Drug-Dna Interaction Protocols

1 DNase I Footprinting Keith R. Fox 1. Introduction Footprmtmg provides a simple, quick, and reasonably mexpensive method for assessingthe sequence specific mteraction of ligands with DNA. Although the techmque was developed in 1978 for studying the mteraction of DNAbinding proteins with then target sites (I), it has proved invaluable for determining the sequence specificity of many small hgands 1.1. Footprinting , Footprmting is essentially a protection assay, m which cleavage of DNA is inhibited at discrete locations by the sequence specific binding of a hgand or protein. In this technique, a DNA fragment of known sequence and length (typically a restriction fragment of 100-200 bp), which has been selectively radiolabeled at one end of one strand, IS lightly dtgested by a suitable endonucleolytic probe m the presence and absence of the drug under investigation The cleavage agent is prevented from cutting around the drug-binding sites so that, when the products of reaction are separated on a denaturing polyacrylamide gel and exposed to autoradiography, the position of the ligand can be seen as a gap m the otherwise continuous ladder of bands (see Fig. 1). In this figure, cleavage at position “a” will produce, after denaturing the DNA, one long fragment (9 bases) corresponding to the left hand strand, and two short fragments (7 bases and 2 bases) from cleavage of the right hand strand. Since the bands are located by autoradiography, only the shortest of these species bearing the radioactive label will be visualized. The condittons of the cleavage reaction are adjusted so that, on average, each DNA fragment is cut no more than once. As a result, each of the bands on the autoradiograph is produced by a single cleavage event, i.e., single-hit kmetics. If an excessive amount of cleavage agent is used, then From

Methods

m Molecular

Edited

by

Biology,

K R Fox

Vol 90 Drug-DNA

Humana

1

Press

Interactron

Inc , Totowa.

NJ

Protocols

Fox

gel eleotrophoresis

Fig 1 Schemattc representation of the footprtntmg experiment The DNA is labeled (*) at the 3’ end of the right-hand strand

labeled products can arose from more than one cleavage event, biasing the dlstribution

of fragments toward short products. In general, the extent of cleavage

1sadjusted so that between 60 and 90% of the radtolabeled DNA remains uncut, though longer fragments require greater amounts of digestion able band intensities.

to produce suit-

DNase I footprmtmg has been successfully employed for mdentrfymg or conlirmmg the preferred DNA binding sites for several hgands mcludmg actinomycm

(2-4), mtthramycin

(5), quinoxalme

antrbrotrcs (6,7), daunomycm

(8,9), nogalamycin (1/J), vartous minor groove binding agents (2,3,12), and triplex binding

ohgonucleottdes

(12,13). Various other cleavage agents, both

enzymrc and chemical, have also been used as footprinting probes for drugDNA interactions including micrococcal nuclease (24), DNase II (6,15), copper phenanthrolme (16,17), methtdiumpropyl-EDTA.Fe(II) (MPE) (18-21), uranyl photocleavage (22,23), and hydroxyl radicals (24-26). Each of these has a different cleavage mechanism,

revealmg

different aspects of drug-DNA

interactions. An ideal footprmtmg agent should be sequence neutral and generate an even ladder of DNA cleavage products in the absence of the hgand This property is

almost achieved by certain chemical probes, such as MPE and hydroxyl radicals. However,

the most commonly

used cleavage agent (because of its cost

and ease of use) 1sthe enzyme DNase I, which produces an uneven cleavage pattern that varies according DNA sequence and local structure (see Subheading 1.2.). Cleavage at mdrvtdual phosphodiester bonds can vary by over an order

DNase I Foo tprinting

3

of magnitude m a manner determined by both local and global DNA structure (27,28). In addltlon, drugs that modrfy DNA structure can induce enhanced DNase I activity m regions surroundmg their binding sites if they alter the DNA structure so as to render it more suscepttble to cleavage (3,6,15,29,30). This ISmost frequently seen m regions that are particularly refractory to cleavage m the drug-free controls. 1.2. DNase I DNase I 1sa monomeric glycoprotem of mol wt 30,400. It IS a double strandspecific endonuclease,which introduces single strand nicks m the phosphodiester backbone, cleaving the 03’-P bond. Single stranded DNA is degraded at least four orders of magmtude more slowly (32,32). The enzyme requires divalent cations and shows opttmal actlvlty m the presence of calcmm and magnesium (33). Although it cuts all phosphodiester bonds, and it does not possess any simple sequence dependency, its cleavage pattern 1svery uneven and 1sthought to reflect variations m DNA structure (27,34). In particular, A, * T, tracts and GC-rich regions are poor substrates for the enzyme. The most important factors affecting Its cleavage are thought to be mmor groove width (27,28) and DNA flexibility (35,36). Several crystal structures have been determined for both the enzyme and its complex with oligonucleotides (37-42). These show that DNase I bmds by inserting an exposed loop mto the DNA minor groove, Interacting with the phosphate backbone, as well as the walls of the groove. This explains why cleavage is poor in regions, such as A,, * T, tracts on account of their narrow minor groove, to which the enzyme cannot bind. An additional feature of these crystal structures 1sthat the DNA 1salways bent by about 2 lo toward the major groove, away from the enzyme. If this bendmg 1sa necessary feature of the catalytic reaction, then rigid regions, such as GC-rich sequences,may be refractory to cleavage. However, these factors do not explain the very different cutting rates that are often observed at adjacent dinucleotide steps.It 1spossible that this is determined by precise orientation of the sclssile phosphodlester bond, However, the crystal structures show that there may be other specific interactions between the exposed loop and DNA bases removed from the cutting site. In particular, tyrosme-76 mteracts with the base 2 posItIons to the 5’ side of the cutting site and arginme-4 1 binds to the base at position -3. This latter mteraction 1ssterically hindered by a GC base pair in thts position. By examining the characteristics of several good DNase I cleavage sites, Herrera and Chaires (43) suggested that the best cleavage site was WYWIWVN (where W = A or T, Y = C or T, and V = any base except T). The DNA-binding surface of DNase I covers about 10 bp, i.e., one complete turn the DNA helix. This has tmportant consequences for interpreting

4

Fox

A

B

Fig 2. Schemattc representatron of the 3’staggered cleavage produced by DNase I The DNA helix has been opened out and IS viewed along the minor groove The hatched box represents DNase I. the tilled box represents a DNA-binding ligand

footprmtmg results and explams the observatton that the enzyme overesttmates drug-binding site sizes Although DNA bases he perpendtcular to the hellcal axis, they are mclmed relative to the phosphodtester backbone. As a result, closest phosphates, postttoned across the minor groove, are not attached to a single base pan, but are staggered by about 2-3 bases m the 3’ direction. This is illustrated m Fig. 2A, m which the DNA has been drawn lookmg along the minor groove, showmg the inclmatton of the DNA base pans. Since DNase I (hatched box) binds across this groove, its bmdmg sate on the top strand 1s located 2 bases to the 3’ side of that on the lower strand. When a DNA-binding hgand is added (filled box in Fig. 2B), it can be seen that the closest approach of the enzyme is not the same on each strand. DNase I can approach closer to the enzyme on the lower strand; the region of the upper strand protected extends by about 2 bases beyond the actual ligand-bmdmg sate. As a result, DNase I footprmts are staggered by about 2-3 bases m the 3’ direction across the two strands

2. Materials 2.1. DNase

I

For most footprintmg experiments the DNase I does not need to be especially pure. There 1s ltttle advantage m purchasmg HPLC-pure, RNase-free enzymes. Currently purchased 1s the type IV enzyme, from bovme pancreas, from Sigma (St. Louis, MO). This should be dtssolved m 0.15 MNaCl contaming 1 mMMgC1, at a concentratton of 7200 Kumtz U/mL. Thts can be stored at

-20°C, and is stable to frequent freezing and thawing. The enzyme 1sdiluted to workmg concentrattons immedtately enzyme should be discarded

before use; the remainder

of the diluted

5

DNase I Footprinting Table 1 Sequence

of the tyrT DNA Fragment

AATTCCGGTTACCTTTAATCCGTTACGGATGAAAATTACGC~CCAGTTCATTTTTCTC~CGT~CAC 0 10 20 30 40 3'-AAGGCCAATGGAAATTAGGCAATGCCTACTACTTTT~TGCGTTGGTC~GT~GAGTTGCATTGTG

50

60

TTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGAT~GGGAGCAGGCCAGT~GCATT 70 80 90 100 110 AAATGTCGCCGCGCAGTAAACTATACTACGCGGGGCGAAG

120

130

ACCCCGTGGTGGGGGTTCCC 140 150 TGGGGCACCACCCCCAAGGGCT-5'

The fragment ISobtainedby cutting with EcoRI andAvuI a-32P-dATP ISusedto labelthe3’endof the lower strand,whereasa-32P-dCTPISusedto labelthe upperstrand

2.2. Choice of DNA Fragment 2.2.1. Natural DNA Fragments For footprinting experiments, the length of fragment used depends on both convenience (how easily a specific fragment can be generated) and the resolution limit of the polyacrylamide gels. The chosen fragment length is typically between 50 and 200 bp. Although different laboratories have adopted different natural fragments as standard substratesfor footprmtmg experiments, a few have been used more widely Among these are the 160 bp tyrT fragment (sequence shown m Table 1) t&8)), the EcoRI-PvuII fragments from PBS (Stratagene) (4&M), and several fragments from pBR322 (HindIII-HueIII, HindIII-AM, or EcoRI-RsaI). The plasmids from which these can be prepared are available from commercial sources or from the author’s laboratory. In many ways it would be convenient if a few fragments did become recognized standards, since this would facilitate direct comparison of the relattve specrfictttes of hgands prepared in different laboratories. Since many sequence selective small molecules have recognition sites of between 2 and 4 bp, there is a reasonable probability that their preferred sites will be present in a lOO- to 200-bp restriction fragment. However, it should be noted that there are 2 different bp, 10 different dmucleotides, 32 trmucleotides, 136 tetranucleotides, 512 pentanucleotides, and 2080 hexanucleotides. It can therefore be seen that the chance of finding a particular binding site within a given DNA fragment becomes more remote the greater the selectivity of the ligand. A further complicatmg factor is that, although many ltgands spectfically recognize only a dmucleotlde step, their binding affinity is often influenced by the nature of the surrounding bases,

6

Fox

which alter the local DNA structure (47-49). It IS therefore possible that using a natural fragment may fail to detect the optimum bmdmg sites for the most selective hgands. This becomes especially relevant since many novel synthetic ligands possessenhanced sequence recogmtton properties, with binding sites of eight or more base pairs. 2.2.2. Synthetic Oligonucleotides As explamed, although footprmtmg experiments with natural DNA fragments provide a reasonable estimate of a ligand’s preferred bmdmg sites, these are complicated by the limited number of sequences studied, together with ambiguities over the exact bmdmg site within a larger footprmt. The next step m confirmmg the sequence preference may be to prepare a synthetic DNA fragment containing the putative binding site and to use this as a substrate for footprmting experiments (50,51). In addition, for compounds that have been produced as the result of rational design, one may be able to predict their preferred bmdmg site. Synthesis of suitable length ohgonucleotides (50 bases or longer) IS now routine. However, the results obtained with short oligonucleotides need to be interpreted with caution and rigorously controlled for several reasons. First, binding sites located close to the ends of short ohgonucleotides may not adopt the same configuration as when located within longer sequences because of “end effects.” Second, smce the synthetic fragments will contam only one or two binding sites, it is necessary to ensure that other sequences with equal or greater affinity have not been excluded. This can be investigated by comparing the mteraction with other closely related sequences, m which one or two bases m or around the cognate sequence are altered m turn. Analysis is simphfied further if the variant sites are contamed withm the same DNA fragment. 2.2.3. Synthetic Fragments A frequent variant on the above is to clone the synthetic oligonucleottdes mto longer DNA fragments. This removes the problems associated with end effects and provides other common flanking sequences to which ligand binding can be compared. An added advantage is that, once it has been cloned, the sequence can be readily isolated from bacteria. The authors usually clone synthetic ohgonucleotides mto the BamHI site of pUC plasmids. They have prepared a wide range of such cloned inserts, containing central GC, CG, or (A/T),, sites (11,15,29,30), which are available from the authors’ laboratory on request. DNA fragments contammg the synthetic inserts can be prepared and radiolabeled at either end (see Subheading 3.2.) by isolatmg the modified polylmker. Once again a proper analysis will requtre fragments contammg both cognate and closely related noncognate sequences.

DNase I Footprinting

7

2.3. Buffers 2.3.1. Solutrons for Plasmid Preparation 1 Resuspenston solution 50 mM Trts-HCl. pH 7 5, contammg 10 mM EDTA. 2. Lysis solution. 0.1% SDS, 0.1 MNaOH. 3 Neutralization solutton 3 M potassium acetate, 2 A4 acettc acid

2.3.2. Genera/ Buffers 1 10 mA4Tris-HCl, pH 7 5, contannng 0 1 mA4EDTA This is used for dtssolvmg DNA. 2. 10 mM Trts-HCl, pH 7.5, containing 10 mA4 NaCl. This is used for preparing drug solutions 3 DNase I buffer 20 mMNaC1,2 mM MgCl*, 2 mM MnC&

2.3.3. Reagents for Electrophoresis 1. TBE electrophorests buffer This should be made up as a 5X stock solutton containing 108 g Tns, 55 g Boric acid, and 9.4 g EDTA made up to 2 L with water 2 Acrylamide solutions Polyacrylamide sequencing gels are made from a mixture containing acrylamtde*btsacrylamtde in the ratio 19.1. Because of the toxic nature of these compounds. acrylamide solution are best purchased from a commerctal supplier (National Diagnostics [Atlanta, GA], Anachem [Luton, Beds, UK]) and should be used according to the manufacturers mstructions 3 DNase I stop solution. Formamide containing 10 mM EDTA and 0 1% (w/v) bromophenol blue 3. Methods

3.1. Plasmid Preparation Several methods are available for preparing plasmid DNA, which IS suitable for restriction digestion and radiolabeling, including several commerctal kits (including Qiagen or Wizard) and caesium chloride density gradient centrifugation. It 1sbeyond the scope of this article to review the relative merits of each procedure, except to note that in many instances it is not necessary to generate high purity plasmid preparations. Since the radtolabeled restrtction fragments are eventually isolated and purified by gel electrophoresis, prior purification of the plasmids may not be necessary, so long as the preparations do not contain nucleases or any agents that inhibit restriction enzymes or polymerases. As a result, plasmtds are usually prepared by standard alkaline lysts procedures, followed by extraction with phenol/chloroform. A very brief protocol for extractmg pUC plasmids 1sdescribed as follows: 1 Grow 50 mL bacteria overnight. 2 Spin culture at 3000g (I e., 5000 rpm m a Beckman JA20 rotor) for 5 mm m Oakridge tube.

Fox

8

3 Resuspend the bacterial pellet m 5 mL cell resuspension solution (50 mM Tns-HCl, pH 7.5, containing 10 mM EDTA) 4. Add 5 mL cell lysis solution (0 1% SDS, 0 1 MNaOH) and mix gently until the solution becomes clear Add 5 mL neutralization solution (3 M potassium acetate, 2 M acetic acid) Spin at 17,000g (12,000 rpm) for 15 mm Remove the supernatant and add 0 6 vol of lsopropanol. Spin at 17,OOOg(12,000 rpm) for 15 mm Remove the supernatant and wash the crude DNA pellet with 5-10 mL 70% ethanol Transfer the pellet to an Eppendorf tube and dry 10 Redissolve pellet m 0 5 mL 10 mA4 Tns-HCl, pH 7 5, containing 0.1 mM EDTA and 100 pg/mL RNase Leave at 37°C to dissolve for at least 30 mm 11 Extract twice with 0 5 mL phenol/chloroform (phenol forms the bottom layer and should be discarded) The interface will probably be very messy, leave the Junk behind 12. Remove any dissolved phenol by extracting twice with 0 5 mL ether (which forms the top layer and should be discarded) Allow excess ether to evaporate by standing at 37°C for a few minutes 13 Precipitate with ethanol, dry and dissolve m 100-l 50 JJL Tns-HCI, pH 7 5, containing 0.1 mM EDTA

3.2. Radiolabeling

the DNA

DNA fragments can be efficiently labeled at either the 5’ end (using polynucleotlde kmase) or 3’ end using a DNA polymerase. However, the results of DNase I digestion are easiest to interpret for 3’-end-labeled fragments. Smce DNase I cuts the 03’-P bond, the products of dlgestlon possess a 3’-hydroxyl and 5’-phosphate group. In contrast, Maxam-Gilbert sequencing reactions, which are used as markers in footprmtmg gels (see Subheading 3.3.), leave phosphate groups on both sides of the cleavage pomt (52). As a result, the radlolabeled products of DNase I cleavage and Maxam-Gilbert sequencmg reactions will be identical if the DNA 1s labeled at the 3’ end (i.e., both possess a phosphate at the 5’ end). However, if the DNA 1s labeled at the 5’ end then the labeled DNase I products will possess an extra phosphate group and so run slightly faster than the correspondmg Maxam-Gllbert products. Although this difference 1s often overlooked in footprmtmg gels, it becomes significant for short fragments for which the difference m mobility may be as great as 2-3 bands. For enzymes that cut the O-5’ bond, such as DNase II and mtcrococcal nuclease, 5’-end-labeled fragments comlgrate with the Maxam-Gilbert marker lanes.

3.2.1. 3’-End Labeling with Reverse Transcriptase The production of 3’-end-labeled DNA fragments can be achieved by cutting with a restrlction enzyme that generates sticky ends with 3’-overhanging

9

DNase I Footprmting

ends, followed by filling m with a polymerase using a suitable [a-32P]-dNTP. The fragment of interest IS then released from the remamder of the plasmid by cleaving with a second enzyme that cuts the other side of the region of interest. The two restriction enzymes usually cut at single locatlons in the plasmid, though this 1snot necessary so long as the various radiolabeled fragments can be separated from each other. The most commonly used polymerase is the Klenow fragment. However, it is found that the most efficient labeling is achieved using AMV reverse transcriptase, even though this 1s actually an RNA-dependent DNA polymerase. However, not all commercially sources of this enzyme are equally reltable; consistent results are obtained with reverse transcrlptase from Promega or Pharmacia 3 2 1 .l

RESTRICTION DIGESTION AND a’-END

LABELING

Using the aforementioned procedure for DNA isolation, the followmg 1s used for generating radlolabeled Hindlll-EcoRl polylmker fragments from pUC plasmids. 1. Mix 30 pL plasmld (about 50 pg DNA) with 10 pL of 10X restrlctlon enzyme

buffer (as supplied by the manufacturer), 45 PL water. 2 Add 3 pL HzndIII (A/AGCTT) and incubate at 37°C for 2 h 3. Add 1 PL [a-32P]-dATP (3000 Wmmol, Amersham)together with 1 PL reverse transcriptase and Incubate for a further 1 h 4 The reverse transcriptase IS then Inactivated (to prevent further mcorporatlon of radiolabel at the 3’ end of the second restrlctlon site) by heatmg at 65°C for 5 mm 5 After cooling to 37”C, 3 pL EcoRI (G/AATTC) is added and the mixture mcubated for a further 1-2 h In this case, the DNA can be labeled on the opposite strand by reversing the order of addition of EcoRI and HzndIII

If the second enzyme produces blunt ends or sticky ends with 5’ overhangs, or if the 3’ overhangs sites can not be filled m with dATP, then all the enzymes can be added simultaneously. Examples of such combinations for pUC polylinker fragments are HzndlII-SacI, and EcoRI-&I. The @rT fragment can be prepared by simultaneous digestion with EcoRl and Aval. In this instance the EcoRl end is labeled with [a-32P]-dATP, whereas the Aval end can be labeled with [a-32P]dCTP. Although various enzymes are supplied with dlfferent reaction buffers, it 1sfound that there IS usually no need to change buffers between the first and second enzymes. 6 The mixture of radlolabeled fragments is preclpltated by addmg 10 PL of 3 M sodium acetate and 300 pL ethanol, followed by centrlfugatlon m a suitable microfuge, at top speed The pellet 1swashed with 70% ethanol, dried and dlssolved m 15-20 FL Tris-HCl containing 0 1 mA4 EDTA. Then 4 PL of loading dye (20% F~oll, 10 mA4EDTA, 4 1% [w/v] bromophenol blue) is added before

10

Fox loading onto a polyacrylamide gel (typically 6-8%). The gel should be run cold, so as not to denature the DNA, it is usually run 0 3-mm-thick, 40-cm-long gels in 1X TBE at 800 V Samples are loaded into slots 10 mm wide by 15 mm deep After the bromophenol blue has reached the bottom of the gel (about 2 h), the plates are separated and the gel covered with Saran wrap Scanning the gel with a hand-held Geiger counter should give a reading off scale (1 e , at least 3000 cps) over the radiolabeled bands The precise location of the radiolabeled bands is determined by short (2-10 min) autoradiography This autoradlograph IS placed under the glass plates and used to locate the band of Interest, which IS cut out using a sharp razor blade

3.2.1.2

EXTRACTION OF RADIOLABELED DNA FRAGMENTS

The simplest, labeled DNA

cheapest, and most efficient

fragments

from polyacrylamlde

method

for extracting

gel slices IS by diffusion

radioPlace a

small glass wool plug m the bottom of a 1 mL (PlOOO) pipet tip and seal the bottom end with parafilm. Add the gel slice containing the radiolabeled DNA and cover this with 10 mA4 Tris-HCl, pH 7 5, containing 10 mM EDTA (about 300 pL is sufficient). Cover the top of the pipet tip with parafilm and incubate at 37°C with gentle agitation. This is usually incubated overmght, though most of the DNA elutes after 2 h. Remove the parafilm from the top and bottom of the tip and expel the buffer mto an Eppendorf tube using a pipet and/or lowspeed centrifugation (15OOg m an Eppendorf centrifuge). The gel slice should be retamed in the pipet tip by the plug of glass wool, though a small amount of polyacrylamide does occasionally come through This can be removed by centrifugation. For fragments shorter than 200 bp, this procedure recovers about 95% of the radiolabel m the gel slice, though the efficiency decreases for longer fragments. The DNA should then be precipitated with ethanol and redissolved m Tris-HCI containing 0.1 mA4 EDTA so as to generate at least 10 cps per pL on a hand-held counter. For most footprintmg experiments it is not necessary to know the absolute DNA concentration, since this is vamshmgly small. The important factor is concentration of the radiolabel, which should be sufficient to produce an autoradiograph within l-2 d exposure.

3.3. Maxam-Gilbert

Marker Lanes

Bands in the DNase I digestion patterns are identified by comparison with suitable marker lanes. Since each DNA fragment produces a characteristic sequence dependent digestion pattern, it is sometimes possible to identify the bonds by comparison with a previous (published) pattern.

3.3.1. G-Tracks The simplest and most commonly used marker lane is the dimethylsulfatepiperidme marker specific for guanine (52). Since the procedure is more time-

11

DNase I Footprintmg

consuming than DNase I digestion itself, it is usual to prepare sufficient quantity of “G-track” for several footprmting experimentswith the batch of radiolabeled DNA. Add 10 uL radiolabeled DNA to 200 pL of 10 mA4 Tris-HCl, pH 7.5, contammg 10 mM NaCl. To this add 1 pL dtmethylsulfate and mcubate at room temperature

for 1 mm before stopping the reaction by addmg 50 uL of a solution

containing 1.5 Msodmm acetate and 1Mmercaptoethanol followed by 750 pL ethanol. Some laboratortes include tRNA in this G-stop, as a coprectpttant, but it is found that this is not generally necessary. Leave the mixture on dry ice for 10 min, then spin at full speed in an Eppendorf centrifuge (12,000g) for 10 min. Remove the supernatant and wash the pellet twice with 70% ethanol. After drying the pellet, add 50-l 00 yL of 10% (v/v) plperidme

and heat at 100°C for

between 20 and 30 min. Remove the ptpertdme by either lyophilizatton or m a speed-vat. Redissolve the sample m loading dye (formamlde

containing

10 mJ4

EDTA and 0.1% [w/v] bromophenol blue) so that each electrophorests sample contains about 10 cps. 3.3.2. G+A Tracks Although the preparation of a G-track is reliable, it is time-consummg and mvolves some highly toxic compounds (dimethylsulfate). G+A marker lanes are also widely used and are usually prepared by limited acid depurmation using formtc acid-ptperidme

reactions. During the DNase I footprintmg

work

it was noted that occastonal careless handling of the samples resulted m put-me tracks appearing m the DNase I cleavage lanes. This observatton has been used to establish an empirical method for rapidly preparing G+A marker lanes To 2 pL of radiolabeled DNA, add 15-20 pL of Trts-HCl, pH 7.5, contaming 10 MNaCl and 5 pL of loading dye (formamide containing 10 mM EDTA

and 0.1% [w/v] bromophenol blue). Heat at 100°C for about 20 mm in an Eppendorf tube, with the cap open This reduces the volume to about 5-6 pL, sufficient for loading onto the gel and generates a clean G+A track. Since this method 1s rapid, each marker lane can be freshly prepared while performing the DNase I digestions. 3.4. DNase I Footprinting

3.4. I. Basic Footprinting Protocol The basicprocedure for DNase I footprinting is quick and snnple (hence its popularity as a footpnnting agent) and can readily be adaptedto suit a rangeof conditions. 1. Mix 2 uL radiolabeled DNA (dissolved m 10 mMTrrs-HCl, pH 8.0, contannng 0.1 rniI4 EDTA) with 2 uL ligand (dissolved in a surtable buffer, such as 10 n&I Trrs-HCl, pH 7.5, containing 10 m&I NaCl). See Note 5 for suitable hgand concentrations.

12

Fox

2 Leave this to equihbrate for an approprtate length of time. For most small hgands, such as minor groove binding ligands or simple intercalators, the interaction with DNA is very fast, though some hgands require in excess of 30 mm for equiltbrium distribution. 3. Start the digestion by adding 2 PL DNase I (dissolved in 2 mM MgCI,, 2 mM MnCl,, 20 mM NaCi) 4 After 1 minute stop the reaction by adding 3 pL of formamide containing 10 mh4 EDTA and 0 1% (w/v) bromophenol blue The concentratton of DNase I requtred will depend on the reaction condrttons, 1-e , temperature, pH, DNA concentration, tonic strength This should be adjusted emptrtcally so as to give suitable extent of dtgestton (see Notes l-4). It 1s typically found that, at 20°C with 10 mM NaCl, a suitable enzyme concentration is about 0.03 Kunitz U/rnL (i.e., dilute 2 PL of stock DNase I [7200 U/mL] m 1 mL DNase I buffer, followed by adding 2 l.rL of this dtlutton to a further 1 mL buffer Each of these dilutions should be mixed gently, avotdmg vtgorous agitation) The enzyme should be freshly diluted immediately before use.

3.5. Electrophoresis

and Autoradiography

1 After DNase I digestion the samples should be denatured by boiling for about 3 mm, before loading onto a denaturing polyacrylamide gel Samples can be loaded directly from the boiling conditions, though excessive heating can produce some depurmation. However, it is probably best rapidly to cool the samples on ice before loading For most footprmtmg reactions there ts no need to use sharks teeth combs, and simple slots are sufficient Denaturing polyacrylamide gels (6-l 2% depending on fragment length) should contam 8 M urea and are run m 1X TBE buffer, For some CC-rich DNAs these denaturing conditions are not harsh enough and some bands are compressed. Thts can be alleviated by including formamtde (up to 30%) m the gel mixture and can be further improved by prerunning the gel for 30 mm before use. Formamtde contammg gels run slightly slower than conventtonal gels and should be of a slightly higher percentage. For footprmtmg expertments 0.3-mm-thick gels are normally used that are 40 cm long; these are run at 1500 V until the bromophenol blue reaches the bottom (about 2 h). The gels should be run hot, maintaining the DNA m a denatured form. Although many modern electrophoresls tanks are thermostatically controlled, “smtling” of the lanes can also be avoided by clamping a metal plate over the glass surface, ensuring an even dtstributton of heat. 2. After electrophoresis the plates are separated and the gel is soaked in 10% (v/v) acetic acid. This serves to fix the DNA and remove much of the urea, prior to drying Each 2 L of 10% acetic acid can be used to fix up to three gels.

DNase I Foo tpnn trng

13

3 After fixing, the gels are transferred to Whatman 3MM paper, covered with Saran wrap and dried at 80°C m a commercial gel drier 4. The dried gels are exposed to autoradiography If the DNA IS suitably “hot,” then 1-2 d exposure at -70°C with an Intensifying screen should be sufficient.

3.6. Analysis Although rigorous quantitative analysis is required for assessingthe relative binding affinity at different sites, and for measuring bmdmg constants, the locatton of drug-induced footprmts can usually be directly assessedby visual mspectlon. Quantitative analysis requires additional equipment (densitometer or phosphorimager) and 1sbeyond the scope of this chapter (see Chapter 2). However, since DNase I footprmts are necessarily larger than the actual hgand binding site, on account of the size of the enzyme, both visual and quantitative analyses leave some uncertainties. The footprint will be larger than the binding site, and this too may be larger than the recognition site. For example, although actinomycm D specttically recognizesthe dmucleotide GpC, tt covers about 4 bp and protects about 6 bases from DNase I cleavage. For small hgands that recognize only 2 or 3 bp, and which may generate several discrete footprmts on any given DNA fragment, the ambiguity concermng the exact bindmg can often be resolved by determmmg the sequencesthat are common to each of the footprints. Additional mformatton is gleaned by comparmg the location of the footprints on each of the DNA strands, visualized by performing separate experiments with DNA labeled on each strand. Since DNase I footprmts are staggered in the 3’ direction by 2-3 bases,the exact binding site will be located toward the 5’ end of each footprint and will be contained m the region of overlap protected on both strands. If there are still uncertamtres about the sequence recognitton properties, then it may be necessary to synthesize (a series of) synthetic fragments that contam putative binding sites based on the preliminary footprinting data. An example of this is the AT-selective bifuncttonal intercalator TANDEM Footprmting experiments with natural DNA fragments confirmed the AT-selectivity, but could not determine whether the recognition site was ApT or TpA (7). This was resolved by producmg fragments containing a series of different AT-rich binding sites, i.e., ATAT, TATA, TTAA, and AATT (53). These demonstrated that the recognition sateis TpA not ApT. An alternative strategy is to use another footprmting agent such as MPE, hydroxyl radicals, mrcrococcal nuclease, DNase II, or uranyl radicals, though these suffer to different degrees from the same problems of locating the exact ligand binding site. 3.7. A Worked Example Figure 3 shows DNase I digestion of the tyr?” DNA fragment m the presence of varying concentratrons of the AT-selective anttbiotrc distamycm. The

Fox

14

20-

Fig. 3. DNaseI footprinting of distamycin on the 160bp Qv-TDNA fragment,whose sequenceis presentedin Table 2. The EcoRI-AvaI fragment is labeled at the 3’ end of the EcoRI site. The distamycin concentration(pA4) is shown at the top of the lanes. Each pair of lanescorrespondsto cleavageby the enzyme for 1 and 5 min.

sequenceof this DNA fragment is presentedin Table 1. The DNA fragment in Fig. 3 hasbeen obtainedby digesting with EcoRI andAvaI and hasbeen labeled at the 3’ end of the EcoRI site with a-32PdATP, using reverse transcriptase, revealing the bottom strand in Table 1. Since this fragment has been widely used as a footprinting substrate,the bands have been assignedby comparison with other published data. Sampleshavebeenremoved from the digestion mixture at times of 1 and 5 min. This figure will be usedto illustrate severalaspects of DNase I footprinting. It can be seenthat DNase I cleavagein the drug-free control is not even (see Note 6). Some regions are cut poorly, particularly between 26-32 and 42-50. These are staggeredto the 3’ side of the A, 1T, blocks at 27-33 and 46-52.

D Nase I Foo tpnn tmg

75

Cleavage is also poor around position 100, m a GC-rich block. In addition some positions are cut much better than the surroundmg bonds (e.g., 41, 69, and 81), whereas others are cut less well (e.g., 39,58, 83). The poor cutting m the AT-rich regions of the control presents an obvious problem for this hgand that 1sAT-selective since the binding sites correspond to regions where there is little or no cleavage m the control. Visual inspection reveals that distamycm has altered the DNase I cleavage pattern. Clear protections from DNase I cleavage are evident at the lowest hgand concentration (0.2 PM) at positions 26-32 and 43-50. These sites correspond to regtons that are poor sites of DNase I cleavage in the control. Other regions of protection can be seen at 1 and 5 )L&!at 56-68, 78-89, and around 110. Each of these positions corresponds to an AT-rich sequence. The first contains two distamycin bmdmg sites (TTA and TAAA) that produce a single overlappmg footprint, as does the second (AAT and ATAT), whereas the third contams a single site TTAT. At concentrations of 25 and 100 uM most of the cleavage in the lower portion of the fragment is protected. It can be seen that each of these protections is staggered by 2-3 bases in the 3’ (lower) direction relative to the actual binding site For example, the protection around posinon 60 extends down at least as far as posttion 56, whereas the AT-bindmg site ends at position 59 In contrast, the 5’ (upper) end of the footprmt is coincident with the edge of the binding sites (position 69) As a result of the overlapping footprints, and the poor cleavage of the enzyme around some bmdmg sites, it is not possible to determine the ligand bmdmg site size from these footprmts. The intensity of certain bands is increased at distamycm concentrations of 5 wand above, especrally at positions 72/73,94/95, and 99/l 00, each of which is located m a GC-rich region. Indeed at the highest lrgand concentration the bands at 72/73 and 94/95 are the only cleavage products remainmg. These regions of enhanced cleavage have previously been interpreted as arising from ligand induced changes in DNA structure (4). However, in view of small amount of free DNA available for enzyme cleavage these enhancements could simply reflect changes in the ratio of free DNA to enzyme (54,55). Since most of the enzyme binding sites are occupied by the ligand, the relative concentration of enzyme at these sites will be much greater, hence the greater cleavage efficiency (see Note 8). It should be noted that, in this example, the 5-min lanes are overdigested; only a small proportion of the DNA is uncut. As a result, bands toward the top of the gel are much lighter, whereas those toward the bottom are overrepresented, since they arise from multrple cleavage events. Although it is still possible to discern the footprmting sites m the lower portion, this is less clear m the upper part, and could certamly not be used in any quantitative analysis.

16

Fox

Table 2 The Effect of Various Conditions on the Relative of DNase I Required in Footprinting Experiments Relative enzyme concentration

Ionic strength

4°C 20°C 37OC

6 1 05

001 0.1 10

5OT

1

65°C

2

Temperature

Concentration

Relative enzyme concentration 1 5 10

pH 50 6.0 70 80

Relative enzyme concentration 5 3

1 1

4. Notes 1 The activity of DNase I will. of course, vary according to the different reactlon condltlons, affecting the extent of digestion, and suitable adjustments should be made to ensure sufficient cleavage, yet maintaining “single-hit” kinetics This can be achieved either by altermg the digestion time or varying the concentration of the enzyme The latter 1s generally varied A rough guide for the effect of various condltlons on the relative concentration of DNase I required IS presented m Table 2 For mitral experiments it 1soften worth performing a time course for the enzyme digestion, increasing the volume of the reactants and removing allquots e g., say, 1, 5, and 30 mm 2. DNase I requires the presence of dlvalent metal ions, particularly magnesium, and so Its action can be stopped by adding EDTA The enzyme has more than one bmdmg site for dlvalent catlons, though only one of these 1sat the catalytic site The literature on the preferred metal ions IS confusing with various claims for different sites for calcium and/or magnesium suggestmg that both ions are required However, good cleavage is observed with either calcium or magnesium, although slrghtly higher enzyme concentrations are reqmred when using calcmm alone Since manganese has been shown to increase the rate of digestton, equlmolar concentrations of manganese and magnesium are generally used It IS found that the cleavage pattern 1s largely unaffected by the nature of the divalent metal Ion, even though crystallographic data has suggested an alternative bmdmg site for manganese that might produce a different cleavage pattern In contrast, mllllmolar concentrations of ions such as Co*+ and Zn*+ inhlblt the activity of DNase I 3 DNase I 1sreasonably tolerant to a variety of organic solvents mcludmg methanol, ethanol, and dlmethylsulfoxlde (DMSO) This 1s useful since many DNAbindmg ligands are only sparmgly soluble m water and must be prepared as stock solutions in various other solvents. DMSO concentrations as high as 40% require a threefold higher enzyme concentration, though this does modify the cleavage pattern, increasing the cuttmg m regions that are poor substrates for DNase I, such as polydA tracts

DNase I Footprinting 4. A glance at the literature reveals that many laboratories include known concentration of unlabeled carrier DNA m the footprmtmg reaction. This is only necessary for experiments m which the absolute DNA concentration 1s needed (I e , some forms of quantitative footprmtmg analysis) and can be omitted for most experiments However, one advantage of mcludmg a fixed concentration of carrler DNA IS that the concentration of DNase I required to produce a given level of cleavage does not vary between experiments m which the absolute amount of radlolabeled DNA may not be constant 5 In most footprintmg reactions the concentration of the target DNA IS vamshmgly small (nanomolar) whereas the DNA bmdmg ligand IS present m mlcromolar amounts The extent of bmdmg is, therefore, not determined by the stolchlometric ratio of drug to DNA, but by the equlhbrmm bmdmg constant In this regard footprinting reactions resemble typlcal pharmacological experiments, m which the concentration of the target site IS small and unknown and m which the probability of each site being occupied is 50% at a ligand concentration equivalent to the equlhbrium dlssoclatlon constant Since many hgands bmd to DNA with affmties of between 1 and 100 PM’, drug concentrations between 1 and 100 @4 are usually examined. For drugs that bmd more tightly, lower ligand Concentrations should be explored. It IS generally best to test a range of hgand concentrations, extending down to a concentration at which the digestion IS not noticeably affected High hgand concentrations (100 CLM)often mhlblt DNase I digestion throughout the DNA fragment, this could be the result of nonspecific interaction with DNA or direct inhibition of the enzyme itself 6 A major problem with using DNase I as a footprmtmg tool IS that the enzyme cuts different sequences with efficiencies that can vary over two orders of magmtude. These variations can be both local, m which isolated bonds are cut better or worse than average, or global, where long DNA regions are cut poorly In general, polydA polydT tracts are poor substrates for DNase I, on account of their narrow minor grooves GC-rich regions are also cut poorly, probably because they are more rigid and resist the bending that may be an important part of the DNase I catalytic reaction. In addition, RpY steps are generally cut better than YpR. Llgands that bind to those regions that are cut poorly by DNase I, produce footprmts that are difficult to detect. The only way round this problem 1sto use a different footprmting probe 7 A similar problem 1sencountered when assessing the exact size of a footprint if bands at the edges of the footprint are cut poorly m the control Although this may be clarified by examining the cleavage of the other strand, the ambiguity often remains so that the footprmting site size can usually only be quoted to within an accuracy of +l base. 8 As well as producing footprmts, many hgands also generate enhanced DNase I cleavage m regions surrounding their binding sites. These have been explained m two different ways, each of which is correct in different circumstances First, these may arise from drug-induced changes m DNA structure, which are propagated mto neighboring regions, and which render the DNA more susceptible to

18

9

10

11.

12

Fox DNase I cleavage. Second, they may simply reflect a change in the ratio of free DNA to enzyme m the presence of the ligand (5455) These two posslblhtles can only be properly dlstingulshed by quantitative footprmtmg experiments However, a few other factors may indicate which is occurrmg. Enhancements artsmg from changes m the ratio of free DNA to enzyme should be constant at all points to which the hgand 1snot bound, whereas those that are directly attributable to hgand bmdmg will be located closest to the hgand bmdmg sites A further posseblhty, which 1s rarely considered, 1s that of llgand-induced protections from enzyme cleavage, m surrounding regions An apparently mmor detail, which 1srarely addressed, concerns the hgand concentration Does this refer to the actual concentration before or after adding the DNase 17 For a hgand m fast exchange with the DNA, a new equlhbrmm will rapidly be established after the small dilution because of the addltlon of the enzyme In contrast, if the dlssoclatlon IS slow compared with the time course of the dlgestion, then the dlstrlbutlon of the hgand will resemble the startmg condltlons throughout the reaction In the former case the hgand concentration should be that after adding the DNase I, whereas m the latter case this should refer to the concentration before In theory, the answer to the question requires some prior knowledge of the kinetics of hgand bmdmg, though m practice one or other 1s consistently adopted Unwanted bands sometimes appear m the lanes, which clearly do not arlse from enzyme digestion These may be contaminants m the DNA preparation and can be checked by running a sample of DNA that has not been digested with the enzyme Artlfactual bands, particularly depurmatlon products, can be produced by the bollmg procedure. These can be obviated by mcludmg a small amount of sodium hydroxide (l-2 m44) in the stop solution Since DNase I cuts from the minor groove, protections are easiest to Interpret for llgands that also bind m this groove, sterlcally inhibiting enzyme activity However, major groove bmdmg agents, such as triplex-formmg ohgonucleotldes, also generate clear DNase I footprints (12,13) In this case cleavage mhlbltlon cannot result from sterlc hmderance, but must arise from changes in the DNA structure and/or rigidity and are, therefore, less easily interpreted It should be noted that the footprmtmg pattern should still be staggered across the two strands by about 2-3 bases m the 3’ direction since this is a function of the cleavage agent, rather than the ligand under mvestlgatlon Agents that cut from the major groove would be expected to generate a 5’ stagger Another ambiguity m DNase I footprinting gels, which 1srarely addressed, concerns the numbering/assignment of the cleavage products. Although this would seem to be a trivial problem the uncertainty arises because, whereas most DNA sequences number the bases, DNase I cleavage products correspond to the phosphodlester bonds When Maxam-Gilbert markers are used alongslde DNase I cleavage of 3’-end-labeled fragments, each band m the marker lane (X) comlgrates with the band corresponding to cleavage of the phosphodlester bond on the 3’ side, 1 e , the XpY step

DNase I Foo tprin tmg

79

13 By adapting the simple footprmtmg protocol it can also be used for measurmg slow kinetic parameters, by removing samples from a reaction mixture and subjecting to short DNase I footprintmg (48,49). 14. It IS possible that some sequence selective compounds will not produce DNase I footprints if they are in rapid exchange with the DNA. In such cases footprints can be induced by lowermg the temperature, thereby increasing then persistence time on the preferred binding sites (56).

Acknowledgments Work in the author’s laboratory ts supported by grants from the Medical Research Council and the Cancer Research Campaign.

References 1 Galas, D J. and Schmitz, A (1978) DNAase footprmtmg-simple method for detection of protein-DNA binding specificity Nucleic Acids Res 5, 3 157-3 170 2 Lane, M. J , Dabrowrak, J C , and Vournakis, J N. (1983) Sequence specificity of actinomycm D and netropsm binding to pBR322 analysed by protection from DNAase I. Proc Nat1 Acad Sci USA 80,326&3264 3 Scamrov, A V. and Beabealashvilh, R Sh. (1983) Bmdmg of actmomycm D to DNA revealed by DNAase I footprintmg. FEBS Lett 164, 97-101. 4 Fox, K R and Warmg, M J (1984) DNA structural variatrons produced by actrnomycm and distamycm as revealed by DNAase I footprmtmg Nuclezc Aczds Res 12,9271-9285 5 Fox, K R. and Howarth, N R (1985) Investigations into the sequence-selective bmding of muhramycm and related ligands to DNA Nuclezc AczdsRes 13,8695-87 14 6. Low, C M L , Drew, H R , and Waring, M J (1984) Sequence-specific binding of echmomycm to DNA. evidence for conformational changes affecting flanking sequences. Nucleic Acids Res 12, 48654879 7. Low, C. M L , Olsen, R K., and Warmg, M. J. (1984) Sequence preferences m the binding to DNA of triostm A and TANDEM as reported by DNase I footprmtmg. FEBS Lett 176,4 14-4 19. 8 Chaires, J. B., Fox, K. R , Herrera, J E., Britt, M , and Warmg, M J (1987) Site and sequence specificity of the daunomycin-DNA interaction Blochemzstry 26,8227-8236 9 Chanes, J B , Herrera, J E , and Waring, M J (1990) Preferential bindmg of daunomycm to S’(A/T)CG and S’(A/T)GC sequences revealed by footprmtmg titration experiments Brochemzstry 29, 614556153 10 Fox, K. R. and Warmg, M J. (1986) Nucleotide sequence bmdmg preferences of nogalamycin investigated by DNase I footprintmg. Bzochemzstry 25,4349-4356 11 Abu-Daya, A , Brown, P M., and Fox, K. R. (1995) DNA sequence preferences of several AT-selecttve minor groove binding hgands Nucleic Acids Res 23, 3385-3392 12 Cooney, M., Czernuszewicz, G., Pastel, E. H , Flmt, S. J., and Hogan, M E (1988) Site-specific oligonucleotide binding represses transcription of the human c-myc gene in vitro Science 241,456459

20

Fox

13 Cheng, A -J and van Dyke, M W (1994) Oltgodeoxyribonucleotide length and sequence effects on mtermolecular purine-purme-pyrimidme triple-helix formatlon Nucleic Acids Res 22,4742-4747 14 Fox, K. R and Waring, M. J (1987) The use of micrococcal nuclease as a probe for drug-binding sites on DNA Blochrm Bzophys Acta 909, 145-l 55 15 Cons, B M G and Fox, K R (1990) The GC-selective hgand mtthramycm alters the structure of (AT), sequences flankmg its bmding sites FEBS Lett 264, lo&104 16. Stgman, D. S. (1990) Chemical nucleases. Brochemlstry 29,9097-9105 17 Spassky, A and Slgamn, D S (1985) Nuclease acttvny of 1,lO phenanthrolmecopper ion. conformational analysis and footprmting of the lac operon Blochemwtry 24,8050-8056. 18 Van Dyke, M W , Hertzberg, R P , and Dervan, P B (1982) Map of distamycin, netropsm and actmomycm binding sites on heterogeneous DNA DNA cleavage inhibition patterns with methidmmpropyl-EDTA-Fe(I1). Proc Nat1 Acad Scz USA 79,5470-5474 19. Van Dyke, M W and Dervan, P. B (1983) Chromomycin, mithramycm and ohvomycin binding sites on heterogeneous deoxyribonucleic acid Footprintmg with (methidmmpropyl-EDTA)Iron(II) Biochemutry 22,2373-2377 20 Hertzberg, J P and Dervan, P B. (1984) Cleavage of DNA with methidmmpropylEDTA-Iron(I1) reaction conditions and product analyses Blochemlstry 23, 3934-3945 2 1. Van Dyke, M. W. and Dervan, P B. (1983) Methidmmpropyl-EDTA.Fe(II) and DNase I footprmtmg report different small molecule bmdmg site sizes on DNA Nuclerc Acids Res 10,5555-5567 22. Nielsen, P E., Jeppesen, C., and Buchardt, 0. (1988) Uranyl salts as photochemical agents for cleavage of DNA and probing of protein DNA contacts FEBS Lett 235, 122-124. 23. Nielsen, P E., Hiort, C , Sonmchsen, S H., Buchardt, O., Dahl, O., and Norden, B. (1993) DNA bmdmg and photocleavage by uranyl(VI)(UOZ2’) salts J Am Chem Sot 114,4967-4975 24. Cons, B. M. G. and Fox, K R. (1989) High Resolution hydroxyl radtcal footprmting of the bmdmg of mtthramycin and related antibiotics to DNA Nucleic Acids Res 17,5447-5459 25. Churchill, M. E. A , Hayes, J J , and Tullms, T D. (1990) Detection of drug binding to DNA by hydroxyl radical footprintmg Relationship of distamycm binding sites to DNA structure and positioned nucleosomes on 5s RNA genes of Xenopus Biochemistry 29,6043-6050. 26 Portugal, J and Warmg, M J. (1987) Hydroxyl radical footprmtmg of the sequenceselective bmdmg of netropsm and distamycin to DNA. FEBS Lett 225, 195-200 27 Drew, H. R and Travers, A A. (1984) DNA structural variations m the E colz tyrT promoter. Cell 37,491-502 28. Drew, H. R. (1984) Structural specificrues of five commonly used DNA nucleases J Mel Bzol 176,535-557

DNase I Footprintmg

21

29. Waterloh, K. and Fox, K R. (199 I) The effects of actmomycm on the structure of dA, * dT, and (dA-dT), regions surroundmg its GC bmding site: a footprintmg study J Biol Chem. 266,6381-6388. 30. Waterloh, K. and Fox, K R. (1991) Interaction of echmomycm with A,, T, and (AT), regions flanking its CG bmding site Nucleic Acids Res 19,67 19-6724 3 1. Laskowskr, M (197 1) Deoxyrlbonuclease I, in The Enzymes, vol. 4 (Boyer, P D , ed ), Academtce, London, pp 289-3 11, 32. Kumtz, M. (1950) Crystallme deoxyribonuclease I isolation and general properties spectrophotometric method for the measurement of deoxyribonuclease activity. J Gen Physzol 33, 349-369 33. Price, P. A (1975) The essential role of Cazf m the activity of bovine pancreatic deoxyribonuclease J Blol Chem 250, 1981-1986 34 Lomonossoff, G. P , Butler, P. J. G , and Klug, A. (198 1) Sequence-dependent variation m the conformation of DNA. J Mol BIO~ 149,745-760. 35 Hogan, M. E., Roberson, M W., and Austin, R. H. (1989) DNA flexibility variation may dominate DNase I cleavage Proc Nat1 Acad Scz USA 86,9273-9277 36 Brukner, I., Jurukovski, V , and Savic, A. (1990) Sequence-dependent structural variations of DNA revealed by DNase I. Nuclezc Aczds Res 18, 89 l-894 37. Suck, D., Oefner, C , and Kabasch, W. (1984) Three-dimensional structure of bovine pancreatic DNAase I at 2.5A resolution. EMBO J 3, 2423-2430. 38 Suck, D. and Oefner, C (1986) Structure of DNaseI at 2A resolution suggests a mechanism for bmdmg to and cuttmg DNA Nature 321,62(X-625. 39 Oefner, C and Suck, D (1986) Crystallographic refinement and structure of DNAase I at 2A resolution. J Mol Blol. 192, 605432. 40 Suck, D , Lahm, A, and Oefner, C (1988) Structure refined to 2A of anicked octanulceotide complex with DNAase I Nature 332,464-468 4 1 Weston, S A , Lahm, A , and Suck, D. (1992) X-ray structure of the DNase Id(GGTATACC)2 complex at 2 3k resolution. J Mol Bzol 226, 1237-1256 42 Lahm, A. and Suck, D (1991) DNase I-induced DNA conformation. 2A structure of a DNase I-octamer complex J Mel Bzol 221, 645-667 43. Herrera, J. E. and Chaires, J B (1994) Characterization of preferred Deoxyribonuclease I cleavage sites J Mol Bzol 236,405-411 44. Bailly, C., Donker, I. O., Gentle, D., Thornalley, M., and Warmg, M. J (1994) Sequence selective binding to DNA of cis- and trans- butamidme analogues of the anti-Pneumocystis carmn pneumonia drug pentamidme. MoZ Pharm 46, 3 13-322 45 Bailly, C , Gentle, D , Hamy, F , Purcell, M., and Waring, M J. (1994) Localized chemical reactivity in DNA associated with the sequence specific bismtercalatlon of echmomycm Blochem J 300, 165-173 46 Ridge, G. S , Bailly, C , Graves, D. E., and Warmg, M J (1994) Daunomycm modifies the sequence-selective recognition of DNA by actinomycm. Nuclezc Acids Res. 22,5241-5246.

47. Waterloh, K. and Fox, K. R. (1992) Secondary (non-GpC) bmdmg sites for actinomycin on DNA. Blochzm Biophys Acta 1131,300-306

22

Fox

48 Fletcher, M C and Fox, K R. (1993) Vtsuahsmg the kmettcs of dtssoctatron ofactinomycin from mdtvrdual bmdmg sites m mixed sequence DNA by DNase I footprmting Nucleic Acids Res 21, 1339-l 344 49 Fletcher, M C and Fox, K R (1996) Dtssoctatton kmettcs of echmomycm from CpG sites m different sequence envtronment Bzochemzstry 35, 1064-l 075 50 Huang, Y -Q , Rehfuss, R. P , LaPlante, S. R., Boudreau, E Borer, P N , and Lane, M J (1988) Actmomycm D Induced DNAase I cleavage enhancement caused by sequence specttic propagation of an altered DNA structure Nuclezc Aczds Res 16, 11,125-l 1,139 5 1 Bishop, K D , Borer, P N , Huang, Y -Q., and Lane, M J (1991) Actmomycm D induced DNase I hypersensitivtty and asymmetrtc structure transmission m a DNA hexadecamer Nucleic Aclds Res 19, 87 l-875 52 Maxam, A M and Gilbert, W (1980) Sequencmg end labelled DNA wtth basespecific chemical cleavages Methods Enzymol 65,499-560 53 Lavesa, M., Olsen, R K , and Fox, K. R (1993) Sequence spectfic bmdmg of [NMeCys3,N-MeCys’] TANDEM to TpA. Blochem .I 289,605-607. 54 Ward, B. Rehfuss, R , Goodisman, J , and Dabrowtak, J C (1988) Rate enhancements m the DNase I footprmting experiment Nucfezc Aczds Res 16, 1359-l 369 55 Ward, B. Rehfuss, R Goodisman, J., and Dabrowtak, J D. (1988) Determination of netropsm-DNA bmdmg constants from footprmtmg data Bzochemzstry 27, 1198-1205 56 Fox, K R and Warmg, M J (1987) Footprmtmg at low temperatures* evidence that ethidmm and other sample mtercalators can drscrimmate between different nucleottde sequences Nucleic Aczds Res 15,49 l-507

2 Quantitative

DNA Footprinting

James C. Dabrowiak,

Jerry Goodisman,

and Brian Ward

1. Introduction Footprmting analysis has been used to identify the bmdmg sites of drugs and other hgands bound to DNA molecules (see Chapter 1) (1-3). It is particularly useful for equilibrium bmdmg drugs or hgands that leave no record of their residence position on DNA In the footprmtmg procedure, the hgandDNA complex is exposed to an agent or probe that can cleave DNA, and the ohgonucleotide products from the cleavage reaction are separated using, for example, electrophoresis m a polyacrylamide gel. If the hgand, when bound, inhibits cleavage by the probe, the ohgonucleotides that terminate at the hgand binding site will be underrepresented among the products analyzed using the sequencing gel. This appears as omissions or “footprmts” m the spots on the sequencing autoradiogram In quantitative footprmtmg, digests are carried out using different concentrations of drug. Then the drug binding can be seen as a decreasein the intensity of a spot (corresponding to a particular cleavage site) with drug concentration. Since the autoradiographic spot mtensities are directly proportional to oligonucleotide concentrations, they give the proportion of sites occupied by drug so that from the dependence of spot mtenstty on drug concentration one may obtain the drug (or protein) bmdmg constant for a particular site, i.e., as a function of sequence. In this chapter, we outline the approach used to obtain binding constants for drugs bound to DNA. In Subheading 3.1., the experiment is reviewed and, m Subheadings 3.2.-3.3., the theory behind quantitative footprmtmg analysis is outlined. The method is illustrated with published results (46) for the DNA sequence shown m Fig, 1 (Subheading 3.4.), with new results for ohgonucleotide duplexes having only a single site (Subheading 3.5.). The drug used m From

Methods

m Molecular

Edlted

by

Bology,

K R Fox

Vol 90 Drug-DNA

Humana

23

Press

Interact/on

Inc , Totowa,

NJ

Protocols

Dabrowiak et al.

24

5’-AGCTTTAATGCGGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGGCACcGTGTATGAAATcTAACAA . 30% 40 50 60 70 00

90

TGCGCTCATCGTCATCCTCGGCACCGTCACCCTGGATGCTGTAGGCATAGGCTTGGTTATGCCGGTACTGCCG~3’ 100 110 120 130 140 150 160 ACGCGAGTAGCAGTAGGAG~CGTFGCqGTGGGACCTACGACAT~ATC~ACCAAT~CCATGACGGC-5’ -

-

Strong Site

u

170

Weak Site

Fig 1, The sequence of a 139-bp fragment from pBR 322 DNA Strong and weak binding sites for ActD are indicated by filled and hatched rectangles, respectively (6).

both casesIS actinomycin D (ActD). Quantitative footprinting analysis is also apphed to determination of the dissociation constantof a triple helix formed from an ohgonucleotlde and a lineanzed double-stranded plasmld (Subheading 3.6.) 2. Materials The materials and equipment necessary for quantitative footprinting analySISare readily avallable m most biochemical laboratories. The DNA substrate can be obtained from restriction cleavage of natural DNA& synthesized or generated using PCR. It 1sadvisable to purify the end-labeled DNA, using a gel to remove labeling reagents that may interfere with the equilibria being measured (7). If calf thymus DNA 1sto be added to the mixture, it should be deproteinized and sonicated prior to use. No special treatment of the enzyme DNase I 1snecessary.However, all commercial preparations of the enzyme slowly degrade m solution with time. For this reason, calibrated stocks of DNase I should be stored at -20°C until needed(8). The sequencing gel, after electrophoreSIS,can be analyzed with a phosphorlmagmg device or by autoradlography/ mlcrodensitometry to obtain quantities proportional to DNA concentrations. The concentrations can be used to measure ligand binding constants according to the method outlined in Subheaading 3.2. 3. Methods 3.7. The Footprinting Experiment: General Considerations The interpretation of the quantitative footprmtmg experiment 1sslmphfied when one terminates the cleavage reaction with -80% of the full-length DNA uncleaved. This ensures that the products are the result of a single cleavage m the full-length fragment of DNA. In this “single-hit” regime, the amount of each ohgomer 1sproportional to the probability of cleavage at the correspondmg

Quantitative DNA Footprintmg -

300

27Ol'

340:

74 %210E

25

. A

AA 1, AA A -p-‘---.._‘-a ---_ --__ -5 AA ---_ f

*

--__ --a_ A --. A .

Fig 2 Sum of the band mtenslties m a lane as a function of Actmomycm D concentration (6)

site on the original DNA. To choose the concentration of cleavage agent, the amount of DNA, and the reaction time so as to be m the single-htt regime, one carries out a series of calibration experiments in the absence of drug. One also carries out a series of reactions with vartous concentrations of the DNA-binding drug to be studied to establish the general range of drug concentration over which drug loading takes place on the polymer Since one 1strying to measure a titration curve, one wants more points for drug concentrations for which the occupation probabthty of a site varies, and fewer for drug concentrations corresponding to zero occupation or complete occupation. Afterward, experiments are performed using drug concentrattons in the range identified. From quantitation of the resulting gel, one obtains spot intenstties as a function of sequence and drug concentration. In principle, one has carried out a series of digests of identical DNA fragments in the presence of varying amounts of drug, but otherwise under identical conditions. The “total cut” plot, the sum of the spot intensities as a function of drug concentration, is shown for actmomycin D interacting with a 139-bp fragment from pBR 322 DNA m Fig. 2 (4). To account for lane-to-lane differences, a “total cut” plot, the sum of all cleavage products vs the drug concentration, 1sconstructed. Since this plot is a smooth function of drug concentration, deviattons from the curve are due to experimental error. A least-square-fit stratght line is shown m Fig. 2; in many

cases,a horizontal line, i.e., total cut = constant,fits the dataas well as a function contammg more parameters. To correct for experimental error, all spot

26

Dabrowiak et al.

mtenstties m a lane are multiplied by a common factor, the ratlo of the value of the smooth curve to the actual spot intensity sum. After making this correction, one constructs a plot of spot intensity vs drug concentration for each ohgomer. These plots are referred to as “footprinting plots.” Some footprmting plots for ActD bmding to a 139-mer are shown in Fig. 3 Their shapes can be explamed by noting that the spot Intensity is proportional to the rate of cleavage at a nucleotide position because the digest time IS constant. The rate of cleavage at site 1, m turn, may be written as: (rate), = k, [probe], where k, is the rate constant for cleavage at site i, and [probe],, the effective concentration of cleavage agent at that site, may depend on drug concentration. For a nucleotide position within a drug-bmdmg site, [probe], decreases as drug IS added to the systembecause this increases the probability that drug ~111 be bound at that site and cleavage agent cannot bmd where drug is already present. This is the classic footprmtmg phenomenon; it predicts a monotomc decrease of spot mtensity with drug concentration. If the drug-bmding constant is much larger than that for probe, so that a drug molecule always displaces a probe, [probe], will be proportional to I-vk, where vk IS the fraction of sites 1 having drug bound. For a nucleotide site not within a drug bmdmg site, the spot mtensity should not depend on drug concentration. For relatively long DNA molecules, spot mtensities correspondmg to sites between drug-bmdmg sites are observed to mcrease as drug is added to the system. If DNA is not saturated with probe, increased cleavage with added drug may occur because bound drug decreasesthe amount of cleavage agent at drug binding sites and, hence, must increase tt elsewhere, i.e., m bulk solution and at sites not blocked by drug. The increase m [probe], is important when the ratio of probe concentration to DNA concentration 1ssmall. It ~111not occur when the DNA is saturated wtth probe. It is also possible that drug binding induces a structural change in the DNA, changing the cleavage rate constant k,. This could lead to either an increase or a decrease in (rate),, superposed on the mass-action effect just mentioned. Intercalating drugs like ActD are more likely to cause a distortion m DNA upon bmdmg than are groove-bmdmg drugs like netropsin (9). Alterations in cleavage rate constantsk, may explain apparent osclllations seenin some footprintmg plots for low drug concentrations,O-2 l.tA4,Fig. 3. Some of the footprinting plots shown seem to be composites: cleavage is first enhanced and then mhlbtted by increased drug concentration. Nonmonotomc footprmting plots arise for cleavage sites within secondary drug-binding sites, with lower bmdmg constants than primary drug-binding sites. The explanation is that, for lower drug concentrations, drugs bind at the primary sites, displacmg probe and leading to enhanced cleavage at other sites. At higher drug concen-

Quantitative DNA Foo tprin tmg

0.0

.

..

. . . ..‘.‘..““.‘~,‘,“.‘,.,,.,..,.)

’

‘“[A&&i&y’”

”

7.0 6.0 5.0 4.0 3.0 2.0 1.0 0.0

[Actinomycin],

Fig 3. Footprinting

p M

plots for selected sites on the 139-mer shown in Fig. 1

drug binds at the secondary sites, thus blocking probe binding and decreasing cleavage. Footprinting plots are like titration curves except that fractronal occupation is being plotted agamst total drug concentratron rather than against free-drug concentration. Although footprinting plots are not linear, it IS sometimes useful to fit their behavior at low drug concentration to a straight line. Then one can

tratlons,

4o

28

Dabrowiak et al.

calculate “mitial relative slopes,” i.e., the slope of the lme divided by the intercept. Plotted as a function of sequenceof the fragment, the mitral relative slopes clearly show the positions of drug binding. They may also point to possible druginduced structural changes and enhancements caused by the mass-action effect 3.2. Constructing the Model The first step m constructmg a model for drug bmdmg and tts effect on cleavage is to inspect footprmting plots or initial relative slopes One can deduce the size of the inhibition region, i.e., how many sites are blocked by binding of a drug molecule. One wants footprmting plots for as many sites as possible, but, for some sites, if DNase I is the cutting agent, mtensmes will be low, and reliable mformation on the effect of drug concentratton on cleavage will be difficult to obtam Another comphcation is that single-site resolution cannot be obtained over the entire sequencing autoradiogram. Resolution along the DNA helix decreases as ohgomer length increases, so one obtains less mformatton about bmdmg sites that are far from the radiolabel. The size of the mhibmon region depends on the drug as well as the probe. For ActD, the preferred intercalation site for the phenoxazone rmg 1s5’-GC-3’, with the two cychc pentapeptides displaced 1 bp to either side of the mtercalation site (9). A single ActD molecule would thus cover about 4 bp of DNA However, DNase I has a small loop, important to the binding process, that fits mto the minor groove of DNA, and spans 3-4 bp of DNA (20). Smce the catalytic site is located at the end of the loop, there ISan mhibmon region of 3-4 bp to the 3’ side of a bound ActD molecule. The enzyme-DNA contacts on the other side of the catalytic site are relatively weak, so the enzyme can probably cleave near the 5’ edge of a drug site. Thus, the inhibition region would be 7-8 bp m length. For an isolated drug-binding site j, the concentratton of bound drug is related to the bmdmg constant KJ by: K, =

cJ (c - c,>Do

Here, c, 1s the concentration of sites J at which drug is bound, c is the total concentration of sites J (equal to the concentration of DNA m molecules), and D, is the free-drug concentration The probability that a probe site i wtthm the inhibition region of drug site j is blocked by drug, v,, is equal to c,/c. Then [probe], is proportional to: 1- v, = (1 + K,D,)-’ If two drug sites j and k, with bmdmg constants K, and &, are near enough to each other so that a probe site 1may be blocked by drug bmdmg at either site J or site k:

29

Quantitative DNA Footprintmg l-vl=il-~h-y-~=(~

+KkD0>

+K,p):l0

If, however, two drug sites j and k are so close that drug binding at one prevents drug binding at the other, the probability of drug bmdmg at site j ISK,D,l (1 + K,D, + &D,,), with a similar expression for the probability of binding at site k. Then the probability that there is no drug blocking probe bmdmg at probe site i 1s: l-v*=

1

(1 + KJDo+K,D,)

Because the drug sites are not independent, one cannot srmply multiply together the probabilmes that each one is vacant. The total concentration of probe at all cleavage sites depends on the drugprobe competition. If the total cut IS constant as a function of drug concentration, the system behaves as if the amount of probe available for binding to DNA is unchanged by the addition of drug. Added drug decreasesprobe concentration at drug-bindmg sites of the DNA and increases it at other sites. If the number of avallable probe molecules is small compared to U, the number of unblocked sites, the concentration of probe at such sites should be inversely proportional to U. This effect IS represented by dividing [probe], by (1 -K.&, where cb IS the total concentration of drug bound to DNA and the “enhancement constant” K, is a parameter whose value is determined along with drugbindmg constants. If the probe and the hgand are specific for certain sites, or the DNA molecule IS so small that drug and probe compete for a common site, one can consider explicitly the competmve equilibrium between drug and probe. The probabtlity that probe is bound at a site is determmed by the stmultaneous equilibrium expressions* Cl

K, =

(c - cl - q,,)Do

, K,,

CPl

=

(c - Cl -

CpJPo

Here, c, is the concentration of sites I with drug bound and c,,,the concentration of sites i with probe bound, so that c-c, -cP, is the concentration of empty sites I. D, and PO are the concentrations of unbound drug and unbound probe, so tgb§, for isolated sites: Do=Dt-

cI c,

Po=Pt-C

cp1 I

with D, and Pt the (known) total drug and probe concentrattons. The above equations are solved simultaneously to get c, and c,,,.

30

Dabrowiak et al.

Often, unlabeled carrier DNA is present in addition to the DNA fragment whose cleavage products are measured. The carrier, if present m large excess over the fragment, determines the concentration of free drug present m the system. One has to model drug bmdmg by the carrier because the free-drug concentration enters the bindmg constant expressions for the radiolabeled fragment If the carrier DNA has approximately the same base-pair composition as the fragment, the number of strong drug-bmdmJpsites on the carrier can be estimated from the number on the fragment. Otherwise, one may represent drug bmdmg to the carrier in terms of an effective concentration of strong sttes on the carrier, c,, and an average binding constant for these sites, KC. Then the amount of drug bound to the carrier, cb, 1sgtven fi. .: Kc=

cb (cc

- Cb)&

where D, is equal to the total drug concentration minus the concentration of drug bound to the radtolabeled fragments and the concentration of drug bound to the carrier. Because the carrier is present in large excess,D, = D, - cb. The values of the parameters c, and Kc may be determined along with other constants in the mimmizatton (see Subheading 3.3.). Sometimes only the product of c, and Kc may be determined reliably. A fragment may have weak-bmding sites in addition to strong sites. If one goes to high enough drug concentration so that binding to the weaker sites 1simportant, one must consider similar weak sites on the carrier. To summarize, there are a number of causesfor an alteration m the cleavage rate of a probe in drug-DNA footprmtmg experiments. Although enhancements are often attributed to drug- or protein-induced structural changes in DNA, there are other factors that can affect the cleavage rate without changing the cleavage rate constant. 3.3. Parameter Search The individual site binding constants, K,, and other parameters are chosen to minimize the devtation between theoretical and experimental footprmtmg plots:

D=c (I,1 -i,,’ Here I,, is the jth measured intensity (corresponding to the jth drug concentration) for an ollgomer formed by cleavage at site 1 and i,j is the correspondmg intensity calculated using the parameters. To calculate i,,, [probe], 1sevaluated for thejth total-drug concentration using given values of the parametersK,, c, Kc, and K,, The drug-bmndmgconstantsdetermine the probability that site 1is blocked by drug, and [probe], is proportional to 1

Quantitative DNA Footprin ting minus thts probability. The free-drug concentration, required to calculate the probability of drug binding, must be calculated from the known total drug concentration Dt by combmmg 0, = D, - ,S,c,with the equiltbrmm-constant expresstons. If a carrier is present, binding to the carrier must also be considered usmg a single site of concentration c, and equilibrium constant Kc, unless the drug concentrations used are high enough to require modeling weak sites on the carrier as well. The cleavage rate constants k,, which multiply [probe], to give the cleavage rate, are additional parameters; smce these are linear, the best values to use for them can be determined analytically. For the nonlinear parameters, a systematic search algorithm in multiparameter space is required The search procedure used 1sthe Simplex Method. It is conceivable that there are several relative minima for D, and there IS no way to guarantee that the minimum found is the true absolute mmimum. To gain confidence in the result, one may carry out the simplex search several times with different starting points. If the deviations of the calculated i,] from the experimental intensities I,Jare no larger in sizethan the fluctuations of I,J from one drug concentratton to the next, the model is said to fit the data, Naturally, use of a model wtth more parameters (for example, describing cooperative or anticooperative drug bmdmg) will always give a smaller value of D, but it makes no senseto increase the number of parameters when the deviations )I,,-i,, ] are already smaller than the experimental error. The more parameters used, moreover, the less likely it will be that they will be mutually independent, which will make the search procedure work less well. To assign a precision to the values of parameters determined m this way, one can examme the effect of a change m the value of one parameter on the value of D. It is usually found that changing an equilibrium constant by a few percent changes D by 10% or more. Naturally, if the bmdmg constants have different magnitudes, D is least sensitive to the values of the smallest. Note also that one can generally change a parameter by more than a few percent without much changing D, if other parameters are allowed to adjust then values. 3.4. Application to a Multisite Problem The approach outlined in Subheadings 3.2.-3.3. is now applied to the multisite restriction fragment of Fig. 1. The authors’ first work concentrated (4,s) on the strong drug-binding sites, usmg only footprmtmg data for low drug concentration, but a later study, using data for more sites and for a wider range of drug concentration, obtained binding constants for the weaker sues as well (6). For this system, drug binding to DNA causesthe cleavage agent, DNase I, to redistribute to DNA sites not blocked by bound drug (11). The DNase I footprmtmg experiments were carried out in the presence of calf thymus DNA as a carrier (193 @4 in bp), usmg as many as 26 different

32

Dabrowiak et al.

ActD concentrations from 0 to 38.8 pJ4. The mtenstties of spots corresponding to cut fragments were obtained by microdensitometric scanning of the sequencmg autoradiogram. The resulting total-cut plot, shown m Fig. 2, was used to correct for lane-to-lane vartattons The linear fit, shown m Fig. 2, was 247 1 0.825c,, with a mean-square devtatton of 19.9; fittmg to a quadratic function gave a mean-square devlatton of 18.4. The average of the total cleavage was 239.1, with a mean-square devtatton of 22.2 The decrease m mean-square deviation with more complicated functtons is not stattsttcally significant, and it 1sconcluded that total cleavage IS essentially constant as a function of drug concentration. Total-cut corrected mtenstttes were used to construct footprmtmg plots for 69 sites on the 139-mer, a few of which are shown m Fig. 3. To determine the bmdmg regions, “imtlal relative slopes” were obtamed and plotted vs site. Drug-bmdmg regions were clearly apparent as negative initial relative slopes surrounded by large positive slopes. The sequencesat which the negative slopes appeared indicated that ActD binds most strongly to S-GC-3’ and that the mhibttion region extends from -3 bp to the 5’ side of G to -2 bp to the 3’ side of C, for a total length of 6-7 bp. The first study, focusing on the stronger drug-binding sites,included data from 32 sites, excluding sites for which spot mtensmeswere too low for reliable measurement. These sites were: 54-56, 60, 62-69, 71-72, 85, 87, 98, 99, 102, 103, 106, 112, 114, 120, 124, 128, 133, 136, 138, 143, 145, and 161 (Fig. 1). As mentioned, resolution decreasesfor the longer fragments. Sites 54-56, 85, 87, 106, 112, 114, 120, 143, and 145 behaved as enhancement sites, whereas the others showed inhibition of cleavage due to drug bmdmg. Cutting at sites from 6 1 to 72 was inhibited by drug binding to the GC’s at 63-64 and 69-70; cuttmg at sites from 98 to 105 was inhibited by drug binding to the GC’s at 101- 102 and 103- 104; sites from 133 to 138 were influenced by the GC drug-binding site at 137- 138; and site 161 was influenced by the GC site at 160-161. Sites 124 and 128 exhibited inhibition, but lessthan thosejust listed. It is believed they point to a weak drug-binding site that is not 5’-GC-3’, but has the sequence 5’-CGTC-3’. Note that the drug-binding sites at 101-102 and 103- 104 are expected to be mutually exclusive: they cannot bind drug simultaneously. However, the sites at 63-64 and 69-70 seem far enough apart to permit simultaneous drug binding at both. There is weak binding to the sequence 5’-GGC-3’. This is shown m the footprinting plots for sites having this sequenceon the 139-mer. Data were used for 19 drug concentrationsfrom 0 to 12.4 pM, so that there were 608 data points, to be used to determine rune nonlinear parameters, These were the seven drug-binding constants, for the six GC sites and the site at 124- 127, the drug binding constant to the caner, and an enhancement constant K,. The values of all the nme parameters were determined by calculating intensities to

33

Quantitative DNA Footprinting

be compared with all 608 measured intensities and minimizing D with respect to the parameters. Since the concentration of carrier DNA (193 @4 in bp) far exceeds the concentration of fragment DNA (estimated to be 0.2 FM m bp), the free-drug concentratton for any total-drug concentration IS mainly determined by the equihbrium for carrier DNA. The free-drug concentrations were used in the drug-fragment DNA equilibrium expressions to calculate fractional occupation of sites and hence inhibition of binding of cleavage agent. To estimate the concentration of strong drug-binding sites on the carrier, it is noted that, in a 114-bp segment of the 139-mer, there are five strong ActD sites (excluding the site at 124-127). Then, if the basesin the (calfthymus) carrier DNA are dtstributed like the bases in the fragment DNA, 193 pA4 bp concentration should provide a strong-site concentration of (5/l 14)( 193) = 8.5 pA4, or--considering the two mutually exclusive sites as a single s&-(4/1 14)( 193) = 6.8 PM If the carrier is considered as a random arrangement of base pairs with a fraction 0.6 being A or T and a fraction 0.4 G or C, the probability of tindmg a G or a C at an arbitrary position is 0.2, and the probabihty of finding a GC with no G to the 3’ side (i.e., not GGC) is (0.8)(0.2)(0.2) = 0.032. Then the concentration of strong actinomycin siteson the carrier is estimatedas (0.032) (193 PM) = 6.2 @4. One can also determine this concentration, c,, using the footprrntmg data, by making c, an additional parameter to be varied m the mmlmizatton of D. It was found that D went through a minimum as a function of c, at c, = 4.7 @4, In this case, c, and K, are not mutually dependent. The footprmting plots for the higher drug concentrations (> 10 PM) suggest there are many additional bmdmg sites on the fragment, with lower binding constants than those considered so far. Such sites must exist on the carrier as well, and be considered in a model to explain footpnntmg data for higher totaldrug concentrations. Their mclusion lowers the free-drug concentration D, for any total-drug concentration, and leads to higher apparent binding constants to fragment sites. Therefore, weak-binding carrier sites were added with total effective concentration c, and average binding constant K, to the model, If c, is the concentration of drug bound to weak sites: Kw = (cw ~&A7

The total drug concentration then satisfies: Dt = Do + cb + c = Do + ccKQO + cwKwDo 1 + K,D,,

1 + K,D,

In these calculations, c, = 5 @4 and first estimated c, from a consideratron of the relative numbers of strong and weak sites on the fragment. Later, c,, K,,

34

Dabrowiak et al.

and K, were determmed along with the other nonhnear parameters by mimmizing D, giving c, near 10 pM The values found for the fragment-binding constants for the strong sites were somewhat lower than those reported by Chen (12) for ActD bmdmg to small oligonucleotide duplexes, measured optically. Phasepartition studies of Winkle and Krugh (13) on polymeric DNAs such as poly dG-poly dG yielded bmdmg constants consistent with those obtained from the footprinting experiments. This suggests that small ohgomers have higher binding constants for this drug than do polymeric DNAs. As noted, the footprintmg data show that ActD binds to the sequence S-CGTC-3’, that does not contam a 5’-GC-3’ site. This is consistent with the report of Snyder et al. (14) that two ActD molecules bmd to the self-complementary duplex d(CGTCGACG)*. The binding is cooperative and the complex exhibits aberrant spectroscopic and calorimetric behavior, suggesting that binding at this site is different from that at sites having 5’-GC-3’. The apparent binding constant reported by Snyder et al. (14) is 1.5 x 107M-‘, about two orders of magnitude higher than this value, perhaps because of the effect of DNA length or to the fact that the spectroscopic/calorimetric experiments measure two events that are cooperative. The analysisdoes not consider drug-induced structural changesin DNA. If drug binding at onesite causesa structuralchange,it could affect cleavagewithin a second drug-binding site,and changethe appearanceof the correspondmgfootprintmg plots, There are, m most of the footprmtmg plots, noticeable at an ActD concentration of -2 rnM, which may be the result of structural changeson the fragment and/or the carrier DNA. For example, it is known that mtercalation of ActD bends the DNA helix (15). This could releasehgand to solution or decreasethe free-hgand concentration by enhancedbinding. The anomalous footprinting plots for sitessuch as 58 and 59 (Fig. 3) may also be the result of alterations m DNA structure.The mitral relative slopesof the plots for 58 and 59 are, respectively, above andbelow what is expected from the simple mass-action mechanism. A DNA-cleaving metalloporphyrm, like DNase I, shows anomalous cleavage rates m this region of the 139-mer in ActD footprinting experiments (4), Since groove width and DNA flexibility are known to affect DNase I cleavage, mtercalation by ActD at nearby sites could affect cleavage in this region A later analysis of footprinting data for this system used data for 26 actinomycin concentrations from 0 to 38.8 rnM, m order to identify the weaker binding sites and derive their binding constants. Since the actmomycin concentrations were large enough to show binding to the weak sites, it was necessary to include weak as well as strong sites in modeling the carrier. This work also allowed for closer consideration of possible structural changes m DNA. The HzndIIIINczI 139-bp restriction fragment from pBR-322 DNA was end-labeled at position 33(A) for one set of experiments and at position

Quan tita We DNA Footprin ting

35

172(G) for a second set (6). In the second set, the labeled fragments produced by cleavage at the higher-numbered sites were shorter, yielding better site resolution for these sites. However, only 10 drug concentrations were used in these experiments: 2.48, 3.40, 4.86, 6.93, 9.89, 14.1, 20.2,28.8,41.0, and 58.7 PM. After rejecting data for sites showing very low or unreliable spot intensities, data were retained for 54 sites for the A-label gel, and 43 sites for the G-label gel. For the A-label experiment, the footprinting plots were similar to those of the G-label experiment: some showed a decrease in cleavage with increased drug concentration, correspondmg to drug bindmg Interfering with cleavage by the enzyme. Those showing the most rapid decreases were associated with the strongest binding sites. Some sites showed an increase in cleavage for low drug concentration, followed by a decrease, explained by nearby weak drug sites not occupied by drug until the drug concentration reached a high value. Other sites showed a rapid increase or enhancement m cleavage with drug concentration, believed to be caused by the mass-action effect, bound drug displacing cleavage agent to sites where no drug 1sbound. A few satesshowed only a slow Increase in cleavage with drug concentration, interpreted as pointing to very weak drug sites for which drug bindmg canceled some of the enhancement effect because of mass action. The weak binding sites found from this qualitative analysis of the footprintmg plots had sequences*GGC (at 76-78), CCG (at 80-82), GGC (at 119-121), CCGT (at 123-126), CCC (at 129-131), GGC (at 143-145), GGC (at 149-151), GCCGG (at 160-164), and other sequencesnear 86 and 112. The strong binding sites were those identified m the previous work: the sequence GC at 63-64. 69-70. 101-102, 103-104, 137-138, and 160-161. The footprinting data from the G-label gel were analyzed using the model of strong and weak drug-binding sites developed from the analysis of the A-label gel. The data from the G-label gel showed more scatter than the data from the A-label gel, as can be seen on comparing the total-cut plots (6). Interestingly, there seems to be a drop-off in the total cut near drug concentration of 20 @4, suggesting that this is a real effect. Because there were fewer data points, fewer rehable values for binding constants were obtained from the G-label gel. The bmding constants are compared to those from the A-label gel in Table 1. It should be noted that site resolution for the A-label gel is highest for smaller site numbers and the reverse for the G-label gel. Therefore, the first few binding constants will be determined more reliably from the A-label gel, and the last few will be determined more reliably from the G-label gel, In general, binding constants from the two analyses agree to within a factor of two (note that the binding constants span two orders of magnitude), except for the TGCT site at 62-65, for which one must take the value from the Alabel gel as the valid one.

Dabrowiak et al.

36

Table 1 ActD-Binding Constants on 139-bp Restriction Fragment, in (@W-1 (6) Posrtion 62-65 68-71 76-79 80-83

100-103 102-l 05 118-1 21 123-1 26 128-1 31 136-1 39 143-1 46 149-152 159-162

Sequence

From A-label gel

TGCT CGCA GGCA CCGT TGCG CGCT CGGC CCGT ACCC TGCT GGCA GGCT TGCC

3 50

048

1 80 0.21 0 18

0 13 0 17

2.50 2.00 0.12

2 20 0.88 003 0.09 048 3 00 020 008 045

0.18 0.94 640 0.25

0 05 042

From G-label gel

The highest bmdmg constant found on the fragment, 6 x 106W1, occurs for the sequence S-TGCT-3’ at sites 136-139. The same sequence occurs at sites 62-65; the binding constant here 1sdetermined to be 4 x 1O6AR’. If, as 1sbelieved,

bmdmg constants can be determmed to better accuracy than 50%, the difference between these two values ts real, implying that basesflankmg the tetramer may change its binding constant. As another example, the binding constant for the 5’-GCGC-3’ sequence at sites 101-l 04 was determmed as 2 x 1O6 M-* in this work, and quantitatrve footprinting studies of ActD bmdmg to the fragment d(TAGCGCTA), returned a value double this The discrepancy may be because of flanking sequences again, or to end effects associated (12) with short pieces of DNA. Another problem 1sthat the values of all drug-binding constants depend to some

extent on how the carrier is modeled. In this work, the carrier was considered to have both strong and weak sites, requrrmg four parameters, two (average) bmding constants and two (effective) concentrations. The concentration of strong sites was fixed at 5 @4, based on earlier work, and the other three parameters were varied. Their values, determined by mmimtzatton of D, were 10 PM, 1.1 x 1O7W*, and 4.7 x 1O5M-i, respectively. Although the average deviation between experimental and calculated intensities approached the estimated experimental error, the deviations in certain footprintmg

plots remained

significant.

Some experimental

plots had shapes

that could not be explamed by the model. For example, mtensities for site 59, Fig. 3, modeled as an enhancement site, are roughly constant for drug concen-

Quan tita We DNA Foo tprin ting

37

trations ~20 pA4,and also constant, but at about double the original value, for concentrations ~30 piH. Other footprmting plots seem to be responding to drug binding, but are not near any site at which drug could reasonably be expected to bind. Also, many footprintmg plots show a small but abrupt decrease in Intensity near 2 PMdrug concentration, followed by an abrupt increase. These effects were considered in a second publication, which attempted to show how one could distmguish between enhancements caused by structural effects and the mass-action effect (II). 3.5. Single-Site Problem: ActD Binding to Dodecamers The analysis for cleavage of small, single-site, oligonucleotides by DNase I IS given here (16). Footprmtmg titration studies were performed on several different self-complementary 16-bp sequencescontaining actmomycm-binding sites. The sequences for a single strand were: GC 1: 5’-CTTTTTTGCAAAAAAG-3’ GC 1AT. S-CATATATGCATATATG-3’

Intensities corresponding to cut fragments of various lengths, as well as the full-length, uncut fragment, were measured for different concentrations of ActD. Several sets of intensities were collected for each olrgomer. Many included intensities for cleavage at all sites from 5 through 16 (uncut ohgomers); for some, lack of resolution made it necessary to combme intensities for several sites. The nucleotide positions on the duplexes are numbered from left to right on the sequences shown above. The concentration of DNase I was -0.1 @4, the concentration of hexadecamers was 0.625 uA4, and the concentration of actinomycin varied from 0 to 31 uLMm some data setsand from 0 to 100 ~IV m others. To correct for loading errors and differences in digest time, the total cut was calculated and fitted to a linear (decreasing) function of drug concentration. Intensities for each drug concentration were then corrected as discussed m Subheading 3.2. From plots of corrected intensities vs drug concentration, it was easy to determine which cleavage sites are blocked by drug. For GCl, intensities for sites 10 through 7 decreased strongly with mcreasing drug concentration, and intensities for sites 11 and 6 less strongly, mdicating the end of the blockage region. This means that the blockage region is less than 8 bp long, with GC (at sites 8 and 9) approximately in the middle, For GC 1AT, inhibition of cleavage by drug was evident for sites 5 through 12, and less evident for site 13. The data for the inhibition sites on GCl were analyzed according to the competitive-binding model, in which each site can be empty, occupied by drug, or occupied by probe (DNase I), and the probability of cleavage (and hence

Dabrowiak et al.

38

spot intensity) is proporttonal to the occupation by probe. For each total-drug concentration D,, one solves the stmultaneous equthbrmm expressions: Cvb

K= (C - CVb

- CVp)

CVP

andKp = (Dt

- CVb)

(C - Cvl,

-

C’.‘p)

(P,

-

Cvp)

to obtam the concentration of probe bound at a site. Here, c is the concentration of sites, nb and nPare the fraction of sites wtth drug and probe bound, respecttvely, and Pt IS the total probe concentration. The amount of fragment produced by cleavage at a site is assumed proportional to n,,.Binding constants for both probe (K,, assumed the same for all sites) and drug (K) are determmed by seeking the values of these parameters, whtch give the best fit of calculated to experimental intensities. Since only mhibttion sites are considered, t-t,,is the same for all sites, so the theoretical curves of spot mtensity vs drug concentration for different sites differ only by a multtphcative constant. It was found that mtenstties for cut fragments did not approach zero when the actinomycm concentration approached zero, mdicatmg that fragments of length less than 16 were present m the origmal DNA To represent this, it was assumed that the intensity of fragment I for total drug concentration D, is* Here A, and B, are constants (different for different sites) to be determined by fitting to experimental intenstttes, B, giving the intensity because of fragments of length i present in the original DNA For analyzing the GCI data, intensities for drug-bmdmg sites 6 through 11 were used. Most data sets mvolve 2 1 drug concentrations, so there are 126 data pomts. In addition to the drug-bindmg constant K and the probe-binding constant Z$,, there are 12 lmear parameters, A, and B, for each sue 1. Values of parameters are chosen to mnumize the sum of the squared deviations of calculated from expertmental mtensittes. For GC 1AT, data for five or six drugbmding sttes were used, since mtensmes for mdivtdual sites could not always be resolved. Most of the data sets include mtensities for 21 drug concentrations. Some representative results are shown m Fig. 4. The determined values of K for GCl (four sets of expertments used) and GCl AT (five setsof experiments) are given m Table 2. Values of tP determined from the GC 1AT experimentsare also gtven. For GC 1, the averageK 1s0.180 pm’ with the root-mean-square deviation from the average 0.082 PM-‘, For GC 1AT, the average K is 0 168 pm’ with the root-mean-square deviation from the average 0.021 pm’. It does not seem that there is a significant difference between the drug-binding constants for GC 1 and GC 1AT. In contrast, actinomytin binding constants for strong sttes on restrictton fragments vary widely, dependmg on the sttes netghbormg the GC

Quantitative DNA Footpnnting 4ooa

El

3000

i! t: JY zooc !a

150

ui

100

u” 1000 ii

SO

L1

0

in

[Actinomycin]

pM

[Actmomycm]

m WM

Fig 4. Footprintmg plots for several cleavage sttes on the hexadecamer GC 1, 5’-CTTTTTTGCAAAAAAG-3’, with a single bmdmg site for ActD. Table 2 Binding Constant to Oligonucleotide

K for ActD Binding Duplexes in @Pi (16)

Deternnnatton

GCl

A B C D E

0317 0.112 0 119 0 173

GCIAT 0 207 0 1.51 0 152 0 156 0.176

3.6. Measurement of Triple-Helix Dissociation Constant using a Type IIS Restriction Enzyme as Probe The footprinting method has been used to determme the dtssociatton constant of a triple heltx, formed by interaction of the ohgonucleottde dT,, and the 272%bp plasmid pA20 shown below (17). The plasmid was constructed to contain a target sequence for dT2a as well as three cleavage sites for the type IIS restriction enzyme Eco571, at bp 429, 1375, and 2423, the first lying wtthm the dTZOtarget sequence. Cleavage and end-labeling of the plasmid at the Me1 site (position 183) produced the doubly end-labeled lmeartzed plasmtd shown below. (The binding region for dT,, is shown by x’s) Eco571 183

429

Eco571 1375

Eco571 2423

NdeI 2728

xxxxxxx

Limited (single-hit) digests of linear pA20 with Eco571 could produce seven possible labeled fragments; m fact, they produced mostly fragments of lengths

Dabrowiak et al.

40

2728 (uncut plasmid), 488 (band l), and 246 (band 2) bp. Bands 1 and 2 are the result of Eco571 cleavage at positions 2423 and 429, respectively. Because site 429 lies within the target region for dT,, and site 2423 does not, the presence of dTZo decreases the intensity of band 2 whereas that of band 1 is unchanged. Band 1 was used as an internal standard to correct for lane-to-lane variances. Since the concentrations of dTZO for which intensities of band 2 changed markedly ranged from 0.065 to 1.OuMand the concentration of PA,,, was only 0.3 nA4,the free-ligand concentration could be assumed equal to the total hgand concentration for [dT,,] > 0.065 PM. This also held for lower concentrations, for which there was no appreciable bmdmg of dT,, to the duplex. It was also shown that one could neglect binding of lrgand to Lambda DNA, which contams 40 Eco571 sites and was added to the reactions as a carrier, buffering the endonuclease Eco571 Intensities of bands 1 and 2 were measured for fourteen values of [dT,,]: 0 and 13 concentrations from 0.001 to 4.16 PM. After subtracting background (intensities m the absence of enzyme), the intensity for band 2 for each [dT2e] was divided by the corresponding intensity for band 1 to produce the experimental points plotted m Figure 5. These were used to find the dissociation equilibrium constant Kd, where:

Kd= ([TWPIY[-U Here, D refers to duplex, T refers to triplex (i.e., duplex with dTZObound), and [TFO] is the concentration of free dT,, (TFO = triple-helix-forming oligonucleotide). If only duplex, and not triplex, can be cleaved by Eco571, the intensity of band 2 (I), divided by the intensity in the absence of drug (IO), should be equal to the fraction of duplexes with no dTZObound. Therefore: r=

[Dl

1’

[D] + [T]

=

Kd & + [TFO]

As indicated above, the concentration of free dTZOwas considered to be equal to the total concentration of dT2,. The assumption that I/I0 IS equal to the fraction of duplexes with no dTZO bound is valid when the binding constant of dT,a to the duplex is much larger than the binding constant of Eco571 to its sites on the duplex. Then bound ltgand always displaces probe. To show that this 1sthe case m these measurements, the mtensitres of bands 1 and 2 were measured for 15 concentrations of Eco571, in the absence of dT2e and in the presence of 0.076 pMdT,a. For band I, intensities were not changed by the dT,,; for band 2, dTZOreduced mtensmes by the same factor for all Eco571 concentrations, as should be the case tf bound ligand always displaces probe.

Quan tita We DNA Foo tpnn ting

41

h

x2.5 ii Tj2.0

Fig. 5. Intensity of band 2 as a function of concentration of triple-helix oligomer (Z 7)

forming

To find Kd, the 14 intensities were fitted to I = IO&/(& + [TFO]) by seeking the values of the parameters I0 and Kd, which minimized the sum of the squares of the deviations between calculated and measured values of I (a simplex search was used). The results were. I0 = 2.21~0.17andKd=0.172f0009@4(errors are standard deviattons). The fitted intensities are given by the curve in Fig 5. The sum of the squares of the deviations was 0.152. The value of Kd 1s consistent with values measured for similar triplexes, using quantitative affimty cleavage and DNase I footprmtmg (28). Since type IIS restriction enzymes like Eco571 cleave DNA with little sequence specificity, they should be useful probes for measuring other DNA-hgand interactions. The ease with which an internal standard 1s included (cleavage at nonligandbinding sites) and the simplicity with which the data may be mterpreted and analyzed constitute two reasons for further experimentation with these probes. Acknowledgment The authors wish to thank J. B. Chalres and Julio Herrera for kindly providing the footprinting data for the oligonucleotlde duplexes. References 1. Dabrowiak, J. C., Stankus,A. A., andGoodisman,J. (1992) Sequencespecificity of drug-DNA interactlons m “Nucleic acid targeted drug design” (Propst, C. L. and Perun, T. J., eds.), Marcel Dekker, New York, pp 93-149.

42

Dabrowiak et al.

2 Shubsda, M., Klshlkawa, H.. Goodisman, J , and Dabrowtak, J C (1994) Quantitative footprmtmg analysis J A401 Recogn 7, 133-139 3 Dabrowlak, J. C and Goodlsman, J (1989) Quantltatlve footprmtmg analysis of drug-DNA mteractlons m Chemistry and Physzcs of DNA-Lzgand Interactzons

(Kallenbach, N. P., ed ), Adenme, Gullderland, NY, pp 143-174 4 Rehfuss, R., Goodlsman, J,, and Dabrowlak, J C (1990) Quantitative footprmtmg analysis of the actmomycm D-DNA mteractlon, m Molecular Baszs of Speczjkzty zn Nuclezc Aczd-Drug Interactions (Pullman, B and Jortner, J., eds.), Kluwer Academic, Netherlands, pp 157-I 66 5 Ward, B , Rehfuss, R , Goodlsman, J , and Dabrowlak, J C (1988) Rate enhancements m the DNase I footprmting experiment. Nucleic Aczds Res 16, 135%1369 6 Goodlsman, J., Rehfuss, R., Ward, B , and Dabrowlak, J C (1992) Site specific bmdmg constants for actmomycm D on DNA determined from footprmtmg studles Blochemlstry 31, 1046-1058 7. Sambrook, J , Fntsch, E F , and Mamatls, T (1989) Molecular Clonmg, A Laboratory Manual, 2nd ed , Cold Sprmg Harbor Laboratory, Cold Sprmg Harbor, NY 8. Ward, B and Dabrowlak, J C (1988) Stablhty of DNase I m footprmtmg expenments Nucleic Aczds Res 16, 8724 9 Gale, E F., Cundhffe, E , Reynolds, P. E , Richmond, M H , and Warmg, M J (198 1) The molecular basis of antlblotlc action Wiley, London 10 Suck, D , Lahm, A., and Oefner, C. (1988) Structure refined to 2A of a mcked DNA octanucleotlde complex with DNase I Nature 332,465-468. 11. Goodlsman, J and Dabrowlak, J C. (1992) Structural changes and enhancements in DNase I footprintmg experiments. Bzochemzstry 31, 1058-1064. 12. Chen, F -M. (1992) Bmdmg specificities of actmomycm D to non-self-complementary XGCY-tetranucleotlde sequences. Biochemistry 31, 6223-6228 13 Winkle, S A. and Krugh, T R (1981) Equlhbrlum bmdmg of carcmogen and antitumor antiblotlcs to DNA site selectivity, cooperativlty, allosterlsm Nucleic Aczds Res. 9,375-3 186. 14 Snyder, J. G , Hartman, N G , D’Estantolt, B L , Kennard, 0 , Remeta, D P , and Breslauer, K. J (1989), Binding of actinomycin D to DNA evidence for a nonclassical high-affinity bmdmg mode that does not require GpC sites Proc Nat1 Acad. Scl USA 86,3968-3972 15 Kamitori, S. and Takusagawa, F (1992) Crystal structure of the 2.1 complex between d(GAAGCTTC) and the anticancer drug actmomycm D J A401 Bzol 225,445-456. 16 Herrera, J E (1993) Ph. D Dlssertatlon, University of Mississippi. 17 Ward, B. (1996) Type IIS restriction enzyme footprmtmg I. Measurement

a triple helix dlssoclatlon

constant with Eco57I at 25’C

of Nucleic Acids Res

24,2435-2440 18 Best, G C and Dervan, P. B (1995) Energetlcs of formation

of sixteen triple helical complexes which vary at a single position within a pyrlmldme motif J Am Chem Sac 117, 1187-l 193

Uranyl Photoprobing of DNA Structures and Drug-DNA Complexes Niels Erik Mdlegaard

and Peter E. Nielsen

1. Introduction The uranyl(IV) ion (UOZ2’) binds strongly to the phosphates of DNA and, upon irradiation with long wavelength ultraviolet light, the proximal deoxyriboses are oxidized by the photochemically excited state of the many1 ion, a very strong oxidant (1). Thus the uranyl ion is an efficient DNA photocleavage reagent (2,3) that has been used to study the sequence specific interaction with the phosphates of the DNA backbone of the respective DNA recogmtion sites of various proteins, such as the h-repressor/OR1 complex (3), RNA polymerasedeoP 1 promoter of Escherzchza coli (4), RNA polymerase/cyclic AMP receptor protein (CRP)-deoP2 promoter of E coli (S), CRP/CytR repressor-deoP2 promoter of E. colz (5), and transcription factor IIIAIXenopus 5s internal control region (6). It was also found that the sequence-dependent modulation of the uranylmediated DNA photocleavage is specifically influenced by the pH of the medium (7,s). Whereas the cleavage pattern is rather uniform at neutral pH, a strong modulation was observed at slightly acidic pH (pH 16.5), and this modulation reflects the conformation of the DNA helix since regions of narrowed minor groove--such as (A/T),, tracts-are cleaved several fold more efficiently than regions of widened minor groove (G/C-rich regions) (7,9). Consequently, the uranyl ion can also be exploited for DNA conformational analyses (7-9). Furthermore, metal ion binding sites, e.g., as found in the folded X-structure of the four-way Holliday DNA recombination junction (10) and in yeast tRNAPhe (II), have been probed by uranyl mediated photocleavage. The mechanism of uranyl cleavage is not yet fully understood, but it has been shown that uranyl bmds to the phosphates and oxidizes the proximal deoxyFrom

Methods m Molecular Bfology, Vol 90 Drug-DNA lnteractron Edlted by K R Fox Humana Press Inc , Totowa, NJ

43

Protocols

M&legaard and Nielsen

44

rlboses thereby generating 3’- and S-phosphate termmi m the DNA and hberatmg free nucleobases (2) This chapter describes how uranyl photoprobmg can be used to study the binding of small drugs, exemplified by dlstamycm, to DNA as well as to analyze DNA conformatlon and thus the connection, if any, between drug binding sites and DNA helix conformation. 2. Materials 1 Uranyl mtrate (U02[N0&) 100 mM stock solution m water, which has been shown to be stable for several years at room temperature. Restriction fragments 32P-end labeled at either the 3’ or the 5’ end by standard

techniques(12) When deciding which position to label, it IS important to note

4 5 6 7 8. 9 10 II 12 13

that the best resolution of the uranyl photocleavage pattern IS obtained m the first 70 bp from the labeling, because of some “fuzzyness” of the uranyl cleavage bands Buffer for drug footprmtmg* 0.5 M Tris-HCl, pH 7 2, and for uranyl probing of DNA structure. 0.5 M NaAc, pH 6 2 (see Note 1) 0.5 M NaAc, pH 4 5 Ethanol 96% Ethanol 70% Calf thymus DNA, 2 mg/mL Gel loading buffer 80% formamide m 1X TBE buffer, 0.05% bromphenol blue, and 0 05% xylene cyan01 1X TBE: 90 mM Tns-borate, 1 rnM EDTA, pH 8 3 Polyacrylamide gel* 8-lo%, 0 3% brs-acrylamlde, 7 Murea, 1X TBE buffer, Dlstamycm (or other drug). 1 mM stock solution (see Note 3) X-ray film Phillips TL 4OW/O3 fluorescent light tube.

3. Methods 3.1. Many/ Photoprobing 1. Approximately 10,000 cpm/sample of the radioactive labeled fragment IS mixed with the drug m mlcrofuge tubes m 50 mMTns-HCl, pH 7 2 (for the footprmtmg experiment), or m 50 mM NaAc, pH 6.2 (for the DNA structure analysis). Calf thymus DNA is added (0 5 pg/sample) The drug concentration should be varied from 1 to 30 pM to optimize protection A final sample volume of 100 pL IS recommended. The samples are equilibrated for 15 mm at room temperature prior of uranyl (see Note 1). 2. The 100 mMuranyl nitrate stock solution is diluted to 10 mM in water, and 10 yL IS added to the sample to obtam a final uranyl concentration of 1 mM

3 Irradiate the samplesfor 30 mm at 420 nm by placing the open tubes directly under the fluorescent light tube at a distance of approx 1 cm (see Note 2). 4. Add 20 pL of 0.5 M NaAc, pH 4 5, to prevent copreclpltatlon of the uranyl salts, which will interfere with the gelanalysis. Add 300 pL of 96% ethanol and place the tubes m dry ice for 15 mm and subsequently centrifuge for 15 mm at 20,OOOg

Uranyl Photoprobmg

45

5. 6. 7. 8

The pellets are washed with 70% ethanol and dried zn vacua (speedvac). Add 5-10 pL 80% gel loadmg buffer. Heat the sample to 90°C for 2 mm and subsequently place the tubes on ice Half of the samples are loaded on a polyacrylamide sequencing gel and run together with an A + G sequence ladder at appropriate voltage The remaining halves are saved at -20°C for further gel analysis if needed. 9 The bands are vlsuahzed by autoradlography using amplifymg screen 10. The results can be quantified by scanning of the autoradiograph, or using a phosphoimager.

3.2. Example An example is shown here of a dlstamycin footprint using uranyl photocleavage at pH 7.2 (which gives the most uniform DNA cleavage), and a probing of the narrow minor groove by uranyl photocleavage at pH 6.2. We have focused on the tyrT promoter, which hasbeen subject for several footprint studiesusmg different probes, including DNAseI and FeIEDTA (e.g., refs. 13 and 14). This makes a direct comparisonbetweenthe uranyl cleavagemethodandthe other methodspossible. The results of a uranyl photofootprinting experiment are presented m Fig. 1 (autoradiogram) and Fig. 2 (densitometry scannings of the autoradlogram). It is clearly seen that regions of protection (bars in Fig. 1) appear on both strands

as the concentration of distamycin 1s increased. Furthermore, it is observed that the regions of protection are shifted 2-3 bases to the 3’ side when comparing the two DNA strands (Fig. 3). This is typical of protection and thus bmding-as would be expected for dlstamycin binding-in the minor groove of the DNA helix. Finally, a comparison of the distamycin footprints with the uranyl photocleavage pattern at low pH (Fig. lA, lane 8, and Fig. lB, lane 7) reveals that the major regions of cleavage hypersensitivity coincide with dlstamycinbindmg sites (Fig. 3). This observation is fully consistent with the contention that both dlstamycin binding (15,16) and uranyl hypersensitivity (7,9) are functions of a narrowed minor groove of the DNA helix, which 1sparticularly pronounced at A/T-tracts. A comparison of the Fe/EDTA (hydroxyl radical) footprintmg results prevlously reported for dlstamycm and the tyrT promoter fragment (13) (Fig. 3) reveals that the uranyl photofootprmts reported here are more narrow than the Fe/EDTA footprints, In particular, it 1snoted that two binding sites are resolved around position 90, whereas only one combined site was detected with Fe/EDTA. Similarly, protein uranyl photofootprints are also more narrow than those obtained with Fe/EDTA (3,4). Thus, as previously noted (3,4), the mformatlon obtained from uranyl photoprobmg m spite of the similarity of the footprints complements that of Fe/EDTA footprint, since the former reflects the accessiblhty of the backbone phosphates as well as the electrostatic potential, whereas the latter reflects the accessibility of the deoxyriboses of the backbone.

3’4abeled A/G1234

S-labeled 56

78

60

50

40

30

Fig. 1. Uranyl photofootprint of distamycin binding and probing of minor groove width in the &rT promoter. Both strandsof the 160 bp EcoRI-AvaI 32P-labeledfragment, including the tyrT promoter regions, were incubated with varying concentrations of distamycin before uranyl photocleavage.The fragment labeled at the 3’-end (A): A/G: A+G sequenceladder. Lane 1, no distamycin; lane 2,0.5 ClM;lane 3, 1 @, lane 4,2 pM, lane 5,4 CUM; lane 6,8 cuz/I;and lane 7, 16 pA4distamycin.Lane 8, uranyl cleavagein NaAc pH 6.2. The fragment labeledat the 5’ end (B): A/G: A+G sequence ladder. Lane 1, no distamycin; lane 2, 1 pA4distamycin; lane 3, 2 ClM;lane 4,4 w, lane 5, 8 PA& lane 6, 16 pM distamycin. Lane 7, uranyl cleavagein 50 pM NaAc pH 6.2. The sampleswere run on a 8% polyacrylamide gel and subjectedto autoradiography. Regions of distamycin binding are shown by black bars.

Q’dabeled Control

Dlstamycm

pH62

Fig 2 Densitometric scans of the autoradiographs Lanes 1 (no distamycin) and lanes with the highest distamycin concentration (7 and 6) of the autoradlographs were scanned. In addition the lanes of DNA structure probing were scanned (lane 8 and 7) The numbers refer to the sequence of Fig. 3

4. Notes 1. The buffer for uranyl photocleavage is a very important parameter, because the sequence specificity change at different pH. Uranyl Itself is acidic, so the final pH should be checked if a certain pH IS important for the drug-binding capacity.

Mdlegaarci and Nielsen

48

TVT 0 Cl 0 q40ACGCA?mAGT+~AT-Tlffmc~~cG I GGCCAATGGAXYM'AGGCACCTAC CCGGTT*CCTTTAAT26)CG~cGG2&AAA

I

~TGCGTTGGT&AGT~AGW‘&#EAG

0 0 70 O100 TTTACAGC~~GGTCA~AT~A~CGCCCCGCT ~~GTCGCCGCCAGT~CTACGCGGGGCGCGGGGCG~GGGCTA~CCCTCGTCC~TCA0

0

I

: Distamyciduranyl

n -

q

: Uranyl hypersensitivity :Distamycitiydroxyl radical

Fig. 3 Dtstamycm protectton and many1 hypersensttrvtty displayed on a sequence The distamycm protected nucleotides are displayed as black boxes and uranyl hypersensmvity as open boxes Dtstamycm protection accordmg to the Fe/EDTA method (13) is shown by lines; broken lines indicate weak protection. For footprmtmg, a pH range of 7.0-7 2 1s appropriate, and for analysts of DNA structure, a pH range of 6.@-6 5 should be chosen. Furthermore, uranyl photocleavage IS most efficient m acetate, HEPES or PIPES buffers, lesser m Tns-HCl, and absent m phosphate buffers Finally, the photocleavage is not sensttive to temperatures 2 Any light source emittmg 300-420 nm can be used, and the Phillips TL 40 W/O3 tube (h max -420 nm) IS recommended, when reaction times of 20-60 mm are convenient However, if even shorter irradration times are required, the uranyl cleavage reaction can be performed with a Xenon lamp or a laser at appropriate wavelength The sample may be placed m a thermostated bath if required 3 Apart from distamycm, we have prevtously used uranyl photofootprintmg to study the bmdmg of the drug mttramycm, which m a complex with Mg*+ binds as a dimer m the minor groove of GC regions (17) In contrast, we have not been able to obtain footprmts wrth echmomycm. Thus uranyl photofootprmtmg may be limited to drugs that interact strongly and electrostatically with the DNA backbone.

References 1 Burrows, H. D. and Kemp, T. J (1974) The photochemtstry of the uranyl ton. Chem Sot Rev 3, 138-165 2 Nielsen, P E., Htort, C , Buchardt, 0 , Dahl, O., Sonmchsen, S. H., and Nordtn, B (1992) DNA Bmdmg and Photocleavage by Uranyl(V1) (UO,*‘) Salts J Amer Chem. Sot 114,4967-4975

Uranyl Photoprobrng

49

3 Nielsen, P. E., Jeppesen, C., and Buchardt, 0. (1988) Uranyl salts as photochemical agents for cleavage of DNA and probing of protein-DNA contacts. FEBSLett 235, 122-124 4 Jeppesen, C. and Nielsen, P (1989) Uranyl mediated photofootprmtmg reveals strong E cob RNA polymerase-DNA backbone contacts in the +lO region of the deoP1 promoter open complex. Nucleic Acids Res 17,49474956 5. Mollegard, N. E , Rasmussen, P B, Valentm-Hansen, P , and Nielsen, P E (1993) Charactertzatton of promoter recognition complexes formed by CRP CytR for repression and by CRP and RNA polymerase for acttvatton of transcriptton on the E. co11deoP2 promoter J &al Chem 268, 17,47 l-l 7,477 6 Nielsen, P E. and Jeppesen, C. (1990) Photochemtcal probing of DNA complexes. Trends Photochem Photoblol 1,39-47 7 Nielsen, P. E., Mollegaard, N E.. and Jeppesen, C. (1990) DNA conformational analysis in solutton by uranyl mediated photocleavage Nucleic Acids Res 18, 3847-385 1 8 Mollegaard, N E (1992) Uranyl photoprobmg of DNA structures and protein DNA mteracttons, Thesis 9 Sonnichsen, S H. and Nielsen, P E (1996) .I MO! Recognztion 9,219-227 10. Mollegaard N E , Murchte, A. I., Lllley, D M , and Nielsen, P. E (1994) Uranyl photoprobmg of a four-way DNA Junction. Evidence for spectfic metal ton bmdmg EA4BO J 13, 1508-1513 11 Nielsen, P. E and Mollegaard, N E (1996) J Mel Recognztzon 9,228-232 12 Sambrook, J , Fritsch, E. F., and Maniatls, T (1982) Molecular Clonuzg* A Laboratory Manual Cold Spring Harbor Laboratory, Cold Sprmg Harbor, NY 13 Portugal, J and Waring, M J. (1987) Eur J Bzochem. 167,28 l-289 14 Portugal, J. and Waring M J. (1987). Hydroxyl radical footprmting of the sequence-selective binding of netropsin and distamycin FEBS Lett. 225, 195-200. 15. Coll, M , Frederick, C A , Wang, A H., and Rich, A (1987) Proc Natl Acad Scl USA 84,8385-8389 16. Wood, A. A., Nunn, C. M., Boykm, D. W., and Needle, S. (1995) Nucleic Acids Res 23,3678-3684. 17 Nielsen, P E , Cons, B M G , Fox, K. R , and Sommer, V B (1990) Uranyl photofootprmtmg DNA structural changes upon bmdmg of mtthramycm, m Molecular Basis ofSpec&c@ in Nuclex Acid Drug Interactions, vol. 23 (Pullman, B and Jortner, J , eds ), The Jerusalem Symposmm on Quantum Chemistry and Btochemtstry, Dordrecht, pp. 423-432

4 Diethylpyrocarbonate and Osmium Tetroxide as Probes for Drug-Induced Changes in DNA Conformation In Vitro Christian

Bailly and Michael J. Waring

1. Introduction Chemical probmg of nucleic acids is a powerful and versatile approach to the detection and analysis of the structural and functional complexity of nucleic acids (I). Secondary structures of native DNA and RNA as well as ligandinduced changes in conformation can be probed by the use of a variety of chemical reagents, either in vitro with purified nucleic acids m a reconstituted acellular environment, or directly withm the framework of a cell Over the last 10 yr, new advances m technology and new chemical probes have been developed that allow for sensitive, high-resolution detection of variations m DNA and RNA secondary structures. Another aspect of chemical probing experiments concerns their application to investigate the effect of chemotherapeutic drugs on nucleic acid structures. A number of antitumor and antiviral drugs owe their efficacy to their capacity to interact with DNA and subsequently inhibit DNA replication, transcription, and other key steps in the proliferation of the cancer cell or of a virus. Therefore, it is of great importance to understand the mechanism by which drugs interact with DNA and whether or not (and how) these drugs distort the DNA double helix upon binding to it. Although many sophtsticated spectroscopic techniques such as NMR and X-ray crystallography have provided a large body of information about drug-induced structural changes in DNA, these techniques are limited with respect to the size of the DNA molecule that can be studied and have therefore been restricted to experiments employing short ohgonucleotides. In addition, it is sometimes necessary to use very high concentrations of both the DNA and the ligand or even to add chemicals in order to stabilize the dmg-DNA complex (e.g., dehydrating agents used From

Methods m Molecular Btology, Vol 90 Drug-DNA Interact/on Edlted by K R Fox Humana Press Inc , Totowa, NJ

51

Protocols

Bail/y and Waring

52

Table 1 Use of DEPC to Detect Unusual DNA Structures DNA sequence/structure

Refs

Polypurme polypyrlmldme sequences H-DNA, triple hehces, and duplex-triplex Junctions Parallel-stranded DNA Methylated DNA Curved DNA sequences Left-handed Z DNA and B-Z Junctions Smgle-stranded regions Cruciform and hairpin structures Protein-DNA interactions Branched DNA Drug-DNA interactions

10,16,34-41 42-58 59,60 61 10,20,62,63 51,54,64-73 43,74 75-77 74,78,79 8&83 see Table 3

for X-ray crystallography). The use of chemical probes does not suffer from such constraints so that both short and long DNA molecules can be probed under a variety of condltlons m vitro and m vlvo. Chemical probmg expenments are Ideally sulted to detect both local and propagated conforrnatlonal changes in DNA down to the atomic level A large variety of probes exist with diverse chemical and/or sterlc sensltivIty to analyze the structure of DNA and ligand-DNA interactions. This chapter

is not intended as a compilation of those different probes since comprehensive reviews on the subject have been published

previously

(2-5)

Rather we focus

on two specific probes, dlethylpyrocarbonate (ethoxyformic anhydride or dlethyloxydiformate,

usually

referred

to as DEPC)

and osmium

tetroxlde

(OsOJ, which are, together with potassium permanganate (KMnO,), the most frequently used chemical reagents for detecting particular DNA structures (Tables 1 and 2). Probes such as DEPC and Os04 have long been employed for characterizing

the structural

perturbations

of DNA induced by drug bmdmg,

particularly intercalating drugs (Table 3). In thrs chapter, the prmctpal features of the chemical

properties

of DEPC and Os04 will be rehearsed, the current

technical protocol from the authors’ laboratory described, together with recent examples that illustrate DNA recognition.

the appllcatlons

of these reagents m the study of drug-

1.1. Reactivity of Diethyipyrocarbonate and Osmium Tetroxide with DNA: Chemical and Structural Aspects DEPC and Os04 modify DNA in very different ways, reacting with purmes and pynmldines, respectively (Fig. 1). DEPC (6), which was mltlally mtro-

Drug-Induced Table 2 Use of 0~0,

Changes in DNA Conformation to Detect Unusual

53

DNA Structures

DNA sequence/structure

Refs

84

DNA sequencing Polypurme * polypyrtmtdme sequences H-DNA, triple hehces, and duplex-triplex junctions Parallel-stranded DNA Left-handed Z DNA and B-Z junctions Smgle-base-pan- mismatches Single-stranded regions Cructform and hatrpm structures Three-, four-way DNA junction Drug-DNA interactions

16,35-38,4&41,85,86

36,42-44,4?,5&52,54-58, 87-89 59,60 51,54,64,68,72,73,90-99 13,64,100,101 98 15,68,94,99,102-107 8&83,108-110

see Table 3

Table 3 Use of DEPC and Os04 to Study Drug-DNA

Interactions Refs

Drug Echmomycm TANDEM Actmomycin Mithramycm Ethrdium Acridine derivatives Bleomycm Nogalamycm Ellipttcine Lucanthone, hycanthone Tilorone Benzopyridomdole cu-Platinum Porphyrm

oso, 67,111,112

116,126,127

132 30 18 133,134

DEPC 32,67,112-121 122,123 124,125 121 114,116 116 128,129 130 131 132 30 18 133 135

duced as a reagent for modifying histidme and tyrosme residues m proteins (7,8), reacts strongly with the N-7 atom of purmes (9). The carbethoxylation reaction of A and G leads to the mtroductron of a posmve charge at the N-7 positron, which perturbs the electron resonance of the purine ring. The alkylated purine nucleus is unstable, which causes opening of the lmidazole rmg between atoms N-7 and C-8, thereby creatmg an alkali-labile adduct (Fig. 2).

Bail/y and Waring

54

NH,OH

NHz Fig. 1 Structure of the bases and sites of reactivity of chemical probes

At neutral pH, DEPC reacts much more strongly with adenosme residues compared to guanosmes. At acidtc pH, the reactlvlty of G IS increased. When the exocychc N6 ammo group of adenme IS accessible, tt forms a reactive posttron for DEPC as well. This chemical has proved useful as a probe sensitive to variation in DNA structure and has been applied successfully to detect Z-DNA, H-DNA, crucrform loops, and many other non-B DNA structures (Table 1). The reactton mechamsm by whtch DEPC attacks purmes IS not known with certainty, but models have suggested a form of proton catalysts. Hydrogen bond-donating ammo groups of DNA have the potential to acid-catalyze DEPC reaction at the N-7 position of purmes. The frequently observed higher reactlvlty of adenines compared to guanines might depend on the ability of the exocychc N6 amino group of adenme to rotate so as to attam the optimum geometry for promotmg hydrolysis of DEPC (20) 0~0, reacts with a sharp base specificity in the major groove of the double helix.

Although

0~0,

alone can attack

DNA

effrclently,

It 1s very often

premixed with a tertiary amme that accelerates the rate of formatton of base adducts. Pyrtdine, whtch mcreases the reaction of osmtum tetroxide with thymidmes by about lOO-fold, IS most commonly used, but other ammes have been employed suchasbrpyndine, phenanthrolme and tetramethylethylenedlamine

Drug-Induced DEPC 0

*c-o

55

Changes m DNA Conformatlon ,C&

,W%

O$>-”

NH>

,&eNH2 NeN

fc,WW20

\

majorgroove A H

Os04

\

2(C5HsN)

/

m/norgtwve Fig. 2 Reactlon of diethylpyrocarbonate and osmmm tetroxlde with an A * T base pair. Broken lines represent the hydrogen bonds between the palred bases Base adducts formed by reactlon of DEPC with adenine and of the 1.2 OsO,-pyrtdme complex with thymine are boxed. The major and minor grooves of the hehx are indicated

(TEMED) (II). The reaction requn-es much higher molar concentrations of pyrldine than of osmmm tetroxide. It IS plausible that, at least m the first stage of reaction, pyridine acts as a part of the solvent and may cause sequencedependent structural changes facllitatmg the subsequent formation of thymmeosmium adducts. The 2: 1 pyndine-Os04 complex attacks the 5-6 double bond of pyrlmldines to form a cyclic ester (12) (Fig. 2). The reactlon occurs prmcipally at thymme residues; only rarely at cytosmes. Osmium tetroxlde is known to react with cytosine basesat about one-fortieth the rate of reactlon with thymine (13). Parenthetically, it has recently been reported that 0~0, can be used for G-specific chemical sequencing of DNA. Treatment of native B-DNA with Os04 in the absence of pyrldine Induces cleavage predommantly and evenly at G residues, especially if the reaction ts conducted m the presence of CaC12to eliminate background T reactivity (14). In the B-DNA double hehx, the target C5-C6 double bond of thymme ts located in the major groove, where it is not easily accessible to the bulky electrophlhc osmmm probe (Fig. 2). Like DEPC, Os04 represents a useful tool to

56

Bail/y and Waring

sensevariations in DNA structure (Table 2). Os04 and DEPC share the property of reacting with the side of the basesthat is not involved m Watson-Crick hydrogen bondmg (Fig. 2). Indeed, the Os04-reactive C5-C6 double bond of thymme lies completely on the opposite side of the pyrimldme rmg from the substltuents that hydrogen bond to ademne. LIkewise, the N7 posltion of guanine that 1scarbethoxylated by DEPC lies on the opposite side of the purine ring from the hydrogen bonding to cytosme.Therefore, Os04 and DEPC reactions can proceed even if the base palrmg 1smaintained. In other words, these two reagents do not represent probes of base-pair dIsruptIon. However, adduct formation does require out-of-plane attack by the electrophlle and thus may be subject to sterlc hindrance by stacking of neighboring basepairs (explammg the poor reactlvity toward B-DNA) Os04 and DEPC are really probes of base stacking. The reason why the osmium probe cannot react, or can only react very weakly, with the C5-C6 double bond of thymme m the native B-form double helix 1sessentially stencal. The bulky Os04-pyndme complex, which must be added czsto the thymme rmg (12), would collide with the helix backbone and/ or the m-plane methyl group attached to the C5 posltlon. When the DNA structure 1s locally unwound, as 1sthe case m the presence of a DNA-intercalating drug, the C5-C6 double bond target becomes more readily accessible to the probe and the thymme-osmate-pyndme ester can thus be formed. Both expenmental and recent molecular mechamcs studies have shown that the addition of the osmmm-pyndine to the thymme restdues m DNA causes relatively mmor global structural changes m DNA conformation (15-17). As a result, the reactivity of both DEPC and OsO,,toward DNA, m common with most other chemical probes, depends partly on the primary nucleotlde sequence as well as to a considerable extent on the local conformation, thus allowing both structural and sequence mapping. The structural sensitivity as opposed to the chemical reactivity explains why DEPC and Os04 are frequently used for investigating all sorts of unusual DNA structures (Tables 1 and 2) The reactlvlty toward a chemical probe can also be affected by the charged environment of the molecule. The electrostatic contribution to the reactivity of DEPC and Os04 with DNA 1srelatively weak becauseboth probes are uncharged, but m other cases, such as that of KMn04, the electrostatic influence can be significant. Although Os04 and KMnO, generally exhibit comparable chemical reactivity, it has been observed that these two T-specific probes can sense drug-Induced changes in DNA conformation quite differently, probably as a result of their different electrical charge (18). A slgmficant advantage of the chemical probing experiment with reagents such as DEPC and Os04 compared to footprmting experiments is that the former yields positive results, whereas the latter IS essentially a negative technique. Footprmting experiments with DNAase I or hydroxyl radicals requn-e

Drug-Induced

Changes in DNA Conformat/on

57

the vast majority of the DNA molecules to have the test ligand bound at specific sites m order to detect a footprint, i.e., an absence of bands. By contrast, experiments with DEPC and 0~0~ detect the appearance of a posltlve signal corresponding to increased reactivity and consequent cleavage at specific sites. This peculiarity renders the signal detectlon much more sensitive, allowing accurate analysis of structural changes even if only a small proportion of the DNA molecules are affected. 7.2. Experimental Procedures The techniques for analyzing drug-induced DNA structural changes in vitro by chemical probing with DEPC and 0~0~ are stralghtforward and convenient. Briefly, the DNA (radloactlvely labeled at its 3’ or 5’ end) or drug-DNA complex is exposed to limited reaction with the chemical probe so that less than one chemical modification per DNA molecule can occur. The modified DNA molecules are then cleaved, and the resulting polynucleotides resolved as a ladder of bands on a denaturing polyacrylamlde gel. Llmltmg the extent of reaction to less than one cut per whole DNA molecule has the effect of lmposmg “single-hit” kinetic condmons so that the probe reactlvlty toward sites all along the sequence can be examined at a comparable level of sensitivity. The sites of attack by the probes, i.e., the distorted sites m the double helix, are located to nucleotlde resolution The followmg section describes the 0~0~ and DEPC chemical probing procedures m current use m the authors’ laboratory. These two fairly explicit protocols have been regularly and successfully used over many years. They have always yielded highly reproducible results. However, protocols are evolving and the reader can be referred for alternative procedures to the methods sections of articles cited m Tables 1 and 2. A variety of adaptations can be applied to the same purpose, each with its own merits. 2. Materials 2.7. Reagents Both DEPC and 0~0~ are commercially available and no special punfication is required. The DEPC reagent (97% solution purchased from any of several commercial suppliers, e.g., Sigma or Aldrich) 1s stored at 4°C and it IS recommended that it be renewed from time to time (at least once a year). Osmnun tetroxide is very toxic (strongly irritating) and unstable. It 1simportant to stress the fact that both DEPC and 0~0, are dangerous chemicals (DEPC IS considered to be carcinogenic) and must therefore be handled with care. All reactions involving the direct use of either DEPC or 0~0, should be carried out m a chemical fume hood while wearing gloves. 0~0~ can be purchased in a sealed ampoule contammg 250 mg (from Sigma or Aldrich for example). Because it

58

Bail/y and Waring

is volatile, the ampoule containing the pale yellow solid has to be cooled down before opening. Addrtion of 2 mL of deionized water immediately after openmg the ampoule gives a 500-W stock solution, which is then diluted 1O-fold and dispensed mto 50-uL aliquots for storage at -2OOC. Frozen solutions of 0~0~ are relatively stable (for at least 6 mo). 2.2. DNA An important facet of a successful chemical probing experiment is the quality of the DNA. A well-purified DNA fragment with high spectlic radioactrvtty will give the best results, be tt with DEPC or OsOQ,or any other probe. There is little point m proceeding with attempts to analyze drug-induced structural distorttons m DNA if the polymer IS impure and/or weakly labeled. DNA restriction fragments or synthetic oligonucleotides are labeled at the 3’ or 5’ end with 32Pand then purified on native polyacrylamtde gels using standard protocols (19). It is found that 150-200 bp is a good size for subsequent analysis. 3. Methods Although there is no strict requirement for a parttcular solvent medium, as a general rule buffers containmg free amino groups should be avoided to prevent artifacts arismg from the probe reacting with the buffer. It has been found convenient to use 10 mM Trls buffer adjusted to pH 7 0 with HCI and containing 10-50 mMNaC1. In several publications, sodium cacodylate buffer is also frequently used. Recently it has been reported that a side reaction can occur between Tris-HCI buffer and probes such as KMnO, producing new reactive species that apparently are liable to generate an extra set of piperidine-sensitive lesions, thereby obscurmg the specific reaction between KMn04 and susceptible thymmes (20). However, the authors have never observed such side effects when using DEPC and 0~0~ m a Tris buffer. Experiments are usually performed at 4°C 20°C (room temperature), or 37OC, but the chemical reactions are quite workable at different temperatures as well as m the presence of different salt concentrations so that the degree of stability and the conformation of the drug-DNA complexes can be examined under various functional conditions. The osmium tetroxide-pyrtdme complex is prepared fresh each time just prior to its addition to the DNA solution by mixing 50 uL of 50 mJ4 0~0~ with 30 uL water and 20 pL pyridine (99% analytical grade). This gives an Os04/pyridme mixture (4: 1, by vol) containing 25 mM 0~0,. The OsO,, solution turns yellow upon adding the pyridine. 3.1. DEPC Reaction The labeled DNA samples (100-500 cps) are diluted with the solution of the test drug prepared m 10 mA4Trts-HCl buffer (or other compatible buffer). The

Drug-induced

Changes in DNA Conformation

59

samples (20 pL) are left to equtlibrate for a mimmum of 30 mm at 37°C One microliter of DEPC is then added and the mrxture left at room temperature for a further 15 min with frequent mixing (DEPC 1snot mtscrble wtth water). The reaction is stopped by adding 200 pL of 0.3 M sodium acetate and the DNA IS precipitated with 3 vol of ethanol. The solution is chilled at -70°C for 10 mm before centrtfugation for 15 mm at 14,000 rpm. Using stlicomzed tubes may ard in recovermg material after the precrpttatton. The DNA pellet 1sthen redtssolved in 100 pL of 0.3 M sodmm acetate, reprecipttated with ethanol and washed once with 70% ethanol. The DNA pellet IS then briefly dried. 3.2. 0~0, Reaction The labeled DNA samples (100-500 cps) are exposed to the test drug in 10 mM Tris-HCI or other compatible buffer. The samples (45 pL) are left to equilibrate for a minimum of 30 mm at 37°C and cooled to 0°C (5 min) Then the reaction ISconducted by mixing the preequllibrated drug-DNA solution with 5 PL of a freshly prepared OsO$pyrtdine solution (4/l, v/v) to adJust the final 0~0~ concentratton to 2.5 n-&I. After 15 mm at room temperature, the reaction 1sstopped by extracting the reagent twice with 300 FL of dtethyl ether and the modified DNA ISrecovered by precipitation wrth 3 vol of ethanol. The solutton IS chilled at -70°C for 10 min before centrifugatton for 15 mm at 14,000 rpm. The DNA pellet IS then redissolved in 100 p.L of 0.3 M sodium acetate, reprectpitated with ethanol and washed once with 70% ethanol prior to drying. Although both DEPC and OsO,,react only weakly with unmodified DNA, a mandatory control for any probe is to treat the polynucleotide wtth the chemical reagent in the absence of the test drug so as to verify that the nucleic acid IS not partially denatured or distorted under the chosen experimental condttions (espectally at high salt concentrations or temperatures higher than 37°C) as well as to verify the quality of the DNA preparation. 3.3. Detection of Adducts DEPC-purme and osmmm-thymine adducts in DNA can be located by dtfferent methods including transcription termination assays,inhibition of primer extension, or inhibition of restriction enzyme cleavage (21). The primer extension method does not require an end-labeled DNA fragment and consequently can be used with large DNA molecules. But the most convenient, direct, and frequently used method for accurate single-nucleottde resolutton consists in the treatment of chemically modified DNA with hot ptpertdine. The sugarphosphate bonds 5’ and 3’ to the base adduct are alkali-labile and can easily be broken with dilute piperidme. However, a potential problem wrth the use of this procedure is that It causes weak, but noticeable, background cleavage in unmodified DNA probably becauseprpertdine, which IS a strong base, can pro-

60

Bail/y and Waring

duce high concentrattons of hydroxyl ions capable of reacting wrth the bases so as to mduce strand breaks. The background cleavage (usually observed at guanme residues) IS of little consequence if the level of specific chemtcally induced adducts IS large, but can be a problem if tt 1ssmall. To circumvent this problem, piperrdine may be replaced with other ammes capable of catalyzing p-elnnination reactions Accordmg to a recent study,NJ’-dtmethylethylenedlamine inflicts much less, tf any, background degradation on DNA Unlike prperidme, it catalyzes p-ehmmatron efficiently at neutral pH and phystologtcal temperature (100 mM solution buffered to pH 7.4, 15 min at 37°C) and does not have to be removed before samples are apphed to sequencing gels (22). 3.4. Piperidine Cleavage of DEPC- and Os04-Modified DNA The subsequent steps apply to both DEPC- and Os04-treated DNA samples as well as to the control samples Resuspend the air-dried pellet m 50 pL of freshly diluted plperrdine Although most protocols recommend the use of 10% prpertdme (about 1 M), in most cases, the percentage of piperidme can be reduced to 5% without noticeable loss of activity. Similarly there is little, If any, difference in using 25 pL instead of 50 pL dilute piperidme. Place the microfuge tubes (keep the lids of the tubes closed) in the sand bath or water bath and incubate at 90°C for 20 mm. Qurckly spin the tubes and place them on ice for about 30 s to cool the samples prior to openmg the tubes. Freeze the sample m dry ice and drive off the hqutd by lyophrlizmg (a Speed-Vat concentrator 1sconvenient). Once the prperrdine has completely evaporated, resuspend the dry pellet n-r 50 uL of dtstrlled water, and repeat the lyophilization at least twice. The pellet usually contains white traces after the first lyophihzation and becomes more or less translucent when all the prperidine has been removed. Dissolve the samples in 5 uL of sequencing dyes made with deromzed formamide (80% deionized formamide, 25 miI4 EDTA, 0.3% bromophenol blue, 0.3% xylene cyanol), botl for 4 mm at 9O”C, chill in Ice for 4 mm, and then load onto a standard sequencing gel An 8% acrylamrde contaming 7 Murea is typttally used, but of course this can be varied depending on the length of the DNA substrate. Electrophorests is usually performed using TBE buffer (89 rnitJTrrs base, 89 m boric acid, 2 5 mM Na,EDTA, pH 8.3) at 60 W (about 1600 V, BRL sequencers model S2) until the bromophenol blue marker has run out of the gel Gels are soaked in 10% acetic acid for 10 mm, transferred to Whatman 3MM paper, dried under vacuum at 8O”C, and subjected to autoradrography using either a phosphorlmager (Molecular Dynamics) or X-ray films exposed at -70°C with an intensifying screenif desired (the use of mtensrfying screensat -7O’C has been questioned [23J. Exposure ttmesof the X-ray films are adjusted according to the number of counts per lane loaded on each individual gel (usually 24 h).

Drug-induced Changes m DNA ConformatIon

61

4. Applications Prior to presenting examples that illustrate the applicattons of DEPC and 0~0, in the study of drug-DNA recognition, tt is worth giving an example of the utility of the probes for evidencing an unusual DNA conformatton. Very recently, the authors were seeking to charactertze the triple helix-stabthzmg effects of a benzo[flpyrtdoqumoxaline derivative structurally related to the previously reported benzo[e]pyridoindole compound BePI (24). For that purpose, two parallel triple helix model systems were investigated: one in which the third strand matched perfectly a 27-bp purine-pyrtmidme motif in the target DNA; another in which the third strand was one nucleotrde longer, i.e., a 2%mer. In the latter system, the pairing of the (Y)28 thn-d strand to the (YR),, target requires the formation of a bulge containing at least one unpaired base. Evidence for the formation of the bulge was gamed from chemical probing experiments with osmium tetroxtde (25). The gel in Fig. 3A shows that the three bases-Cl 3, T14, and TlS-are sensitive to 0~0~ attack, thus allowing unambiguous locatton of the bulge around nucleotide T14 within the trtplehelix structure (Fig. 3B). The fact that the two residues flanking the unpaired thymme T14 are also sensitive to the osmmm probe probably indicates that these two bases are not deeply inserted into the major groove and may not be fully engaged in triplex formatton with the target duplex As indicated m Table 3, DEPC and 0~0~ have been used to detect structural distorttons in DNA induced by both classical (e.g., ethrdmm, actmomycm) and threading mtercalators (e.g , nogalamycin) as well as more subtle conformatronal changes induced by minor groove binders such as mtthramycm. They have also been employed to look at the effects of drugs that cross-lmk DNA such as cu-platinum or DNA cleavers such as bleomycm. Hyperreacttvity of a drug-DNA complex toward DEPC and 0~0~ provides convmcmg evidence that upon binding to DNA the drug has affected the conformation of the double helix To illustrate the utility of DEPC and 0~0~ for detecting drug-induced structural changes m DNA, studies performed with the antitumor antrbrotic echmomycin will be referred to. Echmomycin has been extensively studied over many years in the authors’ laboratory. The anticancer actrvlty of this quinoxaline antibiotic is believed to result from its capacity to bmd tightly to DNA by a mechanism of bu-intercalation (26). Footprinting studies have established that echinomycm binds preferentially to sites surrounding CpG steps m DNA (27,28). The exocyclic 2-ammo group of guanme exposed m the minor groove is a crtttcal determinant for sequence-specific recognition of DNA by echinomycin, as it IS for several other antlbiottcs (2%31) Echinomycm powerfully potenttates the reactivity of the adenine nucleotides m DNA toward DEPC whereas it moderately enhances the oxtdatton of a subset of thymine residues by osmium tetroxide (Fig. 4). The adenme residues that

B ((Y*R)2r(Y)28)

bulge-containing

triplex

1 10 20 30 40 50 S’-AATTCGAGCTCGCCCGCCTCTAGAGCTCGCTC~TCTTTTTTCTTCTTCTTTTTTCTTCTT~CTCG~CGCCC~A 3’-

60

70

80 -3’

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I II I I I I I NlHl~~l I I I I I I I I I I I I I I I I I I I I I I I I I I I I AAGCTCGAGCGGGXCCTAGGAGATCTCGAGCGAGTTAGMaAAX, AAAAAAGAAGAATTGAGCCCGCGGGCCCTTCGA-5’ .. .. .. . . ... . .. . .. ... .. . .. .. 3’-TCTTTTTTCTTCTTCTTTTTTCTTCTT-5’ ITL

1

\

t

Fig. 3. (A) Probing wtth osmum tetroxrde of the triple helix formed between an 8 1-bp double-stranded target DNA and a 5’-labeled 28-mer ohgonucleottde. Lane 1 refers to the reaction with the labeled single stranded ohgonucleotrde m the absence of its double-stranded target; reaction is essentially complete and no macromolecular products are visible. In the lanes numbered 2-5, the target duplex was added at 1,2 5,5, and 10 pA4. The cleavage products were resolved on a 15% polyacrylamide gel containing 8 A4 urea. Pyrimidme-specific sequence markers obtained by treatment of the 5’-labeled 28-mer oligonucleotide with hydrazme followed by ptpendme were run m the lane marked T+C (B) Sequence of the [(Y R)*, (Y&j parallel bulge-containmg triplex. Arrows point to the three nucleotrde residues-C 13, T 14, and T 15-that are hyperreacttve toward osmmm tetroxtde (25)

Bail/y and Waring

64 DEPC

Fig. 4. Reaction of diethylpyrocarbonateand the osmium tetroxide-pyridine complex with a 133-bp DNA. The fragment was cut out of plasmid PBS with AvaI and PvuII restriction enzymesand 3’-end labeled at the AvaI site with [a-32P]dCTPin the presenceof AMV reversetranscriptase.The cleavageproducts were resolved on an 8% polyacrylamide gel containing 8 A4urea. Specific strand cleavagesoccur at the modified nucleotidesafter treatmentwith piperidine. Control lanes(Ct) show the products resulting from treatmentof the DNA with the chemical probesin the absenceof antibiotic. Laneslabeled G, T+C, and G+A show the productsresulting from the dim-

Drug-Induced

Changes In DNA Conformation

65

display enhanced reactivity toward DEPC he immediately adjacent to a CpG dmucleotide step. As can be seen m the densltometrlc profiles in Fig. 5, at low antibiotic concentration (1 PM), only the bases flanking a CpG step exhibit a very pronounced reactivity toward DEPC. At higher echinomycin concentration (5 @4) the adenmes on the 3’ side of the G remain especially sensitive to attack by DEPC, but other ademnes and some guanme residues distal to the bindmg sites also become reactive. The intensity of the bands m the echmomycin-containmg lanes 1sby no means uniform, mdlcatmg that the distortion of the helix, which is sensed by DEPC, varies locally according to the sequence to which the drug 1sbound. Yet it does seem that DEPC hyperreactlve sites are dlstnbuted all along the DNA sequence mdlcatmg that it 1sthe entire secondary structure of the DNA fragment which, to varying degrees, 1saffected by the bmdmg of echmomycm. Altogether the results indicate that Os04 reacts most strongly with thymmes located around, but not necessarily adjacent to, an echmomycin bmdmg site, whereas carbethoxylation reactions caused by DEPC occur pnmarily at the ademne residues lymg unmedlately adJacent to the dmucleotide that denotes a binding site for the antibiotic (30). The results are totally consIstent with those previously obtained with other DNA fragments (32). Recently, the cooperatlvity of binding of echmomycin to DNA by measurmg the strength of bmdmg to DNA fragments containing closely spaced CpG steps has been examined. Quantitative footprinting experiments using DNase I as cleaving agent were undertaken to demonstrate that the bmdmg of echinomycin to DNA can be highly cooperative and that the extent of cooperatlvity depends on the nature of the sequencesclamped by the antlblotic (33). These designed DNA fragments, each containing two pairs of classical echmomycm binding sites(ACGT and TCGA) in direct juxtaposition or spacedby two or four A * T bp, provide an ideal substrate for investigating the extent of conformatlonal effects associated with the bmdmg of echmomycm to DNA. The reactivity of the DNA fragments toward DEPC and Os04 m the presence and absence of the antibrotlc was examined, with the reactivity being detected via the sensitivity of the reacted site to plperidme-catalyzed hydrolysis. Results from an experiment m which the 5’-labeled 16%bp fragment contammg the designed 5%mer insert

ethyl sulfate/plperidine,hydrazine/pipendine,andformic acld/pipendinereactionsand Indicate the locatlon of guanine,pyrimldine, andpurine residues,respectively, wlthm the sequence The lane marked “DNA” contamsthe [32P]-labeledDNA alone, mcubated without antiblotlc or probe; this sampleservesas acontrol to assessbackground nicking of the DNA The remaining lanes show the products of chemical probing m the presence of increasing concentrations of echinomycin (expressed as mlcromolar). Numbers on the right side of the gels refer to the numbering scheme (112).

Bail/y and Waring

66 Echinomycin 1pM - DEPC

*.AGCAa, -

XA-s -

Y-AGCG.s y.AGCG-s l -

1

2

Nuckotide Position

3

5

6

.J

”

Echinomycin 5ph4- DEPC t s*.AGCG-s

t r.AGCA-s

x2

Nucleotide Pariiii

t KAGCA.5 t .

.J

w

Fig. 5. Densitometrictracesshowingtheproductsof diethylpyrocarbonate reactionwith the 3’-endlabeledstrandof thePBS fragmentcausedby addingechinomycinat 1 @4 (top panel)and5 cuz/i(bottompanel).Theadenineandguanineresiduesthatrespondto DEPCin the presenceof echinomycinareindicatedby tilled and opencirclesrespectively.Arrows point to theadenineresiduesmostsensitiveto carbethoxylationby DEPC;all theseadenines lie on the 3’ sideof an underlinedCpG dinucleotidestepdenotingan echinomycin-binding site.Barsnumberedl-6 belowthehorizontalaxisreferto thepositionof theDNAaseI and MPE * Fe” (shaded)footprintsof echinomycinon theDNA fragment(112).

CBl was exposed to DEPC and Os04 are shown in Fig. 6. In the absenceof antibiotic (lanes marked Ct), the DNA reactsweakly with the probes. By contrast, in the presenceof the antibiotic the DNA becomesincreasingly suscep-

Drug-Induced Changes in DNA Conformation

67 0904

DEPC echinomycin Ct 0.5 1 2.5 -----------em-mm---

5

(PM) 10

20

echinomycin Ct

GA

T+C

G

Ct

0.5

1

2.5

5

(pM) 10

20

Ct

‘;: T

Fig. 6. Reaction of a 168-bp DNA fragment containing the insert CBl with diethylpyrocarbonate(DEPC)andosmiumtetroxide(0~0~) in the absence(Ct) andpresenceof echinomycin(was indicated).The duplexDNA wasS-endlabeledat the EcoRI sitewith Y-[~~P]ATPin thepresenceof T4 polynucleotidekinase(33). The cleavageproducts were resolvedon an 8% polyacrylamidegel containing8 A4urea.LaneslabeledG, G+A and T+C show the productsresultingfrom the dimethyl sulfate/piperidine,formic acid/piperidine,and hydrazine/piperidinereactionsand indicatethe location of guanine, purine,andpyrimidine residuesrespectivelywithin the sequence.Numbersat the left side of the gelsrefer to the numberingschemeusedin Fig. 7. The sequenceson the right side showthe locationof the ACGT andTCGA sitesto which echinomycinbinds.

68

Bail/y and Waring

table to attack mdmatmg that the bmdmg of the drug has facilitated the access of the probes to substrtuents lying m the major groove of DNA. The few adenine and thymine restdues that become reactive toward DEPC and Os04 m the presence of echmomycin are indicated in the sequence in Fig. 7. It can be seen that the underlined adenine residues m the sequence TCGATATAACGT are strongly reactive toward DEPC, whereas none of the purines in the sequence ACGTACGT react with DEPC. Srmilarly, only the doubly underlined thymme m the former sequenceis reactive toward Os04, whereas the reactivity of pyrimidmes within the latter sequence 1salmost imperceptible. However, footprmting studies have revealed clearly that the antibiotic binds very efficiently (and cooperatively) to both CpG steps in each sequence (33). Therefore, it must be concluded that the nature and/or extent of structural perturbatrons produced upon intercalation of the quinoxalme chromophores into the double helix varies according to the recognized sequence. The present results highlight the importance of the sequence context and local conformatton m the reaction of chemical probes with DNA. It 1snoteworthy that, in Fig. 6, a weak level of reactrvtty wtthm the (AT), tract on the 5’ side of the CpG-binding sttes can be discerned. Weak bands at a few T and A residues can be detected suggesting that the local distortion produced by the mtercalation process can propagate some distance from the binding sites. Why do certain thymme or adenine residues become very sensitive to the chemical probes while the reactivity of other residues adjacent to the binding sites remains unaffected? At present it IS not possible to provide a definitive answer. Induced DEPC and Os04 sensitivity is a sure sign that the target DNA has been distorted into a non-B-form structure, but the further interpretation IS not straightforward. Hyperreacttvity can be accounted for by unwinding, strffenmg, local melting, kinkmg, and so on. Vn-tually any structural change that increases the exposure of the 5-6 thymme double bond or the N-7 atom of purme residues would be expected to provoke detectable sensitivity toward osmium tetroxrde or DEPC, respectively. In other words, drug-induced structural changes m DNA can be sensitively detected by chemical probes such as DEPC and Os04, but m the absence of complementary information one can only speculate about the exact nature of those changes. In the aforementioned examples, the reactivity of Os04 toward the double helix is enhanced by the binding of echinomycin, but only rather weakly. This is becauseof the drug, not the osmium probe, for the latter can react strongly with thymmes provrdmg that tt can gam accesseither above or below the plane of the pyrrmidine ring. A clearer example of the value of Os04 for detecting drugInduced changes in DNA conformation is given in Fig. 8. The gel shows the effect of two closely related benzopyrrdoindole derivatives, (BePI and BgPI) on the reacttvity of a 265-bp fragment toward the osmium-pyridme complex.

~-ATATATATATATATAGCTATATTGCATATATATATGCATGCATATATT w/m W//A I I 20 40

I 50

ETZZZI-

I 60

Fig. 7. Diagrammatic representation of the DNAase I footprints and DNA strand cleavages produced by DEPC and 0~0, on the 16%bp DNA fragment contammg the Insert CB 1. Only the region of the restictlon fragment analyzed by densltometry 1s shown. The sequences marked by hatched boxes indicate the posltlons of mhlbltlon of DNAase I cutting, representing echmomycm-binding sites. Superscript bars indicate sites of echmomycm-mediated reactivity toward DEPC (filled columns) and Os04 (open columns) The lengths of the columns are proportional to the intensity of cleavage.

Bail/y and Waring

BePl

BgPl

90.

80.

Fig. 8. Reaction of a 265-bp DNA fragment with the osmium tetroxide-pyridine complex in the absence(Ct) and presenceof the benzopyridoindole derivatives BgPI or BePI. The DNA fragment was cut out of plasmid PBS with the restriction enzymes EcoRI and PvuII and 3’-end labeled at the EcoRI site with [a-32P]dATP in the presence of avian myeloblastosisvirus reversetranscriptase.The concentration (pA4) of the drugs is shown at the top of the appropriategel lanes.The track labeled“Cl” representsa dimethylsulfate-piperidine marker specific for guanine residues.Numbers at the left side of the gel refer to the standardnumbering scheme(31).

Drug-Induced

Changes

m DNA Conformation

71

The two drugs, which selecttvely stabilize triple-helical DNA-oligonucleotide complexes, strongly enhance the susceptibility of the DNA to oxidation of its thymme residues by 0~0~. Although the two drugs are very comparable m structure, BgPI potentiates the reaction of Os04 with DNA more strongly than BePI. Indeed, at a concentration of 1 pA4 BePI, the reactivity of the probe is hardly enhanced at all, whereas under the same conditions 1 PM BgPI IS sufficient to induce the formation of a clear set of adducts susceptible to cleavage by piperidme. At higher concentrations (25 P!v!) both drugs strongly enhance the oxidation of thymidme residues m DNA. A detailed analysis of the reactive sites has revealed that pyrimldine residues located in the triplet sequences 3’-GTA and 3’-GCA provide a privileged target for 0~0~ attack. This sequence-dependent oxldative process is observed with BgPI, but not with BePI The sequence 3’-A-T-Pyr-Pur(A>G)-5’ appears as a kind of consensus showing hypersensrtivtty to 0~0~ attack in the presence of BePI. The use of probes such as 0~0~ has led to the finding that, despite their structural homology and mdlstmguishable selectivity Judged by footprmting, the two benzopyrldomdole derivatives induce distinct conformational changes m the structure of the double helix. These examples illustrate how chemical probes such as DEPC and 0~0, that require different base and DNA structural properties for reaction are tremendously valuable for exammmg discrete drug-induced conformatronal changes in the double helix By utilizing a variety of probes that can detect maJor and/or mmor groove interactions, considerable structural mformation can be obtained for virtually any drug-DNA complex.

References 1 Lilley, D. M J. (1992) Probes of DNA structures. Methods Enzymol 212, 133-139. 2 Ehresman, C., Baudm, F., Mougel, M., Romby, P., Ebel, J. P., and Ehresman, B. ( 1987) Probing the structure of RNAs in solution Nuclezc AczdsRes 15,9109-g 128. 3. Wells, R. D., Collier, D A , Hanvey, J. C., Shimrzu, M., and Wohlrab, F (1988) The chemistry and biology of unusual DNA structures adopted by oligopurmeoligopyrimidine sequences. FASEB J. 2,2939-2949 4. Nielsen, P. E. (1990) Chemical and photochemical probing of DNA complexes. J MOE Recognltlon 3, l-2.5. 5. Fox, K R. (1992) Use of enzymatic and chemical probes to determine the effect of drug binding on local DNA structure, in Advances zn DNA Sequence Speczfic Agents, vol. 1, JAI, pp. 167-214. 6 Boehm, T and Metha, D (1938) ester der pyrokohlensaure Chem Ber 71,1797 7. Milles, E W. (1977) Modification of histrdyl residues m protems by drethylpyrocarbonate Methods Enzymol 47,43 l-442. 8. Sams, C. F. and Mathews, K. S. (1988) Diethyl pyrocarbonate reaction with the lactose repressor protein affects both inducer and DNA binding Blochemzstry 27,2277-228 1.

72

Bailly and Waring

9 Vmcze, A, Henderson, R. E L., McDonald, F., and Leonard, N J. (1973) Reacnon of drethylpyrocarbonate wtth nucletc actd components. Bases and nucleosldes derrved from guanme, cytosine, and uractl .J Am Chem Sot 95,2677-2682 10. McCarthy, J G , Wtlhams, L D , and Rich, A (1990) Chemtcal reactrvtty of potassium permanganate and dtethyl pyrocarbonate wtth B-DNA specific reactivity with short A-tracts Bzochemzstry 29,607 l-608 1 11 Palecek, E. (1992) Probing DNA structure with osmmm tetroxrde complexes m vrtro Methods Enzymol 212, 139-l 55 12. Neidle, S. and Stuart, D. I. (1976) The crystal and molecular structure of an osmium btspyrtdme adduct of thymme Blochlm Blophys Acta 418,226-23 1 13. Cotton, R. G H., Rodrtgues, N R , and Campbell, R D. (1988) Reactrvtty of cytosine and thymme in single-base-pan mtsmatches with hydroxylamine and osmium tetroxtde and its apphcatron to the study of mutations. Proc Natl. Acad Scr USA 85,4397-440 1 14 Debt, A. L , Matsumoto, K , Santha, E., and Agoston, D V (1994) Guanme specific chemtcal sequencing of DNA by osmmm tetroxrde Nucleic Aczds Res. 22,4846-4847 15. Furlong, J C , Sullivan, K M., Murchre, A I H , Gough, G W , and Ltlley, D M. J. (1989) Localized chemical hyperreactivtty m supercotled DNA evtdence for base unpairing m sequences that induce low-salt cructform extruston Bzochemistry 28,2009-2017

16. Sulhvan, J. K. and Lebowttz, J (1991) Differential sequence dynamics of homopolymertc and alternating AT tracts m a small plasmtd DNA Bzochemzstry 30,2664-2673 17. Mejzltk, P. (1994) Complexes between osmmm tetraoxtde brspyrtdme and DNA a molecular mechanics study J Blomol Struct Dyn 12, 327-342 18. Bailly, C , Marchand, C , Nguyen, C H , Bisagm, E , Garestier, T , Helene, C , and Warmg, M. J (1995) Locahzed chemical reactrvny in double-stranded DNA associated with the mtercalative binding of benzo[e]pyndomdole and benzo[g]pyndomdole tnple-helix-stabrhzmg hgands. Eur J Blochem 232,66-76. 19. Sambrook, J , Frrtsch, E. F., and Mamatts, T. (1982) Molecular Clonzng, A laboratory manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 20. McCarthy, J. G , Frederick, C. A , and Nrcolas, A (1993) A structural analysts of the bent kmetoplast DNA from Crlthzdiafasczculata by high resolution chemtcal probing Nucleic Aczds Res 21, 33093317. 2 1. Htun, H. and Johnston, B. H. (1992) Mapping adducts of DNA structural probes using transcrrptton and pnmer extension approaches Methods Enzymol. 212,272-294. 22. McHugh, P. J and Knowland, J (1995) Novel reagents for chemical cleavage at abasrc sues and UV photoproducts m DNA. Nucleic Aczds Res 23, 1664-1670. 23. Hengen, P. N. (1995) Cycle sequencmg through GC-rich regions. Trends Bzochem. SCL 21,33,34 24. Mergny, J. L., Duval-Valentm, G., Nguyen, C. H., Perrouault, L., Faucon, B., Rougee, M., Montenay-Garestrer, T , Btsagni, E , and Helene, C (1992) Triple helix-specific hgands Sczence 256, 168 l-l 684.

Drug-Induced

Changes in DNA Conformation

73

25. Marchand, C , Barlly, C , Nguyen, C H , Bisagni, E., Garestier, T., Helene, C , and Warmg, M. J. (1996) Stabthsatton of triple hehcal DNA by a benzopyridoqumoxaline mtercalator Biochemistry 35,5022-5032. 26 Waring, M. J. and Wakelm, L. P G (1974) Echmomycm: a brfuncttonal mtercalating antibiotic. Nature 252,653-657. 27 Low, C. M. L., Drew, H R , and Waring, M. J. (1984) Sequence-specific binding of echmomycin to DNA. evrdence for conformattonal changes affecting flanking sequences Nucleic Acids Res. 12,48654877 28. Van Dyke, M. W. and Dervan, P. B. (1984) Echinomycin binding sites on DNA. Sczence 225,1122-l 127 29. Marchand, C., Bailly, C., McLean, M. J., Moroney, S., and Waring, M. J. (1992) The 2-ammo group of guanine is absolutely required for specific bmdmg of the anti-cancer antibiotic echinomycin to DNA. Nucleic Acids Res 21,5601-5606. 30. Bailly, C and Waring, M J. (1993) Footprmting studies on the sequence-selecttve binding of trlorone to DNA. Antwzral Chem Chemother. 4, 113-126. 3 1 Barlly, C and Waring, M. J (1995) Transferring the purme 2-ammo group from guamnes to ademnes m DNA changes the sequence-specific bmdmg of antrbiotICS.Nucleic Acids Res. 23,885-892. 32. Batlly, C., Gentle, D., Hamy, F , Purcell, M , and Warmg, M J (1994) Locahzed chemical reactivity in DNA associated with the sequence-specific brsintercalation of echmomycm. Blochem J 300,165-173. 33. Bailly, C., Hamy, F , and Waring, M. J (1996) Cooperatrvrty m the bmdmg of echinomycin to DNA fragments containing closely spaced CpG sites Bzochemzstry35,1150--1161 34. Evans, T. and Efstratradts, A (1986) Sequence-dependent S1 nuclease hypersenstttvtty of a heteronomous DNA duplex. J Bzol Chem 261, 14,771-14,780 35. Collier, D. A., Grrffin, J A., and Wells, R. D. (1988) Non-B right-handed DNA conformations of homopurme homopyrrmldine sequences in the murme nnrnunoglobulin Ca switch region J Blol Chem. 263,7397-7405 36 Hanvey, J C., Klysrk, J., and Wells, R. D. (1988) Influence of DNA sequence on the formation of non-B right-handed hehces m ohgopurme + ohgopyrimtdine inserts in plasmrds. J Blol. Chem. 263,7386-7396. 37. Bern&s, J., Belt&n, R., Casasnovas,J M., and Azonn, F. (1989) Structural polymorphism of homopurine-homopymmdme sequences:the secondaryDNA structure adopted by a d(GA * TC)22 sequence m the presence of zinc ions. EMBO J f&2087-2094. 38 Fox, K. R. (1990) Long (dA), (dT), tracts can form intramolecular trtplexes under superhelical stress. Nucleic Acids Res. l&5387-5391. 39. Fox, K R (1992) Wrapping of genomic polydA * polydT tracts around nucleosome core particles. Nucleic Acids Res 20, 1235-l 242. 40. Panyutm, I. G. and Wells, R D. (1992) Nodule DNA m the (GA)37 * (CT),, insert m superhelical plasmids. J Biot. Chem. 267, 5495-5501. 4 1. Martinez-Balbas, A. and Azorin, F. (1993) The effect of zinc on the secondary structure of d(GA * TC), DNA sequences of dtfferent length. a model for the formation of *H-DNA Nucleic Aczds Res 21,2557-2562

74

Bail/y and Waring

42. Johnston, B. H, (1988) The Sl-senstttve form of d(C-T), * d(A-G),: chemical evidence for a three-stranded structure m plasmtds Scrence 241, 1800-l 804 43 Hanvey, J C , Shtmlzu, M , and Wells, R D (1988) Intramolecular DNA trtplexes m supercotled plasmtds Proc Nat1 Acad Scl USA 85,6292-6296. 44. Hanvey, J C , Shimrzu, M., and Wells, R D. (1989) Intramolecular DNA trtplexes m supercooled plasmtds II. Effect of base composmon and noncentral interrupttons on formation and stability. J B~ol Chem 264, 5950-5956 45 Voloshm, 0 N , Mirkm, S M , Lyamtchev, V I., Belotserkovskn, B P , and Frank-Kamenetskii, M. D (1988) Chemical probmg of homopurme-homopyrimtdme mirror repeats m supercoiled DNA Nature 333, 475-476 46 Voloshin, 0 N , Shlyakhtenko, L. S., and Lyubchenko, Y. (1989) Locahzation of melted regtons m supercotled DNA FEBS Lett 243,377-380. 47. Htun, H and Dahlberg, J E (1988) Single strands, triple strands, and kmks in H-DNA Sczence 241,1791-1796 48 Htun, H. and Dahlberg, J E. (1989) Topology and formation of triple-stranded H-DNA. Sczence 243, 1571-I 576 49 Parniewskt, P , Galazka, G , Walk, A., and Klysrk, J. (1989) Complex structural behavior of ohgopurme ohgopyrtmtdme sequence cloned wtthm the supercoiled plasmid. Nuclerc Acrds Res 17, 6 17-629 50 Shtmtzu, M., Hanvey, J C , and Wells, R. D (1989) Intramolecular DNA triplexes m supercotled plasmtds I. Effect of loop size on formation and stabihty J Blol Chem 264,5944-5949

51 Blancht, A , Wells, R. D , Hemtz, N H., and Caddle, M S (1990) Sequence near the ortgm of replication of the DHFR locus of chmese hamster ovary cells adopt left-handed Z-DNA and triplex structures J Blol Chem 265,2 1,789-2 1,796 52 Berm&, J., Beltran R , Casasnovas, J M., and Azorin, F. (1990) DNA-sequence and metal-ton spectficlty of the formatton of *H-DNA. Nuclezc Aczds Res 18, 40674073. 53 Collier, D. A , Mergny, J. L., Thuong, N. T , and Helene, C. (199 1) Site-spectfic intercalation at the triplex-duplex Junction Induces a conformational change which 1s detectable by hypersenstttvtty to dtethylpyrocarbonate. NucEezc Acids Res 19,42 19-4224. 54. Pestov, D G., Dayn, A , Siyanova, E Y ., George, D L , and Mtrkin, S. M. (199 1) H-DNA and Z-DNA m the mouse c-Ki-ras promoter. Nuclezc Acids Res 19, 6527-6532 55 Klyslk, J. (1992) Cruciform extrusion facilitates ibtramolecular triplex formation between distal ohgopurme ohgopyrtmidme tracts. long range effects J. Blol Chem. 267, 17,430-17,437 56. Hartman, D A, Kuo, S. R., Broker, T R., Chow, L T , and Wells, R D. (1992) Intermolecular triplex formatton distorts the DNA duplex m the regulatory region of human papillomavnus type- 11 J Blol Chem 267,5488-5494. 57 Dayn, A., Samadashwily, G M., and Mtrkm, S. M (1992) Intramolecular DNA trtplexes: unusual sequence requirements and influence on DNA polymertzatton Proc Nat1 Acad SCL USA 89, 11,406-l 1,410

Drug-induced

Changes In DNA Conformation

75

58. Pecinka, P., Huertas, D., Azorm, F., and Palecek, E (1995) Intramolecular TAT triplex m (dA)5s.(dT)58. Influence of tons. J Bzomol Struct Dyn. 13,29-46. 59 Klysik, J., Rippe, K., and Jovm, T M (1990) Reactivity of parallel-stranded DNA to chemical modification reagents. Bzochemlstry 29,983 l-9839 60 Klysik, J., Rippe, K , and Jovin, T M (1991) Parallel-stranded DNA under topologtcal stress: rearrangement of (dA) (dT),, to a d(A * A T), triplex. Nuclerc Aczds Res 19, 7 145-7 154

61. Guo, Q., Lu, M., and Kallenbach, N R. (1995) Effect of hemimethylatton and methylatton of adenine on the structure and stability of model DNA duplexes Bzochemzstry 34, 16,35916,364 62 McCarthy, J G. and Rich, A. (1991) Detection of an unusual distortion m A-tract DNA usmg KMnO, effect of temperature and dtstamycm on the altered conformation Nuclex Aads Res. 19, 342 l-3429. 63 Carrera, P. and Azorm, F (1994) Structural charactertzatton of mtrmstcally curved AT-rich DNA sequences Nucleic Acids Res 22,367 l-3680 64. Johnston, B H. and Rich, A (1985) Chemical probes of DNA conformation. detection of Z-DNA at nucleotide resolutton. Cell 42, 7 13-724 65. Herr, W. (1985) Diethyl pyrocarbonate: a chemical probe for secondary structure in negatively supercoiled DNA Proc Natl Acad Scl USA 82, 8009-80 13 66 Runkel, L. and Nordheim, A. (1986) Chemical footprmtmg of the interaction between left-handed Z-DNA and anti-Z-DNA antibodres by diethyl pyrocarbonate carbethoxylatton J Mol Biol 189,487-501, 67. McLean, M J and Waring, M J (1988) Chemical probes reveal no evrdence of Hoogsteen base pairing m complexes formed between echmomycin and DNA m solution. J Mol Recognrtron 1, 138-151 68. McLean, M. J. and Wells, R D (1988) The role of DNA sequence m the formation of Z-DNA versus cruciforms in plasmids. J Bzol Chem 263,7370-7377 69. Vogt, N , Rousseau, N , Leng, M., and Malfoy, B. (1988) A study of the B-Z transition of the AC-rich region of the repeat unit of a satelltte DNA from Cebus by means of chemical probes J Biol Chem 263,11,826-l 1,832. 70. NeJedly, K., Klysik, J , and Palecek, E (1989) Supercoil-stabihzed left-handed DNA in the plasmtd (dA-dT)16 insert formed m the presence of N12+ FEBS Lett 243,313-317. 71. Guo, Q , Lu, M., Shahrestanifar, M , Sheardy, R. D , and Kallenbach, N. R. (199 1) Drug bmdmg to a DNA BZ molecule* analysis by chemical footprintmg. Blochemzstry 30, 11,735-l 1,741 72. Johnston, B. H. (1992) Generatton and detection of Z-DNA. Methods Enzymol 211, 127-158.

73 Albert, A -M., Roman, A. M., Bouche, G., Leng, M., and Rahmouni, A R. (1994) Gradual and oriented B-Z transition m the 5’-untranscrtbed region of mouse ribosomal DNA J Blol Chem 269, 19,238-19,244. 74 Buckle, M and But, H (1989) Fine mapping of DNA smgle-stranded regions using base-specific chemical probes. study of an open complex formed between RNA polymerase and the lac UV5 promoter. Blochemlstry 28,4388-4396.

76

Bail/y and Waring

75. Furlong, J C and Ltlley, D M. J (1986) Highly selective chemical modtficatton of cructform loops by drethyl pyrocarbonate. Nucleic Aads Res 14,3995-4007 76 Scholten, P M and Nordheim, A. (1986) Dtethyl pyrocarbonate* a chemical probe for DNA cructforms Nucleic Aclds Res 14, 3981-3993 77. Nadel, Y , Wetsman-Shomer, P., and Fry, M (1995) The fragtle X syndrome single strand d(CGG), nucleottde repeats readily fold back to form ummolecular hanpin structures J Brol Chem 270,28,970-28,977 78 Heuer, C and Htllen, W (1988) Tet repressor-tet operator contacts probed by operator-modificatron Interference studies. J Mol BIOI 202,407-4 15 79 Bateman, E and Paule, M R. (1988) Events during eucaryotic rRNA transcrtption imtiation and elongation converston from the closed to the open promoter complex requrres nucleotrde substrates. Mol. Cell B~ol. 8, 1940-1946 80 Zhong, M , Rashes, M S , Marky, L A., and Kallenbach, N R (1992) T-T base mismatches enhance drug bmdmg at the branch sate rn a four-arm DNAJunctron Bzochemzstry 31,8064-807 1 81 Zhong, M , Rashes, M S , and Kallenbach, N R (1993) Effects of T-T base mismatches on three-arm DNA Junctions Bzochemistry 32,6898-6907. 82 Zhong, M , Rashes, M S , Leontis, N B., and Kallenbach, N R (1994) Effects of unpaired bases on the conformatton and stability of three-arm DNAJuncttons Blochemzstry 33,3660-3667 83 Welch, J. B , Duckett, D R , and Lrlley, D M. J (1993) Structures of bulged three-way Junctions Nucleic Aczds Res 21,4548-4555 84 Friedman, T. and Brown, D M. (1978) Base specific reactions useful for sequencing* methylene blue sensitized photooxtdatron of guanme and osmium tetraoxtde modificatron of thymme Nucletc Acids Res 5, 615-622 85 VoJtiskova, M and Palecek, E (1987) Unusual protonated structure in the homopurme * homopyrrmrdme tract of supercorled and linearized plasmtds recognized by chemrcal probes. J Bromol Struct Dyn 5,283-296 86. Vojttskova, M., Mirkm, S , Lyamtchev, V , Voloshm, O., Frank-Kamenetskn, M., and Palecek, E (1988) Chemical probing of the homopurme * homopyrrmtdme tract m supercotled DNA at single-nucleottde resolutron FEBS Lett 234,295299 87 Palecek, E., Rasovska, E , and Boublikova, P. (1988) Probing of DNA polymorphic structure m the cell with osmmm tetroxtde Bzochem Biophys Res Commun 150,73 l-738. 88 Karlovsky, P., Pecinka, P , Vojttskova, M , Makaturova, E , and Palecek, E (1990) Protonated trrplex m E colr cells as detected by chemical probmg FEBS Lett 274, 39-42 89. Peleg, M., Kopel, V., Borowrec, J. A., and Manor, H (1995) Formatton of DNA triple helices inhtbtts DNA unwinding by the SV40 large T-antigen helrcase Nucleic Aads Res 23, 1292-1299 90 NeJedly, K., Kwmkowski, M , Galazka, G., Klystk, J., and Palecek, E. (1985) Recognitron of the structural dtstorttons at the Juncttons between B and Z segments m negatively supercorled DNA by osmmm tetroxtde J Bzomol Struct Dyn 3,467478

Drug-Induced

Changes m DNA Conformatlon

77

9 1 Galazka, G., Palecek, E., Wells, R. D., and Klystk, J (1986) Site-specific 0~0, modification of the B-ZJunctions formed at the (dA-dC),, region in supercooled DNA J Blol Chem 261,7093-7098. 92. Palecek, E , Boubhkova, P , and Karlovsky, P. (1987) Osmium tetroxide recogmzed structural distortions at junctions between rtght- and left-handed DNA m a bacterial cell. Gen Physzof Bzophys 6, 593-608 93 Palecek, E., Boubhkova, P , NeJedly, K., Galazka, G , and Klysik, J (1987) B-Z junctton in supercooled pRW751 DNA contain unpaired bases or non-watsonCrrck base pairs J Bzomol Struct Dyn 5,297-306. 94 Blaho, J. A., Larson, J. E., McLean, M J., and Wells, R. D. (1988) Multiple DNA secondary structures in perfect Inverted repeat mserts m plasmtds J Bzol Chem. 263, 14,44614,455. 95 Rahmouni, A. R. and Wells, R D. (1989) Stabilizatton of Z DNA m vlvo by localized supercoilmg. Sczence 246,358-363. 96. Rahmouni, A. R. and Wells, R. D (1992) Direct evidence for the effect of transcription on local DNA supercoilmg in vzvo J MOE Bzol 223, 13 1-144 97. Albert, A.-C., Leng, M., and Rahmouni, A R. (1995) The size ofthe topological domam modulates the B-Z transition of a (TG), contaming repeat J Blomol Struct Dyn 13,47-56

98 Murchte, A. I H. and Lilley, D M J (1992) Retinoblastoma susceptibility genes contain 5’ sequences with a high propensity to form guanme-tetrad structures Nucleic Acids Res 20,49-53

99 Ltlley, D M J. and Palecek, E. (1984) The supercool-stabilized cruciform of ColE 1 1shyperreactive to osmmm tetroxide EMBO J 3, 1187-l 192 100 Cotton, R. G. H. and Campbell, R D (1989) Chemical reactivity of matched cytosme and thymme bases near mismatched and unmatched bases m a heteroduplex between DNA strands with multiple differences Nuclezc Aczds Res 17, 4223-4233 101. Bhattacharyya, A and Ltlley, D. M. J. (1989) Single base mtsmatches m DNA J. Mol Blol 209, 583-597

102 Greaves, D R , Patient, R K , and Lilley, D. M J (1985) Factle cructform formation by an (A-T)s4 sequence from a Xenopus globm gene. J, Mol. Bzol 185, 46 l-478 103. McClellan, J. A., Palecek, E., and Ulley, D M. J. (1986) (A-T), tracts embedded in random sequence DNA-formation of a structure which 1schemically reactive and torsionally deformable. Nucleic Acids Res 14,9291-9309. 104. McClellan, J. A., Boublrkova, P., Palecek, E., and Lilley, D. M. J. (1990) Superhelical torsion in cellular DNA responds directly to environmental and genetic factors. Proc. Nat1 Acad. Scl USA 87, 8373-8377. 105 McClellan, J A. and Ltlley, D. M. J. (1987) A two-state conformational equihbrtum for alternatmg (A-T),, sequences in negatively supercorled DNA. J. Mel Biol. 197,707-721.

106. Lyamichev, V. I., Mirkin, S. M , Danilevskaya, 0. N., Voloshm, 0. N., Balatskaya, S V., Dobrynm, V N , Filippov, S A , and Frank-Kamenetskti, M D

Sail/y and Waring

78

107. 108

109 110 111

112

113 114

115 116

117

118 119. 120

121

122

(1989) An unusual DNA structure detected m a telomeric sequence under superhelical stress and at low pH Nature 339,634-637 Palecek, E., Boubhkova, P , and Nejedly, K. (1989) Probing of DNA structure with osmmm tetroxrde. Effect of hgands Bzophys Chem 34,634s Duckett, D R., Murchie, A. I H., Diekmann, S , von Knzmg, E., Kemper, B , and Lilley, D M J (1988) The structure of the Holhday Junction and its resolution Cell 55,79-89. Duckett, D. R , Murchie, A. I H., and Lilley, D. M J (1990) The role of metal ions m the conformation of the four-way DNAJunction. EMBO J 9, 583-590 Duckett, D R and Lilley, D. M J. (1990) The three-way DNAJunction is a Y-shaped molecule m which there IS no helix-helix stacking EMBO J 9, l&5%1664 McLean, M J , Seela, F , and Waring, M. J (1989) Echmomycm-induced hypersensitivity to osmium tetroxide of DNA fragments incapable of formmg Hoogsteen base pairs Proc Nat1 Acad Scl USA 86.9687-9691 Bailly, C and Waring, M J (1995) Comparison of different footprintmg methodologies for detectmg bmdmg sites for a small ligand on DNA J Bzomol Struct. Dyn 12,869-898 Mendel, D and Dervan, P. B (1987) Hoogsteen base pairs proximal and distal to echmomycm Proc Nat1 Acad Scl USA 84,91&9 14 Portugal, J , Fox, K R , McLean, M J., Richenberg, J L , and Waring, M. J (1988) Diethyl pyrocarbonate can detect a modified DNA structure induced by the bmdmg of qumoxalme antibiotics. Nucleic Acids Res 16,3655-3670 Fox, K. R. and Kentebe, E. (1990) Footprmtmg studies on the effect of echmomycin on the structure of a bent DNA fragment. Blochem J 269,2 17-22 1 Jeppesen, C. and Nielsen, P. E (1988) Detection of intercalation-induced changes m DNA structure by reaction with diethylpyrocarbonate or potassium permanganate Evidence against the mduction of Hoogsteen base panmg by echmomycm FEBS Lett 231, 172-176. Fox, K. R and Kentebe, E (1990) Echmomycm bmdmg to the sequence CG(AT)nCG alters the structure of the central AT region. Nuclerc Acids Res 18, 1957-1963 Fox, K. R , Marks, J. N , and Waterloh, K. (1991) Echmomycin to alternatmg AT Nucleic Acids Res 19,6725-6730 Waterloh, K. and Fox, K. R. (1991) Interaction of echmomycm with A, * T, and (AT), regions flanking its CG binding site. Nucleic Acids Res 19,671%6724. Sayers, E W. and Waring, M. J (1993). Footprmtmg titration studies on the bmdmg of echinomycm to DNA incapable of formmg Hoogsteen base pairs Bzochemtstry 32,9094-9107 Fox, K. R. and Cons, B. M G (1993) Interaction of mithramycm with DNA fragments complexed with nucleosome core particles comparison with distamycin and echinomycm Bzochemlstry 32,7 162-7 17 1 Waterloh, K., Olsen, R K , and Fox, K. R (1992) Btfunctional intercalator [NMeCys3,N-MeCys’]TANDEM binds to the dinucleotide TpA Blochemzstry 31, 62466253

Drug-induced Changes in DNA Conformation

79

123 Lavesa, M., Olsen, R K., and Fox, K R. (1993) Sequence-specific binding of [N-MeCys3,N-MeCys7]TANDEM to TpA. &&em J 289,605-607. 124. Waterloh, K and Fox, K R (1990) Effect of actmomycm on a (TA), plasmtd insert, Anti-Cancer Drug Des 5,89-92. 125. Waterloh, K. and Fox, K R (1991) The effects of actmomycm on the structure of dA, dT, and (dA-dT), regions surroundmg its GC bmdmg site J Blol Chem 266,638 16388. 126. Bailly, F., Bailly, C., Waring, M J , and Hemchart, J P. (1992) Selective bmdmg to AT sequences m DNA by an acridme-linked pepttde contamlng the SPKK mottf Blochem Bzophys Res Commun 184,93O-937 127 Flock, S , Badly, F., Bailly, C., Waring, M J , Henichart, J P , Colson, P , and Houssier, C (1994) Interaction of two peptide-acrtdme comugates contammg the SPKK peptide motif with DNA and chromatm J Bzomol Struct Dyn 11, 881-900. 128 Fox, K R and Gregg, G W (1988) Diethylpyrocarbonate and permanganate provtde evidence for an unusual DNA conformation Induced by the bindmg of the antitumour antibiotics bleomycin and phleomycm Nucleic Acids Res 16, 2063-2075 129 Nightingale, K. P. and Fox, K. R. (1992) Interaction of bleomycm with a bent DNA fragment Blochem J 284,929-934. 130. Fox, K R. (1988) Footprmting studies on the mteractions of nogalamycm, arugomycin, decilorubicm and viriplanm with DNA Anti-Cancer Drug Design 3, 157-168 131. Bailly, C , OhUigm, C , Rivalle, C , Btsagm, E.. Hemchart, J. P , and Waring, M J. (1990) Sequence-selective binding of an ellipttcme derivative to DNA Nuclezc Aczds Res l&6283-6291 132 Batlly, C. and Waring, M J (1993) Preferenttal mtercalatton at AT sequences m DNA by lucanthone, hycanthone, and mdazole analogs, A footprmtmg study Blochemlstry

32, 5985-5993

133 Marrot, L and Leng, M. (1989) Chemical probes of the conformation of DNA modified by cis-diammmedxhloroplatmum(I1). Blochemlstry 28, 1454-1461 134 Schwartz, A., Marrot, L., and Leng, M. (1989) Conformation of DNA modified at a d(GG) or a d(AG) site by the antrtumor drug cu-d~ammmedichloroplatmum(II) Bzochemutry

28, 7975-1979.

135. Ford, K. G and Needle, S (1995) Perturbations m DNA structure upon interaction with porphyrms revealed by chemical probes. DNA footprmtmg a,ld molecular modelling BloOrg Med Chem 3,611-677

5 Footprinting Studies with Nucleosome-Bound

DNA

Philip M. Brown and Keith R. Fox 1. Introduction Although there have been many studies on the interaction of DNA-binding agents with both natural and synthetic nucleic acids, these have almost exclusively concerned their binding to naked DNA. In contrast, cellular DNA 1s packed into chromatm, generating higher order structures, which may alter the local DNA conformation and/or mask potenttal bindmg sites. This chapter describes the preparation of nucleosome particles contammg radlolabeled DNA fragments that can be used as substrates for footprmtmg experiments.

1.1. Nucleosomes The first level of orgamzatlon of cellular DNA involves the formation of nucleosomes. Each nucleosome contains about 145 bp of DNA that ISwrapped 1 8 times around a htstone octamer, containing two each of htstones H2A, H2B, H3, and H4. Although nucleosomes are associated with many different DNA sequences, there IS constderable evtdence that they adopt well-defined postttons on DNA sequences both m vivo and in vitro (I-5). The packaging of DNA around nucleosomes may be an important factor m gene acttvatton or repression (6). This posittonmg can be considered at two dtfferent levels: translational posmonmg and rotational positionmg. There has been considerable progress in the understanding of the latter, which depends on DNA amsotroprc bendability. Since the double helix must bend as it wraps around the protein, sequencesthat facilitate bending have been implicated m directing nucleosome formatton. In general, GC-rich regions are positioned with their wider than average minor grooves facing away from the protein core, whereas the narrow minor grooves of AT-sequences face towards the protein (1,3). Certain repetitive sequences,as well as double-stranded RNA, will not wrap around nucleoFrom

Methods

III Molecular

Edlted

by

Ebology, Vol 90 Drug-DNA

K R Fox

Humana

Press

Inferacbon

Inc , Totowa,

NJ

frofocols

82

Brown and Fox

somes (71, although recent studies have shown that long blocks of A,, * T, may not be excluded (8,9) Within each DNA fragment it is not possible to satisfy all the local preferences; sequences at the center of each nucleosome have a greater effect on rotational positioning than those toward the ends (10). The hehcal repeat of DNA also varies along the nucleosome from about 10.0 bp per turn at the ends to 10.7 at the dyad, compared with a value of 10.5 for DNA free m solution (5). Much less IS known about the factors mfluencmg translational positioning, but thts too is thought to be determmed by sequence dependent amsotroptc bendmg (II). Those sequences that are harder to bend are more likely to be excluded from the nucleosome

1.2, Interaction of Ligands with Nucleosome-Bound

DNA

Since DNA positioning is determined by its structure and flexibility, one might expect that hgands that distort the DNA hehx will alter the way m which it interacts with the nucleosome, or conversely that the protem core will affect ligand bmding One can imagine several ways in which the nucleosome might modulate the bindmg of hgands to DNA. At the simplest level, tt would not be expected that binding sites that face toward the core should be excluded from drug binding. Ligands that affect DNA bending may also alter the way m which it interacts with the protein. Intercalators that alter DNA persistence length and helical repeat are likely to affect positionmg. Since nucleosome-bound DNA is positioned so that narrow minor grooves tend to face toward the histone core, the best binding sites for hgands like dtstamycin will be maccessible. There have been few studies on the Interaction of ligands with nucleosome-bound DNA (22-26); many of these origmated from Waring’s group m the mid- 1980s. These studtes showed that echmomycm and the minor groove binding hgands alter DNase I cleavage patterns in a manner consistent with the DNA having rotated by 180” on the protein surface. However, this suggestion could not be confirmed wtth hydroxyl radical footprintmg (16). In these studies, although the drugs caused clear changes m the DNase I digestion patterns, no simple footprmts were evident, suggesting that they were occurrmg at low levels of occupancy. In contrast, actinomycm merely binds to accessible sites at low concentrations and displaces the DNA from the histone core at higher concentrations (23). Mithramycin also binds to nucleosomal DNA, but the exact location of the sites is modified by the interaction with the protein (16). Whatever the mterpretation of these results, it is clear that these hgands do not bind to nucleosomal DNA m the same fashion as naked DNA. Another recent example of hgand binding affecting nucleosome structure is that triple helix formation excludes nucleosome assembly and causes a rearrangement of DNA on the nucleosome (17).

83

Foo tpnnting Studres 2. Materials 2.1. Solutions for Nucleosome Preparation All the following solutions should be stored at 4°C.

1 Buffer A 15 mM potassium cacodylate, 60 mM potassium chloride, 15 mA4 sodmm chloride, 0 5 Wspermldme, 0.15 mM spermine, pH 6 0 This buffer can be made as a 10X stock soluhon and diluted to workmg concentrations as required for preparing solutions 1 and 2 2 Solution 1 Buffer A containing 0.34 Msucrose, 0 2 mMPMSF, 1 mn/ibenzamldme, 15 mM P-mercaptoethanol, pH 6.0. Four liters of this solution ~111be needed for each nucleosome preparation PMSF, benzamldme, and P-mercaptoethanol should be added immediately before use.

3 Solution 2. Buffer A containing 0.34 M sucrose,0 2 mM PMSF, and 15 mM P-mercaptoethanol, pH 6 0 One liter of this solution will be required As for solution 1, PMSF and P-mercaptoethanol should be added nnmedlately before use 4. Solution 3 10 mMTns-HCl, pH 8 0, containing 0 2 mM EDTA, 0 2 mM PMSF This solution ISused to lyse the nuclear envelope; no more than 500 mL needs to be prepared 5 Solution 4 20 mA4 sodmm cacodylate, pH 6 0, containing 0 63 M sodium chlorrde, 0.2 WPMSF, and 1 0 mMEDTA This solution IS used as a column buffer for nucleosome purification; 8-10 L should be prepared

2.2. Solutions

for Nucleosome

Reconsthtion

1 20 mhrPTns-HCl, pH 7.4, contamrng 1 mMEDTA This 1sused for dlssolvmg the radlolabeled DNA 2 30 mM Tris-HCl, pH 8 0, containing 4.5 M NaCl and 1 mA4 EDTA. 3 5 n-J4 PMSF (Phenyl methyl sulfony fluoride) 4 5 mM Tris-HCl, pH 8.0, containmg 1 mM EDTA and 0.1% Nomdet P40

2.3. Buffers for DNase I Digestion 1. 10 mMTns-HCl, pH 7.5, containing 100 mMNaC1, for preparing drug solutions. 2. DNase I buffer. 20 n& NaCl, 2 mM MgCl,, 2 mMMnC1,.

2.4. Solutions for Hydroxyl Radical Cleavage This should be prepared immediately before use m ultrapure water. 1. 0.2 mMEDTA 2. 0.2 tr& Ferrous ammonium sulfate. 3. 10 mM Ascorbic acid.

4. 0.1% Hydrogen peroxide. 2.5. DNase I Type IV enzyme,from bovine pancreas(Sigma, St. LOUIS,MO). This should be dissolved in 0.15 mMNaC1, at a concentrationof 7200 Kumtz units mI-‘. This can be stored at -2O”C, and ISstable to frequent freezing and thawing (seeChapter 1).

Brown and Fox

84

2.6. Reagents

for Electrophoresis

1 TBE electrophoresis buffer This should be made as a 5X stock soluhon contammg 108 g Tns, 55 g boric acid, and 9 4 g EDTA made up to 2 L with water 2 Gel loading buffer Formamide contammg 10 mM EDTA and 0 1% (w/v) bromophenol blue 3. Methods

3.1. Nucleosome

Preparation

Nucleosomes are prepared from chicken red blood cells by a method modified from Lutter (18) and Drew and Travers (1,19). All steps should be performed at 4OC unless stated otherwise. Approximately 50 mL of fresh chlckens blood 1s required This can usually be collected form a local abattou- and must be immediately mixed with l/7 vol of 84 mM sodium citrate pH 7.0 to prevent coagulation (see Note 4). 1 Dilute the blood to 500 mL with solution 1 2 Centrifuge the resulting mixture at 5008 (1 e., 2000 rpm m a Beckman JA20 rotor) for 3 mm and discard the supernatant. 3 Resuspend the pellet in a further 500 mL of solution 1, 4 This should be repeated three times. The supernatant will become clear with successive washes White blood cells form a thm layer on top of the red blood cells, and may be removed with a pipet 5 Two liters of solution 1 should now be adjusted to 0 1 % v/v Nomdet P40 and the pH then be adjusted from 6 0 to 7 5 with Trrs base 6 The pellet 1s resuspended m 500 mL of this solution, which will lyse the cell walls releasmg the cell nuclei Centrifuge at 1OOOg(I e ,300O rpm m a Beckman JA20 rotor) for 3 mm and discard the supernatant 7 Repeat this step a further three times to wash the nuclei The pellet should become white and contains the cell nuclei 8. The washed nuclei should be resuspended m solution 2 and centrifuged at 1OOOg (3000 rpm) for 3 min. Again the supernatant should be discarded 9. Resuspend the pellet m 100 mL of the same buffer, after adjustmg the pH to 7 5 using Trls base. Any material that does not dissolve should be broken Into smaller pieces by gentle pipetting The DNA concentration of the solution can be determined from the absorbance at 260 nm, measured in 0.1 M sodium hydroxide. The absorbance should then be adjusted to 50 U/mL of nuclei, correspondmg to about 5 mg/mL protem plus DNA. It is found that, with fresh chicken blood, the absorbance 1s usually close to this value and no adjustment is necessary. The next stage 1s mlcrococcal nuclease digestion. This 1s performed to release the DNA from the nuclear cell wall, so that when the nuclei are lysed

Footpnntmg Studies

85

the chromatm can be separated from the nuclear envelope. A trial digest (steps 10-11) should be performed to estimate the correct digestlon time (see Note 2). 10 One mllllllter of the mixture should be adjustedto 1 mA4calcium chloride and incubated at 37°C for 3 mm Micrococcal nuclease IS then added to a concentration of 40 U/mL Samples should be removed after digestion for O-20 mm. Digestion is stopped by adjusting the solution to 2 mA4 EDTA. 11 Centrifuge the samples at 3000g (5000 rpm) for 10 mm The supernatant is discarded and each of the pellets IS resuspended m solution 3 The pH must be kept above 7 5 to ensure that the chromatin stays m solution The solution should be kept on ice for at least 30 mm, shaking gently as required to bring the chromatic back into solution. The very low salt concentration m this step lyses the nuclear membrane, and thereby releases the dlgested material mto solution.

The absorbance of these solutions should be measured at 260 nm to determine the DNA content. After lys~sfor 30 min the solutions are again centrifuged for 10 min at 3000g (5000 rpm). An appropriate level of digestion should release 7040% of the total absorbance into the supernatant. 12 This process should now be repeated for the whole of the nuclei solution obtained m step 7, using the dlgestlon time obtained from steps 8 and 9 The supernatant should now contam about 300 mg of soluble chromatin

It should be noted that the activity of micrococcal nuclease 1sexpressed in two kmds of units, based either on prnoles of DNA released (Sigma, St. LOUIS, MO) or on the absorbance of DNA released (Boehrmger, Mannhelm). All concentrations of the enzyme hsted above are m units of absorbance released; to convert from units of pmoles to units of absorbance, multiply by 85. 13. The total volume of the supernatant should now be measured accurately and transferred to a flask at 4°C 4 M sodium chloride should now be added, dropwlse whrle strrring, so as to achieve a final concentration of exactly 0 65 M. The solutlon of chromatin should start clear, turn cloudy, and then go clear again as more salt 1s added. This step ensures the quantltatlve release of histones Hl and H5 from the chromosomal fiber. The solution now contams Hl/H5 stripped long chromatm, together with free histones Hl and H5. 14 The solution, which contams a mixture of Hl stripped chromatm, hlstone pro-

teins Hl and H5 and somefree DNA, 1snow applied to a column of Sepharose 6B (2.5 x 100 cm) that has been equlhbrated m solution 4 Hl stripped chromatm will elute after about 68 h (see Note 3). The absorbance of all column fractions need to be measured. A plot of absorbance versus fraction number should show two peaks; the first peak contams the HI stripped chromatm, whereas the second contams linker DNA and histone proteins Hl and H5. Small ahquots of representative fractions can be applied to a protein gel, contammg 18% acrylamlde and 0 1% SDS, to look for the presence of histones HI and H5 (see Note 1)

Brown and Fox

86

15. The fractions containing Hl stripped chromatm but not hrstonesH 1 and H5, are combmed mto a smgle volume and concentrated to 8 mg/mL by ultrafiltratton usmg a PM10 membrane If the nucleosome cores are to be stored m 50% glyc-

erol they should be further concentratedto 16mg/mL. Proteins H2A, H2B, H3, and H4 should be checked for proteolysrs after ultrafiltration, on an 18% polyacrylamrde gel. The total yield of this H 1-stripped chromatin IS typically about 80 mg protein Thus can be stored at 4°C for l-2 mo, or at -20°C for 3-6 mo m 50% glycerol, 1.0 mM benzamrdme. Some workers digest thusmaterial further with mrcrococcal nuclease,releasmg mononucleosomes, and requiring further column purrficatron (1,20). However, it 1sfound that thusis not necessaryfor preparing nucleosomesreconstituted with short (I00 pg of a selected supercolled plasmld DNA from E colz by alkaline lysls, followed by phenol-chloroform extraction and ethanol preclpltatlon (4). The DNA should be stored m TE buffer (see Notes 1 and 2). 2 Obtam the followmg reagents commercially: a. SequenaseTM DNA sequencing kit (US Blochemlcals, Cleveland, OH) containing* I Sequenase, a modtfied form of bacteriophage T7 DNA polymerase 11 dNTPs and ddNTPs stocks 111 Sequencing reaction buffer (see Note 3). b [cz~~P] dATP m aqueous solution (Amersham or New England Nuclear) c Oligonucleotlde primers complementary to the bacterral plasmld (see Note 4)

119

Drug-DNA Interactions Control

Netropsin

GATC

GATC

Fig. 1. PIA autoradiogram of netropsin-treatedDNA: 100 yglmL netropsin was reactedwith the oligoprimed plasmid DNA for 2 h at 22”C, and then subjectedto PIA. The noncovalent interaction with DNA results in the accumulation of “Ns” within G:C rich segmentsof a DNA sequence.The strong netropsin PIA arrest site(s) on the gel at 5’-TTCCWCTCT (wherethe underlinedsitesappearasNs) correspondsto 5’-AGAGEGGAA on the template strand. The weaker arrest site(s) within the autoradiogram sequence5’-CCGAGCGCTGG correspondsto 5’-CCAGCGCTCGG on the template strand. The sequencesare read starting at the bottom, and the dots denoteNs or sites of DNA polymerasearrest. 3. Obtain or preparesufficient stock reagentsfor multiple experiments: a. 50 mL Dimethyl formamide (DMF). b. 50 mL Dimethyl sulfoxide (DMSO). c. 50 mL 2.0 A4Sodium hydroxide (NaOH); preparedfresh weekly. d. 50 mL 3.0 A4Sodium acetate(NaOAc) pH 7.0. e. 500 mL Ethanol (EtOH; at -2O’C). f. 500 mL 75% EtOH. g. Siliconizing agent. h. 10 mL 0.1X SSPE:15 mMNaC1, 1 mMNaH,P04, 0.1 mMEDTA, pH 7.4. i. 200 mL 38% Acrylamide/2% his-acrylamide.

Dooley and We/land

720 J k 1 m. n o

10 mL 10% Ammonmm persulfate (APS); prepared fresh weekly 10 mL TEMED 500g Urea 2.0 L 10X TBE buffer* 0 89MTns base, 0.89Mbonc acid, 20 mMEDTA, pH 8 0 100 mL 1X TE buffer 10 mMTrts-HCl, 1 mMEDTA, pH 8 0 1 mL 1 5X Sample loadmg buffer 95% formamtde, 20 mM EDTA, 0 05% xylene cyanol FF, 0 05% bromophenol blue

2.2. Equipment 1 2000+ V electrophorests power transformer 2 DNA Sequencing polyacrylamide gel electrophoresis apparatus (mm of 40 cm long, e g., IBI or Jordan Scientific). 3 PAGE gel spacers and well-forming combs (0 4-mm thickness) 4 Whatman 3MM blotter paper 5 Autoradiographic film (e g , Kodak BioMax or XAR film) 6 Autoradiographic film cassette (Spectromcs). 7. Vacuum- and heat-asststed gel dryer (Blo-Rad). 8 Vacuum pump with refrigerated organic phase trap (Savant) 9 Plastic wrap (e g , Saran wrap) 10. 20,200, and 1000 pL Pipetman and disposable tips (Ramm) 11 Disposable gloves 12 60 mL disposable syrmges and 18-gage needles. 13 Microfuge (Eppendorf or Brmkmann). 14 Microfuge tubes (1.5 mL) 15 Plexiglass p-emitter shield (Jordan Scientific). 16 Gel-sealing tape

3. Methods 3.1. Denaturation

of DNA

1 For each set of sequencing reactions, denature 1 or 2 pg of double-stranded plasmid DNA in 20 uL of 0 2 MNaOH m a 1 5-mL microfuge tube for 5 mm at 22°C (for each sample) If more than one test agent, differing agent concentrations, or ohgonucleotide primers are to be studied, then set up sufficient additional samples m an identical manner A negative control reaction m which no agent is added should always be included for each primer. 2 Add 0 1 vol of 3 MNaOAc, pH 7 0, and 2 vol of chilled EtOH, 3. Precipitate at -70°C for 10 mm, then spm in a microfuge for 5 mm at 16,000g. 4 Remove supernatant and rinse pellet by vortexmg in 1.O mL 75% EtOH at room temperature, then spm m a mlcrofuge for 2 mm (see Note 5) 5. Remove the rinse supernatant and vacuum dry the pellet (see Note 6)

3.2. Preparation

of Polyacrylamide

Gels

1. Clean glass plates with detergent, rinse with dH,O, and rub with Kimwipes and ethanol Apply smconizmg agent to one surface of only one plate Assemble

Drug-DNA

121

Interactions

glass plates and spacers (ca. 0 4-mm thrckness). Taping of edges may be necessary to prevent leaks 2. Prepare acrylamide gel mix by dissolvmg 48 g urea m 50 mL dH,O by heatmg at 65OC briefly in a microwave (final concentration IS 8 M urea), then cool to room temperature For a 6% acrylamide gel, add 15 mL of acrylamidelbu-acrylamtde stock (acrylamide is toxtc and requires gloves when handling), 10 mL of IOX TBE, and adjust volume to 100 mL with dH,O. 3 When ready to “pour” the gel (standing upright and tilted back), add 0.5 mL 10% APS and 5 yL TEMED to the gel solution, qutckly mtx without producing air bubbles, and fill immediately between the plates using a 60-cc syringe and steady pressure Lay the gel horizontal on the benchtop and insert the comb Cover the gel top with a piece of plastic wrap The gel should polymerize within 30 mm.

3.3. Oligonucleotide

Priming and Drug-DNA interaction

1 Resuspend the denatured DNA m 2 pL of 5X Sequenase buffer and 6 uL of water containing 10 ng of the appropriate ohgonucleotide primer (without delay) and vortex to mrx 2. Anneal the primer to the denatured DNA by mcubation at 37 C for 1 h 3 Add 2 yL of the DNA-interactive test compound m solutton (see Notes 7 and 8). 4. Incubate at 37°C for 1 h, followed by an optional mcubation at room temperature (ca. 22°C) for an additional 2 h (see Note 9) 5 (Optional) If the agent IS suspected to form stable alkyl adducts, then the drugtreated samples can be precipitated m 0 1 vol of 3 0 MNaOAc, pH 7 0, and 2 vol of EtOH to remove unbound excess agent Following precipitation and centrifugation, the samples should be resuspended and primer annealed as per steps 1 and 2 (and skip steps 3 and 4) Thus, by simply ethanol precipitating the drugtreated samples prior to the PIA reactions, one can remove the noncovalently bound portion of the agent This option can help discrtmmate between DNA bonding and DNA-binding agents (i e., binding agents are likely removed by EtOH precipitation).

3.4. DNA Sequencing Reactions and Gel Electrophoresis 1. The ohgonucleotide-primed, agent-treated DNA samples are subjected to routine dideoxynucleottde chain termination sequencing (3), using [cL-~~P] dATP and the Sequenase protocol outlmed by the manufacturer (US Biochemicals, Cleveland, OH), contained within the commercial DNA sequencing kit Do not repeat the denaturation step(s) described by the manufacturer All reactions should be done using appropriate radtotsotope shieldmg (see Notes 3 and 10) 2. Remove the seal and spacer at the bottom of the polymerized 6% gel. Then mount the gel in the electrophoresis apparatus, fill the reservoirs with 1X TBE, remove the comb, and flush all air bubbles from the gap between the plates at the bottom of the gel using a 1X TBE-filled syringe and bent needle. Prewarm the gel at constant current (suggested 30 mA) for 30 mm to ca 55°C. Prior to loading samples, the wells must be manually rinsed using a Pasteur pipet to remove urea

Dooley and Weiland

122

3. Add 4 pL of the 1.5X runnmg dye mtxture to each reaction (G, A, T, C), and boll the samples for 5 mm prror to loading the prewarmed polyacrylamtde gel. 4 Load l-2 pL of each sample onto the gel from left to rrght with the G, A, T, C lanes of the untreated control DNA, followed by a space and the next set of samples (1.e , the test agent-treated samples) Then, maintain constant current durmg electrophoresls One may also do a second loadmg m other wells on the gel l-2 h later, to permtt “readmg” further on the gel 5 After the bromophenol blue dye (faster mobrlny than xylene cyanol) has run off the bottom of the gel, turn off the current and dtsassemble the gel plates The gel will adhere to the nonsilrconized plate and should be delicately transferred to Whatman paper, covered wrth plasttc wrap, and drred m a vacuum- and heat-

assistedgel dryer 6 Expose X-ray film overnight (8 h) to the plastic-wrapped surface of the gel (wrthm a film cassette) Develop the autoradlogram the followmg mornmg If the exposure mtensrty is too low, then re-expose longer or wrth the atde of an mtenstfier screen at -70°C

3.5. Interpretation

of Results

The radtoacttve products of the DNA sequencing reactions wtthin the drted gel will produce an Image on the X-ray film that ISvery similar to conventtonal Sanger drdeoxynucleottde chain termmation DNA sequencing (Fig. 1). The smaller fragments migrate faster than the larger fragments (htgher up the gel). One reads the DNA sequence startmg at the bottom of the autoradiogram, whrch corresponds to the ohgonucleottde prtmer-proxtmal sequence The mformatron will be revealed

in a 5’- to 3’-dn-ectron,

and will correspond

to the

complement of the template strand being read by the DNA polymerase. The sttesat which polymerase is inhibited or terminated on the template strand will result m an accumulation of nascent radrolabeled DNA molecules in the drugtreated samples relative to the untreated control. In the case of bulky adducts (e.g., adozelesin), the accumulatron appears at the nucleotrde posttton tmmedtately adjacent (5’) to the adduct site. However, the sequence information read from the actual gel corresponds to the complement of the template strand (1.e, the displaced strand) being synthesizedby the polymerase. Therefore, one Infers the polymerase arrest sites as the complement of the actual autoradiographic data. By way of example, the following adozelesm alkylatlon

result has been reported

(I): the untreated control sequence 5’-GAGTAT appears wtthm the gel m the drug-treated sequence as 5’-GANTAT, where the “N” mdtcates the site of terminated nascent molecule accumulatron m all four lanes. This result mdtcates that the actual template adduct is located at the adenosme nucleottde denoted by the asterisk m the complementary sequence 5’-ATA*CTC. Adozelesm 1sa known minor groove N3 adenosine alkylator with reactivity to the consensus sequence S-ATA* or S-TTA*. Another example of polymerase inhibition by

Drug-DNA

Interactions

123

netropsin, a nonbonding agent, 1sdemonstrated m Fig. 1. In this case, netropsm m interacting at G-C rich regions of double-stranded DNA. It 1srecommended that all sequences flanking the “Ns” be recorded for results obtained from approx 1 kb of sequence. Then, ahgnment of the multiple Ns can reveal the consensus for binding or bonding of the agent. One must always compare the drug-treated and control samples, as some polymerase inhibition sites are often observed without any agent binding or bonding, because of inherent structural constraints of the template (e.g., G:C rich regions or secondary structure). In some instances, multiple consecutive Ns can be observed wtthm a short sequence on the gel. It is possible that selected less bulky alkyl adducts, mtercalators, and nonintercalattve bmdmg agents arrest at the bonding or bmding sttes per se, whereas adozelesin arrests polymerase at the adjacent nucleotrde posttion (i.e., prior to the adduct). The tttration of the test agent can be adjusted to yield etther mmimal or complete polymerase termmation, as has been observed for adozelesin (1) and melphalan (unpublished results) A caveat should be noted: rf no “background” sequencmg ladder 1sproduced m the drug-treated samples, tt IS formally possible that the test agent has a direct effect on the DNA polymerase enzyme, independent of DNA interaction. Furthermore, tt has been noted that some target sites wtthm a DNA sequence react better than others, resulting in quantitative differences m PIA band density (see example in Fig. 1). These differences could be quantrfied by densitometrtc scannmg for rank ordering. If necessary, the PIA-derived mteractlon sates can be confirmed using other techniques (e.g., Maxam and Gilbert chemical cleavage sequencing or postlabelmg methods).

4. Notes 1. Purification of supercoiled plasmid DNA via CsCl gradient ultracentrifugation IS preferred, although ion exchange chromatography (e.g., DEAE resin or Elutip-d columns from Schleicher and Schuell, Keene, NH) may be used following the phenol-chloroform extraction. The plasmid concentration should be determined spectrophotometrically. 2. The plasmid choice is largely irrelevant, although the following guidelines might be helpful. a. It is convenient to use a known plasmid for which a variety of ohgonucleotlde primers are either already avallable in one’s laboratory or else commercially available (e.g , pUC 19, pGEM vectors). b The primers should not bind precisely at the sequences suspected to be sites for alkylation adduct formation c. Depending on the anticipated sequence selectivity of an agent, one should select a plasmid known to contam several permutations of the putative interaction sequence flanked by available oltgonucleotide primers, or else create test plasmids by hgation of synthetic double stranded ohgonucleotides contaming the desired sites into a convenient vector restriction cleavage site

Dooley and Weiland

3

4

5 6

7

8

9.

10

d Use a common bacterial plasmid vector contaming a ColE 1-related multicopy replication ortgm (5) It has been determmed that the Klenow (large) fragment of E toll DNA polymerase I also works well m the PIA method. Therefore, one can substttute the Sequenase enzyme (and kit) for other bacterial polymerases (and kits), provided the reaction buffers are compatible with PIA The ohgonucleottde primers should be ca. 15-25 deoxyrtbonucleottdes m length, capable of forming approx 50% G C bp with the template, and each should bmd specifically to only one site on the plasmid vector The 75% EtOH rmse is likely necessary to remove the excess NaOH and salts If the agent is suspected to produce bulky alkyl adducts on DNA, then the method may be modtfied to permit mcubatton and alkylatton of the DNA prior to denaturation The denaturatton step merely allows the ohgonucleotide primer to bind for use as the free 3’-OH for DNA synthesis Simply premcubate the DNA and the test agent in the approprtate aqueous solutton (e.g , 0.1X SSPE) prior to ethanol rmsmg and denaturatton by 0 2 MNaOH However, note that denaturatton m NaOH might affect the adduct, resultmg m its cleavage. If totuc strength ts constdered as a stgmficant vat-table for bmdmg or bonding, then the drug-DNA mteraction may be supplemented with MgCl,, NaCl, or KC1 (although not tested m our hands) The stock solution of the test compound should be prepared fresh by dtssolvmg it m either dHzO, DMSO, or DMF (in which the agent is known to be readily soluble) The suggested concentration of the agent m the stock solution should be > 100 I~V and < 100 n&f. The stock solution should be serially diluted m the same solvent, and several concentrations of the agent should be used to treat the DNA samples, m order to determine empirically the optimal amounts needed to detect mteracttons with the DNA For instance, the extremely potent N3-adenosme alkylator adozelesm (U-73975) is easily detected m this assay at 20 ph4 final concentration, at a drug plasmtd DNA molecule ratio of approx 200: 1 A typical 3.0-kb plasmid contains approx 47 copies of a umque 3-bp recogmtton sequence. If the test agent has sequence selecttvny for less than 3 bp, then the number of potential target mteractton sites can exceed several hundred per template molecule, and would likely require higher concentrattons of the test agent to produce the same relative levels of mhibttion. These mcubatton times and temperatures are suggested for the mttral attempts However, one should empirically determine the opttmal drug-DNA mcubatton times, temperatures, and concentrattons for mdtvldual agents In the authors’ hands, most agents Interact, or at least alkylate, better at elevated temperatures (e g., ca. 37°C relative to room temperature). One can also use the Sequenase kit wtth the deaza-dNTPs to assist m resolutton of normal polymerase mhibition sates (not test agent related).

Acknowledgments The authors are grateful to Dr. Mark Mitchell encouragmg dlscussrons.

(Upjohn)

for mslghtful

and

Drug-DNA

Interactions

125

References 1 Weiland, K. L and Dooley, T. P. (1991) In vztro and zy1vzvo DNA bonding by the CC-1065 analogue U-73975. Biochemistry 30,7559-7565. 2. Mitchell, M. A., Wetland, K. L., Aristoff, P. A., Johnson, P. D., and Dooley, T P. (1993) Sequence-selective guanme reacttvtty by Duocarmycm A. Chem Res Toxic01 6,42 l-424 3 Sanger, F., Nicklen, S., and Coulson, A. R. (1977) DNA sequencing with chamtermmatmg mhibltors Proc Nat1 Acad Scl USA 74,5463-5467. 4. Sambrook, J , Frtsch, E F., and Mamatis, T. (1989) Molecular Cloning A Laboratory Manual (2nd ed ), Cold Sprmg Harbor Laboratory, Cold Spring Harbor, NY 5. Dooley, T. P., Tamm, J , and Pollsky, B (1985) Isolatton and charactertzatlon of mutants affecting functional domains of ColEl RNA1 J A4ol &ol 186, 87-96

a Transcriptional Footprinting of Drug-DNA Interactions Don R. Phillips and Carleen Cullinane 1. Introduction There are now approx 50 registered anticancer drugs that are m routme cln-ncal use as chemotherapeuttc agents (1-3). Of these, over half are known to interact with DNA, either by mtercalation (e.g., doxorubicm, mitoxantrone), groove bmdmg (e.g., distamycm), formation of adducts or crosslmks (e.g., melphalan, cisplatm, mitomycm C), or by mcorporation of modified bases (e.g., 5-fluorouracil, 6-thioguanme). There has therefore been a great effort over many years to establish where on the DNA these drugs interact, with the expectation that a good understanding of the nature of the DNA receptor site would lead to the design of a new generation of these drugs. The early attempts to elucidate the sequence specificity of DNA-binding drugs relied largely on physicochemical techniques such as detergent sequestration dissocration kmetics (4,5), equilibrium dialysis (61, and spectrophotometric and spectrofluorometric binding studies (7,s). Whereas these approaches were successful in defining the overall sequence specificity of reversibly binding drugs (i.e., the average of a multitude of binding sites on heterogenous DNA), they do not generally provide details of the drug-DNA interaction at individual sites on the DNA (8). For this reason a variety of DNA footprintmg procedures evolved, such as DNaseI, MPE-Fe(H), and hydroxyl radical footprmtmg, and these have been reviewed extensively (P-12). Alternative techniques have since emerged that yield similar sequence specificity mformation of the location of drug sttes m a pseudophysiological situation where drug sites are revealed by blockage to the processivity of either exonuclease (13,14), DNA polymerase (15,16), or RNA polymerase (17-21). Procedures that are dependent on blocking the progression of RNA polymerase along dsDNA are From

Methods

w Molecular Bo/o~y, Vol 90 Drug-DNA lnteracbon Edlted by K R Fox Humana Press Inc , Totowa, NJ

127

Protocols

128

PhillIps and Cullinane

now referred to as an “in vitro transcrrption assay” or alternatrvely as “transcrrptlonal footprintmg.” The term “brdrrectlonal transcrtptron footprmtmg” denotes the use of two counterdnected promoters, such that truncated transcrrpts to both srdesof the drug site define the physlcal sizeof the drug-occupred region (20-22). The m vitro transcrrptronal analysrs of drug-DNA mteractlons reqmres a synchromzed populatron of mmated transcrrption complexes, all of whrch contam the nascent RNA of the same length, with all of these transcrrpts beginning from the same mmatron nucleotide. In order to ensure that this assay IS as versatile as possible (i.e., so that it can be applied to both reversibly and n-reversrbly bmdmg drugs), these condrtions restrict the number of promoters that can be employed to those with the followmg characterrstrcs’ 1, They should not requne additional actlvatmg elementssuchas CAP and CAMP, smcetheseadd an unnecessarydegreeof complexrty to the assay 2. They should be “strong” promoters (I e , the RNA polymerase should have a hrgh aftimty for the promoter region) 3 “Shppage” at the start sate of transcrrptron should be mmtmal-the fidehty of the start sate of transcrtptlon should be >99%, or must be able to be “forced” to that level of fidelity 4 The rate of formatron of the mittated transcripts should be raptd (for expertmental convenience) 5 The sequence of the nascent RNA must be such that a stable mrtiated complex can be formed with only three (or less) nucleotrdes 6. The half-life of the initiated transcriptron complex should be at least several hours

Several promoters satisfy all of these criteria (Table 1). Since the luc UV5 promoter has been extenstvely characterized, rt has been used for all initial work m this assay, and has continued to be the promoter most widely used. Stable inmated complexes of UV5 exist when the nascent RNA IS 10 nucleottdes (yteldmg a complex with a half-life of 23 h) (29, with increasing stabrlity resulting from longer transcripts formed by the use of longer initiating olrgonucleotrdes (26). Once the inmated transcription complex has been formed, rt IS then reacted with the drug of interest. Subsequent elongatton of the transcrrptron complex yields RNA of lengths up to the drug blockage sites, and defines the location of each drug binding site-the physical size of the drug site 1s also revealed if transcription IS initiated from two counter-directed promoters, which yield transcripts up to both sides of the drug site. Quantitation of the relative amount of each blocked transcript, as a functton of elongatron time, yields the relative drug occupancy at each site, the dissociatron rate constant of drug from each site, and the probability of termination of transcription at each site.

Footprinting of Drug-DNA Table 1 Promoter Systems that Yield Synchronized Promoter uv5 N25 TetR SP6 T3 T7 W.

Interactions

Initiated

Transcription

129

Complexes

Imtiation dmucleotide

Nucleotide absent during mltiatlon

Length of nntlated transcript

Ref

GA AU AG AG AG AG AU

CTP CTP GTP GTP CTP UTP UTP

10 29 11 9 12 13 15

23 22 23 24 24 24 23

2. Materials

2.1. Unidirectional Transcription The following items are required for in vitro transcription from the E colz lac UV5 promoter contained from the plasmid pCC 1 1 2 3 4

5 6. 7. 8 9 10.

11. 12.

on the 512-bp PvuIIIHindIII

fragment

derived

Lac UV5 promoter, contained in the plasmid pCC1 (see Notes 1 and 2). Agarose, electrophoresls purity reagent (Blo-Rad, Hercules, CA). Blo-Trap electroelutor (Schleicher and Schuell, Dassel, Germany). Phenol/chloroform* redistilled phenol (Kodak, molecular biology certified), equilibrated with TE buffer and containing 0.1% hydroxyqumolme and 0.2% P-mercaptoethanol, in 1.1 mixture with chloroform (BDH)/lsoamylalcohol (BDH) (24: 1, v/v) Store at 4°C 5 Mammomum acetate m Type I water from a M&-Q water purlficatlon system (Mllllpore, Bedford, MA). Urea, electrophoresis purity reagent (Blo-Rad) Acrylamide and bu-acrylamlde (electrophoresis purity reagent, Blo-Rad) as 30% stock solution (19 1) m MI&Q water (see Note 3). TEMED, electrophoresls purity reagent (Bio-Rad) Ammomum persulphate, electrophoresis purity reagent (Blo-Rad) Transcription buffer 40 mM Tns-HCl, pH 8.0, 100 mA4 KCI, 3 mM MgC&, 0 1 mA4 EDTA, 5 mM DTT (electrophoresis purity reagents, Blo-Rad), 125 pg/mL BSA (RNase and DNase free, Pharmacla, Plscataway, NJ), 1 U/pL RNase mhtbltor (human placenta, Pharmacla). Make as a 10X stock solution In M&-Q water and store at -20°C (see Notes 4-6) E cd RNA polymerase (1 U/pL, New England Blolabs, Beverly, MA). Rlbonucleotides ATP, CTP, GTP, and UTP (ultrapure reagents, Pharmacla): 100 @4 stock solutions m Milli-Q water Store at -20°C.

Phillips and Cullinane

130

13 Dinucleottde GpA (ultrapure reagent, Pharmacia) 2-mM stock solutton m Mtlh-Q water. Store at -20°C 14 10% Methoxy CTP/90% CTP, 3’-methoxy CTP (Pharmacia, 0.02 mA4) and CTP (0 18 mM) m transcriptton buffer containtng 0.8 M KCl, and 5 m/r4 of each of ATP, GTP, and UTP Store at -2O’C (see Note 7) 15. 10% Methoxy GTP/90% GTP* 3’-methoxy GTP (Pharmacia, 0 02 mM) and GTP (0 18 mA4) m transcription buffer contammg 0 8 M KCl, and 5 mM of each of ATP, CTP and UTP. Store at -20°C (see Note 7) 16 2 mg/mL grade 1 heparm (Sigma, St Louis, MO) dissolve in Milli-Q water. Store at -20°C 17 Elongation nucleotides ATP, CTP, GTP, and UTP (all 5 mM) m transcription buffer containing 0 8 M KC1 18 CX-[~~P]UTP (3000 Ci/mmol, Amersham, UK) (see Notes 8 and 9) 19

20 21 22 23 24 25. 26 27

1X TBE (Trwborate-EDTA)

buffer

90 mM Trls, 90 mA4 boric acid, 2 mh’

EDTA, pH 8 3 Store at 4°C as a 10X stock solutton 1X TE (Tris-EDTA) buffer. 10 mMTrn+HCl, 1 mM EDTA, pH 8.0, made up m Milli-Q water Store at 4°C as a 1OX stock solutton Termmation/loadmg buffer. 10 Murea, 10% sucrose, 40 mA4 EDTA, 0.1% xylene cyanol, 0 1% bromophenol blue m 2X TBE buffer, pH 7 5 Fixing solution. 10% acetic acid/lo% methanol (v/v) Hyperfilm-pmax X-ray film (Amersham, UK) and laser densttometer, or alternatively, a Molecular Dynamics 400B PhosphorImager or equivalent Restrictton endonucleases PvuII and Hind111 (Boehrmger Mannhelm, Germany). High-resolution DNA-sequencing electrophoresis apparatus and power supply (preferably constant wattage supply up to 3000 V, 150 W). Transilluminator (Spectroline, Spectrontcs [New York], Model TVC3 12A, 3 12 run) Speed Vat Concentrator (Savant, NY)

2.2. Bidirectional

Transcription Footprinting

For bidirectional transcrlptlon footprinting, most of the Items llsted m Subheading 2.1. are required, together with the following items. 1 Counter-directed UV5 and N25 promoters contained m the plasmtd pRW2 (see Note 10).

2. Restrtctton endonucleases DraI, BstNI, PvuII, and XhoI 3 Dmucleottde ApU (ultrapure reagent, Pharmacia) 2-&stock solution in MilltQ water. Store at -20°C 4 Trmucleottde dGGA. Synthesize using any DNA synthesizer (0.2 or 1.O umol scale) 2-mh4 stock solution m Milli-Q water Store at -20°C

3. Methods The formation of drug-induced transcrtptronal blockages requires a range of distinct steps-to aid the understanding of these steps they have been represented diagrammattcally in Figs. 1 and 2 and are described in Subheadings

Footprinting of Drug-DNA

interactions

131

RNA POLYMERASE

HEPARIN

INITIATE

ELONQAlE

Fig. 1 Overview of the transcription assay. The major steps are: (1) formation of a synchromzed mrtiated transcrrptron complex (see Fig. 2 for details), (2) reactron of the imtrated transcrtptron complex with drug; (3) elongatron of the transcription complex to yield drug-induced blocked transcripts.

3.1.-3.5. Details of a rigorous analysis of the kinetics of RNA polymerase progression past each drug-induced blockage site are outlined m Subheading 3.6.

A method for obtaining a brdirectlonal transcriptional footprint of drug sites IS presented in Subheading 3.7.

Phillips and Cullinane

132 5 I ----w-w-----3 9-------m-m---

GGAATTGTGAGCGGATAACAATTTCACACA CCTTAACACTCGCCTATTGTTAAAGTGTGT

GPA [3*P]-UTP,ATP,GTP E.coli RNA polymerase

5'------------3 I -I-----------

+l I

*

GGAATTGTGAGCGGATAACAATTTCACACA CCTTAACACTCGCCTATTGTTAAAGTGTGTGT

**

*

5 ’ - GAJLuuGuGAG \ 2

Template NascentRNA

strand

Fig 2 The synchronized imtlated transcription complex Imtlatlon of the luc UVS promoter with GpA, ATP, GTP, and CI-[~~P]UTP results m a stable transcnptlon complex contammg a nascent RNA mainly 10 nucleotides m length, up to C of the nontemplate strand (denoted with an arrow), since CTP IS absent from the mltlatlon nucleotlde mixture The nascent RNA begins at the - 1 position with G of GpA present m the mltlatlon mixture The first nucleotlde of the transcript formed under normal condltlons IS denoted as +I, RadIolabel (32P) IS Incorporated into the nascent RNA at three sites, denoted with an asterisk.

3.7. Isolation of 512 bp lac UV5 DNA Fragment (see Notes 2, 17, and 72) 1 Digest 10 pg of pCC1 (1 h, 37°C) with PvuII (10 U) and Hind111 (10 U) in 50 pL of buffer supplied with the restrictlon enzymes (see Note 2) 2 To separate the resultant two DNA fragments, SubJeCt the restriction digest to electrophoresls usmg a 1.5% mimsubmarme agarose gel contammg 0 5 pg/mL ethldmm bromide at 10 V/cm for 2 h (TBE buffer) 3 Vlsuahze the locatlon of the 5 12-bp fragment with a translllummator (see Note 11) 4 Cut out the sectlon of agarose contammg the 5 12-bp DNA 5 Place the agarose into a Blo-Trap apparatus and electroelute the DNA fragment 6 Purify the DNA further by extracting with an equal volume of phenol/chloroform. 7 Transfer the upper aqueous phase to a fresh tube 8. Add an equal volume of 5 M ammonmm acetate followed by 2 vol of ethanol. Leave at -70°C for 30 mm and then collect the DNA pellet by centrlfugatlon m 1.5mL tubes at approx 12,OOOgfor 15 mm

Footprin

ting of Drug-DNA

in &t-actions

133

9 Redissolve the DNA m TE buffer to a concentration of approx 100 ng/pL (see Note 12)

3.2. Synchronized lnifiafed (see Notes 73-78)

Transcription

Complexes

1. To a 1.5-mL microcentrlfuge tube add 1.5-2.0 yg of lac UV5 DNA fragment (approx 50 r&I), 50 pL of 2X transcription buffer and add MIIII-Q water to a total volume of 100 PL. 2 Add 1 PL of E colz RNA polymerase, mix gently, and Incubate for 15 mm at 37T (see Note 13) 3. Add 10 PL of heparm and incubate for 5 mm at 37 “C (see Note 14) 4 Add 20 pL of GpA, 10 pL of ATP, 10 PL of GTP, and 100 ~CI w[~~P]UTP (dried in a Speed Vat Concentrator and redissolved m 50 JJL of 2X transcrlptlon buffer) and Incubate for a further 5 mm at 37°C (see Notes 15-17) The resulting initiated transcription complex comprises a nascent RNA predominantly 10 nucleotldes long (see Fig 2), and 1svery stable with a half-hfe of 23 h at 37°C (see ref. 25; Note 18). 5 Take a 5-pL ahquot of the mitiated complex and add to 5 yL of termmatlon/ loadmg buffer on Ice.

3.3. Formation of Drug-Induced (see Notes 7, 19-27)

Blocked Transcripts

1. Take two 5-yL aliquots of the mltlated transcript, add 5 PL of 10% 3’-methoxyCTPI90% CTP to one and 5 pL of 10% 3’-methoxy-GTP/90% GTP to the other, incubate at 37°C for 5 mm (see Note 19), then add 5 JJL of termmation/loadmg buffer to both samples 2. Divide the remaining Initiated transcription complex mto two equal parts. To one half add the drug of Interest (see Note 20) for a sufficient length of time to ensure that an equilibrium has been estabhshed-typically 5-60 mm for a reversibly reacting drug, but up to 48 h for slow, irreversible processes such as some alkylatlon events (25). To the other half add a similar volume of buffer used for the drug solution. 3. Add an equal volume of elongation nucleotldes to both control and drug-treated initiation mixtures (see Note 21) and mix rapldly (this IS zero time for subsequent kinetic analysis) 4. Take 10-PL ahquots for kinetic studies of drug-DNA dlssoclatlon from both reaction mixtures at appropriate time intervals (e.g., 5 or 6 data points m the first halflife) and add to 10 pL of termmatlon/loadmg buffer on Ice

3.4. Separation

of Blocked Transcripts

(see Notes 22 and 23)

The RNA transcripts are separated using high resolution sequencing gels (see Note 22). An example is shown in Fig. 3 for the preclmlcal anthracyclme derivative, cyanomorpholmoadrlamycin (27).

134

Phillips and Cullinane

Fig. 3. Transcriptional blockagesinducedby cyanomorpholinoadriamycin(CMA). The initiated transcription complex was reactedwith 1 pJ4 CMA for 1 h, 37”C, in transcription buffer, pH 8.0, and then elongated for l-240 min prior to separation of transcripts by sequencinggel electrophoresis(2 7). The lane representingthe initiated transcript is shown as I, and the 3’-methoxy-CTPand 3’-methoxy-GTP sequencing lanes denoted as C and G, Control lanes of DNA not subjectedto reaction with CMA, but elongatedfor l-240 min, are denotedas CONT.

Footprmtmg of Drug-DNA

FRACTION

135

InteractIons

0 01

Ftg. 4. Sequence speclfictty of CMA adducts The mole fraction of blocked transcripts was determined from the I-mm elongation lane of Fig. 3 (27) Numbermg IS from G of the GpA dinucleotlde used to mltlate transcription 1 Prepare a conventtonal 12% acrylamide denaturmg gel (19.1 acrylamlde.bzsacrylamlde, containmg 7 M urea) m TBE buffer 2. SubJect gel to pre-electrophoresls for 1 h to heat to approx 60°C (typlcally 2000 V, approx 100 W) 3. Heat all samples m termmatlon/loadmg buffer at 90°C for 5 mm, then place on ice 4. Load 10 pL of each sample onto the gel and contmue electrophoresls until the bromophenol Just migrates off the bottom of the gel (approx 2 h) 5 Fix gel in 10% acetic acid/lo% methanol for 20 min (see Note 23). 6. Dry gel using a commercial gel dryer.

3.5. Quantitation

of Blocked Transcripts

(see Notes 2&26)

Quantitation of the relative amount of each length of RNA can be performed either by conventional autoradiography, or by a phosphorimaging process. Both procedures are outlined stnce the former is routinely avatlable to all laboratories, whereas the imaging process, although being preferable since it is faster, more sensitive and fully computerized, involves a large initial expenditure for the phosphorlmager Itself and IS therefore not yet routinely available to all laboratories. A histogram of the mole-fraction of blocked transcripts induced by cyanomorpholinoadrlamycin IS shown in Fig. 4 as analyzed from the 1-mm elongation lane of Fig. 3.

3.5.1. Autoradiography I. Place the dried gel m contact with Amersham HyperfilmJ3max or Kodak XAR-5 X-ray film overnight, without mtenslfjring screens,at room temperature (see Note 24)

Phillips and Cd/inane

136

2. Scan the autoradlogram with a densitometer (laser light source to maximize resolution) coupled to an integrator 3 Sum the total area (proportional to radloactlvlty) m each lane and express each band as a fraction of the total-this yields the mole fraction of blocked transcripts m each reaction mixture (see Note 25)

3.52. Phosphorimaging

(see Note 26)

1 Place the dried gel m contact with phosphor plate for l-2 h 2 Scan the phosphor plate with a phosphorlmagmg system 3 Normalize each transcript with respect to the total intensity m each lane, to yield the mole fraction of each transcript m each reaction mixture

3.6. Relative

Occupancy

and Drug Oissocia tion Kinetics

The mole fraction of RNA blocked at each drug site IS an mdlcatlon of the relative occupancy of drug at each site. However, a true correlation between these two parameters exists only at mfirnte dilution of the drug. In practice this means using the lowest drug level possible to detect blockages. Under these conditions most drug sites will not be occupied, and the majority of RNA polymerases in the mltiated transcrlptlon complex will elongate fully to yield a full-length transcript 1 Form Initiated transcrlption complexes as outlined m Subheading 3.2. 2 React the mltlated complexes with a range of drug concentrations (typically 0 l100 @4for a prehmmary study) for the reqwred time, asoutlined m Subheading 3.3. 3. Measure blocked transcripts as outlmed m Subheadings 3.4. and 3.5. 4 Repeat steps l-3 using a drug level that yields approx 90% of full-length transcripts (i.e., only approx 10% of the total drug sites are occupied), but use a range of elongation times 5 Plot ln[RNA] (where [RNA] IS the mole-fraction of blocked transcript) agamst elongation time for the first few drug-induced blockages. The slope of these plots, if linear, yields the rate constant for the bypass of RNA polymerase past a drug site (generally reflecting dlssoclatlon of drug from each site) (1%21) (see Note 27) An example 1s shown m Fig. 5 for the first-order by-pass of enzyme past cyanomorpholmoadrlamycm snes (the first three shown in Fig. 3).

3.7. Bidirectional

Transcription

Footprin ting

The in vitro transcription assay described in Subheadings 3.1.-3.5. has been remarkably successful m detecting the locatlon of one end of drug-induced blockage sites on DNA, but does not indicate the physical size of the blocking unit. In order to obtain this information, the blockage can be probed by RNA polymerase from both directions. This assay, in which two counter-dlrected promoters are employed 1s summarized in Fig. 6 For example, the blockages induced by cyanomorpholmoadrlamycm are shown m Fig. 7, and the resulting

Footpnntmg of Drug-DNA -2.000

137

Interactions , t;’

I .

I

*

In [RNA]

I I

I

! 1 )

-8.000 0

I

I

I

I

30

80

90

120

/

TIME(mln)

Fig 5 Ftrst-order decay of transcrtptional blockages induced by CMA The RNA concentratton IS represented as the mole fraction of blocked transcripts (after elongation for 1 min) at sites 1 (D, 29/30-mer), 2 (0, 37-mer), and 3 (+, 43/44-met) of the data shown m Fig. 3 (27)

footprints revealed as a histogram m Fig. 8, where eight of the rune sites probed reveal an intrastrand crosslink at GpG sequences (27). 1 Digest 10 pg pRW2 wtth PvuII (10 U) and XhoI (10 U) and isolate the 3 15-bp fragment containing counter-directed UV5 and N25 promoters (see Note 28) as described m Subheading 3.1. 2. Digest 315-bp fragment with DraI (2 U), as described m Subheading 3.1., to deactivate N25 promoter 3 Initiate UV5 promoter with dCGA (200 p&f), UTP, GTP, and ATP (1 CUM),and 100 $I IX-[~~P]UTP as described m Subheading 3.2. 4. React initiated UV5 fragment with drug and elongate and quantttate blocked transcrtpts as outlined m Subheading 3.3. 5. Digest 3 15-bp fragment with BstNI (2 U), as described m Subheading 3.1., to deactivate UV5 promoter. 6. InitiateN25 promoterwith ApU (200 @4), UTP, GTP, and ATP (1 pA4), and 100 ~0 a-[32P]UTP. 7 React initiated N25 promoter fragment with drug and elongate and quantitate blocked transcripts as outlined in Subheadings 3.2.-3.5. 8 Correlate mole fraction of blocked transcripts from both promoters m a htstogram to reveal bidtrectional transcrtption footprints (22,2X27)

4. Notes 1 The Iac UV5 promoter was from the plasmid pHWO1 and contained a single copy of the L8UV5 double mutant, 203-bp lac promoter at the EcoRI site of

Phillips and Cullmane

738

F

=,’ -4-

Fig 6 Schematic representation of brdrrectronal transcription footprmtmg. The DNA fragment contammg the counter-drrected UV5 and N25 promoters is shown in (A). Selective deactrvatron of either one of the promoters yrelds (B), additron of E colz RNA polymerase and mmatron nucleotides yields the mrtrated transcrrptron complex (C) Reactron with drug yrelds (D) and subsequent elongatron results m a range of drug-Induced blocked transcripts (E). The two sets of blocked transcrrpts are summarized together m (F) to reveal bidrrectronal transcription footprints of drug sites. pHW 1 (28). Only the UV5 mutatron at -9 (numbermg with respect to the mRNA start site at +l) IS sigmficant for this work smce this confers strong “up” promoter characterrstics to the promoter and inmatron of transcrrptron does not require actrvatron by CAP (29). A good summary of the sequences drfferences between the famrly of four 203-bp fragments, only two of which contam the UV5 promoter, is available (30). 2 The 203-bp fragment was ligated into the umque EcoRI sateofpBR322, removed as a BamHIIHzndIII fragment, the 5’-overhanging ends filled with Klenow DNA polymerase and the blunt ends ligated usmg standard procedures to yreld pRW 1. The UV5 promoter can be excised as a 497-bp PvuIIISulI fragment However, since the yield from thus promoter IS low the 497-bp fragment

Footprinting of Drug-DNA Interactions

139

A I

CONT 1 515

CMA C G 1 515 I

1

CONT 515

CMA C G 1 515

-76

-55

Fig. 7. Bidirectional transcription footprinting of CMA. The restriction digested (modified) 3 15-bpDNA fragmentwas initiated from either the UV5 or N25 promoter (A) and (B), respectively,andthe initiatedtranscriptioncomplexthenreactedwith 2 $4 CMA for 60 min and was then subjectedto elongation for 1-15 min (27). containing the UV5 promoter hasbeenincorporateddirectionally into the PvuIIl Sal1site of pSP64to yield a much higher copy numberplasmid, pCC 1. The plasmid yield from this vector is significantly greater than from pBR322-derived vectors. The UV5 promoter is then excisedas a 5 12-bpPvuIIIHindIII fragment (31). The ZucUV5 promoteris alsoavailablecommercially in the vector pKK3381 (Clonetech, CA). Another sourceof the 203-bp fragment is from the plasmid pMB9-UV5 (32).

Phillips

140

and Cullmane

OG2 uv5 * 0.15

-

0.10

3 I

9 5

0.05

-

0.0

-

1

4 2

MOLE FRACTION

0.0 1 0.05

&

IL

A

l-

A

I

I

0.10

0.15

#N25 0.2

Fig 8. Bidirectional transcription footprint of CMA The mole fraction of blocked transcripts from either the UV5 promoter (upper sequence, which represent the 5’3’-nontemplate strand) or N25 promoter were determined from the data shown m Fig. 7 (27). 3 It is important to use high purity, sterile water to prepare all solutions m this assay The presence of trace amounts of metal ions, bacteria, or nucleases can completely destroy the assay 4 Because of the limited hfettme of DTT, especially under alkaline condtttons, add the required

DTT

on the day of the experiment

5. The use of RNase inhibitor is optional for short reaction and elongation ttmes, but becomes increasingly necessary for reactions m the 2- to 20-h time range. 6. The exact MgCl* concentration IS critical to ensure efficient transcription and mmimal natural pausing (32). Different buffer condittons are required for bacteriophage RNA polymerases (24)

Footprinting of Drug-DNA Interactions

141

7 Dideoxy CTP and dideoxy GTP can be used as an alternative to 3’-methoxy nucleotrdes to generate sequencmg lanes, but require a higher percentage in the mixture (compared to the respective CTP and GTP ribonucleotides) to ensure adequate incorporation of the modified nucleotide. 8. Any suppher of 32P-labeled rrbonucleotrdes will be satisfactory, provided the nucleotides have been purified by HPLC to remove ATP (required by some suppliers m the 32P labeling process) and trace levels of other nucleotides 9. In general, the fresher the 32P nucleotides the better for transcriptional studies since radiolytic degradation products can inhibit the process of transcription, especially when mvolvmg bacteriophage RNA polymerases (33) 10. Details of construction and use of the plasmid pRW2 have been described m detail elsewhere (22) 11 Exposure of the DNA to UV light should be as brief as possible to mnumize any possible damage to the DNA. 12 The DNA concentration can be determmed by several means, mcludmg drrect absorbance at 260 nm, by the relatrve fluorescence compared to calf thymus DNA standards in the presence of an excessof ethrdmm bromide, or by capillary electrophoresis, using a series of standards of known concentration (momtormg peaks at 260 nm). 13 An mcubation of as little as 1 mm will suffice if necessary 14. Heparin displaces bacterial RNA polymerase from nonspecrtic binding sites on the DNA, including the ends of the linear DNA which have modest affinity for the polymerase. This procedure ensures that only single-copy transcripts result from the subsequent elongation step since the RNA polymerase will be unable to rebind to the promoter because of competition with heparin 15 It is convenient to keep a series of each of the required amounts of GpA (20 pL), ATP ( 10 pL), and GTP (10 pL) frozen at -20°C as previously dispensed ahquots 16. The CX-[~~P]UTP is supplied at 10 mCi/mL in aqueous solutron and the required amount is usually dried m a Speed Vat Concentrator prior to redissolvmg m the ribonucleotide solution. 17. Transcription from the UV5 promoter does not begin exclusively from the +I site-when all four nucleotides are present only 59% of transcripts begin at the +l site, with 29, 7, and 9% beginning from the -1, +2, and +5 positions, respectively (34) To ensure that transcription begms from one site only, all nucleotides are maintained at ~5 @4 Since these levels are too low for mcorporation of the first nucleotide mto the transcription complex, little mitiation occurs Innration is therefore achieved with great selectivity from the high concentration of dmucleotide, GpA, with the nascent RNA starting from the -1 location (see Fig. 2) 18. Additional stability of the transcription complex may be achieved by ensuring that the nascent RNA is longer than a IO-mer This can be achieved by imtiatmg the transcription complex with the trinucleotide dGGA, or by using other promoters that have early transcribed regions of appropriate sequence to yield long nascent RNA from only three nucleotides m the nntiation mixture (23,24,26) 19. The methoxy-nucleotides provide a statistical probabrhty of terminating the elongation phase m transcription, and yield C and G sequencing lanes analogous to

142

20.

21

22

23.

24 25. 26

27.

Phillips and Cullmane dtdeoxy-termmated DNA sequencing lanes If sequencing lanes are required for RNA longer than approx 150 nucleottdes, the ratto of the 3’-methoxynucleottde.nucleottde must be reduced to enable the RNA polymerase to be able to transcrtbe further along the DNA before transcription IS termmated by incorporation of the methoxynucleotide mto the nascent RNA. Subsaturatmg levels of drug are normally used to ensure that most drug sites are not occupied This precaution results m a range of different drug sites bemg detected subsequently m the elongation phase If high drug loadings were employed, the first drug site would be completely occupied-RNA polymerase would not proceed past that sate and therefore be unable to probe addtttonal downstream drug sates(2135) Natural pausing of RNA polymerase IS muumized by the use of high levels (2 5 mM) of all four nucleottdes during the elongation process, as well as by high tonic strength (0 4 A4 KCl) (22) The high level of nucleottdes also ensures that additional mcorporatton of cQ3*P] mto the growing RNA cham is effectively ehmtnated, and ensures that all transcrtpts, trrespecttve of length, have the same amount of radtolabel If low levels of transcrtptton or high levels of background occur (i e , resultmg from pausing of the transcrtptton complex prior to formatton of full-length transcripts) the most ltkely cause IS msuffictent purity of the promoter-contarnmg DNA fragment This can often be recttlied by SubJectlng the DNA to an addtttonal purification step, such as a NENSORB 20 nucletc acid purtlicatron cartridge (NEN Research Products, DE) Other sources of the problem may be degradatton of one of the nucleottdes, or bacterial contammatton of the transcrtpnon buffer. In etther case, It IS prudent to make fresh stock soluttons of all reagents as this has mvartably proven to be quicker than trying to identify the individual contaminated component Fixing and drying the gel improves resolution of the autoradtogram. The washing step m this procedure also serves to remove almost all background m the gels arising from radtolyttc degradatton products of the labeled nucleotide-these contaminants would otherwise obscure the bottom one third of the gel Amersham Hyperfilm-P max X-ray film is routmely used for final quantitative work because of the low background absorbance and high contrast of thts film. The time of exposure of the gel must be modified to ensure that photographic lmeartty is mamtamed-for Kodak XAR X-ray film lmeartty IS restricted to the O-1 absorbance range (36). The phosphortmaging process offers two major advantages over the photographic process: It 1s up to 250-fold more sensmve for the detection of 32P, and tt has a linear dynamic range at least 400 times greater than that of film processes (3 7) A true dtssoctation rate constant is revealed only from the first drug sate encountered by the initiated transcription complex All subsequent dtssociatton rate constants are distorted to some degree by read-through of RNA polymerase from earher (upstream) sites, and by the fact that all sites downstream of the first site are underestimated because less RNA polymerase reaches them compared to the

Footprinting of Drug-DNA

interactions

143

first site For these reasons, estimates of drug occupancy and dissociation kmetICS are only good approxtmattons (except for the first site) If the drug occupancy at each site IS low For a more rtgorous approach, Monte-Carlo (38) and kinetic modellmg (35) simulations have been employed with the latter bemg partrcularly rapid and effective 28. If the kmetlcs of read-through past occupied drug sites are not of interest then any counter-directed commercral promoter systems could be employed (e g , SP6/ T7 or T3/T7, both of which are available from a variety of molecular biology suppliers, as are the bacteriophage SP6, T3, and T7 RNA polymerases). The ternary transcription complexes formed with these polymerases are generally less stable than those mvolvmg bacterial RNA polymerase, and they are, therefore, well-suited to definmg the location of covalent adducts on DNA, but less suited to the study of reversibly bound drugs (24)

References I Schacter, L. P., Anderson, S., Canetta, R. M., Kelley, S., Nicaise, C , Onetto, N , Rozencweig, M., Smaldone, L , and Winograd, B (1992) Drug discovery and development tn the pharmaceutical industry. Semen Oncol 19,613-62 1 2. Loxman, N R and Narayanan, V. L. (1988) Chemtcal Structures oflnterest to the Dtvtston of Cancer Treatment, Drug Synthesis and Chemzstry Branch, Developmental Therapeutics Program, Nattonal Cancer Institute, Bethesda, vol. VI 3 Chabner, B A (1993) Cancer drug discoveries and development, m Cancer Prtnctples and Practice of Oncology, 4th ed (Devrta, V. T., Hellman, S , Rosenberg, S A., and eds ), Lippmcott, Philadelphia, PA, pp. 325-417. 4 Warmg, M. J and Fox, K. R (1983) Molecular aspects of the mteractton between qumoxalme antibiotics and nucleic acids, m Molecular Aspects of Anttcancer Drug Action (Needle, S and Waring, M J., eds ), Macmillan, London, pp 127-l 56 5. Wakelm, L. P. G. and Denny, W. A. (1990) Kmetics and equihbrmm bmdmg studies of a series of intercalating agents that bmd by threading a sidecham through the DNA helix, in Molecular Basis of Spectfictty tn Nucletc Aced-Drug Interactzons (Pullman, B. and Jortner, J., eds.), Kluwer Academic, Dordrecht, pp 19 l-206. 6 Chaires, J. B (1992) Application of equilibrium binding methods to elucidate the sequence specificity of antibiotic binding to DNA, m Advances tn DNA Sequence Speczfic Agents, vol 1 (Hurley, L H , ed.), JAI, CT, pp 3-23 7. Dougherty, G. and Pigram, W. J. (1982) Spectroscopic analysis of drug-nucleic acid Interactions CRC Crtttcal Rev Biochem 12, 103-132 8. Chaires, J. B. (1990) Daunomycin bmding to DNA: from the macroscopic to the microscopic, m Molecular Basts ofSpect&ty m Nucleic Acid-Drug Interactton (Pullman, B and Jortner, J , eds ), Kluwer Academic, Dordrecht, pp 123-136 9 Dabrowiak, J. C. and Goodisman, J (1989) Quantitative footprmtmg analysis of drug-DNA mteractions, m Chemistry and Physzcs of DNA-Ltgand Interacttons (Kallenbach, N. R , ed ), Adenine, NY, pp 143-174. 10 Nrelsen, P E (1990) Chemrcal and photochemical probing of DNA complexes J Molec. Recognttton 3, 1-25

Phillips

144

and CM/inane

11 Leupm, W (1990) Experimental proofs of a drug’s DNA spectfictty, m M&ecular Basis ofSpeczj%ty zn Nuclezc Acid-Drug Interactzons (Pullman, B and Jortner, J., eds.), Kluwer Academic, Dordrecht, Holland, pp 579-603 12 Goodtsman, J and Dabrowlak, J C. (1992) Quantltattve aspects of DNaseI footprmtmg, in Advances zn DNA Sequence Speczjk Agents, vol 1 (Hurley, L H., ed.), JAI, CT, pp l-37 13 Mymryk, J. S and Archer, T. K. (1994) Detection of transcrrptton factor bindmg m vtvo usmg lambda exonuclease Nucleic Aczds Res 22,434+4345 14. Cullmane, C and Phillips, D R. (1994) The sequence specificity ofcyanomorpholmoadrlamycm m human cells. Bzochemzstry 33, 6207-62 12 15 Murray, V , Motyka, H., England, P. R., Wtckham, G., Lee, H. O., Denny, W A , and McFadyen, W D (1992) The use of Taq DNA polymerase to determine the sequence specificity of DNA damage caused by Cw-dtammmedtchloroplatmum (II), acridine-tethered platmum (II) dlammme complexes or two analogues J Bzol Chem 267, 18,805-l 8,809. 16 Murray, V., Motyka, H , England, P. R , Wtckham, G , Lee, H. 0 , Denny, W A , and McFadyen, W D (1992) An mvestigatton of the sequence specific mteractton of Czs-dtammmedtchloroplatmum (II) and four analogues (mcludmg two acridme-tethered complexes) with DNA inside human cells. Bzochemzstry 31, 11,812-l 1,817 17 White, R J and Phillips, D R (1988) Transcrtpttonal analysis of multi-sue drugDNA dtssoctation kmettcs. Delayed termmatton of transcription by actmomycm D Bzochemzstry 27,9 122-9 132 18 PhillIps, D R , Whtte, R J , Trist, H., Cullmane, C , Dean, D., and Crothers, D M (1990) New insight into drug-DNA interactions at indivtdual drug sites probed by RNA polymerase during active transcrtption of the DNA. Antz-Cancer Drug Deszgn 5, 2 l-29. 19. Phtlhps, D. R , Cullmane, C., Trust, H., and White, R. J (1990) In vztro transcrtptton analysts of the sequence spectficrty of reversible and irreversible complexes of Adriamycm wtth DNA, m Molecular Baszs of Speczjkzzy zn Nuclezc Aced-Drug Interactzons (Pullman, B and Jortner, J., eds ), Kluwer Academic, Dordrecht, Holland, pp. 137-155. 20. Phtlhps, D. R. and Crothers, D. M. (1995) An zn vztro transcriptton assay for probmg drug-DNA mteracttons durmg active transcrtptton of DNA, m Methods zn Molecular

Bzology, vol 37 In Vitro Transcrzptzon and Translation

Protocols

(Tymms, M J , ed ), Humana, Totowa, NJ, pp. 89-105. 2 1 Phillips, D R. (1996) Transcrtptton assay for probmg the specifictty of drug-DNA interactions m Advances zn DNA Sequence Specific Agents, vol. 2 (Hurley, L H and Chaues, J B , eds ), JAI, Connecticut, pp 101-134 22 Whtte, R. J and Philhps, D. R (1989) Bidirectional transcription footprmtmg of DNA bindmg hgands Bzochemzstry 28,6259-6269 23. Trust, H. and Phtlhps, D R (1989) In vztro transcription analysis of the role of flanking sequences on the DNA sequence spectficlty of Adrlamycm Nuclezc Aczds Res 17,3673-3688

Footprinting of Drug-DNA

Interactions

145

24. White, R J and Phtllrps, D R. (1989) Sequence-dependent termination

of bacteriophage T7 transcrtptton m vitro by DNA binding drugs Bzochemistry 28,4277-

4283 25. Cullinane, C and Phillips,

26. 27 28 29 30

31 32

33

D R. (1990) Induction of stable transcripttonal blockage sites by Adrtamycm. GpC specificity of apparent Adrtamycin-DNA adducts and dependence on non (III) tons Bzochemistry 29, 5638-5646. Straney, D C and Crothers, D M (1985) Intermedtates in transcrtptton mmatton from the E colr lac UV5 promoter. Cell 43,449-459 Cullmane, C and Philltps, D. R. (1992) In vttro transcription analysis of DNA adducts by cyanomorpholmoadriamycm Bzochemzstry 31, 95 13-95 19. Wu, H and Crothers, D. M (1984) The locus of sequence-directed and proteminduced DNA bmdmg Nature 308, 509-5 13 Silverstone, A E , Ardittr, R R., and Magasmk, B (1970) Catabohte-msensttrve revertants of lac promoter mutants Proc Nat1 Acad Scl USA 66, 773-779 Schaeffer, F , Kolb, A , and But, H (1982) Point mutattons change the thermal denaturation profile of a short DNA fragment contammg the lactose control elements Compartson between experiment and theory EMBO J 1,99-105 Cullinane, C (1993) Detection and Characterzsatlon ofAdrzamyczn-DNA Adducts, PhD Thesis, La Trobe Umverstty, Bundoora, Vie , Australia Stefano, J E. and Gralla, J (1979) Lac UV5 transcription m vitro. Rate limitation subsequent to formation of an RNA polymerase-DNA complex Bzochemzstry 18, 1063-1067 Melton, D A , Kretg, P A , Rebaghatt, M R , Mamatts, T , Zmn, K , and Green, M R (1984) Efficient zn vztro synthesis of btologtcally active RNA and RNA hybrtdisatton probes from plasmtds containing a bacterrophage SP6 promoter

Nucleic Acids Res 12, 7035-1056 34 Caprousts, A J., Stefano, J E , and Gralla, J D (1982) 5’-Nucleottde heterogeneity and altered imtiatton of transcription at mutant lac promoters. J Mol. Bzol 157,619-633 35 Philltps, D R., Moate, P J , and Boston, R C (1994) A modellmg procedure for

the analysts of dynamic drug-DNA mteracttons probed durmg active transcrrpbon of the DNA An&Cancer Drug Deszgn 9,20%219. 36 Dabrowtak, J. C., Skorobogaty, A , Rich, N., Vary, C. P H., and Vournakts, J N (1986) Computer assisted mtcrodensitometrrc analysts of footprintmg autoradtographic data. Nucleic Aczds Res 14,489-499. J I. Johnston, R F., Ptckett, S. C , and Barker, D L (1990) Autoradtography using storage phosphor technology Electrophoreszs 11,355-360. 38. Phillips, D. R., White, R J , Dean, D., and Crothers, D M (1990) Monte-Carlo stmulatton of multtstte echinomycm-DNA interactions detected by zn vztro transcription analysts Bzochemlstry 29,4812-4819

Determination of the DNA Sequence Specificity of Alkylation Damage Using Cleavage-Based Assays John A. Hartley and Michael D. Wyatt 1. Introduction Many agents that possess antitumor activity have been shown to bmd to DNA. Several chnlcally used chemotherapeutic drugs are alkylatmg agents, which are known to bind covalently to, and m many casescrosslmk, the bases of DNA. These include the nitrogen mustard, chloroethyl-mtrosourea, tnazene, and dlmethanesulfonate classes of agents. Most simple alkylatmg agents of this type show a base specificity for guanine, bmdmg primarily to the guamneN7 posltlon m the major groove of DNA (2). In contrast, more complex agents such as the natural product CC-l 065 and the novel agent talhmustme bmd primarily to adenine bases at the N3 posltlon m the minor groove (2,3). In addition to this base speclficlty it is now apparent that many, if not all antltumor agents that bind to DNA, do so with some degree of base-sequence selectivity. This can vary from agents such as mtrogen mustards, which show a limited dlscrlmmatlon between the target base in different sequence contexts, to those such as CC-l 065 and talhmustme, which show a high degree of selectlvlty to certain unique sequences,with the corresponding avoidance of others. The DNA sequence selectivity of alkylatlon for agents that react at the guarune-N7 or adenine-N3 positions can be measured relatively easily using modlficatlons of DNA sequencing-based techmques. The principle of the technique is shown in Fig. 1. A singly end-labeled fragment of DNA of known sequence is used to pinpoint the precise posltlon of drug binding followmg the quantltative production of a strand break at the alkylatlon site. This can be achieved at sites of guanine-N7 alkylation by treatment with hot piperldme (4), or by thermal cleavage at sites of adenine-N3 or guanme-N3 alkylation (3). In the case of the plperldme reaction, the alkaline conditions cause rupture of the C&N9 From

Methods

In Molecular B/ology, Vol 90 Drug-DNA InteractIon Edfted by K R Fox Humana Press Inc , Totowa, NJ

147

Protocols

Hartley

148

-m singly end-labeled DNA fragment

-

w

+ covalently bIndIng drug P )

* w

C *llTif nrlIIIIIIlmlT -11111111111111111111II cleavage at -rrrm-msites of 111111(11111111(111111 damage wulluduu

and Wyatt

D

I-

denaturing polyacrylamide gel electrophoresk3

-

Fig 1, Outlme of the cleavage-based methods. C and D are control and drug-treated samples, respectively

bond of the N7-alkylated base producing a formamido-pynmldine structure. Plperldme displaces the formamido-pynmidme structure from its sugar and catalysesp-ehmmatlon of phosphatesfrom the sugar, breaking the phosphodiester backbone (4) (see Note 1). Prowded the drug reactlons employed produce single hit kinetics (i.e., each DNA molecule receives at most one alkylatlon) the Intensity of a band produced on a DNA sequencing gel IS proportional to the extent of alkylation at that base position. 2. Materials 1. 2 3 4 5. 6 7. 8 9. 10 11. 12

Restrlctlon enzymes and their appropriate reaction buffers Plasmld DNA As an example we use the pBR322 plasmld (5) MIcrocentrifuge. Bacterial alkaline phosphatase (BAP)* 100 LJ/pL m 10 mA4 Tris-HCl, pH 8 0, 0 12 M NaCl, 50% v/v glycerol (Glbco-BRL) Bacterial alkaline phosphatase buffer (5X): 10 mA4 Tris-HCl, pH 8.0, 120 mM NaCl (Gibco-BRL, Galthersburg, MD) Buffer saturated phenol (Appllgene, Oncor, Chester-le-St, UK) Chloroform (Fluka, Glllmgham, UK) Isoamyl alcohol (Sigma, St. LOUIS, MO) 95% Ethanol. Lyophlllzer or vacuum dryer T4 polynucleotlde kinase (PNK)* 5 U/pL in 50 mM Tns-HCI, pH 7.5, 25 mM KCl, 5 mM DTT, 0 1 p&f ATP, 50% v/v glycerol, 0 2 mg/mL BSA (Glbco-BRL). Forward reactlon buffer (5X) 200 mMTns-HCl, pH 8 0,75 mA42-mercaptoethanol,

50 mM MgC12,1.65 @I ATP (Glbco-BRL) 13. Sucrose loading buffer: 0.6% sucrose, 0 04% bromophenol blue, and 0.04% xylene cyan01 in dIstIlled and deionized water. 14 Tris-acetate EDTA (TAE) agarose gel runmng buffer: 40 mA4Trq 20 Wacetlc acid, 2 mM Na,EDTA, pH 8.1

DNA Sequence Specificity 15. 16 17 18 19 20 21 22 23 24. 25 26 27 28 29 30 31 32 33 34. 35 36

149

Low-melting-pomt (LMP) agarose (BRL) Long-wave UV transillummator Ethldmm bromide solution (10 mg/mL stock) Heat block capable of running at 90°C. Water baths GELaseTM (Eplcentre Technologies) 50X GELase buffer (Eplcentre Technologies) TEOA buffer 25 mA4 tnethanolamme, 1 mMNa,EDTA, pH 7.2 Alkylation stop solution. 0 6 Msodmm acetate, 20 mMNa,EDTA, 100 pg/mL tRNA Sodium citrate buffer 1.5 mA4 sodium citrate, 15 mMNaC1, pH 7 2. Piperidme (Sigma) 10% Plperidme solution m distIlled and deionized water 1s made up fresh (see Note 11). Formamide loading dye* 0.04% bromophenol blue, 0.04% xylene cyanol, 98% deionized formamlde. Tris-boric acid EDTA (TBE) polyacrylamlde gel running buffer 90 mMTns-HCl, 90 mM boric acid, 2 mA4 EDTA, pH 8.3 Sequencing gel mix is purchased as a kit called Sequagel-6 (National Dlagnostlcs, Hessle, UK) Ammonium persulfate (APS) (Sigma). Stock solution of APS (0.25 mg/mL) IS made up fresh. Tetramethylethylenedlammme (TEMED) (Sigma). Standard DNA sequencing gel electrophoresls equipment. In our case a gel apparatus that IS 80 cm x 20 cm x 0 4 mm for maximum resolution was used 3MM filter paper (Whatman, Maidstone, UK) DE 8 1 filter paper (Whatman) Standard vacuum gel drying equipment. Autoradiography cassettes X-ray film and developing faclhtles

3. Methods 3.1. Preparation of 5’-Sing/y End-Labeled Fragment This protocol describesthe lmeanzation, S-end labeling and second restriction enzyme cleavage of plasmld DNA to produce a 5’-singly end-labeled fragment. For alternatwe methods of producing singly end-labeled fragments see Note 2. 3.1.1. Restriction Digest and 5’-End Labeling 1 Lmemze the closed circular plasrmd (20 pg) with the first of the two restnctlon enzymes m its appropriate buffer, per manufacturers speclficatlons (for suitable choice of restnctlon enzymes, see Note 3). Following the incubation, add one tenth ~013 M sodium acetate and precipitate the DNA by addition of 3 vol of 95% ethanol (see Note 4) Chill the samples in a dry Ice/ethanol bath for 10 min and then spin m a rmcrofuge for 10 mm at 16,000g. After centrifugatlon, remove the supematant and lyophthze the DNA pellet to remove all ethanol Resuspend the dry DNA pellet m dlstllled and deionized water

150

Hartley and Wyatt

2. Dephosphorylate the DNA with bactertal alkaline phosphatase (BAP, 3 U/pg) for 1 h at 65°C m BAP reaction buffer, m a final volume of 100 pL Followmg the mcubatton, add 100 yL of phenol, vortex the sample thoroughly and spin for 5 mm at 16,000g m a mtcrofuge to separate the phases Remove the aqueous phase (top layer) to an Eppendorf tube and vortex with 100 pL of 24:l chloroform/tsoamyl alcohol Remove the aqueous phase and repeat the step a second time Back extract the organic layers with 50 pL of dtsttlled water, combme the aqueous layers, and precipitate the DNA as described in step 1 3 5’-end label 5 pg of the DNA with T4 PNK (2 U/pg), [Y-~~P]ATP (10 @I), m forward reaction buffer (20 pL final vol) at 37°C for 30 mm. Followmg mcubatton, add one vol of 7 5 Mammonmm acetate and precipitate the DNA with 3 vol 95% ethanol After chlllmg, centrtfugatton and lyophtllzatton, as described m step 1, resuspend the dry DNA pellet m 50 pL of distilled and detomzed water Precrpttate the DNA a second time wtth 5 pL of 3 A4 sodmm acetate and 165 pL 95% ethanol, and dry the samples by lyophdlzatton 4 Cleave the DNA with a second restrictron enzyme (see Note 3) After mcubatmg under the appropriate condmons for the restrlctlon enzyme, precipitate the DNA with sodmm acetate and ethanol, dry by lyophtltzatton as descrtbed m step 1, and resuspend m 15 pL of sucrose loading buffer

3.1.2. Purification of the 5’-Singly End-Labeled This protocol

describes one suitable method.

Fragment

For alternattves

see Note 5.

1 Prepare a 1 0% LMP agarose gel in TAE buffer 2 Dissolve the DNA tn the sucrose loading buffer, load onto the gel and electrophorese for 90 mm at 75 V m TAE buffer 3 After electrophorests, stain the gel with ethtdmm bromide (0 5 pg/mL) and locate the band of interest by UV fluorescence. Excise the shce of gel contammg the fragment and collect m a prewelghed Eppendorf tube, weigh, and add the appropriate amount of GELase 50X buffer for a final 1X concentratton 4 Completely melt the gel slice m a 65’C water bath for 1O-l 5 mm and then place m a 45°C bath for 10 mm Add the appropriate amount of GELase and digest the agarose for 3 h at 45°C (see Note 6) 5 At the end of the dtgestton, add one vol of 7 5 M ammomum acetate and 3 vol of 95% ethanol, mtx, and spin m a mtcrofuge for 30 mm at 16,000g Remove the supernatant and dry the DNA pellet by lyophtltzatton Resuspend the pellet m 100 pL water, mix with an equal vol of chlorofotm/tsoamyl alcohol (24. l), remove the aqueous layer, prectpttate the DNA and dry by lyophthzatlon (see Note 7)

3.2. Drug-DNA

Incubations

1 Dissolve the 5’-end labeled DNA from Subheading 3.1.2. m suffictent TEOA buffer to give 10 pL per reaction tube (see Note 8) 2 Make dtluttons m TEOA buffer from a freshly prepared stock solutton of drug (usually 10 mM) m the approprtate solvent for the drug Prepare drug dtluttons at

151

DNA Sequence Specifmty

10X final required concentration and add 5 pL to the DNA and buffer to give a final vol of 50 pL 3 Incubate at 37°C for the approprrate time (see Note 9) 4. Terminate the drug-DNA mcubatlon by the addition of an equal vol of alkylation stop solution (see Note lo), followed by 3 vol of 95% ethanol Chtll and spm the samples, remove the supernatant, and add 75 ltL of 70% ethanol. Spm the samples for a further 10 mm, remove the supernatant and dry the DNA pellets by lyophihzatton

3.3. Piperidine

Cleavage

Assay

1 Prepare a 10% ptperidine solution in Ice cold water fresh for each experiment and keep on ice until use (see Note 11) 2. In a fume hood, quickly add 100 ltL of the 10% pipertdme solution to the Eppendorf tubes contammg the dried DNA pellets and reseal the tubes Vortex the tubes to completely dissolve the DNA 3. Place the samples in a 90°C heating block for 15 mm (see Note 12) 4 Immediately snap freeze the samples m a dry ice/ethanol bath and lyophihze the samples to dryness 5 Add distilled water (20 pL) and dissolve the DNA, snap freeze, and lyophilize to dryness Repeat a second time (see Note 13) 6 Wash the samples with 70% ethanol (75 pL), spm for 10 mm, remove the supernatant, and dry by lyophdtzatlon

3.4. Thermal Cleavage

Assay

1 Dissolve the dry DNA pellets from the drug-DNA mcubattons m 100 pL of sodium citrate buffer, pH 7 2 2. Incubate the samples m a 90°C heatmg block for 30 mm 3 Followmg heat treatment, chill the samples in an ice bath 4. Prectpitate the DNA with sodium acetate and 95% ethanol, and then dry by lyophihzation.

3.5. Maxam and Gilbert Marker Lane (5) A sample of the 5’-singly end-labeled fragment IS always reserved for a marker lane. For a G+A ladder, add 7 PL of formic acid to a 10 PL DNA sample and react for 7 min at room temperature. Terminate the reaction by adding an equal vol of alkylatton stop solutron, followed by 3 vol of 95% ethanol. Chill the sample, spm and remove the supernatant, then dry by lyophtltzatton. Perform the steps described in Subheading 3.3. for the pipertdme treatment. 3.6. Po/yacry/amide

Gel Electrophoresis

1 Prepare a standard 6% polyacrylamide, 8 Murea, sequencing gel and prerun with the TBE runnmg buffer until the temperature has reached approx 55°C

152

Hartley and Wyatt

2 Dissolve the samples m 3 pL of the formamtde loading dye by vigorous vortexing, and pulse spm to collect the sample m the bottom of the Eppendorf tube. 3 Heat the samples m a 90°C heating block for 2 mm to denature the DNA, and immediately place m an ice water bath to prevent renaturatton 4. Load the samples onto the gel using a Hamilton syrmge (see Note 14) and during the electrophoresis maintain the gel temperature between 5@-6O”C to ensure the DNA remains denatured. 5. Terminate electrophoresis when the bromophenol blue marker has migrated nearly the length of the gel. A typical 80-cm gel takes approx 3 h. 6 Remove one glass plate and carefully peel the gel from the other plate using a sheet of 3MM paper. Place this on a sheet of DE 81 paper and cover the gel with Saran wrap (see Note 15) Dry the gel on a vacuum dryer at 80°C 7 Expose X-ray film to the dried gel to vtsuahze the DNA fragments Exposure times vary, depending on the amount of radioactivity m each lane and the size of the fragment studied. Overnight exposure of the gels is usually possible using an mtensifymg screen at -7O“C Sharper images are obtained without a screen, but exposure times are longer Densuometry of the autoradiograms can be carried out using high resolutton imaging densitometers

3.7. Examples Figure 2 shows examples of the ptperrdme cleavage method showing the sequence spectfictty of guanme-N7 alkylatton of DNA modified by two chloroethyl-mtrosoureas (Fig. 2A) or three nitrogen mustards (Fig. 2B). Figure 3 shows an example of the thermal cleavage method showing the sequence spectticity of adenine-N3 or guanme-N3 alkylatton of DNA modified by novel mlnor groove alkylatmg agents. 4. Notes 1. The formation of a covalent bond is necessary to destabtltze the N-glycostdtc bond for subsequent cleavage The antitumor drug ctsplatin cannot be examined for its sequence specitictty using either method because the coordination complex formed with purme-N7 positions does not sufficiently destabilize the basesugar bond. Bleomycm degrades the DNA sugar backbone via a metal and oxygen-dependent process Caltcheamicm, upon an internal Bergman cycbzation, and certain chromophores, upon photoacttvatton, produce free radicals that degrade the DNA sugar backbone via hydrogen abstraction. In these cases, smgly end-labeled fragments can be used to determine the sequence specificity of cleavage directly and the cleavage step is not required 2 Smgly end-labeled fragments can be prepared by a number of methods 3’-end labelmg can be achieved using the Klenow fragment of DNA polymerase (5) Alternatively, the authors have found PCR amplification using a plasmid template and two primers, one of which is 5’-end labeled, to be a useful method. By choosmg appropriate primers, this allows control of the size and composition of the fragment, but tt 1s important to optimize PCR condittons carefully for the

153

DNA Sequence Specificity

A

B

abed

abed

-240 -220 -200

-160 -170 -160 -150 -140 -130

-120

-110

Fig. 2. (A) Example of the piperidine cleavage method showing guanine-N7 alkylation produced in a 622 bp liindIII-Sal1 fragment of pBR322, 5’ end labeled at the Hind111site, by 2 chloroethylnitrosoureas: 1-(2-chloroethyl)-3-(cis-2-hydroxy) cyclohexyl- 1-nitrosourea (500 uA4, lane b), l -(2-chloroethyl)- 1-nitrosourea (500 uA4,lane c). Lane a is control, unalkylated DNA, and lane d is DNA treated with the guanine-N7 methylating agent dimethylsulfate (1 mM). The runs of three or more consecutive guanines within the sequenceare indicated by arrows. A clear preference of the two chloroethylnitrosoureas for the runs of guanines is evident. (B) Example of the piperidine cleavage method showing guanine-N7 alkylation produced in a 276-bp BarnHI-Sal1fragment of pBR322 DNA, 5’-end labeled at the BamHI site, by the nitrogen mustards melphalan (100 PM, lane a), quinacrine mustard (0.1 @4, lane b), and uracil mustard ( 20 @4, lane c). Lane d is the G+A (formic acid) marker lane. The three nitrogen mustardsgive different patternsof guanine-N7 alkylation. In both figures the numbersrefer to the sequenceas listed in ref. 5.

Hartley and Wyatt

154 abcde

Fig. 3. Example of the thermal cleavagemethod showing purine-N3 alkylation produced in a 213-bp fragment of pBR322 DNA (bases3090-3303), generatedby PCR amplification and S-end labeled at the 3090 site, by a series of benzoic acid mustard(BAM) andpyrrole (Py) containing conjugatesrelatedto distamycin. Lane a, control unalkylated DNA; lane b, G+A marker lane; lane c, BAM-Py,, 5 pLM;lane d, BAM-Py2, 5 pM; lane e, BAM-Py3, 5 @4. The BAM-Py, conjugateclearly alkylates at severaladeninesandoneguanine.The BAM-Py, conjugate,becauseof its enhanced sequencespecificity, only strongly alkylates at one site on the strand. Taken with permission from ref. 6.

DNA Sequence Specificity

3

4. 5,

6 7.

8

9.

10. 11 12.

155

template and primers with regard to magnesium concentration and cycling condltlons prior to generating labeled fragments It 1s helpful to consider the restriction enzymes when choosing a smtable plasmrd The first restriction enzyme ideally should cut at only one site on the plasmid The second enzyme should produce fragments sufficiently different m size so that the fragments can be easily separated by electrophoresls and isolated Since the resolution of a 6% polyacrylamlde sequencmg gel is between 200 and 300 bp, this ts the ideal size for the fragment to be studied As an alternative to isolating and purifying a singly end-labeled fragment, the second restriction enzyme can be chosen that cuts l&30 bp from the first cut (e g , pBR322 cut with EcoRI and MndIII) The very long and short labeled fragments can then be used wlthout separation and lsolatlon, and the short fragment IS run off the bottom of the sequencing gel during electrophoresls (see Note 8) In this case care should be taken m disposing of the electrophoresls buffer, which will be radloactlve It 1sImportant that the samples are thoroughly vortexed before chilling so that the water does not freeze There are many different procedures published for the purlficatlon of end-labeled fragments, each of which vary m yield, purity, and ease, includmg preparatory gels, glass wool columns, and electroelution The particular method described was chosen because of its high yield. It IS important that the agarose dIgestIon goes to completion Small agarose fragments remaining can cause problems later It 1simportant to include the chloroform wash step If ethldmm bromide IS used to visualize the DNA The presence of ethldlum bromide might possibly Interfere with drug binding, and If this 1sa concern, then it 1s suggested that the fragment be located by exposing X-ray film to the wet gel covered with plastic wrap Normally, 5 pg of labeled DNA IS enough for 10-15 samples When runnmg a very short fragment off the gel (see Note 3), however, many more counts per sample are required because the counts will be distributed over two fragments, one of which ~111 be very large The drug doses are chosen over a broad range initially, but for accurate determination of sequence speclficlty the dose of drug must produce “single-hit” kmetits. In other words, a drug dose should be chosen that provides no more than one drug lesion per DNA molecule. It is important to include the tRNA in the stop solution m order to faclhtate the DNA precipitation. It 1s important that the plperldine stock 1scolorless (it can yellow with age), the 10% solution be prepared fresh, and the piperidme added to Ice cold water Because of the volatility of the plperidme, it 1s important to ensure that the reaction tubes remain sealed while being heated, either by using screw-cap Eppendorf tubes or by placing a weight on the caps of the Eppendorf tubes The plperidme incubation time and temperature are important m order to keep background strand breaks to a mmlmum, which can occur above 95°C and at longer mcubatlon times (4)

156

Hartley and Wyatt

13 It IS tmportant to include both 20-pL wash steps m order to remove all residual traces of ptpertdine The presence of residual piperrdme can severely affect the electrophoresrs 14. It IS important to purge the wells of urea immedtately prior to loading the samples on the gel m order to ensure proper loadmg and electrophoresrs 15 In order to ensure easy removal of the sequencmg gel from the glass plates, the front plate is srhcomzed so that this can be removed, leavmg the gel on the back plate The DE 8 1 filter paper is necessary to capture the smaller DNA fragments, which can pass through the 3MM paper durmg gel drying

References 1 Hemmmkr, K and Ludlum, D. B (1984) Covalent modrfication of DNA by anttneoplastic agents. J Nat1 Cancer Znst 73, 1021-1028 2 Broggmr, M , Coley, H , Mongelh, N., Grandr, M , Wyatt, M D , Hartley, J A , and D’Incalcr, M. (1995) DNA sequence spectfic ademne alkylatton by the novel antitumor drug talhmustme (FCE245 17), a benzoyl nitrogen mustard derivative of distamycm Nuclerc Acrds Res 23, 8 1-87. 3 Reynolds, V L , Molmeux, I J , Kaplan, D. J , Swenson, D H , and Hurley, L H (1985) Reaction of the antitumor antrbrottc CC- 1065 with DNA. Location of the site of thermally induced strand breakage and analysrs of DNA sequence spectticrty Blochemlstry 24,6228-6237 4. Mattes, W B., Hartley, J A , and Kohn, K W (1986) Mechamsm of DNA strand breakage by prperrdme at sites of N7-alkylguanmes Bzochzm Brophys Acta 868, 7 l-76 5. Sambrook, J , Frrtsch, E F , and Mamatrs, T (1982) Molecular Clonrng. A Laboratory Manual Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 6 Wyatt, M D , Lee, M , Garbnas, B J , Souhamr, R L , and Hartley, J. A (1995) Sequence specrticrty of alkylation for a series of nitrogen mustard-containing analogues of drstamycin of mcreasmg bmdmg site size. evidence for increased cytotoxicity with enhanced sequence specificity. Blochemlstry 34, 13,034-l 3,04 1

PCR-Based Methods for Detecting DNA Damage and Its Repair at the Subgene and Single Nucleotide Levels in Cells Keith A. Grimaldi and John A. Hartley 1. Introduction A large category of anticancer drugs owe their cytotoxicity to their abihty to Interact with, and damage, DNA. Many agents form bulky adducts that block RNA and DNA polymerases, inhibiting transcription, and DNA rephcation. It is well-known that cancer chemotherapy is far from satisfactory. The many problems include unpleasant, sometimes life threatening side effects, tumor resistance to drugs, and mutagenic effects of the drugs themselves that can cause secondary cancers and can increase the mutation rates of existing tumors leading to the emergence of more invasive and aggressive disease. DNA damage and repair is central to many of these problems and therefore studying this process at fine levels of resolution m mammalian cells, both transformed and normal, will be important. Also, with the aim of improving the specificity of cancer therapy, novel sequence specific cytotoxic agents are being developed that may allow some degree of gene targeting. Clearly, for the development and rational design of such agents, it is important to have methods that will allow the sequence selectivity of binding to be studied m cells to see if the intended target sequence is being hit and to what extent individual lesions are repaired. Since its first description in 1985 (I), the polymerase chain reaction (PCR) has been adapted for use m Just about every branch of molecular biology and beyond. It is no surprise then that it should find a place in the study of DNA damage and repair resulting from drug-DNA interactions. This chapter will focus on uses of PCR developed m the authors’ laboratory that allow drugDNA interactions to be studied at various levels of resolution from gene regions From

Methods

m Molecular Biology, Vol Edlted by K R Fox Humana

157

90 Drug-DNA Interacbon Press Inc , Totowa, NJ

Protocols

Grimaldi and Hartley

158 Template DNA (genomic)

EXPONENTIAL AMPLIFICATION

EXPONENTIAL AMPLIFICATION OF ONE STRAND ONLY

+ --

-

NO EXPONENTIAL AMPLIFICATION

Fig 1 QPCR method

(300-3000 bp) (2,3) right down to the ultimate level of detection-mdividual nucleottdes m smgle-copy genes m mammalian cells (4) The overall PCR method to be described m this chapter exploits the fact that covalent drug-DNA adducts can block taq polymerase. It can be separated into three parts and used accordmg to the level of resolution desired by the investigator Quantitative PCR (QPCR) will measure the aggregate damage on both strands in a gene region of choice. It is sensitive enough to be used to look at subgene functional regions such as mtrons, exon, promoters, and so forth. Currently, a convenient size would be between 300-3000 bp, however, with new reagents allowmg “long-PCR” becoming available the upper limit may be extended up to 20-30 kbp allowing QPCR to be used to study entire genes. Strand-specific QPCR (ss-QPCR) mcorporates adaptations that allow damage to be measured m the same region as QPCR, but m a strand specific way This 1sparticularly important m the light of recent discoveries showing heterogeneity of repair among gene regions and that by means of transcription coupled repair the transcribed strand of an expressed gene can be repaired more efficiently than the nontranscrtbed strand (5). Smgle-strand ligation PCR (sslig-PCR) extends further the method to allow the detection of adduct formation at the level of single nucleotides, on mdividual strands, in a single copy gene m mammalian cells. 1.7. Overview of the Protocols 7.1.7. QPCR (see Fig. 7) A pair of ohgonucleotide primers 1sused that defines the region of the gene selected for study. In the PCR each strand of genomtc DNA serves as a potential template for exponential amplification and the presence of one or more

DNA Damage Detected by PC/?-Based Methods

159

adducts will block the ampliticatton of that strand. Therefore, when drugtreated DNA 1samphfied, and the reaction 1sstopped m the exponential phase, the amount of product will be reduced compared to untreated DNA. Furthermore, the extent of the reduction will be proporttonal to the amount of damage caused by the drug treatment and by mcludmg a radtoacttve nucleottde m the PCR the extent of damage caused by particular treatments (and subsequent repair) can be accurately quantified. 1.1.2. SS-QPCR The method is outlined m Fig. 2 (as set up to measure lesions on the transcribed strand). DNA extracted from drug-treated and untreated cells is subjected to a first round “linear” PCR using a single btotmylated primer (5 1tB), complementary to the transcribed strand. This PCR generates a family of single-stranded molecules, some of which will be truncated because of the presence of a blocking leston on the transcribed strand of the template DNA. All are captured on streptavidm-coated paramagnetic beads and washed with NaOH to remove genomic DNA including any hybridized to the PCR products. After neutraltzation, the single-stranded molecules, while stdl attached to the beads, serve as templates m a second, exponential, PCR In the exponential amphfication the downstream primer (primer 2) is complementary to the transcribed strand and is nested with respectto primer 1 The upstream primer (primer 3) is complementary to the nontranscrtbed strand and its bmdmg site determines the length of the gene region m which damage is to be measured. In this PCR only those DNA molecules that were extended past the site of primer 3, ~.e., those that were not blocked by lesions on the genomtc DNA, will be exponentially amplified. Thus, provided the PCR remains m the exponential phase when stopped, the amount of product wtll be directly proportional to the amount of undamagedtemplate presentm the region under studyof the origmal genomic DNA. 1.1.3. Sslig-PCR The method of ssltg-PCR 1soutlined m Fig. 3. As with ss-QPCR tt mvolves a first round PCR usmg a single 5’-biotmylated primer, which defines the area of the gene to be investigated. Thirty cycles of linear amplificatton by PCR generates a family of single-stranded molecules of varying length for which the 5’ end is defined by the primer and for which the 3’ ends are defined by the posittons of the DNA-drug adducts. In order to exponenttally amplify these molecules, which are captured and isolated by binding to streptavtdm coated magnetic beads,a single stranded, 5’-phosphorylated, oligonucleotide is ligated to their 3’-OH ends usmg T4 RNA ligase. This oligonucleottde also bears a 3’-terrmnal amine group to block self-ligation. With both ends of the DNA molecules defined, they can then be exponentially amplified and detected. The sequence

160

-Capture on beads, - NaOH wash to remove hybndlzed DNA - TE wash

1 3-J i-

------

+tp@J

3-

-----,.,

-2

3

-------

W4-tB-@ Denature

Exponential Quantlftcatlon

I+.@ -2

and anneal

Amplification and of PCR product

Fig 2.

No Product

DNA Damage Detected by PCR-Based Methods

161

positions of the adducts are determined by electrophoresmg the sshg-PCR products on a sequencing gel. 2. Materials The followmg

lists equipment

and reagents required to detect damage at all

levels, i.e., from gene region down to single bases.Individual needs will determme what is necessary. For example, if damage and repair IS to be studied at the level of a gene region (300-2000 bp) and without any strand specificity then only those items necessary for QPCR will be needed. 2.1. Cell and DNA Treatment 1. Cells m suspensron or monolayer culture (see Note 1) 2 DNA-binding drug, e.g., Cisplatm, mechlorethamme, and so on 3 10X Teoa (store at 4’C; for treatment of naked DNA)* 250 mMTriethanolamme, pH 7.2, 10 mMEDTA 4 Drug stop solutron. 0.6M Sodium acetate, pH 5.2 5. Tissue culture plates (6-well, 24-well, and/or Petri dishes)

2.2. DNA Isolation 1 Cell lys~s buffer (store at room temp): 400 mMTrrs-HCl, pH 8.0,60 mM EDTA, 150 mMNaC1, 1% (w/v) sodium dodecyl sulfate (SDS) 2 5 M Sodium perchlorate (store at room temperature) 3, Chloroform. 4 37 and 65OC water bath 5 Rotary mixer 6 Mrcrofuge 7. Vacuum dryer

2.3. Oligonucleo tides Oligonucleotides were obtained from Genosys UK, or Pharmacia. Store all oligonucleotrdes at-20°C. The olrgonucleotrde sequences ~111 obvrously depend on the region of the gene to be studied. Those described here were used to

study damage and repair m a region comprismg mtron 1 of the human N-ras gene (see Table 1 for sequence). 2.3.1. QPCR 1. NRAS-A 5’-CCT AAA TCT GTC CAA AGC AGA GGC from the coding strand. 2. NRAS-B: 5’-CAG CAA GAA CCT GTT GGA AAC CAG from the noncoding strand Thus primer pan defines a 523-bp region of the N-ras gene mtron 1 Fig 2 (opposztepage) scrrbed strand)

Ss-QPCR method (as set up to measure lessons on the tran-

162

Amplnl**tOp

strand

.

.

Fig. 3.

DNA Damage Detected by PCR-Based Methods 2.3.2. Strand-Specific The following gene mtron 1.

163

QPCR (ss-QPCR)

primers ~111 measure damage in a 350-bp region of the N-ras

2.3.2 1. STEP 1 I To measure damage on the nontranscribed strand ofN-rus: 3 1nB (5’-Blotinylated): 5’-CAG CAA GAA CCT GTT GGA AAC CAG. 2 To measure damage on the transcribed strand of N-ras. 5 ItB (5’ Biotmylated): 5’-GGT CCT TCC ATT TGG TGC CTA CG. (These primers were obtained synthesized with blotin incorporated at the 5’-end) 2.3.2 2. STEP 2 3 Oligo 3.2, 5’-CCA GTA ATC AGG GTT AAT TGC GAG C 4 Ollgo 5 2 5’-ACG TGG GGA GAT CTT CGA GA

2.3.3. Single-Strand Ligation PCR (sslig-PCR, to measure damage on individual nucleotides) The following primers are required m addition to the primers above for ss-QPCR (3 lnB, 5.ltB, Oligo 3.2, Ohgo 5.2):

described

1 To measure damage on the nontranscrlbed strand. Oligo 3 3. 5’-GCG AGC CAC ATC TAC AGT AC 2 To measure damage on the transcribed strand Oligo 5 3 5’-TGG AGA CAG AAG GGA GAA TG 3 “Ligation Ohgonucleotlde ” 5’-p-ATC GTA GAT CAT GCA TAG TCA TA-n This ollgonucleotlde should be supplied gel or HPLC purified. It must also be 5’-phosphorylated (p) and bear a 3’-termmal amine group (n) to block self-hgatlon (these modifications should be incorporated at synthesis) 4. “Ligation Primer”* 5’-TAT GAC TAT GCA TGA TCT ACG AT This ollgonucleotlde, which 1s complementary to the “ligation oligonucleotlde,” must be gel or HPLC purified.

2.4. End Labeling

Oligonucleotides

(at 5’ end)

Oligonucleotides were end-labeled with T4 polynucleotide kinase using Glbco-BRL (Gaithersburg, MD) kits with forward reaction buffer 1. [Y-~~P]-ATP 10 #Z!lIpL (Amersham). 2. Forward buffer* 300 mM Tns-HCl, pH 7.8, 75 mM 2-mercaptoethanol, M&I,, 1.65 @4ATP

50 mM

Fig. 3. (opposite page) Sshg-PCR method (as set up to measure lesions on the nontranscribed strand).

Table 1 Human h-as, 484 434 384 334 284 234 184 134 84 34

lntron

CCTAAATCTG ATGCAGAGTG GCCAGAAATG GGTCCTTCCA AATGGGAAGG CGGGGAGTAA CCAAGGACTG CCAGAAGTGT CTTTAAGAAC ATAGAAGCTT TGGTTTCCAA

Numbermg

1 Sequence:

Nontranscribed

TCCAAAGCAG TTCGGCTTTG GAGCAGAATC TTTGGTGCCT AGTTGCGGCC TAGGAAGGGG TTGAAAAATA GAGGCCGATA CAAATGGAAG TAAAGTACTG CAGGTTCTTG

Strand AGGCAGTGGA GGATGTGGAA TATCAGCTGG ACGTGGGGAG TGGAGGTTCC GATCTCCATT GCTAAGGATG TTAATCCGGT GTCACACTAG TAGATGTGGC CTG

starts from the first base of the bmdmg site of Ohgo 3 3 (the underlmed

GCTTGAGGTA TGTTCAGGCG AGACAAAGGC ATCTTGGAGA TGCTAGAGCT GCTTAGGCTG GGGGTTGCTA GTTTTTGCGT GGTTTTCATT TCGCAATTAA

AGTTTATCTC TTTCACTGAT CTTGGGCGGG CAGAAGGGAG GAGAAGCCTT AGGGCGGGGC GAAAACTACT TCTCTAGTCA TCCATTGATT CCCTGATTAC

base) and corresponds to that In Fig. 6

DNA Damage Detected by PCR-Based Methods

165

2.5. PCR 2.5.7. All Reactions 1. TagPolymerase (Perkin-Elmer, Promega, Advanced Brotechnologtes, UK, and so on). 2 10X PCR buffer (see Note 5). 200 mM (NH&SO,, 750 mA4 Tris-HCl, pH 9.0, 0.1% (w/v) Tween 3. 25 mA4 MgC& (store at 4°C). 4 10X dNTP’s (Pharmacra): make a mixture containing 2 mA4 concentration each of dATP, dGTP, dCTP, and dTTP; store at -20°C 5 Thermal cycler (e g , MJ PTC-100 with heated lid see Note 6) 6. Mineral oil (if thermal cycler is without heated Itd facthty) 7 PCR tubes-O 5 or 0.2 mL

2.5.2. QPCR and ss-QPCR [c+~~P]-ATP be performed by TCA precipitation tive (item 2) is phosphor image

10 @Zi/~L (Amersham). Quantrtatron of the PCR product may one of two methods (see Note 13). One method (item 1) mvolves of the PCR product and scmtillation counting. The alternaquantitation by densitometric scannmg of autoradiographs or analysis after agarose gel electrophoresrs.

1. TCA precipitation. a. Whatman GFC filters (24~mm diameter) b, Multiple filtration mamfold (Mtlhpore) c. 5% TCA. 5% (w/v) trichloroacetic acid, 20 mM tetrasodmm pyrophosphate (store at 4°C) d. Scmtillatron flurd (Ecoscmt, National diagnostics) e. Scintillation counter (e g., Beckman LS 1800) 2. Agarose gel electrophoresis and densitometnc scanning or phosphor image analysts. a Equipment for horizontal agarose gel electrophoresis. b. 50X TAE: 2 M Tris-acetate; 0 05 M EDTA (per L 242 g Tris base; 57 1 mL glacial acetic acid; 100 mL, 0 5 A4 EDTA, pH 8 0) c Agarose. d 6X Agarose gel loading buffer. 0.25% bromophenol blue, 4% (w/v) sucrose in water. e. Gel dryer (suitable for agarose and acrylamide gels, e g , Hoeffer). f. Autoradiography cassette or phosphor Image cassette. g. Autoradrography film h. Standard equipment for X-ray film development 1. Gel Scanner or Phosphor Image analyzer,

2.5.3. ss-QPCR Only 1. Freshly prepared 0.4 M NaOH.

166 2.5.4. ss-QPCR and sslig-PCR 1 Streptavidm M-280 Dynabeads (Dynal, UK) 2 Magnet to capture beads-capacity at least six Eppendorf tubes, e g , MPC-E6 (Dynal, UK) 3 5X Washing and binding buffer (WBB, store at 4°C) 25 mMTris-HCl, pH 7 6, 5 mM EDTA, 5 M NaCl. 4 TE (pH 7 6) (store at 4’C) 10 n&f Tris-HCl, pH 7 6, 1 mM EDTA

2.5.5. sslig- PCR On/y 1 PEG (store at 4°C) 50% (w/v) PEG 8000 2 10X Ligation Buffer (store at -70°C): 0.5 MTns-Cl, pH 8.0,lOO mMMgCl,, 10 rnJ4 hexammme (III) cobalt chloride, 100 yg/mL bovme serum albumm, 200 w ATP. To make 1 mL 500 pL 1 MTris-HCl, pH 8 0,100 uL 1 MMgCl,, 10 pL 10 mg/mL BSA, 2.68 mg hexammme (III) cobalt chloride, 2 uL 100 mh4ATP, 388 pL H,O. 3 T4 RNA Llgase (New England Biolabs, activity = 20 U/pL, store at -20°C) 4. Sequencmg gel loading buffer. 96% (v/v) formamide (deionized), 20 mMEDTA, 0.03% (w/v) xylene cyanol, 0.03% (w/v) bromophenol blue. 5. Sequencing gel* 6% sequencing gels were prepared wtth Sequagel (National Diagnostics) Composition ,5 7% acrylamrde, 0.3% bu-acrylamide, 8 3 MUrea, 0 1 A4 tris-borate, pH 8 3, 2 mMEDTA 6. TEMED. 7 50% (w/v) ammonium persulfate (store at 4’C) 8. Sequencmg gel apparatus: at least 60 cm long, 20 cm wide, and 0 4 mm thick Suppliers include Kodak-IBI and Life Technologtes 9. 10X TBE: 0.9 M Trrs-borate; 0.02 M EDTA (per La 108 g trrs base; 55 g boric acid, 7.44 g Na-EDTA) 10 Equipment for horizontal agarose gel electrophoresis. 11 Gel dryer (suitable for acrylamide gels; e.g., Hoeffer) 12 Autoradiography cassettes (43 x 35 cm) 13 Autoradrography film 14. Standard equipment for X-ray film development

3. Methods 3.1. Treatment

of Isolated DNA

1 Use 0.5 pg DNA for QPCR and ss-QPCR and 3 pg DNA for sslig-PCR per reaction. 2. Incubate DNA with drug for 1 h at 37°C m Teoa ma total volume of 50 pL m 1.5~mL microfuge tubes 3. Add 50 pL 0.6 M sodium acetate “drug stop” solution and precipitate DNA with 3 ~0195% ethanol 4. Wash DNA pellet with 2 x 1 mL 75% ethanol (room temperature) and dry under vacuum 5 Resuspend DNA m deionized 10 pL Hz0 ready for PCR.

DNA Damage Detected by PCR-Based Methods

767

3.2. Treatment of Cells 3.2. I. Suspension Cultures 1. Count cells and resuspend at a density of 2 x IO6 cells/ml m tissue culture medium with or without fetal calf serum as requn-ed (see Note 2). 2 Add required amount of drug (dissolved m tissue culture medium or Isotonic solution) to the wells of 24-well tissue culture plates. 3. Add tissue culture medium to make the volume up to 0.5 mL 4 Add 0.5 mL of cell suspension (1 x 1O6cells) and incubate at 37°C for appropnate time 5 Transfer cells to 1.5-mL mlcrofuge tubes, wash out wells with 0 4-mL tissue culture medium and add to tubes Spm for 5 mm at 27Og, 4°C 6 Remove supematant and wash cells-by resuspendmg and spmnmg-with 3 x 1 mL tissue culture supernatant 7 After washmgs remove supematant At this pomt the cell pellet may be stored at -20°C untd DNA isolation For repalr experiments the cells are resuspended in 1 mL tissue culture medium, with fetal calf serum, transferred to a fresh 24-well plate and incubated at 37°C for appropriate times before harvesting the cells.

3.2.2. Adherent Cells 1 Grow cells to almost confluence m 2-cm diameter wells 2 Treat with drug as for suspension cells except the drug is added together in I-mL tissue culture medium to avoid adding concentrated drug directly to the cells. 3. Incubate as for suspension cells 4. Remove drug medium and gently wash cells three times with 1 mL fresh tissue culture medium (see Note 3). 5 If repair experiments are to be carried out, add tissue culture medmm with serum and incubate for appropriate times. 6 Harvest the ceils by trypsmlzatlon and spin as for suspension cells These cells may be stored at -20°C

3.3. DNA Isolation 1. 2 3. 4. 5. 6. 7. 8

9.

Resuspend cell pellet m 340 yL cell lysis buffer Add 100 pL 5 A4 sodium perchlorate. Incubate at 37°C for 20 min, mixing occasionally Transfer to a 65°C water bath and incubate for 20 min with occasional mixing by inversion Add 580 yL chloroform precooled to -20°C. MIX by rotation for 20 min at room temperature. Spin in microfuge at 11,600g for 10 mm. Remove half (220 pL; equivalent to 5 x lo5 cell from suspension cultures) upper aqueous layer, transfer to fresh 1.5-mL microfuge tube and add 440 PL absolute ethanol (kept at -2O’C) to precipitate DNA (see Note 4). Spin at top speed m a microfuge for 20 min and wash DNA pellet with 2 x 1 mL 75% ethanol (kept at room temperature).

Gritnaldi and Hartley

168

10 Dry the DNA pellet under vacuum 11 Resuspend pellet in H,O. The amount of H,O to use depends on which experiment is to be carried ouk-QPCR* resuspend in 250 pL H,O, use 50 pL per PCR; ssQPCR and sshg-PCR. resuspend m 50 PL H,O, use 10 yL per PCR

3.4. QPCR The efficiency and specificity of PCR often depends on the MgCl, concentration m addition to the annealmg temperature. These parameters should, therefore, be established by titration before proceeding with damage experiments. Initial

optimization

of PCR can be performed

without radioactivity,

the

performance being assessedby ethidium staining of agarose gels. With QPCR (and ss-QPCR, see Subheading 3.5.) DNA damage m the region of the gene under study leads to a reduction m the amount of PCR product, (see Subheading 1.). It is essential to ensure that the only hmitmg component of the PCR 1sthe template DNA and that the reaction remains in the exponential phase when terminated so that any damage to DNA will cause a directly proporttonal reduction m the amount of radioactive product. The important factors are cycle number and quantity of DNA, so prehmmary experiments must be performed to determine the condrtions required. The first experiment to do is to keep the amount of DNA constant at, for example, 0.5 pg and vary the number of cycles between 20 and 30 cycles. After quantitation of the radtoactive product, the results should show an exponential mcrease in the amount of amplified product with increasing cycle number (see Fig. 4A) A cycle number is then chosen, which is well wtthm the exponential range but which generates sufficient amplified DNA to be easily measured. In the N-vus example 26 cycles were chosen. Next a DNA titration is performed using this fixed number of cycles, the amount of DNA is varied between 0.1 and 1.O pg and the amount of amplified product should increase linearly m direct proportion to the amount of starting DNA (see Fig. 4B). These experiments thus establish the conditions under which QPCR and ss-QPCR will give a quantitative measurement of the amount of DNA template available for amplification (i.e., free of damage) and DNA damage experiments can be performed. 1. Reaction components and template DNA are mixed in a volume of 100 pL containing 50 pmol of each primer NRAS-A and NRAS-B; 2 U tuq polymerase; 2 pCi [a-32P]-dATP; 200 pMeacb dATP, dGTP, dCTP, dTTP; 1 5 mMMgC1, (see Note 7), 10 pL 10X PCR buffer. If necessary, add 40 pL mineral oil overlay. 2. Place tubes m thermal cycler and carry out cycling as follows. 3 min at 94OC initial denaturation then 26 cycles of: 1 mm at 94”C, I mm at 60°C (annealing temp-+ee Note g), 1 min at 72OC This is followed by a final incubation of 4 min at 72°C 3. For quantitative results each PCR should be carried out m triplicate and the followmg controls are essenttal: a. No DNA m PCR.

DNA Damage Detected by PCR-Based Methods

20

22

24

26

169

28

30

Cycles

0

Fig. 4. (A) Exponential QPCR. 0.5 ug untreated genomic DNA was subjected to QPCR usmg primers to amplify a 523-bp region of intron I of the N-ras gene The reaction was stopped after varying numbers of cycles and the product wasmeasured by scintillation countmg after TCA precipitation. (B) DNA tttration. Varymg amounts ofuntreated genomic DNA were subjected to 27 cycles of QPCR, the PCR product was measured as above b. Untreated DNA c. Samples contammg l/3 and 2/3 amounts of untreated DNA. If the reaction 1s stopped in the exponential phase, then these samples should yield l/3 and 213 amounts of PCR product and thus control for the linearity of the PCR and guarantee Its quantitative nature

Grimaldi and Hartley

170

3.4 1 Quantitation of QPCR Product One of two methods can be employed

(see Note 13).

1 TCA prectpttatton a Transfer 40 uL PCR product to 1 5-mL mtcrofuge tubes and add 1 mL 5% TCA mix b Load Whatman GFC filters mto vacuum filtratton manifold c Rinse filters with 1 mL 5% (ice-cold) TCA mix d Load PCR product/TCA mix on filters. e Wash filters with 10 mL 5% TCA mix (ice-cold) and 10 mL absolute ethanol (ice-cold) f. An-dry filters, place m scinttllatron vials, and add 5 mL scintillatton flutd g Count on scintillation counter 2 Autoradrography and densttometrtc scanning or phosphor Image analysis a MIX 10 pL PCR product with 2 pL 6X agarose gel loading buffer and electrophorese in 1 5% agarose gel (see Note 9) b Dry gel on slab gel dryer and expose gel to X-ray film or phosphor image cassette c Develop film or cassette and quantttate bands by scannmg or phosphor image analysis

3.4.2 Expression of Results 1 The simplest way of expressmg results is as a percentage decrease of PCR product (compared to untreated DNA control) as drug concentratton increases (Fig. 5A) Repan of damage IS seen as a recovery of the amount of PCR product wtth time (Fig. 5B) 2 With relattvely nonsequence specific drugs such as cisplatm and mechloethamine, the dtstrtbutton of DNA adducts can be considered to be random and the number of lesions per strand m the region defined by the primers can be calculated using the Poisson equation Lesions/strand = -In (Ad/A) where A 1sthe amount of PCR product from undamaged template and Ad 1s the amount from damaged template. In this way, quantttative compartsons between drugs can be made. It 1s Important to remember that each strand is a template m the PCR and, therefore, the Poisson formula gives results and lesions per strand This should be doubled to arrtve at a figure for the number of lesions per doublestranded region of the gene under study 3.5. ss-QPCR

Preliminary experiments need to be carried out to establish condltlons for the speciklty and efficiency of the PCR and for linearity of the assay. These are exactly the same as described for QPCR (Subheading 3.4.) ss-QPCR m fact, measuresDNA damage in the sameway as QPCR, the rationale IS the same,and the amount of DNA used as template 1sthe same. Extra steps are required to make

RNA Damage Detected by PCR-Based Methods

1

QM

3

Cont.

(PM;

7oooo -B 60000 $1 z 50000 0 40000 -

Repair

Time

(Hours)

Fig. 5. (A) Inhibition of QPCR. K562 cells were treated with qumacrme mustard for 1 h at the doses indicated, DNA damage was measured by QPCR and the 523-bp N-m PCR product was measured by scintillation counting after TCA precipltatron (B) Repair of Quinacrine Mustard lesions K562 cells were treated for 1 h with 1 ).&f qumacrme mustard and allowed to repair for the indicated time periods. Damage and repair was measured by QPCR and the amount of PCR product was determined as above. The data point at around 60,000 cpm (0 h) represents DNA from untreated cells.

this assaystrand specific (see Fig. 2). The protocol described here usespnmers that measure damage in a 350-bp region of intron 1 of the human N-rus gene.

172

Grimaldi and Hartley

3.5.1. PCR-1 1. The single primer used m the first round determmes on which strand the damage will be measured (I.e., using a primer complementary to the transcribed strand will detect damage on the transcribed strand). First round “linear” PCR 1scarried out m a volume of 40 pL contammg 0.6 pmol of 5’-blotmylated primer 5. ItB, I U taq polymerase, 200 pA4 each dATP, dGTP, dCTP, dTTP; 2.5 mA4 MgCI, (see Note 7), 10 yL 10X PCR buffer If necessary, add 40 p.L mmeral oil overlay 2 Place tubes m thermal cycler and carry out the followmg: an initial denaturatlon step of 3 mm at 94°C and then 20 cycles of 94°C for 1 mm, 60°C (see Note 8) for 1 mm and 72°C for 1 mm This IS followed by a final mcubatlon of 4 mm at 72°C 3 If mineral oil was used this needs to be removed as follows Add 60 pL Hz0 and 100 pL water-saturated chloroform. Spm tubes bnefly, remove upper aqueous layer and transfer to 1.5-n& microfuge tubes. Add a further 100 pL Hz0 to the original PCR tubes, spm agam, and remove the aqueous layer and add to the 1.5~mL microfuge tubes Precipitate DNA with ethanol and after drying resuspend m 50 pL 1X WBB

3.5.2. Capture of PCR Products 1 Transfer streptavldm-coated Dynabeads to a 1 5-mL mlcrofuge tube Use 5 pL per PCR plus an extra 5 pL (e g , for 10 reactions transfer 55 pL beads) 2 Place tube m magnetic rack to sediment beads (about 30 s) and then remove supernatant-keep tubes m magnetic rack’ 3 Remove tube from magnetic rack and resuspend beads in 200 pL 1X WBB Replace m rack to sediment beads and remove supernatant Repeat this washing process one more time 4 Resuspend beads m 1X WBB using 40 pL per PCR (1 e., for 10 tubes resuspend m 400 pL). Mix well and transfer 40-)1L ahquots to 1 5-mL tmcrofuge tubes 5. Place tubes in rack to capture beads and remove supernatant. The beads are now ready for the addition of the PCR mix. 6 To the 40 pL PCR mix add 10 yL of 5X washing and binding buffer (WBB) and transfer mixture to the washed beads. If mineral 011was used m PCR- 1, transfer the resuspended DNA (from step 3, Subheading 3.5.1.) directly to the beads without adding 5X WBB 7 Incubate at 37°C (not m magnetic rack) for 30 min with occasional agitation to resuspend the beads. 8. Place tubes in rack to sediment beads, remove supernatant, and wash three times with 200 pL freshly prepared 0.4 A4 NaOH and then 1X with 200 pL TE 9 Resuspend beads in 40 pL H,O and transfer to PCR tubes

3.5.3. PCR-2 1 The second round, exponential PCR is carried out m a volume of 100 pL contammg the DNA template still attached to the beads The reaction 1sthe same whether

DNA Damage Detected by PCR-Based Methods

173

damage 1sto be measured on the transcribed strand or the nontranscrtbed strand smce this spectfictty was determmed by PCR- 1. The components of the PCR are as for PCR- 1 (Subheading 3.5.1.) except for 50 pmol each primer Oligo 3 2 and Oligo 5.2, 2 U taq polymerase, 2 uCi [a-32P]-dATP. 2. Cyclmg condrtions An mittal denaturatron step of 2 min at 94’C and then 26 cycles (see Note 12) of 94°C for 1 min, 60°C (see Note 8) for 1 min and 72°C for 1 mm with a final mcubatron of 4 min at 72°C. 3. The controls required are the same as those for QPCR (Subheading 3.4., step 3) with one addition to control for the efficiency of the washing of the beads after PCR- 1 Thrs is vital as any carry-over of genomic DNA would provrde template for the exponential PCR-2 and lead to abnormally high results. Therefore, m PCR- 1, control samples must be included that contain all components except taq polymerase and in the PCR-2 they are treated as for the test samples, 1.e , with taq polymerase Values above background with these samples would indicate genomic DNA carry over and invalidate the assay 4. The PCR product IS quantified, and the results expressed, m exactly the same way as for QPCR-see Subheadings 3.4.1. and 3.4.2.

3.6. sslig-PCR 3.6.1. PCR-1

(see Notes 18 and 19)

Follow exactly the same protocol 3.5.1., steps l-3).

as for PCR-1 in ss-QPCR

(Subheading

3.6.2. Capture of Biotinylated PCR Products 1 Follow steps l-7 in Subheading 3.5.2. 2. Place tubes in magnetic rack, remove supernatant, and wash beads three times wrth 200 pL TE. 3. Resuspend beads in 50 pL Hz0 and spin briefly in a microfuge to bring all the hqmd to the bottom of the tubes

3.6.3. Ligation of Ligation Oligonucleotide 1. Prepare ligation mix The ligation is carried out in a volume of 10 pL Sufficient mix IS prepared to give 10 pL more than required, t.e , for ten tubes a mix of 110 pL is prepared. The cornpositron of the mix (per tube) is as follows: 5 PL 50% PEG, 1 uL ligation Ohgonucleotide @ 20 pmol/pL, 1 pL 10X ligation buffer, 2 pL H20, 1 pL T4 RNA Ltgase @ 20 U/pL. 2. Place the tubes contammg the bead suspension in the magnetic rack to sediment the beads and remove supernatant. 3. Resuspend the beads in 10 pL ligation mrx and ligate overnight at room temperature. 4. After hgatron add 180 pL TE and place tubes in magnetic rack 5. Remove supernatant and wash beads three times with 200 pL TE. 6 Resuspend beads m 40 PL Hz0 ready for PCR-2

174

Gnmalcli and Hartley

3.6.4. PCR-2 and PCR3 1 The second round PCR is carried out in a volume of 100 uL contaming the DNA template on the beads Two primers are used hgatton primer and either Ohgo 3 2 or Ohgo 5 2, dependmg on which strand adducts are to be measured In the N-ras example, to measure adducts on the nontranscribed strand Ohgo 3 1nB is used m PCR-1 and, therefore, Ohgo 3.2 wtll be used m PCR-2 (and 3 3 m PCR-3) 2 The beads, suspended m 40 uL H20. are transferred to PCR tubes contammg the PCR mrx. The reaction composition is as follows 10 pmol Oligo 3 2, 10 pmol ligation primer, 2 5 U taq polymerase, 200 luV each dATP, dGTP, dCTP, dTTP, 2 5 mM MgCI, (see Note 7), 10 uL 10X PCR buffer 3. The cycling conditions are an mmal denaturatron at 94°C for 5 mm then X cycles of 94°C for 1 mm, 58’C for 1 mm (see Note 8), 72°C for 1 mm + 1 s extension per cycle with a final 5-mm step at 72°C The number of cycles (X) m this step has to be determmed empirically for each set of prtmers It generally falls between 22-28 cycles (see Note 16) 4 PCR-3 is carried out untnediately after PCR-2 is finished Add to the tubes 10 uL of PCR mix contammg 1 uL 10X PCR buffer, 5 uL (5 pmol) 32P 5’-end labeled Ohgo 3 3 (see Subheading 3.6.6.), 1 U taq polymerase, 1 pL 10X dNTP mtx, 2 5 mM MgCl* (see Note 7) 5 A further four cycles are performed* 94’C for 1 mm, 64°C for 1 mm (see Note 8), and 72°C for 1 mm with a final 5-mm step at 72°C 6 Spin PCR tubes briefly m a microfuge (remove mmeral oil at this pomt if necessary) and transfer supernatant to 1 5-mL microfuge tubes Rinse the PCR tubes with 100 uL H20, spin, and add to the mrcrofuge tubes Precrpitate with 3 vol 95 ethanol (kept at -20°C) and dry under vacuum.

3.6 5. Sequencing Gel 1. Resuspend DNA (radtoactive) in 5 uL sequencing gel-loading buffer and electrophorese m 6% acrylamtde sequencing gel at 2500-3000 (see Note 17) 2 Dry the gel onto Whatman 3MM paper, supported by a layer of Whatman DE 8 1 paper to bmd the shorter fragments, whtch ~111 pass through the 3MM 3 Expose gel to X-ray film, usually overnight is sufficient to give a srgnal Sometimes an intenstfymg screen may be requtred and if so the film IS exposed at -70°C

3.6.6. Oligonucleotide

5’ End Labeling

1 Five picomoles of end-labeled ohgo 3.3 or 5 3 are required for each tube m PCR3. For 10 samples label 55 pmol: In a 1.5~mL microfuge tube, add 12.5 uL H20, 5 5 pL Oligo 3 3 or 5 3 (at a concentration of 10 pmol/uL), 1 uL T4 polynucleotide kmase (5 U/pL), 1 yL [T-~*P]-ATP (10 uCt/uL), 5 uL 5X reaction buffer. 2 Incubate at 37°C for 30 mm, add 25 uL H20 and separate unmcorporated nucleottde from the labeled ohgonucleotide either by ethanol prectpltatton or by usmg a spin column (e g , Bio-Spm-6; Bio-Rad) Use labeled ohgo as directed m Subheading 3.6.4.

175

DNA Damage Detected by PCR-Based Methods “Naked” DNA

cells 10

@IAT436

pM Cisplatin

IO

_ , s 300-

t

Pvu II Site

““; i y& 9