Genes, Hearing and Deafness: From Molecular Biology to Clinical Practice

1181 FM

4/4/07

4:16 PM

Page i

Genes, Hearing, and Deafness From Molecular Biology to Clinical Practice Edited by Alessandro Martini Audiology and ENT Clinical Institute University of Ferrara Ferrara Italy

Dafydd Stephens School of Medicine Cardiff University Cardiff Wales

Andrew P Read Department of Medical Genetics St Mary’s Hospital Manchester UK

1181 FM

4/4/07

4:16 PM

Page ii

© 2007 Informa UK Ltd First published in the United Kingdom in 2007 by Informa Healthcare, Telephone House, 69–77 Paul Street, London EC2A 4LQ. Informa Healthcare is a trading division of Informa UK Ltd. Registered Office: 37/41 Mortimer Street, London W1T 3JH. Registered in England and Wales number 1072954. Tel: +44 (0)20 7017 6000 Fax: +44 (0)20 7017 6699 Website: www.informahealthcare.com All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means, electronic, mechanical, photocopying, recording, or otherwise, without the prior permission of the publisher or in accordance with the provisions of the Copyright, Designs and Patents Act 1988 or under the terms of any licence permitting limited copying issued by the Copyright Licensing Agency, 90 Tottenham Court Road, London W1P 0LP. Although every effort has been made to ensure that all owners of copyright material have been acknowledged in this publication, we would be glad to acknowledge in subsequent reprints or seditions any omissions brought to our attention. Although every effort has been made to ensure that drug doses and other information are presented accurately in this publication, the ultimate responsibility rests with the prescribing physician. Neither the publishers nor the authors can be held responsible for errors or for any consequences arising from the use of information contained herein. For detailed prescribing information or instructions on the use of any product or procedure discussed herein, please consult the prescribing information or instructional material issued by the manufacturer. A CIP record for this book is available from the British Library. Library of Congress Cataloging-in-Publication Data Data available on application ISBN-10: 0 415 38359 5 ISBN-13: 978 0 415 38359 2 Distributed in North and South America by Taylor & Francis 6000 Broken Sound Parkway, NW, (Suite 300) Boca Raton, FL 33487, USA Within Continental USA Tel: 1 (800) 272 7737; Fax: 1 (800) 374 3401 Outside Continental USA Tel: (561) 994 0555; Fax: (561) 361 6018 Email: [email protected] Distributed in the rest of the world by Thomson Publishing Services Cheriton House North Way Andover, Hampshire SP10 5BE, UK Tel: +44 (0)1264 332424 Email: [email protected] Composition by Egerton + Techset. Printed and bound in India by Replika Press Pvt Ltd.

1181 FM

4/4/07

4:16 PM

Page iii

Contents List of contributors

v

Preface

ix

PART I: GENETICS AND HEARING IMPAIRMENT 1 Understanding the genotype: basic concepts Andrew P Read

3

2 Understanding the phenotype: basic concepts in audiology Silvano Prosser, Alessandro Martini

19

3 Newly emerging concepts in syndromology relevant to audiology and otolaryngology practice William Reardon

39

4 Deafblindness Claes Möller

55

5 Nonsyndromic hearing loss: cracking the cochlear code Rikkert L Snoeckx, Guy Van Camp

63

6 Age-related hearing impairment: ensemble playing of environmental and genetic factors Lut Van Laer, Guy Van Camp

79

7 Noise-related hearing impairment Ilmari Pyykkö, Esko Toppila, Jing Zou, Howard T Jacobs, Erna Kentala

91

8 Otosclerosis: a genetic update Frank Declau, Paul Van De Heyning

111

9 Mitochondrial DNA, hearing impairment, and ageing Kia Minkkinen, Howard T Jacobs

121

PART II: CURRENT MANAGEMENT 10 Psychosocial aspects of genetic hearing impairment Dafydd Stephens

145

11 Attitudes of deaf people and their families towards issues surrounding genetics Anna Middleton

163

12 Genetics of communication disorders Elisabetta Genovese, Rosalia Galizia, Rosamaria Santarelli, Edoardo Arslan

173

13 Audiometric profiles associated with genetic nonsyndromal hearing impairment: a review and phenotype analysis Patrick L M Huygen, Robert Jan Pauw, Cor W R J Cremers

185

14 Early detection and assessment of genetic childhood hearing impairment Agnete Parving

205

1181 FM

4/4/07

iv

4:16 PM

Page iv

Contents

15 What genetic testing can offer Paolo Gasparini, Andrew P Read

213

16 Pharmacotherapy of the inner ear Ilmari Pyykkö, Esko Toppila, Jing Zou, Erna Kentala

219

17 Diagnosis and management strategies in congenital middle and external ear anomalies Frank Declau, Paul Van De Heyning

239

18 Cochlear implantation in genetic deafness Richard Ramsden, Shakeel Saeed, Rhini Aggarwal

253

19 Auditory neuropathy caused by the otoferlin gene mutation Constantino Morera, Laura Cavallé, Diego Collado, Felipe Moreno

263

PART III: THE FUTURE 20 Innovative therapeutical strategies to prevent deafness and to treat tinnitus Jian Wang, Matthieu Guitton, Jérôme Ruel, Rémy Pujol, Jean-Luc Puel

271

21 Stem cells in the inner ear: advancing towards a new therapy for hearing impairment Marcelo N Rivolta

279

22 Tissue transplantation into the inner ear Mats Ulfendahl

289

23 Gene therapy of the inner ear M Pfister, A K Lalwani

299

24 Mechanisms for hair cell protection and regeneration in the mammalian organ of Corti Sara Euteneuer, Allen F Ryan

305

Index

313

1181 FM

4/4/07

4:16 PM

Page v

Contributors Rhini Aggarwal Department of Otolaryngology Manchester Royal Infirmary Manchester UK

Edoardo Arslan Department of Audiology and Phoniatrics University of Padova Padova Italy

Laura Cavallé Department of Otorhinolaryngology University Hospital La Fe Valencia Spain

Paolo Gasparini Medical Genetics Department of Reproductive Sciences and Development University of Trieste Trieste Italy

Elisabetta Genovese Department of Audiology and Phoniatrics University of Padova Padova Italy

Matthieu Guitton INSERM, U583 Laboratoire de Physiopathólogie et Thérapie des Déficits Sensoriels et Moteurs Montpellier France

Diego Collado Department of Otorhinolaryngology University Hospital La Fe Valencia Spain

Patrick L M Huygen Department of Otolaryngology Radboud University Medical Center Nijmegen The Netherlands

Cor W R J Cremers Department of Otolaryngology Radboud University Medical Center Nijmegen The Netherlands

Frank Declau Department of Otorhinolaryngology, Head and Neck Surgery and Communication Disorders University of Antwerp Antwerp Belgium

Howard T Jacobs Institute of Medical Technology University of Tampere Tampere Finland

Erna Kentala Department of Otolaryngology University of Helsinki Helsinki Finland

A K Lalwani Sara Euteneuer Department of Surgery/Otolaryngology University of California San Diego (UCSD) School of Medicine La Jolla CA USA Department of Otorhinolaryngology St. Elisabeth-Hospital Ruhr-University Boschum School of Medicine Bochum Germany

Department of Otolaryngology and Head and Neck Surgery University of Tübingen Tübingen Germany

Alessandro Martini Audiology and ENT Clinical Institute University of Ferrara Ferrara Italy

Anna Middleton Rosalia Galizia Department of Audiology and Phoniatrics University of Padova Padova Italy

Institute of Medical Genetics School of Medicine Cardiff University Cardiff Wales

1181 FM

4/4/07

vi

4:16 PM

Page vi

List of contributors

Kia Minkkinen Institute of Medical Technology University of Tampere Tampere Finland

Claes Möller Department of Audiology The Swedish Institute of Disability Research – Orelro University Hospital – Orelro Sweden

Felipe Moreno Institute of Molecular Genetics Hospital Ramon y Cajal Madrid Spain

Constantino Morera Department of Otorhinolaryngology University Hospital La Fe Valencia Spain

Agnete Parving Department of Audiology HS Bispebjerg Hospital Copenhagen Denmark

Rémy Pujol INSERM, U583 Laboratoire de Physiopathólogie et Thérapie des Déficits Sensoriels et Moteurs UMR-S583 Université Montpellier Montpellier France

Ilmari Pyykkö Department of Otolaryngology University of Tampere Tampere Finland

Richard Ramsden Department of Otolaryngology Manchester Royal Infirmary Manchester UK

Andrew P Read Department of Medical Genetics St Mary’s Hospital Manchester UK

William Reardon Our Lady’s Hospital for Sick Children Dublin Ireland

Robert Jan Pauw Department of Otolaryngology Radboud University Medical Center Nijmegen The Netherlands

Markus Pfister Department of Otolaryngology and Head and Neck Surgery University of Tübingen Tübingen Germany

Silvano Prosser Audiology Unit and ENT Clinical Institute University of Ferrara Ferrara Italy

Jean-Luc Puel INSERM, U583 Laboratoire de Physiopathólogie et Thérapie des Déficits Sensoriels et Moteurs UMR-S583 Université Montpellier Montpellier France

Marcelo N Rivolta Centre for Stem Cell Biology Department of Biomedical Sciences University of Sheffield Sheffield UK

Jérôme Ruel INSERM, U583 Laboratoire de Physiopathólogie et Thérapie des Déficits Sensoriels et Moteurs Montpellier France

Allen F Ryan Department of Surgery/Otolaryngology and Neuroscience University of California San Diego (UCSD) School of Medicine La Jolla CA USA

Shakeel Saeed Department of Otolaryngology Manchester Royal Infirmary Manchester UK

1181 FM

4/4/07

4:16 PM

Page vii

List of contributors Rosamaria Santarelli Department of Audiology and Phoniatrics University of Padova Padova Italy

Rikkert L Snoeckx Department of Medical Genetics University of Antwerp Antwerp Belgium

Dafydd Stephens School of Medicine Cardiff University Cardiff Wales

Esko Toppila Institute of Occupational Health Helsinki Finland

Guy Van Camp Department of Medical Genetics University of Antwerp Antwerp Belgium

Paul Van De Heyning Department of Otorhinolaryngology, Head and Neck Surgery and Communication Disorders University of Antwerp Antwerp Belgium

Lut Van Laer Department of Medical Genetics University of Antwerp Antwerp Belgium

Jian Wang INSERM, U583 Laboratoire de Physiopathólogie et hérapie des Déficits Sensoriels et Moteurs Montpellier France

Mats Ulfendahl Center for Hearing and Communication Research Karolinska Institutet Stockholm Sweden

Jing Zou Department of Otolaryngology University of Tampere Tampere Finland

vii

1181 FM

4/4/07

4:16 PM

Page viii

1181 FM

4/4/07

4:16 PM

Page ix

Preface Frequently, hearing impairment has been considered to require no more than the provision of a hearing aid, with little understanding of the need for thorough aetiological investigation to ensure prevention and remediation where possible and structured rehabilitation programmes, if the distressing personal and social consequences of hearing impairment are to be avoided. It is worth pointing out that one in every 1,000 new-born babies suffers from congenital severe or profound hearing impairment. Furthermore, epidemiological studies demonstrate that the percentage of the population who have a hearing impairment that exceeds 45 dB HL and 65 dB HL are about 1.3% and 0.3% between the ages of 30 and 50 years, and 7.4% and 2.3% between the ages of 60 and 70 years, respectively (Davis, 1989). Hearing loss has for some time, been considered a permanent effect and consequence of factors such as infections, ototoxicity, trauma and ageing. In recent years, molecular biology and molecular genetics have made a key contribution to the understanding of the normal and defective inner ear, not only in congenital profound hearing impairment but also in late onset/progressive hearing impairment.

The HEAR and GENDEAF projects In September 1994, when a Preparatory Workshop for the Constitution of a European study group on genetic deafness was held in Milan, only four loci of non-syndromal hearing impairment and only three genes responsible for syndromal hearing impairment had been discovered, whereas at the time of writing, some 45 genes which can cause non-syndromal hearing impairment have been identifies and over 110 loci found. The importance of establishing common terminology and definitions and co-ordinating the multi-disciplinary approach was the core aim of HEAR project-European Concerted Action HEAR (Hereditary Deafness: Epidemiology and Clinical Research 1996–1999). The idea was to deal with the problem of combining clinical in-depth family and phenotype studies with basic molecular genetics and gene mapping methods in a more standardized way, with the aim of establishing a stable international collaboration. The initiative also wanted to create a bank of updated information on these disorders that would be useful not only to experts but to the entire scientific community in identifying sources of information and specialized centres to which specific cases may be referred. This project stimulated a considerable amount of work in this field leading to developments in molecular genetics and the mapping of human loci associated with hearing disorders. The numerous and scattered

loci mapped reflect a heterogeneous set of genes and mechanisms responsible for human hearing and suggest a complicated interaction between these genes (Lalwani and Castelein, 1999). GENDEAF European Union Thematic Network Project 2001–2005 has helped to further open and widen the analysis of genotype/phenotype correlations, the effects of deafness on the family and the psychosocial aspects (also involving patient associations). This book is aimed as a follow up of these two projects. It endeavours to provide a broad and up to date overview of genetic hearing impairment for audiologists, otolaryngologists, paediatricians and clinical geneticists to improve the quality of care for the large group of patients with suspected genetic hearing impairment. It does not set out to be a comprehensive description of syndromes such as the excellent and complete text of Toriello, Reardon, and Gorlin (2004), but to provide an easily read sourcebook for those students and clinicians with an interest in this field. The book is divided into three parts: The first part reports the important elements of current knowledge of the various situations in which genes have an influence on inner ear dysfunction. Chapters 1 and 2 provide the reader with an appropriate background, presenting an introduction to auditory function, basic genetics and genetic techniques significant to this field. Chapter 3 does not list the various syndromes, but intends to discuss and help clinicians to interpret the signs in order to better understand how molecular genetics can be informative. Chapter 4 tackles the complex genetic aspect of deaf/blindness. Chapter 5 analyses the role of the various genes as a causative of non-syndromal hearing loss. Chapters 6 to 9 analyse the responsibility of genetic factors in certain complex situations such as ageing, noise exposure, ototoxic drugs and otosclerosis. Part II discusses current approaches to and management of hearing impairment in different ways. Thus Chapters 10 and 11 review the psychosocial impact of genetic hearing impairment and how culturally Deaf people react to genetic interventions. Chapter 12 looks at the related area of genetic factors in speech and language while Chapters 13 to 15 provide guidance on the identification of specific genotypes from phenotypic information, steps which should be taken in this respect in deaf children and how geneticists approach such a challenge. Developments in the pharmacological approach to hearing impairment and tinnitus are covered in Chapters 16 and 20, while Chapters 17 to 19 discuss the medical and surgical management of specific genetic disorders affecting the outer/middle ear, the cochlea and the cochlear nerve respectively.

1181 FM

4/4/07

x

4:16 PM

Page x

Preface

Finally, the third part delves into our future and is an update of various lines of research covering a range of therapeutic strategies. These include the use of stem cells, tissue transplantation into the inner ear, gene therapy and finishes with an overview of the important process of apoptosis and how it can be prevented. The contributing experts are all authoritative in their fields and have been asked to present up to date, concise and brief

reviews of their particular subject matter; the reader should find this book follows the rapid pace of change in medical science. Alessandro Martini Dafydd Stephens Andrew P Read Editors

1181 Chap01

3/28/07

4:29 PM

Page 1

Part I Genetics and hearing impairment

1181 Chap01

3/28/07

4:29 PM

Page 2

1181 Chap01

3/28/07

4:29 PM

Page 3

1 Understanding the genotype: basic concepts Andrew P Read

Introduction This chapter is for readers who feel threatened by genetics, who are apt to see genetics as a malignant growth, taking over familiar areas of medicine and rendering them strange and incomprehensible. It is a survival kit but also an entry ticket to this most intellectually exciting area of biomedical science. Genetics is not taking over medicine; it is burrowing under it and rearranging the foundations. Genetics is relevant to hearing and deafness at two levels. In everyday clinical practice, effective diagnosis and management of patients require some familiarity with common patterns of inheritance and with the availability, use, and limitations of genetic tests. More fundamentally, to understand the causes and pathology of hearing impairments, we need to understand the molecular pathology of the genes that program cells in the inner ear. What follows is a review of the concepts and vocabulary of genetics as it applies to both these levels. Italicised words are defined in the Glossary at the end of this chapter. For readers who would like more detail, references are given below to the relevant sections of Strachan & Read Human Molecular Genetics; the text of the second edition (“S&R2”) is freely available on the NCBI Bookshelf website (1).

Genes, DNA, and chromosomes These are the three most basic elements in genetics. “Genes,” like elephants, are easier to recognize than to define. Unlike elephants, genes are recognised in two fundamentally different ways: ■ ■

As determinants of characters that segregate in pedigrees according to Mendel’s laws As functional units of DNA

Genes recognised in the first way are rather formal, abstract entities. In retrospect, their connection to physical objects began early, with the recognition of chromosomes and crystallised with Avery’s 1943 demonstration that the genetic substance of bacteria was DNA. However, it was not until the 1970s that physical investigation of genes acquired any clinical relevance. Developments in molecular genetics in no way make formal mendelian genetics obsolete. The ability to recognize mendelian pedigree patterns and calculate genetic risks remains an essential clinical skill, while understanding the relation between the DNA sequence and an observable character is a central intellectual challenge of genetics. DNA is the molecule that carries genetic information. For understanding most of genetics, it is sufficient to view DNA as a long chain of four types of unit called A, G, C, and T. Organic chemists define the structure of A, G, C, and T as nucleotides (nts), each composed of a base (adenine, guanine, cytosine, or thymine) linked to a sugar, deoxyribose, and a phosphate. Watson and Crick in 1953 showed how DNA consists of two polynucleotide chains wrapped round one another in a double helix. The two strands fit together like the two halves of a zip, with A on one chain always next to T on the other, and G always opposite C. As Watson and Crick famously remarked, “it has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material.” Note, however, that in itself the Watson-Crick structure sheds no light on how the sequence of nucleotides along a DNA chain might control the characteristics of an organism—understanding of that process only began to dawn in the 1960s. Chapter 1 of S&R2 provides rather more detail on DNA structure and function. Geneticists use some conventions and shortcuts in describing DNA that can confuse the unwary. ■

The terms base, nucleotide, and base pair (bp) are normally used interchangeably to describe the A, G, C, and T units

1181 Chap01

4

■

■

3/28/07

4:29 PM

Page 4

Genetics and hearing impairment

of a DNA chain, although strictly they mean different things. A double helix with 100 units in each chain is 100 bases, 100 nt, or 100 bp long (not 200). Looking at the detailed chemical structure shows that DNA chains are not symmetrical. The two ends are different and so the sequence AGTC is not the same as the sequence CTGA. The ends are labelled 5⬘ (“5 prime”) and 3⬘, and it is a universal convention that sequences are always written in the 5⬘→3⬘ direction. It is just as wrong and unnatural to write a sequence in the 3⬘→5⬘ direction as it is to write an English word from right to left. This may seem a trivial and pedantic point, but its importance comes from the fact that the two chains in a Watson–Crick double helix run in opposite directions (the structure is described as antiparallel). Thus the strand complementary to AGTC is not TCAG but (5⬘→ 3⬘) GACT. Geneticists are no happier than anybody else about the way this makes a sequence and its complement look very different, and they get round it by a convention that makes the relation between the sequence of a gene, a messenger RNA (mRNA), and (via a table of the genetic code) a protein all immediately obvious. So for most purposes you can forget about 5⬘ and 3⬘, but the convention needs mentioning because otherwise readers with enquiring minds will run up against seemingly baffling inconsistencies. (see section 3.2 for the detail.)

“Chromosomes” (Fig. 1.1) are seen in cells when they divide. These visible chromosomes represent the DNA packaged into a set of compact bundles so that it can be divided up between the daughter cells. The 46 human chromosomes (23 pairs) each contain between 45 and 280 million base pairs (Mb) of DNA in the form of a single immensely long double helix. Before a cell divides, it replicates all its DNA. When the chromosomes become visible, each consists of two identical sister chromatids, each containing a complete copy of the DNA of that chromosome. Cell division separates the two chromatids, sending one into each daughter cell, and in their normal state each chromosome consists of a single chromatid but with the DNA somewhat decondensed and fluffed out so that it is not visible under the microscope. Even in this state, the DNA is

still quite highly structured. It exists as chromatin, a complex of DNA, and various proteins, particularly histones. Chapter 2 of S&R2 describes and illustrates the structure and function of chromosomes. Back in the 1880s, biologists recognised that there were two types of cell division. The usual form is mitosis. This precisely divides the replicated genetic material between the two daughter cells so that each is genetically identical. All the normal cells of a person are derived by repeated mitosis from the original fertilised egg. That is why you can use a blood, skin, or any other sample to study somebody’s DNA; it is the same in every cell (more or less). Gametes (sperm and egg) are formed by a special process, meiosis, which has two purposes. It halves the number of chromosomes so that a 23-chromosome sperm fertilizes a 23-chromosome egg to produce a 46-chromosome zygote. It also shuffles genes so that every sperm or egg that a person produces contains a novel combination of the genes he or she inherited from his or her mother and father. Mendelian pedigree patterns are a consequence of the events of meiosis. Linkage analysis, which maps a gene to a specific chromosomal region, also depends on features of meiosis, as detailed below. Note the disparity between chromosomes and DNA. The smallest chromosome abnormality visible under the microscope involves around 5 Mb of DNA. Molecular genetic techniques are most efficient when dealing with no more than 1000 bp (1 kb) of DNA. New techniques that fill the gap between these two scales (“molecular cytogenetics”) have been important recent drivers of genetic discovery.

Patterns of inheritance Humans have around 25,000 genes and every human genetic character must depend on the action of very many genes, together with environmental factors. However, for some variable characters, presence or absence of the character depends, in most people and in most circumstances, on variation in a single gene. These are the mendelian or single-gene characters that are by far the easiest genetic characters to analyse. When following the segregation of alternative forms of a gene (alleles)

Figure 1.1 The structure of a chromosome as seen in a cell dividing by mitosis. (Left image) chromosome 9 as seen in a conventional cytogenetic preparation. The two sister chromatids are tightly pressed together. The banding pattern (G-banding) is produced by partial digestion with trypsin before staining with Giemsa stain. It helps the cytogeneticist to recognize chromosome abnormalities. (Right image) chromosome 9 as seen under the electron microscope. Threads of chromatin of diameter 30 nm can be seen, which form loops attached to a central protein scaffold (not visible). DNA is highly packaged even within the 30 nm thread. Overall, chromosome 9 is about 10 ␮m long and contains about 5 cm of DNA.

1181 Chap01

3/28/07

4:29 PM

Page 5

Understanding the genotype: basic concepts

through a pedigree, the alleles are conventionally designated by upper and lower case forms of the same letter, e.g., “A” and “a.” The art of human pedigree interpretation is to make a judgment of the most likely mode of inheritance. The two main questions are the following questions: ■ ■

Is the character dominant or recessive? Is the gene autosomal, X-linked, or mitochondrial?

An initial hypothesis is formed by asking the following questions: ■

■

Does each affected person have an affected parent? If so, the condition is probably dominant; if not, either it is recessive or something more complex is going on. Are there any sex effects? If not (affects both sexes, can be transmitted from father to son, from father to daughter, from mother to son, or from mother to daughter), the character is probably autosomal. If yes, it may be X-linked. Y-linked pedigrees are possible in theory but are unlikely in human diseases. Characters that are transmitted only by the mother, but affect both sexes, may be mitochondrial.

The pedigree is then tested for consistency with the initial hypothesis by writing in presumed genotypes. If this process requires special coincidences (an unrelated person marrying in, who happens to carry the same disease allele; a new mutation), alternative hypotheses are tested. The most likely interpretation is the one that requires the fewest coincidences. It is important to stress that for most pedigrees these interpretations are provisional because families are too small to be sure. Sometimes past experience tells us that a particular condition is always inherited in a particular way, but this is often not the case and particularly not with nonsyndromic hearing impairment. Pedigree description of autosomal dominant inheritance. Both males and females can be affected. The disorder is transmitted from generation to generation and can be transmitted in all possible ways—female to female, female to male, male to female, or male to male. With human autosomal dominant diseases, affected people are almost always heterozygotes; when married to an unaffected person each offspring has a 50:50 chance of inheriting the mutant allele. In small families, the mode of inheritance can be difficult to determine, but transmission of a rare condition across three generations is good evidence for dominant inheritance. Many dominant conditions are variable (even within families) and may skip generations (nonpenetrance, see below). Pedigree description of autosomal recessive inheritance. Both males and females can be affected. Both parents are usually unaffected heterozygous carriers, and the risk for any given child is 1 in 4. Recessive inheritance is likely when unaffected parents have more than one affected child, especially if the parents are consanguineous. In most cases, there is only one affected individual in the family, making the pedigree pattern hard to identify, but in large multiply inbred kindreds,

5

affected individuals may be seen in several branches of the family. Pedigree description of X-linked inheritance. Many X-linked diseases are seen only or almost only in males; where females are affected, they may be more mildly or more variably affected. The X chromosome is transmitted to a male from his mother and never from his father, so male-to-male transmission rules out X-linked inheritance. The line of inheritance in a pedigree must go exclusively through females (or affected males). All daughters of an affected male are carriers. Having the wrong number of chromosomes is usually fatal; yet males and females manage to be healthy despite having different numbers of X chromosomes. This is because of a special mechanism, X inactivation or Lyonisation (named after its discoverer, Mary Lyon). In each early embryo, each cell somehow counts the number of X chromosomes it contains. If there are two, each cell picks one at random and permanently inactivates it. The chromosome is still there, but the genes on it are permanently switched off. If there are more than two X chromosomes, all except one are inactivated. Thus every cell, male or female, has only one active X chromosome. X inactivation happens only once in the early embryo, but the decision as to which X to inactivate is remembered. As the few cells of the early XX embryo divide and divide, whichever X was inactivated in the mother cell is inactivated in both daughter cells. Thus, an adult woman is a mosaic of clones, some derived from cells that inactivated her father’s X and others that inactivated her mother’s X. If the woman is a heterozygous carrier of an X-linked disease, some of her cells will be using just the good X and others just the bad X. Depending on the nature of the disease, this may be evident as a patchy phenotype, as in some skin conditions, or there may just be an averaging effect, as in hemophilia. Either way, the distinction between dominant and recessive is not as obvious in X-linked as in autosomal conditions. For males, of course, there is no question of dominance or recessiveness because here are no heterozygotes. Pedigree description of mitochondrial inheritance. The mitochondria in cells have their own little piece of DNA, probably a leftover from their origin as endosymbiotic bacteria. It is tiny compared to the nuclear genome (16.5 kb and 37 genes, compared to 3.2 million kb and around 24,000 genes; see S&R2 section 7.1.1), but mutations in the mitochondrial DNA are important causes of hearing loss (and other problems). A person’s mitochondria come exclusively from the egg; the sperm contributes none. Thus, mitochondrial conditions are passed on only by the mother (matrilineal inheritance). An affected mother transmits the condition to her children of either sex. The resulting pedigrees can look very like autosomal dominant pedigrees unless they are large enough for the exclusively maternal transmission to be obvious. Cells contain many mitochondria, and it often happens that these are a mixture of normal and mutant versions (heteroplasmy). Heteroplasmy, unlike nuclear genetic mosaicism (see below), can be passed from mother to child, because the egg

1181 Chap01

6

3/28/07

4:29 PM

Page 6

Genetics and hearing impairment

Figure 1.2 Autosomal dominant (A), autosomal recessive (B), X-linked (C), and mitochondrial (D) pedigree patterns. Squares represent males; circles, females. Blacked-in symbols are individuals affected by the condition. Dots in a symbol indicate a phenotypically normal carrier. An unshaded diamond-shaped symbol containing a number, e.g., 6 means 6 unaffected offspring, sexes not specified. Consanguineous marriages can be highlighted by a double marriage line. Generations are numbered in Roman and individuals are numbered across each generation in Arabic numerals. These are ideal pedigrees; those encountered in the clinic are rarely so clear-cut.

contains many mitochondria. Mitochondrial mutations show a particularly poor correlation between genotype and phenotype— for example, the A3243G mutation has been identified as the cause of nonsyndromal hearing loss in some people but diabetes in others (2). Figure 1.2 shows ideal pedigrees for the main modes of inheritance. Note the conventions used in drawing pedigrees. Several factors commonly complicate pedigree interpretation: ■

■

■

Nonpenetrance. This describes the situation where a person carries a gene that would normally cause them to have a condition but does not show the condition. Evidence for this can come from the pedigree (an unaffected person who has an affected parent and an affected child) or from DNA testing. The cause is straightforward: a rare lucky combination of other genes or environmental factors may occasionally rescue the person from the condition. Penetrance can be age related, as in late onset hearing loss. Mitochondrial conditions are especially likely to show reduced penetrance. Nonpenetrance is a serious pitfall in genetic counselling. New mutations. For dominant or X-linked conditions that seriously diminish reproductive prospects, many new cases are caused by fresh mutations. This is not normally the case for recessive conditions. Mosaicism. A person carrying a new mutation may have a mixture of mutant and nonmutant cells if the mutation happened in one cell of the early embryo. This can directly

■

■

affect their phenotype and can also produce an unusual pedigree pattern if their gonads contain some mix of normal and mutant cells. Such germinal mosaicism explains why occasionally a phenotypically normal person with no family history produces two or more offspring affected by a dominant condition. Phenocopies. People who clinically have the condition, but for a nongenetic reason. Obviously, this is a major problem in interpreting pedigrees of hearing loss. Deaf–deaf marriages. These can make it impossible to work out who inherited what from whom.

Genes as functional units of DNA Overview Back in the 1940s, Beadle and Tatum recognised that the primary function of a gene is to direct the synthesis of a protein. In modern terms, the sequence of A, G, C, and T nucleotides in the DNA is used to specify the sequence of amino acids in the polypeptide chain of a protein. In essence, the process consists of two steps: 1. An RNA copy is made of the gene sequence (transcription). 2. The nucleotide sequence in the RNA is used to specify the sequence in which amino acids are assembled into a protein, via the genetic code (translation).

1181 Chap01

3/28/07

4:29 PM

Page 7

Understanding the genotype: basic concepts

7

Figure 1.3 Essentials of gene expression.

In slightly more detail (Fig. 1.3): 1. A decision is made to transcribe a particular small segment of the continuous DNA strand. 2. An RNA copy of the whole gene sequence (the primary transcript) is made by the enzyme RNA polymerase. 3. The primary transcript is processed, mainly by cutting out introns (see below) and splicing together exons, to produce the mature mRNA.

4. The mRNA moves out from the nucleus to the cytoplasm, where a complicated machinery comprising ribosomes and transfer RNAs (tRNAs) translates it. In the genetic code, (Fig. 1.4) three consecutive nts form a codon, coding for one amino acid. Since there are 64 possible codons to encode only 20 amino acids, most amino acids are encoded by more than one codon. When the ribosome encounters any one of three stop codons (UGA, UAA, or UAG), it detaches from the mRNA and releases the newly synthesised polypeptide chain.

U

C

A

G

U

Phe Phe Leu Leu

Ser Ser Ser Ser

Tyr Tyr STOP STOP

Cys Cys STOP Trp

U C A G

C

Leu Leu Leu Leu

Pro Pro Pro Pro

His His Gln Gln

Arg Arg Arg Arg

U C A G

A

lle lle lle Met

Thr Thr Thr Thr

Asn Asn Lys Lys

Ser Ser Arg Arg

U C A G

G

Val Val Val Val

Ala Ala Ala Ala

Asp Asp Glu Glu

Gly Gly Gly Gly

U C A G

Transcription 3rd base in codon

1st base in codon

2nd base in codon

Figure 1.4 The genetic code. This code is almost universal in all living organisms, although the small protein synthesis apparatus within mitochondria uses a slightly modified version.

Transcription starts when a large multiprotein complex including RNA polymerase is assembled at a particular point on the DNA. DNA sequences (promoters) that are able to bind the complex mark the genes, which are quite thinly scattered along either strand of the double helix. The DNA-binding proteins of the complex (transcription factors) include some that are universal and others that are present only in specific cells or tissues, or in response to specific signals. Other proteins stabilize or destabilize the complex purely through protein–protein interactions (co-activators and co-repressors). This specific and variable activation or repression of transcription is the major way in which cells establish their identity (muscle cells, neurons, and lymphocytes all contain the same genes, but activate them differentially) and control their activity. Not surprisingly, mutations in the genes encoding transcription factors are a major cause of genetic disease, including hereditary deafness.

1181 Chap01

8

3/28/07

4:29 PM

Page 8

Genetics and hearing impairment

The primary transcript is an RNA molecule corresponding precisely to the DNA sequence of the gene. RNA is chemically virtually identical to DNA, with small differences: ■ ■

RNA has ribose where DNA has deoxyribose RNA has uracil (U) wherever the corresponding DNA has thymine.

These small differences allow the cell to target different enzymes to RNA and DNA so that they perform different functions in the cell. DNA is the central archive of genetic information; RNA molecules have quite a variety of different roles (Table 1.1). RNA is single stranded simply because cells do not contain enzymes to synthesise a complementary strand. Splicing, ribosomes, and transfer RNA are described below. If the DNA sequence at some point reads AGTC, the RNA transcribed from this strand would read GACU, writing the sequences, as always, in the 5⬘→3⬘ direction. This is where the convention mentioned above is brought in to make life simpler. Rather than give the sequence of the DNA strand that was used as a template in transcription, we give the sequence of the opposite strand (the “sense strand”). This is GACT, and so, immediately relates to the RNA sequence. Gene sequences are always written in this way.

Processing the primary transcript: exons and introns In 1977, a wholly unexpected and baffling feature of our genes was discovered. At that time, the broad outlines of transcription and translation had been identified through work on the bacterium Escherichia coli. But in 1977, researchers discovered that in humans and chickens, the coding sequence of a gene was split into several noncontiguous segments (exons) separated by noncoding introns. This exon–intron organisation turned out to be typical of the great majority of genes in all eukaryotes (organisms

higher than bacteria). There is no seeming logic in the number or size of introns. Over the whole human genome, the average number is eight, but for different genes, it varies from 0 to over 100. Their size also varies enormously, from a dozen nts up to over 100 kb. Exons also vary in size from a few nucleotides up to several kb, though the distribution is more clustered around 100 to 150 bp. Introns are usually bigger than exons—the average in humans is 1300 bp—and so the majority of most genes consists of noncoding sequence. Table 1.2 shows some typical examples. Arguably, this exon–intron organisation allows novel proteins to evolve by shuffling exons that encode functional modules; but it is fair to say that nobody predicted that our genes would be organised in this way, and it still remains one of the most remarkable aspects of the human genome. Overall, the average human gene is 27 kb long, has nine exons averaging 145 bp, and the introns average 3365 bp—but as the table shows, the range is very wide. Note that the “size in genome” figure refers to the transcribed sequence (exons ⫹ introns) and does not include the promoter or other regulatory sequences. Within the cell nucleus, the primary transcript is processed by physically cutting out the introns that are degraded and splicing together the exons. This is done by a complex machine, the spliceosome, which consists of numerous proteins plus some small RNA molecules. Spliceosomes recognize introns in the primary transcript through details of the nucleotide sequence. Introns nearly always start with GU and end with AG. In themselves those signals would not be sufficient—most GU or AG dinucleotides do not function as splice sites. Splice sites are recognised when the invariant GU or AG is embedded in a broader consensus sequence. For many genes—at least 40% of all human genes, probably the majority—primary transcripts can be spliced in more than one way, so that several isoforms are produced. There may also be alternative start points for transcription. Thus, a single gene often encodes more than one protein. Much of this alternative

Table 1.1 A partial list of the types of RNA in a cell RNA species

Typical size

Role in cell

Messenger RNA (⬎100,000 types)

500–15,000 nt

Mediators of gene expression

Ribosomal RNA (2 species)

4700, 1900 nt

Structural and functional components of the ribosome

Transfer RNA (ca. 50 species)

Ca. 80 nt

Each ferries a specific amino acid to the ribosome and base pairs with the appropriate codon in the mRNA

Small nuclear and nucleolar RNAs (many types)

Typically ca. 100 nt

Control mRNA splicing and other RNA processing

Micro-RNA (several hundred types)

20–22 nt

A recently discovered class believed to be important regulators of gene expression

Abbreviation: nt, nucleotide.

1181 Chap01

3/28/07

4:29 PM

Page 9

Understanding the genotype: basic concepts

9

Table 1.2 Structures of some human genes Gene

Size in genome (kb)

No. of exons

Average exon size (bp)

Average intron size (bp)

Exons as % of primary transcript

Interferon A6 (IFNA6)

0.57

1

570

—

100

Insulin (INS)

1.4

3

154

483

32

Class 1 HLA (HLA-A)

2.7

7

160

269

41 18

Collagen VII (COL7A1)

51

118

78

358

Phenylalanine hydroxylase (PAH)

78

13

206

6264

3.4

Cystic fibrosis (CFTR)

189

27

227

7022

3.2

2090

79

178

26615

0.7

Dystrophin (DMD)

splicing is functional and may be controlled according to the needs of the cell, though in some cases it may just reflect inefficiencies in the machinery. Figure 1.5 shows a typical human gene, with large introns and several alternative splice isoforms. Mutations that alter splice signals are a major cause of malfunction of genes. Researchers have found it difficult to predict when a sequence change near an intron–exon boundary will affect splicing, and probably this class of mutations often goes unrecognised when it does not alter the invariable GU. . .AG signal. The only sure way to identify splicing patterns is to study mRNA extracted from appropriate cells. To complete processing of the primary transcript, a specific nonstandard nt (the “cap”) is added to the 5⬘ end and a string of around 200 A nts is added to the 3⬘ end [the poly(A) tail]. The mature mRNA is now ready to move to the cytoplasm to be translated.

Translation In the cytoplasm, ribosomes engage the 5⬘ end of mRNA molecules. Ribosomes are huge multimolecular complexes comprising two large RNA molecules (ribosomal RNA) and around 100 proteins. The ribosomes physically slide along the mRNA until they encounter a start signal. This is the codon AUG embedded in a consensus (“Kozak”) sequence. At this signal, they start assembling amino acids into a polypeptide chain, moving along the mRNA and incorporating the appropriate amino acid in response to each triplet codon, according to the genetic code (Fig. 1.4). Amino acids are brought to the ribosome by yet another class of small RNA molecule, tRNAs. Ultimately, which amino acid is incorporated in response to which codon depends on which tRNA carries that amino acid, which in turn is determined by the specificity of the enzymes that join amino acids onto tRNA molecules. There is no evident logic in the code. It is a sort of frozen accident; it could

perfectly well have been different, but once arrived at, any mutation that changed it in an organism would cause such chaos as to be lethal. Translation continues until a stop codon (UAG, UAA, or UGA) is encountered, at which point the ribosomes detach from the mRNA and release the newly synthesised polypeptide chain. This may then undergo a whole series of specific enzymecatalysed modifications—cleaving off parts, attaching sugars or other residues—before being transported to the location inside or outside the cell where it is required. Note that only part of the mature mRNA carries the code for protein. Although the introns have all been removed within the nucleus, the remaining exonic sequence includes the two untranslated ends of the mRNA—the 5⬘ untranslated sequence (5⬘UT) between the cap and the start codon, and the 3⬘UT between the stop codon and the poly(A) tail. Both these untranslated sequences are important for correct control of translation and mRNA stability, so changes in them can have consequences for gene function. However, we understand very little of the detail; so, it is usually impossible to predict whether a mutation in either of these sequences will be pathogenic.

Overview of the human genome Our genome (one copy of chromosome 1, one copy of chromo9 some 2, etc.) comprises about 3.2 ⫻ 10 bp of DNA. There are about 24,000 protein-coding genes on current estimates; this figure is provisional because there is no sure-fire way of recognising genes. Genes are scattered quite thinly and apparently randomly along the chromosomes, with no evident reason why a gene is in one place rather than another. Figure 1.6 shows an example. This figure also illustrates one of the main computer programs (genome browsers) used to make sense of the raw human-genome sequence in the public databases. About 1.5% of our genome codes for protein. So what does the other 98.5% do?

1181 Chap01

10

3/28/07

4:29 PM

Page 10

Genetics and hearing impairment

Figure 1.5 A typical human gene. The diagram shows a 100 kb section of chromosome 2 containing the PAX3 gene, which encodes three isoforms. The horizontal lines represent the primary transcripts. Vertical bars represent exons; the lines linking each set of exons represent the introns. Solid bars are coding sequence; open bars are the 5⬘ and 3⬘ untranslated sequences. The transcript marked by an asterisk has eight exons that in total make up 3% of the primary transcript. Source: From Ref. 3.

■

■

■

The transcribed gene sequences, as explained above, include the 5⬘ and 3⬘ untranslated sequences and also all the introns. Genes, including their introns, account for about 20% of our genome. Gene expression is regulated by nontranscribed sequences. Most obviously, this includes the promoter, which lies immediately upstream of the gene, but other regulatory elements (“enhancers” and “locus control regions”) may be situated anything up to 1Mb either side of the transcribed sequence. These poorly understood elements bind activating or repressing proteins, and the DNA may loop round so that physically it lies close to the promoter of the gene it regulates. Alternatively, the regulatory proteins may trigger chemical modification of the histone proteins in chromatin, causing a structural change in the chromatin. Chromatin configuration (“open” vs. “closed”) is a key determinant of gene activity. Much current interest attaches to identifying and investigating noncoding sequences that are highly conserved in evolution (i.e., are little changed between humans, mice, and, maybe, other organisms), on the assumption that evolutionary conservation implies an important function. Such conserved noncoding sequences make up around 3% of our genome. Exploring our DNA reveals many nonfunctional copies of active genes. These pseudogenes are believed to have arisen through accidental duplication of a gene. Once there are two copies, there is no pressure of natural selection to prevent mutated versions of one copy being transmitted to the offspring.

■

■

As well as the 24,000 protein-coding genes, we have other genes whose product is a functional RNA. These include all the classes of non-mRNA shown in Table 1.1. The computer programs that are used to identify genes in the raw genome sequence are very poor at identifying genes that do not encode proteins; so, we have little idea how many such genes we have. A large fraction of our genome is at least occasionally transcribed, but it is not known how much of this is functional and how much is just mistakes by the transcription machinery. Micro-RNAs (miRNAs), in particular, are a very hot topic in research. Some workers believe miRNAs will turn out to control much of the way our genome functions. Some DNA sequences control chromosome structure and function. These include centromeres, telomeres (the ends of chromosomes, which are marked by special structures), and scaffold attachment regions that bind the DNA in large (20–100kb) loops to the central protein core of the chromosome.

Some 50% of our DNA consists of repetitive sequences. That is, the same sequence is present several times in the genome. A small proportion of this represents genes that are present in many copies, particularly the genes that encode the various functional RNA molecules shown in Table 1.1. The rest fall into two categories: ■

Tandem repeats: The same sequence is repeated a few to several thousand times one after another at a particular location in the DNA. Tandem repeats are important for the structure of centromeres and telomeres; other tandem

Figure 1.6 Genes in a 0.5 Mb stretch of the short arm of human chromosome 7. The chromosome is shown as a thick black line. Genes are shown as exons (vertical lines) linked together to show how they are spliced. Note the small proportion of the total sequence that is occupied by exons. Genes shown above the line are transcribed from left to right, using the upper DNA strand as the sense strand; those below the line use the lower strand and so are transcribed in the opposite direction (remember that the two strands of the double helix are antiparallel). Source: From Ref. 3.

1181 Chap01

3/28/07

4:29 PM

Page 11

Understanding the genotype: basic concepts

■

repeats are thought to arise from mistakes in DNA replication (“stuttering”) and are not functional but are important research tools for gene mapping (microsatellites, see below). Interspersed repeats: The same sequence is present at many different locations in the genome. The great majority of all repetitive DNA, and about 45% of the entire human genome, is made up of families of repeats that have, or had in the past, the ability to replicate themselves within the genome, almost like viruses. Scientists argue about whether these “transposonderived repeats” are useless “junk DNA” or whether they have some beneficial function. Studying these repeats reveals much about the evolution of mammalian genomes. We have about 1,200,000 copies of one family, the 280bp Alu sequence, and about 600,000 copies (mostly incomplete) of the 6.5kb LINE1 sequence.

One cannot fail to be struck by the contrast between, on the one hand, our anatomy and physiology, where we constantly encounter marvels of natural engineering, elegant functional adaptation, and beautiful fitness for purpose, and, on the other hand, our genome, which seems disorganised and chaotic. Maybe there is some deep organising principle of genomes that we do not understand, but more probably, it is because natural selection has no interest in a tidy genome, just as long as it works.

protein-coding information, much human genome research has focused on cDNAs. Databases compiled by industrial-scale sequencing of small segments of cDNAs (expressed sequence tags) prepared from different tissues are important resources for identifying genes and for seeing which genes are expressed in a given tissue. Genes as determinants of mendelian characters cannot be picked out in this way. No amount of analysis of the DNA sequence databases, or sequencing of cDNAs, could produce anything labeled “Late-onset hearing loss” or “Pendred syndrome.” Genes defined in this way can only be found by studying families where the condition is segregating.

Genetic mapping The principle of genetic mapping of a mendelian character is to find a chromosomal segment whose segregation in a family or series of families exactly parallels the segregation of the character being investigated. Figure 1.8 shows the principle. Chromosomal segments are followed through pedigrees by using genetic markers. A genetic marker can be any character that is variable in a population and is inherited in a mendelian fashion. In practice, DNA polymorphisms are invariably used. Two types of common DNA variants are the main tools for current genetic mapping: ■

Mapping and identifying genes Two ways of identifying genes At the start of this chapter, I described the two ways genes are recognised, as functional units of DNA or as determinants of mendelian characters. These two views underlie the two broad strategies for identifying genes. Genes as functional DNA units are identified by careful study of the genome sequence (“annotating the sequence”). Computer programs scan the sequence for open reading frames—stretches of the DNA that can be read as protein code without hitting a stop codon. Figure 1.7 shows a hypothetical example. This sort of analysis is fairly straightforward in bacteria, but in higher organisms, the open reading frames are fragmented by introns. Programs must try to identify fragments of coding sequence flanked by plausible splice sites and thinly scattered through much longer regions of noncoding DNA. As mentioned above, even this route is not available for genes that encode functional RNAs rather than proteins. As a result, gene predictions are uncertain and provisional until supported by laboratory identification of the predicted mRNA. In the laboratory, for technical reasons, it is convenient to study mRNA in the form of synthetic DNA copies [complementary DNA (cDNA)]. Because cDNAs represent only a small fraction of our genome (maybe 2%) but contain all the

11

■

Single nucleotide polymorphisms (SNPs): The history of our species has endowed us with a rather counterintuitive pattern of variability in our DNA. Most nucleotides are the same in all of us, with occasional rare variants, but about 1 nucleotide in every 300 is polymorphic, with two alternatives being reasonably common in populations worldwide. Around 10 million SNPs have been identified. Almost all are in the 98% of our DNA that does not code for protein, and they have no phenotypic effect. Microsatellites: These are a subgroup of the tandem repetitive DNA in which the repeating unit is a two-, three-, or four-nt sequence. Often, the number of units in the repeated block varies from person to person. For example, everybody might have a run of CACACACA . . . at a particular location on chromosome 3, but in some people there might be 10 CA units, in others 11, 12, 13, etc.

5’ CCTATGGCATGGTCTCGCTAAACATTCCACATCGTGCATAGCGGC 3’ 3’ GGATACCGTACCAGAGCGATTTGTAAGGTGTAGCACGTATCGCCG 5’ Figure 1.7 Looking for an open reading frame. Both strands of the DNA are shown. Any ATG triplet (reading 5⬘→ 3⬘ as always) could mark the start of an open reading frame (AUG in a mRNA). But each of the underlined ATGs leads quickly to a stop codon, TGA, TAA, or TAG when the sequence is read 5⬘→ 3⬘ in triplets. Only the double-underlined ATG starts an open reading frame, suggesting it might mark the translation start of a gene. A real gene should have an open reading frame of 100 amino acids or more.

1181 Chap01

12

3/28/07

4:29 PM

Page 12

Genetics and hearing impairment

Either type of marker can be easily scored by standard laboratory methods (see S&R2 section 17.1.3 for details). The protocol for mapping a mendelian condition consists, in principle, of the following: 1. The starting point is a large family, or more often a collection of families, in which the condition of interest is segregating. DNA samples must be obtained from all family members, and the diagnoses carefully confirmed by an experienced clinician. 2. All the DNA samples are typed for a genetic marker. 3. The results are checked to see whether segregation of the marker follows segregation of the condition. The test statistic is the lod score, calculated by computer. This is the logarithm of the odds of linkage versus no linkage. A lod score of 3.0 corresponds to the conventional p ⬍ 0.05 threshold. (See S&R2 section 11.3 for an explanation of lod scores.) 4. Assuming the lod score falls short of 3.0, try another marker and keep trying marker after marker until you find evidence of linkage. In a typical family collection, about 300 microsatellites or 1000 SNPs would be required to test every chromosomal segment. 5. When convincing linkage is found, the chromosomal location of the relevant DNA polymorphism (which can be looked up in public databases) identifies the approximate location of the disease gene. If the marker tracks nearly but not quite always with the disease, other markers from nearby on the chromosome can be used to define the minimal chromosomal segment that tracks completely with the disease. This defines the candidate region that must contain the disease gene.

Positional cloning Once a candidate region has been defined by genetic mapping, we need to find which gene within that region is mutated to cause the condition. In years past, this endeavour, called positional cloning, was a massive undertaking that often involved years of intensive toil by small armies of postdoctoral scientists. Now that we have the human genome sequence, it is very much easier. We can search the public databases to draw up a list of the genes within the candidate region. Hopefully, the list will be not more than a few dozen. These are then prioritised for investigation based on any available knowledge about their function, domain of expression, etc. A gene causing nonsyndromal hearing loss should be expressed in the inner ear, and ideally it should encode an ion channel, motor protein, or gap junction protein, since these are the commonest genes involved in hearing loss. A gene causing syndromal hearing loss should be expressed during the development of the ear and the other organs involved, and ideally, it should encode a transcription factor. Given a candidate gene, its sequence is then examined in a panel of unrelated individuals who have the condition being investigated. The correct gene is one that is mutated in those people but not in unaffected controls. The techniques used to do this are the same as those used in genetic testing (see below).

How genes go wrong The mechanics of mutations As we have seen, the route from genotype (the DNA sequence) to phenotype (an observable character) is long and complex.

I

II

III Scenario 1 Scenario 2

Figure 1.8 The principle of genetic mapping. The diagram shows two possible ways a specific chromosome might segregate in a family in which hearing loss is being transmitted as an autosomal dominant trait. The mother in generation II (II-1) inherited her hearing loss from her father. The chromosome that she inherited from her father is shown in bold. In Scenario 1, there is no relation between whether an offspring in generation III inherits hearing loss and whether they inherit the marked chromosome. This suggests that the gene responsible for the hearing loss is not on that particular chromosome but on one of the other 22 that II-1 received from her father. In Scenario 2, inheritance of the bold chromosome exactly parallels inheritance of hearing loss. If this happens sufficiently often, it would suggest that the hearing-loss gene is carried on that chromosome. This is the principle of linkage analysis. However, in real life, pairs of chromosomes swap segments during each meiosis, so what we have to follow through the pedigree is a chromosomal segment rather than a whole chromosome.

1181 Chap01

3/28/07

4:29 PM

Page 13

Understanding the genotype: basic concepts

Inevitably, it can go wrong in many different ways. Table 1.3 lists the main things that can go wrong. Frameshifts are best explained by an example. Consider a string of letters that is to be read as a series of three-letter words: ■

The big bad boy hit the cat. . . .

If we add or delete one letter, from then on the whole message is corrupted: ■ ■

The bix gba dbo yhi tth eca t The bib adb oyh itt hec at. . . ..

When the ribosomes translate an mRNA, the reading frame is fixed by the AUG start codon, and there is no further check. So just as in the above examples, it can be thrown out by insertions or deletions. Frameshifts result not only from insertion or from deletion of any number of nucleotides that is not a multiple of three but also from splicing mutations or exon deletions

that remove a nonintegral number of codons. Since 5% (3/64) of random codons are stop codons, when ribosomes read an mRNA out of frame, it is usually not long before they encounter a stop codon. Unexpectedly, premature stop codons (whether due to frameshifts or nonsense mutations) usually do not result in production of a truncated protein. Instead, in most cases, the mRNA is broken down and the result is no product. This “nonsense mediated decay” probably functions to protect the cell against deleterious effects of partially functional proteins. A major distinction is between mutations that totally abolish gene expression or totally wreck the product and those that lead to an abnormal degree of expression or to a recognizable but abnormal product. As indicated in the table, this is not always easy to predict just by looking at the sequence change and may need to be checked experimentally. Many missense mutations have no effect on the function of the gene product, but this is virtually impossible to predict—as genetic diagnostic laboratories have learned to their cost.

Table 1.3 How genes go wrong Type of change

Likely effect

Whether function should be totally abolished

Delete all of the gene

Total absence of product

Yes

Delete one or more exons

Variable

Generally yes, but missing exon(s) may not be necessary for gene function or may be used in only one splice isoform

Mutation in promoter

May change level of expression of the gene

Generally no, but hard to predict

Missense mutation in coding sequence

Replace one amino acid with another

Not unless that amino acid is vital to the function

Synonymous change in coding sequence

Replaces one codon for an amino acid with another for the same amino acid

Usually no effect, but sometimes the change may affect splicing

Nonsense mutation

Mutate an amino acid codon to a stop codon

Usually yes

Frameshift mutation

Insert or delete 1, 2, or any number of nts that is not a multiple of 3, so as to change the reading frame

Usually yes

Change invariant GT . . . AG splice signal

Exon may be skipped, or intronic material retained in the mature mRNA

Usually yes, but it may just alter balance of splice isoforms

Mutations in 5⬘UT or 3⬘UT

Might affect stability of mRNA

Unlikely, but hard to predict

Mutations in introns

None, unless they affect splicing

Usually no, but effects on splicing are hard to predict

Abbreviations: bp, base pair; nt, nucleotide. Source: From Ref. 3.

13

1181 Chap01

14

3/28/07

4:29 PM

Page 14

Genetics and hearing impairment

The effects of mutations

Genetic testing

In attempting to think through the likely effect of a mutation, the first question to ask is whether it causes a loss of function or a gain of function.

The central problem in genetic testing is to see the one particular piece of DNA of interest against a background of the 9 6 ⫻ 10 bp of irrelevant DNA in every cell. There are two general solutions to this:

■

■

Loss of function results from complete gene deletions, most frameshift, nonsense, and splice site mutations, and from some missense mutations. All mutations that cause complete loss of function of a gene would be expected to have the same phenotypic effect. What this effect is depends on how vital the function is and the other allele. Assuming the other allele functions normally, cells of a heterozygous person have 50% of the normal amount of the gene product. For many genes, this is sufficient for normal function; the person is normal and the condition is recessive. The common frameshifting mutation in connexin 26, 35delG, is an example. In some cases 50% is not sufficient (“haploinsufficiency”), a heterozygote will be affected and the condition is dominant. Loss of function mutations in the PAX3 gene causing Type 1 Waardenburg syndrome are an example of haploinsufficiency. Mutations causing a partial loss of function might be expected to have similar but milder effects, though much depends on the details. Gain of function does not usually mean gain of an entirely novel function—this happens in tumours when chromosomal rearrangements may combine exons of two genes, but it is almost unknown among inherited mutations. Rather, it means a gene being expressed inappropriately—at the wrong level, in the wrong cell, in response to the wrong signal, etc. Alternatively, it can mean that the product of the mutated gene is toxic or interferes with the working of the cell. For example, some missense mutations in connexin 26 cause dominant hearing loss because the abnormal protein causes gap junctions between cells to behave abnormally. This is called a dominant negative effect. Gain-of-function mutations are likely to produce dominant effects because the gain of function is present even in a heterozygous person. Since the effect depends on the presence of the gene product, these are normally missense mutations.

Genotype–phenotype correlations are the Holy Grail of clinical molecular genetics. We would like to be able to see a change in the DNA sequence and predict what effect that would have on the person carrying it. Very seldom is that possible. Although we know many genes that, when mutated, can cause hearing loss, it is unrealistic to expect that a given mutation will always cause a specific degree of loss, a specific audiogram configuration, or a specific age of onset in every mutation carrier. Even mendelian conditions do not really depend on just a single gene, and the innumerable genetic and environmental differences between people are likely to have some effect on the phenotype. Thus, although it is always sensible to look for genotype–phenotype correlations, we should not hold exaggerated hopes of what we might find.

■

■

Selectively amplify the sequence of interest to such an extent that the sample consists largely of copies of that sequence. Pick out the sequence of interest by hybridising it to a matching sequence that is labeled, e.g., with a fluorescent dye.

In the past, selective amplification was achieved by cloning the sequence into a bacterium, but nowadays the polymerase chain reaction (PCR) is universally used. For details of this technique see S&R2 section 6.1; for present purposes, it suffices to know that PCR allows the investigator to amplify any chosen sequence of up to a few kilobases to any desired degree in a few hours. All that is necessary is to know a few details of the actual nucleotide sequence that is to be amplified and to order some specific reagents (PCR primers) from one of the firms that custom-produce these. Almost all genetic testing involves PCR, although some companies make kits based on alternative methods, mainly to avoid the royalty payments required of users of the patented PCR process. The big limitation of PCR is that it can only be used to amplify sequences of, at most, a few kilobases. It is not possible to PCR-amplify a whole gene (average size 27 kb), still less a whole chromosome (average size 100 Mb). Hybridisation depends on the fact that the two strands of the DNA double helix can be separated (“denatured”) by brief boiling, and when the resulting single-stranded DNA solution is cooled, each Watson strand will try to find a matching Crick strand. If a dye-labeled single strand corresponding to the sequence of interest (a “probe”) is added, some of the test DNA will stick to the probe and can be isolated, followed, or characterised by using the label. Hybridisation was important in the now largely obsolete technique of Southern blotting, and it has regained importance as the principle behind microarrays (“gene chips”). Various applications of PCR and/or hybridisation make it relatively straightforward to check any predetermined short stretch of a person’s DNA—but the key word is “short.” In general, each exon of a gene must be the subject of a separate test, and when DNA is sequenced, a maximum of around 500 to 700 bp can be sequenced in a single test. Details of how these methods work are given in S&R2 sections 6.3 and 17.1, but the key point to appreciate is that our ability to answer questions about a person’s DNA depends crucially on the precision with which the question is posed. Consider three possible questions: 1. Does this patient have any genetic cause for her hearing loss?

1181 Chap01

3/28/07

4:29 PM

Page 15

Understanding the genotype: basic concepts

2. Does this patient have any mutation in her connexin 26 genes that could explain her hearing loss? 3. Does this patient have the 35delG mutation in her connexin 26 genes? Question 1 is unanswerable in any diagnostic setting—it might well be too challenging even for a PhD project. Question 3, on the other hand, can be answered cheaply and in an afternoon. Question 2 lies somewhere in between. To answer it, it would be necessary to examine the entire gene. For connexin 26, this is fairly simple because it is a small gene with only two exons. The same question in Type 1 Usher syndrome is a very different proposition. Several different genes can cause Type 1 Usher syndrome, and they are large—MYO7A for example has 50 exons. Most diagnostic laboratories would not be willing to devote so much effort to a single case, and even if they were willing, the cost would be high. Gene chips and/or developments in laboratory automation may, in the near future, make such problems much more tractable—but it remains true that the key to successful genetic testing is to pose a precise question. DNA technology is developing very fast. Sequencing and genotyping become cheaper every year and new technologies allow both to be done on scales that were unthinkable a few years ago. Some companies claim to be developing methods that would allow a person’s entire genome to be sequenced in a few days for a few thousand dollars. Optimists and pessimists alike dream of the day when everybody’s complete genome sequence will be stored in vast databases; they differ only in their reaction to this prospect. Among all this heady talk, it is important to remember that DNA analysis can reveal only those things about us that are genetically determined.

References 1.

2. 3.

Strachan T, Read AP. Human Molecular Genetics. 2nd ed. Oxford: Bios Scientific Publishers, 1999 on the NCBI Bookshelf: http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db ⫽ Books (accessed 31st May 2005). Mitomap www.mitomap.org (accessed 31st May 2005). Ensembl genome browser www.ensembl.org/Homo_sapiens/ (accessed 23rd February 2005).

15

Autosomal Recessive: The pedigree pattern seen when an allele at an autosomal locus causes a recessive character. Base: The heterocyclic rings of atoms that form part of nucleotides. Chemically, adenine and guanine are purines, cytosine, thymine, and uracil are pyrimidines. Base Pair: The A-T and G-C pairs in the DNA double helix. They are held together by hydrogen bonds. Carrier: An unaffected person with one pathogenic and one normal allele at a locus. Best restricted to heterozygotes for recessive conditions, but the word is sometimes applied to unaffected people with a gene for an incompletely penetrant or lateonset dominant condition. cDNA: A DNA copy of a mRNA, made in the laboratory. DNA is more stable than RNA and can be cloned, sequenced, and manipulated in ways that RNA cannot. Chromatin: A nonspecific term for the DNA-protein complex in which the DNA of eukaryotic cells is packaged. Heterochromatin is a highly condensed genetically inert form of chromatin, characteristic of the centromeres of chromosomes; the alternative is euchromatin. Coactivator: A protein that helps to assemble the various protein components needed to initiate transcription by binding to several components of the complex. Corepressor: A protein that works in the same way as a co-activator, but to opposite effect. Codon: The trio of nucleotides in a gene or mRNA that encodes one amino acid. Codons in the mRNA base pair with anticodons in the tRNA. Consanguineous: Parents are consanguineous if they are blood relatives. Since ultimately everybody is related, a practical working definition is that the parents are second cousins or closer relatives. Second cousins are children of first cousins; first cousins are children of sibs. Dominant: A character that is manifest in a heterozygote. Dominant Negative Effect: An inhibitory effect, seen in a heterozygote when a mutant protein prevents the normal version from functioning by sequestering it in nonfunctional dimers or multimers. Eukaryote: Any organism higher than bacteria. Characterised by cells with a membrane-bound nucleus, internal organelles, DNA in the form of chromatin and genes with introns.

Glossary

Exon: The parts of the DNA or primary transcript of a gene that are retained in the mature mRNA.

Allele: One or several possible forms of a particular gene, which may or may not be pathological.

Expressed Sequence Tag (EST): A partial sequence, typically around 300 nt, of a cDNA—incomplete but sufficient to recognise it uniquely.

Autosome: Any chromosome other than the X or Y sex chromosomes. Autosomal Dominant: The pedigree pattern seen when an allele at an autosomal locus causes a dominant character.

Genetic Marker: Any character used to follow a segment of a chromosome through a pedigree. SNPs and microsatellites are the genetic markers of choice.

1181 Chap01

16

3/28/07

4:29 PM

Page 16

Genetics and hearing impairment

Genotype: The genetic constitution of a person. One can talk of the genotype at a single locus, or the overall genotype. Cf. Phenotype. Germinal Mosaicism: Mosaicism affecting the gonads, so that a person can produce sperm or eggs representing each genotype present in the mosaic. Haploinsufficiency: The situation where a 50% level of function of a locus is not sufficient to produce a fully normal phenotype. It causes loss-of-function mutations to produce dominant conditions. Haplotype: A series of alleles at linked loci on the same physical chromosome. Heterozygous: Having two different alleles at a locus. Homozygous: Having two identical alleles at a locus. Hybridisation: The process where two single strands of DNA or RNA that have complementary sequences stick together to form a double helix. Intron: The parts of a primary transcript of a gene that are removed and degraded during splicing. It is sometimes called intervening sequences (IVS). Isoforms: Different forms of the protein product or mature mRNA of a single gene produced by alternative splicing of exons or the use of alternative start sites—a normal feature of gene expression. Locus: The position that a gene occupies on a chromosome. Since people have a pair of each autosome, a person has two alleles (identical or different) at each autosomal locus. Locus Heterogeneity: Locus heterogeneity is seen when indistinguishable mendelian disorders can be caused by mutations at more than one locus. This is a common finding in genetics, e.g., Usher syndrome Type 1 can be caused by mutations at loci on the long arm of chromosome 14 (14q31), the long arm of chromosome 11 (11q13) or the short arm of chromosome 11 (11p13). Lod Score: The statistical outcome of linkage analysis. It is the logarithm of the odds of linkage versus no linkage. A lod score above ⫹3 gives significant evidence for linkage, and a score below ⫺2 gives significant evidence against linkage. Lyonisation: An alternative name for X inactivation, a phenomenon discovered by Mary Lyon. Marker: See Genetic marker. Meiosis: The specialised cell division that produces sperm and eggs. It consists of two successive cell divisions that ensure each gamete contains 23 chromosomes with a novel combination of genes. Mendelian: A character or pedigree pattern that follows Mendel’s laws because it is determined at a single chromosomal location. Characters determined by combinations of many genes are called multifactorial, complex, or nonmendelian. Microsatellite: A small run of tandem repeats of a very simple DNA sequence, usually 1 to 4 bp, for example (CA)n.

Microarray: A postage-stamp size wafer of silicon or glass carrying a large arrayed set of single-stranded oligonucleotides corresponding to parts of the sequence of one or more genes. When fluorescently labelled PCR-amplified genomic DNA or cDNA is hybridised to the array, the pattern of hybridisation can be used to read off the sequence, to check which genes are expressed in a tissue, or to genotype a sample for a large number of SNPs in parallel. Mitosis: The normal process of cell division by which each daughter cell receives an exact and complete copy of all the DNAA in the mother cell. Mosaic: An individual who has two or more genetically different cell lines derived from a single zygote (because of a fresh mutation or chromosomal mishap). Nonpenetrance: It describes the situation when a person carrying a gene for a dominant character does not manifest the character. This is because of the effects of other genes or of environmental factors. Nucleotide: The units out of which DNA and RNA chains are constructed. It consists of a base linked to a sugar (deoxyribose in DNA, ribose in RNA) linked to a phosphate group. A nucleoside is the same but without the phosphate. Obligate Carrier: A person who is necessarily a carrier by virtue of the pedigree structure. For autosomal recessive conditions, this normally means the parents of an affected person, for X-linked recessive conditions, a woman who has affected or carrier offspring and also affected brothers or maternal uncles. A woman who has only affected offspring is not an obligate carrier of an X-linked condition, because new mutations are frequent in X-linked (but not autosomal recessive) pedigrees. Open Reading Frame: A stretch of genomic DNA that could be translated into protein without encountering a stop codon. Penetrance: The probability that a phenotype will be seen with a given genotype. Phenocopy: An individual who has the same phenotype as a genetic condition under study, but for a nongenetic reason, e.g., somebody with nongenetic deafness in a family where genetic deafness is segregating. Phenocopies can be a major problem in genetic mapping. Phenotype: The observed characteristics of a person (including the result of clinical examination). Compare with Genotype. Poly(A) Tail: The string of around 200 consecutive A nucleotides that is added on to the 3⬘ end of most mRNAs. It is important for the stability of mRNA. Polymerase Chain Reaction (PCR): A method for selectively copying a defined short (no more than a few kilobases) segment of a large or complex DNA molecule. The basis of most genetic testing. Primary Transcript: The initial result of transcribing a gene: an RNA molecule corresponding to the complete gene sequence, introns as well as exons.

1181 Chap01

3/28/07

4:29 PM

Page 17

Understanding the genotype: basic concepts

Probe: A labelled piece of DNA that is used in a hybridisation assay to identify complementary fragments. Depending on the application, probes may be pieces of cloned natural DNA around 1 kb long, or much shorter (20–30 nt) pieces of synthetic DNA. Promoter: The DNA sequence immediately upstream of a gene that binds RNA polymerase and transcription factors, so that the gene can be transcribed. Pseudogene: A nonfunctional copy of a working gene. Pseudogenes are quite common in our genome and represent the failed results of abortive evolutionary experiments. Recessive: A character that is manifest only in the homozygous state and not in heterozygotes. Sibs (Siblings): Brothers and sisters, regardless of sex. A sibship is a set of sibs. SNP (Single Nucleotide Polymorphism): The main class of genetic marker used for very high-throughput genotyping. About 1 nucleotide in every 300 is polymorphic. Most SNPs

17

have no phenotypic effect, but some may contribute to susceptibility to common complex diseases. Southern Blotting: A method of studying DNA based on separating fragments by size and hybridising them to a labelled probe. It is largely superseded by PCR, which entails much less work but still used for some special applications. It is named after its inventor; Northern blotting and Western blotting are similar techniques used on RNA and proteins, respectively— the names are jokes. Transcription Factor: A protein that binds the promoters of genes so as to activate transcription. Basal transcription factors are involved in transcription of all genes; tissue-specific transcription factors cause different cells to express different subsets of their genes. X–Inactivation: The mysterious process by which every human cell has only a single working X chromosome, regardless of how many X chromosomes are present. X-Linked Inheritance: X-linked inheritance is seen when a condition is caused by an allele located on the X chromosome.

1181 Chap01

3/28/07

4:29 PM

Page 18

1181 Chap02

3/29/07

4:39 PM

Page 19

2 Understanding the phenotype: basic concepts in audiology Silvano Prosser, Alessandro Martini

Introduction Knowledge in audiology, as in many other medical fields, advances discontinuously, paralleling developments in technology applied to scientific research. After the eras of psychoacoustics, tympanic measurements, electrophysiological responses, and otoacoustic emissions, it is apparent today that molecular biochemistry will play an important role in the exploration of auditory function. From a clinical point of view, it will transform the classification of hearing impairment and the possibilities for new therapeutic approaches. Studies in molecular genetics are accumulating an impressive quantity of knowledge on the aetiopathology of hearing loss, as the mapping and cloning of genes reveal their functions in the inner ear, its structural organisation, and its homeostasis. Currently, several hundred chromosomal loci have been identified and associated with syndromal and nonsyndromal hearing impairments. This number has been estimated to represent about half of the genetic changes resulting in hearing impairments. Thus, genetic factors have to be considered in diagnostic audiology much more frequently than in the past. At present, clinical audiology has to meet two requirements. First, there is the need for deeper knowledge of the pathophysiological changes that gene mutations induce in the auditory system; second, there is a need for new audiological diagnostic tools sensitive enough to elucidate these changes. This could help to better define the phenotype and narrow, to within a reasonable range, the set of genetic investigations necessary.

Pure-tone hearing-threshold measurements The principal audiometric test entails measuring the auditory thresholds for pure tones. Results indicate the minimum sound

pressure levels (dB SPL) that evoke the minimal auditory sensation within the frequency range between 125 and 8000 Hz. International standards define the SPL threshold values for normal hearing, and, after normalisation, relate them to 0 dB hearing loss (HL). Threshold increments up to 25 dB HL, although irrelevant for medicolegal purposes, may be valuable for diagnostic purposes. Two separate measures of the hearing threshold, respectively air-conducted (through an earphone or an insert) or bone-conducted (a vibrator on the forehead or the mastoid process) stimuli, permit the distinction between two main kinds of hearing losses: conductive and sensorineural. The first show a normal bone-conducted and an elevated airconducted hearing threshold. The second show equal values of the two thresholds. There are also mixed hearing losses, which have elements of both conductive and sensorineural losses. When a marked difference exists between the hearing thresholds of the two ears, noise masking is needed for the better ear, in order to ensure that a sensation evoked in the better ear does not interfere with the sensation elicited in the worse ear. A diagnosis of conductive hearing loss made by pure-tone audiometry indicates a dysfunction of the external or middle ear, but its origin cannot be pinpointed without otoscopic examination and admittance measurement. A diagnosis of sensorineural hearing loss indicates dysfunction in either the cochlea or the auditory pathway: other investigations are needed to confirm the site of the lesions. Clinical pure-tone audiometry, such as the psychoacoustical tests described below, is based on a stimulusresponse behavioural model, which requires active cooperation and attentive attitude by the subject being tested. Simulators, individuals with low levels of vigilance and reduced attention may give unreliable results, i.e., a hearing threshold poorer than the actual threshold or one excessively variable at retest. Threeto five-year-old children can reliably perform pure-tone audiometry: Younger children can be examined by special conditioning procedures.

1181 Chap02

20

3/29/07

4:39 PM

Page 20

Genetics and hearing impairment

Table 2.1 Relevant terms and definitions Hearing threshold level It means the threshold value averaged over frequencies 0.5, 1, 2, and 4 kHz in the better ear Hearing threshold levels (0.5–4 kHz)

Frequency ranges

Mild: over 20 and ⬍40

Low: up to and equal to 500 Hz

Moderate: over 40 and ⬍70 dB

Mid: over 500 up to and equal to 2000 Hz

Severe: over 70 and ⬍95 dB

High: over 2000 up to and equal to 8000 Hz

Profound: equal to and over 95 dB

Extended high: over 8000 Hz

Types of hearing impairment Unilateral: one ear has either ⬎20 dB pure-tone average or one frequency exceeding 50 dB, with the other ear better than or equal to 20 dB Asymmetrical: ⬎10 dB difference between the ears in at least two frequencies, with the pure-tone average in the better ear worse than 20 dB Progressive: a deterioration of ⬎15 dB in the pure-tone average within a 10-year period. Results in those aged over 50 years should be treated with some caution. In all cases the time-scale and patient age should be specified Conductive: related to disease or deformity of the outer/middle ears. Audiometrically, there are normal bone-conduction thresholds (⬍20 dB) and an air-bone gap ⬎15 dB averaged over 0.5-1-2 kHz Mixed: related to combined involvement of the outer/middle ears and inner ear/cochlear nerve. Audiometrically ⬎20 dB HL in the bone-conduction threshold together with ⬎15 dB air-bone gap averaged over 0.5-1-2 kHz Sensorineural: related to disease/deformity of the inner ear/cochlear nerve with an air-bone gap ⬍15 dB averaged over 0.5–1-2 kHz Sensory: a subdivision of sensorineural related to disease or deformity in the cochlea Neural: a subdivision of sensorineural related to a disease or deformity in the cochlear nerve

A relative contraindication to pure-tone audiometry may be the presence of occluding wax in the ear canal, since this may be responsible for a conductive loss of 20 to 30 dB HL. By examining patients suspected of having noise-induced hearing loss, an unexposed interval of 16 hours is needed to avoid false results due to “temporary threshold shift” phenomena. Commonly, the hearing threshold is measured at frequencies separated by octave intervals, from 0.125 to 8 kHz. The addition of intermediate frequencies (1.5, 3, 6, 10, and 12 kHz) may improve the overall threshold estimate. Indeed, as the threshold values of contiguous frequencies are correlated, the more the frequencies recorded, the less the probability of the errors associated with a single-frequency threshold measurement. The measurement error for air-conduction testing is usually estimated within ⫾ 5 dB, and it is about twice that figure for bone-conduction testing. These errors mainly originate from the transducers’ incorrect positioning as well as subject-related factors. The accuracy of the pure-tone hearing threshold is crucial in defining any progression of the hearing impairment (1). Some genetic hearing impairments show this characteristic. Hence, the first pure-tone threshold has to be measured with

high precision, since it will then be the reference for successive threshold comparisons. Table 2.1 gives relevant terms and definitions, derived from Stephens (2), on the basis of recommendations of the HEAR European project.

Relationship between pure-tone hearing thresholds and auditory damage External and middle ear A variety of genetic syndromes can affect the anatomy of these structures. By altering the sound transmission to the cochlea, they present as a conductive hearing impairment. Such anomalies range from simple stenosis of the external meatus to total lack of the tympano-ossicular complex, with intermediate conditions including an atretic external canal, an absence of the tympanic bone, and a lack or fusion of the ossicles, stapes

1181 Chap02

3/29/07

4:39 PM

Page 21

Understanding the phenotype: basic concepts in audiology

fixation, and atretic Eustachian tube. [See Van de Heyning (3) for an otosurgical classification.] Even in young children, the consequences of these anomalies can be measured by means of auditory-evoked potentials presented by air and bone conduction. Two extreme pathological pictures may be taken as a reference to predict the pure-tone threshold: (i) Simple atresia of the external meatus causes a 30 to 35 dB conductive hearing impairment due to the attenuation of the sounds directed to the tympanic membrane. (ii) A complete lack of the tympanic function causes a 60 to 70 dB conductive hearing loss, essentially due to the attenuation of the acoustical energy directed to the cochlea. Between these two extremes, the hearing loss may vary in respect to the anatomical structures involved and their consequence on auditory function (Fig. 2.1).

Inner ear Inner ear lesions resulting in a sensorineural hearing loss show a moderate relationship with the pure-tone threshold. An elevated threshold at high frequencies indicates damage to the basal portion of the cochlea. An elevated threshold for low frequencies suggests damage of the apical portion. Schuknecht’s (4) studies on the comparison of audiograms to cochlear histology (“cochleograms”) corroborates such a relationship. A further distinction involves the degree of hearing loss. Based on the role of outer and inner hair cells, we can assume that a total loss of outer cells causes a hearing impairment of 55 and 65 dB for low- and high-frequency ranges, respectively. A complete loss of inner hair cells should cause a profound hearing impairment (95 dB HL to total hearing loss). In practice, the lesions usually involve both the outer and the inner hair cells, with the proportions depending on the causative factor. Apart from these observations, other conditions have to be considered, in which the audiogram–histology relationship may break down. One of these is that the cochlea may appear anatomically normal in its microscopic structure, but the biochemical–metabolic

dB HL

.125 010 20 30 40 50 60 70 80 90 100110120-

.25

.5

1

2

4

8 KhZ

< < < <


B.C. A.C. mask.


> > > >

Figure 2.19 In speech audiometry, the scores of correct responses are affected by an intrinsic variability, depending on the number of items within the list. The speech audiogram (A) shows two intelligibility functions, one from a normal subject and one from a patient with a hearing impairment. For the latter, the range of variability (⫾2 SD) is shown, as expected for a 10-items list, (B) shows the standard deviation as a function of the number of items. The lower insert depicts the format used for adaptive procedures. Each stimulus consists of a different word, and intensity changes according to whether the responses are correct or incorrect. For this simple up–down procedure, the speech reception threshold (50% correct responses) is given by averaging the median intensities between the peaks and the troughs.

% 100

middle ear disorder

dBHL

20 SRT =30 dB

50

PTA=30 dB

50

80 0 0

20

40

60

80

% dBHL

inner ear disorder

x

100

20

x x

50

x x x

x PTA=50 dB

100 dB

SRT=50 dB

50

80 AC=BC

x

0 0

20

40

60

80

100 dB

% 20

dBHL

cochlear nerve disorder

PTA=30 dB

50 80

100 SRT= 40

50

AC=BC

0 0

20

40

60

80

100 dB

Figure 2.20 The function of intelligibility also reflects the perceptual distortions found with different kinds of hearing loss. Compared to normal (pointed function), in middle ear disorders, the SRT is shifted by the same amount as the pure-tone hearing threshold (PTA, 0.5-1-2 kHz). In inner ear disorders, the maximum intelligibility may be less than 100% due to perceptual disorders typical of cochleopathies. In retrocochlear disorders (cochlear nerve and brain stem), the SRT is shifted by an amount greater than that predicted from the PTA. In addition, a progressive reduction of intelligibility with intensity is sometimes observable (“roll-over effect”). Abbreviations: PTA, pure tone average; SRT, speech reception threshold.

1181 Chap02

36

3/29/07

4:39 PM

Page 36

Genetics and hearing impairment

Such results may be sensitised by the use of special speech materials in which redundancy is decreased by changing the acoustical properties of the speech signal or by adding other competing signals. Although speech audiometry has been excluded from the test battery originally recommended in individuals with a suspected genetic hearing impairment (82), it has recently provided useful results in the characterisation of some forms of dominant nonsyndromal hearing impairments. For example, the progressive forms, DFNA2 and DFNA5, show a deterioration in the rate of speech recognition that occurs relatively slowly over time. On the other hand, DFNA9 and DFNA10, with a later onset, show a more rapid deterioration, with an intelligibility reduction estimated at 1.8% per year (83–85). Such findings could indicate that, in DFNA2 and DFNA5, the cochlear damage is relatively stable, whereas in DFNA9 and DFNA10, in which speech test scores are similar to those of “presbyacusis,” the damage tends to involve structures other than the outer hair cells (86,87).

References 1. Pennings RJE, Huygen PLM, VanCamp G, et al. A review of progressive phenotypes in nonsyndromic autosomal dominant hearing impairment. Audiol Med 2003; 1:47–55. 2. Stephens D. Audiological terms. In: Martini A, Mazzoli M, Stephens D, Read A, eds. Definitions, Protocols & Guidelines in Genetic Hearing Impairment. London: Whurr, 2001:9–16. 3. Van de Heyning P, Claes J, Brokx J, et al. Surgical management of hearing impairment in audiological medicine. In: Luxon L, Furman F, Martini A, Stephens D, eds. Textbook of Audiological Medicine. London: Martin Dunitz, 2003:603–640. 4. Schuknecht HF. Further observations on the pathology of presbyacusis. Arch Otolaryngol 1964; 80:369–382. 5. Raphael Y, Altshuler RA. Structure and innervation of the cochlea. Brain Res Bull 2003; 60:397–422. 6. Cryns K, VanCamp G. Deafness genes and their diagnostic applications. Audiol Neuro otol 2004; 9:2–22. 7. Boothroyd A, Cawkwell S. Vibrotactile thresholds in pure tone audiometry. Acta Otolaryngol 1979; 69:381–387. 8. Schuknecht HF, Woellner R. An experimental and clinical study of deafness for lesions of the cochlear nerve. J Laryngol Otol 1955; 69:75–97. 9. Lehnhardt E. Neuro-axonal recruitment: a result of selective compression. J Laryngol Otol 1990; 104:185–190. 10. Spoendlin H. Retrograde degeneration of the cochlear nerve. Acta Otolaryngol 1975; 79:266–275. 11. Jerger J, Herer G. An unexpected dividend in Bekesy audiometry. J Speech Hear Disord 1961; 26:390–391. 12. Erlandsson B, Hakansson H, Ivarsson A, et al. Comparison of the hearing threshold measured by manual pure-tone and by self-recording (Bekesy) audiometry. Audiology 1979; 18:414–429.

13. McCommons RB, Hodge DC. Comparison of continuous and pulsed tone for determining Bekesy threshold measurements. J Acoust Soc Am 1969; 45:1499–1503. 14. Laroche C, Hetu R. A study of the reliability of automatic audiometry by the frequency scanning method (Audioscan). Audiology 1997; 36:1–18. 15. Stephens D, Meredith R, Sirimanna, et al. Application of the Audioscan in the detection of carriers of genetic hearing loss. Audiology 1995; 34:91–97. 16. Mauermann M, Long GR, Kollmeier B. Fine structure of hearing threshold and loudness perception. J Acoust Soc Am 2004; 116:1066–1080. 17. Parving A. Reliability of Bekesy threshold tracing in identification of carriers of genes for an X-linked disease with deafness. Acta Otolaryngol 1978; 85:40–44. 18. Meredith R, Stephens D, Sirimanna T, et al. Audiometric detection of carriers of Usher’s type II. J Audiol Med 1992; 1: 11–19. 19. Cohen M, Francis M, Luxon L, et al. Dips on Bekesy or Audioscan fail to identify carriers of autosomal recessive non-syndromic hearing loss. Acta Otolaryngol 1996; 116:5121–527. 20. Stephens D, Francis M. The detection of carriers of genetic hearing loss. In: Martini A, Read A, Stephens D, eds. Genetics and hearing impairment. London: Whurr, 1996:100–108. 21. Dobie RA. The relative contributions of occupational noise and aging in individual cases of hearing loss. Ear Hear 1992; 13: 19–27. 22. International Standard Organization. ISO 1999. Acousticsdetermination of occupational noise exposure and estimation of noise-induced hearing impairment. Geneva, ISO 1990. 23. International Standard Organization. ISO 7029. Acousticsthreshold of hearing by air conduction as a function of age and sex for otologically normal persons. Geneva, ISO 1984. 24. Wuyts FL, Van de Heyning PH, Decalu F. Audiometric criteria for linkage analysis in genetic hearing impairment. In: Stephens D, Read A, Martini A, eds. Developments in Genetic Hearing Impairment. London: Whurr, 1998:54–55. 25. Karlsson KK, Harris JR, Svartengren M. Description and primary results from an audiometric study of male twins. Ear Hear 1997; 18:114–120. 26. Gates GA, Couropmitree NN, Myers RH. Genetic associations in age-related hearing thresholds. Arch Otolaryngol Head Neck Surg 1999; 125:275–280. 27. Robinson DW. Long-term repeatability of the pure-tone hearing threshold and its relation to noise exposure. Br J Audiol 1991; 25:219–235. 28. Martini A, Prosser S, Mazzoli M, et al. Contribution of age related factors to the progression of nonsyndromic hereditary hearing impairment. J Audiol Med 1996; 5:141–156. 29. Huygen PLM, Pennings RJE, Cremers CWR. Characterizing and distinguishing progressive phenotypes in nonsyndromic autosomal dominant hearing impairment. Audiol Med 2003; 1:37–46. 30. Hinchcliffe R. The threshold of hearing. In: Luxon L, Furman F, Martini A, Stephens D, eds. Handbook of Audiological Medicine. London: Martin Dunitz, 2003:213–247.

1181 Chap02

3/29/07

4:39 PM

Page 37

Understanding the phenotype: basic concepts in audiology

31. Job A, Delplace F, Anvers P, et al. Analyze automatique d’audiogramme visant à la surveillance épidémiologique di cohortes exposée aux bruits impulsifs. Rev Epidem Santè Pub 1993; 41:407–520. 32. Ozdamar X, Eilers RE, Miskiel E, et al. Classification of audiograms by sequential testing using a dynamic Bayesian procedure. J Acoust Soc Am 1990; 88:2171–2179. 33. Sorri M, Muhli A, Maeki-Torkko E, et al. Unambiguous system for describing audiogram configurations. J Audiol Med 2000; 9: 160–169. 34. Martini S, Milani M, Rosignoli M, et al. Audiometric patterns of genetic non-syndromal sensorineural hearing loss. Audiology 1997; 36:228–236. 35. Griffith AJ, Sprunger LK, Sirko-Osada DA, et al. Marshall syndrome associated with a slicing defect at the COL11A1 locus. Am J Hum Genet 1998; 62:816–823. 36. Asher JH, Sommer A, Morell R, et al. Missense mutation in the parallel domain of PAX3 causes craniofacial-deafness-hand syndrome. Hum Mut 1996; 7:30–35. 37. Friedman B, Friedman JM, Shulz M, et al. Recent advances in the understanding of syndromic forms of hearing loss. Ear Hear 2003; 24:289–302. 38. Li XC, Everett LA, Lawani AK, et al. A mutation in PDS causes non-syndromic recessive deafness. Nat Gen 1998; 18:215–217. 39. Hasson T, Heintzelman MB, Santos-Sacchi J, et al. Expressions in the cochlea and retina of myosin VIIa, the gene product defective in Usher syndrome type Ib. Proc Natl Acad Sci 1995; 92:9815–9819. 40. Chang EH, VanCamp G, Smith RJH. The role of connexins in human disease. Ear Hear 2003; 24:314–323. 41. Hall JW. Classic site-of-lesion tests. In: Rintelmann WF, ed. Hearing assessment. 2nd ed. Needham Heights, MD: Allyn & Bacon, 1991:669–679. 42. Glasberg BR, Moore BCJ. Psychoacoustic abilities of subjects with unilateral and bilateral cochlear impairments and their ability to understand speech. Scand Audiol 1989; suppl 32:1–25. 43. Rosenberg P. Abnormal auditory adaptation. Archs Otolaryngol 1971; 89:89–97. 44. Borg E, Canlon B, Engstroem B. Noise induced hearing loss. Literature review and experiments in rabbits. Scand Audiol 1995; 24(suppl 40):1–147. 45. Moore BCJ, Huss M, Vickers DA, et al. A test for the diagnosis of dead regions in the cochlea. Br J Audiol 2000; 34:205–224. 46. Moore BCJ. Dead regions in the cochlea: diagnosis, perceptual consequences and implication for the fitting of hearing aids. Trends Amplif 2001; 5:1–34. 47. Summers V, Molis MR, Musch H, et al. Identifying dead regions in the cochlea: psycophysical tuning curves and tone detection in threshold equalizing noise. Ear Hear 2003; 24:133–142. 48. Moore BCJ, Killen T, Munro KJ. Application of TEN test to hearing-impaired teenagers with severe-to-profound hearing loss. Int J Audiol 2003; 42:465–474. 49. Vickers DA, Moore BCJ, Baer T. Effects of low-pass filtering on the intelligibility if speech in quiet for people with and without dead regions at high frequencies. J Acoust Soc Am 2001; 110:1164–1175.

37

50. Jerger J, Jerger S, Mauldin L. Studies in impedance audiometry. I. Normal and sensorineural ears. Arch Otolaryngol 1972; 96:513–523. 51. Jerger J, Anthony L, Jerger S, Mauldin L III. Studies in impedance audiometry. III. Middle ear disorders. Arch Otolaryngol 1974; 99:165–171. 52. Liden G, Bjorkman G, Nyman H. Tympanometry and acoustic impedance. Acta Otolaryngol 1977; 83:140–145. 53. Hayes D, Jerger J. Pattern of acoustic reflex and auditory brainstem response abnormality. Acta Otolaryngol 1981; 92:199–202. 54. Borg E. On the neural organization of the acoustic middle ear reflex: a physiological and anatomical study. Brain Res 1973; 49:101–123. 55. Metz O. Threshold of reflex contraction of muscles of middle ear and recruitment of loudness. Arch Otolaryngol 1952; 55:536–543. 56. Anderson H, Barr B, Wedenberg E. Early diagnosis of the eight nerve tumors by acoustic reflex tests. Acta Otolaryngol 1970; suppl 263:232–237. 57. Bel J, Causse P, Michaux R, et al. Mechanical explanation of the on-off effect (diphasic impedance change) in otospongiosis. Audiology 1976; 15:128–140. 58. Hall JW. Predicting hearing level from the acoustic reflex: a comparison of three methods. Arch Otolaryngol 1978; 104:601–606. 59. Gorga M, Neely S, Bergman B, et al. Otoacoustic emissions from normal-hearing and hearing-impaired subjects: distortion product responses. J Acoust Soc Am 1993; 93:2050–2060. 60. Prieve BA, Gorga M, Schmidt A, et al. Analysis of transientevoked otoacoustic emissions in normal-hearing and hearingimpaired ears. J Acoust Soc Am 1993; 93:3308–3319. 61. Prieve BA, Fitzgerald TS, Schulte LE, et al. Basic characteristics of distortion product otoacoustic emissions in infants and children. J Acoust Soc Am 1997; 102:2871–2879. 62. Eggermont JJ. Basic principles for electrocochleography. Acta Oto laryngol 1974; 316 (suppl):7–16. 63. Arslan E, Prosser S, Conti G, Michelini S. Electrocochleography and brainstem potentials in the diagnosis of the deaf child. Int J Pediatr Otorhinolaryngol 1982; 5:251–259. 64. Yoshie N. Diagnostic significance of electrocochleogram in clinical audiometry. Audiology 1973; 12:504–539. 65. Moeller AR. Neural generators of the brainstem auditory evoked potentials. Sem Hear 1998; 19:11–27. 66. Starr A, Achor J. Auditory brainstem responses in neurological disease. Arch Neurol 1975; 32:761–768. 67. Starr A, Hamilton A. Correlation between confirmed sites of neurological lesions and abnormalities of far-field auditory brainstem responses. Electroencephal Clin Neurophysiol 1976; 41:596–608. 68. Salamy R. Maturation of auditory brainstem response from birth through early childhood. J Clin Neurophysiol 1984; 1:293–329. 69. Kraus N, Ozdamar O, Stein L, et al. Absent auditory brain stem response: peripheral hearing loss or brain stem dysfunction? Laryngoscope 1984; 94:400–406. 70. Starr A, Picton TW, Sininger Y, et al. Auditory neuropathy. Brain 1996; 119:741–753. 71. Langner G, Schreiner CE. Periodicity coding in the inferior colliculus of the cat. I. Neuronal mechanisms. J Neurophysiol 1988; 60:1799–1822.

1181 Chap02

38

3/29/07

4:39 PM

Page 38

Genetics and hearing impairment

72. Perez-Abalo MC, Savio G, Toores A, et al. Steady state responses to multiple amplitude-modulated tones: an optimized method to test frequency-specific thresholds in hearing impaired children and normal hearing subjects. Ear Hear 2001; 22:200–211. 73. Rance G, Rickards FW, Cohen LT, et al. The automated prediction of hearing thresholds in sleeping subjects using auditory steady-state evoked potentials. Ear Hear 1995; 16:499–507. 74. Herdmann AT, Stapells DR. Thresholds determined using the monotic and dichotic multiple auditory steady state response technique in normal hearing subjects. Scand Audiol 2001; 30:41–49. 75. John MS, Brown DK, Muir PJ, et al. Recording auditory steadysate responses in young infants. Ear Hear 2004; 25: 539–553. 76. Lins OG, Picton TW. Auditory steady state responses to multiple simultaneous stimuli. Electroencephal Clin Neurophysiol 1995; 96:420–432. 77. Bocca E, Calearo C. Central hearing processes. In: Jerger J, ed. Modern developments in audiology. New York: Academic Press, 1963:337–370. 78. Jerger J, Jerger SW. Clinical validity of central auditory tests. Scand Audiol 1975; 4:147–163. 79. Lyregaard P. Towards a theory of speech audiometry tests. In: Martin M, ed. Speech Audiometry. London: Taylor & Francis, 1987: 33–67. 80. Levitt H. Adaptive testing in audiology. Scand Audiol 1978; 6(suppl):241–291.

81. Festen JM. Contribution of comodulation masking release and temporal resolution to the speech–reception threshold masked by interfering noise. J Acoust Soc Am 1993; 94: 1725–1736. 82. Stephens D. Audiometric investigation of probands. In: Martini A, Mazzoli M, Stephens D, Read A, eds. Definitions, Protocols & Guidelines in Genetic Hearing Impairment. London: Whurr, 2001:29–31. 83. De Leeheener EMR, Huygen PLM, Wayne S, et al. The DFNA 10 phenotype. Ann Otol Rhinol Laryngol 2001; 110:861–866. 84. De Leeheener EMR, Huyhen PLM, Coucke PJ, et al. Longitudinal and cross-sectional phenotype analysis in a new, large Dutch DFNA 2/KCNQ4 family. Ann Otol Rhinol Laryngol 2002; 111: 267–274. 85. De Leenheer EMR, vanZuijlen DA, Van Laer L, et al. Further delineation of the DFNA5 phenotype. Results of speech recognition tests. Ann Otol Rhinol Laryngol 2002; 111:639–641. 86. Bom SJH, De Leeheener EMR, Leamrie FX, et al. Speech recognition scores related to age and degree of hearing impairment in DFNA2/KCNQ4 and DFNA9/COCH. Arch Otolaryngol 2001; 127:1045–1048. 87. Ketharpal U. DFNA9 is a progressive audiovestibular dysfunction with a microfibrillar deposit in the inner ear. Laryngoscope 2000; 110:1379–1384.

1181 Chap03

3/29/07

6:33 PM

Page 39

3 Newly emerging concepts in syndromology relevant to audiology and otolaryngology practice William Reardon

Clinical basics—the descriptive language of dysmorphology Dysmorphologists recognise four essential categories of birth defect. Firstly “deformations,” which means that the birth defect results from abnormal mechanical forces acting to distort an otherwise normal structure. These often occur quite late in gestation after normal initial formation of organs, but the growth and subsequent development of these organs or structures are hampered by the mechanical force. An example of one such birth defect might be a club foot (talipes), but it needs to be borne in mind that talipes is not always the result of a deformation and can result from other categories of birth defect. Secondly, “disruptions,” are structural defects caused by actual destruction of previously normal tissue. This type of birth defect could be consequent on haemorrhage or poor blood flow during development to a particular region of the developing fetus. Disruptional abnormalities generally affect several different tissue types within a well-demarcated anatomical region. Thirdly, “dysplasias,” being abnormal cellular organisation or function within a specific tissue type throughout the body, resulting in clinically apparent structural changes. A good example of a dysplasia is a skeletal dysplasia, resulting in

“dwarfing,” where the patient’s short stature is caused by a major gene mutation causing a dysplasia of the cartilage, with the result that the bones do not elongate. The fourth type of birth defect is “malformation.” This term is reserved for abnormalities caused by failure of the embryonic process; in other words, the particular tissue or organ is arrested, delayed or misdirected, causing permanent abnormalities of the structure. This was a structure, which never pursued normal development. Many malformations are the result of genetic mutations and can result in a malformation syndrome affecting several different body systems and causing a range of different clinical signs of birth defects in the individual patient. In contrast to deformations and disruptions, malformations suggest an error occurring early in gestation, either in tissue differentiation or during the development of individual organ systems. Likewise it should be inferred that since both deformations and disruptions usually affect structures, which have undergone normal initial development, the presence of a birth defect thus classified does not signify an intrinsic abnormality of the tissues involved. Furthermore, it follows that there is rarely a cause for concern about mental retardation or other hidden future medical problems if the birth defect in a child is determined to be a disruption or a deformation—unless there has been structural damage to the brain as part of the birth defect.

1181 Chap03

40

3/29/07

6:33 PM

Page 40

Genetics and hearing impairment

The relationship of birth defects to one another Four distinct relationships are recognised and these will be outlined.

Single system defects Malformations comprising a local region of a single organ system of the body account for the majority of birth defects. Representative examples include cleft lip, congenital heart disease, and congenital dislocation of the hip.

Associations Clinical signs, which occur together in a nonrandom fashion and result in a recognisable “pattern,” but whose single underlying cause remains unknown are said to represent an association. A good example is a fairly common condition seen in newborn babies and recognised by the pattern of birth defects. The condition is VATER association, comprising vertebral abnormalities, anal atresia, tracheo-oesophageal fistula, renal abnormalities and limb defects. The cause(s) of this condition is not known. Chromosome and other genetic studies are invariably normal in the affected patient. What is recognised is that a child with tracheo-oesophageal fistula, who will present with inability to swallow on day 1 or 2 of life, needs to have careful examination for these other clinical features, which are sometimes associated. So, it acts as a prompt to the astute clinician to look for some of the more cryptic birth defects such as the vertebral abnormalities, which might otherwise be overlooked but have serious long-term sequelae.

Sequences Some patterns of multiple birth defects result from a cascade of seemingly unrelated events but which actually follow from a single developmental event/defect. Consequently, this primary abnormality interferes with normal embryological and fetal development to result in the birth of a child who appears to have separate and distinct abnormalities, possibly involving widely separated body areas and organ systems. For instance, in Potter sequence, the primary abnormality is absent kidneys. The failure to produce urine results in a greatly reduced volume of amniotic fluid around the baby, which in turn leads to mechanical constraint on the baby with deformations such as limb bowing, joint contractures, and compressed facial features, known as Potter’s facies. These deformations are elements of the sequence of events, which follow from the primary defect, which is the absent kidneys.

Syndromes A particular set of congenital anomalies repeatedly occurring in a generally consistent pattern is known as a “syndrome.” In

contrast to an association, a syndrome suggests that the link between the various anomalies is fairly consistent from patient to patient. Often a syndrome is differentiated from an association by the identification of the underlying cause, which explains the seemingly disparate clinical elements of the syndrome. Consequently, it will be understood that a syndrome may be caused by a chromosomal problem (Down syndrome), a biochemical defect (Smith–Lemli–Opitz syndrome), a Mendelian genetic defect (Treacher Collins syndrome), or an environmental agent (fetal alcohol syndrome). Since this particular term, syndrome, is at the heart of this discussion, a few points of elaboration may be in order. Birth defect syndromes are usually recognised from the report of a single or a few individual cases which bear a resemblance to one another. With the publication of further cases, this emerging new syndrome is expanded by the inclusion of other birth defects not observed in the original reports. Likewise, these follow-on publications tend to throw light on the natural history of the condition, clarify the prognosis, and, with luck, establish a causation or identify a new investigation, which is diagnostic. This is a period of natural tension between aspiring authors, anxious to publish their cases and expand the clinical documentation of the new syndrome, and journal editors and referees, who have a duty to keep the literature free of impurities but also an obligation to publish genuine cases, which do add to the sum total of knowledge in relation to the newly emerging/emerged condition. However, in the absence of hard objective laboratory investigations, cases that are wrongly attributed can and sometimes do get published, resulting in confusion in the emerging literature. One can then understand why it is that for newly emerging, individually rare, conditions, based on relatively few cases, the clinical basis of the diagnosis may remain “soft” for a considerable period. It is worth quoting directly from Aase (1), “even after considerable refinement, however, diagnoses based on clinical observations show a great range of latitude and there may be no “gold standard” against which a particular patient can be compared. . . .there is inherent variability in the manifestations of most dysmorphic disorders, both in type and in severity of structural abnormalities . . . Syndrome diagnosis still relies heavily on the ability of the clinician to detect and to correctly interpret physical and developmental findings and to recognise patterns in them.”

The impact of gene identification and the altered environment of clinical practice This chapter addressed a decade ago might have had a strong emphasis on the need for careful phenotypic examination of patients with a view to gathering together adequate pedigrees to pursue linkage and aspire to gene identification. For many well-defined syndromes, these goals have now been attained and

1181 Chap03

3/29/07

6:33 PM

Page 41

Newly emerging concepts in syndromology relevant to audiology

current molecular strategies are increasingly turning toward nonMendelian conditions, often characterised as associations. There is an increasing reliance on molecular cytogenetics to investigate patients whose clinical conditions, occurring sporadically within their families, have previously been unexplained. Much of this work stems from observations of Flint and others in the mid1990s that up to 7% of unexplained mental retardation could be caused by subtelomere deletions of chromosomes in patients whose gross chromosomal examination was normal (2,3). As a result of this new focus of research into previously undiagnosable cases, new syndromes are emerging, many of them of relevance to the audiological physician and his/her surgical counterpart. Meanwhile, rare or poorly defined syndromes continue to be subject to ongoing research studies with a view to identifying causative mutations underlying those conditions and easing diagnostic controversies in cases on the margins of those diagnoses. In parallel with these active research developments, clinicians have worked to apply many of the lessons learned from syndromes and conditions for which diagnostic genetic tests have now become available to enhance clinical management of patients and families with these conditions. It would be impossible in this contribution to allude to all of the advances relevant to syndromology of audiological medicine and otolaryngology practice, so the author proposes to focus on specific examples, which demonstrate the principles above outlined.

41

Figure 3.1 Cupped, prominent ear, in a patient with CHARGE syndrome. Abbreviation: CHARGE, coloboma, heart defect, atresia choanae, retarded growth, ear anomalies/deafness.

Identifying a genetic basis for a sporadically occurring condition—CHARGE association becomes a syndrome CHARGE association was first described in 1979 by Hall in 17 children with multiple congenital anomalies, who were ascertained because of choanal atresia (4). Low-set, small, and malformed ears were identified among several of these cases, and associated clinical observations encompassing congenital heart defects, ocular colobomas, deafness, hypogenitalism, facial palsy, and developmental delay were noted as inconsistent findings across the patient cohort. Writing in the same year, Hittner et al. (5) reported 10 children, ascertained for colobomatous microphthalmia, with essentially the same constellation of clinical malformations. The term CHARGE was first proposed by Pagon et al. (6) to reflect the major clinical clues to this diagnosis, such as coloboma, heart defect, atresia choanae, retarded growth, or ear anomalies/deafness. As recognised by Graham (7), the characteristic asymmetry of the clinical findings and the frequent absence of either choanal atresia or coloboma made diagnosis difficult in many cases, and several patients looked like they “might” have CHARGE association, but, without a diagnostic test, the clinical designation of such cases remained dubious. Experienced clinical geneticists often seized upon the ear morphology, the typically cup-shaped ear, as a clue to diagnosis in these marginal cases (Fig. 3.1). An important clinical landmark was reached in 2001 when Amiel et al. (8) reported absence or hypoplasia of the semicircular canals on temporal bone computed tomography

Figure 3.2 CHARGE syndrome—axial computed tomography of the petrous bone at the level of the internal auditory meatus at the expected level of the horizontal semicircular canal, which is absent. The crus of the posterior semicircular canal should also be seen at this level indicating complete absence of the semicircular canals (with thanks to Dr. E. Phelan). Abbreviation: CHARGE, coloboma, heart defect, atresia choanae, retarded growth, ear anomalies/deafness.

scanning as a core feature of CHARGE association (Fig. 3.2). Likewise, a large-scale clinical study by the same group, of clinical characteristics of patients with CHARGE association, unsurprisingly showed many other clinical features occurring as uncommon but probably integral features of the syndrome (9). In addition to reporting semicircular canal hypoplasia on temporal bone scans in 12 of 12 cases, these authors also drew attention to asymmetric crying facies, esophageal and laryngeal anomalies, renal malformations, and facial clefts among patients with CHARGE association. Despite these important clinical increments in recognising the totality of the spectrum of associated anomalies, the cause of the condition remained unidentified. A teratogenic aetiology

1181 Chap03

42

3/29/07

6:33 PM

Page 42

Genetics and hearing impairment

had been proposed but no specific agent had been identified common to women who had had such children (7). A few instances of parent-to-child transmission had been recorded (7), suggesting, in this subpopulation of CHARGE cases at least, a genetic, autosomal-dominant basis. Other evidence for a genetic basis was drawn from observation of concordance of the condition in monozygotic twins and discordance in dizygotic twins (7). Although it was routine clinical practice for clinical geneticists to undertake chromosomal analysis in CHARGE association cases, this was generally seen as an exercise in hope rather than a realistic investigation likely to give an abnormality. Most such cases resolutely showed normal chromosomal analysis. Hurst et al. (10) had drawn attention to a de novo chromosomal rearrangement, a seemingly balanced whole arm chromosomal rearrangement between chromosomes 6 and 8 in a child with typical clinical features of CHARGE, but there being no further evidence to substantiate this as an important finding, it was equally likely that it was a red herring and not of aetiological significance. All of this changed however when Vissers et al. (11) used the comparative genome hybridisation approach to screen CHARGE patients for submicroscopic copy number changes with a view to identifying microdeletions or duplications in patients with CHARGE association. They identified a CHARGE case with 8q12 clones deleted in a region of approximately 5 Mb. Recognising the possible value of Hurst’s report and obtaining DNA from her case, these researchers then hybridised genomic DNA from Hurst’s patient onto the chromosome 8 BAC array and identified two submicroscopic deletions overlapping with the earlier 5Mb 8q12 critical region. Proceeding from these important initial data, no deletions were identified in 17 other cases of CHARGE. Nine genes were identified within this critical region and sequencing of these genes identified mutations within a specific locus, CHD7, in 10 of the 17 patients with CHARGE association not related to 8q12 submicroscopic deletions. The CHD genes are a family of genes encoding chromodomain helicase DNAbinding proteins, a family of proteins thought to have pivotal roles in early embryonic development by affecting chromatin structure and gene expression. The findings of Vissers et al. (11) clearly establish that haploinsufficiency of the CHD7 gene results in CHARGE features. Interestingly, and as might have been predicted, the individual with the microdeletion has relatively severe mental retardation in association with the core clinical features of CHARGE—presumably this represents the haploinsufficiency of genes adjacent to CHD7, whose specific absence accounts for the typical CHARGE features. What of the seven individuals for whom neither deletions nor mutations were identified within this locus? It is already known that CHARGE can be associated with chromosome 22q11.2 deletion syndrome-like phenotype, a cytogenetic deletion syndrome more readily associated with clinical stigmata of Di George sequence, velocardiofacial syndrome, and Cayler syndrome (12). Consequently the emerging data confirm that

CHARGE is a genetically heterogeneous condition, most cases being caused by haploinsufficiency of CHD7, but some other cases may possibly represent an extended chromosome 22q11.2 microdeletion syndrome and other cases an as yet unidentified genetic causation. However, it is now fair to recognise that most cases of CHARGE do share an underlying genetic basis, irrespective of variability in clinical signs and that the condition might correctly be termed a syndrome under the distinction outlined above.

Improved cytogenetics identifies new syndromes with specific audiological and ENT relevance. Clinical and cytogenetic interaction can result in recognition of abnormal chromosomes One of the questions most posed to geneticists relates to the origins of “new” syndromes. Of course the conditions referred to as new are not new. They have always existed but have not been previously recognised as distinct clinical entities. New syndromes emerge through the medical literature all the time. In the past, these have frequently comprised clinical reports of instructive families or individuals, but a particular trend of the last few years has been the identification of syndromes with specific chromosomal abnormalities which are deemed to be clinically recognisable. Consequently, seeing a patient in whom one is reminded of one of these new cytogenetic syndromes, the clinician has a definite idea of what investigations he/she might request of their laboratory in seeking to establish the underlying diagnosis in that particular patient. Deletions of chromosome 1p36 represent a good instance of special relevance to clinicians dealing with deafness in the context of developmental delay. Shapira et al. presented clinical details of 14 patients with deletion of chromosome 1p36 and identified that the condition was much more common than previously recognised by the then prevailing cytogenetic techniques. Exploiting fluorescent in-situ hybridisation (FISH) and other advances in cytogenetic technology facilitated the identification of the syndrome in cases where this had not previously been possible. Moreover, the clinical phenotype described was strongly suggestive of a pattern of malformations, which should be clinically recognisable. Thus the clinician, by redirecting the attention of cytogeneticists toward this area of the karyotype, might assist in identification of the underlying chromosomal abnormality and thus solve the diagnostic issue for the patient (13). In fact it is clear from reading this paper that the clinicians were able to make the diagnosis clinically once they had become accustomed to the phenotype from the first few cytogenetically positive cases. Following that breakthrough paper, there were several other reports of this syndrome being recognised by clinicians elsewhere; these are well summarised by Slavotinek et al. in a major review article (14). The clinical profile of affected individuals, which has been crystallised from these reported experiences is one of motor delay and hypotonia (90% ⫹), moderate to severe

1181 Chap03

3/29/07

6:33 PM

Page 43

Newly emerging concepts in syndromology relevant to audiology

mental retardation (90% ⫹), pointed chin (80%), seizures (70% ⫹), clinodactyly and/or short fifth finger (60% ⫹), ear asymmetry (55% ⫹), low-set ears (55% ⫹), hearing deficits (55% ⫹), and other variable features, including congenital heart disease and cleft lip, and/or palate. Some have commented on a horizontality of the eyebrows, which they find clinically valuable in alerting them to this syndromic diagnosis but that is inconstant, as any examination of published photographs shows. If present, it is a valuable clue. However, for this author at least, the clue is often the shape of the chin, which is pointed and often rather prominent (Fig. 3.3). While the low-set ears and ear asymmetry may be noted in audiology or ENT clinics, the main concern will often relate

43

to hearing abnormalities. These have been characterised as high frequency bilateral sensorineural hearing loss in 8 of 18 cases in one report, a further two cases having conductive loss characterised as severe degree (15). It is valuable to know that experienced dysmorphologists will often recognise children with this syndrome clinically, despite a normal karyotype report, and discussion with cytogeneticist colleagues will often lead to reevaluation of the original chromosome report and the identification of the underlying deletion. A further example of this clinical–cytogenetic interaction proving valuable in identification of an underlying causative chromosomal abnormality occurs in relation to chromosome 4qter deletion. The existence of a syndrome

Figure 3.3 Facial characteristics seen in six children with chromosome 1p36 deletion. Note especially the horizontality of the eyebrows, which is a good clinical sign but not universal. The pointed chin, cases B, D, and E especially, is another good clinical clue. (Kindly reproduced from Ref. 14 by permission of the BMJ Publishing Group.)

1181 Chap03

44

3/29/07

6:33 PM

Page 44

Genetics and hearing impairment

Figure 3.4 Tail of a nail sign in chromosome 4q-syndrome.

comprising developmental delay, hypertelorism, often cleft palate and palatal dysfunction, low-set ears, poor growth, and abnormal fifth finger nails has been known for many years (16). Indeed, this latter sign has been recognised by Flannery as the main clue to the diagnosis and led him to coin the term “tail of a nail” syndrome for the condition (17). However, the deletion can be subtle cytogenetically, and, the patient’s clinical condition being mild, be missed. Such a case arose in this author’s own practice recently.

The patient was the youngest of three sisters born to unrelated parents. At the age of one, she presented with an acute respiratory arrest. Laryngotracheobronchoscopy showed multiple haemorrhagic regions in the trachea and main bronchi, consistent with acute respiratory arrest. No obstructive or other cause for this was identified. Routine investigations including basic chromosomes were normal. A genetics referral led to some new points being established—specifically there was no facial dysmorphism, but the developmental history was suggestive of slight parental concern in that milestones were not being achieved at the same rate as had occurred in the older siblings. Specifically, as she got older, it became clear that speech was delayed. The only clinical sign was an abnormal fifth fingernail unilaterally (Fig. 3.4), which prompted the clinical geneticists to ask for cytogenetic reevaluation with specific reference to chromosome 4q. A tiny deletion was shown on extended banding review of the chromosomes (Fig. 3.5). Subsequently this child developed severe palatal insufficiency, with little evidence of gag reflex on video fluoroscopy (Fig. 3.6), which led to gastrostomy and direct feeding. Following fundoplication, airway function improved greatly and eventually it was possible to reinstigate oral feeding. Oropharyngeal hypotonia and palatal dysfunction are a well-established feature of the 4q–syndrome, frequently leading to the need for tracheostomy and gastrostomy. Several such cases are described. Considering the numbers of children who have these surgical procedures, it ought to be worth clinically examining the nails for tail of the nail sign and reviewing the chromosomes for evidence of 4q-abnormality, which can be familial and asymptomatic in some individuals.

Figure 3.5 The karyotype of the patient with “tail of a nail” sign is shown. Note specifically the arrowed deletion of chromosome 4qter. (With thanks to Mr. A. Dunlop.)

1181 Chap03

3/29/07

6:33 PM

Page 45

Newly emerging concepts in syndromology relevant to audiology

Figure 3.6 Swallowing study of 4q–showing the aspiration from the pharynx into the trachea, which is often seen in children with this chromosomal abnormality and can lead to life-threatening consequences.

New clinical signs and associations are crystallised which are relevant to audiological physicians and surgeons It is difficult to conceive that the practice of medicine can, after all the generations of our antecedents, still throw up new clinical signs. Perhaps it is not so much the clinical sign itself, which is new, as the recognition of that sign as a marker for a specific genetic disease or syndrome. A case in point with particular relevance to the clinical examination of ears has come to light over the last few years and now bears the eponym Mowat– Wilson syndrome, after the pair of principal observers, Drs. David Mowat and Meredith Wilson. In 1998, Mowat et al. published a series of six children bearing a distinctive facial phenotype, in association with mental retardation, microcephaly, short stature, and, in four of the six, neonatal Hirschsprung’s disease (18). Severe constipation was present in all

45

six. Having established a deletion of chromosome 2q22–23 in one of these patients, the authors then proceeded to review the literature of clinical data from published cases with visible deletions in this region of chromosome 2q and felt there were strong facial resemblances between the features on the six cases under report and the case previously identified by Lurie et al. (19). Mowat et al. observed that following the recognition of the phenotype in the first two cases in their series, the next three cases were recognised within a six-month period. This phenomenon exemplifies the important learning process, which dysmorphologists often comment upon and call “getting your eye in”—essentially a learning period during which one recognises the phenotype and, having so done, recognises the pattern in future consultations with other patients. This learning stage is an important process in the emergence of any new dysmorphic syndrome. It also follows that if the original authors identified five patients within a few months that the syndrome must be a relatively common problem and these cases were unlikely to be unique cases. Subsequent events have shown that such is indeed the correct conclusion—a review by the original authors in 2003 recorded 45 cases from several continents (20). In the interim period between the publication of the original observations and the review, the genetic basis of the syndrome had been established as involving the ZFHX1B gene on chromosome 2q22q23. Some patients, as in the case reported by Lurie et al. (19) and the original observation by Mowat et al. (18), had large deletions encompassing this locus and surrounding regions, occasionally resulting in cytogenetic deletions visible down the microscope. Most patients however had intragenic mutations of ZFHX1B and the clue to undertaking this confirmatory test in these individuals lay in the phenotype. Reflecting on the fundamental facial features, Mowat et al. (20) drew attention to a prominent chin, hypertelorism, deepset eyes, a broad nasal bridge, saddle nose, prominent rounded nasal tip, posteriorly rotated ears, and large uplifted ear lobes. Commenting on the configuration of the ear lobes, which they described “as like orecchiette pasta or red blood corpuscles in shape, is a consistent and easily recognised feature.” (Figs. 3.7 and 3.8). The point that needs to be established is that a new syndrome has emerged, which is identifiable on the basis of clinical features and that the recognition of those clinical features is the key to directing investigation toward the ZFHX1B gene for mutation analysis. Perhaps the clinical sign itself is not new—indeed it is likely that this condition has always existed, but the relevance of the clinical signs and their specific causal association with ZFHX1B have only recently emerged. A similar phenomenon is beginning to emerge in relation to some cases of choanal atresia. Most cases of this malformation arise as isolated clinical findings and many patients are never investigated beyond a brief consideration of whether the choanal atresia may represent a presentation of CHARGE syndrome. Most cases arise as new events in the family and, if taken, the family history is unremarkable. One aspect of history, which is frequently not sought, is the history of the pregnancy,

1181 Chap03

46

3/29/07

6:33 PM

Page 46

Genetics and hearing impairment

Figure 3.7 The facial appearance of two children with Mowat–Wilson syndrome in infancy and childhood is shown. (Kindly reproduced from Ref. 20 by permission of the BMJ Publishing Group.)

1181 Chap03

3/29/07

6:33 PM

Page 47

Newly emerging concepts in syndromology relevant to audiology

47

Figure 3.10 Broad halluces seen in association with deafness in a case of Keipert syndrome. Source: From Ref. 24.

Figure 3.8 The characteristic ear appearance in Mowat–Wilson syndrome is shown. (Kindly reproduced from Ref. 20 by permission of the BMJ Publishig Group.)

and, in particular, a history of maternal medication. In fact, a trickle of cases since Greenberg first observed choanal atresia in the offspring of a woman exposed to carbimazole in pregnancy (21) have supported a likely causal effect for choanal

atresia in several cases of carbimazole exposure (22,23), which may be associated with oesophageal atresia, nipple aplasia or hypoplasia, and dysmorphic facial features in some instances (Fig. 3.9). As with the ear abnormalities in 2q deletion syndrome, choanal atresia related to the ingestion of carbimazole during pregnancy has long existed but the association has been overlooked by failure to take the history of the pregnancy. The lesson is that for cases of isolated choanal atresia, it is worth taking a detailed history of the pregnancy and looking carefully at the nipples of the baby. Often the diagnostic significance of a specific clinical sign can be obscured by lack of reports or failure to observe the sign in cases with the condition. It certainly seems that this observation is true in respect of Keipert syndrome, in which condition deafness is associated with broad thumbs and halluces (Fig. 3.10). Only a handful of reports have recognised this rare diagnosis, but the author is aware of at least three further cases, which have been brought to his attention following a report of a classical case (24). Apart from the broad thumbs, there was general reduction in the terminal phalanges on radiology with a large thumb epiphysis (Fig. 3.11). It is likely that there are many other cases of this syndrome currently unrecognised for want of clinical examination.

Molecular genetics of known syndromes informs clinical classification and explains some previous contradictions

Figure 3.9 Nipple hypoplasia in carbimazole exposure is demonstrated. Some children have had complete absence of nipple formation in association with choanal atresia in this teratogenic syndrome.

Antley–Bixler syndrome Antley–Bixler syndrome is a condition derived from the eponymous 1975 report of a patient with craniosynostosis, radiohumeral synostosis and femoral bowing (25). Over 30 subsequent cases have been described, sometimes as single events, often as sibships. In common with other children with severe craniosynostosis, many of these children have significant audiological problems, complicating a clinical profile, which already encompasses craniofacial, dental, orthopaedic and endocrine

1181 Chap03

48

3/29/07

6:33 PM

Page 48

Genetics and hearing impairment

Figure 3.11 Short terminal phalanges in Keipert syndrome. Note also the abnormally large epiphysis in the thumbs. Source: From Ref. 24.

elements. Genital abnormality is an inconstant element of the condition. However, the syndrome is very difficult to distinguish from two other clinical disorders: Pfeiffer syndrome with large joint synostosis, in which the genital malformations are absent, and fluconazole embryopathy. In the latter condition, mothers taking fluconazole have given birth to children with a clinical picture, which closely resembles Antley–Bixler syndrome and may be indistinguishable (26). The observation of clitoromegaly in a single case of Antley–Bixler syndrome led one group of authors to pursue this line of enquiry further. They observed abnormalities of steroid biogenesis in 7 out of 16 patients with a clinical presentation consistent with Antley–Bixler syndrome, finding mutations of the FGFR2 (fibroblast growth factor receptor 2) gene in a further seven cases. This led to the authors postulating that there were different forms of Antley–Bixler syndrome—those associated with steroid biogenesis abnormalities and those whose clinical phenotype might reflect FGFR mutation only (27). This suggestion has been developed further and mutations in cytochrome P450 oxidoreductase identified in children with disordered steroidogenesis, ambiguous genitalia, and Antley–Bixler syndrome, this condition segregating as an autosomal recessive disorder in contrast with the new dominant mutation of FGFR2, which gives a similar phenotype, but for the absence of genital ambiguity (28). Not only has the molecular genetics resolved the differences between the overlapping clinical phenotypes but it has also given an understandable reason for the genital ambiguity in some families, which was not apparent in the FGFR2related forms. Finally the fluconazole embryopathy phenotype can be readily understood in the context of considering the mode of action of that antifungal agent. Fluconazole acts through the cytochrome P450 enzyme C-14 ␣ demethylase, principally inhibiting the demethylation of lanosterol, the predominant sterol of the fungal cell wall. Although one of

the therapeutic advantages of fluconazole is the improved specificity it shows for the fungal cytochrome P450 enzyme complex, the embryopathy is likely to reflect relative adrenal insufficiency in infants who develop features of the embryopathy in mothers exposed to fluconazole during pregnancy. The identification of mutations in the POR gene consolidates this likely mechanism of action as the basis of the fluconazole embryopathy and the phenotypic overlap with FGFR2 mutation and POR mutation. Thus clinical observations, in this instance the identification of ambiguous genitalia in a single case, which can initially seem rather disparate, can be crucial to the ultimate understanding of the pathological spectrum in all its variations and the apparent contradictions can be elided. Pendred syndrome There are several other good examples of this in conditions, which are considered more “mainstream” with respect to deafness syndromology. If we look at Pendred syndrome, the classical diagnostic triad of deafness, goitre, and a positive perchlorate discharge test have been shown to be relatively poor identifiers of affected individuals. The substitution of radiological malformation in the form of Mondini malformation or dilatation of the vestibular aqueduct greatly enhances diagnosis and identification of affected individuals (29,30). Indeed, in clinical practice, the use of the perchlorate discharge test has largely been supplanted. Likewise the identification of mutations in the PDS gene on chromosome 7q has greatly added to the investigative tools available in recognising this syndrome in all its manifestations (31). Over 100 mutations of the gene are now known, though a small number are much more prevalent than others, some of which have only been observed on a single occasion. The deployment of these new forms of investigation has facilitated the resolution of diagnostic conundrums posed by particular interesting cases and families. For instance,

1181 Chap03

3/29/07

6:33 PM

Page 49

Newly emerging concepts in syndromology relevant to audiology

Gill et al. presented a case in which the proband had been dead for 35 years (32). The patient had been congenitally deaf and hypothyroid, the deafness having been assumed to be secondary to the hypothyroidism. Temporal bone sections had been stored and on review, 35 years later, a grossly dilated vestibular aqueduct was identified. An affected younger sibling was identified and investigated, revealing typical clinical and radiological findings of Pendred syndrome. The developmental delay in the index case was clearly attributable to the congenital hypothyroidism, a very rare complication in the profile of Pendred syndrome. Likewise there have been perplexing families reported, whose clinical conditions have been resolvable by molecular approaches. The best example of such is the Brazilian family recorded by Billerbeck et al. (33). Goitre associated with deafness and a positive perchlorate discharge test was observed in at least two affected individuals in the highly consanguineous pedigree under consideration. To complicate matters, the family emanated from a region of endemic goitre. The likely diagnosis of Pendred syndrome was offset by the observation of positive perchlorate test in the absence of hearing loss in other individuals in the pedigree, while others were recorded with deafness alone or goitre as a sole finding. The identification of mutations in the PDS gene facilitated the wider exploration of the underlying pathology in this confusing pedigree. It transpired that the index case, satisfying all typical diagnostic parameters for Pendred syndrome, did harbour a homozygous deletion in exon 3 of the gene, resulting in a frameshift and premature stop. An additional two individuals in the pedigree also shared this genotype, and thus had Pendred syndrome. However, several deaf individuals in the pedigree were not homozygous for the PDS mutation, suggesting a likely alternative autosomal recessive cause for deafness in these patients. Moreover six individuals in the family with goitre did not have PDS gene mutations and the likely cause for the goitre in these was the endemic iodine deficiency (34). Accordingly the clinical classification of this family has been established as comprising three distinct conditions—Pendred syndrome, goitre related to endemic iodine deficiency, and nonsyndromic deafness. Similar phenomena have been observed and formally established in another confusing family (35). Waardenburg syndrome Waardenburg syndrome and the various subtypes of this condition provide one of the most elegant examples of how good clinical observation, careful family studies, and integration of molecular data can powerfully combine to enhance understanding of clinical observations, which, initially at least, seemed to be at variance with received wisdom, ultimately resulting in the recognition of new disease processes. It is worth briefly reviewing the progress, which has been made relating to this group of disorders. The original observation of deafness with heterochromia irides, white forelock, and white skin patches dates from 1951 (36). Some 20 years later, it was the observations of Arias that

49

the dystopia canthorum segregated with deafness in some families but not in others, which led to the separation of type I (with dystopia) from type II (37). Subsequent reports were less amenable to classification: the observation by Shah et al. in 1981 of infants with Hirschsprung disease and white forelock, seemingly inherited in autosomal recessive manner (38) and the report from Klein in 1983 of a patient with features of Waardenburg syndrome type I associated with severe arm hypoplasia and arthrogryposis of the wrists and hands (39). Aided by careful attention to phenotype and, in particular, to dystopia canthorum, linkage studies on Waardenburg syndrome type I (WSI) led to identification of mutations in the PAX3 gene on chromosome 2 (40,41). Subsequent studies have established that almost all cases conforming to the WSI phenotype have mutations at this locus and there is no substantial evidence for genetic heterogeneity. However, deafness is a variable feature of the syndrome among WSI individuals, with Read and Newton citing a prevalence of 52% in their experience (42). This seems not to be related to the nature of the mutation and the exact cause of this variation in penetrance remains unclear. However, identification of mutations in PAX3 has considerably aided our understanding of clinically confusing situations outlined above. Klein–Waardenburg syndrome, also known as WSIII, has proven to be another phenotype of PAX3 mutation. In some instances, this is due to a contiguous gene deletion involving the PAX3 locus and adjacent regions of chromosome 2q35, but in others, intragenic mutations of PAX3 have been found, either in the homozygous or in the heterozygous state. A good example is the family reported by Woolnik et al. in which parents with WSI shared a mutation for PAX3, the offspring being homozygous for the mutation, Y90H, and having the WSIII phenotype (43). In mice, homozygosity of PAX3 mutations results in severe neural tube defects and lethality. Likewise a phenotype of exencephaly and severe contracture and webbing of the limbs in human kind has been speculated to be consistent with a severe PAX3 mutation in homozygous form (44). Indeed screening patients with neural tube defects for PAX3 mutation led to the identification of one patient with a myelomeningocele who, on close examination, was shown to have mild features of WSI, which were also seen to segregate with the mutation in several family members (45). Less predictable was the finding that craniofacial-deafness-hand syndrome is allelic to WSI, being caused by an exon 2 missense mutation in affected members of this unique family. The phenotype comprises autosomal-dominant deafness, with hypoplasia of the nasal bones, telecanthus, nasolacrimal duct absence/obstruction, ulnar deviation of the hands, and flexion contractures of the ulnar digits (46). Notably there are no features of pigmentary disturbance in this pedigree. The mutation in this family is a missense mutation, resulting in substitution of asparagine by lysine (N47K). However, alternative mutation of this asparagine residue to histidine in another family results in a more typical clinical outcome of WSIII in affected individuals. However, unlike the PAX3 mutations seen in homozygous form in some WSIII patients, this N47H mutation causes WSIII

1181 Chap03

50

3/29/07

6:33 PM

Page 50

Genetics and hearing impairment

in heterozygous form (47). More commonly however, the WSIII phenotype is seen as a consequence of compound heterozygosity for PAX3 mutation. The likely explanation for these seemingly contradictory observations lies in the effects of the mutation on the function of the PAX3 mutant protein. Indeed, there is evidence for this from the work of DeStefano et al. (48) who studied the relationship between mutation type and clinical sequelae in 271 WS individuals, representing 42 unique PAX3 mutations. Deletions of the homeodomain were most significantly correlated with significant clinical findings and were seen especially to correlate strongly with white forelock. In parallel with these emerging insights into the clinical phenotypes attributable to genetic mutation at the PAX3 locus, there has been considerable advance on the understanding of the genetic basis of WSII and related disorders. Mutations in the MITF gene on chromosome 3p have been established in several families conforming to the clinical definition of WSII. Other clinically interesting phenomena associated with mutation at this locus have also been observed. Deafness is more common as a clinical finding of WSII than is the case in WSI, being observed in approximately 80% of cases (42). However, the absence of pigmentary abnormalities in many patients, or the presence of such features in only very subtle form, does lead to difficulty in discrimination between WSII and patient with nonsyndromic deafness. Indeed Read has confirmed this clinical observation at molecular level with his observation that 10% of cases with a clinical diagnosis of WSII in fact have mutations at the Connexin 26 locus and do not have WSII at all (49). As often happens, once the molecular genetics of a syndrome become established, conditions, which had been considered to represent clinically distinct syndromes have been recognied as allelic forms, due to the identification of a mutation at the same locus. Tietz syndrome is a case in point. The syndrome dates from the 1963 report of Tietz of a family in which deafness segregated as a dominant trait over six generations but always in association with albinism. The irides were blue, with albinoid fundi, the hair being blond, and the skin very fair. MITF mutation was shown as the basis of this syndrome of albinism and deafness (50). Foremost among the clinical observations, which underlay this syndrome was the cosegregation of albinism and deafness in affected individuals as autosomal-dominant traits. Albinism is more often and classically observed as an autosomal recessive trait in clinical genetics. However, families were also known in whom WSII and ocular albinism existed but in which the pattern of cosegregation was not as clear-cut. This was known as the Waardenburg syndrome type II with ocular albinism (WSII-OA) phenotype. Such pedigrees are rare, but Morrell et al. studied one such pedigree, establishing an intragenic deletion within the MITF locus. Individuals with the OA phenotype were shown to have homozygosity or heterozygosity for the R402Q mutation in the tyrosinase gene, which functionally reduces the catalytic activity of the tyrosinase enzyme, in addition to the MITF mutation (51). These observations led the authors to

propose that the WSII-OA phenotype is consequent on digenic interaction between MITF and tyrosinase, a gene regulated by MITF. Not all cases of WSII phenotype have mutation of the MITF locus. Indeed, online mendelian inheritance in man (OMIM) currently lists four loci for WSII, respectively, termed WSIIA-D. However, only the MITF locus is confirmed and to date, this represents the sole locus for WSII at which mutations have been established, which result in the WSII phenotype. MITF is a key activator for tyrosinase, a major enzyme in melanogenesis and critical for melanocyte differentiation. PAX3 transactivates the MITF promoter and is assisted in doing so by another gene SOX10. Not surprisingly, this latter is also an important gene in WS phenotypes and specifically in the WS4 clinical spectrum. The term WS4 relates, as outlined above, to the observations of Hirschsprung disease in association with other phenotypic characteristics of WS. In a study of a large Mennonite family, many of whose members had Hirschsprung disease, sometimes associated with low-grade features of WS (white forelock in 7.6% of cases), Puffenberger et al. identified a causative mutation in the endothelin receptor B gene (EDNRB) on chromosome 13 (52). This was an interesting mutation, which showed dosage sensitivity. Homozygotes have a 74% chance of showing Hirschsprung disease against a 21% chance in heterozygotes. This was a seminal finding, leading not only to the identification of a genetic basis for many cases of nonsyndromic Hirschsprung disease, but also to mutation of the EDNRB locus in families conforming to the Waardenburg-Shah phenotype (WS4) (53) as well as the recognition of an allelic condition, albinism, black lock, cell migration disorder of the neurocytes of the gut, and deafness (ABCD) syndrome (54). The latter refers to a child with deafness, albinism, a black lock in the right temporo-occipital region, and spots of retinal depigmentation, in whom severe intestinal innervation defects were established. These clinical findings were causally attributed to homozygosity for a C to T transition in the EDNRB gene resulting in a stop codon with no production of normal protein possible. Prompted by these observations and encouraged by the knowledge that mutation of the endothelin 3 gene in mouse results in a phenotype similar to WS4, Edery et al. searched for and reported mutations of the EDN3 gene in patients with Waardenburg-Shah syndrome (55). Subsequently mutations at this same locus have been found in other cases of WS4 but also in isolated cases of Hirschsprung disease and even in a patient with Hirschsprung disease associated with central hypoventilation syndrome. It is now known that EDNRB has a strictly defined role in governing migration of the precursor cells of the enteric nervous system into the colon. Binding sites for SOX10 enhance the migration of these enteric nervous system cells. Not surprisingly, then, the SOX10 gene, on chromosome 22q13, is also associated with WS phenotypes. Specifically several patients with WS4 phenotype have been described due to mutation at this locus. Moreover, a patient thought to have

1181 Chap03

3/29/07

6:33 PM

Page 51

Newly emerging concepts in syndromology relevant to audiology

a separate condition, Yemenite deaf–blind hypopigmentation syndrome, was also reported with SOX10 mutation (56). Likewise, SOX10 mutations have been recorded in patients with pigmentary disturbance and deafness suggestive of WS but in whom rectal biopsy is normal. Nonetheless, the patients have persistent bowel symptoms suggestive of bowel obstruction. This establishes that aganglionosis is not the only mechanism associated with intestinal dysfunction in SOX10 mutation (57). Other clinically important phenomena have been observed in the spectrum of SOX10-associated disease. Donnai presented details of an adult deaf female with raindrop pigmentation of the skin, in whom a SOX10 mutation was established (58). A further set of patients was identified with WS4 features associated with a peripheral neuropathy and/or central hypomyelinating neuropathy associated with SOX10 mutation (57,59). This neurological variant is now known as peripheral demyelinating neuropathy, central demyelinating leukodystrophy, Waardenburg syndrome, and Hirschsprung disease (PCWH), and recent work has established that this more severe phenotype occurs because truncated, mutant SOX10 proteins with potent dominant negative activity escape the nonsense medicated decay pathway (60). To summarise, mutations at five distinct loci, PAX3, MITF, EDNRB, EDN3, and SOX10, have been described in association with Waardenburg syndrome phenotypes. However, careful attention to clinical examination and investigation in these patient groups has contributed enormously to an enhanced understanding of the molecular mechanisms, the mutational spectrum, and the embryological events, which underlie the differing presentations of Waardenburg syndrome.

Phenotypic studies of syndromes with an already established genetic basis enhances clinical data, patient management and drives further research The cloning of a gene and the establishment of causative mutations at that locus for various phenotypes are sometimes seen as an end in itself. To researchers engaged on such research, this does represent a momentous milestone. However, to clinicians, families with the condition and those charged with delivery of medical services to such patients and families, the identification of mutations does not usually change patient care other than by facilitating identification of others in the kindred who themselves have inherited the mutation and might benefit from specific screening measures for covert disease. What the identification of mutations underlying a specific syndrome does allow is more detailed phenotypic studies of that condition and encourage the clinical “teasing out” of clinically overlapping conditions, so that it can become clearly established as to what particular pathology applies in an individual patient or family. A good example of this is provided by the dilated vestibular aqueduct syndrome (Fig. 3.12). Dilatation of the vestibular aqueduct has been known since 1978. Several series of deaf patients with this radiological phenomenon had been published,

51

Figure 3.12 Dilatation of the vestibular aqueduct is shown in a typical case of Pendred syndrome. Source: From Ref. 29.

resulting in over 200 cases being identified and reported in radiological and ENT literatures. It appears that none of these patients had been recognised as having an underlying genetic syndrome and indeed it is never addressed in any of these publications as to whether any of the patients included in the various series were related. Phelps recognised that almost all cases of Pendred syndrome manifest dilatation of the vestibular aqueduct (30,61) and there has since been a mushrooming of interest in this radiological marker of deafness. This interest in investigating deaf patients more systematically and in seeking to identify the precise basis of the deafness has established that dilatation of the vestibular aqueduct is not confined to Pendred syndrome. Indeed, it is not at all surprising, considering the shared pathology of ion transporter defects seen in both conditions, that renal tubular acidosis and deafness, a distinct autosomal recessive condition, should share this characteristic with Pendred syndrome (62). There are now suggestions that there may be a genetically distinct autosomal recessive syndrome of dilatation of the vestibular aqueduct and deafness separate from Pendred syndrome and for which the locus remains to be established (63). Such claims, whether they will be validated in time or not, are only possible because of detailed phenotypic work, which has continued following the identification of the genetic basis of Pendred syndrome and the incorporation of such mutational studies into clinical practice. The best estimate currently available is that Pendred syndrome mutation accounts for about 86% of cases of vestibular aqueduct dilatation (29). Likewise with respect to branchio-oto-renal (BOR) syndrome, the cloning and identification of mutation at the EYA1 gene has shown that there are other clinically overlapping phenotypes, which are not due to mutation at this locus. Among families, comprising the majority, which do owe their clinical phenotype to EYA1 mutation, there has been enhanced

1181 Chap03

52

3/29/07

6:33 PM

Page 52

Genetics and hearing impairment

incorporation of genetic data into patient care and management. Chang et al. have furnished their data incorporating 40 families with 33 distinct mutations segregating and have identified the major features as deafness in 98.5%, preauricular pits in 83.6%, branchial anomalies in 68.5%, and renal anomalies in 38.2% (64). However, other phenotypes have also been associated with mutation at this locus, including cataract and anterior ocular defects (65), Otofaciocervical syndrome (66) and a contiguous gene deletion syndrome, which is clinically characterised by BOR syndrome but with additional clinical features of Duane eye retraction syndrome, hydrocephalus, and aplasia of the trapezius muscle (67). In addition to these allelic diseases emerging from BOR-related studies, there has also been clarification of those families whose clinical phenotype appears to suggest a likely diagnosis of BOR but for whom mutation at EYA1 was not established and linkage data suggested that the disease phenotype was a function of mutation at another locus. A good example of this is provided by the large kindred forming the basis of the report of another BOR locus on chromosome 14q (68). This pedigree, comprising over 40 affected individuals, differs from the classical BOR syndrome profile in that only approximately 25% had branchial arch-related defects, the age of onset of deafness was much later and more variable than is generally seen in EYA1-related deafness, and no renal malformations or anomalies are reported in the clinical data furnished on the family. Purists might argue with the nosology of the syndrome as BOR3, but it is difficult to argue against this in light of the clinical finding of branchial defects in 25% of affected individuals. The mutational basis of this, to date unique, family remains unresolved at this time, but it is worth noting that other “nonsyndromic deafness” loci map to the same region on linkage (DFNA23 and DFNB35). The designation BOR2 has been given to another hitherto unique dominant pedigree mapping to chromosome 1q (69). Such a designation is certainly more contentious as the family had always been considered clinically distinct from BOR by the absence of cervical fistulae, renal anomalies, and the presence of lip pits. However, there is no doubt that this pedigree represents another form of autosomaldominant deafness associated with preauricular sinuses. BOR syndrome also represents an example of how learning that a member of a specific gene family can cause a particular phenotype extends the opportunities for establishing molecular pathology in clinically related situations. EYA1 is one of four related human loci, and mutations at another of the genes in this family, EYA4, have been reported in deafness of autosomaldominant nonsyndromic type (70).

References 1. Aase JM. Diagnostic Dysmorphology. Plenum Medical Book Company. New York, 1990. 2. Knight SJL, Flint J. Perfect endings: a review of subtelomeric probes and their use in clinical diagnosis. J Med Genet 2000; 37: 401–409.

3. Flint J, Knight S. The use of telomere probes to investigate submicroscopic rearrangements associated with mental retardation. Curr Opin Genet Dev 2003; 13:310–316. 4. Hall BD. Choanal atresia and associated multiple anomalies. J Pediatr 1979; 95:395–398. 5. Hittner HM, Hirsch NJ, Kreh GM, Rudolph AJ. Colobomatous microphthalmia, heart disease, hearing loss and mental retardation: a syndrome. J Pediatr Ophthalmol Strabismus 1979; 16: 122–128. 6. Pagon RA, Graham JM, Zonana J, Young SL. Congenital heart disease and choanal atresia with multiple anomalies. J Pediatr 1981; 99:223–227. 7. Graham JM Jr. A recognizable syndrome within CHARGE association: Hall-Hittner syndrome. Am J Med Genet 2001; 99: 120–123. 8. Amiel J, Attie-Bitach T, Cormier-Daire V, et al. Temporal bone anomaly proposed as a major criteria for diagnosis of CHARGE syndrome. Am J Med Genet 2001; 99:124–127. 9. Tellier AL, Cormier-Daire V, Abadie V, et al. CHARGE syndrome: report of 47 cases and review. Am J Med Genet 1998; 76: 402–409. 10. Hurst JA, Meinecke P, Baraitser M. Balanced t(6;8)(6p8p;6q8q) and the CHARGE association J Med Genet 1991; 28:54–55. 11. Vissers LELM, van Ravenswaaij CMA, Admiraal R, et al. Mutations in a new member of the chromodomain gene family cause CHARGE syndrome. Nat Genet 2004; 36:955–957. 12. de Lonlay-Debeney P, Cormier-Daire V, Amiel J, et al. Features of DiGeorge syndrome and CHARGE association in five patients. J Med Genet 1997; 34:986–989. 13. Shapira S, McCaskill C, Northrup H, et al. Chromosome 1p36 deletions: the clinical phenotype and molecular characterization of a common newly delineated syndrome. Am J Hum Genet 1997; 61:642–650. 14. Slavotinek A, Shaffer LG, Shapira SK. Monosomy 1p36. J Med Genet 1999; 36:657–663. 15. Heilstedt HA, Wu YQ, May K, et al. Bilateral high frequency hearing loss is commonly found in patients with the 1p36 deletion syndrome. Am J Hum Genet Suppl 1998; 63:A106. 16. Lin AE, Garver KL, Diggans G, et al. Interstitial and terminal deletions of the long arm of Chromosome 4: further delineation of phenotypes. Am J Med Genet 1988; 31:533–548. 17. Flannery DB. Tale of A Nail; Proceedings of the Greenwood Genetics Center. 1993; 12:90. 18. Mowat DR, Croaker GDH, Cass DT, et al. Hirschsprung Disease, microcephaly, mental retardation, and characteristic facial features: delineation of a new syndrome and identification of a locus at chromosome 2q22-q23. J Med Genet 1998; 35:617–623. 19. Lurie IW, Supovitz KR, Rosenblum-Vos LS, Wulfsberg EA. Phenotypic variability of del (2)(q22-q23): report of a case and review of the literature. Genet Couns 1994; 5:11–14. 20. Mowat DR, Wilson MJ, Goossens M. Mowat-Wilson syndrome. J Med Genet 2003; 40:305–310. 21. Greenberg F. Choanal atresia and athelia: methimazole teratogenicity or a new syndrome? Am J Med Genet 1987; 28:931–934. 22. Myers AK, Reardon W. Choanal atresia—a recurrent feature of Fetal Carbimazole syndrome. Clin Otolaryngol 2005; 30:375–377.

1181 Chap03

3/29/07

6:33 PM

Page 53

Newly emerging concepts in syndromology relevant to audiology

23. Lam WWK, Keng WT, Metcalfe K, et al. Fetal Carbimazole— characteristic facial features. 11th Manchester Birth Defects Conference. Manchester, 2004. 24. Reardon W, Hall CM. Broad thumbs and halluces with deafness: a patient with Keipert syndrome. Am J Med Genet 2003; 118A: 86–89. 25. Antley RM, Bixler D. Trapezoidocephaly, midfacial hypoplasia and cartilage abnormalities with multiple synostoses and skeletal fractures. Birth Defects 1975; XI:397–401. 26. Aleck KA, Bartley DL. Multiple malformation syndrome following Fluconazole use during pregnancy: report of an additional patient. Am J Med Genet 1997; 72:253–256. 27. Reardon W, Smith A, Honour JW, et al. Evidence for digenic inheritance in some cases of Antley-Bixler syndrome? J Med Genet 2000; 37:26–32. 28. Flück CE, Tajima T, Pandey AV, et al. Mutant P450 oxidoreductase causes disordered steroidogenesis with and without AntleyBixler syndrome. Nat Genet 2004; 36:228–230. 29. Reardon WO, Mahoney CF, Trembath R, Jan H, Phelps PD. Enlarged vestibular aqueduct: a radiological marker of Pendred syndrome and mutation of the PDS gene. Quart J Med 2000; 93:99–104. 30. Phelps PD, Coffey RA, Trembath RC, et al. Radiological malformations of the ear in Pendred Syndrome. Clin Radiol 1998; 53:268–273. 31. Everett LA, Glaser B, Beck JC, et al. Pendred syndrome is caused by mutations in a putative sulphate transporter gene. Nat Genet 1997; 17:411–422. 32. Gill H, Michaels L, Phelps PD, Reardon W. Histopathological findings suggest the diagnosis in an atypical case of Pendred syndrome. Clin Otolaryngol 1999; 24:523–526. 33. Billerbeck AEC, Cavaviere H, Goldberg AC, Kalil J, MedeirosNeto G. Clinical and genetic studies in Pendred syndrome. Thyroid 1994; 4:279–284. 34. Kopp P, Arseven OK, Sabacan L, et al. Phenocopies for deafness and goiter development in a large inbred Brazilian kindred with Pendred’s syndrome associated with a novel mutation in the PDS gene. J Clin Endocrinol Metab 1999; 84:336–341. 35. Vaidya B, Coffey R, Coyle B, et al. Concurrence of Pendred syndrome, autoimmune thyroiditis and simple goiter in one family. J Clin Endocrinol Metab 1999; 84:2736–2738. 36. Waardenburg PJ. A new syndrome combining developmental anomalies of the eyelids, eyebrows, and nose root with pigmentary defects of the head hair and with congenital deafness. Am J Hum Genet 1951; 3:195–250. 37. Arias S. Genetic heterogeneity in the Waardenburg syndrome. Birth Defects Original Article Series 1971; 7:87–101. 38. Shah KN, Dalal SJ, Sheth PN, Joshi NC, Ambani LM. White forelock, pigmentary disorder of the irides and long segment Hirschsprung disease: possible variant of Waardenburg syndrome. J Pediatr 1981; 99:432–435. 39. Klein D. Historical background and evidence for dominant inheritance of the Klein-Waardenburg syndrome (type III). Am J Med Genet 1983; 14:231–239.

53

40. Tassabehji M, Read AP, Newton V, et al. Waardenburg syndrome patients have mutations in the human homologue of the Pax-3 paired box gene. Nature 1992; 355:635–636. 41. Baldwin CT, Hoth CF, Amos JA, da-Silva EO, Milunsky. An exonic mutation in the HuP2 paired domain gene causes Waardenburg’s syndrome. Nature 1992; 355:637–638. 42. Read AP, Newton V. Waardenburg syndrome. In: Martini, Read, Stephens, eds. Genetics and Hearing Impairment. London Whurr, 1996. 43. Woolnik B, Tukel T, Uyguner O, et al. Homozygous and heterozygous inheritance of PAX3 mutations causes different types of Waardenburg syndrome. Am J Med Genet 2003; 122A:42–45. 44. Ayme S, Philip N. Possible homozygous Waardenburg syndrome in a fetus with exencephaly. J Med Genet 1995; 59:263–265. 45. Hol FA, Hamel BCJ, Geurds MPA, et al. A frameshift mutation in the gene for PAX3 in a girl with spina bifida and mild signs of Waardenburg syndrome. J Med Genet 1995; 32:52–56. 46. Sommer A, Bartholomew DW. Craniofacial-Deafness-Hand Syndrome Revisited. Am J Med Genet 2003; 123A:91–94. 47. Hoth CF, Milunsky A, Lipsky N, et al. Mutations in the paired domain of the human PAX3 gene cause Klein-Waardenburg syndrome (WS-III) as well as Waardenburg syndrome type I (WS-I). Am J Hum Genet 1993; 52:455–462. 48. DeStefano AL, Couples LA, Arnos KS, et al. Correlation between Waardenburg syndrome phenotype and genotype in a population of individuals with identified PAX3 mutations. Hum Genet 1998; 102:499–506. 49. Read AP. Genes Hearing and Deafness—from Molecular Biology to Clinical Practice. Caserta, Italy, 2005. 50. Amiel J, Watkin PM, Tassabehji M, Read AP, Winter RM. Mutation of the MITF gene in albinism-deafness syndrome (Tietz syndrome). Clin Dysmorph 1998; 7:17–20. 51. Morell R, Spritz RA, Ho L, et al. Apparent digenic inheritance of Waardenburg syndrome type 2 (WS2) and autosomal recessive ocular albinism (AROA). Hum Mol Genet 1997; 6:659–664. 52. Puffenberger EG, Hosoda K, Washington SS, et al. A missense mutation of the endothelin-B receptor gene in multigenic Hirschsprung’s disease. Cell 1994; 79:1257–1266. 53. Syrris P, Carter ND, Patton MA. Novel missense mutation of the endothelin-B receptor gene in a family with WaardenburgHirschsprung disease. Am J Med Genet 1999; 87:69–71. 54. Verheij JBG, Kunze J, Osinga JC, van Essen AJ, Hofstra RMW. ABCD syndrome is caused by a homozygous mutation in the EDNRB gene. Am J Med Genet 2002; 108:223–225. 55. Edery P, Attie T, Amiel J, et al. Mutation of the endothelin-3 gene in the Waardenburg-Hirschsprung disease (Shah-Waardenburg syndrome). Nat Genet 1996; 12:442–444. 56. Bondurand N, Kuhlbrodt K, Pingault V, et al. A molecular analysis of the Yemenite deaf-blind hypopigmentation syndrome: SOX10 dysfunction causes different neurocristopathies. Hum Mol Genet 1999; 8:1785–1789. 57. Pingault V, Guiochon-Mantel A, Bondurand N, et al. Peripheral neuropathy with hypomyelination, chronic intestinal pseudoobstruction and deafness: a developmental “neural-crest syndrome” related to a SOX10 mutation. Ann Neurol 2000; 48:671–676.

1181 Chap03

54

3/29/07

6:33 PM

Page 54

Genetics and hearing impairment

58. Donnai D. The Carter Lecture. British Society of Human Genetics. York, September 2004. 59. Inoue K, Tanabe Y, Lupski J. Myelin deficiencies in both the central and the peripheral nervous systems associated with a SOX10 mutation. Ann Neurol 1999; 46:313–318. 60. Inoue K, Khajavi M, Ohyama T, et al. Molecular mechanism for distinct neurological phenotypes conveyed by allelic truncating mutations. Nat Genet 2004; 36:361–369. 61. Phelps PD. Large vestibular aqueduct: large endolymphatic sac? J Laryngol Otol 1996; 110:1103–1104. 62. Berrettini S, Neri E, Forli F, et al. Large vestibular aqueduct in distal renal tubular acidosis. High-resolution MR in three cases. Acta Radiol 2001; 42:320–322. 63. Pryor SP, Madeo AC, Reynolds JC, et al. SLC26A4/PDS genotype-phenotype correlation in hearing loss with enlargement of the vestibular aqueduct (EVA): evidence that Pendred syndrome and non-syndromic EVA are distinct clinical and genetic entities J Med Genet 2005; 42:159–165. 64. Chang EH, Mebezes M, Meyer NC, et al. Branchio-Oto-Renal Syndrome: the mutation spectrum in EYA1 and its phenotypic consequences. Hum Mutat 2004; 23:582–589. 65. Azuma N, Hirakiyama A, Inoue T, Asaka A, Yamada M. Mutations of a human homologue of the Drosophila eyes absent

66.

67.

68. 69.

70.

gene (EYA1) detected in patients with congenital cataracts and ocular anterior segment anomalies. Hum Mol Genet 2000; 9:363–366. Rickard S, Parker M, van’t Hoff W, et al. Oto-facial-cervical (OFC) syndrome is a contiguous gene deletion syndrome involving EYA1: molecular analysis confirms allelism with BOR syndrome and further narrows the Duane syndrome critical region to 1 cM. Hum Genet 2001; 108:398–403. Vincent C, Kalatzis V, Compain S, et al. A proposed new contiguous gene syndrome on 8q consists of branchio-oto-renal (BOR) syndrome, Duane syndrome, a dominant form of hydrocephalus and trapeze aplasia; implications for the mapping of the BOR gene. Hum Mol Genet 1994; 3:1859–1866. Ruf RG, Berkman J, Wolf MTF, et al. A gene locus for branchio-otic syndrome maps to 14q21.3–24.3. J Med Genet 2003; 40:515–519. Kumar S, Deffenbacher K, Marres HAM, Cremers CWRJ, Kimberling WJ. Genome-wide search and genetic localization of a second gene associated with autosomal dominant branchio-oto-renal syndrome: clinical and genetic implications. Am J Hum Genet 2000; 66:1715–1720. Wayne S, Robertson NG, DeClau F, et al. Mutations in the transcriptional activator EYA4 cause late-onset deafness at the DFNA10 locus. Hum Mol Genet 2001; 10:195–200.

1181 Chap04

3/29/07

4:41 PM

Page 55

4 Deaf blindness Claes Möller

Introduction Deafblindness comprises a number of heterogeneous hearing and vision disorders. These disorders can be caused by trauma, diseases, and different genetic syndromes. The two senses hearing and vision are the primary communication tools for humans; their action is complementary and they enhance each other. To be fast and reliable, communication between humans relies on vision and hearing. Since communication is derived from the Latin word “communicare,” which means to do things together, it is obvious that a loss of these two senses can be catastrophic. For example, in noisy environments where it is difficult to hear, visual input such as body language and expressions can supplement our understanding. Likewise, when vision is poor, hearing plays a major role in the localisation of sounds and detection of danger etc. The definition deafblindness comprises many different forms of impairments. A person with deafblindness can be profoundly deaf and completely blind, completely deaf with visual impairment, completely blind with hearing impairment, or have a hearing and vision dysfunction. As mentioned before, vision and hearing interact, thus deafblindness is 1 ⫹ 1 ⫽ 3. A widely used definition is by the Northern European committee on disability who in 1980 stated as follows: A person is deafblind when he/she has a severe degree of combined visual and auditory impairment. Some deafblind people are totally deaf and blind, whereas others have residual hearing and residual vision. Another categorisation of deafblindness is to discuss these disorders as either congenital or acquired deafblindness.

Congenital deafblindness Congenital deafblindness is extremely rare: about 1 in 10,000 newborn babies is affected. Causes of congenital deafblindness include genetic syndromes, premature birth, infections, etc. Subjects with complete congenital deafblindness very often

have other dysfunctions such as mental retardation, cerebral palsy, etc. Due to the lack of vision and hearing, the subject has to rely on sensory influx from smell, taste, and touch. This also gives a severe risk of sensory deprivation, which might enhance a mild mental retardation. Subjects with congenital deafblindness need an environment with extremely good professional communication skills. The communication training is lifelong and relies heavily on tactile sign language and input via the remaining senses—touches, smell, and taste. When working with persons with congenital deafblindness, the goals have so far been to open new channels for communication. During the previous years, very promising achievements have been made through the advent of cochlear implants (CI). If a child with congenital deafblindness does not have severe brain damage, early cochlear implantation might result in hearing and even in speech. In other syndromes associated with additional brain damage, the goal of CI is simply to create sound awareness and basic recognition of sounds. Thus, in the future, CI will probably dramatically change communication skills for many persons with congenital deafblindness. Similar vision implants have not yet proved to be successful but ongoing research will probably result in similar achievements. Today (2006), at least 20 different genetic syndromes are known to cause congenital deafblindness. In some of these, the genes have been identified and cloned. Because of the rarity of these genetic conditions and difficulties in assessment, congenital deafblindness can sometimes be missed and hidden due to other dysfunctions and, thus, attributed to other conditions.

Acquired deafblindness As in congenital deafblindness, there are many causes of acquired deafblindness. The prevalence of acquired deafblindness is hard to estimate, in part depending on the definition. Usually only young and middle-aged people are included and most of the syndromes known today have clinical features present from childhood or young adulthood. It should be noted, however, that in

1181 Chap04

56

3/29/07

4:41 PM

Page 56

Genetics and hearing impairment

old people, a severe hearing loss as well as a severe visual loss caused by conditions such as cataracts, macular degeneration, and age-related hearing loss will create a severe communication problem. Thus, age-related deafblindness is not caused by syndromes but will result in the same impairment, which if not compensated, will increase dementia and other disorders. Today (2006), more than 50 hereditary syndromes are known to cause acquired deafblindness. Out of those, at present, in around 40 different syndromes, the gene has been localised and in quite a few, the gene has been identified. Many of these syndromes have proven to be heterogeneous with many different genes causing the same or similar phenotypes (1).

Some deafblind syndromes The following syndromes are described in more detail below: ■ ■ ■ ■ ■ ■

Usher syndrome (US) Alström syndrome Norrie disease Mohr–Tranebjaerg syndrome Wolfram syndrome Refsum syndrome

Usher syndrome The three clinical features of US are retinitis pigmentosa (RP), hearing loss/deafness, and vestibular dysfunction/areflexia. US is an autosomal recessive disorder. The prevalence of US differs in different countries but approximately 50% of all people affected with deafblindness have US (2). The disease was first described by Albrecht von Graefe in 1858 with the occurrence of RP and congenital deafness in three brothers. The next to describe the disease was Charles Usher in 1914. He described deafness and RP in several families in England. Another historic landmark was the recognition by Julia Bell in 1933 of the hearing loss variation in US (3). Retinitis pigmentosa RP is a description of several different disorders of the retina. The disease in the retina is degeneration. A hallmark for RP is “bones spicules,” which are caused by release of pigment from the pigment epithelium, forming black spots in the retina. The degeneration starts in the rods, and the cones are affected later. This will give rise to different symptoms such as glare sensitivity, night blindness, and progressive reduction of the visual field. RP is present in many heterogeneous disorders, and it can be inherited in autosomal dominant, or recessive as well as sex-linked patterns. A large number of genes causing RP have been identified. Classification Classification of US can be made from the phenotype or the genotype. The clinical classification is at present based on three

Table 4.1 The genetic subtypes of Usher syndrome Type

Chromosome

Gene

Usher IB

11q13.5

MYO7A

Usher IC

11p15.1

USH1C

Usher ID

10q22.1

CDH23

Usher IE

21q21

Unknown

Usher IF

10q21-22

PCDH15

Usher IG

17q24-25

SANS

Usher IIA

1q41

Usherin

Usher IIB

3p23-24.2

Unknown

Usher IIC

5q14.3-q21.3

VLGR1

Usher III

3q25

Clarin

clinical subtypes I, II, and III (4). Table 4.1 shows the current classification of US based on molecular genetic studies (5). (Note that Usher 1A (6) is no longer valid since the families were later found to have mutations in MY07A.) US type I Hearing: The hearing loss is congenital, profound bilateral deafness. The audiogram might sometimes show a little residual hearing at low frequencies (corner audiogram). The profound deafness does not allow development of speech. The habilitation of children with type I US has dramatically changed during recent years with the introduction of CI. If implantation is made early in life (before two years of age), the results are excellent and will result in hearing and spoken language as well as benefiting sound localisation later in life when vision deteriorates. Vision: The degeneration is progressive, bilateral, and symmetrical. The degeneration starts in the periphery. The initial symptoms are glare sensitivity, night blindness, and, later, constricted visual fields. The first visual symptoms can be observed in early childhood. The child is insecure in darkness, clumsy, etc. The fundus changes are seen rather late, thus the first reliable diagnostic tool is electroretinography (ERG). This can show changes as early as in the first or second year of life. The progress of RP in type I is slow and most persons will have central vision with approximately 5° visual field at the age of 50 to 60 years. The RP is often complicated by cataracts (80%). Balance: Subjects with type I have bilateral vestibular areflexia (deaf in the vestibular-balance organs). This is a hallmark of type I and the clinical symptoms are late motor milestones, late walking age (⬎18 months), and clumsiness, especially in darkness. The bilateral vestibular areflexia, which will cause the late walking age, is the first obvious symptom of a possible US. This is easily assessed in small children by using video-Frenzel

1181 Chap04

3/29/07

4:41 PM

Page 57

Deafblindness

during rotation. Thus screening for vestibular deficiency in deaf and hearing-impaired children, and a finding of a bilateral vestibular areflexia, will in approximately 30% to 40% of these children result in a diagnosis of US (2). So far, six different genetic loci have been identified for Type I US (Table 4.1). ■

■

■

■

■

■

Usher type Ib: This common form of Usher type I has been linked to chromosome 11q13.5 and is caused by mutation of the myosin VIIa (MYO7A) gene. This protein is believed to act on the cytoplasmic actin filaments (7). A mouse model (shaker-1) has been found for Usher type Ib. The mouse is deaf and has vestibular areflexia but no RP (8). The gene is expressed in many organs. The MYO7A gene is large and at present (2005) more than 80 different mutations have been reported. Usher type Ic: The gene is linked to chromosome 11p14-p15.1 and was first described in the French Acadian population of Louisiana, U.S.A. (9). The gene product is named Harmonin and is suggested to play a role in transmission of nerve impulses. The exact function of Harmonin is not yet fully understood. Usher type Id: This condition is linked to chromosome 10q and is caused by mutations in the Cadherin (CDH23) gene (10). A mouse model for Usher type Id, called the Waltzer mouse, exists. In this mouse, the stereocilia and the kinocilium are disrupted (11). Usher type Ie: The locus has been linked to chromosome 21q21. The gene is not yet identified. Only one family from Morocco has been found (12). Usher type If: This form is linked to chromosome 10q21 and has been found in a few families. The protein is related to otocadherin and the gene is expressed both in the retina and in the inner ear. The gene has now been named Protocadherin 15 (PCDH15) and it seems to be necessary for development of the neurological system. A mouse model of Usher type If has been created, which is called the Ames Waltzer mouse (13). Usher type Ig: This form is linked to chromosome 17q24-25 and has been found in two different families. Mutations are found in the SANS gene, which is involved in a functional network together with harmonin, cadherin 23, and myosin VIIa (14). Thus, the genes of Usher type I seems to interact with each other and in the future new research will probably reveal a close interaction between these genes and maybe between genes causing type II and III condition as well. Today it is believed that Usher type Ib and Usher type Id are the most common genotypes.

US type II Hearing: The first symptom in US type II is a congenital or extremely early–acquired sensorineural hearing loss. The hearing loss is bilateral, symmetrical, and moderate to severe. The audiogram is down sloping with a mild-to-moderate loss at lower frequencies and a severe-to-profound loss at higher frequencies. The hearing loss is in most cases stable but a

57

mild progression can be seen from the fourth decade. The hearing benefits from bilateral hearing aid amplification as early as possible. Vision: The visual problems are similar to those in Type I. The course of RP (progression of visual acuity loss and visual field loss) might be milder in Usher type II compared with Usher type I (15). Balance: vestibular function is normal. So far, three different genetic loci have been found with mutations (Table 4.1). ■

■

■

US type IIa: This is the most common form. It has been linked to chromosome 1q and the mutation 2299delG is the single most common form of mutation (16). The mutations are found in a gene named Usherin, which codes for a novel protein in the extracellular matrix and in cell-surface receptors. Usherin is found in many organs. Its exact function is still unclear. US type IIa seems to account for more than 70% of all subjects with Usher type II (17). Genetic testing is available on a clinical basis. US type IIb: This form is linked to chromosome 3p23-24.2 and has been localised in one family. The gene is not known (18). US type IIc: Type IIc has been linked to chromosome 5q14 and has so far been reported in four families. The gene is named VLGR1; the protein is still unknown (19,20).

US type III Hearing: Patients affected with type III have a congenital or early bilateral sensorineural hearing loss. It differs from type II in one important respect: The progression of hearing loss is rapid and results in acquired profound deafness at the age of 30 to 40 years (21). Vision: The progression of RP can so far not be separated from the clinical picture found in type I and type II (21). Balance: The vestibular function is, in most cases, normal during childhood but might progress similar to the hearing loss (21). The prevalence of type III is low in the United States and in Europe except for Finland. In Finland, a founder effect is known and type III accounts for nearly 40% of all Finnish Usher affected (22). At present, one gene has been linked to chromosome 3q25. So far, nine mutations have been identified in US type III (23). Prevalence of US The prevalence of US in different parts of the world is not very well known. One large epidemiological prevalence study from Sweden has confirmed a prevalence rate of type I, 1.6/100,000, type II, 1.4/100,000, and type III, 0.3/100,000. These prevalence figures are likely to be underestimates due to the late age at which US is diagnosed. The prevalence of type I is significantly higher in the northern parts of Sweden, which indicates a founder effect (24). Very few other studies are representative for a larger geographic area.

1181 Chap04

58

3/29/07

4:41 PM

Page 58

Genetics and hearing impairment

New and ongoing studies (2005) have indicated that there are genotype–phenotype correlations with differences between different types. The current genotype and phenotype knowledge of US will probably in the near future produce new insights and thus hopefully new possibilities for treatment and eventually cure. Treatment modalities could be antioxidants, growth hormone factors, or gene or stem cell therapy.

Alström syndrome Alström syndrome is a rare autosomal recessively inherited disorder, which affects many organs. Approximately 300 subjects are known today but many new cases are being added as the disorder is better characterised. The disease was first described in 1959 by the Swedish doctor Carl Henry Alström (25). It is characterised by multiple organ system involvements, with much heterogeneity. Features include RP, sensorineural hearing loss, cardiomyopathy, obesity, diabetes mellitus type 2, increased serum lipids, other endocrine disturbances, liver dysfunction, pulmonary symptoms, and different developmental and behaviour disturbances. The disorder has different clinical appearances during childhood and young adulthood (26): ■

■

■

■

■

Zero to two years: The first symptom is RP with early retinal pigmentary degeneration. This is first demonstrated by light sensitivity and nystagmus. A severe deterioration of cone function and later a progressive deterioration of rod function are found. In Alström syndrome, the diagnosis of RP is usually made before the age of two years by electroretinography (ERG) and fundoscopy. During the first year of life, 50% of children suffer from a cardiomyopathy, which can be misinterpreted as pulmonary infection. The cardiomyopathy is severe and life threatening. Two to four years: The RP will progress with diminished darkness sensitivity and diminished vision fields. The child is clumsier than other children. Most children have a rapid growth, with childhood obesity in nearly all children. A rapid weight gain is usually observed even before two years of age. During these years, the child might have numerous upper airway infections as well as urinary infections. Four to six years: A continued rapid gain of weight and in many children elevated blood lipids. More than 50% develop diabetes type 2 during childhood. During these years, a progressive hearing loss is apparent but sometimes the diagnosis is missed due to all the other organ dysfunctions. Six to twelve years: visual function is rapidly deteriorating and during age of 12 to 15 years, most children will be blind. As this age, other dysfunctions such as liver, kidney, heart problems, etc. can develop. Twelve to eighteen years: Nearly all are blind, and besides RP, most have also developed cataract. The hearing disorder is in some cases progressive from moderate to severe and at older ages, profound bilateral deafness. The cardiomyopathy might reappear; thus, regular monitoring of cardiac functions is vital.

The heterogeneity in Alström syndrome is extensive. The author knows of five individuals who all are above 20 years of age. They are all blind, have a severe/profound progressive hearing loss; they all have diabetes, elevated lipids, and liver, kidney, and cardiac dysfunctions (unpublished observations). Very few persons with Alström syndrome are over 40 years of age. Developmental milestones are delayed in approximately 50%. These can be fine motor skills, language delay, and autistic-spectrum behaviour abnormalities (27). One causative gene has so far been mapped to chromosome 2p (28). The gene is ALMS1. This gene probably interacts with genetic modifiers, which could explain the large heterogeneity. A mouse model has been created. The findings from the mouse model suggest that ALMS1 has a role in intracellular trafficking (29,30). Since Alström syndrome is a very complex disorder affecting many organs and with a large heterogeneity, it is likely that other genes are also involved in this disorder.

Norrie disease This disorder was first described by Gordon Norrie in 1933. It was, however, Mette Warburg, in 1961, who reported seven cases of a hereditary degenerative disease found in seven generations in a Danish family, suggesting the name of the disorder. (31). Norrie disease belongs to the category of congenital deafblindness. The inheritance is X-linked. The symptoms of Norrie disease are variable and may include many organs. Hearing: A progressive hearing loss with variable progression is found during early childhood. In most cases, profound deafness is found at the age of 30 years. The localisation of the hearing loss is in the cochlea (unpublished observations by the author). Vision: A congenital severe vision loss or congenital blindness is often present. The vision loss is due to several abnormalities such as iris atrophy, retinopathy, pseudoglioma, and cataracts. Usually severe mental retardation and microcephaly are found and other dysfunctions can include cryptorchidism and hypogonadism (32). The gene (NDP) is located on chromosome Xp11.4 and has been cloned. Because of the small size of the Norrie gene, mutation detection in Norrie disease is particularly simple and fast (33). The protein product of the NDP gene is called norrin, and is a secreted protein.

Mohr–Tranebjaerg syndrome The Mohr–Tranebjaerg syndrome is an X-linked recessive disorder. In 1960, Mohr and Mageroy described a family where four generations were affected with a progressive form of deafness. The family was Norwegian. Originally, it was reported as a nonsyndromic X-linked recessive deafness. Tranebjaerg et al. in 1992 and 1995 did a reinvestigation and discovered several visual dysfunctions in the family.

1181 Chap04

3/29/07

4:41 PM

Page 59

Deafblindness

Vision: The visual loss is severe and includes myopia, decreased visual acuity, constricted visual fields, and abnormal electroretinograms. A severe retinal degeneration is found. Hearing: The hearing loss is progressive and will eventually be profound. A combination of cochlear loss and auditory neuropathy might be found (unpublished observations by the author). As well as the hearing and vision deficiencies described above, there are central nervous system disorders such as dystonia, spasticity, dysphagia, dysarthria, tremor, hyperreflexia, and mental deterioration. Behavioural and psychiatric abnormalities are also common. In addition to the Norwegian family, other families have been described. There seems to be a clinical heterogeneity; so far, the Norwegian family have had the most severe symptoms. In this family, mental deficiency and blindness as well as deafness were found in nearly all individuals (34). Linkage analysis located the causative gene to Xq22, close to a gene found in X-linked Alport syndrome. In 1999, Wallace and Murdock found that the underlying defect is in the mitochondrial oxidative phosphorylation chain (35).

Wolfram syndrome Wolfram syndrome was first described in 1938 by Wolfram and Wagener, who described a family with juvenile diabetes mellitus and optic atrophy (36). Wolfram syndrome is also named DIDMOAD (diabetes insipidus, diabetes mellitus, optic atrophy, and deafness). The syndrome is autosomal recessive. The disorder is heterogeneous and many studies are based on case reports and family studies. Vision: Optic atrophy is the main feature of this disorder. The atrophy of the optic nerve can be visualised by fundoscopy and magnetic resonance imaging and imaging findings have revealed atrophy of the optic nerve, chiasma, and optic tracts. Hearing: The pattern of hearing loss is unusual, with lowfrequency loss. The severity is variable from mild to profound. It has been demonstrated that patients with nonsyndromic, low-frequency hearing loss also might have mutations in the Wolframin gene-1 (37). Other neurological abnormalities that might be apparent include mental retardation. Imaging findings in Wolfram syndrome have revealed atrophy of the optic nerve, chiasma, and tracts as well as atrophy of the brain stem and cerebellum. The diabetes could be both diabetes insipidus and diabetes mellitus where the onset usually is early (juvenile). Wolfram syndrome has so far been localised to two different genes (WFS1 and 2). WFS1 is localised to chromosome 4p. More than 120 mutations have been identified in WFS1; the most common mutation described is in exon 8 (38). The second type, WFS2, is also linked to chromosome 4p (39). Recent research has suggested that the Wolfram gene might be expressed in the canalicular reticulum, which is a special form of the endoplasmic reticulum in the inner ear. Thus, the Wolframin genes might play a role in inner ear homeostasis.

59

This might also explain the low-frequency hearing loss found, which shows similarities to Menière’s syndrome.

Refsum disease The disorder is named after Sigvard Refsum who in 1949 described the visual and neurological symptoms (40). The clinical findings of Refsum disease are RP, chronic polyneuropathy, cerebellar dysfunction, and hearing loss/deafness. Other symptoms described are ichthyosis and dysplasia of the skeleton. In 1963, Klenk and Kahlke discovered accumulation of fatty acids and phytanic acid. The probable cause is a diminished ability to degrade phytanic acid. The accumulation will cause degeneration in different organs (41). It has been suggested that a diet free of chlorophyll and other food that might contain phytol will reduce the amount of unresolved phytanic acid in the blood, and thus reduce the progression of symptoms or even make a clinical improvement. This has not yet been convincingly proven. Vision: The vision loss is RP of a mild type with late onset blindness. In-depth studies of RP in Refsum disease have so far not been performed. Hearing: The hearing loss is moderate to severe and down sloping; in many patients it is progressive. Recent findings have suggested that the localisation of the hearing loss is not in the inner ear but rather in the auditory nerve (auditory neuropathy) (42). Refsum disease is a heterogeneous disorder. One gene has been localised to chromosome 10p (43); however, recent studies have shown that many patients with Refsum disease do not have mutations in this gene. The prevalence of Refsum syndrome is so far unknown but the resemblance between Refsum and US might result in false diagnosis in some patients with Refsum syndrome, which will result in wrong treatment and rehabilitation. Thus testing for Refsum syndrome should always be made if a patient with RP and sensorineural hearing loss has other clinical symptoms such as polyneuritis, ichthyosis, etc. An early designation called “infantile Refsum disease” was used for a similar congenital, very severe deafblind disorder with high morbidity and early mortality. This disorder also has phytanic acid accumulation, but due to other causes. It is suggested that the designation “infantile Refsum” should be avoided (44).

Summary “I went to the doctor and he told me that I would go deaf and blind. He does not know when, but it might be in the near future. Then the doctor abruptly left the room. No! Not my hearing, not my vision! It is not fair! How could God do this to me? Why wasn’t I told until I was grown up? Somebody help me!!!” The gradual loss of hearing and vision creates stress, anxiety, grief, and horror. Deafblindness should be described as a functional entity with the two major channels for communication

1181 Chap04

60

3/29/07

4:41 PM

Page 60

Genetics and hearing impairment

being hampered. The rapid progress of gene identification and cloning might in the near future lead to better medical and, hopefully, genetic treatment. The new discoveries of antioxidants and growth-hormone factors along with the increasing understanding of the physiology of vision and hearing will result in new treatment modalities. These new insights into genetics combined with more advanced diagnostic tools for assessment of vision and hearing will make early and correct diagnosis in most cases possible. Early diagnosis and prognosis will give better habilitation, rehabilitation, and treatment. Another important outcome of the new genetic discoveries are the possibilities of information to patients and family concerning aetiology, which in many cases will reduce fear and misunderstanding that will foster more realistic expectations and allow better rehabilitation, and, hopefully, in the future, treatment.

References 1. Omim http//www.ncbi.nlm.nih.gov. 2. Kimberling WJ, Möller C. Clinical and molecular genetics of Usher syndrome. Am Acad Audiol 1995; 6:63–72. 3. Bell J. Retinitis pigmentosa and allied diseases. In: Pearson K, ed. Treasury of Human Inheritance. London: Cambridge University Press, 1933:1–29. 4. Smith RJ, Berlin CI, Hejtmancik JF, et al. Clinical diagnosis of the Usher syndromes. Am J Med Genet 1994; 50:32–38. 5. van Camp G, Smith RJ. Hereditary Hearing Loss Homepage, http://webhost.ua.ac.be/hhh. 6. Kaplan J, Gerger S, Bonneau D, et al. A gene for Usher syndrome type I (USH1A) maps to chromosome 14q. Genomics 1992; 14:979–987. 7. Kimberling WJ, Möller CG, Davenport S, et al. Linkage of Usher syndrome type I gene (USH1B) to the long arm of chromosome 11. Genomics 1992; 14:988–994. 8. Gibson R, Walsh J, Mburu P, et al. A type VII myosin encoded by the mouse deafness gene shaker-1. Nature 1995; 374:62–64. 9. Smith RJ, Lee EC, Kimberling WJ, et al. Localisation of two genes for Usher syndrome type I to chromosome 11. Genomics 1992; 14:995–1002. 10. Wayne S, Kaloustian V, Schloss M, et al. Localisation of the Usher syndrome type Id gene (USH1D) to chromosome 10. Hum Mol Genet 1996; 5:1689–1692. 11. Di Palma F, Holme RH, Bryda EC, et al. Mutations in CDH23, encoding a new type of cadherin, cause stereocilia disorganisation in waltzer, the mouse model for Usher syndrome type 1D. Nat Genet 2001; 27:103–107. 12. Chaib H, Kaplan J, Gerber S, et al. A newly identified locus for Usher syndrome type I, USH1E, maps to chromosome 21q21. Hum Mol Genet 1997; 6:27–31. 13. Ahmed ZM, Riazuddin S, Bernstein SL, et al. Mutations of the protocadherin gene PCDH15 cause Usher syndrome type 1F. Am J Hum Genet 2001; 69:25–34.

14. Weil D, El-Amraoui A, Masmoudi S, et al. Usher syndrome type I G (USH1G) is caused by mutations in the gene encoding SANS, a protein that associates with the USH1C protein, harmonin. Hum Mol Genet 2003; 12:463–471. 15. Sadeghi M, Eriksson K, Kimberling WJ, Sjöström A, Möller C. Long-term visual prognosis in Usher syndrome type I and II. Scand J Ophtalmol 2005. In Press. 16. Kimberling W, Weston M, Möller C, et al. Localisation of Usher syndrome type II to chromosome 1q. Genomics 1990; 7:245–249. 17. Weston M, Eudy J, Möller C, et al. Genomic structure and identification of novel mutations in usherin, the gene responsible for Usher syndrome type IIa. Am J Hum Genet 2000; 66:1199–1210. 18. Hmani M, Ghorbel A, Boulila-Elgaied A, et al. A novel locus for Usher syndrome type II, USH2B, maps to chromosome 3 at 3p2324.2. Eur J Hum Genet 1999; 7:363–367. 19. Pieke-Dahl S, Möller CG, Astuto LM, Cremers CW, Gorin MB, Kimberling WJ. Genetic heterogeneity of Usher syndrome type II: localisation to chromosome 5q. J Med Genet 2004; 44: 256–262. 20. Weston MD, Luijendijk MW, Humphrey KD, Möller C, Kimberling WJ. Mutations in the VLGR1 gene implicate G-protein signalling in the pathogenesis of Usher syndrome type II. Am J Hum Genet 2004; 74:357–366. 21. Sadeghi M, Cohn ES, Kimberling WJ, Tranebjaerg L, Möller C. Audiological and vestibular features in affected subjects with USH3: a genotype/phenotype correlation. Int J Audiology 2005. In Press. 22. Pakarinen L, Sankila EM, Tuppurainen K, Karjalainen S, Helena K. Usher syndrome type III (USH3): the clinical manifestations in 42 patients. Scand J Log phon 1995; 20:141–150. 23. Joensuu T, Blanco G, Pakarinen L, et al. Refined mapping of the Usher syndrome type III locus on chromosome 3, exclusion of candidate genes, and identification of the putative mouse homologous region. Genomics 1996; 38:255–263. 24. Sadeghi M, Kimberling WJ, Tranebjaerg L, Möller C. The prevalence of Usher syndrome in Sweden:a nation-wide epidemiological and clinical survey. Audiol Med 2004; 2:220–228. 25. Alström CH, Hallgren B, Nilsson LM, Åsander A. Retinal degeneration combined with obesity, diabetes mellitus and neurogenous deafness: a specific syndrome distinct from Laurence-Moon-Biedel syndrome. A clinical, endocrinological and genetic examination based on a large pedigree. Acta Psychiatr Neurol Scand 1959; 34(suppl 1229):1–35. 26. Hopkinson I, Marshall JD, Paisey RB, Carrey C, Macdermott. Alström’s syndrome. Available at http://www.genetests.org. Accessed Aug 2005. 27. Marshall JD, Bronson R, Collin G, et al. New Alström syndrome phenotypes based on the evaluation of 182 cases. Arch Intern Med 2005; 165:675–683. 28. Collin GB, Marshall JD, Cardon LR, Neshina PM. Homozygosity mapping of Alström syndrome to chromosome 2p. Hum Mol Genet 1997; 6:213–219. 29. Collin GB, Marshall JD, Ikeda A, et al. Mutations in ALMS1 cause obesity, type 2 diabetes and neurosensory degeneration in Alström syndrome. Nat Genet 2002; 31:74–78.

1181 Chap04

3/29/07

4:41 PM

Page 61

Deafblindness

30. Collin GB, Bronson R, Marshall J, et al. ALMS1-disruped mice recapitulate human Alström syndrome. Hum Mol Genet 2005; 15:2323–2333. 31. Warburg M. Norrie’s disease: a new hereditary bilateral pseudotumor of the retina. Acta Ophthal 1961; 39:757–772. 32. Warburg M. Norrie disease, a congenital progressive oculo-acousticocerebral degeneration. Acta Ophthal 1966; 89(suppl): 1–147. 33. Berger W, Meindl A, van de Pol TJ, et al. Isolation of a candidate gene for Norrie disease by positional cloning. Nat Genet 1992; 1:199–203. 34. Tranebjaerg L, Schwartz C, Eriksen H, et al. A new X-linked recessive deafness syndrome, blindness, dystonia, fractures and mental deficiency is linked to Xq22. J Med Genet 1995; 32:257–263. 35. Wallace DC, Murdock DG. Mitochondria and dystonia: the movement disorder connection? Proc Nat Acad Sci 1999; 96:1817–1819. 36. Wolfram D, Wagener HP. Diabetes mellitus and simple optic atrophy among siblings: report of four cases. Mayo Clin Proc 1938; 13:715–718. 37. Gurtler N, Kim Y, Mhatre A, et al. Two families with nonsyndromic low frequency hearing loss harbor novel mutations in Wolfram syndrome gene 1. J Mol Med 2005; 83:553–560.

61

38. Hardy C, Khanim F, Torres R, et al. Clinical and molecular genetic analysis of 19 Wolfram syndrome kindreds demonstrating a wide spectrum of mutations in WFS1. Am J Hum Genet 1999; 65:1279–1290. 39. Collier DA, Barrett TG, Curtis D, et al. Linkage of Wolfram syndrome to chromosome 4p16.1 and evidence for heterogeneity. Am J Hum Genet 1996; 59:855–863. 40. Refsum S, Salomonsen L, Skatvedt M. Heredopathia atactica polyneuritiformis in children. J Pediatr 1949; 35:335–343. 41. Kahlke W, Wagener H. Conversion of h3-phytol to phytanic acid and its incorporation into plasma lipid fractions in heredopathia atactica polyneuritiformis. Metabolism 1996; 15:687–693. 42. Oysu C, Aslan I, Basaran B, Baserer N. The site of the hearing loss in Refsum’s disease. Int J Pediatr Otorhinolaryngol 2001; 61:129–134. 43. Nadal N, Rolland MO, Tranchant C, Reutenauer L. Localization of Refsum disease with increased pipecolic acidaemia to chromosome 10p by homozygosity mapping and carrier testing in a single nuclear family. Hum Mol Genet 1995; 4:1963–1966. 44. Jansen GA, Waterham HR, Wanders RJ. Molecular basis of Refsum disease: sequence variations in phytanoyl-CoA hydroxylase (PHYH) and the PTS2 receptor (PEX7). Hum Mutat 2004; 23:209–218.

1181 Chap04

3/29/07

4:41 PM

Page 62

1181 Chap05

3/29/07

4:51 PM

Page 63

5 Nonsyndromic hearing loss: cracking the cochlear code Rikkert L Snoeckx, Guy Van Camp

Introduction Hearing impairment (HI) is the most common sensory impairment, affecting 1/650 newborns (1). In approximately 30% of the cases, a specific syndrome can be identified, with more than 400 syndromes claiming HI as a component. The remaining 70% of cases are nonsyndromic (2,3). Prelingual HI is caused by a mutation in a single gene (monogenic) in 60% of the cases, with an autosomal-dominant (20%), autosomalrecessive (80%), X-linked (1%), and mitochondrial (⬍1%) inheritance pattern. The most common type of nonsyndromic HI is postlingual and affects 10% of the population by age 60 and 50% by age 80 (4). In most cases, this HI is due to an unfavourable interaction between genetic and environmental factors (multifactorial or complex disease). The genetic factors contributing to monogenic HI have long remained unknown. The human cochlea comprises about 20,000 neurosensory hair cells that do not last a lifetime and do not regenerate when lost. Due to the low number of cells and their location in the temporal bone, which is hard to access, it is very difficult to obtain information about the function of hair cells through biochemical studies. Positional cloning of genes for genetic forms of deafness has contributed greatly to our understanding of the physiology of the inner ear. Soon after the identification of the first locus for hereditary hearing loss in 1992 (5), many other gene localisations and identifications followed. It became clear that HI could be caused by many genes, which is in accordance with the structural complexity of the inner ear. Over the years, HI has become a paradigm for genetic heterogeneity. To date, more than 90 genes have been localised for nonsyndromic HI of which 40 genes have already been identified (6). The extraordinary progress in the identification of deafness genes has been helped greatly by the sequencing of the human

and the mouse genomes and the improvement of gene annotation methods. Also, the combination of genetic research with physiological and morphological information is beginning to lead to an in-depth understanding of many complex physiological and pathophysiological mechanisms of the hearing process. However, the function of several genes is not yet elucidated and many genes for nonsyndromic HI remain to be identified. Nonsyndromic forms of hereditary deafness can be classified by their mode of inheritance. Chromosomal loci harbouring mutations that lead to nonsyndromic HI are named with DFNA, DFNB, or DFN symbols. DFNA and DFNB symbols followed by a numerical suffix indicate that the mutant allele is segregating in an autosomal-dominant or -recessive way, respectively. Sex-linked nonsyndromic hearing loss is designated with a DFN symbol and a numerical suffix. The division between nonsyndromic and syndromic HI is, at times, not easy to define. In some syndromic forms, hearing loss is detected before the manifestations of other organ pathology. As a result, a child might be incompletely diagnosed with nonsyndromic hearing loss. Additionally, several human genes can underlie both syndromic and nonsyndromic hearing loss. Possibly, these proteins have several functions, with specific and irreplaceable functions in the inner ear and a less critical function in other tissues, which may only be compromised by certain mutations or under certain conditions. Mutations in GJB2 cause mostly nonsyndromic HI, although some specific mutations cause additional skin abnormalities underlying keratitisichthyosis-deafness (KID) syndrome, Vohwinkel syndrome, and palmoplantar keratoderma (7–9). Other examples are the gene WFS1, which, besides autosomal-dominant nonsyndromic HI, can also cause Wolfram syndrome and the SLC26A4 gene, which can be the cause of autosomal-recessive nonsyndromic HI as well as Pendred syndrome (10–13). Usher syndrome can be caused by mutations in CDH23, MYO7A, and USH1C, but these genes can also be the cause of nonsyndromic HI (14–19).

1181 Chap05

64

3/29/07

4:51 PM

Page 64

Genetics and hearing impairment

This review gives a state-of-the-art description of genes that cause nonsyndromic HI. A classification is made according their putative function. These categories include genes involved in the homeostasis of the cochlea, genes required for the morphogenesis of the hair-cell bundle, extracellular matrix components and transcription factors, and genes encoding proteins with an unknown function. Two additional categories include mitochondrial mutations and modifier genes.

Genes involved in the homeostasis of the cochlea ⫹

After the influx of K , the inner and outer hair cells (OHCs) ⫹ are required to remove the excess of K ions. A possible recy⫹ cling pathway for K , through gap junctions and potassium channels (epithelial cell-gap junction pathway), has been proposed on the basis of physiological and morphological findings (Fig. 5.1) (21,22). Potassium ions are released basolaterally from the hair cells to the extracellular space of the organ of ⫹ ⫹ Corti by K channels. This K is taken up by the supporting cells and moves to the lower part of the spiral ligament through the epithelial-gap junction pathway. Subsequently, the ions enter the extracellular space of the spiral ligament and are then taken up by the fibrocytes (connective tissue-gap junction path⫹ way). Finally, K passes through this system towards the stria vascularis back into the endolymphatic sac (23).

Connexins Gap junctions are channels that connect neighbouring cells and allow passive transfer of small molecules. They are made up of

two hemi channels or connexons that sit in the cell membranes, and align and join to form a channel. Connexons consist of six proteins called connexins. These gap junctions are important for the electric and metabolic coupling of neighbouring cells. Connexins are expressed in many different tissues. Connexin 26 (GJB2) and connexin 30 (GJB6) Connexin 26 is encoded by the gap junction ␤2 (GJB2) gene, which is expressed in several tissues including the cochlea and skin (23). In the cochlea, GJB2 is expressed in the supporting cells, the spiral ligament, the spiral limbus, and the stria vascu⫹ laris, most likely contributing to the recycling of K ions (24). Recently, it has been shown that the intercellular transduction of the second messenger inositol triphosphate (IP3) by gap junctions in the inner ear is also essential for the perception of sound (25). 2⫹ The spreading of an IP3-mediated Ca signal would be essential 2⫹ to the propagation of Ca waves in cochlear-supporting cells. In many different populations, mutations in the GJB2 gene are the major cause of autosomal-recessive nonsyndromic hearing loss at the DFNB1 locus (26–29). However, some mutations are responsible for autosomal-dominant HI, although at a much lower frequency (30). Most of these dominant mutations in GJB2 cause a syndromic form of HI, with additional skin abnormalities (keratodermas) that are clinically very heterogeneous (7–9,31,32). In many European populations, the most frequent mutation in the GJB2 gene is the 35delG mutation (26,28,33–35). This single base-pair deletion creates a frameshift very early in the gene, most likely causing complete disruption of expression. In non-European populations, the 35delG mutation is rare, but sometimes other frequent mutations are found. These include the 235delC mutation in Japanese and Koreans (36–38), the 167delT in Ashkenazi Jews (39,40), and the R143W mutation

Figure 5.1 Location of the different components ⫹ of the cochlea. The K recycling pathway is indicated. Source: From Ref. 20.

1181 Chap05

3/29/07

4:51 PM

Page 65

Nonsyndromic hearing loss: cracking the cochlear code

in a village in eastern Ghana (41). For three of these (167delT, 35delG, and 235delC), the mutation was shown to be derived from a common founder, which in the case of 35delG was estimated to be 10,000 years old (29,33,39). Because a general GJB2 knockout mouse is embryonically lethal (42), a tissue-specific GJB2 knockout was created using the LoxP-Cre system (43). In this way, GJB2 was disrupted only in the epithelial network of the cochlea, whereas GJB2 expression in the connective tissue network of the cochlea as well as in all other organs stayed intact. This cochlear epithelial network-specific GJB2 knockout mouse had HI, without signs of vestibular dysfunction and skin abnormalities. Recently, two deletions near the GJB2 gene on 13q12 were detected (44, 44a). A novel 232-kb deletion involving the GJB6 gene (connexin-30) in Spanish subjects with autosomal-recessive nonsyndromic hearing impairment (submitted 2004).] These mutations, called del(GJB6-D13S1830) and del(GJB6D13S1854), leave the GJB2 coding region intact but delete a large region close to GJB2 and truncate another connexin (CX30, GJB6) located within 50 kb of GJB2. These deletions are frequently found in compound heterozygosity with a GJB2 mutation. Coimmunostaining showed expression of CX26 (GJB2) and CX30 (GJB6) in the same gap-junction plaques (45). The del(GJB6-D13S1830) mutation was the accompanying mutation in 50% of deaf GJB2 heterozygotes in Spain, whereas the del(GJB6-D13S1854) mutation accounts for 25% of the affected GJB2 heterozygotes, which remained unexplained after screening of the GJB2 gene and the del(GJB6D13S1830) mutation in the Spanish patients. HI in patients with both deletions is assumed to be caused by the deletion of a putative GJB2 regulatory element or by digenic inheritance. However, pure digenic inheritance seems to be unlikely because compound heterozygosity with a GJB2 mutation has not been found for other GJB6 mutations. The HI in patients with del(GJB6-D13S1830) and del(GJB6-D13S1854) is more severe than HI in patients with other GJB2 mutations (46). This may be due to the inactivation of one allele of GJB6 by the deletion. If GJB6 can partly substitute for the function of GJB2 in the inner ear, as has been suggested (45), this substitution could be less efficient with only one GJB6 gene left, leading to more severe HI. Finally, there has been only one report of a missense mutation that can cause nonsyndromic hearing loss in GJB6, i.e., T5M (47). Other mutations in the GJB6 gene can cause the Clouston syndrome, an autosomal-dominant disorder characterised by changes in the epidermis and the appendages, including diffuse palmoplantar keratoderma, nail dystrophy, and sparse scalp and body hair (48). HI of variable degree is also observed in some Clouston cases. It is currently unknown why GJB2 mutations are a frequent cause of autosomal-recessive deafness in many ethnically diverse populations. Nevertheless, it is clear that GJB2 mutations are a major cause of deafness in most of the populations that have hitherto been studied. Generally, the most important genetic test for nonsyndromic HI is molecular screening of the GJB2 gene. A recent genotype–phenotype

65

correlation study for GJB2 mutations makes it possible that more accurate information about the probability of having a child with severe or profound HI can be given to couples who carry GJB2 mutations (46). Connexin 31 (GJB3) Another connexin that, when mutated, can cause hearing loss is Connexin 31, encoded by the GJB3 gene. This gene is localised within the DFNA2 region at chromosome 1p34, close to the KCNQ4 gene, which is also a deafness gene. GJB3 mutation analysis revealed mutations in only a few families with an autosomal-dominant or -recessive nonsyndromic HI (49,50). In the cochlea, its specific expression is restricted to the spiral limbus and spiral ligament. There is strong evidence that mutations in this gene can also cause erythrokeratoderma variabilis, an autosomal-dominant skin disorder, without HI (51). One specific dominant mutation D66H in the GJB3 gene can cause peripheral neuropathy and sensorineural HI (52). This amino acid residue at position 66 is highly conserved across species and most likely also plays a functionally important role in other connexins. In GJB2, D66H causes Vohwinkel syndrome (7), whereas 66delD in the GJB1 gene results in the peripheral neuropathy disorder X-linked Charcot-Marie-Toot disease (53). Remarkably, knockout mice with the GJB3 gene have no symptoms of hearing loss. However, a reduced embryonic viability due to placental dysmorphogenesis has been detected (54).

Claudin 14 (CLDN14) ⫹

The major role in the paracellular pathway of inner ear K recycling is played by the tight junctions, which seal neighbouring cells together to prevent leakage (55). Tight junctions are composed of at least three types of membrane-spanning proteins: occludin, different members of the claudin family, and junction-adhesion molecules (56–58). Mutations in the CLDN14 gene, a member of the claudin family, can cause profound congenital recessive deafness in humans and in mice (59,60). Homozygous cldn14 knockout mice have a normal endocochlear potential, but they are deaf due to the rapid degeneration of cochlear OHCs. This is followed by a slower degeneration of inner hair cells. CLDN14 is expressed in the sensory epithelium of the organ of Corti and is probably required as a cation-restrictive barrier to maintain the ionic composition of the fluid surrounding the basolateral surface of OHCs.

Potassium channel, voltage gated, subfamily Q, member 4 (KCNQ4) This gene encodes a voltage-gated K-channel, KCNQ4, and is responsible for the most frequent form of autosomal-dominant nonsyndromic HI (DFNA2). KCNQ proteins have six transmembrane domains and although it has not been shown directly, four KCNQ subunits probably combine to form functional potassium channels.

1181 Chap05

66

3/29/07

4:51 PM

Page 66

Genetics and hearing impairment

KCNQ4 is expressed in both inner and OHCs of the cochlea and in auditory nuclei of the brainstem. It is probably ⫹ involved in basolateral K secretion of hair cells (61,62). As ⫹ the K channel is formed by a tetramer of KCNQ4 subunits, any given mutation with a dominant-negative effect can cause ⫹ a severe reduction in K channel activity. This is compatible with the autosomal-dominant inheritance pattern and complete penetrance of the progressive HI associated with KCNQ4 mutations.

Pendrin (SLC26A4) Pendred syndrome is inherited in an autosomal-recessive manner and is characterised by the association of congenital hearing loss with thyroid abnormalities (goitre). This thyroid defect can be demonstrated by the perchlorate test. Cochlear malformations are common in Pendred syndrome. All Pendred syndrome patients have enlarged vestibular aqueducts (EVA) and many have Mondini dysplasia (63). The gene responsible for this syndrome is SLC26A4, which encodes the chloride–iodide transporter pendrin that is expressed in both the thyroid and the cochlea (11). Pendrin has a highly discrete expression pattern throughout the endolymphatic duct and sac, in the distinct areas of the utricule and the saccule, and in the external sulcus region (64). These regions are thought to be important for endolymphatic fluid resorption in the inner ear. Some mutations in the SLC26A4 gene can also cause nonsyndromic autosomal-recessive hearing loss with EVA but without any signs of goitre. For this reason, SLC26A4 mutation analysis is often performed in cases with nonsyndromic HI and EVA. However, no exact genotype–phenotype correlation can be made because of the intrafamilial variability and nonpenetrance of the thyroid phenotype. Remarkably, in many patients with nonsyndromic HI and EVA, only a single SLC26A4 mutation is found (65), suggesting common undetected mutations outside the coding region or a dominant effect in some cases.

Genes involved in the structure and function of the hair cell Adhesion molecules Cadherin 23 and Protocadherin 15 belong to the cadherin superfamily, most members of which play a role in calciumdependent cell-to-cell adhesion. Cadherin 23 is located at the tips of the bundles in hair cells and is proposed to be an essential component of tip links (Fig. 5.2) (67,68). Remarkably, missense mutations of CDH23 with presumed subtle functional defects of cadherin 23 are associated with nonsyndromic hearing loss (DFNB12), whereas Usher syndrome type 1D (USH1D) is caused by mutant alleles of CDH23 with a more severe effect (69–71). Usher syndrome is characterised by

Figure 5.2 Schematised illustration of proteins that constitute adhesion complexes on the plasma membrane of stereocilia. Experimentally demonstrated interactions between myosin VIIa, harmonin, cadherin 23, and SANS are shown as well as the interaction of myosin XVa with whirlin. Cadherins and protocadherins are linked to each other, thereby constituting the lateral links. The molecules with which Myosin XVa and Whirlin may interact at the tips of the stereocilia as well as those that interact with protocadherin 15 are not yet identified. Abbreviation: SANS, scaffold protein containing ankyrin repeats and SAM domain. Source: From Ref. 66.

HI and retinitis pigmentosa and can be classified into three different types on the basis of clinical findings. To date, 11 genes have been localised for different types of Usher syndrome, of which eight genes have already been identified. In the eye, cadherin 23 is thought to play a fundamental role in the organisation of synaptic junctions. Like CDH23, several other genes that are required in the morphogenesis of the hair bundle have also been detected in nonsyndromic HI. Protocadherin 15 is an important protein in the morphogenesis and cohesion of stereocilia bundles through long-term maintenance of lateral connections (lateral links) between stereocilia (72). Mutations in the PCDH15 gene are responsible for the HI in families linked to DFNB23 and for the Usher syndrome in families linked to USH1F (73,74). The two mouse strains Waltzer and Ames Waltzer have been identified as having mutations in cdh23 and pcdh15, respectively. The phenotype of both mice is characterised by deafness, vestibular dysfunction, retinal dysfunction, and disorganised, splayed stereocilia in homozygous mice (70,75–77).

1181 Chap05

3/29/07

4:51 PM

Page 67

Nonsyndromic hearing loss: cracking the cochlear code

Scaffolding proteins USH1C encodes a PDZ domain–containing protein called harmonin, and mutations also cause both nonsyndromic HI and Usher syndrome in families linked to the DFNB18 and the USH1C loci, respectively (14,17). PDZ domain–containing proteins are central organisers of high-order supramolecular complexes located at specific emplacements in the plasma membrane. In the cochlea, harmonin is restricted to the hair cells, where it is present in the cell body and the stereocilia. Harmonin has been shown to interact with cadherin 23 and SANS to form macromolecular complexes (78–80). The latter protein SANS is also mutated in Usher syndrome (USH1G) but not in nonsyndromic HI. An important regulator of the development of stereocilia is Whirlin, encoded by the gene WHRN. The protein is involved in the elongation and maintenance of stereocilia in hair cells (81). Mutations in the WHRN gene cause autosomal-recessive HI at the DFNB31 locus. The HI in the Whirler mouse mutant (wi) is caused by abnormally short but nearly normal organised stereocilia (81).

Myosins: intracellular motors The myosin superfamily can be subdivided into 17 classes of unconventional and 1 class (class II) of conventional myosins. This conventional–unconventional dichotomy is artificial in terms of structure and evolution. However, it is operationally useful because of the historical emphasis on conventional myosins. In humans, 40 different myosin genes can be divided into 12 classes based on the relationships of their head-domain sequences and their tail structure (82). Class II consist of 15 conventional genes, including the cluster of 6 skeletal-muscle myosin heavy chains on chromosome 17, 2 cardiac myosin heavy chains, a smooth-muscle myosin heavy chain, and 3 nonmuscle myosin heavy chains (83). All other myosin classes consist of a total of 25 unconventional genes. Although the role of myosin in contraction and force production in muscles is well characterised, little is known about the specific functional roles of nonmuscle myosins. They are likely to participate in motility, cytokinesis, phagocytosis, maintenance of cell shape, and particle trafficking. Three unconventional myosins have already been extensively studied: myosin VI (MYO6), myosin VIIa (MYO7A), and myosin XVa (MYO15A). Dominant and recessive mutations in the first two myosins can cause nonsyndromic HI (DFNA22/ DFNB37 and DFNA11/DFNB2, respectively) (16,19,84,85). In the MYO15A gene, only recessive mutations have been described in families linked to the DFNB3 locus (86). Additionally, mutations in the MYO7A gene have been described, which cause Usher syndrome (USH1B) (18). Myosin VI is localised at the base of the hair bundle within the cuticular plate (87). This structure is thought to provide mechanical stability to the apex of the hair cell. The mouse strain Snell’s Waltzer (sv) is deaf due to a mutation in the myo6 gene that ablates all myosin VI protein in any tissue (88). The

67

stereocilia of these mice are fused at their bases, indicating that myosin VI is required to anchor stereocilia rootlets (89,90). Myosin VIIa binds at the lateral surface of the harmonincadherin 23–SANS macromolecular complexes and links them in this way to the actin filaments during hair-cell–bundle maturation. The mouse ortholog myo7a causes HI in the shaker-1 mouse strain (sh1) (91). Interestingly, two types of hair-cell anomalies have been detected in this mouse mutant. In the most severely affected mutants, the hair bundle is disorganised, with clumps of stereocilia projecting outside instead of forming the highly ordered structure. In addition, the kinocilium has an erratic position, indicating a role of myosin VIIa in the polarity of the hair bundle (92). Myosin XVa is localised to the extreme tips of stereocilia, possibly anchored by integral membrane proteins (93). Interestingly, longer stereocilia have more myosin XVa at their tips compared to shorter stereocilia. Although not much is known about possible interactions, the PDZ domain–containing protein, whirlin, is a good candidate for HI (Fig. 5.2). The reason for this is that the myosin XVa protein has a PDZ-ligand sequence and the mouse mutants (sh2 and wi) of both proteins share a similar phenotype. Other myosins have also been shown to cause HI, although not much is known about their biological role in the cochlea. Among the conventional nonmuscle myosins, myosin IX (MYH9) and myosin XIV (MYH14) have been shown to cause autosomal-dominant HI in families linked to DFNA17 and DFNA4, respectively (94,95). The expression pattern differs between the two myosins. Myosin IX is localised specifically in the OHCs, the spiral ligament, and the Reissner’s membrane, whereas myosin XIV is located in all cells of the scala media wall, except for Reissner’s membrane, with a relatively higher level in the organ of Corti and the stria vascularis (94,95). Interestingly, only one mutation in the MYH9 gene has been found to cause nonsyndromic hearing loss, i.e., R705H. All other mutations cause a variety of syndromes, with a decreased number of blood platelets as a common symptom (96). Other unconventional myosins that can cause nonsyndromic HI are myosin IIIA (MYO3A) and myosin Ia (MYO1A) in families linked to DFNB30 and DFNA48, respectively (97,98).

Genes involved in cytoskeletal formation The cytoskeleton regulates cell shape, transport, motility, and integrity. It consists of microfilaments, intermediate filaments, and microtubules. The most abundant microfilament protein in cells is actin. In most cells, ␤-actin is the predominant isoform, although ␥-actin, encoded by the ACTG1 gene, predominates in intestinal epithelial cells as well as in auditory hair cells,

1181 Chap05

68

3/29/07

4:51 PM

Page 68

Genetics and hearing impairment

where it is found in stereocilia, the cuticular plate, and the adherens junctions (99). Auditory hair cells are highly dependent on their actin cytoskeletons (100). Mutations in ACTG1 are the basis for hearing loss in four families affected with nonsyndromic HI (DFNA20/26) (101). Actin nucleation is accelerated through the interaction of diaphanous with the actin filaments (102). Diaphanous (DIAPH1) belongs to the formin protein family. Mutations in DIAPH1 cause lowfrequency HI in families linked to the DFNA1 locus (103). Another important structural element of the hair bundle of mammalian hair cells is espin, a calcium-insensitive, actinbundling protein. A recessive mutation of the gene (ESPN) in the deaf jerker mouse (je) results in failure to accumulate detectable amounts of this protein in the hair bundle. This leads to shortening, loss of mechanical stiffness, and eventual disintegration of stereocilia (104). Remarkably, the amount of espin is proportional to the length of the stereocilium (105). In humans, recessive mutations of ESPN at the DFNB36 locus cause profound prelingual hearing loss and peripheral vestibular areflexia (106).

Prestin (PRES) The most impressive property of OHCs in the cochlea is their ability to change their length in a voltage-dependent manner, contributing to the exquisite sensitivity and frequencyresolving capacity of the mammalian hearing organ (107,108). The contractility of their lateral cell membrane is an interesting mammalian cochlear specialisation that does not occur in inner hair cells. Prestin is a member of a gene family, solute carrier (SLC) family 26, which encodes anion transporters and related proteins. The lateral wall of OHCs has a high concentration of prestin, which is thought to be responsible for the electromotility of OHCs (104). The importance of prestin in hearing is strengthened by the detection of a 5’-UTR splice-acceptor mutation (IVS2-2A⬎ G) in exon 3 in two unrelated families with recessive nonsyndromic deafness (109,109a). Additionally, the pres -/- knockout mouse model has a 40 to 60dB loss of cochlear sensitivity and their OHCs do not exhibit electromotility in vitro (110).

Extracellular matrix components Cochlin (COCH) The Coagulation Factor C Homology gene (COCH) encodes cochlin, a protein that is highly expressed in the cochlea (111). Cochlin comprises approximately 70% of all bovine inner ear proteins (112) and is expressed in fibrocytes of spiral limbus, spiral ligament, and fibrocytes of the connective tissue stroma underlying the sensory epithelium of the crista ampullaris in the semicircular canals (113). Sixteen different isoforms of cochlin can be classified into four groups according to their molecular weight: p63s, p44s, p40s, and CTP. Two isoforms, p63s and CTP, contain a specific limulus factor C, Coch-562 and LGL1 (LCCL) domain that is the only region in which mutations

have been found in autosomal-dominant nonsyndromic HI (DFNA9). Remarkably, DFNA9 patients also exhibit a variety of vestibular and Menière-like symptoms (including instability in the dark, imbalance, positional vertigo, tinnitus, and aural fullness). A total of six different mutations have been found in the COCH gene, of which P51S is the most frequent. Already 15 different families with the P51S mutation have been identified, making it the most frequent mutation in this gene. This mutation has been shown to originate from a common founder from Belgium or The Netherlands (114). The exact pathogenic mechanism of the Cochlin mutations is unknown. Collagen XI a2 (COL11A2) Collagen fibrils provide structural elements of high tensile strength in extracellular matrices. According to their function, they can be grouped into fibril-forming collagens, fibrilassociated collagens, sheet-forming collagens, and anchoring collagens. Interactions between collagen fibrils, other matrix components, and cells are likely to provide the basis for the precise three-dimensional patterns of fibril arrangement in tissues. In the tectorial membrane, the fibril-forming collagen, XIa2, is an important structural component. It was not only found to cause autosomal-dominant nonsyndromic HI at the DFNA13 locus but also Stickler syndrome (STL2) (115). Mutations in two other collagens, collagen IIa1 (COL2A1) and collagen XIa1 (COL11A1), can also cause Stickler syndrome. Features of Stickler syndrome include progressive myopia, vitreoretinal degeneration, premature joint degeneration with abnormal epiphyseal development, midface hypoplasia, irregularities of the vertebral bodies, cleft palate deformity, and variable sensorineural hearing loss. Remarkably, persons with Stickler syndrome due to COL11A2 mutations do not have visual dysfunction. This can be explained by the absence of collagen XIa2 in the vitreous, where it is replaced by Collagen V (116). Electron microscopy of the tectorial membrane of homozygous col11a2 mice revealed loss of organisation of the collagen fibrils, which leads to moderate-to-severe hearing loss (115).

Otoancorin (OTOA) and stereocilin (STRC) The attachment of inner ear acellular gels (tectorial membrane, otoconial membrane, and the cupula) to the apical surface of the underlying nonsensory cells is probably effected by otoancorin and stereocilin. These proteins share a significant similarity with 900 C-terminal amino acids (117). Stereocilin is almost exclusively expressed in the inner hair cells (118), whereas otoancorin is present on the apical surface of sensory epithelia and their overlying acellular gels (119). Based on the sequence similarity and expression pattern, it was suggested that stereocilin may have a comparable function to otoancorin, i.e., the attachment of the tectorial and otoconial membranes to sensory hair bundles at the level of hair cells. Mutations in STRC and OTOA cause nonsyndromic recessive HI at the DFNB16 and DFNB22 locus, respectively (118,119).

1181 Chap05

3/29/07

4:51 PM

Page 69

Nonsyndromic hearing loss: cracking the cochlear code

␣-Tectorin (TECTA) The tectorial membrane is an important extracellular matrix component in the cochlea that lies on top of the stereocilia. Deflection of this membrane is induced by sound and results in the generation of a receptor potential. The tectorial membrane is composed of collagens and noncollagenous glycoproteins, of which ␣-tectorin and ␤-tectorin are the most important. ␣-tectorin, encoded by the TECTA gene, is proteolytically processed into three polypeptides that are connected to each other by disulfide bridges. These polypeptides interact with ␤-tectorin. Several dominant and recessive mutations have already been described in the TECTA gene, causing HI in families linked to DFNA8/12 and DFNB21 (120,121). It was suggested that dominant mutations exert a dominant-negative effect, thereby disrupting proper interaction between the different ␣-tectorin polypeptides (120). Recessive mutations are functionally null alleles. Half the normal amount of ␣-tectorin is probably enough to preserve the auditory function, thereby explaining the lack of symptoms in heterozygous carriers. Mice homozygous for a targeted deletion in a ␣-tectorin have moderate-to-severe hearing loss due to the detachment of the tectorial membrane from the organ of Corti (122).

Transcription factors Eyes absent 4 (EYA4) The EYA gene family encodes a family of transcriptional activators that interact with other proteins in a conserved regulatory hierarchy to ensure normal embryological development. Mutations in one member, EYA4, can cause autosomal-dominant HI in families linked to the DFNA10 locus (123). The protein product of EYA4 probably plays a developmental role in embryogenesis and a survival role in the mature cochlea. Its exact role in the inner ear is not yet known. Interestingly, mutations in another EYA member, EYA1, can cause the Branchio-Oto-Renal syndrome, an autosomal-recessive disorder that is characterised by a variable combination of branchial arch abnormalities, HI, and renal abnormalities (124).

POU genes Pit, Oct, and Unc DNA-binding domain (POU) genes are members of a family of transcription-factor genes involved in development and, in particular, in terminal differentiation of neural cells (125). Mutations in two different POU-domain transcription-factor genes, POU3F4 and POU4F3, are associated with nonsyndromic hearing loss in families linked to DFN3 and DFNA15, respectively (126,127). The two genes are expressed in distinct cell types and at different time points. Mice that are deficient in the transcription factor pou3f4 have ultrastructurally abnormal fibrocytes and reduced endocochlear potential (128). POU3F4 is likely to be important for development of inner-ear mesenchyme, which gives rise to the fibrocytes of the spiral ligament (129,130). By comparing inner ear gene expression profiles of the wild type and the pou4f3 mutant deidler mouse strain (ddl), a new gene, g fi1 (growth-factor

69

independence 1) was identified as a likely target gene regulated by pou4f3 (131). Gfi1 is the first downstream target of a hair cell–specific transcription factor. The OHC degeneration in pou4f3 mutants is thus largely or perhaps entirely a result of the loss of expression of gfi1. Transcription factor cellular promoter 2 (TFCP2L3) TFCP2L3 encodes a member of the transcription factor cellular promoter 2 (TFCP2) protein family that has a broad epithelial pattern of expression, including cells that line the developing cochlear duct. It shows homology to the Drosophila gene grainyhead and causes autosomal-dominant HI in families linked to the DFNA28 locus (132).

Genes with atypical or poorly understood function The function of several deafness genes is currently not well known. No exact physiological role of these genes is known and, therefore, it is not possible to classify these genes in the previously described categories.

DFNA5 (DFNA5) DFNA5 was first localised in a single, large, Dutch kindred– segregating autosomal-dominant progressive hearing loss (133). The phenotype cosegregated with an insertion/deletion in the seventh intron of a gene of unknown function that was named DFNA5 (134). Later on, mutations were found in two other families (135,136). Although these mutations are different at the genomic DNA level, they all lead to skipping of exon 8 at the mRNA level. It is hypothesised that the HI associated with DFNA5 is caused by a gain-of-function mutation and that mutant DFNA5 has a deleterious new function (137). Morpholino antisense knockdown of DFNA5 function in zebrafish leads to disorganisation of the developing semicircular canal and reduction of pharyngeal cartilage. In DFNA5 morphants, expression of ugdh is absent in the developing ear and pharyngeal arches. Additionally, hyaluronic-acid (HA) levels are strongly reduced in the outgrowing protrusions of the developing semicircular canals (138). HA probably serves as a friction-reducing lubricant and molecular filter in the developing inner ear (139). It was proposed that a reduction of HA can lead to mechanical stress on hair cells and that this may lead to progressive HI (138).

Otoferlin (OTOF) OTOF is a novel member of a mammalian gene family related to the Caenorhabditis elegans spermatogenesis factor fer-1. OTOF is expressed exclusively in adult hair cells (140). Several mutations have been found to cause hearing loss in families

1181 Chap05

70

3/29/07

4:51 PM

Page 70

Genetics and hearing impairment

linked to the recessive DFNB9 locus (141,142). A founder mutation in this gene (Q829X) is a common cause of prelingual hearing loss in Spanish individuals who are not deaf due to GJB2 mutations (142). Interestingly, OTOF mutations are associated with a nonsyndromic, autosomal-recessive auditory neuropathy (143). Auditory neuropathy is a type of HI that preserves otoacoustic emissions and is not a known feature of any other autosomal-recessive phenotype. Therefore, genetic analysis of otoferlin may be indicated in cases of auditory neuropathy of presumed autosomal-recessive inheritance. However, another family with progressive, autosomal-dominant auditory neuropathy is reported by Kim et al. (144), and it maps to chromosome 13q14-21.

inner ear (150). This sodium channel may have a role in the maintenance of the low sodium concentration of endolymph.

Wolframin (WFS1)

Mutations in this transmembrane channel–like gene are known to cause an autosomal-recessive hearing loss as well as autosomaldominant hearing loss located at DFNB7/11 and DFNA36, respectively (145,146). TMC1 is predicted to encode a multipass transmembrane protein with no similarity to proteins of known function that is expressed in the hair cells of the postnatal mouse cochlea. TMC1 mutations were also identified in the autosomalrecessive deafness (dn) and autosomal-dominant Beethoven (Bth) mouse mutant strains segregating postnatal hair-cell degeneration (146,147). This indicates that TMC1 is required for postnatal hair-cell development or maintenance, although its exact function is not known.

WFS1 encodes a glycoprotein (wolframin), predominantly localised in the endoplasmic reticulum. In the cochlea, wolframin is mainly located in cells lining the scala media, in vestibular hair cells, and in spiral ganglion cells (152). Mutations in WFS1 cause the autosomal-recessive Wolfram syndrome and autosomal-dominant, low-frequency sensorineural HI DFNA6/14 (10,12,153,154). Wolfram syndrome is characterised by diabetes mellitus and optic atrophy, and, in most cases, by additional symptoms including diabetes insipidus, deafness, and urinary tract atony (155). Although not much is known about the exact function of wolframin, the gene has important diagnostic applications. Interestingly, only noninactivating WFS1 mutations that are mainly located in the C-terminal region cause nonsyndromic HI, whereas the majority of mutations in Wolfram syndrome are inactivating (156). This suggests that a loss of function of WFS1 is the cause of Wolfram syndrome. Homozygous wfs1 knockout mice developed glucose intolerance due to insufficient insulin secretion and a subsequent progressive ␤-cell loss. The severity of the diabetic phenotype was dependent on the mouse background. The defective insulin secretion is accompanied by reduced cellular calcium responses (157). The auditory function of the knockout mice has not yet been studied.

Transmembrane inner ear (TMIE)

Mitochondrial HI

Mutations in the TMIE gene are a cause of vestibular and audiological dysfunction in the spinner (sr) mouse model. The postnatal morphological defects of the stereocilia in this mouse model suggest a role for this gene in the correct development and maintenance of stereocilia bundles (148). TMIE is expressed in many tissues and has no similarity to other known proteins (148). In humans, this gene is mutated in several consanguineous families that are linked to the autosomal-recessive DFNB6 locus (106).

The mtDNA molecule encodes 13 protein-coding genes as well as 2 rRNAs and 22 tRNAs, which are required for assembling a functional mitochondrial protein-synthesizing system. A cell contains several of these mitochondrial genomes. When patients with a mitochondrial disease carry the mutation in every mtDNA molecule, it is called homoplasmic. When a mixed population of normal and mutant genomes is present, the mutation is heteroplasmic. Heterogeneous tissue distribution might therefore cause large phenotypic variability in patients with heteroplasmic mutations. mtDNA mutations are usually heteroplasmic, and most of them cause multisystem syndromes. Syndromic HI due to heteroplasmic mitochondrial mutations mostly has additional neuromuscular abnormalities (158). However, also nonsyndromic HI can be caused by mitochondrial mutations. The homoplasmic 1555A⬎ G mutation in the mitochondrial MTRNR1 gene that encodes the 12S rRNA was the first detected in nonsyndromic HI (Table 5.1) (159). Although in many pedigrees and individual patients with this 1555A ⬎ G mutation the hearing loss occurred after aminoglycoside exposure (175–177), a significant number of pedigrees were described with HI without aminoglycoside exposure (178,160). In contrast, with the normal 12S rRNA, the mutated form has a high affinity to aminoglycosides (179). Additionally, aminoglycosides clearly

Transmembrane channel 1 (TMC1)

Transmembrane serine protease 3 (TMPRSS3) Type II transmembrane serine proteases (TTSPs) represent an emerging class of cell-surface proteolytic enzymes. Most TTSPs have been identified relatively recently and have not yet been functionally characterised. TMPRSS3 is the only protease that has so far been identified as a causative gene for HI (DFNB8/10) (149). It is expressed in the supporting cells, the stria vascularis, and the spiral ganglion (150). Although the specific role of TMPRSS3 in the development and maintenance of the cochlea is still unknown, it is reported that deafness-causing mutations in this gene disrupt the proteolytic activity of the protein (151). This will probably affect the amiloride-sensitive sodium channel (ENaC) because this could be a substrate of TMPRSS3 in the

1181 Chap05

3/29/07

4:51 PM

Page 71

Nonsyndromic hearing loss: cracking the cochlear code

71

Table 5.1 Mitochondrial mutations involved in maternally inherited hearing impairment Nonsyndromic HI gene

Mutation

Presence of additional symptoms

References

12SrRNA

1555A→G

Aminoglycoside induced/worsened

159–161

1494C→T

Aminoglycoside induced/worsened

162

961 (diff. mut.)

Aminoglycoside induced/worsened

163,164

7445A→G

Palmoplantar keratoderma

165–167

7472insC

Neurological dysfunction

168–171

7510T→C

None

172

7511T→C

None

173,174

Ser(UCN)

tRNA

affect the protein synthesis of cells with mutated 12S rRNA (180). The phenotype of patients with the 1555A⬎ G mutation ranges from profound congenital deafness, through progressive moderate hearing loss to completely normal hearing. This phenotypic variability is influenced by putative modifier genes of which already two have been identified. The first is the highly conserved mitochondrial protein encoded by the nuclear MTO1 gene. It is involved in tRNA modification and may regulate the translational efficiency and accuracy of codon–anticodon base pairing on the coding region of ribosomes. It can contribute to the phenotypic variability of the 1555A⬎ G mutation by suppressing the phenotypic manifestation of the 1555A⬎ G mutation. The second gene encodes the mitochondrial transcription factor TFB1M (181). This methylates adenine residues in the adjacent loop of the 1555A⬎ G mutation in the MTRNR1 gene and its function is described as mitochondrial maintenance (181,182). Two other mutations in the MTRNR1 gene have been reported, both of which confer susceptibility to aminoglycoside-induced ototoxicity (961delT and 1494C⬎ T). In another gene, MTTS1, which encodes the mitochondrial Ser(UCN) , four mutations have been detected that cause nontRNA syndromic hearing loss (Table 5.1). Both the 7445A⬎ G and the 7472insC mutations have been found in families with syndromic and nonsyndromic hearing loss. Additional symptoms can be palmoplantar keratoderma for the 7445A⬎ G mutations and neurological dysfunction (ataxia and myoclonus) for the 7472insC mutation. To date, it is not fully understood how the Ser(UCN) defective tRNA and 12S rRNA can lead to hearing loss.

In a family linked to DFNB26, several patients homozygous for the disease haplotype do not have HI. Instead, they all have a shared haplotype at the DFNM1 modifier locus at chromosome 1q24 (183). This suggests a modifier gene at the DFNM1 locus that can rescue the loss of hearing due to the pathogenic DFNB26 allele. The map location of DFNM1 was within the DFNA7 interval, suggesting that the DFNM1-suppressor phenotype and the DFNA7 hearing loss may be phenotypic variants of the same gene. To date, the responsible gene in both intervals has not yet been identified. Most other identified modifier genes have a more subtle effect, affecting the age of onset, the degree of severity, or the rate of disease progression. Two examples of modifier genes detected in humans are MTO1 and TFB1M. These genes can cause variability in mitochondrial deafness and were described in the previous section. Several mouse models have already been used for detecting factors that modify the degree of hearing loss. The genetic diversity between inbred mouse strains makes them a valuable tool for studying the interaction of these factors. The 753A allele modifies the degree of hearing loss in the deafCDH23 waddler mouse, which is caused by a mutation in the pmca2 gene, a plasma membrane calcium pump located at chromosome 6 (184). This calcium pump helps to maintain low cytoso2⫹ 2⫹ lic Ca by pumping Ca out of the cell. To cause the early-onset hearing loss in mdfw mice, a combination of 753A homozygosity of the cdh23 allele must coexist with haploin753A sufficiency of pmca2. Interestingly, the CDH23 allele also contributes to the susceptibility for age-related hearing loss in mice (185,186).

Modifier genes for HI Phenotypic variation has been observed within both hearingimpaired families and individual patients carrying the same mutations. This variation can be attributed to either environmental or genetic factors. By interacting in the same or a parallel biological pathway as a disease gene, modifier genes can affect the phenotypic outcome of a given genotype.

Diagnostic applications To date, more than 100 loci for nonsyndromic hearing loss have been detected, and the responsible gene has been identified for 40 of them. Although this indeed represents a formidable result,

1181 Chap05

3/29/07

72

4:51 PM

Page 72

Genetics and hearing impairment

Table 5.2 Genetic testing for nonsyndromic hearing impairment

a

Gene

Inheritance

Clinical indications

COCH

AD

Late-onset (⬎30 yr) progressive HI and simultaneous vestibular dysfunction

OTOF

AR

Auditory neuropathy, congenital

SLC26A4

AR

Enlarged vestibular aqueduct, congenital

MTRNR1(12S rRNA)

M

Aminoglycoside-induced HI

WFS1

AD

Low-frequency HI, early onset

a

On the basis of specific clinical indications, routinely available in some laboratories. In the absence of specific indications, GJB2 (Cx26) testing is routinely carried out (for autosomal-recessive inheritance) in many laboratories. Abbreviations: AD, autosomal dominant; AR, autosomal recessive; HI, hearing impairment; M, mitochondrial.

many more genes need to be discovered and many more loci probably remain unidentified. Unfortunately, this large increase in knowledge has not led to widespread diagnostic applications, as has been the case for many other hereditary diseases. The most important obstacle is the extreme genetic heterogeneity. Nonsyndromic HI gives few clinical characteristics that can be used to subclassify patients. Moreover, the few characteristics that are available are often poor indicators of the involvement of specific genes because for most genes, there is a significant clinical variability. A few exceptions exist and in some situations a clue for a possible culprit gene can be obtained from clinical data (Table 5.2). However, these exceptions only apply to a small percentage of patients with putative genetic HI. This has led to the unfortunate situation that currently a large gap exists between scientific achievements for deafness genes and diagnostic applications that result from it. With increasingly more deafness genes being found in a small number of patients, this gap widens as research progresses. Despite these problems, there is one gene that has found widespread diagnostic applications. This gene is GJB2, and in several ways, it is an excellent gene for DNA diagnostics. Firstly, it is responsible for a large fraction of deafness patients in some populations, with up to 50% of patients having genetic deafness in Mediterranean countries. A second major advantage of the gene is its very small size, which makes genetic analysis affordable. However, for patients without GJB2 mutations or for populations with a low incidence of GJB2 mutations, the genetic causes are distributed over dozens of genes, some of which are very large in size and hence expensive to analyse. Screening all known deafness genes for mutations would be extremely expensive with current technology, prohibiting the diagnostic use of this procedure. A promising technique for future diagnostics may be the use of DNA microarrays (also called DNA chips). Microarrays offer the possibility of performing a large number of genetic tests in parallel in a single experiment. This can either be the analysis of many known mutations or be the complete mutation analysis of

one or more genes. Initiatives to use microarrays for DNA diagnostics in the deafness field are emerging. One initiative will use arrays to analyse all currently known mutations for Usher syndrome (H. Kremer, personal communication). As Usher syndrome is genetically heterogeneous, with mutations spread over several very large genes, traditional analysis is not cost effective, and DNA microarrays may yield a cost-effective alternative. A second initiative will use a DNA microarray for the complete mutation analysis of eight genes causing autosomal-recessive deafness (H. Rehm, personal communication). This method has the advantage that also currently unknown mutations can be detected, the disadvantage being that only a limited set of genes is included. However, this limitation is mainly based on the technological limitations of the array. Using several arrays, or using future more-dense arrays, the simultaneous analysis of many more genes may become a reality.

Conclusions Over the last decade, tremendous progress has been achieved in the identification of deafness genes. As a result, our understanding of the complex mechanism of hearing has increased enormously. It is to be expected that mapping and identification of new genes will continue for years to come, with a further growing insight in to the molecular biology of hearing. Promising results have recently been reported about phenotypic variability in hearing loss caused by modifier genes. The identification and characterisation of these modifiers will definitely be a new challenge for deafness research. Despite the escalating number of genes implicated in hearing loss, only a minority of them have routinely available diagnostic tests (Table 5.2). Therefore, a promising technique for future diagnostics will be the use of robust and cost-effective DNA microarrays. Hopefully, this will help in reducing the increasing gap between scientific research and diagnostic applications for hearing loss.

1181 Chap05

3/29/07

4:51 PM

Page 73

Nonsyndromic hearing loss: cracking the cochlear code

References 1. Mehl AL, Thomson V. The Colorado newborn hearing screening project, 1992–1999: on the threshold of effective population-based universal newborn hearing screening. Pediatrics 2002; 109:E7. 2. Marazita ML, Ploughman LM, Rawlings B, et al. Genetic epidemiological studies of early-onset deafness in the U.S. school-age population. Am J Med Genet 1993; 46:486–491. 3. Morton NE. Genetic epidemiology of hearing impairment. Ann N Y Acad Sci 1991; 630:16–31. 4. Davis A, Wood S, Healy R, et al. Risk factors for hearing disorders: epidemiologic evidence of change over time in the UK. J Am Acad Audiol 1995; 6:365–370. 5. Leon PE, Raventos H, Lynch E, et al. The gene for an inherited form of deafness maps to chromosome 5q31. Proc Natl Acad Sci USA 1992; 89:5181–5184. 6. Hereditary Hearing Loss Homepage, http://webhost.ua.ac.be/hhh. 7. Maestrini E, Korge BP, Ocana-Sierra J, et al. A missense mutation in connexin26, D66H, causes mutilating keratoderma with sensorineural deafness (Vohwinkel’s syndrome) in three unrelated families. Hum Mol Genet 1999; 8:1237–1243. 8. Alvarez A, del Castillo I, Pera A, et al. De novo mutation in the gene encoding connexin-26 (GJB2) in a sporadic case of keratitisichthyosis-deafness (KID) syndrome. Am J Med Genet 2003; 117A:89–91. 9. Heathcote K, Syrris P, Carter ND, et al. A connexin 26 mutation causes a syndrome of sensorineural hearing loss and palmoplantar hyperkeratosis (MIM 148350). J Med Genet 2000; 37:50–51. 10. Bespalova IN, Van Camp G, Bom SJ, et al. Mutations in the Wolfram syndrome 1 gene (WFS1) are a common cause of low frequency sensorineural hearing loss. Hum Mol Genet 2001; 10:2501–2508. 11. Everett LA, Glaser B, Beck JC, et al. Pendred syndrome is caused by mutations in a putative sulphate transporter gene (PDS). Nat Genet 1997; 17:411–422. 12. Inoue H, Tanizawa Y, Wasson J, et al. A gene encoding a transmembrane protein is mutated in patients with diabetes mellitus and optic atrophy (Wolfram syndrome). Nat Genet 1998; 20:143–148. 13. Li XC, Everett LA, Lalwani AK, et al. A mutation in PDS causes non-syndromic recessive deafness. Nat Genet 1998; 18:215–217. 14. Ahmed ZM, Smith TN, Riazuddin S, et al. Nonsyndromic recessive deafness DFNB18 and Usher syndrome type IC are allelic mutations of USHIC. Hum Genet 2002; 110:527–531. 15. Bitner-Glindzicz M, Lindley KJ, Rutland P, et al. A recessive contiguous gene deletion causing infantile hyperinsulinism, enteropathy and deafness identifies the Usher type 1C gene. Nat Genet 2000; 26:56–60. 16. Liu XZ, Newton VE, Steel KP, et al. Identification of a new mutation of the myosin VII head region in Usher syndrome type 1. Hum Mutat 1997; 10:168–170. 17. Verpy E, Leibovici M, Zwaenepoel I, et al. A defect in harmonin, a PDZ domain-containing protein expressed in the inner ear sensory hair cells, underlies Usher syndrome type 1C. Nat Genet 2000; 26:51–55.

73

18. Weil D, Blanchard S, Kaplan J, et al. Defective myosin VIIA gene responsible for Usher syndrome type 1B. Nature 1995; 374:60–61. 19. Weil D, Kussel P, Blanchard S, et al. The autosomal recessive isolated deafness, DFNB2, and the Usher 1B syndrome are allelic defects of the myosin-VIIA gene. Nat Genet 1997; 16:191–193. 20. Steel K. The benefits of recycling. Science 1999; 285:1363–1364. 21. Wangemann P. Comparison of ion transport mechanisms between vestibular dark cells and strial marginal cells. Hear Res 1995; 90:149–157. 22. Kikuchi T, Adams JC, Miyabe Y, et al. Potassium ion recycling pathway via gap junction systems in the mammalian cochlea and its interruption in hereditary nonsyndromic deafness. Med Electron Microsc 2000; 33:51–56. 23. Kikuchi T, Kimura RS, Paul DL, et al. Gap junctions in the rat cochlea: immunohistochemical and ultrastructural analysis. Anat Embryol (Berl) 1995; 191:101–118. 24. Lautermann J, ten Cate WJ, Altenhoff P, et al. Expression of the gap-junction connexins 26 and 30 in the rat cochlea. Cell Tissue Res 1998; 294:415–420. 25. Beltramello M, Piazza V, Bukauskas FF, et al. Impaired permeability to Ins(1,4,5)P3 in a mutant connexin underlies recessive hereditary deafness. Nat Cell Biol 2005; 7:63–69. 26. Zelante L, Gasparini P, Estivill X, et al. Connexin26 mutations associated with the most common form of non-syndromic neurosensory autosomal recessive deafness (DFNB1) in Mediterraneans. Hum Mol Genet 1997; 6:1605–1609. 27. Estivill X, Fortina P, Surrey S, et al. Connexin-26 mutations in sporadic and inherited sensorineural deafness. Lancet 1998; 351: 394–398. 28. Green GE, Scott DA, McDonald JM, et al. Carrier rates in the midwestern United States for GJB2 mutations causing inherited deafness. JAMA 1999; 281:2211–2216. 29. Ohtsuka A, Yuge I, Kimura S, et al. GJB2 deafness gene shows a specific spectrum of mutations in Japan, including a frequent founder mutation. Hum Genet 2003; 112:329–333. 30. Chaib H, Lina-Granade G, Guilford P, et al. A gene responsible for a dominant form of neurosensory non-syndromic deafness maps to the NSRD1 recessive deafness gene interval. Hum Mol Genet 1994; 3:2219–2222. 31. Kelsell DP, Wilgoss AL, Richard G, et al. Connexin mutations associated with palmoplantar keratoderma and profound deafness in a single family. Eur J Hum Genet 2000; 8:469–472. 32. Rouan F, White TW, Brown N, et al. Trans-dominant inhibition of connexin-43 by mutant connexin-26: implications for dominant connexin disorders affecting epidermal differentiation. J Cell Sci 2001; 114:2105–2113. 33. Van Laer L, Coucke P, Mueller RF, et al. A common founder for the 35delG GJB2 gene mutation in connexin 26 hearing impairment. J Med Genet 2001; 38:515–518. 34. Denoyelle F, Weil D, Maw MA, et al. Prelingual deafness: high prevalence of a 30delG mutation in the connexin 26 gene. Hum Mol Genet 1997; 6:2173–2177. 35. Kelley PM, Harris DJ, Comer BC, et al. Novel mutations in the connexin 26 gene (GJB2) that cause autosomal recessive (DFNB1) hearing loss. Am J Hum Genet 1998; 62:792–799.

1181 Chap05

74

3/29/07

4:51 PM

Page 74

Genetics and hearing impairment

36. Abe S, Usami S, Shinkawa H, et al. Prevalent connexin 26 gene (GJB2) mutations in Japanese. J Med Genet 2000; 37:41–43. 37. Park HJ, Hahn SH, Chun YM, et al. Connexin26 mutations associated with nonsyndromic hearing loss. Laryngoscope 2000; 110: 1535–1538. 38. Kudo T, Ikeda K, Kure S, et al. Novel mutations in the connexin 26 gene (GJB2) responsible for childhood deafness in the Japanese population. Am J Med Genet 2000; 90:141–145. 39. Morell RJ, Kim HJ, Hood LJ, et al. Mutations in the connexin 26 gene (GJB2) among Ashkenazi Jews with nonsyndromic recessive deafness. N Engl J Med 1998; 339:1500–1505. 40. Sobe T, Erlich P, Berry A, et al. High frequency of the deafnessassociated 167delT mutation in the connexin 26 (GJB2) gene in Israeli Ashkenazim. Am J Med Genet 1999; 86:499–500. 41. Brobby GW, Muller-Myhsok B, Horstmann RD. Connexin 26 R143W mutation associated with recessive nonsyndromic sensorineural deafness in Africa. N Engl J Med 1998; 338:548–550. 42. Gabriel HD, Jung D, Butzler C, et al. Transplacental uptake of glucose is decreased in embryonic lethal connexin26-deficient mice. J Cell Biol 1998; 140:1453–1461. 43. Cohen-Salmon M, Ott T, Michel V, et al. Targeted ablation of connexin26 in the inner ear epithelial gap junction network causes hearing impairment and cell death. Curr Biol 2002; 12: 1106–1111. 44. del Castillo I, Villamar M, Moreno-Pelayo MA, et al. A deletion involving the connexin 30 gene in nonsyndromic hearing impairment. N Engl J Med 2002; 346:243–249. 44a.del Castillo FJ, Rodriguez-Ballesteros M, Alvarez A, et al. Related articles, Links a novel deletion involving the connexin-30 gene, del (GJB6d13s1854), found in trans with mutations in the GJB2 gene (connexin-26) in subjects with DFNB1 non-syndromic hearing impairment. J Med Genet 2005; 42(7):588–594. 45. Ahmad S, Chen S, Sun J, et al. Connexins 26 and 30 are co-assembled to form gap junctions in the cochlea of mice. Biochem Biophys Res Commun 2003; 307:362–368. 46. Cryns K, Orzan E, Murgia A, et al. A genotype-phenotype correlation for GJB2 (connexin 26) deafness. J Med Genet 2004; 41: 147–154. 47. Grifa A, Wagner CA, D’Ambrosio L, et al. Mutations in GJB6 cause nonsyndromic autosomal dominant deafness at DFNA3 locus. Nat Genet 1999; 23:16–18. 48. Lamartine J, Munhoz Essenfelder G, Kibar Z, et al. Mutations in GJB6 cause hidrotic ectodermal dysplasia. Nat Genet 2000; 26:142–144. 49. Xia JH, Liu CY, Tang BS, et al. Mutations in the gene encoding gap junction protein beta-3 associated with autosomal dominant hearing impairment. Nat Genet 1998; 20:370–373. 50. Liu XZ, Xia XJ, Xu LR, et al. Mutations in connexin31 underlie recessive as well as dominant non-syndromic hearing loss. Hum Mol Genet 2000; 9:63–67. 51. Richard G, White TW, Smith LE, et al. Functional defects of Cx26 resulting from a heterozygous missense mutation in a family with dominant deaf-mutism and palmoplantar keratoderma. Hum Genet 1998; 103:393–399.

52. Lopez-Bigas N, Olive M, Rabionet R, et al. Connexin 31 (GJB3) is expressed in the peripheral and auditory nerves and causes neuropathy and hearing impairment. Hum Mol Genet 2001; 10:947–952. 53. Young P, Grote K, Kuhlenbaumer G, et al. Mutation analysis in Chariot-Marie Tooth disease type 1: point mutations in the MPZ gene and the GJB1 gene cause comparable phenotypic heterogeneity. J Neurol 2001; 248:410–415. 54. Plum A, Winterhager E, Pesch J, et al. Connexin31-deficiency in mice causes transient placental dysmorphogenesis but does not impair hearing and skin differentiation. Dev Biol 2001; 231:334–347. 55. Madara JL. Regulation of the movement of solutes across tight junctions. Annu Rev Physiol 1998; 60:143–159. 56. Furuse M, Hirase T, Itoh M, et al. Occludin: a novel integral membrane protein localizing at tight junctions. J Cell Biol 1993; 123:1777–1788. 57. Tsukita S, Furuse M. The structure and function of claudins, cell adhesion molecules at tight junctions. Ann N Y Acad Sci 2000; 915:129–135. 58. Martin-Padura I, Lostaglio S, Schneemann M, et al. Junctional adhesion molecule, a novel member of the immunoglobulin superfamily that distributes at intercellular junctions and modulates monocyte transmigration. J Cell Biol 1998; 142:117–127. 59. Wilcox ER, Burton QL, Naz S, et al. Mutations in the gene encoding tight junction claudin-14 cause autosomal recessive deafness DFNB29. Cell 2001; 104:165–172. 60. Ben-Yosef T, Belyantseva IA, Saunders TL, et al. Claudin 14 knockout mice, a model for autosomal recessive deafness DFNB29, are deaf due to cochlear hair cell degeneration. Hum Mol Genet 2003; 12:2049–2061. 61. Kharkovets T, Hardelin JP, Safieddine S, et al. KCNQ4, a K⫹ channel mutated in a form of dominant deafness, is expressed in the inner ear and the central auditory pathway. Proc Natl Acad Sci USA 2000; 97:4333–4338. 62. Beisel KW, Nelson NC, Delimont DC, et al. Longitudinal gradients of KCNQ4 expression in spiral ganglion and cochlear hair cells correlate with progressive hearing loss in DFNA2. Brain Res Mol Brain Res 2000; 82:137–149. 63. Phelps PD, Coffey RA, Trembath RC, et al. Radiological malformations of the ear in Pendred syndrome. Clin Radiol 1998; 53: 268–273. 64. Everett LA, Morsli H, Wu DK, et al. Expression pattern of the mouse ortholog of the Pendred’s syndrome gene (Pds) suggests a key role for pendrin in the inner ear. Proc Natl Acad Sci USA 1999; 96:9727–9732. 65. Naganawa S, Koshikawa T, Fukatsu H, et al. Enlarged endolymphatic duct and sac syndrome: relationship between MR findings and genotype of mutation in Pendred syndrome gene. Magn Reson Imaging 2004; 22:25–30. 66. Frolenkov GI, Belyantseva IA, Friedman TB, et al. Genetic insights into the morphogenesis of inner ear hair cells. Nat Rev Genet 2004; 5:489–498. 67. Siemens J, Lillo C, Dumont RA, et al. Cadherin 23 is a component of the tip link in hair-cell stereocilia. Nature 2004; 428:950–955.

1181 Chap05

3/29/07

4:51 PM

Page 75

Nonsyndromic hearing loss: cracking the cochlear code

68. Sollner C, Rauch GJ, Siemens J, et al. Mutations in cadherin 23 affect tip links in zebrafish sensory hair cells. Nature 2004; 428: 955–959. 69. Bork JM, Peters LM, Riazuddin S, et al. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of the novel cadherin-like gene CDH23. Am J Hum Genet 2001; 68:26–37. 70. Di Palma F, Holme RH, Bryda EC, et al. Mutations in Cdh23, encoding a new type of cadherin, cause stereocilia disorganization in waltzer, the mouse model for Usher syndrome type 1D. Nat Genet 2001; 27:103–107. 71. Bolz H, von Brederlow B, Ramirez A, et al. Mutation of CDH23, encoding a new member of the cadherin gene family, causes Usher syndrome type 1D. Nat Genet 2001; 27:108–112. 72. Ahmed ZM, Riazuddin S, Ahmad J, et al. PCDH15 is expressed in the neurosensory epithelium of the eye and ear and mutant alleles are responsible for both USH1F and DFNB23. Hum Mol Genet 2003; 12:3215–3223. 73. Alagramam KN, Yuan H, Kuehn MH, et al. Mutations in the novel protocadherin PCDH15 cause Usher syndrome type 1F. Hum Mol Genet 2001; 10:1709–1718. 74. Ahmed ZM, Riazuddin S, Bernstein SL, et al. Mutations of the protocadherin gene PCDH15 cause Usher syndrome type 1F. Am J Hum Genet 2001; 69:25–34. 75. Alagramam KN, Zahorsky-Reeves J, Wright CG, et al. Neuroepithelial defects of the inner ear in a new allele of the mouse mutation Ames waltzer. Hear Res 2000; 148:181–191. 76. Hampton LL, Wright CG, Alagramam KN, et al. A new spontaneous mutation in the mouse Ames waltzer gene, Pcdh15. Hear Res 2003; 180:67–75. 77. Libby RT, Kitamoto J, Holme RH, et al. Cdh23 mutations in the mouse are associated with retinal dysfunction but not retinal degeneration. Exp Eye Res 2003; 77:731–739. 78. Boeda B, El-Amraoui A, Bahloul A, et al. Myosin VIIa, harmonin and cadherin 23, three Usher I gene products that cooperate to shape the sensory hair cell bundle. Embo J 2002; 21:6689–6699. 79. Siemens J, Kazmierczak P, Reynolds A, et al. The Usher syndrome proteins cadherin 23 and harmonin form a complex by means of PDZ-domain interactions. Proc Natl Acad Sci USA 2002; 99: 14946–14951. 80. Weil D, El-Amraoui A, Masmoudi S, et al. Usher syndrome type I G (USH1G) is caused by mutations in the gene encoding SANS, a protein that associates with the USH1C protein, harmonin. Hum Mol Genet 2003; 12:463–471. 81. Mburu P, Mustapha M, Varela A, et al. Defects in whirlin, a PDZ domain molecule involved in stereocilia elongation, cause deafness in the whirler mouse and families with DFNB31. Nat Genet 2003; 34:421–428. 82. Sellers JR, Goodson HV. Motor proteins 2: myosin. Protein Profile 1995; 2:1323–1423. 83. Berg JS, Powell BC, Cheney RE. A millennial myosin census. Mol Biol Cell 2001; 12:780–794. 84. Melchionda S, Ahituv N, Bisceglia L, et al. MYO6, the human homologue of the gene responsible for deafness in Snell’s waltzer

85.

86.

87.

88.

89. 90.

91. 92.

93.

94.

95.

96.

97.

98.

99. 100. 101.

75

mice, is mutated in autosomal dominant nonsyndromic hearing loss. Am J Hum Genet 2001; 69:635–640. Ahmed ZM, Morell RJ, Riazuddin S, et al. Mutations of MYO6 are associated with recessive deafness, DFNB37. Am J Hum Genet 2003; 72:1315–1322. Wang A, Liang Y, Fridell RA, et al. Association of unconventional myosin MYO15 mutations with human nonsyndromic deafness DFNB3. Science 1998; 280:1447–1451. Avraham KB, Hasson T, Sobe T, et al. Characterization of unconventional MYO6, the human homologue of the gene responsible for deafness in Snell’s waltzer mice. Hum Mol Genet 1997; 6:1225–1231. Avraham KB, Hasson T, Steel KP, et al. The mouse Snell’s waltzer deafness gene encodes an unconventional myosin required for structural integrity of inner ear hair cells. Nat Genet 1995; 11:369–375. Self T, Sobe T, Copeland NG, et al. Role of myosin VI in the differentiation of cochlear hair cells. Dev Biol 1999; 214:331–341. Altman D, Sweeney HL, Spudich JA. The mechanism of myosin VI translocation and its load-induced anchoring. Cell 2004; 116:737–749. Gibson F, Walsh J, Mburu P, et al. A type VII myosin encoded by the mouse deafness gene shaker-1. Nature 1995; 374:62–64. Self T, Mahony M, Fleming J, et al. Shaker-1 mutations reveal roles for myosin VIIA in both development and function of cochlear hair cells. Development 1998; 125:557–566. Belyantseva IA, Boger ET, Friedman TB. Myosin XVa localizes to the tips of inner ear sensory cell stereocilia and is essential for staircase formation of the hair bundle. Proc Natl Acad Sci USA 2003; 100:13958–13963. Lalwani AK, Goldstein JA, Kelley MJ, et al. Human nonsyndromic hereditary deafness DFNA17 is due to a mutation in nonmuscle myosin MYH9. Am J Hum Genet 2000; 67:1121–1128. Donaudy F, Snoeckx R, Pfister M, et al. Nonmuscle myosin heavy-chain gene MYH14 is expressed in cochlea and mutated in patients affected by autosomal dominant hearing impairment (DFNA4). Am J Hum Genet 2004; 74:770–776. Toren A, Rozenfeld-Granot G, Rocca B, et al. Autosomaldominant giant platelet syndromes: a hint of the same genetic defect as in Fechtner syndrome owing to a similar genetic linkage to chromosome 22q11–13. Blood 2000; 96:3447–3451. Donaudy F, Ferrara A, Esposito L, et al. Multiple mutations of MYO1A, a cochlear-expressed gene, in sensorineural hearing loss. Am J Hum Genet 2003; 72:1571–1577. Walsh T, Walsh V, Vreugde S, et al. From flies’ eyes to our ears: mutations in a human class III myosin cause progressive nonsyndromic hearing loss DFNB30. Proc Natl Acad Sci USA 2002; 99:7518–7523. Khaitlina SY. Functional specificity of actin isoforms. Int Rev Cytol 2001; 202:35–98. Hofer D, Ness W, Drenckhahn D. Sorting of actin isoforms in chicken auditory hair cells. J Cell Sci 1997;110(Pt 6):765–770. Zhu M, Yang T, Wei S, et al. Mutations in the gamma-actin gene (ACTG1) are associated with dominant progressive deafness (DFNA20/26). Am J Hum Genet 2003; 73:1082–1091.

1181 Chap05

76

3/29/07

4:51 PM

Page 76

Genetics and hearing impairment

102. Higashida C, Miyoshi T, Fujita A, et al. Actin polymerizationdriven molecular movement of mDia1 in living cells. Science 2004; 303:2007–2010. 103. Lynch ED, Lee MK, Morrow JE, et al. Nonsyndromic deafness DFNA1 associated with mutation of a human homolog of the Drosophila gene diaphanous. Science 1997; 278:1315–1318. 104. Zheng L, Sekerkova G, Vranich K, et al. The deaf jerker mouse has a mutation in the gene encoding the espin actin-bundling proteins of hair cell stereocilia and lacks espins. Cell 2000; 102:377–385. 105. Loomis PA, Zheng L, Sekerkova G, et al. Espin cross-links cause the elongation of microvillus-type parallel actin bundles in vivo. J Cell Biol 2003; 163:1045–1055. 106. Naz S, Griffith AJ, Riazuddin S, et al. Mutations of ESPN cause autosomal recessive deafness and vestibular dysfunction. J Med Genet 2004; 41:591–595. 107. Brownell WE, Bader CR, Bertrand D, et al. Evoked mechanical responses of isolated cochlear outer hair cells. Science 1985; 227:194–196. 108. Dallos P, Fakler B. Prestin, a new type of motor protein. Nat Rev Mol Cell Biol 2002; 3:104–111. 109. Liu XZ, Ouyang XM, Zia XY, et al. Prestin, a cochlear motor protein, is defective in non-sndromic hearing loss. Hum Mol Genet 2003; 12:1155–1162. 109a. Tang HY, Xia A, Oghalai JS, Pereira FA, Alford RL. High frequency of the IVS2-2A>G DNA sequence variation in SLC26A5, encoding the cochler motor proein prestin, precludes its involvement in hereditary hearing loss. BMC Med Genet 2005; 6:30. 110. Liberman MC, Gao J, He DZ, et al. Prestin is required for electromotility of the outer hair cell and for the cochlear amplifier. Nature 2002; 419:300–304. 111. Robertson NG, Khetarpal U, Gutierrez-Espeleta GA, et al. Isolation of novel and known genes from a human fetal cochlear cDNA library using subtractive hybridization and differential screening. Genomics 1994; 23:42–50. 112. Ikezono T, Omori A, Ichinose S, et al. Identification of the protein product of the Coch gene (hereditary deafness gene) as the major component of bovine inner ear protein. Biochim Biophys Acta 2001; 1535:258–265. 113. Robertson NG, Resendes BL, Lin JS, et al. Inner ear localization of mRNA and protein products of COCH, mutated in the sensorineural deafness and vestibular disorder, DFNA9. Hum Mol Genet 2001; 10:2493–2500. 114. Fransen E, Verstreken M, Bom SJ, et al. A common ancestor for COCH related cochleovestibular (DFNA9) patients in Belgium and The Netherlands bearing the P51S mutation. J Med Genet 2001; 38:61–65. 115. McGuirt WT, Prasad SD, Griffith AJ, et al. Mutations in COL11A2 cause non-syndromic hearing loss (DFNA13). Nat Genet 1999; 23:413–419. 116. van Steensel MA, Buma P, de Waal Malefijt MC, et al. Otospondylo-megaepiphyseal dysplasia (OSMED): clinical description of three patients homozygous for a missense mutation in the COL11A2 gene. Am J Med Genet 1997; 70:315–323.

117. Jovine L, Park J, Wassarman PM. Sequence similarity between stereocilin and otoancorin points to a unified mechanism for mechanotransduction in the mammalian inner ear. BMC Cell Biol 2002; 3:28. 118. Verpy E, Masmoudi S, Zwaenepoel I, et al. Mutations in a new gene encoding a protein of the hair bundle cause nonsyndromic deafness at the DFNB16 locus. Nat Genet 2001; 29:345–349. 119. Zwaenepoel I, Mustapha M, Leibovici M, et al. Otoancorin, an inner ear protein restricted to the interface between the apical surface of sensory epithelia and their overlying acellular gels, is defective in autosomal recessive deafness DFNB22. Proc Natl Acad Sci USA 2002; 99:6240–6245. 120. Verhoeven K, Van Laer L, Kirschhofer K, et al. Mutations in the human alpha-tectorin gene cause autosomal dominant non-syndromic hearing impairment. Nat Genet 1998; 19:60–62. 121. Mustapha M, Weil D, Chardenoux S, et al. An alpha-tectorin gene defect causes a newly identified autosomal recessive form of sensorineural pre-lingual non-syndromic deafness, DFNB21. Hum Mol Genet 1999; 8:409–412. 122. Legan PK, Lukashkina VA, Goodyear RJ, et al. A targeted deletion in alpha-tectorin reveals that the tectorial membrane is required for the gain and timing of cochlear feedback. Neuron 2000; 28:273–285. 123. Wayne S, Robertson NG, DeClau F, et al. Mutations in the transcriptional activator EYA4 cause late-onset deafness at the DFNA10 locus. Hum Mol Genet 2001; 10:195–200. 124. Abdelhak S, Kalatzis V, Heilig R, et al. Clustering of mutations responsible for branchio-oto-renal (BOR) syndrome in the eyes absent homologous region (eyaHR) of EYA1. Hum Mol Genet 1997; 6:2247–2255. 125. Wegner M, Drolet DW, Rosenfeld MG. POU-domain proteins: structure and function of developmental regulators. Curr Opin Cell Biol 1993; 5:488–498. 126. de Kok YJ, van der Maarel SM, Bitner-Glindzicz M, et al. Association between X-linked mixed deafness and mutations in the POU domain gene POU3F4. Science 1995; 267:685–688. 127. Vahava O, Morell R, Lynch ED, et al. Mutation in transcription factor POU4F3 associated with inherited progressive hearing loss in humans. Science 1998; 279:1950–1954. 128. Minowa O, Ikeda K, Sugitani Y, et al. Altered cochlear fibrocytes in a mouse model of DFN3 nonsyndromic deafness. Science 1999; 285:1408–1411. 129. Phippard D, Heydemann A, Lechner M, et al. Changes in the subcellular localization of the Brn4 gene product precede mesenchymal remodeling of the otic capsule. Hear Res 1998; 120: 77–85. 130. Phippard D, Lu L, Lee D, et al. Targeted mutagenesis of the POU-domain gene Brn4/Pou3f4 causes developmental defects in the inner ear. J Neurosci 1999; 19:5980–5989. 131. Hertzano R, Montcouquiol M, Rashi-Elkeles S, et al. Transcription profiling of inner ears from Pou4f3(ddl/ddl) identifies Gfi1 as a target of the Pou4f3 deafness gene. Hum Mol Genet 2004; 13:2143–2153.

1181 Chap05

3/29/07

4:51 PM

Page 77

Nonsyndromic hearing loss: cracking the cochlear code

132. Peters LM, Anderson DW, Griffith AJ, et al. Mutation of a transcription factor, TFCP2L3, causes progressive autosomal dominant hearing loss, DFNA28. Hum Mol Genet 2002; 11:2877–2885. 133. van Camp G, Coucke P, Balemans W, et al. Localization of a gene for non-syndromic hearing loss (DFNA5) to chromosome 7p15. Hum Mol Genet 1995; 4:2159–2163. 134. Van Laer L, Huizing EH, Verstreken M, et al. Nonsyndromic hearing impairment is associated with a mutation in DFNA5. Nat Genet 1998; 20:194–197. 135. Yu C, Meng X, Zhang S, et al. A 3-nucleotide deletion in the polypyrimidine tract of intron 7 of the DFNA5 gene causes nonsyndromic hearing impairment in a Chinese family. Genomics 2003; 82:575–579. 136. Bischoff AM, Luijendijk MW, Huygen PL, et al. A novel mutation identified in the DFNA5 gene in a Dutch family: a clinical and genetic evaluation. Audiol Neurootol 2004; 9:34–46. 137. Van Laer L, Vrijens K, Thys S, et al. DFNA5: hearing impairment exon instead of hearing impairment gene? J Med Genet 2004; 41:401–406. 138. Busch-Nentwich E, Sollner C, Roehl H, et al. The deafness gene dfna5 is crucial for ugdh expression and HA production in the developing ear in zebrafish. Development 2004; 131:943–951. 139. Anniko M, Arnold W. Hyaluronic acid as a molecular filter and friction-reducing lubricant in the human inner ear. ORL J Otorhinolaryngol Relat Spec 1995; 57:82–86. 140. Yasunaga S, Grati M, Cohen-Salmon M, et al. A mutation in OTOF, encoding otoferlin, a FER-1-like protein, causes DFNB9, a nonsyndromic form of deafness. Nat Genet 1999; 21:363–369. 141. Houseman MJ, Jackson AP, Al-Gazali LI, et al. A novel mutation in a family with non-syndromic sensorineural hearing loss that disrupts the newly characterised OTOF long isoforms. J Med Genet 2001; 38:E25. 142. Migliosi V, Modamio-Hoybjor S, Moreno-Pelayo MA, et al. Q829X, a novel mutation in the gene encoding otoferlin (OTOF), is frequently found in Spanish patients with prelingual non-syndromic hearing loss. J Med Genet 2002; 39:502–506. 143. Rodriguez-Ballesteros M, del Castillo FJ, Martin Y, et al. Auditory neuropathy in patients carrying mutations in the otoferlin gene (OTOF). Hum Mutat 2003; 22:451–456. 144. Kim TB, Isaacson B, Sivakumaran TA, et al. A gene responsible for autosomal dominant auditory neuropathy (AUNA1) maps to 13q14–21. J Med Genet 2004; 41:872–876. 145. Scott DA, Carmi R, Elbedour K, et al. An autosomal recessive nonsyndromic-hearing-loss locus identified by DNA pooling using two inbred Bedouin kindreds. Am J Hum Genet 1996; 59:385–391. 146. Kurima K, Peters LM, Yang Y, et al. Dominant and recessive deafness caused by mutations of a novel gene, TMC1, required for cochlear hair-cell function. Nat Genet 2002; 30:277–284. 147. Vreugde S, Erven A, Kros CJ, et al. Beethoven, a mouse model for dominant, progressive hearing loss DFNA36. Nat Genet 2002; 30:257–258. 148. Mitchem KL, Hibbard E, Beyer LA, et al. Mutation of the novel gene Tmie results in sensory cell defects in the inner ear of

149.

150.

151.

152.

153.

154.

155.

156.

157.

158. 159.

160.

161.

162.

77

spinner, a mouse model of human hearing loss DFNB6. Hum Mol Genet 2002; 11:1887–1898. Scott HS, Kudoh J, Wattenhofer M, et al. Insertion of betasatellite repeats identifies a transmembrane protease causing both congenital and childhood onset autosomal recessive deafness. Nat Genet 2001; 27:59–63. Guipponi M, Vuagniaux G, Wattenhofer M, et al. The transmembrane serine protease (TMPRSS3) mutated in deafness DFNB8/10 activates the epithelial sodium channel (ENaC) in vitro. Hum Mol Genet 2002; 11:2829–2836. Lee YJ, Park D, Kim SY, et al. Pathogenic mutations but not polymorphisms in congenital and childhood onset autosomal recessive deafness disrupt the proteolytic activity of TMPRSS3. J Med Genet 2003; 40:629–631. Cryns K, Thys S, Van Laer L, et al. The WFS1 gene, responsible for low frequency sensorineural hearing loss and Wolfram syndrome, is expressed in a variety of inner ear cells. Histochem Cell Biol 2003; 119:247–256. Young TL, Ives E, Lynch E, et al. Non-syndromic progressive hearing loss DFNA38 is caused by heterozygous missense mutation in the Wolfram syndrome gene WFS1. Hum Mol Genet 2001; 10:2509–2514. Strom TM, Hortnagel K, Hofmann S, et al. Diabetes insipidus, diabetes mellitus, optic atrophy and deafness (DIDMOAD) caused by mutations in a novel gene (wolframin) coding for a predicted transmembrane protein. Hum Mol Genet 1998; 7:2021–2028. Wolfram DJ, Wagener HP. Diabetes mellitus and simple optic atrophy among siblings: report of four cases. Mayo Clin Proc 1938; 13:715–718. Cryns K, Sivakumaran TA, Van den Ouweland JM, et al. Mutational spectrum of the WFS1 gene in Wolfram syndrome, nonsyndromic hearing impairment, diabetes mellitus, and psychiatric disease. Hum Mutat 2003; 22:275–287. Ishihara H, Takeda S, Tamura A, et al. Disruption of the WFS1 gene in mice causes progressive beta-cell loss and impaired stimulus-secretion coupling in insulin secretion. Hum Mol Genet 2004; 13:1159–1170. Fischel-Ghodsian N. Mitochondrial deafness mutations reviewed. Hum Mutat 1999; 13:261–270. Prezant TR, Agapian JV, Bohlman MC, et al. Mitochondrial ribosomal RNA mutation associated with both antibiotic-induced and non-syndromic deafness. Nat Genet 1993; 4:289–294. Estivill X, Govea N, Barcelo E, et al. Familial progressive sensorineural deafness is mainly due to the mtDNA A1555G mutation and is enhanced by treatment of aminoglycosides. Am J Hum Genet 1998; 62:27–35. Usami S, Abe S, Kasai M, et al. Genetic and clinical features of sensorineural hearing loss associated with the 1555 mitochondrial mutation. Laryngoscope 1997; 107:483–490. Zhao H, Li R, Wang Q, et al. Maternally inherited aminoglycosideinduced and nonsyndromic deafness is associated with the novel C1494T mutation in the mitochondrial 12S rRNA gene in a large Chinese family. Am J Hum Genet 2004; 74:139–152.

1181 Chap05

78

3/29/07

4:51 PM

Page 78

Genetics and hearing impairment

163. Bacino C, Prezant TR, Bu X, et al. Susceptibility mutations in the mitochondrial small ribosomal RNA gene in aminoglycoside induced deafness. Pharmacogenetics 1995; 5:165–172. 164. Casano RA, Johnson DF, Bykhovskaya Y, et al. Inherited susceptibility to aminoglycoside ototoxicity: genetic heterogeneity and clinical implications. Am J Otolaryngol 1999; 20:151–156. 165. Fischel-Ghodsian N, Prezant TR, Fournier P, et al. Mitochondrial mutation associated with nonsyndromic deafness. Am J Otolaryngol 1995; 16:403–408. 166. Reid FM, Vernham GA, Jacobs HT. A novel mitochondrial point mutation in a maternal pedigree with sensorineural deafness. Hum Mutat 1994; 3:243–247. 167. Sevior KB, Hatamochi A, Stewart IA, et al. Mitochondrial A7445G mutation in two pedigrees with palmoplantar keratoderma and deafness. Am J Med Genet 1998; 75:179–185. 168. Jaksch M, Klopstock T, Kurlemann G, et al. Progressive myoclonus epilepsy and mitochondrial myopathy associated with mutations in the tRNA(Ser(UCN)) gene. Ann Neurol 1998; 44:635–640. 169. Schuelke M, Bakker M, Stoltenburg G, et al. Epilepsia partialis continua associated with a homoplasmic mitochondrial tRNA(Ser(UCN)) mutation. Ann Neurol 1998; 44:700–704. 170. Tiranti V, Chariot P, Carella F, et al. Maternally inherited hearing loss, ataxia and myoclonus associated with a novel point mutation in mitochondrial tRNASer(UCN) gene. Hum Mol Genet 1995; 4:1421–1427. 171. Verhoeven K, Ensink RJ, Tiranti V, et al. Hearing impairment and neurological dysfunction associated with a mutation in the mitochondrial tRNASer(UCN) gene. Eur J Hum Genet 1999; 7:45–51. 172. Hutchin T. Sensorineural hearing loss and the 1555G mitochondrial DNA mutation. Acta Otolaryngol 1999; 119:48–52. 173. Gluckman E, Broxmeyer HA, Auerbach AD, et al. Hematopoietic reconstitution in a patient with Fanconi’s anemia by means of umbilical-cord blood from an HLA-identical sibling. N Engl J Med 1989; 321:1174–1178. 174. Sue CM, Tanji K, Hadjigeorgiou G, et al. Maternally inherited hearing loss in a large kindred with a novel T7511C mutation in the mitochondrial DNA tRNA(Ser(UCN)) gene. Neurology 1999; 52:1905–1908.

175. Matthijs G, Claes S, Longo-Mbenza B, et al. Non-syndromic deafness associated with a mutation and a polymorphism in the mitochondrial 12S ribosomal RNA gene in a large Zairean pedigree. Eur J Hum Genet 1996; 4:46–51. 176. Pandya A, Xia X, Radnaabazar J, et al. Mutation in the mitochondrial 12S rRNA gene in two families from Mongolia with matrilineal aminoglycoside ototoxicity. J Med Genet 1997; 34: 169–172. 177. Gardner JC, Goliath R, Viljoen D, et al. Familial streptomycin ototoxicity in a South African family: a mitochondrial disorder. J Med Genet 1997; 34:904–906. 178. el-Schahawi M, Lopez de Munain A, Sarrazin AM, et al. Two large Spanish pedigrees with nonsyndromic sensorineural deafness and the mtDNA mutation at nt 1555 in the 12s rRNA gene: evidence of heteroplasmy. Neurology 1997; 48:453–456. 179. Hamasaki K, Rando RR. Specific binding of aminoglycosides to a human rRNA construct based on a DNA polymorphism which causes aminoglycoside-induced deafness. Biochemistry 1997; 36:12323–12328. 180. Guan MX, Fischel-Ghodsian N, Attardi G. A biochemical basis for the inherited susceptibility to aminoglycoside ototoxicity. Hum Mol Genet 2000; 9:1787–1793. 181. Bykhovskaya Y, Mengesha E, Wang D, et al. Human mitochondrial transcription factor B1 as a modifier gene for hearing loss associated with the mitochondrial A1555G mutation. Mol Genet Metab 2004; 82:27–32. 182. Seidel-Rogol BL, McCulloch V, Shadel GS. Human mitochondrial transcription factor B1 methylates ribosomal RNA at a conserved stem-loop. Nat Genet 2003; 33:23–24. 183. Riazuddin S, Castelein CM, Ahmed ZM, et al. Dominant modifier DFNM1 suppresses recessive deafness DFNB26. Nat Genet 2000; 26:431–434. 184. Street VA, McKee-Johnson JW, Fonseca RC, et al. Mutations in a plasma membrane Ca2⫹ -ATPase gene cause deafness in deafwaddler mice. Nat Genet 1998; 19:390–394. 185. Zheng QY, Johnson KR, Erway LC. Assessment of hearing in 80 inbred strains of mice by ABR threshold analyses. Hear Res 1999; 130:94–107. 186. Nemoto M, Morita Y, Mishima Y, et al. Ahl3, a third locus on mouse chromosome 17 affecting age-related hearing loss. Biochem Biophys Res Commun 2004; 324:1283–1288.

1181 Chap06

3/29/07

4:55 PM

Page 79

6 Age-related hearing impairment: ensemble playing of environmental and genetic factors Lut Van Laer, Guy Van Camp

Introduction The next 50 years will witness a significant increase in ageing in the European Union, the United States, and Japan, with the number of people aged 65 and above growing significantly. The most common sensory impairment among the elderly is agerelated hearing impairment (ARHI), also called presbyacusis. In its most typical presentation, ARHI is mid to late adult-onset, progressive, bilaterally symmetrical, sensorineural, and most pronounced in the high frequencies, leading to a moderately sloping pure tone audiogram. Thirty-seven percent of people aged between 61 and 70 have a significant hearing loss of at least 25 dB (1). This prevalence increases further at older ages. Sixty percent of 71- to 80-year-olds are affected by ARHI (1). Considering the ageing of the population in large parts of the Northern hemisphere, the number of people affected by ARHI will steadily increase in the future. ARHI patients often experience difficulty adjusting to their sensory loss. In addition, hearing loss may have a major influence on their quality of life and their feeling of well-being. Hearing impairment has a deleterious impact on social life; reduced communication skills frequently result in poor psychosocial functioning and consequently in isolation of the ageing individual. In addition, ARHI grossly limits independence and may contribute to depression, anxiety, lethargy, and possibly cognitive decline (2).

Currently, hearing aids are the only possibility for therapeutic intervention in ARHI. Unfortunately, these are only suitable for a limited number of people. Although hearing aids succeed in sufficient amplification of sound, the gain in speech recognition is often experienced as poor, especially in noisy environments. In addition, many do not accept hearing aids because of social stigmatisation. Future therapies for hearing impairment will have to rely on basic rather than on symptomatic approaches. This requires a thorough knowledge of the aetiological factors leading to ARHI. Up to now, little research has been performed on ARHI. This is, at least partly, due to the misconception that hearing impairment is an inevitable burden of ageing, rather than a potentially preventable or even curable disease. This chapter will give an overview of the current status of knowledge on ARHI and will outline future research aiming at the identification of the genetic risk factors involved in ARHI.

Epidemiology ARHI is the most frequent sensory disability of the elderly. Between the ages of 61 and 70, the prevalence of clinically significant hearing loss (25 dB and over) for the general British population was approximately 37%, increasing to 60% between the ages of 71 and 80 (pure tone thresholds averaged for 0.5, 1,

1181 Chap06

80

3/29/07

4:55 PM

Page 80

Genetics and hearing impairment

2, and 4 kHz in the better ear) (1). These figures are comparable with those obtained in a U.S. population-based crosssectional study—the Beaver Dam Epidemiology of Hearing Loss Study in Wisconsin. The latter study revealed prevalence figures of 44% for the age range 60 to 69 years and 66% for the 70 to 79 age range (pure tone thresholds averaged for 0.5, 1, 2, and 4 kHz in the worse ear) (3). The same population was investigated five years later. Twenty-one percent of subjects with normal hearing abilities during the first investigation showed a significant hearing loss in the follow-up examination, indicating that older adults (between 48 and 92 years) have a high risk of developing ARHI (4). The prevalence of ARHI is gender related, in general, men being more severely affected (1,3). Using data from the extended Baltimore Longitudinal Study of Ageing, it was concluded that hearing thresholds increase more than twice as fast in men as in women for all ages and frequencies, that the age of onset is later in women than in men, and that men hear better than women at lower frequencies, while women hear better than men at frequencies above 1000 Hz (5). Interestingly, gender-related differences were also detected in mouse models for age-related hearing loss (AHL). In CBA mice, a model for late-onset AHL, distortion product otoacoustic emissions (DPOAEs) decreased in middle-aged and old males, while in females, the decline in outer hair cell (OHC) function was only initiated at older, postmenopausal ages (6). Another study confirmed the younger age of onset for male hearing loss in CBA mice, while in a model for early-onset hearing loss (C57BL/6J), it was found that females tend to lose their hearing capabilities earlier than males (7). On average, ARHI thresholds increase approximately 1 dB per year for individuals aged 60 and over (8). However, ARHI shows extensive variation; the age at onset, the progression, and the severity of the hearing loss vary considerably among the elderly. The International Organisation for Standardisation (ISO) 7029 standard perfectly illustrates this variation (9). These norms were recorded by the ISO in 1984 and represent the median thresholds for otologically normal persons and the spread around this median, for each age and each frequency, both in men and in women (9). The largest spread is found at high frequencies and at older ages. For instance, at 60 years of age, the best hearing 10% of the population display high frequency thresholds better than 10 dB, while the worst hearing 10% suffer from a hearing loss of 55 to 75 dB at the high frequencies (9). This significant variation was seen as an indication of the involvement of hereditary factors in the development of ARHI.

Age-related pathological changes in the inner ear Based on correlations between audiometric data and histological findings, Schuknecht proposed a classification scheme of human ARHI (10). Schuknecht’s framework involves three cochlear components: the afferent neurons, the organ of Corti, and the

stria vascularis, which can all degenerate independently. In “sensory” ARHI, the primary degeneration involves the organ of Corti, while in “strial” ARHI and in “neural” ARHI, the stria vascularis and the spiral ganglion, respectively, are the major affected structures (10,11). According to Schuknecht, audiometric or speech discrimination data may reflect degeneration of only one of the three structures. A fourth hypothetical category, “cochlear-conductive” ARHI, comprises a gradually decreasing, linear audiometric pattern without pathological correlate. Schuknecht speculated that this type of hearing loss is caused by alterations in the physical characteristics of the cochlear duct (10,11). The most common type is sensory ARHI with predominantly high-frequency hearing loss. Less common is the “metabolic” or strial type of ARHI, which is characterised by an audiogram that is flat across the low frequencies with variable degrees of high-frequency hearing loss. A combination of pathologies affecting many cell types (“mixed” ARHI) is often found. In addition, 25% of all cases cannot be classified according to Schuknecht’s scheme. These cases are designated as “indeterminate” ARHI (10,11). In humans, preferential loss of OHCs was observed, most prominent in the first half of the basal turn (12,13). This correlates tonotopically with the high-frequency hearing loss present in sensory ARHI. In another study, human temporal bones of seven individuals with sensory ARHI were investigated. Approximately 80% of the OHCs, mainly in the apical parts of the cochlea, were lost. Apart from the expected reduction in hair cells, the most significant change in the cochlea was an agerelated loss of nerve fibres. The latter had most probably occurred secondary to the hair cell loss (14). Using electron microscopy, further ultrastructural changes were detected in these specimens, including changes in the cuticular plate, the stereocilia, the pillar cells, the stria vascularis, and the spiral ligament (15). Finally, in a study on human temporal bones selected for their typical strial type of audiometry (i.e., flat), only one out of six had significant atrophy of the stria vascularis. The most prominent changes in these specimens were OHC loss in combination with inner hair cell (IHC) or spiral ganglion cell (SGC) loss (16). Pathologic changes in the inner ear as a direct function of age remain, therefore, controversial (17). Correlations between audiometric data and inner ear pathology are difficult to obtain in humans. Mouse ARHI models can help to validate the classification scheme proposed by Schuknecht and clarify the underlying cellular changes. Table 6.1 gives an overview of some recent findings in the inner ear of C57BL/6J inbred mice, the early-onset model for AHL. The most prominent changes in this mouse model were OHC and SGC loss in addition to atrophy of the stria vascularis, leading to a mixed type of AHL. Only a few data exist for other inbred strains. In contrast to the early start of hair cell loss in C57BL/6J mice (one to two months of age), mice of the CBA/Ca strain, the model for late-onset AHL, show relatively little hair cell loss until late in life (18). In the senescence-accelerated mouse (SAMP1), loss of IHCs and OHCs and atrophy of the stria vascularis were demonstrated. Areas of degeneration were concentrated in the

1181 Chap06

3/29/07

4:55 PM

Page 81

Age-related hearing impairment: ensemble playing of environmental

apex and the base (25). In CD-1 mice, the changes were similar to those observed in C57BL/6J mice (26). In BALB/cJ mice, AHL seemed to be best correlated with changes in the supporting cells of the basal half of the cochlea and with alterations in the spiral limbus in the apical part of the cochlea (27). Finally, in the 129S6/sV strain, high-frequency hearing loss seemed to correlate with basal loss of OHCs and type IV fibrocytes of the spiral ligament and with alterations in the supporting cells at the cochlear base (28). In addition, apical neuronal loss was accompanied by abnormalities in pillar cells and the Reissner’s membrane and loss of fibrocytes in the spiral limbus at the apical cochlear turn (28). Other animals that have been studied include the monkey, rat, rabbit, gerbil, dog, and guinea pig. For instance, in house dog cochleas, loss of SGCs, atrophy of the organ of Corti and the stria vascularis, and thickening of the basilar membrane were observed. The changes were most prominent at the base of the cochlea. The advantage of studying house dogs instead of laboratory animals is that they have been kept in a similar environment as humans (29).

Central auditory dysfunction— auditory neuropathy In the ageing population, speech discrimination scores often decrease without a parallel loss in pure tone thresholds (30–32). This indicates that in addition to peripheral pathology,

degenerative changes in the central auditory pathway are involved in the development of ARHI. In the Framingham cohort, a relation between auditory and cognitive dysfunction was observed. Moreover, aberrant test results for central auditory function could predict the onset of senile dementia (33). In the C57BL/6J mouse model, a disruption of the central representation of frequency (i.e., the tonotopic organisation) was observed (34). In addition, it was shown that many normally responding neurons survive alongside slowly responding neurons in older mice, indicating that wastage of individual neurons and not a general decline seems to accompany the ageing process (34). Finally, an increase in the spontaneous activity of inferior colliculus neurons in older animals might suggest a change in the physiological signal-to-noise ratio, contributing to presbyacusis as well as tinnitus (34). More recently, additional studies gathered different types of evidence of the role of the central auditory pathway in presbyacusis. The contralateral suppression of DPOAEs was tested in humans and in CBA mice. Contralateral suppression is the phenomenon that white noise stimulation of one ear typically reduces the magnitude of the DPOAEs measured in the opposite ear. This contralateral suppression is due to activation of the medial olivocochlear system, which, in turn, inhibits the cochlear OHCs. Both DPOAE levels and contralateral inhibition decreased with age in humans as well as in mice. Moreover, the decline in contralateral inhibition preceded the decline in DPOAE levels, indicating that a functional decline of the medial olivocochlear system with age precedes OHC degeneration (35,36).

Table 6.1 Age-related changes in the inner ear of the C57BL/6J mouse model for early-onset age-related hearing loss Cell type or structure

Age-related effect

References

OHC

Preferential loss of OHCs Base-to-apex gradient of OHC loss Regionalised patterns of OHC loss correlated with changes in hearing thresholds

18, 19 18, 19–22 21

IHC

Less affected than OHCs

19, 20

SGC

Loss of SGCs; retrograde degeneration

20, 22, 23

Stria vascularis

Atrophy

23

Organ of Corti

Disorganisation

23

Spiral ligament

Degeneration of type IV fibrocytes Reduced density of Cx26 staining Na-K-ATPase immunolabelling increased

22 23 23

Spiral limbus

Changes in the apical part of the cochlea

24

Pillar cells

Apical-to-basal progression of pathology

24

Reissner’s membrane

Apical-to-basal progression of pathology

24

Abbreviations: IHC, inner hair cell; OHC, outer hair cell; SGC, spiral ganglion cell.

81

1181 Chap06

82

3/29/07

4:55 PM

Page 82

Genetics and hearing impairment

Heritability of ARHI

so far nothing is known about the genes that contribute to ARHI in humans.

Heritability in human subjects The spectrum of human diseases forms a continuum between purely genetic and purely environmental conditions. Nearly all frequent diseases that are important for public health such as diabetes, heart disease, and cancer are complex in aetiology, involving the interaction of several genes and environmental factors. The relative importance of the genetic and the environmental factors in the aetiology of the disease is often expressed as the heritability of a disease. The hypothesis that ARHI has a genetic basis has been put forward for many years in many publications, but the scientific basis for this claim has only recently been laid. Three separate studies have estimated heritability values for ARHI and have shown that ARHI is a complex disorder with genetic as well as environmental aetiological factors. In a first study, a Swedish male twin population, comprising 250 monozygotic and 307 dizygotic twins aged between 36 and 80 years, was studied using a combination of audiometric and questionnaire data (37). This study clearly indicated that the variation in hearing ability in the high frequencies is due to an interaction of genetic and environmental effects. Moreover, the relative influence of the environment becomes more important with increasing age. The heritability estimate for the age group above 65 years was 0.47, indicating that approximately half of the population variance for high-frequency hearing ability above the age of 65 is caused by genetic differences, and half by environmental differences (37). A second study analysed audiometric data from families who participated in the Framingham Heart and the Framingham Offspring Study. The auditory status in genetically unrelated (spouse pairs) and genetically related people (sibling pairs, parent-child pairs) was compared. This study showed a clear familial aggregation for age-related hearing levels, although the aggregation levels were stronger in women than in men. The heritability estimates of this study suggested that 35% to 55% of the variance of the sensory type of ARHI and 25% to 42% of the variance of the strial type of ARHI is attributable to the effects of genes (38). More recently, a Danish twin study evaluated the selfreported reduced hearing abilities in 3928 twins of 75 years of age and older. Calculations of concordance rates, odds ratios, and correlations resulted in consistently higher values for monozygotic twin pairs when compared to dizygotic twin pairs across all age and sex categories. This indicates the involvement of genetic risk factors. The heritability value was estimated at 40% in this study (39). Because self-assessment of hearing loss only partly corresponds to audiometric measures of hearing loss and frequently results in misclassification (30), this heritability value may represent an underestimate of the involvement of genetic factors in ARHI. Although it has been proven in three separate studies that ARHI is a complex disease caused by an interaction of environmental and genetic factors,

Heritability in mouse models for AHL Evidence for a substantial genetic basis for ARHI was not only gathered from studies on human subjects. An important contribution involves research performed in inbred mouse strains with AHL. These mouse strains may represent valuable models and may be used for the investigation of genetic factors in human ARHI. Through the study of hearing loss in 5 inbred strains and the 10 possible combinations of F1 hybrids, Erway et al. found evidence that supports a genetic model for recessive alleles contributing to AHL at three different loci (40). A first major, recessive gene affecting AHL in C57BL/6J mice (designated Ahl) was localised to chromosome 10, near D10Mit5, using a C57BL/6J ⫻ CAST/Ei backcross (41). Ahl was associated with degeneration of the organ of Corti, the stria vascularis, and the spiral ligament and with loss of SGCs, suggesting that it promotes a “mixed” type of AHL (mixed sensory/neural/strial type, according to Schuknecht’s typology). In subsequent studies, the Ahl gene was shown to be a major contributor to the hearing loss present in nine other inbred mouse strains—129P1/ReJ, A/J, BALB/cByJ, BUB/BnJ, C57BR/cdJ, DBA/2J, NOD/LtJ, SKH2/J, and STOCK760 (42)—and to be allelic with the modifier of deaf waddler gene (mdfw) (43). The gene responsible was identified in 2003; in exon 7 of cadherin 23 (Cdh23), a hypomorphic single-nucleotide polymorphism (753A), leading to in-frame skipping of exon 7, showed significant association with Ahl and mdfw (44). The AHL of inbred strains homozygous for this polymorphism may be due to altered adhesion properties or reduced stability of the CDH23 protein lacking exon 7 (44). Using a congenic strain with genomic DNA derived completely from C57BL/6J, except in the Ahl-chromosome 10 region, where the genomic material was derived from CAST/Ei (B6.CAST-+Ahl), it has recently been shown that additional loci, besides the Ahl locus, may contribute to the differences in hearing loss between C57BL/6J ⫻ CAST/Ei mice (45). A second locus affecting AHL (Ahl2) was mapped to chromosome 5 using a C57BL/6J ⫻ NOD/LtJ backcross. Johnson and Zheng demonstrated that the hearing loss attributable to Ahl2 is dependent on a predisposing Ahl genotype (46). Using a C57BL/6J ⫻ MSM backcross, a third locus (Ahl3) was positioned on chromosome 17 (47).

Nongenetic risk factors for ARHI As illustrated above, ARHI is a complex disease caused by a combination of environmental and genetic factors. ARHI excludes hearing loss caused by factors such as exposure to excessive noise, intrinsic otological disease (including otosclerosis, chronic otitis media, Ménière’s disease), and some underlying

1181 Chap06

3/29/07

4:55 PM

Page 83

Age-related hearing impairment: ensemble playing of environmental

medical conditions. ARHI might, however, reflect the cumulative effects of disease, ototoxic agents, and other environmental (including noise) and dietary factors that act together with hereditary factors to influence the cochlear ageing process.

Environmental risk factors Several environmental risk factors have been put forward as being involved in the development of ARHI (noise, drugs, organic solvents, etc.). However, considerable controversy exists concerning the role of many of the risk factors. The best known and the most studied risk factor for hearing loss is noise exposure. In general, ageing and noise exposure lead to similar physiological and anatomical changes (27). Although exposure to excessive occupational noise should be excluded as a causative factor, constant low-level noise (the noise of every day life in our industrialised and urbanised environment, also called “acoustic smog”) is regarded as an environmental risk factor for ARHI. This is best illustrated by the absence of ARHI in some isolated African tribes in the Kalahari Desert and the Sudan, who live in relatively noise-free environments (48,49). Also, noise exposure due to leisure activities (rock, classical or jazz music, personal listening devices, e.g., walkmans, and “household” noise) should be taken into consideration, although the most serious assault on hearing capabilities results from recreational hunting or target shooting (50). From experiments in a mouse strain carrying the Ahl gene (C57BL/6J, see above), it became clear that a genetic predisposition to ARHI might be revealed sooner in life due to noise exposure. In other words, genes that are associated with ARHI might render the cochlea more susceptible to noise (51,52). It has been a point of debate whether ageing and noise act in an additive or in an interactive way to produce permanent hearing loss. If the latter is more important, the question remains whether they amplify each other or tone each other down (53). The assumption of an additive effect has been most widely accepted. However, recently an interesting interaction between ageing and noise has been proposed (54). Using data from the Framingham cohort, it was shown that noise-induced hearing loss reduces the effects of ageing at noise-associated frequencies but accelerates the deterioration of hearing at adjacent frequencies. The rate of ARHI seems to differ in noise-damaged ears when compared to non–noise-damaged ears (54). In general, there is agreement on the fact that age-related changes exceed noise-induced changes for the 0.5, 1, 2, and 3 KHz puretone average (55). Besides noise, several other environmental factors have been implicated in the aetiology of ARHI, an overview of which is given in Table 6.2. Ototoxic medication as a risk factor for hearing loss is well documented. Especially in the elderly, ototoxic medication can become problematic because they usually take more medication and for longer periods compared to other age groups, and because they have altered liver and renal functions, which can cause blood levels of drugs to rise above certain critical levels (56–59). The detrimental effects of some chemicals on hearing

83

levels are indisputable (60,61). The effect of tobacco smoking and of alcohol (ab)use on hearing loss remains controversial (57,62–67). Hearing loss due to head trauma could possibly be caused by disruption of the membranous portion of the cochlea, by disturbance in the cochlear microcirculation, or by haemorrhage into the fluids of the cochlea (68). The nutritional status also seems to have importance (69), while caloric-restriction does not seem to have much effect (70). Finally, even socioeconomic status has been implicated as a contributory factor. Interestingly, this effect remained even when noise exposure was taken into account (71). Clearly, it will be very difficult to assess what the contribution of all separate factors will be on the final outcome, i.e., the level of hearing loss.

Medical risk factors Several medical conditions have been postulated as risk factors for ARHI. A possible relation between ARHI and cardiovascular disease (coronary heart disease, stroke, and intermittent claudication) and cardiovascular disease risk factors (including hypertension, diabetes, smoking, weight, and serum lipid levels) was investigated in the Framingham cohort (65). Cardiovascular disease was associated with ARHI, although predominantly in the low-frequency range and in women. Of the cardiovascular disease risk factors, hypertension and systolic blood pressure were related to hearing thresholds both in men and in women, while high-density lipoprotein and blood glucose levels were associated with low-frequency pure-tone averages only in women (65). Brant et al. later confirmed the relationship between ARHI and systolic blood pressure for speech frequencies (66), while Lee et al. could confirm the effect of high-density lipoproteins on ARHI in women (72). Classically, low-frequency ARHI has been associated with microvascular disease, leading to atrophy of the stria vascularis. Another indication that vascular abnormalities might be important in the development of ARHI has recently been obtained in an animal model for ARHI (C57BL/6J mice), where a significantly reduced expression of cochlear vascular endothelial growth factor (VEGF) was observed as a function of age (73). Patients who suffer from chronic renal failure and undergo dialysis are also at risk of developing high-frequency hearing loss. Either the disease itself (due to uraemic neuropathy, electrolyte imbalance, premature cardiovascular disease, shared antigenicity between cochlea and kidney) or the treatment (chronic dialysis most often followed by kidney transplantation and an accompanied use of ototoxic medication) might be responsible for the increased risk in renal patients (74). Demineralisation of the cochlear capsule in conjunction with agerelated bone mass loss may lead to ARHI. This was reported by Clark et al., who could demonstrate that the femoral neck bone mass, but not the radial bone mass, was associated with ARHI in a population of rural women aged 60 to 85 years (75). Another study could not demonstrate a relation between hipbone mineral density and hearing abilities (76). Several investigators have observed an association between diabetes mellitus

1181 Chap06

84

3/29/07

4:55 PM

Page 84

Genetics and hearing impairment

Table 6.2 Environmental risk factors for ARHI a

Factor

Effect

References

Ototoxic medication

Salicylate ß-adrenergic drugs Aminoglycosides Loop diuretics

56, 57 58 59 59

Chemicals

Organic solvents Heavy metals

60, 61 60

Smoking

Causing hearing loss Having no effect Passive smoking: causing hearing loss

57, 62–64 65, 66 63

Alcohol

Abuse causing hearing loss Abuse having no effect Moderate use: protective effect

57, 67 62 62, 67

Head trauma

Whiplash

68

Nutrition status

Low vitamin B-12 Low folate

69 69

Caloric-restricted diet

No, or a very small, protective effect

70

Socioeconomic

Low social class Lower level of education

71 71

a

Unless indicated otherwise the environmental factors listed here cause hearing loss.

and high-frequency hearing loss. This association might be explained either by microangiopathic lesions in the inner ear (cochlear loss) or by primary neuropathy of the acoustic nerve (retrocochlear loss) (77). Finally, a role for the immune system in the development of ARHI has been suggested. When SAMP1 mice were bred in a specific pathogen-free environment, the age-related diseases typically observed in these mice (including AHL) were delayed in onset, when compared to mice bred in pathogenic environments. The involvement of autoimmune mechanisms was excluded (78). It was argued that the stress that a host experiences due to pathogen-induced infections impairs the immune functions, preceding a general decline in various physical functions (78).

Genetic risk factors for ARHI In contrast to the huge quantity of information regarding environmental and medical risk factors involved in the development of ARHI, only a minimal amount of information regarding genetic risk factors can be found in existing literature. Most of the studies describe work on animal models. Up to the

present time, only few studies have attempted to identify ARHI genes in human, and none have been identified so far. In the section on heritability in mouse models for AHL (see above), the localisation of three mouse AHL loci (Ahl) (41,46,47) and the identification of a first mouse AHL gene (CDH23) (44) were described. Another gene that has been implicated in the development of AHL in mice is VEGF (also described above), for which a significant reduction in expression was observed as a function of age (73). Recently, it has been shown that mice susceptible to AHL have a significant decrease in expression of the ß2 subunit of the high-affinity nicotinic acetylcholine receptor (nAChR). In addition, in mice lacking the ß2 nAChR subunit, a significant hearing loss and reduction in the number of SGCs has been observed, indicating a requirement for the ß2 nAChR subunit in the maintenance of SGCs during ageing (79). An important causative role for oxidative stress and consequently also for mitochondrial deletions has been postulated. Both aspects are further elaborated in the following paragraphs.

Oxidative stress Reactive oxygen species (ROS) have been implicated in hearing loss associated with ageing and noise exposure. ROS are a

1181 Chap06

3/29/07

4:55 PM

Page 85

Age-related hearing impairment: ensemble playing of environmental

normal by-product of cellular metabolism, in particular of the oxidative phosphorylation process. ROS are potentially toxic and can cause DNA, cellular and tissue damage if not inactivated by cellular antioxidant protection systems (glutathione and glutathione-related enzymes, superoxide dismutases and catalase). ROS can cause direct damage to mitochondrial DNA. Hypoperfusion leads to the formation of ROS. As a reduction in blood flow to several tissues, including the cochlea, has been associated with ageing, this might mean that hypoperfusion of the cochlea is an important causative factor of ROS formation and subsequent hearing loss (80). Significantly decreased glutathione levels have been observed in the auditory nerve, but not in other cochlear parts, in 24-month-old rats (81). Cytosolic copper/zinc superoxide dismutase (SOD1) is highly expressed in the cochlea. SOD1deficient mice displayed a more pronounced AHL than wild-type mice (82,83). However, SOD1 overexpression did not protect against AHL, indicating that the oxidative metabolism may be more complex than previously assumed (84). Antioxidants, which block and scavenge ROS, thereby reducing the deleterious impact of ROS at the molecular level, might attenuate ARHI. This has been demonstrated with oversupplementation of vitamins E and C (85), and with two mitochondrial metabolites (acetyl-1-carnitine and alpha-lipoic acid) (86). Animals treated with these nutritional supplements demonstrated an overall reduction in mitochondrial deletions, less OHC loss, and the best preservation of hearing abilities. Caloric restriction, which is also thought to reduce levels of oxidative stress, reduced the rate of AHL (85), although in previous studies in humans no, or only a very small, effect had been observed for caloric restriction (Table 6.2) (70). Supplementation with lecithin, a polyunsaturated phophatidylcholine that plays a role in SOD activation, also resulted in significant protection (80).

Mitochondrial deletions Mitochondrial DNA has a high mutation rate. This might be due to the fact that mitochondrial DNA is in the close vicinity of the mitochondrial inner membrane, which is the major source of ROS. When sufficient mitochondrial DNA damage accumulates, the affected cell will become bioenergetically deficient. The most vulnerable cells are found in muscle and nerve tissue (including the cochlea) because these cells require high energy levels. In addition, cochlear cells are terminally differentiated; damaged cells will not be replaced. As a result, cochlear tissues are very sensitive to mitochondrial damage caused by oxidative stress. Specific acquired mitochondrial mutations have been proposed as one of the causes of ARHI. They occur more frequently with increasing age and with the progression of ARHI. The socalled common ageing mitochondrial deletion involves 4977 bp in humans (87–89), 4834 bp in rats (87,90), and 3867 bp in mice (91). An accumulation of many different acquired mitochondrial mutations was detected in auditory tissues of at least a proportion of ARHI patients (92). Clinical expression of

85

mitochondrial mutations is dependent both on environmental factors and on nuclear-encoded modifier genes (93).

How genes involved in ARHI can be identified Up to now, no ARHI susceptibility genes have been identified in humans. Since it was clearly demonstrated that ARHI has an important genetic component (see the section on the Heritability of ARHI), the use of extended genetic association and linkage studies aiming at the identification of ARHI susceptibility genes seems justified. However, the late onset of the ARHI phenotype and the numerous confounding nongenetic factors complicate human genetic studies for ARHI.

How genes involved in complex diseases can be identified The dissection of complex traits in humans has been particularly problematic. However, presently, many of the initial problems have been overcome by new technological developments (both statistical and laboratory methods). In general, two possible study designs can be used for the identification of susceptibility genes for complex diseases: linkage studies on one hand and association studies on the other hand. Both types of studies rely on the analysis of genetic polymorphisms. These can be microsatellites (polymorphic tandem repeat consisting of small repeat units of 2 to 5 bp) or single nucleotide polymorphisms (SNPs). SNPs are variations that occur at a single nucleotide position at a frequency of over 1 per 1000 bp throughout the entire genome. SNPs are a byproduct of the Human Genome Project and are thought to be a main source of variation among individuals. According to the “common variant, common disease” hypothesis, some of these SNPs might also be causative factors for complex diseases. All currently identified SNPs (more than 4 million) are entered in a SNP-database [(dbSNP; (94)]. By taking into account linkage disequilibrium between neighbouring SNPs, which is being determined for the complete human genome by the international HapMap project (95), efficient SNP selection strategies are now possible. Most typically, microsatellites are used for linkage studies and SNPs for association studies. But this is certainly not a general rule. In fact, due to the development of high throughput SNP genotyping methods, linkage studies using SNPs have become increasingly popular. Linkage studies try to identify regions of the genome that harbour susceptibility genes on the basis of the inheritance pattern of the disease and genetic markers. If marker alleles from a certain region are coinherited with the disease more than can be expected by chance, this region is said to be linked to the disease under investigation. Typically for complex diseases, nonparametric linkage analysis is performed on a large collection of small families. The nonparametric methods, also called model-free methods,

1181 Chap06

86

3/29/07

4:55 PM

Page 86

Genetics and hearing impairment

make no assumptions about the mode of inheritance, the disease frequency, or other parameters. Association studies on the other hand analyse genetic variations in unrelated individuals and try to identify those variations that are more frequent in affected individuals compared to unaffected individuals. The ultimate in association studies is a genome-wide association study. In that case, hundreds of thousands of SNPs across the entire genome are analysed in unrelated individuals. Although genome-wide association studies have become technically feasible very recently, they remain prohibitively expensive, and usually association studies are limited to a carefully selected set of candidate genes. Extended sample collections, preferably containing thousands of samples, are a prerequisite for genetic studies of complex diseases. The nature of the sample collections depends on the study design. Linkage studies require large sets of small families, while association studies are usually done using large sets of unrelated individuals.

Description of the ARHI phenotype A first requirement for undertaking genetic studies for ARHI is a clear description of the phenotype. ARHI can be treated as a dichotomous trait. In this case, a group of patients affected with ARHI (cases) will be compared with unaffected individuals (controls). This subdivision is usually based upon audiometric values. On the other hand, ARHI can also be regarded as a quantitative trait—an approach that should have advantages over the dichotomous approach, since the dichotomisation of a quantitative trait leads to loss of statistical power (96). If ARHI is described as dichotomous trait, a genetic variant that is associated with ARHI would be more frequent among affected individuals (cases) than among unaffected individuals (controls). When ARHI is treated as a quantitative trait, samples will be grouped according to the genotype of a particular polymorphism under investigation, and the differences in the quantitative values between the groups will be statistically analysed. Recently, a novel Z-score-based method has been published that allows ARHI to be described as a quantitative trait (97). The Z-score, which is based on the ISO7029 standard (9), gives an indication of the affection status of an individual independent of age and gender. Z-scores are calculated for each frequency as units of standard deviations from the median value for a particular age and gender. A negative Z-score indicates a person with better than median hearing, while a positive Zscore indicates hearing that is worse than the median value of otologically normal persons (97).

Association studies for ARHI As explained above, association studies compare the presence of variations in candidate genes in predefined groups. The selection of candidate genes is based upon physiological, functional, and expression information. The genes identified for monogenic hearing loss are excellent candidate ARHI susceptibility genes (see Box).

MONOGENIC FORMS OF HEARING LOSS ARE CANDIDATE ARHI SUSCEPTIBILITY GENES Up to now, genetic research into hearing impairment has mainly focused on monogenic forms of hearing loss. Using classic positional cloning approaches and provided that extended families are available, the localisation and identification of genes for monogenic types of hearing impairment is relatively easy and straightforward, especially since the completion of the human genome sequence. At the moment, 54 loci for nonsyndromal autosomal dominant (DFNA), 59 loci for nonsyndromal autosomal recessive (DFNB), and 8 loci for X-linked (DFN) hearing loss, in addition to two modifier loci (DFNM), have been reported. More than 40 genes for monogenic nonsyndromal hearing impairment and even more for syndromal hearing impairment have been identified. These genes belong to very different gene families with various functions, including transcription factors, extracellular matrix molecules, cytoskeletal components, and ion channels and transporters. For an overview of the current state of the art, see Chapter 5. In addition, the Hereditary Hearing Loss Homepage (http://webhost. ua.ac.be/hhh/) is a regularly updated online source of information on monogenic hearing impairment in humans. As the most frequent type of ARHI is progressive, sensorineural, and most pronounced in the high frequencies, genes causing monogenic hearing impairment with phenotypic similarities to ARHI, although with a much younger age at onset, are excellent candidate ARHI susceptibility genes. KCNQ4 (DFNA2), DFNA5 (DFNA5), COCH (DFNA9), MYH9 (DFNA17), and TMC1 (DFNA36) are examples of such genes. Notably, all these genes are autosomal dominant hearing loss genes. This does not mean that autosomal recessive genes cannot be candidates for ARHI. Because some genes are responsible for autosomal recessive as well as autosomal dominant hearing loss, or for syndromal as well as nonsyndromal hearing loss, one might argue that all genes involved in monogenic hearing loss are excellent ARHI candidate genes. Molecular knowledge of the genetics of nonsyndromal hearing impairment has been obtained only relatively recently. Before 1994, only a single gene localisation had been reported, and until 1997 only one single gene had been identified. The increasing knowledge regarding these purely genetic, albeit rare forms of monogenic deafness, is in sharp contrast with the lack of knowledge regarding genes leading to ARHI. Hopefully, a similar increase in knowledge of the complex forms of hearing loss can be realised in the near future.

1181 Chap06

3/29/07

4:55 PM

Page 87

Age-related hearing impairment: ensemble playing of environmental

Only a few association studies have been published for ARHI. Van Laer et al. studied the involvement of the DFNA5 gene in a Flemish set (using the quantitative Z-score method) and in a set derived from the Framingham cohort (using the dichotomous method) (98). DFNA5 was selected as a candidate ARHI susceptibility gene because mutations in DFNA5 cause a type of hearing loss that closely resembles the most typical type of ARHI (i.e., high-frequency, progressive, sensorineural hearing loss). Two SNPs leading to an amino acid substitution in DFNA5 were analysed. However, no significant association was detected in either sample collection (98). Recently, a second study has been published. To investigate the hypothesis that variations in gluthathione-related antioxidant enzyme levels are associated with the risk of ARHI, Ates et al. analysed three glutathione S-transferase polymorphisms (GSTM1, GSTT1, and GSTP1) using a case–control association study (99). This study could not demonstrate a significant association either.

Linkage studies for ARHI A huge problem in collecting families for linkage studies of ARHI is the late onset of the disease, which means that the parents from the required pedigrees are frequently deceased. In a first study using the Framingham cohort, this problem was overcome by collecting DNA and audiological information for the parents in a first phase (between 1973 and 1975), and for the children in a second phase (between 1995 and 1999). Pure tone averages of medium and low frequencies were adjusted for cohort, sex, age, age squared, and age cubed, and a genomewide linkage scan was performed. This led to the identification of several chromosomal regions that showed suggestive evidence for linkage: 11p, 11q13.5, and 14q (100). In complex diseases, several genome-wide scans need to be performed on independent sample sets in order to confirm previously published candidate regions and to identify new regions that might be linked to ARHI. Preferably, after the completion of a handful of such studies, a meta-analysis should be performed that will define the ultimate candidate regions. Because currently only one genome scan has been published, there is still a lot of work to be done to unravel the genetic basis of ARHI.

Future prospects Although a great deal of work has been done already, in particular, the unravelling of the genetic basis of ARHI will demand further joint efforts. Genetic analysis will clarify the influence of genetic variations in ARHI susceptibility genes: which variations in these genes increase the risk for ARHI and which do not. By integrating information on genetic and environmental risk factors, it may become clear how the vulnerability of a person’s hearing system correlates with his genetic background. It might be that certain environmental risk factors are potentially

87

harmful only in a limited number of individuals, depending on their genetic background. By means of genetic testing for susceptibility genes in an individual, personalised guidelines for ARHI prevention may be designed. Future therapies for hearing impairment will have to rely on basic rather than on symptomatic approaches. To achieve this, a better understanding of the basic molecular and cellular processes involved in ARHI is a prerequisite. Ultimately, a pharmacogenomic (i.e., adapting drugs to an individual’s genetic background) approach to ARHI may become feasible.

References 1. Davis A. Prevalence of Hearing Impairment. In: Davis A, ed. Hearing in Adults. London: Whurr Publishers Ltd, 1994:43–321. 2. Dalton DS, Cruickshanks KJ, Klein BE, et al. The impact of hearing loss on quality of life in older adults. Gerontologist 2003; 43:661–668. 3. Cruickshanks KJ, Wiley TL, Tweed TS, et al. Prevalence of hearing loss in older adults in Beaver Dam, Wisconsin. The Epidemiology of Hearing Loss Study. Am J Epidemiol 1998; 148:879–886. 4. Cruickshanks KJ, Tweed TS, Wiley TL, et al. The 5-year incidence and progression of hearing loss: the epidemiology of hearing loss study. Arch Otolaryngol Head Neck Surg 2003; 129:1041–1046. 5. Pearson JD, Morrell CH, Gordon-Salant S, et al. Gender differences in a longitudinal study of age-associated hearing loss. J Acoust Soc Am 1995; 97:1196–1205. 6. Guimaraes P, Zhu X, Cannon T, et al. Sex differences in distortion product otoacoustic emissions as a function of age in CBA mice. Hear Res 2004; 192:83–89. 7. Henry KR. Males lose hearing earlier in mouse models of late-onset age-related hearing loss; females lose hearing earlier in mouse models of early-onset hearing loss. Hear Res 2004; 190:141–148. 8. Lee FS, Matthews LJ, Dubno JR, et al. Longitudinal study of puretone thresholds in older persons. Ear Hear 2005; 26:1–11. 9. International Organization for Standardization. Acoustics-threshold of hearing by air conduction as a function of age and sex for otologically normal persons. International Standard ISO7029 1984. 10. Schuknecht HF. Further observations on the pathology of presbycusis. Arch Otolaryngol 1964; 80:369–382. 11. Schuknecht HF, Gacek MR. Cochlear pathology in presbycusis. Ann Otol Rhinol Laryngol 1993; 102:1–16. 12. Johnsson LG, Felix H, Gleeson M, et al. Observations on the pattern of sensorineural degeneration in the human cochlea. Acta Otolaryngol Suppl 1990; 470:88–96. 13. Soucek S, Michaels L, Frohlich A. Evidence for hair cell degeneration as the primary lesion in hearing loss of the elderly. J Otolaryngol 1986; 15:175–183. 14. Felder E, Schrott-Fischer A. Quantitative evaluation of myelinated nerve fibres and hair cells in cochleae of humans with age-related high-tone hearing loss. Hear Res 1995; 91:19–32.

1181 Chap06

88

3/29/07

4:55 PM

Page 88

Genetics and hearing impairment

15. Scholtz AW, Kammen-Jolly K, Felder E, et al. Selective aspects of human pathology in high-tone hearing loss of the aging inner ear. Hear Res 2001; 157:77–86. 16. Nelson EG, Hinojosa R. Presbycusis: a human temporal bone study of individuals with flat audiometric patterns of hearing loss using a new method to quantify stria vascularis volume. Laryngoscope 2003; 113:1672–1686. 17. Ohlemiller KK. Age-related hearing loss: the status of Schuknecht’s typology. Curr Opin Otolaryngol Head Neck Surg 2004; 12:439–443. 18. McFadden SL, Ding D, Salvi R. Anatomical, metabolic and genetic aspects of age-related hearing loss in mice. Audiology 2001; 40:313–321. 19. Mizuta K, Nozawa O, Morita H, et al. Scanning electron microscopy of age-related changes in the C57BL/6J mouse cochlea. Scanning Microsc 1993; 7:889–896. 20. White JA, Burgess BJ, Hall RD, et al. Pattern of degeneration of the spiral ganglion cell and its processes in the C57BL/6J mouse. Hear Res 2000; 141:12–18. 21. Francis HW, Ryugo DK, Gorelikow MJ, et al. The functional age of hearing loss in a mouse model of presbycusis. II. Neuroanatomical correlates. Hear Res 2003; 183:29–36. 22. Hequembourg S, Liberman MC. Spiral ligament pathology: a major aspect of age-related cochlear degeneration in C57BL/6 mice. J Assoc Res Otolaryngol 2001; 2:118–129. 23. Ichimiya I, Suzuki M, Mogi G. Age-related changes in the murine cochlear lateral wall. Hear Res 2000; 139:116–122. 24. Ohlemiller KK, Gagnon PM. Apical-to-basal gradients in agerelated cochlear degeneration and their relationship to “primary” loss of cochlear neurons. J Comp Neurol 2004; 479:103–116. 25. Saitoh Y, Hosokawa M, Shimada A, et al. Age-related cochlear degeneration in senescence-accelerated mouse. Neurobiol Aging 1995; 16:129–136. 26. Wu T, Marcus DC. Age-related changes in cochlear endolymphatic potassium and potential in CD-1 and CBA/CaJ mice. J Assoc Res Otolaryngol 2003; 4:353–362. 27. Ohlemiller KK. Reduction in sharpness of frequency tuning but not endocochlear potential in aging and noise-exposed BALB/cJ mice. J Assoc Res Otolaryngol 2002; 3:444–456. 28. Ohlemiller KK, Gagnon PM. Cellular correlates of progressive hearing loss in 129S6/SvEv mice. J Comp Neurol 2004; 469:377–390. 29. Shimada A, Ebisu M, Morita T, et al. Age-related changes in the cochlea and cochlear nuclei of dogs. J Vet Med Sci 1998; 60:41–48. 30. Matthews LJ, Lee FS, Mills JH, et al. Audiometric and subjective assessment of hearing handicap. Arch Otolaryngol Head Neck Surg 1990; 116:1325–1330. 31. Boettcher FA. Presbyacusis and the auditory brainstem response. J Speech Lang Hear Res 2002; 45:1249–1261. 32. Pichora-Fuller MK, Souza PE. Effects of aging on auditory processing of speech. Int J Audiol 2003; 42(suppl 2):2S11–2S16. 33. Gates GA, Cobb JL, Linn RT, et al. Central auditory dysfunction, cognitive dysfunction, and dementia in older people. Arch Otolaryngol Head Neck Surg 1996; 122:161–167.

34. Willott JF. Central physiological correlates of ageing and presbycusis in mice. Acta Otolaryngol Suppl 1991; 476:153–156. 35. Jacobson M, Kim S, Romney J, et al. Contralateral suppression of distortion-product otoacoustic emissions declines with age: a comparison of findings in CBA mice with human listeners. Laryngoscope 2003; 113:1707–1713. 36. Kim S, Frisina DR, Frisina RD. Effects of age on contralateral suppression of distortion product otoacoustic emissions in human listeners with normal hearing. Audiol Neurootol 2002; 7:348–357. 37. Karlsson KK, Harris JR, Svartengren M. Description and primary results from an audiometric study of male twins. Ear Hear 1997; 18:114–120. 38. Gates GA, Couropmitree NN, Myers RH. Genetic associations in age-related hearing thresholds. Arch Otolaryngol Head Neck Surg 1999; 125:654–659. 39. Christensen K, Frederiksen H, Hoffman HJ. Genetic and environmental influences on self-reported reduced hearing in the old and oldest old. J Am Geriatr Soc 2001; 49:1512–1517. 40. Erway LC, Willott JF, Archer JR, et al. Genetics of age-related hearing loss in mice: I. Inbred and F1 hybrid strains. Hear Res 1993; 65:125–132. 41. Johnson KR, Erway LC, Cook SA, et al. A major gene affecting agerelated hearing loss in C57BL/6J mice. Hear Res 1997; 114:83–92. 42. Johnson KR, Zheng QY, Erway LC. A major gene affecting agerelated hearing loss is common to at least ten inbred strains of mice. Genomics 2000; 70:171–180. 43. Zheng QY, Johnson KR. Hearing loss associated with the modifier of deaf waddler (mdfw) locus corresponds with agerelated hearing loss in 12 inbred strains of mice. Hear Res 2001; 154:45–53. 44. Noben-Trauth K, Zheng QY, Johnson KR. Association of cadherin 23 with polygenic inheritance and genetic modification of sensorineural hearing loss. Nat Genet 2003; 35:21–23. 45. Keithley EM, Canto C, Zheng QY, et al. Age-related hearing loss and the Ahl locus in mice. Hear Res 2004; 188:21–28. 46. Johnson KR, Zheng QY. Ahl2, a second locus affecting age-related hearing loss in mice. Genomics 2002; 80:461–464. 47. Nemoto M, Morita Y, Mishima Y, et al. Ahl3, a third locus on mouse chromosome 17 affecting age-related hearing loss. Biochem Biophys Res Commun 2004; 324:1283–1288. 48. Rosen S, Bergman M, Plester D, et al. Presbycusis study of a relatively noise-free population in the Sudan. Ann Otol Rhinol Laryngol 1962; 71:727–743. 49. Jarvis JF, van Heerden HG. The acuity of hearing in the Kalahari Bushmen . A pilot survey. J Laryngol Otol 1967; 81:63–68. 50. Clark WW. Noise exposure from leisure activities: a review. J Acoust Soc Am 1991; 90:175–181. 51. Erway LC, Shiau YW, Davis RR, et al. Genetics of agerelated hearing loss in mice. III. Susceptibility of inbred and F1 hybrid strains to noise-induced hearing loss. Hear Res 1996; 93:181–187. 52. Ohlemiller KK, Wright JS, Heidbreder AF. Vulnerability to noiseinduced hearing loss in ‘middle-aged’ and young adult mice: a

1181 Chap06

3/29/07

4:55 PM

Page 89

Age-related hearing impairment: ensemble playing of environmental

53. 54.

55.

56. 57.

58.

59.

60. 61. 62.

63.

64.

65.

66.

67.

68. 69.

70.

dose-response approach in CBA, C57BL, and BALB inbred strains. Hear Res 2000; 149:239–247. Corso JF. Support for Corso’s hearing loss model. Relating aging and noise exposure. Audiology 1992; 31:162–7. Gates GA, Schmid P, Kujawa SG, et al. Longitudinal threshold changes in older men with audiometric notches. Hear Res 2000; 141:220–228. Dobie RA. The relative contributions of occupational noise and aging in individual cases of hearing loss. Ear Hear 1992; 13:19–27. Stypulkowski PH. Mechanisms of salicylate ototoxicity. Hear Res 1990; 46:113–145. Rosenhall U, Sixt E, Sundh V, et al. Correlations between presbyacusis and extrinsic noxious factors. Audiology 1993; 32:234–243. Mills JH, Matthews LJ, Lee FS, et al. Gender-specific effects of drugs on hearing levels of older persons. Ann N Y Acad Sci 1999; 884:381–388. Aran JM, Hiel H, Hayashida T. Noise, aminoglycosides, diuretics. In: Dancer A, Henderson D, Salvi R, Hamernik R, eds. Noise Induced Hearing Loss. St. Louis: Mosby, 1992:175–187. Rybak LP. Hearing: the effects of chemicals. Otolaryngol Head Neck Surg 1992; 106:677–686. Johnson AC, Nylen PR. Effects of industrial solvents on hearing. Occup Med 1995; 10:623–640. Itoh A, Nakashima T, Arao H, et al. Smoking and drinking habits as risk factors for hearing loss in the elderly: epidemiological study of subjects undergoing routine health checks in Aichi, Japan. Public Health 2001; 115:192–196. Cruickshanks KJ, Klein R, Klein BEK, et al. Cigarette smoking and hearing loss: the epidemiology of hearing loss study. J Am Med Ass 1998; 279:1715–1719. Uchida Y, Nakashimat T, Ando F, et al. Is there a relevant effect of noise and smoking on hearing? A population-based aging study. Int J Audiol 2005; 44:86–91. Gates GA, Cobb JL, D’Agostino RB, et al. The relation of hearing in the elderly to the presence of cardiovascular disease and cardiovascular risk factors. Arch Otolaryngol Head Neck Surg 1993; 119:156–161. Brant LJ, Gordon-Salant S, Pearson JD, et al. Risk factors related to age-associated hearing loss in the speech frequencies. J Am Acad Audiol 1996; 7:152–160. Popelka MM, Cruickshanks KJ, Wiley TL, et al. Moderate alcohol consumption and hearing loss: a protective effect. J Am Geriatr Soc 2000; 48:1273–1278. Fitzgerald DC. Head trauma: hearing loss and dizziness. J Trauma 1996; 40:488–496. Houston DK, Johnson MA, Nozza RJ, et al. Age-related hearing loss, vitamin B-12, and folate in elderly women. Am J Clin Nutr 1999; 69:564–571. Willott JF, Erway LC, Archer JR, et al. Genetics of age-related hearing loss in mice. II. Strain differences and effects of caloric restriction on cochlear pathology and evoked response thresholds. Hear Res 1995; 88:143–155.

89

71. Sixt E, Rosenhall U. Presbyacusis related to socioeconomic factors and state of health. Scand Audiol 1997; 26:133–140. 72. Lee FS, Matthews LJ, Mills JH, et al. Analysis of blood chemistry and hearing levels in a sample of older persons. Ear Hear 1998; 19:180–190. 73. Picciotti P, Torsello A, Wolf FI, et al. Age-dependent modifications of expression level of VEGF and its receptors in the inner ear. Exp Gerontol 2004; 39:1253–1258. 74. Antonelli AR, Bonfioli F, Garrubba V, et al. Audiological findings in elderly patients with chronic renal failure. Acta Otolaryngol Suppl 1990; 476:54–68. 75. Clark K, Sowers MR, Wallace RB, et al. Age-related hearing loss and bone mass in a population of rural women aged 60 to 85 years. Ann Epidemiol 1995; 5:8–14. 76. Purchase-Helzner EL, Cauley JA, Faulkner KA, et al. Hearing sensitivity and the risk of incident falls and fracture in older women: the study of osteoporotic fractures. Ann Epidemiol 2004; 14:311–318. 77. Kurien M, Thomas K, Bhanu TS. Hearing threshold in patients with diabetes mellitus. J Laryngol Otol 1989; 103:164–168. 78. Iwai H, Lee S, Inaba M, et al. Correlation between accelerated presbycusis and decreased immune functions. Exp Gerontol 2003; 38:319–325. 79. Bao J, Lei D, Du Y, et al. Requirement of nicotinic acetylcholine receptor subunit ß2 in the maintenance of spiral ganglion neurons during aging. J Neurosci 2005; 25:3041–3045. 80. Seidman MD, Khan MJ, Tang WX, et al. Influence of lecithin on mitochondrial DNA and age-related hearing loss. Otolaryngol Head Neck Surg 2002; 127:138–144. 81. Lautermann J, Crann SA, McLaren J, et al. Glutathionedependent antioxidant systems in the mammalian inner ear: effects of aging, ototoxic drugs and noise. Hear Res 1997; 114:75–82. 82. McFadden SL, Ding D, Burkard RF, et al. Cu/Zn SOD deficiency potentiates hearing loss and cochlear pathology in aged 129,CD-1 mice. J Comp Neurol 1999; 413:101–112. 83. McFadden SL, Ding D, Reaume AG, et al. Age-related cochlear hair cell loss is enhanced in mice lacking copper/zinc superoxide dismutase. Neurobiol Aging 1999; 20:1–8. 84. Coling DE, Yu KCY, Somand D, et al. Effect of SOD1 overexpression on age- and noise-related hearing loss. Free Radic Biol Med 2003; 34:873–880. 85. Seidman MD. Effects of dietary restriction and antioxidants on presbyacusis. Laryngoscope 2000; 110:727–738. 86. Seidman MD, Khan MJ, Bai U, et al. Biologic activity of mitochondrial metabolites on aging and age-related hearing loss. Am J Otol 2000; 21:161–167. 87. Seidman MD, Bai U, Khan MJ, et al. Association of mitochondrial DNA deletions and cochlear pathology: a molecular biologic tool. Laryngoscope 1996; 106:777–783. 88. Bai U, Seidman MD, Hinojosa R, et al. Mitochondrial DNA deletions associated with aging and possibly presbycusis: a human archival temporal bone study. Am J Otol 1997; 18:449–453.

1181 Chap06

90

3/29/07

4:55 PM

Page 90

Genetics and hearing impairment

89. Dai P, Yang W, Jiang S, et al. Correlation of cochlear blood supply with mitochondrial DNA common deletion in presbyacusis. Acta Otolaryngol 2004; 124:130–136. 90. Seidman MD, Bai U, Khan MJ, et al. Mitochondrial DNA deletions associated with aging and presbyacusis. Arch Otolaryngol Head Neck Surg 1997; 123:1039–1045. 91. Zhang X, Han D, Ding D, et al. Cochlear mitochondrial DNA3867 bp deletion in aged mice. Chin Med J (Engl) 2002; 115:1390–1393. 92. Fischel-Ghodsian N, Bykhovskaya Y, Taylor K, et al. Temporal bone analysis of patients with presbycusis reveals high frequency of mitochondrial mutations. Hear Res 1997; 110:147–154. 93. Fischel-Ghodsian N. Mitochondrial deafness. Ear Hear 2003; 24:303–313. 94. http://www.ncbi.nlm.nih.gov/

95. http://www.hapmap.org 96. Page GP, Amos CI. Comparison of linkage-disequilibrium methods for localization of genes influencing quantitative traits in humans. Am J Hum Genet 1999; 64:1194–1205. 97. Fransen E, Van Laer L, Lemkens N, et al. A novel Z-score-based method to analyze candidate genes for age-related hearing impairment. Ear Hear 2004; 25:133–141. 98. Van Laer L, DeStefano AL, Myers RH, et al. Is DFNA5 a susceptibility gene for age-related hearing impairment? Eur J Hum Genet 2002; 10:883–886. 99. Ates NA, Unal M, Tamer L, et al. Glutathione S-transferase gene polymorphisms in presbycusis. Otol Neurotol 2005; 26:392–397. 100. DeStefano AL, Gates GA, Heard-Costa N, et al. Genomewide linkage analysis to presbycusis in the Framingham Heart Study. Arch Otolaryngol Head Neck Surg 2003; 129:285–289.

1181 Chap07

3/29/07

5:05 PM

Page 91

7 Noise-related hearing impairment Ilmari Pyykkö, Esko Toppila, Jing Zou, Howard T Jacobs, Erna Kentala

Introduction The economic basis of our society—the way the people make their livelihoods—has undergone fundamental changes during the last half of the twentieth century. The important changes include dependency on communication skills and increase of environmental noise exposure. In the past, we depended largely on manual labour. Today we depend upon communication skills—hearing, speech, and language. This, in turn, has a profound effect on definition of illness and society’s expectation and demands placed on the medical profession. About 13% of European citizens have a communication disorder that almost exclusively depends on being hard of hearing. In 1853, Robert Koch stated “now when we have won the battle over tuberculosis, we have to conquer the next great problem—noise-induced hearing loss (NIHL).” This statement is still valid, and the riddle of NIHL has not been solved. In Europe, around 50 million subjects are exposed to hazardous levels of environmental noise, creating a risk for NIHL and tinnitus. The losses in economic terms are substantial, at a minimum level 0.2% of national net income. This equals about 400 billion Euros annually at European Community level. This amount includes direct and indirect costs related to production. The indirect costs do not include factors related to reduced quality of life. The factors affecting quality of life include social isolation, increased unemployment, and difficulties in family life due to communication difficulties related to hearing handicap. Needless to say, NIHL is still one of the leading health-related problems in industrialised countries. NIHL is insidious and progressive in nature and is invisible. At no time is there a sudden noticeable change in hearing. The loss of frequency resolution is unknown to people and the

inability to hear sounds against background noise is attributed to other causes and not to hearing loss in the workplace. The affected workers attribute their difficulties to fatigue, lack of interest or concentration, poor articulation of the talkers, and excessive background noise. Interaction with these people reveals inconsistent behaviour and is attributed to an unwillingness to communicate.

Definition of NIHL NIHL refers to sensory-neural hearing loss (SNHL) in subjects exposed to environmental noise, when other reasons for SNHL are excluded. Causes such as head trauma, ototoxic medication, hereditary hearing loss, and various inner ear diseases should be excluded. In estimation of the specific noise-related hearing loss, the subject’s age is used as a correction term in most models (1,2). For example in the ISO 1999 (1990) database (2), age correction is used when the subject is older than 18 years. According to the ISO 1999 database A (1) model for NIHL, an exposure of 100 dB for 8 hours a day over 30 years gives a median NIHL of 45 dB, with variation of 60 dB (10th–90th percentiles) at 4 kHz. Several confounding factors have been cited to attempt to explain the variance, such as inadequate evaluation of the noise exposure, pitfalls in the equal energy principle, prevalence of combined exposure, and individual susceptibility to noise. Due to unknown factors for SNHL, exact risk prediction for NIHL is difficult in individual cases (Fig. 7.1) (3,4). Age is regarded as a contributing factor for NIHL but has been subjected to criticism. The age correction provided in most proposed NIHL standards may not be an accurate estimate

1181 Chap07

Percentage of hearing losses (%)

92

3/29/07

5:05 PM

Page 92

Genetics and hearing impairment

100

80 dB 85 dB

80

90 dB 60

95 dB

40

100 dB 105 dB

20

110 dB 115 dB

0 5

10

15

20 25 Time (years)

30

35

40

Figure 7.1 Noise–exposure curves for the development of noise-induced hearing loss based on ISO 1999 (1976).

of deterioration of hearing in individual cases and may cause variation in estimating NIHL (5,6). A deeper analysis of confounding factors might reduce the uncertainty in evaluation of NIHL. Another problem in the evaluation of NIHL is the shortage of information on free-time noise and on the individual use of hearing protectors. In the estimation of noise dose, evaluation of free-time noise exposure and the type of hearing protector and its attenuation profile and use should be included (7). A database should include all this information if its purpose is to evaluate total exposure for assessing hearing loss risk in individual cases.

Historical databases used in evalution of NIHL One of the first criteria for the risk of damage based on exposure to steady-state noise was proposed by Kryter (8). The damage risk criterion is derived from a group of curves that were based on laboratory experiments on the development of temporary threshold shift (TTS). Data collected during 1955 to 1956 on permanent threshold shifts (PTS) in workers exposed to industrial noise was also included. The committee on hearing, bioacoustics, and biomechanics (9) used the data to express the hearing level contour as a function of exposure. This was the first norm proposed for evaluation of hazardous noise. The first large epidemiological study of the relationship between noise exposure and hearing loss was made by Baughn (10). His studies from the early 60s involved a large worker population (n ⫽ 6835) at stable work locations and under conditions with stable noise exposure (10,11). The exposure durations went up to 45 years, with average noise exposure levels of 78, 86, and 92 dB(A). Baughn (10) recommended that the hearing loss of subjects exposed to the 78 dB(A) noise should be considered as typical of non–noise-exposed males. According to his data, it is possible that factory workers suffer more socioacusis and nosoacusis than the general population. Burns and Robinson (12) studied 759 subjects, of whom 422 males were exposed to four classes of noise ranging from 87

to 97 dB(A). The maximum exposure was about 49 years. As controls 97 subjects not exposed to noise were included in the study. The population was shown to be otologically normal. The authors developed a mathematical generalisation of the predicted hearing loss (13,14). This model introduced the energy principle to enable the combination of different sound levels (15). Hearing loss was divided into two parts: age-dependent hearing loss (presbyacusis) and NIHL. After correcting the model for age and gender, the distribution of hearing loss was calculated by using the specific formulas. The separation of presbyacusis from NIHL leads to a predicted hearing loss that is smaller than that found in other models, partly because the material was rigorously screened for otologically healthy subjects (16). Passchier-Vermeer (17) summarised the results of 19 smaller studies, 12 of which have 50 or fewer cases. The data agree well with Robinson’s data at some frequencies, but, at other frequencies, large differences were found. One reason was the variation in the definition of audiometer zero level used in some of the studies (18). Johnson (19) prepared a report for the U.S. Environmental Protection Agency on the prediction of NIHL from exposure to continuous noise. This report is based on the data of Burns and Robinson (12) and Passchier-Vermeer (17). The data of Baughn (10,11) was also used in evaluating hearing loss in the nonexposed population. For this reason, the hearing loss of the nonexposed population is somewhat less in this report than in the work by Burns and Robinson (12) or PasschierVermeer (17). The National Institute for Occupational Safety and Health (NIOSH) in the United States conducted a study on industrial workers exposed to noise levels of approximately 85, 90, and 95 dB(A) and control subjects exposed to levels below 80 dB(A) (NIOSH 1974). The study consisted of an otologically screened normal population of 792 noise-exposed subjects and 380 controls. Hearing loss was tabulated by a function determined by exposure level and duration. Using these tables, the occurrence of NIHL could be calculated by subtracting the control values from hearing threshold values measured in noiseexposed subjects. In 1975 the ISO published a standard for assessing occupational noise exposure for hearing conservation [ISO 1999 (1975)] (20). The information on which this standard is based is not identified, but, according to Suter (16), the data of Baughn (10,11) form the basis of this standard. The ISO standard adopted the equal-energy principle for the combination of different exposure levels from the Robinson model. According to ISO tables, 5% of non–noise-exposed people have a hearing loss, whereas Robinson and Sutton (21) demonstrated a 10% and U.S. public health services study (22,23) a 20% prevalence of hearing loss for nonnoise–exposed people. The ISO model was corrected, and a mathematical formula for the hearing loss was given in order to produce the present standard model [ISO 1999 (1990)] (2). The problem with historical data is that subjects were not screened for genetic factors and with few exceptions the

1181 Chap07

3/29/07

5:05 PM

Page 93

Noise-related hearing impairment

workers were exposed to the same type of noise. In today’s society, the noise exposure sources vary and free-time noise has become an important source for NIHL. Therefore, the ISO standard [ISO 1999 (1990)] has frequently been criticised.

Demands set by new European union directives The European Union (EU) has set a directive for protection of workers against occupational hazards (Council Directive on the Introduction of Measures to Encourage Improvements in the Safety and Health of Workers at Work, No 89/391/EC). Based on this framework directive, a new directive (2003/10/EC) was introduced on protection against noise. In this directive, the need to evaluate all factors affecting the development of NIHL is recognised. This includes noise characteristics (duration, impulsiveness, and level) and the effect of combined exposure with vibration and ototoxic chemicals. Finally, the employer must give particular attention when carrying out risk assessment

on workers belonging to particularly sensitive risk groups during their whole working career. To deal with this, a database should include all environmental and health related factors that may be cause of hearing loss in NIHL. In prevention work the focus in early diagnosis of NIHL. The following table (Table 7.1) shows the limit values set by the directive and their relation to the ISO 1999 (1990) international standard.

Evaluation of noise exposure history In one study, Pyykkö et al. (24) recorded accurate work histories from 675 of 682 workers in different occupations. For data collection, an expert program (NoiseScan ver 1.0) was used (25). For all subjects, noise immission of individual working places (machines) or working tasks (grinding and welding) was measured by determining the environmental noise and thereafter by performing noise dosimetry in selected workers. The noise immission in forest work was evaluated by determining the average noise level of the chain saws and by performing noise dosimetry in selected forest workers. The collected immission

Table 7.1 Relationship between EU noise directive (EN-10/2003/EU) and ISO 1999 (1990) a

Noise level —Daily equivalent level and peak level

Relevance in regulation (Directive EN-10/2003/EU)

Reference to ISO 1999

75 dB(A)

Not defined

No changes in hearing thresholds

b

Lower exposure action level Preventive efforts to reduce noise should be attempted Worker has access to hearing protectors Workers have right to test their hearing Workers should receive information on noise risks and benefit of the use of hearing protectors

No hearing loss in speech frequencies (500–2000 Hz)

b

Upper exposure action level Preventive efforts to reduce noise should be done Employer must establish a noise control program and provide hearing protectors Employer must promote the use of hearing protectors by all possible means Workers must use hearing protectors Noise areas must be identified and marked and access to these areas should be restricted

5% of workers will get NIHL

c

Exposure limit value must not be exceeded

8% of workers will get NIHL

80 dB(A) and 135 dB(C)

85 dB(A) and 137 dB(C)

87 dB(A) and 140 dB(C) a

Weekly equivalent level may be used if there is a large variation in daily noise exposure. The effect of hearing protectors is not taken into account. c The effect of hearing protectors is taken into account. Abbreviations: EU, European Union; NIHL, noise-induced hearing loss. b

93

1181 Chap07

94

3/29/07

5:05 PM

Page 94

Genetics and hearing impairment

data was used in the estimation of noise exposure for each worker by determining their daily exposure to noise. The immission data gave noise level outside the hearing protective device (HPD). Noise immission remained relatively constant in all workplaces. In a paper mill, the mean noise immission level was 91 to 94 dB (A), in a shipyard, it was 93 to 95 dB (A), and in forest work, it was 95 to 97 dB (A). To obtain the noise level inside the protector, the mean attenuation performance of the HPD was measured with miniature microphone techniques (26). Noise measurements were taken simultaneously inside and outside the HPD. Inside the HPD, a miniature microphone was attached at the middle of the ear canal entrance. The microphone signal was fed to a signal analyser by a thin (0.3 mm) cable to minimise leakage between the skin and the HPD cushion ring. At different work sites, 10 minute samples were recorded for the analysis of Aweighted noise equivalent level and impulsiveness (27). The measurements showed that the protector attenuation is about 15 dB among forest workers, 17 dB among paper mill workers, and 20 dB in the shipyard workers (more impulsive noise). For the calculation of lifetime exposure to noise, the results from a questionnaire on occupational history and use of hearing protectors were included. Noise levels were used to calculate the A-weighted noise immission level (LANO) outside the HPD and emission level (LANI) inside the HPD for each worker according to the following formulae:

L ANO ⫽ ∑ (LAEqi ⫹10 ⋅ LOG(T)),

L ANI ⫽ ∑ (LAEqi ⫺ A ′ ⫺10 ⋅ LOG(Ti )),

(1)

where LAEqi is the A-weighted equivalent noise level during ith ⬘ exposure period, A is the effective attenuation of hearing protectors, Ti is the length of the ith work period in years, and LOG is base 10 logarithm. The effective attenuation (A⬘) of HPDs was calculated using the following formula, which takes into account the use rates:

A ′ ⫽ L ⫺ L ′ ⫽ L ⫺10 ⋅ LOG(10 L /10 ⋅ (1⫺ c) ⫹10(( L⫺A)/10) ⋅ c),

(2)

where L ⫽ noise level outside the HPD, L⬘ ⫽ noise level inside the HPD, A ⫽ attenuation of the HPD, and c ⫽ usage rate/100. Use rates were elicited for all work periods in steps 0, 25, 50, 75, and 100, where 0 means no use at all and 100 means regular use. The contribution of occupational, free-time, and military noise and use of hearing protectors can also be evaluated. Although the 3 dB equal-energy rule is not universally accepted as a method for characterising exposures that consist of both impulsive and continuous-type noises, the evaluation of cumulative lifetime noise exposure might be based on the concept of “the noise immission level” (in dB).

After some modification, the total noise immission level that takes into consideration occupational, free-time, and military noises can be expressed using following formula: L1A ,total

⎛ E A ,tot ,occup ⫹ E A ,tot , freetime ⫹ E A ,tot ,military ⎞ ⫽ 10 log ⎜ ⎟⎠ p ⋅T ⎝ 2

0

0

(3)

where EA,tot,occup is the total occupational A-weighted sound exposure, EA,tot,freetime-totalfreetime is the weighted sound exposure, and EA,tot,militaryp the total military A-weighted sound exposure, T0 reference duration (⫽one year), and ␳0 reference sound pressure, L /10 in Pa (␳0p ⫽ 20 ␮Pa). EAt0,x ⫽ 10 ANI and x refers to occupational, free-time, or military exposure.

Accuracy of measurement The detailed noise exposure measurements are necessary to improve the understanding of exposure–response relationships. Factors such as the calibration of instruments, validity of measurement periods, and the site of the measurement may affect the measurement by as much as ⫾8 dB [ISO 9612 (1997)] (28).

Steady-state vs. impulsive noise The equal energy principle provides a good approximation for the vulnerability of the ear in steady-state noise as in the process industry. However, the time domain characteristics of noise have been shown to affect the harmfulness of noise; the risk of NIHL is higher in occupations where workers are exposed to impulse noise. In several occupations, the impulses are so rapid that they contribute only a minimal amount to the energy content of noise. For example, in impulsive noise among shipyard workers, the hearing loss was 10 dB greater than could be predicted by the model. The observed hearing levels were very consistent with the model for forest workers, where the noise was not impulsive. Pauses in exposure allow for some recovery, and the resulting hearing loss is not as great as is proposed by the equal energy principle in animal experiments (29). Among paper mill workers, the hearing loss among those who used HPDs on average 50% of the time was less than the hearing loss among those who never used HPD. The difference could not be explained by the small change in exposure. The conclusion was that even temporary use of HPDs may provide relatively good protection against hearing loss.

Free-time and military noise exposure The most frequent exposure to noise in free time is exposure to loud music. The highest music exposure rates are from rock music. Noise levels in a concert or a disco often exceed 100 dB (30). Thus, only one attendance a week causes an exposure exceeding the occupational exposure limit value. Similar levels are reported in the users of portable cassette recorders (31). In classical music, the levels are lower, but the musicians still have a risk of hearing loss (32). The role of music in NIHL is not well understood. In studies conducted among young people,

3/29/07

5:05 PM

Page 95

Noise-related hearing impairment

Free-time and military noise The A-weighted sound exposure for free-time and military noise, excluding shooting noise and impulse noise from military sources, will be determined in a similar way. In this case Lex,8hi should be replaced with the equivalent continuous A-weighted sound pressure level. Effective time exposure per day (or week or year) will be also taken into consideration. In the case of shooting noise (hunting as a hobby) or impulse noise from military sources, the A-weighted sound exposure EAimp 2 (in Pa s) might be calculated from the equation (4): M

EA Impi = E0 ∑ N i ⋅ 10

( LEAm 1 s

)/10

u − K HDi

,

i =1

(4)

where Ni is number of impulses, LEA,1si is the A-weighted sound exposure level of single impulse [averaged over one second; see ISO ⫺10 2 1999 (1990)], E0 the reference sound exposure (E0 ⫽ 4·10 Pa s), KHDi is a hearing protector correction, in dB, and M is the total number of various sources of impulse noise. Apart from assessment of the total lifetime noise exposure, each type of exposure (occupational, free-time, and military) will be considered separately. Additionally, in the case of occupational exposure, the noise spectrum will be evaluated for audible, ultrasonic, and infrasonic frequencies [see ISO 9612 (1997)]. In the case of shooting noise and impulse noise from military exposure, evaluations based on the number of shots or explosions and C-weighted or unweighted peak sound pressure level will be incorporated (e.g., see Regulations for Shooting Noise in the Netherlands) (Fig. 7.2). Nonoccupational noise exposure interacts with occupational noise exposure by enhancing the risk of NIHL. At present, this interaction is not taken into account in assessing risk criteria for NIHL in industry. In addition to occupational noise, other noise sources such as military noise, vehicle noise, and, especially, exposure to free-time noise have become increasingly important for the development of NIHL. The nonoccupational noise exposure confounds the NIHL and, in many cases, overrules the occupational noise exposure.

Evaluation of the use of HPDS The use of HPDs started in the early 1970s in most workplaces and since then has increased over time. In Nordic countries, in 1990s, about 60% of paper mill workers, 90% of shipyard workers, and 97% of forest workers reported that they used HPDs during the whole working time (7).

10 120

Cumulative exposure (dB(A))

exposure to loud music causes no changes in the audiogram. It has been suggested that the effect of music exposure would show up later. This is in accordance with recent studies showing that people exposed to loud music had more frequent and severe tinnitus than people with less exposure to music (33).

20

30

40

50

60

Shooting

Work exposure without HPD

95

32 30 28

Concerts and disco noise

100

26 24 22 20

Work exposure with HPD

80

18 16

Shooting noise (dB)

1181 Chap07

14 20

30

40

50

60

Age, years

Figure 7.2 Example of prediction of hearing loss when environmental factors are included. The shipyard worker starts working at the age of 20 years in an impulsive noise environment of 98dB(A). The nominal attenuation of HPD is 24dB. He attends weekly discos and concerts with a mean sound pressure level of 98dB(A) for six hours. He starts visiting the discos at the age of 15 and stops at the age of 30. His hobby is hunting with annually 30 shots in the forest without HPD and 100 shots for targeting with HPDs. Abbreviation: HPD, hearing protective device.

Although the use rate is now at a very high level in some branches of industry, there is still room for improvement in other branches. The nominal attenuation, recommended by the manufacturers, varies from 11 to 35 dB, depending on the HPD and the frequency content of the noise. Whether this nominal attenuation is obtained is often questioned (34,35). For maximum attenuation, a use rate of over 99% is needed (EN 458-1993) and the HPD needs to be in good condition. The real protection provided by HPDs depends on the use rate. A case study among paper mill workers demonstrated that hearing loss among those who used HPDs on average 50% of the time was less than the hearing loss among those who never used HPDs. The difference could not be explained by the small change in exposure. Thus, even temporary use of HPDs provides some protection against hearing loss. However, the use of manufacturers’ data for the evaluation of attenuation has been questioned by the several studies, suggesting that 3 to 18 dB should be subtracted from the protection values given by the manufacturer. At present, a proposal under preparation in Europe is that for custom-moulded HPDs 3 dB should be subtracted, for ear muffs 5 dB, and for ear plugs 8 dB. The HPDs attenuate industrial impulse noise even more effectively than steady-state continuous noise. This is due to the high content of high frequencies in impulses (36) that are attenuated effectively by earmuffs. Even though earmuffs reduce the impulse noise rate, workers in the metal industry are still exposed to more impulsive noise than workers in paper mills and forestry. The use of HPDs gives best results with motivated users. Low motivation to wear HPDs is manifested as low use rates and low true attenuation values (37). Successful motivation can be obtained via appropriate education and training. The users must be informed about the effects of noise and the risks

1181 Chap07

96

3/29/07

5:05 PM

Page 96

Genetics and hearing impairment

at work (2003/10/EC). Best results are obtained if personal audiometric data is used (38). This means that the education must be given privately. Users need training on the maintenance, installation, and use of HPDs. The attenuation of HPDs works well only if the HPDs are well maintained (EN 4581993). Good maintenance consists of cleaning, changing of replaceable parts such as cushions, and overall monitoring of the state of the HPD. Installation must be done before entering the noisy area (EN 458-1993). If earplugs are used, special attention must be paid to the proper installation technique (34,37). In branches of the military where large calibre weapons are used, recruiters face a high risk of developing NIHL. HPDs have shown to be less effective due to the nonlinearity of the attenuation against very high peak levels and the low frequency components of large calibre weapons. According to one study, workers exposed to occupational noise showed on average 5 dB greater hearing loss if during their conscript period they were exposed to the noise of large calibre weapons (39). Although it is possible to obtain highly motivated users with proper education and training, the motivation tends to decrease over time. To avoid this, the education and training must be repeated consistently (38).

Measurement of hearing and evaluation of hearing Loss Audiometry Calibration of the audiometer, background noise in the measurement booth, instructions given to test subjects, and possible contamination with TTSs should be considered in the measurement protocol and included in the evaluation of hearing threshold. In practice, we recommend that the audiometry test starts at 1 kHz and that the tester evaluates the threshold in descending order. The hearing threshold is set when the subject correctly hears two out of three tone peeps at the lowest thresholds. Thereafter lower frequencies are tested, then the 1 kHz test frequency is repeated, and after that higher frequencies of 2, 3, 4, 6, and 8 kHz are tested. Measurement errors as much as 10 dB can occur in audiometric data if each of the items mentioned before is not controlled. In practice, the examiner should screen the accuracy of the audiometry each day by listening to the sound before making any evaluation of test subject’s hearing level. The type of audiometer used (clinical, Bekesy, screening, bone conducting, or automatic) should be noted in the evaluation. This is because screening audiometry measures hearing at 20 dB HL level at best, whereas other audiometers are able to measure hearing threshold values at 0 dB level. The automatic audiometer has a step accuracy of 1 dB, in contrast to clinical audiometry that has a step width of 5 dB (Fig. 7.3). These all cause variability in the audiometric database and should be noted in the measurement protocol.

BORDERS IN HEARING SOUND PRESSURE LEVEL (dB)

160 140 120

MUSIK

100

WHISPER DAMAGE PAIN

80

SPEECH

60 40 20 0 250

500

1000

2000

4000

8000 Hz

FREQUENCY

Figure 7.3 Thresholds for hearing and whisper; hearing damage limit and pain limit shown as a function of sound pressure level. Also sound pressure levels for speech and music are indicated.

Otoacoustic emission The term otoacoustic emission (OAE) refers to sounds emitted by the ear (40). The emitted sounds originate from the electrical activation of outer hair cells that leads to mechanical contraction of the organ of Corti and may be helpful in the early identification of SNHL caused by occupational noise exposure. It must be stressed that OAE provides a statistical measure based on a large hair cell population. Three forms of OAE exist, all of which are evoked by particular stimuli. In the normal ear, spontaneous OAEs (SPOEAs) are present in the absence of acoustic stimulation among 70% of subjects. After even subtle lesions, the spontaneous oto-acoustic emissions (SOAE) seems to disappear (41). Thus absence of previously identified SOAE indicates a lesion in the contractile properties of the outer hair cells. Transient-evoked OAEs (TOEAS) are elicited by brief stimuli such as clicks or tone pips. When two signals are averaged and compared, the repeatability of the signal can be ascertained. As parameters for hair cell damage, the amplitude of the signal over a specified frequency range and its repeatability can be used. Transient emissions are normally present when hearing loss is 20 dB or less. Thereafter transient oto-acoustic emissions (TOAEs) decrease in a nonlinear manner and are absent when the sound pressure level (SPL) is about 40 dB. This nonlinearity in the response and the absence of any early indication of incipient hearing loss limit the use of TOAE in diagnosis of SNHL (42,43). Distortion product OAEs (DPOAEs) are elicited by a nonlinear interaction of two simultaneous long-lasting pure tones. The evoking tones are referred to as the f1 and f2 primaries in humans. The largest DPOAEs occur at a frequency equivalent to 2f1 to f2. DPOAEs are widely used as a screening method for SNHL, and there is a moderately good correlation between SNHL and the output of DPOAE. In the assessment, the amplitudes at different frequencies are used for comparison (44). However, there is no physiological evidence to support the

1181 Chap07

3/29/07

5:05 PM

Page 97

Noise-related hearing impairment

expectation that normal DPOAEs can predict pure tone thresholds directly. There are various ways by which the recording and interpretation of DPOAE can be improved. In comparing pure tone audiometry with DPOAE, Kimberley et al. (44) demonstrated a significant probability of false responses when the DPOAE amplitude is less than 6 dB above the noise floor. Contralateral inhibition of the distortion product is recognised as a reduction in the amplitude of evoked OAE upon stimulation of the opposite ear. OAEs are vulnerable to noxious agents such as ototoxic drugs, intense noise, and hypoxia, which are all known to affect the cochlea. They are absent with cochlear hearing loss greater than 35 dB. The type of OAE most commonly used for clinical purposes is TOAE. These are attractive for use as a screening procedure as the test procedure is short and no cooperation of the subject is needed. DPOAE may be more sensitive than TEOAE to discriminate subjects with NIHL (45). However, the value and accuracy of OAE in assessing NIHL have not yet been evaluated. So far few databases exist with data on OAE.

Assessment of NIHL According to ISO 1999 (1990) (2), noise vulnerability is linked to the A-weighted sound energy entering to the ear. No changes in the audiogram are to be expected at speech frequencies if the A-weighted equivalent noise level is less than 80 dB. However, in most countries, if compensation is to be awarded, a higher level of 85 or 90 dB(A) is required. Although the new EU Directive (46) recognised that 80 dB can cause NIHL to the most susceptible people, a higher limit may be used for compensation. The criteria of NIHL outside the EU are country dependent and may include other criteria than those related to the audiogram, such as speech intelligibility. In clinical work, NIHL is acknowledged when the mean hearing loss exceeds 25 dB across speech frequencies and starts to cause problems with communication. Although this limit is arbitrary, it closely follows the normal threshold values for hearing defined by the World Health Organisation. Usually NIHL starts in the 3 to 6 kHz area where a typical notch in the audiogram can be observed. When the noise damage increases the notch becomes wider and deeper and the audiogram starts to flatten, indicating damage at speech frequencies. With prolonged and very severe noise exposure, the NIHL levels out across the high frequencies at 60 to 80 dB HL, but commonly low frequencies are less affected than high frequencies. Usually both ears are involved to the same extent, and if the interaural difference at speech frequencies exceeds 10 dB HL, inner ear damage should be assumed to be confounded by factors other than noise. Often the occupational assistants who carry out industrial audiometry have little experience and education in the field of audiology. Earwax may not be removed and the ears may not have been inspected. We not infrequently observe workers with wax-blocked ear canals or with noise protection cotton left in the ear canal, and such situations may cause biased deterioration in the hearing threshold shift. On certain occasions, the subject

97

may not understand the instructions and provides inaccurate responses, resulting in an unreliable audiogram. Instructions should be simple and given verbally before the test. Importantly the noise-free period should be 16 hours to allow hearing threshold measurement that is free from TTSs caused by environmental or occupational noise. Therefore, the audiometry test should be done as the first thing in the morning and the subject should not have been exposed to noise in the previous evening. Attention should be paid to the background noise in the audiometry booth, and this noise should be measured, as even at low frequencies it may mask the tone pips in the tested frequencies. In these instances, the 0-dB threshold values cannot be measured. As a rule, the background should not exceed 30 dB(A) in the booth to allow 0-dB threshold values to be measured. In industry, screening audiometry is performed for 20-dB hearing level at any frequency. For this purpose, background noise should not exceed 40 dB(A) in the booth. For audiogram evaluation, the Occupational Safety and Health Administration (OSHA) uses the occurrence of a “standard threshold shift” (STS), defined as 10 dB or greater worsening over time in the average hearing threshold levels for 2, 3, and 4 kHz tones in either ear. NIOSH recommended an improved criterion for the detection of significant threshold shifts in workplace audiometric monitoring, the “15 dB twice” criterion. This is defined as 15 dB worsening at any frequency, 0.5 through 6 kHz, remaining present in two consecutive annual audiograms. Daniell et al. (47) evaluated a relatively large population in a longitudinal retrospective study of eight years with consecutive audiograms. None of the criteria used was accurate, and all the criteria produced significant numbers of false-positive audiograms. Based on the OSHA criteria, 36% of workers had at lest one threshold shift in seven years, and it was estimated by other criteria that the true value was 18%. The respective figures for NIOSH criteria were 54% and 35%. Who then should be referred to an otologist? A worker with a 10 dB hearing change at two frequencies between the last two audiograms should be referred, as the change may indicate NIHL or an ear disorder. Also if the threshold shift is greater than 25 dB at any single frequency, the worker should be referred to an otologist. Also any subjects with possible conductive or inner ear disorders other than NIHL should be referred. Some inner ear diseases such as idiopathic tinnitus, Ménière’s disease, otosclerosis, and sudden deafness may begin with a pure inner ear component affecting only hearing or masking the hearing as tinnitus may do. Infectious ear diseases such as chronic otitis media or tympanosclerosis cause hearing loss and should be identified. In addition to a complete exposure history and audiograms, the case history must document other factors that may cause SNHL. These include head traumas, explosives, and use of vibrating tools. The possible use of ototoxic drugs such as streptomycin and cisplatin should be queried. Heavy use of antiinflammatory agents as salicylates and indomethacin-type analgesics may cause reversible or nonreversible hearing loss and aggravate the NIHL (48).

1181 Chap07

98

3/29/07

5:05 PM

Page 98

Genetics and hearing impairment

Early detection of problems Although individual models for the development of NIHL have been provided in a few of them (49,50), the studies have not been very successful so far. One reason may be inaccuracies in the evaluation of exposure data, in the use rate of hearing protectors or in estimations of sosioacusis and of socioacusis, especially in the detection of genetic factors. One of the most confounding factors in assessing damage risk criteria for noise is the large variation, often exceeding 60 dB, in expected NIHL. This large variation means that in assessing the risk of noise damage in the workplace, a large number of subjects are needed before any conclusions can be reached. In order to reduce the number of subjects there are two possibilities: 1. Removal from the study sample of subjects having a non-NIHL 2. Taking into account the effect of individual risk factors for NIHL Both these methods are disadvantageous. In the former alternative, a large number, perhaps a majority of subjects, are excluded from the analysis. In the latter alternative, the risk factors may play variable roles in the aetiology of hearing loss in different subjects and at different ages. By taking a population having similar risk profiles the variation of results is reduced. In subjects with practically no risk factors, the effect of noise on hearing is evident (27). When subjects have a large number of risk factors for hearing loss, the effect of noise is severely masked by these risk factors. In the case of interaction of a chemical and noise, this effect may easily be masked in small populations unless the risk profile of the workers is taken into account.

Age as a confounder for NIHL Several factors have been suspected as being the underlying cause of age-related hearing loss (presbyacusis), including hypertension, dietary habits, drugs, and social noise exposure. For example, Rosen and Olin (5) and Hincliffe (6) suggest that if all environmental and disease processes could be controlled, no prominent age-related hearing impairment could be demonstrated. Driscol and Royster (51) concluded in their study on the aetiology of age-dependent SNHL that existing databases are contaminated by environmental noise, leading to overestimation of the effect that age has on hearing. Stephens (52) examined consecutive presbyacusis patients seeking rehabilitation and found that in 93%, there was an underlying cause for presbyacusis. A prospective study of the causes of hearing loss in the elderly by Lim and Stephens (53) showed that in 83% of cases, a disease condition was associated with a hearing loss. About 30% of the subjects took ototoxic medications. Humes (54), in a critical review of the causes of hearing loss, found several confounding factors affecting age-related hearing loss.

To compare people of different ages, an age correction is usually made. The interaction of NIHL and presbyacusis does not yet seem to be well established (55). The uncertainty in the age correction might be diminished by selecting an internal control group. Usually a group that would be otologically screened and exposed to similar environmental stressors other than noise is not available. Robinson (13) focused on the problem of evaluating NIHL in an industrial population. He concluded that it is not generally realistic to compare such a population with an age-matched “otologically normal” baseline, since a noise-exposed population will include adventitious hearing loss as well as noise-related components. The lack of a well-documented baseline for data comparison makes it difficult to estimate hearing loss in different geographic areas by using standard forms. In baseline data adopted by Robinson and Sutton (21), the importance of age-related hearing loss in the context of industrial noise exposure is documented and also provides the basis of age-related changes in hearing loss. Although aging gives a crude estimate of the effect these biological factors have on hearing, age correction for individual cases can be misleading. In Robinson’s study aging alone seems to influence NIHL to a smaller extent than would be expected in the ISO 1999 model.

Individual risk factors Figure 7.4 demonstrates factors affecting noise susceptibility in man. The reciprocal connections and the weight of each factor vary from subject to subject. In order to prevent NIHL, all these factors should be analysed and documented, and based on the individual model, prevention should be commenced. Several biological factors have been studied as possible aggravating factors for NIHL. In population surveys, advanced hearing loss in nonexposed populations has been attributed to biological (3,56) and environmental factors (6). Factors such as elevated blood pressure (57,58), altered lipid metabolism (5), the vibration syndrome (58,59), and genetic factors (60) are associated with NIHL. An association between elevated blood pressure and NIHL has been described by some researchers (61–63), but the relationship has not been found in all studies (64). Animal studies have indicated that arterial hypertension accelerates agerelated hearing loss (57,65). An antihypertensive medication may partly mask the effect of elevated blood pressure on NIHL (3). The effect of hypertension on hearing is promoted by other factors. Toppila et al. (27) showed among noise-exposed workers that age alone explained about 18% of the variance of NIHL in a linear model. Cholesterol levels correlated significantly with age, as did hypertension treatment and smoking. The older subjects also suffered more often from pain than the younger subjects and consequently used more analgesics. Therefore, presbyacusis was contaminated by several factors, each of which could affect hearing but mediated by somewhat

1181 Chap07

3/29/07

5:05 PM

Page 99

Noise-related hearing impairment

PROTECTION

WORK NOISE

PLUGS EAR MUFFS USAGE RATE

LEVEL DURATION IMPULSIVENESS HEARING PROTECTION

NOSOCUSIS (LEISURE TIME NOISE) MUSIC (DISCO, WALKMAN ETC) POWER TOOLS (CHAIN SAW ETC) SHOOHING (< 100 SHOTS) MILITARY SERVICE TYPE

BIOLOGICAL VARIABLES

ENVIRONMENTAL VARIABLES

HEARING LOSS & TINNITUS

CHOLESTEROL PIGMENTATION AGE RAYNAUD'S PHENOMENON

99

INHERITANCE

SMOKING ANALGESICS VIBRATION SOLVENTS

RESTRICTION OF ACTIVITY

DETOXIFICATION GENES POTASSIUM GENES MITOCHONDRIAL GENES OTHER COMPLEX GENES

PARTICIPATION RESTRIC. COMUNICATION RESTRIC. SOUND ORIETATION SLEEP DISTURBANCES CONCENTRATION DISTURBANCES

HEARING CONSERVATION PROGRAM (HCP) IDENTIFYING SENSITIVE PERSONS IDENTIFICATION. OF NOISY WORK PLACES, IMPROVING PROTECTION INCREASING KNOWLEDGE

Figure 7.4 Summary diagram of factors influencing noise-induced hearing loss and outcome measures. Abbreviation: HCP, hearing conservation program.

different mechanisms. There is not sufficient evidence to show whether the effects of noise and hypertension are additive or synergistic. Smoking together with hypertension heightens the role of smoking in causing NIHL (66). Pyykkö et al. (3) studied noise-exposed workers and proposed that the predicted hearing loss at 4000 Hz should be corrected with the following factors: smoking 1.5 dB (23), cholesterol 1 dB at 4000 Hz (24), and hypertension 2 dB at 4000 Hz (6). The cholesterol-linked hearing loss is age dependent and is observed in subjects aged 40 years or over (67). Synergism occurs also between noise and solvents. In animal experiments, noise combined with a high 3 level of styrene (600 ppm/m ) caused a threshold shift in hearing that is 30 dB greater than when the animals were exposed to noise or styrene alone (68). Such a high level of styrene is seldom encountered in industry, and solvent-linked NIHL is significantly less likely in man than demonstrated in this animal experiment. Skin pigmentation seems to affect the vulnerability to NIHL. A study among African-Americans showed a somewhat better average hearing threshold levels than among Caucasians (49). This has been attributed to higher levels of melanocytes

and their capability to protect the inner ear against noise damage (69,70). Many authors have found a significant and relatively large difference in vulnerability between men and women (2,71). These results may be explained by women’s smaller exposure to free-time noise, especially to gunfire. In a recent study where these factors were controlled more accurately, no difference was found (33).

Evidence for genetic factors There are insufficient data available on the relationship between NIHL and genetic background. Such data would be crucial in explaining the great variability of noise vulnerability in population studies. Several studies have estimated the heritability (the proportion of the population variance attributable to genetic variation) of age-related hearing loss. An extension of the Framingham Heart Study examined the heritability of human age-related hearing impairment and tried to identify the

1181 Chap07

100

3/29/07

5:05 PM

Page 100

Genetics and hearing impairment

chromosomal regions involved (72). Audiometric examinations were conducted on 2263 original cohort members and 2217 offspring. Of these, 1789 individuals were members of 328 extended pedigrees used for linkage analysis. DeStefano et al. (72) found heritability of age-adjusted pure-tone average at medium and low frequencies to be 0.38 and 0.31, respectively. A good correlation was found with early onset of hearing loss and extent of presbyacusis within the family. In men, the relationship was not as evident as in females. In men, the exposure to environmental noise was a significant confounding factor. Christensen et al. (73) conducted a population survey on the genetic influence on presbyacusis in twins aged 70 and older identified in Danish Twin Registry. In total, 2778 twins aged 70 to 76 were studied, and hearing was evaluated by questionnaire. The heritability was estimated using structural-equation analyses. Concordance rates, odds ratios, and correlations were consistently higher for monozygotic twin pairs than for dizygotic twin pairs in all age and sex categories, indicating heritable effects. The heritability of self-reported reduced hearing was 40% (95%, CI ⫽ 19–53%). The remaining variation could be attributed to individuals’ nonfamilial environments. Kaksonen et al. (74) studied a large pedigree with lateonset nonsyndromic hearing loss. They found weak evidence for a correlation between noise exposure and hearing loss among affected family members, but the levels of occupational and free-time noise exposures were quite low, seldom exceeding 90 dB. Those subjects who had passed military service demonstrated worse hearing, but this association could be biased by sex as women did not perform military service. They also found an association between the use of analgesics and hearing loss. The strongest association was with the use of non-steroid antiinflammatory drugs (NSAID) analgesics, confirming the findings of some other studies (3,24). In the pedigree, the patients more often had vertigo with tinnitus than their normal hearing relatives. It is likely that a similar degeneration in the vestibular end organ occurs, similar to that in the cochlea that can be measured with audiograms. This may explain the presence of vertigo in some genetic disorders, for example, in DFNA9. Although case histories indicate that some vestibular disorders such as Meniere’s disease can arise by extensive noise trauma, the evidence of linkage between NIHL and vestibular deficit is still not documented.

Identifying the genetic susceptibility factors Many genes have been identified that when mutated cause mendelian forms of hearing impairment (see Chap. 5). Genetically induced hearing loss in nonsyndromic form is often difficult to separate from NIHL. It is often age dependent and worsens with aging. Therefore, genes identified as causing mendelian forms of hearing loss have been good candidate

susceptibility factors for age-related and noise-induced loss. Mutations of large effect might cause the mendelian forms, whereas mutations with much smaller functional effects could act as susceptibility factors. The scientific basis of the linkage and association methods used is described in Chapter 6. In the extended Framingham study, quantitative measures from audiometric examinations were tested for linkage to markers from a genome-wide scan in this population-based sample ascertained without respect to hearing status. The outcome traits for linkage analysis were pure-tone average at medium (0.5, 1.0, and 2.0 kHz) and low (0.25, 0.5, and 1.0 kHz) frequencies adjusted for cohort, sex, age, age squared, and age cubed. The analysis did not identify any statistically significant lod scores, but several locations showed suggestive evidence of linkage. Of particular interest are the regions 11p [maximum multipoint lod score (MLOD), 1.57], 11q13.5 (MLOD, 2.10), and 14q (MLOD, 1.55), which overlap with genes known to cause congenital deafness, for example, Usher syndrome. In this study, there was evidence that genetic and environmental factors contribute to hearing loss in the mature human population. However, the study was inconclusive as to whether the same genes cause presbyacusis and congenital hearing loss. Of particular interest are genes where the mutants show inner ear structural changes similar to those seen in age-related or noise-induced loss. It is notable that actin structures appear to be structurally damaged as a consequence of noise exposure and aging (75). Actin is one of the major proteins responsible for providing the structural basis for hair cell shape, and Chan et al. (76) have demonstrated that acoustic overstimulation causes reversible reduction in the stiffness of the outer hair cells. Zhu et al. (77) have determined that mutations in g-actin are the basis for hearing loss in four families affected with DFNA20/26. Persons affected with the DFNA20/26 disorders display sensorineural hearing loss that, like age related hearing loss gene (AHL), begins in high frequencies and steadily progresses to include all frequencies. DPOAE data are consistent with a cochlear site of lesion. Thus people with minor abnormalities in the actin genes may be more susceptible to NIHL. Genetic analysis in mice has identified three loci (Ahl, Ahl2, and Ahl3) involved in age-related hearing loss, as described in Chapter 6. Several functional studies have reported that the Ahl gene renders mice more susceptible to NIHL than strains that do not carry this gene (78–80). Harding and Bohne (81) exposed the mice to 4 kHz octave band noise for four hours. They observed sizeable variation in the magnitude of TTSs, PTS, and hair-cell loss among mice of the same genetic strain. The congenic B6.CAST ⫾Ahl male mice had significantly less TTS immediately postexposure than C57BL/6J males or females but not less PTS or hair-cell losses at 20 days postexposure. These results indicate that, at one month of age, mice carrying two copies of the Ahl gene have an increased susceptibility to TTS from low-frequency noise before they have any indication of age-related hearing or hair-cell loss. However, this appeared not to be the case for PTS. The Ahl gene appears to play a role

1181 Chap07

3/29/07

5:05 PM

Page 101

Noise-related hearing impairment

in susceptibility to NIHL, but the authors point out that other genes as well as systemic and local factors are involved. Because of the similarities between the human and mouse auditory systems, the genes causing AHL in mice may also identify homologous human genes. The mouse Ahl allele is a single-nucleotide variant in the Cdh23 (cadherin 23) gene; it is not clear whether a similar functional variant exists in humans, and if so whether it can explain any of age related or NIHL. Recent studies have shed light on the genetic background on caspase activation, including mitogen-activated protein kinases and p53. Cheng et al (82) suggested that p53 is activated by noise oppoture initiating apoptous. Also genes involved in potassium recycling in the exmer ear are respected to cause nubnerclarity to noise (83).

Mitochondrial genes It is also possible that mitochondrial gene defects may cause NIHL, as hearing in noise is a high-energy consuming process. The prevalence of these mutations in the population and their association with NIHL has not been documented yet. Most studies are difficult to interpret, either because the patient selection criteria are too imprecise or because they focus only on families with probable maternal inheritance of hearing impairment, or else only a subset of possible mutations was investigated. In addition, virtually all previous studies have been conducted in localised populations, so that their wider relevance is unclear. Many previous reports in the literature have identified matrilineal pedigrees in which mitochondrial DNA mutations are associated with isolated nonsyndromic deafness. The most commonly reported such mutations are A1555G (84), A7445G (85,86), 7472insC (87,88), and A3243G (89,90); the latter mutation is also found in families with more severe, syndromic disease. Assignment of these mutations as pathological is based upon their absence from unaffected families, their ability to produce a biochemical phenotype in cultured cell models such as rho-zero cybrids, and demonstrable effects on mitochondrial protein synSer(UCN) thesis (91–96). A number of other mutations in tRNA , i.e., T7510C (97,98), T7511C (99,100), and T7512C (101), as well as another mutation in 12S rRNA, C1494T (102), have been reported in cases of similar phenotypes (syndromic hearing impairment in the case of T7512C). This tRNA as well as Leu(UUR) may be hotspots for such mutations, although other tRNA tRNAs have not been systematically excluded. According to Jacobs et al. (103), the specific case of the A1555G mutation presents additional problems. It was originally reported in matrilineal pedigrees and singleton cases with acute aminoglycoside ototoxicity, as well as in some families with nonsyndromic deafness but no known aminoglycoside exposure (84,86). More recent studies have revealed the mutation in a substantial proportion (up to approximately 25%) of cases of late-onset, familial, sensorineural deafness in Spain (104–106). However, studies in other populations, including other European countries, have reported it only at a much lower

101

frequency, typically 1% to 2% of cases (107,108), although the groups of patients studied were not always identically defined. The majority of Spanish A1555G patients have no recorded history of aminoglycoside use. Such use is very rare in, for example, Nordic countries today. Since the mutation is found on diverse haplogroup backgrounds amongst Spanish patients (105), founder effects seem an unlikely explanation. Multiple founder effects in a population that is otherwise not untypical of the European norm would have to be invoked. This leaves two other plausible explanations. Either there is some systematic difference in the way patients have been recruited or defined in Spain versus other countries or else environmental factors such as unrecorded aminoglycoside exposure or local dietary components may account for the difference. Lehtonen et al. (109) reported that in Northern Finland, the prevalence of A1555G was 2.6% in a highly selected population with sensorineural hearing loss. Confirming their findings, in our recent study, we found A1555G mutations in 3/500 subjects visiting a tertiary referral centre for hearing loss (Jacobs H. unpublished observation). Thus in Nordic countries mutations linked to A1555G seem not to be important in the aetiology of NIHL (103).

Mitochondrial haplogroup affiliations and hearing impairment The background and emigration of populations can be traced according to their membership of ancient matrilineal clans defined by founder polymorphisms in mtDNA. These haplogroups and their sub-branches [haplogroup clusters (HVs)] show subtle differences between populations (110), for example, east–west and north–south clines within Europe (western Eurasia). Previously, associations between specific haplogroups or HVs have been reported with a variety of disorders, including male infertility (111), Parkinson’s Disease (112), Alzheimer’s and other types of dementia (113,114), and multiple sclerosis (115), as well as with longevity in different populations (116,117). Not all these studies are congruent, however, and virtually no evidence is available to support a specific functional role in the pathogenesis of polymorphisms characteristic of, or unique to, specific haplogroup backgrounds. Nevertheless, a general trend is evident, in that the most common European haplogroup H, or the HV to which it belongs, is associated more frequently than expected, given its overall population frequency, with disease or short lifespan (103). So far, it is not known whether specific haplogroups are linked to any hearing loss or increase in susceptibility to NIHL. However, studies conducted on identical twins favour the idea of genetic background for increased vulnerability or predisposition. Jacobs et al. (103) have recently focused on the assessment of possible associations between the haplogroups and hearing loss. Lehtonen (109) found an increased number of rare polymorphisms amongst Finnish patients with sensorineural hearing impairment, compared with controls, consistent with at

1181 Chap07

102

3/29/07

5:05 PM

Page 102

Genetics and hearing impairment

least some of them being mildly deleterious mutations contributing collectively to the phenotype. Several recent papers have suggested that mitochondrial haplogroup can influence the disease phenotype of patients carrying other mtDNA mutations. Thus, the A12308G polymorphism, diagnostic for the U.K. HV, seems to be associated with a more severe phenotype, including retinopathy, short stature, and cardiac defects, amongst patients with mtDNA deletions (118). However, Torroni et al. (119) failed to find any haplogroup associations underlying phenotypic variability of A3243G patients. The data of Jacobs et al. (103) suggest a distortion towards HV amongst patients with early-onset but postlingual hearing impairment, at least compared with population controls or patients with presbyacusis. The fact that this applies to two geographically distinct populations supports it as being meaningful, but it is of only borderline statistical significance. A recent study demonstrated statistically significant haplogroup differences between adult Finnish controls and a healthy cohort of individuals aged 90 to 91 from the same geographical area, on the basis of which they proposed a haplogroup association with healthy aging. Whatever the underlying cause of this phenomenon, it suggests that “population controls” may not be rigorous enough to demonstrate haplogroup associations with hearing loss, and that tightly age-matched controls might be needed. The bias in HV would suggest that polymorphisms that have arisen uniquely on the HV background may contribute to hearing loss (103).

The need for further research There is an urgent need for population studies in the EU to clarify the role of genetic factors in the aetiology of NIHL. It has been suggested that as much as 60% of NIHL may be linked to genetic factors (120). A modern database should therefore include possible indications of a genetic background for NIHL. The complete case history should include questions on possible hard-of-hearing relatives in the pedigree. This is also the aim in the new EU-based noise control directive. We are currently performing a study of a number of gene loci known to cause mendelian forms of hearing loss in a large sample of EU citizens with hearing loss. So far no significant clusters of gene mutations have been found that would indicate increased noise sensitivity [EU age related hearing impairment (ARHI) project, 2005]. It seems likely that the genes currently identified through family studies are not the major loci responsible for noise vulnerability or aging.

Hearing conservation program The primary goal of an industrial hearing conservation program (HCP) is prevention (or, at least, limitation) of NIHL associated with exposure to industrial noise (121). Other goals

may be formulated in addition to this primary goal, such as reduction of employees’ stress and absenteeism and reduction of workplace accidents. An HCP is costly and demands resources and personnel. Often due to these factors only selected personnel who are in high risk for the development of NIHL are tested audiologically, whereas newly employed persons are not tested. If a hearing test is not carried out before starting to work, it may be difficult later to show that the hearing loss is of preemployment origin. It is strongly recommended that all person entering jobs with a risk of developing NIHL should be tested. Several HCPs have been launched in order to better understand the effect of occupational noise on the human ear (49,122–124). Some recent HCPs utilise database analysis programs comparing data on the noise emission level and including evaluation of factors other than workplace noise (50,125). These programs may take into consideration, for instance, the association of aging, nonoccupational noise, and medical history (125). Other researchers use models based on risk analysis in which the relative importance of various factors as well as workplace noise is considered (3,59). Only few programs actively monitor the use of personal hearing protectors and their attenuation efficacy. The OSHA (126) requires employers with excessively noisy jobs to maintain a continuing and effective HCP, providing personal hearing protecting devices, annual training, and annual audiometric monitoring for exposed workers. The employer must monitor individuals’ audiograms for occurrence of STS, defined as 10 dB or greater worsening over time in the average hearing threshold levels of 2, 3, and 4 kHz tones in either ear. When STS is documented, the employer is required to notify the individual worker, provide retraining and refitting of hearing protectors, and make any necessary referral for otological evaluation. One major problem in HCPs is establishing individual baseline values. Royster and Royster (50) demonstrated a significant improvement of age-corrected audiograms when the subjects were annually tested over six years. The improvement was interpreted as due to the training effect but depended on the noise emission level. Also, those with prominent hearing loss had less training effect. Royster and Royster (50) proposed that the audiogram showing the best hearing at frequencies of 500 to 6000 Hz should form the baseline level. Thus any audiometric evaluation used in a HCP should be based on a serial audiogram, and the database should include some expert programs to validate the data in order to establish baseline values for hearing and also to calculate hearing loss. The components of an effective HCP are as follows (127): 1. Measurement of work-area noise levels 2. Identification of overexposed employees 3. Reduction of hazardous noise exposure to the extent possible through engineering and administrative control 4. Provision of HPD if other controls are inadequate 5. Initial and periodic education of workers and management 6. Motivation of workers to comply with HCP policies

1181 Chap07

3/29/07

5:05 PM

Page 103

Noise-related hearing impairment

7. 8. 9. 10.

Professional audiogram review and recommendations Follow-up for audiometric changes Detailed record-keeping system for the entire HCP Professional supervision of HCP

One observes that many of these above-mentioned tasks are not well defined. The exposure evaluation is not a simple straightforward task, and comparison of audiograms is not easy, due to large variations in NIHL and the strong effect of age. The use of HPDs gives best results with motivated users. Low motivation to wear HPDs is seen as low usage rates and low true attenuation values (37). A successful motivation can be obtained via appropriate education and training. The users must be informed about the effects of noise and the risks at work (89/188/EEC, 2003/10/EC). Best results are obtained if personal audiometric data is used (38). This means that the education must be given privately. Users need training on maintenance, installation, and the use of HPDs. The attenuation of protectors works well only if they are well maintained (EN 458-1993). Good maintenance consists of cleaning, changing of replaceable parts such as cushions, and overall monitoring of the state of the HPD. Installation must be done before entering the noisy area (EN 458-1993). If earplugs are used, special attention to the proper installation technique must be paid (37). Although it is possible to obtain highly motivated users with proper education and training, the motivation tends to decrease over time. To avoid this, the education and training must be repeated consistently (38). The data should preferably refer to a large international database of individual worker information to include the individual susceptibility factors and thereby provide personalised HCP. The approach to the protection of workers described in the directive 2003/10/EC is based on the identification of the risks in the workplace. The identification includes the effect of impulse noise, interaction with vibration and ototoxic chemicals, and effect noise and hearing protection of risk of accident. Also the groups susceptible to noise must be identified. If there is risk of NIHL, the employer must develop a HCP (Fig. 7.5). In HCP, the first task is to evaluate the sources of noise and the possibilities to reduce the levels by technical means. If reduction of the noise source is not possible, the workers should be provided with HPDs and the workers should be informed about the risks and the correct use of the selected HPDs in an appropriate way. These guidelines are not sufficient for practical purposes. The following problems must be solved: ■ ■ ■

How to guarantee that the HPDs are used properly How to discover risky workplaces or tasks Addressing protective measures against the relevant noise source, especially if the greatest exposure occurs in free time is difficult.

By solving these questions, the minimal legal requirements of a HCP will be achieved. A good HCP contains additional

103

elements. These elements are added to increase the power of the HCP.

Objectives of the database The database should be multidisciplinary, and the extent of hearing loss should be studied as a function of environmental noise exposure, individual sensitivity factors, interacting diseases, and genetic background, as indicated with the recent EU-based noise directive. In assessment of these factors, artificial intelligence may be used to create a complete HCP valid for individual subjects. The database should include the following components: 1. Information on separate and combined exposures for occupational noise 2. Information on use of hearing protecting device and type 3. Information on separate and combined effects of free-time noise 4. Information of human (risk) factors on hearing impairment 5. Information of interaction of diseases on hearing impairment 6. Information of genetic factors in the aetiology of hearing impairment 7. Relevant audiological test results 8. Otologic history and examination 9. The impact of hearing impairment on the quality of life A functionally customer friendly database program should contain three major parts: the database, inference engine, and interface. The purpose of the interface is to provide easy access for the user to view the data or add new cases. The inference engine assists the user to combine different noise sources to generate a single index of exposure and determine the efficacy of hearing protectors against noise. It also should warn against excessive noise sensitivity and print out the risk factors for NIHL at individual level. The inference engine should be based on knowledge and decision-making rules, because the purpose of HCP is to assist in minimising the risk of developing hearing loss. Usually the executive part is composed from abstract grammar or algorithms (e.g., genetic algorithms, neural networks, and decision trees). The engine calculates different ways of classifying the data, based on a set of training examples. The risk models should by preference be based on the ISO model; new models may emerge from the analysis. In a sophisticated form, the database can be used to formulate individual HCPs.

Quality of life The psychosocial consequences of environmental noise are widespread, in addition to measurable hearing loss. Thus,

1181 Chap07

104

3/29/07

5:05 PM

Page 104

Genetics and hearing impairment

Figure 7.5 Example of output from a hearing conservation program data sheet given to the customer. Note that a copy of the audiogram and its relation to ISO standard, lifetime noise dose, environmental and work dose, and individual risk factors are displayed.

reduced oral communication is a social handicap. NIHL also reduces the perception of warning signals, exposing to subjects to unwanted events such as accidents and distortion of environmental sounds fields or music. Consequently, NIHL may lead to social isolation, decreased worker productivity and morale, and an increase in job-related accidents. The effects of NIHL are often misperceived. On first questioning, most workers do not associate their listening and communication difficulties with their hearing loss as assessed by audiometry. Below is the diagram of International Classification of Function that describes the dimensions causing the handicap in NIHL (Fig. 7.6). NIHL is insidious and progressive in nature and is invisible. At no time is there a sudden noticeable change in hearing. The loss of frequency resolution is unknown to people. Affected workers attribute their difficulties to fatigue, lack of interest or concentration, poor articulation of speakers, and excessive background noise. Interaction with these people reveals inconsistent behaviour and is attributed to an unwillingness to communicate.

The awareness of hearing difficulties is further hampered by the stigma associated with deafness. The experience of hearing difficulties has a strong negative impact on self-image, which manifests itself as a sense of being incompetent, perceiving oneself as abnormal, physically diminished, prematurely old, or having a defect (128). Any sign of impairment is seen as a sign of weakness, thus concealment is adopted as a strategy. When NIHL is moderate to severe, it leads to speech distortion, reduced word discrimination, noise intolerance, and tinnitus. NIHL may be a limiting factor of quality of life, and in short inventories hearing loss–related problems are reflected in reduced mobility and in mood of the subject [for example in European quality of life (EQoL) 5D (129) and in 15D (130)]. Therefore a database should by some means also record factors related to quality of life. In Europe, one instrument that is relatively simply to use and needs only a few questions answering is EQoL 5D. Other instruments used in Europe are the qualityof-life instruments 15D and SF 12 (131) that also include a question on hearing ability.

1181 Chap07

3/29/07

5:05 PM

Page 105

Noise-related hearing impairment

Figure 7.6 Components of international classification of function in evaluating effect of disorder on the performance of the subject in society.

Construction of a modern database program The interface between the subject and database may be interactive as was previously common when the nurse or doctor took the exposure history (4,25). It may be based on questionnaires that can be scanned later or an interview with a person with direct access to a database or can be interactive when the person fills the database by himself through the computer (4). The modern possibility to operate the questionnaire through Internet is useful in large surveys as in recruiting persons in military bases or in assessing hearing loss in large factories. Interactive questioning with direct input into the database is most commonly used by midsize and small industries where the occupational nurse will feed the data in of the case histories (25). Paper-based questionnaires are mostly used in field studies and in cross-sectional studies. Commonly the questionnaires are scanned in with a text scanner and screened for possible error. Specific software and text scanners reduce the rate of input errors. An example of a questionnaire for NIHL is documented in Appendix I. We have recently launched an Internet-based questionnaire, where the subject can input the data at home or in the office. Security is guaranteed and the subject has the right to fill in the questionnaire and correct it up to the point when it is ready to be submitted. This model is available for demonstration at www.equicare.fi (132).

Summary NIHL is insidious and progressive in nature and is invisible. At no time is there a sudden noticeable change in hearing. To prevent workers from hearing loss several efforts have been made: regulation of noise exposure, use of personal hearing protectors, and establishment of HCP among others. These efforts may be useful on a large scale, but still sensitive subjects may become affected by noise injury. Several important questions remain to be solved,

105

including genetic susceptibility to noise trauma, individual risk factors and their role, and age factors. One of the approaches that should be applied to all workplaces is to establish a common database for hearing conservation. This should include (i) screening of workers who may be at a risk of developing NIHL in selected work tasks or sites, (ii) warning against excessive noise pollution in selected work tasks or sites, (iii) allowing comparative assessment of success among various HCPs, and finally (iv) calling to attention individual susceptibility. To fulfil these demands, the common database must include all known factors that affect hearing loss. Such factors are audiometric testing methods, the testing environment, the type and use of hearing protectors, and exposure to military and leisure time noise. It must provide accurate data from lifetime noise exposure in various jobs or work tasks. Finally, confounding factors must be controlled, such as genetic inheritance, elevated blood pressure, the presence of vibration-induced white finger syndrome, elevated serum cholesterol level, and use of various ototoxic drugs. Such factors can explain a significant part of the variation in the extent of hearing loss in individual cases. In the present database, we have attempted to include such factors known to be relevant for HCP.

References 1. Robinson DW. Estimating the risk of hearing loss due to continuous noise. In: Robinson DW, ed. Occupational Hearing Loss. London: Academic Press, 1971. 2. ISO 1999 (1990). Acoustics—Determination of occupational noise exposure and estimation of noise induced hearing impairment. International Organization for Standardization, Geneva. 3. Pyykkö I, Koskimies K, Starck J, Pekkarinen J, Färkkilä M, Inaba R. Risk factors in the genesis of sensorineural hearing loss in Finnish forestry workers. Br J Ind Med 1989; 46:439–446. 4. Toppila E, Pyykkö I, Starck J, Kaksonen R, Ishizaki H. Individual risk factors in the development of noise-induced hearing loss. Noise Health 2000; 8:59–70. 5. Rosen S, Olin P. Hearing loss and coronary heart disease. Arch Otolaryngol 1965; 82:236–243. 6. Hincliffe R. Epidemiology of sensory-neural hearing loss. Audiology 1973; 12:446–452. 7. Toppila E, Pyykkö I, Starck J. The use of hearing protectors among forest, shipyard and paper mill workers in Finland - a longitudinal study. Noise Health 2005; 7(26):3–9. 8. Kryter KD. Damage risk criterion and contours based on permanent and temporary hearing loss data. J Am Ind Hyg Assoc 1965; 26:34–44. 9. Kryter KD, Ward WD, Miller JD, Eldredge DH. Hazardous exposure to intermittent and steady-state noise. J Acoust Soc Am 1966; 39:451–464. 10. Baughn W. Relation between daily exposure and hearing loss based on evaluation of 6835 industrial noise exposure cases. US Air Force 1973; Rep. AMRL-TR-7353. 11. Baughn W. Noise control—Percent of population protected. Int Audiol 1966; 5:331–338.

1181 Chap07

106

3/29/07

5:05 PM

Page 106

Genetics and hearing impairment

12. Burns W, Robinson DW. Hearing and noise in industry. Her Majesty’s Stationery Office 1970. 13. Robinson DB, Shipton MS. Tables for the estimation of noiseinduced hearing loss. NPL Acoustics Rep Ac 61. 2nd ed. British A.R.C., 1977. 14. Robinson DW. The relationship between hearing loss and noise exposure. NPL Aero Rep Ac 32. British A.R.C., 1968. 15. Burns W, Permanents effects of noise on hearing. In: Burns W, eds. Noise and Man. 2nd ed. John Murray London, 1973. 16. Suter A. The development of federal noise standards and damage risk criteria. In: Lipscomb D, ed. Hearing Conservation in Industry, Schools and the Military. San Diego: Singular publishing Group, 1994. 17. Passchier-Vermeer W. Hearing loss due to continuous exposure to steady-state broad-band noise. J Acoust Soc Am 1974; 46(5):1585–1593. 18. Glorig A, Nixon J. Distribution of hearing loss in various populations. Ann Otol Rhinol Laryngol 1960; 69(2):497–516. 19. Johnson D. Prediction of NIPTS due to continuous noise exposure. US Air Force 1973; Rep. AMRL-TR-73-91. 20. ISO 1999 (1975). Acoustics - Determination of occupational noise exposure and estimation of noise induced hearing impairment. International Organization for Standardization, Geneva. 21. Robinson DW, Sutton GJ. Age effects in hearing—a comparative analysis of published threshold data. Audiology 1979; 18:320–334. 22. Glorig A, Roberts JJ. Hearing levels of adults by age and sex: United States 1960–1962, Rep. PHS-PUB-100-SER-11-11, Nat Cent health serv res dev, Oct 1965. 23. Rowland M. Basic data on hearing levels of adults 25–74 years. DHEW Publ no (PHS) 80-1663, series 11, no 215 US dep Health, Educ and Welfare, Jan 1980. 24. Pyykkö I, Starck J, Toppila E, Juhola M, Auramo Y, Ishizaki H. Motivation for the hearing program-factors explaining the variability in hearing losses. In: Prasher D, Luxon L, Pyykkö I, eds. Advances in Noise Research: Protection against noise. Vol. 2. London: Whurr Publishers Ltd, 1998:224–230. 25. Pyykkö I, Toppila E, Starck J, Juhola M, Auramo Y. Database for a hearing conservation program. Scand Audiol 2000; 29:52–58. 26. Liu Chang-Chun, Pekkarinen J, Starck J. Application of the probe microphone method to measure attenuation of hearing protectors against high impulse sound levels. Appl Acoustics 1989; 27:13–25. 27. Toppila E, Pyykkö I, Starck J. Age and noise-induced hearing loss. Scand J Audiol 2001; 30:236–244. 28. ISO 9612.2 (1997) Acoustics— Guidelines for the measurements and assessments of exposure to noise in working environment, International Organization for Standardization, Geneva. 29. Campo P, Lataye PR. Intermittent noise and equal energy hypothesis. In: Dancer, et al., eds. Noise-Induced Hearing Loss. Mosby year Book. St. Louis: publ, 1992:456–466. 30. Smith P, Davis A, Ferguson M, Lutman M. The prevalence and type of social noise exposure in young adults. Noise Health 2000; 6:41–56. 31. Airo E, Pekkarinen J, Olkinuora P. Listening to music with earphones: an assessment of noise exposure. Acustica united with acta acustica, 1996; 82, 8:885–894.

32. Laitinen H, Toppila E, Olkinuora P, Kuisma K. Sound exposure among the Finnish national opera personnel. Appl Occup Environ Hyg 2003; 18(3):177–182. 33. Davis AC, Lovell EA, Smith PA, Ferguson MA. The contribution of social noise to tinnitus in young people—a preliminary report. Noise Health 1998; 1(1):40–46. 34. Berger E, Franks J, Lindgren F. International review of field studies of hearing protector attenuation. In: Axelsson A, Borchgrevink H, Hamenik RP, Hellström P, Hendersson D, Salvi RJ, eds. Scientific Basis of Noise-Induced Hearing loss. New York: Thieme Medical Publication, 1983. 35. Toppila E. What kind of protectors are used in the EU and is their use mandatory? In: Prasher D, Luxon L, Pyykkö I, eds. Advances in Noise Research: Protection Against Noise. Vol. 2. London: Whurr Publishers Ltd, 1998:164–166. 36. Starck J, Pekkarinen J, Pyykkö I. Impulse noise and hand-arm vibration in relation to sensory neural hearing loss. Scand J Environ Health 1988; 14:265–271. 37. Foreshaw S, Cruchley J. Hearing protector problems in military operations. In: Alberti P, ed. Personal Hearing Protection in Industry. New York: Raven Press, 1981 (sivut). 38. Lipscomb DM. The employee education program. In: Lipscomb DM, ed. Hearing Conservation in Industry, Schools and the Military. San Diego: Singular publishing group inc., 1994:81–230. 39. Pekkarinen J, Iki M, Starck J, Pyykkö I. Hearing loss risk from exposure to shooting impulses in workers exposed to occupational noise. Br J Audiol 1993; 27:175–182. 40. Kemp DT. Evidence of mechanical nonlinearity and frequency selective wave amplification in the cochlea. Arch Otorhinonlaryngol 1979; 224:37–45. 41. Furst M, Reshef J, Attias J. Manifestations of intense noise stimulations on spontanous emissios and threshold microstucture: experiment and model. J Acoust Soc Am 1992; 91:1003–1013. 42. Avan P, Bonfils P. Frequency specifity of human distortion product otoacoustic emissions. Audiology 1993; 32:12–26. 43. Harris FP, Probst R. Otoaucoustic emissions and audiometric outcomes. In: Robinette MS, Glattke TJ, eds. Otoacoustic Emissions: Clinical Applications. New York: Thieme, 1997:151–180. 44. Kimberley BP, Brown DK, Allen JB. Distortion product emissions aqnd sensorineural hearing loss. In: Robinette MS, Glattke TJ, eds. Otoacoustic Emissions: Clinical Applications. New York: Thieme, 1997:180–204. 45. Oeken J. Typical findings of distortion product otoacoustic emissions (DPOAE). In: Prasher D, ed. Occupational Noise-Induced Hearing Loss. Vol. 1. Biological Effects of Noise. London: Luxon L, Whurr I Publisher Ltd, 1998:193–204. 46. 2003/10/EC Council directive on the minimum health and safety requirements regarding the exposure of workers to the risks arising from physical agents (noise), Brussels 2003. 47. Daniell WE, Stover BD, Takaro TK. Comparison of criteria for significant threshold shift in workplace hearing conservation programs. J Occup Environ Med 2003; 45:295–304. 48. Grifo S. Aspirin ototoxicity in the Guinea pig. ORL 1975; 37:27–34.

1181 Chap07

3/29/07

5:05 PM

Page 107

Noise-related hearing impairment

49. Royster LH, Lilley LT, Thomas WG. Recommended criteria for evaluating effectiveness of hearing conservation program. Am Ind Hyg Assoc 1980; 41:40–48. 50. Royster JD, Royster LH. Using audiometric data base analysis. J Occup Med 1986; 28:1055–1068. 51. Driscoll DP, Royster L. Comparisons between the median hearing threshold levels for an black non-industrial noise exposed population (NINEP) and four presbycusis data bases. Am Ind Hyg Assoc J 1984; 45:577–593. 52. Stephens SGD. Clinical investigation of hearing loss in the elderly. In: Stephens SGD, ed. Adult Audiology, Part II ScottBrown’s Otolaryngology. London: Butterworths, 1982:142–143. 53. Lim D, Stephens SGD. Clinical investigation of hearing loss in the elderly. In: Stephens D, ed. Causes of Hearing Loss in Adults. Adult Audiology. Scott-Brown’s otolaryngology. London: Butterworths, 1987. 54. Humes LE. Noise-induced hearing loss as influenced by other agents and by some physical characteristics of the individual. J Acoust Soc Am 1984; 76:1318–1329. 55. Rössler G. Progression of hearing loss caused by occupational noise. Scand Audiol 1994; 23:13–37. 56. Chung DY, Willson GN, Cannon RP, Mason K. In: Hammernik RP, Henderson D, Salvi R, eds. Individual Susceptibility to Noise. New Perspectives on Noise-Induced Hearing Loss. New York: Raven Press, 1982:511–519. 57. McCormic G, Harris DT, Hartley CB, Lassiter RBH. Spontaneous genetic hypertension in the rat and its relationship to reduced cochlear potentials: implications for preservation of human hearing. Proc Natl Acad Sci USA 1982; 79:26–68. 58. Pyykkö I, Koskimies K, Starck J, Pekkarinen J, Inaba R. Evaluation of factors affecting sensory neural hearing loss. Acta otolaryngol (Stockh) 1988; 449:155–160. 59. Pyykkö I, Pekkarinen J, Starck J. Sensory-neural hearing loss in forest workers. An analysis of risk factors. Int Arch Occup Environ Health 1986; 59:439–454. 60. Gates GA, Couropmitree NN, Meyers RH. Genetic associations in age-related hearing thresholds. Arch Otol Head Neck Surg 1999; 125:654–659. 61. Johansson A, Hansson L. Prolonged exposure to a stressful stimulus (noise) as a cause of raised blood pressure in man. Lancet 1977; 1:86–87. 62. Andren L, Lindstedt G, Bjorkman M, Borg KO, Hansson L. Effect of noise on blood pressure and stress hormones. Clin Sci (Lond) 1982; 62(2):137–141. 63. Talbott E, Helmkamp J, Matthews K, Kuller L, Cottington E, Redmont G. Occupational noise exposure, noise-incluced hearing loss, and the epidemiology of high blood pressure. Am J Epidemiol 1985; 121: 501–514. 64. Drettner B, Hedstrand H., Klockhoff I, Svedberg A. Cardiovascular risk factors and hearing loss. Acta Otolaryngol 1975; 79:366–371. 65. Borg E. Noise-induced hearing loss in normotensive and spontaneously hypertensive rats. Hear Res 1982; 8:117. 66. Starck J, Toppila E, Pyykko I. Smoking as a risk factor in sensory neural hearing loss among workers exposed to occupational noise. Acta Otolaryngol 1999; 119(3):302–305.

107

67. Nieminen O, Pyykkö I, Starck J, Toppila E, Iki M. Serum cholesterol and blood pressure in the genesis of noise induced hearing loss. In: Olofsson J, ed. Transactions of the XXV Congress of the Scandinavian Oto-Laryngological Society. Bergen, Norway: Daves Tryckeri, 2000:48–50. 68. Mäkitie A. The ototoxic effect of styrene and its interactions with an experimental study in rats. Helsinki: Academic dissertation University of Helsinki, Helsinki University Hospital, 1997. 69. Barrenäs M, Lindgren F. The influence of eye color on susceptibility to TTS in humans. Br J Audiol 1991; 25:203–207. 70. Barrenäs M. Pigmentation and noise-induced hearing loss: is the relationship between pigmentation and noise-induced hearing loss due to an ototoxic pheolaminin interaction or to otoprotective eumelan effects. In: Prasher D, ed. Advances in Noise Research. Vol. 1. Biological Effects of Noise. London: L Luxon, Whurr Publisher Ltd, 1998:59–70. 71. Berger E, Royster L, Thomas W. Presumed noise-induced permanent threshold shift resulting from exposure to an A-weighted Leq of 89 dB. J Acoust Soc Am 1978; 64(1):192–197. 72. DeStefano AL, Gates GA, Heard-Costa N, Myers RH, Baldwin CT. Genomewide linkage analysis to presbyacusis in the Framingham Heart Study. Arch Otolaryngol Head Neck Surg 2003; 129(3):285–289. 73. Christensen K, Frederiksen H, Hoffman HJ. Genetic and environmental influences on self-reported reduced hearing in the old and oldest old. J Am Geriatr Soc 2001; 49(11):1512–1517. 74. Kaksonen R, Widen E, Cormand B, et al. Autosomal dominant midfrequency hearing impairment. Scandinavian Audiology, Taylor and Francis Ltd 2001; 30(1):85–87. 75. Hu BH, Henderson D. Changes in F-actin in the outer hair cell and the Deiters cell in the chinchilla cochlea following noise exposure. Hear Res 1997; 110:209–218. 76. Chan E, Suneson A, Ulfendahl M. Acoustic trauma causes reversible stiffness changes in auditory sensory cell. Neuroscience 1998; 83:961–968. 77. Zhu M, Yang T, Wei S. Mutations in the gamma-actin gene (ACTG1) are associated with dominant progressive deafness (DFNA20/26). Am J Hum Genet 2003; 73(5):1082–1091. 78. Davis RR, Newlander JK, Ling X-B, Cortopassi GA, Krieg EF, Erway LC. Genetic basis for susceptibilty to noiseinduced hearing loss in mice. Hear Res 2001; 155:82–90. 79. Davis RR, Newlander JK, Ling X-B, Cortopassi GA, Krieg EF, Erway LC. Genetic basis for susceptibility to noiseinduced hearing loss in mice. Hear Res 2001; 155:82–90. 80. Jimenez AM, Stagner BB, Martin GK, Lonsbury-Martin BL. Susceptibility of DPOAEs to sound overexposure in inbred mice with AHL. J Assoc Res Otolaryngol 2001; 2:233–245. 81. Harding GW, Bohne BA, Vos JD. The effect of an age-related hearing loss gene (Ahl) on noise-induced hearing loss and cochlear damage from low-frequency noise. Hear Res 2005; 204(1–2):90–100. 82. Cheng AG, Cunningham LL, Rubel EW. Mechanisms of hair cell death and protection. Curr Opin Otolaryngol Head Neck Surg 2005; 13(6):343–348.

1181 Chap07

108

3/29/07

5:05 PM

Page 108

Genetics and hearing impairment

83. Van Lear L, CarlssonPI, Ottschytsch N, et al. The contribution of genes involved in potassium-recyling in the inner ear to noiseinduced hearing loss. Hum Mutat 2006; 27(8):786–795. 84. Prezant TR, Agapian JV, Bohlman MC, et al. Mitochondrial ribosomal RNA mutation associated with both antibioticinduced and non-syndromic deafness. Nature Genet 1993; 4: 289–294. 85. Reid FM, Vernham GA, Jacobs HT. Complete mtDNA sequence of a patient in a maternal pedigree with sensorineural deafness. Hum Mol Genet 1994; 3:1435–1436. 86. Fischel-Ghodsian N, Prezant TR, Chaltraw WE, et al. Mitochondrial gene mutation is a significant predisposing factor in aminoglycoside ototoxicity. Am J Otolaryngol 1997; 18:173–178. 87. Tiranti V, Chariot P, Carella F, et al. Maternally inherited hearing loss, ataxia and myoclonus associated with a novel point mutation in mitochondrial tRNASer(UCN) gene. Hum Mol Genet 1995; 4:1421–1417. 88. Verhoeven K, Ensink RJ, Tiranti V. Hearing impairment and neurological dysfunction associated with a mutation in the mitochondrial tRNASer(UCN) gene. Eur J Hum Genet 1999; 7:45–51. 89. van den Ouweland JM, Lemkes HH, Ruitenbeek W, et al. Mutation in mitochondrial tRNA(Leu)(UUR) gene in a large pedigree with maternally transmitted type II diabetes mellitus and deafness. Nature Genet 1992; 1:368–371. 90. Majamaa K, Moilanen JS, Uimonen S, et al. Epidemiology of A3243G, the mutation for mitochondrial encephalomyopathy, lactic acidosis, and strokelike episodes: prevalence of the mutation in an adult population. Am J Hum Genet 1998; 63:447–454. 91. Reid FM, Rovio A, Holt IJ, Jacobs HT. Molecular phenotype of a human lymphoblastoid cell-line homoplasmic for the np 7445 deafness-associated mitochondrial mutation. Hum Mol Genet 1997; 6:443–449. 92. El Meziane A, Lehtinen SK, Hance N, et al. A tRNA suppressor mutation in human mitochondria. Nature Genet 1998; 18:350–353. 93. Guan MX, Enriquez JA, Fischel-Ghodsian N, et al. The deafnessassociated mitochondrial DNA mutation at position 7445, which affects tRNASer(UCN) precursor processing, has long-range effects on NADH dehydrogenase subunit ND6 gene expression. Mol Cell Biol 1998; 18:5868–5879. 94. Guan MX, Fischel-Ghodsian N, Attardi G. Nuclear background determines biochemical phenotype in the deafness-associated mitochondrial 12S rRNA mutation. Hum Mol Genet 2001; 10:573–580. 95. Chomyn A, Enriquez JA, Micol V, Fernandez-Silva P, Attardi G. The mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episode syndrome-associated human mitochondrial tRNALeu(UUR) mutation causes aminoacylation deficiency and concomitant reduced association of mRNA with ribosomes. J Biol Chem 2000; 275:19198–19209. 96. Toompuu M, Yasukawa T, Suzuki T, et al. The 7472insC mitochondrial DNA mutation impairs the synthesis and extent of aminoacylation of tRNASer(UCN) but not its structure or rate of turnover. J Biol Chem 2002; 277:22240–22250. 97. Hutchin TP, Cortopassi GA. Mitochondrial defects and hearing loss. Cell Mol Life Sci 2000; 57(13–14):1927–1937.

98. del Castillo FJ, Villamar M, Moreno-Pelayo MA, et al. Maternally inherited non-syndromic hearing impairment in a Spanish family with the 7510T ⬎ C mutation in the mitochondrial tRNA (Ser(UCN)) gene. J Med Genet 2002; 39:82. 99. Sue CM, Tanji K, Hadjigeorgiou G, et al. Maternally inherited hearing loss in a large kindred with a novel T7511C mutation in the mitochondrial DNA tRNA(Ser(UCN)) gene. Neurology 1999; 52:1905–1908. 100. Chapiro E, Feldmann D, Denoyelle F, et al. Two large French pedigrees with non syndromic sensorineural deafness and the mitochondrial DNA T7511C mutation: evidence for a modulatory factor. Eur J Hum Genet 2002; 10:851–856. 101. Jaksch M, Klopstock T, Kurlemann G, et al. Progressive myoclonus epilepsy and mitochondrial myopathy associated with mutations in the tRNA(Ser(UCN)) gene. Ann Neurol 1998; 44:635–640. 102. Zhao H, Li R, Wang Q, et al. Maternally inherited aminoglycoside-induced and nonsyndromic deafness is associated with the novel C1494T mutation in the mitochondrial 12S rRNA gene in a large Chinese family. Am J Hum Genet 2004; 74:139–152. 103. Jacobs HT, Hutchin TP, Kappi T, et al. Mitochondrial DNA mutations in patients with postlingual, nonsyndromic hearing impairment. Eur J Hum Genet 2005; 13(1):26–33. 104. Estivill X, Govea N, Barcelo E, et al. Familial progressive sensorineural deafness is mainly due to the mtDNA A1555G mutation and is enhanced by treatment of aminoglycosides. Am J Hum Genet 1998; 62:27–35. 105. Torroni A, Cruciani F, Rengo C, et al. The A1555G mutation in the 12S rRNA gene of human mtDNA: recurrent origins and founder events in families affected by sensorineural deafness. Am J Hum Genet 1999; 65:1349–1358. 106. Gallo-Teran J, Morales-Angulo C, del Castillo I, et al. Genetic associations in age-related hearing thresholds. Arch Otol Head Neck Surg 1999; 125:654–659. 107. Ostergaard E, Montserrat-Sentis B, Gronskov K, BrondumNielsen K. The A1555G mtDNA mutation in Danish hearingimpaired patients: frequency and clinical signs. Clin Genet 2002; 62:303–305. 108. Tekin M, Duman T, Bogoclu G, et al. Maternally inherited hearing loss, ataxia and myoclonus associated with a novel point mutation in mitochondrial tRNASer(UCN) gene. Hum Mol Genet 1995; 4:1421–1417. 109. Lehtonen MS, Uimonen S, Hassinen IE, Majamaa K. Frequency of mitochondrial DNA point mutations among patients with familial sensorineural hearing impairment. Eur J Hum Gene 2000; 8:315–318. 110. Richards M, Macaulay V, Torroni A, Bandelt HJ. In search of geographical patterns in European mitochondrial DNA. Am J Hum Genet 2002; 71:1168–1174. 111. Ruiz-Pesini E, Lapena AC, Diez-Sanchez C, et al. Human mtDNA haplogroups associated with high or reduced spermatozoa motility. Am J Hum Genet 2000; 67:682–696. 112. van der Walt JM, Nicodemus KK, Martin ER, et al. Mitochondrial polymorphisms significantly reduce the risk of Parkinson disease. Am J Hum Genet 2003; 72:804–811.

1181 Chap07

3/29/07

5:05 PM

Page 109

Noise-related hearing impairment

113. Chinnery PF, Taylor GA, Howell N, et al. Mitochondrial DNA haplogroups and susceptibility to AD and dementia with Lewy bodies. Neurology 2000; 55:302–304. 114. Carrieri G, Bonafe M, De Luca M, et al. Mitochondrial DNA haplogroups and APOE4 allele are non-independent variables in sporadic Alzheimer’s disease. Hum Genet 2001; 108:194–198. 115. Kalman B, Li S, Chatterjee D, et al. Large scale screening of the mitochondrial DNA reveals no pathogenic mutations but a haplotype associated with multiple sclerosis in Caucasians. Acta Neurol Scand 1999; 99:6–25. 116. De Benedictis G, Rose G, Carrieri G, et al. Mitochondrial DNA inherited variants are associated with successful aging and longevity in humans. FASEB J 1999; 13:1532–1536. 117. Niemi AK, Hervonen A, Hurme M, Karhunen PJ, Jylha M, Majamaa K. Mitochondrial DNA polymorphisms associated with longevity in a Finnish population. Hum Genet 2003; 112:29–33. 118. Crimi M, Del Bo R, Galbiati S, et al. Mitochondrial A12308G polymorphism affects clinical features in patients with single mtDNA macrodeletion. Eur J Hum Genet 2003; 11:896–898. 119. Torroni A, Campos Y, Rengo C, et al. Mitochondrial DNA haplogroups do not play a role in the variable phenotypic presentation of the A3243G mutation. Am J Hum Genet 2003; 72:1005–1012. 120. Pyykkö I, Starck J, Toppila E, Johnson A-C. Methodology and value of databases. Henderson D, Prasher D, Kopke R, Salvi R, Hamernik R, eds. Noise Induced Hearing Loss Basic Mechanisms, Prevention and Control. London: Noise Research Network Publications, 2001:387–399. 121. Royster LH, Royster JD, Berger EH. Guidelines for developing an effective hearing conservation program. Sound Vib 1982; 16:22–25. 122. Melnick W. Evaluation of industrial hearing conservation programs: a review and analysis. Am Ind Hyg Assoc J 1984; 45:459–467.

109

123. Dement JM, Pompeii LA, Ostbye T, et al. An integrated comprehensive occupational surveillance system for health care workers. Am J Ind Med 2004; 45:528–538. 124. Starck J, Toppila E, Pyykkö I. Do we have unnecessary hearing loss - Can we improve the efficiency of hearing conservation programs? In: Henderson D, Prasher D, Kopke R, Salvi R, Hamernik R, eds. Noise Induced Hearing Loss a Basic Mechanisms, Prevention and Control. London: Noise Research Network Publication, 2001:197–202. 125. Franks JR, Davis RR, Kreig EF. Analysis of hearing conservation program data base: factors other than work place noise. Ear hear 1989; 10:273–280. 126. Occupational Health and Safety Administration (OSHA). Occupational injury and illness record keeping and reporting requirements; final rule. Occupational Safety and Health Administration. Federal Register 2002; 67:44037–44048. 127. Stewart AP. The comprehensive hearing conservation program. In: Lipscomb DM, ed. Hearing Conservation in Industry, Schools and the Military. San Diego: Singular Publishing Group Inc, 1994:81–230. 128. Stephens D. Audiological rehabilitation. In: Luxon LM et al., eds. Audiological Medicine. Clinical Aspects of Hearing and Balance. London: Martin Dunitz Taylor & Francis Group, 2003:513–532. 129. Szende A, Williams A, ed. Measuring Self-reported Population Health: An International Perspective based on EQ-5D. Spring MED Publishing, 2004. 130. Sintonen H, Pekurinen M. A fifteen-dimensional measure of health-related quality of life (15 D) and its applications. In: Walker SR, Rosser RM, eds. Quality of Life Assessment. Key Issues in the 1990s. Dordrecht: Kluwer Academic Publishers, 1993. 131. Stewart AL, Hays RD, Ware JE Jr. The MOS short-form general health survey. Reliability and validity in a patient population. Med Care 1988; 26(7):724–735. 132. www.equicare.fi

1181 Chap07

3/29/07

5:05 PM

Page 110

1181 Chap08

3/28/07

5:12 PM

Page 111

8 Otosclerosis: a genetic update Frank Declau, Paul Van De Heyning

Introduction Otosclerosis (OTSC) is a disorder of the bony labyrinth and stapes known to affect only humans. It affects the bone homeostasis of the labyrinthine capsule, resulting in abnormal resorption and redeposition of bone. This bone dysplasia limited to the otic capsule originates in the endochondral bone layer. OTSC neither affects other endochondral bones in humans nor is found in animals. OTSC is the most important cause of chronic progressive conductive hearing loss in adults and a significant cause of progressive sensorineural hearing loss as well (1). Conductive hearing loss develops when otosclerotic foci invade the stapediovestibular joint (oval window) or round window region and interfere with the free motion of the stapes. Although the sensorineural hearing loss cannot be corrected, stapes microsurgery has proven to be a highly successful means to restore normal ossicular conduction and improve hearing thresholds. Here we present an analysis of the literature concerning the phenotypic expression, mode of inheritance, prevalence, age of onset, sex ratio, and sporadic cases of OTSC.

Phenotypic expression The diagnostic criteria for OTSC consist of conductive hearing loss unrelated to known causes such as the sequelae of Eustachian tube dysfunction, trauma, or congenital cholesteatoma. The magnitude of the conductive hearing loss is directly related to the degree of fixation of the stapes footplate (2,3). The otolaryngologist must take into account the physical examination, pure tone audiogram, and admittance findings as well as the past medical and surgical history. As a rule, the tympanoscopy is normal. Sporadically, the otospongiotic focus reveals itself otoscopically as a pink or violaceous hue on the promontory (known as Schwartz’s sign). Tympanometry demonstrates a normal type A or a type As.

The progression of the hearing loss in OTSC may be described as follows. At first, only the low frequencies are diminished (“stiffness tilt”) due to an enhanced stiffness of the tympano-ossicular system. Then, the ossicular chain becomes heavier, which gives rise to a flat conductive hearing loss. Often an elevation of bone conduction thresholds can be seen, known as the Carhart notch. The elevation of the bone conduction thresholds is approximately 5 dB at 500 Hz, 10 dB at 1000 Hz, 15 dB at 2000 Hz, and 5 dB at 4000 Hz. Acoustic stapedial reflexes are usually absent in full blown OTSC. However, in the initial stage of the disease, a biphasic response may be seen, known as the on-off effect. The offset in particular is pathologic (the onset may be seen in 40% of the normal population). The foci of otosclerotic bone are symptomatically quiescent until the movement of the stapes is impaired by invasion of the stapedovestibular joint (4). Fixation of the stapes as a cause of hearing loss was first recognised by Valsalva as early as 1704 (5). In 1894, Politzer (6) called this type of ankylosis “OTSC.” In 1912, Siebenmann’s microscopic examinations (7) showed that the lesion apparently began as a spongification of the bone; hence, the term “otospongiosis.” In commenting on OTSC, Guild (8) emphasised the importance of distinguishing between clinical and histological OTSC. “Histological OTSC” refers to the disease process without clinical symptoms or manifestations that only can be discovered by sectioning of the temporal bone at autopsy. “Clinical OTSC” concerns the presence of OTSC at a site where it causes conductive hearing loss by interfering with the motion of the stapes or of the round window membrane. Many otologists believe that OTSC also damages the inner ear to cause progressive sensorineural hearing loss (9,10). Although Guild (8) failed to establish a correlation between OTSC and sensorineural hearing loss, Topsakal et al. recently found a statistically significant additional perceptive hearing loss component in otosclerotic patients as compared to a normal population (1). In a histopathological survey of 248 temporal bones with OTSC, Kelemen and Alonso (10) found an otosclerotic focus involving the cochlear endost in 40% of patients with clinical OTSC. Any encroachment of the membranous labyrinth usually occurs in the

1181 Chap08

112

3/28/07

5:12 PM

Page 112

Genetics and hearing impairment

lateral arcs of each cochlear turn (4). In these areas, the inner periosteal layer is deformed, and subjacent atrophy of the spiral ligament may be seen (11). However, severe alterations in the bony labyrinth and spiral ligament may occur with no observable histological alterations in the structures of the cochlear duct (4). There does not appear to be a consistent spatial relationship between areas of atrophy of the spiral ligament and atrophy of the organ of Corti. Several reports correlate the degree of cochlear endosteal involvement with the magnitude of the sensorineural hearing loss (12–14). According to Hueb et al. (15), there is a relation between the size of the foci and the degree of sensorineural hearing loss. The concept of “cochlear OTSC,” that is, pure sensorineural hearing loss caused by OTSC of the bony labyrinth without stapes fixation, has been the subject of much debate (16). Causse and Causse (17) believe that a number of cases with low-, mid-, and high-frequency sensorineural hearing loss and a dominant mode of inheritance, described as separate syndrome entities by Königsmark and Gorlin (18), actually represent cochlear OTSC. On the other hand, a temporal bone study of patients with pure sensorineural deafness of unknown cause has failed to show otosclerotic foci of significant incidence or size to explain the inner ear changes (4,15). OTSC usually involves both ears. However, Morrison (19) and Cawthorne (20) found unilateral OTSC in 13% and Larsson (21) in 15%. Guild (8) reported histologically unilateral OTSC in 30%. Usually low-pitch tinnitus is present. Vertiginous spells or dizziness are quite common (25–55%). Three types of vertigo may exist: (i) attacks of dizziness and mild instability (20 minutes–6 hours) with a normal caloric response and no visible nystagmus, (ii) postural instability, and (iii) Menièriform attacks with acute rotatory vertigo with tinnitus enhancement and fluctuating hearing loss; the caloric test may be normal or diminished and the rotatory chair test is abnormal. Virolainen (22) found objective disturbances, in order of frequency, were caloric hypoexcitability and elevated thresholds of angular acceleration and deceleration, directional preponderance, and positional nystagmus. At the initial stages, paracusis Willisii or the ability to hear better in a crowd, may be present.

Histopathological appearance Histologically, distinct sites of predilection of this dysplasia within the otic capsule exist. The most common site is the anterior margin of the oval window [80% according to Guild (8)]. Other areas of predilection are the round window niche, the anterior wall of the internal auditory canal, and within the stapedial footplate (4). OTSC was restricted to the footplate in 12% of a series reported by Guild (8), and 5% of those studied by Rüedi and Spoendlin (23). The otosclerotic lesion is pleomorphic, varying from spongiotic to dense sclerotic bone. The progression of OTSC may be

divided into four stages (4,24): the common factor is total disorganisation of the lesion that replaces normal bone. Resorptive phase (⫽otospongiosis): The focus of resorption arises in the endochondral bone of the otic capsule. The bone is replaced with a highly vascular cellular and fibrous tissue. This resorption occurs through osteoclastic bone destruction, perhaps by vascular obliteration, or by lysosomal enzymes secreted by macrophages (25). According to Jorgensen and Kristensen (26), the smallest focus that can be detected by light microscopy is about 80 ␮m in diameter: only at this size is a medullary space and vascularised connective demonstrable. Early new bone formation: Osteoid and mucopolysaccharide deposits within the fibrous tissue matrix produce a dysplastic, immature basophilic bone. Remodelling: Repetition of the remodelling process of resorption and new bone formation: the basophilic bone becomes more acidophilic. The bone demonstrates a disordered lamellar appearance and is less vascular than in the earlier phases. Mature phase: Formation of a highly acidophilic bone having a mosaic-like appearance because of irregular patterns of resorption and new bone formation associated with the deposition of fatty tissue in the marrow spaces. These various phases may occur simultaneously in adjacent areas of the same focus, or various stages may be found in separate foci within the temporal bone. Based on micromorphological studies of the normal development of the human otic capsule in the prenatal period, it has been concluded that its bony tissue is highly specialised and unique in the human body (27). The otic capsule is completely formed at term and the micromorphological organisation of its bone undergoes hardly any changes throughout subsequent life. The otic capsule differs in this respect from other bones, where bone remodelling is continuous and characterised by repetitive cycles of resorption and redeposition. According to Frisch et al. (28), the otic capsule bone remodelling is spatially organised into a distinct perilabyrinthine pattern. All bones within this narrow perilabyrinthine zone are completely inactive, including most of the primary endochondral bone. Outside this “no-remodelling zone,” capsular bone remodelling units are distributed centrifugally in relation to inner ear spaces. Since OTSC can be defined as a defect in the physiologic inhibition of bone turnover at this narrow perilabyrinthine zone of “no-remodelling,” the search for otosclerotic foci has to be restricted to this area (29).

Aetiology OTSC is generally accepted to be a hereditary disorder, with segregation analyses most consistent with autosomal dominant inheritance with reduced penetrance (25–40%). OTSC represents a heterogeneous group of heritable diseases in which different genes may be involved in regulating the bone homeostasis of the otic capsule. It is hypothesised that various gene

1181 Chap08

3/28/07

5:12 PM

Page 113

Otosclerosis: a genetic update

defects allow the physiologic inhibition of bone turnover in the otic capsule to be overruled by environmental factors, resulting in the localised bone dysplasia known as OTSC (30). Many different environmental factors have been implicated in the aetiology of OTSC, including infectious causes such as measles virus (31), hormones (related to puberty, pregnancy, and menopause) (32), and nutritional factors (fluoride intake) (33). About 50% of patients with OTSC report a positive family history, with the remainder considered sporadic. No gene responsible for OTSC has yet been cloned. However, six genetic loci, OTSC1 (OMIM 166800), OTSC2 (OMIM 605727), OTSC3, OTSC4, OTSC5, and OTSC7, have been identified to date, supporting the hypothesis that mutations in any of a number of genes may be capable of causing the OTSC phenotype (34). Such genetic heterogeneity has been well demonstrated for nonsyndromic sensorineural hearing loss. OTSC1 was mapped to chromosome 15q25-q26 in an Indian family in which hearing loss began in childhood and penetrance appeared to be complete (35). The OTSC2 locus was mapped to a 16 cM region on chromosome 7 in a large Belgian family (36). More recently, the OTSC3 locus was mapped on chromosome 6 in a large Cypriot family (37). The defined OTSC3 interval covers the human leukocyte antigen (HLA) region, consistent with reported associations between HLAA/HLA-B antigens and OTSC (38). The localisation of OTSC4 at chromosome 16q21-23.2 in an Israeli family was also recently reported (39). OTSC5 has been localised on chromosome 3q22–24 in a Dutch family (40). OTSC7 has recently been localized on chromosome 6q13–16.1 in a large Greek pedigree (40a). The pooled data from two families segregating with the OTSC2 locus demonstrated quite variable audiometric configurations with only a limited contribution of age. Even in this monogenic form of OTSC, it seems that other modifying factors are implicated in the mechanism that triggers the osseous change (41). McKenna et al. (42) suggest that mutations in COL1A1, similar to those that occur in type-I osteogenesis imperfecta, may account for a small percentage of cases of OTSC, and that the majority of cases of clinical OTSC are related to other genetic abnormalities yet to be identified. Also some cases of OTSC and osteoporosis could share a functionally significant polymorphism in the Sp1 transcription factor binding site in the first intron of the COL1A1 gene (43). However, Rodriguez et al. (44) found no evidence supporting the putative link of COL1A1 and COL1A2 genes with OTSC. Although genetic and basic histologic patterns have been identified in OTSC, there is no definite agreement as to aetiology and pathogenesis. Various hypotheses implicate one or more environmental factors including (i) viral involvement, (ii) enzymatic and cellular reactions, (iii) vascular changes, (iv) infection, radiation, trauma, or exposure to toxic substances, (v) an autoimmune phenomenon, and (vi) metabolic changes. 1. Studies suggest that mumps and measles vaccines may reduce the incidence of OTSC. Particles of viruses have been found

2.

3.

4.

5.

113

in the inner ear bone of those affected by the disorder. Niedermeyer et al. (45) used a very sensitive polymerase chain reaction technique in assessing the association between viruses and OTSC. Evidence showed that the disorder was a measles virus–associated disease. It was concluded that the viral infection acts as at least one factor in the development of the spongy tissue. Arnold and Friedmann (46) and McKenna and Mills (31) found expression of viral antigens within otosclerotic foci. McKenna and Mills (31) showed ultrastructural and immunohistochemical evidence of measles virus type A (nucleocapsid in osteoblasts and preosteoblasts) in active OTSC. However isolation and characterisation of virus from otosclerotic bone has not yet been successful. It is not clear if this material came from isolated or familial cases. However, an inflammatory response to an inciting antigen is proposed (46). The enzymatic concept of otospongiotic disease has been put forward by Chevance et al. (47) in 1972. These authors postulated that lysosomal (cytotoxic) enzymes diffusing from histiocytes and some osteoclasts into the perilymph are the cause of the sensorineural loss as a result of their direct effect on the organ of Corti. Fluorides are known to be potent inhibitors of lysosomal enzymes (48). They also reduce osteoclastic bone resorption and at the same time promote osteoblastic bone formation (49). The use of sodium fluoride as an enzyme inhibitor to stabilise otosclerotic foci was first recommended by Shambaugh and Scott (50) in 1964. Fluoridation of drinking water has been found to have a beneficial effect on nonoperated otosclerotic ears (51). Radiation of the cochlear bone induces a lesion similar to OTSC and causes recruitment of similar cells in this process (52). Yoo (53) showed the presence of elevated antibody titers to type-II collagen and proposed that OTSC is a consequence of an autoimmune process against collagen molecules. According to this author, cartilage rests in the globuli interossei become autoantigenic and the response would be genetically controlled by the Ir-genes in the major histocompatibility loci. Bujia et al. (54) found significant elevated levels of antibodies to collagen type II and IX. Both research groups claim an autoimmune process as the aetiology for OTSC. Gordon et al. (55) found a significantly lower level of mRNA production for stromelysin (an activator of tissue collagenase) among individuals with OTSC as compared to controls. According to these authors, OTSC could be a more generalised connective tissue disorder.

Epidemiology Clinical OTSC is a quite frequent hearing disorder, although its exact incidence is unknown. Knowing this however is important for health planning. In Sweden, the clinical incidence has recently been estimated (56) as 6.1/100 000. This figure is lower

1181 Chap08

3/28/07

114

5:12 PM

Page 114

Genetics and hearing impairment

than others reported previously: [12/100 000: Stahle et al. (57); 13.7/100 000: Pearson et al. (58)]. Levin’s estimate (56) was based on the number of patients admitted in hospital for stapedectomy due to OTSC. The recent decline of OTSC operations and hence of the incidence calculations can be explained by the overwhelming publicity for stapedectomy and stapedotomy operations during the fifties, sixties, and seventies. However, McKenna (Personal communication, Harold Schuknecht meeting, Boston, 1994.) argues that systematic vaccination for measles also accounts for the decreased incidence of OTSC. Elucidation of the prevalence of OTSC is befogged by the differentiation of clinical and histological OTSC (59). The prevalence of clinical OTSC in the white population has been studied by different authors (Table 8.1). In the early studies (2,20,60), no attempt has been made to relate the clinical condition to a known population at a given time. Clinical OTSC has a reported prevalence of 0.3% among white adults, making it the single most common cause of hearing impairment in this population (17). The prevalence of histological OTSC has also been studied by different authors (Table 8.2). Although its prevalence has been estimated as high as 8.3% among white adults (64), in a prospective study of Declau et al. (65), only 6 of 236 temporal bones (2.5%) or 4 of 118 autopsy cases (3.4%) revealed otosclerotic foci. Although histology remains the gold standard for the evaluation of OTSC, a multitechnique method was used to screen for otosclerotic lesions in a cost-effective and less time-consuming way. Lesions as small as 1.4 mm could be detected. There had been no selection of the material in the present study that would favour OTSC. On the contrary, previous publications were all based on existing laboratory collections, which may have contained results biased by the presence of cases with hearing loss or other otological diseases. This is witnessed by the fact that many of these publications included audiometric data recorded during life, questioning the unselected character of these temporal bone banks. Also many of these authors candidly admit that a certain selection had taken place when ascertaining the reasons for which the various instiTable 8.1 Prevalence of clinical otosclerosis in the white population

tutions had sent them the temporal bones for histological investigation (65). Having made some allowance for this possible error, there is no doubt that histological OTSC (phenotype) occurs in the absence of clinical OTSC (genotype). According to the figures of Guild (7), 15% of temporal bones with histological OTSC showed ankylosis of the stapediovestibular articulation. In Altmann’s review on histological OTSC (64), 12% of the temporal bones with histological OTSC had stapedial fixation. Although the prevalence figure of 2.5% is strikingly lower than previously published figures on histological OTSC, it correlates well with the extrapolated data based on clinical studies of otosclerotic families. If this prevalence figure is used to calculate by extrapolation the prevalence of clinical OTSC, the calculated figure of 0.30 to 0.38% correlates well with the clinical data of otosclerotic families (clinical prevalence ⫽ 0.3%). The female-to-male ratio was approximately 7 to 6. OTSC is predominantly a Caucasian disease and follows their geographic distribution throughout the world. OTSC is quite rare among Blacks, Orientals, and American Indians (64). One possible exception is that of the Todas, an isolate in South India. The prevalence of what appears to be OTSC (there is no histological confirmation) in these people is about 17% (64a).

Age of onset The age of onset of OTSC varies from the first through fifth decades of life, most commonly presenting in the third decade. About 90% of affected persons are under 50 years of age at the time of diagnosis. The exact age of onset is difficult to determine, since a patient may not become aware of a hearing impairment for a number of years. Based on the similar findings of Davenport (60), Larsson (21), and Morrison (19), the greatest Table 8.2 Prevalence of histological otosclerosis in the white population Author

Number of temporal bones studied

Number of cadavers

Prevalence (%)

Weber (66)

?

200

11

Engström (67)

145

100

12

Guild (7)

?

518

8.3

Jorgensen and Kristensen (26)

237

155

11.4

Author

Prevalence (%)

Davenport et al. (60)

0.1–0.25

Shambaugh (2)

0.5–1

Cawthorne (20)

0.5

Morrison (19)

0.2

Hall (61)

0.3

?

4.4

0.28

Schuknecht and Kirchner (68)

734

Pearson et al. (58) Gapany-Gapanavicius (62)

0.044–0.1

Hueb et al. (15)

144

?

12.75

Ben Arab et al. (63)

0.6

Declau et al. (65)

236

118

2.5

1181 Chap08

3/28/07

5:12 PM

Page 115

Otosclerosis: a genetic update

period of risk can be determined between 11 and 45 years. Cawthorne (20) reported that 70% of patients with clinical OTSC first noticed the hearing losses between the age of 11 and 30. Deafness interpreted as OTSC and beginning as early as age five in some cases was described by Kabat (69). The age of onset is similar in males and females. There is also a striking similarity within families and especially within sibships. On the other hand, Morrison (19) found a tendency towards an earlier age of onset with succeeding generations (anticipation).

Mode of inheritance The first pedigrees in which the transmission of OTSC from generation to generation was demonstrated were published by Hammerschlag (70), Körner (71), Albrecht (72), and Bauer and Stein (73). Albrecht (72) concluded that OTSC is due to a simple dominant factor, but Bauer and Stein (73), with larger material and more sophisticated statistical methods, postulated a double autosomal recessive mode of inheritance. These early 20th century studies show a lot of bias due to inadequate otologic diagnosis, especially in secondary cases, and improper selection strategies. The majority of the more recent studies on OTSC (17,19,21,62) indicate an autosomal dominant mode of inheritance. The monogenic forms of OTSC also demonstrate an autosomal dominant mode. These studies have included all patients without regard to family history, age, or prior therapy. A firm clinical diagnosis was made by otoscopic and audiometric analysis and also to a large extent by surgery. Exclusion of phenotypes has also been done. Bias of ascertainment has been corrected using Weinberg’s proband method (74) (omission of the proband and inclusion of the sibship each time it is ascertained) for correcting incomplete multiple ascertainment. The expected frequencies of affected individuals for autosomal dominant traits were compared with the observed frequencies for relatives of otosclerotics. Many families had transmission of OTSC through three or more generations. Analysis of families with secondary cases outside the sibship of the proband revealed that they inherited the gene from only one side of the family. In the offspring of two affected parents, no accelerated or early onset cases were detected. There is no evidence for a phenotypical difference between the heterozygous and homozygous state. The assumption of autosomal dominant inheritance is based on the existence of particular pedigrees. However, it may be difficult to draw definite conclusions from isolated pedigrees for the following reasons (75): (i) Individual families may demonstrate exceptions to the rule. They may have attracted attention by noteworthy accumulations of secondary cases or particularly serious cases (21). (ii) Individual pedigrees may mimic a mode of inheritance, especially if a carrier state, incomplete penetrance, or variable expressivity exists. (iii) More than one mode of inheritance may be responsible for a given disease (as in retinitis pigmentosa). (iv) A given entity may actually represent a heterogeneous group of diseases.

115

Modifying genes and environmental factors are likely to play a role in the expression or penetrance of OTSC and may be responsible for the high degree of variability between families. This is in no way inconsistent with the accepted autosomal dominant mode of inheritance (19). Ben Arab et al. (63) postulated an autosomal dominant major gene with a high polygenic component. Other modes of inheritance are highly unlikely as can be concluded from the detailed mathematical analyses of Larsson (21) and Gapany-Gapanavicius (62). Autosomal recessive inheritance is unlikely given the presumed degree of penetrance, but cannot absolutely be ruled out. Digenic inheritance has been claimed by several authors: two autosomal recessive genes (73), an autosomal dominant and an X-linked dominant gene (60), or an autosomal recessive and an X-linked dominant gene (76). It is relatively easy to create an ad hoc hypothesis to fit existing data with such models, but this type of inheritance is quite uncommon in humans and the models do not convincingly explain the overall epidemiology of OTSC.

Penetrance Larsson (21) and Morrison and Bundey (77) explained that the degree of penetrance represents the percentage of patients with histologic OTSC in whom the otosclerotic foci interfere with the hearing mechanism. In the monogenic forms, a high degree of penetrance can be found (41): 50% for OTSC 1 and 100% for OTSC 2. In pedigree studies however, the degree of penetrance is much lower. Two methods for determining the degree of penetrance of OTSC have appeared in the literature. Morrison (19) and Causse and Causse (17) calculated the difference between observed and expected ratios in relatives of otosclerotics. In both cases, the authors concluded that penetrance approximated 40%. Larsson (21) calculated a penetrance of 25% by applying a formula devised by Weinberg (74) to Guild’s postmortem material (7). His study has been criticised by Gordon (75), who pointed to a number of unwarranted assumptions in the method and deficiencies in the data.

Sporadic cases According to most studies (Table 8.3), the percentage of isolated cases ranges from 40% to 50%. According to Morrison and Bundey (77), the presence of isolated cases can be explained as follows: 1. Isolated cases of OTSC may be phenocopies of the disease. Without surgical exploration, it may be difficult to exclude acquired or congenital ossicular fixations or defects. 2. New mutations may account for a small fraction of these isolated cases [Morrison (19) suggested the mutation rate is: ⫺6 50 ⫻ 10 ].

1181 Chap08

3/28/07

116

5:12 PM

Page 116

Genetics and hearing impairment

Table 8.3 Frequency of sporadic cases with clinical otosclerosis Author

% Isolated cases

Nager (78)

42

Cawthorne (20)

46

Shambaugh (2)

44.5

Larsson (21)

49

Morrison (19)

30

Gapany-Gapanavicius (62)

48.4

3. Given the reduced penetrance of 25% to 40%, it would seem reasonable to suppose that sporadic cases are due to nonpenetrance in other family members (though they might be expected to have histological OTSC). However, the incidence of histologic OTSC exceeds the incidence of clinical OTSC by far more than can be accounted for by accepted penetrance figures alone. Therefore, Morrison and Bundey (77) proposed that these isolated cases might have an alternate mode of inheritance, so that clinical OTSC could be explained by more than one genetic mechanism. They calculated the theoretical prevalence of histological OTSC on the assumption that isolated cases follow recessive inheritance, while the familial cases follow dominant inheritance. According to their theory, the homozygous state would produce clinical OTSC, while the heterozygous “carrier” state might result in areas of histological OTSC without stapedial ankylosis. The frequency of histological OTSC was the sum of the heterozygous recessive state, the dominant genotype (as seen in pedigrees), and (the less significant) mutation rates for each mode of inheritance. It was estimated as 6.145%, close to the frequency recorded by Guild (7) (8.3%). There is no evidence that the hearing loss in sporadic OTSC is of greater severity than in the obvious hereditary cases (19). However, in contrast to familial cases, there is a consistent tendency for later birth ranks to be associated with more cases of OTSC. Both maternal and paternal ages do not differ from the expected. So this tendency must be due to either parity or environmental factors. The sex ratio in sporadic cases is exactly equal. According to Larsson (21), there is a lower morbidity risk for siblings of probands. He explains this finding as follows: (i) There exists a lower degree of penetrance, owing to modifying genes. (ii) It is also possible that they follow a different mode of inheritance. (iii) An admixture of environmental factors can also not be excluded.

Sex ratio Investigations of the occurrence of histological OTSC have not shown any significant sex disparity (7,66,67), whereas it is

common knowledge among otologists that clinical OTSC is encountered more frequently in females than in males. Interestingly, as regards the occurrence of stapes ankylosis in those cases of histological OTSC, the males predominate (21). A sex ratio in clinical OTSC of about 2F:1M has been noted by many authors (2,19–21,60,73,78,79). This circumstance may indicate that OTSC manifests itself clinically in a higher percentage of females than males (21). This impression is partly given by the increasing proportion of females in any population of advancing years, coupled with the increasing disability of otosclerotic deafness with the passage of time. There is no obvious difference in the age of onset between males and females nor their hearing loss at the time of consultation. However the progression of the hearing loss is greater in females than in males during the first 20 years of the disease (21) (10 dB ⫹). Also at surgical intervention, the pathological process of ankylosis of the stapes is more advanced (19). Unilateral OTSC is more common in males [20% in men vs. 9% in women (19)]. The apparent sex disparity has been ascribed to hormonal factors, particularly pregnancy (20,78,79). On the other hand, the partial sex limitation with regard to clinical OTSC mainly relates to probands, while among unselected secondary cases, the sex ratio becomes exactly equal (77). If Weinberg’s ascertainment method is used to cope with the ascertainment bias, than the sex ratio in complete sibships becomes almost equal. Gristwood and Venables (80) calculated the likelihood that female patients with bilateral OTSC would report worsening of their hearing during pregnancy. Their results ranged from 33% after one pregnancy to 63% after six pregnancies. Schaap and Gapany-Gapanavicius (81) found in the Lithuanian population another explanation for the observed increase in frequency of clinical OTSC in females. They found a distorted sex ratio of offspring (both affected and normal) in the matings of a normal parent with a parent with OTSC. Moreover, a considerably higher frequency of OTSC was found in the female than in the male offspring (36.5% vs. 20.2%). Schaap and GapanyGapanavicius (81) explained this finding as an intrauterine selection against heterozygous or hemizygous males. In the families with at least one affected male, however, the morbidity risk was again equal. However, James (82) does not accept this hypothesis because a disparity in sex ratio should be present in sibs as well as in the offspring. Since it is not, there has to be another explanation. According to this author, the familial pattern of female selection could be related to steroid hormone metabolism. This distorted sex ratio in the offspring is not a universal finding: both Larsson (21) and Morrison (19) found an almost equal sex ratio after applying Weinberg’s correction.

Conclusion We suggest that OTSC represents a heterogeneous group of heritable diseases in which different genes may be involved in regulating the bone homeostasis of the otic capsule. It is

1181 Chap08

3/28/07

5:12 PM

Page 117

Otosclerosis: a genetic update

hypothesised that in response to various gene defects, the physiologic inhibition of bone turnover in the otic capsule is overruled due to a greater susceptibility to environmental factors, resulting in a localised bone dysplasia known as OTSC. Search for huge OTSC families with at least 12 positively identified cases is warranted, so that a genome search within each family becomes possible. However, such families are rare. Since the age of onset of OTSC is delayed, multiple generations of subjects with clinical OTSC are usually not available for study. Consequently, it has been difficult to identify large families with a sufficient number of affected persons to allow adequate statistical power for genetic linkage analysis. Nonparametric methods (e.g., affected sibling pair or affected pedigree member) could be employed, but under an assumption of genetic heterogeneity, it is likely that hundreds of relative pairs affected with OTSC would be required to have sufficient power. Smaller families may only be informative if OTSC patients are present with associated chromosomal or additional abnormalities. A candidate gene approach, while feasible, would be quite labour-intensive, given the large number of candidate genes with a large number of exons. Even if DNA analysis of the exons revealed no mutations, it may be impossible to rule out a gene. A mutation in an intron may interfere with mRNA splicing, or a mutation in a remote enhancer may otherwise reduce expression. Moreover, the diagnosis of OTSC is befogged by the differentiation of clinical and histological OTSC: Clinically unaffected members cannot be considered as genetically unaffected due to the limited penetrance and the variable expression. A genetic susceptibility may be harder to recognise when penetrance is reduced, syndromic features are subtle, and, by chance, all siblings and/or children may be unaffected. Also in family members with only perceptive hearing loss, we fail to discriminate these individuals with cochlear OTSC from those with other types of genetic hearing loss.

References 1. Topsakal V, Fransen E, Schmerber S, et al. Audiometric analyses confirm a cochlear component, disproportional to age, in stapedial otosclerosis. Otol Neurotol 2006; 27(6):781–787. 2. Shambaugh GE. Fenestration operation for otosclerosis. Acta Otolaryngol Suppl (Stockh) 1949; 79:1–101. 3. Arnold W, Friedmann I. Presence of viral specific antigens (measles, rubella) around the active otosclerotic focus. Ann Rhinol Laryngol 1987; 66:167–171. 4. Schuknecht HF. Pathology of the Ear. Cambridge: Harvard University Press, 1974. 5. Valsalva AM. De aure humana tractatus. Utrecht 1704. 6. Politzer A. Uber primare Erkrankung der Knochernen Labyrinthkapsel. Z Ohrenheilkd 1894; 25:309. 7. Siebenmann F. Totaler knocherner Verschluss beider Labyrinthfester und Labyrinthitis serosa infolge progressiver Spongiosierung. Verh Dtsch Otol Ges 1912; 21:267.

117

8. Guild SR. Histologic otosclerosis. Ann Otol Rhinol Laryngol 1944; 53:246–267. 9. Ramsay HAW, Linthicum FH Jr. Mixed hearing loss in otosclerosis: indication for long-term follow-up. Am J Otol 1994; 15(4):536–538. 10. Kelemen G, Alonso A. Penetration of the cochlear endost by the fibrous component of the otosclerotic focus. Acta Otolaryngol 1980; 89:453–458. 11. Friedmann I. Pathology of the Ear. Oxford: Blackwell, 1974. 12. Lindsay JR, Beal DD. Sensorineural deafness in otosclerosis: observations on histopathology. Ann Otol Rhinol Laryngol 1966; 75:436–457. 13. Linthicum FH. Pathology and pathogenesis of sensorineural deafness in otosclerosis. EENT Digest 1967; 29:51–56. 14. Linthicum FH, Filipo R, Brody S. Sensorineural hearing loss due to cochlear otospongiosis: theoretical considerations of etiology. Ann Otol Rhinol Laryngol 1975; 85:544–551. 15. Hueb MM, Goycoolea MV, Paparella MM, Oliveira JA. Otosclerosis: the University of Minnesota temporal bone collection. Otolaryngol Head Neck Surg 1991; 105(3):396–405. 16. Shambaugh GE. Clinical diagnosis of cochlear (labyrinthine) otosclerosis. Laryngoscope 1965; 75:1558. 17. Causse JR, Causse JB. Otospongiosis as a genetic disease. Am J Otol 1984; 5(3):211–223. 18. Königsmark BW, Gorlin RJ. Genetic and metabolic deafness. Philadelphia: WB Saunders, 1976. 19. Morrison AW. Genetic factors in otosclerosis. Ann R Coll Surg Eng 1967; 41:202–237. 20. Cawthorne T. Otosclerosis. J Laryngol Otol 1955; 69:437–456. 21. Larsson A. Otosclerosis: a genetic and clinical study. Acta Otolaryngol Suppl (Stockh) 1960; 154:1–86. 22. Virolainen E. Vestibular disturbances in clinical otosclerosis. Acta Otolaryngol Suppl (Stockh) 1972; 306. 23. Rüedi L, Spoendlin H. Die Histologie der otosklerotischen Stapesankylose im Hinblick auf die chirurgische Mobilisation des Steigbügels. Bibl Otol rhinol laryngol Fasc 1957; 4:1. 24. Arnold WJ, Laissue JA, Friedmann I, Naumann HH. Diseases of the Head and Neck. An Atlas of Histopathology. New York: Thieme Medical Publishers, 1987. 25. Chevance LG, Bretlau P, Jorgensen MB, Causse J. Otosclerosis. An electron microscopic and cytochemical study. Acta Otolaryngol Suppl (Stockh) 1970; 272:1–44. 26. Jorgensen MB, Kristensen HK. Frequency of histological otosclerosis. Ann Otol Rhinol Laryngol 1967; 76:83–88. 27. Declau F. Morfologische organisatie van het beenweefsel in het otische kapsel van de humane foetus. Ph. D. Thesis. University of Antwerp, Belgium, 1991. 28. Frisch T, Sorensen MS, Overgaard S, Bretlau P. Predilection of otosclerotic foci related to the bone turnover in the otic capsule. Acta Otolaryngol Suppl 2000; 543:111–113. 29. Declau F, Scheuermann W, Somers T, Van de Heyning P. Scanning electron microscopy of normal and otosclerotic bone in the region of the oval window. In: Lurato S, Veldman J, eds. Progress in Human Auditory and Vestibular Histopathology. New York: Kugler Publications, 1997:31–39.

1181 Chap08

118

3/28/07

5:12 PM

Page 118

Genetics and hearing impairment

30. Declau F, Van de Heyning P, Van Camp G. The GENDEAF otosclerotic database. Bulletin of the European network on genetic deafness 2003; 2:5–7. 31. McKenna M, Mills BG. Ultrastructural and immunohistochemical evidence of measles virus in active otosclerosis. Acta Otolaryngol Suppl (Stockh) 1990; 470:130–140. 32. Weber BP, Zenner HP. Otosclerosis and estrogen-gestagen substitution in the menopause. Dtsch Med Wochenschr 1991; 116:1292. 33. Shambaugh GE Jr, Petrovic A. The possible value of sodium fluoride for inactivation of the otosclerotic bone lesion. Experimental and clinical studies. Acta Otolaryngol 1967; 63:331–339. 34. Van den Bogaert K, Govaerts PJ, De Leenheer EMR, et al. Otosclerosis: a genetically heterogeneous disease involving at least 3 different genes. Bone 2002; 30:624–630. 35. Tomek MS, Brown MR, Mani SR, et al. Localization of a gene for otosclerosis to chromosome 15q25-q26. Hum Mol Genet 1998; 7:285–290. 36. Van den Bogaert K, Govaerts PJ, Schatteman I, et al. A second gene for otosclerosis, OTSC2, maps to chromosome 7q34-36. Am J Hum Genet 2001; 68:495–500. 37. Chen W, Campbell CA, Green GE, et al. Linkage of otosclerosis to a third locus (OTSC3) on human chromosome 6p21.3-22.3. J Med Genet 2002; 39:473–477. 38. Singhal SK, Mann SB, Datta U, et al. Genetic correlation in otosclerosis. Am J Otolaryngol 1999; 20:102–105. 39. Brownstein Z, Frydman M, Avraham KB. Identification of a New Gene for Otosclerosis, OTSC4. ARO Meeting. Daytona Beach, Florida, USA, 2004. 40. Van den Bogaert K, de Leenheer EMR, Chen W, et al. A fifth locus for otosclerosis, OTSC5, maps to chromosome 3q22-24. J Med Genet 2004; 4:1450–1453. 40a.Thys M, Van Den Bogaert K, Iliadou V, et al. A Seventh locus for otosclerosis, OTSC7, maps to Chromosome 6q13–161. Eur J Hum Genet 2007; 15(3): 362–368. 41. Declau F, Van den Bogaert K, Van De Heyning P, et al. Phenotypegenotype correlations in otosclerosis: clinical features of OTSC2. In: Häusler R, ed. Advances in ORL. Otosclerosis and Stapes Surgery. 2007; 65:114–118. 42. McKenna MJ, Kristiansen AG, Tropitzsch AS. Similar COL1A1 expression in fibroblasts from some patients with clinical otosclerosis and those with type I osteogenesis imperfecta. Ann Otol Rhinol Laryngol 2002; 111(2):184–189. 43. McKenna MJ, Nguyen-Huynh AT, Kristiansen AG. Association of otosclerosis with Sp1 binding site polymorphism in COL1A1 gene: evidence for a shared genetic etiology with osteoporosis. Otol Neurotol 2004; 25(4):447–450. 44. Rodriguez L, Rodriguez S, Hermida J, et al. Proposed association between the COL1A1 and COL1A2 genes and otosclerosis is not supported by a case-control study in Spain. Am J Med Genet A 2004; 128(1):19–22. 45. Niedermeyer H, Arnold W, Neubert WJ, Hofler H. Evidence of measles virus RNA in otosclerotic tissue. J Otorhinolaryngol Relat Spec 1994; 56(3):130–132.

46. Arnold W, Friedmann I. Immunohistochemistry of otosclerosis. Acta Otolaryngol Suppl (Stockh) 1990; 470:124–129. 47. Chevance LG, Causse J, Jorgensen MB, Bergés J. Hydrolytic activity of the perilymph in otosclerosis. A preliminary report. Acta Otolaryngol (Stockh) 1972; 74:23–28. 48. Parahy CH, Linthicum FH. Otosclerosis. Relationship of spiral ligament hyalinization to sensorineural hearing loss. Laryngoscope 1983; 93:717–720. 49. Petrovic A, Shambaugh GE Jr. Promotion of bone calcification by sodium fluoride: short-term experiments on newborn rats using tetracycline labeling. Arch Otolaryngol 1966; 83:104–122. 50. Shambaugh GE Jr, Scott A. Sodium fluoride for arrest of otosclerosis. Arch Otolaryngol 1964; 80:263–270. 51. Vartianen E, Karjalainen S, Nuutinen J, et al. Effect of drinking water fluoridation on hearing of patients with otosclerosis in a low fluoride area: a follow-up study. Am J Otol 1994; 15(4): 545–548. 52. Mendoza D, Rius M, De Stefani E, Leborgne F Jr. Experimental otosclerosis. Its causation by ionizing radiations. Acta Otolaryngol (Stockh) 1969; 67(1):9–16. 53. Yoo TJ. Etiopathogenesis of otosclerosis: a hypothesis. Ann Otol Rhinol Laryngol 1984; 93(1):28–33. 54. Bujia J, Alsalameh S, Jerez R, et al. Antibodies to the minor cartilage collagen type IX in otosclerosis. Am J Otol 1994; 15(2):222–224. 55. Gordon MA, McPhee JR, Van De Water TR, Ruben RJ. Aberration of the tissue collagenase system in association with otosclerosis. Am J Otol 1992; 13(5):398–407. 56. Levin G, Fabian P, Stahle J. Incidence of otosclerosis. Am J Otol 1988; 9(4):299–301. 57. Stahle J, Stahle CH, Arenberg JK. Incidence of Meniere’s disease. Arch Otolaryngol 1978; 104:99–102. 58. Pearson RD, Kurland LT, Cody DTR. Incidence of diagnosed clinical otosclerosis. Arch Otolaryngol 1974; 99:288–291. 59. Declau F, Van De Heyning PH. In: Martini A, Read A, Stephens D, eds. Genetics and Hearing Impairment. London: Whurr Publishers, 1996:221–235. 60. Davenport CB, Milles BL, Frink LB. The genetic factor in otosclerosis. Arch Otolaryngol 1933; 17:135–170, 340–383, 503–548. 61. Hall JG. Otosclerosis in Norway. A geographical and genetical study. Acta Otolaryngol Suppl 1974; 324:1–20. 62. Gapany-Gapanavicius B. Otosclerosis: Genetics and Surgical Rehabilitation. Jerusalem: Keter, 1975. 63. Ben Arab S, Bonaiti-Pellie C, Belkahia A. A genetic study of otosclerosis in a population living in the north of Tunisia. Ann Genet 1993; 36:111–116. 64. Altmann F, Glasgold A, Mcduff JP. The incidence of otosclerosis as related to race and sex. Ann Otol Rhinol Laryngol 1967; 76(2):377–392. 64a.Kapur YP, Patt AJ. Hearing in Todas of South India. Arch Otolarngol 1967; 85(4): 400–406. 65. Declau F, Van Spaendonck M, Timmermans JP, et al. Prevalence of otosclerosis in an unselected series of temporal bones. Otol Neurotol 2001; 22:596–602. 66. Weber M. Otosklerose und Umbau der Labyrinthkapsel. Leipzig: Poeschel and Trepte, 1935.

1181 Chap08

3/28/07

5:12 PM

Page 119

Otosclerosis: a genetic update

67. Engström H. On the frequency of otosclerosis. Acta Otolaryngol 1939; 27:608–614. 68. Schuknecht HF, Kirchner JC. Cochlear otosclerosis: fact or fantasy? Laryngoscope 1974; 84:766–782. 69. Kabat C. A family history of deafness. J Hered 1943; 34:377–378. 70. Hammerschlag V. Zur Frage der Vererbbarkeit der “Otosklerose.” Wien Klin Rundschau 1905; 19:5–7. 71. Körner O. Das Wesen der Otosklerose im Lichte der Vererbungslehre. Ztschr Ohrenheilk 1905; 50:98. 72. Albrecht W. Uber der Vererbung der konstitutionellen sporadischen Taubstummheit und der Otosclerose. Arch Ohren Nasen Kehlkopfheilkd 1922; 110:15–48. 73. Bauer J, Stein C. Verbung und Konstitution bei Ohrenkrankheiten. Ztchr ges Anat 1925; 10:483. 74. Weinberg W. Methoden und Technik der Statistik mit besonderer Berücksichtigung der Sozialbiologie. In: Gottstein A, Schlossmann A, Teleky L, eds. Handbuch der sozialem. Berlin: Springer, 1925.

119

75. Gordon MA. The genetics of otosclerosis: a review. Am J Otol 1989; 10(6):426–438. 76. Hernandez-Orozco F, Courtney GT. Genetic aspects of clinical otosclerosis. Ann Otol Rhinol Laryngol 1964; 73:632–644. 77. Morrison AW, Bundey SE. The inheritance of otosclerosis. J Laryngol Otol 1970; 84:921–932. 78. Nager F. Zur klinik und pathologischen Anatomie der Otosklerose. Acta Otolaryngol 1939; 27:542. 79. Schmidt E. Erblichkeit und Gravidität bei der Otosklerose. Arch Ohr Nas Kehlheilk 1933; 136:188. 80. Gristwood RE, Venables WN. Pregnancy and otosclerosis. Clin Otolaryngol 1983; 8:205–210. 81. Schaap T, Gapany-Gapanavicius B. The genetics of otosclerosis: distorted sex ratio. Am J Hum Genet 1978; 30:59–64. 82. James WH. Sex ratios in otosclerotic families. J Laryngol Otol 1991; 103:1036–1039.

1181 Chap08

3/28/07

5:12 PM

Page 120

1181 Chap09

3/29/07

7:16 PM

Page 121

9 Mitochondrial DNA, hearing impairment, and ageing Kia Minkkinen, Howard T Jacobs

Introduction In recent years, inherited mutations in mitochondrial DNA (mtDNA) have been discovered to be associated with a variety of human diseases. mtDNA mutations can be thought of as forming a continuous spectrum from neutral (or even advantageous) polymorphisms through mildly or moderately deleterious changes to clearly pathological mutations, with devastating disease phenotypes. Supposedly neutral mtDNA polymorphisms, which have accumulated sequentially along radiating maternal lineages as the result of mtDNA evolution, define the mtDNA haplotypes of modern-day populations. In the recent years, haplogroup-defining polymorphisms have been suggested to contribute to the multifactorial aetiologies of many late-onset degenerative disorders by acting as “risk factors” that predispose individuals of certain mtDNA haplogroups to these diseases. Deleterious mtDNA mutations, on the other hand, have been found to be directly responsible for a wide range of phenotypes, most often by compromising the function of the mitochondrial oxidative phosphorylation (OXPHOS) system in individual cell types, tissues, or whole organisms. In addition to inherited mtDNA mutations, somatically acquired mutations and rearrangements have been shown to accumulate within many tissues during ageing. Such accumulation may lead to a progressive decline in energy production and the overall function of the tissue, thereby precipitating the onset of many agerelated degenerative diseases. Lastly, mtDNA mutations rarely act alone, and the clinical presentation of a mitochondrial disease is often the result of the interplay between the mitochondrial and the nuclear genomes as well as various environmental factors. Among this diverse spectrum of diseases, mtDNA mutations are recognised as one of the most frequent causes of familial

hearing disorders. Inherited mtDNA mutations have been identified in both syndromic and nonsyndromic hearing loss as well as in predisposition to aminoglycoside-induced ototoxicity (1). However, most of the previous studies have been limited to cases of early-onset deafness, which has been recently shown to be genetically distinct from age-related hearing impairment (ARHI) (2). The possible involvement of the mtDNA genotype in ARHI, one of the most common age-related sensorineural defects, remains controversial. In this review, we briefly summarise current knowledge concerning the mitochondrial genetic system, discuss the relationship between mtDNA genotype and defined hearing disorders, and evaluate the evidence for possible mtDNA involvement in ARHI.

mtDNA and disease Mitochondria Structure and organisation Mitochondria are cytoplasmic organelles that have a variety of functions in the cell, the most important being the synthesis of adenosine triphosphate (ATP) by OXPHOS. Mitochondria are present in all cell types except mature erythrocytes. A typical human cell has several hundred up to a thousand mitochondria, the exact number depending on the metabolic activity and energy requirements of the tissue. Mitochondria can also vary in shape, size, and location depending on the cell type and tissue function. Rather than isolated individual entities, mitochondria are thought to exist in the cell as a dynamic network, with constant fusion and fission events.

1181 Chap09

122

3/29/07

7:16 PM

Page 122

Genetics and hearing impairment

A mitochondrion has two membranes, the outer membrane that surrounds the organelle and the inner membrane that is folded into structures called cristae to maximize its surface area. The compartment between the outer and the inner membranes is called the intermembrane space (IMS). The outer membrane contains large transmembrane channels composed of the protein porin, and the membrane is readily permeable to ions and most molecules smaller than 5 kDa. The inner membrane in turn is impermeable to most small ions and molecules including protons and specific transporters are required for these species to cross the inner membrane. Embedded in the inner membrane are the enzymes involved in OXPHOS, namely, the complexes of the respiratory chain (I to IV), the ATP synthase (complex V), and the adenine nucleotide translocator (ANT). Enclosed by the inner membrane is the mitochondrial matrix, which is an aqueous solution containing a number of metabolic enzymes including those involved in the tricarboxylic acid cycle (TCA cycle), the
-oxidation pathway, the pathways of amino acid oxidation, and the oxidation of pyruvate (the pyruvate dehydrogenase complex), as well as a multitude of different intermediates of energy metabolism. Also found in the matrix are several copies of the circular mtDNA, the mitochondrial ribosomes, the transfer RNAs (tRNAs), and the various enzymes required for the maintenance, transcription, and translation of the mitochondrial genome. Many of these components of the matrix are, however, intimately associated with the inner membrane. The role of mitochondria in energy metabolism The most important function of mitochondria in the cell is the production of ATP by OXPHOS. In aerobic organisms, OXPHOS is the final stage of energy-yielding metabolism, where all oxidative steps in the degradation of carbohydrates, fats, and amino acids converge. The mitochondrial matrix contains all the pathways of substrate oxidation except glycolysis, which takes place in the cytosol. Specific transporters carry pyruvate (produced from carbohydrates by glycolysis), fatty acids (from triglycerides), and amino acids or their -keto derivatives (from protein breakdown) into the matrix to be further converted into the two-carbon acetyl group of acetyl-CoA by the pyruvate dehydrogenase complex, the
-oxidation pathway and the pathways of amino acid oxidation, respectively. The acetyl groups are taken up by the TCA cycle, which enzymatically oxidizes them to CO2. The energy released by the oxidation is conserved in the reduced forms of freely diffusible electron carriers, nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide, reduced form (FADH2 ), which in turn can pass the high-energy electrons to the respiratory chain (3). The protein complexes of the respiratory chain are located within the inner membrane. Each of the complexes is assembled from multiple subunits, which, apart from complex II, include subunits encoded by both the mitochondrial and the nuclear genomes. Subunits of the complexes include proteins with prosthetic groups capable of accepting and donating either one or two electrons, thus forming a series of sequentially acting electron carriers. High-energy electrons are first transferred

from NADH to complex I (NADH dehydrogenase) and then to ubiquinone (Q), whereas the electrons from succinate are passed to ubiquinone via complex II (succinate dehydrogenase), the only membrane-bound enzyme of the TCA cycle. Similarly, the glycerol 3-phosphate dehydrogenase on the outer face of the inner membrane and the FAD-containing enzymes of the fatty acid oxidation, both bypass complex I by delivering the reducing equivalents directly to ubiquinone. From the reduced form of ubiquinone, QH2, the electrons are transferred to complex III (ubiquinone:cytochrome c oxidoreductase), which carries them to cytochrome c. Complex IV (cytochrome c oxidase) completes the process by transferring the electrons from cytochrome c to molecular oxygen, which is reduced to H2O. The oxygen consumption of the electron transport chain (ETC) is coupled with the phosphorylation of adenosine diphosphate (ADP) through an electrochemical gradient (4). The energy released in the process of electron transfer is efficiently conserved in the form of a proton gradient across the inner mitochondrial membrane. Protons are pumped from the matrix to the IMS by complexes I, III, and IV. For each pair of  electrons that are transferred to O2, 4H are pumped out by   complex I, 4H by complex III, and 2H by complex IV, resulting in the formation of an electrochemical gradient () across the inner membrane. The flow of protons down this gradient back to the matrix side creates a proton-motive force, which is used to drive the synthesis of ATP from ADP and inorganic phosphate (Pi). This reaction is catalysed by the enzyme complex ATP synthase, which has two multimeric components, an integral membrane component FO, which forms the proton channel, and a peripheral membrane protein F1, providing the active sites for the ATP synthesis. In addition to providing the energy for ATP synthesis, the proton-motive force is also responsible for driving the transport of substrates, ADP and Pi into the mitochondrial matrix, and the product, ATP, out to the cytosol. The exchange of the ionic 3 4 forms of ADP and ATP is carried out by the antiporter, ANT, dissipating some of the electrical gradient. The Pi in turn is imported by a membrane symporter phosphate translocase in   the form of H2PO4 . For each H2PO4 , one proton is moved into the matrix, thereby consuming the proton gradient. A summary of the components essential for the process of OXPHOS is shown in Figure 9.1.

The mitochondrial genome Compelling evidence exists for the theory that the energyconverting organelles of present-day eukaryotes evolved from aerobic bacteria in an endosymbiotic process about two to three billion years ago (5,6). The structure and lipid composition of the mitochondrial double membrane as well as the existence of the circular mitochondrial genome and tRNAs and ribosomal RNAs (rRNAs) of the mitochondria-specific transcription and translation systems that resemble those of prokaryotes support the hypothesis that mitochondria originate from aerobic

1181 Chap09

3/29/07

7:16 PM

Page 123

Mitochondrial DNA, hearing impairment, and ageing

123

Figure 9.1 Electron transport chain complexes (I–IV) and the ATP synthase (V). Abbreviations: Q, ubiquinone; QH2, reduced form of ubiquinone; ADP, adenosine diphosphate; ATP, adenosine triphosphate.

bacteria, which were engulfed by primitive eukaryotic cells (7). Being capable of aerobic energy production, the endosymbiont can be assumed to have provided an obvious metabolic advantage to the host. The initial uptake event has been followed over time by sequential transfer of the genes of the organelle to the developing nucleus of the host cell. As a consequence, present day mitochondria have lost much of their own genome and become heavily dependent on the nucleus for its gene products. In fact, out of the estimated 1500 polypeptides of the mitochondrial proteome (8), only 13 are encoded by their own DNA. Despite their small number, however, the gene products of mtDNA have fundamental and essential functions in the energy metabolism of eukaryotic cells. Each mitochondrion contains 1 to 11 copies of the circular, double-stranded mtDNA molecule, the average being estimated at about two genomes per organelle (9). In humans, each mtDNA molecule is 16,569 base pairs long and contains 13 genes-encoding subunits of the OXPHOS system as well as the genes for the two (12S and 16S) rRNAs and 22 tRNAs essential for the mitochondrial protein synthesis machinery. The human mtDNA Cambridge Reference Sequence, published in 1981, was the first component of the human genome to be completely sequenced (10). The two strands of the mtDNA differ in base composition and can be separated by denaturing cesium chloride gradient centrifugation. The guanine-rich strand encoding 12 of the 13 polypeptide encoding genes, 14/22 of the tRNA genes, and both of the rRNA genes is named the heavy strand, while the other, cytosine-rich strand is called the light strand. Due to the absence of introns and the contiguous organisation of the coding sequences, the human mtDNA is a very small and compact genome. Some genes overlap each other, and some of the termination codons are not even encoded in the genome but are generated posttranscriptionally by polyadenylation (11). The only substantial noncoding segment of the mtDNA is the displacement loop (D-loop) region (nt 16104–16191), which is thought to contain the proposed origin of replication as well as the promoters for heavy- and light-strand transcription (PH, PL) (Fig. 9.2).

Figure 9.2 Organisation of the human mitochondrial genome. Transfer RNA genes are denoted by the single letter abbreviation for the amino acid they carry. Source: From Ref. 12.

mtDNA exists as protein–DNA complexes called nucleoids, which can be detected by confocal microscopy as distinct spots within the mitochondrial networks (13). Each nucleoid is believed to contain several copies of the mtDNA as well as proteins required for the maintenance and replication of the genome. They have also been suggested to be the unit of mtDNA inheritance (14). However, the exact role, molecular composition, and dynamics of the nucleoids remain to be elucidated.

1181 Chap09

124

3/29/07

7:16 PM

Page 124

Genetics and hearing impairment

mtDNA is replicated and transcribed within the mitochondrion but it is completely reliant on nuclear-encoded proteins for its maintenance and propagation. Replication of the mitochondrial genome continues throughout the lifespan of an organism, in both proliferating and postmitotic cells. The mtDNA had originally been thought to replicate by a bidirectional and asynchronous mechanism (15) in which the synthesis of DNA initiates at two distinct origins. According to this model, heavy strand synthesis starts from the so-called origin of heavy-strand, OH, and proceeds two-thirds of the way around the circular molecule, displacing the parental strand until the light-strand origin, OL, is exposed. Light-strand synthesis is then initiated and proceeds in the opposite direction along the heavy-strand template. However, evidence from the analysis of two-dimensional agarose gel electrophoresis of replication intermediates has suggested an alternative model in which two mechanisms of DNA replication may exist simultaneously (16). In addition to the asymmetric asynchronous mechanism, another more conventional mechanism has been proposed, where the synthesis of the leading and lagging strand are coupled. In this case, the synthesis would start from a single origin and proceed unidirectionally around the circular genome, and the lagging strand would have to be synthesised in short Okazaki-like fragments. Unlike the strand-asynchronous replication, which is thought to work mainly in the maintenance of a constant-copy number of the mitochondrial genome, the synchronous mechanism would involve frequent lagging-strand initiation and be the predominant mode of replication in conditions for which efficient mtDNA amplification is required (16). Recent data suggests, however, that instead of a single origin of replication, the replication of mtDNA may initiate from multiple origins across a broader initiation zone, proceed first bidirectionally, and only after fork arrest near OH, be restricted to one direction only (17). The machinery responsible for mtDNA replication is known to include several nuclear-encoded proteins, only four of which have been well characterised: the actual DNA polymerase of mtDNA called DNA polymerase gamma (POLG) and its accessory subunit (18,19), the mitochondrial singlestranded DNA-binding protein (20), and the transcription factor A of mitochondria (TFAM) (21,22). Other proteins with a suggested role in mtDNA replication and maintenance include Twinkle, a putative mtDNA helicase (23). The human mitochondrial genome is transcribed by the mitochondrial RNA polymerase (24), assisted by mitochondrial transcription factors, all of which are nuclear-encoded proteins. mtDNA is transcribed as long polycistronic transcripts from two heavy-strand promoters (PH) and one light-strand promoter (PL) (25). tRNA sequences, which are scattered around the genome, provide structural signals for RNA processing. They fold within the transcripts and are cleaved out, after which the precursors of tRNAs and released mRNAs and rRNAs undergo posttranscriptional processing (11). An RNA transcript from the PL is also proposed to act as a primer for the mtDNA synthesis (26), thus functionally coupling mtDNA

transcription with replication of the genome and explaining why defective mtDNA transcription may also affect replication (27). The 13 mitochondrially encoded mRNAs are translated into polypeptides on the mitochondrial ribosomes, using a mitochondrion-specific genetic code, which differs slightly from that used in the nucleus. These proteins, assembled into functional complexes together with more than 60 nuclear-encoded subunits, form four of the five enzyme complexes that are required for OXPHOS (complex II consists solely of subunits encoded by nuclear genes). In addition to the majority of subunits of the OXPHOS complexes, all the metabolic enzymes, ribosomal proteins, DNA and RNA polymerases, and other proteins involved in mtDNA maintenance, RNA synthesis and translation, as well as protein import and turnover are encoded by nuclear genes, synthesised on cytoplasmic ribosomes, and imported posttranslationally into mitochondria.

Special features of mitochondrial genetics Due to the cytoplasmic location and high copy number of the mitochondrial genome, mitochondrial genetics has several unique features that are essential for understanding the origin and transmission of mitochondrial diseases. Some of these characteristic features are discussed below. Maternal inheritance mtDNA is transmitted exclusively through the maternal line (28). The sperm cell contributes a small number of mitochondria to the fertilised egg but these mitochondria seem to be eliminated at the early stages of embryogenesis by a mechanism that is not currently well known but is suspected to involve the ubiquitin-proteosome pathway (29). Apart from one reported exception, a patient with severe mitochondrial disease, there is no evidence of paternal inheritance of mtDNA under normal conditions of fertilisation (30). Maternal inheritance is therefore a characteristic feature of mitochondrial disease pedigrees. In addition, it is one of the factors that make mtDNA a particularly useful tool in human evolutionary studies. High mutation rate Mitochondria are suspected to lack some of the efficient DNArepair mechanisms that are present in the nucleus. There may also be a lack of proteins to physically package and protect mtDNA in a manner analogous to the histones in the nucleus, although the TFAM could fulfill such a role, at least to some extent. If the mtDNA is exposed to the deleterious effects of various mutagenic agents, including the endogenous reactive oxygen species (ROS), which are generated as a by-product of OXPHOS, it could be especially susceptible to damage. Furthermore, mtDNA molecules are attached to or located in close proximity with the inner mitochondrial membrane, which is the primary site of oxygen radical generation. These reasons are proposed to account for the unusually high mutation rate of the mtDNA, which has been estimated to be up to 10 to 20 times as fast as that of the nuclear DNA (31). Because of the highly

1181 Chap09

3/29/07

7:16 PM

Page 125

Mitochondrial DNA, hearing impairment, and ageing

compact organisation and lack of introns and intergenic regions in the mtDNA, the relative mutation frequency affecting the coding regions can be thought to be even higher. As well as a variety of pathological mutations identified in the mtDNA, the fast mutation rate has also resulted in the accumulation of neutral polymorphisms throughout the genome. Most of these sequence variants are located within the fast-evolving, noncoding region of the mtDNA (the D-loop), and the rate of accumulation of mtDNA point mutations can be used as a “molecular clock” when determining evolutionary events and relationships. Heteroplasmy and replicative segregation 3 4 In human cells, mtDNA is present in 10 to 10 copies per cell (32), depending on the cell type, and generally, all of these copies are identical. When an mtDNA mutation arises, however, an intracellular mixture of mutated and nonmutated mtDNA molecules is created. This condition is referred to as heteroplasmy as opposed to homoplasmy in which the individual shows only a single mitochondrial genotype with respect to a given nucleotide (nt) position. At each mitotic or meiotic cell division, the individual mitochondria and mtDNAs are believed to be randomly distributed to the daughter cells, and the percentage of mutant versus normal molecules in a cellular lineage may drift toward either pure mutant or pure wild type over many cell generations, a process known as replicative segregation (33). However, at least in some cell types, the process has been suggested to be constrained in some way (14). Replicative segregation in the female germ line can result in variable proportions of mutant mtDNA being transmitted from the mother to the offspring, and the genetic drift may be quite rapid. Large variations in the percentage of mutant mtDNA between generations are believed to be due to a socalled “genetic bottleneck,” which occurs during early embryogenesis (34). In the first cell divisions of a fertilised zygote, prior to blastocyst formation, there is no biogenesis of mitochondria. Instead, the existing pool of mitochondria and mtDNA (about 5 1–2 10 copies) is distributed along with the cytoplasm to the daughter cells, resulting in a dramatic reduction in the mtDNA copy number in the cells of the blastocyst, including those destined to become the female germ line (35). At later stages of oogenesis, this pool is amplified up to 1000 times to reach the normal high copy number of a mature oocyte. Because of this bottleneck, the resulting mtDNA pool originates from a very small number of mtDNA molecules, introducing a large in vivo sampling error. If a mutant mtDNA is acquired by the germ-line progenitors, the proportion of the mutant mtDNA may increase dramatically. If such an oocyte ends up being fertilised, this increased proportion of mutant mtDNA is passed on to the offspring, and the mtDNA genotype can shift to virtually pure mutant in just a few generations.

Mitochondrial disease A growing number of human diseases can be attributed to mutations in mtDNA. These mutations can affect any of the

125

13 mitochondrially encoded polypeptides of the OXPHOS system or the rRNAs and tRNAs required for the mitochondrial protein synthesis. In addition to the over 50 different pathological mtDNA point mutations that have been identified to date, large-scale rearrangements of mtDNA have been found in tissues of patients suffering from neuromuscular disorders of varying severity. These include both sporadically occurring heteroplasmic deletions and duplications such as those seen in the Kearns–Sayre syndrome (KSS) (36) as well as the rare forms of inherited diseases in which the multiple mtDNA deletions are due to a nuclear defect, for example, POLG mutations in progressive external ophthalmoplegia (PEO) (37). A large number of other mitochondrial diseases are due to mutations in the nuclear genes, encoding either the subunits of the respiratory chain complexes or the large number of proteins involved in the maintenance and expression of the mitochondrial genome (38). Many of these defects are not yet characterised at the molecular level but can be defined in terms of the biochemical consequences and distinguished from mtDNA defects by the Mendelian transmission of the phenotypes. In addition to causative mutations, supposedly neutral polymorphisms defining the mtDNA haplotype have been proposed as genetic risk factors or possible modifiers of the phenotypic expression of various disorders. Finally, somatic point mutations in the mtDNA are known to accumulate with age and have been linked to the pathogenesis of many degenerative diseases. Pathological mtDNA mutations Except where arising as new mutations, pathological mtDNA mutations are invariably inherited through the maternal line and can occur in genes encoding the mitochondrial tRNAs, rRNAs, or the mitochondrially encoded subunits of the respiratory chain complexes. Because of the biochemical and genetic complexity of the OXPHOS system, the mitochondrial disorders can present with an exceptionally wide spectrum of clinical symptoms, making systematic classification of mitochondrial diseases very challenging. The phenotypes range from lesions of single tissues or structures such as the optic nerve in Leber hereditary optic neuropathy (LHON) or the cochlea in maternally inherited nonsyndromic deafness to more widespread lesions including myopathies, encephalomyopathies, cardiomyopathies, or complex multisystem syndromes (39). The molecular background of some syndromes is fairly well established, whereas others are defined only on the basis of clinical, morphological, or biochemical findings. Curiously, the same mutation can lead to entirely different phenotypes in different individuals and, on the other hand, very similar phenotypes can be produced by different mutations. Moreover, some of the mitochondrial mutations might lead to disease only when a specific nuclear/mitochondrial genotype or environmental agent is present, further adding to the complexity of these diseases. The threshold effect As described above, many (although not all) pathological mtDNA mutations are heteroplasmic. The penetrance and

1181 Chap09

126

3/29/07

7:16 PM

Page 126

Genetics and hearing impairment

severity of the disease phenotype is often dependent on the ratio of the mutant versus wild-type mitochondrial genotype, i.e., the level of heteroplasmy. There is generally a certain critical proportion of the mutant mtDNA, a threshold level above which the deleterious effects of the mutation can no longer be complemented by the coexisting wild-type mtDNA, and the mutation therefore becomes relevant in terms of cellular dysfunction and pathology. However, the degree of heteroplasmy that is tolerated without clinical presentation of the disease is known to vary greatly depending on the nature of the mutation as well as other coexisting genetic and environmental factors. Tissue specificity Although the pathological mtDNA mutation is usually present in all tissues of the body, the clinical symptoms of the disease are often tissue specific. Possible explanations for the highly tissuespecific phenotypes seen in mitochondrial diseases include varying levels of heteroplasmy in different tissues, differential expression of the nuclear components of the mitochondrial genetic system, or variable sensitivity of different cell or tissue types to the deleterious effects of the decreased respiratory chain function and energy-generating capacity. Different tissues and organs have their own tissue-specific energetic thresholds, and the organs that are commonly involved and severely affected by mitochondrial disease include many of the ones with the highest aerobic energy demands, such as the central nervous system, the heart, and the skeletal muscle. Not all tissues with high ATP demands are as severely affected, however (40). For example, tissues as highly energy dependent as the liver and the kidney do not seem to be affected by OXPHOS deficiency to the same extent as nerve or muscle. It has been suggested that because cells with continuous lack of ATP would inevitably die and thereby compromise the viability of the whole organism (creating an in utero lethal phenotype), the cells most severely affected by mtDNA mutations are perhaps the ones with varying ATP demands (41). Such cells are predicted to function relatively normally until their ATP demand is stimulated above the basal level. The lack of ATP under such conditions would compromise the primary function of the cells as well as increase their susceptibility to apoptosis. This idea would apply particularly well to muscle and neuronal cells in which the energy demand is known to be uneven and might also provide an explanation for the selective loss of some specific cells such as the optic nerve or cochlear hair cells, which are continuously having to respond to rapidly changing environmental stimuli.

Mitochondrial sequence variation and disease mtDNA sequence variation in human populations Due to the lack of protective histones, the possibly inefficient DNA repair systems, and the continuous exposure to mutagenic effects of oxygen radicals, the mutation rate in the mtDNA is approximately 10 to 20 times higher than that of the nuclear

genome (31) and varies between different regions of the mtDNA, with the hypervariable sequences in the noncoding D-loop evolving much more rapidly than the coding regions (42). Occasionally, genetic drift allows selectively neutral base substitutions to reach polymorphic frequencies. Over time, the high mutation rate has resulted in a wide range of neutral population-specific polymorphisms in the mitochondrial genome, and it has been estimated that the mtDNA sequence of any one person in the world today differs from that in another person by an average of 25 base substitutions (43). mtDNA as a phylogenetic tool The mtDNA polymorphisms have accumulated sequentially along radiating maternal lineages, which have diverged as human populations have colonised different geographical regions of the world (44). The mode of inheritance of the mtDNA, i.e., the maternal transmission and the relative lack of recombination makes it a particularly useful tool in human evolutionary studies. Phylogenetic analyses of mtDNAs, in conjunction with the calibrated mutation rates for the analysed sequences, have in fact allowed the clarification of several controversial issues concerning the origin of humans, the time and colonisation pattern of the various regions of the world, and some of the genetic relationships of modern human populations (45). mtDNA sequencing and restriction fragment length polymorphism (RFLP) analysis of mtDNAs from a wide range of modern human populations have revealed a number of singlenucleotide polymorphisms that have presumably originally arisen in our early ancestors who migrated out of Africa about 130,000 years ago to become dispersed among the different continents (Fig. 9.3). Since those days, these founder polymorphisms have increased in frequency to a considerable level of prevalence and have characterised the present-day human populations in different geographical regions. Based on different combinations of these sequence variants, modern populations can be stratified into a variety of related groups of mtDNAs called haplogroups. Haplogroups show subtle differences between populations, and the majority of them have been shown to be continent specific (44). According to the scheme proposed by Macaulay and Richards (Fig. 9.4) (47–49), the root of the human mtDNA sequences from which all others descend, the so-called “mitochondrial Eve,” belongs to the L1 cluster of the African haplogroups. There are two other major African clusters, L2 and L3, but all non-African sequences appear to have descended from the L3 branch. The non-African subclusters of L3 include M and N. Asian and Native American haplogroups map to both of these clusters, whereas all European haplogroups belong to the N branch of the tree. Haplogroup associations of clinical disorders Haplogroup analysis can be used in conjunction with disease data to reveal a possible correlation between a certain haplogroup and an increased disease susceptibility. Polymorphisms

1181 Chap09

3/29/07

7:16 PM

Page 127

Mitochondrial DNA, hearing impairment, and ageing

127

Figure 9.3 The major events of the migratory history of the human mitochondrial DNA haplogroups. Figures are number of years before present; letters represent the various mt-DNA haplogroups. Source: From Ref. 46.

in the coding regions of the mtDNA, although often termed “neutral,” may cause subtle changes in the mitochondrially encoded polypeptides or the components of the mitochondrial translation system required for their expression, thereby affecting the function of the OXPHOS. It has been suggested that due to defective respiration and the consequent increase in the production of deleterious free radicals, individuals with a certain mitochondrial haplotype may be predisposed to a variety of degenerative cellular processes (51). Alternatively, polymorphisms characteristic of a given mitochondrial haplotype may themselves play no role in the disease susceptibility but merely serve as markers of the genetic background upon which some more recent pathological variant(s) may have arisen. A considerable body of literature has recently emerged, reporting the association of certain haplogroups or haplogroup clusters with a variety of disorders including male infertility (52), Parkinson’s disease (53,54), multiple sclerosis (55), Alzheimer’s disease (AD) (56,57), Lewy body dementia (35), and occipital stroke (58). Some of these results remain inconclusive, however, due to small sample cohorts, the use of subpopulations from very limited geographical areas or, in case of multiple studies, the failure to reproduce previous findings. An association of certain mtDNA haplogroups with successful ageing and longevity has also been suggested in two different populations (51,59). These associations have, however, been shown to be population specific and even discrepant between populations (60,61). An underrepresentation of haplogroup H and a corresponding excess of haplogroups J and U was reported in Finnish individuals older than 90 years compared with both middle-aged and infant controls from the same population, supporting the view that mitochondrial genotype may be one of the factors affecting ageing. Based on these results, two possibilities were suggested by the authors: that mildly deleterious polymorphisms may cause a subtle decrease in OXPHOS activity and thereby shorten lifespan, or conversely, that there are certain advantageous polymorphisms in

haplotypes J and U, which may actually contribute to the longevity of these individuals (51). Polymorphisms characteristic of a certain mtDNA haplogroup have also been shown to modulate the clinical expression of some disease phenotypes in individuals carrying other primary mtDNA mutations. For example, the degree of penetrance of the pathological mtDNA mutations in LHON (62–64), or a large-scale mtDNA deletion in mitochondrial encephalomyopathies (65), has been reported to depend on the mtDNA background on which they occur. Conversely, the expression of mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS), although very complex and varied, does not seem to be affected significantly by the haplogroup background (66,67).

mtDNA and deafness mtDNA and hearing impairment It has been estimated that up to 67% of patients with mtDNA disorders also manifest sensorineural hearing loss (68). The majority of the deafness-associated mitochondrial mutations have been found in families with severe systemic neuromuscular diseases such as KSS, myoclonic epilepsy with ragged red fibres (MERRF), or the MELAS syndrome, hearing loss being only one of the symptoms of the general neuromuscular dysfunction associated with these disease phenotypes. The causative mutations are often heteroplasmic and the disease shows great phenotypic variability. As an example, the consequences of a heteroplasmic point mutation at np 3243 of the tRNA-Leu(UUR) gene have been shown to range from diabetes and hearing loss when present at 10% to 30% of total mtDNA (69) to most severe forms of the MELAS syndrome at heteroplasmy levels higher than 70% (70).

1181 Chap09

128

3/29/07

7:16 PM

Page 128

Genetics and hearing impairment

Figure 9.4 The Macaulay and Richards phylogenetic tree of human mtDNA sequences. Abbreviation: mt, mitochondrial. Numbers refer to the position of the nucleotide change. Source: From Ref. 50.

In addition, a multitude of different mtDNA mutations has been reported in maternal pedigrees, with isolated sensorineural hearing impairment (SHI). The term nonsyndromal deafness is used in this case to distinguish the phenotype from those linked to other syndromal diseases. Although these mutations give rise to a severe tissue-specific auditory phenotype, they do not seem to have such deleterious effects on other tissues or on development in general. These mutations have been found to be generally homoplasmic, suggesting that the highly tissue-specific phenotype is not a result of different levels of heteroplasmy but

rather the complex interactions between the mitochondrial genotype, the nuclear genotype, and the environmental factors (71). Previously identified mutations in nonsyndromal SHI The most commonly reported mtDNA mutations associated with nonsyndromal hearing impairment (NSHI) include A1555G in the 12S rRNA gene (72), A7445G (73,74) and 7472insC (75,76) in the gene for tRNA-Ser(UCN), and A3243G (77,78) in tRNA-Leu(UUR), which, however, has also been found in families with diabetes mellitus and MELAS,

1181 Chap09

3/29/07

7:16 PM

Page 129

Mitochondrial DNA, hearing impairment, and ageing

showing that the distinction between the syndromal and the nonsyndromal forms of SHI is not always clear-cut. Interestingly, most of the mtDNA mutations found in association with nonsyndromal SHI appear to be located in a few distinct regions, namely the tRNA genes Leucine (UUR) and Serine (UCN) and the gene for the 12S rRNA. Several other mutations in the tRNA-Ser, including T7510C (79,80), T7511C (81,82), and T7512C (83), as well as another mutation in the 12S rRNA, C1494T (84), have also been reported with similar phenotypes. The molecular consequences of the SHI-associated mutations are complex and only partially understood. It has been suggested that some of the mutations in the tRNA genes interfere with the pre-tRNA processing or the translational properties of the mature tRNAs such as their aminoacylation (85,86). The resulting imbalance in the ratio of different functional tRNAs may lead to defects in the mitochondrial protein synthesis, such as misincorporation of amino acids or premature translation termination. Accumulation of abnormal translation products has in fact been proposed as one of the key mechanisms involved in the pathology of SHI. The rRNA mutations on the other hand are known to affect the translational accuracy centre of the mitoribosome and increase its susceptibility to antibiotics, which further impair the translational fidelity. Such relaxation of the stringency of translation is also suspected to promote the accumulation of abnormal translation products, leading to a unifying hypothesis linking mtDNA mutations to SHI (71). Based on this hypothesis, any genes whose products have a role in the mitochondrial protein quality control may be considered candidates for involvement in SHI, including the components of the mitoribosomal accuracy centre, tRNA processing, and aminoacylation, as well as any of the nuclear-encoded proteins involved in the delivery and discrimination of the charged tRNAs, the correct folding and subunit assembly of the released polypeptides, and the turnover of mistranslated or misfolded proteins in the mitochondria. Whether the above hypothesis is fully accurate remains to be answered as does the question as to why the clinical defect remains confined to the cochlea rather than affecting every tissue of the body. One proposed explanation for the tissue specificity is the possible existence of cochlear-specific isoforms or splice variants of the nuclear proteins involved in mitochondrial RNA processing or translation. The abnormal interaction of such tissue-specific proteins with the mutated rRNAs, tRNAs, or polycistronic mRNA transcripts is suggested to lead to qualitative or quantitative changes in the mitochondrial protein products (1). Deafness-associated mtDNA mutations and ARHI An interesting aspect of mitochondrial SHI is its striking similarity to ARHI in terms of audiometrical findings. Both these forms of hearing loss initially present with elevation in the highfrequency thresholds. Based on the similarities, mitochondrial SHI could perhaps be hypothesised to represent an acceleration of the more gradual process of age-related hearing loss, raising the possibility of a common underlying cause. However, this view was seemingly contradicted by the results of a previous

129

study in which we screened patients with postlingual SHI from two different populations (United Kingdom and Italy) for the most common previously reported deafness-associated mtDNA mutations. Causative mutations were found in approximately 5% of patients in both the populations, representing almost 10% of the cases that were clearly familial (2). The age of onset of hearing loss in these patients was generally childhood or early adulthood. In contrast, no instances of any of the previously reported mtDNA mutations were found in patients with lateonset hearing loss (Table 9.1), indicating that at least in terms of mtDNA mutations, ARHI seems to be genetically distinct from early-onset, nonsyndromal deafness.

A1555G transition and aminoghycosideinduced ototoxicity The A-to-G transition in the gene for the 12S rRNA is a remarkable example of how the auditory phenotype caused by mtDNA mutations can be affected by the complex interactions between the mtDNA genotype, the nuclear genotype, and environmental agents. Individuals carrying the homoplasmic A1555G mutation are known to be abnormally sensitive to aminoglycoside antibiotics (72). When exposed to aminoglycosides, these patients typically experience a sharp loss of hearing within a short period of time due to acute ototoxicity. However, this mutation has also been found in families with hearing loss in the absence of known exposure to aminoglycosides (87), suggesting the involvement of a possible nuclear modifier, which has also been supported by genetic and biochemical evidence (88,89). A candidate locus has been identified on chromosome 8 (90) but no definite modifier genes have been detected so far. In contrast to the acute severe aminoglycoside-induced deafness, in the absence of aminoglycoside Table 9.1 Causative mitochondrial DNA mutations found among patients with postlingual nonsyndromal hearing impairment and age-related hearing impairment United Kingdom (postlingual)

S. Italy (postlingual)

Finland (ARHI)

A1555G

2/80

2/128

0/138

A3243G

1/80

0/110

0/221

A7445G

1/80

2/115

0/313

7472insC

1/80

1/115

0/313

T7510C

1/80

0/115

0/313

T7511C

0/80

0/115

0/313

T7512C

0/80

0/115

0/313

Total frequency (%)

7.5%

4.2%

0%

Abbreviation: ARHI, age-related hearing impairment. Source: From Ref. 2.

1181 Chap09

3/29/07

130

7:16 PM

Page 130

Genetics and hearing impairment

exposure, the A1555G mutation typically results in milder, lateonset, progressive sensorineural hearing loss (87,91), suggesting that the mutation may have an age-dependent penetrance, which is enhanced by treatment with aminoglycosides. Conversely, aminoglycoside-induced deafness is also seen in the absence of the A1555G mutation, especially in the Asian populations (92), suggesting that in some cases, the interaction of the nuclear genotype and the medication alone can account for the ototoxic effect. Consistent with the endosymbiosis theory (5,6), the mitochondrial ribosomes more closely resemble bacterial ribosomes than those found in the cytosol of eukaryotes, although almost half of the rRNA contained in the bacterial ribosome is replaced with proteins in the mitoribosome (93). Many of the functionally important proteins of the translational accuracy centre show structural similarity to their bacterial homologs as well as resemblance in terms of sensitivity of the ribosomes to certain antibiotics (94). There is relatively little primary sequence conservation between the bacterial and the mitochondrial rRNAs; yet, the major secondary structures have been preserved. The np 1555 site maps to a phylogenetically highly conserved domain of the small subunit (SSU) rRNA and is equivalent to the position 1491 in the 16S rRNA of Escherichia coli (95). The biochemical basis for the pathology of the A1555G transition is thought to lie in the change of the small subunit rRNA to a secondary structure that more closely resembles that of the bacterial equivalent in a region that is known to have a key role in translational fidelity (96). The mutated nt A at np 1555 is predicted to form a novel base pair with a cytosine at np 1494 and thereby lengthen the base-paired stem region of the 12S rRNA molecule by one nt pair (Fig. 9.5), rendering it more similar to the bacterial SSU rRNA than the wild type. The antibacterial effect of the aminoglycoside antibiotics is based on their ability to bind the decoding site of the bacterial SSU rRNA, thereby causing translational infidelity. The G-C base pair is expected to create a new binding site for these drugs in the 12S rRNA structure,

1494

(A)

C- -G G- -C U U C- -G A A A C C C A C- -G U- -A C- -G C- -G U- -A C- -G

1555

1494

(B)

C- -G G- -C U U C- -G A A A C C C- -G C- -G U- -A C- -G C- -G U- -A C- -G

1555

Figure 9.5 The decoding region of the human mitochondrial 12S rRNA. (A) Wild type, (B) containing the A1555G mutation. Source: From Ref. 96.

thus promoting aminoglycoside sensitivity (96). Consistent with this model are the findings that the C-to-T mutation at np 1494, which facilitates the equivalent base pairing of the 1494U with the wild-type 1555A, is also associated with aminoglycoside-induced hearing loss (84). The frequency of the A1555G mutation in patients with nonsyndromal deafness varies considerably between different countries, being exceptionally high in Spain, where it has been shown to account for up to 20% to 30% of all cases with familial NSHI (87,97) as opposed to about 1% to 3% in other European populations (2,98,99). However, the general population prevalence has been shown to be surprisingly similar in different European populations (Jacobs et al., unpublished data), suggesting that the high frequency of deafness caused by the A1555G in Spain is likely to be due to high levels of aminoglycoside exposure, either via therapeutic use or via dietary exposure. The typical late onset of the hearing loss in patients in the absence of aminoglycoside exposure prompts the question as to whether the A1555G mutation could account for some proportion of the unexplained ARHI cases. Although none of the ARHI patients in the initial screen was found to carry this mutation, these results may be considered inconclusive because of the relatively small sample number (n  138).

mtDNA and ageing The role of mitochondria in ageing Ageing is a complex multifactorial process, characterised by the progressive decline in physiological capacity and the reduced ability to respond to environmental stresses (100). These timedependent changes lead to increased vulnerability to various age-associated diseases, accompanied by an exponential increase in mortality with age. Although a universal and widely studied process, no unifying theory of ageing exists, owing to the obvious complexity of the phenomenon. At least a dozen different hypotheses have been proposed in the last few decades, however, including both stochastic and developmental genetic theories. Among the proposed mechanisms, the socalled free-radical theory, or its more refined version, the mitochondrial theory of ageing, have perhaps attracted the most attention. According to these hypotheses, ageing is associated with an impairment of bioenergetic function due to the accumulation of mtDNA mutations and the resulting increase in the production of ROS. ROS and oxidative stress ROS are oxygen-derived species that contain an unpaired electron and are therefore highly unstable. These free radicals react readily with other nearby molecules to capture the missing electron and become chemically stable. As a consequence, more free radicals are formed out of the attacked molecules, which subsequently create more free radicals, starting a chain reaction

1181 Chap09

3/29/07

7:16 PM

Page 131

Mitochondrial DNA, hearing impairment, and ageing

and amplifying the effects of the initial attack (100). It has been well established that the major intracellular source of free radicals is the mitochondrial ETC, which has been estimated to generate more than 90% of the intracellular ROS. The nature of the one-electron oxidation–reduction reactions within the mitochondrial ETC makes the electron carriers prone to side reactions with molecular oxygen. Complexes I and III are thought to be the predominant sites of ROS production (101). The high-energy electrons react with O2 to form the superoxide – anion O2 , which is converted to hydrogen peroxide, H2O2 by the manganese superoxide dismutase (MnSOD). H2O2 is usually detoxified by glutathione peroxidase but in the presence of reduced transition metals, it can be converted to the highly reactive hydroxyl radical, OH, by the Fenton reaction. It has been estimated that approximately 0.4% to 4% of all oxygen consumed by the mitochondria is converted to ROS in normal human tissues (102). ROS have the capacity to oxidize cellular macromolecules, causing irreversible damage to the mitochondrial and cellular proteins, lipids, and nucleic acids. Each of the different species of ROS has its own mechanisms of production, detoxification, and reactions with their biological targets, and the exact pathological effects thus vary, depending on the species involved. The free-radical theory of ageing, first proposed by Harman (103), states that ageing is caused by the mitochondrial production of ROS and the resulting accumulation of damage to biological macromolecules, which eventually overwhelms the self-repair capacity of the biological systems, leading to an inevitable functional decline. Ironically, the mitochondria, as well as being the major generators of ROS, also seem to be the direct victims of the deleterious effects of these species. Because mtDNA lies in immediate proximity to the major sites of ROS production and is unprotected by histones, it is considered an especially sensitive target for ROS attack. Compared with nuclear DNA, the level of oxidatively modified bases in mtDNA has been found to be 10- to 20-fold higher (104). The different types of lesions detected in the mtDNA include base modifications, abasic sites, and point mutations, as well as strand breaks and rearrangements. One of the most commonly used markers of oxidative damage of DNA is the content of the oxidised nucleoside, 8-hydroxy2 -deoxyguanosine (8-OHdG), which has been shown to increase in mtDNA of various ageing tissues (105–107). 8-OHdG is premutagenic because it is capable of pairing with both adenine and cytosine with almost equal efficiency and can therefore induce mutations during DNA replication (108). Because all the gene products of the mtDNA are either polypeptides of the ETC or components required for their synthesis, any random mutation in the coding regions of mtDNA is likely to affect the OXPHOS system in one way or another. Accumulation of mutations in the mtDNA can be expected to lead to the synthesis of increasingly dysfunctional mitochondrially encoded subunits that are incorporated into the respiratory chain complexes. The defective or incorrectly assembled complexes are predicted to allow greater interaction between oxygen and redox active electron carriers, increasing the

131

production of ROS. ROS generation can be thought to increase in proportion to the general rate of respiratory chain electron flow in a given cell or tissue, leading to differential accumulation of oxidative stress between tissues and organs, and possibly explaining the differences in their functional decline in human ageing (109). It has also been suggested that since the disturbed synthesis of mitochondrial polypeptides most severely affects the assembly and/or function of those complexes of the ETC with the highest content of mitochondrial subunits, the chain ends up being “disproportionate.” Such partial defects within the chain are predicted to block the electron flow near the site of the defect and increase the half-lives of the upstream redox active components, increasing the level of ROS production above the critical threshold for toxicity (110). ROS are not exclusively detrimental for the cells, however. They also take part in various critical cellular functions, for example, as secondary messengers in signalling pathways regulating differential gene expression, replication, and differentiation, ion transport, calcium mobilisation, and apoptotic program activation (111). Under normal conditions, an array of different antioxidant enzymes takes care of the disposal of ROS. The MnSOD and copper/zinc superoxide dismutases (Cu/ZnSOD) can convert the superoxide anion to less dangerous and diffusible H2O2, which is further converted to H2O by reactions catalysed by glutathione peroxidase and catalase. With the help of some smaller molecular weight antioxidants such as glutathione and vitamins C and E, these enzymes enable the cell to cope with the normal production of ROS. However, complete or partial deficiency of these enzymes has been shown to lead to a rapid accumulation of oxidative damage, induction of apoptosis, and shorter lifespan (112). Oxidative stress can thus be thought to result from any imbalance between the ROS-generating mechanisms and the protective mechanisms, and ageing can be attributed to not only increasing levels of ROS but also decreasing capacity of the intracellular antioxidant and damage-repair systems with advancing age. The “mitochondrial theory of ageing” The extension of the initial free-radical theory (103) has led to the development of several different ageing theories such as the “altered protein theory,” “the waste accumulation theory,” and the “mitochondrial theory.” According to the mitochondrial theory of ageing, mtDNA mutations accumulate progressively during life and are directly responsible for the deficiency in the function of the OXPHOS system. Defects in the respiratory chain are proposed to cause increased production of ROS, which in turn leads to the accumulation of further mtDNA damage (113,114). The ageing process has therefore been suggested to be a self-perpetuating vicious cycle (Fig. 9.6) of exponentially increasing oxidative damage, which eventually leads to a bioenergetic crisis, various age-associated metabolic and physiologic changes, as well as activation of apoptosis and the loss of specific cell types, tissue dysfunction, and an increased susceptibility to disease.

1181 Chap09

132

3/29/07

7:16 PM

Page 132

Genetics and hearing impairment

Figure 9.6 The vicious cycle proposed by the mitochondrial theory of ageing. Abbreviations: mtDNA, mitochondrial DNA; ROS, reactive oxygen species; OXPHOS, oxidative phosphorylation.

There is a substantial amount of indirect evidence supporting various aspects of the mitochondrial theory of ageing, including the proposed role of the increasing burden of mtDNA mutations in ageing and degenerative disease. Both point mutations and rearrangements (deletions and/or duplications) of the mtDNA have been reported to accumulate with age in a variety of tissues in both humans and experimental animals. The occurrence of a specific 4977 bp deletion, previously found among patients with the rare mitochondrial diseases KSS and PEO, has been shown to increase in the postmitotic tissues also during normal ageing (115). Accumulation of certain pathological mtDNA mutations such as those associated with MELAS (116) or MERRF (117) has also been reported in normally ageing individuals, albeit to a very low level and in a highly tissue-specific manner (118). Similarly, specific point mutations in the noncoding region of the mtDNA, such as A189G and T408A in skeletal muscle (119), T414G in fibroblasts (120), or T150C in leukocytes (121) have been reported to accumulate in aged individuals but have also been shown to be restricted to specific tissues. Besides systematic accumulation of specific mutations, the abundance of different types of somatic mtDNA rearrangements (deletions and partial duplications), detected by semiquantitative polymerase chain reaction (PCR) assay, has also been shown to increase with age in the human heart, although a considerable variation in their levels was detected at all ages (122). In addition, sequencing of the D-loop region, and, more recently, also certain coding regions, has revealed an age-dependent increase in the total point-mutation load in mtDNA from mouse liver (123) as well as human brain (124,125) and, based on preliminary results, possibly also heart (Vahvaselkä et al., unpublished results). The reported mutation levels are typically in the range of one to two mutations per 10 kb of sequence and can therefore be estimated to affect only a few percent of the total mtDNA. According to model cell systems, levels of 60% to 80% of mutant mtDNA are required in vitro to observe deleterious biochemical effects (126), and relatively high heteroplasmic levels are also often tolerated by patients with mtDNA mutations without detectable clinical presentation of the disease. Therefore, it seems unlikely that the low levels of mutations detected in the above-mentioned studies could actually result in any

biochemical defect, assuming they were distributed randomly among cells. This assumption is also supported by previous observations from cultured human cells expressing 3 to 5 proofreading-deficient mtDNA polymerase (127). Cells with the “POLG mutator”-accumulated mtDNA mutation loads higher than 5/10 kb after two to three months were yet associated with only a very modest respiratory chain deficiency, indicating that the threshold level for OXPHOS deficiency is considerably higher than the mutation loads generally observed in ageing tissues. The possibility that needs to be considered, however, is that low levels of mutated mtDNA may clonally expand in a small subset of cells due to mitotic segregation or genetic drift in postmitotic cells during ageing. High proportions of clonal mutant mtDNA, presumably expanded from a single initial mutant mtDNA molecule, have been detected in single-cell analysis of tissues as diverse as buccal epithelium and heart muscle (128). Clonal expansion of mtDNA-point mutations or deletions within individual skeletal muscle-cell fibres has been shown to lead to very high levels of specific mtDNA mutations, causing defects in the mitochondrial OXPHOS complex cytochrome-c-oxidase (COX) in single-muscle fibres (129,130). Similar COX-deficient cells have been detected in other aged tissues including the human heart (131) as well as brain tissue of patients with AD (132), indicating high levels of mutant mtDNA in individual cells. Although it is unclear whether such a mosaic pattern of respiratory chain deficiency is able to actually compromise the function of the whole tissue or organ, it has nevertheless been hypothesised that clonal expansion of mutations may be actively involved in ageing and degenerative disease (128), and pathological consequences have been suggested particularly if the affected cells perform an integral role in a complex network, as is often the case in the central nervous system (133). Although a considerable number of studies support the idea that mtDNA mutations accumulate during ageing, it is impossible to conclude from such correlative data alone that this accumulation actually has a causal role in ageing rather than just being an epiphenomenon of the process. The first direct, experimental link between the increased levels of somatic mtDNA mutations, the respiratory chain dysfunction, and the accelerated ageing phenotype was established by creating a homozygous knock-in mouse expressing a proofreading-deficient mitochondrial polymerase POLG (134). These mice developed a three- to fivefold increase in the levels of somatic mtDNA mutations compared with wild-type animals, and the substantial burden of mutations was associated with reduced lifespan and premature onset of many age-related changes such as weight loss, reduced subcutaneous fat, alopecia, kyphosis, osteoporosis, anaemia, reduced fertility, and heart hypertrophy, suggesting a causative link between mtDNA mutations and ageing phenotypes in mammals. Although the mutation loads found in the oldest POLG-mutator mice were of the order of 10 to 15 mutations per 10 kb, their premature ageing was accompanied by only a moderate OXPHOS deficiency, consistent with the previous

1181 Chap09

3/29/07

7:16 PM

Page 133

Mitochondrial DNA, hearing impairment, and ageing

observations in cultured human cells with a similar mutator (127). These results initially suggested that rather than bioenergetic insufficiency alone, the accumulation of mtDNA mutations is likely to promote ageing via some kind of toxic mechanism or via extensive mitotic segregation and genetic drift. The most obvious candidate for a toxic mechanism is the increased production of ROS, as suggested by the mitochondrial theory of ageing. Recent results show, however, that contrary to the vicious cycle theory, which would predict an exponential accumulation of mtDNA mutations, the mtDNA-mutator mice accumulate mtDNA mutations in an approximately linear manner over their lifetime (135). Despite the respiratory chain deficiency, the amount of ROS production was shown to be normal, as were the levels of the studied biomarkers of oxidative stress and the expression levels of antioxidant defence enzymes. Based on these observations, it was proposed that rather than a vicious cycle of increasing oxidative stress and exponential accumulation of mtDNA mutations, the accelerated ageing of the mtDNA mutator mice is after all induced primarily by the respiratory chain dysfunction itself via a variety of possible mechanisms, including a bioenergy deficit in physiologically crucial cells, decreased signal thresholds for apoptosis, or induction of replicative senescence in stem cells.

ARHI Deterioration of hearing ability is one of the inevitable consequences of advancing age. Because of its high prevalence, ARHI is a significant socioeconomic health problem. In Finland, for example, ARHI represents one of the most common age-associated sensorineural defects, estimated to affect one-third of the adults between the ages of 65 and 75 and as much as two-thirds of the Finnish population older than 75 years (136). ARHI, also known as presbyacusis, is a multifactorial process that shows variation in age of onset and progression and can range in severity from mild to substantial. Clinically, the disorder is characterised by a progressive, bilateral high-frequency hearing loss that is demonstrated by a moderately sloping audiogram. The symptoms include reduced hearing sensitivity and speech discrimination, especially in environments with background noise, slowed central processing of acoustic information as well as impaired localisation of sound sources (137). With time, the hearing loss usually extends also to the lower frequencies, further impairing the comprehension of speech and the overall communication abilities of the affected individuals. Despite extensive research attempting to determine the underlying causes of presbyacusis, understanding of the exact pathophysiology still remains incomplete. The process of sound perception follows a complex pathway, and age-related changes in several of its components can contribute to the loss of hearing sensitivity. Most often, the hearing loss can be attributed to degeneration or loss of the sensory cells (inner and outer cochlear hair cells), neural damage of the spiral ganglion, and/or atrophy of the stria vascularis (138), although it is currently not clear to what extent each of these contributes.

133

Clinical classification The aetiology of age-related hearing loss is still not understood. Most current knowledge comes from animal models, epidemiological studies, clinical experience, and human temporal-bone research. According to early studies of Schuknecht et al. (139), presbyacusis can be divided to four main subcategories, based on the histological changes in the cochleae and the corresponding premortem clinical symptoms and auditory test results (140). These classic types of the disorder—sensory, neural, strial, and mechanical—can occur alone or in combination. Sensory presbyacusis is characterised by atrophy of the sensory hair cells and supporting cells in the organ of Corti, originating in the basal turn of the cochlea and progressing toward the apex. The consequence of these changes is an abrupt highfrequency hearing loss, usually beginning after middle age. Neural presbyacusis, on the other hand, refers to the degeneration of the spiral ganglion nerve cells and central neural pathways. Even without noticeable elevation in hearing thresholds, the neural form often leads to a severe decrease in speech discrimination, especially in the presence of background noise. The third category, named strial presbyacusis, involves atrophic changes of the stria vascularis. Because the normal function of these cells is critical to the maintenance of the endocochlear potential as well as the metabolic health of the sensory cells, this form of presbyacusis is also sometimes called metabolic presbyacusis. The loss of threshold sensitivity begins in the high-frequency region but progresses to the lower frequencies as the metabolic function of the strial cells declines. Because the entire cochlea is eventually affected, the hearing loss in strial presbyacusis is typically represented by a flat or slightly descending audiogram. The last form is the mechanical presbyacusis, which is thought to result from changes in the vibrational properties of the basilar membrane, thereby affecting the conductivity of the cochlea. Hearing loss due to mechanical stiffness of the basilar membrane results in a linear, gradually sloping audiogram, with the highest frequencies being the most affected. Regardless of the above division, in the majority cases of ARHI, simultaneous changes occur at multiple sites, making such a classification difficult. In fact, Schuknecht et al. also later added two more categories: mixed and indeterminate, the latter of which they proposed to account for 25% of all cases (139). Heritability of ARHI Heritability studies indicate that ARHI is a complex disorder influenced by both genetic and environmental factors. The relative importance of the genetic component of a disease can be expressed as the fraction of the phenotypic variance that is due to the effect of genes (141). Recent studies on monozygotic and dizygotic twins (142) as well as cohort studies of genetically related and unrelated individuals (143) show a clear familial aggregation, indicating that as much as half of the variance in ARHI may be due to heritable factors.

1181 Chap09

134

3/29/07

7:16 PM

Page 134

Genetics and hearing impairment

Much of the past and current research has focused on finding some of the underlying genetic abnormalities, which may cause, contribute to, or predispose to the development of ARHI. However, unravelling the genetics of complex diseases is far from straightforward. Since the number of causative variants and risk factors and their relative contributions to the phenotype and complex interactions with each other are not known, classic positional cloning strategies are not applicable to complex disorders. As a consequence, very little is known about the genetic component of ARHI. Up to now, almost 130 loci have been reported for monogenic nonsyndromal hearing impairment, and about 50 of these genes have been identified. Conversely, there are only a few candidate loci for late-onset or progressive hearing loss, and no true susceptibility genes have been identified so far (144). Two of the most powerful strategies for searching for genetic determinants of ARHI are association studies and linkage analysis. Association studies search for DNA variants associated with the trait using unrelated samples, based on the assumption that if a certain variant confers increased susceptibility to a complex disease, it should be more frequent among the affected individuals compared to a control group. Linkage studies, on the other hand, attempt to identify the regions harbouring the susceptibility genes by nonparametric linkage analysis on a large collection of small families. In the case of ARHI, collecting families can be difficult due to the late onset of the disorder because samples from higher generations are generally not available. Due to the similarities between the monogenic forms of NSHI and ARHI, the genes causing NSHI comprise a welldefined set of candidate genes to be tested for involvement in ARHI. Possible candidate genes have also been derived from murine models of age-related hearing loss. Inner ear function is similar between mice and humans, which suggests that the pathways to hearing loss may also be shared, and the human orthologs of genes identified to be associated with ARHI in mice are therefore justifiable candidates to be tested in humans. The most interesting of such mouse loci is the Ahl locus in chromosome 10 (145), which has been described to contain several candidate genes for possible predisposition to ARHI. Because of the suspected interplay between genetic and environmental factors, the genetic risk factors of interest also include those that may increase the susceptibility to noise, ototoxicity, or ageing. Environmental risk factors ARHI is often regarded as the consequence of accumulating auditory stresses during life, superimposed upon the natural ageing process. The involvement of environmental factors is implied, for example, by the fact that hearing levels are generally poorer in industrialised than in isolated or agrarian societies (137). Apart from family history, the most commonly studied risk factors of age-related hearing loss include noise-induced damage, otological, and other disorders as well as exposure to ototoxic agents. It is unclear, for the most part, whether these

factors act on specific physiological pathways or just somehow speed up the rate of the normal ageing of the cochlea. Complex interactions between the effects of various factors are likely to affect the overall susceptibility to hearing loss, although the evidence of such interactions remains incomplete. Noise exposure is the most studied environmental factor causing hearing loss. Very high–intensity acoustic overstimulation is known to cause mechanical damage to the cochlea (146), whereas at lower noise levels, the cochlear damage is predominantly metabolic, suggested to be mediated by increased production of free radicals (147), glutamate excitotoxicity (148), impaired mitochondrial function (149), and/or glutathione (GHS) depletion (150). Based on animal models, the primary histopathological sign of noise exposure is loss of the outer hair cells, but with continuous overexposure for a long time, the inner hair cells will also disappear (151). Excitotoxicity may also cause swelling of the afferent nerve endings and disruption of the postsynaptic structures, leading to neuronal death in the spiral ganglion (148). Histological as well as audiometric changes in noise-induced hearing loss are often indistinguishable from those of age-related hearing loss. Certain prescribed drugs, namely aminoglycoside antibiotics, are well known ototoxins and account for approximately 3% to 4% of hearing loss in developing countries and a smaller but still significant number of adults in developed countries (152). The problem has been suggested to be even more pronounced among the elderly, who often use more medication compared to people in other age groups (141). Aminoglycosideinduced ototoxicity is usually dose dependent, and in the elderly, the blood levels of medication may also be more likely to rise above the critical levels due to altered renal or liver functions. Other major classes of drugs known to cause permanent hearing loss are the platinum-based chemotherapeutic agents such as Cisplatin, used in the treatment of cancer. Both these groups of drugs are known to damage the hair cells in a pattern similar to noise-induced damage, causing nonreversible, highfrequency hearing loss. In spite of the differences in the nature of the insult, the hearing loss from ototoxic drugs and noise exposure share a number of similarities in cochlear pathology, and similar mechanisms including increased oxidative stress and glutathione depletion have been suggested to mediate the hair-cell death (150). Aminoglycosides have also been reported to intensify the ototoxic effects of noise exposure and vice versa (141). Another example of the complex interactions between the various genetic and environmental factors contributing to hearing loss is the fact that three mtDNA mutations have been reported to confer an increased susceptibility to aminoglycoside ototoxicity. Cardiovascular disease and its risk factors have been shown to affect hearing to some extent (153). Stroke, myocardial infarction, claudication, hypertension, hyperlipidaemia, and diabetes mellitus have all been previously associated with excessive hearing loss (154–156). In some studies, long-term smoking (157) and excessive alcohol intake (158) have been shown to correlate with hearing loss in the elderly, although the

1181 Chap09

3/29/07

7:16 PM

Page 135

Mitochondrial DNA, hearing impairment, and ageing

effects of smoking still remain controversial. A variety of workplace chemicals are known as potentially ototoxic if exposure exceeds a certain level (159), and there is accumulating evidence that many of these toxins may be able to potentiate the ototoxicity of noise through oxidative stress mechanisms (1). The effects of diet on age-related hearing loss have been extensively studied, and high-lipid diets have been associated with poor hearing (154). Potential benefits of low-calorie diets or consumption of antioxidant agents in preventing auditory ageing have been suggested (160), but the existing evidence remains inconclusive. Prevention and therapy Based on the current knowledge of the risk factors, the most essential preventive strategies include avoidance of hazardous noise exposure and ototoxic agents as well as maintenance of good general health and fitness. Because of the presumed involvement of ROS in several of the mechanisms triggering hearing loss, one suggested strategy to protect the inner ear from ototoxicity would be the administration of antioxidant drugs to scavenge ROS and thereby prevent the activation of cell-death pathways. Downstream prevention of apoptosis with any possible drug-based therapy would in turn require interruption of the already activated cell-death cascades, for which a much more detailed knowledge of these pathways and the key cellular targets is needed. There is no cure currently available for ARHI. Because the hearing loss is irreversible, the existing treatment strategies are mainly focused on functional improvement, i.e., compensating for the disability as much as possible. Hearing aids are usually recommended when the impaired hearing causes a significant disadvantage in the everyday life of the patient. Even though the hearing aids and assistive listening devices cannot restore hearing to normal, they can, in many cases, improve the patient’s ability to communicate. The benefits are, however, very individual. In very severe cases, where hearing aids no longer provide benefit, cochlear implantation may be considered. In order to actually restore hearing, it would have to become possible to successfully replace the lost hair cells and/or spiral ganglion neurons. However, even such strategies would probably turn out to be inefficient, unless the actual cause of the cell death is known and can be treated. Overall, the future development of efficient treatment strategies will clearly require a more detailed knowledge of the molecular mechanisms underlying the cell loss. The proposed role of mtDNA in ARHI One of the key molecular mechanisms suggested to underlie cell loss in ARHI is mitochondrial dysfunction due to mtDNA mutations (68). Mitochondria have several important roles in cells, their primary function being the production of ATP by OXPHOS. Mutations in the mtDNA can affect either components of the OXPHOS system directly or the rRNAs and tRNAs required for their synthesis. Their deleterious effects on

135

cell function can thus be mediated via a variety of different mechanisms, including impaired mitochondrial protein synthesis, accumulation, and defective turnover of abnormal translation products, bioenergy insufficiency, oxidative stress, calcium dyshomeostasis, and activation of apoptotic cell death (41). Inherited mtDNA mutations have been linked to a diverse spectrum of human disorders. In addition, polymorphic variants associated with certain mtDNA haplotypes have been reported to act as predisposing factors to a variety of disorders. A considerable amount of evidence also supports the involvement of mtDNA in sensorineural hearing loss. Mutations in the mtDNA have been identified in both syndromal and nonsyndromal hearing loss as well as in predisposition to aminoglycoside induced to ototoxicity (1), therefore, also comprising an obvious set of candidates for possible involvement in ARHI. Moreover, it has been proposed that somatic mtDNA mutations accumulate during ageing, especially in postmitotic tissues and are responsible for the age-related decline in bioenergetic function and tissue viability. Accumulation of somatically acquired mtDNA mutations has therefore been suggested to play a role in many age-related degenerative processes including cochlear cell degeneration that causes decreased auditory sensitivity in ARHI (161). Does mtDNA mutation accumulation play a role in ARHI? Evidence of increased levels of mtDNA damage has not only been reported in normally ageing individuals but also in various tissues of patients with age-related degenerative diseases. For example, increased levels of mtDNA rearrangements, namely the 4977 bp deletion, have been found in different regions of the brain of patients with AD (162) and Parkinson’s disease (163) compared with age-matched controls. The aggregate burden of mtDNA-point mutations has also been reported to increase in the brain mtDNA of AD patients with age (124). In contrast, other studies have failed to detect any signs of mtDNA-point mutation accumulation in the brains of either normal elderly individuals or patients with age-related neurodegenerative disease (164). ARHI is a common aspect of ageing. Similar to many classical neurodegenerative diseases, functional deficits in ARHI are also associated with irreversible loss of specific cell types, namely the cochlear hair cells, the cells of the stria vascularis, or the spiral ganglion neurons. It has thus been suggested that the accumulation of mtDNA mutations, and the subsequent impairment of mitochondrial function, could also play a role in the age-related degeneration of auditory tissue in ARHI (161). In support of this idea, increased levels of mtDNA mutations (165) as well as the common 4977 bp ageing deletion (166) have been detected in mtDNA from archived human temporal bones of patients with presbyacusis compared with controls, suggesting that at least some proportion of ARHI patients have significant loads of mtDNA mutations in the auditory tissue. However, these findings can hardly be considered conclusive due to the very small number of samples studied.

1181 Chap09

136

3/29/07

7:16 PM

Page 136

Genetics and hearing impairment

The deleterious physiological effects of mtDNA mutations on the acoustic neural system could be thought to result from a general deficiency of OXPHOS or be mediated via other cumulative toxic mechanisms such as excessive generation of ROS. Significantly reduced blood supply in the ageing cochlea has been suggested to lead to ischaemia and increased generation of ROS in the cochlear tissue (160,167). The resulting oxidative stress has been proposed to adversely affect the inner-ear neural structures and contribute to the decline in cellular viability and cochlear function during the ageing process. Based on animal studies, treatment with antioxidant compounds known to either block or scavenge ROS has been suggested to have a protective effect on age-related hearing loss (160). Lastly, and perhaps most interestingly, very recent results from the analysis of the POLG-mutator mice show that, along with all the above-listed consequences of premature ageing, the mice also develop a progressive impairment of hearing with auditory system pathology strikingly similar to that found in humans with ARHI (Aleksandra Trifunovic, personal communication). In these mice, the progressive loss of hearing is accompanied by apoptotic loss of cells of the stria vascularis as well as neurons of the spiral ganglion and the central cochlear nuclei, suggesting that elevation of somatic mtDNA mutation levels does indeed result in progressive degeneration of the auditory system and leads to age-related hearing loss in the mice. The cell loss in the auditory system was observed to progress in an approximately linear fashion, which is congruent with the previously reported linear accumulation of mtDNA mutations and respiratory chain deficiency in these mice (135) but contradicts the idea of the vicious cycle of exponential deterioration of mitochondrial function due to mtDNA mutation accumulation. Despite the recent findings indicating that mitochondrial dysfunction due to increased levels of somatic mtDNA mutations has the capacity to cause pathology closely resembling the physiological and anatomical changes seen in human ARHI, no direct evidence exists so far that mtDNA mutations do actually accumulate in excessive amounts in patients with ARHI.

Acknowledgements Our work is supported by the Academy of Finland, Juselius Foundation, Tampere University Medical Research Fund, and the European Union (GENDEAF QLG1-CT-2001-01429, MitAGE QLK6-CT-2000-00054, MitEURO QLG1-CT-200100966, and EUMITOCOMBAT LSHM-CT-2004-503116 projects). We are very grateful to Marie Lott (Mitomap.org), Vincent Macaulay, Martin Richards, and Anja Rovio for providing pictures and to Ilmari Pyykkö, Anu Wartiovaara, Hans Spebrink, and many other colleagues for stimulating discussions and suggestions.

References 1. Fischel-Ghodsian N, Kopke RD, Ge X. Mitochondrial dysfunction in hearing loss. Mitochondrion 2004; 4:675–694. 2. Jacobs HT, Hutchin TP, Käppi T, et al. Mitochondrial DNA mutations in patients with postlingual, nonsyndromic hearing impairment. EJHG 2005; 13:26–33. 3. Nelson DL, Cox MM. Lehninger Principles of Biochemistry. 3rd ed. New York: Worth Publishers, 2000:659–690. 4. Mitchell M. Coupling of phosphorylation to electron and hydrogen transfer by a chemiosmotic type of mechanism. Nature 1961; 191:144–148. 5. Margulis L. Symbiosis in Cell Evolution. San Fransisco: WH Freeman, 1981. 6. Gray MW, Berger G, Lang BF. Mitochondrial evolution. Science 1999; 283:1476–1481. 7. Gray MW. The endosymbiont hypothesis revisited. Intl Rev Cytol 1992; 141:233–357. 8. Taylor SW, Fahy E, Ghosh SS. Global organellar proteomics. Trends Biotech 2003; 2182–2188. 9. Cavelier L, Johannisson A, Gyllensten U. Analysis of mtDNA copy number and composition of single mitochondrial particles using flow cytometry and PCR. Exp Cell Res 2000; 259:79–85. 10. Anderson S, Bankier AT, Barrell BG, et al. Sequence and organization of the human mitochondrial genome. Nature 1981; 290:357–465. 11. Ojala D, Montoya J, Attardi G. tRNA punctuation model of RNA processing in human mitochondria. Nature 1981; 290:470–474. 12. MITOMAP: A Human Mitochondrial Genome Database. http://www.mitomap.org, 2006—mitomapgenome.pdf. 13. Garrido N, Griparic L, Jokitalo E, et al. Composition and dynamics of human mitochondrial nucleoids. Mol Biol Cell 2003; 14:1483–1496. 14. Jacobs HT, Lehtinen SK, Spelbrink JN. No sex please, we are mitochondria: a hypothesis on the somatic unit of inheritance of mammalian mtDNA. Bioessays 2000; 22:564–572. 15. Clayton DA. Replication of animal mitochondrial DNA. Cell 1982; 28:693–705. 16. Holt IJ, Lorimer HE, Jacobs HT. Coupled leading- and laggingstrand synthesis of mammalian mitochondrial DNA. Cell 2000; 100:515–524. 17. Bowmaker M, Yang MY, Yasukawa T, et al. Mammalian mitochondrial DNA replicates bidirectionally from an initiation zone. J Biol Chem 2003; 278:50961–50969. 18. Ropp PA, Copeland WC. Cloning and characterization of the human mitochondrial DNA polymerase, DNA polymerase . Genomics 1996; 36:449–458. 19. Lim SE, Longley MJ, Copeland WC. The mitochondrial p55 accessory subunit enhances DNA binding, promotes processive DNA synthesis, and confers NEM resistance to human DNA polymerase. J Biol Chem 1999; 274:38197–38203. 20. Tiranti V, Rocchi M, DiDonato S, et al. Cloning of human and rat cDNAs encoding the mitochondrial single-stranded DNAbinding protein (SSB). Gene 1993; 126:219–225.

1181 Chap09

3/29/07

7:16 PM

Page 137

Mitochondrial DNA, hearing impairment, and ageing

21. Parisi MA, Clayton DA. Similarity of human mitochondrial transcription factor 1 to high mobility group proteins. Science 1991; 252:965–969. 22. Parisi MA, Xu B, Clayton DA. A human mitochondrial transcriptional activator can functionally replace a yeast mitochondrial HMG-box protein both in vivo and in vitro. Mol Cell Biol 1993; 13:1951–1961. 23. Spelbrink JN, Li FY, Tiranti V, et al. Human mitochondrial DNA deletions associated with mutations in the gene encoding Twinkle, a phage T7 4-like protein localized in mitochondria. Nat Genet 2001; 28:223–231. 24. Tiranti V, Anna Savoia A, Forti F, et al. Identification of the gene encoding the human mitochondrial RNA polymerase (h-mtRPOL) by cyberscreening of the expressed sequence tags database. Hum Mol Genet 1997; 6:4615–4625. 25. Montoya J, Christianson T, Levens D, et al. Identification of initiation sites for heavy-strand and light-strand transcription in human mitochondrial DNA. Proc Natl Acad Sci USA 1982; 79:7195–7199. 26. Chang DD, Clayton DA. Priming of human mitochondrial DNA replication occurs at the light-strand promoter. Proc Natl Acad Sci USA 1985; 82:351–355. 27. Clayton DA. Transcription and replication of mitochondrial DNA. Hum Reprod 2000; 15:11–17. 28. Giles RE, Blanc H, Cann HM, et al. Maternal inheritance of human mitochondrial DNA. Proc Natl Acad Sci USA 1980; 77:6715–6719. 29. Manfredi G, Thyagarajan D, Papadopoulou LC, et al. The fate of human sperm-derived mtDNA in somatic cells. Am J Hum Genet 1997; 61:953–960. 30. Schwartz M, Vissing J. No evidence for paternal inheritance of mtDNA in patients with sporadic mtDNA mutations. J Neurol Sci 2004; 218:99–101. 31. Wallace DC, Ye JH, Neckelmann SN, et al. Sequence analysis of cDNAs for the human and bovine ATP synthase beta subunit: mitochondrial DNA genes sustain seventeen times more mutations. Curr Genet 1987; 12:81–90. 32. Lightowlers RN, Chinnery PF, Turnbull DM, et al. Mammalian mitochondrial genetics: heredity, heteroplasmy and disease. Trends Genet 1997; 13:450–455. 33. Wallace DC. Mitochondrial DNA sequence variation in human evolution and disease. Proc Natl Acad Sci USA 1994; 91:8739–8746. 34. Marchington DR, Macaulay V, Hartshorne GM, et al. Evidence from human oocytes for a genetic bottleneck in an mtDNA disease. Am J Hum Genet 1998; 63:769–775. 35. Chinnery PF, Taylor GA, Howell N, et al. Mitochondrial DNA haplogroups and susceptibility to AD and dementia with Lewy bodies. Neurol 2000; 55:302–304. 36. Poulton J, Morten KJ, Marchinton D, et al. Duplications of mitochondrial DNA in Kearns-Sayre syndrome. Muscle Nerve 1995; 3:S154–S158. 37. Zeviani M, Bresolin N, Gellera C, et al. Nucleus-driven multiple large-scale deletions of the human mitochondrial genome: a new autosomal dominant disease. Am J Hum Genet 1990; 47:904–914.

137

38. Suomalainen-Wartiovaara A. Multiple mitochondrial DNA deletions and mitochondrial DNA depletion. In: Holt IJ. Genetics of Mitochondrial Disease. Oxford University Press, 2003:165–180. 39. Zeviani M, Tiranti V, Piantadosi C. Mitochondrial disorders. Medicine (Baltimore) 1998; 77:59–72. 40. Inoue K, Nakada K, Ogura A, et al. Generation of mice with mitochondrial dysfunction by introducing mouse mtDNA carrying a deletion into zygotes. Nature Genet 2000; 26:176–181. 41. James AM, Murphy MP. The effects of mitochondrial DNA mutations on cell function. In: Holt IJ. Genetics of Mitochondrial Disease. Oxford University Press, 2003:209–228. 42. Howell N, Kubacka I, Mackey DA. How rapidly does the human mitochondrial genome evolve? Am J Hum Genet 1996; 59:501–509. 43. Chinnery PF, Howell N, Andrews RM, et al. Mitochondrial DNA analysis: polymorphisms and pathogenicity. J Med Genet 1999; 36:505–510. 44. Torroni A, Huoponen K, Francalacci P, et al. Classification of European mtDNAs from an analysis of three European populations. Genetics 1996; 144:1835–1850. 45. Torroni A, Wallace DC. Mitochondrial DNA variation in human populations and implications for detection of mitochondrial DNA mutations of pathological significance. J Bioenerg Biomembr 1994; 26:261–271. 46. MITOMAP: A Human Mitochondrial Genome Database. http://www.mitomap.org, 2006—WorldMigrations.pdf. 47. Macaulay V, Richards M, Hickey E, et al. The emerging tree of West Eurasian mtDNAs: a synthesis of control region sequences and RFLPs. Am J Hum Genet 1999; 64:232–249. 48. Richards M, Macaulay V, Hickey E, et al. Tracing European founder lineages in the Near Eastern mtDNA pool. Am J Hum Genet 2000; 67:1251–1276. 49. Richards M, Macaulay V, Torroni A, et al. In search of geographical patterns in European mitochondrial DNA. Am J Hum Genet 2002; 71:1168–1174. 50. www.stats.gla.ac.uk/~vincent/images/skeleton07-08-02.jpg. 51. Niemi AK, Hervonen A, Hurme M, et al. Mitochondrial DNA polymorphisms associated with longevity in a Finnish population. Hum Genet 2003; 112:29–33. 52. Ruiz-Pesini E, Lapena AC, Diez-Sanchez C, et al. Human mtDNA haplogroups associated with high or reduced spermatozoa motility. Am J Hum Genet 2000; 67:682–696. 53. van der Walt JM, Nicodemus KK, Martin ER, et al. Mitochondrial polymorphisms significantly reduce the risk of Parkinson disease. Am J Hum Genet 2003; 72:804–811. 54. Ross OA, McCormack R, Maxwell LD, et al. mt4216C variant in linkage with the mtDNA TJ cluster may confer a susceptibility to mitochondrial dysfunction resulting in an increased risk of Parkinson’s disease in the Irish. Exp Gerontol 2003; 38:397–405. 55. Kalman B, Li S, Chatterjee D, et al. Large scale screening of the mitochondrial DNA reveals no pathogenic mutations but a haplotype associated with multiple sclerosis in Caucasians. Acta Neurol Scand 1999; 99:16–25.

1181 Chap09

138

3/29/07

7:16 PM

Page 138

Genetics and hearing impairment

56. Chagnon P, Gee M, Filion M, et al. Phylogenetic analysis of the mitochondrial genome indicates significant differences between patients with Alzheimer disease and controls in a French-Canadian founder population. Am J Med Genet 1999; 85:20–30. 57. Carrieri G, Bonafe M, De Luca M, et al. Mitochondrial DNA haplogroups and APOE4 allele are non-independent variables in sporadic Alzheimer’s disease. Hum Genet 2001; 108:194–198. 58. Majamaa K, Finnila S, Turkka J, et al. Mitochondrial DNA haplogroup U as a risk factor for occipital stroke in migraine. Lancet 1998; 352:455–456. 59. De Benedictis G, Rose G, Carrieri G, et al. Mitochondrial DNA inherited variants are associated with successful aging and longevity in humans. FASEB J 1999; 13:1532–1536. 60. Ross OA, McCormack R, Curran MD, et al. Mitochondrial DNA polymorphism: its role in longevity of the Irish population. Exp Gerontol 2001; 36:1161–1178. 61. Dato S, Passarino G, Rose G, et al. Association of the mitochondrial DNA haplogroup J with longevity is population specific. Eur J Hum Genet 2004; 12:1080–1082. 62. Brown MD, Sun F, Wallace DC. Clustering of Caucasian Leber hereditary optic neuropathy patients containing the 11778 or 14484 mutations on an mtDNA lineage. Am J Hum Genet 1997; 60:381–387. 63. Torroni A, Petrozzi M, D’Urbano L, et al. Haplotype and phylogenetic analyses suggest that one European-specific mtDNA background plays a role in the expression of Leber hereditary optic neuropathy by increasing the penetrance of the primary mutations 11778 and 14484. Am J Hum Genet 1997; 60:1107–1121. 64. Howell N, Herrnstadt C, Shults C, et al. Low penetrance of the 14484 LHON mutation when it arises in a non-haplogroup J mtDNA background. Am J Med Genet 2003; 119:147–151. 65. Crimi M, Del Bo R, Galbiati S, et al. Mitochondrial A12308G polymorphism affects clinical features in patients with single mtDNA macrodeletion. Eur J Hum Genet 2003; 11:896–898. 66. Hofmann S, Jaksch M, Bezold R, et al. Population genetics and disease susceptibility: characterization of central European haplogroups by mtDNA gene mutations, correlation with D loop variants and association with disease. Hum Mol Genet 1997; 6:1835–1846. 67. Torroni A, Campos Y, Rengo C, et al. Mitochondrial DNA haplogroups do not play a role in the variable phenotypic presentation of the A3243G mutation. Am J Hum Genet 2003; 72:1005–1012. 68. Seidman MD, Ahmad N, Bai U. Molecular mechanisms of agerelated hearing loss. Ageing Res Rev 2002; 1:331–343. 69. van den Ouweland JM, Lemkes HH, Trembath RC, et al. Maternally inherited diabetes and deafness is a distinct subtype of diabetes and associates with a single point mutation in the mitochondrial tRNA(Leu(UUR)) gene. Diabetes 1994; 43:746–751. 70. Goto Y, Nonaka I, Horai S. A mutation in the tRNA(Leu)(UUR) gene associated with the MELAS subgroup of mitochondrial encephalomyopathies. Nature 1990; 348:651–653. 71. Jacobs HT. Mitochondrial deafness. Ann Med 1997; 29:483–491. 72. Prezant TR, Agapian JV, Bohlman MC, et al. Mitochondrial ribosomal RNA mutation associated with both antibiotic-induced and non-syndromic deafness. Nat Genet 1993; 4:289–294.

73. Reid FM, Vernham GA, Jacobs HT. A novel mitochondrial point mutation in a maternal pedigree with sensorineural deafness. Hum Mutat 1994; 3:243–247. 74. Fischel-Ghodsian N, Prezant TR, Fournier P, et al. Mitochondrial mutation associated with nonsyndromic deafness. Am J Otolaryngol 1995; 16:403–408. 75. Tiranti V, Chariot P, Carella F, et al. Maternally inherited hearing loss, ataxia and myoclonus associated with a novel point mutation in mitochondrial tRNASer(UCN) gene. Hum Mol Genet 1995; 4:1421–1427. 76. Verhoeven K, Ensink RJ, Tiranti V, et al. Hearing impairment and neurological dysfunction associated with a mutation in the mitochondrial tRNASer(UCN) gene. Eur J Hum Genet 1999; 7:45–51. 77. van den Ouweland JM, Lemkes HH, Ruitenbeek W, et al. Mutation in mitochondrial tRNA(Leu)(UUR) gene in a large pedigree with maternally transmitted type II diabetes mellitus and deafness. Nat Genet 1992; 1:368–371. 78. Majamaa K, Moilanen JS, Uimonen S, et al. Epidemiology of A3243G, the mutation for mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes: prevalence of the mutation in an adult population. Am J Hum Genet 1998; 63:447–454. 79. Hutchin TP, Parker MJ, Young ID, et al. A novel mutation in the mitochondrial tRNA(Ser(UCN)) gene in a family with non-syndromic sensorineural hearing impairment. J Med Genet 2000; 37:692–694. 80. del Castillo FJ, Villamar M, Moreno-Pelayo MA, et al. Maternally inherited non-syndromal hearing impairment in a Spanish family with the 7510T  C mutation in the mitochondrial tRNA(Ser(UCN)) gene. J Med Genet 2002; 39:e82. 81. Sue CM, Tanji K, Hadjigeorgiou G, et al. Maternally inherited hearing loss in a large kindred with a novel T7511C mutation in the mitochondrial DNA tRNA(Ser(UCN)) gene. Neurol 1999; 52:1905–1908. 82. Chapiro E, Feldmann D, Denoyelle F, et al. Two large French pedigrees with nonsyndromic sensorineural deafness and the mitochondrial DNA T7511C mutation: evidence for a modulatory factor. Eur J Hum Genet 2002; 10:851–856. 83. Jaksch M, Klopstock T, Kurlemann G, et al. Progressive myoclonus epilepsy and mitochondrial myopathy associated with mutations in the tRNA(Ser(UCN)) gene. Ann Neurol 1998; 44:635–640. 84. Zhao H, Li R, Wang Q, et al. Maternally inherited aminoglycoside-induced and nonsyndromic deafness is associated with the novel C1494T mutation in the mitochondrial 12S rRNA gene in a large Chinese family. Am J Hum Genet 2004; 74:139–152. 85. Reid FM, Rovio A, Holt IJ, et al. Molecular phenotype of a human lymphoblastoid cell-line homoplasmic for the np 7445 deafnessassociated mitochondrial mutation. Hum Mol Genet 1997; 6:443–449. 86. Toompuu M, Yasukawa T, Suzuki T, et al. The 7472insC mitochondrial DNA mutation impairs the synthesis and extent of aminoacylation of tRNASer(UCN) but not its structure or rate of turnover. J Biol Chem 2002; 277:22240–22250. 87. Estivill X, Govea N, Barcelo E, et al. Familial progressive sensorineural deafness is mainly due to the mtDNA A1555G mutation and is enhanced by treatment of aminoglycosides. Am J Hum Genet 1998; 62:27–35.

1181 Chap09

3/29/07

7:16 PM

Page 139

Mitochondrial DNA, hearing impairment, and ageing

88. Bu X, Shohat M, Jaber L, et al. A form of sensorineural deafness is determined by a mitochondrial and an autosomal locus: evidence from pedigree segregation analysis. Genet Epidemiol 1993; 10:3–15. 89. Guan MX, Fischel-Ghodsian N, Attardi G. Biochemical evidence for nuclear gene involvement in phenotype of non-syndromic deafness associated with mitochondrial 12S rRNA mutation. Hum Mol Genet 1996; 5:963–971. 90. Bykhovskaya Y, Yang H, Taylor K, et al. Modifier locus for mitochondrial DNA disease: linkage and linkage disequilibrium mapping of a nuclear modifier gene for maternally inherited deafness. Genet Med 2001; 3:177–180. 91. Yamasoba T, Goto Y, Oka Y, et al. Atypical muscle pathology and a survey of cis-mutations in deaf patients harboring a 1555 A-to-G point mutation in the mitochondrial ribosomal RNA gene. NMD 2002; 12:506–512. 92. Fischel-Ghodsian N, Prezant TR. Mitochondrial ribosomal RNA analysis in patients with sporadic aminoglycoside ototoxicity. Am J Hum Genet 1993; 53:1158. 93. Suzuki T, Terasaki M, Takemoto-Hori C, et al. Structural compensation for the deficit of rRNA with proteins in the mammalian mitochondrial ribosome. Systematic analysis of protein components of the large ribosomal subunit from mammalian mitochondria. J Biol Chem 2001; 276:21724–21736. 94. Scheffler IE. Evolutionary origin of mitochondria. In: Mitochondria. San Diego: University of California, Wiley-Liss, Inc. 1999:7–13. 95. Hamasaki K, Rando RR. Specific binding of aminoglycosides to a human rRNA construct based on a DNA polymorphism which causes aminoglycoside-induced deafness. Biochemistry 1997; 36:12323–12328. 96. Guan MX, Fischel-Ghodsian N, Attardi G. A biochemical basis for the inherited susceptibility to aminoglycoside ototoxicity. Hum Mol Genet 2000; 9:1787–1793. 97. Gallo-Teran J, Morales-Angulo C, del Castillo I, et al. Familial susceptibility to aminoglycoside ototoxicity due to the A1555G mutation in the mitochondrial DNA. Med Clin (Barc) 2003; 121:216–218. [Article in Spanish] 98. Ostergaard E, Montserrat-Sentis B, Gronskov K, et al. The A1555G mtDNA mutation in Danish hearing-impaired patients: frequency and clinical signs. Clin Genet 2002; 62:303–305. 99. Tekin M, Duman T, Bogoclu G, et al. Frequency of mtDNA A1555G and A7445G mutations among children with prelingual deafness in Turkey. Eur J Pediatr 2003; 162:154–158. 100. Troen BR. The biology of aging. Mt Sinai J Med 2003; 70:3–22. 101. Balaban RS, Nemoto S, Finkel T. Mitochondria, oxidants, and aging. Cell 2005; 120:483–495. 102. Golden TR, Melov S. Mitochondrial DNA mutations, oxidative stress, and aging. Mech Ageing Dev 2001; 122:1577–1589. 103. Harman D. Aging: a theory based on free radical and radiation chemistry. J Gerontol 1956; 11:298–300. 104. Richter C, Park JW, Ames BN. Normal oxidative damage to mitochondrial and nuclear DNA is extensive. Proc Natl Acad Sci USA 1988; 85:6465–6467.

139

105. Hayakawa M, Torii K, Sugiyama S, et al. Age-associated accumulation of 8-hydroxydeoxyguanosine in mitochondrial DNA of human diaphragm. Biochem Biophys Res Comm 1991; 179:1023–1029. 106. Hayakawa M, Hattori K, Sugiyama S, et al. Age-associated oxygen damage and mutations in mitochondrial DNA in human hearts. Biochem Biophys Res Comm 1992; 189:979–985. 107. Mecocci P, MacGarvey U, Kaufman AE, et al. Oxidative damage to mitochondrial DNA shows marked age-dependent increases in human brain. Ann Neurol 1993; 34:609–616. 108. Cheng KC, Cahill DS, Kasai H, et al. 8-Hydroxyguanine, an abundant form of oxidative DNA damage, causes G—T and A—C substitutions. J Biol Chem 1992; 267:166–172. 109. Wei YH. Oxidative stress and mitochondrial DNA mutations in human aging. Proc Soc Exp Biol Med 1998; 217:53–63. 110. Szibor M, Holtz J. Mitochondrial ageing. Basic Res Cardiol 2003; 98:210–218. 111. Finkel T. Oxidant signals and oxidative stress. Curr Opin Cell Biol 2003; 15:247–254. 112. Melov S, Schneider JA, Day BJ, et al. A novel neurological phenotype in mice lacking mitochondrial manganese superoxide dismutase. Nat Genet 1998; 18:159–163. 113. Harman D. The biologic clock: the mitochondria? J Am Geriatr Soc 1972; 20:145–147. 114. Linnane AW, Marzuki S, Ozawa T, et al. Mitochondrial DNA mutations as an important contributor to ageing and degenerative diseases. Lancet 1989; I(8639):642–645. 115. Cortopassi GA, Shibata D, Soong NW, et al. A pattern of accumulation of a somatic deletion of mitochondrial DNA in aging human tissues. Proc Natl Acad Sci USA 1992; 89:7370–7374. 116. Liu VW, Zhang C, Linnane AW, et al. Quantitative allele-specific PCR: demonstration of age-associated accumulation in human tissues of the A  G mutation at nucleotide 3243 in mitochondrial DNA. Hum Mutat 1997; 9:265–271. 117. Muenscher C, Rieger T, Mueller-Hoecker J, et al. The point mutation of mitochondrial DNA characteristic for MERRF disease is found also in healthy people of different ages. FEBS Lett 1993; 317:27–30. 118. Murdock DG, Christacos NC, Wallace DC. The age-related accumulation of a mitochondrial DNA control region mutation in muscle, but not brain, detected by a sensitive PNA-directed PCR clamping based method. Nucl Acids Res 2000; 28:4350–4355. 119. Wang Y, Michikawa Y, Mallidis C, et al. Muscle-specific mutations accumulate with aging in critical human mtDNA control sites for replication. Proc Natl Acad Sci USA 2001; 98:4022–4027. 120. Michikawa Y, Mazzucchelli F, Bresolin N, et al. Aging-dependent large accumulation of point mutations in the human mtDNA control region for replication. Science 1999; 286:774–779. 121. Zhang J, Asin-Cayuela J, Fish J, et al. Strikingly higher frequency in centenarians and twins of mtDNA mutation causing remodeling of replication origin in leukocytes. Proc Natl Acad Sci USA 2003; 100:1116–1121.

1181 Chap09

140

3/29/07

7:16 PM

Page 140

Genetics and hearing impairment

122. Kajander OA, Karhunen PJ, Jacobs HT. The relationship between somatic mtDNA rearrangements, human heart disease and aging. Hum Mol Genet 2002; 11:317–324. 123. Khaidakov M, Heflich RH, Manjanatha MG, et al. Accumulation of point mutations in mitochondrial DNA of aging mice. Mutat Res 2003; 526:1–7. 124. Lin MT, Simon DK, Ahn CH, et al. High aggregate burden of somatic mtDNA point mutations in aging and Alzheimer’s disease brain. Hum Mol Genet 2002; 11:133–145. 125. Simon DK, Lin MT, Zheng L, et al. Somatic mitochondrial DNA mutations in cortex and substantia nigra in aging and Parkinson’s disease. Neurobiol Aging 2004; 25:71–81. 126. Hayashi J, Ohta S, Kikuchi A, et al. Introduction of diseaserelated mitochondrial DNA deletions into HeLa cells lacking mitochondrial DNA results in mitochondrial dysfunction. Proc Natl Acad Sci USA 1991; 88:10614–10618. 127. Spelbrink JN, Toivonen JM, Hakkaart GA, et al. In vivo functional analysis of the human mitochondrial DNA polymerase POLG expressed in cultured human cells. J Biol Chem 2000; 275:24818–24828. 128. Nekhaeva E, Bodyak ND, Kraytsberg Y, et al. Clonally expanded mtDNA point mutations are abundant in individual cells of human tissues. Proc Natl Acad Sci USA 2002; 99:5521–5526. 129. Brierley EJ, Johnson MA, Lightowlers RN, et al. Role of mitochondrial DNA mutations in human aging: implications for the central nervous system and muscle. Ann Neurol 1998; 43:217–223. 130. Fayet G, Jansson M, Sternberg D, et al. Ageing muscle: clonal expansions of mitochondrial DNA point mutations and deletions cause focal impairment of mitochondrial function. NMD 2002; 12:484–493. 131. Muller-Hocker J. Cytochrome-c-oxidase deficient cardiomyocytes in the human heart - an age-related phenomenon. A histochemical ultracytochemical study. Am J Pathol 1989; 134:1167–1173. 132. Cottrell DA, Blakely EL, Johnson MA, et al. Mitochondrial enzyme-deficient hippocampal neurons and choroidal cells in AD. Neurol 2001; 57:260–264. 133. Elson JL, Samuels DC, Turnbull DM, et al. Random intracellular drift explains the clonal expansion of mitochondrial DNA mutations with age. Am J Hum Genet 2001; 68:802–806. 134. Trifunovic A, Wredenberg A, Falkenberg M, et al. Premature ageing in mice expressing defective mitochondrial DNA polymerase. Nature 2004; 429:417–423. 135. Trifunovic A, Hansson A, Wredenberg A, et al. Somatic mtDNA mutations cause aging phenotypes without affecting reactive oxygen species production. Proc Natl Acad Sci USA 2005; 102:17993–17998. 136. www.kuulonhuoltoliitto.fi. 137. Gates GA, Mills JH. Presbycusis. Lancet 2005; 366:1111–1120. 138. Spicer SS, Schulte BA. Pathologic changes of presbycusis begin in secondary processes and spread to primary processes of strial marginal cells. Hear Res 2005; 205:225–240. 139. Schuknecht HF, Gacek MR. Cochlear pathology in presbycusis. Ann Otol Rhinol Laryngol 1993; 102:1–16.

140. Schuknecht HF. Presbycusis. Laryngoscope 1955; 65:402–419. 141. Fransen E, Lemkens N, Van Laer L, et al. Age-related hearing impairment (ARHI): environmental risk factors and genetic prospects. Exp Gerontol 2003; 38:353–359. 142. Karlsson KK, Harris JR, Svartengren M. Description and primary results from audiometric study of male twins. Ear Hear 1997; 18:114–120. 143. Gates GA, Couropmitree NN, Myers RH. Genetic associations in age-related hearing thresholds. Arch Otolaryngol Head Neck Surg 1999; 125:654–659. 144. Hereditary Hearing-loss Homepage http://webhost.ua.ac.be/hhh/. 145. Johnson KR, Zheng QY, Erway LC. A major gene affecting agerelated hearing loss is common to at least ten inbred strains of mice. Genomics 2000; 70:171–180. 146. Mulroy MJ, Henry WR, McNeil PL. Noise-induced transient microlesions in the cell membranes of auditory hair cells. Hearing Res 1998; 115:93–100. 147. Yamasoba T, Nuttall AL, Harris C, et al. Role of glutathione in protection against noise-induced hearing loss. Brain Res 1998; 784:82–90. 148. Pujol R, Puel JL. Excitotoxicity, synaptic repair, functional recovery in mammalian cochlea: a review of recent findings. Ann N Y Acad Sci 1999; 884:249–254. 149. Hyde GE, Rubel EW. Mitochondrial role in hair cell survival after injury. Otolaryngol Head Neck Surg 1995; 113:530–540. 150. Henderson D, Hu B, McFadden S, et al. Evidence of a common pathway in noise-induced hearing loss and carboplatin ototoxicity. Noise Health 1999; 2:53–70. 151. Emmerich E, Richter F, Reinhold U, et al. Effects of industrial noise exposure on distortion product otoacoustic emissions (DPOAEs) and hair cell loss of the cochlea: long term experiments in awake guinea pigs. Hearing Res 2000; 148:9–17. 152. Rybak LP, Whitworth CA. Ototoxicity: therapeutic opportunities. Drug Discov Today 2005; 10:1313–1321. 153. Torre P III, Cryickshanks KJ, Klein BE, et al. The association between cardiovascular disease and cochlear function in older adults. J Speech Lang Hear Res 2005; 48:473–481. 154. Gates GA, Cobb JL, D’Agostino RB, et al. The relation of hearing in the elderly to the presence of cardiovascular disease and cardiovascular risk factors. Arch Otolaryngol Head Neck Surg 1993; 119:156–161. 155. Brant LJ, Gordon-Salant S, Pearson JD, et al. Risk factors related to age-associated hearing loss in the speech frequencies. J Am Acad Audiol 1996; 7:152–160. 156. Kurien M, Thomas K, Bhanu TS. Hearing threshold in patients with diabetes mellitus. J Laryngol Otol 1989; 103:164–168. 157. Mellström D, Rundgren A, Jagenburg R, et al. Tobacco smoking, ageing and health among the elderly: a longitudinal population study of 70-year-old men and an age cohort comparison. Age Ageing 1982; 11:45–58. 158. Rosenhall U, Sixt E, Sundh V, et al. Correlations between presbyacusis and extrinsic noxious factors. Audiology 1993; 32:234–243. 159. Rybak LP. Hearing: the effects of chemicals. Otolaryngol Head Neck Surg 1992; 106:677–686.

1181 Chap09

3/29/07

7:16 PM

Page 141

Mitochondrial DNA, hearing impairment, and ageing

160. Seidman MD. Effects of dietary restriction and antioxidants on presbyacusis. Laryngoscope 2000; 110:727–738. 161. Seidman MD, Ahmad N, Joshi D, et al. Age-related hearing loss and its association with reactive oxygen species and mitochondrial DNA damage. Acta Otolaryngol Suppl 2004; 552:16–24. 162. Corral-Debrinski M, Horton T, Lott MT, et al. Marked changes in mitochondrial DNA deletion levels in Alzheimer brains. Genomics 1994; 23:471–476. 163. Ikebe S, Tanaka M, Ohno K, et al. Increase of deleted mitochondrial DNA in the striatum in Parkinson’s disease and senescence. Biochem Biophys Res Comm 1990; 170:1044–1048.

141

164. Chinnery PF, Taylor GA, Howell N, et al. Point mutations of the mtDNA control region in normal and neurodegenerative human brains. Am J Hum Genet 2001; 68:529–532. 165. Fischel-Ghodsian N, Bykhovskaya Y, Taylor K, et al. Temporal bone analysis of patients with presbycusis reveals high frequency of mitochondrial mutations. Hearing Res 1997; 110:147–154. 166. Han W, Han D, Jiang S. Mitochondrial DNA4977 deletions associated with human presbycusis. Zhonghua Er Bi Yan Hou Ke Za Zhi 2000; 35:416–419. [Article in Chinese]. 167. Seidman MD, Khan MJ, Dolan DF, et al. Age-related differences in cochlear microcirculation and auditory brain stem response. Arch Otolaryngol Head Neck Surg 1996; 122:1221–1226.

1181 Chap09

3/29/07

7:16 PM

Page 142

1181 Chap10

3/29/07

6:15 PM

Page 143

Part II Current management

1181 Chap10

3/29/07

6:15 PM

Page 144

1181 Chap10

3/29/07

6:15 PM

Page 145

10 Psychosocial aspects of genetic hearing impairment Dafydd Stephens

Introduction There is an extensive literature on the psychosocial impact of hearing impairment and much of this literature has been recently reviewed (1). The present chapter will address those elements of such a psychosocial impact due to genetic disorders, which may be superimposed on such general effects of the hearing impairment per se. Over the years, genetic hearing impairment has been found to account for a larger and larger proportion of individuals with hearing difficulties, now widely regarded as being responsible for at least 50% of permanent hearing loss both in young children and in elderly people (2,3). In certain isolated communities, a particular genetic cause of prelingual hearing impairment may achieve a high prevalence and result in a different set of attitudes towards deafness in that society. This mirrors, in some ways, the attitudes towards people with acquired hearing impairment in certain communities with a long history of employment in a particularly noisy industry, such as the jute weavers of Dundee (4). Probably the best known example of a high prevalence of congenital deafness affecting societal attitudes was the case of Martha’s Vineyard, an island off the coast of Massachusetts, vividly described by Norma Groce in her book “Everyone here spoke sign language” (5). The population, in that case, had a high prevalence of a nonsyndromal recessive condition, which appeared to have originated in Southeast England. The high prevalence of the condition resulted in “deafness” being regarded as a normal state and the hearing population using sign language to communicate with their deaf family and neighbours in a natural way. Such communities have been found elsewhere in the world (6), and one of the most interesting examples is found in the northern part of the island of Bali. Here there is a village called Bengkala where some 2% to 3% of the population has congenital deafness caused by DFNB3, a recessive mutation involving the Myosin 15A gene (7,8). The social interactions within this

community, where both the deaf and hearing people communicate using sign language, with the deaf people well adjusted and integrated within the community have been described (9). However, even within this community, the great majority of deaf children receive no formal education. Elsewhere, in the general population, there have been a number of anecdotal reports of people denying genetic factors as a cause of hearing loss in their children, of being unaware of such hearing loss in their parents and siblings, and attributing it merely to age, noise, or other factors. Thus parents of a deaf child with a clearly dominant family history may insist that the child was deafened as a result of a pertussis infection. Eightyyear-old patients have reported that their parents’ hearing loss was due to “old age” even though it began at the age of 60 and their own hearing loss dated back to such an age or younger. There has been little attempt to explore any effects of genetic or familial hearing loss in a systematic way, and the present chapter sets out to do that under the aegis of Working Party 6 of the European Union GENDEAF project within the fifth framework. The present author is particularly indebted to the contributions in this respect of Sylviane Chéry-Croze, Lionel Collet, Berth Danermark, Lesley Jones, Sophia Kramer, Kerstin Möller, Wanda Neary, and Hung Thai Van. An additional group member, who contributed widely to the discussions, was Anna Middleton, author of the next chapter in the present book. The aim of the working group was to provide an interface between the molecular and clinical geneticists and those people facing the real world problems caused by genetic disorders affecting the auditory system. This chapter deals fairly briefly with hearing disorders in children, an area in which it was difficult to obtain participants in either qualitative or quantitative studies. Hearing disorders affecting working age and older adults are studied using both epidemiological approaches and clinic-based studies, and this provides the main focus for the chapter. The first studies in this respect are based on secondary analyses of epidemiological investigations. These are followed by a qualitative analysis of

1181 Chap10

146

3/29/07

6:15 PM

Page 146

Current management

people’s perception of the impact of their family history on themselves. That, in turn, leads to investigations of such an impact on activity limitations and participation restrictions, motivation for seeking rehabilitative help, and on rehabilitative outcomes. This is followed by a consideration of the influence of a family history on the impact of tinnitus and finally by two specific genetic disorders. These are otosclerosis, one of the few causes of genetic hearing impairment amenable to surgical intervention, and neurofibromatosis 2 (NF2) in which premature death may occur and which generally presents with a hearing loss. The background to this work has been presented in some detail in the literature review produced by the working party (1) and details of most of the experimental studies presented here will be found in the second publication (10). Overall, in nonsyndromal hearing impairment, it would seem that a family history with role models available is what has had the greatest effect on people affected themselves, rather than the genetic hearing loss per se. The total impact of that from a psychosocial standpoint is also relatively modest compared with other factors such as the severity of the impairment and the age of its onset.

Family history influences in children These studies date back to the 1940s, but two important investigations were conducted in the 1970s in the United States (11) and in the United Kingdom (12). These, together with a number of related investigations, have been discussed in some detail elsewhere (13), but may be summarised as indicating that it is the fact of having deaf parents, which is important, rather than having a specific genetic disorder. Thus, it was found that, among a group of children with genetic disorders, the children of deaf parents who signed to them performed better on a number of educational parameters in the Stanford Achievement test than did those without deaf parents (11). Deaf school leavers from throughout the United Kingdom were subdivided into those with a family history and deaf parents, those with a family history and no deaf parents (FHHP), those with an acquired cause, and those whose aetiology was unknown (12). No significant difference between the four groups in terms of the youngsters’ speech intelligibility was found, but those with deaf parents performed significantly better than the other three groups in terms of their reading age and in a speech comprehension ratio of lipreading. In these last two measures, the FHHP group did not differ in performance from those with acquired or unknown aetiologies. Interestingly, in a 20-year follow-up of these young people, it was found that those with an acquired or unknown cause for their hearing impairment were twice as likely to have had psychiatric problems than those with a genetic cause (14). These findings are compatible with other results in the general literature, which indicate that deaf children of deaf parents

are likely to be better adjusted (15,16), to have a more positive coping framework (17) and less likely to have psychiatric problems (18). It has been strongly argued that many such differences may be attributable to early and effective mother–child communication, leading to the development of a more stable individual (19). Most of these studies have involved relatively small numbers of subjects, not necessarily controlled for a number of confounding variables. Recently a large-scale study on children with hearing impairments has been conducted in the United Kingdom in which an attempt has been made to control for a range of variables such as hearing level, age of onset of hearing impairment, previous rehabilitative intervention as well as the social class and ethnicity of the parents (20). The results for 338 children whose parents had some hearing difficulties were compared with those of 2519 children whose parents had no such difficulties. After controlling for gender, age, ethnicity, average unaided hearing level, age of onset of hearing impairment, additional hearing disabilities, parental occupation, and cochlear implantation, they examined any effect of family history. The findings of that study are shown in Table 10.1. This indicates that, while the auditory receptive communication of those children with hearing-impaired parents was poorer, their sign language skills were better. It also supports the earlier findings of better academic achievement in those children

Table 10.1 Significant findings from main study on UK children (20) in which children with hearing-impaired parents differed from those with hearing parents Communicative skills

— a

Auditory receptive capabilities a,b

Use of BSL

More likely a,b

Understanding of BSL

Better

a,b

Use of SSE

More likely a,b

Understanding of SSE

Better

Academic achievements

—

a

Academic abilities

Higher a

Key stage attainments

Higher

Participation and engagement a in education

Better

Quality of life Positive feelings about life Need for help with social activities, e.g., shopping b and inviting friends a

Poorer

— b

Less Less need

Teacher ratings. Parent ratings. Abbreviations: BSL, British sign language; SSE, signed supported English.

b

1181 Chap10

3/29/07

6:15 PM

Page 147

Psychosocial aspects of genetic hearing impairment

with hearing-impaired parents. Finally, in reported quality of life, those children with hearing-impaired parents felt less positive about their lives, but were more independent. Unfortunately that study considered neither the severity of the parental hearing impairment nor the impact of hearing impairment in siblings, and further analyses were subsequently performed (21). Here children were divided into five groups: Those with one or more parents “totally deaf ”; Those with one or both parents with “some hearing difficulties”; Those with one or more siblings totally deaf, but hearing parents; Those with one or more siblings with some hearing difficulties, but hearing parents; Those with neither parents nor siblings with hearing problems. The first four groups were each compared with group 5 after controlling for the demographic and other variables considered in the earlier analysis. The results for those children with one or both totally deaf parents are the clearest and account for most of the differences found in Table 10.2. They are also generally in line with the published literature and the broader results of this study (Table 10.1).

Table 10.2 Significant findings from further analyses (21) in which children with one or both “totally deaf ” parents differed from those with hearing parents Communicative skills b

Auditory receptive capabilities a,b

Use of BSL

Poorer More likely

Production of BSL

a

Better a

Understanding of BSL

Better

a,b

Use of SSE

More likely

Production of SSE

a

Better a

Understanding of SSE

Better

Academic achievements b

Academic abilities

Higher

a

Reading age

Engagement in education

Older a

Better

Quality of life Need for help with social activities, e.g., shopping b and inviting friends a

Less need

Teacher ratings, Parent ratings. Abbreviations: BSL, British sign language; SSE, signed supported English.

b

147

It may be noted, however, that this group of children do not have the negative feelings about life indicated in the broader study. The results for the other three subject groups are less clear, although three findings were significant at the (P ⬍ 0.01) level. These indicate that children with one or both parents with “hearing difficulties” have less positive feeling about their lives. Those with one or more siblings with “total deafness” were reported by their parents to have poorer intelligibility of their British sign language (BSL). Those children with one or more siblings with hearing difficulties were reported by their teachers as achieving better key stage results in their education. The factors responsible for such results are not immediately clear and certainly more research is needed in this field.

Effects of a family history of hearing problems in adults in the community The results to be considered here are derived from secondary analyses of two large-scale surveys, the UK Medical Research Council’s survey of Ear, Nose and Throat problems (MRC-ENT) conducted in 1998 in Wales, Scotland, and England (22,23) and the Australian Blue Mountain Survey conducted in New South Wales between 1997 and 2000 (24). The MRC-ENT study was a household survey administered to 22,000 households and provided data on some 34,000 individuals aged 14 years and older. The Blue Mountain survey combined audiometry and questionnaires and was administered to 2956 participants aged 49 years and older. Apart from the age and methodological difference between the two surveys, the key question on family history differed markedly between the two, one of the likely consequences of any studies based on secondary analyses. The relevant question in MRC-ENT was “Did any of your parents, children, brothers or sisters have great difficulty in hearing before the age of 55 years?” That used in the Blue Mountain Survey was “Do (or did) any of your close relatives have a hearing loss?” It is evident that the latter question was more all-encompassing, and this is reflected in the fact that while 11% of the respondents to the MRC-ENT survey answered affirmatively (9.8% of those aged over 60 years), 38% of those in the Blue Mountain survey indicated a family history in response to that question. Audiometric measures were performed only in the Blue Mountain survey. These indicated that, after controlling for age and sex, those with a parental family history of hearing loss had significantly worse hearing than those without (Fig. 10.1), with a lesser difference found for those with hearing-impaired siblings but hearing parents. This was true for both their better ear (BEHL) and worse ear hearing levels (WEHL), as well as for the mid- and for the high frequencies. However, all differences were relatively small. The impact of family history on the activity limitation (hearing problems) reported by the subjects was investigated by different general questions in the two surveys. In the MRC-ENT

1181 Chap10

3/29/07

148

6:15 PM

Page 148

Current management

60

30

***

25

40 Mean hearing 30 level (dB) 20

***

NS

35

***

50 ***

HI Parents(s) Hearing Parents

10

P