheaver, G. (1979). Production of experimental brain abscess in the rat. J. Neurosurg., 51,685-690. Wolberg, G., DeWitt, C. W. (1969). Mouse virulence of K(L) antigen-containing strains by Escherichia coli. J. BacterioL, 100, 730-737. Wood, J. H., Doppman, J. L., Lightfoote, W. E., Girton, M., Ommaya, A. K. (1978). Role of vascular proliferation on angiographic appearance and encapsulation of experimental traumatic and metastatic brain abscesses. J. Neurosurg., 48, 264-273. Wood, J. H., Lightfoote, W. E. II and Ommaya, A. K. (1979). Cerebral abscesses produced by bacterial implantation and septic embolisation in primates. J. NeuroL Neurosurg. Psychiatr., 42, 62-69.

0 Q. (1)

0

tl) 0mq,

mk

m

0

0 0

0

This Page Intentionally Left Blank

Chapter 77

Rodent Models of Candida Sepsis V. Joly and P. Yeni

Background of human infection Rates of candidemia have increased substantially, and Candida has become the fourth most common isolate recov-

ered from blood cultures (Jarvis, 1995). Candidal infections occur on both medical and surgical services. The mortality rate is high. A noticeable shift in the species of Candida causing infection toward non-albicans species has occurred (Wingard et aL, 1991; Rex et aL, 1994; Wingard, 1995); some of these non-albicans emerging species are relatively resistant to the available antifungal agents, whereas there are few new antifungal agents under development. Numerous risk factors for candidemia have been identified, including use of antibiotics, neutropenia, indwelling catheters, chemotherapy, parenteral alimentation, immunosuppressive therapy after organ transplantation and colonization with Candida species. Knowledge of the most appropriate therapeutic strategies remains limited because few studies have compared the usefulness of recent antifungal agents (fluconazole, itraconazole, lipid-based amphotericin B formulations) to that of the traditional agent, deoxycholate amphotericin B. The study of serious candidal infection remains difficult due to the complex disease profile of these patients.

Wout et aL, 1989), CF1 mice (Karyotakis et aL, 1993), CD-1 mice (Hanson et al., 1991). Inbred mice from different strains (C3H/He, BALB/c, C57BL etc.) including congenitally immunodeficient mice (nude mice, beige mice) have also been used to study the strain-dependent difference susceptibility of mice to candidosis (Marquis et al., 1986; Cantorna and Balish, 1990). Disseminated candidosis can also be obtained in guineapig (Hurley and Fauci, 1975) and outbred strains of rats (male, 200-250g; Rogers and Balish, 1978; Fisher et aL, 1989; Vitt et aL, 1994).

Preparation of animals No specialized housing or care is required. Rodents may be immunocompromised, with the aim of studying the efficacy of antifungal drugs in the context of severe underlying immunosuppression, or to obtain infection with non-albicans Candida species. Neutropenia can be induced with cyclophosphamide (Van't Wout et aL, 1989; Anaissie et aL, 1993), 5-fluorouracil or gold sodium thionalate (Atkinson et aL, 1994). Hydrocortisone acetate is used to decrease phagocytic activity (Anaissie et aL, 1993; Kullberg et aL, 1993).

Background of model Storage and preparation of inocula In 1885, Klemperer produced disseminated candidosis in guinea-pigs by intravenous inoculation of C. albicans. This experiment was soon repeated and expanded by others. Of the many types of animal used to study disseminated candidosis, the mouse is the most popular species, followed by the rabbit, the rat and the guinea-pig.

Animal species Several strains of mice have been used in this model. The use of outbred mice (male, 25-30 g) is generally appropriate m ICR mice (Barchiesi et aL, 1996), Swiss mice (Van't Handbook of Animal Models of Infection

ISBN 0-12-775390-7

Various albicans and non-albicans Candida strains have been used, usually clinical isolates from blood cultures. Isolates are maintained on Sabouraud dextrose agar slants or in water stocks. Organisms are freshly subcultured over 18-24 hours on Sabouraud agar or in appropriate broth, then suspended in 0.9% NaC1 or phosphate buffered saline, washed and adjusted to the appropriate inoculum spectrophotometrically or by enumeration with a hemocytometer. Counts of colony-forming units (cfu) per ml are verified by plating serial 10-fold dilutions on to Sabouraud dextrose agar plates. It is possible to prepare aliquots of a stock solution of the inoculum, kept frozen at-80°C and thawed before the experiment. Copyright © 1999AcademicPress All rights of reproduction in any form reserved

V. Joly and P. Yeni

650

A large range of inoculum has been tested. In normal, unpretreated mice, the intravenous LDso is of the order of 104-106 yeasts; the LDso depends on the virulence of the Candida strain and on the susceptibility of the mouse strain to disseminated candidosis.

Infection process Intravenous injection of a suitable Candida inoculum is sufficient to establish a disseminated visceral infection that resembles disseminated candidosis in humans. This route of experimental infection is used the most widely. Intraperitoneal inoculation also commonly leads to disseminated infection, but the inoculum needs to be 10 times higher than an intravenous inoculum to induce similar extensive pathology. Finally, experimental gastrointestinal candidosis in immunosuppressed mice may be used as a model for dissemination of Candida infection from the gut to the blood stream (Wingard et al., 1980).

Key parameters to monitor infection and response to treatment Main key parameters to monitor infection are death and organ cfu. The rate of progression of experimental disseminated candidosis varies with the inoculum size: in mice, most investigators have found that an intravenous inoculum greater than 106 C. albicans yeasts is rapidly lethal whereas an inoculum less than 104 gives a low-grade, chronic infection with spontaneous resolution. With Candida species of low virulence, the severity of the disease can be modulated by the use ofimmunosuppressed animals. Mortality data can be expressed in terms of LDs0 value, that is, the dose inducing death in 50% of animals until the end of the observation, as mean survival time or as a Kaplan-Meier survival curve. The course of experimental disseminated candidosis has been described in many papers. In mice, enumeration of viable C. albicans in body organs shows a peak in cfus recoverable from liver, lungs and spleen shortly after intravenous infection (Evans and Mardon, 1977). This peak is followed by a gradual decline in the number of organisms in all organs except the kidney. Viable counts in the kidney steadily increase and this organ becomes the most severely infected. The high predilection of Candida for the kidney remains unexplained. Maximum involvement of the kidney after intravenous inoculation is also observed in the rat (Rogers and Balish, 1978) and the guinea-pig (Hurley and Fauci, 1975). The kidney is thus the site of choice to assess cfu counts. Organs are sampled aseptically, weighed and homogenized in phosphate buffered saline. Ten-fold dilutions of the homogenate are plated on Sabouraud agar and the colonies are counted after 24-48 hours incubation at

37°C. Results are expressed in log cfu per gram of tissue. Histopathology can be performed to assess host inflammatory reaction and morphologic form of the organism (yeasts, pseudohyphae, hyphae). An increase in peripheral blood granulocytes and monocytes is noted after infection of mice (Kullberg et al., 1992, 1993) and rats (Vitt et al., 1994). Tumor necrosis factor (TNF) and interleukin-6 are produced systemically during C. albicans infection (Riipi and Carlson, 1990; Steinshamn and Waage, 1992). Complement plays a major role in innate resistance (Hector et al., 1982).

Antimicrobial therapy In vitro tests for the assessment of antifungal agents activity

have some limitations, particularly in the case of azole compounds, for which it is difficult to define interpretative breakpoints predicting in vivo efficacy. Animal models of candidosis are largely used to study simultaneously the in vivo efficacy and toxicity of antifungal agents. Several laboratories have developed the mouse/intravenous model to the point at which reproducible inoculation of intermediate doses of Candida is routinely achieved, so that the model can be used to evaluate antifungal action with manageable mortality rates and times. Most systemic antifungal agents have been evaluated in the rodent model of disseminated candidosis. Table 77.1 lists some examples of a variety of rodent models of disseminated candidosis and the antifungals tested in them. Treatment can be administered by a variety of routes: subcutaneously, by oral gavage, intravenously, intraperitoneally. The intravenous route allows one to know precisely the amount of administered drug, but is less convenient than intraperitoneal route for repeated administrations. The intraperitoneal route may be considered to be representative of a slow-rate infusion. The choice of the route also depends on the drug: some lipophilic triazoles are not available for the parenteral route, and the intravenous route is the only valuable route for liposomal-amphotericin B to respect the conditions of administration in humans. Drug therapy is begun Within the hours following infection, ranging from 1 hour to several days after challenge. By contrast, drug therapy begins before infection in some studies. The duration of therapy varies from a single administration to several days. The dosing schedule and choice of dose should be given careful consideration, as stated below. Determination of cfus in kidney is usually done one to several days after the end of therapy.

Pitfalls of the model The models of systemic candidosis in rodents have several limitations. After intravenous challenge of a high inocu-

30

0 0 m z

-4

T a b l e 77.1

Examples of rodent models of candidosis used for the evaluation of antifungal agents in vivo

Model

Am B

L-Am B

Flu cytosine

Ke toconazole

Triazoles

Echinocandins

Drug combination

Mouse

Rabinovich et aL (1974) Lopez-Berestein et al. (1983) Lopez-Berestein et aL (1984a) Van't Wout et al. (1989) Tremblay et aL (1984) Gondal et aL (1989)

Lopez-Berestein et aL (1983) Lopez-Berestein et al. (1984a) Tremblay et aL (1984) Gondal et aL (1989)

Pitillo and Ray (1969) Rabinovich et al. (1974) Anaissie et aL (1994)

Heel et aL (1982)

Richardson et aL (1985) Van't Wout et al. (1989) Kullberg et aL (1992) Karyotakis et al. (1993) Anaissie et aL (1994) Sugar et aL (1994a)

Abruzzo et al. (1997) Graybill et al. (1997a) Graybill et aL (1997b)

Rabinovich et al. (1974) Polak et al. (1982)

Hare and Loebenberg, 1988 Richardson et aL (1985)

Clark et aL (1991) Pahls and Schaffner (1994)

Hanson et al. (1991) Clark et al. (1991)

Rat

Karyotakis et al. (1993) Sugar et al. (1994a) Sugar et al. (1994b) Anaissie et al. (1994) Galgiani and Van Wyck (1984) Richardson et al. (1985) Fisher et aL (1989)

Sugar et al. (1994b) Barchiesi et al. (1996)

Rogers and Galgiani (1986) Richardson et al. (1985)

Atkinson et al. (1994) Sugar et al. (1994a)

0 0 m I0

-!1

t~ m "o t~ t~ m

Sugar et al. (1994b) Hanson et al. (1991) Sanati et al. (1997)

Richardson et aL (1985) Rogers and Galgiani (1986) Fisher et aL (1989)

(33 O1

652

lum, infection is so rapidly fatal that drugs cannot be expected to exert a significant effect. On the other hand, infection with a low inoculum leads to spontaneous high survival rates and, therefore, drug effects are likely to be inapparent. Even in the case of a reproducible inoculation of intermediate doses of C. albicans, leading to an acute infection, many studies involve a prophylactic treatment with the drug given before or at the same time as the Candida inoculum, rarely beyond 24 hours after infect i o n m f a r from the usual situation in humans. Furthermore, the model remains difficult to adapt to infections caused by species other than C. albicans. The results of therapeutic trials vary substantially with the timing and route of administration of the antifungal drug. The route of administration of antifungals in animal models is not always the same as that used in humans: nontraumatic oral administration of drugs is a frequent problem with laboratory animals and repeated intravenous injections may be difficult in rodents. The intraperitoneal route is therefore often preferred, but is not suitable for some antifungal agents such as lipidic formulations of amphotericin B. Pharmacokinetics of drugs may be different in rodents and humans. The serum half-life of drugs is often decreased in rodents compared to humans; this can lead to therapeutic failure if the interval between doses is too long. Animals with systemic candidosis typically develop renal infection and drugs with good renal concentrations and low nephrotoxicity may have a special advantage, which does not necessarily extrapolate to human illness. In experimental candidosis in rodents, evaluation of toxicity is basic, mainly founded on survival. Histologic studies and biochemical monitoring of hepato- and nephrotoxicity are infrequently performed and do not bring as much information as in studies performed in more sophisticated models. For example, the first studies performed with liposomal-amphotericin B reported a dramatically favorable degree of protection against toxicity of the drug (LopezBerestein et aL, 1983), but further studies performed in rabbits (Lee et aL, 1994) or rats (Longuet et aL, 1991) and clinical data showed that nephrotoxicity could be observed for daily dosages which were clearly lower than the higher dose tolerated in mice as assessed on the basis of survival.

Contributions of the model to infectious disease therapy Indication of efficacy of antimicrobial agents

Disseminated candidosis in rodents is the first step in the evaluation of the in vivo activity of antifungal compounds. This model allowed the demonstration that fluconazole was superior to ketoconazole in the treatment of disseminated candidosis; this result has been further confirmed by clinical data. In mice infected with 10~cfu and treated daily

V. Joly and P. Yeni

for 10 days, the percentage of mice alive on day 11 was used to determine the effective dose 50 (ED50) of fluconazole, i.e., the dose inducing survival of 50% of the animals Fluconazole had an EDs0 of 0.15 mg/kg, and ketoconazole was far less active, with an ED50 of 20mg/kg. Although mice treated with azoles appeared to be cured, a more quantitative analysis did not support this conclusion. The average log cfu per kidney was stabilized at about 104 cfu per kidney, the level found 6 hours after inoculation, showing that azoles acted as fungistatic agents in this model. By contrast, 3 subcutaneous doses of amphotericin B reduced pathogen levels to below the level of detection of 100 CFU per kidney. The model could therefore distinguish between fungicidal and fungistatic compounds (Hare and Loebenberg, 1988). In rats infected with C. albicans, ketoconazole (10 mg/kg daily for 3 days) was more efficient than fluconazole (0.5 mg/kg daily for 3 days) to increase survival, although ketoconazole was 16-fold more active in vitro on the Candida strain (Rogers and Galgiani, 1986). Disseminated candidosis has also been used extensively to study the comparative efficacy of deoxycholate-amphotericin B (Fungizone) and lipidic formulations of amphotericin B (Lopez-Berestein et aL, 1983; Gondal et aL, 1989; Clark et aL, 1991). Most studies have shown that lipidicamphotericin B was as effective as free amphotericin B when used at similar dosage, but the reduced toxicity of lipidic-amphotericin B allowed the dose to be increased. Thus, lipidic-amphotericin B had an improved therapeutic index. Clinical data have confirmed that lipidic-amphotericin B could be used at higher dosages (3-5 mg/kg daily) than Fungizone, and allowed to obtain good clinical and mycological response in patients in whom Fungizone would have been toxic. Experimental disseminated candidosis has been used to study the role of resistance to antifungal agents in therapeutic failure. Some Candida species exhibit intrinsic resistance to antifungal agents: C. krusei, for example, is resistant in vitro to fluconazole, and fluconazole is not active in the model of disseminated candidosis due to C. krusei (Anaissie et aL, 1993; Karyotakis et aL, 1993). This species has been shown to emerge under prophylaxis in patients (Wingard et aL, 1991). In mice infected with clinical strains isolated from oral cavities of patients with acquired immunodeficiency syndrome (AIDS), the therapeutic efficacy of fluconazole was clearly decreased when mice were challenged with strains isolated from patients in the post-therapy period (Barchiesi et aL, 1996). In addition, correlations between in vitro activity and in vivo efficacy of a given antifungal agent have been established in the model of systemic candidosis (Anaissic et aL, 1993): it has been shown that the breakpoint level of in vitro activity necessary to obtain in vivo antifungal effect had to been defined for each drug. However, for a given drug, in vitro activity predicted in vivo therapeutic efficacy, providing that appropriate tests were used (Rogers and Galgiani, 1986; Anaissie et aL, 1993). Disseminated candidosis in rodents is a simple way of evaluating the in vivo anticandidal activity of new com-

RODENT MODEL OF CANDIDA SEPSIS

pounds. MK-991 is a new echinocandin candidate for clinical development. It acts through inhibition of the 1,3-I]-Dglucan synthase, which synthetizes a critical structural cell wall component in certain pathogenic fungi. It has shown efficacy in the treatment of murine disseminated candidiasis, including fluconazole-resistant strain (Graybill et aL, 1997a) and non-albicans strains (Abruzzo et aL, 1997; Graybill et al., 1997b).

653

Odds, 1983; Kwon-Chung et aL, 1985; Shimizu et aL, 1996). The relationship between virulence and drug resistance has been studied in mice: the multidrug-resistant strain colonized kidneys to high levels, but had a markedly reduced virulence compared to parental strain on the view of mice mortality (Becker et aL, 1995).

Indication of pharmacokinetics, pharmacodynamics and tissue penetration Indication of probably synergistic/antagonistic effects of antifungal agent combinations The availability of different antifungal drugs makes the administration of combinations of drugs desirable in an attempt to achieve synergy, to broaden their combined spectrum of activity or to lower the dose, because of the toxicity of amphotericin B. Studies in experimental candidosis have shown that amphotericin B and flucytosine are usually additive or indifferent (Polak et al., 1982). There were theoretical concerns that combinations of polyenes, whose affinity for fungal cell membrane is increased by the presence of ergosterol, and azoles, which inhibit the synthesis of ergosterol, would be antagonistic. The study performed by Schaffner and Frick (1985) in experimental aspergillosis suggested that the combination of ketoconazole and amphotericin B might be antagonistic. In murine disseminated candidosis, however, it was shown that the combination of fluconazole and amphotericin B was not antagonistic (Sugar et aL, 1994b; Sanati et aL, 1997). The same type of results were found with the combination of amphotericin B and saperconazole (Sugar et aL, 1994a) or DO870 (Atkinson et aL, 1994). The interactions of azoles and polyenes may differ according to fungus strain, test model and the drug used, and a general rule concerning the concomitant or sequential use of these drugs cannot be drawn from these experimental data. Additional studies are necessary, including clinical studies.

Differential pathogenicity of Candida Candida species involved in various human infections differ in their inherent capacity to cause disease. C. albicans iso-

lates are consistently the most virulent, causing morbidity or mortality. Experimentally, non-albicans strains are usually less pathogenic (Bistoni et aL, 1984; Anaissie et aL, 1993), although some studies suggest that C. tropicalis could be more pathogenic than C. albicans, particularly in disseminated infection resulting from gastrointestinal colonization (Wingard et aL, 1980; De Repentigny et aL, 1992). Species and strain differences in yeast pathogenicity can be exploited as a basis for determining molecular virulence attributes in the pathogenesis of candidosis. Some experimental studies suggest that enzymes produced by C. albicans (hyaluronidase, chondroitin sulphatase, proteinase and phospholipase) might be virulence factors (Macdonald and

Plasma and tissue distribution of antifungal drugs can be studied in uninfected or infected mice. This has been particularly important for new formulations of amphotericin B in an attempt to evaluate the alteration of drug pharmacokinetics in the presence of different lipidic vehicles. Lopez-Berestein et aL (1984a) showed that liposomal encapsulation of amphotericin B improved the delivery of the drug to the liver, spleen, lung and kidney in both normal and infected mice. Furthermore, amphotericin B was measurable in brain tissue of infected animals after injection of the encapsulated drug, but not in the brain of normal animals, nor infected animals treated with free amphotericin B (Lopez-Berestein et aL, 1984b); these results suggested that vectorization, capillary endothelial damage and phagocytic uptake during infection may alter tissue amphotericin B delivery.

Increase in understanding host inflammatory response The role of phagoc'ytosis as a major defense mechanism against disseminated candidosis is reinforced by the susceptibility to systemic Candida challenge of animals pretreated with agents that reduce the number of phagocytic leukocytes (Moser and Domer, 1980; van't Wout et aL, 1988). Conversely, modifications leading to enhanced neutrophils or phagocytic killing, such as treatment with granulocyte or macrophage colony-stimulating factor may improve the evolution of disseminated experimental candidosis (PolakWiss, 1991; Vitt et aL, 1994). The role of complement in the elimination of C. albicans has been shown in mice - - higher LDs0 for C5-sufficient than for CS-deficient mice (Morelli and Rosenberg, 1971). Evidence has been obtained for a major role of T helper type I response in controlling invasive forms of candidosis in mice with demonstrable immunity (Cenci et al., 1990). Cytokine production by CD4 T cells, particularly interferon-7, contribute to resistance to infection (Romani et al., 1992). Administration of recombinant interferon-], enhances host resistance against acute disseminated C. albicans infection in mice through activation of polymorphonuclear cells (Kullberg et al., 1993). Interleukin-1 administered therapeutically with fluconazole in neutropenic mice can lead to a significant clearance of C. albicans from the kidney and the spleen (Kullberg et aL, 1992).

654

Tumor necrosis factor (TNF) and interleukin-6 are systemically produced during Candida albicans infection (Riipi and Carlson, 1 9 9 0 ; Steinshamn and Waage, 1992). Neutralization of T N F with an anti-TNF antibody results in an increased proliferation of C. albicans in normal mice, but not in granulocytopenic mice, suggesting the role of T N F for granulocyte antifungal activity in vivo (Steinshamn and Waage, 1992).

Conclusion Disseminated candidosis in rodents is a simple and reproducible model that can be used to study the mechanisms involved in Candida species pathogenicity and to predict clinical efficacy of antifungal drugs, providing that different parameters (inoculum size, Candida species, therapeutic regimens) are controlled and that large numbers of animals are used. To enhance the predictibility of these models, it is necessary to use as many Candida strains as possible, including clinical isolates due to new resistance patterns. Results obtained in rodents could be confirmed in more sophisticated models of experimental infections that allow a more accurate evaluation of drug pharmacokinetics and toxicity.

References Abruzzo, G. K., Flattery A. M., Gill, C. J. et aL (1997). Evaluation of the echinocandin antifungal MK-991 (L-743,872): efficacies in mouse models of disseminated aspergillosis, candidiasis, and cryptococcosis. Antimicrob. Agents Chemother., 41; 2333-2338. Anaissie, E., Hachem, R., K-Tin-U, C., Stephens, L. C., Bodey, G. P. (1993). Experimental hematogenous candidiasis caused by Candida krusei and Candida albicans: species differences in pathogenicity. Infect. Immun., 61, 1268-1271. Anaissie, E. J., Karyotakis, N. C., Hachem, R., Dignani, M. C., Rex, J. H., Paetznick, V. (1994). Correlation between in vitro and in vivo activity of antifungal agents against Candida species. J. Infect. Dis., 170, 384-389. Atkinson, B. A., Bocanegra, R., Colombo, A. L., Graybill, J. R. (1994). Treatment of disseminated Torulopsis glabrata infection with DO870 and amphotericin B. Antimicrob. Agents Chemother., 38, 1604-1607. Barchiesi, F., Najvar, L. K., Luther, M. F., Scalise, G., Rinaldi, M. G., Graybill, J. R. (1996). Variation in fluconazole efficacy for Candida albicans strains sequentially isolated from oral cavities of patients with AIDS in an experimental murine candidiasis model. Antimicrob. Agents Chemother., 40, 1317-1320. Becket, J. M., Henry, L. K., Jiang, W., Koltin, Y. (1995). Reduced virulence of Candida albicans mutants affected in multidrug resistance. Infect. Immun., 63, 4515-4518. Bistoni, F., Vecchiarelli, A., Cenci, E., Puccetti, P., Marconi, P., Cassone, A. (1984). A comparison of experimental pathogenicity of Candida species in cyclophosphamide-immunodepressed mice. Sabouradia J. Med. Vet. MycoL, 22, 409-418. Cantorna, M. T., Balish, E. (1990). Mucosal and systemic candidiasis in congenitally immunodeficient mice. Infect. Immun., 58, 1093-1100.

V. Joly and P. Yeni

Cenci, E., Romani, I., Vechiarelli, A., Puccetti, P., Bistoni, F. (1990). T cell subsets and IFN- 7 production in resistance to systemic candidiasis in immunized mice.J. ImmunoL, 144, 4333-4339. Clark, J. M., Whitney, R. R., Olsen, S. J. et aL (1991). Amphotericin B lipid complex therapy of experimental fungal infections in mice. Antimicrob. Agents Chemother., 35, 615-621. De Repentigny, L., Phaneuf, M., Mathieu, L. G. (1992). Gastrointestinal colonization and systemic dissemination by Candida albicans and Candida tropicalis in intact and immunocompromised mice. Infect. Immun., 60, 4907-4914. Evans, Z. A., Mardon, D. N. (1977). Organ localization in mice challenged with a typical Candida albicans strain and a pseudohyphal variant. Proc. Soc. Exp. BioL Med., 155, 234-238. Fisher, M. A., Shen, S., Haddad, J., Tarry, W. F. (1989). Comparison of in vivo activity of fluconazole with that of amphotericin B against Candida tropicalis, Candida glabrata and Candida krusei. Antimicrob. Agents Chemother., 33, 1443-1446. Galgiani, J. N., Van Wyck, D. B. (1984). Ornithyl amphotericin B methyl ester treatment of experimental candidiasis in rats. Antimicrob. Agents Chemother., 26, 108-109. Gondal, J. A., Swartz, R. P., Rahman, A. (1989). Therapeutic evaluation of free and liposome-encapsulated amphotericin B in the treatment of systemic candidiasis in mice. Antimicrob. Agents Chemother., 33, 1544-1548. Graybill, J. R., Najvar, L. K., Luther, M. F., Fothergill, A. W. (1997a). Treatment of murine disseminated candidiasis with L-743,872. Antimicrob. Agents Chemother., 41, 1775-1777. Graybill, J. R., Bocanegra, R., Luther, M., Tothergill, A., Ribaldi, M. J. (1997b). Treatment of murine Candida krusei or Candida glabrata infection with L-743,872. Antimicrob. Agents Chemother., 41, 1937-1939. Hanson, L. H., Perlman, A. M., Clemons, K. V., Stevens, D. A. (1991). Synergy between cilofungin and amphotericin B in a murine model of candidiasis. Antimicrob. Agents Chemother., 35, 1334-1337. Hare R. S., Loebenberg, D. (1988). Animal models in the search for antifungal agents. ASM News, 54, 235-239. Hector, R. F., Domer, J. E., Carrow, E. W. (1982). Immune responses to Candida albicans in genetically distinct mice. Infect. Immun., 38, 1020-1028. Heel, R. C., Brogden, R. N., Carmine, A., Morley, P., Speight, A., Avery, G. S. (1982). Ketoconazole: a review of its therapeutic efficacy in superficial and systemic fungal infections. Drugs, 23, 1-36. Hurley, D. L., Fauci, A. S. (1975). Disseminated candidiasis. I. An experimental model in the guinea-pig. J. Infect. Dis., 131, 516-521. Jarvis, W. R. (1995). Epidemiology of nosocomial fungal infections, with emphasis on Candida species. Clin. Infect. Dis., 20, 1526-1530. Karyotakis, N. C., Anaissie, E. J., Hachem, R., Dignani, M. C., Samonis, G. (1993). Comparison of the efficacy ofpolyenes and triazoles against hematogenous Candida krusei infection in neutropenic mice.J. Infect. Dis., 168, 1311-1313. Klemperer, G. (1885). Ueber die natur des soorpilzes. Zbl. Klin. Med., 6, 849-851. Kullberg, B-J., van't Wout, J. W., Poell, R. J. M., van Furth, R. (1992). Combined effect of fluconazole and recombinant human interleukin-1 on systemic candidiasis in neutropenic mice. Antimicrob. Agents Chemother., 36, 1225-1229. Kullberg, B-J., van't Wout, J. W., Hoogstraten, C., van Furth, R. (1993). Recombinant interferon-gamma enhances resistance to

RODENT MODEL OF CANDIDA SEPSIS

acute disseminated Candida albicans infection in mice. J. Infect. Dis., 168, 436-443. Kwon-Chung, K. J., Lehman, D., Good, C., Magee, P. T. (1985). Genetic evidence for role of extracellular proteinase in virulence of Candida albicans. Infect. Immun., 49, 571-575. Lee, J. W., Amantea, M. A., Francis, P. A. et al. (1994). Pharmacokinetics and safety of a unilamellar liposomal formulation of amphotericin B (AmBisome)in rabbits. Antimicrob. Agents Chemother., 38, 713-718. Longuet, P., Joly, V., Amirault, P., Seta, N., Carbon, C., Yeni, P. (1991). Limited protection by small unilamellar liposomes against the renal tubular toxicity induced by repeated amphotericin B infusions in rats. Antirnicrob. Agents Chemother., 35, 1303-1308. Lopez-Berestein, G., Mehta, R., Hopfer, R. L. et al. (1983). Treatment and prophylaxis of disseminated infection due to Candida albicans in mice with liposome-encapsulated amphotericin B.J. Infect. Dis., 147, 939-945. Lopez-Berestein, G., Hopfer, R. L., Mehta, R., Mehta, K., Hersh, E. M., Juliano, R. (1984a). Liposome-encapsulated amphotericin B for treatment of disseminated candidiasis in neutropenic mice. J. Infect. Dis., 150, 278-283. Lopez-Berestein, G., Rosenblum, M. G., Mehta, R. (1984b). Altered tissue distribution of amphotericin B by liposomal encapsulation: comparison of normal mice to mice infected with Candida albicans. Cancer Drug Deliv., 1,199-205. Macdonald, F., Odds F. C. (1983). Virulence for mice of a proteinase-secreting strain of Candida albicans and a proteinasedeficient mutant. J. Gen. Microbiol., 129, 431-438. Marquis, G., Montplaisir, S., Pelletier, M., Moisseau, S., Auger, P. (1986). Strain-dependent differences in susceptibility to experimental candidosis. J. Infect. Dis., 154, 906-909. Morelli, R., Rosenberg, L. T. (1971). Role of complement during experimental Candida infection in mice. Infect. Immun., 3, 521-523. Moser, S. A., Domer, J. E. (1980). Effects ofcyclophosphamide on murine candidiasis. Infect. Immun., 27, 376-386. Pahls, S., Schaffner, A. (1994). Comparison of the activity of free and liposomal amphotericin B in vitro and in a model of systemic and localized murine candidiasis. J. Infect. Dis., 169, 1057-1061. Pitillo, R. F., Ray, B. J. (1969). Chemotherapeutic activity of 5-fluorocytosine against a lethal Candida albicans infection in mice. Appl. Microbiol., 17, 773-774. Polak, A., Scholer, H. J., Wall, M. (1982). Combination therapy of experimental candidiasis, cryptococcosis and aspergillosis in mice. Chemotherapy, 28, 461-479. Polak-Wiss, A. (1991). Protective effect of human granulocyte colony stimulating factor (hG-CSF) on Candida infections in normal and immunosuppressed mice. Mycoses, 34, 109-118. Rabinovich, S., Shaw, B. D., Bryant, T., Donta, S. T. (1974). Effect of 5-fluorocytosine and amphotericin B on Candida albicans infection in mice. J. Infect. Dis., 130, 28-31. Rex, J. H., Bennett, J. E., Sugar, A. M. et al. (1994). A randomized trial comparing fluconazole with amphotericin B for the treatment of candidemia in patients without neutropenia. N. Engl. J. Med., 331, 1325-1330. Richardson, K., Brammer, K. W., Marriott, M. S., Troke, P. F. (1985). Activity ofUK-49,858, a bis-triazole derivative, against experimental infections with Candida albicans and Trichophyton mentagrophytes. Antimicrob. Agents Chemother., 27, 832-835.

655

Riipi, L., Carlson, E. (1990). Tumor necrosis factor (TNF) is induced in mice by Candida albicans: role of TNF in fibrinogen increase. Infect. Irnmun., 58, 2750-2754. Rogers, T. J., Balish, E. (1978). Immunity to experimental renal candidiasis in rats. Infect. Immun., 19, 737-740. Rogers, T. E., Galgiani, J. N. (1986). Activity of fluconazole and ketoconazole against C. albicans in vitro and in vivo. Antirnicrob. Agents Chernother., 30, 418-422. Romani, L., Mencacci, A., Cenci, E. et al. (1992). Course of primary candidiasis in T cell-depleted mice infected with attenuated variant cells. J. Infect. Dis., 166, 1384-1392. Sanati, H., Ramos, C. F., Bayer, A. S., Ghannoum, M. A. (1997). Combination therapy with amphotericin B and fluconazole against invasive candidiasis in neutropenic-mouse and infective-endocarditis rabbit models, antimicrob. Agents Chemother., 41, 1345-1348. Schaffner, A., Frick, P. G. (1985). The effect of ketoconazole on amphotericin B in a model of disseminated aspergillosis. J. Infect. Dis., 151,902-910. Shimizu, M. T., Almeida, N. Q., Fantinato, V., Unterkircher, C. S. (1996). Studies on hyaluronidase, chondroitin sulfatase, proteinase and phospholipase secreted by Candida species. Mycoses, 39, 161-167. Steinshamn, S., Waage, A. (1992). Tumor necrosis factor and interleukin-6 in Candida albicans infection in normal and granulocytopenic mice. Infect. Imrnun., 60, 4003-4008. Sugar, A. M., Salibian, M., Goldani, L. Z. (1994a). Saperconazole therapy of murine disseminated candidiasis: efficacy and interactions with amphotericin B. Antimicrob. Agents Chemother., 38, 371-373. Sugar, A. M., Hitchcock, C. A., Troke, P. F., Picard, M. (1994b). Combination therapy of murine invasive candidiasis with fluconazole and amphotericin B. Antirnicrob. Agents Chemother., 39, 598-601. Tremblay, C., Barza, M., Fiore, C., Szoka, F. (1984). Efficacy of liposome-intercalated amphotericin B in the treatment of systemic candidiasis in mice.Antimicrob. Agents Chemother., 26, 170-173. Van't Wout, J. W., Linde, I., Leijhh, P. C., van Furth, R. (1988). Contribution of granulocytes and monocytes to resistance against experimental disseminated Candida albicans. Eur. J. Clin. Microbiol. Infect. Dis., 7, 736-741. Van't Wout, J. W., Mattie, H., Van Furth, R. (1989). Comparison of the efficacies of amphotericin B, fluconazole, and itraconazole against a systemic Candida albicans infections in normal and neutropenic mice. Antimicrob. Agents Chemother., 33, 147-151. Vitt, C. R., Fidler, J. M., Ando, D., Zimmerman, J., Aukerman, S. L. (1994). Antifungal activity of recombinant human macrophage colony-stimulating factor in models of acute and chronic candidiasis in the rat. J. Infect. Dis., 169, 369-374. Wingard, J. R. (1995). Importance of Candida species other than C. albicans as pathogens in oncology patients. Clin. Infect. Dis., 20, 115-125. Wingard, J. R., Dick, 1. D., Merz, W. G., Sandford, G. R., Saral, R., Burns, W. H. (1980). Pathogenicity of Candida tropicalis and Candida albicans after gastrointestinal inoculation in mice. Infect. Immun., 29, 808-813. Wingard, J. R., Merz, W. G., Rinaldi, M. G., Johnson, T. R., Karp, J. E., Saral, R. (1991). Increase in Candida krusei infection among patients with bone marrow transplantation and neutropenia treated prophylactically with fluconazole. N. Engl. J. Med., 325, 1274-1277.

This Page Intentionally Left Blank

Chapter 78

A Generalized Candida albicans Infection Model in the Rat A. Schmidt

Introduction A reproducible intravenous infection model of a generalized Candida albicans infection was established in rats. In contrast to the intravenous C. albicans model in mice which has a high affinity of the infective organism to the kidney, the infectious process in rats is much more severely spread into organs other than the kidneys, such as brain, heart, liver, lung, eye, and spleen. Apart from a severe granulomatous nephritis beginning 1 day after infection, a severe pneumonitis was observed 3 days after infection with a mass of extravasal erythrocytes in the interstitium and the alveolar space. Furthermore, multiple nodular lesions could be observed in the brain, heart, liver, retina and spleen on the first day after infection. Total mortality occurred within 1 week; most deaths occurred from the fifth to the seventh day. Antifungal therapy with amphotericin B (1 mg/kg body weight twice daily over 5 days given by oral gavage) or fluconazole (2.5 mg/kg respectively) led to long-term survival over 4 months. Such long-term survival could not be achieved in mice, even after sufficient therapy with high doses of the two substances, as was shown in previous tests performed in our laboratory.

Background of human fungal infections Life-threatening systemic fungal infections are rapidly increasing in incidence (Wegmann, 1994). The increased incidence of these opportunistic infections is mainly due to factors such as more aggressive cancer and post-transplantation chemotherapy, the emergence of acquired immunodeficiency syndrome (AIDS) as well as predisposing factors resulting from improved intensive care treatment, and the widespread use of antibiotics, corticosteroids, and immunosuppressives (Ellis, 1994). All these factors result in a lowered resistance of the host towards a wide range of infectious agents, including fungal pathogens (KwonChung and Bennett, 1992). Most of these fungal infections are caused by yeasts, mainly due to Candida species, though hyphomycetes such as different Aspergillus species - - and in particular A. furniHandbook of Animal Models of Infection ISBN 0-12-775390-7

(Schmidt, 1995, 1997)--also are outstandingly important. Further, a mass of emerging rare fungal pathogens (e.g., Fusarium species and other miscellaneous moulds, dermatiaceous fungi, Zygomycetes, etc.) are an increasing cause of opportunistic mycoses (Anaissie et aL, 1989; Kwon-Chung and Bennett, 1992; de Hoog and Guarro, 1995). Yeasts account for up to 10% of nosocomial blood stream infections and are a serious cause of mortality among different patient populations (Komshian et aL, 1989; Banerjee et al., 1991; Wenzel and Pfaller, 1991). Most of the systemic fungal infections are due to yeasts of the genus Candida and C. albicans is extremely important (Pfaller, 1989; Pfaller and Wenzel, 1992). To a lesser extent, although increasing in importance, yeast infections are also caused by non-albicans Candida species such as C. tropicalis, C. krusei, C. parapsilosis, and Candida (formerly also Torulopsis) glabrata (Solomon et al., 1984; Gomez-Mateos et al., 1988; McQuillen et al., 1992). The increase of non-albicans Candida species in systemic yeast infections can partly be explained by a selection process due to antifungal prophylaxis regimen (Komshian et al., 1989; Wingard et al., 1991; Hitchcock et al., 1993). For the treatment of systemic mycotic infections, even nowadays, only a limited spectrum of antimycotic agents is available. Apart from amphotericin B and 5-fluorocytosine, broad-spectrum azoles such as fluconazole and itraconazole are the mainstay of therapy (Denning and Stevens, 1989; Simon and Stille, 1997). Especially for 5-fluorocytosine and azole antimycotics, the development of resistance of the fungi is a major problem (Fan-Havard et al., 1991; Horn et al., 1995; Rex et al., 1995). The increased medical need as a result of increased incidence of systemic fungal infections as well as development of resistance in the causative fungal pathogens has stimulated research on new antifungal agents, for which animal testing is an indispensable necessity (Zak and Sande, 1986; Miyaji, 1987).

gatus

Background of the model Animal experiments are essential for the study of infectious diseases, including mycotic infections (Miyaji, 1987). They Copyright © 1999AcademicPress All rights of reproduction in any form reserved

A. Schmidt

6{58

offer the possibility of studying the parasitic forms of fungi (Miyaji and Nishimura, 1980), the host defence mechanisms in mycotic infections (Nishimura and Miyaji, 1985), and the effects of antimycotic agents in vivo (Zak and Sande, 1986). In view of the increased systemic fungal infections, standardized in vivo models for these infections with human pathogenetic relevance (Yamaguchi, 1987), which are easy to handle, are of outstanding importance. Where therapy has failed after antimycotic therapy together with good in vitro sensitivity of the strain to the corresponding antimycotic agent, animal models are useful for the assessment in vivo of experimental antifungal susceptibility of these selected patient strains. Furthermore, the evaluation of the correlation of different antifungal susceptibility-testing methods (Rinaldi and Troke, 1991; NCCLS, 1997) with the in vivo outcome of therapy requires reproducible and standardized animal tests and is a good complement to clinical studies (Ghannoum et aL, 1996; Denning e t aL, 1997). In vivo models for systemic Candida infections caused by the intravenous route, with or without induced immunosuppression, which have been described previously include generalized infections in mice (Louria et aL, 1960, 1963; Rogers and Balish, 1976; Schmidt, 1996a; Schmidt and Geschke, 1996; Schmidt et aL 1996), rats (Rogers and Balish, 1976; Balk et aL, 1978; Nakamura et aL, 1991; Schmidt, 1996b; Schmidt and Geschke, 1996), guinea-pigs (Winner, 1960; Hurley and Fauci, 1975), and rabbits (Walsh et aL, 1992). In this chapter, a reproducible infection model of a generalized systemic C. albicans infection, caused by the strain C. albicans ATCC (American Type Culture Collection) 200498, which is identical to C. albicans strain BSMY 212 (Bayer Strain collection Mycology Yeasts; Schmidt, 1996b), in the Sprague-Dawley rat will be described, evaluated histopathologically and discussed. This model has been established without immunosuppression, which guarantees that no undesired interference of immunosuppressive drugs with tested antimycotic agents can occur.

Animals used Eight-week-old specific pathogen-free male SpragueDawley rats (HsdOla: Sprague-Dawley SD, Winkelmann, Paderborn, Germany) weighing 200g were housed in groups of five in type four Macrolon cages (Ehret, Emmendingen, Germany) on wood chips (Rettenmaier, Ellwangen, Germany). Photo periods were adjusted to 12 hours of light and 12 hours of darkness daily. The environmental temperature was constantly 23°C. Altromin standard diet (Altromin, Lange, Germany) and water were provided ad libiturn. Acclimatization time before the experiment was 1 week.

Storage of the organism and preparation of inoculum The strain C. albicans ATCC 200498 (= BSMY 212) used in this model is a clinical isolate obtained from a patient with gastrointestinal candidiasis and was deposited at the American Type Culture Collection by the author. The strain was maintained by cryoconservation in liquid nitrogen over the whole time period. For the preparation of the infection inoculum, the strain was cultivated on malt extract agar slopes (Difco, Detroit, MI) inoculated the day before harvesting and incubated at 28°C in the dark. Yeast cells were scraped off and washed twice with phosphate-buffered saline (PBS) by resuspending them in PBS on a Vortex-Mixer (Heidolph, Kelheim, Germany) with a consecutive centrifugation step at 3000g for 5 minutes each time. This suspension was then further diluted with PBS to an optical density which corresponds to an inoculum of 107 colony-forming units (cfu) of C. albicans per millilitre as determined by quantitative plating in 1:10 dilution steps on Sabouraud 2% dextrose agar (Merck, Darmstadt, Germany), and 0.5 ml of this suspension, which corresponds to an inoculum of 5 × 106 cfu of C. albicans, was administered to each rat by the intravenous route. In earlier tests performed in our laboratory, this inoculum (5 x 106 cfu per rat) was shown to be the lowest infectious dose to achieve a standardized 100% mortality within 1 week. Half of this infectious dose (2.5 x 106cfu per rat) still leads to almost 100% mortality within 2 weeks, but the mortality pattern cannot be well-standardized with this infectious dose: there is a high degree of variation in mortality between different experiments, which was shown in previous tests in our laboratory.

Infection process Animals were infected by injecting 5 × 106 cfu of C. albicans per animal in 0.5 ml PBS intravenously through the lateral tail vein using a tuberculin syringe of 1 ml with a 0.6 x 30 mm needle with a translucent hub. For the infection process, the animals were suitably restrained in a plastic rat restrainer (our own construction). Dilatation of the tail vein was achieved by a tourniquet around the base of the tail which was released after puncture, just before the injection was performed, as described by Waynforth and Flecknell (1992). Animals were observed twice daily for mortality and behavioural abnormalities until the end of the experiment.

Histopathological technique For the histopathological examination, animals were sacrificed by CO2 inhalation. Organs were removed

A GENERALIZED CANDIDA ALBICANS INFECTION MODEL IN THE RAT

immediately after mortification and fixed in 5% aqueous formaldehyde solution. After paraffin embedding and sectioning, the material was simultaneously stained by haematoxylin and eosin (H&E), and periodic acid-Schiff (PAS; all reagents: Sigma, Deisenhofen, Germany) as a special staining method for fungal elements (for further information on the staining methods, see Bancroft et aL, 1990).

Parameters to monitor infection Course of infection

Early reactions within 24 hours of infection could not be observed. On the second day after infection, encrustations of blood could be seen in the medial eye angle as well as on the tip of the nose. The first animals died on the fifth day after infection; mortality was 100% on the seventh day after infection (Figure 78.1).

0

"=

~==

w

i

~=~

~=~

~

J

•~ 10

0

0

2

4 6 days after infection

--

=

8

=

659

the parenchyma. Centrally, a necrotic tissue reaction could be observed with polymorphonuclear leukocytes surrounding the loci. Most lesions were located interstially between the tubuli; no penetration into the glomeruli was found. Mycelial structures were predominant towards blastospores. PAS-positive red spots, which were seen in the peripheral areas of the lesions, can be interpreted as degeneration products of fungal elements. Only a few lesions were located in the medulla, and these were mostly in subcortical areas. On the second day, granulomata had an average diameter of 0.3 ram. In the whole medulla, granulomata could be observed, penetrating from the papilla into the kidney pelvis. All granulomata contained mycelia, blastospores and chlamydospore-like structures. Tubuli were filled with protein cylinders. On the third day, the diameter of granulomata increased significantly with severe necrotic tissue reactions. Glomeruli were mostly unaffected. Fungal elements were significantly reduced in the granulomata, combined with a massive proliferation of fungal elements in the kidney pelvis, containing mycelia, blastospores and chlamydospore-like structures. There was only a sparse infiltration of the fungal mass in the kidney pelvis with polymorphonuclear leukocytes. On the fifth day, the whole kidney was covered with granulomata with a diameter up to 0.5 mm. Granulomata were predominantly free of fungal elements; sometimes a few chlamydospore-like structures of PAS-positive red spots could be found. The kidney pelvis was still filled with a mass of fungal elements containing blastospores and hyphae.

Spleen

10

Figure 78.1 Mortality of Sprague-Dawley rats. Infection established by intravenous injection of Candida albicans ATCC 200498 (= BSMY 212); infectious dose: 5 x 106 colonyforming units per animal. From Schmidt (1996b), with permission.

Necropsy status

On the first day after infection, only a few germinating blastospores without any inflammatous tissue reaction were found in the spleen. There was no special affinity to the white or red pulpa; foci in the spleen were self-limiting and were not seen after the second day after infection.

Liver

Histopathological evaluation of the model

On the first day after infection, a few nodular lesions with a diameter of up to 0.1 mm could be seen in the liver with a quite homogeneous distribution. There was no specific affinity to central or periportal areas of the hepatic lobe. These lesions contained only a few fungal elements, mostly only a few PAS-positive red spots. A diffuse leukocyte infiltration could be observed in the loci, with a relatively high PAS density of the hepatocytes surrounding the loci. Lesions in the liver subsequently regressed during the following days.

Kidney

Heart

One day after infection, nodular lesions with an average diameter of 0.15 mm could be found in the cortical region of

On the first day after infection, necrotic tissue reactions with a diameter of up to 0.2 mm could be observed in the

In the necropsy of rats that died of the infection, white foci were found on the surface of both kidneys. On other organs, no foci could be observed macroscopically. On the surface of the lung lobes, petechial bleedings and, in some cases also, free blood in the pleural cavity were evident.

A. Schmidt

660

heart with quite homogeneous distribution. Only a sparse leukocyte infiltration could be seen; the loci contained mycelia, blastospores and PAS-positive red spots. The surrounding myocardial parenchyma showed a red tinge in the PAS stain. Fungal elements became rarer during the following days, with remaining focal myocardial necrotizations.

tively. The minimal dose to achieve a 100% survival rate over 4 months was 1 mg/kg body weight twice daily over 5 days for amphotericin B. With the dose of 0.5 mg/kg under the same administration regimen, a 60% survival rate was achieved within 1 month (3 of 5 animals survived).

Brain

Validation of the model

On the first day after infection, cortical and subcortical small necrotic lesions with a diameter of up to 0.05 mm were seen in the cerebrum as well as in the cerebellum and the brain stem. Some loci contained mycelia and blastospores without any inflammatory tissue response, although highly reactive processes with an extended polymorphonuclear leukocytic infiltration and PAS-positive red spots could be observed. Fungal elements in the loci decreased from the second day with remaining necrotic tissue reactions.

In this rat model of a generalized C. albicans infection, a severe progressive granulomatous nephritis was found starting 1 day after infection. A severe progressive kidney dysfunction seems to be a main reason for the mortality. Apart from that, a severe bleeding disorder started around the second day after infection, with an extended pneumonitis with a mass of extravasal erythrocytes in the interstitium and the alveolar space. In addition, petechial bleedings on the surface of the lung lobes as well as free blood in the pleural cavity, in the eye angles, and on the tip of the nose could be observed. The mechanisms of these bleeding phenomena still need further clarification and may possibly help to understand bleeding disorders as they occur in fungal diseases such as aspergillomata in humans (Raper and Fennell, 1977; Wegmann, 1994). The focal myocarditis could have haemodynamic consequences and could be another mortality factor. Although infectious loci were found in the central nervous system, no severe behavioural disorders of the animals could be observed apart from a slowly progressive sedation. The course of infection in liver and spleen was rather limited. On the fifth day after infection, almost no fungi could be microscopically found in the kidney parenchyma, though the kidney pelvis was massively filled with fungal elements. This is the reason why the worth of quantitative plating of mashed organs, such as kidneys, in order to a s s e s s the fungal organ burden seems to have severe limitations and should be combined with histopathological methods. Quantitative plating does not allow the differentiation between parenchymal infection and cavital proliferation/ persistence of the organisms which can be achieved by histopathological evaluations. In contrast to the model in Wistar rats, as described by Balk et al. (1978), who observed a continuous distribution of deaths from the first day up to the 10th day after infection, this model shows a later but much more rapid pattern of mortality with nearly all deaths occurring from the fifth to the seventh day after infection. Further, cases of C. albicans arthritis as described by Nakamura et al. (1991) were not observed in this model.

Eye On the third day after infection, lesions with predominantly blastospores could be observed in the retina. Lung

The lung showed only discrete pathological changes with a few erythrocytes and lymphocyte-like cells in an apparently widened interstitium up to the second day after infection. On the third day after infection, an extensive pneumonitis with a mass of extravasal erythrocytes in the interstitium as well as the alveolar space could be seen. The lung was histopathologically free of fungal elements.

Antimycotic therapy and response to treatment For therapy, five rats in each group were treated with fluconazole (CAS 86386-73-4; Pfizer, Karlsruhe, Germany) or amphotericin B (CAS 1397-89-3 [Na-desoxycholate complex]; Squibb-Heyden, Munich, Germany) at doses of 0.5, 1, 2.5 and 5 mg of free substance per kg body weight. Substances were administered in 0.5 ml glucose (5%) agar (0.2%) solution (chemicals: Sigma) by oral gavage, twice daily with an interval of 8 hours in between over 5 days starting 1 hour after infection. Animals were examined twice daily up to 4 months after infection. The minimal oral dose to achieve a 100% survival rate over 4 months was 2.5 mg/kg body weight twice daily over 5 days for fluconazole. With the dose of 1 mg/kg under the same administration regimen, an 80% survival rate was achieved within 1 month (4 of 5 animals survived); the dose of 0.5 mg/kg led to a 20% survival rate (1/5 animals) respec-

Contributions to antimycotic therapy This C. albicans infection in rats offers the possibility to induce a more generalized, systemic experimental infection

A GENERALIZED CANDIDA ALBICANS INFECTION MODEL IN THE RAT

with dissemination into several other organs apart from the kidneys. This model mimics a generalized invasive candidosis much more than the intravenous C. albicans infection model in mice, which is much more restricted to the kidneys as almost the only target organ. The rat model described shows a highly standardized mortality pattern which occurs within 1 week. With only five animals per group, even weak signals of efficacy of substances can be detected in a highly reproducible way in the search for new antimycotic lead structures, as is known from the routine use of this model in our laboratory. Further, the 1-week mortality allows one to perform substance evaluations within a suitable period of time. Apart from the oral substance application described above, subcutaneous, intravenous, and intraperitoneal applications can easily be performed and show efficacy with the two antimycotics tested, as we know from our experience in our laboratory. The long-term survival over 4 months we observed after antimycotic therapy with amphotericin B (1 mg/kg body weight twice daily over 5 days) and fluconazole (2.5 mg/kg respectively) could not be achieved after therapy of the systemic C. albicans infection in mice with the same two antimycotics. Also, after sufficient therapy with high doses of these two substances, almost all mice showed late cases of deaths, even occurring 1 month or later after infection. From our histopathological and blood chemical observations (unpublished data), these late deaths seem not to be due to the primary mycotic infection but rather can be attributed to aseptic necrotic residues of nephritis of still unknown origin causing a progressive renal failure. This phenomenon was not observed in the rat model described. This rat model of a systemic C. albicans infection is a good complement to the familiar systemic candidiasis model in mice and is especially appropriate in second-line in vivo testings in the search for new antimycotic lead structures as well as for the development and evaluation of the potency of antimycotic agents in a species other than mice. A relative disadvantage of this model over the Candidainfection model in mice is that on average 10 times more substance is required to treat rats with an average body weight of 200 g per animal, in contrast to young mice which have a body weight of 15-20 g per animal on average.

Acknowledgement All animal tests reported here were performed in strict accordance with federal regulations. Results of this work have already partly been published by the author (Schmidt, 1996b).

References Anaissie, E. J., Bodey, G. P., Rinaldi, M. G. (1989). Emerging fungal pathogens. Eur. J. Clin. Microbiol. Infect. Dis., 8, 323-330.

661

Balk, M. W., Crumrine, M. H., Fischer, G. W. (1978). Evaluation of miconazole therapy in experimental disseminated candidiasis in laboratory rats. Antimicrob. Agents Chemother., 13, 321-325. Bancroft, ]. D., Stevens, A., Turner, D. R. (1990). Theory and Practice of Histological Techniques. Churchill Livingstone, Edinburgh, UK. Banerjee, S. N., Emori, T. G., Culver, D. H. et al. (1991). Secular trends in nosocomial primary blood stream infections in the United States, 1980-1989. Am. ]. Med., 91 (suppl. 3B), 86-89. de Hoog, G. S., Guarro, ]. (1995).Atlas of Clinical Fungi. Centraalbureau voor Schimmelcultures, Baarn/Delft, Netherlands. Denning, D. W., Stevens, D. A. (1989). New drugs for systemic fungal infections. Greater choice and more difficult clinical decisions. Br. Med. ]., 299, 407-408. Denning, D. W., Baily, G. G., Hood, S. V. (1997). Azole resistance in Candida. Eur. ]. Microbiol. Infect. Dis., 16, 261-280. Ellis, D. H. (1994). Clinical Mycology. The Human Opportunistic Mycoses. Gillingham Prints, Underdale, Australia. Fan-Havard, P., Capano, D., Smith, S. M., Mangia, A., Eng, R. H. K. (1991). Development of resistance in Candida isolates from patients receiving prolonged antifungal therapy. Antimicrob. Agents Chemother., 35, 2302-2305. Ghannoum, M. A., Rex, ]. H., Galgiani, ]. N. (1996). Susceptibility testing of fungi: current status of correlation of in vitro data with clinical outcome. ]. Clin. Microbiol., 34, 489-495. Gomez-Mateos, ]. M., Porto, A. S. et al. (1988). Disseminated candidiasis and gangrenous cholecystitis due to Candida spp. ]. Infect. Dis., 158, 653-655. Hitchcock, C. A., Pye, G. W., Troke, P. F., Warnock, D. W. (1993). Fluconazole resistance in Candida glabrata. Antimicrob. Agents Chemother., 37, 1962-1965. Horn, C. A., Washburn, R. G., Givner, L. B., Peacock, ]. E. Jr, Pegram, P. S. (1995). Azole-resistant oropharyngeal and esophageal candidiasis in patients with AIDS. AIDS, 9, 533-535. Hurley, D. L., Fauci, A. S. (1975). Disseminated candidiasis. An experimental model in guinea-pigs. ]. Infect. Dis., 131, 516-521. Komshian, S. V., Uwaydak, A. K., Sobel, ]. D., Crane, L. R. (1989). Fungemia caused by Candida species and Torulopsis glabrata in the hospitalized patient: frequency, characteristics, and evaluation of factors influencing outcome. Rev. Infect. Dis., 145, 45-56. Kwon-Chung, K. ]., Bennett, ]. E. (1992). Medical Mycology. Lea & Febiger, Philadelphia, USA. Louria, D. B., Fallon, N., Browne, H. G. (1960). The influence of cortisone on experimental fungus infections in mice. ]. Clin. Invest., 39, 1435-1449. Louria, D. B., Brayton, R. G., Finkel, G. (1963). Studies on the pathogenesis of experimental Candida albicans infection in mice. Sabouraudia, 2, 271-283. McQuillen, D. P. et aL (1992). Invasive infections due to Candida krusei. Report of ten cases of fungemia that include three cases of endophthalmitis. Clin. Infect. Dis., 14, 472-478. Miyaji, M. (1987).Animal Models in Medical Mycology. CRC Press, Boca Raton, USA. Miyaji, M., Nishimura, K. (1980). Parasitic forms of pathogenic fungi.]pn. ]. Clin. Med., 38, 14-19. Nakamura, Y., Masuhara, T., Ito-Kuwa, S., Aoki, S. (1991). Induction of experimental Candida arthritis in rats. ]. Med. Vet. Mycol., 29, 179-192.

662

NCCLS (National Committee for Clinical Laboratory Standards; 1997). Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeast; Approved Standard M 27-A, vol. 17 (no. 9). NCCLS, Wayne, USA. Nishimura, K., Miyaji, M. (1985). Tissue responses against Cladosporium trichoides and its parasitic forms in congenitally athymic nude mice and their heterozygous littermates. Mycopathologia, 90, 21-27. Pfaller, M. A. (1989). Infection control: opportunistic fungal infect i o n - t h e increasing importance of Candida species. Infect. Control Hosp. Epidemiol., 9, 408-416. Pfaller, M. A., Wenzel, R. (1992). Impact of the changing epidemiology of fungal infections in the 1990s. Eur. J. Clin. Microbiol. Infect. Dis., 11,287-291. Raper, K. B., Fennell, D. I. (1977). The Genus Aspergillus. Krieger, Malabar, FL, USA. Rex, J. H., Rinaldi, M. G., Pfaller, M. A. (1995). Resistance of Candida species to fluconazole. Antimicrob. Agents. Chemother., 39, 1-8. Rinaldi, M. G., Troke, P. F. (1991). Antifungal Susceptibility Testing; A Manual of Methods in Development. Pfizer, New York, USA. Rogers, T., Balish, E. (1976). Experimental Candida albicans infection in conventional mice and germfree rats. Infect. Immun., 14, 33-38. Schmidt, A. (1995). Diagnostics in aspergillosis [Diagnostik der Aspergillose; in German]. Miinch. Med. Wochenschr., 137, 607-610. Schmidt, A. (1996a). Pathogenicity of Candida tropicalis, Candida krusei, and Torulopsis (Candida) glabrata for outbred CFW1 mice.J. Mycol. Med., 6, 133-135. Schmidt, A. (1996b). Systemic candidiasis in Sprague-Dawley rats. J. Med. Vet. Mycol., 34, 99-104. Schmidt, A. (1997). Pathogenetic Relevance of Molds of the Genus Aspergillus with Studies Concerning the Morphological Variability and Chemosensitiv#y of Aspergillus fumigatus [Pathogenetische Bedeutung von Schimmelpilzen der Gattung Aspergillus mit Untersuchungen zur morphologischen Variabilit~it und in vitro Sensibilit~it von Aspergillusfumigatus; in German]. Deutsche Hochschulschriften 2449. H~insel-Hohenhausen, Egelsbach, Germany.

A. Schmidt

Schmidt, A., Geschke, F. U. (1996). Comparative virulence of Candida albicans strains in CFWl mice and Sprague-Dawley rats. Mycoses, 39, 157-160. Schmidt, A., Geschke, F. U., Jaroch, M., Osterkamp, M., RtihlH6rster, B. (1996). Virulence of Candida albicans in outbred and C5-deficient inbred mice [Virulenz yon Candida albicans in Auszucht- und C5-defekten Inzucht-M~iusest~immen; in German]. Abstract V15, MYK 96-30. Sc. Symp. DMyKG. Simon, C., Stille, W. (1997). Antibiotics in Clinic and Practice [Antibiotikatherapie in Klinik und Praxis; in German]. Schattauer, Stuttgart, Germany. Solomon, S. L. et aL (1984). An outbreak of Candida parapsilosis bloodstream infections in patients receiving parenteral nutrition.]. Infect. Dis., 149, 98-102. Walsh, T. J., Lee, J. W., Roilides, E. et aL (1992). Experimental antifungal chemotherapy in granulocytopenic animal models of disseminated candidiasis. Approaches to understanding investigational antifungal compounds for patients with neoplastic diseases. Clin. Infect. Dis. 14 (suppl. 1), 139-147. Waynforth, H. B., Flecknell, P. A. (1992). Experimental and Surgical Technique in the Rat. Academic Press, London, UK. Wegmann, T. (1994). Medical Mycology, A Practical Guideline [Medizinische Mykologie~ein praktischer Leitfaden; in German]. Editiones Roche, Basel, Switzerland. Wenzel, R. P., Pfaller, M. A. (1991). Candida species: emerging hospital blood stream pathogens. Infect. Control Hosp. EpidemioL, 12, 523-524. Wingard, 1. R., Merz, W. G., Rinaldi, M. G.,etaL (1991). Increase in Candida krusei infections among patients with bone marrow transplantation and neutropenia treated prophylactically with fluconazole. N. Engl. J. Med., 325, 1274-1277. Winner, H. J. (1960). Experimental moniliasis in the guinea-pig. J. Pathol. Bacteriol., 79, 420-423. Yamaguchi, H. (1987). Opportunistic fungal infections. In Animal Models in Medical Mycology (ed. Miyaji, M.), pp. 101-158. CRC Press, Boca Raton, USA. Zak, O., Sande, M. A. (1986). Introduction: the role of animal models in the evaluation of new antibiotics. In: Experimental Models in Antimicrobial Chemotherapy (eds Zak, O., Sande, M. A.), vol. 1. Academic Press, London, UK.

Chapter 79

Experimental Oropharyngeal and Gastrointestinal Candida Infection in Mice A. M. Flattery, G. K. Abruzzo, C. J. Gill, J. G. Smith and K. Bartizal

Background of model Maintenance of Candida albicans in the gastrointestinal tract of non-immune-compromised mice is short-lived, with the host immune system rapidly clearing the yeast. Evidence suggests that cell-mediated immunity, and more specifically, CD4 + T lymphocytes, play an important role in resistance to mucosal candidiasis (Rogers and Balish, 1980; Balish et al., 1990; Cantorna and Balish, 1991). In particular, the decrease in CD4 + T-lymphocyte counts associated with human immunodeficiency virus (HIV) infection and acquired immunodeficiency syndrome (AIDS) has been correlated with the rise in cases of alimentary tract candidiasis (Epstein et al., 1984; Klein et al., 1984; Glatt et al., 1988; Pankhurst and Peakman, 1989). Other mouse models of mucosal candidiasis have been described which utilize combinations of chemically induced immune suppression, elimination or alteration of host microflora by administration of antibiotics, high inocula, trauma, infant animals or animals with congenital, functional, physiological, immunological or metabolic defects to facilitate colonization of the gastrointestinal tract by C. albicans (Nolting, 1975; Jorizzo et al., 1980; Field et al., 1981; Guentzel and Herrera, 1982; Ekenna and Fader, 1989; Cole et al., 1990; Narayanan et al., 1991). This model of oropharyngeal and gastrointestinal candidiasis was designed to represent the immune status of the patient population in which mucosal candidiasis is prevalent. It employs a combination of selective CD4 + Tcell depletion to initiate a specific immune deficiency and antibiotic reduction of the normal gastrointestinal microflora to allow colonization of the alimentary tract by Candida. Efficacy of therapy with a variety of known and novel antifungals may then easily be assessed in this model.

Animal species Mice deficient in CD4 + T-lymphocyte function facilitate prolonged colonization of the alimentary tract by C. albicans. This immune deficiency may be created in a variety of Handbook of Animal Models of Infection

ISBN 0-12-775390-7

ways in both immune-competent and immune-deficient mice as well as in outbred and inbred strains. Mice may be selectively depleted of CD4 + T-lymphocytes by treatment with a rat immunoglobulin G: monoclonal antibody (MAb) secreted by GK1.5 hybridoma cells (American Type Culture Collection, Rockville, MD, Culture #TIB 207), which is specific for mouse CD4 + T cells. Alternately, mice may be injected directly with the hybridoma cells subcutaneously, leading to in vivo secretion of MAb and depletion of the CD4 + population. We commonly use complement component 5-deficient female DBA/2 mice (Taconic, Germantown, NY) since these mice show acceptable duration of depletion of CD4 + T cells and are easily colonized with C. albicans both orally and in a disseminated model of candidiasis (Bartizal et al., 1992). Similar methods of CD4 + T-cell depletion have also been used in C3Heb/FeJ mice with comparable results and in BALB/c mice with a shorter duration of CD4 + T-cell depletion (McFadden et al., 1994). Presumably other strains of mice may be used; however the efficacy of the immune suppression would need to be verified by fluorescence-activated cell sorter (FACS) analysis and perhaps the level of MAb administered adjusted accordingly. Recently, transgenic mice have been developed which lack certain genes necessary for CD4 + T-lymphocyte production and thus which are CD4 + T-lymphocyte deficient. These mice are available from multiple sources, including Jackson Laboratories (Bar Harbor, ME) and eliminate the need for antibody treatment altogether. Fecal C. albicans colonization levels after oral inoculation in these transgenic animals are similar to those in MAb-induced CD4 +T-lymphocytopenic mice.

Immune suppression In DBA/2 mice three intraperitoneal (i.p.) injections of 300pg purified MAb per mouse in sterile saline administered 3 days prior to, the day of and 1 week after challenge maintain depletion of CD4 + T cells through 14 days after challenge. A single subcutaneous (s.c.) injection of 9 × 106 GK1.5 hybridoma cells 4 days prior to challenge maintains CD4 +T-cell depletion through 21 days after challenge. Copyright © 1999AcademicPress All rights of reproduction in any form reserved

664

A.M. Flattery, G. K. Abruzzo, C. J. Gill, J. G. Smith and K. Bartizal

Cell culture

GK1.5 hybridoma cells are cultured in high glucose Dulbecco's Modified Eagle's Medium (D-MEM, Sigma, St Louis, MO) supplemented with 10% fetal bovine serum (Sigma), 1% L-glutamine (Sigma), 100 units/ml penicillin (Sigma) and 100 pg/ml streptomycin (Sigma) at 37°C under 5% CO2. Cells for injection should be passaged and incubated for log phase growth. Cultures are then harvested, centrifuged for 8 minutes at 400g to pellet cells and washed twice with the above medium. Resuspended cells should be counted on a hemacytometer, with viability confirmed by trypan blue dye exclusion, and adjusted to the appropriate concentration for CD4 + T-cell depletion by s.c. injection or for generation of MAb by ascites production.

Ascites production

Athymic nu/nu mice are used for ascites production. In our experience outbred athymic nu/nu Swiss Webster mice (Taconic) work well. Mice are primed by i.p. injection with 0.5 ml of pristane (2,6,10,14-tetramethylpentadecane, Sigma). Ten days after pristane priming, mice are injected i.p. with 5 x 106 GK1.5 hybridoma cells prepared as stated above. Ascites is then collected from the mice, centrifuged for 10 minutes at 400g to remove cellular debris, and then stored frozen at-20°C until use for antibody purification. MAb is purified from ascites by passage over a protein G column (MabTrap G, Pharmacia LKB, Piscataway, NJ) and quantitated by Bio-Rad Protein Assay (Bio-Rad, Rockville Center, NY) using a bovine gamma globulin standard. Purified MAb is then stored a t - 2 0 ° C until used for immune suppression.

FACS analysis

The depletion of CD4 + T lymphocytes is monitored using FACS analysis. Splenic T lymphocytes may be stained with fluoresceinated MAbs specific for mouse CD4 +, CD8 + or CD3 + T cells. Spleens are removed aseptically and using frosted glass microscope slides splenic tissue is teased apart to create a cell suspension. Cells are suspended in 3 ml phosphate-buffered saline (PBS, GIBCO, Grand Island, NY) and centrifuged for 5 minutes at 400g. The supernatant is decanted and the cell pellet resuspended in 1 ml ACK lysing buffer (GIBCO), vortexed for 1 minute to lyse red blood cells, then diluted in 3 ml PBS and centrifuged for 5 minutes at 400g. The supernatant is again decanted and cells are resuspended in 4 ml PBS. Then, 100 lal of the spleen cell suspension is incubated with rat anti-mouse MAb at a concentration of 5 pg/ml for 30 minutes at room temperature. The cells are stained either with fluorescein isothiocyanate (FITC) conjugated L3T4 (CD4) (PharMingen, San Diego, CA) and R-phycoerythrin (PE) conjugated Ly-2 (CDSa) (PharMingen), or with FITC conjugated Thy-l.2

(PharMingen), which reacts with 100% of T cells in mice expressing the Thy-l.2 allele. Cells are washed with 3 ml PBS and centrifuged for 5 minutes at 400g. The supernatant is then decanted and the cell pellet resuspended in 200 pl propidium iodide (Sigma) at 1 pg/ml. Samples are run on the FACScan analyzer (Becton Dickinson, San lose, CA) to determine percentage of total lymphocytes which are CD4 +, CD8 +or CD3 +T cells.

Preparation of animals Housing

Animals should be housed in sterile microisolator cages and given sterile feed and water ad lib#urn. Mice are pretreated with gentamicin (Garamycin injectable, Schering, Kenilworth, NI), a non-absorbable broad-spectrum antibacterial, at 0.1 mg/ml in the drinking water from 4 days prior to C. albicans challenge through 3 days postchallenge to reduce the normal gastrointestinal microflora, allowing less competition for colonization of the gastrointestinal tract by C. albicans.

Preparation of inocula and infection process Stock cultures of C. albicans MY1055 (Merck Culture Collection) are maintained by monthly transfers on Sabouraud dextrose agar (SDA, BBL, Cockeysville, MD). Growth from an 18-24-hour SDA culture of C. albicans is suspended in sterile saline to a concentration of 108 cells/ml determined by hemacytometer count and verified by plate counts. Mice are challenged by gavage with 0.2 ml of the yeast suspension (approximately 2 x 107 cells/mouse) and additionally by swabbing their oral cavities with the yeast suspension, while gently abrading the buccal mucosa by rotation of the swab. This model should be amenable to use of other strains of C. albicans as well as other species of Candida; however, colonization levels may vary between strains and species and challenge amounts may need to be adjusted accordingly.

Key parameters to monitor infection and response to treatment Infection in this model is confined to the oropharynx and gastrointestinal tract and translocation of the yeast out of the gastrointestinal tract is rare, and in fact difficult to induce. Despite high levels of colonization mice show no outward signs of illness. The extent of colonization of the alimentary tract after challenge may then easily be moni-

EXPERIMENTAL OROPHARYNGEAL AND GASTROINTESTINAL CANDIDA INFECTION IN MICE

665

tored throughout the study by culturing fecal samples and by swabbing the oral mucosa. This model also allows the investigator to follow individual mice throughout the course of treatment since mice need not be euthanized for sampling. Fresh fecal pellets are collected from each mouse, weighed, homogenized in sterile saline, serially diluted and plated on Sabouraud's dextrose agar containing 501ag/ml chloramphenicol (SDAC) for inhibition of bacterial growth. Oral swabs may also be taken from each mouse and plated on SDAC for a qualitative estimate of oral Candida load. At termination of the study segments of the alimentary tract may also be cultured as above to determine levels of colonization. Typically DBA/2 mice carry a Candida load of between 4 and 5 log colony-forming units (cfu) per gram feces through at least 14 days. Oral Candida cfu may vary markedly depending on the technique of the individual swabbing the oral cavity and the method of applying the swabbed material to the culture plate.

therapy the rapidity and extent of efficacy may easily be determined. Also, rebound in growth of any uncleared yeasts may be seen if fecal cultures are taken 24 hours after the termination of therapy at day 14 after challenge. We have used this model to assess the efficacy of novel antifungal agents as compared to the efficacy of agents currently marketed for oropharyngeal candidiasis. The activity of currently marketed agents in this model correlated well with their efficacy in humans. Fluconazole administered for 10 days in the drinking water at 100-400 lag/ml (approximately 25-100mg/kg per day) rapidly decreases the fecal and oral Candida load in this model. The polyene nystatin administered in the drinking water was somewhat less efficacious, with fecal and oral colonization levels decreasing more slowly and to a lesser extent than the azole (Flattery et al., 1996).

Antifungal therapy

There is no difference in gastrointestinal colonization by Candida in mice depleted of CD4 + T cells by either the hybridoma or antibody method; however, there are certain side-effects associated with each method. In long-term experiments, multiple injections of rat GK 1.5 MAb may cause some mortality in mice. A single injection of hybridoma cells requires no antibody purification and less animal handling but it also has some disadvantages. Approximately 50% of DBA/2 mice injected with hybridoma cells develop visible tumors beginning 3 weeks following hybridoma injection. Many of these tumors become so large that they are lethal, while approximately one in eight tumors regresses. All mice with visible tumors are depleted of CD4 +T cells and depletion may continue for up to 5 weeks after tumor regression. In mice with no visible tumors CD4 + T cells begin to reappear at 4 weeks after injection of hybridoma cells. For experimental procedures requiring less than 3 weeks to complete, these tumors pose no problem. However, in long-term experiments, significant mortality and the reappearance of CD4 +T cells after 4 weeks must be anticipated. These tumors are observed using DBA/2 mice; however, in other strains of mice such as BALB/c and C3Heb/FeJ mice, visible tumors have not formed and the length of CD4 + T-cell depletion varied (McFadden et al., 1994). For these reasons use of transgenically CD4 + T-lymphocyte deficient mice, although possibly more costly, might be preferable to either antibody or hybridoma treatment, especially for long-term experiments. Although this model mimicks the immune status of the patient population in which the infection commonly occurs, it may not be truly representative of the disease state seen in humans. Histology of the oropharynx and gastrointestinal tract of DBA/2 mice shows little adhesion of C. albicans to the mucosal surface and little, if any, inflammatory

Many different routes of administration of antifungal therapy may be used in this model, including parenteral injection, administration by garage (p.o.) and administration in the drinking water. Administration i.p., s.c. and p.o. allows exactly measured amounts of drug to be delivered, while administration in the drinking water gives an approximate dose level, given that mice drink approximately 5ml of water per day (Ralston Purina Company, 1961). However, the drinking water route of administration allows for therapy similar to the "swish-and-swallow" routes now used clinically with both Diflucan (fluconazole for oral suspension) and Fungizone (amphotericin B oral suspension). The route chosen may be affected by the properties of the compound given. For example, administration in the drinking water requires that the compound be relatively soluble in a formulation suitable for oral administration to mice, since insoluble compounds tend to settle at the bottom of the water bottle. These compounds must also be relatively stable at room temperature. An experimental chemotherapeutic not having these characteristics may need to be administered by an alternate route. Typically, antifungal therapy in this model is begun 3 days after challenge so that the yeast has sufficient time to colonize the alimentary tract and also so that a pretreatment colonization level may be determined. Therapy is then begun by any of the above routes and continued for varying lengths of time based on the characteristics of the antifungal under study. A dosing regimen of 10 days (days 3-13 after challenge) allows maximal time for the antifungal to reduce the Candida load, while also maintaining the test to within the 14 days in which antibody-treated mice are CD4depleted and colonization levels in control mice are still high. Since mice are monitored throughout the course of

Advantages and disadvantages of the model

666

A . M . Flattery, G. K. Abruzzo, C. J. Gill, J. G. Smith and K. Bartizal

response, indicating a colonization rather than true infection. In 85% of DBA/2 mice intragastrically inoculated with C. albicans and administered antibiotics over a long term, small self-limiting loci of mucosal involvement in the stomach were seen, but C. albicans was eventually cleared without dissemination (Bistoni et al., 1993). In fact it has been shown that in mice a combination of both cell-mediated immunity and phagocytic cell defects is necessary for extensive infection or invasion of the gastrointestinal tract (Cantorna and Balish, 1990). The CD4 +T-lymphocyte-deficient DBA/2 mice offer a good model of chronic Candida without dissemination, in which in vivo antifungal activities correlate well with in vitro susceptibility of the isolate to the antifungal compounds.

Contributions of the model to infectious disease therapy With the increase in numbers of immunocompromised patients, there has been a significant rise in the incidence of fungal infections, including alimentary tract candidiasis. Unlike antibacterials, few antifungal agents exist which are both safe and efficacious. Also, with the incidence of azoleresistant Candida strains on the rise, the need for novel antifungal agents is increasing. This model of oropharyngeal and gastrointestinal candidiasis may give a good indication of the efficacy of novel agents as compared to currently marketed antifungals. These agents may then also be useful in more severe models of disseminated fungal disease.

References Balish, E., Filutowicz, H., Oberly, T. D. (1990). Correlates of cellmediated immunity in Candida albicans-colonized gnotobiotic mice. Infect. Immun., 58, 107-113. Bartizal, K., Abruzzo, G., Trainor, C. et al. (1992). In vitro antifungal activities and in vivo efficacies of 1,3-~-D glucan synthesis inhibitors L-671,329, L-646991, tetrahydroechinocandin B, and L-687,781 a papulacandin. Antimicrob. Agents Chemother., 36, 1648-1657. Bistoni, F., Cenci, E., Mencacci, A. et al. (1993). Mucosal and systemic T helper cell function after intragastric colonization of adult mice with Candida albicans. ]. Infect. D#., 168, 1449-1457. Cantorna, M. T., Balish, E. (1990). Mucosal and systemic candidiasis in congenitally immunodeficient mice. Infect. Immun., 58,

1093-1100. Cantorna, M. T., Balish, E. (1991). Role of CD4 + lymphocytes in resistance to mucosal candidiasis. Infect. Immun., 59, 2447-2455. Cole, G. T., Lynn, K. T., Seshan, K. R. (1990). An animal model for oropharyngeal, esophageal, and gastric candidosis. Mycoses, 33,7-19. Ekenna, O., Fader, R. C. (1989). Effect of thermal injury and immunosuppression on the dissemination of Candida albicans from the mouse gastrointestinal tract.]. Burn Care Rehabil., 10, 138-145. Epstein, J. B., Truelove, E., Izutzu, K. T. (1984). Oral candidiasis: pathogenesis and host defense. Rev. Infect. D#., 6, 96-106. Field, L. H., Pope, L. M., Cole, G. T., Guentzel, M. N., Berry, L. J. (1981). Persistence and spread of Candida albicans after intragastric inoculation of infant mice. Infect. Immun., 31, 783-791. Flattery, A. M., Abruzzo, G. K., Gill, C. J., Smith, J. G., Bartizal, K. (1996). New model of oropharyngeal and gastrointestinal colonization by Candida albicans in CD4 +T-cell-deficient mice for evaluation of antifungal agents. Antimicrob. Agents Chemother., 40, 1604-1609. Glatt, A. E., Chirgwin, K., Landesman, S. H. (1988). Treatment of infections associated with human immunodeficiency virus. N. Engl. ]. Med., 3, 1439-1448. Guentzel, M. N., Herrera, C. (1982). Effects of compromising agents on candidosis in mice with persistent infections initiated in infancy. Infect. Immun., 35, 222-228. Jorizzo, ]. L., Sams, W. M., Jr, Jegasothy, B. V., Olansky, A. J. (1980). Cimetedine as an immunomodulator: chronic mucocutaneous candidiasis as a model. Ann. Intern. Med., 92, 192-195. Klein, R. S., Harris, C. A., Small, C. B., Moll, B., Lesser, M., Friedland, G. H. (1984). Oral candidiasis in high-risk patients as the initial manifestation of the acquired immunodeficiency syndrome. N. Engl. ]. Med., 311,354-358. McFadden, D. C., Powles, M. A., Smith, J. G., Flattery, A. M., Bartizal, K., Schmatz, D. M. (1994). Use of anti-CD4 + hybridoma cells to induce Pneumocystis carinii in mice. Infect. Immun., 62, 4887-4892. Narayanan, R., Joyce, W. A., Greenfield, R. A. (1991). Gastrointestinal candidiasis in a murine model of severe combined immunodeficiency syndrome. Infect. Immun., 59, 2116-2119. Nolting, S. (1975). Effect of antibiotics and cytostatic drugs on experimental candidiasis in mice. Mykosen. , 18, 309-313. Pankhurst, C., Peakman, M. (1989). Reduced CD4 + T cells and severe oral candidiasis in absence of HIV infection. Lancet, i, 672. Ralston Purina Company (1961). Laboratory Animal Care: Management of Laboratory Animals, the Mouse, section 2, p. 5. Ralston Purina Co., St. Louis, MO. Rogers, T. J., Balish, E. (1980). Immunity to Candida albicans. Microbiol. Rev., 44, 660-682.

Chapter 80

P a w O e d e m a as a M o d e l of Localized Candidiasis G. Findon

Background of model Existing models of localized Candida albicans infections are semiquantitative and do not allow continuous observations to be made in individual animals. These models include the mouse thigh model (Pearsall and Lagunoff, 1974), cutaneous lesions in rodents (Ray and Wuepper, 1976) and guinea-pigs (Sohnle et al., 1976), subcutaneous lesions (Giber et al., 1978) and diffusion chambers (Poor and Cutler, 1981). This chapter describes a procedure for the quantitation of experimentally induced candidiasis which uses the inflammatory response to infection as a surrogate measure of living yeast cell numbers in the footpad. The model allows consecutive readings in the same animal and correlates well with the number of yeast cells in the local lesion. The animals tolerate the procedure well and show few signs of discomfort.

measured as swelling, is used as a correlate of yeast cell numbers.

Materials required Anaesthetic, skin disinfectant (95% alcohol), Hamilton syringe and 26 G needle and engineer's thickness gauge are required.

Anaesthesia Animals are anaesthetized with Nembutal (pentobarbitone sodium, Techvet Laboratories, Auckland, NZ) or other suitable short-acting anaesthetic. No pain relief is necessary.

Infection procedure

Animal species Male and female animals from an inbred colony of Dark Agouti rats, weighing between 200 and 250 g were used to characterize this model. Other strains may be suitable but have not been evaluated. The animals are housed in polycarbonate cages on litter of untreated wood shavings and fed pelleted food (Diet 86) and water ad libitum.

After anaesthesia, the hind footpads are sterilized with 95% alcohol. The inoculum of yeast cells is suspended in 20 tll of sterile normal saline and injected intradermally into the plantar region of each hind footpad, using a 26 G needle and a 0.1 ml Hamilton syringe. Great care must be taken to ensure that the inoculum is injected intradermally, not subcutaneously (Gray and lennings, 1955). This is confirmed by the appearance of a skin blister at the site of injection.

Preparation of animals

Postoperative care

No specific care or pretreatment is required.

No special postoperative care is required and the animals resume normal activities immediately after recovery from the anaesthetic.

Details of surgery Storage and preparation of inocula Overview Live Candida albicans is injected intradermally directly into the footpad and the resulting inflammatory response, Handbook of Animal Models of Infection

ISBN 0-12-775390-7

The inoculum consists of a culture of Candida albicans from a clinical specimen, maintained in Sabouraud dextrose broth at-20°C and subcultured monthly on to Sabouraud Copyright © 1999Academic Press All rights of reproduction in any form reserved

668

dextrose agar for storage at 4°C. The cultures are grown overnight in nutrient broth at 37°C and washed three times in saline. Cell concentration is adjusted after counting the yeast cells in an improved Neubauer counting chamber. The number of viable organisms is confirmed by colony counts in serial 10-fold dilutions in pour plates of Sabouraud dextrose agar.

G. Findon

60

T

H 10 4 viable yeast cells O--O 10 s viable yeast cells ~ 10 6 viable yeast cells 10 7 viable yeast cells

_

e-

"-'

50

~

4O

ID

~ .

(1) L.. o e-_

~

30

20

Measurement of footpad oedema e-

~

10

o

Footpad thickness is measured centrally between the dorsal and plantar surfaces using an engineer's pocket thickness gauge (model 7309, range 0.01-9.00 mm _+ 0.01 mm, Mitutoyo, Tokyo, Japan), previously modified to avoid pressure on the swollen tissue by reducing the spring tension (Winter et al., 1962). Before injecting the yeast suspensions, a baseline thickness for each footpad is measured. The footpads are measured daily and the increase in footpad thickness expressed as a percentage of the baseline value. To establish the error of the procedure, we measured the footpad thickness of 10 normal untreated rats over a period of 10 days. The readings were within 1.8% of the mean baseline thickness.

Key parameters to monitor infection and response to treatment Inflammatory response to local infection When rats were injected in both hind feet with 104, 10 5, 106 or 107 viable yeast cells and the footpad thickness measured daily for 14 days, the peak inflammatory response for all inocula occurred in the first 2 days and then gradually subsided. Host responses to inocula of 104 and 105 yeast cells were minimal, but 10~and 107 yeast cells induced maximum increases in footpad thicknesses of 27% and 55% respectively (Figure 80.1). Apart from the footpad swelling and some redness, no other signs of infection were visible and no surface lesions developed. Control animals were challenged with heat-killed (100°C for 1 hour) yeast cells at various dilutions (105, 106 and 107). The peak swelling was only onethird of that observed with the equivalent inoculum of viable cells. Footpad thickness returned to normal within 4 days in the control groups, whereas footpads injected with viable yeast cells remained swollen for more than 10 days.

g. 0

Time after injection ( d a y s )

Figure 80.1 Footpad responses to a local infection induced by increasing doses of Candida albicans injected directly into the plantar tissue, n = 20, bars represent 2 so. From Miller and Findon (1985), with permission.

a sterile scalpel blade and forceps; the tissue was weighed then chopped coarsely with a scalpel blade. After homogenizing the tissue in 9 ml sterile saline with a rotating Teflon pestle in a heavy-walled glass tube (Tri-R Instruments, Long Island, New York, USA), serial 10-fold dilutions were made in pour plates of Sabouraud dextrose agar containing 0.1 mg/ml chloramphenicol (Chloromycetin, Parke Davis). Numbers of yeast cells per gram of footpad were determined by colony counts.

Correlation of footpad oedema with yeast cell numbers Before footpad swelling could be accepted as a substitute for yeast cell numbers, it was necessary to demonstrate a close correlation between the inflammatory response and the course of infection. This was achieved through the manipulation of the inflammatory response by treating animals with cyclophosphamide to depress immune capability, or amphotericin to limit yeast cell replication. The effect of these manipulations on yeast cell numbers in the footpads and on footpad oedema was then compared.

Cyclophosphamide treatment Determination of yeast cell numbers in the footpad At post-mortem, animals were placed in a prone position with the hind legs extended toward the operator. Each foot was flooded with 95% alcohol and left to dry. The plantar tissue was removed from the ventral surface of the foot with

Animals were made neutropenic by the subcutaneous implantation of 3×75 mg of cyclophosphamide bone cement discs, 4 days before footpad challenge. The procedure has been fully described by Ormrod et al. (1984). In animals treated in such a way, the peripheral leukocyte count reduces to 1.7 _ 0.6 × 109Aand remains at this level for

PAW OEDEMA AS A MODEL OF LOCALIZED CANDIDIASIS

at least 10 days. After a challenge of 106 viable yeast cells, large increases in the inflammatory response were observed in the immunocompromised group compared with an untreated control group. The responses in the two groups were similar 24 hours after challenge but thereafter inflammation subsided in the controls. In contrast, inflammation continued to increase in the cyclophosphamide-treated animals and was maintained at a significantly higher level for at least 10 days (Figure 80.2A). In a further group of animals, numbers of viable yeast cells in the footpads of cyclophosphamide-treated and control animals (Figure 80.2B) closely followed the inflammatory oedema profiles. Yeast cell numbers up to 100 times that of the control group were found in the cyclophosphamide treated animals. By the end of the study, infection had resolved in the control group and in 50% of the cyclophosphamide-treated animals.

669

50

A.

-~ 40

"~

_

T

H Control o - o Amp

30

E

~ 2o

g

o

0

~

4

7

8

~0

;~

~

B.

~ - ~ ~"5 E

A.

;

Time after injection (days)

H

Control

..

6

5

i...

H

~ 4

Control

o

¢.m ¢-

~

40 ""

3

3o

~

2

20

.__ >

.~_ I1)

~

0

. _E

~

lO

E I1)

Time after injection (days) o

o

~

~

6

;

;0

~

~,

Time after injection (days)

8

B.

"~ ~ o ,~

Figure 80.3 Effect of (A) footpad swelling and (B) number of viable yeast cells in untreated controls and in animals treated with 5 mg/kg amphotericin after challenge with 106 C. albicans. A" n = 20; B: n = 12; bars represent 2 so. From Miller and Findon (1985), with permission.

~

H

Control

6

Ampfiotericin treatment

ffl

o ....

0

~

~

6

;

~0

~

~'~

Time after injection (days)

Figure 80.2 Effect on (A) footpad swelling and (B) number of viable yeast cells in untreated controls and in animals treated with 225 mg cyclophosphamide after challenge with 106 colony-forming units C. albicans. A- n = 20; B" n = 12; bars represent 2 so. From Miller and Findon (1985), with permission.

Animals were given 5 mg/kg amphotericin (Fungizone, ER Squibb, Hounslow, Middlesex) daily i.p. for 2 days before footpad infection and throughout the course of the study. Control animals were given 1 ml saline instead of amphotericin and all animals were challenged with 106 viable yeast cells/footpad. Challenge of amphotericin-treated animals with yeast cells failed to induce footpad swelling (Figure 80.3A). The result corresponded with the quantitative mycological examination, which showed that the infection had failed to become established and that yeast cells had been progressively eliminated during a 4-day period (Figure 80.3B). A pilot experiment using a carrageenaninduced footpad swelling technique (Miller and Ormrod, 1980), showed that the drug had a marginal anti-inflammatory effect at the dose used.

03 0

Table 80.1

Comparison

Model

Thigh lesion* Flank cutaneous lesion1Cutaneous lesion: rats1: Cutaneous lesions: guinea-pigs§ Diffusion chambers** Footpad inflammation (this chapter)

o f t h e f e a t u r e s o f a n i m a l m o d e l s of C a n d i d a a l b i c a n s i n f e c t i o n Inoculum size (cfu)

Lesion size

Animal discomfort

Peak response

No. animals for experiment

Environmental contamination

Systemic involvement

Ease of measurement

Accuracy

5 x 108 in 0.2 ml

Large

High

6 days

Few

Unlikely

Possible

Difficult

108

Small

Low

6 days

Few

Unlikely

Unlikely

Difficult

104 in 10 pl 107 and 109 in 50 pl 4 x 107 in 0.15ml

Small Moderate Nil

Low Low Medium

21 hours 24 hours 24 hours

Many Few Many

High High Possible

Unlikely Unlikely Unlikely

Not quantitative Not quantitative Time consuming

Not reported Range up to _+9% Not reported Range up to _ 24% Not measurable Not measurable Satisfactory _+3%

107 in 20 IJI

Small

Low

24 hours

Few

Unlikely

Unlikely

Simple

Satisfactory + 1.8%

* Pearsall and Lagunoff (1974). 1 Giger et al. (1978). ~: Ray and Wuepper (1976). t3 Sohnle et al. (1976). ** Poor and Cutler (1981). From Miller and Findon (1985), with permission.

O

"11 m ,

3 Q. 0

PAW OEDEMA AS A MODEL OF LOCALIZED CANDIDIASIS

Pitfalls (advantages/disadvantages) of the model This model has several advantages over other models of localized yeast infection. These are summarized in Table 80.1. The infection is localized to the footpad and allows continuous assessment in the same animal. Because both hind feet are used, the number of observations for a given number of animals is doubled. Laboratory contamination is minimized by eliminating the need for tissue homogenization and pour plate counting. Environmental contamination from open lesions is also avoided and the animals suffer minimal discomfort, so it is more ethically acceptable. Measurement of the swelling is simple and accurate, with a margin of error of 1.8%. The only care needed is to ensure that the spring tension on the gauge is reduced to minimize pressure on the swollen footpad, which may reduce the accuracy of the reading by forcing the fluid away from the site. Repeated measurements at the same timepoint should be avoided for similar reasons.

Use of the model The measurement of the footpad swelling as described in this model does not require special equipment or skills to achieve reproducible results. The simple measurement of the footpad thickness accurately correlates with the number of viable yeast cells in the footpad. This model is therefore useful in the study of C. albicans and perhaps other fungal infections and in the assessment of new antifungal agents.

671

References Giger, D. K., Domer, J. E., McQuitty, J. T. (1978). Experimental murine candidiasis: pathological and immune responses to cutaneous inoculation with Candida albicans. Infect. Immun., 19, 499-509. Gray, D. F., Jennings, P. A. (1955). Allergy in experimental mouse tuberculosis. Am. Rev. Tuberculosis, 72, 171-195. Miller, T. E., Findon, G. (1985). Experimental candidosis: paw oedema in the analysis of local infection. J. Med. Microbiol., 20, 283-290. Miller, T. E., Ormrod, D. (1980). The anti-inflammatory activity of Perna canaliculus (NZ green lipped mussel). N.Z. Med. J., 92, 187-193. Ormrod, D. J., Cawley, S., Miller, T. E. (1984). Extended immunosuppression with cyclophosphamide using controlledrelease polymeric implants (bone cement). Int. J. Immunopharmacol., 7, 443-448. Pearsall, N. N., Lagunoff, D. (1974). Immunological responses to Candida albicans. I. Mouse-thigh lesion as a model for experimental candidiasis. Infect. Immun., 9, 999-1002. Poor, A. H., Cutler, J. E. (1981). Analysis of an in vivo model to study the interaction of host factors with Candida albicans. Infect. Immun., 31, 1104-1109. Ray, T. L., Wuepper, K. D. (1976). Experimental cutaneous candidiasis in rodents. J. Invest. Dermatol., 66, 29-33. Sohnle, P. G., Frank, M. M., Kirkpatrick, C. H. (1976). Mechanisms involved in elimination of organisms from experimental cutaneous Candida albicans infections in guinea pigs. J. Immunol., 117, 523-530. Winter, C. A., Risley, E. A., Nuss, G. W. (1962). Carrageenininduced edema in hind paw of the rat as an assay for antiinflammatory drugs. Proc. Soc. Exp. Biol. Med., 111,544-547.

This Page Intentionally Left Blank

Chapter 81

Murine Model of Allergic Bronchopulmonary Aspergillosis P. Dussault, M. Laviolette and G. M. Tremblay

Background of the model Aspergillus species are ubiquitous fungi that cause in humans

a number of lung-associated diseases. They are largely distributed and found in construction sites, compost piles, potting soil, mulches, sewage facilities, water and bird excreta (Fink and Kurup, 1997). The lungs constitute a major potential site of growth by Aspergillus, particularly Aspergillusfumigatus (Af). The spectrum of pulmonary aspergillosis includes first, saprophytic diseases such as airway colonization and aspergilloma; second, hypersensitivity diseases such as asthma, hypersensitivity pneumonitis and allergic bronchopulmonary aspergillosis (ABPA); and third, acute and chronic forms of invasive pulmonary aspergillosis (IPA). Morphologic and growth characteristics for Aspergillus as well as the determinants of pulmonary aspergillosis have been reviewed recently (MacLean, 1996; Fink and Kurup, 1997). ABPA is usually associated with mild to moderate asthma with productive cough (Patterson et al., 1995). Lung histological changes concentrate essentially around the bronchi and membranous bronchioles of the upper respiratory tree. These changes are characterized by mucoid impaction of the bronchi, bronchocentric granulomatosis, central bronchiectasis, eosinophilic and exudative bronchitis and bronchiolitis, and eosinophilic pneumonia (Myers, 1995). To document the diagnosis of ABPA, several serological tests are used, including total serum immunoglobulin E (IgE), precipitating antibodies to Afantigen and serum specific IgE and IgG (Roberts and Greenberger, 1995). IPA usually affects patients whose immune system is suppressed by either disease or medication (Saral, 1991). IPA is mostly characterized by the presence of fungal hyphae invading lung tissues (Fraser, 1993). The invasiveness of IPA distinguishes this form of aspergillosis from the saprophytic and hypersensitivity forms where tissue invasion is absent (MacLean, 1996). To our knowledge, only ABPA and IPA possess reliable animal models. Our laboratory and the one of Dr Kurup in Wisconsin developed a murine model of ABPA which mimicks two major immunological features of human ABPA, namely pulmonary eosinophilia (Wang et al., 1994) and elevated total and specific serum IgE and IgG (Kurup et al., 1990; Wang et al., 1994). This ABPA model is the Handbook of Animal Models of Infection

ISBN 0-12-775390-7

focus of the present chapter. Readers interested in an IPA model are referred to the following articles: Eisenstein et al. (1990); Mondon et al. (1996); Nawada et al. (1996).

Animal species Two different animal species have been used as an ABPA model. While primates have been used in the past (Slavin et al., 1978), mice are preferred today (Kurup et al., 1992; Wang et al., 1994). Strains of mice used include C3H/HeN (Kurup et al., 1990), Balb/c (Kurup et al., 1992) and C57B1/6 (Wang et al., 1994). C57B1/6 has been used extensively in our laboratory (Wang et al., 1993, 1994, 1996; Chu et al., 1995, 1996a,b).

Animal model establishment Preparation and storage of inoculum Strains and forms of Aspergillus

Several strains and forms of Af (spores, soluble antigen or particulate antigen) can be used to induce ABPA in mice. We isolated a strain of A f (local Af) from an air sample of swine confinement buildings (Cormier et al., 1990). Once instilled, the local Afwas comparable to a commercial strain of Af(ATCC 13073) to induce a strong pulmonary inflammatory response (Wang et al., 1994). This response was not due to contamination by bacteria or endotoxins, as shown by microbiological culture and smear examination and by a limulus amebocyte lysate assay (Wang et al., 1994). Recently, Kurup et al. (1997) demonstrated the antigenic potential of different forms of Afantigen. In contrast to soluble antigen, particulate antigen (soluble antigen coupled to inert particles) produced a superior peripheral blood eosinophilia and pulmonary inflammation. Antigen preparation from mycelium

The method used for antigen preparation is modified from Sang and Chaparas (1978). The inoculum comes from a Copyright © 1999AcademicPress All rights of reproduction in any form reserved

674

3-day-old culture of A f on Sabouraud malt extract agar slant tubes. The conidia are recuperated by scraping the surface with a sterile solution of sodium dodecyl sulfate (0.5%). Then, 200 ml of Czapek medium is seeded with conidia in a cotton-closed bottle of 500 ml. After 4 days of incubation with agitation at 37°C, the mycelium is recuperated, separated from the culture filtrate by passage through a Whatman no. 42 paper, washed three times with sterile distilled water, resuspended in sterile distilled water and stored at 4°C. The day after, the mycelium is harvested by filtrating on Buchner. Finally, the mycelium is resuspended with two parts of sterile distilled water and frozen at-70°C to facilitate the later rupture of cells. After defrosting, the suspension is pre-broken with an Omni mixer homogenizer (Omni International, Gainesville, Florida). Then, 25 ml of the suspension is transferred to a 50-ml bottle with 20 ml of 0.45-mm glass beads. The mixture is homogenized on a Braun mechanical cell homogenizer for 5 minutes with intermittent chilling with CO2. The crude antigen preparation is finally freeze-dried and resuspended in sterile physiological saline to a final concentration of 2 mg/ml. The suspension is aliquoted and stored at-70°C until used.

Administration of inoculum

C57B1/6 mice are lightly anesthetized with isoflurane (AErrane, Ohmeda Pharmaceuticals Products, Mississauga, Ontario), then 50 Ill of antigen (100 lag dry weight) is administered at the tip of the nose with a micropipette (e.g. Pipetman). The mice are held upright during instillation. The Afantigen is instilled on 3 successive days per week for 3-12 weeks. Control mice are instilled with 50 lal of sterile physiological saline (NaC1 0.9%). Other routes of inoculation, such as intraperitoneal, do not induce blood and lung eosinophilia despite increased IgE and IgG levels (Kurup et al., 1992). Repeated intranasal instillations should therefore be preferred because this is closer to the normal way of sensitization in humans. Interestingly, a similar instillation protocol in C57B1/6 mice with Saccharopolyspora rectivirgula, an antigen responsible for farmer's lung disease, induces an alveolar mononuclear cell and neutrophil infiltration instead of an eosinophilia (Tremblay et al., 1993a,b). This highlights the specificity of the pulmonary response depending on the antigen used.

Bronchoalveolar lavage (BAL) and serum collection

BAL is used to assess the alveolar cell population and to measure the different immunoglobulins, cytokines and mediators present in the epithelial lining fluid. After euthanasia by cervical dislocation, the trachea is exposed, incised and cannulated with a 21-gauge catheter (Wang et al., 1994). Hank's balanced salt solution (1 ml), at room temperature, is instilled with a syringe and recuperated. This

P. Dussault, M. Laviolette and G. M. Tremblay

procedure is repeated twice and at least 85% of the 3-ml solution administered is usually recovered. All recuperated BAL fluids are kept on ice until further processing. Cells are separated from BAL fluid by centrifugation at 400 g for 10 minutes. Total cell count and viability are determined on a hemacytometer by crystal violet and exclusion of trypan blue respectively (Wang et al., 1994). The excessive presence of erythrocytes in the BAL fluid indicates a contamination by peripheral blood and such samples should be discarded. Cell differential counts are done by the glass cover slip method (Laviolette et al., 1988), stained with Diff-Quik (Baxter Healthcare Corporation, McGaw Park, IL) and examined for cellular morphology. Serum is collected from blood by cardiac puncture. Aliquots of BAL supernatants and serum are made and stored at-70°C.

Histological examination Lung index and histology

Unlavaged lungs are removed, trimmed of extraneous tissues and weighed. Lung index (LI) is calculated according to the following formula: LI = (LW/BW)~e~e/(LW/BW) ......

1

where LW = lung weight and BW = body weight (Wilson et al., 1982). The same lung can be processed to lung histology in order to evaluate the nature and progression of the pathology. Several methods can be used to prepare lungs for histology. After fixation with Bouin liquid, lung tissues are embedded in paraffin, sectioned and then stained with hematoxylin and eosin for routine coloration (Wang et al., 1993, 1994). Sirius red is used to show the presence of eosinophils (Bogomoletz, 1980), while Silver stain or periodic acid-Schiff (PAS) reveals the presence of aspergillus (Luna, 1968; Hould, 1984). Instead of Bouin liquid, icecooled acetone containing phenylmethylsulfonyl fluoride (PMSF) and iodoacetamide as protease inhibitors may be used to fix tissues overnight at 4°C (Chu et al., 1995, 1996a,b). Then, lung tissues are transferred into acetone and methylbenzoyl at room temperature followed by immersion in glycol methacrylate (GMA) monomer at 4°C for 7 hours. Finally, tissues are embedded in GMA resin prepared by mixing GMA monomer and benzoyl peroxide and polymerized overnight at 4°C. Britten et aL (1993) demonstrated that GMA embedding preserves antigenic sites for immunodetection. The blocks are stored in airtight containers at-20°C for later analysis. The same routine staining as carried out by Wang et al. (1993, 1994) could be performed on these lung preparations except for the specific coloration of eosinophils, which is 1% chromotrope 2R staining (Broide et al., 1992). Other investigators prefer to fix lung tissues in 10% buffered formalin followed by paraffin embedding (Kurup et al., 1990, 1992, 1994, 1997). In addition to stan-

MURINE MODEL OF ALLERGIC BRONCHOPULMONARY ASPERGILLOSIS

dard staining for histological examination, Wright-Oiemsa eosinophilsand Gomoriandmethenaminefungi respectively.Silver

~ ~ ; ~ ! r

are used to stain

Histopathology scores are utilized by several investigators to demonstrate the severity and progression of lung pathology. Wang et al. (1994) scored the severity of each histopathological event as follows: 0+ (no lesion), 1+ (focal), 2+ (mild), 3+ (moderate), and 4+ (massive). The events observed include focal alveolar lesion, focal alveolar lesion with epithelioid cells, granuloma with giant cells, peribronchovascular infiltration with lymphoid cells, and eosinophil infiltration. Kurup et al. (1990) used two histopathological scoring systems: first, alveolar macrophage infiltration: + (minimal reaction and inflammatory cells), ++ (mild increase), +++ (moderate increase), and ++++ (severe increase); second, peribronchiolar and perivascular inflammatory cells: + (minimal), + + (mild), + + + (moderate), and + + + + (severe). Recently, Kurup et al. (1997) have used a different scoring system for eosinophil count: 0 (no), 1-3 (occasional), 3-10 (few), and 11-30 (numerous eosinophils).

675

:,:i:,~:~,:~

" ~ ~ " ... :~i::~:ii:]~i

~[. ........,~ :/~,[~, "7 : !' ~iii

"1 ~,[~,~3 ~,:~::~~ .........~ ( ~7!'~

/~ '*

(A)

Serum

Serological assays, such as biotin-streptavidin-linked immunosorbent assay (BSELISA), are used to detect total IgE, total IgG~ and specific IgG, antigen in BAL fluid and sera (Wangetal., 1993, 1994). KurupetaL (1990, 1992, 1994, 1997) also used different variants of ELISA techniques. (B)

Monitoring the inflammation

•:~ii:!:. :,.~:: ~!!~!i g~i"

The induced inflammation is mostly restricted to the lung. Any modifications in physical appearance, body weight loss and food and water intake should indicate the occurrence of another inflammatory or infectious process. Although A f could be grown from our A f antigen preparation, lung histology examination of Af-treated mice did not show any evidence of Aflung invasion (Wang et al., 1994). Moreover, culture of lung samples and BAL fluid obtained from Aftreated mice did not allow any A f colony to grow (Wang et al., 1994).

.i~i~:.~i! ~ ~';"

......::"!,~:"~....

~gi~,~%,:~,~ ....

g

~i~i!~qi. iiii::i~j'%......

]ii

,

(c) Basic p a r a m e t e r s

Normal control mice demonstrate a low number of cells in which macrophages constitute the majority of BAL cells (>97%). Lymphocytes and neutrophils count for less then 1.5% each of total BAL cells respectively. After repeated exposures to A f antigen, there is a 10-fold increase of total BAL cells (1 × 106 versus 1 × 105 cells), predominantly constituted of eosinophils (65-70%; Wang et al., 1994). On a 3week experiment basis, Wang et al. (1993) observed a kinetic in the different cell populations recovered by BAL. The first week, the population was constituted mainly of

Figure 81.1 Histological findings. (A) Section of lung of a mouse treated with saline instillations showing normal bronchi and parenchyma. Haematoxylin & eosin stain; original magnification x150. (B) Section of lung of a mouse, treated with Aspergillus antigen at week 2, showing a diffuse cellular infiltration and a few epithelial cells forming granuIoma with giant cells. Hematoxylin & eosin stain; original magnification x320. (C) Section of lung of a mouse treated with Aspergillus antigen showing a diffuse infiltration of lymphocytes, epithelioid cells and mainly numerous eosinophils. Sirius red stain; original magnification x 320.

676

P. Dussault, M. Laviolette and G. M. Tremblay

macrophages, lymphocytes and neutrophils. The second and third week showed a different population pattern with a predominance of eosinophils followed by macrophages and lymphocytes, while neutrophil numbers diminished markedly (Figure 81.1). The same authors observed an elevation in total IgE and IgG in both BAL and serum. Moreover, they detected the presence of Af-specific IgG in the Aspergillus-treated mice group. Histopathological findings presented an inflammatory pulmonary response characterized by focal alveolar lesions with peribronchial and perivascular infiltration of lymphoid cells, numerous eosinophils and epithelioid cells, and a few granulomas with giant cells (Figure 81.2). These findings are similar to human ABPA, but without tissue necrosis (Greenberger, 1984; Slavin et al., 1988). A 12-week experiment was done to evaluate more chronic histopathological features (Wang et al., 1994). The first weeks demonstrated the same results as mentioned above. The peak of eosinophilia and pulmonary infiltration was observed at 4 weeks. Thereafter, the repeated antigen exposure did not exacerbate the eosinophilia in the BAL

fluid, nor did it worsen histological damage. No bronchocentric granulomatosis nor bronchiectasis was observed. The results obtained with this chronic model show that the inflammatory process is self-limited, in terms of lung necrosis and fibrosis, even if antigen is given for 12 weeks, which represents a significant period in the life of a mouse. Immunohistochemistry showed that different cell markers and cytokine-positive cells are increased in murine ABPA. Such information gives clues to facilitate a better understanding of the different mechanisms leading to the development and establishment of ABPA.

More specific parameters In Af-challenged mice, the expression of intercellular adhesion molecule-1 (ICAM-1) is up-regulated on endothelial cells of arteries, arterioles, veins and venules as on bronchial and alveolar epithelial cells and alveolar macrophages (Chu et al., 1995). The elevated expression of ICAM-1 seems more important in the alveolar walls than in the venules.

240 _

• Total cells 13 Eosinophils | Macrophages

200 _

O Lymphocytes @ Neutrophils

160 _

O

120 _

~~

80

-

40_

20 .L~

,

10

.L

2

4

6 Time

8

10

12

(weeks)

Figure 81.2 Bronchoalveolar lavage (BAL) total cell and the differential cell counts of Aspergillus-antigen-treated C57BI/6 mice for the 12-week study. BAL total cell, eosinophil, macrophage, lymphocyte and neutrophil counts of the saline-treated group remained low during this period: 8.5-17.6 × 104, 0.0-0.2 × 104, 8.0-14.8 x 104, 0.2-2.3 x 104 and 0.1-0.7 × 104 cells. Results are expressed as means _+SEM (/9 = 3). *P < 0.05 compared to control mice.

M U R I N E M O D E L OF A L L E R G I C B R O N C H O P U L M O N A R Y A S P E R G I L L O S I S

This observation suggests that in inflamed lung, inflammatory cells transmigrate, probably from the alveolar capillary sites to the interstitium and air spaces. In Af-challenged lung, clusters of inflammatory cells are seen where ICAM1 is increased. No eosinophil positive for ICAM-1 is observed. Other cell-membrane markers, such as CD3 (T lymphocytes) and LFA-1 (hematopoietic cells, lymphocytes, monocytes, macrophages, neutrophils and eosinophils) are also increased in Af-challenged mice and are differentially expressed throughout the experiment. On day 14, levels of CD3, CD4 (thymocytes, helper T cells, monocytes and bone marrow cells) and CD8 (thymocytes, cytotoxic T lymphocytes and some dendritic cells) are increased. At the end of the treatment (day 21), only CD3 and CD4 are increased. The Th, profile, which is represented principally by CD8 T lymphocytes, seems to be suppressed. Proinflammatory cytokines, including tumor necrosis factor-0~ (TNF-00 and interleukin- 10~ (IL- 1o0, have been investigated by us (Chu et al., 1996b). We found an increased expression of both TNF-0~ and IL-10~ in the same cellular population expressing ICAM-1. Alveolar macrophages represented more than 90% of cells expressing these cytokines. In contrast, bronchial epithelial cells in Aftreated mice only expressed TNF-oC The increased expression of TNF-0~ and IL-10~ was observed on days 4, 14 and 21. There was no eosinophil positive for TNF-0~ and IL-10~ in the Af-treated mouse lung. This suggests that eosinophils do not significantly produce these cytokines. We also examined other cytokines that may play a significant role in tissue eosinophilia in the context of an allergic inflammatory response, namely granulocyte-macrophage colony-stimulating factor (GM-CSF), IL-4 and IL-5 (Chu et al., 1996a). On a 3-week basis, the expression of these cytokines is increased differently. Two weeks after the

4"8

N

(a)

677

beginning of the challenge, GM-CSF, IL-4 and IL-5 are upregulated. In contrast, on day 21, only GM-CSF expression is up-regulated. Most of the positive-expressing cells are T lymphocytes. Few eosinophils are positive for GM-CSF and IL-5. Moreover, we observed a strong correlation between in situ GM-CSF and IL-5 expression and pulmonary eosinophilia.

ABPA therapy To date, there have been few records of treatments administered to stop the inflammatory reaction generated by A f i n an animal model. We know that IL-5 is a potent eosinophil chemoattractant and activator. Use of an anti-IL-5 antibody proved to abrogate the peripheral blood, lung and bone marrow eosinophilia generated by an Afchallenge (Murali et al., 1993). Also, the utilization of anti-IL-4 antibody diminished the level of IgE (Kurup et al., 1994). We used dexamethasone to inhibit the Af-induced eosinophil pulmonary infiltration (Figure 81.3) and the serum IgE production (Wang et al., 1996). Treatment with this glucocorticoid also reduced the number of T cells and IL-4, IL-5 and GM-CSF-positive cells.

Pitfalls Not all the human histopathological findings are found in the murine model and the reasons are still unknown. AntiIL-5, as described above, only diminish the number of eosinophils. There is still a moderate interstitial chronic

I-(b)

4"2 E ~ 3"6

'o 3'0 ×24 1.8 (..) 1'2 rn 0 6 00

b

o

o

Soline A. fumigofus

b C

C

(3

b

a

Soline A. fum/gofus

Dex

CsA

Treotment Figure 81.3 (a) Effect of dexamethasone (Dex) and of (b) cyclosporin A (CsA) on the bronchoalveolar lavage (BAL) total cell counts and BAL eosinophil numbers in C57BI/6 mice. Dex, Mice treated with dexamethasone before instillation with Aspergillus fumigatus; CsA, mice treated with CsA before instillation with A. fumigatus. The results are expressed as mean _+S E M ( n - 3 or 4). The statistical differences between individual groups are as follows: (a) a-b, P < 0.01; a-c, P < 0.05; b-c, P < 0.01; (b) a-b, P < 0.01; a-c, P < 0.01; b-c, P < 0.01. m, Total cells; I-q, eosinophils.

678

inflammatory infiltrate consisting of lymphocytes, plasma cells and histiocytes (Kurup et al., 1994). Cyclosporin A (CsA) is an immunosuppressive agent that acts primarily on T cells (Bierer, 1994). This product interacts specifically with differentiation of T lymphocytes into helper/inducer and cytotoxic subsets. CsA is proven to be useful in suppressing the cytotoxic subset implicated in organ transplantation. In murine hypersensitivity pneumonitis, CsA modulates positively the progression of the disease (Takizawa et al., 1988; Denis et al., 1992). In contrast, CsA induces a paradoxical reaction in the murine ABPA model. All the inflammatory parameters mentioned above, such as IL-4-, GM-CSF- and IL-5-positive cells, are increased. Moreover, in Af-treated mice, CsA increases the total number of BAL cells (Figure 81.3). Therefore, we hypothesize that CsA, by inhibiting Th]-derived cytokine expression, may favor the Th2 pathway despite the fact that we never found any IL-2 and interferon- 7. The exact mechanism by which CsA acts on a Th2-1ike response is still unknown (Wang et al., 1993, 1996).

Contributions of the model to disease therapy The ABPA murine model presents a significant limitation. No lung tissue necrosis and remodeling is induced by the A f antigen. Various explanations could be proposed. The A f antigen used in the model does not allow A f growth whereas, in humans, a bronchial colonization happens. This colonization might promote the presence of different Afantigens and the combination of various immunological stimulations which could then induce the tissue remodeling seen in humans. Growth of A f could also liberate toxins (MacLean, 1996) not present in the Afantigen preparation used in our murine model. These toxins could, with the concomitant antigenic stimulation, induce tissue lesions. It is also possible that mice develop tolerance against A f and won't present any lung necrosis and remodeling. Despite the fact that the murine ABPA model cannot be used to evaluate the mechanisms underlying tissue necrosis and remodeling, it is useful to understand the immunological mechanisms involved in ABPA. The role of different cell populations and of various mediators and cytokines in the inflammatory process could be evaluated. Moreover, the A f antigens involved in these phenomena could be identified. The model is therefore useful to define ABPA pathogenesis better (MacLean, 1996) and eventually to define therapeutic immunological strategies (Murali et al., 1993). In humans, corticosteroids constitute the main therapeutic avenue to treat ABPA (Greenberger, 1995). These drugs are also very effective in the mouse model (Wang et al., 1996). However, CsA proved to increase the inflammatory reaction in the Af-challenged mouse. We are investigating this paradoxical action of CsA. Since the inflammatory

P. Dussault, M. Laviolette and G. M. Tremblay

response observed is mostly of the T h 2 type in this model, whereas CsA is mostly used to damper Thl host response to graft, this suggests that CsA should be used with caution in any Th2-driven inflammatory condition.

References Bierer, B. A. (1994). Biology of cyclosporin A and FK506. Prog. Clin. Biol. Res., 390, 203-223. Bogomoletz, W. (1980). Avantages de la coloration par le rouge Sirius de l'amyloYde et des ~osinophiles. Arch. Anat. Cytol. Pathol., 4, 250-253. Britten, K. M., Howarth, P. H., Roche, W. R. (1993). Immunohistochemistry on resin sections: a comparison of resin embedding techniques for small mucosal biopsies. Biotech. Histochem., 68, 271-280. Broide, D. H., Paine, M. M., Firestein, G. S. (1992). Eosinophils express interleukin 5 and granulocyte macrophage-colonystimulating factor mRNA at sites of allergic inflammation in asthmatics. J. Clin. Invest., 90, 1414-1424. Chu, H. W., Wang, J. M., Boutet, M., Boulet, L.-P., Laviolette, M. (1995). Increased expression of intercellular adhesion molecule-1 (ICAM-1) in a murine model of pulmonary eosinophilia and high IgE level. Clin. Exp. Immunol., 100, 319-324. Chu, H. W., Wang, J. M., Boutet, M., Boulet, L.-P., Laviolette, M. (1996a). Immunohistochemical detection of GM-CSF, IL-4 and IL-5 in a murine model of allergic bronchopulmonary aspergillosis. Clin. Exp. Allergy, 26, 461-468. Chu, H. W., Wang, J. M., Boutet, M., Boulet, L.-P., Laviolette, M. (1996b). Tumor necrosis factor-0~ and interleukin-10t expression in a murine model of allergic bronchopulmonary aspergillosis. Lab. Anita. Sci., 46, 42-47. Cormier, Y., Tremblay, G., Meriaux, A., Brochu, G., Lavoie, J. (1990). Airborne microbial contents in two types of swine confinement buildings in Quebec. Am. Ind. Hyg. Assoc. J., 51, 304-309. Denis, M., Cormier, Y., Laviolette, M. (1992). Murine hypersensitivity pneumonitis: a study of cellular infiltrates and cytokine production and its modulation by cyclosporin A. Am. J. Respir. Cell MoL Biol., 6, 68-74. Eisenstein, D. J., Biddinger, P. W., Rhodes, J. C. (1990). Experimental murine invasive pulmonary aspergillosis. Am. J. Clin. Pathol., 93, 510-515. Fink, J. N., Kurup, V. P. (1997). Allergic bronchopulmonary aspergillosis. In Asthma (eds Barnes, P. J., Grunstein, M. M., Left, A. R., Woolcock, A. J.), pp. 2077-2087. LippincottRaven, Philadelphia. Fraser, R. S. (1993). Pulmonary aspergillosis: pathologic and pathogenic features. PathoL Annu., 28, 231-277. Greenberger, P. A. (1984). Allergic bronchopulmonary aspergillosis. J. Allergy Clin. Immunol., 74, 645-653. Greenberger, P. A. (1995). Management of allergic bronchopulmonary aspergillosis. In: Allergic Bronchopulmonary Aspergillosis (eds Patterson, R., Greenberger, P. A., Roberts, M. L.), pp. 25-33. OceanSide Publications, Providence. Hould, R. (1984). M&hode de digestion du glycog~ne sur coupes par l'amylase. In: Techniques d'Histopathologie et de Cytopathologie (ed. Hould, R.), pp. 190-191. D&arie, Montreal.

MURINE MODEL OF ALLERGIC BRONCHOPULMONARY ASPERGILLOSIS

Kurup, V. P., Choi, H., Resnick, A., Kalbfleisch, J., Fink, I. N. (1990). Immunopathological response of C57B1/6 and C3H/HeN mice to Aspergillus fumigatus antigens. Int. Arch. Allergy AppL Immunol., 91,145-154. Kurup, V. P., Mauze, S., Choi, H., Seymour, B. W. P., Coffman, R. L. (1992). A murine model of allergic bronchopulmonary aspergillosis with elevated eosinophils and IgE. J. Immunol., 148, 3783-3788. Kurup, V. P., Choi, H., Murali, P. S., Coffman, R. L. (1994). IgE and eosinophil regulation in a murine model of allergic aspergillosis. J. Leukoc. Biol., 56, 593-598. Kurup, V. P., Choi, H., Murali, P. S., Resnick, A., Fink, J. N., Coffman, R. L. (1997). Role of particulate antigens of Aspergillus in murine eosinophilia. Int. Arch. Allergy Imrnunol., 112,270-278. Laviolette, M., Carreau, M., Coulombe, R. (1988). Bronchoalveolar lavage cell differential on microscope glass cover: a simple and accurate technique. Am. Rev. Respir. Dis., 138, 451-457. Luna, L. G. (1968). Grocott's method for fungi (GMF). In Manual of Histologic Staining Methods of the Armed Forces Institute of Pathology (ed. Luna, L. G.), pp. 230-232. McGraw-Hill Book Company, New York. MacLean, J. A. (1996). The spectrum of pulmonary responses to Aspergillus. In Immunopathology of Lung Disease (eds Kradin, R. L., Robinson, B. W. S.), pp. 281-299. ButterworthHeinemann, Newton. Mondon, P., De Champs, C., Donadille, A., Ambroise-Thomas, P., Grillot, R. (1996). Variation in virulence of Aspergillus fumigatus strains in a murine model of invasive pulmonary aspergillosis. J. Med. Microbiol., 45, 186-191. Murali, P. S., Kumar, A., Choi, H., Bansal, N. K., Fink, J. N., Kurup, V. P. (1993). Aspergillus fumigatus antigen induced eosinophilia in mice is abrogated by anti-IL-5 antibody. J. Leukoc. Biol., 53, 264-267. Myers, J. L. (1995). Pathology of allergic bronchopulmonary aspergillosis. In Allergic Bronchopulmonary Aspergillosis (eds Patterson, R., Greenberger, P. A., Roberts, M. L.), pp. 39-46. OceanSide Publications, Providence. Nawada, R., Amitani, R., Tanaka, E. et al. (1996). Murine model of invasive pulmonary aspergillosis following an earlier stage, noninvasive Aspergillus infection. J. Clin. Microbiol., 34, 1433-1439. Patterson, R., Greenberger, P. A., Roberts, M. L. (1995). The diagnosis of allergic bronchopulmonary aspergillosis. In Allergic Bronchopulmonary Aspergillosis (eds Patterson, R., Greenberger, P. A., Roberts, M. L.), pp. 1-3. OceanSide Publications, Providence. Roberts, M., Greenberger, P. A. (1995). Serologic analysis of

679

allergic bronchopulmonary aspergillosis. In Allergic R., Bronchopulmonary Aspergillosis (eds Patterson, Greenberger, P. A., Roberts, M. L.), pp. 11-15. OceanSide Publications, Providence. Sang, J. K., Chaparas, S. D. (1978). Characterization of antigens from Aspergillusfumigatus: preparation of antigen from organisms grown in completely synthetic medium. Am. Rev. Respir. Dis., 118, 547-551. Saral, R. (1991). Candida and Aspergillus infections in immunocompromised patients: an overview. Rev. Infect. Dis., 13, 487-492. Slavin, R. G., Fischer, V. W., Levin, E. A., Tsai, C. C., Winzenburger, P. A. (1978). A primate model of allergic bronchopulmonary aspergillosis. Int. Arch. Allergy Appl. Immunol., 56, 325-333. Slavin, R. G., Bedrossian, C. W., Hutcheson, P. S. et al. (1988). A pathologic study of allergic bronchopulmonary aspergillosis. ]. Allergy Clin. Immunol., 81,718-725. Takizawa, H., Suko, M., Kobayashi, N. et al. (1988). Experimental hypersensitivity pneumonitis in the mouse: histologic and immunologic features and their modulation with cyclosporin A.]. Allergy Clin. Immunol., 81,391-400. Tremblay, G. M., Israel-Assayag, E., Sirois, P., Cormier, Y. (1993a). Murine hypersensitivity pneumonitis: evidences for the role of eicosanoids and platelet activating factor. Immunol. Invest., 22, 341-352. Tremblay, G. M., ThSrien, H.-M., Rocheleau, H., Cormier, Y. (1993b). Liposomal dexamethasone effectiveness in the treatment of hypersensitivity pneumonitis in mice. Eur. J. Clin. Invest., 23,656-661. Wang, J. M., Denis, M., Fournier, M., Laviolette, M. (1993). Cyclosporin A increases the pulmonary eosinophilia induced by inhaled Aspergillus antigen in mice. Clin. Exp. Immunol., 93, 323-330. Wang, J. M., Denis, M., Fournier, M., Laviolette, M. (1994). Experimental allergic bronchopulmonary aspergillosis in the mouse: immunological and histological features. Scand. J. Immunol., 39, 19-26. Wang, J. M., Chu, H. W., BossY, M., St-Pierre, J., Boutet, M., Laviolette, M. (1996). Dexamethasone and cyclosporin A modulation of cytokine expression and specific antibody synthesis in an allergic bronchopulmonary aspergillosis murine model. Eur. J. Clin. Invest., 26, 951-959. Wilson, B. D., Sternick, J. L., Yoshizawa, Y., Katzenstein, A.-L., Moore, V. L. (1982). Experimental murine hypersensitivity pneumonitis: multigenic control and influence by genes within the I-B subregion of the H-2 complex. ]. Immunol., 129, 2160-2163.

This Page Intentionally Left Blank

Chapter 82

Experimental Pulmonary Cryptococcal Infection in Mice M. F. Lipscomb, C. R. Lyons, A. A. Izzo, J. Lovchik and J. A. Wilder

Background of model Cryptococcus neoformans is a fungus which infects the host as an encapsulated yeast acquired from the environment, probably in a desiccated form. Infection is generally thought to be initiated in the human host as a respiratory tract infection, but causes only minimal respiratory tract symptoms, if any. The organism then disseminates to extrapulmonary sites in the predisposed. The most common clinical presentation is as a chronic meningococcal infection with headache and fever, and is particularly likely to occur in T lymphocyte-deficient hosts. Nevertheless, infections in the lung, bone, and other tissues are not uncommon and the organism often produces a widespread systemic infection in the severely immunocompromised host. The pathogenic mechanisms of C. neoformans are still incompletely understood, but three major ones have been identified (Mitchell and Perfect, 1995). First is the ability to produce a capsule which allows the organism to escape phagocytosis and exert immunosuppressive activity. The second is the ability to grow at 37°C. A third important mechanism is melanin production. Thus, the organism expresses a unique phenol oxidase which oxidizes several substrates, including norepinephrine and dopamine, which are constituents of the central nervous system. Melanin has antioxidant activity and may function to protect the yeast from destruction by oxidative phagocyte killing mechanisms (Jacobson and Tinnell, 1993). C. neoformans is classified for purposes of human disease into two varieties, var. neoformans and var. gattii, as well as by serologically defined capsular epitopes A, B, C, D, and AD. A and D are closely related and occur in var. neoformans (Mitchell and Perfect, 1995). Similarly, C and D are also closely related and occur in var. gattii. Serotype A, var. neoformans produces the overwhelming majority of all infections in humans. Although for many years C. neoformans was not known to exist in a perfect state, less than 25 years ago Kwon-Chung demonstrated that C. neoformans represented the anamorphic (asexual) form of the telomorphic (sexual) Filobasidiella neoformans (Kwon-Chung, 1976). The increased incidence of cryptococcal infections with the acquired immunodeficiency syndrome (AIDS) epidemic has heightened interest in this ubiquitous organism, Handbook ofAnirnalModelsof Infection ISBN 0-12-775390-7

which is generally considered an opportunist. The difficulty of treating severely immunocompromised patients with cryptococcosis has renewed interest in new vaccine strategies to prevent the infection. In addition, new antibiotics and innovative new adjunctive therapies such as monoclonal antibodies and recombinant cytokines could be extremely useful. While in vitro studies with the organism are useful in identifying promising chemotherapeutic agents, animal models are finally necessary to demonstrate in vivo efficacy. To that end, central nervous system, systemic and pulmonary infection models of cryptococcosis are very important. This chapter will discuss methods to use the respiratory route of infection to produce a cryptococcal pneumonia in mice. In our opinion, this route of infection more closely mimicks the route of infection in humans. However, unlike the situation in humans, the lung route of infection always produces a prominent pneumonia in mice, unless an acapsular strain is used (Lipscomb, unpublished observations). Thus, this initial lung infection, which either becomes chronic or clears very slowly depending on the virulence of the yeast, provides an excellent model to study the efficacy of drug delivery via the aerosol route for treatment of chronic persisting lung infections. Furthermore, dissemination of the organism to extrapulmonary organs, including the brain, can occur in those mice whose pneumonia is persistent. Therefore, systemic agents can be tested in these mice to treat the later stages of disease.

Animal species Both rats and mice have been used to study cryptococcal infections initiated by the respiratory route. However, the murine model offers the greatest advantage and is the model described here. Advantages include lower cost and the availability of many genetically characterized mouse strains as compared to rats. Either outbred or inbred mouse strains may be used and are infected between 8 and 12 weeks of age. However, it is very important to appreciate that responses to infection differ among inbred strains. Copyright © 1999Academic Press All rights of reproduction in any form reserved

682

M . F . Lipscomb, C. R. Lyons. A. A. Izzo, J. Lovchik and J. A. Wilder

Indeed, these defined genetic differences are among the advantages of using mice, since genetic factors in resistance may then be examined. Following intratracheal inoculation of a low-virulence C. neoformans strain 52D (24067 from the American Type Culture Collection, Rockville, MD, USA), BALB/c, C.B-17, and CBA mice exhibit resistance in the lung with gradual clearance of the yeast. In contrast, C57BL/6, C3H, and B10.D2 mice exhibit much less resistance to this organism and are considered susceptible (Huffnagle et al., 1991b; Hoag et al., 1995; Lipscomb et al., personal observations). Severe combined immunodeficient C.B-17 scid/scid (SCID) mice (congenic with C.B-17) and athymic nude mice on a BALB/c background develop chronic persisting and widely disseminated infections which are often lethal (Huffnagle et al., 1991b). These observations have been used to argue that acquired T cell immunity is necessary for optimal lung clearance in resistant m o u s e strains.

version to the above micro-organisms. Thus, concurrent infections with these microorganisms both alter the course of the cryptococcal infection, as measured by survival rates and colony-forming units (cfu) in the various organs, and also change the tempo and character of the inflammatory response. In order to guarantee protection against inadvertently infecting experimental animals with these pathogens, all handlers must gown, glove and don masks before entering the immediate animal housing quarters. All food, water, bedding and cages should be autoclaved before use. Otherwise animals are allowed to run freely on bedding and are given standard chow and water ad lib#urn.

Organism Any cryptococcal strain may be used. However, the course of the infection in the lung must be carefully analyzed for each new cryptococcal strain and inbred mouse strain before using the model for testing a new therapeutic agent, because there are clear differences depending on each of these parameters. The yeast strain used in the majority of our experiments, i.e., strain 52D, has a relatively low virulence for mice and requires T cell depletion in resistant mice to circumvent the lung clearance. Thus, murine infection with 52D may more closely resemble C. neoformans infections in humans, i.e., T cell immunodeficiency makes the infection both much more frequent and much more serious. The course of a lung infection with strain 52D in C.B-17, BALB/c and C57BL/6 mice is shown in Figure 82.1: this illustrates the typical gradual clearance of

Care and housing Mice must be housed under pathogen-free conditions in order to avoid developing common rodent infections with agents such as mouse hepatitis virus, Sendai virus, and Mycoplasrna pulmonis. Furthermore, if mice are ordered from a vendor, it is recommended that they be shipped in special filtered boxes that prevent contamination from any other animals that might be shipped or received at the same time. Sentinel animals should be housed with the mice and tested regularly (we test every 3 months) for serologic con7 6.5

6 O

5.5

~

s

~

4.5

._1

4

3.5

"

3

-e- C57BL/6

2.5 0

i

!

10

20

9< i

30

40

50

60

70

80

90

Day after C. neoformans intratracheal inoculation Figure 82.1 Pulmonary clearance pattern of Cryptococcus neoformans, strain 52D, after intratracheal infection of three mouse strains. At the days indicated, lungs were removed and colony-forming units (cfu) per lung were assessed. Data are expressed as mean _+standard error. After day 7, C.B-17 clearance is different from C57BL/6 at all points, and from BALB/c on days 14 through 35. BALB/c clearance is different from C57BL/6 at all time points except days 7 and 21. n = 11-61 mice per strain per time point.

EXPERIMENTAL PULMONARY CRYPTOCOCCAL INFECTION IN MICE

the lung infection in both C.B-17 and BALB/c mice and the persistence in C57BL/6. Frozen stock cultures are prepared from ATCC stock in Sabouraud's dextrose broth (SDB, 1% neopeptone, 2% dextrose; Difco, Detroit, MI, USA), sedimented, resuspended in 15% glycerol in saline, and stored at-70°C. Resting stock cultures are grown from frozen stock cultures on SD agar slants and stored refrigerated for up to 6 months. New resting stock cultures are prepared from frozen stock every 6 months. Fresh working cultures are prepared monthly by streaking from the refrigerated resting stock culture on SD agar (SDA) slants, growing at room temperature, and storing in the refrigerator. The return to frozen stock on a regular basis for preparing resting stock cultures is essential in order to guard against progressive selection of yeast with a changed virulence when inoculated into mice. To prepare organisms for infections and for growth inhibition studies, the organism is grown in SDB for 36-48 hours at room temperature on a shaker. For the standard 5 × 103 inoculum, prior to inoculation the organism is washed in sterile saline, counted on a hemocytometer, and diluted to approximately 105 cfu/ml in sterile nonpyrogenic saline (Baxter Healthcare Corporation, Deerfield, IL, USA).

Surgical procedures and initiation of infection Overview

Mice infected via the respiratory tract always develop a pulmonary infection. The pulmonary infection can be initiated by several methods. First, mice have been allowed to run over bedding which was admixed with the organisms (Smith et al., 1964). Aerosol exposures have also been used (Smith et al., 1964). Intranasal infection also successfully infects mice (Ritter and Larsh, 1963) and is the method of choice of some investigators because of ease of performance, although animals must be lightly anesthetized. However, the intranasal route may result in a more variable lung deposition. Furthermore, significant ingestion of the organism may require that attention be paid to the role of the gastrointestinal tract in regulating the immunologic response to the infection. Intratracheal inoculation may be administered via two methods: directly into the trachea or orally via an endotracheal catheter. We have chosen the former because of ease of performance. This method will be described. It is essential when initiating an infection for studying treatment effects on groups of animals that all animals be approximately the same age. We attempt to mix sexes equally unless all are of the same sex. The inoculum of C. neoforrnans should always be prepared in a standard way, and both the inoculum and the amount deposited initially should be accurately quantitated.

683

Anesthesia

All mice receive anesthesia prior to undergoing intratracheal inoculation. They are given Avertin (44 pmol/1 tribromoethanol and 71 pmol/1 tert-amyl alcohol in distilled water) via the intraperitoneal route in the amount of 0.02ml/g. Mice are allowed to lose consciousness to the extent that there is no visible reaction to gentle pressure exerted on the extremities before undergoing surgery. For euthanizing mice for harvest of organs and/or body fluids, they are generally given 100% CO2 by inhalation, although an overdose of Avertin may also be used.

Intratracheal inoculation

Some investigators have used an oral method of intratracheal inoculation by placing a rigid needle into the trachea and threading a small catheter through the needle. This method is quite satisfactory, but placement of the needle is sometimes uncertain and delivery of the inoculum can be into the stomach. Proper placement can be assured when utilizing this method by cutting down over the trachea and examining the trachea as the needle is inserted. We prefer to use a direct intratracheal inoculation through the tracheal wall just below the pharynx. To achieve this, anesthetized mice are gently restrained in the supine position on a small clean styrofoam board. A good exposure of the trachea can be achieved by attaching the upper incisors to a rubber band which encircles the board, thus arching the neck slightly upwards. A small incision is made over the trachea, and the trachea is exposed by blunt dissection. A slightly bent 30 G needle attached to a tuberculin syringe via PE-10 tubing (Intramedic; Clay Adams, Parsippany, NI, USA) is inserted into the trachea, and 50 ml of fluid containing the yeast is delivered. After injection, the skin is closed with cyanoacrylate adhesive. Following surgery, the mice should be kept warm with a heating pad and allowed to recover from the anesthesia under direct observation prior to being put back into cages.

Analysis of infection Overview

In resistant C.B-17 and BALB/c mice administered strain 52D (5 x 103cfu), the organism grows rapidly in the lungs for the first 7 days, peaking between 106 and 107 cfu. In C.B17 mice, clearance begins at that time (Figure 82.1). The clearance in the BALB/c is initially more gradual than the C.B-17 and numbers of lung cfu vary more. By 3 months both C.B-17 and BALB/c have either completely cleared the infection or retain less than 104 cfu. Inflammation is not detectable until about 5 days in either strain. It is first prominently neutrophilic, but admixed with lymphocytes

684

M.F. Lipscomb, C. R. Lyons. A. A. Izzo, J. Lovchik and J. A. Wilder

and macrophages (Lovchik et al., 1995). Inflammation peaks at day 14 when macrophages and lymphocytes predominate. At this time the inflammation is clearly granulomatous with cells surrounding the organism in alveolar spaces but with prominent perivascular lymphocytic cuffing (Huffnagle et al., 1991a). The inflammation gradually resolves over time as the yeast cfu decrease. In the more sensitive C57BL/6 strain, the number of cfu peaks at days 7 and 14, decreases slightly and then persists over the ensuing 3 months (Figure 82.1); in some mice of this strain the infection is lethal. A distinguishing feature of the C57BL/6 mice is that in addition to granulomatous inflammation, a persisting and prominent eosinophilia is present (Huffnagle et al., 1998).

Survival studies These are useful when a new inoculum dose, cryptococcal strain or mouse strain is used. Time of death and even whether death occurs or not is variable, depending on each of these parameters. Mice given a lethal inoculum of cryptococci intravenously usually succumb to an overwhelming meningeal infection. In contrast, death following an intratracheal infection may occur with high lung cfu and lower brain cfu than occurs in animals dying following the parenteral route. Thus, pneumonia appears to play a major role in causing death. A high dose of a very virulent organism may inflict death on half the animals by 35 days, which contrasts with the intravenous route, where death in a mouse strain deficient in the fifth complement component may occur as early as 5 days, or in complement-sufficient mice between 12 and 25 days (Rhodes et al., 1980). In both the intravenous and pulmonary infection model, depletion of T cells may hasten death. Animals must not be allowed to suffer any excessive morbidity due to the infection. When infected mice demonstrate behavior consistent with near death (significant respiratory distress, ruffled fur, hunching and decreased mobility), the animals should be immediately euthanized.

Following the progress of infection: assessing colony-forming units Mice are euthanized. Their lungs, brain, spleen, or other organs of interest are removed into 2-10 ml of sterile water and homogenized. Several techniques for homogenization are acceptable, but we prefer to use a tissue homogenizer with cleansing between samples in 70% alcohol and sterile water to remove traces of alcohol. We have found that carry-over from one sample to the next is not a problem if care in cleansing the blades is taken. Serial 10-fold dilutions are made and 501al is placed on to SDA plates containing chloramphenicol. Cfu are assessed following 48-72 hours of growth at room temperature.

Following the progress of infection: assessing inflammation The progress of the infection may be monitored by histological assessment of inflammation and location of the organisms in various tissues using standard techniques. Inflation with buffered formalin via the trachea will enhance the histologic preparation of the lung. Routine sections are stained with hematoxylin and eosin (H&E) or with mucicarmine to visualize the organisms optimally. If immunohistochemical assessment is desired, preparing frozen sections will insure preservation of antigenic structure. In this circumstance, inflation with a solution of embedding medium for frozen sections (Tissue Tek; Miles, Eckhart, IA, USA) diluted 1:3 in phosphate-buffered saline (PBS), pH 7.4, prior to excision is desirable. The lungs should then be immediately placed into 2-methylbutane (Aldrich Chemicals, Milwaukee, WI, USA) that has been cooled in a methanol/dry ice bath. The lungs can then be stored at-70°C. We have developed a semiquantitative assessment of the total inflammatory response for each lung using H&E sections as follows: a low-power objective is used to scan the entire H&E-stained lung and the lung is scored depending on the percent of the lung that contains inflammatory cells. The scoring system is as follows: 1 = 6-20% involvement, 2= 21-40%, 3 = 41-60%, 4 = 61-80%, 5 = 81-100%. Lungs are also scanned to determine the relative density of infiltrating cells in the inflamed areas using a graded coding system similar to that used to assess the percentage of inflamed lung, i.e., 1 = 6-20% of the inflamed area is occupied by cells, etc. The two values for each lung can then be multiplied to obtain a possible total score of 25. For example, if 50% of the lung were involved with inflammation, but in each of the inflamed areas the cells occupied only 15% of the area on average, the total score would be 3 x 1 = 3. Sections are best read blinded and by two individuals. A score for each mouse lung is the average of both readers' scores, and the data is expressed as the mean _ SD for each mouse lung per group per time point. Another good way to characterize the inflammatory response in the infected mouse lung is to isolate, count and determine the cell types by either Wright-Giemsa smears or, more accurately, by flow cytometry using monoclonal antibodies specific for a given cell type. To obtain cells from the bronchoalveolar space, bronchoalveolar lavage can be performed using PBS containing 0.6mm ethylenediaminetetraacetic acid in a 1 ml syringe connected to a small piece of PE-50 tubing. Five lml aliquots of fluid are injected into the lungs via the trachea and drawn out through the same syringe, with 0.5-0.8ml aliquots being withdrawn each time. To enumerate and characterize all lung cells, the lungs are perfused from the right heart ventricle with saline, minced and treated for 90 minutes at 37°C with Collagenase A (0.7mg/ml, Boehringer Mannheim Biochemicals) and DNase I (301ag/ml, Sigma) in 15ml RPMI with 5% fetal calf serum per lung. Digested tissue is

EXPERIMENTAL PULMONARY CRYPTOCOCCAL INFECTION IN MICE

tapped through a wire screen (60 mesh), and cells are collected in Hanks Balanced Salt Solution (HBSS) or complete medium (RPMI 1640, supplemented with 100 U/ml penicillin, 100 tlg/ml streptomycin, 21ag/ml amphotericin B, 2mmol/1 L-glutamine non-essential amino acids, and 1 mmol/l sodium pyruvate) and washed. Coarse clumps may be removed by passing the cell suspension through a small, loose, nylon wool plug. Red cells may be lysed using 0.383% ammonium chloride lysing buffer. Cells may then be counted with live cells assessed using trypan blue. Cell types are determined by differential counting after staining cytospin preparations with either a Leukostat Stain Kit (Fisher Diagnostic, Pittsburgh, PA, USA) or any acceptable Wright-Giemsa staining method.

Contribution of the model to infectious disease therapy Use of model to study pulmonary immunoregulation Our primary use of the pulmonary cryptococcal infection model has been to gain a better understanding of how the host mounts an effective immune response in the lung against a chronic, opportunistic infectious agent. It was our hypothesis that the less virulent 52D cryptococcal strain would initiate a primary immune response on inoculation into the murine lung (Huffnagle et al., 1991b). Thus, the strain grows progressively in the lungs and disseminates, but after day 7, the cfu in the lung steadily decreases. The decrease in lung cfu correlates in time with the development of a delayed-type hypersensitivity (DTH) reaction as measured by a positive foot pad swelling assay in resistant BALB/c mice, although little D T H is detected in susceptible C57BL/6 (Huffnagle et al., 1991b). As discussed, by comparing immunocompetent BALB/c mice and congenic C.B-17 mice with athymic nude and SCID mice, T cells were demonstrated to be required for optimal lung clearance. Furthermore, adoptive transfer experiments demonstrated that immune lung T cells or splenocytes were effective in protecting SCIDs from pulmonary growth of Cryptococcus neoformans following an intratracheal inoculation of the yeast. We have also demonstrated a role for CD4 and CD8 T cells in pulmonary clearance by depleting BALB/c mice of these cells with the relevant monoclonal antibodies (clones GKI.5 and YTSI69.4 respectively; Huffnagle et al., 1991a). Both CD4 and CD8 cells are required for optimal clearance, and examination of the lungs histologically demonstrated that there was a marked decrease in inflammation in lungs of both CD4- and CD8-depleted mice. In mice depleted of both CD4 and CD8 T cells, virtually no inflammation occurs at 14 days, the time when normal mice demonstrate a peak inflammatory response. Additional studies have shown that an effective T helper 1 (Thl)

685

response is essential for clearance and that the effector mechanism is related to the ability of lung macrophages to make nitric oxide (Hoag et al., 1995; Lovchik et al. 1995).

Use of model in studying new therapeutic agents We have used the infection with 52D strain in C.B-17 mice to study the role of the cytokines interleukin (IL)-12 and interferon- 2 (IFN-7) in regulating the development of a protective Thl response which is required to resolve the infection (Hoag et al., 1997). We have found that sensitive C57BL/6 mice develop a non-protective Th2 response (Hoag et al., 1997; Huffnagle et al., 1998) and studied the effect of antibodies to IL-4 in shifting the Th2 to a Thl response--so far without success (Izzo and Lipscomb, unpublished data). Both of these models, i.e., the resistant and susceptible variants, could be used to assess the role of systemic and/or aerosol delivery of various adjuvant cytokine therapies in altering the course of infection. We have also examined the effect of cyclosporin A (CsA) in altering the course of a pulmonary infection using a highly virulent, lethal, serotype A cryptococcal strain, 145A (Mody et al., 1988, 1989). CsA was originally developed as a possible antifungal agent, but was almost immediately recognized as a remarkable T-cell-suppressive drug and gained wide use in prevention of allograph rejection. Early literature suggested that Cne replication was not directly affected by this drug (Perfect and Durack, 1985), and our initial studies were designed to determine the effect of Tcell suppression by CsA on infection with Cne 145A. Mice were pretreated with the drug prior to being infected by either the intravenous or intratracheal routes. The surprising result was that survival of mice was indefinitely prolonged in both infection models. In vitro studies established that CsA was directly cytotoxic to the organism at doses achieved in mouse blood (Mody et al., 1988). Additional studies established that the doses of CsA used were sufficient to immunosuppress the mice (20, 50, and 75 mg/kg per day; Mody et al., 1988), so the results were doubly surprising because they implied that a drug that is immunosuppressive might still protect against an infection if it had a greater toxic effect on the micro-organism. In a second series of experiments, we assessed whether mice could be protected if CsA were administered after the infection was already established or if they were profoundly immunosuppressed, i.e., had no T cells (Mody et al., 1989). Both infected immunocompetent BALB/c mice and congenic infected athymic nude mice were studied after an intratracheal infection. In normal mice after 28 days of infection (just prior to the time of the usual demise of the animals), initiation of CsA treatment effectively prolonged survival. CFU in organs just prior to death were significantly less than they were at day 28 when treatment was initiated; that is, with the exception

686

M . F . Lipscomb, C. R. Lyons. A. A. Izzo, J. Lovchik and J. A. Wilder

of in the brain. Apparently, once the organism reached the brain, CsA was relatively ineffective, and treated animals still eventually died of meningitis. To verify this interpretation, normal mice were inoculated with cryptococci intravenously to initiate a rapidly developing brain infection. In these mice, CsA was unable to reduce the numbers of brain CFU, verifying the poor access of CsA into cerebrospinal fluid. In athymic nude mice infected via the respiratory tract, treatment also prolonged survival, but did not prevent death. Our conclusions were that CsA could kill Cne in vivo, but could not sterilize the host if there were a complete absence of T cells. Nor could CsA penetrate the central nervous system to afford protection once the organism was implanted at this site. These experiments illustrate the utility of the lung infection model in assessing the efficacy of a therapeutic modality, but also suggest the need to explore various routes of initiating infection in order to understand completely the full effect of the intervention.

Summary Using a low-virulence cryptococcal strain, a cryptococcal lung infection model in mice has been extensively studied, describing survival and lung clearance data. Inflammatory and effector mechanisms in the lungs of resistant and sensitive immunocompetent mice have also been characterized. Using a highly virulent cryptococcal strain, an example of the effect of a therapeutic agent on the evolution of a cryptococcal lung infection was also discussed. Either model or a variation of these models would be useful in examining new therapeutics for this difficult-to-eradicate infection in the immunocompromised host.

References Hoag, K. A., Street, N. E., Huffnagle, G. B., Lipscomb, M. F. (1995). Early cytokine production in pulmonary Cryptococcus neoformans infections distinguishes susceptible and resistant mice. Am. J. Respir. Cell MoL Biol., 13, 487-495. Hoag, K. A., Lipscomb, M. F., Izzo, A. A., Street, N. E. (1997). IL-12 and IFN- 7 are required for initiating the protective Thl response to pulmonary cryptococcosis in resistant C.B-17 mice. Am. J. Respir. Cell MoL Biol., 17, 733-739. Huffnagle, G. B., Yates, J. L., Lipscomb, M. F. (1991a). Immunity to a pulmonary Cryptococcus neoformans infection requires both CD4 + and CD8+ T cells. J. Exp. Med., 173, 793-800. Huffnagle, G. B., Yates, J. L., Lipscomb, M. F. (1991b). T cellmediated immunity in the lung: a Cryptococcus neoformans pulmonary infection model using SCID and athymic nude mice. Infect. Immun., 59, 1423-1433. Huffnagle, G. B., Boyd, M. B., Street, N. E., Lipscomb, M. F. (1998). IL-5 is required for eosinophil recruitment, crystal deposition, and mononuclear cell recruitment during a pulmonary Cryptococcus neoformans infection in genetically "susceptible" mice (C57BL/6). J. Immunol., 160, 2393-2400. Jacobson, E. S., Tinnell, S. B. (1993). Antioxidant function of fungal melanin.J. Bacteriol., 175, 7102-7104. Kwon-Chung, K. J. (1976). Morphogenesis of Filobasidiella neoformans, the sexual state of Cryptococcus neoformans. Mycologia, 68, 821-833. Lovchik, J. A., Lyons, C. R., Lipscomb, M. F. (1995). A role for gamma interferon-induced nitric oxide in pulmonary clearance of Cryptococcus neoformans. Am. J. Respir. Cell MoL Biol., 13, 116-124. Mitchell, T. G., Perfect, J. R. (1995). Cryptococcosis in the era of A I D S - 100 years after the discovery of Cryptococcus neoforroans. Clin. MicrobioL Rev., 8, 515-548. Mody, C. H., Toews, G. B., Lipscomb, M. F. (1988). Cyclosporin A inhibits the growth of Cryptococcus neoformans in a murine model. Infect. Immun., 56, 7-12. Mody, C. H., Toews, G. B., Lipscomb, M. F. (1989). Treatment of murine cryptococcosis with cyclosporin-A in normal and athymic mice. Am. Rev. Respir. Dis., 139, 8-13. Perfect, J. R., Durack, D. T. (1985). Effects of cyclosporin in experimental cryptococcal meningitis. Infect. Immun., 50,

22-26.

Acknowledgment The authors gratefully acknowledge the contributions of Drs Chris Mody, Gary Huffnagle, Nancy Street, and Kathy Hoag to the development of the described model. All studies were supported by a National Institutes of Health grant, #RO1A121951.

Rhodes, J. D., Wicker, L. S., Urba, W. J. (1980). Genetic control of susceptibility to Cryptococcus neoformans in mice. Infect. Immunol., 29, 494-499. Ritter, R. C., Larsh, H. W. (1963). The infection of white mice following an intranasal instillation of Cryptococcus neoformans. Am. J. Hygiene, 78, 241-246. Smith, C. D., Ritter, R., Larsh, H. W., Furcolow, M. L. (1964). Infection of white Swiss mice with airborne Cryptococcus neoformans. J. Bacteriol., 87, 1364-1368.

Chapter 83

Experimental Pulmonary Cryptococcus neoformans Infection in Rats D. L. Goldman and A. Casadevall

Background of human infection Cryptococcus neoformans is a fungus which can cause lifethreatening infections in humans. Most cases occur in immunosuppressed individuals, but occasional cases occur in persons with no obvious immune deficiency. Cryptococcosis occurs in 6-8% of patients with acquired immunodeficiency syndrome (AIDS) and characteristically involves the meninges and brain parenchyma (Dismukes, 1988; Lee et al., 1996). Despite antifungal therapy, the acute mortality associated with cryptococcal infection in AIDS patients is approximately 15% (Saag et al., 1992). Complete cure is rare in patients with AIDS and those who survive the initial presentation require lifetime suppressive therapy to prevent recurrence of disease (Chuck and Sande, 1989). Cryptococcal infection is believed to be acquired by inhalation of desiccated yeast cells or basidiospores. Pulmonary infection in immunocompetent individuals characteristically produces no or little symptoms. The histopathologic findings of pulmonary cryptococcal infection in the immune-competent host consist primarily of welldefined granulomas and suggest the importance of cellular immunity in controlling infection. It has been hypothesized that the impaired host response of certain immunodeficiency states allows extrapulmonary dissemination, which can in turn result in cryptococcal meningoencephalitis. C. neoformans infections are often chronic and the organism can cause latent infections that have the potential to reactivate, especially in the setting of acquired immune deficiency. Much of what we know about the pathogenesis of cryptococcal infection was learned by animal experimentation. Animal models of pulmonary cryptococcosis are important for elucidating the immune mechanisms responsible for confining infection to the lungs and for the development of therapies that will enhance local host responses.

lated subcutaneously with C. neoformans developed large tumor-like subcutaneous lesions in association with lung, spleen and kidney involvement. In 1935, Benham described systemic cryptococcal infection in rats following intraperitoneal inoculation of C. neoformans. The first description of a pulmonary model of C. neoforroans infection in rats was made by Gadebusch and Gikas in 1964. These investigators induced pulmonary infection in Holtzman rats by aerosolization of a clinical strain of C. neoformans. Graybill et al. (1983) induced pulmonary infection in Sprague-Dawley and nude rats by direct injection of a clinical isolate of C. neoformans into the right main stem bronchus following tracheostomy. In the method described here, rats are infected under direct visualization of the larynx using an otoscope without the need for surgery (Goldman et al., 1994). In addition to in-vivo models, rat cells and tissues have been used to study various aspects of C. neoformans pulmonary infection. Alveolar macrophages obtained from bronchioalveolar lavage of Lewis, Fischer and SpragueDawley rats have been used in in-vitro phagocytosis and killing assays (Bolanos and Mitchell, 1989; Chen et al., 1994). Furthermore, primary rat lung cell cultures prepared from the lungs of Sprague-Dawley rats have been used to study C. neoformans adhesion properties (Merkel and Cunningham, 1992).

Animal species Male Fischer 344 rats obtained from the National Cancer Institute (Frederick, MD) and ranging in weight from 150 to 250 grams were used in the model described here. Other rat strains used to study pulmonary infection, include Sprague-Dawley, nu/nu rats of the Rowett strain (Graybill etal., 1983) and Holtzman rats (Gadebusch and Gikas, 1964).

Background of model Preparation of animals Rats have been used as models of C. neoformans infection for over a century. Early investigators focused on systemic models of disease. In 1896, Curtis observed that rats inocuHandbook of Animal Modelsof Infection ISBN 0-12-775390-7

No special feed or housing preparations are needed. Rats should be free of Mycoplasma pulmonis and cilia-associated Copyright © 1999AcademicPress All rights of reproduction in any form reserved

688

D.L. Goldman and A. Casadevall

respiratory bacillus, both of which can induce spontaneous pulmonary infection in rats and could interfere with the interpretation of pulmonary findings.

Overview The basic protocol involves the inoculation of C. neoformans cells directly into the lungs through the intubated trachea. This procedure is accomplished with an otoscope and provides a mechanism for direct pulmonary inoculation without the need for surgery to expose the trachea. Briefly, anesthetized rats are placed on an incline board. An otoscope is placed in the mouth of the rat and used to visualize the trachea and vocal cords (Figure 83.1). Rats are then infected by placing a blunted spinal needle or an angiocath (BectonDickinson, Franklin Lakes, NJ) through the mouth into the trachea with the tip resting at a site distal to the vocal cords and injecting a suspension of yeast cells into the lungs.

Materials required The materials required include 23 G spinal needles with blunted tips or 14G angiocaths, otoscope, ear speculums, incline board, methoxyflurane (Pitman-Moore, Mundelein, IL), tuberculin syringes and anesthetic chamber. The speculum is modified by cutting a groove in it to accommodate the angiocath or spinal needle. Angiocaths are softer than the spinal needle and less likely to induce local trauma. They are therefore preferred by some investigators to intubate the trachea.

Organism strain and preparation

Figure 83.1 Rat on incline board with otoscope, spinal needle and angiocath.

sterile phosphate-buffered saline (PBS) and counted in a hemocytometer. The number of cells is then adjusted to 0.5-1 x 108/ml. A 0.2 ml volume of PBS solution containing C. neoformans (inoculum dose 1-2 x 107 cells) is drawn up into a tuberculin syringe with a small volume (0.1-0.2 ml) of air behind the PBS solution.

Anesthesia Rats are placed in an anesthetic chamber in which a gauze, lightly saturated with methoxyflurane, has been placed. Prior to the onset of respiratory depression, rats are removed from the chamber. Adequate anesthesia can be insured by squeezing a footpad and observing for lack of withdrawal. The time needed to induce appropriate anesthesia is of the order of several minutes but there is significant variation between individual animals and each rat should be observed carefully.

C. neoformans American Type Culture Collection (ATCC, Rockville, MD) strain 24067 (serotype D) was used in this model. ATCC 24067 has also been used extensively in murine models of cryptococcal disease, including pulmonary infection models (Curtis et al., 1994; Feldmesser and Casadevall, 1997). While serotype D constitutes approximately 7% of clinical isolates in the USA, this serotype is the most common clinical isolate in some European countries (Kwon-Chung and Bennett, 1984). Various C. neoformans isolates have been used to induce pulmonary infection in mice. Since C. neoformans strains can differ significantly in their virulence, experimentation would be required to determine the optimal inoculum needed to induce infection, if other rat or C. neoformans strains are to be used. Cells are grown in Sabouraud's media in a rotary shaker at 30°C until they reach stationary phase (2-3 days). They are then collected by centrifugation, washed three times in

Procedure The anesthetized rat is placed supine on the incline board with the head of the rat at the top of the incline. A rubber band is placed underneath the upper, central incisors to prevent the rat from slipping down the incline (Figure 83.1). The tongue of the rat is pulled out and to the side by hand and an otoscope with the modified speculum is inserted into the pharynx. Using the edge of the otoscope to exert light pressure on the tongue, the visualized field is kept clear and the vocal cords are visualized. An angiocath or blunted spinal needle attached to a tuberculin syringe containing C. neoformans inoculum is inserted into the groove of the speculum and placed between the vocal cords under direct visualization. Occasionally mucus secretions may obstruct visualization of the vocal cords. These secretions can be

EXPERIMENTAL PULMONARY CRYPTOCOCCUS NEOFORMANS INFECTION IN RATS

removed by use of a cotton-tip applicator. The procedure usually takes 2-3 minutes.

Infection process With the tip of the catheter in place immediately below the vocal cords, the inoculum of C. neoformans in a volume of 0.2ml of PBS is instilled. The entire air contents of the syringe are injected, including the air bubble, to insure that the complete inocula is uniformly delivered to the lungs.

Clinical course Rats infected in this manner recover quickly from the actual infection procedure. Despite successful inoculation, there are no acute clinical signs of pulmonary or extrapulmonary disease. Death secondary to crytpococcal infection using the experimental parameters described here (i.e strain 24067 at infecting dose of 1 x 107 in Fischer rats) is rare. In the context of immunosuppression or following the administration of very high inoculum (i.e., 109) of C. neoformans, the mortality rate may be greatly increased (Gadebusch and Gikas, 1964; Graybill et al., 1983).

Key parameters to monitor infection and response to treatment It is difficult to ascertain whether infection was successful by clinical observation alone. Rats will appear well and the investigator may wonder whether infection was successful. In our hands, the protocol described here results in 100% acute infection using an inocula of 1 x 107yeast cells per rat. Because immunocompetent rats are capable of containing infection in the lungs, there are few parameters to monitor infection in live rats. In fact, the only definitive means of establishing that the rat was infected is to kill the animal and harvest the lung tissue for colony count determination.

Organ fungal burden In the immunocompetent rat, inoculation of C. neoformans into the respiratory tract produces pulmonary infection with low levels of extrapulmonary dissemination (Graybill et al., 1983; Goldman et al., 1994). Occasional colonies can sometimes be recovered from the brain, liver, spleen and kidneys. In contrast, infection of nude rats or administration of glucocorticoids to immunocompetent rats significantly increases levels of extrapulmonary dissemination. Organ fungal burdens are determined by culturing organ

689

homogenates on Sabouraud's agar plates and incubating plates at 30°C for 3-4 days. Briefly, this is done by homogenizing tissue in PBS and spreading an aliquot (100 btl) on Sabouraud agar or a comparable fungal media. In heavily infected lungs, serial dilutions of tissue homogenates are necessary for quantitative measurements of organ fungal burden.

Serum polysaccharide levels Cryptococcal polysaccharide (CNPS) antigen is seldom detectable in the serum of rats given pulmonary infection unless dissemination has occurred. Hence serum CNPS levels can be used to monitor extrapulmonary dissemination, but this assay is not likely to be useful for determining whether pulmonary infection was successful. The presence of CNPS in the serum is believed to be the result of shedding capsular polysaccharide by yeast cells. The antigen is not degradable by host enzymes and tends to accumulate in tissues. Since the level of serum antigen reflects the infection burden, CNPS levels can be used to monitor the response of disseminated disease to therapy. Serum CNPS antigen levels may be determined by latex agglutination or enzyme-linked immunosorbent assays (ELISAs). Commercial assays are available for measuring CNPS levels in biological fluids. A double-sandwich ELISA assay which utilizes monoclonal antibodies to capture and immobilize CNPS has been developed by Casadevall et al. (1992). This system provides quantitative measurement of CNPS levels. Prior to CNPS determinations, serum specimens should be treated with pronase to remove endogenous antibodies that bind CNPS and could potentially interfere with antigen detection.

Antibody titers Antibody responses to CNPS are dependent upon the immune status of the host. Significant interspecies variation in antibody responses are also likely; however this has not been thoroughly investigated. In patients with cryptococcal meningitis, the development of anti-CNPS response has been reported to be a positive prognostic indicator (Diamond and Bennett, 1974). Antibody responses to CNPS in rats have been detected after intravenous and subcutaneous administration of CNPS (Gadebusch and Gikas, 1964; Goldman et al., 1995). Pulmonary infection also induces an antibody response. Using a hemagglutination inhibition assay, Gadebusch and Gikas (1964) demonstrated that administration of cortisone reduces anti-CNPS titers in rats immunized with CNPS. Using ELISA, Goldman et al. (1994) demonstrated immunoglobulin M (IgM) and IgG responses to CNPS during the course of pulmonary infection in the rat. The

690

D.L. Goldman and A. Casadevall

IgG response was maximum 25 days after infection and correlated with an increase in opsonizing activity of rat sera in an in-vitro assay. The same authors have demonstrated local antibody production in the lungs of rats infected with C. neoforrnans using immunohistochemical techniques (Goldman et al., 1994).

Pathology The pathology of cryptococcal pulmonary infection in the rat model is remarkable for extensive granuloma formation. Areas of inflammation may be apparent on gross examination of lungs and appear as consolidated, whitish discolored regions. With the experimental conditions described here, maximum granuloma formation is present at day 14 of infection with some resolution of the inflammatory response by day 25. Granulomas tend to localize to peribronchial regions and protrusion of the inflammatory response into the bronchiolar lumen may be evident. Some granulomas may be necrotic. There is extensive lympho-

cytic infiltration with large amounts of perivascular cuffing as early as day 7 of infection.

Immunohistochemistry Immunohistochemical techniques have also been used to characterize various aspects of the pulmonary model of C. neoforrnans infection. Some of these techniques are suitable for paraffin sections, while others require frozen sections. A list of some of the antibodies used in this model, along with technical information and important findings, is given in Table 83.1 (Goldman et al., 1994, 1996).

Antimicrobial therapy No studies have been done to examine the effect of antimicrobial therapy in the rat pulmonary model of C. neoforrnans infection. However, Finquelievich et al. (1988) and

Table 83.1 Summary of immunohistochemical reagents used in rat model of cryptococcosis.

Primary antibody dilution

Antibody directed against

Tissue Processing

Cryptococcal polysaccharide (CNPS) (Mukherjee et al., 1994)

Frozen or paraffin

Casadevall Laboratory (Rabbit polyclonal antibody commercially available)

1:1000

• Demonstration of C. neoformans cells • Release of CNPS into lung parenchyma • Localization of CNPS to macrophages and epithelioid cells

Inducible nitric oxide synthase (NOS2)

Frozenor paraffin

Transduction Laboratories

1:200

• NOS2 expression in granulomas, which varies between granulomas and with the stage of infection

Proliferating cell nuclear antigen

Paraffin

Sigma (St Louis, MO)

1:50

• Proliferation of macrophages and lymphocytes within the inflammatory response. Decreased proliferative activity during the later stages of infection

Granulocyte macrophage colony-stimulating factor (GM-CSF)

Frozen

Sigma

1:500

• GM-CSF immunoreactive cells adjacent to inducible NOS2-positive granulomas

Interferon-y

Frozen

Biosource, (Camarillo, CA)

1:200

• Cell immunoreactive for interferon-y adjacent to NOS2positive granulomas

Transforming growth factor-13

Frozen

Genzyme (Cambridge, MA)

1:200

• TGF-~ immunoreactive cells within NOS2 positive granulomas

Source

Important findings

EXPERIMENTAL PULMONARY CRYPTOCOCCUS NEOFORMANS INFECTION IN RATS

Negroni et al. (1991) have evaluated the efficacy of various antimicrobial agents, including amphotericin B, itracanazole, fluconazole and SCH 39304 (an experimental azole) in a rat model of systemic C. neoforrnans infection and demonstrated that these antimicrobials are effective. This systemic model involves intracardiac injection of C. neoformans in Wistar rats which produces a subacute, progressive and disseminated infection involving brain, lungs, and thymus. The efficacy of antimicrobial therapy was evaluated by examination of histopathology and fungal burden. Hence, antifungal agents can be effective in rats even though these drugs have not been specifically evaluated in the pulmonary infection model described here. The rat model may be particularly useful in evaluating the efficacy of drug regimens to prevent central nervous system infection in patients at risk for cryptococcosis.

Advantages and disadvantages The rat is one of several animal species that can be used to study C. neoformans infection. In the past, rabbits and mice have provided the primary animal models to study the pathogenesis of cryptococcal infection and the efficacy of drug regimens against cryptococcosis. While mice have been used primarily to study pulmonary and systemic infection, rabbits have been used to study central nervous infection. In general, the rat as a species offers several advantages compared to rabbits and mice in the study of cryptococcal pathogenesis. Unlike rabbits, rats are naturally susceptible to cryptococcal infection and do not require immunosuppressive therapy to establish infection. Furthermore, the body temperature of the rat approximates that of humans, while the body temperature of rabbits is significantly higher (38.5-40°C) and may alter cryptococcal pathogenesis (Perfect et al., 1980). In comparison to mice, rats are larger and certain procedures including endotracheal intubation and intracisternal puncture can be performed more easily. With respect to a pulmonary model of infection, the rat model offers several advantages when compared to the murine model. As noted above, rats can be infected without the need for surgery. In addition, the pathogenesis of pulmonary infection in the rat seems to resemble more closely infection in immunocompetent humans than does infection in mice. Mice are very susceptible to C. neoformans infection and pulmonary inoculation characteristically produces disseminated disease. In contrast, rats like immunocompetent humans are able to contain C. neoformans infection to the respiratory tract. The rat model therefore provides an opportunity to study the host defense mechanisms that are important in containing infection and preventing dissemination. The disadvantages of the rat pulmonary model are related to the lack of clinical signs and non-invasive assays available to ascertain the course of pulmonary infection. Since rats are asymptomatic and seldom die from pul-

691

monary cryptococcal infection, survival cannot be used as an endpoint for antimicrobial studies, unless massive inocula are used. A definitive assessment of pulmonary infection usually requires killing the animal and studying the fungal burden in lung tissue and/or pathology. In addition, rats are more expensive than mice and gene-deficient (knockout) rats are currently unavailable. There are also fewer reagents available to study the immunological aspects of rat infection compared to murine infection.

Contributions of the model to infectious disease therapy The rat model of pulmonary C. neoformans infection has provided important insights into the pathogenesis of cryptococcal infection. This model has been used to demonstrate the shedding of CNPS antigen by cryptococcal organisms into the lung parenchyma and to demonstrate that serum CNPS antigen is absent, without significant extrapulmonary dissemination (Goldman et al., 1994). This model has also been used to demonstrate and to characterize inducible nitric oxide synthase (NOSe) expression by granulomas during the course of pulmonary infection. Local expression of cytokines which regulate NOS e expression (interferonq,, transforming growth factor granulocyte-~ and macrophage colony-stimulating factor), within granulomas has also been shown (Goldman et al., 1996). Other important findings include demonstration of inhibition of alveolar macrophage migration following pulmonary infection with C. neoformans (Graybill et al., 1983) and a characterization of the effects of glucocorticoids on antibody responses to CNPS (Gadebusch and Gikas, 1964).

Key References Benham, R. W. (1935). Cryptococci - their identification by morphology and by serology.J. Infect. Dis., 57, 255-274. Bolanos, B., Mitchell, T. G. (1989). Phagocytosis and killing of Cryptococcus neoformans by rat alveolar macrophages in the absence of serum. J. Leukoc. Biol., 48, 521-528. Casadevall, A., Mukherjee, J., Scharff, M. D. (1992). Monoclonal antibody ELISAs for cryptococcal polysaccharide.J. Immunol. Meth., 154, 27-35. Chen, G.-H., Curtis, J. L., Mody, C. H., Christensen, P. J., Armstrong, L. R., Toews, G. B. (1994). Effect of granulocytemacrophage colony stimulating factor on rat alveolar macrophage anticryptococcal activity in vitro.J. Immunol., 152, 724-734. Chuck, S. L., San&, M. A. (1989). Infections with Cryptococcus neoformans in the acquired immunodeficiency syndrome. N. Engl. J. Med., 321,794-799. Curtis F. (1896) Contribution fi l'&ude de la saccharomycose humaine.Ann. Inst. Pasteur., 10, 449-468. (cited in) Drouhet, E. (1997) Milestones in the history of Cryptococcus and cryptococcosis. J. Mycol. Med., 7, 10-27.

692

Curtis, J. L., Huffnagle, G. B., Chen, G. H. et al. (1994). Experimental murine pulmonary cryptococcosis. Lab. Invest., 71, 113-126. Diamond, R. D., Bennett, J. E. (1974). Prognostic factors in cryptococcal meningitis. Ann. Intern. Med., 80, 176-181. Dismukes, W. E. (1988). Cryptococcal meningitis in patients with AIDS. J. Infect. Dis., 157, 624-628. Feldmesser, M., Casadevall, A. (1997). Effect of serum IgG1 to Cryptococcus neoformans glucuronoxylomannan on murine pulmonary infection. J. Immunol., 158, 790-799. Finquelievich, J. L., Negroni, R., Bava, A. J., Iovannitti, C. (1988). Treatment of experimental sub-acute cryptococcosis in the Wistar rat. Medicina, 48, 506-510. Gadebusch, H. H., Gikas, P. W. (1964). The effect of cortisone upon experimental pulmonary cryptococcosis. Am. Rev. Resp. Dis., 92, 64-74. Goldman, D., Lee, S. C., Casadevall, A. (1994). Pathogenesis of pulmonary Cryptococcus neoformans infection in the rat. Infect. Immun., 62, 4755-4761. Goldman, D. L., Lee, S. C., Casadevall, A. (1995). Tissue localization of Cryptococcus neoformans glucuronoxylomannan in the presence and absence of specific antibody. Infect. Immun., 63, 3448-3453. Goldman, D., Cho, Y., Zhao, M.-L., Casadevall, A., Lee, S. C. (1996). Expression of inducible nitric oxide synthase in rat pulmonary Cryptococcus neoformans granulomas. Am. J. Pathol., 48, 1275-1282.

D . L . Goldman and A. Casadevall

Graybill, I. R., Ahrens, l., Nealon, T., Paque, R. (1983). Pulmonary cryptococcosis in the rat. Am. Rev. Respir. Dis., 127, 636-640. Kwon-Chung, K. J., Bennett, 1. E. (1984). Epidemiologic differences between the two varieties of Cryptococcus neoformans. Am. J. Epidemiol., 120, 123-130. Lee, S. C., Dickson, D. W., Casadevall, A. (1996). Pathology of cryptococcal meningoencephalitis: analysis of 27 patients with pathogenic implications. Hum. Pathol., 27, 839-847. Merkel, G. J., Cunningham, R. K. (1992). The interaction of Cryptococcus neoformans with primary rat lung cell cultures. J. Med. Vet. Mycol., 30, 115-121. Mukherjee, S., Lee, S., Mukherjee, J., Scharff, M. D., Casadevall, A. (1994). Monoclonal antibodies to Cryptococcus neoformans capsular polysaccharide modify the course of intravenous infection in mice. Infect. Immun., 62, 1079-1088. Negroni, R., De Elias Costa, M. R. I., Finquelievich, J. L. et al. (1991). Treatment of experimental cryptococcosis with SCH 39304 and fluconazole. Antimicrob. Agents Ckemother., 35, 1460-1463. Perfect, J. R., Lang, S. D. R., Durack, D. T. (1980). Chronic cryptococcal meningitis: a new experimental model in rabbits. Am. J. Pathol., 101,177-193. Saag, M. S., Powderly, W. G., Cloud, G. et al. (1992). Comparison of amphotericin B with fluconazole in the treatment of acute AIDS-associated cryptococcal infections. N. Engl. J. Med., 326, 83-89.

Chapter 84

Rat Model of Invasive Pulmonary Aspergillosis A. C. A. P. Leenders, E. W. M. van Etten and I. A. J. M. Bakker-Woudenberg

Background of the model Aspergillus species are opportunistic fungi, giving rise to pulmonary and other invasive infections in immunocompromised patients (Rinaldi 1983; Denning and Stevens, 1990; McWhinney et al., 1993). The number of invasive Aspergillus infections is steadily increasing (Denning et al., 1991; McWhinney et al., 1993; Khoo and Denning, 1994). This is due to growing numbers of susceptible patients-patients with prolonged granulocytopenia after aggressive chemotherapy and acquired immunodeficiency syndrome (AIDS) patients. A major problem with these infections is the lack of sufficient effective therapy. Even when treated promptly with the gold standard therapy (amphotericin B deoxycholate), these infections have a high morbidity and mortality (Denning and Stevens, 1990). Several animal models have been used to study these infections and their treatment, mostly mice models of systemic aspergillosis (Leenders and de Marie, 1997). Pulmonary aspergillosis has been studied in models using rabbits and rats (Leenders and de Marie, 1997). The rat model here described is based on the rat model of Klebsiella pneumoniae pneumonia, described by BakkerWoudenberg et aL (1982). The main features of A. fumigatus pneumonia in this model are one-sided onset of infection of the lung, persistent granulocytopenia and start of treatment at a time when hyphal growth is firmly established.

General aspects of the model Animal species and care The rats used were female R-strain albino rats (specified pathogen-free; 18-26 weeks old; weight 185-225 g; bred at Harlan CPB, Austerlitz, The Netherlands). Animals receive a normal, pathogen-free diet and water ad libitum and, during experiments, are housed separately under filter caps. The microbiological status of the rats is of importance when choosing an antibacterial prophylactic regimen for prevention of opportunistic infections (see below). Because Handbook of Animal Modelsof Infection ISBN 0-12-775390-7

animals are rendered severely granulocytopenic, without antibacterial prophylaxis superinfections with Enterobacteriaceae and even enterococcal species occur. To prevent bacterial superinfections strict hygienic care was applied and animals received ciprofloxacin (660mg/1) and polymyxin B (100mg/1) in their drinking water throughout the experiment. Starting 1 day before inoculation daily amoxycillin (40mg/kgi.m.) was added to this regime for the remainder of the experiment. Finally gentamicin (40mg/kgi.m.) was administered shortly before and after inoculation.

Aspergillus strain and inoculum preparation A clinical isolate of A. fumigatus from an immunocompromised patient with invasive pulmonary aspergillosis is used (strain number 1040403005). This strain is kept stored in oil on short agars during the study. The minimum inhibitory concentration (MIC) and minimum fungicidal concentration (MFC) for amphotericin B, determined by the method described by Schmitt et aL (1988), are 0.4 and 0.8btg/ml respectively. The strain is subcultured on Sabouraud dextrose agar (SDA) for 96 hours until a dense mycelium with abundant conidia has formed. These conidia are harvested by adding 5 ml of phosphate-buffered saline (PBS) and rubbing the surface gently. This suspension is washed in PBS. After this, conidia are resuspended in PBS and counted with a hemocytometer. The number of viable A. fumigatus used to inoculate the left lung in each experiment is confirmed by plate counts on SDA plates. Before each experiment the strain is passed through a rat to keep virulence as constant as possible. Although we did not study this, when using other strains of a. fumigatus, different infection characteristics can be expected (time to mortality, dissemination, etc.).

Induction of leukopenia Leukopenia is induced and maintained by multiple doses of cyclophosphamide (Sigma Chemical, St Louis, MO, USA) intraperitoneally. A first dose of 90 mg/kg is administered Copyright © 1999AcademicPress All rights of reproduction in any form reserved

694

A . C . A . P . Leenders, E. W. M. van Etten and I. A. J. M. Bakker-Woudenberg

5 days before fungal inoculation and a second of 60 mg/kg 1 day before fungal inoculation. This scheme is sufficient to keep animals persistently granulocytopenic (granulocytes _7-10 days to exhibit substantial efficacy as compared with their counterparts in untreated control groups. Thus, studies to determine the absolute or comparative effects of various antifungal regimens in experimental models must be conducted over a prolonged time period. This necessitates a considerable expense in housing and animal care costs, amounts of antifungal agent used, as well as technical and veterinary stafftime, as compared with studies of shorter duration. This is particularly true when antifungal therapies require unusual routes of administration (e.g. intraperitoneal), or multiple administrations per day.

Potential pitfalls of the model The experimental model of Candida IE is subject to standard limitations inherent to any animal model of infection. These include the fact that some differences exist in physiology (e.g. tissue response to anesthesia and trauma, innate and acquired immune functions), as well as pharmacokinetic profiles and efficacy between experimental animals and humans. In addition, investigators must guide their interpretations of data derived from such studies by considerations of potential pitfalls unique to these models. For example, experimental IE is an infection which is induced by first traumatizing the cardiac valve to be studied. Thus, while the establishment of such an infection may be highly relevant to human infections in patients with rheumatic heart disease or prosthetic valves, the relevance of the model to community-acquired IE in patients lacking underlying valve disease is less clear. Furthermore, the catheter model creates a setting in which fungal pathogenesis may be substantially influenced by the presence of an indwelling foreign body. In addition to the above stipulations, large inocula are required to initiate IE, even following valvular trauma. These high inocula probably initiate artificially aggressive infections which do not realistically simulate the clinical situation. None the less, these factors make the rabbit and rat models of IE even more rigorous tests of the prophylactic and therapeutic efficacy of antifungal agents. Alternatively, such large inocula may activate host defenses which would otherwise remain quiescent in less dramatic challenges, giving rise to misintrepretation of fungal virulence. This possibility makes the potential use o f e x vivo models (Rybak et al., 1997) meritorious, given that they can minimize potential confounding variables related to immune system function in limiting infection. For example, individual components integral to IE pathogenesis, such as platelets, organisms, or plasma, may be tested in such models for their relative influence on organism survival and proliferation. Given the above limitations, appropriate experimental design is essential to address a specific study hypothesis.

M.R. Yeaman, J. Lee and A. S. Bayer

718

Thus, studies involving untreated control groups, as well as animal groups treated with standard agents of known efficacy, are crucial for assessing the antifungal activities of novel agents. Antifungal regimens in animals should be designed to best approximate parameters of dosage, route and frequency of administration, and physiologically relevant and achievable serum or tissue concentrations in humans (if known) in the context of the in vitro antifungal susceptibility profiles of the infecting strain.

Contributions of the model to pathogenesis and therapy Pathogenesis of Candida IE Use of the animal model of experimental Candida IE has revealed remarkable insights into the pathogenesis of infection due to this organism, as well as related fungal pathogens. These observations have focused on the interrelationship between the organism, endothelium, neutrophils, and platelets. The fact that Candida must traverse the endothelial barrier to gain access to the deeper tissue parenchmya makes this organism an invaluable probe for determining microbial mechanisms of immunoavoidance, endothelial cell invasion and penetration, and the role of platelet and neutrophil interactions in antimicrobial host defense of the vascular endothelium. Likewise, immune responsiveness (e.g. cytokine expression, neutrophil chemotaxis, endogenous antimicrobial peptides) to Candida may provide increased awareness of surveillance mechanisms for detecting and responding to fungemia. Such information will be integral to the development of new approaches for prevention (e.g. vaccines, inhibitors of adhesion) and therapy of systemic fungal infections, including Candida IE, and perhaps infections caused by unrelated organisms.

Antifungal efficacy There is no certainty that antifungal agents will act in humans as they do in animal models. However, the overall outcome of antifungal therapy in humans appears to reflect that of the rabbit and rat models of Candida IE (Filler et al., 1991; Witt and Bayer, 1991; Witt et al., 1993). Thus, these animal models of experimental Candida IE have proven extremely useful in profiling the relative prophylactic and therapeutic effects of many novel antifungal agents, particularly in comparison to agents with known degrees of efficacy. Moreover, newer antifungal agents identified as being efficacious in these models (e.g. fluconazole) have proven themselves to be significantly less toxic than previously existing agents (e.g. amphotericin B). In this regard, use of animal models such as these has directly led to a significant improvement in the prevention and therapy of life-threatening disseminated Candida infections in humans.

References Andriole, V. T., Kravetz, H. M., Roberts, W. C., Utz, J. P. (1962). Candida endocarditis: clinical and pathologic studies. Am. J. Med., 23, 251-285. Archer, G., Fekety, F. R. (1972). Experimental cndocarditis due to Pseudomonas aeruginosa. I. Description of a model. J. Infect. Dis., 134, 1-7. Baddour, L. M., Christensen, G. D., Lowrance, L. H., Simpson, W. A. (1989). Pathogenesis of experimental endocarditis. Rev. Infect. Dis., 11,452-463. Bansci, M. F., Thompson, J., Bertina, R. M. (1994). Stimulation of monocyte tissue factor expression in an in vitro model of bacterial endocarditis. Infect. Immun., 62, 5669-5672. Bayer, A. S., Crowell, D. l., Yih, J., Bradley, D. W., Norman, D. C. (1988). Comparative pharmacokinetics and pharmacodynamics of amikacin and ceftazidime in tricuspid and aortic vegetations in experimental Pseudomonas endocarditis. J. Infect. Dis., 158, 355-359. Bayer, A. S., O'Brien, T., Norman, D. C., Nast, C. C. (1989). Oxygen-dependent differences in exopolysaccharide production and aminoglycoside-inhibitory or bactericidal interactions with Pseudomonas aeruginosa - implications for endocarditis. J. Antimicrob. Chemother., 23, 21-35. Bayliss, R., Clarke, C., Oakley, C. M., Somerville, W., Whitfield, A. G. W., Young, S. E. J. (1983). The microbiology and pathogenesis of infective endocarditis. Br. Heart J., 50, 513-519. Berney, P., Francioli, P. (1990). Successful prophylaxis of experimental streptococcal endocarditis with single-dose amoxicillin administered after bacterial challenge. J. Infect. Dis., 161, 281-285. Bertens, A. P. M. G., Booij, L. H. D. l-, Fleckness, P. A., Lagerweij, E. (1993). Anesthesia, analgesia, and euthanasia. In Principles of Laboratory Animal Science (eds van Zutphen, L. F. M., Baumans, V. et al.), pp. 267-298. Elsevier, New York, NY. Brown, M. l-, Pearson, P. T., Tomson, F. N. (1993). Guidelines for animal surgery in research and teaching. J. Am. Vet. Assn., 54, 1544-1559. Calderone, R. A., Rotondo, M. F., Sande, M. A. (1978). Candida albicans endocarditis- ultrastructural studies of vegetation formation. Infect. Immun., 20, 279-289. Calderone, R. A., Cihlar, R. L., Lee, D. D. S., Hoberg, K., Scheld, W. M. (1985). Yeast adhesion in the pathogenesis ofendocarditis due to Candida albicans: studies with adherence-negative mutants.J. Infect. Dis., 152, 710-715. Calderone, R. A., Scheld, W. M. (1987). Role of fibronectin in pathogenesis of candidal infections. Rev. Infect. Dis., 9, $400-$403. Calderone, R. A., Linehan, L., Wadsworth, E., Sandberg, A. L. (1988). Identification of C3d receptors on Candida albicans. Infect. Immun., 56, 252-258. Christin, L., Wysong, D. R., Meshulam, T., Hastey, R., Simons, E. R., Diamond, R. D. (1998). Human platelets damage AspergiUus fumigatus hyphae and may supplement killing by neutrophils. Infect. Immun., 66, 1181-1189. Cole, M. F., Bowen, W. H., Zhao, X. l-, Cihlar, R. L. (1995). Avirulence of Candida albicans auxotrophic mutants in a rat model of oropharyngeal candidiasis. FEMS MicrobioL Lett., 126, 177-180. Colman, R. W. (1991). Receptors that activate platelets. Proc. Soc. Exp. BioL Med., 197, 242-248. De Bernardis, F., Cassone, A., Sturtevant, J., Calderone, R. (1995).

EXPERIMENTAL CANDIDA ENDOCARDITIS

Expression of Candida albicans SAP-1 and SAP-2 in experimental vaginitis. Infect. Immun., 63, 1887-1892. Dhawan, V. K., Yeaman, M. R., Cheung, A. L., Kim, E., Sullam, P. M., Bayer, A. S. (1997). Phenotypic resistance to thrombininduced platelet microbicidal protein in vitro is correlated with enhanced virulence in experimental endocarditis due to Staphylococcus aureus. Infect. Immun., 65, 3293-3299. Drake, T. A., Pang, M. (1988). Staphylococcus aureus induces tissue factor expression in cultured human cardiac valve endothelium. ]. Infect. D#., 157, 749-756. Drake, T. A., Pang, M. (1989). Effects of interleukin-1, lipopolysaccharide, and streptococci on procoagulant activity of cultured human cardiac valve endothelial and stromal cells. Infect. Immun., 57, 507-512. Drake, T. A., Rodgers, G. M., Sande, M. A. (1984). Tissue factor is a major stimulus for vegetation formation in enterococcal endocarditis in rabbits.]. Clin. Invest., 73, 1750-1753. Durack, D. T., Beeson, P. B. (1972a). Experimental bacterial endocarditis. I. Colonization of a sterile vegetation. Br. J. Exp. Pathol., 53, 44-49. Durack, D. T., Beeson, P. B. (1972b). Experimental bacterial endocarditis. II. Survival of bacteria in endocardial vegetations. Br. J. Exp. Pathol., 53, 50-53. Durack, D. T., Beeson, P. B. (1973). Experimental bacterial endocarditis. III. Production and progress of the disease in rabbits. Br. J. Exp. Pathol., 54, 142-151. Edwards, J. E., Jr. (1991). Invasive Candida infections: evolution of a fungal pathogen. N. EngL ]. Med., 324, 1060-1062. Edwards, J. E., Jr., Mayer, C. L. (1990). Adherence of Candida albicans to mammalian cells. In Microbial Determinants of Virulence and Host Response (eds Ayoub, E. M., Cassel, G. H., Branche, W. C. Jr., Henry, T. J.), pp. 179-194. American Society for Microbiology, Washington, DC. Edwards, J. E., Jr., Montgomerie, J. Z., Foos, R. Y., Shaw, V. K., Guze, L. B. (1975). Experimental hematogenous endophthalmitis caused by Candida albicans. ]. Infect. Dis., 131, 649-657. Edwards, J. E., Jr., Gaither, T. A., O'Shea, J. J. et al. (1986). Expression of specific binding sites on Candida with functional and antigenic characteristics of human complement receptors. ]. Immunol., 137, 3577-3583. Edwards, J. E., Jr., Rotrosen, D., Fontaine, J. W., Haudenschild, C. C., Diamond, R. D. (1987). Neutrophil-mediated protection of cultured human vascular endothelial cells from damage by growing Candida albicans hyphae. Blood, 69, 1450-1457. Fallon, K., Bausch, K., Noonan, J., Huguenel, E., Tamburini, P. (1997). Role of aspartic proteases in disseminated Candida albicans infection in mice. Infect. Immun., 65, 551-556. Filler, S. G., Crislip, M. A., Mayer, C. L., Edwards, J. E. Jr. (1991). Comparison of fluconazole and amphotericin B for treatment of disseminated candidiasis and endophthalmitis in rabbits. Antimicrob. Agents Chemother., 35, 288-292. Filler, S. G., Ibe, B. O., Luckett, P. M., Usha Raj, J., Edwards, J. E. Jr. (1991). Candida albicans stimulates endothelial cell eicosanoid production. J. Infect. Dis., 164, 928-935. Filler, S. G., Swerdloff, J. N., Hobbs, C., Luckett, P. M. (1995). Penetration and damage of endothelial cells by Candida albicans. Infect. Immun., 63, 976-983. Filler, S. G., Pfunder, A. S., Spellberg, B. J., Spellberg, J. P., Edwards, J. E. Jr. (1996). Candida albicans stimulates cytokine production and leukocyte adhesion molecule expression by endothelial cells. Infect. Immun., 64, 2609-2617.

719

Flattery, A. M., Abruzzo, G. K., Gill, C. J., Smith, J. G., Bartizal, K. (1996). New model of oropharyngeal and gastrointestinal colonization by Candida albicans in CD4+ T-cell-deficient mice for evaluation of antifungal agents. Antimicrob. Agents Chemother., 40, 1604-1609. Fraser, C. M. (1991). Management, husbandry, and diseases of rabbits. In The Merc k Veterinary Manual: A handboo k of diagnosis, therapy, and disease prevention and control for the veterinarian (ed. Fraser, C. M.), pp. 1060-1061. Merck & Co., Rahway, NJ. Fu, Y., Filler, S. G., Spellberg, B. J. et al. (1998). Cloning and characterization of CAD1/AAF1, a gene from Candida albicans that induces adherence to endothelial cells after expression in Saccharomyces cerevisiae. Infect. Immun., 66, 2078-2084. Futenma, M., Kawakami, K., Saito, A. (1995). Production of tumor necrosis factor-alpha in granulocytopenic mice with pulmonary candidiasis and its modification with granulocyte colony-stimulating factor. MicrobioL Immunol., 39, 411-417. Garvey, G. J., Neu, H. C. (1978). Infective endocarditis- an evolving disease. Medicine, 57, 105-127. Griffin, M. R., Wilson, W. R., Edwards, W. D., O'Fallon, W. M ' Kurland, L. T. (1985). Infective endocarditis. Olmstead County, Minnesota, 1950-1981. JAMA, 254, 1199-1202. Han, Y., Cutler, J. E. (1997). Assessment of a mouse model ofneutropenia and the effect of an anti-candidiasis monoclonal antibody in these animals. J. Infect. Dis., 175, 1169-1175. Harkness, J. E., Wagner, J. E. (1995). Specific diseases and conditions: Pasteurella multocida infections in rabbits. In The Biology and Medicine of Rabbits and Rodents (eds Harkness, J. E., Wagner, J. E.), pp. 265-271. Williams & Wilkins, Baltimore, MD. Hata, K., Kimura, J., Miki, H., Toyosawa, T., Moriyama, M., Katsu, K. (1996). Efficacy of ER-30346, a novel oral triazole antifungal agent, in experimental models of aspergillosis, candidiasis, and cryptococcosis. Antimicrob. Agents Chemother., 40, 2243-2247. Herzyk, D. J., Ruggieri, E. V., Cunningham, L. et al. (1997). Single-organism model of host defense against infection: a novel immunotoxicologic approach to evalulate immunomodulatory drugs. ToxicoL Pathol., 25,351-362. Kammer, R. B., Utz, J. P. (1974). AspergiUus species endocarditis: the new face of a not so rare disease. Am. J. Med., 56, 506-521. Klotz, S. A. (1992). Fungal adherence to the vascular compartment: a critical step in the pathogenesis of disseminated candidiasis. Clin. Infect. Dis., 14, 340-347. Klotz, S. A., Drutz, D. J., Harrison, J. L., Huppert, M. (1983). Adherence and penetration of vascular endothelium by Candida yeasts. Infect. Immun. 42,374-384. Klotz, S. A., Drutz, D. J., Zajic, J. E. (1985) Factors governing adherence of Candida species to plastic surfaces. Infect. Immun., 50, 97-101. Klotz, S. A., Maca, R. D. (1988). Endothelial cell contraction causes Candida adherence to exposed extracellular matrix. Infect. Immun., 56, 2495-2498. Klotz, S. A., Harrison, J. L., Misra, R. P. (1989). Aggregated platelets enhance adherence of Candida yeasts to endothelium. J. Infect. Dis., 160, 669-677. Kretschmar, M., Nichterlein, T., Hannak, D., Hof, H. (1996). Effects of amphotericin B incorporated into liposomes and in lipid suspensions in the treatment of murine candidiasis. Arzneimittelforschung, 46, 711-715. Maisch, P. A., Calderone, R. A. (1980). Adherence of Candida albicans to a fibrin-platelet matrix formed in vitro. Infect. Immun., 27, 650-656.

720

Maisch, P. A., Calderone, R. A. (1981). Role of surface mannans in the adherence of Candida albicans to fibrin-platelet clots formed in vitro. Infect. Immun., 32, 92-97. Matuschak, G. M., Lechner, A. J. (1997). The yeast to hyphal transition following hematogenous candidiasis induces shock and organ injury independent of circulating tumor necrosis factoralpha. Crit. Care Med., 25, 111-120. McLeod, R., Remington, J. S. (1978). Fungal endocarditis. In Infective Endocarditis (ed. Rahimtoola, S. H.), pp. 211-290. Grune & Stratton, New York. Moyer, D. V., Edwards, J. E. Jr. (1992). Fungal endocarditis. In Infective Endocarditis (ed. Kaye, D.), Raven Press, New York. National Center for Research Resources (1996). National Institutes of Health (NIH; USA) Guidelinesfor the Care and Use of Laboratory Animals. National Academy Press, Washington, DC. Ohtsuka, K., Watanabe, M., Orikasa, Y. et al. (1997). The in vivo activity of an antifungal antibiotic, benanomicin A, in comparison with amphotericin B and fluconazole. ]. Antimicrob. Chemother., 39, 71-77. Pelletier, L. L., Petersdorf, R. G. (1977). Infective endocarditis: a review of 125 cases from the University of Washington Hospitals. Medicine, 56, 287-313. Plotkin, B. J., Paulson, D., Chelich, A. et al. (1996). Immune responsiveness in a rat model for type II diabetes (Zucker rat, fa/fa): susceptibility to Candida albicans infection and leucocyte function. ]. Med. Microbiol., 44, 277-283. Robboy, S. J., Kaiser, J. (1975). Pathogenesis of fungal infection on heart valve prostheses. Hum. Pathol., 6, 711-715. Robert, R., Senet, J. M., Mahaze, C. etal. (1992). Molecular basis of the interactions between Candida albicans, fibrinogen, and platelets. ]. Mycol. Med., 2, 19-25. Rotrosen, D., Edwards, J. E., Jr., Gibson, T. R., Moore, J. C., Cohen, A. H. (1985). Adherence of Candida to cultured vascular endothelial cells: mechanisms of attachment and endothelial cell penetration.]. Infect. Dis., 152, 1264-1274. Rotrosen, D., Calderone, R. A., Edwards, J. E. Jr. (1986). Adherence of Candida species to host tissues and plastic surfaces. Rev. Infect. Dis., 8, 73-85. Rozalska, B., Ljungh, A., Burow, A., Rudnicka, W. (1995). Biomaterial-associated infection with Candida albicans in mice. Microbiol. Immunol., 39, 443-450. Rubenstein, E., Noriega, E. R., Simberkoff, M. S., Holzman, R., Rahal, Jr. J. J. (1975). Fungal endocarditis: analysis of 24 cases and review of the literature. Medicine, 54, 331-344. Rybak, M. J., Houlihan, H. H., Mercier, R. C., Kaatz, G. W. (1997). Pharmacodynamics of RP 59500 (quinupristin-dalfopristin) administered by intermittent versus continuous infusion against Staphylococcus aureus-infected fibrin-platelet clots in an in vitro infection model. Antimicrob. Agents Chemother., 41, 1359-1363. Sawyer, R. G., Adams, R. B., Rosenlof, L. K., May, A. K., Pruett, T. L. (1995a). Effectiveness of fluconazole in murine Candida albicans and bacterial C. albicans peritonitis and abscess formation.J. Med. Vet. Mycol., 33, 131-136. Sawyer, R. G., Adams, R. B., May, A. K., Rosenlof, L. K., Pruett, T. L. (1995b). Development of Candida albicans and C. albicans/Escherichia coli/Bacteroides fragilis intraperitoneal abscess models with demonstration of fungus-induced bacterial translocation. J. Med. Vet. Mycol., 33, 49-52. Scheld, W. M., Valone, J. A., Sande, M. A. (1978). Bacterial adherence in the pathogenesis of endocarditis. Interaction of bacter-

M.R. Yeaman, J. Lee and A. S. Bayer

ial dextran, platelets, and fibrin.J. Clin. Invest., 61, 1394-1404. Scheld, W. M., Strunk, R. W., Balian, G., Calderone, R. A. (1985). Microbial adhesion to fibronectin in vitro correlates with production of endocarditis in rabbits. Proc. Soc. Exp. Biol. Med., 180, 474-482. Schmidt, A. (1996). Systemic candidiasis in Sprague-Dawley rats. J. Med. Vet. Mycol., 34, 99-104. Seelig, M. S., Speth, C. P., Kozinn, P. J., Taschdjian, C. L., Toni, E. F., Goldberg, P. (1974). Patterns of Candida endocarditis following cardiac surgery: importance of early diagnosis and therapy (an analysis of 91 cases). Prog. Cardiovasc. Dis., XVII, 125-160. Seelig, M. S., Kozinn, P. J., Goldberg, P., Berger, A. R. (1979). Fungal endocarditis: patients at risk and their treatment. Postgrad. Med. J., 55, 632-641. Torack, R. M. (1957). Fungus infections associated with antibiotic and steroid therapy. Am. J. Med., 22, 872-882. Tunkel, A. R., Scheld, W. M. (1992). Experimental models of endocarditis. In Infective Endocarditis (ed. Kaye, D.), pp. 37-56. Raven Press, New York. Vo, N. M., Russell, J. C., Becker, D. R. (1981). Mycotic emboli of the peripheral vessels: analysis of 44 cases. Surgery, 90, 541-545. Walsh, T. J., Pizzo, A. (1988). Nosocomial fungal infections: a classification for hospital-acquired infections and mycoses arising from endogenous flora or reactivation. Annu. Rev. Microbiol., 42, 517-545. Walsh, T. J., Pizzo, A. (1988). Treatment of systemic fungal infections: recent progress and current problems. Eur. J. Clin. Microbiol. Infect. Dis., 7, 460-475. Waynforth, H. B., Flecknell, P. A. (1992). Specific surgical operations. In Experimental and Surgical Technique in the Rat, pp. 203-312. Academic Press, New York, NY. Weksler, B. B. (1992). Platelets. In Inflammation: Basic Principles and Clinical Correlates (eds Gallin, J. I., Goldstein, I. M., Snyderman, R.). Raven Press, New York. Witt, M. D., Bayer, A. S. (1991). Comparison of fluconazole and amphotericin B for prevention and treatment of experimental Candida endocarditis. Antimicrob. Agents Chemother., 35, 2481-2485. Witt, M. D., Imhoff, T., Li, C., Bayer, A. S. (1993). Comparison of fluconazole and amphotericin B for treatment of experimental Candida endocarditis caused by non-C, albicans strains. Antimicrob. Agents Chemother., 37, 2030-2032. Woods, G. L., Wood, R. P., Shaw, B. W. Jr. (1989). Aspergillus endocarditis in patients without prior cardiovascular surgery: report of a case in a liver transplant recipient and review. Rev. Infect. Dis., 11,263-272. Yeaman, M. R. (1997). The role of platelets in antimicrobial host defense. Clin. Infect. Dis., 25, 951-970. Yeaman, M. R., Puentes, S. M., Norman, D. C., Bayer, A. S. (1992). Partial characterization and staphylocidal activity of thrombin-induced platelet microbicidal protein. Infect. I mmun., 60, 1202-1209. Yeaman, M. R., Soldan, S. S., Ghannoum, M. A., Edwards, J. E., Jr., Filler, S. G., Bayer, A. S. (1996). Resistance to platelet microbicidal protein results in increased severity of experimental Candida albicans endocarditis. Infect. Immun., 64, 1379-1384. Yeaman, M. R., Tang, Y. Q., Shen, A. J., Bayer, A. S., Selsted, M. E. (1997). Purification and in vitro activities of rabbit platelet microbicidal proteins. Infect. Immun., 65, 1023-1031.

Chapter 87

Rabbit Model of Cryptococcal Meningitis J. R. Perfect

Background of model Cryptococcal meningitis has become the most common cause of fungal meningitis worldwide. This clinical infection has become more frequent because of several factors. First, the yeast has been found in a variety of environments and therefore exposure to the infectious propagule is common. Second, there is an enlarging worldwide immunocompromised population with the pandemic of human immunodeficiency virus infections. Third, treatment of some modern maladies has frequently included immunosuppressive drugs such as corticosteroids and the immunophilins cyclosporine and tacrolimus. These agents can make the host particularly susceptible to infection with Cryptococcus neoformans. It was also this clinical insight which helped develop the rabbit model of cryptococcal meningitis. Rabbits are considered a corticosteroid-sensitive species similar to humans. Large doses of exogenous corticosteroids rapidly cause lymphopenia in rabbits by lyses of lymphocyte populations in blood and tissue. Reduction in cell populations can be rapid and can occur within 5-8 hours of a corticosteroid dose. This ability to immunosuppress rabbits is crucial to the establishment of a prolonged and fatal infection in this species with C. neoformans. However, normal rabbits and those in which corticosteroids are discontinued can generally recover from a high inoculum-induced infection. The rabbit model focuses on the active proliferation stage of cryptococcal infection as the yeast primarily produces infection within the central nervous system (CNS) in this model (Perfect et al., 1980). Similar to the standard rabbit model of bacterial meningitis, this model also introduces yeasts directly into the subarachnoid space of anesthetized rabbits through a cisternal inoculation. Although infection is primarily expressed in the subarachnoid space and adjacent brain parenchyma, yeast can disseminate from CNS and grow in other organs such as liver, lung, spleen, and kidney. Although the CNS is the focus of this particular model, the rabbit has been used for other cryptococcosis models, including endophthalmitis (Weiss et al., 1948; Kligman and Weidman, 1949; Fujita, 1983), lung infection (Fehon et al., 1966), and intratesticular infection (Bergman, 1996). Corneal and intraocular infections can be easily produced but the lung is difficult to cause infection without immunoHandbook of Animal Modelsof Infection ISBN 0-12-775390-7

suppression. Direct inoculation into the lung can result in short-term pneumonia, fungemia and evidence of meningitis but the CNS features are not prominent (Fehon et al., 1966). However, more frequent involvement of the CNS can probably be improved with severe immunosuppression treatment regimens. The use of testicular tissue reflects the general observation that C. neoformans strains generally do not tolerate high environmental temperatures (i.e. greater than 39°C). The rabbit has an average body temperature of 39.3-39.5°C. However, despite the high body temperature in rabbits, C. neoformans strains can grow in this host under corticosteroid immunosuppression.

Animal species Pathogen-flee 2-3 kg male New Zealand White rabbits are used and fed standard diets of Purina rabbit chow and water ad lib. Male rabbits have been used since it has been known that male species tend to be more susceptible to cryptococcosis. However, it is likely that under corticosteroid immune suppression female animals will also be susceptible to infection.

Preparation of animals There is no specialized housing of animals. Although yeasts will disseminate to multiple body tissue sites in this model, except for cerebrospinal fluid (CSF), C. neoforrnans has not been routinely recovered from other body fluids. Also, when bedding and fecal pellets from rabbits were examined, C. neoformans could not be recovered. However, rabbit cages catch waste in removable paper pads which are sprayed with 10% Clorox before discarding. When handling infected rabbits, disposable latex gloves and surgical facial masks are worn. Rabbits are treated with cortisone acetate 1 day prior to inoculation of C. neoformans. The corticosteroid is given intramuscularly in the hind quarters and injections are repeated daily throughout the infection. Cortisone doses can significantly affect the progression of infection and are Copyright © 1999Academic Press All rights of reproduction in any form reserved

722

the major factor in the temporal control of CSF yeast counts within a single strain. Doses ranging from 0.25 to 25 mg/kg per day of cortisone acetate have been used. A standard dose of 2.5 mg/kg per day has been most frequently administered to produce a consistent infection with persistence of high concentrations of yeasts in CSF over a 2-week observation period and without animals experiencing neurological deficits or death. Alternatives for cortisone acetate have not been commonly used but would include triamcinolone at 4 mg/kg per day or a hydrocortisone suspension. All corticosteroid preparations except cortisone acetate will likely need to be adjusted in dose and duration to allow for consistency of infection. It should be noted that, because of corticosteroid administration, rabbits will lose 10-20% of their initial body mass despite excellent oral intake. Despite this weight loss from the steroids, daily corticosteroid dosing is based on initial weight at the beginning of the experiment.

Details of inoculation Overview Inocula are injected percutaneously into the cisternal magna of anesthetized rabbits and CSF is withdrawn through a similar percutaneous needle-stick. Inoculation is performed with rabbits in a prone position and with flexion of the head. The needle is inserted behind the occipital notch in the midline. The syringe is aspirated until CSF flows into the barrel and inocula of 0.3 ml are injected. CSF can be used for quantitating yeasts present in subarachnoid space and isolating RNA from these cells; CSF host cells and contents of CSF can also be studied. CSF can be withdrawn daily from the same animals during infection. Some animals (_104 cfu/g in more than 90% of the infected kidney, with all of the kidneys with grade 2 and 3 pyelonephritis showing >_10~cfu/g. There was a significant relationship between renal and urinary Candida populations (P:;

• ~~::~

..............

Figure 88.6

Candida bezoars (arrows) filled the renal pelvis distended by incomplete ureteral obstruction (periodic acid-Schiff, x400).

Candida cells increased significantly depending on the his-

tological grade in the infected kidneys (P

100

% X

80

"5 ~

ao

~

~o

o 20

o

[

,

!

JL,

DAYS

Figure 89.2 Experimentally induced rat vaginitis with clinical vaginal isolates of Candida albicans (squares), Candida parapsilosis (circles) and Saccharomyces cerevisiae (triangles). Kinetics of vaginal infections are expressed as mean colony-forming units (cfu) +_ SE (bar)/ml vaginal fluid of infected (> 103 cfu/ml) rats.

Some of its disadvantages include size, cost and maintenance of the animal and more difficult handling compared to the mouse. Moreover, the mouse is, at present, more useful for immunological studies because of the better basic knowledge of mouse immunology and availability of immunological tools together with genetically modified strains. However, in our hands, mouse infection is more severely dependent on continued estrogen treatment and Candida counts are more variable if the loop-sampling method is used. In fact, several authors prefer to use the whole vagina Candida counting, which necessitates animal sacrifice. The rat model avoids this substantial inconvenience and is more suitable for monitoring infection and reinfection. Another great advantage of the rat model is the possibility of obtaining a relatively large amount of vaginal fluid and other materials (blood, for instance) for the studies of pathogenesis and immunity in candidiasis. It is expected that current research will soon cover the gap between the rat and mouse in the availability of gene knockout animals and immunological tools.

Contributions of the model to evaluate the efficacy of antifungal therapy The studies of the efficacy of antifungal drugs in rat vaginitis offer more accurate data of the in vivo outcome than tests in vitro or in other models involving mice or other animals. Thus, the model has been largely used to study the

738

therapeutic effect of antifungal agents in eradicating or controlling acute vaginitis (Mc Ripley et aL, 1979; Thienpont et aL, 1980; Ryley et aL, 1981; Sobel et aL, 1981; Sobel and Muller, 1983, 1984; Kinsman et aL, 1986; Van Cutsen et aL, 1987; Jansen et aL, 1991). In particular, several problems can be encountered in determining the sensitivity of C. albicans isolates to imidazole and triazole antifungals in vitro, as no standard methods exist. Moreover, the rat model uses animals without inducing systemic morbidity and lethality, so that the animals can be reused for other in vivo experiments. Sometimes C. albicans isolates, which cause relapse, are no less sensitive to antimycotics than any other isolate in vitro. The sensitivity depends upon the method employed. The evaluation of drug sensitivity in the animal model of vaginitis gave additional confirmation and a more accurate correlation with the clinical observation. In fact, studies with animals offer one solution to the problem of in vitro compensation for the effect of host factors. As described above, experimental Candida vaginitis in rats is a relatively short-lived (1-2 months), self-limiting and spontaneously healing infection, nonetheless, the model is reasonably good for the assessment of antifungal activity in vivo and has become a model correlate of human therapy of vaginal candidiasis. Most studies involve prophylactic treatment with an antifungal given before or at the same time as the Candida inoculum. In therapeutic models it is rare for treatment to be delayed much beyond 24 hours after infection--quite the opposite of the usual situation in humans. The route of administration of antifungal in animal tests is not always the same as that intended for humans: nontraumatic oral administration of drugs is a frequent problem with laboratory animals. The data from animals may not be readily extrapolated to humans, for the pharmacokinetics of these antifungal agents in animals are usually different from those in humans. Despite the limitations in the use of this and other animal models, they offer the most reliable information in the preclinical evaluation of antifungal drugs.

Contributions of the model to studying aspects of the pathogenesis and immunity in Candida vaginitis The rat vaginitis model has been particularly useful for studying fungal virulence factors. For C. albicans (the most virulent and most frequently isolated species of Candida) the putative virulence attributes are dimorphism, adherence, enzyme secretion, phenotypic switching, antigen variation and possession of complement-binding receptors (Sobel, 1989; Cutler, 1991). However, the actual contribution of each of these factors to the pathogenesis and severity of the disease awaits elucidation. Recently, the use of

F. De Bernardis, R. Lorenzini and A. Cassone

mutant strains and their parental counterparts has been important to investigate the role of virulence factors of Candida in the pathogenesis of candidal vaginitis. We studied the vaginopathic potential and the intravaginal morphology of a non-germinative variant of C. albicans, strain CA-2. This mutant expressed low virulence in systemic infections while, in contrast, being capable of causing a vaginal infection of the same duration and extent as that obtained in rats challenged with the parental germ-tubeforming strain C. albicans, 3153. During the experimental infection, the CA-2 cells did not maintain their yeast morphology but developed hyphal filaments (De Bernardis et al. 1993). The elevated vaginopathic potential of strain CA-2, in contrast to its low virulence in systemic infection, suggested that different Candida virulence factors come into play in local and disseminated candidal infections (De Bernardis et al., 1993). Secreted aspartyl proteinases (Sap) appear to be another virulence-associated attribute of Candida species (Cutler, 1991). Most members of this family of isoenzymes are expressed at acidic vaginal pH and can cleave several proteins which are important in host defense, such as antibodies of both immunoglobulin G (IgG) and IgA isotype. They may also promote the colonization, penetration and invasion by C. albicans (Hube, 1996). Since, because of the pH constraint, the expression of these enzymes in mucosal surface may be more important than in systemic candidiasis, we have been studying Sap secretion and activity in experimental vaginitis. In the rat model, a clear correlation between the ability of strains to secrete aspartyl proteinase in vivo and to cause disease has been observed. In fact we found that a stable non-proteolytic mutant of C. albicans was less vaginopathic than the proteolytic parent strain (Ross et al., 1990). Experimental vaginitis with associated Sap secretion in vaginal fluids was produced in rats challenged with proteolytic species (C. albicans and C. parapsilosis) but not on challenge by non-proteolytic species (C. glabrata, C. krusei, S. cerevisiae; Agatensi et al., 1991). In this model we also studied the expression of two major Sap genes (SAP1 and SAP2). Northern blot analysis with RNA extracted from the vaginal fluid of rats infected with highly vaginopathic strains demonstrated the expression of both SAP1 and SAP2 during the first week of infection. In contrast, neither gene was expressed during infection by a non-vaginopathic strain (which did not adhere to and infect vaginal cells to the same extent as other strains tested). The results demonstrated that both SAP1 and SAP2 were expressed in vivo during vaginal infections. It is important that these genes are expressed in vivo only by strains which are more virulent in this animal model (De Bernardis et al., 1995). The in vivo expression of SAP genes was also monitored by a polymerase chain reaction (PCR) detection with primers selected for each of the SAP genes. RNA extracted from vaginal fluids taken from rats at different days postinfection with C. albicans was converted in complementary

RAT MODEL OF CANDIDA VAGINAL INFECTION

DNA and amplified by PCR. The identity of PCR products generated by amplification was confirmed by hybridization with the corresponding probes. Thus, SAP1, SAP2 and SAP3 were expressed by C. albicans during vaginal infection while no SAP4, SAP5 and SAP6 vaginal transcripts were found. Thus, the rat vaginitis model proved to be the first animal model of candidiasis where the expression of virulence genes could be rapidly and conveniently monitored during infection (De Bernardis et aL, 1997; Figure 89.3). More refined and definitive evidence of the role of the virulence factors of Candida in the pathogenesis of infection may be obtained using this animal model to evaluate the virulence of gene knockout mutants and revertant fungal strains. Animal models of C. albicans vaginitis have also been adopted to study host defense mechanisms associated with vaginal infections. In fact, some authors have suggested that women with recurrent vulvovaginal candidiasis have local--rather than systemicmspecific immune deficiency leading to a high susceptibility to the disease (Sobel, 1989; Fidel and Sobel, 1996). In particular, using the mouse model, Fidel and colleagues (1994, 1995a,b) showed that systemic cell-mediated immunity (CMI) was not protective against vaginitis, and suggested that local host defense mechanisms could be operative at the vaginal mucosa, as distinct from more general anti-Candida mechanisms. However, the nature of the immunoprotective factors remains undefined (Steele et al., 1997).

1

2

3

4 MW

kb

MW 5

6....

739

In the rat model of vaginitis we showed that, after clearing the primary C. albicans infection, the animals were highly resistant to a second vaginal challenge with the fungus. The vaginal fluid of Candida-resistant rats contained antibodies directed against mannan constituents and Sap enzymes of C. albicans and was capable of transferring a degree of anti-Candida protection to naive, non-immunized rats (Cassone et aL, 1995). Pre-absorption of the antibody-containing fluids with e i t h e r - - o r b o t h m m a n n a n and proteinase sequentially reduced or abolished the level of protection. A degree of protection against vaginitis was also conferred by postinfection intravaginal administration of anti-proteinase and anti-mannan monoclonal antibodies and by intravaginal immunization with a mannan extract or with a highly purified SAP2 preparation. No anti-Candida antibodies were elicited during C. albicans vaginal infection of congenitally athymic nude rats and these animals did not show increased resistance to a rechallenge, demonstrating that induction of anticandidal protection in normal rats was a thymusdependent antibody response. Overall, the results obtained using the rat vaginitis model demonstrated that antibodies against some defined Candida antigens are relevant in the mechanism of acquired anti-candidal protection in vaginitis (De Bernardis et aL, 1997). In conclusion, our data show that the rat vaginitis model is perfectly suitable to study the vaginal immunity to Candida. It is hoped that genetic manipulation in the rat to a level similar to the one currently achievable with the mouse will soon bring about the discovery of mechanisms of immune response to Candida in the vagina, in order to facilitate evidence-based and rational approach to immunotherapy or immunoprophylaxis of Candida vaginitis in humans.

2.1

1.,7 1.2,.. a

1.2

1.0 O.6

Acknowledgments The authors wish to thank Drs M. Boccanera, L. Morelli and D. Adriani for their excellent technical support and participation in the referenced work. Special thanks are due to Mrs G. Mandarino, for help in the preparation of the manuscript. The authors' work quoted in this paper has been supported by a grant from the National AIDS Project, contract no. 10/A/U.

Figure 89.3 (A) RNA extracted from Candida albicans grown in vitro (lanes 1,3 and 5) and from rat vaginal fluids 2 days post-infection with C. albicans (lanes 2, 4 and 6) was converted into DNA and amplified by polymerase chain reaction (PCR) with specific primers for SAP1 (lanes 1 and 2), SAP2 (lanes 3 and 4) and SAP3 (lanes 5 and 6) genes. (B) The identity of PCR products generated by amplification was confirmed by hybridization with the corresponding probes.

References Agatensi, L., Franchi, F., Mondello, F. et al. (1991). Vaginopathic and proteolytic Candida species in outpatients attending a gynaecology clinic. J. Clin. Pathol., 44, 826-830. Cassone, A., Boccanera, M., Adriani, D., Santoni, G., De Bernardis, F. (1995). Rats clearing a vaginal infection by Candida albicans acquire specific antibody-mediated resistance to vaginal reinfection. Infect. Immun., 63, 2619-2624.

740

Cutler, J. E. (1991). Putative virulence factors of Candida albicans. Annu. Rev. Microbiol., 45, 187-218. De Bernardis, F., Lorenzini, R., Morelli, L., Cassone, A. (1989). Experimental rat vaginal infection with Candida parapsilosis from outpatients with vaginitis. ]. Clin. Microbiol., 27, 2598-2603. De Bernardis, F., Adriani, D., Lorenzini, R., Pontieri, E., Carruba, G., Cassone A. (1993). Filamentous growth and elevated vaginopathic potential of a non-germinative variant of Candida albicans expressing low virulence in systemic infection. Infect. Immun., 61, 1500-1508. De Bernardis, F., Cassone, A., Startevant, J., Calderone, R., (1995). Expression of Candida albicans SAP1 and SAP2 in experimental vaginitis. Infect. Immun., 63, 1887-1892. De Bernardis, F., Boccanera, M., Adriani, D., Spreghini, E., Santoni, G., Cassone, A. (1997). Protective role of antimannan and anti-asparyl proteinase antibodies in an experimental model of Candida albicans vaginitis in rats. Infect. Immun., 65, 3399-3405. Fidel, P. L., Sobel, J. D. (1996). Immunopathogenesis of recurrent vulvovaginal candidiasis. Clin. Microbiol. Rev., 9, 335-348. Fidel, P. L., Lynch, M. E., Sobel, J. D. (1993). Candida-specific cell-mediated immunity is demonstrable in mice with experimental vaginal candidiasis. Infect. Immun., 61, 1032-1038. Fidel, P. L., Lynch, M. E., Sobel, J. D. (1994). Effect ofpreinduced Candida-specific systemic cell-mediated immunity on experimental vaginal candidiasis. Infect. Immun., 62, 1032-1038. Fidel, P. L., Cutright, J. L., Sobel, J. D. (1995a). Effects of systemic cell-mediated immunity on vaginal candidiasis in mice resistant and susceptible to Candida albicans infections. Infect. Immun., 63, 4191-4194. Fidel, P. L., Lynch, M. E., Sobel, J. D. (1995b). Circulating CD4 and CD8 T-cells have little impact on host defence against experimental vaginal candidiasis. Infect. Immun., 63, 2403-2408. Hube, B. (1996). Candida albicans secreted aspartyl proteinases. Curr. Top. Med. Mycol., 7, 55-69. Ichise, K., Tanio, T., Saji, I., Okuda, T. (1986). Activity of SM4470, a new imidazole derivative, against experimental fungal infections. Antimicrob. Agents Ckemotker., 30, 366-369. Jansen, T. M., Van De Ven, M. A., Borgers, M. J., Odds, F. C., Van Cutsen, J. M. P. (1991). Fungal morphology after treatment with itraconazole as a single oral dose in experimental vaginal candidosis in rats. Am. ]. Obstet. Gynecol., 165, 1552-1557. Kinsman, O. S., Collard, A. E. (1986). Hormonal factors in vaginal candidiasis in rats. Infect. Immun., 53, 498-504. Kinsman, O. S., Collard A. E., Savage, T. J. (1986). Ketoconazole in experimental vaginal candidosis in rats. Antimicrob. Agents Ckemotker., 30, 771-773. McRipley, R. J., Schwind, R. A., Erhard, P. J., Whitney, R. R.

F. De Bernardis, R. Lorenzini and A. Cassone

(1979). Evaluation of vaginal antifungus formulations in vivo. Postgrad. Med. ]., 55,648-652. Ross, J. K., De Bernardis, F, Emerson, G. W., Cassone, A., Sullivan, P. A. (1990) The secreted aspartate proteinase of Candida albicans: physiology of secretion and virulence of a proteinasedeficient mutant. ]. Gentile. Microbiol., 136, 687-694. Ryley, J. F., McGregor, S. (1986). Quantification of vaginal Candida albicans infections in rodents. ]. Med. Vet. Mycol., 24, 455-460. Ryley, J. F., Ryley, N. G. (1990). Candida albicans- do mycelia matter? ]. Med. Vet. Mycol., 28, 225-239. Ryley, J. F., Wilson, R. G., Gravestock, M. B., Poyser, J. P. (1981). Experimental approaches to antifungal chemotherapy. Adv. Pkarm. Ckemotker., 18, 49-176. Ryley, J. F., Wilson, R. G., Barrett-Bee, K. S. (1984). Azole resistance in Candida albicans. Sabouraudia, 22, 53-63. Scholer, H. J. (1960). Experimentalle vaginal candidiasis der ratte. Patkol. Microbiol., 23, 62-68. Sobel, J. D., (1985). Epidemiology and pathogenesis of recurrent vulvovaginal candidiasis. Am. ]. Obstet. Gynecol., 152,924-935. Sobel, J. D., (1989). Pathogenesis of Candida vulvovaginitis. In Current Topics in Medical Mycology (eds McGinnis, M. R., Borges, M.), pp. 86-108. Springer-Verlag, Stuttgart, Germany. Sobel, J. D., Muller, G. (1983). Comparison of ketoconazole, BAY N7133 and BAY L9139 in the treatment of experimental vaginal candidiasis. Antimicrob. Agents Ckemotker., 24, 434-436. Sobel, J. D., Muller, G. (1984). Comparison of itraconazole and ketoconazole in the treatment of experimental candidal vaginitis. Antimicrob. Agents Ckemotker., 26, 266-267. Sobel, J. D., Meyers, P. G., Kaye, D., Levison, M. E. (1981). Adherence of Candida albicans to human vaginal and buccal epithelial cells. ]. Infect. Dis., 143, 76-83. Sobel, J. D., Muller, G., Buckley, H. R. (1984). Critical role of germ tube formation in the pathogenesis of candidal vaginitis. Infect. Immun., 44, 576-580. Sobel, J. D., Muller, G., McCormick, J. F. (1985). Experimental chronic vaginal candidosis in rats. Sabouraudia, ]. Med. Vet. Mycol., 23, 199-206. Steele, C., Ozenci, H., Luo, W., Scott, M., Fidell, P. L. (1997). Anti-Candida host resistance by vaginal epithelial cells. Abstract P 15. Fourth NIAID Workshop in Medical Mycology, Lake Tahoe, CA, August, 1997. Taschdjian, C. L., Reiss, F., Kozinn, P. J. (1960). Experimental vaginal candidiasis in mice; its implications for superficial candidiasis in humans. J. Invest. Dermatol., 34, 89-94. Thienpont, D., Van Cutsen J., Borger, S. M. (1980). Ketoconazole in experimental candidosis. Rev. Infect. Dis., 2, 570-577. Van Cutsen, J., Van Gerven, F., Janssen, A. J. (1987) Activity of orally, topically and parenterally administered itraconazole in the treatment of superficial and deep mycoses animal models. Rev. Infect. Dis., 9 (Suppl. 1), S 15-$32.

Chapter 90

Murine Models of Candida Vaginal Infections P. L. Fide/Jr. and J. D. Sobel

Background on the human infection Vulvovaginitis (VVC) is a significant problem in women of child-bearing age. It can be expected that 75% of all women will experience at least one episode of VVC during their lifetime, with between 5 and 10% of women experiencing recurrent vulvovaginal candidiasis (RVVC; Sobel, 1988). Greater than 85% of vaginal fungal infections are caused by the dimorphic fungal organism, Candida albicans, with C. glabrata, C. tropicalis, C. parapsilosis, and C. krusei identified in the remaining diagnosed symptomatic infections (Sobel, 1988). C. glabrata, the lone non-dimorphic Candida species (formerly known as Torulopsis glabrata), is the most common non-albicans Candida species identified and often occurs under conditions of diabetes mellitus (Sobel, 1988; Redondo-Lopez et al., 1990). Signs and symptoms ofvaginitis include vaginal and vulvar erythema and/or edema, vaginal itching, burning, soreness, an abnormal cottagecheese-like discharge, and dyspareunia (Sobel, 1988). C. albicans is considered a vaginal commensal organism with detectable asymptomatic colonization rates in approximately 15-25% of normal healthy women (Sobel, 1988). Although there are several predisposing factors for acute episodes of VVC (i.e., antibiotic usage, oral contraceptives, pregnancy, uncontrolled diabetes mellitus, and tight underclothing), chronic or recurrent VVC is often unexplained or idiopathic (Sobel, 1988). It is proposed that women with idiopathic RVVC share some immunological deficiency or dysfunction that enhances susceptibility to the local infection (Fidel and Sobel, 1996), but no specific systemic or local deficiency has been identified to date. Nevertheless, most cases of symptomatic acute or chronic vaginitis require antimycotic drug intervention. There is no evidence, though, that antifungal drug resistance contributes to the susceptibility to repeated episodes of RVVC caused by C. albicans (Lynch et al., 1996).

Background of the model Animal models have been widely used to test experimental topical or systemic antifungal therapies for a variety of Handbook of Animal Models of Infection

ISBN 0-12-775390-7

fungal infections, both systemic and mucosal. Included are the rodent models of experimental C. albicans and C. glabrata vaginitis (Sobel et al., 1985; Ryley and McGregor, 1986; Fidel et al., 1996a). In fact, the original rodent vaginitis models were developed for the sole purpose of testing therapeutic agents (McRipley et al., 1979; Sobel et al., 1985; Ryley and McGregor, 1986). A critical property of the model is the dependence upon estrogen (pseudoestrus) for the infection to be acquired and persist long enough to evaluate therapeutic regimens (Taschdjian et al., 1960; Sobel et al., 1985; Ryley and McGregor, 1986). Despite this somewhat artificial requirement, the experimental animal models have been extremely useful and predictive of clinical efficacy. Recently, experimental vaginitis models have been expanded to examine immunological issues in the pathogenesis of Candida vaginitis (Fidel et al., 1993a,b, 1994, 1995b; Cassone et al., 1995; De Bernardis et al., 1997). Specifically, the models have been employed to study systemic- and mucosal-associated innate and acquired host defense mechanisms, including effector function by phagocytes, antibodies, and T cells. This chapter will review the technical aspects of the experimental models of C. albicans and C. glabrata vaginal infections in mice.

Animal species Female mice have been employed in the experimental model of C. albicans vaginal infection. The age of the animals can vary, but should be > 6 weeks of age. In general, most mice used for vaginitis are >20g. The infection in mice is relatively easy to induce and numerous strains (CBA/J, DBA/2, C57BL/6, C3H/HEN, BALB/c) covering several haplotypes (H-2 k'b'd) can be employed (Fidel et al., 1993a, 1995a). In contrast to experimental models ofC. albicans systemic infection (Hector et al., 1982), there does not appear to be any difference in susceptibility of various strains of mice to experimental C. albicans vaginitis (Fidel et al., 1995b). In contrast to the relative ease of inducing experimental C. albicans vaginal infections, it is extremely difficult to induce experimental C. glabrata infections. To date, the C. glabrata vaginal infections have only been Copyright © 1999 AcademicPress All rights of reproduction in any form reserved

742

P.L. Fidel Jr. and J. D. Sobel

induced in mice genetically susceptible to a hyperglycemic condition (non-obese diabetic mice, NOD/Lt; Fidel et al., 1996a), or CBA/J mice given streptozocin to generate an artificial state of hyperglycemia (Fidel, unpublished observations).

Preparation of the animals An important prerequisite for a C. albicans or C. glabrata vaginal infection is a persistent hormonal state of estrus. Since rodents have a short 4-day estrus cycle with a state of estrus lasting for not more than 2 days at a time, the mice must be placed in a state of constant estrus (pseudoestrus) with or without ovariectomy. The estrogen converts the columnar epithelium to thick stratified squamous epithelium (Figure 90.1), and increases the glycogen content, pH, and growth substrates (CHO, N2), all of which increases the avidity of the yeast for the tissue and enhances its growth

A

(Powell and Drutz, 1983; Kinsman and Collard, 1986). Additionally, estrogen is known to inhibit innate and/or acquired host defenses (Carlsten et al., 1991; Styrt and Sugarman, 1991). Together, the organism grows in population numbers under the pseudoestrus condition, overwhelms any remaining host defense mechanisms, and causes a superficial infection of the vaginal squamous epithelium. This critical role of estrogen in the animals is analogous to its role in humans. VVC is rare in premenarchal females and occurs considerably less frequently in postmenopausal women unless they are receiving estrogen hormone replacement therapy (Sobel, 1988). To induce the pseudoestrus condition, estradiol valerate (Sigma) is dissolved in sesame oil (this requires heating at 37°C with intermittent vortexing) and injected subcutaneously into the abdomen of each mouse in a volume of 0.1ml (Ryley and McGregor, 1986; Fidel et al., 1993a; Valentin et al., 1993). The first injection is usually given 48-72 hours prior to organism inoculation and should continue weekly for the duration of the experiment. In addition to the pseudoestrus-mediated histological changes within the tissue (Figure 90.1), one can usually visualize the pseudoestrus condition as the anterior vaginal tissue shows visual signs of swelling and redness. A wide range of estrogen concentrations (0.01-0.5 mg/ms) can be used depending upon the condition desired. For C. albicans infections, 0.2-0.5mg/ms should be used if a long-lived persistent infection is desired (i.e., efficacy of therapeutic agents). On the other hand, 0.01-0.02 mg/ms should be employed if a less persistent infection is warranted (3-4 weeks; i.e., immunological analyses). Figure 90.2 illustrates the relative

--~o.2. ~ . ~ •-'6--0.05

\

/

mg/wk

-

i

--e-ore .Wwk i

- - - - -

•

'~ i//

~EIl~~~:!d

0 i!::!

~-.--..~..---.---.-.~~~~~~ ......'-~"~~~" ~ ~ - , . - . - , ~ ~ - ~ ~,~ ~ ii.~.,~!': i'~, ,~~ ;~ i : " ; ! ~ i ~ a ' : ~ i i ~ ~ ~ ~: 600 540 3.6 74.0 > 100 3.4 196 3700

1.0 75 135 19.3 > 5.0 117 3.3 15.4 > 30 28.3 70 2643

P. y. yoelii

17X

Chloroquine

16

A

P. y. nigeriensis

N67

Chloroquine

6.7

A

P. yoellii ssp.

NS SAM MEF SH SPN ART SAT

Chloroquine Amodiaquine Mefloquine Halofantrine Pyronaridine Artem isinin Atovaquone

56 112 1000 375 33.5 165 5.6

P. c. chabaudi

AS ASCQ

Sensitive Chloroquine

Asynchronous/ synchronous A A A A A A A A A A A A

1.0 6.2 139 375 27.9 16.5 112

A A A A A A A

1.0 > 1.0

S S

ED90Resistant line * Index of cross-resistance (190)= ED90Parent strain For the purposes of determining 190values, lines are compared with the parent strain from which they are derived, e.g. lines derived from chloroquine-resistant P. yoelii ssp. NS are compared with this and not with chloroquine-sensitive P. berghei. When P. yoelii ssp. NS is compared directly with P. berghei K173 it has an 190of 18. If 190values for NS-derived strains were also calculated in this way, the degree of crossresistance would be grossly distorted.

762

is protected with a suitable cryopreservant. Blood is collected from donor animals as described below in a heparinized syringe. It is diluted with Alsever-glycerol solution that is prepared as follows. Alsever solution contains 4.66 g glucose, 1.05 g NaC1 and 2.0 g Na citrate in 200 ml distilled water. To this is added glycerol to 10% final concentration. One part of blood is gently mixed with three parts of the Alsever-glycerol, then inserted into 1 ml plastic cryotubes or capillary tubes which are then sealed. These are appropriately labelled, then snap-frozen in liquid nitrogen. After freezing they are stored immersed in the liquid phase of a liquid nitrogen container. For use the containers are removed, rapidly thawed in warm water, then injected undiluted into mice by the intraperitoneal (i.p.) route. When parasitaemia reaches an appropriate level in the first recipients, their blood can be used, after appropriate dilution, to infect further animals. It is likely that only the young ring stages survive cryopreservation. In principle, malaria blood-stage parasites can be cryopreserved indefinitely. In our hands strains have been recovered from liquid nitrogen after more than 20 years. However, there is some evidence that cryopreservation may select for certain characteristics, e.g. chloroquine resistance, presumably because these clones within an uncloned, preserved parasite population are more durable than the others. As a precaution it is advisable, every year or so, to unfreeze a sample of such material, passage it through clean mice, then refreeze. Rodent parasites can also be maintained in vivo, either by simple passage of blood containing asexual, intraerythrocytic stages (for the technique, see below) or, for gametocyte-producing strains, by intermittent cyclical passage through A. stephensi (see following sections). Although isolates of P. falciparum are routinely maintained in vitro in continuous passage, it has proved very difficult to conserve any rodent species in this way. As the procedure described by Janse et al. (1984) is labour-intensive and gives inconsistent results, it is better to employ either cryopreservation or in vivo blood passage for routine maintenance of murine malaria.

Infection techniques Blood stages

The two routes for infecting mice with donor blood are i.p. and intravenous (i.v.). The latter is preferable since the resulting infection in any group of recipient animals shows little variation whereas, on the contrary, a wide spread of parasitaemia levels may be found in animals inoculated i.p. With practice the i.v. route is as simple and as rapid to use as the i.p. route, especially if the mice are gently warmed with a heat source such as an infrared lamp and they are immobilized with a simple device such as that shown in Figure 92.2.

W. Peters and B. L. Robinson

Figure 92.2 A simple device made of Perspex to immobilize mice while performing an intravenous inoculation via the dorsal tail vein. From Peters (1987), with permission.

Blood is collected from a donor animal that has a parasitaemia of approximately 20% in a 10 ml heparinized syringe. The donor is first anaesthetized with intravenous pentobarbitone sodium (60 mg/kg) after which the axilla is opened in a sterile manner, the subclavian artery severed, and the emerging blood drawn up into the syringe. Alternatively, blood may be obtained from the anaesthetized animal by cardiac puncture. The blood is gently mixed, then diluted with the appropriate volume of sterile physiological saline such that each 0.2 ml contains approximately 2 × 106 parasitized erythrocytes. The recipient mice are held in a large holding cage and infected in random order, care being taken gently to mix the contents of the syringe at frequent intervals to avoid the red cells depositing. After infection the animals are caged in groups of five in the test cages.

Sporozoite infections

The adult Anopheles stepkensi stock colony is maintained at 24.0+1.0°C and 70.0%+5.0% relative humidity in autoclavable, wire-framed cages 60× 60× 60 cm in size, covered with black mosquito netting. The females are offered a blood feed from anaesthetized, uninfected T F W mice each day and sugar solution is provided at all times. Water bowls are provided for egg-laying and eggs are collected each day and set up in polypropylene water trays. The larvae are fed Biodin PL, which is a proprietary brand of fish food made from freeze-dried plankton. Pupae are harvested each day and transferred in netting-covered bowls, either to the stock cages or into experimental cages. These are similar in construction to the stock cages but are only 30 cm 3. The netting covering is used to deny access to gravid females seeking to lay eggs and the newly emerged mosquitoes trapped with the bowls are released each morning and afternoon. When sporozoites are required, the female mosquitoes are allowed to feed on mice that have been infected with the required parasite species, at a time when gametocytes are just becoming visible in thin blood films. This is usually

MALARIA

about 3 days after the mice are infected from donors. The mosquitoes are then held in plastic cups, about 20 per cup. The cups are closed with mosquito netting on top of which is placed a wad of cotton wool soaked in 5% glucose. The cups are held in the insectary at an environmental temperature of 19-20°C for P. bergkei strains and 24°C for P. yoelii or P. ckabaudi subspecies or strains for a minimum of 11 days. One or two insects are removed from the 1 l th day onwards and dissected to confirm the presence of sporozoites in the salivary glands. The sporozoite inoculum is prepared from A. stepkensi fed 12-14 days earlier on infected mice. The mosquitoes are stunned by concussion and homogenized by hand in a Teflon grinder with Locke's solution with added 3% w/v bovine serum albumin (fraction V). The suspension is lightly centrifuged, decanted and 0.2 ml inocula are given intravenously to mice. Approximately 500 mosquitoes are used to infect 50 mice.

M a i n t e n a n c e and t r e a t m e n t of animals Animal accommodation and diet Malaria infection in mice rapidly results in a fall in their body temperature which must be countered by maintaining them at a sufficiently high environmental temperature and humidity. Animals are normally caged in groups of five per cage which should be held in a dedicated unit. In our institute the unit is held at a temperature of 20_+2°C and 55% relative humidity (_+10%) with a dedicated airconditioning system monitored by a computerized control system. The rooms are kept under positive pressure with an exchange flow of 320 cubic feet/minute, providing 20 air changes each hour. The animals are housed in North Kent Plastic RM2 cages (32 × 20 x 20 cm) and are maintained on a diet of SDS RM3 expanded diet and water ad libitum. The nature of the diet is very important since it must contain adequate p-aminobenzoic acid to permit the parasites to develop, but not enough to antagonize the action of such compounds as sulphonamides and sulphones.

Contaminating mouse pathogens Although it is not necessary to use specific pathogen-flee (SPF) animals, it is essential that the mice should come from well-controlled breeding colonies that are uncontaminated by such organisms as Eperytkroaoon coccoides, Haemobartonella muris or the commoner pathogenic murine viral and bacterial infections. E. coccoides, which is transmitted by mouse ectoparasites, is a particularly insidious pathogen since it may be present undetected in a mouse colony and only come to light when animals are infected with malaria. The organisms are frequently mistaken by the microscopist for granules of Romanowsky stain (Figure 92.3).

763

Figure 92.3 Eperythrozoon coccoides lining the surface of a mouse erythrocyte. Other isolated organisms appear to be free in the plasma or attached to other red cells. From Peters (1987), with permission.

If malaria-infected blood from a mouse contaminated with E. coccoides is used to infect new animals or is cryopreserved, the contaminants are carried with the plasmodia and thus perpetuated in new hosts or in the cryobank. The most obvious effect they exert on the host is to haemolyse erythrocytes to which they are attached. They also serve as stimulants of the immune system. Since the course of the intraerythrocytic malaria infection is influenced by the proportions of normocytes and reticulocytes in the circulation, animals contaminated with E. coccoides and H. muris show great diversity in the levels of parasitaemia from mouse to mouse. Critical review of many early publications on chemotherapy and immunity in rodent malaria suggests that many bizarre results were probably attributable to the authors' unawareness of the presence and/or significance of such contaminants. Unfortunately, only two types of compound have been identified that will clear these pathogens, namely organic arsenicals such as neoarsphenamine and the tetracyclines. The latter have the disadvantage that they will also remove the malaria parasites, whereas compounds such as neoarsphenamine and oxophenarsine are no longer available. If these contaminating pathogens are detected, therefore, it is best to discard both parasites and hosts and start from clean material. If the status of the mice is not known, e.g. when a new supplier is used, Eperytkrozoon infection may be readily revealed by splenectomizing a few animals and preparing Giemsa-stained blood films daily. If present, substantial numbers of Eperytkrozoon will be apparent in the blood within 2-4 days.

Specific techniques for compounds acting on different stages of the life cycle Causal prophylactics General. For the routine examination of compounds for causal prophylactic activity we use the modified form of the

W. Peters and B. L. Robinson

764

technique described by Gregory and Peters (1970) and later elaborated by Peters et aL (1975a). This has an inherent drawback in its inability to differentiate between direct action on the hepatic schizont and an effect on the emerging blood in the presence of both causal prophylactic and marked residual activity. Nevertheless we feel that, for the majority of compounds, this has proved to be the most satisfactory of the tests available other than the use of P. cynomolgi in the rhesus monkey with all its intrinsic problems. In this context it should also be stressed that, unlike the rhesus monkey/P, cynomolgi system, the rodent model is designed to demonstrate causal prophylactic action and not antirelapse activity.

Host and parasite species. The most commonly used vector for rodent malaria is A. stephensi. The methods used for producing and harvesting the infective sporozoites are described above. The most suitable parasites for studies on causal prophylaxis are:

1. P. yoelii nigeriensb (N67): transmissible, slightly chloroquine-resistant strain

2. P. yoelii yoelii (17X): transmissible, slightly chloroquineresistant strain

3. P. berghei (ANKA): transmissible, chloroquine-sensitive strain of P. berghei. All three are maintained by cyclical transmission through A. stephensi without drug pressure.

Preliminary screening test. This test is designed to indicate the presence of any form of prophylactic activity in mice infected with P. y. nigeriensis. Three groups of T F W mice (3 mice/group) are used in this test for each compound: 1. Group 1: sporozoite inoculum at D + 0 2. Group 2: sporozoite inoculum at D + 0; 30 mg/kg test s.c. compound 2 hours post-infection 3. Group 3: sporozoite inoculum at D + 0; 100mg/kg test s.c. compound 2 hours post-infection. Mice are infected with sporozoites as described above. Test compounds are prepared for use as described below for the "4-day test". Unless an alternative route is indicated, the compounds routinely are administered subcutaneously. The dose levels used have been arbitrarily selected to give an indication of the doses to be used in the full causal prophylactic test, and may be varied when necessary, e.g. where the test compound is toxic at the proposed dose. Stained blood films from each animal are examined at D + 7 and D + 14. The results are expressed only as positive or negative and four categories of activity are recognized: 1. 2. 3. 4.

Grade Grade Grade Grade

1: ? fully active--0/3 positive 2: ? activem 1/3 positive 3: ? slightly active---2/3 positive 4:inactivem3/3 positive.

This preliminary screen affords a simple method of determining the presence or absence of activity and also, by extension of the dose range, it enables a large number of compounds to be screened rapidly to determine the probable effective dose prior to examination in the more time-consuming, full causal prophylactic test.

Definitive test protocol. This test is designed to differentiate between prophylactic activity and residual suppressive effect of test compounds in rodent malaria infections. It does not indicate the presence of antirelapse activity since there is no comparable stage in this infection to the hypnozoite of P. cynomolgi or P. vivax. The test is based on the inverse linear relationships between the logarithm of the sporozoite inoculum and the mean time taken for the resulting erythrocytic infection rate in groups of mice to reach 2%. This relationship is valid only in an established range and breaks down if the sporozoite inoculum is insufficient to give 100% patency, or if the sporozoite inoculum is extremely large. Furthermore, the test depends on the finding that the minimum prepatent period is between 47 and 50 hours (48 hours has been assigned for purposes of calculation) and the growth rate and drug sensitivity of the erythrocytic stage of the parasite are independent of the source, i.e., whether derived from injected sporozoites or parasitized red blood cells (RBC). The original test contained a control group which received infected RBC only, as well as the control which was infected with both sporozoites and RBC, but a statistical analysis of several hundred control animals has shown that there is no significant difference in the mean prepatent period between these groups. Therefore the control receiving only RBC has been dropped from the test and, as a result, the calculation of residual and prophylactic activity has become much simpler. Four groups of mice are used in the test: 1. Group l: sporozoite inoculum on DO; saline at DO + 2 hours 2. Group 2: sporozoite inoculum on DO; test compound at DO + 2 hours 3. Group 3: as Group 1 + RBC at DO + 48 hours 4. Group 4: as Group 2 + RBC at DO + 48 hours. The sporozoite inoculum is prepared and administered as described for the preliminary screening technique. The blood inoculum, from infected T F W strain mice, is given intravenously in a volume of 0.2ml and contains 2x 106 infected RBC in isotonic saline. The parasite we normally use is P. y. nigeriensis N67. Test compounds are prepared and administered as previously described for the blood schizontocidal test. Primaquine phosphate is included in all tests as a positive control. Daily blood films are made and examined from D + 3 until the parasitaemia reaches 2%. Any animals which do not show patent infection by D + 14 are considered to be negative. Differences in the pre-2% patency period (P2PP) between control and treated, sporozoite-inoculated animals

MALARIA

765

can reflect a drug action on exoerythrocytic stages, erythrocytic forms or both. Cross-inoculation in parallel series of groups with infected RBC allows the residual drug action on erythrocytic forms to be assessed, leaving a value proportional to the effect on the EE stages only. Hence if P2PP Group 1 = a, P2PP Group 2 = b, P2PP Group .3 =c, P2PP Group 4 = d, then:

( b - a ) = Total activity ( d - c ) = Residual activity ( b - a ) - ( d - c) = Causal prophylactic activity. Where negative values or positive values less than 0.5 are obtained from these calculations they should be regarded as 0 (zero). Table 92..3 summarizes data on causal prophylaxis

Table 92.3 The activity of primaquine and a primaquine analogue (tafenoquine) in the definitive test for causal prophylaxis. Parasite P. yoelii nigeriensis N67 Compound name: Primaguine diphosphate Route: s.c.

Dose

Formulation: Distilled water Maximum tolerated dose: > 100 mg/kg x 1

Control

30.0

60.0

100.0

Sporozoites Blood stages

5/5 5/5

5/5 5/5

2/5 5/5

0/5 5/5

Mean 2% time Sporozoite-infected

(a) 4.03

(b) 4.86

(b) > 11.49

(b) > 14.00

(c)

(d)

(d)

(d)

Blood-stage infected

3.59

3.28

3.32

3.29

0.83

>7.46

>9.97

0

0

0

0.83

> 7.46

> 9.97

Slightly active

Active

Fully active

Patency- infected with:

Total activity (b-a)

Residual activity (d-c)

Prophylactic activity (b - a) - (d - c)

Comment Minimum fully active dose: 60-100 mg/kg x 1 Residual activity: Nil at 100 mg/kg x 1 Compound name: Tafenoquine Route: s.c.

Dose

Formulation: Distilled water Maximum tolerated dose: > 100 mg/kg x 1

Control

10.0

30.0

100.0

Sporozoites Blood stages

5/5 5/5

4/5 5/5

1/5 5/5

0/5 5/5

Mean 2% time Sporozoite-infected

(a) 5.55

(b) > 7.43

(b) > 12.58

(b) > 14.00

(c)

(d)

(d)

(d)

Blood-stage infected

3.30

2.96

5.71

9.84

> 1.88

> 7.03

> 8.45

0

2.41

6.54

(b - a) - (d - c)

>3.60

>4.62

>1.91

Comment

Active

Active. Some residual activity

Fully active. Much residual activity

Patency- infected with:

Total activity (b-a)

Residual activity

(d-c) Prophylactic activity

Minimum fully active dose: 30-100 mg/kg x 1 Residual activity present at: 30 mg/kg x 1 Marked at: 100 mg/kg x 1

W. Peters and B. L. Robinson

766

obtained in the definitive test with two active 8-aminoquinolines. The amount of compound normally required is 500 mg for preliminary and full test.

Blood schizontocides The "4-day test". Of all the variations of the test that have been published since the early 1950s, that described here (Peters et al., 1975b) has been the most widely used. Reference to similar procedures will be found in Thompson and Werbel (1972) and Peters (1987). Preliminary "4-day test" for detection of suppressive activity. For each compound under test, two batches of five male, random-bred Swiss albino mice weighing 18-22g are inoculated intravenously with 2 x 106 RBC parasitized with P. bergkei N and a further two groups with P ckabaudi AS strain. Animals are then given a fixed dose of 30 mg/kg once daily for 4 consecutive days beginning on the day of infection (DO). Compounds are dissolved or suspended, using ultrasonication to achieve an even suspension, in sterile distilled water with Tween 80 and administered subcutaneously to one group of each infection and orally to a second group. Where exceptional difficulty is encountered in preparing an aqueous preparation, the test compound is first dissolved in dimethyl sulphoxide and subsequently an aqueous dilution is prepared for use. Some highly lipophilic compounds may be dissolved in sesame oil and dilutions made from this for s.c. or oral administration. In this case sesame oil must also be used as a control. The parasitaemia is determined on the day following the last treatment (D + 4) to determine qualitatively the presence and degree of activity at the screening dose. The amount of compound required is 100 mg.

"4-day test'for quantitative assessment of blood schizontocidal activity. Male, random-bred Swiss albino mice weighing 18-22g are inoculated intravenously with 2×106 RBC parasitized with one of the above strains. Animals are then dosed once daily for 4 consecutive days beginning on the day of infection (i.e. DO to D + 3), using a dose range determined by the results obtained in the preliminary test. Compounds dissolved or suspended as described above are administered s.c., i.p., p.o. or by such other route as may be required. The parasitaemia is determined on the day following the last treatment (D + 4) and the EDs0 and ED90 values, i.e. 50% and 90% suppression of parasitaemia when compared with untreated controls, are estimated from a plot of log-dose against probit-activity. Standard deviations are determined using Microsoft Excel. The degree of crossresistance (I50or 190) is determined by comparing activity in the sensitive and resistant strains using the following formula: Index of cross-resistance -

EDs0/ED90 Resistant line EDs0/ED90 Sensitive parent strain

The amount of compound required is 250-1500mg depending on active dose level found in the preliminary screen.

"Extended test" for blood sckizontocidal activity. Male, random-bred, Swiss albino mice weighing 18-22g are inoculated intravenously with 2x 106 P. ckabaudi-infected RBC. Animals are then dosed daily for 14 consecutive days beginning on the day of infection. Compounds prepared as above are administered s.c., i.p., p.o. or by such other route as may be required. The parasitaemia is monitored daily from D+ 1 to D+35 using Giemsa-stained blood films and a graph illustrating the course of infection is plotted. P. ckabaudi AS strain infections can be expected to prove lethal by D+ 7 to D+8 in untreated controls and activity can be demonstrated by an extension of life. Radical cure can be proved by subinoculation of blood from animals which are aparasitaemic at D+35 into clean mice. In addition, the parasitaemias on D+4 may be used to determine the EDs0 and ED90 of active compounds as described above. A further application of extended observation using this parasite or P. bergkei N is to observe the effect of administering a single large drug dose on the level of parasitaemia, rate of recrudescence and morphology of the treated parasites. In this case the drug is given at a time when the parasitaemia has reached between 10 and 20% and daily parasite counts are made in thin blood films. This is similar to the initial stage of the "2% relapse technique" described below. The amount of compound required is 1500 mg. Suppressive curative activity. Compounds shown to possess suppressive activity can be further tested at a dose range determined from the "4-day test" results and including one dose step beyond the minimum fully suppressive dose, for suppressive curative activity and influence on survival times. T F W mice are infected with P. berghei (N strain) and treated in the same manner as described above for the "4-day test". The parasitaemia is monitored on D + 4 and D + 7 and a record of survival times is kept. Any mice surviving beyond D + 7 have their parasitaemia monitored by examination of blood films every 7 days until D + 35. On D + 35, pooled blood from each blood film-negative group is subinoculated into clean mice and the absence of patent infection in these mice within 21 days is regarded as evidence of curative activity. This technique is very similar to the so-called "Thompson test" (Thompson and Werbel, 1972). The advantage of infecting mice i.v. can be seen from Figure 92.4 which is made from part of the data obtained in a test of the suppressive curative activity of chloroquine phosphate. The figure shows individual parasitaemias in mice infected with P. berghei N strain on DO treated with the subcurative dose of 3 mg/kg per day x 4 s.c. of chloroquine, compared with those in untreated control animals. The points to be noted are the relative closeness of the counts in individual control mice; the marked action of chloroquine which, at this dose, represents approximately

MALARIA

100

% -

80

-

60

-

40

-

767

Parasitaemia

I

0 0

1

T

T

T

I

I

I

I

i

-I

2

3

4

5

6

7

8

9

10

Days -e- CO 3.0 mg/kg x 4 sc

after infection

m- Control mice

Figure 92.4 The action of 3mg/kg per day x4 s.c. of chloroquine phosphate in the suppressive curative test, on the parasitaemia and survival of mice infected with Plasmodium berghei N strain (see text for comments).

the ED95 as it would be assessed if this were a "4-day test", and the rapid rise of parasitaemia of this virulent parasite after D + 4. All control animals died from days + 4 to + 7 and treated animals died between days + 6 and + 8.

"Rane test". This is a simple test that was used to screen the bulk of the 300000 compounds that entered the WRAIR antimalarial programme. It had the advantage of requiring minimal labour since it was based essentially on the observation of the levels of mortality of P berghei-infected mice and did not, in its early form at least, require the preparation and microscopic examination of blood films. Although it could be criticized as being a crude procedure, the Rane test did, in fact, yield an unprecedented volume of data from which promising new lead compounds were identified for more detailed evaluation in other test systems (Peters, 1987). Basically the test was conducted as follows. Mice are inoculated i.p. with 106 infected donor RBC on DO. Test drugs prepared as solutions or ultrasonicated in arachis oil are administered on a single occasion at an initial dose range of 80, 160, 320 and 640 mg/kg s.c. on D + 3. The animals are observed daily for survival or death. Survival time to more than twice that of the controls is taken as evidence of activity and survival beyond 60 days is considered as a cure. The minimum effective dose (MED) is compared with the maximum tolerated dose, i.e. the dose that produces no more than 1 in 5 toxic deaths. Dose levels are titrated downwards to find the MED and to give an indication of the therapeutic index. Promising compounds revealed by the Rane test can then be submitted to the "4day test" or similar procedure to obtain more accurate information on their activity. Test for repository action. The duration of action of a compound depends, firstly, on its rate of absorption from the site of administration (i.e. bioavailability) and then on other factors such as tissue binding, rate of metabolism and rate of excretion. Poorly soluble compounds, those that are highly bound to body tissues and others that are only slowly

metabolized may have a long duration of action. The rodent model can be adapted to give an indication of this "repository" effect as follows. Seven groups of 5 T F W mice are treated with the maximum tolerated dose of the compound under test. An untreated control group is set up in parallel with each treated group. Pairs of groups are challenged with infective inocula of 2 × 106 parasitized RBC from P. berghei N straininfected donor mice at intervals of 1, 2, 4, 7, 14, 21 and 28 days after treatment. The development of infection after challenge is monitored to the 2% level by examination of Giemsa-stained, thin blood films and the results compared with that of the control group to determine the days' delay to 2% parasitaemia produced by the compound. In the event of a compound still showing a repository effect at the 28-day challenge, a further test is performed using an extended dosing regime, i.e. 35, 42, 49, 56, 63, etc. days. Any compound possessing a significant repository effect at the dosage employed in this test is re-examined through a range of doses using the same technique. The amount of compound required is 500-1500mg, depending on the maximum tolerated dose.

Induction of drug resistance--the "2% relapse technique" (Peters et al., 1970). The rapid spread of resistance to antimalarials over the past few years has made it imperative to have means of protecting not only the present generation of drugs, but also those new compounds that are currently being developed. One of the important features of a novel antimalarial, therefore, is the rate at which resistance to it can be selected. We employ the following procedure. This may be used not only on single compounds (e.g. Ridley et al., 1996) but also on effective combinations, identified in drug interaction tests. It is our experience that this technique is a far more realistic model for resistance acquisition than that employing steadily increasing drug doses. The latter can produce artificially high levels of resistance that have no counterpart in the resistant strains of human malaria. The best example of this is our P berghei RC strain (Peters, 1965) which has a very high level of resistance to chloroquine but many abnormal morphological and physiological characteristics. Studies of the influence of drug mixtures on the rate of development of resistance to mefloquine using the "2% relapse" technique have been reported by Peters et al. (1977) and more recently the combination of mefloquine and a mixture of pyrimethamine and sulfadoxine were investigated by the same means (Peters and Robinson, 1984). It is essential that further studies should be performed to investigate this important means of prolonging the useful life of those drugs presently in use, as well as those which are due to be introduced and which appear already to be vulnerable to the development of resistance. As a prelude to the "2% technique", a range of single doses of the test drug is given an hour following the infection of groups of mice and the development of parasitaemia is followed in daily blood films. That dose that prolongs the attainment of 2% for a period of 7-10 days is

768

W. Peters and B. L. Robinson

then selected for administration at the time of each passage. Daily blood films are made and the development of the parasitaemia is monitored. Comparison of the time taken to reach a 2% parasitaemia in this treated group with that in an untreated control group reveals the "2% delay time". This value is expressed as a percentage of the delay time of the parent strain as found at passage 1 of the series and may be plotted against time in a graph which shows the course of development of resistance. The strain is passaged from the treated group as soon as possible after 2% patency is reached and each successive passage is treated with the same, single, fixed dose as was used in the first passage of the series. Resistant lines are developed in this technique from both drug-sensitive P bergkei N strain and chloroquine-resistant P. yoelii ssp. NS strain. It has been our experience that, generally, resistance is far more readily acquired by the NS strain than by a drug-sensitive line (Peters and Robinson, 1992). This reflects the picture seen in the development and spread of multidrug-resistant P.falciparum and, indeed, this technique has a proven record of predicting the ease with which resistance to new antimalarials will develop. Figure 92.5 illustrates the rapid development of resistance to atovaquone using this technique and the stability of resistance when the drug selection pressure is withdrawn. Once maximum resistance has been acquired using the relapse technique, the strain is passaged under drug pressure until stability of the resistance is apparent from consistent 2% delay times. At this point, the process is reversed and a subline is started in which the infection is serially passaged using the untreated control mice as donors. This subline reveals whether the resistant parasite is capable of maintaining resistance in the absence of drug selection pressure. The line is cryopreserved at the first passage and at intervals during its development to allow a comparison of actual levels of resistance in the developing strain to be made with the parent strain by the use of the "4-day test". The maximally resistant strain is added to the reference cryobank for possible future use in drug testing.

100

% Passage 1 Delay

_~ 0

10

20

30

40

o ~ ~ _ 50

60

70

Days 1.0 mg/kglsc Drug pressurewithdrawn

Figure 92.5 Resistance developing in a single passage to atovaquone in a line of Plasmodium yoelii ssp. NS in the "2% relapse technique". The acquisition of resistance is indicated by a decrease in the "% Passage 1 delay time". In this example the level of resistance remained constant even after the release of drug selection pressure.

The amount of compound required depends on initial doses and outcome.

Combination studies. There are a number of reasons for deploying drug combinations. These include the exploitation of combinations that display synergism, thus enabling lower doses of the individual compounds to be administered and of drug pairs that are able to reverse drug resistance (e.g. verapamil with chloroquine)mso-called resistance modulators, some of which may possess no inherent antimalarial activity. Since some drug combinations, however, may also prove to be antagonistic, it is essential to be able to detect these at an early stage. The procedures we follow are as follows. The "4-day test" technique has proved itself to be a sensitive system for detecting interactions between drugs. When two compounds are simultaneously administered in an appropriate series of dilutions, it is possible to determine the influence of one compound upon the ED90 of the other in a series of combination ratios. The ED90 values obtained with combinations in a test of this type may be compared with those of the individual compounds to obtain an isobolar equivalent. These are plotted for each compound in an isobologram in order to demonstrate the presence of synergism, antagonism or a simple additive action. It is, however, frequently the case that compounds which themselves have little or no inherent antimalarial activity may influence the action of, for example, chloroquine on chloroquine-resistant parasites (e.g. verapamil), providing combinations where only one compound has a direct action on the parasite. This precludes the use of the conventional isobologram for the analysis of the interaction between the two compounds, since it is necessary to know the ED90 of both compounds for this technique. To overcome this difficulty we have devised a method to illustrate graphically and to quantify the influence of an antimalarially inactive compound on the activity of a known antimalarial in the rodent model (Peters and Robinson, 1991). Graphically, this is done by plotting the EDg0 of the active partner against varying dosage of the antimalarially inert drug on a simple graph which has a line indicating the ED90 of the active drug drawn on it. Figure 92.6 illustrates this principle and shows how the different types of interaction present themselves by this technique. The single compound ED90 line is bounded by the extreme limits of confidence and points falling within this zone indicate a failure to influence the activity of the antimalarial partner compound. Synergism is shown by a graph which drops away from the ED90 line toward the bottom axis whilst, if antagonism is present between the two compounds, the curve will rise progressively as the dose increases. A quantitative assessment of the degree of influence of the inactive compound on its antimalarial partner is made by calculating the activity enhancement index (AEI). This involves a simple calculation in which the ED90 of the active compound alone is divided by the EDg0 of the paired drugs at each dose of the "inert" compound. For example, in order to quantify the influence of a

MALARIA

769

100

V

ANTAGONISM

80

E

"O ¢-.

Extreme limits of confidence

2~ O Q.

60

E

=============================================================================================== ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: :::::: ..............

~

....

..'''.........•....'......''.•'.........'•..............''.'''''.'"'...''''..'...•.'......'........•......'•...'.•...'.'..•...'''..'..'.•.'...•....'.........-'''.'..'....'."'.•...•'.•'.'....''.'.'.'....'•..''.''....•...

....

0

0

40 Extreme limits of confidence


4-++

a} o" o 3 3 Q.

0 0 m l

), z m

), r-

Table 99.3

Dropping and lesion scores

Eimeria acervulina

Eimeria maxima

Eimeria tenella

Score 1

Score 2

Score 3

Score 4

Score 5

Score 6

Localization

Upper duodenum

Upper duodenum

Upper duodenum

Up to yolk sac

Up to yolk sac

Aspect

Small white patches

Long white patches ladder-like, traversing

Long white patches ladder-like, traversing

Coated aspect

Greyish to bright red

Frequency Intestinal wall Intestinal content Faeces

Singular to very few Normal Normal A little soft

Few Normal Normal 25% soft

Numerous Normal Normal 50% soft

Beyond pancreas slope Long white patches ladder-like, traversing, but partly coalescent Very numerous Thickened Normal All soft

Localization

Central small intestine

Central small intestine

Central small intestine

Central small intestine

Aspect

Small petechiae on serosal side

Frequency Intestinal wall

A few small, pink spots Small, pink spots Bleeding bleeding on serosal side Scattered Normal Normal

Red petechiae on both serosal and mucosa side Numerous Thickened

Intestinal content

Normal

Sometimes orange mucus

Sometimes orange slime

Orange slime

Coalescent Coalescent Thickened and swollen, Greatly thickened and rough mucosa swollen, mucosa rough Slime, pinpoint clots Many blood clots

Localization Aspect Frequency

One caecum Petechiae A few, only one caecum affected Normal

Caeca Petechiae Few, scattered: both caeca affected Normal

Caeca Petechiae Numerous

Caeca Petechiae More numerous

Caeca Bloody Coalescent

A little thickened

Somewhat thickened

Greatly thickened

Normal

Normal (a few caseous granules)

A little blood in caeca (caseous granules)

Blood in the caeca (caseous)

Mostly soft

Soft

Soft

6-10 tips or drops

>10 tips or drops

> 50% with blood

Intestinal wall Intestinal content (day 7 post-infection)

Day 5 post-infection Partly soft consistency of faeces Blood in faeces 1 to 5 small tips

Rather numerous Slightly thickened

O O I11 r-

O

"11

0 0 0 0 m

Coalescent Thickened Watery, slimy Soft, greyish, partly fluid

Completely coalescent Greatly thickened Creamy exudate A lot of fluid

Central to lower small intestine Mucosa side rough and bloody red

Central to lower small intestine Mucosa side rough and bloody red

m

m

z

"11

m

0 -I 0 z m

Caeca Bloody Coalescent

Greatly swollen and thickened mucosa, rough and hard Much blood and many Blood No faecal remains fibrin clots, few or no remains of faeces (caseous, hard) (caseous) Fluid still a little soft; Fluid intestinal content Granular, bloody and All bloody pure blood

CO PO ",4

(30 PO O0

Table 99.3 --

(Continued)

Eimeria brunetti

Eimeria mitis

Eimeria necatrix

Score 1

Score 2

Score 3

Score 4

Score 5

Score 6

Localization

Lower small intestine

Lower small intestine

Lower small intestine

Lower small intestine

Aspect

Normal

Bloody, transverse red streaks in rectum

Bloody and necrotic lesions

Small intestine, caeca, rectum Bloody and necrotic lesions

Frequency

Scattered

Scattered

Coalescent

Coalescent

Intestinal wall

A few salmoncoloured spots Normal

Bloody, transverse red streaks in lower intestine Some salmoncoloured spots Normal

Lower small intestine, caeca, rectum Bloody transverse red streaks in rectum

Nearly normal

Intestina! content

Normal

Normal

Normal

Thickened up to lower Thickened and swollen part A little watery Blood',, and watery, sometimes soft slime balls

Thickened, caseous cores may plug the caeca Sometimes caseous clots obstruct caeca

Localization

Duodenum

Duodenum

Duodenum

Round white patches; red-coloured

Round white patches; red-coloured

Round white patches; red-coloured

Frequency Intestinal wall Intestinal content

Singular Normal Normal

A few Normal Normal

Numerous Normal Normal

Up to lower small intestine Round white patches; red-coloured but more coalescent No coalescence Thickened Watery, slimy

Entire small intestine

Aspect

Upper half of small intestine Round white patches; red-coloured but more coalescent Many A little thickened Normal

Localization Aspect

Small intestine A few scattered petechiae

Small intestine Petechiae; white patches on serosa

Small intestine Petechiae on serosa; violent red

Small intestine Red petechiae and white plaques on serosa

Whole intestine Dark colour, extensive haemorrhages

Frequency Intestinal wall

A few Normal

Small intestine Petechiae; white patches seen from serosal side; no damage on mucosal surface Scattered Normal

Scattered Central small intestine slightly swollen

Numerous Central small intestine ballooned

Very numerous Rough, thickened and swollen up to lower small intestine Extensive haemorrhages

Coalescent Massively swollen

Intestinal content

Normal

Normal

Normal

Based on Janssen Pharmaceutica (1990), Johnson and Reid (1970), Shirley (1995a) and own data. Score 2 identical with 1 after Johnson and Reid (1970); score 4,5,6 identical with 2,3,4 respectively after Johnson and Reid (1970).

Normal

Round white patches; red-coloured but more coalescent No coalescence Greatly thickened Creamy exudate

z

Red or brown mucus

o" o 3 n_ O

m |

A N I M A L M O D E L S OF C O C C I D I A I N F E C T I O N

829

system given in Table 99.3. Other authors (Johnson and Reid, 1970; Shirley, 1995a) use a point-scale with scores of 0-4.

Excretion of oocysts Before the excretion of oocysts begins, the excrement in the faeces collection dishes is removed and the dishes are lined with plastic-coated absorbent paper. To determine the oocyst excretion, the pooled faeces for the day to be investigated are weighed and thoroughly mixed and a sample of about 10g generally worked up directly for counting. We prefer to get a rough idea of the excreted oocysts' sporulation capacity as well (see below). For initial routine testing of substances for efficacy we have restricted ourselves to examining faeces from day 7 after infection. If the substance is found to be effective the pooled faeces for days 4-6 and 7-8 after infection are examined for oocysts in repeat studies. The total number of excreted oocysts can then be determined as well. The number of oocysts is ascertained with the aid of counting chambers. We use the McMaster chamber (Davis, 1973; Janssen Pharmaceutica, 1990; Taylor et al., 1995): 2 g of well-mixed faeces is suspended in 60ml of saturated saline and passed through a fine sieve to eliminate the coarser constituents. The sieved suspension is mixed thoroughly so that the oocysts are uniformly dispersed. The suspension, thoroughly mixed, is introduced into the chamber with a pipette. A second and, if necessary, a third chamber are filled with fresh samples of the suspension. The count can be made after only a few minutes. A microscopic magnification of about 100x is needed for this purpose. The objective and eyepiece chosen must be such that the field of view covers the space between two lines. The counting chamber is 1.5mm deep, and an area of Table 99.4

10 x 10 mm on its cover glass is subdivided by lines running from top to bottom. One field thus corresponds to 0.15 ml of suspension. The number of oocysts found in such a field, multiplied by 200, gives the number of oocysts per g of (Opg) faeces. When the level of infection is low, 2-3 fields must be counted for an accurate determination of the Opg. In the determination of Opg values in samples containing abundant oocysts in the screening test we restrict ourselves to counting only a few rows (except in the case of infected controls). The reduction in accuracy is justified, as this simplified counting saves time and as oocyst excretion in excess of 50% relative to infected untreated controls is no longer included in the rating calculation (cf. Table 99.4, below).

Sporulation rate A faeces sample (approximately 200g) is mixed with the same weight of a 2% solution of potassium dichromate and stirred with an electric stirrer; the container, a 500ml disposable plastic beaker marked with the group number, is covered with aluminium foil and left to stand in the test room (at about 28°C) until the following day, by which time some of the oocysts are already sporulating (except in the case of E. maxima). In microscopic determination of the Opg the fraction of sporulated oocysts is ascertained at the same time, at least for one species. Only products with which the sporulation rate is virtually 0% are of interest here. Precise counting is therefore only necessary in a few instances, i.e. when there is an obvious drastic reduction.

Growth The birds are weighed at the start and end of the study, and the weight gain of the various groups is compared with that

Rating system for chemotherapeuticals with chicken coccidiosis

Dropping scores Score

Mortafity

0 0.5 1.0

0

1.5

1/3 (< 50%)

2.0 3.0

2-3/3 (> 50%)

Calculation

The quotient:

Day 5

Retarded

Lesion scores

(% of infected controls)

Oocysts

Weight (% of non-infected controls)

0 0-3 1-3 2-3 1-4 0-6 4-6

0 1-2

90 75-89 60-74

3

11-20

50

0 1 2

3 4-6

day 5-7

total score for test group total score for infected control group

expressed as a decimal is the rating: 0.00-0.29 = effect (100-71% effect) 0.30-0.79 =slight effect (70-21% effect) 0.80-1.00 = ineffective (20-0% effect)

Sporulating rate (%) 10

830

of the non-infected untreated controls. In the case of mixed infections the impairment of growth cannot be attributed to a particular species. When small groups are used, conclusions can only be drawn from the results in the presence of fairly major differences. For example, if, despite good parasitological efficacy, it is found that growth is distinctly poorer than in untreated non-infected controls, this indicates that the dose in question is poorly tolerated. Very good data for growth, with suppression of deaths but otherwise with minimal effect on the parasitological parameters (diarrhoea, excretion of oocysts, autopsy findings), can also be a significant indication of efficacy, even if inadequate efficacy. The efficiency of feed conversion (quotient of feed consumption and weight gain in grams) can be calculated in supplementary studies and using broiler chicks.

A. Haberkorn and G. Greif

ingredient with about 30g in an electric coffee mill. Treatment of the chicks is begun on the day of infection at the latest. We prefer to start giving the medication on Friday, i.e., 3 days before infection on Monday. In this way any effect on sporozoites is also detected. The treatment goes on until the end of the study. For three 12-day-old chicks of laying breeds and a study duration of 11 days, 1 kg of medicated feed is sufficient. Feed consumption is determined by weighing the feed remaining at the end of the study, and can thus be included in the evaluation. The dose of the standard commercial anticoccidials ranges from 125ppm (e.g., Zoalene) down to 1 ppm (diclazuril). For special purposes an oral treatment using a stomach tube is more convenient than medication via the feed, for example, to determine on exactly which developmental stages a drug is acting.

Autopsy findings (lesion scoring)

At the end of the study (8 days after infection in the case of mixed infections) the birds are sacrificed with CO2 in a closed container or by intraperitoneal injection of T61 (Hoechst AG, 1 ml for chicks weighing around 100g). At autopsy the part of the intestine typically parasitized by the species in question (Figure 99.2) is removed, subjected to an internal and external macroscopic inspection for lesions, and evaluated according to the specified rating system (Table 99.3). In routine tests to identify new active ingredients or possible bases for these (compound screening), many active ingredients do not show any efficacy whatsoever. It is sufficient in these cases mprovided that the birds have been infected with E. tenella - - to evaluate only the caecum, which does not necessitate removal of the intestine in t o t o . In any event, earlier inspection--6-7 days after infection--is better for the evaluation of lesions in the small intestine. As a rule, therefore, we have restricted this inspection to more detailed supplementary studies. Additional microscopic examinations of mucosal samples (stopped-down bright field or interference phase contrast) are a possibility, though we largely restrict their use to more detailed studies. Calculation of findings

The various criteria are considered in relation to one another and compared with the control groups. A rating system was developed on the basis of a method proposed by Jones (1946) and Thompson et aL (1950) for studies with amoebas (Table 99.4; Haberkorn and Schulz, 1981; Haberkorn, 1986).

Anticoccidial medication The active ingredients to be tested are mixed into ground, anticoccidial-free, complete chick feed with an electric feed mixer (e.g., from L6dige, Paderborn). It is advisable to prepare a premix first, by mixing the weighed-out active

Pitfalls (advantages and disadvantages) of the model The model permits reliable conclusions on the efficacy of an active ingredient in the target animal. It also yields rough initial information on tolerability. Consideration of the specified criteria enables the investigator to see, in the very first study, whether all three of the Eimeria species are controlled. It is often already possible at this stage to deduce the phase of parasite development affected by the active ingredient, particularly in the case of E. tenella. Consideration of several criteria also has the advantage that studies in which, for example, all the infected untreated controls survive (for whatever reason) can still be fully evaluated. The disadvantage of using small numbers of birds can easily be eliminated by carrying out repeat studies and increasing the numbers if necessary. Seasonal extremes of temperature together with long travelling distances can occasionally make it difficult to obtain day-old chicks. Cage studies with chicks are much more informative and realistic than in vitro studies, e.g., with E. tenella-infected cell cultures (monolayer tissue cultures). In cell culture studies one can at most form conjectures on in vivo efficacy within a few narrowly delimited groups of chemical substances. A particular disadvantage is the high frequency of falsenegative findings: ineffectiveness in vitro does not exclude efficacy in the chick (Ryley and Wilson, 1972, 1976; Ricketts, 1992). The advantage is that little active ingredient is required for cell culture tests. In vitro studies can be valuable for more detailed supplementary investigations. This is also true for experimental Eimeria infections in embryonating eggs (Shirley, 1995b).

Contributions of the model to infectious disease prophylaxis and therapy All commercially available anticoccidials were discovered in cage studies of this kind and a similar m t h o u g h some-

A N I M A L M O D E L S OF C O C C I D I A I N F E C T I O N

831

18 x 15 u

0

IIit111111tltltlIIIItUtlII i •

E. acervulina

•

I!II!!IIIII11111

ancreas

O ............. _J •

•

•

•

•

u p p e r small intestine

•

llllllIlllllllllllllllllllllllllllllllllllllllltllttlllllllllllltI I I lilt t~,

31 x21 u OO O 0 0 0 0 0 0 0 0 0

\"

/

.•. . .o O O O O

/''.~'eOioooooooooooooo~-,, _L . . . . . . . . . . -~\

central small intestine

E. maxima

yolk sac

OOOOO0

OO0

O O OO0

O ~

0

22x 19p

O(

O O OO000

0

_...__...__

..................................

:

E. tenella

• l o w e r small intestine

I I I I t I . . . . . . . . .

•

II

•

•

•

~mmmm,mmmmnmm~

caecum

21 x 17,u

E. praecox OOOOO0

• . • .........

20x17p

~

pancreas u p p e r small intestine

~ , ~ O O 0 0 0 0 0 0 0 ~ _ _ _ _ _ _O _ ~•O oOO0 O 0

O OOo0

E.A &necatrix AAAA 16

×

14 p

o(~A \OOAA

'~

o*~

A.

A •

A A A A A A. '

1

.~o

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

A *

*

/

,~

central small intestine

o, sac

....

o o-O.~'=/

E. brunetti

~

DDDDDD

/

[]DD

E

l

.. '

~

u

o, ,,,

~ ,

A

o[]

lower small intestine

o o o o o o Do 2,,,, a~r~SDo~" D n ~

[] [] El (313 n D D D

A

caecum

Figure 99.2

Comparative localization of chicken coccidia in the intestine.

A. Haberkorn and G. Greif

832

times less sophisticated -experimental design (Ryley and Betts, 1973; Ryley, 1980). For more detailed investigations, floor-housing studies are then needed as well.

Elucidation of the pathophysiology of coccidiosis Cage studies of this kind with Coccidiu-infected chicks also allow further investigations of pathophysiology, development of immunity, and development of resistance. T h e study conditions described here can be adapted for these without any problem (Hammond and Long, 1973; Rose, 1995; Stephan et ul., 1997).

Preparation of the animals For an initial screening programme a group of 2-3 animals per dose is sufficient. As in every other study, the mice should be delivered at least 1-2 days earlier, so that the course of the infection is not affected by stress due to transport and adaptation to a new environment. Standard commercial pelletized feed and drinking water should be provided ad libitum. Other than this, the conditions for the housing of laboratory mice apply (European Convention for the Protection of Vertebrate Animals used for Experimental and other Scientific Purposes, 1986; see Ausems, 1986). T h e animals are individually marked (see above).

Details of surgery

Mammalian coccidiosis Very up-to-date descriptions of target-animal models are also available for the principal mammalian coccidioses of our domestic animals, e .-g , for rabbits (Coudert et ul., 1995), lambs (Taylor et ul., 1995), calves (Burger et ul., 1995), piglets (Hendriksen, 1995), and dogs . _ - and cats (Rommel et ul., 1986), though these are not screening models but experimental designs for more detailed clinical investigations in the target animal species.

No surgical interventions are necessary, either before or during the study.

Infection procedure Oral infection via oesophageal tube is best carried out on Tuesday morning, with medication with the feed on Monday.

Background of the model Storage and preparation of inocula Given the importance of mammalian coccidiosis and the sometimes considerable variation in sensitivity to drugs, we developed a mouse model which we have been using successfully since 1963 (Haberkorn, 1986). We use E. fulciformis as the parasite. E. fulciformis develops in the caecum and especially in the upper colon of the laboratory mouse (Mus musculus) (Haberkorn, 1970). Other Eimeriu species of the mouse, such as E. uermiformis and E.f:prugensis, are also reasonably suitable (Haberkorn, 1993). Occasionally investigations are successfully carried out with rat coccidia (e.g., E. nieschulzii, E. sepurutu, E. contortu; Haberkorn and Schulz, 1981). For chemotherapeutic studies, e.g., for the identification of new active ingredients, these models d o not in our experience offer any advantage over the mouse model, particularly as the higher body weight means that more active ingredient is required (Haberkorn, unpublished work).

Animal species

SPF mice of one sex, weighing 15-18g, e.g., Bor: C F W are used. Some mouse strains (e.g., C57BUlOScCr Bom) show very high mortality when exposed to coccidial infection (Haberkorn, 1983).

Suspensions of E. fulciformis oocysts can be kept for 12 months without any problems in a refrigerator at 4-6°C. To obtain the infection material S P F mice (e.g., C F W ) weighing 22-30 g are each infected with approximately 5000-10000 sporulated oocysts and sacrificed on day 9 after infection. T h e caecum and colon are removed and opened, and the contents are scraped out with a spatula and suspended in 2% potassium dichromate. T h e suspension, in Petri dishes or beakers, is left to sporulate for 2 days, e.g., on a magnetic stirrer hotplate. T h e oocysts can of course also be obtained from the faeces (day 8-10 after infection). For cleaning of the oocysts, see the relevant section above.

Infection process T h e infection dose is established in a pilot study. T h e rate of mortality from the infection should be around 50%. With our E. fulciformis strain the dose of inoculum used in mice has for many years been 18000 sporulated oocysts per 15-18g body weight. T h e suspension used for the infection must be adjusted so that no more than 0.5 ml per mouse has to be administered.

zm I--

O O m It~ O "11

0 0

0 0 m 0m

T a b l e 99.5

Diarrhoea

Oocysts > 20/MF

'I'1

1

2

3

Intestinal wall

Upper third of colon A little swollen

Upper third of colon A little swollen

Caecum and upper Caecum and more third of colon than ~ colon Swollen Markedly swollen

Content

Normal

Softened

Soft

Faeces

Some soft pellets

'/3 of pellets soft

Anus

Clean

Diarrhoea just detectable

A little dirty

6-24/25 MF

1-2/MF

O. 1-0.5

Lesions

z

Eimeria falciformis mouse scoring of diarrhoea, lesions and oocysts

Localization

Oocysts per

1-5/25 MF

4

of pellets soft

5

6

Caecum and more than ~ colon Swollen,thickened wall Slime

Caecum and more than ~ colon Swollen, thickened wall Slime, bloody

Smeared

A few soft pellets still detectable Very dirty

No pellets were detectable Extremely dirty, including some blood

3-5/M F

6-10/MF

11-20/M F

Soft All pellets soft

m

0 -I m

0 z

microscopic fields (100 × magnification)

(30 O0 GO

834

A. Haberkorn and G. Greif

Key parameters for monitoring infection and response to t r e a t m e n t The main parameters are mortality due to the infection, growth, diarrhoea, and macroscopic and microscopic autopsy findings. The evaluation is carried out as in the chick studies.

Parameters

Mortality Deaths occurring before day 6 after infection are interpreted as toxicity-related or intercurrent. Animals dying on days 6-8 after infection are autopsied.

Diarrhoea Diarrhoea occurs from day 7 after infection. It is readily discernible around the anus. Since in any event the mice have to be picked up by hand for the oral treatment, the individual inspection can be made without any additional work. The evaluation is carried out as shown in Table 99.5.

approximately 30 minutes a drop is lifted from the surface with a cover glass of 18 x 18 mm, transferred to a microscope slide, and examined for oocysts under a microscope (magnification × 100 in a stopped-down bright field or with interference phase contrast). For semiquantitative evaluation we use the system given in Table 99.5. In more detailed studies the pooled faeces from days 6-9 after infection are examined and the number of oocysts is ascertained in a counting chamber. The collected faeces are obtained by keeping the mice in a wire cage suspended in a suitable plastic cage. It is a good idea to put moist absorbent paper in the plastic cage to prevent the droppings from drying out.

Growth Weighing of the animals, which is carried out anyway for the purposes of establishing the exact dose, takes place on days 1, 3, 6, and 8 and (at the end of the study) on day 9 after infection. The difference between the initial and final weights compared with the corresponding difference for non-infected and untreated controls is used in the evaluation (Table 99.5). If the initial weights are the same, one can also compare the final weights.

Calculation offindings

Autopsy findings (lesion scoring) On day 9 after infection the animals are sacrificed, the caecum and colon are removed, and the lesions assessed in accordance with Table 99.5.

This is carried out in the same way as the evaluation of coccidiosis studies in chicks (Table 99.6).

Oocyst excretion

Anticoccidial medication

The contents of the upper colon are scraped out with a spatula and suspended in saturated sodium chloride in a tube (65 × 25 mm) or small dish (separately or pooled groupwise). The tube or dish is filled to the rim with saturated NaC1. After

The test substances are dissolved or suspended in water so that the mice receive 1.0 ml per 20 g body weight. The treatment is generally given orally by oesophageal tube at 24hour intervals on days 1, 2, 3, 6, 7 and 8 after infection. On

Table 99.6

Score 0 1.0 1.5 2.0 2.5 3.O 4.5

Rating system for chemotherapeuticals with mouse coccidiosis

Lesion scores

Oocyst scores

% Opg*

Weight % of non-infected controls

0

0 1-3

0

1-3/3

4 5-6

0.1-3

50

> 90 75-89 60-74 25O 5OO > 1000

5OO 1000-500

250-150" 250-125 250

100 100 125

yes yes yes

ppm mg/kg ppm

> 1000 250 50O

1000-100t 250-125

100-50 500-250

50t

25 25 125

1 2 3

yes yes yes

ppm mg/kg ppm

> 1000 250 250

1000-250 1000

100-50 250-125 500-250

25 10 125

Aprinocid

1 2 3

yes yes yes

ppm mg/kg ppm

250 25 25O

500-100 10 250-100

50-25 5 75-50

10 2.5 25

Buquinolate

1 2 3

yes no yes

ppm mg/kg ppm

> 1000 > 1000 250

1000-250

100

250

250-100

5O 1000 5O

Clopidol

1 2 3

yes yes yes

ppm mg/kg ppm

> 250 50O 250

250 500-250 250

100 100 100

5O 5O 5O

Clopidol + Methylbenzoquate

1 2 3

yes yes yes

ppm mg/kg ppm

> 250 100 500

250-125 100-50 500-50

100-50 25-10

25 5 25

Decoquinate

1 2 3

yes no yes

ppm mg/kg ppm

> 500 > 1000 > 1000

500-25

10

1O00-25

5 1000 10

Diclazuril

1 2

yes yes

ppm mg/kg

> 250 >100

250-0.5 100-5

0.25-0.05 2.5-1

0.025 0.5

Glycamide

1

yes

ppm

> 1000

50-25t

10

2 3

no yes

mg/kg ppm

> 1000 250

1000-100 (5Or) 250-125

100-75

1000 50

Halofuginone

1 2 3

yes yes yes

ppm mg/kg ppm

10 1 15

10-3 2.5-1.5 15

2.5-2.0 1-0.5 10-1.5

1 0.25 1

Lasalocid

1 2 3

yes yes yes

ppm mg/kg ppm

>150 100 500

150-100 500

75 100-30 250-100

50 25 50

Maduramicin

1 2 3

yes yes yes

ppm mg/kg ppm

10 10 15

10-5 10-3 15-5

3-2 2.5-1.5 3-2.5

1.0 1.0 1.0

Monensin

1

yes

ppm

> 500

125-75

50

2 3

yes yes

mg/kg ppm

500 250

500-250 (125") 500 500-125

250 100-75

100 50

Narasin

1 3

yes yes

ppm ppm

> 250 250

250-(125") 250-75

50-25

100 10

Nicarbazin

1 2 3

yes yes yes

ppm mg/kg ppm

> 500 500 50

500-250

100 250-50 25

50 25 10

Drug

Test model

Effective

Unit

1 2 3

yes yes yes

Amprolium

1 2 3

Amprolium + Ethopabate

Aklomide

(no

Dose range

Fully

836

A. Haberkorn and G. Greif

Table 99.7 -- (Continued)

Drug

Test model

Maximum tolerated dose (no mortality)

Fully effective

Slightly effective

Highest not effective dose

500

100-50 250-100

500 25 50

1000-250 250-10 250-100

100 5 50

10 25-10 25-15

5 5 10

Dose range

Effective

Unit

1 2 3

yes yes yes

ppm mg/kg ppm

> 500 100 500

Pyrimethamine

1 2 3

yes yes yes

ppm mg/kg ppm

> 1000 250 250

Robenidine

1 2 3

yes yes yes

ppm mg/kg ppm

500 250 100

500-25 250-50 100-50

Salinomycin

1

yes

ppm

> 150

2 3

no yes

mg/kg ppm

50 500

150-100 (60*) 500-125

Sulfachlorpyrazine

1 2

yes yes

ppm mg/kg

> 1000 500

500

Sulfaquinoxaline

1 2 3

yes yes yes

ppm mg/kg ppm

500 250 500

Toltrazu ril

1 2 3

yes yes yes

ppm mg/kg ppm

Zoalen

1 2 3

yes yes yes

ppm mg/kg ppm

Nitrofurazone

30

100-50

50 30

1000-250

100 250

500-250

100 1000-500 250

50 250 100

1000 250 250

15 1000-5 1000-5

10-7.5 2.5-1 2.5-1

5 0.5 0.5

500 100 500

100 250-125

250-150 50-25 100-50

100 10 25

1, Chicken model (E. acervulina + E. maxima + E. tenella) treatment via feed from day -3 to day 8 post-infection. 2, Mouse model (E. falciformis): oral treatment on day 1,2, 3, 6, 7, 8 after infection; maximum dosage 1000 mg/kg body weight per day. 3, Mouse model (E. falciformis): treatment via feed from 3 days before until 9 days after infection; maximum dosage 1000 ppm. * Not Eimeria tenella; Jr Eimeria tenella only.

days 1, 3, 6 and 8 after infection the animals are weighed immediately before treatment so that the dose can be brought into line with the current body weight through adjustment of the administration volume (0.05 ml more or less for each 1 g above or below 20 g). If the test substances are administered continuously with the feed, they are mixed in with ground mouse feed. In this case it is advisable to start the treatment 2-3 days before the infection.

Pitfalls ( a d v a n t a g e s and d i s a d v a n t a g e s ) of t h e model

The model can be standardized to a very high degree: there is a much better guarantee of animal material of uniform quality, all year round, than is the case with chicks. A further major advantage of the model is that the amount of active ingredient required is much smaller (about one-

third); this also means that work can begin with the highest doses possible (e.g., 1000mg/kg; Table 99.7). The animals are also easier to keep, both in terms of space and room temperature requirements. With oral treatment according to the described system, only 4 out of 22 known products currently or formerly used to combat coccidiosis in chicks did not show any effect against E. falciformis at the maximum tolerated dose: glycamide (1000 mg/kg), salinomycin (50 mg/kg), and buquinolate and decoquinate (1000mg/kg in each case; Haberkorn, 1986). This is not surprising in the case of the last two quinolone products, given their purely static effect against sporozoites. When they were administered in the feed from 3 days before the infection, they proved effective, like all polyethers and like glycamide. The risk that an active ingredient of potential relevance to coccidial infections in poultry may be missed in a preliminary test with E.falciformis is thus small, and practically non-existent with medication via the feed. However, since there are

ANIMAL MODELS OF COCCIDIA INFECTION

often considerable differences in efficacy against coccidia of poultry and mammalian coccidia such as E. falciformis, products which show even the slightest sign of efficacy in the mouse test should be tested in chicks. In our experience a high degree of efficacy against E. falciformis is a very reliable indication of a broad spectrum of action, and in particular of high efficacy against other mammalian coccidia (Haberkorn and Schulz, 1981).

Contributions of the model to infectious disease prophylaxis and therapy In 1971 we were the first to discover the anticoccidial symmetrical triazinetriones in the mouse. This work ultimately led to the discovery and development of toltrazuril, an anticoccidial with an exceptionally broad spectrum of action (Aichinger et al., 1978; Haberkorn and Stoltefuss, 1987).

Elucidation of the pathophysiology of coccidiosis The model described is also highly suitable for the investigation of other questions relating to the biology and immunology of coccidia (Rose, 1995).

References Aichinger, G., Haberkorn, A., K611ing, H., Kranz, E., Reisdorf, J., StoltefuB, J. (1978). Anticoccidial activity of Bay G 7183.4th ICOPA 19-26 Aug. 1978. Short communications section D p. 96. Warsaw, Poland. Ausems E. J. (1986). The European Convention for the protection of vertebrate animals used for experimental and other scientific purposes. Z. Versuchstierk., 28, 219. Bfirger, H.-J., Fiege, N., Gahr, A., Heise, A., Roloff, H. (1995). Eimeria species of cattle. In COST 89/820 Biotechnology, Guidelines on Technics in Coccidiosis Research (eds Eckert J., Braun, R., Shirley, M. W. et al.), pp. 40-51. Office for Official Publications of the European Communities, Luxembourg. Cameron, R. S. (1985). Procedures for drug approval by the EEC. In Research in Avian Coccidiosis. Proceedings of the Georgia Coccidiosis Conference, (eds McDougald, L. R., Joyner, L. P., Long, P. L.) pp. 385-393. University of Georgia Dept. Poultry Science, Athens. Clarke, M. L. (1962). A mixture of diaveridine and sulfaquinoxaline as a coccidiostat for poultry. Vet. Rec., 74, 845-847. Coudert, P., Licois, D., Drouet-Viard, F. (1995). Eimeria species and strains of rabbits. In COST 89/820 Biotechnology, Guidelines on Technics in Coccidiosis Research (eds Eckert, J., Braun, R., Shirley, M. W. et al.) pp. 52-73. Office for Official Publications of the European Communities, Luxembourg. Davies, S. F. M., Joyner, L. P., Kendall, S. B. (1963). Coccidosis. Oliver and Boyd, Edinburgh.

837

Davis, L. R. (1973). Techniques. In The Coccidia Eimeria, Isospora, Toxoplasma and Related Genera (eds Hammond, D. M., Long, P. L.), pp. 411-458. University Park Press, Butterworths, London. Eckert, J., Braun, R., Shirley M. W., Coudert, P. (eds) (1995a). COST 89/820 Biotechnology, Guidelines on Technics in Coccidiosis Research. Office for Official Publications of the

European Communities, Luxembourg. Eckert, J., Taylor, M., Catchpole, J., Licois, D., Coudert, P., Bucklar, H. (1995b). Morphological characteristics of oocysts. In COST 89/820 Biotechnology, Guidelines on Technics in Coccidiosis Research (eds Eckert, J., Braun, R., Shirley, M. W. et al.), pp. 103-119. Office for Official Publications of the European Communities, Luxembourg. Haberkorn, A. (1970). Die Entwicklung von Eimeria falciformis (EIMER 1870) in der weissen Maus. Z. Parasitenkd., 34, 49-67. Haberkorn, A. (1983). Infektionsverlauf einer E i m e r i a u Mischinfektion in verschiedenen M/iusest~immen. Mitt. Oesterr. Ges. Tropenmed. Paras#ol., 5, 39-44. Haberkorn, A. (1986). Use of a mouse coccidiosis model for predicting anticoccidial efficacy in poultry. In Research in Avian Coccidiosis (eds McDougald, L. R., Long, P. L., Joyner, L. P.) pp. 263-270. Georgia Coccidiosis Conference, Nov. 19-21, 1985, Athens, GA, USA. Department of Poultry Science, University of Georgia, AL. Haberkorn, A. (1993). Differences in sensitivity of the mousecoccidia Eimeria f. falciformis, E. f. pragensis and E. vermiformis to toltrazuril and its sulfon. IX. Intern. Congr. Protozoology, July 24-31. 1993, Berlin Abstracts p. 49 (ed. Moltmann, U). German Society of Parasitology, Stuttgart, Germany. Haberkorn, A. (1996). Chemotherapy of human and animal coccidioses: state and perspectives. Paras#ol. Res., 82, 193-199. Haberkorn, A., Mundt, H.-C. (1989). Progress in the control of mammalian coccidiosis. In Coccidia and Intestinal Coccidiomorphs, (ed. Yvore, P). pp. 435-440. Les Colloques de 1' INRA, INRA, Paris. Haberkorn, A., Schulz, H. P. (1981). Experimental chemotherapy of mammalian coccidiosis with Bay G 7183. Zbl. Bakt. Hyg. L Abt. Orig., A250, 260-267. Haberkorn, A., Stoltefuss, J. (1987). Studies on the activity spectrum of toltrazuril, a new anti-coccidial agent. Vet. Med. Rev., 1/87, 22-32. Hammond, D. M., Long P. L. (eds) (1973). The Coccidia Eimeria, Isospora, Toxoplasma and Related Genera. University Park Press, Butterworths, London. Hendriksen, S. A. (1995). Isospora suis of swine. In COST 89/820 Biotechnology, Guidelines on Technics in Coccidiosis Research (eds Eckert, J., Braun, R., Shirley, M. W. et al.) pp. 74-78.

Office for Official Publications of the European Communities, Luxembourg. Hilbrich, P. (1967). Krankhe#en des Gefliigels. Verlag Hermann Kuhn KG, Schwenningen Neckar. Janssen Pharmaceutica (1990). Diagnosis of Coccidiosis in Chickens. Janssen Pharmaceutica Animal Health Department B-2340 Beerse, Belgium. Johnson, J., Reid, W. M. (1970). Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp. Parasitol., 28, 30-36. Jones, W. R. (1946). The experimental infection of rats with Entamoeba histolytica with a method for evaluation the antiamebic properties of new compounds. Ann. Trop. Med. Parasitol., 40, 130-140.

838

Levine, N. D., Ivens, V. (1970). The Coccidian Parasites (Protozoa, Sporozoa) of Ruminants. Illinois biological monographs no. 44. University of Illinois Press, Illinois. Lindsay, D. S. (1990). Isospora: infections of intestine: biology. In Coccidiosis of Man and Domestic Animals (ed Long, P. L.), pp. 77-89. CRC Press, Boca Raton. Long, P. L. (ed) (1982). The Biology of the Coccidia. University Park Press, Baltimore. Long, P. L. (ed) (1990). Coccidiosis of Man and Domestic Animals. CRC Press, Boca Raton. Long, P. L., Reid, W. M. (1982). A Guide for the Diagnosis of Coccidiosis in Chickens (ed. Sparer, D). Research Report 404. University of Georgia College of Agriculture, Athens. Lynch, J. E. (1961). A new method for the primary evaluation of anticoccial activity. Am. J. Vet. Res., 22, 324-326. Maes, L., Coussement, W., Vanparijs, O., Verheyen, F. (1989). Species specificity action of diclazuril (Clinacox®) against different Eimeria species in the chicken. Coccidia and intestinal coccidiomorphs (ed Yuore, P.) Vth Intern. Cocc. Conf. Tours (France) 17-20. Octob. 1989. INRA, Paris. McDougald, L. R. (1982). Chemotherapy of coccidiosis. In The Biology ofthe Coccidia (ed Long, P. L.), pp. 373-427. University Park Press, Baltimore. McDougald, L. R. (1990). Control of coccidiosis: chemotherapy. In Coccidiosis of Man and Domestic Animals (ed Long, P. L.), pp. 307-320. C RC Press, Boca Raton. Mehlhorn H (ed.) (1988). Parasitology in Focus, pp. 1-50. Springer, Berlin. Pellerdy, L. P. (1974). Coccidia and Coccidiosis. Paul Parey, Berlin. Raether, W. (1980). Salinomycin, a polyether antibiotic with marked activity against experimental coccidiosis in chickens and turkeys. 6th European Poultry Conference, Hamburg, 8-12 September 1980, Vol. II, pp. 507-514. World's Poultry Science Association, Braunschweig, Germany. Raether, W., Hofmann, J., Uphoff, M. (1995). In vitro cultivation of avian Eimeria species: Eimeria tenella. In COST 89/820 Biotechnology, Guidelines on Technics in Coccidiosis Research (eds Eckert, J., Braun, R., Shirley, M. W. et al.) pp. 79-92.

Office for Official Publications of the European Communities, Luxembourg. Raines, T. V. (1978). Guidelines for the evaluation ofanticoccidial drugs. In: Avian Coccidiosis (eds Long P. L., Boorman, K. N., Freeman, B. M.) pp. 339-346. British Poultry Science, Edinburgh. Ricketts, A. P. (1992). Eimeria tenella: growth and drug sensitivity in tissue culture under reduced oxygen. Exp. Parasitol., 74, 463-469. Rommel, M., Heydorn, A. O. (1972). Beitr~ige zum Lebenszyklus

A. Haberkorn and G. Greif

der Sarcosporidien III. Isospora hominis (Raillet and Lucet, 1891; Wenyon, 1923) eine Dauerform der Sarkosporidien des Rindes und des Schweins. Berl. Miichn. Tier~'rztl. Wchschr., 85, 143-145. Rommel, M., Schnieder, T., Westerhoff, J., Krause, H. D., Stoye, M. (1986). The use oftohrazuril-medicated food to prevent the development of Isospora and Toxoplasma oocysts in dogs and cats. Syrup. Biol Hung., 33,445-449. Rose, M. E. (1995). Immunity to Eimeria infections: characterisation of cells involved in protection. Proceedings of 1995 Annual Workshop COST 820, Vaccines against animal coccidioses (ed. Bedrnik, P.) Biopharm Research Institute of Biopharmacy and Veterinary Drugs, Jilove, near Prague, Czech Republic. Ryley, J. F. (1980). Screening for and evaluation of anticoccidial activity. Adv. Pharmacol. Chemother., 17, 1-23. Ryley, J. F., Betts, M. J. (1973). Chemotherapy of chicken coccidiosis. Adv. Pharmacol. Chemother., 11, 221-293. Ryley, J. F., Wilson, R. G. (1972). Comparative studies with anticoccidials and three species of chicken coccidia in vivo and in vitro. J. Parasitol., 58, 664-668. Ryley, J. F., Wilson, R. G. (1976). Drug screening in cell culture for the detection of anticoccidial activity. Parasitology, 73, 137-148. Shirley, M. W. (1995a). Eimeria species and strains of chickens. In COST 89/820 Biotechnology, Guidelines on Technics in Coccidiosis Research (eds Eckert, J., Braun, R., Shirley, M. W. et al.) pp. 1-24. Office for Official Publications of the European

Communities, Luxembourg. Shirley, M. W. (1995b). Cultivation of avian Eimeria species in embryonating eggs. In COST 89/820 Biotechnology, Guidelines on Technics in Coccidiosis Research (eds Eckert, J., Braun, R., Shirley, M. W. et al.) pp. 93-94. Office for Official Publications of the European Communities, Luxembourg. Stephan, B., Rommel, M., Daugschies, A., Haberkorn, A. (1997). Studies of resistance to anticoccidials in Eimeria field isolates and pure Eimeria strains. Vet. Parasitol., 69, 19-29. Taylor, M., Catchpole, J., Marshall, R., Norton, C. C., Green, J. (1995). Eimeria species of sheep. In COST 89/820 Biotechnology, Guidelines on Technics in Coccidiosis Research (eds Eckert, J., Braun, R., Shirley, M. W. et al.) pp. 25-39. Office for Official Publications of the European Communities, Luxembourg. Thompson, P. E., Dunn, M. C., Bayeles, A., Reinertson, W. (1950). Action of chloramphenicol (chloromycetin) and other drugs against Entamoeba histolytica in vitro and in experimental animals. Am. J. Trop. Med., 30, 203-215. Tyzzer, E. E. (1929). Coccidiosis in gallinaceous birds. Am. J. Hyg., 10, 269-383.

Chapter 100

Animal Models of Trichomonas vaginalis Infection with Special Emphasis on the

Intravaginal Mouse Model

S. F. Hayward-McClelland, K. L. Delgaty and G. E. Garber

Background of human infection

recent reviews see Wolner-Hanssen et aL, 1989; Rein, 1990; Heine and McGregor, 1993) ranges from asymptomatic to Trichomoniasis is a sexually transmitted disease (STD) of acute or chronic, although one-third of asymptomatic worldwide importance, which is caused by the parasitic women develop clinical disease within 6 months. Acute triprotozoan Trickomonas vaginalis. Trichomoniasis was once chomoniasis can include the following: severe vaginitis, considered a "nuisance disease" of women, but has now pruritus, dysuria, dyspareunia, and diffuse vulvitis associbeen accepted to have important medical, social, and eco- ated with copious leukorrhea. The vaginal discharge is nomic implications. It is the most common non-viral STD, often malodorous, frothy, mucopurulent, and yellowishwith more than 170 million cases occurring annually green in colour. The classic "strawberry cervix", which is throughout the world (World Health Organization, 1995). characterized by punctate hemorrhages, is observed in only In North America alone, more than 8 million new cases are 2% of cases by the naked eye (Fouts and Kraus, 1980), but in reported each year (World Health Organization, 1995). 90% of cases by colposcopy (Wolner-Hanssen et aL, 1989). These estimates may be low, since up to 50% of infections Symptoms and parasitic load are cyclical and worsen durare asymptomatic (Fouts and Kraus, 1980). This is of par- ing menstruation; the pH of the vagina is usually elevated ticular public health importance, since asymptomatic indi- from the normal 4.5 to greater than 5.0. Chronic infection viduals are carriers who may unknowingly transmit the is mild and presents with pruritus and dyspareunia, with disease to others (Nicoletti, 1961). T. vaginalis is associated little or scant vaginal secretion mixed with mucus. with many perinatal complications, genitourinary dis- Complications of T. vaginalis infection include premature orders, and the transmission of other STDs such as human rupture of the placental membranes, premature labour, immunodeficiency virus (HIV; Cameron and Padian, 19"90; low-birth-weight infants, adnexitis, pyosalpinx, endometritis, atypical pelvic inflammatory disease (Heine and Laga et aL, 1993, 1994). T. vaginalis is an obligate parasite which lacks a cystic McGregor, 1993), cervical cancer (Wolner-Hanssen et aL, stage. Although the trichomonad can survive outside the 1989), cervical erosion (Rein and Chapel, 1975), and infertilhost for several hours, it is transmitted almost exclusively ity (Rein, 1990). T. vaginalis infection in males is poorly understood and through coitus (Heine and McGregor, 1993). Trichomoniasis has a cosmopolitan distribution and has there exists many conflicting reports with regard to its clinbeen found in all continents, racial groups and socioeco- ical picture. Male trichomoniasis is generally thought to be nomic strata. Nonetheless, it is associated with exposure to asymptomatic, although non-gonococcal urethritis and promultiple sexual partners, low education and income, and it statitis are not uncommon (Holmes et al., 1975; Mardh and appears more prevalent in certain populations, although it Colleen, 1975; Krieger, 1984; Krieger et aL, 1993). It has also is not known whether this is related to biologic or socioeco- been associated with a number of other inflammatory connomic status (Heine and McGregor, 1993). The true preva- ditions of the male urogenital tract (Krieger et aL, 1993). It lence of T. vaginalis infection is unknown, since it is not a is thought that in men the infection lasts about 10 days, reportable disease. T. vaginalis strains are quite variable although the prevalence of spontaneous resolution and the with respect to virulence, antigenic properties, and geo- consequence of chronic infection remain undefined graphic distribution (Lossick, 1990), but only eight (Krieger, 1990). Diagnosis is often difficult because the symptoms of triserotypes have been identified (Ackers, 1990). This protozoan primarily infects the squamous epithe- chomoniasis mimick those of candidiasis and bacterial vagilium of the genital tract. The incubation period is usually nosis (Rein and Holmes, 1983). Diagnosis is therefore made 3-28 days in women and infection itself may persist for an on the basis of both clinical picture and the identification of extended amount of time. It is chiefly a disease of the repro- trichomonads in the urogenital tract. Detection methods ductive years, and is rarely observed before the menarche or include the gold-standard broth culture, various microafter menopause. Clinical presentation in women (for scopic staining techniques and, more recently, antibody, Handbook of Animal Modelsof Infection ISBN 0-12-775390-7

Copyright © 1999AcademicPress All rights of reproduction in any form reserved

840

S.F. Hayward-McClelland, K. L. Delgaty and G. E. Garber

antigen, and DNA detection (Lossick and Kent, 1991; Bhatt et aL, 1996; Petrin et aL, 1998). Once diagnosed, both the patient and sexual partners are treated orally with metronidazole (single 2 g dose, or 250 mg three times a day for 7 days) to prevent recurrence (Lossick, 1982). Metronidazole is the only licensed treatment in North America for trichomoniasis, but other nitroimidazoles are available around the world. Antibiotic resistance and refractory cases are becoming increasingly problematic, however. New drug and vaccine development may not only provide better treatment, but may offer prophylaxis and protective immunity. Unfortunately, this research has been limited by the lack of understanding of the pathogenesis of the disease, and the role of the host immune response to T. vaginalis infection (for a recent review of these factors, see Petrin et aL, 1998). A good animal model is required for standardized controlled research into the pathogenesis, host immune response, and treatment of T. vaginalis infection.

Background of animal models Many animal models for T. vaginalis infection have been proposed (Jirovec and Petru, 1968; Honigberg, 1978; Kulda, 1990). The intraperitoneal models of Teras and Roigas (1966) and Cavier et aL (1972) and the subcutaneous model of Honigberg et aL (1966) have been used extensively for pathogenesis and drug studies. Intraperitoneal injection of trichomonads produces visceral lesions which can result in death, while subcutaneous injection of T. vaginalis results in the development of a localized abscess. The extent and severity of these indices can be used to estimate the level of virulence, but their correlation with clinical disease is poor (Garber and Lemchuk-Favel, 1990). Vaginal infections are preferable to those of ectopic nature since they more closely parallel the human disease. However, many of the intravaginal infections in laboratory animals have not met the expectations of a suitable model. Vaginal infection of the squirrel monkey produces symptomatic disease of up to 3 months, and horizontal transmission between animals has been achieved (Street et aL, 1983; Gardner et aL, 1987). Immune response is weak, however, and the presence of indigenous trichomonads which require eradication is problematic (Hollander and Gonder, 1985). Recent studies have been too small to assess adequately its appropriateness as a model, and more research is required. Unfortunately, associated cost and upkeep are prohibitive. Intravaginal infection of the guinea-pig is relatively simple to accomplish, requiring no supportive estrogen treatment, and results in a symptomatic infection similar to that of women. From this model, a series of reports focusing on the pathology of trichomoniasis was published (Soska et aL, 1962; Kazanowska et aL, 1983; Honigberg, 1978). The model never really progressed beyond the original research,

although guinea-pigs intravaginally infected with Tritrichornonas foetus (which is the bovine urogenital pathogen) have been used in some drug studies (Maestrone and Semar, 1967; Michaels, 1968). This probably reflects the decline in interest for finding novel human treatments, and a surge of research by the veterinary community into bovine trichomoniasis. The intravaginal infection of the hamster (also achieved without supportive hormonal therapy) persists up to several months but is asymptomatic. It was used mainly for drug assays for T. foetus infection (Ryley and Stacey, 1963), and for a few drug assays for T. vaginalis infection (Michaels, 1968; Wildfeuer, 1974; Kulda, 1990). Unfortunately, contamination of the vagina with indigenous trichomonads of the gut render the model and results obtained from it potentially unreliable (Kulda, 1990). Intravaginal infection of the rat is only accomplished after surgical removal of the ovaries, followed by estrogenization (Cavier and Mossion, 1956; Meingassner et aL, 1981). Infection lasts approximately 2-10 weeks, and is generally asymptomatic. The rat model is somewhat applicable to drug studies (Michaels, 1968; Meingassner et aL, 1981; Kulda, 1990), but researchers have sought a more convenient model. With the resurgence of interest in finding novel antitrichomonal therapies, the mouse has gained favor as an appropriate animal for use in models of T. vaginalis infection. This is due, in part, to their availability and simple upkeep. Furthermore, surgical preparation of the animal is not required, and mice seem to be free of indigenous trichomonads. Clearly, the animal models which achieve a consistent, long-lasting, symptomatic genital infection would be ideal.

The intravaginal mouse model Mouse intraperitoneal and subcutaneous T. vaginalis infections have provided a wealth of useful information on drug pharmacology and parasite pathogenesis. However, the intravaginal infection model has the most relevance to human vaginal infections, and it is this model which will be discussed most extensively in this chapter. The intravaginal route of inoculation in the mouse has met with limited success due to technical difficulties encountered by early investigators. Research has been impeded by the fact that the animal models employed did not closely replicate the environment found in the human vagina, where the epithelium is exposed to estrogen throughout most of the menstrual cycle (Larsen, 1993). It has been established that susceptibility of laboratory animals to intravaginal infection is related to their hormonal status and varies with changing phases of the sexual cycle (Kulda, 1990). The estrous cycle of mice (and other laboratory animals) includes four separate phases m t h e y are proestrus, estrus, metestrus and diestrus. Optimal conditions for intravaginal growth of T. vaginalis are found during proestrus and estrus, when an increased level of

ANIMAL MODELS OF T. VAGINALIS INFECTION WITH EMPHASIS ON THE INTRAVAGINAL MOUSE MODEL

estrogen is present, and neutrophils and bacteria are at a minimum (Corbeil et al., 1985). In fact, ]irovec and Petru (1968) suggested that T. vaginalis can grow only in an environment that includes estrogen. To keep the animals in protracted estrus, researchers have employed a supportive treatment with estrogen (thus preventing the animals from cycling into metestrus and diestrus; Kulda, 1990). The first attempt at murine intravaginal inoculation was made by Patten et al. (1963) when they repeatedly introduced T. vaginalis into the mouse vagina over a number of weeks. They examined pathology in response to continuous introduction of the organism, but they did not verify the duration of infection or presence of trichomonads between inoculations. Subsequent researchers, however, were more interested in the establishment of an infection after a primary introduction of the parasite. Cappuccinelli's group (1974) was the first to establish successfully an intravaginal T. vaginalis infection in the mouse with an initial inoculation of the organism, and exogenously administered estrogen. They suggested that estrogen is necessary for induction of infection, but not for maintenance. A number of subsequent studies have supported the need for estrogenization (Coombs et al., 1986; McGrory and Garber, 1992; Meysick and Garber, 1992; Abraham et al., 1996). There have been inconsistencies, however, in the duration of infection in estrogenized mice. The reasons for failure of long-term murine genital T. vaginalis infection are probably multifactorial. Factors directly responsible for the enhancement of growth of trichomonads in estrogenized animals are unknown and the exact role of this hormone is still under debate (Van Andel et al., 1996b). It has been suggested that there is a possible association between increased susceptibility to infection and accumulation of a substrate (glycogen) that could be used as a nutrient source by T. vaginalis (Kulda, 1990). The relationship is probably more complex and may include factors such as the modification of vaginal epithelial cells, changes in the normal vaginal flora, and the number of neutrophils present in the vagina (Corbeil et al., 1985). While it is widely accepted that estrogen levels and stage of estrous are important in the establishment of an intravaginal T. vaginalis infection, it has also been shown that sustained estrogenization alone is insufficient to support long-term genital T. vaginalis infection in mice (Van Andel et al., 1996b). Investigators have therefore made an attempt to alter the mouse vaginal environment so that it more closely reflects the human vaginal milieu. Meingassner (1977) co-inoculated mice with Candida albicans in order to sustain a more reliable model for use in drug testing. Vaginal flora and pH are quite dissimilar in mice and humans; high numbers of lactobacilli and low pH are hallmarks of the human vagina (Paavonen, 1983; Hanna et al., 1985; Larsen, 1993), while only a small percentage of mice harbor lactobacilli and mouse vaginal pH is neutral (Meysick and Garber, 1992). McGrory and Garber (1992) introduced Lactobacillus acidopkilus into the mouse vagina

841

prior to inoculation with T. vaginalis, and observed a significantly more consistent and sustained infection. Of mice preinoculhted with L. acidophilus prior to introduction of T. vaginalis, 69% were still infected (with T. vaginalis) after 24 days; only 11% of the control group (no L. acidopkilus) maintained the infection. They also noted that the addition ofL. acidopkilus did not otherwise significantly alter the resident mouse vaginal flora. The exact nature of the relationship between L. acidopkilus preinfection and greater duration of T. vaginalis infection is not clearly understood. It may be that the lactobacilli become a nutrient source for the T. vaginalis, when the invading trichomonads phagocytose the bacteria. The prolonged infection seen in the presence of the L. acidopkilus may also be attributed to direct or indirect actions of the lactobacilli on the vaginal environment, providing conditions which help facilitate the establishment of a longterm T. vaginalis infection (McGrory and Garber, 1992).

Animal strains Female BALB/c mice (Charles River Co., Montreal, Canada) are used in experiments with the vaginal mouse model described here. Experiments done by Landolfo et al. (1981) support the use of the B ALB/c strain. While studying the genetic control of resistance or susceptibility to T. vagihalls infection in various strains of mice, they found that female BALB/c and DBA/2 mice are highly susceptible to intraperitoneal, subcutaneous, and intravaginal infection with the parasite. Common lab strains C57BL/6 and C3H female mice display intermediate levels of resistance following intraperitoneal or subcutaneous inoculation, whereas they display high levels of resistance to intravaginal infection and would thus be inappropriate for use in the intravaginal infection model. The animals used in the infection protocol are approximately 6-8 weeks old (22-24 g) at the beginning of the experiment. It has been shown that the age of the mice plays an important role in establishment of an infection. Landolfo et al. (1981) found that susceptibility of BALB/c females to T. vaginalis decreases with age; susceptibility is maximal at 3-4 weeks and minimal at 40-42 weeks.

Preparation of animals Mice used in the protocol are housed in plastic cages and are supplied with food and tap water ad libitum. They are provided with 12 hours of artificial illumination each day. All aspects of housing and husbandry are performed in accordance with the regulations set forth by the University of Ottawa Animal Care Committee and the Canadian Council on Animal Care (Olfert et al., 1993). In addition to nutritional provisions, mice are given nesting material and

842

S.F. Hayward-McClelland, K. L. Delgaty and G. E. Garber

polyvinyl chloride (PVC) tubes which are believed to provide environmental enrichment. In this infection protocol, the mice are treated with estrogen, then inoculated with L. acidophilus prior to inoculation with T. vaginalis (see Table 100.1 for an outline of the protocol). On Day-9 of the infection protocol (2 days prior to vaginal inoculation with L. acidophilus and 9 days before inoculation with T. vaginalis), each mouse is given a subcutaneous injection of 0.05 ml of Delestrogen (estradiol valerate 10 mg/ml; Squibb Canada, Montreal, Canada, Cappuccinelli et al., 1974; McGrory and Garber, 1992; Meysick and Garber, 1992; Abraham et aL, 1996). The Delestrogen is suspended in sesame oil and is, therefore, viscous and somewhat difficult to inject. Possible dosage problems can, in part, be overcome by use of a 26 G needle, which is large enough to allow relatively easy injection, while minimizing leakage of estrogen. In addition, leakage can be avoided by massaging the site of injection, allowing immediate subcutaneous distribution of the material. The estrogen treatment is repeated on Day -2 (2 days before vaginal inoculation with T. vaginalis). Other investigators have developed alternate protocols for estrogen treatment (Table 100.2). Before the mice are vaginally inoculated with L. acidophilus, the stage of estrous of each mouse is determined by vaginal smear. The swabs are made by wrapping a small amount of cotton around the end of a round toothpick (which is made dull by snipping the point with scissors). The swab is then moistened with saline, making insertion into the mouse vagina easier and less traumatic for the animal. Once inserted gently, the swab can be carefully rolled and turned in such a way that cells in the vagina are collected on the cotton tip. The swab is removed and lightly rolled on to a glass slide, which is then fixed with CytoPrep (Fisher Scientific, Nepean, Canada). The smear is stained with the Diff-Quick Stain Set (Dade Diagnostics, Aguada, PR), and examined to ascertain stage of estrous. Stage of estrous can easily be determined through comparison with established criteria (Fox and Laird, 1970; Jacoby and Fox, 1984). Characterization of the cycle stage

by means of vaginal smear is based on the detection of changes in the vaginal epithelium. During the estrous cycle, the epithelium becomes cornified, and is eventually shed; this is followed by an influx of leukocytes. The exfoliative cytology at estrus is characterized by the presence of anucleated cornified epithelial cells and a lack of leukocytes. In metestrus, numerous leukocytes are found, together with scattered cornified cells and nucleated squamous cells. Diestrus is characterized by a predominance of leukocytes, while in proestrus, the leukocytes are sparse, and round nucleated cells predominate (Kulda, 1990).

Microbiological organisms T. vaginalis Organisms are grown as previously described (Garber et aL, 1987) in 10ml Diamond's TYI-S-33 medium (pH 6.2; Diamond et aL, 1978) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Gibco BRL, Life Technologies Inc. Grand Island, NY), 100 U/ml penicillin, 100 ~g/ml streptomycin (penicillin-streptomycin solution, Gibco BRL) and 2.5~g/ml amphotericin B (Fungizone, Gibco BRL). Growth media containing the T. vaginalis is incubated at 37°C with 5% CO2 in glass screw-capped tubes held at a 45 o angle. Cultures are passaged every 2-3 days. Viable organisms are counted on a hemacytometer, using trypan blue exclusion (Takahashi et al., 1970). To insure that the culture is healthy and growing as expected, it is advisable to passage the T. vaginalis two to three times (from frozen stock), before use in the infection protocol. It should be noted, however, that a marked decrease in infectivity and pathogenicity was observed by Coombs et aL (1986) and Bremner et aL (1986b) respectively, after prolonged in vitro axenic cultivation (several months) of a strain. For this reason, it is not desirable to passage an isolate over an extended period. For long-term storage, axenic cultures are frozen at

Table 100.1 Experimental timeline for mouse intravaginal infection model Day

Procedure

Day -9

Subcutaneous injection of Delestrogen (estradiol valerate 10 mg/ml; 0.05 cc) Intravaginal inoculation with Lactobacillus acidophilus (101° cfu/ml; 20 #1) Vaginal smear to confirm estrous stage Subcutaneous injection of Delestrogen (estradiol valerate 10 mg/ml; 0.05 cc) Vaginal washes to confirm presence of L. acidophilus infection (50 ILtl MRS) Intravaginal inoculation with Trichomonas vaginalis (9 x 108 cells/ml; 20 ~1) Vaginal washes to confirm presence of T. vaginalis infection (50 pL TYI + 10% FBS)

Day -7/Day -6 Day -2 Day -1 Day 0/Day 1 Days 7, 14, 21, 28

Cfu, Colony-forming units; FBS, fetal bovine serum.

]:,, zm T a b l e 100,2

i: ]:,,

P r o c e d u r e s resulting in the e s t a b l i s h m e n t of lasting Trichomonas vaginalis infections in l a b o r a t o r y mice

/-

Mouse weight or age

Period after estrogen treatment 3 days

Form of hormone and method of administration

Dosage

Estradiol valerate (s.c. inoculation in sesame oil) Estradiol valerate (s.c. inoculation in sesame oil)

0.5 mg/animal every 10 days 0.5 mg/animal in a single dose 40 mg/kg in two equal doses

30 g

No. of trichomonads and volume of inoculation

i:

Results

Infection protocol

Estrogen treatment

Total no. of mice

Initial Dercentage of animals infectedt

Maximum period of infection (days)-~

One inoculation of 5 x 103 or 2 x 106 in 0.05 ml Two inoculations of 5 x 105 at 24-hour intervals in 0.05 ml

48

52 [37-75)

>40

76

~)9

50

Reference

Cappuccinelli et al. (1974) Cappuccinelli 9t aL (1974)

3 days

25-30 g

3 days

One inoculation of 105 trichomonads + Candida albicans* in 0.05 ml

_;27

~)4

NA

Meingassnerl(1977)

0.5 mg/animal weekly

18-20 g

7 days

One inoculation of 1.5 x 105 (4 different strains)in 0.05 ml

77

26 [15-40)

14-21

Wildfeuer (1974)

One inoculation of 5 x 105 or two 48 inoculations of 5 x 105 and 3 x 105 at 24-hour or 48-hour intervals all in 0.05 ml One inoculation of 105 in 0.02 ml 180

52 :5O-65)

42

Wildfeuer (1974)

52

92

24

83

4

18 24

11 79

24 4

Coombs et aL (1986) McGror and McGrory 992) Garber (19921

16

69

24

33

91

7

29

52

28

20

NA

42

0.5 mg/animal weekly

18-20 g

7 days

40 mg/kg in a single dose 0.5 mg/animal weekl~ weekly

2-3 months 22-24 g

2 days 2 days

Two inoculations of I x 104 trichomonads in 0.02 ml

Estradiol valerate (Squibb; s.c. inoculation in sesame oil)

0.5 mg/animal weekl~ weekly

22-24 g

2 days

Two inoculations of 1 x 109 Lactobacillus acidophilus 1 week prior to the two inoculations of I x 104 trichomonads in 0.02 ml Two inoculations of 2 x 108 Lactobacillus acidophilus 1 week prior to the two inoculations of 5 x 10S trichomonads in 0.02 ml Two inoculations of 8 x 10~ trichomonads

Estradiol valerate (Squibb; s.c. inoculation in sesame oil)

0.5 mg/animal weekl~ weekly

22-24 g

1713-Estradiol (s.c. implants)

0.015 mg/ animal

6 weeks

2 days

2 days

'I'1

,,,t

E

30 g

Estradiol undecylate (Progynon-Depot; s.c. and intraperitoneally in sesame oil) Estradiol benzoate microcrystalline suspension (s.c. inoculation) Estradiol benzoate microcrystalline suspension (s.c. inoculation) Estradiol cypionate (Sigma; s.c. inoculation in corn oil) Estradiol valerate (Squibb; s.c. inoculation in sesame oil)

0 C~ m rr,n 0

McGrory and 992) Garber (19921

|

I"" n

z

"111

Ili 0 -I m 0 z

-4 z m

i:

"o z m

0 z -I 3: Ill mm

Abraham et aL (1996) Van Andel et al. (1996b)

*Trichomonads and C. albicans administered in a mixed inoculum. 1 Percentage of animals infected at initial sampling point does not necessarily reflect percentage infected at maximum day of infection -- see individual references for more details. s.c., subcutaneous; NA, data not available in original report. Adapted from Kulda (1990), with permission.

z ,-I :0 O m z I-

O c In Ili

i: 0

Ill I-" 30

844

S.F. Hayward-McClelland, K. L. Delgaty and G. E. Garber

Rockville, MD; strain #4356) is used in the protocol (McGrory and Garber, 1992; Abraham et al., 1996). A startup culture is streaked on to Bacto Lactobacilli MRS agar plates (Difco Laboratories, Detroit, MI), and is then subcultured into 10 ml Bacto Lactobacilli MRS broth (Difco Laboratories) in glass screw-capped tubes. Cultures are incubated in 5% CO2 at 37°C, and are passaged every 2-3 days. At least two to three passages are performed before use in the protocol.

and 1), the T. vaginalis culture (at log phase) is counted on the hemacytometer and the total number of organisms is calculated. The cells are then harvested by centrifugation (Omnifuge RT) for 10 minutes at 900g (at 4°C), and washed three times in cold, sterile PBS (pH 7.2). The final pellet is resuspended in media to a final concentration of 2.5 x 107 cells per ml. The prewarmed (37 ° C) resuspension media is composed of TYI-S-33 supplemented with 10% FBS and 0.32% agar (QueBact, Quelab Laboratories, Montreal, Canada; McGrory and Garber, 1992; Meysick and Garber, 1992; Abraham et aL, 1996). Once the pellet is resuspended, the cells are counted again in order to confirm the concentration of cells in the sample. Necessary adjustments to the concentration are made at this point. Once the concentration of cells is established, it is advisable to passage a small amount of the sample into fresh media to ensure the viability of cells.

Preparation of inocula

Inoculation process

L. acidophilus

All mice are given two intravaginal inoculations (Days-7 and -6) of 20 lttl of L. acidophilus (101° cfu/ml). Similarly, they are inoculated on Days 0 and 1 with the same volume ofT. vaginalis (2.5 x 107 cells/ml; McGrory and Garber, 1992; Abraham et aL, 1996). Intravaginal inoculation of the mice is a delicate process, but can be relatively stress-free for the mouse when it is done quickly in the following manner. It is important to be prepared before starting any manipulations with the mice. The inocula are introduced into the mouse vagina with an Eppendorf pipette (Brinkmann Instruments, Westbury, NY), which is prepared before removing the mouse from its cage. Once the pipette is ready, the mouse can be picked up by the base of the tail and set on the top of the cage in such a way that it is able to grasp the lid with its front feet. While holding the base of the tail, the mouse is lifted slightly so that the vagina can be viewed easily. The inoculum can then be delivered by carefully inserting the tip of the pipette into the vagina and dispelling the contents. Inoculation protocols developed by other researchers are presented in Table 100.2.

-70°C (cryopreserved with 20% heat-inactivated FBS and 10% dimethyl sulfoxide (BDH-Associate of E. Merck, Darmstadt, Germany)).

L. acidophilus L. acidophilus (American Type Culture Collection (ATCC),

On the day before L. acidophilus inoculation into the mouse, a 1 liter volume of MRS broth (at 37°C) is seeded with 1 ml of pure L. acidophilus subculture (grown to log phase). The culture is then left to grow overnight at 37°C in 5% CO2. On the days of inoculation (Days-7 and -6 of the protocol), the culture is quantified by measuring absorbance at 650nm in a spectrophotometer (Beckman DU-88). Absorbance can be correlated with colony-forming units (cfu) per ml with a previously plotted titration curve). The culture is quantified before and after harvest of the L. acidophilus in order to achieve a more accurate estimate of bacterial concentration. Organisms are harvested by centrifugation for 10 minutes at 5000g at 4 °C (Beckman centrifuge, Model J2-21M). The cells are then washed with cold, sterile phosphate-buffered saline (PBS; pH 7.2) three times, and the resulting pellet is resuspended in MRS broth to achieve a final concentration of 101°L. acidophilus/ml. Before inoculation, a Gram stain is done to insure that the culture is not contaminated. To verify the concentration of L. acidophilus inoculated into the mouse, serial 10-fold dilutions in PBS are made from the inoculum. The actual number ofL. acidophilus cfu is determined by spreading 1001ttl of each dilution on to MRS plates, which are then incubated at 37°C (5% CO2); bacterial cfu are counted at 48 hours. All mice are inoculated twice (Days-7 a n d - 6 ; McGrory and Garber, 1992; Abraham et al., 1996).

T. vaginalis T. vaginalis culture (100 ml) is grown to log phase in preparation for inoculation. On the days of inoculation (Days 0

Key parameters to monitor infection Presence of intravaginal infection with L. acidophilus and T. vaginalis is confirmed by vaginal wash (McGrory and Garber, 1992; Meysick and Garber, 1992; Abraham et al., 1996). The wash technique is carried out in the same fashion as the inoculation procedure. Once the mouse is restrained, the pipette tip is inserted into the vagina and 50 ~1 of wash media is injected and drawn back into the pipette tip several times until it is turbid. To confirm the presence of L. acidophilus infection, a

ANIMAL MODELS OF T. VAGINALIS INFECTION WITH EMPHASIS ON THE INTRAVAGINAL MOUSE MODEL

control group of mice is washed with pre-warmed (37°C) MRS broth 1-2 days before T. vaginalis inoculation. The wash material is inoculated into a glass screwcapped tube containing MRS supplemented with 5 ~tg/ml ciprofloxacin (Cipro I.V., Bayer, Etobicoke, Canada) and 20~g/ml metronidazole, which inhibit the growth of other vaginal bacteria. The tubes are incubated at 37°C in 5% CO2 for 24-48 hours. Duration of infection with T. vaginalis is determined by washing with 50gl pre-warmed TYI medium supplemented with 10% FBS. The washes are inoculated into glass screw-capped tubes containing pre-warmed TYI supplemented with 10% FBS, 300 U/ml penicillin, 300}.tg/ml streptomycin, 2.5~tg/ml amphotericin B and 101t.tg/ml gentamicin (Gentamicin Reagent Solution, Gibco BRL); the antibiotics are included to reduce bacterial contamination. The tubes are incubated at 37°C (5% CO2) at a 45° angle, and examined daily for the presence of motile T. vaginalis using an inverted microscope (McGrory and Garber, 1992; Meysick and Garber, 1992; Abraham et al., 1996). Because false negatives can be misleading, lack of infection in an individual mouse should be concluded only after two consecutive negative washes (Coombs et al., 1986; Abraham et al., 1996).

Antimicrobial therapy Most preclinical trials involving antitrichomonal chemotherapy agents were conducted during the 1960s and 1970s. During this time, the mouse subcutaneous and intraperitoneal models of T. vaginalis infection were most popular, followed by the intravaginal rat and hamster models (for reviews, including references to these trials, see Ryley and Stacey, 1963; Michaels, 1968; Kulda, 1990). Metronidazole, the current therapy for trichomoniasis, was originally tested using the subcutaneous mouse model (Cosar and lulou, 1959). Because a satisfactory cure had been found, therapy has not expanded beyond the nitroimidazoles. By the time an intravaginal mouse model became available, interest in preclinical trials for antitrichomonal drugs had faded, and thus few new studies were conducted. In an effort to test the validity of the model itself, some researchers have used metronidazole and other commercial anti-trichomonal agents (Wildfeuer, 1974; Meingassner, 1977) to cure mouse intravaginal infections. Others have employed the model to study the efficacy of new drugs (Bremner et aL, 1986a, 1987; Wang, 1993; Table 100.3). Because of occasional intolerance to metronidazole, and the emergence of metronidazole-resistant strains of T. vaginalis, the need for novel treatment and protection strategies is becoming more clear. This may renew interest in the use of the intravaginal mouse model for preclinical drug trials.

845

The intravaginal mouse model can also be used in the search for a suitable T. vaginalis vaccine. Such a strategy may prove to be an important alternative to current therapies. While the research has been relatively limited, promising data have been published (Abraham et aL, 1996) that demonstrate the efficacy of a whole-cell vaccine preparation against T. vaginalis. The vaccine protocol works around the timeline of the infection protocol, and begins 56 days prior to the intravaginal inoculation with T. vaginalis. On D a y - 5 6 , logphase T. vaginalis is harvested (as per isolation procedure above), with the final pellet resuspended in PBS so that the desired concentration of cells is achieved. A volume of 100~1 of the cell preparation is suspended in an equal volume of Freund's complete adjuvant (FCA; Gibco BRL), and the total volume (200 ~1) is used for subcutaneous immunization in the side of the abdominal/groin area. The same amount of the cell preparation suspended in an equal volume of Freund's incomplete adjuvant (FIA; Gibco BRL) is used for booster immunization (in the side opposite the first immunization) at D a y - 2 8 . Once the T. vaginalis is suspended in the adjuvant, the cells are rendered immobile and will cease to grow. Experiments have shown that a concentration of 9 × 10 6 T. vaginalis/ml (before addition of adjuvant) is optimal for immunization. The same study illustrated the importance of the booster immunization as well as the need for an adjuvant in eliciting an immune response in the mice (Abraham et al., 1996). Abraham et al. (1996) showed that mice that were vaginally infected, treated with metronidazole, and reinfected vaginally, did not develop protective immunity or an increased ability to clear infection. This mirrors the human condition in which women suffer numerous reinfections without developing protective immunity after vaginal exposure. However, mice which had received subcutaneous immunization and boosting with the T. vaginalis vaccine prior to intravaginal challenge were significantly less likely to develop infection. Only 25% of immunized mice were infected after 7 days, while 91% of sham-immunized and naive mice were infected at this timepoint. The mice also demonstrated a significantly increased rate of trichomonad clearance when compared with animals which had received no immunization. While only 4% of mice receiving the vaccine and booster still harbored the organism after 28 days, 52% of those not immunized with T. vaginalis vaccine were still infected. In addition, a measurable serum and vaginal antibody response was observed in mice immunized with T. vaginalis previous to intravaginal challenge (Abraham et aL, 1996). Thus, the method of antigen presentation to the immune system (systemic versus vaginal) may be important in inducing an immune response. This study supports the notion that a vaccine could be an effective anti-trichomonal therapy.

(30 ob

Table 100.3 Drug efficacy in the intravaginal and subcutaneous Trichomonas vaginalis infections in the mouse model Reference

Drug

Dosage of drug

Effect on vaginal infection

Dosage of drug

Effect on subcutaneous infection*

Meingassner (1977)

Metronidazole Tinidazole Nimorazole Ornidazole Metronidazole

3.71 mg/kg p.o. 2, 18, 24 p.i. 1.41 mg/kg 5.62 mg/kg 4.57 mg/kg 50 mg/kg p.o.o.d, x 5 days:l:

Dosages required to clear infection in 50% of animals (ED,0) 100% curative

10.9 mg/kg p.o. 2, 18, 24 hours p.i. 7.5 mg/kg 33.9 mg/kg 10.6 mg/kg 15 mg/kg i.v. 2, 18, 24 hours p.i.

Dosages required to clear infection in 50% of animals (EDs0)

Leupeptin Metronidazole

50 mg/kg i.v. 2, 18, 24 hours p.i. 50 mg/kg p.o.o.d, x 5 days:~

Ineffective 100% curative

50 mg/kg i.v. 2, 18, 24 hours p.i. 15 mg/kg p.o.t.i.d, x 5 days p.i.

Abscess delayed to 50 hours p.i. 100% curative

Diflouromethylornithine Metronidazole

750 mg/kg p.o.t.i.d, x 5 days p.i.§ 50 mg/kg p.o.o.d, x 7 days:l:

Ineffective 100% curative

750 mg/kg p.o.t.i.d, x 5 days p.i. 75 mg/l~g p.o.b.i.d, x 7 days:l:

Abscess delayed to 75 hours p.i. 100% curative

Emodin

500 mg/kg p.o.o.d, x 5 days$

8/14 mice infected after 18 days, but 11/14 mice infected after 42 days

100 mg/kg s.c.b.i.d, x 2 days p.i.

Abscess delayed to 48 hours p.i.

500 mg/kg p.o. or 200 mg/kg s.c.b.i.d, x 7 days:l: 200 mg/kg s.c.b.i.d, x 3 days**

Decreased abscess volume

Bremner et al. (1986a)lBremner et al. (1987)1Wang (1993)t

* Method of Honigberg et al. (1966). 1 See methods of Coombs et al. (1986). ~:Administration of drug began 3 days post-infection (p.i.). § Administration of drug at-2, 2, 4, 6, 21,26, 30, 46, 50, 54, 70, 74, 77, 94, 98, 102 hours post-infection. ** Administration of drug began 2 days post-infection.

No abscess

Decreased no. of trichomonads retrieved from abscess

t~ "11 3:

I

o O o i i i

3 D.

,,m

IO (D i

4t 9}

Q.

I11 o

o"

ANIMAL MODELS OF T. VAGINALIS INFECTION WITH EMPHASIS ON THE INTRAVAGINAL MOUSE MODEL

Key parameters to monitor response to treatment The vaccine protocol includes vaginal washes with TYI to monitor the presence and persistence of vaginal T. vaginalis infection (described above). Vaginal washes with PBS are done 3 days after the TYI washes and are used to detect the level of antibody present in the vagina. Both TYI and saline vaginal washes are performed on a weekly basis following intravaginal inoculation with T. vaginalis (Abraham et aL, 1996). Mice are also tail-bled for serological observation throughout the vaccine experiment. A volume of 15-20btl of blood is taken from each mouse and is centrifuged to separate the serum (Abraham et aL, 1996). The enzyme-linked immunosorbent assay (ELISA) is used to assess antibody reactivity in serum and vaginal washes (Abraham et aL, 1996). Aside from the specific methods used to monitor response to vaccine treatment, there are a number of other parameters used to observe the overall well-being and health of the mice involved in the experiment. Some of these are rather subjective (activity level and general appearance), while other criteria can be assessed more objectively (weight, for example).

Advantages and disadvantages of the intravaginal model The ideal animal model of T. vaginalis infection should mimick human vaginal trichomoniasis, producing in the animal the symptoms, pathology and immune response which are similar to the human disease. The infection should be persistent, consistent, and reproducible. In this way, the variables can be controlled so that only one aspect of the digease can be studied at a given time. Many of the requirements of a good model are met in the intravaginal model. The intravaginal model has advantages over the subcutaneous and intraperitoneal models, since this route is more comparable to the human infection. The vagina is a more appropriate site for the T. vaginalis infection, since it is thought that virulence factors may be tissue-specific or only expressed within the vaginal milieu (Krieger et aL, 1990; Corbeil, 1995). Another advantage of this model is the fact that the infection produces a reliable immunoglobulin G response, which correlates with the presence or absence of vaginal infection (Abraham et aL, 1996). Some intravaginal mouse models have used T.foetus, the causative agent of bovine trichomoniasis (St Claire et aL, 1994; Van Andel et aL, 1996a). However, those which employ the human pathogen (T. vaginalis) are more relevant to the human disease. T. vaginalis does not occur naturally in mice, however, and this can present a disadvantage.

847

There may be host specificity with respect to virulence factors and immune response (Corbeil, 1995). Certainly, it would be ideal to study T. vaginalis infection in humans, but this is usually not feasible, particularly for pilot intervention studies. The intravaginal mouse model which employs lactobacilli (and thus more closely mimicks the human milieu) enjoys an added advantage over some previous intravaginal mouse models. This model results in increased consistency and duration of infection. McGrory and Garber (1992) found that, when they preinfected mice with lactobacilli, 69% were still infected with T. vaginalis after 28 days. Previously, the highest reported frequency of infection at this timepoint was 53% (Coombs et aL, 1986). One disadvantage of the model is that the pathology of the infection has not been adequately described in the literature, and there is some debate as to the extent of clinical symptoms seen in the animals. Van Andel et aL (1996b) found that all mice remained clinically normal throughout their study, but they did observe histologic changes, which they attributed to estrogen therapy. Patten et aL (1963) documented cytopathology in 22% of non-estrogenized mice, as well as delayed maturation of the vaginal epithelium. A more recent intravaginal mouse model of T.foetus infection (St Claire et aL, 1994; Hook et aL, 1995; Van Andel et aL, 1996a), as well as the guinea-pig model of T. vaginalis infection (Soska et aL, 1962; Kazanowska et aL, 1983), produces severe signs and symptoms of vaginal trichomoniasis, and for this reason may be more useful in studies of pathogenesis.

Contributions of the model to infectious disease therapy Pathology, pathogenesis and transmission Intravaginal models of trichomoniasis, particularly the guinea-pig model, have facilitated studies of pathogenesis, and have provided researchers with valuable information regarding virulence, initial events of infection, gross pathology, cytopathology, histopathology, and the role of environmental factors on T. vaginalis infection. The intravaginal mouse model has the potential for studies of transmission, since sexual transmission between male and female mice has been accomplished (Cappucinelli et aL, 1974). A clearer understanding of the pathogenesis of T. vaginalis will lead to the development of potential intervention strategies.

Chemotherapeutic agents Animals have been vital in preclinical drug trials to assess efficacy, routes of administration, mechanism of action, and various other aspects of drug pharmacology. Often, these studies follow the preliminary in vitro work and provide

848

S.F. Hayward-McClelland, K. L. Delgaty and G. E. Garber

information as to whether further research is warranted. Selected drug studies which compared drug efficacy in intravaginal versus subcutaneous and intraperitoneal infections have shown that the latter two infections are, by themselves, inadequate for the assessment of antitrichomonal agents. Variation in drug efficacy is seen when comparing subcutaneous and intravaginal infections, and this may be related to a combination of differences in drug delivery, drug pharmacology, or survival of T. vaginalis between the tissue sites (Bremner et al., 1986a, 1987).

Immunology and vaccine research The intravaginal mouse model has great potential for use in continued research concerning the dynamics of the host immune response and parasite immune evasion. Cappuccinelli's group (1974) was one of the first to look at the connection between intravaginal infection with T. vaginalis and the immune system. Application of this model to vaccine research is the most recent and perhaps the most exciting step in the model's evolution. Employment of the intravaginal mouse model in vaccine research enables novel investigation into vaccine preparation, protocols, routes of administration, adjuvants, immune response, and protection (Abraham et al., 1996). With continued research, a human clinical vaccine trial may well be on the horizon. The eventual refinement of a human vaccine for T. vaginalis will be the culmination of many years of research, with animal models playing a key role in the process.

References Abraham, M. C., Desjardins, M., Filion, L. G., Garber, G. E. (1996). Inducible immunity to Trickomonas vaginalis in a mouse model of vaginal infection. Infect. Immun., 64, 3571-3575. Ackers, J. P. (1990). Immunologic aspects of human trichomoniasis. In Trickomonads Parasitic in Humans (ed Honigberg B. M.), pp. 36-52. Springer-Verlag, New York. Bhatt, R., Abraham, M., Petrin, D., Garber, G. E. (1996). New concepts in the diagnosis and pathogenesis of Trichomonas vaginalis. Can. ]. Infect. Dis., 7, 321-325. Bremner, A. F., Coombs, G. H., North, M. J. (1986a). Antitrichomonal activity of the protease inhibitor leupeptin. IRS Med. Sci., 14, 555-556. Bremner, A. F., Coombs, G. H., North, M. J. (1986b). Studies on Trichomonad pathogenicity: The effects of Trickomonas vaginalis on mammalian cells and mice. Acta Univ. Carolinae (Prague) Biol., 30, 381-386. Bremner, A. F., Coombs, G. H., North, M. J. (1987). Antitrichomonal activity of 0~-diflouromethylornithine. ]. Antimicrob. Ckemotker., 20, 405-411. Cameron, D. W., Padian, N. S. (1990). Sexual transmission of HIV and the epidemiology of other sexually transmitted diseases. AIDS, 4 (suppl. 1), $99-S 103.

Cappuccinelli, P., Lattes, C., Gagliani, I., Ponzi, A. N. (1974). Features of intravaginal Trichomonas vaginalis infection in the mouse and the effect of oestrogen treatment and immunodepression. G. Batteriol. Virol. Immunol. Ann. Osp. Maria Vittoria Torino (Parte I: Ser Microbiol.), 67, 31-40. Cavier, R., Mossion, X. (1956). Essais d'infestation experimentale de la ratte par Trichomonas vaginalis (Donne, 1837). C. R. Acad. Sci. (Paris), 242, 2412-2414. Cavier, R. E., Gobort, J. G., Savel, J. (1972). Application of a method of intraperitoneal infection of the mouse with Trichomonas vaginalis for the pharmacological study of trichomonacides (in French). Ann. Pharm. Ft., 30, 637-642. Coombs, G. H., Bremner, A. F., Markham, D. J., Latter, V. S., Wakers, M. A., North, M. J. (1986). Intravaginal growth of Trichomonas vaginalis in mice. Acta Univ. Carolinae (Prague) Biol.,30,387-392. Corbeil, L. B. (1995). Use of an animal model of trichomoniasis as a basis for understanding this disease in women. Clin. Infect. Dis., 21 (suppl. 2), S158-S161. Corbeil, L. B., Chatterjee, A., Foresman, L., Westfall, J. A. (1985). Ultrastructure of cyclic changes in the murine uterus, cervix and vagina. Tissue Cell, 17, 53-68. Cosar, C., Julou, L. (1959). Activit~ de l(2-hydroxyethyl)-2methyl-5-mitroimidazole (8823 R.P.) vis-fi-vis des infections exp&imentales ~i Trichomonas vaginalis. Ann. Inst. Pasteur (Paris), 96, 238-241. Diamond, L. S., Harlow, D. R., Cunnick, C. C. (1978). A new medium for the axenic cultivation ofEntamoeba histolytica and other Entamoeba. Trans. R. Soc. Trop. Med. Hyg., 72, 431-432. Fouts, A. C., Kraus, S. J. (1980). Trichomonas vaginalis: reevaluation of its clinical presentation and laboratory diagnosis. J. Infect. Dis., 141,137-143. Fox, R. R., Laird, C. W. (1970). Sexual cycles. In Reproduction and Breeding Techniques for Laboratory Animals (ed Hafez, E.S.E.), pp. 107-122. Lea & Febiger, Philadelphia. Garber, G. E., Lemchuk-Favel, L. T. (1990). Association of production of cell-detaching factor with the clinical presentation of Trichomonas vaginal& J. Clin. Microbiol., 28, 2415-2417. Garber, G. E., Sibau, L., Ma, R., Proctor, E. M., Shaw, C. E., Bowie, W. R. (1987). Cell culture compared with broth for detection of Trichomonas vaginalis. J. Clin. Microbiol., 25, 1275-1279. Gardner, W. A. Jr, Culberson, D. E., Scimeca, J. M., Brady, A. G., Pindak, F. F., Abee, C. R. (1987). Experimental genital trichomoniasis in the squirrel monkey (Saimiri sciureus). Genitourin. Med., 63, 188-191. Hanna, N. F., Taylor-Robinson, D., Kalodiki-Karamanoli, M., Harris, J. R. W., McFadyen, I. R. (1985). The relation between vaginal pH and the microbiological status in vaginitis. Br. J. Obstet. Gynaecol., 92, 1267-1271. Heine, P., McGregor, J. A. (1993). Trichomonas vaginalis: a reemerging pathogen. Clin. Obstet. Gynecol., 36, 137-144. Hollander, D. H., Gonder, J. D. (1985). Indigenous intravaginal pentatrichomonads vitiate the usefulness of squirrel monkeys (Saimiri sciurius) as models for human trichomoniasis in men. Genitourin. Med. , 61, 212. Holmes, K. K., Handsfield, H. H., Wang, S. P., Wentworth, B. B., Turck, M., Anderson, J. B., Alexander, E. R. (1975). Etiology of nongonococcal urethritis. N. Engl. J. Med., 292, 1199-1205. Honigberg, B. M. (1978). Trichomonads of importance in human medicine. In Parasitic Protozoa (ed. Kreier, J. P.), pp. 275-454. Academic Press, New York.

ANIMAL MODELS OF T. VAGINALIS INFECTION WITH EMPHASIS ON THE INTRAVAGINAL MOUSE MODEL

Honigberg, B. M., Livingstone, M. C., Frost, J- K. (1966). Pathogenicity of fresh isolates of Trickomonas vaginalis. The "mouse assay" versus clinical and pathologic findings. Acta Cytol. 10, 353-361. Hook, R. R. Jr, St Claire, M. C., Riley, L. K., Franklin, C. L., Besch-Williford, C. L. (1995). Tritrickomonasfoetus: comparison of isolate virulence in an estrogenized mouse model. Exp. ParasitoL, 81,202-207. lacoby, R. O., Fox, 1. G. (1984). Biology and diseases of mice. In Laboratory Animal Medicine (ed. Fox, J., Cohen, B., Loew, F.), pp. 32-89. American College of Laboratory Animal Medicine Series. Academic Press, New York. lirovec, O., Petru, M. (1968). Trickomonas vaginalis and trichomoniasis. Adv. Parasitol., 6, 117-188. Kazanowska, W., Kuczynska, K., Skrrzypiec, R. (1983). Pathology of T. vaginalis infection in experimental animals. Wiad. ParazytoL, 29, 63-66. Krieger, J. N. (1984). Prostatitis syndromes: pathophysiology, differential diagnosis, and treatment. Sex. Transm. Dis., 11, 100-112. Krieger, J. N. (1990). Epidemiology and clinical manifestations of urogenital trichomoniasis in men. In Trichomonads Parasitic in Humans (ed Honigberg, B. M.), pp. 235-245. Springer-Verlag, New York. Krieger, J. N., Wolner-Hanssen, P., Stevens, C., Holmes, K. K. (1990). Characteristics of Trichomonas vaginalis isolates from women with and without colpitis macularis.J. Infect. Dis., 161, 307-311. Krieger, J. N., Jenny, C., Verdon, M. et al. (1993). Clinical manifestations of trichomoniasis in men. Ann. Intern. Med., 118, 844-849. Kulda, J. (1990). Experimental animals in studies of T. vaginalis infection. In Trichomonads Parasitic in Humans (ed. Honigberg, B. M.), pp. 112-153. Springer-Verlag, New York. Laga, M., Manoka, A., Kivuvu, M. et al. (1993). Non-ulcerative sexually transmitted diseases as risk factors for HIV-1 transmission in women: results from a cohort study. AIDS, 7, 95-102. Laga, M., Alary, M., Nzila, N. et al., (1994). Condom promotion, sexually transmitted diseases treatment, and declining incidence of HIV-1 infection in female Zairian sex workers. Lancet, 344, 246-248. Landolfo, S., Martinotti, M. G., Martinetto, P., Forni, G., Rabagliata, A. M. (1981). Trichomonas vaginal#: dependence of resistance among differential mouse strains upon the non-H-2 gene haplotype, sex, and age of recipient host. Exp. Paras#ol., 52,312-318. Larsen, B. (1993). Vaginal flora in health and disease. Clin. Obstet. Gynecol., 36, 107-121. Lossick, J. G. (1982). Treatment of Trichomonas vaginalis infections. Rev. Infect. Dis., 4 (suppl.), $801-$818. Lossick, J. G. (1990). Epidemiology of urogenital trichomoniasis. In Trichomonads Parasitic in Humans (ed Honigberg, B. M.), pp. 311-323. Springer-Verlag, New York. Lossick, J. G., Kent, H. L. (1991). Trichomoniasis: trends in diagnosis and management.Am. J. Obstet. Gynecol., 165, 1217-1222. Maestrone, G., Semar, R. (1967). Experimental infection with Trichomonasfoetus in guinea pigs. Chemotherapia, 12, 137-145. Mardh, P. A., Colleen, S. (1975). Search for uro-genital tract infections in patients with symptoms of prostatitis. Studies on aerobic and strictly anaerobic bacteria, mycoplasmas, fungi, trichomonads and viruses. Scand. J. Urol. Nephrol., 9, 8-16.

849

McGrory, T., Garber, G. E. (1992). Mouse intravaginal infection with Trichomonas vaginalis and role of Lactobacillus acidophilus in sustaining infection. Infect. Immun., 60, 2375-2379. Meingassner, I. G. (1977). Comparative studies on the trichomonacidal activity of 5-nitroimidazole-derivatives in mice infected s.c. or intravaginally with T. vaginalis. Experientia, 33, 1160-1161. Meingassner, 1- G., Nesvedba, H., Meith, H. (1981). New chemotherapeutic nitroheterocycles active against 5-nitroimidazole-resistant strains of trichomonads. Arzneim.-Forsck., 31, 6-8. Meysick, K. C., Garber, G. E. (1992). Interactions between Trichomonas vaginalis and vaginal flora in a mouse model. ]. Parasitol., 78, 157-160. Michaels, R. M. (1968). Chemotherapy of trichomoniasis. Adv. Chemotker., 3, 39-108. Nicoletti, N. (1961). The problem of trichomoniasis of the lower genital tract in the female. Br. ]. Vener. Dis., 37, 222-228. Olfert, E. D., Cross, B. M., McWilliam, A. A. (eds) (1993). Guide to the Care and Use of Experimental Animals, vol. 1, 2nd edn. Canadian Council on Animal Care, Bradda Printing Services, Ottawa, Ontario. Paavonen, I. (1983). Physiology and ecology of the vagina. Scand. J. Infect. Dis., 40 (suppl.), 31-35. Patten, S. F. Jr., Hughes, C. P., Reagan, 1- W. (1963). An experimental study of the relationship between Trickomonas vaginal# and dysplasia in the uterine cervix. Acta Cytol., 7, 187-190. Petrin, D., Delgaty, K., Bhatt, R., Garber, G. E. (1998). Clinical and microbiological aspects of Trichomonas vaginalis. Clin. Microbiol. Rev., 11,300-317. Rein, M. F. (1990). Clinical manifestations of urogenital trichomoniasis in women. In Trichomonads Parasitic in Humans (ed Honigberg, B. M.), pp. 225-234. Springer-Verlag, New York. Rein, M. F., Chapel, T. A. (1975). Trichomoniasis, candidiasis, and the minor venereal diseases. Clin. Obstet. Gynecol., 18, 73-88. Rein, M. F., Holmes, K. K. (1983). Non-specific vaginitis, vulvovaginal candidiasis and trichomoniasis: clinical features, diagnosis and management. In Current Clinical Topics in Infectious Diseases (eds Remington, 1., Swartz, M. N.), pp. 281-315. Blackwell Scientific Publications, New York. Ryley, I. F., Stacey, G. 1- (1963). Experimental approaches to the chemotherapy of trichomoniasis. Parasitology, 53, 303-320. Soska, S., Kazanowska, W., Kuczynska, K. (1962). Injury of the epithelium of the vagina caused by Trickomonas vaginalis in experimental animals. Wiad. ParazytoL, 8, 209-215. St Claire, M. C., Riley, L. K., Franklin, C. L., Besch-Williford, C. L., Hook, R. R., lr. (1994). Experimentally induced intravaginal Tritrichornonasfoetus infection in the estrogenized mouse. Lab. Animal Sci., 44, 430-435. Street, D. A., Taylor-Robinson, D., Hetherington, C. M. (1983). Infection of female squirrel monkeys (Saimiri sciureus) with Trickomonas vaginalis as a model of trichomoniasis in women. Br. ]. Vener. Dis., 59, 249-254. Takahashi, T., Old, L. l., Boyse, E. A. (1970). Surface alloantigens of plasma cells.]. Exp. IVied., 131, 1325-1341. Teras, l., Roigas, E. (1966). Characteristics of the pathomorphological reaction in cases of experimental infection with Trickornonas vaginalis. Wiad. ParazytoL, 12, 161 - 172. Van Andel, R. A., Franklin, C. L., St Claire, M. C., Riley, L. K., Besch-Williford, C. L., Hook, R. R., Jr. (1996a). Lesions of

850

S.F. Hayward-McClelland, K. L. Delgaty and G. E. Garber

experimental genital Tritrichomonasfoetus infections in estrogenized BALB/c mice. Vet. Pathol., 33, 407-411. Van Andel, R. A., Kendall, L. V., Franklin, C. L., Riley, L. K., Besch-Williford, C. L., Hook, R. R., Jr. (1996b). Sustained estrogenization is insufficient to support long-term experimentally induced genital Trichomonas vaginalis infection on BALB/c mice. Lab. Animal Sci., 46, 689-690. Wang, H-W. (1993). Antitrichomonal action ofemodin in mice.J. Ethnopharmacol., 40, 111-116.

Wildfeuer, V. A. (1974). Die chemotherapie der vaginalen Trichomoniasis und Candidosis der Maus. Arzneim.-Forsch., 24,937-943. Wolner-Hanssen, P., Krieger, J. N., Stevens, C. E. et aL (1989). Clinical manifestations of vaginal trichomoniasis. JAMA, 261, 571-576. World Health Organization. (1995). An overview of selected curable sexually transmitted diseases, pp. 2-27. In Global Program on AIDS. World Health Organization, Geneva.

Chapter 101

Animal Models of Cryptosporidium Gastrointestinal Infection D. S. Lindsay, B. L. Blagburn and S. J. Upton

Introduction Human cryptosporidiosis is caused by an Apicomplexan parasite, Cryptosporidium parvum. Infection can cause life-threatening diarrheal disease in immunocompromised humans. The infection is persistent and many acquired immunodeficiency syndrome (AIDS) and other severely immunocompromised patients remain infected for several years or for their life. Immunocompetent individuals also suffer clinical disease but develop immunity and usually clear the parasite. Laboratory models, especially the neonatal mouse, immunocompromised rat, and severe combined immunodeficiency (SClD) mouse, have helped identify potential effective agents for treatment and to elucidate many of the mechanisms of immunity to this intracellular parasite. The present chapter summarizes these three models.

Background of human infection Interest in human cryptosporidiosis was initiated with the advent of the AIDS epidemic and the large numbers of cases seen in these immunocompromised hosts (Current et aL, 1983; Fayer and Ungar, 1986; O'Donoghue, 1995). Profuse, watery diarrhea is the main clinical manifestation of human cryptosporidiosis. Associated symptoms are cramps, abdominal pain, low-grade fever, nausea, and vomiting; malaise, fatigue, headache, myalgia, and anorexia are less common symptoms (O'Donoghue, 1995). The length of time the diarrhea remains is dependent on the immune status of the individual. The duration is generally a few days to a few weeks in immunocompetent individuals. The diarrhea persists for months to years in immunocompromised patients and can be life-threatening. Many antimicrobial compounds have been examined and some are highly effective in animal models (Blagburn and Soave, 1997).

Background of animal models The genus Cryptosporidium was first described from laboratory mice by Tyzzer in 1907 (Tyzzer, 1907, 1910). The type Handbook of Animal Models of Infection

ISBN 0-12-775390-7

species is C. muris which was observed in the gastric glands of the stomach. This species has received much less attention than C. parvurn which was described from the small intestines of mice and rabbits by Tyzzer in 1912 (Tyzzer, 1912). Soon after C. parvum was recognized as a serious pathogen of humans, scientists began work on developing mouse models for the parasite and it was determined that most outbrecl strains of weaned or adult mice were resistant to experimental infection but nursing animals could be readily infected (Tzipori et al., 1980; Sherwood et al., 1982; Current and Reese, 1986).

Animal species Mice and rats are the animal species most often used. Hamsters, guinea-pigs, cats, dogs, calves, pigs, opossums, primates , and chickens have been used as animal models of cryptosporidiosis (Lindsay, 1997). However, mice and rats have been the most frequently used in antimicrobial chemotherapy studies and are the only species that will be discussed here. Nursing mice are more susceptible to infection than are weaned or adult mice. Congenitally immunosuppressed nursing mice develop persistent or prolonged infections (Sherwood et al., 1982; Heine et aL, 1984; Harp and Moon, 1991; Kuhls et aL, 1992; Aguirre et aL, 1994). Immunocompetent nursing mice develop patent infections if inoculated when less than 12-14 days of age (Sherwood et aL, 1982; Novak and Sterling, 1991; Upton and Gillock, 1996). Nursing rats (Tzipori et aL, 1980; Reese et aL, 1982) are more susceptible to C. parvum than are adult rats (Regh et aL, 1987; Meulbroek et aL, 1991). Immunocompetent adult mice and rats are resistant to infection (Rehg et aL, 1987; Enriquez and Sterling, 1991; Johansen and Sterling, 1991; Rasmussen and Healey, 1992). Chemically immunosuppressed (Rehg et aL, 1987, 1988a; Brasseur et aL, 1988; Meulbroek et aL, 1991; Yang and Healey, 1993) and genetically immunosuppressed mice and rats (Heine et aL, 1984; Ungar et aL, 1990, 1991; Gardner et aL, 1991; Harp and Moon, 1991; Mead et aL, 1991a; Kuhls et aL, 1992; Aguirre et aL, 1994) are susceptible to infection. Copyright © 1999AcademicPress All rights of reproduction in any form reserved

852

D.S. Lindsay, B. L. Blagburn and S. J. Upton

Storage, preparation of inocula

Infection process

Large numbers of C. parvum oocysts can be generated in calves. Calves are obtained when 2-3 days old. It is best if the calves have nursed or been fed colostrum. Calves are orally inoculated when 4-6 days of age with 5-20 million oocysts in water or any physiological saline. Calves are fed commercial milk replacer 3 times daily until midday of the fourth day postinfection. The calves are then placed on a commercial oral electrolyte solution 4 times daily. The use of oral electrolyte solution diminishes the amount of fecal fat that is present and aids in eventual concentration and clean-up of oocysts. The calves are placed in stainless steel cages that are 48 in long x 36 in wide × 42 in high with vinyl-coated mesh gratings and collecting pans underneath (LGL Animal Products, Byran, Texas, USA). Feces are collected daily for 6 days beginning on day 5 after inoculation. Feces collected from the pans is brought back to the laboratory and strained through a graded series of wire mesh sieves, with the final exclusion being 100 ~m. Approximately 15 liters of material is produced by a calf in a day. The suspension is concentrated by centrifugation at 800-2000g for 10-15 minutes and stored as a sludge in 2.5% (w/v) potassium dichromate solution (approximately 500ml from a total of 15 liters) at 4°C until used for further purification by sugar flotation or cesium chloride gradient centrifugation (Current, 1990). Oocysts will remain viable for 3-6 months. From 10 to 60 billion oocysts can be collected from a single calf using these methods. Prior to inoculation, the potassium dichromate solution is removed from oocysts by repeated centrifugations (2000 g for 10-15 minutes) in water or saline solution. Oocysts can be sterilized at 4°C in 10% (v/v) bleach solution for 5 minutes. The bleach solution is removed by washing by centrifugation in sterile saline or water solution. Oocysts are counted in a hemocytometer (Figure 101.1) prior to being used for experimental inoculations.

The oral 50% infectious dose (IDs0) for 5-day-old SwissWebster mice is between 100 and 500 oocysts (Ernest et aL, 1986), for suckling BALB/c mice 60 oocysts (Korich et aL, 1990) or 1000 oocysts (Riggs and Perryman, 1987), 600 oocysts for 3-5-day-old C57BL/6J mice (Aguirre et al., 1994), and 79 oocysts for 4-day-old CD-1 mice (Finch et aL, 1993). The numbers of oocyst orally inoculated can influence such parameters as prepatent period, site of intestinal colonization, and the numbers of oocyst excreted by infected hosts (Mead et aL, 1994). Little difference in clinical signs is usually noted with different doses of inoculum. Patent intestinal tract infections can be established in immunosuppressed C57BL/6N mice by intraperitoneal (i.p.) or intravenous (i.v.) injection but not subcutaneous (s.c.) or intramuscular (i.m.) injection of l xl06 oocysts (Yang and Healy, 1994a,b). The patent infections are delayed by several days in some i.p. and s.c. inoculated mice. The uterus is also colonized in some i.v. inoculated mice. Direct inoculation of 2 × 105 oocysts into the uterus will also produce intrauterine infections in BALB/c mice (Liebler et al., 1986). Patent infections can be produced in nursing mice by direct inoculation of oocysts in the colon (Riggs and Perryman, 1987). Direct intratracheal inoculation of 1 x 10~ oocysts will produce respiratory cryptosporidiosis in immunosuppressed but not immunocompetent rats (Meulbroek et aL, 1991).

! ,,

,

iI

i

i!'~J

i

Ij :i

ii

".

i

:"

Key parameters to monitor infection and response to treatment Oocyst excretion is the most reliable parameter to monitor in nursing mice and immunosuppressed rats because no clinical signs are present. If no oocysts are excreted at the appropriate time postinoculation by non-medicated nontreated animals, then no infection or a substandard infection has occurred. Clinical signs of dehydration, icterus and lethargy are helpful in SCID mice but take about 6 weeks to develop. Reduction in oocyst numbers between treated and non-medicated controls are the best indicator of a positive response to treatment.

Antimicrobial therapy

i

Figure 1 0 1 . 1 0 o c y s t s of Cryptosporidium parvum (several are marked by arrows)in a hemocytometer. Bar = 50 ILtm.

Antimicrobial agents must be given orally by gavage when using the nursing mouse model. Appropriate controls must be given the vehicle used to solubilize the test agent. Antimicrobial agents can be given in the drinking water or in food if the immunosuppressed rat or SCID mouse models are being used. Appropriate controls for vehicle must be used if in-water or in-feed methods of treatment are employed.

ANIMAL MODELS OF CRYPTOSPORIDIUM GASTROINTESTINAL INFECTION

Immunocompetent outbred nursing mouse model Outbred nursing mice should be between 5 and 9 days old when used because older mice do not develop reliable infections. Mice that are 7-8 days old appear to produce the most consistent results (Upton and Gillock, 1996). Additionally, litters should be cross-fostered based on weight to help negate any maternal influences (Blagburn et aL, 1991; Upton and Gillock, 1996). If either of these parameters are not met, then the results of chemotherapy studies can be misleading. Blagburn et aL (1991) developed an outbred ICR strain nursing mouse model for chemotherapy studies. In this model, mouse pups are cross-fostered when 2 days old based on weight prior to allocation of litters in to treatment groups. This produces litters with pups of approximately equal weight prior to initiation of the study. Pups are weighed daily and treated orally with a microdoser (Traco Atlas Microdoser Model 1003, Micro-jector Model 1003) and syringe pump equipped with a tuberculin syringe fitted with a 27G needle with microbore tubing (1 mm outer diameter; 0.5 mm inner diameter). A mark is placed on the tubing corresponding to the approximate length from its tip to the stomach of the mouse pup. The technician gently holds the pup's head in one hand and inserts the tube into the pup's mouth with the other hand. Gentle pressure is used and the tube slides down the esophagus. If the tube is forced with too much pressure there is a danger of killing the pup. The tube is inserted in the esophagus until the black line is in the pup's mouth (Figure 101.2). A foot pedal is pressed and the appropriate dose is administered by the microdoser. Because the pups are weighed daily, this allows for the volume of treatment compound to be adjusted daily for the increase or decrease in weight of each mouse pup. This keeps the dose agent constant throughout the study. Treatments are initiated when the mice in each group are 5 days old (usually 3 g in body weight). They are orally inoculated with 2x105 oocysts

8813

1 day later (6 days old). Pups are treated 2 hours after inoculation, and then daily for 6 days. Pups are killed 7 days post-infection and the intestinal tract from the pylorus to the rectum is removed and homogenized in 10ml of 2.5% (w/v) potassium dichromate solution for 30 seconds using a Tekmar tissumizer (Model SDT 1810S1) homogenizer. The numbers of oocysts present are determined by counting, using a hemocytometer (Figure 101.1). Comparisons of oocyst production in treated mice and controls are used to determine the efficacy of anticryptosporidial agents. Modifications to the model described above can be made to suit individual laboratory needs. Small amounts of inoculum or treatment volumes can be administered with a 10-201ttl automatic pipetter. Intestinal tissues can be homogenized in a motor-driven Teflon-coated tissue grinder or similar apparatus. Oocyst numbers can be counted by flow cytometery instead of manually on a hemocytometer (Mead et al., 1995).

Advantages and disadvantages of nursing mouse model The primary advantage of this model is that large numbers of animals can be used. The infection dynamics have been well-characterized. No immunosuppressive treatment is needed. Outbred mice are readily available and require no special housing needs. They are more hardy than inbred mice. Because of the small size (body weight), little test compound is needed. In general, results obtained in the neonatal mouse model have correlated with those observed in other animals. Disadvantages to this model are that neonatal mice are small and some practice is needed in handling and inoculating mice. The mice grow fast and adjustments for weight gain must be made. Occasionally some dams will stop producing milk or cannibalize their young, leading to their removal from the study.

Contributions of neonatal mouse model to anticryptosporidial therapy

Figure 101.2 Insertion of microbore tubing in to the esophagus of a neonatal mouse.

Several anticryptosporidial agents have been examined in the nursing mouse model (Table 101.1; Tzipori et al., 1982; Angus et all., 1984; Blagburn et al., 1991; Fayer and Ellis, 1993, 1994; Rohlman et al., 1993a; Cama et al., 1994; Fayer and Fetterer, 1995; Waters et al., 1997). The neonatal mouse model has been used to examine the developmental biology (Current and Reese, 1986; Tilly et al., 1990) and maternal and other immune mechanisms (Moon et al., 1988; Harp and Whitmire, 1991; Uhl et al., 1992; Waters and Harp, 1996) or pathogen interactions (Vitovec et all., 1991) of C. p a r v u m infections. Additionally, the mouse model is used as a bioassay for the effects various treatments on C. p a r v u m oocyst viability (Upton et al., 1988; Korich et al., 1990; Villacorta-Martinez et al., 1992; Fayer et al., 1991, 1997; Fayer, 1994, 1995).

854 Table

D.S. Lindsay, B. L. Blagburn and S. J. Upton 101.1 Antimicrobial agents examined against

Cryptosporidium parvum

Mouse strain

in n e o n a t a l m i c e

Agent

Dose (mg/kg)*

Results

BALB/c

Clarithromycin

200

+

BALB/c

Azithromycin

100 or 200

+

BALB/c

Erythromycin

100 or 200

+

BALB/c

Paromomycin

100 or 200

+

Inbred/outred

Clopidol

0.25 or 2.5

-

SCID

Atovaq uone

>_100

-

Inbred/outbred

Decoquinate

2.0 or 4.0

-

Inbred/outbred

Methylbenzoquate

0.25 or 2.5

-

C57

Ethopabate

28

-

In b r e d / o u t b r e d

Dinitolmide

0.125

+

Inbred/outbred

Robenidine

0.003 or 0.3

-

Inbred/outbred

Furaltedone

0.2 or 2.0

C57

Furaltadone

0.1

-

Inbred/outbred

Furazolidone

0.4 or 2.0

-

Inbred/outbred

Amprolium

0.25

+

C57

Amprolium

0.02 or 8

-

C57

Arprinocid

8

-

Inbred/outbred

Arprinocid

0.06

+

Inbred/outbred

Sulfaquinoxaline

2.8

+

C57

Sulfaquinoxaline

30

-

C57

Sulfamethazine

5

-

Outbred

Alborixin

1.5 or 2.5

+

Outbred

Lasalocid

20 or 30

+

Outbred

Maduramicin

1.0 or 2.5

+

C57

Monensin

0.04

-

Inbred/outbred

Salinomycin

0.06

+

C57

Salinomycin

0.02

-

C57

Nicarbazin

0.1

-

In b r e d / o u t b r e d

N icarbazin

0.125

-

C57

Enterolyte-N

0.02

-

C57

Trinamide

3

-

C57

Phenamidine

0.01

-

C57

Zoaquin

0.5

-

C57

Halafuginone

6

-

Outbred

Enrofloxacin

1.0 or 3.0

-

Outbred BALB/c C57

A r o m a t i c amidines Artemisinin Emtryl

2.8 or 11.3 200 or 400 4

+ -

BALB/c BALB/c BALB/c BALB/c BALB/c

Thiabendazole Parabendazole Oxibendazole Mebendazole Albendazole

100 30 5 or 8 or 7.5,

-

or 200 10 15 10 or 15

Adapted from Blagburn and Soave (1997), with permission. * Some studies were prophylactic and some were therapeutic. - = No activity; + = partial activity; + = demonstrable activity.

icated feed or by gavage. The weight of the rats, the amount of water and of medicated feed consumed is monitored every 1 or 2 weeks to monitor potential changes in treatmentJimmunosuppression parameters. Clinically, some rats will develop loose stools but diarrhea is not present. Cryptosporidial infections peak at 7 days post-infection and most parasites are present in the terminal 2 cm of the ileum. Extraintestinal involvement is not common in this model. Histological scoring of ileal tissue sections taken at 11 days is used to judge the efficacy of prophylactic treatments and 21 days post-infection to judge therapeutic treatments which are initiated on day 10 post-infection.

Advantages and disadvantages of immunosuppressed rat model Dexamethasone is readily obtainable and in-water immunosuppressive treatment is easy to accomplish. Outbred rats are also easy to obtain and work with. Young adult animals are used and rapid increases in weight, observed in nursing mice, is not a potential problem. Numerous studies have been done with this model and a large database is available for comparative purposes. Because of their size, more test agents must be available for study in rats than in mice. More room is also needed to house and maintain rats than mice. Rats will self-cure if dexamethasone is not continuously administered. Agents are more likely to have activity in this model than in the neonatal mouse or SCID mouse model and may reflect this tendency to self-cure. The currently used method of histological scoring should be replaced by quantitative oocyst counts.

Contributions of immunosuppressed rat model to anticryptosporidial therapy Several anticryptosporidial agents have been examined in the immunosuppressed rat model (Table 101.2; Rehg et aL, 1988b; Rehg, 1991a,b,c, 1993, 1994, 1995; Verdon et aL, 1994, 1995). It has also been used to examine the effects of immunopotentiators on C. parvurn infections (Rasmussen et aL, 1991, 1992, 1993).

Artificially immunosuppressed rat model

SClD mouse model

The dexamethasone-treated rat model was developed by Rehg et aL (1988a). In this model female Sprague-Dawley rats, 200-250g, are immunosuppressed by giving 0.25 mg/kg dexamethasone daily in the drinking water for 10 days prior to oral inoculation with 1-6× 102 C. parvurn oocysts (Rehg, 1991a,b). Dexamethasone must be continuously administered or the rats will self-cure the infection. Anticryptosporidial agents are given in the water, in med-

SCID mice have been used as models of cryptosporidiosis in AIDS patients (Mead et aL, 1991a,b, 1994, 1995; Kuhls et aL, 1992; Rohlman et aL, 1993a). Mead et aL (1994) critically examined the infection dynamics and clinical features of cryptosporidiosis in 6-8-week-old SCID mice. The mice were orally inoculated with 103, 104, 105, 106, or 107 oocysts. Mice inoculated with the lower numbers of oocysts have longer prepatent periods. All mice developed chronic

ANIMAL MODELS OF CRYPTOSPORIDIUM GASTROINTESTINAL INFECTION Table

101.2

Antimicrobial

Cryptosporidium

agents e x a m i n e d against in dexamethasone-treated

parvum

i m m u n o s u p p r e s s e d rats

Agent

Dose (mg/kg)*

Results

Halfuginone

37.5 or 75

-

Halfuginone Paromomycin

150, 300, 600 or 900 50

+ -

Paromomycin Gentamicin

100, 200 or 400 200

+ -

Neomycin Kanamycin A Polymyxin B Streptomycin

200 200 200 200

-

Azithromycin Azithromycin Clarithromycin

50, 100 or 200 400 400

+ + +

Oleandomycin Spiramycin Arprinocid Arprinocid Lasalocid

400 200 12.5 25 or 50 1.12

+ + + -

Lasalocid Monensin Salinomycin Diethyldithiocarbamate

2.25, 4.5, 9 or 18 9 9 37.5

+ -

Diethyldithiocarbamate

75, 150, 300, 600, or

+

900 Amphotericin B

20

Eflornithine Ivermectin Levamisole Thiabendazole Thalidomide Succinylsulfathiazole Sulfacetamide Sulfabenzamide Sulfachloropyridazine Sulfadiazine

3000 0.4 4 50 150 360 120 240 360 250

Sulfadimethoxine Sulfadimethoxine Sulfadoxine Sulfaguanidine Sulfamerazine Sulfameter Sulfamethazine Sulfamethizole Sulfamethoxazole Sulfamethoxypyridazine

10 20,40,80,120 160 120 200 120 175 480 320 160

Sulfanilamide Sulfanilic acid

120 120

-

Sulfanitran Sulfapyridine

200 240

-

-

855

infections. Hepatic involvement was present in all inoculation groups. Thirty to 40% of mice given 103-105 oocysts had hepatic involvement, While 80-90% of the mice inoculated with 107 oocysts had hepatic cryptosporidiosis. Some of these mice died or were euthanized due to hepatic cryptosporidiosis. The SCID mouse model presented by Mead et al. (1995) uses 6-8-week-old female SCID mice. Mice are maintained under pathogen-free conditions and housed in microisolator cages (Nalgene Labware, Rochester, NY) in high-efficiency laminar flow units (Labline, Maywood, NI). All cages, water, and bedding are sterilized before use and sterilized surgical clothing is worn when mice are handled (Mead et al., 1995). All animal manipulations are done on a high-efficiency particulate air-filtered bench. Because the SCID mouse is both an infection and disease model it can be used to examine both the prophylactic and therapeutic activities of an antimicrobial agent. Prophylactic studies are done bybeginning treatment prior to oral inoculation of 106 oocysts. The SCID mice are treated daily for 28 days. Fecal samples are examined for oocysts at weekly intervals. Portions of liver, gallbladder, ileum and large intestine are taken for histologic examination and microscopic lesion scoring. Therapeutic studies are done by orally inoculating mice with 106 oocysts and letting the infection become established for 4 weeks before treatments are begun. Mice are treated with test agents for 3 weeks. Fecal samples are examined for oocysts at weekly intervals. Portions of liver, gallbladder, ileum and large intestine are taken for histologic examination and microscopic lesion scoring.

A d v a n t a g e s and d i s a d v a n t a g e s of the SCID m o u s e model

+ + + + -

Sulfasalazine

400

-

Sulfathiazole Sulfisomidine

120 240

-

Sulfisoxizole

120

+

Adapted from Blagburn and Soave (1997), with permission. * Some studies were prophylactic and some were therapeutic. - = No activity; + = partial activity; + = demonstrable activity.

The primary advantage of the SCID mouse model is that it is both an infection and a disease model. However, diarrhea is not a common clinical sign. Extraintestinal infections are common and mimick what is observed in AIDS patients. Adult mice are used and are easier to handle than are neonatal mice. Additionally, test agents can be administered in the water or food. The main disadvantage is that this model is expensive and requires specialized animalhandling facilities. Because of their body size, more test agent is needed than in neonatal mice but less than in immunosuppressed rats.

Contributions of the SClD m o u s e model to anticryptosporidial t h e r a p y

Few antimicrobial agents have been examined in the SCID mouse model. Rohlman et aL (1993a) tested atovaquone against C. paruum infections in neonatal SCID mice and found little activity at doses of >100mg/kg. Mead et aL (1994) examined two ionophores in adult SCID mice and

856

determined that maduramicin and alborixin were both effective when given at 3 mg/kg. Cama et aL (1994) examined clarithromycin and its metabolite 14-OH clarithromycin in SCID mice and observed moderate activity for both agents. Several groups of researchers have used C. parvum in SCID mice to examine immune mechanisms (Mead et aL, 1991a,b; Kuhls et aL, 1992, 1994; McDonald et al., 1992; Chen et aL, 1993a,b; Rohlman et aL, 1993b) or importance of intestinal microflora (Harp et al., 1992).

References Aguirre, S. A., Masson, P. H., Perryman, L. E. (1994). Susceptibility of major histocompatibility complex (MHC) class I- and class II-deficient mice to Cryptosporidium parvum infection. Infect. Immun., 62, 697-699. Angus, K. W., Hutchison, G., Campbell, I., Snodgrass, D. R. (1984). Prophylactic effects of anticoccidial drugs in experimental murine cryptosporidiosis. Vet. Rec., 114, 166-168. Blagburn, B. L., Soave, R. (1997). Prophylaxis and chemotherapy: human and animal. In Cryptosporidium and cryptosporidiosis (ed. Fayer, R.), pp. 111-128. CRC Press, Boca Raton, Florida. Blagburn, B. L., Sundermann, C. A., Lindsay, D. S., Hall, 1. E., Tidwell, R. R. (1991). Inhibition of Cryptosporidium parvum in neonatal Hsd:(ICR)BR Swiss mice by polyether ionophores and aromatic amidines. Antimicrob. Agents Chemother., 35, 1520-1523. Brasseur, P., Lemeteil, D., Ballet, J. 1. (1988). Rat model for human cryptosporidiosis. ]. Clin. Microbiol., 26, 1037-1039. Cama, V. A., Marshall, M. M., Shubitz, L. F., Ortega, Y. R., Sterling, C. R. (1994). Treatment of acute and chronic Cryptosporidium parvurn infections in mice using clarithromycin and 14-OH clarithromycin. ]. Eu k. Microbiol., 41, 25S. Chen, W., Harp, J. A., Harmsen, A. G. (1993a). Requirements for CD4 + cells and gamma interferon in resolution of established Cryptosporidium parvurn infections. Infect. Imrnun., 61, 3928-3932. Chen, W., Harp, J. A., Harmsen, A. G., Havell, E. A. (1993b). Gamma interferon functions in resistance to Cryptosporidium parvum infection in severe combined immunodeficient mice. Infect. Imrnun., 61, 3548-3551. Current, W. L. (1990). Techniques and laboratory maintenance of Cryptosporidium. In Cryptosporidiosis of Man and Animals (eds Dubey, J. P., Speer, C. A., Fayer, R.), pp. 31-49. CRC Press, Boca Raton, Florida. Current, W. L., Reese, N. C. (1986). A comparison of endogenous development of three isolates of Cryptosporidium in suckling mice. ]. Protozool., 33, 98-108. Current, W. L., Reese, N. C., Ernst, J. V., Bailey, W. S., Heyman, M. B., Weinstein, W. M. (1983). Human cryptosporidiosis in immunocompetent and immunodeficient persons. Studies of an outbreak and experimental transmission. N. Engl. ]. Med., 308, 1252-1257. Enriquez, F., Sterling, C. R. (1991). Cryptosporidium infections in inbred strains of mice. ]. ProtozooL, 38, 100S-102S. Ernest, 1. A., Blagburn, B. L., Lindsay, D. S., Current, W. L. (1986). Infection dynamics of Cryptosporidium parvum in neonatal mice (Mus musculus). ]. ParasitoL, 72, 796-798.

D.S. Lindsay, B. L. Blagburn and S. J. Upton

Fayer, R. (1994). Effect of high temperature on infectivity of Cryptosporidium parvum oocysts in water. AppL Environ. MicrobioL, 60, 2732-2735. Fayer, R. (1995). Effect of sodium hypochlorite exposure on infectivity of Cryptosporidium parvum oocysts for neonatal BALB/c mice. Appl. Environ. MicrobioL, 61,844-846. Fayer, R., Ellis, W. (1993). Glycoside antibiotics alone and combined with tetracyclines for prophylaxis of experimental cryptosporidiosis in neonatal BALB/c mice. J. ParasitoL, 79, 533-558. Fayer, R., Ellis, W. (1994). Qinghaosu (artemisinin) and derivatives fail to protect neonatal BALB/c mice against Cryptosporidiurn parvum (CP) infection. J. Euk. MicrobioL, 41, 41S. Fayer, R., Fetterer, R. (1995). Activity of benzimidazoles against cryptosporidiosis in neonatal BALB/c mice. J. Parasitol., 81, 794-795. Fayer, R., Ungar, B. P. L. (1986). Cryptosporidium species and cryptosporidiosis. MicrobioL Rev., 50, 458-483. Fayer, R., Nerad, T., Rail, W., Lindsay, D. S., Blagburn, B. L. (1991). Studies on the cyropreservation of Cryptosporidium parvum. J. ParasitoL, 77, 357-361. Fayer, R., Farley, C. A., Lewis, E. 1., Trout, 1. M., Graczyk, T. K. (1997). Potential role of the eastern oyster, Crassostrea virginica, in the epidemiology of Cryptosporidium parvum. AppL Environ. MicrobioL, 63, 2086-2088. Finch, G. R., Daniels, C. W., Black, E. K., Schaefer, F. W., Belosevic, M. (1993). Dose response of Cryptosporidium parvum in outbred neonatal CD-1 mice. Infect. Immun., 59, 3661-3665. Gardner, A. L., Roche, I. K., Weikel, C. S., Guerrant, R. L. (1991). Intestinal cryptosporidiosis: pathophysiologic alterations and specific cellular and humoral immune responses in RNU/+ and RNU/RNU (athymic) rats. Am. J. Trop. Med. Hyg., 44, 49-62. Harp, J. A., Moon, H. W. (1991). Susceptibility of mast cell-deficient W/W ~ mice to Cryptosporidium parvum. Infect. Immun., 59, 718-720. Harp, J. A., Whitmire, W. M. (1991). Cryptosporidium parvum infection in mice: inability of lymphoid cells or culture supernatants to transfer protection from resistant adults to susceptible infants. J. Parasitol., 77, 170-172. Harp, J. A., Chen, W., Harmsen, A. G. (1992). Resistance to severe combined immunodeficient mice to infection with Cryptosporidium parvum: the importance of intestinal microflora. Infect. Immun., 60, 3509-3512. Heine, J., Moon, H. W., Woodmansee, D. B. (1984). Persistent Cryptosporidium infection in congenitally athymic (nude) mice. Infect. Immun., 43, 856-859. Johansen, G. A., Sterling, S. R. (1994). Detection of a prolonged C. parvum infection in immunocompetent adult C57BL/6 mice.J. Eu k. Microbiol., 41, 45S. Korich, D. G., Mead, J. R., Madore, M. S., Sinclar, N. A., Sterling, C. R. (1990). Effects of ozone, chlorine dioxide, chlorine, and monochloramine on Cryptosporidium parvum oocyst viability. Appl. Environ. Microbiol., 56, 1423-1428. Kuhls, T. L., Greenfield, R. A., Mosier, D. A., Crawford, D. L., Joyce, W. A. (1992). Cryptosporidiosis in adult and neonatal mice with severe combined immunodeficiency. J. Comp. Pathol., 106, 399-410. Kuhls, T. L., Mosier, D. A., Abrams, V. L., Crawford, D. L., Greenfield, R. A. (1994). Inability of interferon-gamma and aminoguanidine to alter Cryptosporidium parvum infection in

ANIMAL MODELS OF CRYPTOSPORIDIUM GASTROINTESTINAL INFECTION

mice with severe combined immunodeficiency.J. ParasitoL, 80, 480-485. Liebler, E. M., Pohlenz, I. F., Woodmansee, D. B. (1986). Experimental intrauterine infection in adult BALB/c mice with Cryptosporidium sp. Infect. Imrnun., 54, 255-259. Lindsay, D. S. (1997). Laboratory models of cryptosporidiosis. In Cryptosporidium and cryptosporidiosis (ed Fayer, R.) pp. 209-224. CRC Press, Boca Raton, Florida. McDonald, V., Deer, R., Uni, S., Iseki, M., Bancroft, G. J. (1992). muris and Immune response to Cryptosporidium Cryptosporidium parvum in adult immunocompetent or immunocompromised (nude and SCID) mice. Infect. Immun., 60, 3325-3331. Mead, 1. R., Arrowood, M. 1., Healey, M. C., Sidwell, R. W. (1991a). Chronic Cryptosporidium parvum infections in congenitally immunodeficient SCID and nude mice. J. Infect. Dis., 163, 1297-1304. Mead, J. R., Arrowood, M. J., Healey, M. C., Sidwell, R. W. (1991 b). C ryptosporidial infections in SCID mice reconstituted with human or murine lymphocytes.J. Protozool., 38, 59S-6 IS. Mead, 1. R., Ilksoy, N., You, X. et aL (1994). Infection dynamics and clinical features of cryptosporidiosis in SCID mice. Infect. Immun., 62, 1691-1695. Mead, J. R., You, X., Pharr, 1. E. et aL (1995). Evaluation ofmaduramicin and alborixin in a SCID mouse model of chronic cryptosporidiosis. Antimicrob. Agents Ckemotker., 39, 854-858. Meulbroek, J. A., Novilla, M. N., Current, W. L. (1991). An immunosuppressed rat model of respiratory cryptosporidiosis. J. Protozool., 38, 113S-115S. Moon, H. W., Woodmansee, D. B., Harp, J. A., Abel, S., Ungar, B. L. P. (1988). Lacteal immunity to enteric cryptosporidiosis in mice: immune dams do not protect their suckling pups. Infect. Immun., 56, 649-653. Novak, S. M., Sterling, C. R. (1991). Susceptibility dynamics in neonatal BALB/c mice infected with Cryptosporidium parvum. J. Protozool., 38, 102S-104S. O'Donoghue, P. J. (1995). Cryptosporidium and cryptosporidiosis in man and animals. Int. J. Parasitol., 25, 139-195. Rasmussen, K. R., Healey, M. C. (1992). Experimental Cryptosporidium parvum infections in immunosuppressed adult mice. Infect. Immun., 60, 1648-1652. Rasmussen, K. R., Martin, E. G., Arrowood, M. J., Healey, M. C. (1991). Effects of dexamethasone and dehydroepiandrosterone in immunosuppressed rats infected with Cryptosporidium parvum. J. Protozool., 38, 157S-159S. Rasmussen, K. R., Arrowood, M. J., Healey, M. C. (1992). Effectiveness of dehydroepiandrosterone in reduction of cryptosporidial activity in immunosuppressed rats. Antimicrob. Agents Ckemotker., 36, 220-222. Rasmussen, K. R., Martin, E. G., Healey, M. C. (1993). Effects of dehydroepiandrosterone in immunosuppressed rats infected with Cryptosporidium parvum. J. Paras#ol., 79, 364-370. Reese, N. C., Current, W. L., Ernst, J. V., Bailey, W. S. (1982). Cryptosporidiosis of man and calf: a case report and results of experimental infections in mice and rats. Am. J. Trop. Med. Hyg., 31,226-229. Rehg, J. E. (1991a). Anticryptosporidial activity is associated with specific sulfonamides in immunosuppressed rats. J. Paras#ol., 77, 238-240. Rehg, J. E. (1991b). Anti-cryptosporidial activity of macrolides in immunosuppressed rats. J. Protozool., 38, 228S-230S. Rehg, J. E. (1991c). Activity of azithromycin against cryp-

857

tosporidia in immunosuppressed rats. J. Infect. Dis., 163, 1293-1296. Rehg, J. E. (1993). Anticryptosporidial activity of lasalocid and other ionophorous antibiotics in immunosuppressed rats. J. Infect. Dis., 168, 1293-1296. Rehg, J. E. (1994). A comparison of anticryptosporidial activity of paromomycin with that of other aminoglycosides and azirthromycin in immunosuppressed rats. J. Infect. Dis., 170, 934-938. Rehg, J. E. (1995). The activity of halofuginone in immunosuppressed rats infected with Cryptosporidium parvum. J. Antimicrob. Chem., 35,391-397. Rehg, J. E., Hancock, M. L., Woodmansee, D. B. (1987). Characterization of cyclophosphamide-rat model of cryptosporidiosis. Infect. Imrnun., 55, 2669-2774. Rehg, J. E., Hancock, M. L., Woodmansee, D. B. (1988a). Characterization of dexamethasone-treated rat model of cryptosporidial infection. J. Infect. Dis., 158, 1406-1407. Rehg, J. E., Hancock, M. L., Woodmansee, D. B. (1988b). Anticryptosporidial activity of sulfadimethoxine. Antimicrob. Agents Chemother., 32, 1907-1908. Riggs, M. W., Perryman, L. E. (1987). Infectivity and neutralization of Cryptosporidium parvum sporozoites. Infect. Immun., 55, 2081-2087. Rohlman, V. C., Kuhls, T. L., Mosier, D. A. et aL (1993a). Therapy with atovaquone for Cryptosporidium parvum infection in neonatal severe combined immunodeficiency mice. J. Infect. Dis., 168, 258-260. Rohlman, V. C., Kuhls, T. L., Mosier, D. A., Crawford, D. L., Greenfield, R. A. (1993b). Cryptosporidium parvum infection after abrogation of natural killer cell activity in normal and severe combined immunodeficiency mice. J. Parasitol., 79, 295-297. Sherwood, D., Angus, K. W., Snodgrass, D. R., Tzipori, S. (1982). Experimental cryptosporidiosis in laboratory mice. Infect. Imrnun., 38, 471-475. Tilly, M., Upton, S. J., Freed, P. S. (1990). Comparative study on the biology Cryptosporidium serpentis and Cryptosporidium parvum (Apicomplexa: Cryptosporidiidae). J. Zoo. Wildl. Med., 21,463-467. Tyzzer, E. E. (1907). A sporozoan found in the peptic glands of the common mouse. Proc. Soc. Exp. Meal., 5, 12-13. Tyzzer, E. E. (1910). The extracellular coccidium, Cryptosporidium muris (gen. et sp. nov.), of the gastric glands of the common mouse.J. Med. Res., 18, 487-509. Tyzzer, E. E. (1912). Cryptosporidium parvum (sp. nov.) a coccidium found in the small intestine of the common mouse. Arch. Protistenkd., 26, 394-412. Tzipori, S., Angus, K. W., Campbell, I., Gray, E. W. (1980). Cryptosporidium: evidence for a single-species genus. Infect. Immun., 30, 884-886. Tzipori, S., Campbell, I., Angus, K. (1982). The therapeutic effects of 16 antimicrobial agents on Cryptosporidium infection in mice. Aust. J. Exp. BioL Med. Sci., 60, 187-190. Uhl, E. W., O'Connor, R. M., Perryman, L. C., Riggs, M. W. (1992). Neutralization-sensitive epitopes are conserved among geographically diverse isolates of Cryptosporidium parvum. Infect. Immun., 60, 1703-1706. Ungar, B. L. P., Burris, J.A., Quinn, C. A., Finkelman, F. D. (1990). New mouse models for chronic Cryptosporidium infection in immuno deficient hosts. Infect. Immun., 58, 961-969. Ungar, B. L. P., Kao, T. C., Burris, J. A., Finkelman, F. D. (1991).

858

Cryptosporidium infection in an adult mouse model: Independent roles of INF-gamma and CD4+ lymphocytes in protective immunity.J. Immunol., 147, 1014-1022. Upton, S. J., Gillock, H. H. (1996). Infection dynamics of Cryptosporidium parvum in ICR outbred suckling mice. Folia Parasitol., 43, 101-106. Upton, S. J., Tilley, M. E., Marchin, G. L., Fine, L. R. (1988). Efficacy of a pentaiodide resin disinfectant on Cryptosporidium parvum (Apicomplexa: Cryptosporidiidae) oocysts in vitro. J. Parasitol., 74, 719-721. Verdon, R., Polianski, J., Gaudebout, C., Marche, C., Garry, L., Pocidalo, J. J. (1994). Evaluation of curative anticryptosporidial activity of paromomycin in a dexamethasonetreated rat model. Antimicrob. Agents Chemother., 38, 1681-1682. Verdon, R., Polianski, J., Gaudebout, C. et al. (1995). Evaluation of high-dose regimen of paromomycin against cryptosporidiosis in the dexamethasone-treated rat model. Antimicrob. Agents Chemother., 39, 2155-2157. Villacorta-Martinez, I., Ares-Mazas, M., Duran-Oreiro, D., Lorenzo-Lorenzo, M. J. (1992). Efficacy of activated sludge in removing Cryptosporidium parvurn oocysts from sewage. Appl. Environ. Microbiol., 58, 3514-3516.

D.S. Lindsay, B. L. Blagburn and S. J. Upton

Vitovec, J., Koudela, B., Vladik, P., Hausner, O. (1991). Interaction of Cryptosporidium parvum and Campylobacter jejuni in experimentally infected neonatal mice. Zbl. Bakt. , 274, 548-559. Waters, W. R., Harp, J. A. (1996). Cryptosporidium parvum infection in T-cell receptor (TCR)-0~- and TCR-&deficient mice. Infect. Immun., 64, 1854-1857. Waters, W. R., Reinhardt, T. A., Harp, J. A. (1997). Oral administration of putrescine inhibits Cryptosporidium parvum infection of neonatal C57BL-6 mice and is independent of nitric oxide synthesis. J. ParasitoL, 83, 746-750. Yang, S., Healey, M. C. (1993). The immunosuppressive effects of dexamethasone administered in drinking water to C57BL/6N mice infected with Cryptosporidium parvum. J. Parasitol., 79, 626-630. Yang, S., Healey, M. C. (1994a). Patent gut infections in immunosuppressed adult C57BL/6N mice following intraperitoneal injection of Cryptosporidium parvum oocysts. J. Parasitol., 80, 338-342. Yang, S., Healey, M. C. (1994b). Development of patent gut infections in immunosuppressed adult C57BL/6N mice following intravenous inoculations of Cryptosporidium parvum oocysts. J. Eu k. Microbiol., 41, 67S.

Chapter 102

Animal Models of Entamoeba histolytica Infection S. L. Stanley Jr, T. Zhang and K. B. Seydel

Background of human infection Amebic dysentery and amebic liver abscess are major causes of morbidity and mortality worldwide, with approximately 50000000 cases of diarrhea and 50000 deaths each year from these diseases. (For reviews, see Ravdin, 1995; Li and Stanley, 1996). The causative agent of amebiasis, Entarnoeba histolytica, is a protozoan parasite whose only natural host appears to be humans and some non-human primates. E. dispar is a morphologically identical species but is a non-pathogenic gut commensal which can be differentiated from E. histolytica by molecular techniques (Jackson, 1998). The life cycle ofE. histolytica is simple. Disease begins with the ingestion of the cyst form of the parasite, which is found in fecally contaminated water and food. The hardy cyst survives the gastric acidity of the stomach, and in the distal small intestine or proximal colon excysts to form the motile trophozoite. Under some conditions, E. histolytica trophozoites in the distal colon encyst, and these excreted cysts continue the life cycle. E. histolytica trophozoites can adhere to colonic epithelial cells, and are capable of invading into the colonic mucosa, causing colitis, with characteristic flask-shaped ulcers. In as many as 5-10% of individuals with intestinal infection, E. histolytica trophozoites reach the submucosal layers of the gut, and from there enter the portal circulation, which transports them to the liver. There they can cause extensive tissue damage, resulting in an amebic liver abscess.

Background of models Animal models for amebiasis have been limited by the fact that E. histolytica only naturally infects humans, and it has been impossible to establish infections in small animals by the administration of E. histolytica cysts. Over the years there have been scattered reports of the successful establishment of intestinal disease in animals by direct intracecal inoculation of amebic trophozoites, but none of these methods have yet achieved widespread success (Vinayak et

Handbook of Animal Models of Infection ISBN 0-12-775390-7

al., 1979; Chadee and Meerovitch, 1985; Ghosh et al., 1994; Shibayama et al., 1997). In most cases these techniques employed E. histolytica trophozoites that were co-cultured with bacteria (xenic cultures), further complicating the interpretation of these studies. Small animal models of amebic liver abscess have been more reliable, and have been successfully established in hamsters, gerbils, and severe combined immunodeficient (SCID) mice (Thompson et aL, 1954; Sepfilveda et aL, 1974; Chadee and Meerovitch, 1984; Cieslak et aL, 1992). Infection is not established by the natural route (hematogenous spread to the liver by a foci of intestinal disease), but rather by the direct intrahepatic inoculation of axenically cultured (without bacteria) amebic trophozoites into the liver. In some cases, inoculation of trophozoites into the portal vein has been used as a more "physiologic" approach to establishing amebic liver abscess, but this is technically more difficult, and is probably not necessary for most studies of disease (Tsutsumi et al., 1984). Recently, a new model for intestinal amebiasis which employs E. histolytica infection of human intestinal xenografts in SCID mice (SCID-HU-INT mice; Seydel et al., 1997a) has been developed. The intestinal xenografts produce mucin, and differentiate into anatomically normalappearing small intestine or colon, depending on the tissue of origin. This model provides a reproducible system for establishing intestinal amebiasis, and for directly studying the interactions of E. histolytica trophozoites with human intestinal tissue. In this chapter we will describe the methods for producing SCID-HU-INT mice and the infection of their human intestinal xenografts with axenically cultured E. histolytica trophozoites. We will also outline the approach to establishing amebic liver abscesses in gerbils, hamsters, and SCID mice by direct hepatic inoculation of axenically cultured E. kistolytica trophozoites. The reader is referred to other references for details on alternative approaches to establishing amebiasis in animals (Miller, 1952; Tsutsumi et al., 1984; Anaya-Velazquez et al., 1985; Meerovitch and Chadee, 1988; Shibayama-Salas et al., 1992; Ghosh et aL, 1994; Bhopale et al., 1995; Sohni and Bhatt, 1996).

Copyright © 1999AcademicPress All rights of reproduction in any form reserved

860

SCID-HU-INT model of intestinal amebiasis Animal species Male or female CB-17 SCID mice, aged 6-10 weeks old, are used as xenograft recipients. Since maturation of the intestinal xenograft requires at least 10 weeks post-surgery, use of younger mice is recommended.

Preparation of animals All SCID mice are screened for the "leaky" phenotype at the age of 5 weeks by measuring serum antibodies using an enzyme-linked immunosorbent (ELISA) assay (Seydel et al., 1997a). Any mouse with serum immunoglobulin G (IgG) levels greater than 4 btg/ml is considered "leaky" and is not used. SCID mice are housed in a sterile barrier environment and animals are fed with autoclaved food and water.

Details of surgery

Preparation of intestine Fetal human intestinal tissue of 12-15 weeks developmental age is stored at 4°C in Dulbecco's Modified Eagle's media supplemented with penicillin/streptomycin until the time of surgery. All surgical procedures should be carried out in a laminar flow hood, and all instruments should be autoclaved between uses. At the time of surgery, the fetal intestine is decanted into a small Petri dish. All mesentery is removed from the intestine. Care should be taken during this cleaning procedure not to injure the tissue by grasping or pulling on it with forceps. The best technique involves grasping the mesentery with blunt forceps, lifting it off gently to visualize its connection to the intestine and then severing the connection with scissors, thus completely eliminating the manipulation of the intestine itself. This is the time to differentiate small intestine from the large intestine based on proximity to the stomach, and the location of the appendix. In subsequent steps, sections of the intestine will be prepared, and there are no gross differences in appearance between small intestine and large intestine at this time point in development. Once the intestine is cleaned of adjoining organs and mesentery it should be placed into a clean Petri dish with fresh media, and divided into lengths of approximately 4cm. This dish should be kept on ice until the time of implantation.

S.L. Stanley Jr, T. Zhang and K. B. Seydel

are weighed and 12 lttl per gram of body weight of the stock solution is administered intraperitoneally via a 29 G needle. This should provide approximately 15 minutes of anesthesia.

Surgical procedure A small strip of fur from the hip to the scapular area is shaved parallel to the spine on both sides. Animals are immobilized in the prone position, and the shaved area is scrubbed with a povidone-iodine scrub solution. With iris scissors, a 0.5 cm incision is made in the flank and scapular region of each side. The incision should run perpendicular to the axis of the spine, and penetrate just the skin and not any of the underlying muscle layers. A closed pair of 6-in dressing forceps is then inserted into the incision in the flank region (Figure 102.1), and by blunt dissection is tunneled up to the opening at the scapular region. The forceps are forced out of the scapular incision and opened. Often times there will be fascia still covering the forceps at this point. This should be removed, allowing for a patent opening of the forceps' tip. While maintaining the forceps in this subcutaneous position, a section of intestine is chosen with another forceps. The section should be grasped at one extreme end. It should then be dangled above the subcutaneous forceps, allowing the opposite end to be grasped by the subcutaneous forceps (Figure 102.2). The subcutaneous forceps should then be slowly backed out of the subcutaneous tunnel, drawing the intestine through the tunnel. The trailing edge of the intestine should be maintained in the other forceps until the point where both forceps are out of the tunnel and the ends of the intestine are equally spaced extending from the two incisions. At this point one should move to the contralateral side and thread an intestine through that tunnel. This gives the inserted

Anestkesia Mice are prepared for surgery by anesthesia with a mixture of ketamine and xylazine. A stock solution of concentration 5.8 mg/ml ketamine and 0.87 mg/ml xylazine is used. Mice

Figure 102.1 SCID mouse under anesthesia showing the paired skin incisions on both the right and left sides, and the forceps introduced into the posterior incision on the right flank.

ANIMAL MODELS OF ENTAMOEBA HISTOLYTICA INFECTION

861

Infection of intestinal xenografts

Figure 102.2 SCID mouse under anesthesia showing the forceps introduced through both incisions, and grasping the end of a 5 cm length of intestine before pulling it gently into the subcutaneous tunnel.

intestine time to recover from the stretching effect of pulling it through the tunnel. After this respite, the ends of the intestine should be trimmed to where they are even with the incision.

S C I D - H U - I N T animals are anesthetized using ketamine/xylazine as described above. They are immobilized on a surgical board in the prone position. A 3-4 cm incision is made with a surgical blade along the spine of the mouse, and the skin on one side is retracted and pinned to the board with a 31 G needle to expose the subcutaneous graft (Figure 102.3). Care should be taken to insure that the vascular supply to the graft is not compromised during the retraction of the skin. With the graft visualized, the inocula of E. histolytica trophozoites is resuspended and taken up into a l ml syringe with a 26 G needle. The needle is advanced directly through the graft wall at an angle to avoid the possibility of advancing the needle all the way through the lumen and into the opposite wall. There should be very little resistance to injection, as the inocula should be going into the lumen of the xenograft. High resistance indicates the needle is in either of the graft walls, and needs to be relocated. Upon successful inoculation, the needle is removed, and a small square of Gelfoam (Upjohn, Kalamazoo, MI) is placed on the injection site to prevent the leakage of the E. histolytica suspension out of the xenograft. The contralateral xenograft is inoculated using the same protocol. The two skin flaps are then conjoined and closed by stapling with 7.5 mm Michel clips.

Wound closure~postoperative care Each incision is closed with a 7.5 mm Michel clip. The clip should incorporate both skin flaps of the incision as well as the end of the intestine, thus anchoring the end of the intestine. Failure to incorporate the intestine in this clip will result in the shrinkage of the length of the intestine as it matures. The animals should then be returned to their cages and allowed to recover. The success of the engraftment can be assessed after 10 weeks. At this point the grafts can be palpated through the skin. S C I D - H U - I N T mice should be used for experiments between 10 and 14 weeks post-engraftment; grafts allowed to develop for longer periods of time grow too large, endangering the health and well-being of the mouse.

Storage, preparation of inocula

Figure 102.3 SCID mouse under anesthesia shown 10 weeks after engraftment, with the cutaneous tissue peeled back and one of the human intestinal xenografts exposed. Note the extensive vascular supply to the graft, and its increase in width since implantation.

E. histolytica strain HMI:IMSS trophozoites are grown in B1-$33 media. This strain has been passaged bi-monthly through mouse livers to maintain virulence. Culture tubes or flasks containing E. histolytica are chilled on ice for 5 minutes, then the media containing E. histolytica is gently centrifuged (10 minutes x 500g), and the pellet of amebic trophozoites resuspended in B1-S-33 media at a concentration of 106 E. histolytica trophozoites per 100gl. This suspension is kept on ice until used for inoculation.

Key parameters to monitor infection Our studies indicate that infection is established within 4-8 hours of inoculation, and significant tissue damage can be seen histologically by 24 hours after infection. Infection is generally monitored by histologic examination of

862

S.L. Stanley Jr, T. Zhang and K. B. Seydel

hematoxylin and eosin-stained sections of the intestinal xenograft. For studies of the inflammatory response to infection we have also monitored cytokine production by ELISA and reverse transcriptase polymerase chain reaction (RT-PCR; Seydel et aL, 1997a).

Preparation of animals Gerbils and hamsters are housed in pathogen-flee barrier environment and are fed with autoclaved food and water.

Details of surgery and infection

Antimicrobial therapy

Anesthesia

To date, this model has been used to test the efficacy of antiinflammatory therapy in amebic infection, and to study the role of the inflammatory process in amebiasis. r

Pitfalls (advantages/disadvantages) of the model The major advantage of this model is that it allows one to study E. histolytica intestinal disease in vivo. It is ideal for studies of the interactions ofE. histolytica with human intestine, as one can experimentally observe and manipulate amebic adherence to intestinal epithelial cells, invasion through mucosal surfaces, and the host inflammatory response to infection. The disadvantages are the need for human fetal intestinal tissue, the fact that the intestinal xenografts differ from normal bowel in the lack of bacterial flora, peristalsis, and excretion of luminal contents, and the inability to study lymphocyte-based immunity in this model.

Contributions of the model to infectious disease therapy This model could be used to evaluate new anti-amebic agents, and would be especially useful for the assessment of agents designed to work in the gut lumen (e.g. compounds designed to inhibit amebic adherence to target cells). Because the intestinal xenografts are extensively vascularized, this model could also be used to evaluate the efficacy of parenterally and orally administered anti-amebic agents. The major use of this model to date has been in improving our understanding of the pathogenesis of amebic infection, and especially the role of the host inflammatory response in the tissue damage seen with E. histolytica infection (Seydel et aL, 1997a).

Gerbils and hamsters are prepared for surgery by anesthesia with sodium pentobarbital. Hamsters receive 0.8~tl of a 65 mg/ml solution of sodium pentobarbital per gram body weight, while gerbils receive 2 ~tl of a 22 mg/ml solution of sodium pentobarbital per gram/body weight, administered intraperitoneally via a 29 G needle.

Surgical procedure Following the induction of anesthesia, the fur on the anterior abdominal wall and peritoneum is shaved. The gerbil or hamster is then placed ventral side up on a surgical board, and the shaved area is scrubbed with a povidoneiodine scrub solution. Under sterile conditions, using sterile drapes, gloves and instruments, a 1.5 cm vertical incision is made in the anterior abdominal wall and peritoneum with a surgical blade and scissors, and the liver is visualized (Figure 102.4). Using the index finger, the liver is gently pushed out for full exposure. Next, 100 ~tl of amebic inoculum containing 105-106 E. histolytica HMI:IMSS trophozoites is loaded into a 1-ml disposable syringe fitted with a 26 G needle that is kept in the vertical, needle-down position. This suspension is then injected slowly into the left lobe of the liver such that a visible subcapsular bleb is raised at the inoculum site of the liver surface (Figure 102.5). The needle is gently withdrawn and the injection site is blotted

Gerbil and hamster models of amebic liver abscess Animal species Male or female mongolian gerbils (Meriones unguiculatus) or golden hamsters (Mesocricetus auratus) aged 6-12 weeks are used in these studies.

Figure 102.4 Gerbil under anesthesia showing the draped operative field and exposure of the liver immediately prior to inoculation.

ANIMAL MODELS OF ENTAMOEBA HISTOLYTICA INFECTION

Figure 102.5 Gerbil under anesthesia showing inoculation of the gerbil's liver with Entamoeba histolytica trophozoites using a 26 G needle, which is guided just under the liver capsule such that a bleb forms with injection.

863

is calculated as the weight of the abscess divided by the liver weight before abscess removal. A small specimen from each abscess is cultured in BI-$33 medium to look for the growth ofE. histolytica trophozoites. This is done to confirm the etiology as amebic liver abscess, and may be performed as part of our continuous bi-monthly passage of E. histolytica trophozoites through hamster and gerbil livers to maintain virulence. Liver abscesses, as well as normal appearing regions of livers, are fixed in formalin, sectioned, and stained with hematoxylin and eosin for histological examination. Thus, liver abscesses in hamsters and gerbils are monitored on the basis of the gross appearance (Figure 102.6) and quantified by the percentage of the liver that is occupied by the abscess. The diagnosis of amebic liver abscess is confirmed by a positive culture for E. histolytica and compatible histologic findings. Disease appears to be more severe in hamsters, and mortality has been used as an endpoint in studies of amebic liver abscess in that species.

7iiiiiiiiiiiiiiiiiiiiiiiii@iiiiii!iiiii}ii~i:~::

with a small square of sterile Gelfoam (Upjohn) to preclude leakage of the inoculum and stop hemorrhage. The liver is gently placed back into the peritoneal cavity, and the peritoneum is closed using 4-0 chromic gut suture. The two skin flaps are closed by stapling with 7.5 mm Michel clips.

!!9

.........
40 for each species (generally many more worms will be present, with an upper limit of-400), the animals are assigned randomly by cage to treatment groups (3-9 jirds/treatment group, consistent within each experiment).

Anthelmintic therapy and response to treatment Following allocation of animals to treatment groups, compounds to be tested are suspended or dissolved in an appropriate vehicle using a vortex mixer. Each jird is given 0.2 ml per os containing the desired dose, although other routes of administration (intramuscular, intraperitoneal, subcutaneous, topical) can also be used. Drugs are routinely administered once. However, compounds can be given in multiple doses on the same day or daily over a period of days. lirds are routinely necropsied 3 days post-treatment for H. contortus and/or T. colubriformis, or 2 days post-treatment for O. ostertagi infections, but this can be modified to answer specific questions about drug activity (time to clear worms, etc.). Jirds are killed with CO2 and the stomach and/or small intestine removed. Stomach contents are removed by quickly rinsing the stomach in water; the parasites will not be detached from the mucosa. However, small intestine samples cannot be rinsed without loss of T. colubriformis from the lumen. Each tissue is put in a scintillation vial containing 14 ml distilled water and the vials are vortexed and placed in a 37°C water bath for 5 hours. Following incubation, 1 ml of formaldehyde solution is added to each vial and the vials are vortexed and stored for subsequent examination. For examination, the vials are vortexed and the tissues removed. The entire contents of the vial are examined for worms in 1-3 aliquots (depending on clarity) using a dissecting microscope (15-45 ×). Percentage clearance for each drug is determined based on the following formula: [(mean number of worms recovered from vehicle control group)-(mean number of worms recovered from treated group)] + (mean number of worms recovered from vehicle control group) x 100. Most modern broad-spectrum anthelmintics are detected in this model and are effective at doses similar to those efficacious in sheep and cattle. The minimum doses of standard anthelmintics necessary to clear 95% of H. contortus and T. colubriformis and from jirds, sheep and cattle are shown in Table 106.1 and for O. ostertagi in jirds and cattle in Table 106.2. Closantel, which is active only against H. contortus in ruminants, is also active only against H. contor-

890

S.S. Johnson, E. M. Thomas and T. G. Geary Table 106.1

Minimum doses (mg/kg) of standard anthelmintics effective in clearing 95% of adult Haemonchus contortus/Trichostrongylus colubriformis from jirds, sheep and cattle Anthelmintic

Jirds *

Sheept

Cattle?

Albendazole Fen bendazole Oxfendazole Thiabendazole Ivermectin Levamisole hydrochloride

1.875/3.125 1.875/3.125 1.875/3.125 187.5/187.5 0.125/0.0625 10.0/1.875

5.0/5.0 5.0/5.0 5.0/5.0 75.0/75.0 0.2/0.2 7.5/7.5

7.5/7.5 7.5/7.5 2.5/2.5 100.0/100.0 0.2/0.2 7.5/7.5

* Values for jirds are from Conder et al. (1991a). 1 Values for sheep and cattle are from Boersema (1985).

Table 106.2 Minimum doses (mg/kg) of standard anthelmintics effective in clearing 95% of Ostertagia ostertagi from jirds and cattle

Anthelmintic

Jirds

Cattle*

Albendazole Fenbendazole Oxfendazole Thiabendazole Ivermectin Levamisole hydrochloride

62.5 75.0 75.0 187.5 0.5 10.0

10.0 5.0 2.5 66.0 0.2 8.01-

*Values for cattle are from Lynn (1995). 1 Adults only, oral dose.

tus in jirds. Bithionol, diethylcarbamazine and piperazine, which are not active in ruminants, are also inactive in the jird. Anthelmintic resistance is readily detectable in this model (Conder et al., 1991b, 1993). Alternative trichostrongyle models

Background Anthelmintic models using the rodent trichostrongyles H. polygyrus and N. brasiliensis have been frequently used in drug discovery and lead evaluation programs. Detailed descriptions of these models are available (Cavier, 1973; Theodorides, 1976) and will not be repeated here. Since target species can now be used in convenient laboratory models, the value of incorporating a model parasite and a model host into anthelmintic experiments can be questioned. However, an alternative target parasite/model host system has been reported and deserves consideration.

Trichostronglyus colubriformis in tke rat Although attempts have been made to develop infections of T. colubriformis in several small mammal hosts other than jirds, the best documented alternative is the rat (Gration et al., 1992). Young male rats (3-4 weeks old; 40-50g) are maintained on a standard rat chow diet supplemented with

60 ppm hydrocortisone beginning 1 week before infection. Each animal receives 1500 L3-stage T. colubriformis in a small volume of water by oral gavage. These parasites will produce eggs in the feces of infected rats; similar results are obtainable in the jird (Johnson et aL, unpublished results). Rats are treated with anthelmintics at day 14 p.i. by oral gavage or subcutaneous injection. Animals are necropsied 4 days later and the number of worms present in the small intestine determined by counting under a dissecting microscope. Drugs tested include several benzimidazoles, levamisole, morantel, dihydroavermectin B 1I and I-milbemycin. In each case, potency in the rat was very similar to that observed in ruminants and quite comparable to those found in the jird model.

Hookworms (Necator americanus and Ancylostoma ceylonicum) in the hamster, Mesocricetus auratus Background of model

Laboratory animal models of hookworm infections have been reviewed (Behnke, 1990). In our opinion, the hamster is the preferred host for experimental chemotherapy studies. Target parasite species can be assayed conveniently in

INTESTINAL WORM INFECTIONS

the hamster and can be maintained in a continuous cycle in the laboratory, unlike the situation with other rodent hosts.

Host

Either outbred or inbred hamsters can serve as hosts. For infections with N. americanus, very young animals are required and synchronous breeding may be required to provide sufficient numbers of hosts for experiments. Adult animals can be infected with A. ceylonicurn. Male and female hamsters can be used for both species of parasites. Hamsters are kept under standard laboratory conditions with food (standard hamster chow) and water available ad lib#urn.

891

aL, 1989). Immature stages require single doses of 20 mg/kg

pyrantel and 15mg/kg mebendazole to achieve 90-95% clearance. Pyrantel exhibited similar potency against adult worms, but only 5 mg/kg mebendazole was required for 90% clearance. Single doses of 7.5 mg/kg ivermectin were necessary for good efficacy against N. arnericanus. This relative lack of potency reflects the relatively weak activity of ivermectin against this species in other hosts. Thiabendazole required very large single (700 mg/kg) or repeated (2 × 500mg/kg) doses for efficacy against immature stages in this model. Bephenium, known to have activity against hookworms in target hosts (with very poor potency) was only active in the hamster model when given in 2 or 3 consecutive daily doses (400 or 200 mg/kg per day, respectively). Ancylostoma caninum

Parasites

An important aspect of the hookworm-hamster model is that hamster-adapted strains of N. americanus and A. ceylonicum are available (Behnke, 1990). While neither isolate is as fecund as the corresponding wild-type strain in the natural host, both show complete development in the hamster to egg-laying adults. Eggs begin to appear in the feces of hamsters infected with N. americanus at about 6 weeks p.i.; eggs from A. ceylonicum first appear at about 2 weeks p.i. The eggs are fertile and can be cultured from the feces of infected hamsters to the infective larval stage (L3) to permit the infection to be maintained in the laboratory. Adult parasites persist in the small intestine for more than a year, although burdens typically diminish over time.

Adult hamsters 8-12 weeks old are infected by oral gavage, using a 21G blunted needle. Animals typically receive 50-150 L 3larvae to initiate the infection. Dosing can be initiated aganist adult stages beginning about 18 days p.i. Subcutaneous and oral administration of compounds are acceptable routes. Necropsy is scheduled 3-7 days posttreatment. Drug effects are measured by counting worms remaining in the intestine, as described above. Ivermectin was shown to be about 300 times more potent against A. ceylonicurn than N. americanus in this model (Behnke et aL, 1993). Subsequent experiments showed that a similar difference in susceptibility is noted when these parasites are exposed to the drug in vitro (Richards et aL, 1995). In contrast, both hookworm species were equally susceptible to pyrantel in hamsters.

Anthelmintic studies

Detailed studies are available on hamster infections with N. americanus (Sen, 1972) and A. ceylonicurn (Garside and

Behnke, 1989). Neca to r a rnerica n us

Baby hamsters (1-3 days old) are infected percutaneously with -100-500 L 3 larvae and returned to the mother until 21 days of age. Drug effects on immature worms are monitored in animals dosed at 5 weeks p.i., whereas a period of 50 days p.i. is sufficient to test drugs against adult parasites. A few infected animals may be sacrificed prior to treatment to verify infection and provide an estimate of expected worm burden in untreated control animals. Drugs can be administered orally in single or multiple doses (up to 3 days). Hamsters are necropsied 2-3 days post-treatment; the small intestine is removed and opened and hookworms scraped into a Petri dish for counting under a dissecting microscope. Immature worms are about as sensitive to chemotherapy (Rajasekariah et al. 1986) as adult parasites (Rajasekariah et

Ascarids: chicken/Ascaridia galli model Random screening against chickens infected with A. galli has led to the discovery of two anthelmintic classes. However, ascarids per se are not as commercially important for anthelmintic spectrum as trichostrongyles and the ascarid models are not as convenient as the jird model described above. Compounds with anthelmintic activity can be efficiently evaluated for ascaridicidal effects in a target parasite-target host secondary model, such as the dog infected with Toxocara canis. Nonetheless, a model ascarid system can play a role in anthelmintic screening and lead evaluation. The preferred ascarid model is the chick infected with A. galli. Descriptions of several variations of it have been published (Nilsson and Alderin, 1988; Sharma et aL, 1990; Sasaki et aL 1992). Although adult chickens can be used, lower amounts of drugs are needed if 1-week-old chicks are chosen. After acclimatization and routine vaccinations (about 1 week), infections are initiated by oral administration of 200-1500 embryonated eggs of A. galli obtained from gravid female

892

worms removed from infected chickens or from feces dropped by infected birds. Drugs can be administered by oral gavage, subcutaneous injection or in the drinking water beginning 10 days p.i. (for immature stages) or 35 days p.i. (mature adults). Drug effects are monitored by measuring egg excretion from infected birds and/or by direct count of worms remaining in the intestinal tract following necropsy. The major disadvantages of the system include a host animal that is atypical in most laboratory settings and the approximately 8-week duration of the trial.

Whipworms Laboratory models for whipworm infections are not used in primary anthelmintic screens. Secondary models for direct evaluation of compounds with activity in other anthelmintic assays against target parasites in target hosts are available, such as the dog infected with Trichuris vulpis. A Trichur# mur#/mouse model has been developed for anthelmintic evaluation (Keeling, 1961; Worley et al., 1962), but few further studies are available.

Strongyloides Species in the genus Strongyloides are serious pathogens of humans and horses, and sometimes in dogs and swine. As such, they are legitimate targets for anthelmintic drugs and deserve early consideration in efforts to identify the spectrum of candidate compounds. However, animal models of infection with Strongyloides spp. are not preferred for primary anthelmintic evaluation. A model employing Strongyloides ratti, and its natural host, the rat, has been used in anthelmintic testing (Cavier, 1973; Katiyar et al., 1989). An interesting development in this area is the demonstration that the jird can serve as a host for Strongyloides spp.; perhaps most important is a model of the jird infected with the human pathogen, S. stercoralis (Nolan et al., 1993). The infection closely mimicks the human disease in many aspects, including the ability to generate a model of hyperinfection (Nolan et al., 1993; Kerlin et al., 1995). While trials of anthelmintics have not apparently been reported in this model, the inclusion of S. stercoralis (or another Strongyloides spp.) in the group of target parasites that infect the jird could provide an additional indication of spectrum.

Pinworms A pinworm-only anthelmintic would have little commercial value and so pinworm models are not preferred over models that incorporate target parasites. None the less, a mouse model employing the murine pinworm, Syphacia

S.S. Johnson, E. M. Thomas and T. G. Geary obvelata, has proven useful for both screening and compound evaluation (Cavier, 1973; Theodorides, 1976; Coles, 1986). The pinworm was often used in combination with other parasites, such as Heligmosornoides polygyrus and the cestode Hymenolepis nana, so that early indications of anthelmintic spectrum could be obtained in the mouse (Theodorides, 1976). Details of the model are available (Cavier, 1973; Theodorides, 1976) for the interested reader. An interesting option for further development of a pinworm model is the observation that S. obvelata can be maintained in the jird (Wightman et aL, 1978). Complete development occurs in the jird and the infection can be transmitted from jird to jird both naturally and experimentally. Chemotherapeutic trials on pinworms in jirds have not apparently been reported, but would provide an important addition to the model.

Cestode model: Hymenolepis diminuta in the jird Background of model Gravid adult cestodes have been recovered from jirds infected with Taenia crassiceps (Sato and Kamiya, 1989, 1990), Echinococcus multilocularis (Kamiya and Sato, 1990) and Hymenolepis diminuta (Johnson and Conder, 1996), which suggested that this animal could serve as a useful model for anthelmintic studies. H. dirninuta was found to establish, grow and develop to the gravid adult stage 2 weeks post-infection in immunosuppressed jirds. The H. diminuta/jird model has the advantage of cost-effectiveness, since the infected intermediate host beetle, Tenebrio molitor, is commercially available at low cost and the cysticercoids are easily recovered from the intermediate host.

Animal species Outbred female jirds weighing 30-35g (Charles River Laboratories, Stone Ridge, NY) are used. Cysticercoids of H. dirninuta are obtained from infected T. molitor beetles (Carolina Biological Supply Company, Burlington, NC).

Preparation of animals Upon arrival, 3 animals each are randomly assigned to translucent polypropylene cages (26.7 x 21.6 x 14.0 cm) containing wood shavings and fed commercial rodent chow and water ad lib#urn.

Storage, preparation of inocula Infected T. molitor beetles should be acquired within 1 week

INTESTINAL WORM INFECTIONS of use and maintained at room temperature in the carton in

which they were shipped.

Infection process Cysticercoids are harvested from live T. rnolitor beetles. The beetles are placed dorsal side up in a dish containing 0.65% physiological saline (insect physiological saline solution; IPSS). The head, wings and dorsal integument of the beetle are removed and the body contents scraped out. Cysticercoids, which are usually found near the gut, will be released into the saline. For each jird, 5 cysticercoids are drawn into an 18 G dosing needle fitted to a 1 ml syringe preloaded with 0.1 ml IPSS. The cysticercoids are drawn into the needle only, not into the syringe barrel. Each jird is inoculated orally and after inoculation the needle is flushed and the wash examined to be certain all the cysticercoids are delivered. Immediately after inoculation, the jirds are fed medicated rodent chow containing 0.02% hydrocortisone and this feed is continued for the remainder of the experiment.

Anthelmintic therapy and response to treatment Compounds to be tested are suspended or dissolved in an appropriate vehicle using a vortex mixer. The jirds are treated on day 4 or days 4, 5, and 6 p.i and necropsied on day 7 p.i. At necropsy, the jirds are killed by CO2 inhalation. The small intestine is removed and placed in 0.85% physiological saline solution, opened longitudinally and examined grossly for tapeworms. If no worms, or fewer than 5 worms are observed, the intestine should be stripped between thumb and forefinger and the intestine and stripped material re-examined for the presence of scolices using a stereoscopic microscope. Praziquantel, albendazole and niclosamide--compounds with known cestocidal activity--are active in the H. dirninuta/jird model. Praziquantel (10 mg/kg) clears 100% of the worms (>95% clearance at 5mg/kg). Albendazole given orally at 90 mg/kg per day for 3 consecutive days has 95% efficacy and niclosamide at 360mg/kg given for 3 consecutive days clears 80% ofH. diminuta from the jird.

Advantages/disadvantages The H. diminuta/jird model has the advantage of low cost of labor and animals, ease of handling and less space required for housing than the H. diminuta/rat model. A comparison ofH. diminuta in the jird and the rat shows that the worms can live for the life span of the rat (several months) while in the immunosuppressed jird they survive at least 21 days. In both species, the worms grow the length

893

of the intestine and produce gravid adults (16 days in rats; Roberts, 1961). Based on results for praziquantel, albendazole and niclosamide, it appears that the H. diminuta/jird model generally requires higher doses than those needed for efficacy against H. diminuta in the rat. In rats, praziquantel completely cleared H. diminuta at 0.5 mg/kg (Fan and Ito, 1995), and at 2.5-5 mg/kg (Thomas and Andrews, 1977; Thomas and G6nnert, 1977), although 30mg/kg was required by Dixon and Arai (1991). Therefore, it appears that the strain of rat and/or H. diminuta may contribute to the efficacy of praziquantel. McCracken and Lipowitz (1990) found that a single 50 mg/kg dose of albendazole cleared H. dirninuta from rats, whereas this drug is active in the H. diminuta/jird model only when given in consecutive, multiple doses (90 mg/kg per day p.o. for 3 consecutive days). Dixon and Arai (1991) achieved 100% clearance ofH. dirninuta in rats treated with niclosamide at 1500mg/kg, although 95% clearance was observed at 300mg/kg. Lower doses (_>50 mg/kg) resulted in destrobilated worms. In the H. diminuta/jird model, a single oral dose of 360mg/kg produced < 50% clearance, and 360 mg/kg per day for 3 consecutive days resulted in a percentage clearance of 80.5 + 11.6 (three experiments). One of the worms recovered from the animals receiving multiple doses was destrobilated.

Conclusions There remains an acute need for new anthelmintic drugs. Useful anthelmintics must demonstrate an almost unreasonable spectrum of action (considering the diverse group of target organisms), coupled with a high margin of safety and low cost. Laboratory animal models are essential for the discovery of such drugs, since they permit testing of candidate compounds against a wide array of target species in convenient and compound-sparing formats. That so many target species can now be maintained in laboratory model hosts is evidence that experiments in this area of parasitology have borne remarkable fruit. The most promising area for future development is the inclusion of new target species in the jird. This small mammal has proven to be of exceptional value for anthelmintic testing. The possibility that pinworms and Strongyloides spp. could be added to the model requires only straightforward drug trials in already established models. It would be of benefit to determine if the hamster-adapted hookworm strains could infect jirds as well. We predict that the jird will become the standard laboratory host for GI nematodes. Finally, we must note that the large and small strongyles of horses, which are a significant source of equine disease, cannot currently be modeled in laboratory animals. Although there is reason to believe that compounds active in models of ruminant trichostrongyles and hookworms in the genus Ancylostoma (both of which are classified in the

894

same order as the horse strongyles) will also be active against the horse parasites (Bowman, 1995), it will still be a useful addition to the parasitologists' tool kit to be able to grow these parasites in a more convenient host.

References Arena, J. P., Liu, K. K., Paress, P. S. et al. (1995). The mechanism of action of avermectins in Caenorhabditis elegans: correlation between activation of glutamate-sensitive chloride current, membrane binding, and biological activity. J. Parasitol., 81, 286-294. Austin, W. C., Courtney, W., Danilewicz, J. C. et al. (1966). Pyrantel tartrate, a new anthelmintic effective against infections of domestic animals. Nature, 212, 1273-1274. Behnke, J. M. (1990). Laboratory animal models. In Hookworm Disease: Current Status and New Directions (eds Schad, G. A., Warren, K. S.), pp. 105-128. Taylor and Francis, London. Behnke, J. M., Rose, R., Garside, P. (1993). Sensitivity to ivermectin and pyrantel of Ancylostoma ceylanicum and Necator americanus. Int. J. Parasitol., 23, 945-952. Bennett, J. L., Pax, R. A. (1986). Micromotility meter: an instrument designed to evaluate the action of drugs on motility of larval and adult nematodes. Parasitology, 93, 341-346. Boersema, J. H. (1985). Chemotherapy of gastrointestinal nematodiasis in ruminants. In Handboo k of Experimental Pharmacology, vol. 77, Chemotherapy of Gastrointestinal Helminths (eds Vanden Bossche, H., Thienpont, D., Janssens, P.G.), pp. 407-442. Springer-Verlag, New York. Bowman, D. D. (1995). Helminths. In Georgi's Parasitology for Veterinarians (ed. Bowman, D. D.), pp 113-246. W. B. Saunders, Philadelphia, PA. Brown, H. D., Matzuk, A. R., Ilves, I. R. et al. (1961). Antiparasitic drugs. IV. 2-(4'-thiazolyl)-benzimidazole, a new anthelmintic. J. Am. Chem. Soc., 83, 1764-1765. Btirglin, T. R., Lobos, E., Blaxter, M. L. (1998). Caenorhabditis elegans as a model for parasitic nematodes. Int. J. Parasitol., 28, 395-411. Campbell, W. C. (1986). Historical introduction. In Chemotherapy of Parasitic Diseases (eds Campbell, W. C., Rew, R. E.), pp. 3-21. Plenum Press, New York. Campbell, W. C., Fisher, M. H., Stapley, E. O., AlbertsSchonberg, G., Jacob, T. A. (1983). Ivermectin: a potent new antiparasitic agent. Science, 221,823-828. Cavier, R. (1973). Chemotherapy of intestinal nematodes. In Chemotherapy of Helminthiasis, vol. 1 (eds Cavier, R., Hawking, F.), pp. 215-436. Pergamon Press, Oxford. Chan, M. S., Medley, G. F., Jamison, D., Bundy, D. A. P. (1994). The evaluation of potential global morbidity attributable to intestinal nematode infections. Parasitology, 109, 373-387. Coles, G. C. (1986). Models of infection for intestinal worms. Exp. Models Antimicrob. Chemother., 3,333-351. Coles, G. C. (1990). Recent advances in laboratory models for evaluation ofhelminth chemotherapy. Br. Vet. J., 146, 113-119. Coles, G. C., Stafford, K. A., MacKay, P. H. (1998). Ivermectinresistant Cooperia species from calves on a farm in Somerset. Vet. Rec., 142, 255-256. Conder, G. A., Campbell, W. C. (1995). Chemotherapy of nematode infections of veterinary importance, with special reference to drug resistance. Adv. Parasitol., 35, 1-84.

S.S. Johnson, E. M. Thomas and T. G. Geary

Conder, G. A., Johnson, S. S. (1996). Viability of infective larvae of Haemonchus contortus, Ostertagia ostertagi and Trichostrongylus colubriformis following exsheathment by various techniques. J. Parasitol., 82, 100-102. Conder, G. A., Jen, L-W., Marbury, K. S., et al. (1990). A novel anthelmintic model utilizing jirds, Meriones unguiculatus, infected with Haemonchus contortus. J. Parasitol., 76, 168-170. Conder, G. A., Johnson, S. S., Guimond, P. M., Cox, D. L., Lee, B. L. (1991a). Concurrent infections with the ruminant nematodes Haemonchus contortus and Trichostrongylus colubriformis in jirds, Meriones unguiculatus, and use of this model for anthelmintic studies. J. Parasitol., 77, 621-623. Conder, G. A., Johnson, S. S., Guimond, P. M. et al. (1991b). Utility of a Haemonchus contortus/jird (Meriones unguiculatus) model for studying resistance to levamisole. J. Parasitol., 77, 83-86. Conder, G. A., Johnson, S. S., Hall, A. D., Fleming, M. W., Mills, M. D., Guimond, P. M. (1992). Growth and development of Haemonchus contortus in jirds, Meriones unguiculatus. J. Parasitol., 78, 492-497. Conder, G. A., Thompson, D. P., Johnson, S. S. (1993). Demonstration of co-resistance of Haemonchus contortus to ivermectin and moxidectin. Vet Rec., 132, 651-652. Court, J. P., Lees, G. M. (1985). The efficacy of benzimidazole anthelmintics against late fourth stage larvae of Trichostrongylus colubriformis in gerbils and Nippostrongylus brasiliensis in rats. Vet. Parasitol., 18, 359-365. Court, J. P., Lees, G. M., Coop, R. L., Angus, K. W., Beesley, J. E. (1988). An attempt to produce Ostertagia circumcincta infection in Mongolian gerbils. Vet. Parasitol., 28, 79-91. deClercq, D., Sacko, M., Behnke, J., Gilbert, F., Dorny, P., Vercruysse, J. (1997). Failure of mebendazole in treatment of human hookworm infections in the southern region of Mali. Am. J. Trop. Med. Hyg., 57, 25-30. Dixon, B. R., Arai, H. P. (1991). Anthelmintic-induced destrobilation and its influence on calculated drug efficacy in Hymenolepis diminuta infections in rats. J. Parasitol., 77, 769-774. Dtiwel, D. (1975). Laboratory methods in the screening of anthelmintics. Prog. Drug Res., 19, 48-63. Egerton, J. R. (1961). The effect ofthiabendazole uponAscaris and Stephanurus infections. J. Parasitol., 47, (suppl.), 37. Fan, P. C., Ito, A. (1995). The minimum effective dose of praziquantel in treatment of Hymenolepis diminuta in rats. J. Helminthol., 69, 91-92. Fisher, M. H., Mrozik, H. (1992). The chemistry and pharmacology of avermectins. Annu. Rev. Pharmacol. Toxicol., 32, 537-553. Folz, S. D., Pax, R. A., Thomas, E. M., Bennett, J. L., Lee, B. L., Conder, G. A. (1987). Detecting in vitro anthelmintic effects with a micromotility meter. Vet Parasitol., 24, 241-250. Garside, P., Behnke, J. M. (1989). Ancylostoma ceylanicum in the hamster: observations on the host-parasite relationship during primary infection. Parasitology, 98, 283-289. Geary, T. G., Sims, S. M., Thomas, E. M. et al. (1993). Haemonchus contortus: ivermectin-induced paralysis of the pharynx. Exp. Parasitol., 77, 88-96. Geary, T. G., Thompson, D. P., Klein, R. D. (1999). Mechanismbased screening: discovery of the next generation of anthelmintics depends upon more basic research. Int. J. Parasitol., Int. J. Parasitol., 29, 105-112. Gill, J. H., Redwin, J. M., Van Wyk, J. A., Lacey, E. (1995).

INTESTINAL WORM INFECTIONS

Avermectin inhibition of larval development in Haemonchus contortus--effects of ivermectin resistance. Int. J. ParasitoL, 25,463-470. Gill, J. H., Kerr, C. A., Shoop, W. L., Lacey, E. (1998). Evidence of multiple mechanisms of avermectin resistance in Haemonchus contortus--comparison of selection protocols. Int. J. ParasitoL, 28, 783-789. Gration, K. A. F., Bishop, B. F., Martin-Short, M. R., Herbert, A. (1992). A new anthelmintic assay using rats infected with Trichostrongylus colubriformis. Vet ParasitoL, 42, 273-279. Hoekstra, R., Borgsteede, F. H. M., Boersema, J. H., Roos, M. H. (1997). Selection for high levamisole resistance in Haemonchus contortus monitored with an egg-hatch assay. Int. J. Parasitol., 27, 1395-1400. Janssen, p. A. J. (1976). The levamisole story. Prog. Drug Res., 20, 347-383. Jenkins, D. C. (1982). In vitro screening tests for anthelmintics. In Animal Models in Parasitology (ed. Owen, D. G.), pp. 173-186. MacMillan Press, London. Johnson, S. S., Conder, G. A. (1996). Infectivity of Hymenolepis diminuta for the jird, Meriones unguiculatus, and utility of this model for anthelmintic studies. J. ParasitoL, 82, 492-495. Kamiya, M., Sato, H. (1990). Complete life cycle of the canid tapeworm, Echinococcus multilocularis, in laboratory rodents. FASEB J., 4, 3334-3339. Kates, K. C., Thompson, D. E. (1967). Activity of three anthelmintics against mixed infections of two Trichostrongylus species in gerbils, sheep and goats. Proc. Helm. Soc. Wash., 34, 228-236. Katiyar, J. C., Gupta, S., Sharma, S. (1989). Experimental models in drug development for helminthic diseases. Rev. Infect. Dis., 11,638-654. Keeling, J. E. D. (1961). Experimental trichuriasis. II. Anthelmintic screening against Trichuris muris in the albino mouse. J. Parasitol., 47, 647-651. Kerlin, R. L., Nolan, T. J., Schad, G. A. (1995). Strongyloides stercoralis: histopathology of uncomplicated and hyperinfective strongyloidiasis in the Mongolian gerbil, a rodent model for human strongyloidiasis. Int. J. ParasitoL, 25, 411-420. Klein, R. D., Geary, T. G. (1997). Recombinant microorganisms as tools for high throughput screening for nonantibiotic compounds.J. BiomoL Screen., 2, 41-49. Lacey, E. (1988). The role of the cytoskeletal protein tubulin in the mode of action and mechanism of drug resistance to benzimidazoles. Int. J. ParasitoL, 18, 885-936. Lacey, E., Redwin, J. M., Gill, H. J., Demargheriti, V. M., Waller, P. J. (1990). A larval development assay for the simultaneous detection of broad spectrum anthelmintic resistance. In Resistance of Parasites to Antiparasitic Drugs (eds Foray, J. C., Martin, P. J., Roush, R. T.), pp. 117-184. MSD Agvet, Rahway, NJ. Lynn, R. C. (1995). Antiparasitic drugs. In Georgi's Parasitology for Veterinarians (ed Bowman, D. D.), pp. 264-272. W. B. Saunders, Philadelphia, PA. Martin, R. J. (1997). Modes of action of anthelminitic drugs. Vet. J., 154, 11-34. Martin, R. J., Robertson, A. P., Bjorn, H. (1997). Target sites of anthelmintics. Parasitology, 114, S111-S124. McCracken, R. O., Lipowitz, K. B. (1990). Experimental and theoretical studies of albendazole, oxibendazole and tioxidazole. J. ParasitoL, 76, 180-185. McKellar, Q. A., Scott, E. W. (1990). The benzimidazole

895

anthelmintic a g e n t s - a review. J. Vet. PharmacoL Ther., 13, 223-247. Nilsson, O., Alderin, A. (1988). Efficacy of piperazine dihydrochloride against. Ascaridia galli in the domestic fowl. Avian Pathol., 17, 495-500. Nokes, C., Bundy, D. A. P. (1994). Does helminth infection affect mental processing and educational achievement? ParasitoL Today., 10, 14-18. Nolan, T. J., Megyeri, Z., Bhopale, V. M., Schad, G. A. (1993). Strongyloides stercoralis: The first rodent model for uncomplicated and hyperinfective strongyloidiasis, the Mongolian gerbil (Meriones unguiculatus). J. Infect. Dis., 168, 1479-1484. Ostlind, D. A., Cifelli, S. (1981). Efficacy of thiabendazole, levamisole hydrochloride and the major natural avermectins against Trichostrongylus colubriformis in the gerbil (Meriones unguiculatus). Res. Vet. Sci., 31,255-256. Ostlind, D. A., Mickle, W. G., Ewanciw, D. V. et al. (1990). Efficacy of paraherquamide against immature Trichostrongylus colubriformis in the gerbil (Meriones unguiculatus). Res. Vet. Sci., 48, 260-261. Panitz, E., Shum, K. L. (1981). Efficacy of four anthelmintics in Trichostrongylus axei or T. colubriformis infections in the gerbil, Meriones unguiculatus. J. Parasitol., 67, 135-136. Prichard, R. (1994). Anthelmintic resistance. Vet. Parasitol., 54, 259-268. Rajasekariah, G. R., Deb, B. N., Dhage, K. R., Bose, S. (1986). Response of preadult Necator americanus to some known anthelmintics in hamsters. Chemotherapy, 32, 75-82. Rajasekariah, G. R., Deb, B. N., Dhage, K. R., Bose, S. (1989). Response of adult Necator americanus to some known anthelmintics in hamsters. Ann. Trop. Med. Parasitol., 83, 279-285. Richards, J. C., Behnke, J. M., Duce, I. R. (1995). In vitro studies on the relative sensitivity to ivermectin of Necator americanus and Ancylostoma ceylanicum. Int. J. Parasitol., 25, 1185-1191. Roberts, L. S. (1961). The influence of population density on patterns and physiology of growth in Hymenolepis diminuta (Cestoda: Cyclophyllidea) in the definitive host. Exp. Parasitol., 11,332-371. Sangster, N. C. (1996). Pharmacology of anthelmintic resistance. Parasitology, 113, $201 -$216. Sasaki, T., Takagi, M., Yaguchi, T., Miyadoh, S., Okada, T., Koyama, M. (1992). A new anthelmintic cyclodepsipeptide, PF1022A. J. Antibiot., 45,692-697. Sato, H., Kamiya, M. (1989). Deleterious effect of prednisolone on the attachment of Taenia crassiceps cysticerci to the intestine of gerbils.Jpn J. Vet. Sci., 51, 1099-1101. Sato, H., Kamiya, M. (1990). Establishment, development and fecundity of Taenia crassiceps in the intestine of prednisolonetreated Mongolian gerbils and inbred mice. J. Helminth., 64, 217-222. Sen, H. G. (1972). Necator americanus: behaviour in hamsters. Exp. Parasitol., 32, 26-32. Sharma, R. L., Bhat, T. K., Hemaprasanth (1990). Anthelmintic activity of ivermectin against experimental Ascaridia galli infection in chickens. Vet. Parasitol., 37, 307-314. Shoop, W. L., Mrozik, H., Fisher, M. H. (1995). Structure and activity of avermectins and milbemycins in animal health. Vet. Parasitol., 59, 139-156. Simpkin, K. G., Coles, G. C. (1981). The use ofCaenorhabditis elegans for anthelmintic screening. J. Chem. Tech. Biotech., 31, 66-69.

896

Theodorides, V. J. (1976). Anthelmintics: from laboratory animals to the target species. In Chemotherapy of Infectious Disease (ed Gadebusch, H. H.), pp. 71-96. CRC Press, Cleveland, OH. Thomas, H., Andrews, P. (1977). Praziquantel--a new cestocide. Pest. Sci., 8, 556-560. Thomas, H., G6nnert, R. (1977). The efficacy of praziquantel against cestodes in animals. Z. Parasitenk., 52, 117-127. Thompson, D. P., Klein, R. D., Geary, T. G. (1996). Prospects for rational approaches to anthelmintic discovery. Parasitology, 113, $217-$238. Vermunt, J. J., West, D. M., Pomroy, W. E. (1995). Multiple resistance to ivermectin and oxfendazole in Cooperia species of cattle in New Zealand. Vet. Rec., 137, 43-45.

S.S. Johnson, E. M. Thomas and T. G. Geary

Wescott, R. B. (1986). Anthelmintics and drug resistance. Vet. Clin. N. Am. Equine Pract., 2, 367-380. Wightman, S. R., Wagner, J. E., Corwin, R. M. (1978). Syphacia obvelata in the Mongolian gerbil (Meriones unguiculatus): natural occurrence and experimental transmission. Lab. Anita. Sci., 28, 51-54. Worley, D. E., Meisenhelder, J. E., Sheffield, H. G., Thompson, P. E. (1962). Experimental studies on Trichuris muris in mice with an appraisal of its use for evaluating anthelmintics. J. Paras#ol., 48, 433-437.

V)

0 Q.

0

(1) 0

mh

< 0

This Page Intentionally Left Blank

Chapter 107

Animal Models for Central Nervous System and Disseminated Infections with Herpes

Simplex Virus

E. R. Kern

Background of human infections The herpesviruses are the etiologic agents of a wide variety of diseases in humans, many of which have high mortality or morbidity rates in normal or immunocompromised patients. Herpes simplex virus type 1 (HSV-1) is the most common cause of sporadic, life-threatening encephalitis in the United States. In untreated patients, mortality rates are about 70% and severe neurologic sequelae occur in most survivors (Whitley et aL, 1977). In patients with herpes encephalitis, treatment with idoxuridine, the first antiviral agent tested, did not influence the disease and was associated with toxic side-effects (Boston Interhospital Virus Study Group, 1975). In subsequent studies, adenine arabinoside (ara-A) therapy was shown to reduce significantly mortality rates and the frequency of neurologic sequelae (Whitley et aL, 1977, 1981). In the next series of clinical trials, acyclovir (ACV) was shown to be more effective than ara-A for treatment of this disease (Whitley et aL, 1986). HSV-2 infection of the newborn infant, which is usually acquired on passage through the mother's infected birth canal, is also associated with a high mortality rate and severe neurological sequelae in a significant number of the survivors (Whitley et aL, 1980a). Treatment of neonatal herpes with ara-A also significantly reduced mortality and neurologic sequelae (Whitley et aL, 1983), and therapy with ACV has been reported to be at least as effective as ara-A (Whitley et aL, 1991). Although there have been significant advances in the treatment of severe HSV infections with ACV, there is still a need to develop more effective modes of therapy for these infections. In particular, for herpes encephalitis, neonatal herpes, and mucocutaneous infections in acquired immunodeficiency syndrome (AIDS) patients caused by ACVresistant viruses, optimal therapy is currently not available. Hopefully in the next few years, new more active and/or less toxic agents will be developed and the use of better delivery methods or combinations of existing drugs will improve the outcome of these serious diseases.

Background of animal model infections The use of mice inoculated intranasally (i.n.) with HSV-1 as a model for herpes encephalitis was initially described by Handbook, of Animal Models of Infection

ISBN 0-12-775390-7

De Clercq and Luczak (1976) and has been used extensively in our laboratory for evaluation of antiviral agents directed against this disease. After HSV-1 inoculation the virus travels from the nasopharynx via olfactory and trigeminal nerve tracts to the brain, resulting in death from an acute encephalitis. In this model, treatment with ara-A initiated within 24-48 hours of infection resulted in significant protection (Kern, 1988). The protection against mortality observed with ara-A treatment also correlated with alteration of HSV-1 replication in the central nervous system (CNS). Therapy with 250mg/kg of ara-A twice daily for 7 days initiated 48 hours after viral inoculation reduced considerably virus titers in olfactory lobes, cerebral cortex, cerebrum, diencephalon, and the pons medulla when compared with placebo-treated mice (Kern, 1990). Treatment also reduced viral replication in spleen but had only a marginal effect in lung. In clinical trials of HSV-1 encephalitis, treatment with ara-A also resulted in significant reduction in mortality (Whitley et aL, 1977, 1981). In the animal model infection, treatment with ACV was considerably more effective than ara-A in preventing mortality (Kern, 1988). Concentrations as low as 15 mg/kg significantly reduced mortality when therapy was begun 72 hours after infection, a time when virus is replicating in the CNS. In a comparison between ara-A and ACV treatment on the pathogenesis of HSV-1 encephalitis in mice, virus titers in ACV-treated animals were lower in all target organs than in placebo-treated animals (Kern, 1990). In the cerebellum, diencephalon and pons medulla, ACV treatment was superior to ara-A in reducing the magnitude of viral replication and promoted a more rapid clearance of HSV-1 in these tissues. ACV therapy was also more effective than ara-A in reducing viral replication in lung tissue (Kern, 1990). Based on these experimental data, it was predicted that ACV would be more effective than ara-A in treatment of HSV-1 encephalitis in humans. Subsequent clinical trials confirmed observations from the animal model studies as ACV was shown to be significantly more effective than ara-A (Whitley et aL, 1986). Mice inoculated i.n. with HSV-2 appear to be a good model for disseminated neonatal herpes with CNS involvement. After viral inoculation, replication of virus is initially detectable in lung with subsequent dissemination to Copyright © 1999Academic Press All rights of reproduction in any form reserved

E.R. Kern

900

visceral organs. Virus is also transmitted concomitantly by neural routes from the nasopharynx to olfactory lobe and cerebellum n b r a i n stem, cerebrum and spinal cord (Kern et aL, 1978). This animal model provides a severe test of antiviral efficacy and treatment with ara-A failed to provide any protection against mortality; however, there was some reduction of virus replication in brain, lung, liver, and spleen (Overall et aL, 1975; Kern, et aL, 1975, 1978; Kern, 1988). This is a complex model of infection involving both CNS and non-CNS tissues and historically has not responded well to any of the antiviral agents tested. In placebo-controlled clinical trials, however, ara-A did reduce mortality (Whitley et al., 1980b) but many survivors had permanent neurological sequelae (Whitley et al., 1983). Parenteral treatment with ACV in the murine model was very effective in reducing mortality when therapy was initiated 48-96 hours after infection (Kern et aL, 1982; Kern, 1988), and also reduced significantly viral replication in target organs (Kern et aL, 1986). These results from experimental HSV-2 infection in mice predicted that ACV would be more effective than ara-A in the treatment of neonatal herpes; however, in clinical trials in which ara-A and ACV were compared for efficacy, the two agents were judged to be comparable (Whitley et al., 1991). The experimental HSV-2 infection, therefore, accurately predicted efficacy for treatment of human disease with ara-A or ACV but apparently failed to determine which of the two drugs would be most active. It should be stressed, however, that disseminated HSV-2 infections of mice and humans are complex and the animal model may not accurately represent the entire pathogenesis of human disease, which includes not only CNS and disseminated visceral components, but also may have skin, eye, or mouth involvement which are not seen in the mouse model.

Rationale for use of animal models The importance of experimental viral infections in animal models for the development and evaluation of new antiviral agents prior to their use in humans should not be minimized. While tissue culture systems are of great v)lue in determining if a new drug has activity against a particular virus, these systems should not be used as indicators or predictors of activity in humans. Only where suitable animal models are not available should a compound be taken from tissue culture directly into human trials. Although one can legitimately argue that most, if not all, animal model infections are not identical to the human disease, it can be demonstrated that a compound does in fact have activity in an in vivo system and early indications of its antiviral activity, tissue distribution, metabolic disposition, pharmacokinetics, and acute toxicity can be realized. Importantly, all of these parameters of drug pharmacodynamics can be corre-

lated with inhibition of viral replication in target organs. Additionally, our understanding of the pathogenesis of many viral infections, the response of the host to infection and interaction between the viral infection, the host's immune response, and a therapeutic agent has been enhanced greatly through the use of animal model systems. When selecting or developing an animal model for determining efficacy of an antiviral, one should utilize systems that best simulate the corresponding human disease. Some of the factors that need to be considered when selecting an animal model have been reviewed previously (Field, 1988; Kern, 1990). It is obvious that there is currently no experimental viral infection that meets all of the properties of an ideal animal model. The most common animal species used for experimental HSV infections are rodents and these differ from humans by most criteria. There are significant differences in drug metabolism and pharmacokinetics between humans and animals that must be considered when extrapolating results obtained in animal models to the design of initial clinical trials. Since the herpesviruses, and particularly HSV, are the etiologic agents of a wide variety of diseases in humans, it is important that new antiviral agents be tested in animal models that simulate each of those disease states in humans. In addition, since animal models for HSV infections have been the most widely used, the predictability for most of these infections has been established.

Methods Animals and animal care

Three-week-old Balb/c or outbred mice such as CD-1 or Swiss-Webster weighing approximately 10-12g are used for infection. While we have used females exclusively, males can also be used. In our laboratory, Balb/c mice are slightly more susceptible to infection with HSV than the outbred animals, and the results appear to be more consistent. Other animal strains such as C3H or C57/BL6 are more resistant to infection with HSV and virus replicates less well in target organs such as lung, liver, spleen, and kidney than in Balb/c or outbred mice. All mice in our facility are housed in standard filter top polycarbonate shoebox cages (155 square inches). The maximum number of mice housed per cage is 15. They are given standard rodent chow and water ad libitum. Contact bedding is pine chips, and cages and water are changed twice a week. They are maintained on computer-controlled 12-hour off/on light cycle at 35% relative humidity. Cages are checked daily for dead or sick animals.

Virus stocks, assays, and cell cultures

Stock pools of HSV are prepared routinely in primary cultures of rabbit kidney cells. Virus preparations are quanti-

ANIMAL MODELS FOR CENTRAL NERVOUS SYSTEM AND DISSEMINATED INFECTIONS

fled using a standard plaque assay in primary rabbit kidney cells or low passaged human foreskin fibroblast cells under a liquid overlay containing a sufficient amount of antibody (gamma-globulin) to retard extracellular spread or alternatively an agarose or methylcellulose overlay media can be used. Primary rabbit kidney fibroblast cells are prepared from rabbits aged 3 weeks. Kidneys are removed aseptically and washed in saline; the medulla is removed and discarded and the cortex tissue is minced and washed repeatedly with saline to remove debris and red blood cells. Individual cell suspensions are prepared by multiple extractions using 0.25% trypsin. After the tissue is digested, the cells are centrifuged, re-suspended in tissue culture media with 10% fetal bovine serum (FBS) and placed in 175 cm 2 tissue culture flasks and incubated at 37°C with 95% CO2 and 90% humidity. After the cells become confluent, they are trypsinized and added to multi-well tissue culture plates for use in the plaque assay.

Inoculation of animals

Intracerebral Female Balb/c mice (21 days old) are inoculated intracerebrally with various dilutions of HSV by administering 0.03 ml volume with a V~cc glass syringe and a 26G 0.5 in needle into the right cerebral hemisphere. The syringe is held perpendicular to the mouse's head and inserted until the needle just pierces the skull. Care should be taken not to hit one of the major blood vessels. Animals are anesthetized prior to inoculation with 5 mg/ml of ketamine containing 15 mg/ml xylazine in a 0.1 ml volume.

Intraperitoneal Female Balb/c mice (21 days old) are inoculated with 0.1 ml of 102-103 plaque-forming units (pfu) of HSV. A 1 cc tuberculin syringe and 25 G 5/8 in needle are used to deliver virus into the lower left quadrant of the abdomen. No anesthesia is used.

Intranasal Female Balb/c mice (21 days old) are inoculated with 104-105 pfu/animal. Virus is administered in a 0.04 ml volume with a 20~1 Eppendorf pipette tip by allowing the mouse to inhale 20 btl in each nostril. Mice do not need to be anesthetized for this procedure. Male Fischer rats weighing 175-200g are inoculated with HSV-1 at about 104 pfu/ animal. As with mice, rats are given 0.02 ml of HSV in each nostril, with a 201Ltl pipette. The rats are anesthetized for this procedure with 100mg/ml of ketamine containing 15 mg/ml of xylazine at the rate of 0.1 ml/100g of body weight.

901

Experimental infections and pathogenesis I n t r a c e r e b r a l inoculation

Intracerebral inoculation of young mice has been used for evaluation of antiviral therapy; however, it does not represent a natural route of infection and it is not a suitable model for this purpose. Although direct inoculation of HSV into the brain might simulate herpes encephalitis that is a consequence of viral reactivation within the CNS, there is concern that this method of inoculation may disrupt tissue architecture and the blood-brain barrier, making it more permeable to antiviral drugs. While the model is not optimal for evaluating antiviral therapy, it is very useful in determining the virulence of viruses and in particular HSV, as wild-type isolates will kill a young mouse with as little as 1 pfu inoculated directly into the brain. We have utilized the model extensively for characterization of HSV mutants, particularly those that are resistant to antiviral agents such as ACV and have a mutation in the thymidine kinase (TK) or polymerase gene. Additionally, the model is useful for determining the virulence and stability of attenuated HSV vaccines. Virulence is determined according to the number of pfu of HSV required to kill 50% of inoculated animals. Wildtype isolates that are T K + will kill mice at 1-10 pfu, whereas those viruses that no longer produce a functional TK require many orders of magnitude more virus, if in fact any mortality at the highest possible dose inoculated can be demonstrated. We have evaluated the virulence of numerous isolates of HSV-1 or HSV-2 that are ACV-resistant and TK-deficient, compared to MS, a laboratory-passaged standard wild-type strain of HSV-2. The results of some of these isolates inoculated intracerebrally in mice are summarized in Table 107.1. The pfu median lethal dose (LD50) ratios were calculated using combostat, version 3, (Belen'kii and Schinazi, Emory University School of Medicine). The pfu/LDs0 ratio for the HSV-2, MS strain was 0.78. The HSV-2 TK-altered strain, 12247, proved to be as virulent as wild-type with a pfu/LDs0 ratio of 3.2. Of particular interest is the isolate AG-3 which expresses less than 3% (low producer) of normal TK but is still highly virulent. Two isolates in which the T K has been deleted (A305, SR6008) and an ACV-resistant isolate (DM 21) required 104 or greater pfu to produce mortality in mice. Intraperitoneal inoculation

Although the i.n. HSV infection models have been predictive of efficacy for human disease, they are severe tests of efficacy and i.n. inoculation of mice is a tedious and timeconsuming process. As a result, it is difficult to use large numbers of animals for screening several antiviral agents and/or various dosage concentrations and treatment regimens. For these reasons, we first screen compounds for in

902

E.R. Kern

Table 107.1 Virulence of herpes simplex virus (HSV)isolates in mice inoculated intracerebrally

Strain

TK

pfu/ mouse

Dead/ total

pfu/ LDso

HSV-2, MS

+

4.2x102 4.2x10 ~ 4.2 0.42

10/10 10/10 9/10 3/10

0.78

HSV-2, 12247

A

1.2x103 1.2xl 02 1.2x10 ~ 1.2 0.12

10/10 10/10 7/10 5/10 0/10

3.2

HSV-2, AG-3

LP

1.1x103 1 .lx102 1 .lx101 1.1

9/10 9/10 3/10 2/10

1.1x101

HSV-1, DM21

-

1.3x105 1.3xl 04 1.3x103 1.3x102

10/10 2/10 0/10 0/10

1.6x104

6.0xl 04 6.0x103 6.0x102 6.0x101 6.O

2/10 0/10 0/10 0/10 0/10

> 6.0xl 04

4.5x104 4.5xl 03 4.5xl 02 4.5x101 4.5

2/10 0/10 0/10 0/10 0/10

>4.5x104

HSV-1, A305

HSV-1, SR6008

-

-

TK, Thymidine kinase phenotype; pfu, plaque-forming unit; LDs0, median lethal dose; +, positive, wild-type; A, altered; LP, low producer; - negative.

vivo HSV activity in outbred Swiss, CD-1, or Balb/c mice

inoculated intraperitoneally (i.p.) with HSV-1 or HSV-2. After i.p. inoculation with HSV-1 or HSV-2, virus replicates in the gut, liver, and spleen and then spreads to the CNS by viremia and probably also by peripheral nerves (Kern et aL, 1978, 1982). Virus is first detected in the brain by about day 5, and animals die on about day 9, which allows ample time to demonstrate an antiviral effect. This model system has consistently been the most sensitive system for determining efficacy of a new antiviral. Although it does not simulate a natural route of infection, it is an ideal system for screening new compounds and for determining optimal dosages and treatment regimens prior to testing in mice inoculated i.n. that more closely simulate human infections. The effects of ACV in mice inoculated i.p. with HSV2 are shown in Table 107.2 as an example of the use of these models in screening new compounds for HSV activity. Treatment with 20 mg/kg twice daily was highly effective even when treatment was delayed until 72 hours post-infection. The effect of ACV treatment on virus replication in tar-

Table 107.2 Effect of treatment with acyclovir on the mortality of mice inoculated intraperitoneally with herpes simplex virus type 2 (HSV-2)

Mortality Treatment*

No.

Control Placebo

14/15 93 15/15 100

Acyclovir

%

P Value MDD NS

9.0 8.5

P value NS

80mg/kg+24h 80mg/kg+48h 80mg/kg + 72h 80mg/kg + 96h 80 mg/kg - Toxl-

4/15 2/15 3/15 5/15 1/10

27 13 20 33 10



i E z

0

~

~

8-

I"~°°° I*300 s I*~°

I I I

I ~ I I I I

I I I

/

4

2

o

r

0

1

5

10

15

20

25

30

35

DAYS POST INOCULATION

Figure 111.2 Mortality of severe combined immunodeficient (SCID) mice inoculated intraperitoneally with murine cytomegalovirus. organs. The severity of disease in liver and spleen slowly increases to maximum at day 15. At this time, the lesions in liver are still muhifocal but the number of necrotic foci is very great and the individual foci are large. At day 15, the spleen is diffusely affected and severe loss of total spleen parenchyma has occurred. Throughout the infection, there are numerous large intranuclear inclusions typical of CMV in all affected tissue.

od

r

A

:3 U) =am

I---

O . . - - .

q-.

o E

o~

-

3

e;

-

9

-

-

1"2 1"5 1"8 2"1 23 0

6~ Lung

Q.

............. 3

6;

9

=---

1"2 1"5 1"8 2"1 23 0

3

6

9

12 15 18 21 23

_ 9

1'2 1'5 1"8 2'1 23

Pancreas

Adrenals

/

O

o1

o

. . . . . .

m

L

G) p>

,4,1 =m

o

O,,

..--

-

3

6;

I B

o

=

_s-

~) 1"2 1'5 1'8 2"1 23 0

3

6;

9

6

~

~

1'2 1"5 1'8 fi

23 o

3 Days

Figure 111.3 mice.

F)

._f-'

.......

i

3

• Salivary

Brain

8 Kidney

o

1"2 1"5 1'8 2"1 23 0

6

9

12 15 18 21 23 0

3

6

~) 1"2 1"5 I"8 2'1 23

Post-Inoculation

Pathogenesis of murine cytomegalovirus (MCMV) infection in severe combined immunodeficient (SCID)

ANIMAL MODELS FOR CYTOMEGALOVIRUS INFECTION: MURINE CMV

Evaluation of antiviral therapy~ key parameters These murine models lend themselves well to the use ofi.p., subcutaneous , or oral therapy. When first evaluating a new antiviral agent in animal models, one does not generally know the pharmacokinetic profile of the agent in that species. For all initial evaluations, we utilize a standard treatment regimen consisting of twice-daily treatment for 5 days. A sufficient number of drug concentrations should be used so that the maximum tolerated dose and the minimal effective dose can be calculated. The initial and most common endpoint for efficacy evaluation is usually death. An example of a typical mortality experiment using GCV and CDV is presented in Table 111.1. Before beginning efficacy studies in mice, an initial experiment should be conducted in which uninfected animals are treated i.p. twice daily for 7 days, with various concentrations of test compound to establish the maximum tolerated dose. Table 111.1 Effect of treatment with Cidofovir or ganciclovir on the mortality of mice inoculated with murine cytomegalovirus Mortality Treatment*

No.

%

P Value MDD

Control Placebo + 24 h

11/15 (73) 12/15 (80)

NS

Cidofovir 16.7mg/kg + 6h 16.7 mg/kg + 24 h 16.7 mg/kg + 48h 5.6 mg/kg + 6 h 5.6 mg/kg + 24 h 5.6mg/kg + 48h 1.9 mg/kg + 6 h 1.9 mg/kg + 24 h 1.9 mg/kg + 48 h 0.6 mg/kg + 6h 0.6 mg/kg + 24 h 0.6 mg/kg + 48 h

0/15 (0) 2/15 (13) 10/15 (67) 0/15 (0) 1/15 (7) 5/15 (33) 0/15 (0) 7/15 (47) 5/15 (33) 1/15 (7) 6/15 (40) 6/15 (40)

fourfold) rises in serum rotavirus immunoglobulin A (IgA). Stools are collected for 7-10 days after challenge and analyzed for rotavirus antigen by an enzyme-linked immunosorbent assay (ELISA). In this procedure, ELISA plates are coated with either normal rabbit sera (negative wells) or rabbit lgG to rotavirus (positive wells). After washing, as is done between each step with PBS containing 0.05% Tween 20, a 10% stool suspension is added to duplicate positive and duplicate negative wells. Following incubation (1 hour at 37°C) on a rotating platform, wells are blocked with normal goat serum (Vector Laboratories, Inc.) in 5% non-fat dry milk. Hyperimmune guinea-pig serum to rotavirus along with normal rabbit serum is then added (30 minutes, room temperature or r.t.). Biotinylated goat anti-guinea-pig lgG (Vector Laboratories, Inc.) with normal rabbit serum is next added followed by peroxidase-conjugated avidin-biotin (each step: 30 minutes, r.t.). Substrate (o-pheylenediamine with H202) in citric acid phosphate buffer is added (15 minutes, r.t.), and the reaction is stopped with 1 mol/1 H2SO4. Finally, the absorbency at wavelength 490 nm (A490)is measured and the net optical densities determined. The stool is considered positive for rotavirus if the average A490for the positive wells is more than twice the average of the negative wells and >_0.15. The absorbance values for each animal or each group can be graphed to determine a shedding curve (Figure 126.2). Protection from shedding is determined statistically by comparison of the shedding curves for an unimmunized control group with shedding curves of groups receiving experimental vaccines. The other major parameters to evaluate the effects of the experimental vaccine are immunological responses. Serum and stool specimens collected prior to vaccination, prior to challenge, and after challenge are typically measured for rotavirus IgG and lgA by an ELISA method. Briefly, ELISA plates are coated overnight at 4°C with antirotavirus rabbit lgG. EDIM lysate or mock-infected cell lysate are each added to duplicate wells followed by serial twofold dilutions of pooled sera from EDIM-infected mice (assigned concentrations of 160 000 or 10 000 units/ml of rotavirus lgG or lgA, respectively) to generate a standard curve. Mouse sera or stool suspensions to be tested are also added to duplicate wells of each lysate. This is followed by sequential addition of biotin-conjugated goat anti-mouse lgG or IgA, peroxidase-conjugated avidin-biotin, and ophenylenediamine substrate. Color development is again

3.5 O m ,q,


1 year

SIVmne

> 19 weeks after

PMPA 30 or 75 mg/kg, s.q. for 28 days

No reduction in viral antigen levels in lymph nodes No reduction of infectious virus levels in peripheral blood Reduced virus levels Reduced virus levels, enhanced immune responses, prolonged survival Strong reduction in virus levels

s.q., Subcutaneously; AZT, zidovudine; FLT, 3'-fluorothymidine; PMEA, 9-[2-(phosphonomethoxy)ethyl]adenine; PMPA, 9-[2-(phosphonomethoxy)propyl]adenine.

ANIMAL MODELS OF HIV INFECTION: SlV INFECTION OF MACAQUES

antiviral drug administration starting prior to, or at the time of, virus inoculation could prevent infection when a minimal dose of SIV was used for the inoculation (reviewed by Black, 1997). Two compounds were highly effective in preventing infection when treatment was started after virus inoculation: PMPA and 2',3'-dideoxy-3'-hydroxymethyl cytidine (BEA-005; Tsai et al., 1995a; B6ttiger et aL, 1997; Van Rompay et al., 1998a). When infection was not prevented, early drug treatment reduced or delayed the peak of rapid virus replication that occurs during the first weeks of infection (Table 128.2). Reduction in early virus replication resulted in delayed disease progression (Rausch et al., 1995; Van Rompay et al., 1995, 1996; Joag et al., 1997).

T h e r a p y of chronic SIV infection

Few non-human primate studies have investigated the effects of antiretroviral drug therapy on established chronic SIV infection (i.e., after the acute viremia stage; Table 128.3). Initial studies with AZT failed to demonstrate therapeutic effects for macaques once SIV infection was established (B6ttiger et aL, 1992b; Van Rompay et aL, 1992); this was partially due to the relatively weak efficacy of AZT monotherapy to inhibit SIV replication, but also to the lack of sensitive assays to measure virus replication during the asymptomatic stage. During recent years, the discovery of more potent antiviral drugs and the development of more sensitive assays to monitor virus levels during the asymptomatic stage (such as quantitation of viral RNA in plasma) have demonstrated the usefulness of macaques with chronic infection to test the efficacy of novel antiviral drugs, such as 9-[2-(phosphonomethoxy)ethyl]adenine (PMEA) and PMPA (Tsai et all., 1995b, 1997; Van Rompay et al., 1996; Nowak et aL, 1997). Studies with infant macaques have also studied the emergence of drug-resistant SIV mutants during prolonged drug treatment (Van Rompay et aL, 1995, 1996).

Pitfalls (advantages/disadvantages) of the model SIV infection of macaques is generally believed to be the best animal model for HIV infection. Of all members of the animal kingdom, non-human primates are phylogenetically the closest to humans, and have a very similar physiology (including drug pharmacokinetics and metabolism, fetal and neonatal development, and immunology). In addition, SIV is closely related to HIV, and causes a disease in macaques which very closely resembles human AIDS. We can use the same parameters to monitor infection and disease progression as those which are used for HIVinfected patients. Although the high costs of purchasing and housing macaques limit the number of animals per

1065

study, well-designed studies with relatively small animal numbers allow recognition of statistically and biologically significant differences. All these factors allow a more reliable extrapolation of results obtained in non-human primate models towards clinical applications for the human population. The main disadvantage is that SIV, although closely related, is not identical to HIV-1. For antiviral drug studies, it is noteworthy that the polymerase region of SIV has about 60% amino acid homology to that of HIV-1 (Myers et al., 1991). Although SIV is susceptible to many of the same inhibitors of reverse transcriptase (RT) and protease enzymes at approximately the same in vitro concentrations as HIV-1, an exception is the non-nucleoside inhibitors (such as nevirapine) which are specific for HIV-1 and do not inhibit replication of HIV-2 and SIV (reviewed by De Clercq, 1995). To overcome this problem, SIV/HIV-1 chimeric viruses that contain the HIV-1 RT into an SIV background and that are infectious for macaques have been constructed (fUberla et al., 1995).

Contributions of the model to infectious disease therapy Because SIV infection of macaques closely resembles HIV infection of humans, this animal model continues to be extremely valuable in gaining a better understanding of transmission and disease pathogenesis, and for vaccine development. In addition, because their physiology is so similar to that of humans, the macaque model has been very useful for studying toxicity and pharmacokinetics of antiviral drugs, including transplacental drug transfer. By using different study designs (i.e., by manipulating variables such as initiation of drug treatment relative to virus inoculation, the duration of treatment, the age of the animals, the virulence and drug susceptibility of the virus inoculum), investigators have demonstrated that macaque models are well-suited to address very specific questions which are directly relevant to drug treatment of human HIV infection. Macaque studies have provided us with important insights regarding pre- and post-exposure prophylaxis, the effects of early drug intervention, and the emergence and clinical implications of drug-resistant viral variants. The observation that a 6-week AZT treatment regimen prevented SIV infection of infant macaques (Van Rompay et al., 1992) has preceded the demonstration that AZT can prevent infection of humans following exposure to HIV in two clinical settings. First of all, AIDS Clinical Trials Group Protocol 076 demonstrated that AZT administration to HIV-infected pregnant women beginning at 14-34 weeks of gestation, and continuing to their newborns during the first 6 weeks of life, reduces the rate of vertical HIV transmission by two-thirds; implementation of these results has been a major advance in the combat against pediatric

1066

HIV infection (Connor et aL, 1994). More recently, it has also been demonstrated that A Z T administration to health care workers following percutaneous HIV exposure by needlestick accidents reduces the risk of infection by 80% (MMWR, 1995, 1996). The development of antiviral drugs with even higher chemoprophylactic potential in nonhuman primates, such as PMPA (Tsai et aL, 1995a; Van Rompay et aL, 1998a,b), raises the hope that in the future more effective and shorter intervention regimens may become available to reduce vertical HIV transmission drastically, especially for the developing countries. As described earlier, antiviral drug studies in macaques demonstrated that even when SIV infection was not prevented, early drug treatment during the first weeks of infection reduced the peak of rapid virus replication and resulted in enhanced antiviral immune responses and delayed disease progression. In recent years, this observation has been confirmed in HIV-infected people, as there is increasing evidence that early drug intervention during the initial stages of infection offers strong benefits in terms of long-term suppression of viral replication, enhanced antiviral immune responses, and delayed disease progression (Kinloch-de Lo/Ss et aL, 1995; Lafeuillade et aL, 1997; Rosenberg et aL, 1997). In recent years, SIV infection of macaques has also been used to gain a better understanding of the clinical implications of drug-resistant viral mutants. Although the emergence of drug-resistant HIV mutants is a sign of incomplete suppression of virus replication, it is unclear whether drugresistant mutants are fully virulent and whether their emergence contributes to reduced efficacy or failure of drug therapy. Although many studies have focused on determining the in vitro growth kinetics of drug-resistant HIV mutants, studies in the SIV-macaque model have demonstrated repeatedly that the correlation between viral in vitro growth properties and in vivo virulence is often very weak (Kestler et aL, 1991; Lohman et aL, 1994). An animal model allows an approach which is impossible and unethical to do in humans, but which is the most direct way to study the in vivo virulence of drug-resistant mutants minoculation of animals with drug-resistant viral mutants. In recent years, several studies with infant macaques have investigated the emergence of drug-resistant SIV mutants during prolonged therapy with A Z T or PMPA (Van Rompay et aL, 1995, 1996); the clinical implications were further investigated by inoculation of these drug-resistant viruses into naive newborn macaques (Van Rompay et aL, 1997, 1999). Accordingly, this animal model of AIDS provides a system to study first, whether drug resistance mutations affect viral virulence, and second, if drug resistance can be responsible for loss or reduction of the efficacy of drug treatment. The important role that the SIV animal model can play in the clinical development of anti-HIV drugs is exemplified by PMEA and PMPA. These compounds are not highly potent inhibitors of HIV and SIV replication in vitro; however, when PMEA and PMPA were tested in macaques, a surprisingly high antiviral activity was

K . K . A . Van Rompay and N. L. Aguirre

observed (Tsai et aL, 1995a,b, 1997; Van Rompay et aL, 1996). Results of these macaque studies played a major role in moving these drugs into human clinical trials. In conclusion, the optimization of the SIV-macaque model for antiviral drug testing, coupled with a better understanding of HIV disease pathogenesis, is leading to a growing recognition of the importance of results obtained in this animal model. It can be expected that, in coming years, the value of these non-human primate models will continue to grow as excellent and very adaptable tools to rapidly gather data that provide a solid scientific basis to guide human clinical trials.

References Balzarini, J., Naesens, L., Slachmuylders, J. et aL (1991). 9-(2phosphonylmethoxyethyl)adenine (PMEA) effectively inhibits retrovirus replication in vitro and simian immunodeficiency virus infection in rhesus monkeys. AIDS, 5, 21-28. Black, R. J. (1997). Animal studies of prophylaxis. Am. J. Med., 102, 39-43. B6ttiger, D., Vrang, L., Oberg, B. (1992a). Influence of the infectious dose of simian immunodeficiency virus on the acute infection in cynomolgus monkeys and on the effect of treatment with 3'-fluorothymidine. Antivir. Chem. Chemother., 3, 267-271.

B6ttiger, D., Stfihle, L., Li, S.-L., Oberg, B. (1992b). Long-term tolerance and efficacy of 3'-azido-thymidine and 3'-fluorothymidine treatment of asymptomatic monkeys infected with simian immunodeficiency virus. Antimicrob. Agents Chemother., 36, 1770-1772. B6ttiger, D., Johansson, N. G., Samuelsson, B. et aL (1997). Prevention of simian immunodeficiency virus, SIVsm, or HIV-2 infection in cynomolgus monkeys by pre- and postexposure administration ofBEA-OO5. AIDS, 11,157-162. Cohen, J. (1997a). AIDS trials ethics questioned. Science, 276, 520-523. Cohen, J. (1997b). Ethics of AZT studies in poorer countries attacked. Science, 276, 1022. Connor, E. M., Sperling, R. S., Gelber, R. et aL (1994). Reduction of maternal-infant transmission of human immunodeficiency virus type 1 with zidovudine treatment. N. EngL J. ivied., 331, 1173-1180. De Clercq, E. (1995). Antiviral therapy for human immunodeficiency virus infections. Clin. MicrobioL Rev., 8, 200-239. Desrosiers, R. C. (1990). The simian immunodeficiency viruses. Annu. Rev. ImmunoL, 8, 557-578. Du, Z. J., Lang, S. M., Sasseville, V. G. et aL (1995). Identification of a nef allele that causes lymphocyte activation and acute disease in macaque monkeys. Cell, 82, 665-674. Fultz, P. N., McClure, H. M., Anderson, D. C., Switzer, W. M. (1989). Identification and biologic characterization of an acutely lethal variant of simian immunodeficiency virus from sooty mangabeys (SIWSMM). AIDS Res. Hum. Retroviruses, 5, 397-409. Gardner, M. B. (1996). The history of simian AIDS. J. Med. PrimatoL, 25, 148-157. Hu, S.-L., Haigwood, N. L., Morton, W. R. (1993). Non-human primate models for AIDS research. In H I V Molecular

ANIMAL MODELS OF HIV INFECTION: SlY INFECTION OF MACAQUES

Organization, Pathogenicity and Treatment (eds Morrow, W. J. W. Haigwood, N. L.), pp. 294-327. Elsevier, Amsterdam. Israel, Z. R., Dean, G. A., Maul, D. H. et al. (1993). Early pathogenesis of disease caused by SIVsmmPBjl4 molecular clone 1.9 in macaques. AIDS Res. Hum. Retroviruses, 9, 277-286. Joag, S. V., Li, Z., Foresman, L. et al. (1997). Early treatment with 9-(2-phosphonylmethoxyethyl)adenine reduces virus burdens for a prolonged period in SIV-infected rhesus macaques.AIDS Res. Hum. Retroviruses, 13, 241-246. Kestler, H. W., III, Ringler, D. J., Mori, K. et al. (1991). Importance of the nefgene for maintenance of high virus loads and for development of AIDS. Cell, 65, 651-662. Kinloch-de Lo&, S., Hirschel, B. J., Hoen, B. et al. (1995). A controlled trial of zidovudine in primary human immunodeficiency virus infection. N. Engl. J. Med., 333, 408-413. Lafeuillade, A., Poggi, C., Tamalet, C., Profizi, N., Tourres, C., Costes, O. (1997). Effects of a combination of zidovudine, didanosine, and lamivudine on primary human immunodeficiency virus type 1 infection.J. Infect. Dis., 175, 1051-1055. Lange, J. M. A. (1997). Current problems and the future of antiretroviral drug trials. Science, 276, 548-550. Le Grand, R., Clayette, P., Noack, O. et al. (1994). An animal model for antilentiviral therapy: effect of zidovudine on viral load during acute infection after exposure of macaques to simian immunodeficiency virus. AIDS Res. Hum. Retroviruses, 10, 1279-1287. Letvin, N. L., King, N. W. (1990). Immunologic and pathologic manifestations of the infection of rhesus monkeys with simian immunodeficiency virus of macaques. J. AIDS, 3, 1023-1040. Levy, J. (1997). HIV and the Pathogenesis of AIDS, 2nd edn. American Society for Microbiology Press, Washington, DC. Lohman, B. L., McChesney, M. B., Miller, C. J.etal. (1994). A partially attenuated simian immunodeficiency virus induces host immunity that correlates with resistance to pathogenic virus challenge. J. Virol., 68, 7021-7029. Martin, L. N., Murphey-Corb, M., Soike, K. F., DavisonFairburn, B., Baskin, G. B. (1993). Effects of initiation of 3'azido-3'-deoxythymidine treatment at different times after infection of rhesus monkeys with simian immunodeficiency virus. J. Infect. Dis., 168, 825-835. McClure, H. M., Anderson, D. C., Ansari, A. A., Fultz, P. N., Klumpp, S. A., Schinazi, R. F. (1990). Nonhuman primate models for evaluation of AIDS therapy. Ann. N.Y. Acad. Sci., 616, 287-298. Miller, C. J. (1994). Use of the SIV/rhesus macaque system to test virucides designed to prevent the sexual transmission of HIV. In Barrier Contraceptives: Current Status and Future Prospects (eds Mauck, C. K. et al.), pp. 213-223. Wiley-Liss, New York. Miller, C., Rosenberg, Z., Bischofberger, N. (1996). Use of topical PMPA to prevent vaginal transmission of SIV. Ninth International Conference on Antiviral Research, Fukushima, May 19-24 (late breaker abstract). M. M. W. R. (1995). Case-control study ofHIV seroconversion in health-care workers after percutaneous exposure to HIVinfected blood France, United Kingdom, and United States, January 1988-August 1994. M.M.W.R., 44, 929-933. M. M. W. R. (1996). Update: provisional Public Health Service recommendations for chemoprophylaxis after occupational exposure to HIV. M.M.W.R., 45, 468-472. Myers, G., Berzofsky, J. A., Korber, B., Smith, R. F., Pavlakis, G. N. (1991). Human Retroviruses and AIDS. A Compilation and

1067

Analysis of Nucleic Acid and Amino Acid Sequences. Los Alamos National Laboratory, Los Alamos, New Mexico. Nowak, M. A., Lloyd, A. L., Vasquez, G. M. et al. (1997). Viral dynamics of primary viremia and antiretroviral therapy in simian immunodeficiency virus infection. J. Virol., 71, 7518-7525. Oxtoby, M. J. (1994). Vertically acquired HIV infection in the United States. In Pediatric AIDS. The Challenge of H I V Infection in Infants, Children and Adolescents (eds Pizzo, P. A., Wilfert, C. M.), pp. 3-20. Williams & Wilkins, Baltimore, MD. Rausch, D. M., Heyes, M. P., Murray, E. A., Eiden, L. E. (1995). Zidovudine treatment prolongs survival and decreases virus load in the central nervous system of rhesus macaques infected perinatally with simian immunodeficiency virus. J. Infect. Dis., 172, 59-69. Rosenberg, E. S., Billingsley, J. M., Caliendo, A. M. et al. (1997). Vigorous HIV-l-specific CD4+ T cell responses associated with control of viremia. Science, 278, 1447-1450. Tsai, C.-C., Follis, K. E., Sabo, A. et al. (1994). Preexposure prophylaxis with 9-(-2-phosphonylmethoxyethyl)adenine against simian immunodeficiency virus infection in macaques. J. Infect. Dis., 169, 260-266. Tsai, C.-C., Follis, K. E., Beck, T. W. et al. (1995a). Prevention of simian immunodeficiency virus infection in macaques by 9-(2phosphonylmethoxypropyl)adenine (PMPA). Science, 270, 1197-1199. Tsai, C.-C., Follis, K. E., Sabo, A., Grant, R., Bischofberger, N. (1995b). Efficacy of 9-(2-phosphonylmethoxyethyl)adenine treatment against chronic simian immunodeficiency virus infection in macaques. J. Infect. Dis., 171, 1338-1343. Tsai, C.-C., Follis, K. E., Beck, T. W., Sabo, A., Bischofberger, N., Dailey, P. J. (1997). Effects of (R)-9-(2-phosphonylmethoxypropyl)adenine monotherapy on chronic SIV infection. AIDS Res. Hum. Retroviruses, 13, 707-712. fJberla, K., Stahl-Hennig, C., B6ttiger, D. et al. (1995). Animal model for the therapy of acquired immunodeficiency syndrome with reverse transcriptase inhibitors. Proc. Natl Acad. Sci. USA, 92, 8210-8214. Van Rompay, K. K. A., Marthas, M. L., Ramos, R. A. etal. (1992). Simian immunodeficiency virus (SIV) infection of infant rhesus macaques as a model to test antiretroviral drug prophylaxis and therapy: oral 3'-azido-3'-deoxythymidine prevents SIV infection. Antimicrob. Agents Chemother., 36, 2381-2386. Van Rompay, K. K. A., Otsyula, M., Marthas, M. L., Pedersen, N. C. (1994). Simian immunodeficiency virus infection of newborn and infant rhesus macaques: an animal model for testing antiretroviral drugs. Int. Antiviral News, 2, 5-6. Van Rompay, K. K. A., Otsyula, M. G., Marthas, M. L., Miller, C. J., McChesney, M. B., Pedersen, N. C. (1995). Immediate zidovudine treatment protects simian immunodeficiency virus-infected newborn macaques against rapid onset of AIDS. Antimicrob. Agents Chemother., 39, 125-131. Van Rompay, K. K. A., Cherrington, J. M., Marthas, M. L. et al. (1996). 9-[2-(Phosphonomethoxy)propyl]adenine therapy of established simian immunodeficiency virus infection in infant rhesus macaques. Antimicrob. Agents Chemother., 40, 2586-2591. Van Rompay, K. K. A., Greenier, J. L., Marthas, M. L. et al. (1997). A zidovudine-resistant simian immunodeficiency virus mutant with a Q151M mutation in reverse transcriptase causes AIDS in newborn macaques. Antimicrob. Agents Chemother., 41,278-283.

1068

Van Rompay, K. K. A., Cherrington, J. M., Marthas, M. L. et aL (1999). 9-[2-(Phosphonomethoxy)propyl]adenine (PMPA) therapy prolongs survival of infant macaques inoculated with simian immunodeficiency virus with reduced susceptibility to PMPA. Antimicrob. Agents Ckernotker., 43, in press. Van Rompay, K. K. A., Marthas, M. L., Lifson, J. D. etal. (1998a). Administration of 9-[2-(phosphonomethoxy)-propyl]adenine

K . K . A . Van Rompay and N. L. Aguirre

(PMPA) for prevention of perinatal simian immunodeficiency virus infection in rhesus macaques. AIDS Res. Hum. Retroviruses, 14, 761-763. Van Rompay, K. K. A., Berardi, C. l., Aguirre, N. L.etaL (1998b). Two doses of 9-[2-(phosphonomethoxy)-propyl]adenine (PMPA) protect newborn macaques against oral simian immunodeficiency virus infection. AIDS, 12, F79-F83.

Chapter 129

The SCID-hu Thy/Liv Mouse: an Animal Model for HIV-1 Infection C. A. Stoddart

Background of human infection Estimates for 1997 by The Joint United Nations Programme on HIV/AIDS (UN-AIDS) and the World Health Organization indicate that over 30 million people are infected with human immunodeficiency virus type 1 (HIV) worldwide. Better prevention and potent new antiretroviral drugs have limited the spread of HIV-1 and reduced mortality from acquired immunodeficiency syndrome (AIDS) in the United States and western Europe, but HIV-1 continues to spread in the developing world, where more than 90% of HIV-l-infected people live. An estimated 5.8 million people acquired HIV-1 infection and 2.3 million people died of AIDS in 1997. After entry into the body and probable interaction with a dendritic cell, HIV-1 is carried to a CD4+ T cell in a lymphoid organ where it establishes infection and disseminates progeny virus throughout the body (see Fauci, 1996 and Cohen et aL, 1997, for recent reviews). Viral replication is partially controlled by robust immune responses, but the virus escapes from immune control and produces a chronic, persistent infection that leads to fatal disease in about 10 years. In the absence of antiretroviral therapy, tremendous viral turnover rates of-10 ~° virions per day and continual loss of infected CD4 + T cells result in the eventual destruction of the immune system and death from wasting and opportunistic infections. Although the pathogenesis of HIV-l-induced disease is complex and multifactorial (Fauci, 1996), recent advances in our understanding of the role of host factors, viral coreceptors, and cellular tropism in host-HIV-1 interactions suggest new strategies for prevention and therapy. The discovery and identification of HIV-l-suppressing cytokines and inhibitors of coreceptor-mediated HIV-1 entry may lead to promising and novel antiviral agents that could first be evaluated in animal models of HIV-1 disease (McCune, 1997; Moore, 1997).

Background of model The SCID-hu mouse was designed to provide a small animal model for studying human hematopoiesis (McCune Handbook of Animal Models of Infection ISBN 0-12-775390-7

et aL, 1988), facilitating examination of the pathogenesis of HIV-1 in human hematolymphoid organs (Namikawa et aL, 1988; Kaneshima et aL, 1991; McCune et aL, 1991), and evaluation of agents possessing anti-HIV-1 activity in vitro (McCune et aL, 1990; Rabin et aL, 1996). In this model,

severe combined immunodeficient (SCID) mice are implanted with a variety of human fetal organs, including bone, liver, thymus, lymph node, and spleen. In defined instances, the fetal implants become tolerant of the mouse environment and, reciprocally, growth of the human tissue is permitted by the immunocompromised status of the recipient SCID mouse (McCune, 1996, 1997). The SCID-hu Thy/Liv construct is the result of implantation of interactive human lymphoid organs (fragments of human fetal thymus and liver) beneath the mouse kidney capsule. In a highly reproducible manner, the human fetal organs fuse, vascularize, and grow, eventually reaching a total mass of 107-108 human cells in 80-90% of recipient mice. A stable organ termed 'Thy/Liv' is thus established, and it successfully reproduces the differentiation, proliferation, and function of human hematopoietic progenitor cells (derived from the fetal liver) within the context of the human thymus (Namikawa et aL, 1990; McCune, 1996). The Thy/Liv implant possesses histologically normal cortical and medullary compartments that are capable of long-term multilineage human hematopoiesis (Namikawa et aL, 1990; Krowka et aL, 1991), including the generation of large numbers of CD4-bearing thymocytes which can serve as target cells for HIV-1 infection and replication. Importantly for a model of antiviral chemotherapy, it is possible to construct large numbers of SCID-hu Thy/Liv mice (typically 45-60) with tissue from the same fetal donor, and the Thy/Liv organ itself is amenable to experimental manipulation (e.g., infection with HIV- 1). Cells in the Thy/Liv organ are permissive to infection by primary, but not by tissue culture-adapted, isolates after direct inoculation of HIV-1 (Kaneshima et aL, 1991; Su et aL, 1997). Infection with some isolates leads to thymocyte depletion and thymic involution within 3-5 weeks (Aldrovandi et aL, 1993; Bonyhadi et aL, 1993; Stanley et aL, 1993; Kaneshima et aL, 1994). Both T cells and myeloid cells are targets of viral replication, and infection is accompanied by an absolute decrease in the number of double-positive Copyright © 1999 Academic Press All rights of reproduction in any form reserved

1

0

7

0

C

(CD4+CD8+) immature cortical cells and single-positive (CD4+ or CD8+) mature medullary cells. The loss of CD4+ cells is typically greater than that of CD8+ cells, resulting in an inversion of the CD4/CD8 ratio. Viral replication and thymocyte depletion are inhibited by treating the mice with the nucleoside analogs zidovudine (AZT) and didanosine (ddI), with the non-nucleoside reverse transcriptase inhibitor nevirapine, and with a bicyclam inhibitor of viral entry (McCune et aL, 1990; Datema et al., 1996; Rabin et aL, 1996).

Animal species Male inbred homozygous scid/scid (CB-17/IcrTac-scidfDF) mice are used. The autosomal, recessive scid mutation arose spontaneously in CB-17 mice (Bosma et al., 1983), and homozygous mice fail to develop immunocompetent T or B lymphocytes because of a defect in VDJ somatic recombination (Malynn et al., 1988). Implantation of human fetal tissues is performed when the mice are 8-12 weeks of age. Male SCID mice are used because they have larger kidneys, less peritoneal fat, produce less scar tissue after surgical manipulation, and thus have more accessible Thy/Liv implants than do female SCID mice.

.

A. Stoddart

and liver are implanted beneath the kidney capsule to create SCID-hu Thy/Liv mice. Cohorts of 45-60 mice are produced with tissue from the same fetal donor.

Materials required Materials required include cell culture medium (RPMI 1640 containing 10% fetal bovine serum, L-glutamine, and antibiotics), dissection microscope, 102 mm microdissecting straight scissors, 127 mm Semken serrated forceps, 102 mm microdissecting (serrated, straight, extra-delicate) forceps, Vannas straight spring forceps, anesthetic (described below), rodent ear punch, electric hair clippers, 70% ethanol solution, povidone-iodine skin disinfectant, isothermal heating pads (DehaPhase, Braintree Scientific), 18 G trocar (catalog #7926, Popper and Sons, New York), high-vacuum grease (Dow-Corning), l l 0 m m pattern #5 Dumont straight tweezers, 114 mm Moloney serrated curved forceps, suture material (Ethibond 4.0 non-dissolving polyester), Olsen-Hegar (serrated jaws, extra-delicate) needle holder, and Autoclip surgical stapler and 9 mm metal wound clips. Except for trocars, all surgical instruments are purchased from Roboz Surgical, Rockville, MD.

Preparation of animals

Preparation of tissue for implantation

Mice are housed under specific pathogen-free conditions in mouse cages equipped with filter-top isolator bonnets. Cages, bedding, and water bottles are sterilized by autoclaving, and drinking water is maintained at pH 2.5-2.9 by addition of 12 N HC1. Mice are fed ad lib#urn with 3'-irradiated low-fat mouse chow, and food pellets containing trimethoprim-sulfamethoxazole (SCID's MD's, Bio-Serv, Frenchtown, NJ) are added to the food bins to prevent opportunistic infection with Pneumocystis carinii. Each cage rack contains one cage of immunocompetent DBA/2 sentinel mice that receives soiled bedding from the SCID mouse cages at each cage cleaning. Sentinel mice are screened every 6 weeks by serology for a panel of murine pathogens, including murine hepatitis virus, Sendai virus, pneumonia virus of mice, Mycoplasrna pulmonis, parvovirus, and Theiler's murine encephalitis virus (GD-VII). Lungs from 2 or 3 euthanized SCID mice are examined histologically for evidence of P. carinii every 3 months. Mice are rested for a minimum of 1 week after arrival before surgical manipulation or drug dosing.

Fresh, intact human fetal thymus and liver are acquired from products of conception aged 16-24 gestational weeks. All procedures are performed with approval and oversight by institutional human subjects and animal review boards. The tissues are kept in cold medium and minced under a dissection microscope into 1-2 mm 3 pieces. Microdissecting scissors and 127 mm Semken forceps are used for gross dissection of tissue, followed by fine dissection with 102 mm microdissecting forceps and Vannas scissors into appropriately sized fragments. Liver fragments are prepared from undamaged core sections, and thymus fragments that contain thymic lobules (not just connective tissue) are selected by viewing under the dissection microscope. One piece of thymus and two pieces of liver are prepared for each mouse to be implanted, and the coimplanted tissues are obtained from the same fetal donor.

Details of surgery Overview The left kidneys of anesthetized SCID mice are surgically exposed, and 1-2 mm 3 fragments of human fetal thymus

Anesthesia Mice are anesthetized with 100mg/kg ketamine plus 8 mg/kg xylazine by intraperitoneal injection. The anesthetic solution contains 10 mg/ml ketamine (1:10 dilution) and 0.8 mg/ml xylazine (1:25 dilution) in phosphatebuffered saline (PBS) and is administered to the mice at 10 ~1 per gram body weight. Mice that recover prematurely from anesthesia are given methoxyflurane (Metofane) by brief (30 second) inhalation.

THE SCID-HU THWLIV MOUSE: AN ANIMAL MODEL FOR HIV-1 INFECTION Surgical p r o c e d u r e

Anesthetized mice are numbered by ear-punching, and the left side is shaved and disinfected with 70% ethanol followed by povidone-iodine solution. Mice are kept warm on heating pads and their eyes are kept moistened with PBS. The mouse is placed on its right side and a 10 mm lateral incision is made through the skin of the left side with microdissecting scissors. An 8 mm incision through the abdominal wall is then made immediately posterior to the vein in the peritoneal fascia that lies over the spleen. Gentle pressure is applied around the incision so that kidney emerges and rests outside the abdomen, and the kidney is kept moistened with medium to facilitate the sliding motion of surgical instruments and tissue. A greased trocar needle is loaded with a sandwich of tissue in the order: liver, thymus, liver. The kidney capsule is pricked at the caudal end with Dumont #5 pattern forceps, and the loaded trocar needle is inserted, bevel down, through the pricked hole

8-Week-old SCID Mouse

1071

and slid along the dorsal arch of the kidney to a point onethird of the way from the rostral end (Figure 129.1). The plunger (coated with high-vacuum grease to maintain a proper seal) is slowly depressed while the trocar is withdrawn, pushing the tissue fragments out and on to the surface of the kidney underneath the capsule. If the implanted fragments need to be grouped or repositioned, they are pushed by sliding the moistened trocar over the kidney capsule. The kidney is moistened with medium and slipped back into the abdomen by pulling the abdominal wall over the kidney with 114 mm Moloney curved forceps. The abdominal wall is approximated with a single suture, and the skin is closed with one 9 mm metal clip. Mice are placed in a clean cage and monitored until recovery from anesthesia.

Implant a s s e s s m e n t

The size and quality of the Thy/Liv implants are determined 12-14 weeks after implantation in 20% of randomly chosen mice per cohort. Mice are anesthetized and their kidneys are exposed as described above. Implants should be convex in shape, white or cream-colored, vascularized, and have no evidence of bacterial infection. If >80% of the examined implants are ___30mm3 (Figure 129.2), the entire cohort is deemed acceptable and used for HIV- 1 inoculation.

Storage, preparation of inocula Human Liver Human Thymus Human Liver

:Kidney 18 Weeks Later

Figure 129.1 Construction of the severe combined immunodeficiency (SCID-hu) Thy/Liv mouse and inoculation of human immunodeficiency virus type 1 (HIV-1) into an established Thy/Liv organ by direct injection 18 weeks after implantation.

All procedures using infectious HIV-1 are carried out in a Biosafety Level 3 (BL3) facility or in a restricted animal barrier facility under BL3 guidelines. Seed virus from HIV-1 molecular clones is prepared by electroporation of 25 lag of HIV-1 D N A per 5 × 106 flesh phytohemagglutinin (PHA)activated peripheral blood mononuclear cells (PBMC) at 960 [aF and 280 V. Clinical HIV-1 isolates are derived from HIV-l-seropositive patients, and seed virus is obtained by cocuhivation of patient-derived PHA-activated PBMC with PHA-activated PBMC from normal uninfected donors. Working stocks of HIV-1 for implant inoculation are kept at low passage and are prepared by inoculating 108 fresh PHA-activated PBMC with 2 x 105 50% tissue culture infectious doses (TCIDs0) of seed virus in 5 ml of complete medium containing 5 lag polybrene per ml. After 2 hours at 37°C, the cells are diluted to a density of 2-3 x 106 per ml in complete medium containing 50 U interleukin-2 (from human lymphocytes, Boehringer-Mannheim) per ml. On day 3, the cells are counted, and an equal number of uninfected PHA-activated PBMC are added for a final cell concentration of 1.5 x 106 per ml. Virus-containing supernatants are collected daily on days 4-7, and fresh cells are added after each collection, as described above for day 3. Alternatively, working stocks of HIV-1 molecular clones

1072

can be obtained by calcium phosphate transfection of 293T cells (15-30 lag HIV-1 DNA per 5 x 106 cells) with supernatants harvested on days 2 and 3. Virus-containing supernatants are aliquoted and stored in liquid nitrogen, and representative aliquots are analyzed for infectious virus titer by limiting dilution (TCID50) assay in PHA-activated PBMC. Working stocks should have a titer of>l 04.6TCID50 per ml so that each implant can be inoculated with at least 1000-2000 TCID50 in a volume of 25-50 btl.

Infection process Implants are inoculated 16-24 weeks after tissue implantation. Procedures are performed in a restricted animal barrier facility under BL3 guidelines (i.e., with two pairs of gloves, mask, eye-covering, gown, and booties). To maximize visual and manual access, teams of three operators work side-by-side on a bench top. One operator shaves the mouse and exposes the left kidney carrying the Thy/Liv implant as described above. The second operator then gently immobilizes the kidney with forceps and marks an opening in the kidney capsule over the implant with India ink injected with a 1 cc tuberculin syringe and 30 G x V2inch sharp needle (Figure 129.1). Using the ink mark as a guide, the Thy/Liv implant is injected with 25-50 btl of stock virus (1000-2000 TCID50) in 1-3 places with a 250 lal Hamilton glass syringe and 30 G x V2inch blunt needle. A third operator closes the incision as described above. Viral inoculum-containing vials are kept frozen on dry ice until several mice are anesthetized and their implants exposed. Implants are inoculated within 30 minutes of thawing the vial, after which another vial is thawed and used.

Key parameters to monitor infection Implant processing At various times after HIV-1 inoculation (but typically after 12 days), mice are euthanized by CO2 inhalation followed by cervical dislocation, and the Thy/Liv implants are surgically excised and transferred into 6-well tissue culture plates containing cold PBS with 2% fetal bovine serum (FBS). A single cell suspension is made by placing the implant into a sterile nylon mesh bag, submerging the bag in PBS/2% FBS in a 60 mm tissue culture dish, and gently grinding the tissue between the nylon layers with forceps. The cells are counted with a Coulter counter, and appropriate numbers of cells are aliquoted for each assay. For p24 ELISA, pellets of 2.5 × 106 cells are resuspended in 400 lttl of p24 lysis buffer (1% Triton X-100, 0.5% sodium deoxycholate, 5mmol/1 ethylenediaminetetraacetic acid (EDTA), 25mmol/1 Tris C1, 250 mmol/1 NaC1 and 1% aprotinin), rotated overnight at

C.A. Stoddart

4°C, and stored at-20°C. For quantitation of infectious HIV-1, cells are serially diluted in fivefold increments and added to PHA-activated PBMC in 96-well plates. For DNA polymerase chain reaction (PCR), pellets containing 1 x 103 cells are stored a t - 8 0 ° C . For RNA quantitation by branched DNA (bDNA) assay, dry pellets of 2-5 x 106 cells are frozen and stored at-80°C. For flow cytometry analysis, 106 cells per well are placed in a 96-well plate for staining and fixation, and analyzed on the same day.

p24 ELISA assay Samples are lysed in p24 lysing buffer and transferred into HIV p24 antibody-coated microplates (Dupont) for quantitative enzyme-linked immunosorbent assay (ELISA). A standard curve is generated, and results are calculated as pg p24 per 106 cells.

Quantitative microculture assay Serially diluted thymocytes are added to 96-well plates containing 105 PHA-activated PBMC per well and incubated at 37°C. A range of 32-100 000 thymocytes per well are cocultivated in duplicate with the PBMC. After 7 days, cell pellets are lysed and assayed for p24, and wells containing detectable p24 (_>30 pg/ml) are scored positive for HIV-1 infection. Implant HIV-1 titers are expressed as log,0 TCIDs0 per 106 implant thymocytes, and the log~0values are used for calculation of geometric means. The limit of detection is 1.0 log~0TCID50 per 106 cells.

DNA PCR Infection of implant thymocytes is assessed by PCR amplification with primers specific for the conserved U5-gag region of the HIV-1 genome (SK145: AGTGGGGGGACATCAAGCAGCCATGCAAAT, SK431: TGCTATGTCAGTTCCCCTTGGTTCTCT; Gibco BRL). Amplification of human ~-globin DNA is performed as a control for the presence of human DNA. Cell pellets containing 1 x 103 cells are lysed in 100 gl of 1% NP40, 1% Tween-20, 2.5 mmol/1 MgC12, 5 mmol/1 KC1 and 10 lag proteinase K per ml. Samples are vortexed, microfuged, incubated at 60°C for 1 hour, heated at 95°C for 10 minutes to inactivate the proteinase K, vortexed, microfuged, and assayed by a standard PCR assay as previously described (McCune et all., 1990). Amplification of 10 gl lysate (corresponding to 100 cell equivalents) is continued for 40 cycles (cycle 1:6 minutes at 95°C, 2 minutes at 60°C, and 1.5 minutes at 72°C; cycles 2-5:2 minutes at 95°C, 2 minutes at 60°C, and 1.5 minutes at 72°C; cycles 6-40:1 minute at 95°C, 1 minute at 60°C, and 1.5 minutes at 72°C; final extension: 10minutes at 72°C and 8 hours at 27°C). Amplified products are subjected to electrophoresis in a 2%

THE SCID-HU THY/LIV MOUSE: AN ANIMAL MODEL FOR HIV-1 INFECTION

agarose gel with molecular weight standards (BstE IIdigested lambda DNA). Gels contained 0.5 ~g ethidium bromide per ml, and images are acquired on an Eagle Eye II gel imager (Stratagene). Control samples A, B, and C are prepared by mixing HIV-l-positive ACH-2 cells with HIV-l-negative implant thymocytes at concentrations of 10%, 2%, and 0%, respectively. Control A should yield a dark HIV-1 DNA band (scored +), control B a light HIV-1 band (+/-), and control C no HIV-1 band (-). The limit of HIV-1 DNA detection is therefore one to two HIV-l-positive cells per 100 input cells. The H20 control sample (-) should yield neither human ]3-globin nor HIV-1 DNA bands.

Viral RNA quantitation by bDNA assay Cells are disrupted with sterile disposable pestles and a cordless motor grinder (Kontes, Vineland, NJ) in 500 lul of 8 mol/l guanidine HC1 with 0.5% sodium N-lauroylsarcosine. The RNA is extracted by adding 500 M1of 100% EtOH containing 20 ~g polyadenylic acid (Sigma) per ml, and each sample is vortexed thoroughly and pelleted at 12,000 g for 20 minutes at 4°C. Supernatants are aspirated to remove DNA, and RNA pellets are washed with 500 lul of 70% EtOH, placed on dry ice, and digested with reagents supplied by the manufacturer (Quantiplex HIV-1 RNA assay 2.0, Chiron Corporation, Emeryville, CA). Implant HIV-1 RNA load is expressed as copies per 106 implant thymocytes, and the log,0 values are used for calculation of geometric means. The limit of detection is typically l0 s RNA copies per 106 cells.

FACS analysis for thymocyte depletion Pellets containing 106 cells are resuspended in 50 ~1 of a monoclonal antibody cocktail containing fluorescein isothiocyanate-conjugated anti-CD4, phycoerythrin-conjugated anti-CD8, and tricolor-conjugated anti-CD3. Cells from one implant are also stained with conjugated, isotypematched antibodies to control for non-specific antibody binding. Cells are incubated for 30 minutes in the dark, washed three times with PBS/2% FBS, resuspended in 200 ILtlof PBS/2% FBS containing 1% paraformaldehyde in 1.5 ml FACS tubes, and analyzed on a FACScan (Beckton Dickinson). After collecting 10 000 events, percentages of marker-positive (CD4+, CD8+, CD4+CD8+, and CD3CD4 + CD8-) thymocytes in the implant samples are determined by gating on a live lymphoid cell population identified by forward- and side-scatter characteristics.

Kinetics of viral replication Intrathymic injection of 1000-2000 TCIDs0 ofHIV-1 NL43 and various clinical isolates leads to productive infection

1078

of virtually all inoculated implants, and time-dependent increases in implant viral load are observed (Rabin et aL, 1996). Proviral DNA is first detectable in implant thymocytes by PCR at 4 days postinoculation (p.i.) and 100% of infected implants are positive by 11-14 days p.i. Infectious virus and viral RMA can first be detected at 7 days p.i. and p24 antigen becomes measurable by ELISA at 10 days p.i. Although the time course of the infection depends on the virus isolate, input titer, and fetal tissue donor, implant viral load parameters (p24, HIV-1 RNA, and infectivity titer) generally peak by 21 days p.i. and decrease thereafter. In this model, HIV-1 cannot be reliably recovered from the mouse peripheral blood or organs. At 12-14 days p.i., the percentage of CD4 +CD8+ immature cortical thymocytes (which is typically 80-90% of total implant thymocytes) begins to decrease and becomes