VITAMINS A N D HORMONES VOLUME 55
Editorial Board
FRANK CHYTIL
MARYF. DALLMAN JENNY P. GLUSKER
ANTHONY R. MEANS BE...
51 downloads
939 Views
39MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
VITAMINS A N D HORMONES VOLUME 55
Editorial Board
FRANK CHYTIL
MARYF. DALLMAN JENNY P. GLUSKER
ANTHONY R. MEANS BERTW. O’MALLEY VERNL. SCHRAMM MICHAELSPORN ARMENH. TASHJIAN,JR.
VITmINS AND HORMONES ADVANCES IN RESEARCH AND APPLICATIONS
Editor-in-Chief
GERALDLITWACK Department of Biochemistry and Molecular Pharmacology Jefferson Medical College Thomas Jefferson University Philadelphia, Pennsylvania
Volume 55
ACADEMIC PRESS San Diego London Boston New York Sydney Tokyo Toronto
This book is printed on acid-free paper. @ Copyright 0 1999 by ACADEMIC PRESS All Rights Reserved. No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopy, recording, or any information storage and retrieval system, without permission in writing from the Publisher. The appearance of the code at the bottom of the first page of a chapter in this book indicates the Publisher’s consent that copies of the chapter may be made for personal or internal use of specific clients. This consent is given on the condition, however, that the copier pay the stated per copy fee through the Copyright Clearance Center, Inc. (222 Rosewood Drive, Danvers, Massachusetts 01923). for copying beyond that permitted by Sections 107 or 108 of the US. Copyright Law. This consent does not extend to other kinds of copying, such as copying for general distribution, for advertising or promotional purposes, for creating new collective works, or for resale. Copy fees for pre-1999 chapters are as shown on the title pages. If no fee code appears on the title page, the copy fee is the same as for current chapters. 0083-6729/99 $25.00
Academic Press a division of Harcourt Brace & Company 525 B Street, Suite 1900, San Diego, California 92101-4495, USA http://www.apnet.com
Academic Press 24-28 Oval Road, London NW 1 7DX, UK http://www.hbuk.co.uk/ap/ International Standard Book Number: 0- 12-709855-0 PRINTED IN THE UNlTED STATES OF Ah4ERICA 98 99 00 01 02 03 BB 9 8 7 6
5
4
3 2
I
Former Editors KENNETHV. THIMANN ROBERTS. HARRIS Newton, Massachusetts
JOHN A. LORRAINE University of Edinburgh Edinburgh, Scotland
PAUL L. MUNSON University of North Carolina Chapel Hill, North Carolina
JOHN GLOVER University of Liverpool Liverpool, England
GERALDD. ALJRBACH Metabolic Diseases Branch National Institute of Diabetes and Digestive and Kidney Diseases National Institutes of Health Bethesda, Maryland
University of California Santa Cruz, California
IRAG. WOOL University of Chicago Chicago, Illinois
EGONDICZFALUSY Karolinska Sjukhuset Stockholm, Sweden
ROBERTOLSON School of Medicine State University of New York at Stony Brook Stony Brook, New York
DONALDB. MCCORMICK Department of Biochemistry Emory University School of Medicine Atlanta, Georgia
This Page Intentionally Left Blank
Contents PREFACE ..........................................................
xi
G-Protein-Coupled, Extracellular Ca2+-SensingReceptor: A Versatile Regulator of Diverse Cellular Functions
STEPHEN QUINN, EDWARD M. BROWN, PETERM. VASSILEV, AND STEVEN C. HEBERT I. Introduction: Ca2-Sensing and the Maintenance of Mineral IonHomeostasis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11. Indirect Evidence That Parathyroid and Other Cells Sense Ca? Via a G-Protein-Coupled CaR . . . . . . . , . . 111. Isolation of a Bovine Parathyroid CaR by E in Xenopus laevis Oocytes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . rv. Structural Similarity of the CaR to Other GPCRs . . . . . V. Are There Other C a y Sensors? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . VI. Signal Transduction Pathways Employed by the CaR . . VII. The CaR Gene and Regulation of CaR Expression . . . . . . . . . VIII. Structure-Function Relationships of the CaR . . . . . . , . . . . . . . . . . . . . . . IX. The CaRs Tissue Distribution and Functions in Tissues Involved in Mineral Ion Homeostasis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . X. Human Diseases Resulting from C a R Mutations Clarify the Receptor’s Physiological Roles . . . . . . ................................... XI. Tissue Distribution and Functions of the CaR in Tissues Uninvolved in Systemic Ion Homeostasis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ................. XII. CaR-Based Therapeutics . . . . . . . . . . XIII. Summa...................................................... .................................. References . . . . . . . . . . . . .
2 8
9 12 14 17 18 20 21
31 42
55 56 56
Peptide Hormones, Steroid Hormones, and Puffs: Mechanisms and Models in Insect Development AND L. I. GILBERT V. C. HENRICH, R. RYBCZYNSKI,
1. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11. PTTH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111. Juvenile Hormone and the Prothoracic Gland . . . . . . . . . . . . . . . . . . . . . . vii
73 79 92
...
CONTENTS
Vlll
Tv. Ecdysteroid Action ............................................ References
...................................................
93 115
Nuclear Matrix and Steroid Hormone Action AND THOMAS C. SPELSBERG THOMASJ . BARRETT
I . Introduction and Background ................................... I1. Nuclear Matrix-Chromatin Structure ............................ I11. Steroid-Hormone-Induced Effects on Chromatin Structure and Matrix Composition ........................................ IV Contributions of the Nuclear Matrix to Steroid-Mediated GeneTranscription ............................................ V. Role of the Nuclear Matrix in Steroid Hormone Signaling and Nuclear Binding .......................................... VI . Maintenance of the Nuclear Matrix by Steroid Proteins . . . . . . . . . . . . . . VII. Conclusions and Future Directions ............................... References ...................................................
127 128 131
133 136 141 145 150
Coregulatory Proteins in Nuclear Hormone Receptor Action
DEANP. EDWARDS I . Introduction ................................................. I1. Nuclear Receptor Superfamily: Structure and Function . . . . . . . . . . . . . . I11. Accessory Proteins That Modulate Nuclear Receptor Binding toTargetDNASequences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tv. Nuclear Receptor Transcriptional Coactivators ..................... V. Summary and Future Questions ................................. References ...................................................
165 166 169 178 200 204
Molecular Action of Androgen in the Normal and Neoplastic Prostate JOHN M. KOKONTIS AND SHUTSUNG LIAO I. Introduction ................................................. I1. Metabolic Activation ofAndrogens ............................... I11. ARStructure . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
220 221 226
ix
CONTENTS
Iv. Mechanism of AR Activation
v.
....................................
ARMutation ................................................. VI . AR Expression in the Normal Prostate and in Prostate Cancer . . . . . . . . VII . Androgen-Regulated Genes ..................................... VIII . AR Function in Prostate Cancer ................................. IX. Concluding Remarks .......................................... References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
236 244 249 256 267 273 274
Regulation of Androgen Action
A . K. ROY.Y. LAVROVSKY. C. S. SONG. S. CHEN.M . H . JUNG. N . K . VELU.B .Y. BI. AND B . CHATTERJEE I . Introduction ................................................. I1. Androgen Receptor and Androgen Response Elements . . . . . . . . . . . . . . . I11. Regulation of Androgen Receptor Gene Expression . . . . . . . . . . . . . . . . . . Tv. Ligand-Mediated Activation and Inhibition of Androgen ReceptorFunction ............................................ v. Enzymatic Regulation of Androgen Action ......................... VI. Mediation of Androgen Action by Peptide Growth Factors . . . . . . . . . . . . VII . Androgen Action in Target Cells Containing High Levels of Androgens and Androgen Receptor ............................. VIII . Summary .................................................... References ...................................................
309 311 320 323 326 331 332 337 339
Regulation of Estrogen Action: Role of 17P-Hydroxysteroid Dehydrogenases
PIRKKO VIHKO.AND REIJO VIHKO HELLEVIPELTOKETO. I . Introduction ................................................. ......................... I1. I11. 17HSD Type 1Enzyme and Ovarian E2 Production . . . . . . . . . . . . . . . . . Expression and Action of 17HSD v p e 1and Type 2 Enzymes duringpregnancy ............................................. V. Physiological Role and Expression of l7HSD Type 1and Type 2 Enzymes in Peripheral Tissues .................................. VI. Structure and Function of 17HSD Type 1Enzyme: Applications to the Prevention and Treatment of Estrogen-Dependent Cancers ...... VII. Regulation of hHSD17BI Gene Expression ........................ .............................................. VIII . References ..................................... ..
rv
353 355 360 367 373 378 381 385 386
X
CONTENTS
Steroidogenic Acute Regulatory Protein
DOUGLAS M. STOCCO I. Introduction ................................................. 11. What Are the Factors Involved in the Acute Regulation ofsteroidogenesis? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . HI. The Steroidogenic Acute Regulatory Protein ....................... IV. Consequences of a Disordered StAR Gene . . . . V. Putative Mechanism ofAction of StAR . . . . . . . VI. Conclusions ............................. ...... References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
399 402 404
429 430
Regulated Expression of the Bone-Specific Osteocalcin Gene by Vitamins and Hormones
JANE B. LIAN,GARYS. STEIN, JANET L. STEIN, AND ANDREJ. VANWIJNEN I. Introduction ................................................. 11. Protein Properties and Function Rely on the Vitamin-K-Dependent Synthesis of y-Carboxyglutamic Acid Residues ..................... 111. Regulated Expression of Osteocalcin during Osteoblast Differentiation ............................................... IV. Properties of the Rat Osteocalcin Promoter ........................ V. Chromatin Structure, Nucleosome Organization, and Osteocalcin Gene-Nuclear Matrix Interactions Support Interrelationships between Activities at Multiple Independent Promoter Elements . . . . . . . VI. Closing Remarks . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
INDEX. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
443 444 448 458
477 487 488
511
Preface This volume of Vitamins and Hormones covers mainly steroid hormone action, although two contributions discuss calcium and peptide hormones. The first chapter, by Edward M. Brown and collaborators, is devoted to a G-protein-coupled extracellular sensing calcium receptor that plays a role in various cellular functions. The second article, from the laboratory of L. I. Gilbert and his co-workers, focuses on peptide and steroid hormones in insect development. This is followed by a treatise from the laboratory of T. C. Spelsberg on the nuclear matrix and steroid hormone action. D. P. Edwards contributes a timely essay on coregulatory proteins in steroid hormone receptor action. This is followed by two papers on androgen action, one from the laboratory of S. Liao on the molecular action of androgen in normal or neoplastic prostate and a second from the laboratory of A. K. Roy on the regulation of androgen action. Another article deals with the role of 17P-hydroxysteroid dehydrogenases in estrogen action, as discussed by R. Vihko and colleagues. D. M. Stocco then provides a review of the steroidogenic acute regulatory (StAR) protein. Finally, the laboratory of G. Stein ably provides a review of the topic of vitamin D and steroid hormone control of the osteocalcin gene. This volume, then, provides an important update on steroid hormone action and related areas. Academic Press continues to be helpful in the preparation of these books. Subsequent volumes will deal with widely variable subject matter, consistent with the expanded scope of this serial publication. GERALD LITWACK
xi
This Page Intentionally Left Blank
VITAMINS AND HORMONES, VOL. 55
G-Protein-Coupled, Extracellular Ca2+-SensingReceptor: A Versatile Regulator of Diverse Cellular Functions EDWARD M. BROWN,* PETER M. VASSILEV," STEPHEN QUINN,* AND STEVEN C. HEBERTT *Endocrine-HypertensionDivision, Department of Medicine Brigham and Women's Hospital and Harvard Medical School Boston, Massachusetts 02115, and ?Renal Division, Department of Medicine Vanderbilt University Medical Center Nashville, Tknnessee 37201
I. Introduction: CaE+-Sensingand the Maintenance of Mineral Ion Homeostasis 11. Indirect Evidence That Parathyroid and Other Cells Sense Caz+ via a G-ProteinCoupled CaR 111. Isolation of a Bovine Parathyroid CaR by Expression Cloning in Xenopus laevis Oocytes Tv. Structural Similarity of the CaR to Other GPCRS V. Are There Other Ca:+ Sensors? VI. Signal "ransduction Pathways Employed by the CaR VII. The CaR Gene and Regulation of CaR Expression VIII. Structure-Function Relationships of the CaR M. The CaRs Tissue Distribution and Functions in Tissues Involved in Mineral Ion Homeostasis A. Parathyroid B. C Cells C. Kidney D. Bone E. Intestine F. Placenta X. Human Diseases Resulting from CaR Mutations Clarify the Receptor's Physiological Roles A. Familial Hypocalciuric Hypercalcemia B. Neonatal Severe Hyperparathyroidism C. Mouse Models of FHH and NSHPT D. Human Forms of Hypocalcemia Due to Activating CaR Mutations XI. Tissue Distribution and Functions of the CaR in Tissues Uninvolved in Systemic Ion Homeostasis A. Spatial Heterogeneity of Cat+ and Local Ca? Homeostasis B. Microenvironments with Varying Levels of Cat+ C. Possible Roles of the CaR in Local Homeostasis D. CaR in Tissues Uninvolved in Systemic C a p Homeostasis XII. CaR-Based Therapeutics XIII. Summary References
1
Copyright 0 1999 by Academic Press. All rights of reproduction in any form reserved. 0083-6729/99 $25.00
2
EDWARD M. BROWN et al.
I. INTRODUCTION: CaF-SENSINGAND THE MAINTENANCE OF MINERAL IONHOMEOSTASIS Calcium ions play crucial roles in multiple intra- and extracellular processes (Brown, 1991; Pietrobon et at., 1990). Calcium is a key intracellular second messenger and cofactor for various proteins and enzymes, regulating functions as diverse as neurotransmission, muscular contraction, hormonal secretion, cell division, and cellular motility (Pietrobon et al., 1990).In the extracellular space, calcium is a cofactor for clotting factors, adhesion molecules, and other proteins. It also regulates neuronal excitability and is an essential component of the mineral phase of the skeleton. Bone provides both a structural framework protecting crucial bodily structures and enabling locomotion and a large reservoir of mineral ions that can be mobilized in times of need (Brown, 1991; Stewart and Broadus, 1987). In free-living terrestrial organisms, there is only intermittent availability of calcium ions from the environment in the diet (Stewart and Broadus, 1987). For this reason, tetrapods (mammals, birds, reptiles, and amphibians) possess a complex homeostatic mechanism whose principal function is to ensure near constancy of the extracellular ionized calcium concentration (Ca?') (Fig. 1)(Brown, 1991; Stewart and Broadus, 1987). This system enables great flexibility in terms of adjusting the fluxes of calcium ions between the extracellular fluid (ECF) and the environment in kidney and intestine as well as between the ECF and the mineral phase of bone. The egg-laying cycle of birds affords a particularly striking example of the capacity of this system to adjust to large alterations in the requirements of an organism for calcium ions. A laying hen deposits a quantity of calcium in each egg that is more than 10%of that present in the entire hen's skeleton. Mobilizing this amount of calcium from the diet and skeleton and then replacing the lost skeletal calcium over a matter of hours, as frequently as every day, requires that total plasma ionic calcium be turned over approximately four times every minute (Hurwitz et al., 1973). Nevertheless, in this setting the homeostatic mechanism maintains the serum ionized calcium concentration nearly invariant (Diaz et al., 1997a;Hurwitz, 1996) so as to ensure proper functioning of processes requiring constant availability of Ca:+ (e.g., hormonal secretion, cardiac contractility, etc.). The maintenance of near constancy of Ca?+in tetrapods necessitates that specific cells of the mineral ion homeostatic system detect and respond in a homeostatically appropriate manner to changes in plasma calcium concentration on the same order as its normal variability. In
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
3
FIG.1. Schematic diagram illustrating the regulatory system maintaining CaE+homeostasis. The solid arrows and lines show the effects of PTH and 1,25(OH),D,; the dotted arrows and lines demonstrate examples of how C a p or phosphate ions exert direct actions on target tissues. Abbreviations are the following: Ca2+,calcium; PO,, phosphate; ECF, extracellular fluid; PTH, parathyroid hormone; 1,25(OH),D, 1,25-dihydroxyvitamin D; 25(OH)D, 25-hydroxyvitamin D; minus signs indicate inhibitory actions, while plus signs show positive effects. (Reproduced with permission from Brown et al., 1994. Copyright 0 1994 Williams and Wilkins.)
normal humans, the coefficient of variation of the serum ionized calcium concentration is 2% or less, only slightly greater than the precision of the ion-sensitive electrodes used to measure it (Parfitt, 1987; Parfitt and Kleerekoper, 1980).Therefore, there must be cells capable of sensing changes in CaE+ of this magnitude. This article limits the term Ca:+-sensing to actions of Ca:+ occurring within or close to the level of extracellular calcium to which a given cell is normally exposed. In some instances, especially for epithelial cells, as discussed in more detail in Section XI,B, there can be large differences in the levels of Ca:+ in the ECF to which the opposite sides of a given cell are exposed (Brown, 1991).For example, the concentration of total Ca:+ in the prostatic secretions is about 30 mM (Valtin, 19831, while the level of ionized calcium on the side of prostatic cells facing the blood is probably close to that within the circulation (-1.2-1.3 mM).Alternatively, the level of CaE+ in which a cell is bathed may vary sub-
4
EDWARD M. BROWN et al.
stantially, as within the lumen of the proximal portions of the gastrointestinal tract (e.g., stomach and duodenum), depending on the availability of calcium within the diet. What are the most important cells that sense Cap? Classical examples are the parathyroid hormone (PTH)-secreting chief cells of the parathyroid gland and the calcitonin-secreting C cells of the thyroid gland, which secrete less and more, respectively, of these so-called calciotropichormones in response t o elevations in Ca:+ (Brown, 1991). Figure 2A shows the steep inverse sigmoidal relationship between circulating levels of the intact, secreted form of parathyroid hormone, PTH (1-841, and Ca:+ in normal humans (Brent et al., 1988). This curve can be described quantitatively by four parameters (Fig. 2B) (Brown, 1983): maximal secretory rate at low C a p (parameterA), maximal slope (e.g., at the midpoint) (parameter B), midpoint or set point (e.g., the level of C a p that produces half-maximal inhibition of PTH secretion) (parameter C),and minimal secretory rate at high C a r (parameter D ) . The set point is related to the normal level of Ca:+ within the ECF, although the level at which the serum ionized calcium concentration is “set” is usually slightly higher than the parathyroid set point per se. As a result, ambient PTH levels in uiuo are about 20-25% of their maximal levels at low C a r (Brent et al., 1988). The steepness of the curve relating PTH to C a p plays a key role in determining the range over which Ca:+ varies in uiuo, since it ensures that small changes in C a r engender large alterations in PTH. The latter, in turn, normalize Ca:+ through the mechanisms illustrated in Fig. 1. There is also a steep sigmoidal relationship between C a p and calcitonin (CT) secretion, although this relationship is positive with respect to C a r , rather than negative, as for PTH (Austin and Heath, 1981;Fajtova et a,?., 1991; Scherubl et al., 1993). CT can also contribute to maintaining Ca:+ within its normal limits, since this hormone exerts hypocalcemic actions, principally by inhibiting osteoclastic bone resorption and enhancing renal Ca2+excretion (Austin and Heath, 1981; Stewart and Broadus, 1987). Although CT does not contribute importantly to mineral ion homeostasis in adult humans, it does exert potent calciotropic actions in some species, such as the rat. Additional tissues involved in calcium homeostasis also sense Ca:+. For instance, the conversion by renal proximal tubular cells of 25-hydroxyvitamin D to 1,25dihydroxyvitamin D, the most active natural form of vitamin D, is directly modulated by physiologically relevant changes in Ca:+ (Weisingeret al., 1989; Brown, 1991). That this action of Ca:+ is not an indirect one, mediated by concomitant changes in circulating PTH levels, has been shown by studies in which PTH levels were “clamped” by
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
5
I -I
100.
a
EX
; IA.
0
* w
u)
SO'
4 W -I W
a I I-
n
1.03.0 2.0
0
[ Ca+ +I, m M
MlNlMUN
X
FIG.2. (A) The steep inverse sigmoidal relationship between PTH levels and C a r in uiuo. These studies were carried out by infusing EDTA or calcium in normal humans and
measuring circulating levels of intact PTH as a function of serum ionized calcium concentration, here expressed as millimolar levels. (Reproduced in modified form with permission from Brown, 1991. Copyright @ 1991 The American Physiological Society.) (B) Four-parameter model of the inverse sigmoidal relationship between extracellular CP]} + 0,where Y is the maxcalcium and PTH release based on Y = {(A - D)/[l + (X/ imal secretory rate, B is the slope of the curve at its midpoint, C is the midpoint or set point, and D is the minimal secretory rate. Reproduced with permission from E. M. Brown, Four parameter model of the sigmoidal relationship between parathyroid hormone release and extracellular calcium concentration in normal and abnormal parathyroid tissue. J.Clin. Endocrinol. Metab., 56,572-581, 1983; 0 The Endocrine Society.
infusing parathyroid hormone into parathyroidectomized rats by minipump (Weisinger et al., 1989).These animals still showed a steep inverse relationship between circulating levels of 1,25-dihydroxyvita-
6
EDWARD M. BROWN et al.
min D and Ca:+, not unlike that between PTH and Ca:+. A similar inverse function relating Ca?+ to 1,25-dihydroxyvitamin D has been observed in a boy with hypoparathyroidism (Carpenter et al., 1990). This relationship between vitamin D metabolism and C a p is physiologically appropriate. Elevating the level of 1,25-dihydroxyvitamin D during hypocalcemia produces greater absorption of dietary Ca2+ and promotes bone resorption, thereby mobilizing skeletal Ca2+ stores and restoring Ca?+ toward normal (Stewart and Broadus, 1987). Ca:+ also directly modulates the function of other elements of the mineral ion homeostatic system. Raising the peritubular but not the luminal level of Ca:+ in perfused tubules of the thick ascending limb (TAL) of Henle’s limb inhibits the reabsorption of both Ca2+and magnesium (Mg2+) ions (Quamme, 1982).This direct effect of Caz+on tubular reabsorption increases Ca2+ excretion-a homeostatically appropriate response. High CaE+also inhibits bone resorption in organ culture (Raisz and Niemann, 1969) as well as by isolated osteoclasts (Malgaroli et al., 1989; Zaidi et al., 1989). Since the level of Ca:+ beneath a resorbing osteoclast can be markedly higher than that in the systemic ECF (e.g., 8-40 mM) (Silver et al., 19881, this resorbed Ca2+could feed back to limit further osteoclast-mediated breakdown of bone. Elevated levels of Ca:+ also stimulate several aspects of osteoblast function in uitro that could promote increased bone formation in viuo and, therefore, reductions in Ca:+. These include enhancing osteoblastic proliferation (Kanatani et al., 1991; Quarles et al., 1997; Sugimoto et al., 1993) and chemotaxis (Godwin and Soltoff, 1997), increasing release of insulin-like growth factor-I1 (IGF-11) (Honda et al., 1995) and stimulating bone formation in organ culture (Raisz and Niemann, 1969).Finally, Ca?+ modulates aspects of intestinal function that may be relevant to mineral ion homeostasis. CaE+ and 1,25-dihydroxyvitamin D act together to increase duodenal levels of the intracellular calcium-binding protein, calbindin D9K, which may play a role in vitamin D-mediated absorption of dietary calcium (Brehior et al., 1989). This body of data strongly suggests that, in addition to the control of mineral ion homeostasis by the classical calciotropic hormones, PTH, CT, and 1,25-dihydroxyvitamin D, Ca?+itself can act, in effect, as a local or systemic calciotropic “hormone” (Fig. 3). This hormone-like role of Caz+ could modulate the function of many cells and tissues involved in mineral ion metabolism via changes in the local or systemic levels of Gag+ arising from the Ca2+-translocatingactions of these tissues. Although the effects of Ca:+ on the cellular functions described earlier could contribute to maintaining extracellular calcium homeostasis (e.g., as indicated in Figs. 1and 3), Gag+ also modulates the function of
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
7
SYSTEMIC CONTROL OF HORMONAL SECRETION
1 PTH
CONTROL OF HORMONE ACTION
LOCAL PARACRINE
AUTOCRINE
FIG.3. Schematic diagram illustrating the manner in which changes in C a p modulate the function of selected cells involved in mineral ion homeostasis. See text for details.
various other cell types seemingly uninvolved in mineral ion metabolism. Many studies on the effects of Ca2+on various cellular functions have attempted to determine the involvement of the cytosolic calcium concentration (Cay+)in these processes by totally removing extracellular Ca2+.In some cases, however, these studies have documented substantial alterations in cellular function over a range of C a p close to or within physiologically relevant levels. Elevating CaE+,for example, inhibits cyclic AMP (CAMP)accumulation (Siege1 and Daly, 1985) and modulates agonist-evoked phospholipase 4 activity (Matsuoka et al., 1989)in platelets. Raising CaE+ also promotes the differentiation of sev-
8
EDWARD M. BROWN et al.
era1 types of epithelial cells in culture, including keratinocytes (Bikle et al., 1996;Hennings et al., 1980),mammary cells (McGrath and Soule, 1984), urothelial cells of the bladder (Southgate et al., 19941, and intestinal epithelial cells (Black and Smith, 1989; Buset et al., 1986; for review, see Brown, 1991). C a p likewise modulates the function of the testosterone-producing, testicular leydig cells, including the secretion of parathyroid hormone-related peptide (PTHrP) from the malignant Leydig cell line H-500 (Rizzoli and Bonjour, 1989). The physiological relevance of these diverse actions of Ca:+ are uncertain, but they suggest that C a p could exert more generalized effects on various cells, extending well beyond those involved solely in maintaining mineral ion homeostasis. How do these various cells sense Cap? For many years, the mechanisms(s) underlying Ca:+-sensing was obscure. Only since about 1993, have studies elucidated the molecular nature of one such Ca:+-sensora Ca:+-sensing receptor (CaR) initially cloned from bovine parathyroid gland that belongs to the large superfamily of guanine nucleotide regulatory (GI-protein-coupled receptors (GPCRs) (Brown et al., 1993). This discovery has enabled rapid elucidation of the CaRs role in Ca:+sensing by parathyroid and several other cell types, both those involved and those uninvolved in mineral ion metabolism (Chattopadhyay et al., 1996b;Chattopadhyay and Brown, 1997).This article describes the isolation of the CaR and related progress in this area, including the receptor’s predicted structure and the second messenger pathways to which it couples, its tissue distribution and known functions, and the data for its physiological importance that have been afforded by the creation of CaR-deficient mice and the discovery of inherited human diseases of Ca:+ homeostasis resulting from CaR mutations. 11. INDIRECT EVIDENCE THATPARATHYROID AND OTHERCELLS SENSE Ca? VIAA G-PROTEIN-COUPLED CaR
The initial evidence for the presence of a G-protein-coupledCaR came from studies in bovine parathyroid cells examining the actions of Caz+, the physiological agonist for the putative CaR, on intracellular second messengers. The Caz+-inducedchanges in these intracellular signaling pathways closely resemble those caused by known GPCRs, particularly the so-called “calcium-mobilizing”receptors (Brown, 1991;Juhlin et al., 1990; Nemeth and Scarpa, 1986; Shoback et al., 1988).A key observation was that the putative Cap-sensing receptor stimulated release of Ca2+from its intracellular stores (Nemeth and Scarpa, 1986,
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
9
1987). This action suggested that the CaR evoked a second-messengerdependent mobilization of intracellular calcium, most likely via inosito1 1,4,5-trisphosphate (IPJ, a product of the receptor-mediated activation of the phospholipase C (PLC). In fact, subsequent studies showed that high CaE+(Brown et al., 1987) and other CaR agonists [e.g., other divalent cations (MgE+,Ba?+, and Sr?+)(Brown et al., 1990; Shoback et al., 19881, trivalent cations (La:+ and Gd:+) (Brown et al., 19901, and even organic polycations (spermine or neomycin)l (Brown et al., 1991; Ridefelt et al., 1992) activated PLC, thereby generating its immediate products, diacylglycerol and IP, (Kifor and Brown, 1988; Kifor et al., 1992). 111. ISOLATION OF A BOVINEP A R A T ~ O CaR I D BY EXPRESSION CLONING IN Xenopus laevis OOCYTES Expression cloning in Xenopus laevis oocytes has afforded an effective means for the cloning of Ca2+-mobilizingGPCRs for which no molecular probes (e.g., oligonucleotides complementary to its cDNA or antibodies) were available. Injection of X . laeuis oocytes with poly(A)+ RNA [which is enriched in messenger RNA(mRNA)lisolated from a tissue expressing the receptor in question directs synthesis of that receptor via the oocyte's protein biosynthetic machinery. The resultant receptor protein couples to the oocyte's endogenous G proteids) and PLC. Subsequent exposure of the mRNA-injected oocytes to that receptor's agonists produces G-protein-dependent activation of PLC and an ensuing rise in Ca:+(Dascal, 1987). Since the oocytes also contain a large conductance chloride channel activated by increases in Cap+(Dascal, 19871, agonist-evoked, Caf' -dependent increases in C1 current are a sensitive parameter of the receptor's presence that can be followed during the expression cloning process. In a similar manner, Brown et al. (1993) injected X. laeuis oocytes with poly(A)+RNA isolated from bovine parathyroid glands; the oocytes then acquired CaR agonist (e.g., Gd:+)-evoked increases in PLC activity and Ca2+-activated chloride currents. Size fractionation of the poly(A)+RNA yielded fractions of 4-6 kilobases (kb) in size that conferred substantially larger GD:+-evoked Cl- currents following their injection into oocytes. A cDNA library constructed from the most active RNA fractions was screened by injecting additional oocytes with synthetic messenger RNA prepared from the cDNA inserts of pools of -600 independent cDNA clones. The screening of progressively smaller pools of clones that were positive for Gd:+-evoked C1- currents led to even-
10
EDWARD M. BROWN et al.
tual isolation of a single 5.3-kb clone exhibiting agonist-evoked activation of chloride currents with a potency series essentially identical to that for activation of the putative CaE+-sensing receptor in bovine parathyroid cells (Brown et al., 1993). The cloned receptor was called BoPCaR (Bovine Parathyroid Ca:+-Sensing Receptor). The amino acid sequence of BoPCaR predicted from the nucleotide sequence of its cloned cDNA revealed a very large (-600 amino acids) amino (NH,)-terrninal extracellular domain (ECD), a central core of some 250 amino acids with seven predicted transmembrane domains (TMDs)characteristic of GPCRs and an intracellular carboxyl (C)-terminal tail of -200 amino acids (Brown et al., 1993) (e.g., Fig. 4). As might have been expected given the millimolar concentrations of CaE+ within the ECF, there are no high affinity Ca2+binding sites within the receptor's ECD and extracellular loops (ECLs) that might have participated in the binding of C a g . Instead, the CaRs ECD and second extracellular loop (ECL2) contain clusters of negatively charged amino acids (i.e., aspartate and glutamate) that might represent sites for the sensing of Ca:+ and other polycationic agonists. Similar clusters of acidic residues are thought to bind Ca2+in other low-affinity Ca2+-binding proteins (i.e., calsequestrin and calreticulin) (Fliegel et al., 1987). These clusters of negatively charged amino acids could also provide for the highly cooperative control of PTH secretion by CaE+ (Brown, 1983, 1991), presumably through allosteric interactions involving the binding of several Ca2+ions to distinct regions on the receptor. Indeed, the Hill coefficient for the recombinant CaR expressed in mammalian cells is 3-4 (Bai et al., 19961, as compared with the value of unity for the interaction of a ligand with a single, noncooperativebinding site. The ECD of the CaR also contains multiple N-linked glycosylation sites (Brown et al., 1993; Fan et al., 1997), while its intracellular domains [three intracellular loops (ICLs) and C-terminal tail] harbor several predicted consensus protein kinase C (PKC) and protein kinase A (PKA)phosphorylation sites (Brown et al., 1993; Chattopadhyay and Brown, 1997). The cloning of BoPCaR made it feasible to employ nucleic-acid-hybridization-based techniques to search for additional Ca:+-sensing receptors [called CaRs in this article; in some cases, the alternative desFIG.4. Schematic representation of the predicted topological structure of the C a d cloned from human parathyroid gland. Abbreviations include: SP = signal peptide; HS = hydrophobic segment. Also delineated are missense and nonsense mutations causing either familial hypocalciuric hypercalcemia or autosomal dominant hypocalcemia. These are indicated using the three-letter amino acid code, with the normal amino acid indicated before and the mutated amino acid shown after the numbers ofthe relevant codons. (Reproduced with permission from Brown et al., 1997).
X Inactivating lk Activating
S
Pro39Ala SarS3Pro
A.nll8Lym
Prollhu
Qlu127Ala
Arg6aC.t
Phm128L.u ThrllUCt GlU 191LyD
Arg66Cys Tbrl3R(rt
AlallCThr
clyl43Glu Oln245Arp A.nl78A.p Phr612S.r ArglBSGln QlnCBlRim hp2llGly Ph.806S.r -2 18Sir Pro221S.r -227-u (Gln) ClU297LY. Cym582~yr Sir607Stop Smr657Tyr Gly67OArg
A ~ ~ ~ B O C ~ S Pro747r-ahift P X - O ~ ~ B A ~ ~ Arg795Trp VB1817Ilr Thr876hlu
0 Consewed
A
Acidic
0 PKC site
L HOO
Z
12
EDWARD M. BROWN et al.
ignation CaSR (Janicic et al., 1995~) has been employed, while the abbreviation CaS, for calcium sensor, has sometimes been used to describe another putative Ca:+-sensing protein with an entirely distinct structure (Lundgren et al., 1994)-see Section Vl. Full-length CaRs have subsequently been cloned from human (Garrett et al., 1995a)and chicken parathyroid (Diaz et al., 1997); rat (Riccardi et al., 19951, human (Ada et aZ., 1995b), and rabbit kidney (Butters et al., 1997); and rat C cells (Garrett et al., 1995~) and striatum of rat brain (Ruat et al., 1995). All are highly homologous 0 9 0 % identical in their amino acid sequences to BoPCaR in the case of the vertebrate CaRs) and represent species and tissue homologs of the same ancestral gene. An extensive search, however, has not yet uncovered additional CaR isoforms arising from distinct genes. IV. STRUCTURAL SIMILARITY OF THE CaR TO OTHERGPCRs The deduced amino acid sequence of the extracellular Ca2+-sensing receptor contains the canonical seven-membrane-spanning domain found in all GPCRs [see Fig. 4 (Bockaert, 1991; Jackson, 199111. According to the evolutionary tree generated from the database for GPCRs [GCRD; http://www.uthscsa.edu (Kolakowski, 199411, the CaR belongs to family C (Fig. 5). Family C GPCRs are defined as sharing 220% amino acid identity over their seven-membrane-spanning region (Kolakowski, 1994). The family contains three groups of receptors. Group I consists of the metabotropic glutamate receptors, mGluRs 1-8, which are receptors for the excitatory neurotransmitter, glutamate, that are widely expressed in the central nervous system (CNS) (Nakanishi, 1994). In contrast to the ionotropic glutamate receptors (iGluRs) [i.e., the N-methybaspartate (NMDA) receptor], which are ion channels containing an agonist binding site within the same channel molecule, the mGluRs are GPCRs. Group I1 contains two members, the CaR and a recently discovered, multigene subfamily of putative pheromone receptors, VRs or GoVNs (Matsunami and Buck, 1997;Ryba and Trindell, 1997). The latter are found exclusively in Galphao-expressing neurons of the vomeronasal organ (VNO) of the rat, a small sensory organ thought to be involved in regulating instinctual behavior via input from pheromones within the environment (Matsunami and Buck, 1997). Group I11 contains a receptor, the GABA, receptor, for the inhibitory neurotransmitter, y-aminobutyric acid (GABA) (Kaupmann et aZ., 1997).As with the glutamate receptors, there are both ionotropic (e.g.,
G-PROTEIN-COUPLED, EXTRACELLULAR CaZ+-SENSINGRECEPTOR VR4 VR5 VR14 GoVN2 GOVN7 GoVN4 GOVN3 VRI vR2 VR3
13
t
Group II
t
1
Group I
[ GABA-B GABA-0 l1a b LIV-BP
3Group Ill
FIG.5. “Tree” diagram illustrating the degrees of homology and proposed evolutionary relatedness of the members of the family C GPCRs. The farther to the lefl that a given receptor branches off, the less related it is to the other receptors. For details see text.
ligand-gated receptor channels activated by GABA) and G-protein-coupled GABA receptors. The extracellular ligand-binding domains of the family C GPCRs appear to be structurally similar to those of the bacterial periplasmic binding proteins (PBPs) (Conklin and Bourne, 1994; Oh et al., 1993). Although initial support for this similarity was based on molecular modeling (O’Hara et al., 1993; Tam and Saier, 1993) using the known clawlike tertiary structure of the PBPs (Oh et al., 19931, the identified sequence homology between the ECD of the GABA, receptors and the LIV (leucine-isoleucine-valine)bacterial nutrient-binding protein (Kaupmann et al., 1997) has added strong support for an evolutionary link between members of the family C GPCRs and the bacterial periplasmic, nutrient-binding proteins. The bacterial PBPs comprise at least eight families that recognize a broad range of extracellular solutes for cellular uptake, including organic nutrients as well as inorganic ions, such as phosphate and nickel (Sharff et al., 1992; Tam and Saier, 1993). In addition, some PBPs
14
EDWARD M. BROWN et al.
function in chemoreception or sensory transduction (Sharff et al., 1992; Tam and Saier, 1993). In their capacities as cell surface receptors involved in chemoreception, sensory transduction, and transport functions, the soluble PBPs interact with integral membrane proteins in the bacterial cell membrane followingtheir binding of specific chemofactors or nutrients to transmit the signal or transport the nutrient. Thus it seems likely that the family C GPCRs, including the CaR, evolved from the fusion of an ancient family of solute-binding proteins to transmembrane proteins with the seven-membrane-spanning, “serpentine” motif that evolved separately to transmit extracellular signals to the interior of eukaryotic cells in the GPCRs.
V. ARETHEREOTHERCa:+ SENSORS? It is likely that there are Ca:+ receptors or sensors in addition to the CaR that mediate the substantial number of actions of Ca:+ on various cell types. The availability of the cloned CaR has enabled determination in several cases of which of these diverse cell types express the CaR, as described in more detail later. For example, the stimulatory effect of C a p on CT secretion and many of the actions of Ca? on the kidney are likely CaR mediated. The presence of the CaR in a cell whose function is modulated by CaE+does not prove, however, the involvement of the CaR in mediating that action of CaE+. The availability of mice with targeted disruption of the CaR gene (see Section X,C) (Ho et al., 1995) and the discovery of human diseases caused by CaR mutations (see Sections X,A, X,B, and X,D) (Chattopadhyay et al., 1996b) will ultimately be very useful in assessing this receptor’s role in Cap-induced changes in various cellular functions. Furthermore, there are many cell types whose functions are modulated by Ca? but that do not, in fact, express the CaR or have not yet been examined for its expression. In the former case, the actions of Ca:+ are presumably mediated by one or more additional CaE+receptors or sensors whose presence has been inferred on the basis of the evidence discussed later. Monoclonal antibodies directed at a large protein expressed at high levels in parathyroid, proximal tubular, and placental cells modulates the Cap-sensing functions of these cells (Juhlin et al., 1990). For example, these antibodies block the inhibition of PTH secretion from human parathyroid cells by Ca:+ (Juhlin et aZ., 1987). Furthermore, this putative CaE+-sensingprotein is expressed at markedly reduced levels in pathological parathyroid glands from patients with various forms of hyperparathyroidism (HPT) (Juhlin et al., 1988).In HPT, the abnormal
G-PROTEIN-COUPLED, EXTRACELLULAR CaZ+-SENSINGRECEPTOR
15
cells are often less sensitive than normal t o the suppressive actions of Ca: on PTH release (Brown, 1983;Habener, 1978;Nygren et al., 1988), providing indirect evidence that this receptor mediates or is at least closely linked to the CaE+-sensingfunction in parathyroid cells. cDNAs encoding the putative Ca:+ sensor recognized by these antibodies, which is a member of the low-density lipoprotein (LDL) receptor superfamily, have been isolated from human (Hjalm et al., 1996; Lundgren et al., 1994) and rat cDNA libraries (Saito et al., 1994). They encode a very large, -500-kDa protein, called either gp330 or megalin. The large size of this protein has so far frustrated attempts to express its full-length cDNA, but future studies should clarify its role in CaE+sensing and whether it interacts with the CaR in tissues expressing both proteins (e.g., parathyroid, proximal tubule, and placenta). A well-studied example of another CaE+-sensingcell that appears t o express a Ca:+-sensing mechanism distinct from the CaR is the osteoclast. Several groups first reported in 1989 that raising Ca:+ had direct effects on isolated osteoclasts in uitro-inhibiting bone resorption and promoting elevations in Ca:+-reminiscent of those in parathyroid cells (Malgaroli et al., 1989; Zaidi et al., 1989).Although it is not yet known whether this mechanism functions in a physiologically relevant manner in uiuo, it could represent a CaF-sensing system through which the osteoclast monitors and regulates its own resorptive activity. Subsequent studies, primarily by Zaidi and coworkers, have clarified several features of Ca:+-sensing by osteoclasts, although molecular characterization of the sensor and/or receptor has not yet been achieved. Raising Ca:+ causes marked retraction of osteoclasts, reduced expression of podosomes (which anchor the osteoclast t o the underlying bone), and inhibition of the release of hydrolytic enzymes and bone resorption in uitro (Malgaroli et al., 1989; Zaidi et al., 1991).The Ca:+-induced changes in Caf+ are likely an important mediator of the accompanying changes in cellular function, as the calcium ionophore, ionomycin, produces many of the same effects. Not all osteoclasts, however, express this Ca:+-sensing mechanism. Osteoclasts freshly isolated from medullary bone of Japanese quail, for instance, do not respond to Ca:+, but culturing these cells for 5-8 days confers upon them the ability to sense Ca:+ in a manner similar to that of chick or rat osteoclasts (Bascal et al., 1994). A variety of polyvalent cations mimic the actions of Ca;+ on the osteoclast, but their pharmacological profile in this cell type differs distinctly from that in parathyroid and other CaR-expressing cells. In general, the activation of the CaR in parathyroid cells by Ca,: Mg:+, and Ba:+ occur at several-fold lower concentrations than those modulating
16
EDWARD M. BROWN et al.
the function of osteoclasts (Brown et al., 1990; Shoback et al., 1988;Zaidi et al., 1991).The lower affinity of the osteoclast Cap-sensing mechanism may be physiologically appropriate for this cell type, since CaE+ directly measured beneath resorbing osteoclasts can be as high as 40 mM (Silveret al., 1988).Additional polyvalent cations activating the osteoclast’s Ca:+-sensing mechanism include Ni:+, C d r (which doesn’t activate the CaR) (Shankar et al., 1992b),and La:+ (which does stimulate the CaR) (Shankar et al., 1992a). The CaF-sensing receptor in the osteoclast may be related to the ryanodine receptor (Zaidi et al., 19951, since agents [e.g., ryanodine (Zaidi et al., 1992) or caffeine (Shankar et al., 1995)1that interact with the ryanodine receptor [which mediates high Cap-induced release of Ca2+from intracellular stores (e.g., in skeletal muscle)]modulate C a r sensing by osteoclasts. In addition, osteoclasts bind [3H1-ryanodine, which is displaced by CaE+as well as by the ryanodine receptor antagonist, ruthenium red (Zaidi et al., 1995).Finally, an antibody recognizing an epitope within the channel-formingdomain of the ryanodine receptor potentiates the actions of N i r and labels the plasma membrane of nonpermeabilized osteoclasts, while an antibody directed at an intracellular epitope does not (Zaidi et al., 1995). These results suggest that a ryanodine-like Ca:+ sensor is present on the plasma membrane of the osteoclast (unlike the location of the ryanodine receptor in other cells where it is located intracellularly) that acts as a C a r sensor or in close association with another Cap-sensing molecule. Cloning of this putative C a p sensor and characterization of its structure and function(s) by expression in heterologous cells would be of substantial interest. Raising Ca? has several actions on cells of the osteoblast lineage. C a r stimulates the formation of bone in bone explants (Raisz and Niemann, 1969). In addition, C a p and other polycations [e.g., strontium (Canalis et al., 199611 stimulate the proliferation (Godwin and Soltoff, 1997; Quarles et al., 1997; Sugimoto et al., 1993) and/or chemotaxis (Godwin and Soltoff, 1997) of osteoblast-like cells and increase the release of insulin-like growth factor-I1 from osteoblasts (Honda et al., 1995).High Ca:+ also modulates intracellular second messengers in the murine osteoblastic cell line, MC3T3-El. High Ca:+ elevates diacylglycerol (Hartle et al., 1994) and CAMPlevels (Hartle et al., 1996) in these cells, without, however, producing the increases in inositol phosphates that would have been expected from activation of phosphoinositide-specific PLC. Quarles and coworkers (1997) failed to detect transcripts for the CaR by reverse-transcription-based polymerase chain reaction (RT-PCR)and Northern blot analysis and suggested that a dis-
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
17
tinct Ca:+-sensing receptor mediated the actions of Ca:+ on osteoblasts. In preliminary studies, they have also reported amplifying a PCR product from osteoblasts using degenerate primers based on the CaRs sequence, which was related to but distinct from the CaR (Quarles, 1997). To date, however, they have not reported the cloning of a full-length cDNA for this presumably novel form of Cap-sensing receptor. Moreover, we found that MC3T3-El cells obtained from their original source in Japan express both CaR transcripts and protein as assessed by RTPCR, Northern blot analysis, Western blot analysis, and immunocytochemistry (Yamaguchi et al., 1998a). Clearly, additional studies of the mechanism(s) underlying CaE+-sensingby osteoblasts are warranted. VI. SIGNAL TRANSDUCTION PATHWAYS EMPLOYED BY THE CaR The CaR stably transfected into human embryonic kidney (HEK293) cells activates phospholipases C, 4,and D, whereas CaR agonists have no effects on these phospholipases in nontransfected HEK cells (Kifor et al., 1997). Moreover, CaR agonists stimulate the same three phospholipases in bovine parathyroid cells, presumably via the CaR, since high Caz+ no longer exerts these effects in cultured parathyroid cells, in which the level of CaR expression decreases dramatically after 3-4 days in culture (Kifor et al., 1997). CaR-mediated activation of PLC in parathyroid and CaR-transfected HEK cells appears to be a direct, Gprotein-mediated process, probably involving G,,,, in this and in most other mammalian cells, since this effect is not blocked by pertussis toxin. In X . laeuis oocytes expressing the CaR, however, petussis toxin markedly attenuates the high Ca:+-elicited increase in IP, (Brown et al., 1993). Therefore, the CaR apparently activates PLC in the oocyte through a pertussis-toxin-sensitiveG protein. The specificity for G-protein-couplingof various other GPCRs can also differ when expressed in X . Zaeuis oocytes from that observed in their native cells (Moriarty et al., 1989). Activation of phospholipaseA, (PLAJ and phospholipase D (PLD)by high Ca?+,in contrast, are probably indirect, utilizing CaR-mediated, PLC-dependent activation of protein kinase C (Kifor et aZ., 1997), since down-regulation or inhibition of PKC largely abrogates CaR-mediated activation of PLD and/or P&. The high CaF-evoked, transient increase in Caf' in parathyroid cells likely results from IP,-mediated release of Ca2+from intracellular stores. High cap also evokes a sustained rise in C a p in both parathyroid cells and CaR-transfected
18
EDWARD M. BROWN et al.
HEK293 cells through an unknown influx pathway(s) for Ca:+. The CaR increases the open state probability of a Ca2+-permeable,nonselective cation channel (NCC) in CaR-transfected HEK cells studied using the patch-clamp technique (Ye et al., 1996b).Activation of a similar NCC in bovine parathyroid cells by high Ca:+, presumably by a CaRmediated mechanism, may contribute to the high Ca:+-evoked, sustained increase in CaB+in this cell type (Changet al., 1995). In the CaRexpressing C-cell line rMTC44-2 (Fajtova et al., 1991), as well as in AtT-20 cells, in contrast, voltage-gated Ca2+ channels are the major source of the high Ca:+-elicited increases in Caf+ that likely mediate stimulation of CT and adrenocorticotropin (ACTH) secretion. The CaR confers high Ca:+-induced inhibition of CAMPaccumulation when expressed in HEK293 cells stably transfected with the CaR (Rogers et al., 1995b).The similar, high Ca:+-evoked inhibition of CAMP accumulation in bovine parathyroid cells is pertussis-toxin-sensitive (Chen et al., 1989), suggesting that the CaR inhibits adenylate cyclase via one or more isoforms of the inhibitory G protein, Gi. Studies using tubules isolated from the medullary thick ascending limb of the kidney, however, have suggested that high Ca:+-induced inhibition of agoniststimulated cAMP accumulation (Takaichi and Kurokawa, 1988)can occur through an indirect mechanism involving arachidonic acid (Firsov et al., 1995). That is, addition of arachidonic acid to tubule suspensions produced a pertussis-toxin-sensitive reduction in cAMP accumulation (Firsov et al., 1995). Thus additional studies are needed to determine whether the lowering of CAMP by Ca:+ in other cells expressing the CaR entails a similar mechanism or whether the CaR can directly inhibit adenylate cyclase via Gi. High Ca:+ exerts numerous additional actions on parathyroid cells, including inhibition of the expression of the PTH gene, modulation of K+channels (Conigrave et al., 1993;Kanazirska et al., 1995;Lopez-Barneo and Armstrong, 1983), stimulation of the hexose monophosphate shunt, and, perhaps, inhibition of parathyroid cellular proliferation (for review, see Brown, 1991). Additional studies are needed to determine which of these diverse actions of Ca:+ are CaR mediated and to identify the signal transduction pathways underlying them. VII. THECaR GENEAND REGULATION OF CaR EXPRESSION
The human CaR gene contains at least seven exons (Pearce et al., 1995). Six encode the receptor's large N-terminal ECD and/or its upstream untranslated regions, whereas a single exon codes for the receptors TMDs and C terminus. The regulatory regions of the gene have
G-PROTEIN-COUPLED, EXTRACELLULAR CaZ+-SENSINGRECEPTOR
19
not yet been characterized but will be of substantial interest, since expression of the CaR can change under several circumstancesin viuo and in uitro. Cultured calf parathyroid cells exhibit a rapid (within hours) and marked (up to 80-85%) reduction in CaR mRNA and protein (Brown et al., 1995; Mithal et al., 1995). This reduction in CaR expression probably contributes in a major way to the accompanyingdecrease in high CaF-evoked inhibition of PTH release. There is also reduced expression of the CaR in experimentally induced chronic renal insufficiency in the rat (Mathias et al., 19971, which might contribute to the associated reduction in urinary Ca2+excretion in this setting, given the inverse relationship between CaR activity and renal excretion of Ca2+ (see sections 1X.C. and X.A.) (Chattopadhyay et al., 1996b; Hebert et al., 1997). Since, as described later, 1,25-dihydroxyvitamin D can upregulate renal expression of the CaR gene (Brown et al., 19961, the decrease in CaR gene expression with impaired renal function might result, in part, from the concomitant reduction in 1,25-dihydroxyvitamin D levels that occurs with renal insufficiency (Stewart and Broadus, 1987).Alternatively, the increase in circulating PTH levels with chronic renal failure (Stewart and Broadus, 1987) might also contribute t o the reduced CaR gene expression-a possibility yet to be investigated directly. There is a substantial developmental increase in CaR expression in both rat kidney (Chattopadhyay et al., 1996a)and hippocampus (Chattopadhyay et al., 1997a).The up-regulation of the CaR in the kidney occurs in the immediate peri- and postnatal period, and the ensuing higher level of CaR expression persists through adulthood (Chattopadhyay et al., 1996a).In contrast, the increase in the expression of the CaR in brain takes place about a week postnatally and is transient, decreasing several-fold about 2 weeks later to a lower level that is stable into adulthood (Chattopadhyay et al., 1997a). The factors controlling these changes in expression of the CaR gene, including the relative importance of alterations in gene transcription vs posttranscriptional mechanisms, have not been investigated. Studies on the control of the CaRs expression by hormonal and other factors are also at an early stage. Treatment of rats with 1,25(OH),D in uiuo produces a modest rise in the level of CaR mRNA in parathyroid and kidney in one (Brownet al., 1996)but not in another study (Rogers et al., 1995c),whereas chronic reductions or elevations in serum calcium concentration had no effect on CaR mRNA levels in the parathyroid in either of these studies. In contrast, raising the level of Caz+caused an approximately 2-fold increase in CaR mRNA in AtT-20 cells (Emanuel et al., 1996).The physiological relevance of this action of Caz+ on CaR expression is not known, but it raises the possibility that the
20
EDWARD M. BROWN et al
control of the receptor’s expression in tissues involved in Ca:+ homeostasis, such as the parathyroid, might differ from that in tissues (e.g., the brain) uninvolved in mineral ion metabolism. In addition to the actions of 1,25(OH), vitamin D and Caz+on CaR expression, the cytokine IL-1p modestly up-regulates the level of CaR mRNA in bovine parathyroid gland fragments (Nielsen et al., 1997). VIII. STRUCTURE-FUNCTION RELATIONSHIPS OF THE CaR Although detailed information on the structure-function relationships of the CaR are not yet available, several preliminary studies have begun to address the structural basis for the receptor’s biological functions. Hammerland et al. (1995) examined the role of the CaR’s ECD in the binding of polycationic ligands by swapping the ECDs between the CaR and mGluR1. The chimeric receptor with the mGluRl ECD and the remainder of the receptor from the CaR (MGluR1-CaR)was activated by glutamate but not by Ca:+ or other polycationic ligands. Conversely, the chimeric receptor with the CaR’s ECD and the MGluRs TMDs, ECLs, ICLs, and C-terminal tail (CaR-mGluR)was activated by polycationic CaR ligands but not by glutamate (Hammerland et al., 1995). Of interest, in a CaR construct lacking the entire ECD (Hammerland et al., 1995), Ca;+ had no effect on the receptor, but there was still some stimulation by Gdz+.This latter observation suggests that binding determinants for Gd:+ that are sufficient for activating the CaR might reside within the receptor’s ECLs or TMDs. One possible candidate for such an additional binding site is the highly acidic ELEDE (single letter amino acid code for glutamate-leucine-glutamate-aspartate-glutamate) motif in ECL2 (Brown et al., 19931, although this has not been directly investigated by mutational analysis. In contrast, the considerably more hydrophobic “calcimimetic” CaR activators currently in trials for treatment of primary and secondary HPT (e.g., NPS R-568) interact within the CaRs TMDs (Hammerland et al., 1996). That is, R-568 potentiates the activation of the wild-type CaR by Caf+ and of the mGluR-CaR chimera by glutamate but not of the CaR-mGluR chimera by Ca;+. Activators of PKC, such as phorbol myristate acetate (PMA), substantially blunt the high Ca;+-elicited increases in inositol phosphates and CaiJ+in bovine parathyroid cells (Kifor et al., 1990; Membreno et al., 1989; Nygren et al., 1988; Racke and Nemeth, 1993). The presence of predicted PKC phosphorylation sites within the CaRs intracellular domains suggests that PKC may modulate the receptor’s function by phorphorylating one or more of these sites (Chattopadhyay and Brown, 1997).PKC could also, of course, exert additional effects on the PLC/IP,
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
21
pathway by phosphorylating G protein(s), PLC, or other elements within this signal transduction pathway. We (Bai et al., 1998) have investigated the role of these predicted PKC phosphorylation sites within the CaR's intracellular domains in preliminary studies (one each in ICLB and ICL3 and three within the C-terminal tail for the human CaR). For the human receptor, deletion of the two PKC sites within the ICLs has little or no impact on the modulation of high Ca2'-elicited increases in Cap+ by PMA in HEK cells transiently transfected with the mutant CaRs. In contrast, deletion of the PKC site at residue 888 within the CaRs C-terminal tail substantially resuces the effect of PMA. Removal of the two additional PMC sites within the tail have relatively little impact by themselves but produce a modest further reduction in the effect of PMA on high CaE+-evokedincreases in Cap'. Thus the CaRs PKC sites appear to be responsible for much of the inhibitory effect of PKC activators on CaR signaling via the PLC-IP, pathway, although the residual effect of PMA (-30% of that observed with the wildtype receptor) suggests that PKC can regulate other elements in this pathway as well. In contrast to the effect of PKC activators on the CaRs signaling, activators of CAMP-dependentprotein kinase have no apparent effect on high CaE+-elicitedelevations in the levels of inositol phosphates and C a F in bovine parathyroid cells (Brown, 1991). There have, however, been no studies t o date on the impact of PKA on the expressed, recombinant CaR. Shoback and coworkers have reported preliminary studies on the importance of various residues within the CaRs intracellular domains on its activation of downstream signaling (Chang et al., 1997). The phenylalanine at residue 707 (phe707) within ICLB appears critical for activation of PLC, presumably via Gq,ll (Hawkins et al., 1989; Varrault et al., 19951, as do several residues within ICL3. Additional studies are needed t o identify precisely the residues within ICLB that are important in this regard and whether the same or different residues are important for the CaRs coupling to other effectors [e.g., inhibition of adenylate cyclase via Gi (Chen et al., 1989; Varrault et al., 1995).
IX.THECaRs TISSUEDISTRIBUTION AND FUNCTIONS IN TISSUES INVOLVED IN MINERAL IONHOMEOSTASIS A. PARATHYROID The parathyroid glands of humans (Gogusev et al., 1997; Kifor et al., 1996), rats (Autry et al., 1997), mice (Ho et al., 1995), rabbits (Butters et al., 1997), and chickens (Diaz et al., 1997) express abundant CaR
22
EDWARD M. BROWN et al.
mRNA and protein, as assessed by Northern blot analysis and immunohistochemistry or Western blot analysis, respectively. As in a number of other cell types, substantial CaR immunoreactivity can be present within the cytoplasm of parathyroid chief cells. It is presently unclear whether this immunoreactivity represents receptor in the process of being biosynthesized or might possibly indicate that the CaR has intracellular functions. For example, the concentration of Ca2+ within the endoplasmic reticulum (ER) approaches millimolar levels (Pietrobon et al., 1990). It is not known with certainty how the level of filling of the ER is monitored and controlled. Could the CaR serve some function in this regard? As noted previously, the CaR couples to activation of PLC, P L h , and PLD and probably also to inhibition of adenylate cyclase. Studies of inherited diseases of CaE+ homeostasis due to inactivating mutations of the CaR and of mice with “knockout” of the CaR gene provide strong evidence for the central role of the CaR in the control of PTH secretion by Ca:+ (see Section X for details). The intracellular mechanism(s) through which the CaR mediates the inverse control of PTH secretion, however, remains an important unresolved issue. Products of the stimulation of PLC (i.e., IPS-producing a transient increase in Ca?+and/or diacylglycerol),PLA, (e.g., arachidonic acid and/or its products), or PLD (viz., phosphatidic acid); the high Ca:+-elicited, sustained increase in Ca?+, or decrease in cellular CAMP;and/or other mediators have all been proposed as playing key roles in high CaE+-inhibitedPTH secretion (for review, see Brown, 1991). In virtually all instances, however, conditions can be found where alterations in the relevant mediators can be dissociated from concomitant changes in hormonal secretion. In fact, even the crucial step(s) in the secretory pathway regulated by the CaR remain largely unknown (that is, beginning with the budding of secretory granules at the Golgi apparatus to their eventual exocytosis at the plasma membrane). Thus, despite rapid progress in defining the molecular elements of the exocytotic apparatus in other cell types and the cloning of the CaR, we still lack any clear understanding of how parathyroid cells respond to CaE+ in a fashion opposite to that of most other secretory cells. Another feature of parathyroid function that is likely controlled by the CaR is the expression of the PTH gene. Garrett e t al. (1995b)showed in preliminary studies that the calcimimetic CaR agonist, NPS R-568, which activates the receptor at low Ca:+ by an apparently allosteric mechanism, increasing the CaRs affinity for Ca:+, decreases the level of PTH mRNA in bovine parathyroid cells. It remains to be determined whether this CaR-mediated decrease in PTH gene expression occurs at
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
23
a transcriptional and/or posttranscriptional level. The CaR may also reduce parathyroid cellular proliferation, since humans homozygous for inactivating CaR mutations or mice homozygous for targeted disruption of the CaR gene (see Sections X,B and X,C) show marked parathyroid cellular hyperplasia (Chattopadhyay et al., 199613; Ho et al., 1995). Although the receptor may inhibit parathyroid cellular proliferation directly, indirect effects are also possible. For example, severe hypocalcemia might indirectly enhance parathyroid (PT)cellular growth by decreasing the level of 1,25(OH),D (Weisingeret al., 19891,since the latter directly inhibits parathyroid cellular proliferation (Kremeret al., 1989).
B. CCELLS Studies on the regulation of CT secretion by Ca:+ initially stressed how different it was from Ca:+-regulated PT secretion (Eskert et al., 1989; Fajtova et al., 1991; Fried and Tashjian, 1986). In contrast to the latter, CT secretion is stimulated by elevating Ca:+, similar to the more classical, positive relationship between Ca2+and exocytosis in most other hormone-secreting cells (Fajtova et al., 1991; for review, see Brown, 1991). Moreover, influx of extracellular Ca2+is the principal contributor to high Ca:+-evoked increases in Caf+in C cells (Fajtova et al., 1991; Fried and Tashjian, 1986; Muff et al., 1988). In parathyroid cells, in contrast, mobilization of intracellular Ca2+contributes in a major way in this regard, particularly immediately after raising Ca? (Nemeth and Scarpa, 1987).The patterns of high Ca:+-evoked increases in Ca:+ also differ between the two cell types. Individual C cells often show oscillations in Cap+(Eskert et al., 1989; Fajtova et al., 19911, which are either much less apparent (Miki et al., 1995)or absent in single parathyroid cells (Fajtova et al., 1991).Finally, the bulk of the high Ca:+-evoked influx of C a r into C cells takes place via voltage-sensitive Ca2+channels, whereas considerable controversy exists concerning the channels through which uptake of C a r takes place in parathyroid cells (Brown, 1991;Muff et al., 1988;Pocotte et al., 1995).Most investigators assumed, therefore, that the Caz+-sensingmechanisms in parathyroid and C cells were distinctly different, perhaps involving some form of voltage-sensitive Ca2+channel in the latter. A study utilizing Northern blot analysis, in situ hybridization, and immunohistochemistry with anti-CaR antisera, however, has convincingly demonstrated that C cells express the same CaR that is present in parathyroid and kidney cells (Garrett et al., 1995~). Furthermore, a reevaluation of the characteristics of the Ca:+-sensing mechanism in C cells has underscored several similarities in its pharmacology and oth-
24
EDWARD M.BROWN et a1
er properties to those of the CaR (Zink-Lorenzet al., 1995). Not all CaR agonists in the parathyroid cell evoke CT secretion from C cells, however. For example, while raising Mg:+ inhibits PTH secretion (albeit with 2- to 3-fold lower potency than for Cap), Mg:+ has little or no effect on CT secretion from CaR-expressing sheep parafollicular cells (McGehee et al., 1997). Tamir and coworkers (1996) have proposed detailed mechanisms for the CaR-mediated regulation of CT secretion from sheep parafollicular cells by Ca:+. Using electrophysiological techniques, measurement of Cap+and the use of various pharmacological probes, these investigators provide evidence for the following sequence of events underlying CaRstimulated CT secretion in this cell type (McGehee et al., 1997). There is an initial CaR-mediated activation of phosphatidylcholine-specific PLC that provides a source of diacylglycerol (DAG)for the PKC-induced activation of a nonselective cation channel. The latter permits entry of Na+ and Ca2+into the cells, which produces cellular depolarization, activation of voltage-gated, principally L-type Ca2+channels; and the ensuing exocytosis of 5-hydroxytryptamine (5-HT)-and CT-containing secretory vesicles. The CaR may regulate other processes in C cells as well, including a pertussis-toxin-sensitive, PKC-mediated acidification of the 5-HT-containingvesicles (in contrast, the stimulation of secretion of 5-HT and CT by high C a p are pertussis-toxin-insensitive) (Tamir et al., 1996). This vesicular acidification is thought to play an important role in the loading of secretory vesicles with 5-HT and neurotransmitters or hormones. C. KIDNEY Microdissection of short segments of rat renal tubules, isolation of RNA, and subsequent reverse-transcription-based polymerase chain reaction with CaR-specific primers has enabled determination of the distribution of CaR transcripts along the nephron. Riccardi et al. (1996) showed using this approach that CaR transcripts are present along essentially the entire nephron, including glomerulus, proximal convoluted (PCT) and proximal straight tubule (PST), medullary thick ascending limb (MTAL),cortical thick ascending limb (CTAL),distal convoluted tubule (DCT), cortical collecting duct (CCD), and inner medullary collecting duct (IMCD).Inaccessible segments that could not be assessed for CaR transcripts in this study were the thin descending and ascending limbs of Henle's loop and the connecting segment between the DCT and CCD.
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
25
The available studies using immunohistochemistry with CaR-specific antisera have confirmed the localization of the CaR protein within the proximal tubule (Riccardi et al., 19981,MTAL (Riccardi et al., 1998), CTAL (Butters et al., 1997), DCT (Riccardi et al., 1998), and CCD (Riccardi et al., 1998) as well as IMCD (Butters et al., 1997; Sands et al., 1997). In proximal tubule, the CaR is localized principally, if not exclusively, at the base of the brush border on the apical membrane of the tubular epithelial cells. There is also a predominantly apical distribution of the CaR in IMCD. The receptor in CTAL is expressed at high levels on the basolateral aspect of the tubular epithelial cells. It is also expressed predominantly basolaterally in MTAL and DCT, albeit at lower levels (Riccardi et al., 1998). Within the CCD, the CaR is expressed in some, but not all, type A intercalated cells, which are involved in acid secretion and were identified on the basis of costaining with anti-H+ATPase antibodies (Riccardi et al., 1998). Knowing the location of the receptor along the nephron and the effects of CaE+ on tubular function have clarified the functional significance of renal CaRs. Additional clues in this regard are afforded by studies of the “experiments-in-nature” provided by disorders of mineral ion homeostasis caused by inactivating or activating mutations of the CaR (see Sections X,A, X,B, and X,D) (Chattopadhyay et al., 1996b). Previous studies demonstrated that raising peritubular levels of Ca? or Mg:+ reduces the tubular reabsorption of both ions in perfused TAL segments (Quamme and Dirks, 1980; Quamme, 1982). The reabsorption of Ca2+and Mg2+in CTAL takes place principally through a paracellular pathway and is driven by a lumen-positive, transepithelial potential gradient generated by the transport of sodium, potassium, and chloride ions by the apical Na+/K+/2Cl- cotransporter combined with recycling of K+ into the lumen through an apical K+channel (Fig. 6) (De RoufEgnac and Quamme, 1994;Hebert et al., 1997).PTH and other hormones increasing CAMPaccumulation (e.g., glucagon, p-adrenergic catecholamines, and calcitonin) enhance Ca2+ and Mg2+reabsorption by stimulating the overall activity of the cotransporter and, in turn, the magnitude of the lumen positive potential (De Rouffignac and Quamme, 1994; Hebert et al., 1997). Studies using the patch clamp technique have shown that high Ca:+ and neomycin (another CaR agonist) inhibit the apical K+ channel through a mechanism involving a P-450 metabolite(s) of arachidonic acid, probably 20-HETE (Fig. 6) (Wang et al., 1996).In the absence of apical recycling, luminal K+ is depleted, the activity of the cotransporter decreases and paracellular transport of Ca2+and Mg2+diminish. The reduced capacity of patients
26
EDWARD M. BROWN et al
lumen-positive voltage
FIG.6. Diagram showing schematically how the CaR may regulate intracellular second messengers and ionic transport in the renal TAL.Hormones stimulating CAMPaccumulation, such as PTH, activate the paracellular reabsorption of Ca2+and Mg2+by stimulating the activity of the Na+LK+/2Cl- cotransporter as well as an apical K+ channel and, in turn, the lumen-positive, transepithelial potential. The CaR, similarly located on the basolatera1 membrane, stimulates arachidonic acid (AA)production through direct or indirect activation of PLA, (21, which is metabolized via the P-450 pathway to an active metabolite inhibiting the apical K+ channel (4)and, perhaps, the cotransporter (3).Both actions reduce overall cotransporter activity, thereby reducing the lumen-positive potential and paracellular transport of divalent cations. The CaR probably also inhibits adenylate cyclase (1) and reduces hormone-stimulated divalent cation transport as a result. (Reproduced from Bone, 20, Brown, E. M., and Hebert, S. C., Calcium-receptor regulated parathyroid and renal function, 303-309. Copyright 1997 with permission from Elsevier Science.)
with inactivating CaR mutations to excrete Ca2+ in the urine in response to their hypercalcemia, provides indirect support for the role of the CaR in regulating renal tubular Ca2+ reabsorption (see Section X,A). In contrast, patients with activating CaR mutations show excessively high levels of urinary Ca2+ at any given level of CaE+, presumably as a result of “activated CaRs along the nephron, particularly in CTAL (see Section X,D) (Chattopadhyay et al., 1996b). Hypercalcemic patients can have abnormally reduced urinary concentrating ability and, sometimes, overt nephrogenic diabetes insipidus
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
27
(Gill and Bartter, 1961; Stewart and Broadus, 1987; Suki et al., 1969). The identification of the CaR in nephron segments involved in urinary concentration has provided new insights into how high Ca:+ regulates this parameter of renal function. Perfusion of the lumen of isolated rat IMCD tubules with high Ca:+ or neomycin, likely through activation of CaRs located on the apical membrane, reversibly diminishes vasopressin-elicited, transepithelial water flow by about 40% (Sands et al., 1997). The presence of the CaR within the same apical endosomes containing the vasopressin-regulated water channel, aquaporin-2, suggests that the CaR inhibits vasopressin-stimulated water flow in the IMCD by either enhancing the endocytosis or reducing the exocytosis of these endosomes out of or into the apical plasma membrane, respectively (Sands et al., 1997). Moreover, by producing CaR-mediated inhibition of NaCl reabsorption in MTAL (Hebert et al., 1997; Wang et al., 1996), high C a p would also reduce the magnitude of the medullary countercurrent gradient, thereby producing a further diminution in maximal urinary concentrating capacity in hypercalcemic patients (Fig. 7A). Of interest, as described in greater detail in Section X,A, patients with inactivating CaR mutations concentrate their urine normally despite being hypercalcemic (Marx et al., 1981b).Moreover, those with activating mutations can develop defective urinary concentrating capacity at normal or even low levels of serum calcium, presumably as a result of being overly sensitive to the usual effects of elevated Ca:+ on the urinary concentrating mechanism (Pearce et al., 1996b). Are there physiological implications of the abnormal, apparently CaR-mediated renal handling of water in hypercalcemic patients? We have previously suggested that this provides a mechanism for integrating renal handling of divalent cations, particularly calcium and water, thereby enabling appropriate “trade-offs”in the regulation of these aspects of renal function under particular physiological circumstances (Hebert et al., 1997). For instance, consider a situation where a systemic calcium load requires disposal. CaR-mediated integration of increased urinary Ca2+concentration as a result of reduced reabsorption of Ca2+ in CTAL, and perhaps DCT, with concomitant inhibition of maximal urinary concentrating ability might limit the resultant increase in luminal levels of Ca2+in IMCD that might otherwise predispose to forming Ca2+-containingrenal stones. The presence of abundant CaRs in the subfornical organ (SFO) (Rogers et al., 1997), an important hypothalamic thirst center (Simpson and Routenberg, 19751, may provide an additional layer of integration of calcium and water metabolism. Ca:+-evoked, CaR-mediated thirst and attendant drinking behavior could prevent dehydration that might otherwise ensue if there
A 4Caz+-receptor activation
.C Lumen positive voltage
4Ca2'and Mgz+ reabsorption
B
concentrating ability
(
Decreased CaZ+ Reabsorption, Increased
Decreased Urinary
Ca2* Excretion
FIG.7. Hypothetical mechanisms interrelating systemic calcium and water homeostasis in humans. See text for details. (A) The postulated renal mechanisms through which the CaR inhibits maximal urinary concentrating capacity, (Reproduced with permission from Brown, E. M., and Hebert, S. C. (1997).Novel insights into the physiology and pathophysiology of Ca2+-sensingreceptor. Reg. Peptide Lett. VII, 43-47.) (B)Activation of CaRs in the subfornical organ (SFO)may also increase intake of water, thereby mitigating loss of free water as a result of diminished urinary concentration. High CaF-induced reduction in gastrointestinal (GI) motility might also maximize intestinal, particularly colonic, absorption of water. (Reproduced from Brown et al., 1996, with permission.)
1
G-PROTEIN-COUPLED, EXTRACELLULAR CaZ+-SENSINGRECEPTOR
29
was a fixed renal loss of free water as a result of resistance of the kidney to vasopressin (Fig. 7B). Finally, in addition to high Ca:+-evoked thirst, previous studies have demonstrated a specific “calcium appetite” (Tordoff, 1994) that could appropriately modulate intake of calciumcontaining food during hypo- and hypercalcemia. We suggest on the basis of these data, therefore, that there could are multiple layers of integration and coordination in the regulation of various homeostatic mechanisms (i.e., those controlling systemic water and mineral ion metabolism), which are designed to optimize the adaptation of terrestrial organisms to their only intermittent access to dietary calcium and water.
D. BONE Studies have provided strong evidence that the CaR is expressed in a variety of cells within the bone and bone marrow (for additional details, see Section XI,C,3), including those that might represent bone cells or their precursors (House et al., 1997). For example, monocyte-macrophage-like cells express the CaR and could potentially serve as osteoclast precursors, since cells of the monocyte-macrophage lineage are known to form mature multinucleated osteoclasts through a process of differentiation and fusion (Stewart and Broadus, 1987). Indeed, one study found that high concentrations of ca:+ promote the fusion of alveolar macrophages to form multinucleated giant cells, but the mechanism underlying this action has not been further elucidated (Jin et al., 1990).In addition, alkaline-phosphatase-expressing cells derived from marrow, potentially representing preosteoblasts, also express the CaR. As already noted, however, there is substantial evidence for the expression of Ca:+-sensing receptors other than the CaR in bone cells, and additional studies are needed to assess the relative importance of these various Ca:+-sensing mechanisms, including the CaR, in the physiological regulation of bone cell function and bone turnover by Ca:+ (Quarles, 1997).
E. INTESTINE We (Chattopadhyay et al., 1998a)and others (Gama et al., 1997)have shown that several types of cells within the small and large intestines express the CaR, which might, therefore, directly or indirectly contribute to mineral ion homeostasis through its actions on intestinal function. The CaR is expressed by both normal (Chattopadhyay et al., 1998a)and malignant epithelial cells (Gama et al., 1997; Kallay et al.,
30
EDWARD M. BROWN et al.
1997) derived from the small intestinal villus and crypt as well as from the large intestinal crypt. Moreover, Ca:+ exerts several direct actions on intestinal epithelial cells that could potentially be mediated by the CaR. For example, raising Ca:+, in conjunction with addition of 1,25dihydroxyvitamin D to duodenal explants, increases the level of the mRNA for the calcium-binding protein, calbindin D9K (Brehior et al., 19891, which may be involved in duodenal Ca2+absorption. Ca:+ also promotes the differentiation of intestinal goblet cells (Black and Smith, 1989) and inhibits the proliferation of human Caco-2 colon cancer cells in association with a reduction in their expression of the c-myc protooncogene (Kallay et al., 1997). Since Caco-2 cells express the CaR, the latter might mediate this regulation of c-myc expression by Ca:+ (Kallay et al., 1997). Finally, application of low levels of Ca:+ to the apical but not the basolateral side of Caco-2 cells up-regulates c-myc expression (Kallay et al., 1997).The lower third of the lumen of the colonic crypts has been suggested to contain reduced levels of Ca:+ (Whitfield, 1995). Therefore, Ca:+-sensing by the CaR might represent a key cellular “switch” that inhibits the proliferation and promotes the differentiation of intestinal epithelial stem cells at the crypt bases as they migrate up the crypts (Kallay et al., 1997; Whitfield, 1995). The presence of a similar, CaR-mediated mechanism within both small and large intestine might, therefore, indirectly contribute to mineral ion homeostasis by regulating the proper sequence of intestinal epithelial cell differentiation that is crucial for maintaining the normal absorptive and secretory functions of the intestine.
F. PLACENTA During pregnancy, the placenta plays an important role in fetal mineral ion metabolism owing t o the fact that all fetal Ca2+must be transported from the maternal circulation via the placenta. Much of the fetal skeleton forms during the third trimester, and about 30 g of calcium have been deposited in the newborn’s skeleton at the time of birth (Rodda et al., 1992). Ca:+-sensing cells are present in the placenta that may play some role in the regulation of Ca2+transport between mother and fetus, possibly by regulating PTHrP production by placental cells (Hellman et al., 1992); the fetal parathyroid gland also secretes PTHrP in utero, however, which might also contribute in this regard (Rodda et al., 1992).As with parathyroid chief cells, high levels of Ca:+ raise the level of Ca? in human placental cytotrophoblasts (Bradbury et al., 1996; Juhlin et a,!., 1990), suggesting similarities in the mechanism(s) underlying Ca:+-sensing in the two cell types.
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSING RECEPTOR
31
Juhlin and coworkers have shown that gp330, the large putative Ca:+-sensing protein, is expressed in cytotrophoblastic cells of the placenta (Hjalm et al., 1996; Juhlin et al., 1990; Lundgren et czl., 1994). Bradbury et al. (1998) have shown expression of transcripts for the Gprotein-coupled CaR in cytotrophoblast cells from human term placenta. In addition to transcripts similar to those in other CaR-expressing cells, which encode the full receptor protein, an additional transcript is expressed in both cytotrophoblasts and in human parathyroid that is alternatively spliced (Bradbury et al., 1998). This RNA species lacks exon 3 and encodes a truncated and presumably inactive receptor protein, because it introduces a frame shift that produces a premature stop codon within the CaR’s ECD. It is possible, therefore, that one or both of these CaE+-sensingproteins mediates the previously described actions of Ca? on Ca:+ and PTHrP release in this cell type. Additional studies are needed to determine their relative importance. Indeed the significance of their coexpression in placenta, proximal tubule and parathyroid remains uncertain. Could they interact in ways that regulate the sensitivity of the cell to Caz+ or contribute in some manner to determining the downstream signaling pathways to which these Ca:+ sensors couple in these and other cells?
X. HUMAN DISEASESRESULTING FROM CaR MUTATIONS CLARIFY THE RECEPTOR’S PHYSIOLOGICAL ROLES
A. FAMILIAL HYPOCALCIURIC HYPERCALCEMIA The availability of the cDNA clone for the human CaR made it possible to search its gene for mutations in several inherited and sporadic disorders of mineral ion homeostasis. The generally benign hypercalcemic syndrome, familial hypocalciuric hypercalcemia [FHH; sometimes termed either familial benign hypercalcemia (FBH) (Foley et al., 1972) or familial benign hypocalciuric hypercalcemia (FBHH) (Bai et czl., 1997a)1,is an autosomal dominant disorder with nearly 100%penetrance that exhibits characteristic clinical features suggesting generalized Caz+ resistance (Heath, 1994; Law and Heath, 1985; Marx et al., 1981a).Affected members of families with this syndrome generally lack the usual symptoms and signs of hypercalcemia, such as altered mental status, weakness, difficulty concentrating the urine, and a variety of gastrointestinal symptoms (e.g., constipation, nausea, and anorexia) (Stewart and Broadus, 1987). In addition, studies utilizing induced hyper- and hypocalcemia have demonstrated an increase in the set point
32
EDWARD M.BROWN et al.
for CaE+-regulatedPTH secretion in FHH (e.g., there is resistance of the parathyroid to C a p ) (Auwerx et al., 1984; Khosla et al., 1993). Furthermore, individuals with FHH have markedly lower urinary Ca2+excretion than expected for their degree of hypercalcemia. This abnormality in renal Ca2+ handling persists even after parathyroidectomy, indicating that it is not simply the result of blunted suppression of PTH secretion at elevated Ca? but rather represents an intrinsic renal tubular defect (Attie et al., 1983; Davies et al., 1984). Moreover, of the maneuvers normally elevating urinary Ca2+ excretion by direct renal actions, only the loop diuretic ethacrynic acid, which inhibits the Na+/K+/2C1- cotransporter, increases urinary Ca2+ excretion in hypoparathyroid patients with FHH (Attie et al., 19831, suggesting abnormally avid tubular reabsorption of Ca2+in the TAL. Finally, patients with FHH concentrate their urine normally despite being hypercalcemic, unlike comparably hypercalcemic patients with primary HPT, who have reduced maximal urinary concentrating capacity (Marx et al., 1981b). Thus patients with FHH exhibit apparent resistance to several of the expected actions of elevated CaE+on renal function, namely hypercalciuria and defective urinary concentrating ability. The FHH gene was initially mapped to the long arm of chromosome 3 (band q21-24)in four large families (Chou et al., 1992). Linkage analysis also afforded formal proof that individuals with FHH are heterozygous for the disease gene. Ninety percent or more of FHH families large enough for genetic analysis have their disease gene linked to the chromosome 3q locus (Heath et al., 1993; Trump et al., 1995).A single family, in contrast, has a disorder with a similar phenotype linked to the short arm of chromosome 19 (band 19~13.3) (Heath et al., 1993), and in another family with atypical FHH (i.e., osteomalacia in some affected members and a progressive rise in PTH in older members of the family) the syndrome was linked to neither chromosome 3 nor chromosome 19 (Trump et al., 1995). Pollak et al. (1993) demonstrated that the CaR gene is present on the long arm of chromosome 3 near the FHH locus and identified unique missense mutations (e.g., changes in a single nucleotide substituting a new amino acid for the one normally coded for) in each of three FHH families with genetic linkage to chromosome 3. Subsequently, -40 additional CaR mutations have been identified in FHH (Fig. 4) (Aida et al., 1995a; Chou et al., 1995; Heath et al., 1996; Janicic et al., 1995b; Kobayashi et al., 1997; Pearce et al., 1995). Each family generally has its own unique mutation, although a few unrelated families share the same mutation [e.g., Arg185Gln (Bai et al., 1997a; Pollak et al., 1993)l. Most are missense mutations that cluster within (a)the first half of the
G-PROTEIN-COUPLED, EXTRACELLULAR Ca2+-SENSINGRECEPTOR
33
ECD; (b) the ECD immediately before TMD1; or ( c ) the CaRs TMDs, ICLs, or ECLs. In addition to point mutations, several other types of mutations have recently been described in FHH. One family harbors a nonsense mutation just before TMDl (e.g., ser607stop),producing a truncated and presumably biologically inactive ECD that might even be secreted, since it lacks membrane-anchoring TMDs (Pearce et al., 1995).Another mutation produces a single nucleotide deletion with an adjacent transversion (e.g., a change from one nucleotide to another) within codon 747, thereby altering the downstream reading frame and resulting in premature termination after codon 776 within TMD4 (Pearce et al., 1995). Finally, a Nova Scotian family has insertion of a 383-bp Alu repetitive sequence at codon 876 within the CaRs C-terminal tail (Janicic et al., 1995b).This Alu element contains stop signals within all three reading frames, thereby predicting a truncated CaR protein with a long stretch of phenylalanines within its C-terminal tail that are encoded by the element’s long poly(A/T) tract. Interestingly, the Alu element has approximately doubled in size in a subsequent generation of this family (Janicic et al., 1995a). Only about two-thirds of FHH families linked to the chromosome 3 locus have identifiable mutations in the CaR’s coding sequence (Aida et al., 1995a; Chou et al., 1995; Heath et al., 1996; Janicic et al., 1995b; Kobayashi et al., 1997; Pearce et al., 1995). Introns or upstream or downstream regulatory domains of the CaR presumably harbor mutations in the remaining families, but this remains to be documented. Such mutations might interfere with the gene’s normal expression, thereby reducing the number of normal receptors on the surface of parathyroid and renal cells. Several apparently benign polymorphisms reside within the CaR’s C-terminal tail (Heath et al., 1996). These amino acid variations are not associated with overt hypo- or hypercalcemia and are present within a substantial proportion of the population (- 10-30%). Recent preliminary data suggest subtle differences in serum calcium concentration, all encompassed within the normal range, between individuals expressing certain of the polymorphic forms of the CaR, suggesting a functional impact of these amino acid variations (Coleet al., 1997).It is possible, therefore, that future studies may reveal that these modest functional alterations predispose to disorders of CaE+-sensing(i.e., primary hyperparathyroidism). Investigations using mammalian expression systems have characterized the impact of FHH mutations on the CaRs function (Bai et al., l996,1997a,b; Pearce et al., 1996a). Figure 8A shows the effects of several point mutations introduced into the wild-type human CaR on high
34
EDWARD M. BROWN et al.
-
wild type
+ R62M e R66C +T138M
-b- Rl85Q L Rl95W
n
B
10
20
50
40
30
1.0-
0.8-
8C
c
F2 E
0.6-
0.4-
b
Z
0.2
-
-
+ WT
ECsoI 3.7 mM (+/ 0.05)
--C-- F128L
ECso=2.2m M (+/-0.05)’ EC, = 2.7 mM (+/ 0.04)’ EC, = 2.8 mM (+/ 0.06).
+ T151M
-
E191K
p Proliferation
Mineralization
FIG.2. The osteoblast developmental sequence. (A) Micrographs of osteoblasts: 3H thymidine incorporation shows left, growth stage; middle, histochemical detection of alkaline phosphatase activation in all cells; and right, von Kossa’s stain reveals mineralized nodules. Stages in development of the osteoblast phenotype are defined by the temporal expression of cell growth and osteoblast phenotype-related genes, reflected by the cellular representation of mRNAs, during the development of in uitro formed bonelike tissue (nodules) produced by normal diploid rat osteoblasts. Isolated primary cells from fetal rat calvaria were cultured as described. Cellular RNAisolated from days 5,8,14,21, 28, and 35 were assayed for the steady-state levels of various transcript by Northern blot analysis. Procedures and source of the probes are described in Owen et al.,(1990a), McCabe et al.,(1995,19961, Banejee et al.,(1996a,b), Lynch et al.,(1995), and Shalhoub et al.,(1991,1994). Three periods of gene expression are represented by peak mRNA levels and define a (1)proliferation period, represented here by expression of histone gene (4), AP-1 activity (c-fos-c-jun), along with maximal expression of skeletal regulatory factors (Mxs-2) and genes involved in bone extracellular matrix synthesis [transforming growth factor p l (TGFPl), collagen type 11; (2) a matrix maturation period reflected by the post-
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
45 1
mature osteoblasts. The second period of osteoblast differentiation, extracellular matrix maturation, follows the down-regulation of proliferation. Transforming growth factor P (TGFP)and collagen type I mRNAs are reduced to lower levels of expression, but type I collagen synthesis, accumulation, and cross-linking (Gerstenfeld et al., 1988,1993) continues, accounting for up to 35-40% of the ECM (Gerstenfeld et al., 1988; Aronow et al., 1990; Quarles et al., 1992). However, subtle variations in interrelationships between the extent of gene expression and the stage of differentiation can be noted. Reported differences in the temporal pattern of transforming growth factor P (TGFP) (Harris et al., 199413) and collagen gene expression (Birnbaum and Wiren, 1994) in rat calvarial osteoblasts appear to be related to plating density and serum composition. Indeed, dramatic changes in the developmental expression of these genes are observed when cells are cultured on collagen matrices, implicating cell-cell and cell-matrix interactions as key biological determinants of their expression levels (Birnbaum and Wiren, 1994; Franceschi and Iyer, 1992; Franceschi et al., 1994; Andrianarivo et al., 1992; Masi et al., 1992; Lynch et al., 1995; Vukicevic et al., 1990). In the immediate postproliferative period, a large induction of alkaline phosphatase mRNA and enzyme activity occurs (Gerstenfeld et al., 1987; Beresford et al., 1992; Leboy et al., 1991; Cheng et al., 1994) and is a requirement for mineralization of the matrix. In this postproliferproliferative up-regulation of alkaline phosphatase, matrix Gla protein (MGP), and AP1 activity involving fra2/junD and onset of osteocalcin; and (3)a mineralization period where genes, such as osteopontin, osteocalcin, and collagenase, are induced to maximum levels with accumulation of calcium. (B) Model of the reciprocal relationship between proliferation and differentiation in normal diploid cells during development of the osteoblast phenotype. The proliferation-differentiation relationships are schematically illustrated as arrows representing changes in expression of cell-cycle and cell-growth-regulated genes (proliferation arrow) and genes associated with maturation (differentiation arrows) of the osteoblast phenotype as the extracellular matrix accumulates and mineralizes in normal diploid cell cultures. The vertical lines indicate the two experimentally established principal transition points in the developmental sequence exhibited by normal diploid osteoblasts: the first at the completion of proliferation when genes associated with matrix development and maturation are up-regulated and the second a t the onset of ECM mineralization. In the proliferation period, expression of postproliferative genes can be suppressed by several mechanisms, including binding of c-fos-cjun heterodimers to AP1 sites or homeodomain proteins to Hox sequences. The signaling pathways and feedback events (represented by plus and minus signs) are indicated. These include down-regulation of proliferation (-) by the accumulated extracellular matrix (+ECM), which, in turn, leads to up-regulation of postproliferative genes (e.g., alkaline phosphatase). Mineralization leads to both the up-regulation of genes (e.g., osteocalcin) and down-regulation of alkaline phosphatase activity during the third period. Mineralization also leads to turnover of the ECM mediated in part by apoptosis.
452
JANE B. LIAN et al.
ative period, transcription of osteocalcin is first detected with the onset of mineralization, and a third stage of gene expression is initiated, reflected primarily by upregulation of the bone sialoprotein, osteopontin, and osteocalcin. These are all calcium-binding proteins that have been demonstrated by immunolocalization to be associated with the mineral component of bone (Mark et al., 1987; Boivin et al., 1990; Carlson et al., 1993; Kasai et al., 1994; McKee et al., 1993).As mineralization proceeds, alkaline phosphatase mRNA levels are down-regulated, whereas osteocalcin and osteopontin reach their maximal levels, indicating maturation of the osteoblast phenotype. Although osteopontin is expressed in proliferating osteoblasts (Owen et al., 1990a; Chen et al., 1994) and in other tissues (Denhardt and Guo, 1993), osteocalcin expression, which is bone restricted, occurs only postproliferatively (Owen et al., 1990a; Quarles et al., 1992).The postproliferative expression of osteocalcin is further emphasized by its transcriptional enhancement by 1,25(OH),D,, which can be up-regulated only when the gene is transcribed in nondividing cells (Bortellet al., 1992; Owen et al., 1991). Associated with the mineralization phase is a fourth developmental stage characterized by a series of events that may contribute to modifications in organization and turnover of the mature bone extracellular matrix. In Fig. 2A, this stage is designated apoptosis. A continual increase in collagenase mRNA (Shalhoub et al., 1992)reaching maximal levels in heavily mineralized cultures is observed. This increase may be involved in collagen turnover associated with reorganization of the collagen matrix, which undergoes continuous maturation [e.g., crosslinking of collagen fibers (Gerstenfeld et al., 1988, 1993)l. In addition, we detect apoptotic cells associated with the mineralized nodule (Lynch et al., 1994),which may facilitate maintenance of the bonelike extracellular matrix in uitro. During this time, a low level of cell proliferation indicated by histone gene expression and a rise in mRNA of several oncogenes can be detected, suggesting cell turnover. Osteocalcin and osteopontin mRNA levels become down-regulated in late mineralization stage cultures, reflecting perhaps the programmed cell death of this subset of mature osteoblasts. In viuo apoptosis contributes to organ development and one can only speculate as t o why this occurs in uitro.Perhaps apoptosis is a natural mechanism for eliminating osteoblasts that do not become incorporated into an organized mineralized matrix. Studies of bone tissue for the representation of apoptotic cells reveal that hormonal regulation is an important factor in maintaining a viable bone cell population (Tomkinson et al., 1997). Certain functional relationships and signaling mechanisms that reg-
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
453
ulate this developmental sequence of bone formation and support progressive differentiation of the osteoblast phenotype have been established and were reviewed (Stein et al., 1996; Stein and Lian, 1993, 1995). In general, from the various experimental manipulations it is clear that for the normal developmental sequence, cells must progress through two restriction points (Fig. 2B). The first is the shutdown of proliferation, contributed to be an accumulation of collagen matrix, which, in turn, promotes expression of the osteoblast phenotype marked by high levels of alkaline phosphatase. The second transition point is mineralization of the ECM for completion of the differentiation process to the osteocyte. An understanding of these restriction points has provided a basis for addressing molecular mechanisms mediating steroid hormone and growth factor modifications of the differentiation pathway. Thus, in conclusion, this primary osteoblast model having many features of intramembranous bone formation, provides an opportunity for studying developmental regulation of osteocalcin gene expression. B. MEDIATORSOF TRANSCRIPTION CONTROL SUPPORTING PROGRESSIVE DEVELOPMENT OF THE OSTEOBLAST PHENOTYPE AND THE DEVELOPMENTAL EXPRESSION OF OSTEOCALCIN
It is apparent that, in addition to bone extracellular-matrix-associated genes, several classes of transcription factors and other regulator y proteins are expressed temporally during differentiation (Fig. 2B), suggesting functional linkage to maturation of the phenotype due to their ability to modulate signaling cascades and gene expression. The oncogene encoded early response gene family (e.g., C-Fos,c-Jun, Jun-B, Fra-1, and Fra-2) (McCabe et al., 1995; Machwate et al., 19951, helixloop-helix proteins (Murray et al., 1992),homeodomain proteins (Hoffmann et al., 1994; Towler et al., 1994b; Ryoo et al., 1997),runt homology-domain proteins (Merriman et al., 19951, the high-mobility group (HMG) chromosomal proteins (e.g. HMG14, HMG17) (Shakoori et al., 19931, metablastin (Schubart, et al., 1992),insulin-like growth factor I (IGF-I) and IGF-binding proteins (Birnbaum and Wiren, 1994; Thrailkill et al., 1995), and bone morphogenetic proteins (BMPs) (Hughes et al., 1995; Harris et al., 1994a; Chen et al., 1991)have been examined as a function of osteoblast differentiation. The transcriptional regulators of the osteocalcingene, which have additionally been identified in regulation of the progressive development of osteoblast maturation, are further discussed. Expression of members of fos and jun family of transcription factors
454
JANE B. LIAN et al.
with respect to both protein (McCabe et al., 1996) and mRNA (McCabe et al., 1995; Machwate et al., 1995)levels are regulated during bone formation in uiuo (Grigoriadis et al., 1993;Wang et al., 1992) and throughout the growth and differentiation of osteoblasts. AP-1 activity is maximal in proliferating cells. In the growth period of osteoblasts, c-fos and c-jun heterodimers form the complexes most represented at AP-1 sites, whereas fra-2 and jun-B are the abundant family member factors found in differentiated rat osteoblast cultures and MC3T3 cells (McCabe et al., 1996). This profile of expression and activity in osteoblasts (i.e., binding t o m - 1 sites in gene promoters) is consistent with findings from studies in other systems (Rezzonicoet al., 1995; Gandarillas and Watt, 1995; Szabo et al., 1991), which has led to an appreciation for their possible role in regulating cellular differentiation. In osteoblasts, the functional significance of relatively high levels of fra-2 compared to other family members for maturation of the differentiation program is supported by antisense studies in cultured rat calvaria-derived cells. Inhibition of translation of fra-2, but not fra-1, blocked the ability of these cells to produce a mineralizing matrix. Antisense inhibition of c-fos initiated in the growth period resulted in a block in maturation at the early stage of differentiation, the matrix maturation period when alkaline phosphatase levels are maximal. This inhibition suggests c-fos is an important determinant for bone formation as suggested from in uiuo studies (Grigoriadis et al., 1993). Several homeobox-containinggenes have been shown to be critical to skeletal patterning and limb development in embryos (Johnson et al., 1994; Balling et al., 1989; Davis et al., 1995; Martinet al., 1995; Jabs et all., 1993; Lufkin et al., 1992; Satokata and Maas, 1994). Particularly relevant to bone formation are the mammalian Msx-1 and Msx-2 members of the Msh homeodomain gene family (Jabs et al., 1993; Satokata and Maas, 1994; Liu et al., 1994) and the Dlx gene family (Lufkin et al., 1992; Ryoo et al., 1997). These factors are expressed in tissues that require epithelial-mesenchymal interaction in the developing embryo and have been implicated as regulators of inductive events in the vertebrae, limbs, and cranium. The importance of Msx-2 and related proteins in orchestrating normal bone development is illustrated by expression of Msx-2 in early developing bone tissue (Liu et al., 1995; Iimura et al., 1994) and by skeletal abnormalities resulting from mutations of the gene in human (Jabs et al., 1993)or in mice (Satokata and Maas, 1994). Msx-2 also provides important signals for apoptosis during limb development (Coelho et al., 1991; Graham et al., 1993). During osteoblast differentiation in uitro, Msx-2 mRNA levels decline from the growth to differentiation periods and then become up-regulated in the
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
455
late stage of mineralization when apoptosis is ongoing. In contrast, Msx-1 mRNA levels are constitutive, consistent with this factor being ubiquitous, compared to the skeletal tissue restricted expression of Msx-2. Furthermore, in antisense studies, inhibition of Msx-2, but not Msx-1 transcripts, inhibited osteoblast differentiation (Hoffmann et al., 1996). These findings support the concept that expression of the Msx-2 homeodomain proteins in early development of bone may be necessary for dictating outcome of osteoprogenitor differentiation to the final stages of production of a mineralized matrix. Notably, several osteoblast cell lines that do not express osteocalcin also lack Msx-2 transcripts (Hoffmann et al., 1994). However, down-regulation of Msx-2 is required for enhanced expression of osteoblast products, as collagen (Dodig et al., 1996) and osteocalcin (Hoffmann et al., 1994;Towler et al., 1994b). The suppressor activity of homeodomain proteins in mature osteoblasts may functionally be related to maintaining critical levels of osteoblast expressed genes in response to bone turnover. In this regard, other homeodomain proteins are temporally expressed during osteoblast differentiation. Dlx-5, a member of the distal-less family of homeobox-containing genes, is also essential for limb development (Lufkin et al., 1992;Ferrari et al., 1995). Dlx-5 exhibits a reciprocal pattern of expression when compared to Msx-2 (Ryoo et al., 1997). Dlx-5 is detectable only in the postproliferative period and becomes up-regulated during the mineralization period reaching maximal levels in concert with the osteocalcin marker of maturation. These findings suggest that Dlx-5 may be an important regulator of gene expression in mature osteoblasts as well as playing an important role in early limb formation. Dlx-5-null mice have not been generated to date to address this interesting aspect of its expression in vitro. In the characterization of bone-specific transcription factor complexes associated with osteocalcin gene sequences, a consensus sequence for CBFa-AML-related proteins, was identified (Bidwell et al., 1993; Merriman et al., 1995; Banerjee et al., 1996a; Ducy et al., 1997). This transcription factor was designated AML because the gene in human is frequently rearranged in acute myelogenous leukemia. The factor is also named polyoma enhancer binding protein (PEBPa) and core-binding factor (CBFa), the preferred nomenclature. The CBFa-AML family of runt homology domain (RHD) transcription factors were initially identified as a pair rule gene controlling Drosophila development and subsequently as a key regulator of mammalian hematopoietic gene expression (Kagoshima et al., 1993; Levanon et al., 1994). To date, three CBFA genes that influence myeloid cell growth and differentiation are
456
JANE B. LIAN et al
known (Speck and Stacy, 1995). It is now known that one of these genes is essential for bone formation during embryogenesis (Komori et al., 1997; Otto et al., 1997). Null mutation of the Cbfa2 IPEBP2aBIAML-1 gene in mice was embryonic lethal due to disruption of hematopoieses and hemorrhage in the central nervous system prior to development of the skeleton (Okuda et al., 1996). However, ablation of the Cbfall AML-3 gene resulted in mice that survived to birth only. In these mice, skeletal formation was blocked at the stage of osteoblast maturation. Although the cartilage anlage of long bone developed and intramembranous skeletal tissue developed alkaline-phosphatase-positive cells, skeletal formation was disrupted by the absence of mineralized bone tissue did not occur (Otto et al., 1997; Komori et al., 1997).At the same time as this knockout was reported by two independent laboratories, the mutational defect in the human disorder, cleidocranial dysplasia, was identified in different families as deletions of the CBFAl gene (Mundlos et al., 1997; Lee et al., 1997). In situ hybridization for Cbfa 1 during mouse development indicates that Cbfa 1is expressed early in development at high levels from gestational age 9.5 to 12. Expression levels then rise in the bony tissues in osteoblasts in later stages of development and postnatally (Komori et al., 1997; Ducy et al., 1997). The significance of the Cbfa 1/AML-3null mutation with respect to our understanding of transcription factors required for development of the skeleton and maturation of the osteoblast phenotype is quite remarkable in that neither of the other two Cbfa/AML genes, having conserved DNA-binding domains, can compensate the skeletal defect. During osteoblast differentiation in uitro, all Cbfa family members are detected by Northern blot analysis and at the protein level using a panel of antibodies generated by the Hiebert laboratory (Banerjee et al., 1997). Cbfa 1and Cbfa 3 appear to be expressed predominantly in the postproliferative mature osteoblast. Cbfa 2 is present in the proliferating osteoblasts and then declines. Although abundant in bone, Cbfa 1/ AML-3 is found in other tissues (Levanon et al., 1994; Ogawa et al., 1993), suggesting a unique splice variant may represent the osteoblastspecific factor. Indeed, several isoforms with different N- and C-terminal extensions have been identified in osteoblasts (Ducy et al., 1997; Stewart et al., 1997). There are two isoforms of Cbfa 1 arising fron exon 0: Cbfal.met1 [designated as OSF-2 (Ducy et al., 1997)l and Cbfal.met 69 [the til locus (Stewart et al., 199711. However, Cbfal.met1 yields a minor product compared to Cbfal.met69 (Stewart et al., 1997; Thirunavukkarasu et al., 1998). Both isoforms differ from the hematopoietic Cbfa 1 (Bae et al., 1995) that arises from exon 1. Notably, Cbfa factors have equal ability to transactivate OC promoter-reported constructs (Baner-
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
457
jee et al., 1997). Therefore, the reports of “leaky” OC expression in some nonosseous cells may relate to the presence of Cbfa factors, where different splice variants could account for selective potencies. It is appealing to consider Cbfa 1 of the osteoblast as a master switch factor akin to myoD regulating muscle cell differentiation. It has not been demonstrated that the osteoblast-specific Cbfa 1 factor has the same potency for example as BMP-2, which is competent t o modify the phenotype of a nonosseous cell, diverting the cell to become an osteoblast competent to produce a mineralized matrix (Katagiri et al., 1994). It was reported that forced expression of a Cbfa 1 isoform arising from exon 0 resulted in detectable bone-associated gene mRNAs in nonosseous cells (Ducy et al., 1997). In related experiments using the hematopoietic Cbfa 1 isoform, bone-specific genes could not be activated in nonosseous cells (Tsuji et al., 1998). Antisense inhibition studies that ablate all runt-domain-binding proteins in osteoblasts show a block in extracellular matrix mineralization. Thus, the biological activities of specific Cbfa 1 isoforms remain to be established. Taken together, these findings suggest that the bone restricted Cbfa factors may be critical to maintenance of the osteoblast phenotype and progression to the late stages of differentiation (Banerjee et al., 19971, consistent with postnatal expression of Cbfa 1in mature bone. In summary, there is now sufficient documentation that numerous classes of transcription factors, which are transiently expressed during early embryonic development and specify developmental pattern, position, and differentiation of the skeletal elements, are also reexpressed in the mature osteoblast, regulating several parameters of bone formation. Future identification of the target genes will provide insight for the precise functional roles of these factors in maintaining skeletal homeostasis throughout life.
PARALLELS HORMONAL AND GROWTH C. OSTEOCALCIN EXPRESSION FACTOR MODIFICATIONS OF OSTEOBLAST DIFFERENTIATION Osteoprogenitors (proliferating osteoblasts) are target cells for steroid hormone and growth factors that promote osteoblast differentiation. For example, bone morphogenetic protein-2 directs these cells (Rickard et al., 1994; Hughes et al., 1995) and nonosseous cells (Wang et al., 1993; Katagiri et al., 1994) to a mature osteoblast phenotype reflected by expression of osteocalcin. However, the effects of BMP-2 in osteocalcin gene expression are clearly indirect, usually occurring 2-3 days following BMP-2 exposure. In contrast, a potent enhancer of osteocalcin expression is 1,25(OH),D,, which promotes differentiation of
458
JANE B. LIAN et al.
committed osteoprogenitors to mature osteoblasts. Here a rapid transcriptional increase is observed (Lian and Stein, 1993). Cultures of rat osteoblasts exposed to dexamethasone during the proliferation period results in both an increased number and size of the bone nodules (Shalhoubet al., 1992;Bellows et al., 1987).Postproliferativecultures cannot be stimulated to produce more mineralizing nodules (Shalhoub et al., 1992; Bellows et al., 1987). Fetal rat calvarial-derived osteoblasts lose their phenotypic properties with passaging (Shalhoubet al., 1992;Bellows et al., 1987).Exposure of passaged fetus-derivedosteoblasts after plating during their log growth phase to glucocorticoidsalso results in the formation of mutilayered nodules of osteoblasts and mineralized matrix, as well as modified gene expression that reflects a more differentiated phenotype. Glucocorticoid induces expression of the bone cell phenotype in stromal marrow cell cultures (Chenget al., 1994;Kamalia et al., 1992; Kasugai et al., 1991; Quarles et al., 1992; Chen et al., 1994). Synthetic solubleglucocorticoids(e.g., dexamethasone)profoundly affect transcription of numerous osteoblast parameters, including early response genes, growth-regulated genes, and differentiated associated genes, followed by a cascade of subsequent events (Shalhoubet al., 1992; Wong et al., 1990; Bellows et al., 1987; Centrella et al., 1991; Delany et al., 1994). The accelerated differentiation induced by glucocorticoids is reflected by increased osteocalcin expression (mRNA levels and protein synthesis). Initially, that is in the early postproliferative period, transcription of osteocalcin in increased in the dexamethasone (Dex)-treated cultures compared t o slowly differentiating control cultures. However, in mature osteoblasts, dexamethasone decreases osteocalcin transcription (Morrison and Eisman, 1993; Morrison et al., 1989; Stromstedt et al., 1991; Heinrichs et al., 1993b).Although multiple glucocorticoid response elements (see next section) in the OC promoter contributes to this complex responsiveness (Aslam et al., 1995),the increased expression of osteocalcin in Dex-treated cultures is accounted for by mRNA stabilization (Shalhoub et al., 1998).
IV. PROPERTIES OF THE RATOSTEOCALCIN PROMOTER
A. THE OSTEOCALCIN GENES The human osteocalcin gene has been localized to the 1q distal region of chromosome 1 (Puchacz et al., 1989). A mouse gene (Celeste et al., 1986) has also been mapped to chromosome 3. It is interesting to note that this corresponds to the distal region of human chromosome 1 q (Johnson et al., 1991). From these studies and various reports charac-
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
459
terizing gene probes, the osteocalcin gene was initially described as a single-copy gene. However, later studies revealed that three copies of the osteocalcin gene are present in mouse, and perhaps in rat (Rahman et al., 1993; Desbois et al., 1994). Of the three gene copies in mouse, two have similar promoters which regulate tissue-specificexpression in bone. The third gene, designated mOCX (Rahman et al., 1993) or OG3 (Desbois et al., 19941, is regulated by a different promoter that allows for developmental expression of the gene only in several nonbone tissues, including brain, lung, and kidney (Desbois et at., 1994). This promoter lacks the key regulatory basal elements that contribute to bone specific expression (described later) and a vitamin D response element. The coding region of the mOCX-OG3 gene has a similar intron-exon organization as the bone expressed osteocalcin gene but carries five amino acid substitutions, one at the propeptide cleavage site (Rahman et al., 1993). Therefore, it is likely that this protein is not secreted. Indeed, when the osteocalcin gene expressed in bone was ablated in mice (Desbois et al., 1993, no osteocalcin could be detected in either the serum or nonosseous tissues of these mice in which the mOCX-OG3 gene was intact. The function of the nonosseous expressed gene remains to be established. Consideration should be given to the possibilities that it encodes (1)the Gla-containing nephrocalcin isolated from kidney stones (Nakagawa et al., 1991);(2) osteocalcin associated with megakaryocytes and platelets (Thiede et al., 1994) and the hematopoietic environment (Long et al., 1990);and the osteocalcin detected by reversed-transcription polymerase chain reaction (RT-PCR)(Fleet and Hock, 1994) or other methodologies in other nonosseous tissues (Fleet and Hock, 1994;Levyet al., 1983).The cellular levels observed in these nonosseous tissues detected by RT-PCR or only in poly (A)' RNA are three orders of magnitude lower than those found in bone, and polysome association of the mRNA as well as translation of the protein remains to be established. Furthermore, the absence of vitamin-D-responsive regulation of osteocalcin mRNA in peripheral blood platelets, megakaryocytes and nonbone tissue, as well as the inability to demonstrate directly a secreted protein, suggests that control of expression is under a nonskeletal osteocalcin gene promoter. One possibility for this mRNA is a rearranged gene consisting of the osteocalcincoding domain and a unique promoter analogous to that identified in mouse (Rahman et al., 1993; Desbois et al., 1994), or other gene rearrangements. The recent demonstration of secreted osteocalcin protein by a myeloma cell line (NCI-H929)having three copies of chromosome 1 raises this possibility (Barille et al., 1996). Alternatively, aberrant expression of an osteocalcin transactivating factor may contribute to transcription. Nonetheless, the possibility that the osteocalcin in nonskeletal cells and tissues has functional activity remains intriguing.
460
JANE B. LIAN et al.
The bone-expressed human and rat osteocalcin gene promoters have been studied in uivo in transgenic mice (Kesterson et al., 1993; Baker et al., 1992; Sztajnkrycer et al., 1994; Frenkel et al., 1997; Clemens et al., 1997; Sims et al., 1997).When transgenic animals were constructed with 3900 base pairs (bp) of the human osteocalcin promoter fused to the (CAT)reporter (Kesterson et al., 1993; Clemens et al., 1997),expression was observed predominantly in bone, but additionally at reduced levels in hypertrophic chondrocytes and kidney and at very low levels in brain. Osteocalcin expression, regulatable by 1,25(OH),D,, has been found in chick hypertrophic chondrocytes in vitro as the ECM mineralizes; thus, it appears to be under the same regulatory controls as for osteoblasts (Lian et al., 1993a;Clemens et al., 1997). Transgenic mice studies indicate that sequences residing within the proximal 1800 kilobases (kb) of the rat osteocalcin gene promoter support high levels of tissue-specific transcription (Baker et al., 1992; Frenkel et al., 1997). Only trace levels or reporter activity were detected in brain. Tissue-specific transcription of a rat OC promoter-chloramphenical acetyl-transferase (CAT) construct was retained in transgenic mice carrying only 720 nucleotides (nt) of 5' flanking sequences, although the level of expression was dampened (Frenkel et al., 1997). However, this does not preclude the contributions of additional upstream sequences to osteocalcin gene promoter activity. The murine bone specific osteocalcingene exhibits similar cell-specific expression patterns as rat and human, although sequence variations that occur in the vitamin D response elements do not allow enhanced transcription, as occurs in rat and human genes (Clemens et al., 1997; Sims et al., 1997; Lian et al., 1997).
B . ORGANIZATION OF THE BONE-SPECIFIC OSTEOCALCIN GENEPROMOTER The promoters of the osteocalcin genes expressed in rat, human, and mouse bone have a similar overall representation, as well as location of the primary promoter regulatory elements (Fig. 3A). Thus, these genes appear to be organized in a manner that supports similar responsiveness to homeostatic physiologic mediators and developmental expression in relation to bone cell differentiation. In contrast to other bone-related genes (e.g., type I collagen and alkaline phosphatase) (Zernik et al., 1990; Bennett et al., 19891,only a single mRNA transcript has been observed from the osteocalcin gene (Mackowiak et al., 1985).Note that although regulation of expression does not appear to be modulated by changes in the organization of the mRNA transcripts, this does not preclude the presence of sequences in the transcribed region of the osteo-
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
461
calcin gene that contributes to control of transcription. In addition to specific promoter sequence, there is evidence for sequences in the first exon and intron that contribute to suppression of osteocalcin transcription, designated as a “silencer”domain (Frenkel et al., 1993,1994; Li et al., 1995;Goto et al., 1996).Although the activity of the OC silencer is profound (up to two orders of magnitude), its physiological role has not yet been clarified. Tissue-specificexpression of a 1.1-kb rat osteocalcin promoter-CAT reporter construct lacking this domain is retained in vitro (Frenkel et al., 1996) and in transgenic mice (Frenkel et al., 1997; Baker et al., 1992). Involvement in developmental control of expression during osteoblast maturation is suggested by variations in protein-DNA interactions, which are observed with nuclear extracts from proliferating cells not expressing osteocalcin compared to differentiated osteoblasts (B. Frenkel, J. Stein, G. Stein, and J. Lian, unpublished data). Studies with the human osteocalcin silencer sequence strengthen this possibility (Li et al., 1995). Identification of promoter regulatory elements (Lian et al., 1989;Theofan et al., 1989)that are responsive to basal and tissue specific transactivation factors, steroid hormones, and other physiologic responses provides a basis for our understanding of regulatory mechanisms contributing to developmental expression of osteocalcin-tissue-specificity and biological activity. The regulatory sequences illustrated in Fig. 3 have been established in the OC gene promoter and coding region by one or more criteria that includes (1)demonstration of an influence on transcriptionalactivity by deletion, substitution, or site-specificmutagenesis; (2) identification and characterization of sequence-specificregulatory element occupancy by cognate transcription factors; and (3) modifications in protein-DNA interactions as a function of biological activity. A series of elements contributing to basal expression include (a) a tumor-associated transplantation antigen (TATA) motif (Lian et al., 1989; Theofan et al., 19891, which is a sequence in the proximal promoter that binds a multisubunit complex containing a CP 1-NFY-CBF-related CCAAT factor complex (Towler et al., 1994a1, and (b) the osteocalcin box (OC box I) (Owen et al., 1990,1993;Heinrichs et al., 1993a, 19951, a 24-nucleotide element with a homeodomain motif as a central core (Hoffmann et al., 1994; Towler et al., 1994b). These elements have been established as required for rendering the gene transcribable. OC box I, the CBFa-AML sites and the steroid hormone response elements are discussed further later. Other regulatory sequences in the OC gene promoter include a series ofAP-1sites (Owen et al., 1990b; Baneljee et al., 1996b; Schule et al., 1990; Bortell et al., 1992, 1993; Jaaskelainen et al., 1994; Lian et al., 1991;Goldberg et al.,
462
JANE B. LIAN et al.
A I
far distal promoter
I
distal promoter
proximal promoter
A
-0.8 kB
-0.6kB
-0.4 kB -0.2kB
OC-BOX II
-
OC-BOX 1
1
I
TGACCC CCAATTAGT CCTGGCAG half HRE & homeodomaln site CAMP RE
B
---
-460
-434
VDR half elements
coo 00 GGGTGAATGAGGACATTACTGAC CGCTCCTT lxi-l m
o
0.
GGGTGAATGAGGACATTACTGACCGCTCCTT
ma
GGGTGAATGAGGACATTACTGACCGCTCCTT
Iyy-1I
6x3 GGGTGAATGAGGACAVACTGACCGCTCCTT
cFOSlcJUN FIG.3. (A) Organization of the bone-specific rat osteocalcin gene promoter showing 1.1 kb of promoter sequences, indicating defined physiologic regulatory elements and the coding region (black boxes, which include 4 exons). Cognate binding factors are shown above the designated regulatory elements. These include the retinoic acid-vitamin D respon-
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
463
1996),one of which mediates both TGFp and fibroblast growth factor 2 (FGF-2) responsiveness (Boudreaux and Towler, 1996; Banerjee et al., 1996b), an E box (Tamura and Noda, 1994) that presumably interacts with H-L-H containing-transcription factor complexes (Tamura and Noda, 1994; Siddhanti and Quarles, 1994; Quarles et al., 1997). In the human osteocalcin gene promoter, only an NF-KBsite has been reported to be involved in regulation mediated by tumor necrosis factor (Y (TNFa) (Li and Stashenko, 1993) and an SP-1-like G-C-rich element in the proximal promoter, which bind regulatory repressor proteins may be related to cell type specific expression (Goldberg et al., 1995). The overlapping and contiguous organization of regulatory elements, as illustrated by the TATA-glucocortcoid regulatory element (GRE), Hox-AP-1-OC box I, TGFP-Cbfa 1, and AP-1-YY 1-vitamin D response element (VDRE) provides a basis for combined activities that support responsiveness to physiologic mediators. The majority of the regulatory elements have been identified in the region that spans the promoter from the VDRE domain to the first exon using assays of element or promoter-reporter constructs transiently expressed in cells. However, additional upstream sequences that may contribute to both basal and enhancer-mediated control of transcription and may be required for fidelity of tissue-specific expression when osteocalcin resides in the genome in vivo must be further defined. In the search for DNA sequences involved in the regulation of osteocalcin transcription, one must consider sequences accounting for not only tissue-specificity but developmental regulation of osteocalcin transcription during bone growth. In uivo transcription studies using nuclei from calvaria or long bone show an age-correlated expression (Yoon et al., 1987; Shalhoub et al., 1994). Developmental stages of expression are clear; (1)the absence of osteocalcin expression in proliferating 0steoblast progenitor-like cells; (2) detection in postproliferative committed cells, albeit at low levels; (3) transcriptional up-regulation of the sive element (VDRE),which includes a n m - 1 site and a W1-binding site; a glucocorticoid response element (GRE); and a TGF-P response element (TGRE), which shares responsiveness to fibroblast growth factor (FGF) and binds AP-1 factors. The conserved osteocalcin boxes I and I1 (OC box) and the TATAmotif are the primary proximal transcription regulatory elements. OC box I includes the MSX homeodomain-binding motif as the central core, a cyclicAMP (CAMP)response motif, flankingm-1 sites, and a contiguous E box. OC box I and OC box I1 bind osteoblast-specific complexes are designated OCBP-1 and OCBP-2. OCBPS has been identified as a CBFAl (AML-3bCBFPheterodimeric complex. Several sites of interaction (sites A, B, and C) with a nuclear matrix protein complex are recognition motifs for runt-domain homology proteins as AML-CBFa. (B) Sequences and protein-DNA contacts (circles) for recognition motifs in the VDRE are shown.
464
JANE B.LIAN et al.
gene in osteoblasts during mineralization of the matrix in vitro and during bone growth in uivo; and (4) a decline in transcriptional activity after the postnatal growth period i n viuo and in osteocytes i n uitro (Malavalet al., 1994).This developmental regulation is operative in the presence of the steroid hormones (Owen et al., 1993; Lian et al., 1994). However, this level of osteocalcin transcriptional control is abrogated to a significant effect in osteosarcoma cells (Bortellet al., 1993;Lian et al., 1992, 199313; Shakoori et al., 1994). In addition to elements within the osteocalcin promoter contributing to either suppression or activation of transcription, the representation of several transcription factor complexes within the osteoblast, interacting with specific sequences, varies as a function of cellular differentiation (Hoffmannet al., 1994;Owen et al., 1993;Heinrichs et al., 1995; Banerjee et al., 1996a; Ducy and Karsenty, 1995; Bortell et al., 1992). This provides another level of regulation for control of transcriptional activity and several of these factors have now been identified. Scanning of the promoter for sequences interacting with complexes formed only in osteoblastic cell extracts (e.g., mouse MC3T3-E1, rat calvarial osteoblasts) have been a useful first step in identifying putative regulatory signals. Contributions by multiple elements to bone-specific expression of osteocalcin are implicated (Towler et al., 1994a; Heinrichs et al., 1995; Bidwell et al., 1993; Ducy and Karsenty, 1995).Additionally, gel mobility shift assays, footprint analysis, and partial characterization of the proteins that form complexes that associate with both basal and steroid hormone response elements indicate that distinct transcription factors are present in nuclear extracts from proliferating osteoblasts (not expressing osteocalcin) when compared to postproliferative osteoblasts. These modifications support developmental regulated expression during osteoblast differentiation. In osteosarcoma cells, further differences in the element-specific associated factors are observed (van den Ent et al., 1993;Bortell et al., 1993;Lian et al., 1992, 1993b;Shakooriet al., 19941,and osteosarcoma cell lines exhibiting different phenotypic properties (Rodan and Noda, 1990)can provide valuable information as well. A third level of regulation involves the ability of hormones or growth factors t o modulate binding of nonreceptor transcription factors to other regulatory sequences. For example, vitaminD-induced interactions occur at the basal OC box I and TATA domain (Hodgkinson et al., 1993; Owen et al., 1993; Bortell et al., 1992). It is this complexity that allows for hormone responsiveness in relation to either basal or enhanced levels of expression. The specificprotein-DNA interactions as they relate to transcriptional-activity-mediating developmental and tissue-specific expression of osteocalcin are described in
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
465
detail later for each of the characterized regulatory sequences of the osteocalcin gene.
C. OSTEOCALCIN PROMOTER ELEMENTS MEDIATINGDEVELOPMENTAL AND TISSUE-SPECIFIC REGULATION 1. The Conserved OC Box I: A Homeodomain Protein-Binding Site
The transcription factor complexes binding to OC box I have been partially characterized. Several functional experimental approaches (includingmutation and analysis of the element with transfections into osseous and nonosseous cell lines and overexpression or antisense inhibition of putative transcription factors) strongly support a role for this element in bone-specific osteocalcin gene expression. The OC box I site interacts with a novel bone-specific binding protein and homeodomain transcription factors that regulate skeletal development and specific pattern formation in the embryo. Promoter deletion and mutational analysis of the OC box I (nt -99 to -76) have demonstrated that this sequence is required for basal expression (Hoffmannet al., 1994,1996;Towler et al., 1994a;Heinrichs et al., 1995).This highly conserved 24-nt domain is identical in mouse and rat; the human has only 2 nt substitutions. However, these two nucleotides can be attributed to selective binding of species specific complexes (Heinrichs et al., 1993a, 1995). We first described the OC box with a central core CCAAT motif flanked by two AP-1 sites (Owen et al., 1990b).Several studies have confirmed that none of the known CCAAT box binding factors (CBF-NFY, C-EBP, and TF-NF1) interact with the OC box I sequence (Towleret al., 1994a).Rather, there are striking similarities between sequences residing within the OC box and homeodomain protein-binding sites (CAATTAGT) (Hoffmann et al., 1994, 1996;Towler et al., 1994a,b;Heinrichs et al., 1993a;Catron et al., 1993). Mutational analysis and competition gel mobility or transcription assays provide evidence for binding MSX-1and MSX-2 proteins, members of the Msh homeodomain gene family, to the OC box (Hoffmann et al., 1994; Towler et al., 1994b),as well as rHox (Hu et al., 1999, a member of the Engrailed gene family, and Dlx-5 (Ryoo et al., 1997),a member of the Distal-less family of homeobox-containinggenes essential for limb development (Lufkin et al., 1992; Ferrari et al., 1995). Several studies have established suppressor regulation of the OC gene by these MSX2 homeodomain proteins (Hu et al., 1995;Hoffmann et al., 1994,1996). MSX-2 mRNA levels decline from the growth to differentiation periods in fetal rat calvaria-derivedosteoblast cultures (Hoffmannet al., 1994),
466
JANE B. LIAN et al.
which is consistent with MSX-2 mediating down-regulation of osteocalcin transcription. Dlx-5, which is expressed in mature osteoblasts when osteocalcin expression is maximal, may serve as a transcriptional repressor compatible with regulation of genes expressed in postproliferative bone cells. It appears that there is a requirement to stringently control the levels of the gene product osteocalcin to modulate physiological regulation of skeletal homeostasis. It is becoming increasingly evident that selective utilization of promoter regulatory factors provides the required flexibility to execute such control under diverse biological conditions. Can one attribute tissue-specific regulation of osteocalcin to homeodomain proteins based on these observations? Interestingly, a domain in the mouse a1 collagen promoter confers a high level of osteoblast expression (Pavlinet al., 1992;Liska et al., 1994; Rossert et al., 1996), and this enhanced activity may involve homeodomain protein binding (Rossert et al., 1996; Dodig et al., 1996). A molecular mechanism for consideration in osteocalcin gene activation at the OC box is through binding of a nonhomeodomain protein. We have shown by gel-binding assays that complexes unrelated to Hox proteins binds to the OC box at nucleotides that overlap and flank the core Hox-binding site and this complex, designated OCBP-1, is present only in osteoblasts (Hoffmann et al., 1996). Mutations within the OC box that abrogate binding of the Hox proteins and/or mediate enhancement of binding of the osteoblast-specific complex, results in 2 to 3-fold enhanced transcriptional activity (Hoffmann et al., 1996). The data suggest mutual exclusive occupancy of these two classes of transcription factors, the osteoblast-specific complex, and the homeodomain proteins based on competition and methylation interference studies. However, the function of this factor can only be clarified by cloning and directly testing functional activity by overexpression of the factor. In conclusion, the finding of an osteoblast-specific complex-regulating enhancement of promoter activity together with the observation that a mutation in the OC box permits transcription in nonosseous cells and osteoblasts that do not express osteocalcin (e.g., UMR cells, R2 fibroblasts, FRTL thyroid cells, and HeLa cells), strongly supports the contribution of the OC box in regulating tissue-specific expression of the gene. OC box I is also involved in mediating cyclic AMP (CAMP)responsiveness (PuGGTCAmotif) (Towler and Rodan, 1995). This finding was corroborated in a study examining the rapid response of the OC promoter to parathyroid hormone (PTH) (Yu and Chandrasekhar, 1997). Although the novel CAMPresponse region overlapping the OC box I is essential, full activation appears to require several putative CAMPresponse elements throughout the promoter.
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
467
Notably, contiguous to the OC box resides an E box motif postulated t o also contribute to suppression of osteocalcin gene transcription in proliferating osteoblasts and perhaps nonosseous cells. E box motifs bind the Id helix-loop-helix regulatory molecules (Kawaguchi et al., 1992; Tamura and Noda, 1994; Siddhanti and Quarles, 1994). Id is not detected in postproliferative osteoblasts and over expression of Id in MC3T3-El cells suppresses osteoblast differentiation and osteocalcin expression (Murray et al., 1992; Ogata and Noda, 1991). Furthermore, it has been shown that 1,25(OH),D, down-regulates Id expression in Ros 17-2.8 cells (Kawaguchi et al., 19921, conditions that lead to increased osteocalcin expression (van den Ent et al., 1993; Bortell et al., 1993). However, identity of the factor interacting with the OC E box awaits further characterization. Furthermore, Quarles et al. (1997) have shown by mutagenesis of the OC E box sequence that activity of these factors may not be globally essential. In summary, several classes of transcription factors can bind the E-OC box domain contributing to tissue-specific and developmental regulation of the gene by suppressing its activity in nonosseous and proliferating or immature osteoblasts and activating transcription postproliferatively. Caution must be exercised in making generalization about H-L-H protein control of bone related gene transcription. 2. The Cbfa IAML Sequences: Runt Homology Domain Protein-Binding Sites Three sites in the rat promoter (Fig. 3A) were first identified as a consensus sequence in the rat osteocalcin promoter that bound an osteoblast-specific nuclear matrix complex, designated NMP2 (Bidwell et al., 1993; Merriman et al., 1995).The nuclear matrix is an anastomosing network of filaments that provides both structural framework, connecting the nucleus to the cytoplasm, and functions in concentrating and harboring transcription factors as well as providing scaffoldingproteins that bind genes in specific conformations. These sites were established as DNA binding sequences for runt homology domain proteins AMLCBFA-PEBPa transcription factor family (Merriman et al., 1995).These sites also bind an osteoblast-specific nuclear extract complex (Bidwell et al., 1993;Merriman et al., 1995; Banerjee et al., 1996a; Lian et al., 1996; Ducy and Karsenty, 1995).Aseries of studies including competition studies and antibody supershifts of the osteoblast specific complex and the effect of forced expression of CBFA proteins on OC promoter activity established that the CBFA-AML family of proteins regulates osteocalcin expression and functions as a potent enhancer element (Banerjee et al., 1996a, 1997;Ducy et al., 1997; Geoffroy et al., 1995).
468
JANE €3. LIAN et a1
Sequential deletion of 5’ regulatory sequences of the rat (Banerjee et al., 1996b; Hoffmann et al., 1994) established that the proximal Cbfa site (nt - 138 to - 1301, designated site C or OC box I1 (Banerjee et al., 1996a;Bidwell et al., 1993;Merriman et al., 1995)in rat (Banerjee et al., 1996a) and OSE2 in mouse (Geoffroy et al., 19951, contributes t o 75% of basal transcription. Furthermore, a single Cbfa motif of the rat site C (Banerjee et al., 1997)or multimers of mouse OSE2 (Ducy et al., 1997) could confer expression of an OC promoter fragment in nonosseous cells when AML-1B-Cbfa2 was overexpressed (Banerjee et al., 1997). However, our most recent studies (A. Javed, unpublished observations in this laboratory) indicate that mutation of site C-OC box I1 alone within the context of the full OC promoter (- 1100 nt) minimally decreases promoter activity. Only when all three Cbfa recognition sites A, B, and C are mutated, does transcription decrease to 20%of control levels. The residual tissue-specific activity is contributed by the OC box I. These findings suggest a required synergy among the sites for transcriptional control of osteocalcin expression. The .mechanisms accounting for this regulation involve association of Cbfa factors with the nuclear matrix (see Section IV,D). Fundamental questions remain to be addressed related to Cbfa 1regulation of osteoblast-expressedgenes. These include (1)the specific biological activities of different Cbfa proteins present in osteoblasts at different stages of maturation; (2) the sequence-specificpromotor context for binding of individual isoforms; and (3) the regulation of activity of Cbfa factors by interaction with several classes of partner proteins. These partners include heterodimerization with either Cbfp, which results in a transcriptional activator complex, or Groucho/transducin-like enhancer of split (TLE)(Aronsonet al., 1997;Stifani et al., 19921,which represses Cbfa 1activity on the osteocalcin promoter (Guo et al., 1998; Thirunavukkarasu et al., 1998). An additional function of Cbfa complexes that is suggested from mutational analysis of the osteocalcin gene (Javed et al., 1998) and other studies (Palaparti et al., 1997) is a contribution to chromatin organization. Like osteocalcin, the TGFp receptor promoter (Ji et al., 1997) and bone sialoprotein promoter have multiple Cbfa sites which may function in promoter structural oranization through interactions with the nuclear matrix (Stein et al., 1997). Complex splicing variants generate several Cbfa 1proteins (Geoffroyet al., 1998; Stewart et al., 1997)that heterodimerize with members of the CBFP family exhibit tissue-restricted modifications. To what extent these factors contribute to tissue-specific gene regulation remains to be established.
REGULATEDEXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
469
Together, characterization of OC box I and the Cbfa 1sites supports the concept that multiple elements contribute to and may be necessary for stringent tissue-specific gene expression or they may serve redundant functions. It is also of interest t o note that the Cbfa 1site C is contiguous to the AP-l-like sequence that mediates TGFp (Banerjee et al., 1996b) and fibroblast growth factor 2 (FGF-2)(Boudreaux and Towler, 1996)responsiveness. Thus, this conserved OC box I1 domain (Fig. 3A) appears to be a critical element in modulating both tissue-specific and physiological responsiveness of the OC gene. OF DIFFERENT SIGNALING PATHWAYS D. AP-1 SITES:CONVERGENCE
There are several AP-1 motifs within the osteocalcin gene promoter that function as independent elements or overlap other regulatory domains and have shared responsiveness to other physiologic regulators. Initially, two AP-1 sites within the OC box were identified by their ability to bind fos and jun heterodimer complexes (Owen et al., 1990b). However, it is now understood that transcriptional activity at the OC box is mediated largely through the homeodomain protein binding site. In the rat promoter, a single AP-l-like motif mediates TGFp (Banerjee et al., 1996b) and FGF (Boudreaux and Towler, 1996) responsiveness. In the human osteocalcin gene promoter, an additional AP-1 site located between the VDRE and the OC box with homology to a collagen repressor element, functions in suppressing osteocalcin transcription and also influences vitamin D regulation (Goldberget al., 1996). An AP-1 site lies within the vitamin D response element of the rat osteocalcin promoter but is contiguous to the VDRE in the human OC promoter (Ozono et la., 1991).The regulation of AP-1 family members by steroid hormones and their interactions with the steroid receptor has been reviewed (Hyder et al., 1994; Landers and Spelsberg, 1992; Saatcioglu et al., 1994).Functional interactions of the vitamin D receptor by AP-1 binding has been reported in several studies (Owen et al., 1990b; Lian et al., 1991; Breen et al., 1994). The rat osteocalcin VDRE binds recombinant AP-1 factors or AP-1 factors from nuclear extracts of proliferating osteoblasts when minimal binding of VDR occurs, suggesting mutually exclusive occupancy by these factors (Owen et al., 1990b).In studies where the steroid half-elements in the VDRE are mutated, but the AP-1 sequence was retained in rat OC promoter-CAT reporter gene, suppression of promoter activity was observed in the presence of vitamin D, supporting the hypothesis that binding of AP-1 factors oppose the enhancer activity of the vitamin D receptor (VDRI-retinoid X receptor (RXR) heterodimer complex. However, mutations of 2 nt in the
470
JANE B. LIAN et al.
n = 3 spacer of the rat VDRE, which abrogated binding of AP-1 factors and retained VDR-RXR binding, resulted in loss of vitamin-D-mediated enhancer activity (Aslam, 1996; L. R. McCabe, J., Stein, G., Stein, and J. Lian, unpublished observations in this laboratory). This observation suggests that synergistic interactions between AP-1 factor and the VDR-RXR complex may be required for enhancer activity. Notably, the mouse osteocalcin VDRE lacks an internal or contiguous AP-1 motif and is resistant to enhancer activity by 1,25(OH),D3 (Clemens et al., 1997; Lian et al., 1997; Sims et al., 1997). A fra-%containing complex has been shown t o associate with the native rat OC VDRE sequence (McCabe et al., 1996) supporting the general concept that steroid hormone receptor complexes have multiple options for protein-protein interactions to respond to physiological requirements for transcriptional activity of the gene. The significance of fra-2 binding to osteocalcin AP1sites is discussed later. AP-1 activity is maximal in proliferating osteoblasts, consistent with a mode of phenotype suppression that was proposed to explain the absence of osteocalcin transcription and vitamin D inducibility in proliferating cells (Lian et al., 1991). We addressed the mechanism by which suppression of osteocalcin transcription mediated by binding of c-fos and c-jun heterodimers can be reversed postproliferatively when the gene is transcribed. One experimental approach was to examine expression (mRNA and protein levels) of the various fos and jun family members (McCabe et al., 1996). We found fra-2, jun-D, and jun-B protein and mRNA to remain at detectable levels in differentiated 0steoblasts, whereas c-fos and c-jun declined rapidly after the proliferative period. Indeed, the composition of the AP-1 heterodimer complex in differentiated osteoblasts could be accounted for largely by frai2 and jun-D. To test if these family members could functionally regulate the osteocalcin gene, they were overexpressed in ROS cells together with rat OC promoter-deletion constructs. Three- to 4-fold elevations in OC promoter activity were conferred on overexpression of fra-2 and jun-D, whereas c-fos-c-jun decreased promoter activity. Thus, the representation of fra-2 and jun-D in differentiated osteoblasts may account for the high basal levels of osteocalcin transcription that occur as the 0steoblasts mature during mineralization of the extracellular matrix. The enhancer activity was confined largely to the AP-1 site (nt -146 to - 139),which lies contiguous to the Cbfa 1sequence in the proximal promoter (Banerjee et al., 1996a,b);however, fra-2 binding to the VDRE may contribute to the enhancer activity of 1,25(OH),D3. One can conclude that the selective representation of high levels of fos/jun family members during osteoblast differentiation, and the ability for these het-
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
47 1
erodimers either to suppress or enhance OC, support the concept that AP-1 sites are key components of developmental regulation of osteocalcin expression. The AP-1 site at nt - 146 to - 139 in the rat osteocalcin promoter, in addition t o its role in regulating basal transcription, can mediate physiologic responsiveness to growth factors. TGFp1, a regulator of bone development, suppresses osteocalcin transcription and promoter activity (Banerjee et al., 1996b; Price, 1988; Pirskanen et al., 1994). The TGFp response element in the proximal region of the rat osteocalcin promoter has been characterized by promoter deletion and mutation analysis (Banerjee et al., 1996b),in which both transcriptional activity and transcription factor binding were assayed. This led t o the identification of an AP-1-CAMP response element (CRE)like sequence in the rat promoter, TGCAGTCA, as the osteocalcin gene TGFp response element. Antibody supershift analysis established that fra-2 is a component of the AP-1 heterodimer binding to the TGFp response element, and fra2 appears to be posttranslationally modified in response t o TGFp (Banerjee et al., 1996b). The data suggests a mechanism whereby TGFpl induces phosphorylation of fra-2 in repression of OC gene transcription. TGFp activity is thus linked to other signaling pathways operative in the control of osteocalcin gene transcription, reflected by binding of proteins encoded by the fos-jun early response gene family t o the osteocalcin TGFP-promoter element. Of interest is the recent finding that basic bFGF or FGF-2 responsiveness of the rat OC promoter is also mediated in part by activities at this AP-1 site (nt - 144 t o -138, GCAGTCA) (Boudreaux and Towler, 1996). FGF-2 responsiveness, however, requires in addition the PuGGTCA motif at -99 t o -90 in the OC box I domain. This motif is one of two PuGGTCA sequences that maps to CAMPresponsiveness (Towler and Rodan, 1995). This CAMPresponse element is also involved in transient parathyroid hormone effects on osteocalcin promoter activity (Yu and Chandrasekhar, 1997).Although mutation and transfection studies in bone cells clearly establish the AP-1 element (nt -144 to -138) both as a TGF-p response element (TGRE) and an FGF response element (FGRE), what cannot be evaluated for comparison are the involved DNA binding factors. The studies characterizing the TGRE and FGRE used nuclear extracts from different cell types and stages of maturation. Because FGF-2 enhances (while TGFp represses) osteocalcin transcription, the interrelationship of transcription factors mediating these responses become important. Thus, it appears that several independent signaling pathways can converge in modulating OC gene transcription at several AP-1 sites and three of these overlap regulatory do-
472
JANE B. LIAN et a1
mains essential for transcription, OC box I, OC box 11-site C, and the VDRE. ELEMENTS CONTRIBUTING TO STEROID RESPONSIVENESS E. PROMOTER The two steroid hormones, glucocorticoids and 1,25(OH),D,, have complex effects on osteoblast growth, differentiation, and cellular activities related to bone turnover. Furthermore, steroid hormone effects in uitro are dependent on species and origin of the osteoblast [vertebrae or long bone (Suwanwalaikorn et al., 199711 coupled with the maturational stage (osteoprogenitors compared to differentiated phenotype). Several unique features of the osteocalcin gene steroid hormone response elements enable the osteocalcin gene to respond to these hormones under the diverse biologic conditions that results as a consequence of stimulation of osteoblast growth or maturation. By appreciating the contribution of specific modifications of transcription factors related to the cellular phenotype and the cascade of factors regulated by steroid hormones that impinge on specific recognition sequences and crosstalk between regulatory sequences (Nanes et al., 1994; Zernik et al., 19901, molecular mechanisms can be dissected that allow for such physiologic control of transcriptional activity. The glucocorticoid regulatory element of the human osteocalcin gene that was initially characterized is associated with the TATA domain (Stromstedt et al., 1991; Morrison and Eisman, 1993). Glucocorticoids mediate transcriptional down-regulation of the rat and human osteocalcin promoters in ROS 17-2.8 cells and human osteoblasts (Liggett et al., 1994; Jaaskelainen et aZ., 1994). The presence of glucocorticoid regulation (GR)binding sites in close proximity to the basal TATA box suggests interference of GR with the positive transcription factors, such as TFIIB, as a mechanism for negative regulation of osteocalcin by glucocorticoids. Glucocorticoid regulation of gene transcription has been well documented to involve GR-protein interactions at the same sites or other sites, including AP-1 regulatory sequences truss and Beato, 1993; Miner and Yamamoto, 1991; Saatcioglu et al., 1994). The rat promoter exhibits both suppressor activities [e.g., in ROS 17-2.8 cells (Jaaskelainen et al., 1994)l and enhanced transcription by glucocorticoid [e.g., in immature osteoblasts (Shalhoub et aZ., 199211. From studies of the rat osteocalcin promoter, it is now appreciated that multiple GRE domains are involved in modulating glucocorticoid effects on osteocalcin gene transcriptional activity (Heinrichs et al., 1993b;Aslam et al., 1995). The highly homologous TATA-GRE domain in the rat and human osteocalcin genes, and the additional high-affin-
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
473
ity GREs downstream of the TAT and upstream of the VDRE in the rat gene, are illustrated in Fig. 3. For both genes, these sites were identified using purified glucocorticoid receptor and 32P-labeled DNA fragments, confirming protein-DNA interactions at single-nucleotide resolution by DNase I footprinting and methylation interference assays. Analysis of transcriptional activity by promoter-CAT constructs and protein-DNA binding assays revealed that the distal consensus nGRE (nt -697 to -683) contributed to glucocorticoid suppression of promoter activity. The strong suppressor activity of the distal GRE is consistent with its nucleotide sequence (Truss and Beato, 1993). The proximal GRE (nt -16 to -1) could contribute to both positive or negative control of osteocalcin transcription (Aslam et al., 1995).Analysis of the DNA-binding complexes at the proximal and distal sequences indicate modifications of GR interactions as a function of the transcription activity of dexamethasone on endogenous expression during osteoblast differentiation (Aslam et al., 1995). Note that dexamethasone also has significant effects in stabilizing osteocalcin mRNA, thereby providing a mechanism to support increased protein synthesis in dexamethasone differentiated osteoblasts when transcription is down-regulated (Shalhoub et al., 1998). In addition to these two functional GREs, DNase I, and dexamethasone (DMS) protection assays of purified glucocorticoid receptor bound to osteocalcin DNA fragments identified two seroid half-elements at -98 to -93 and - 114 to - 109, separated by 10 nucleotides, located within and immediately upstream of the rat osteocalcin box (Heinrichs et al., 1993b). Mutation of the high-affinity GRE (- 16 to - 1)in a promoter-CAT construct containing either -348 or -108 nt resulted in only partial loss of the response to dexamethasone, implicating potential utilization of these proximal promoter GR binding sites (Aslam et al., 1995). However, only mutation of all GR binding sites (distal and proximal domain) simultaneously will completely abrogate dexamethasone responsiveness (Aslam, 1996).Notably, the half-steroid motifs have been reported to potentially mediate other activities. In the rat osteocalcin promoter, these motifs mediate CAMPresponsiveness and they bind complexes that recognize the thyroid hormone element palindrome (Towler and Rodan, 1995). In summary, these data demonstrate that multiple sites integrate glucocorticoid regulation of the osteocalcin gene, contributing to the complexity that supports steroid-hormone-dependent transcriptional activities that are unique in various cells. Additionally, glucocorticoid receptor binding within the proximal promoter region of the osteocalcin gene may provide different mechanisms by which glucocorticoids
474
JANE B. LIAN et al.
can exert their effects on basal and vitamin-D-enhanced osteocalcin gene expression or in response to other effects. The vitamin D responsive elements of the rat and human osteocalcin genes have been identified and characterized by several approaches (Morrison et al., 1989; Demay et al., 1990,1992a;Markose et al., 1990; Kerner et al., 1989; Terpening et al., 1991). The osteocalcin VDRE was the first to be identified and is similar to the family of related steroid response elements (Truss and Beato, 1993). The VDRE functions as an enhancer (Yoon et al., 1988;Breen et al., 1994;Morrison et al., 1989;Demay et al., 1990; Markose et al., 1990; Kerner et al., 1989;Terpening et al., 19911, but the VDRE transcription factor complex appears to be a target for modifications in vitamin-D-mediated transcription by other physiologic factors, such as glucocorticoids (Godschalk et al., 1992; Schepmoes et al., 1991), TGFp (Pirskanen et al., 1994; Staal et al., 19941, retinoic acid (MacDonald et al., 19931, and TNFa (Nanes et al., 1994; Mayur et al., 1993). The minimal VDRE is characterized by two half-steroid motifs (either perfect or imperfect direct repeatskeparated by 3 nt indicated by protein-DNA contacts and mutational analysis (Morrison et al., 1989; Demay et al., 1990,1992a;Markose et al., 1990;Kerner et al., 1989;Terpening et al., 1991).Characterization of the VDRE in other vitamin-Dregulated genes [osteopontin (Nodaet al., 1990;Zhang et al., 1992;Rafidi et al., 19941, calbindin D9K (Darwish and DeLuca, 1992), calbindin D28K (Gill and Christakos, 19931,PTH (Demayet al., 1992b),the transcription factor Pit-1 (Rhodeset al., 1993),the integrin p3 subunits (Cao et al., 19931, and the vitamin D, 24-hydroxylase enzyme gene (Zierold et al., 1994; Ohyama et al., 199411 show similar features. Notably, the VDRE of the PTH gene mediates transcriptional down-regulation and regulation of the 24(OH)ase gene is controlled by two independent VDREs. Studies have shown that the thyroid hormone, retinoic acid, and vitamin D receptors can activate from the steroid “core”direct repeat but with different spacers (Perlmann et al., 1993;Umesono et al., 1991;Yu et al., 1991;Carlberg et al., 1993;Kliewer et al., 1992;Schrader et al., 1993). These receptors, including the VDR, can form heterodimers in vitro with the receptor for 9-cis-retinoic acid (9-cis-RA)or RXR (Perlmann et al., 1993; Carlberg et al., 1993; Kliewer et al., 1992; Schrader et al., 1993; Towers et al., 1993; Freedman et al., 1994; Nishikawa et al., 1994; Cheskis and Freedman, 1994).The osteocalcin gene is stimulated by RXR-VDR heterodimers, and 9-cis-RA inhibits 1,25-dihydroxyvitamin D, activation by decreasing availability of the RA receptors (MacDonald et al., 1993). These possibilities provide for regulated activity under diverse biological conditions.
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
475
Multiple factors appear t o contribute to the formation of the VDR complex in uiuo, including the possibility for homo- or heterodimer formation with RXR (as discussed above). The transactivation complex of the osteocalcin VDRE formed from nuclear extracts of osteoblast complex formation is potentially influenced by other cell specific nuclear accessory factors, coactivators, or corepressors (Horwitz et al., 1996; Ross et al., 1992; Nakajima et al., 1994; Sone et al., 1991; Oiiate et al., 1995; Li et al., 1997a,b; Schroen et al., 1997; Masuyama et al., 1997); interactions with other transcription factors [e.g., the TATA binding factor TFIID (MacDonaldet al., 1995; Blanco et al., 199513;involvement of the ligand in VDR stabilization (Cheskis and Freedman, 1994; Pan and Price, 1987; Wiese et al., 1992;Arbour et al., 1993; Ross et al., 1993);receptor levels modulated by physiologic factors (Mahonen et al., 1990; Van Leeuwen et al., 1990; Krishnan and Feldman, 1991);phosphorylation of the receptor (Brown and DeLuca, 1990;Jurutka et al., 1993;Darwish et al., 1993; Desai et al., 1995); and vitamin D receptor gene polymorphisms (Morrison et al., 1992). The osteocalcin VDRE functions as an enhancer; it cannot induce transcription but requires basal expression and, furthermore, the increases in transcription are regulated by basal levels. What molecular mechanisms are operative at the osteocalcin VDRE that control these refinements for vitamin D enhancement? For example, why is VDR receptor complex formation at the osteocalcin VDRE either blocked or inactive in proliferating osteoblasts? What allows for a 10- to 20-fold enhanced transcription when basal levels are very low, whereas other vitamin-D-regulated genes (e.g., osteopontin and collagen) are responsive and only a 2- to 3-fold increase when osteocalcin expression is maximal (Owen et al., 1991; Lian et al., 1989; Lian et al., 1994)? Several possibilities for this regulation exist, including evidence for (1) “crosstalk” between activities at the VDRE and proximal basal elements in rat osteocalcin promoter (Bortell et al., 1992; Blanco et al., 1995; MacDonald et al., 1995; Guo et al., 1997);(2) modifications in activity of the VDR-RXR through protein interactions with coactivators (Horwitz et al., 1996; Li et al., 1997b); (3) 1,25(OH),D, regulation of transcription factors contributing to osteocalcin basal expression as Msx-2 (Hodgkinson et al., 1993; Hoffmann et al., 1994) and CBFAl (Zhang et al., 1997); (4) binding of transcription factors other than the VDR-RXR complex to DNA-binding sequences that overlap the steroid half-elements (Fig. 3B); ( 5 ) synergism with other regulatory elements (Sneddon et al., 1997); and (6) chromatin modifications induced by the steroid hormone (Montecino et al., 1996, 1997). Our studies indicate subtle differences in the properties of the vitamin D receptor complex-
476
JANE B. LIAN et al.
es that bind to the rat osteocalcin VDRE are related to the cellular phenotype (e.g.,osteosarcoma, proliferating and differentiated, and diploid cells) (Owen et al., 1993; Bortell et al., 1993; Shakoori et al., 1994; Lian and Stein, 1992). Differences in vitamin D regulation of osteocalcin transcription among the species (e.g.,human, mouse, and rat) may also be accounted for by nucleotide variations of the steroid half-elements and flanking sequences. Notably, although rat (Baker et al., 1992; Frenkel et al., 1997) or human (Kesterson et al., 1993; Clemens et al., 1997; Sims et al., 1997) OC promoter-reporter constructs expressed in transgenic mice or expressed in mouse MC3T3-El cells (Lian et al., 1997)respond to 1,25(OH),D3in the expected 3- to 6-fold increases in transcription, the endogenous mouse OC gene either is not induced or is down-regulated. This sequence-specific regulation by 1,25(OH),D, of mouse OC promoter-reporter constructs was confirmed in uitro osteoblast models [e.g., ROS 17/23 cells (Lian et al., 1997)l. Several possible mechanisms may explain these findings. As described in Section IV,C, AP-1 sequences associated with the rat and human osteocalcin genes are likely a contributing mechanism to the level of vitamin D regulation, but AP-1 sequences do not occur within or contiguous t o the mouse VDRE. The putative mouse VDRE was shown to bind the VDR-RXR heterodimer complex in one study (Lian et al., 19971,but not another report (Zhang et al., 1997), and was down-regulated by 1,25(OH),D3 on a heterologous promoter (Lian et al., 1997). However, a functional mouse VDRE has not been demonstrated by mutational analysis of the mouse promoter. Studies from our group provide evidence for another viable mechanism that influences VDR-mediated activity at the rat osteocalcin VDRE (Guo et al., 1997). W1 is a multifunctional transcription factor (Shrivastava and Calame, 1994; Bushmeyer et al., 1995),and we have identified a YY1 recognition sequence that overlaps the proximal halfsteroid motif of the VDRE. This functional sequence mediates YY1-dependent repression of 1,25(0H),D3-enhanced osteocalcin gene promoter activity (Guo et al., 1997). This recognition sequence is not present in the osteopontin VDRE, a gene that is expressed and vitamin-D-regulated in proliferating osteoblasts. As TFIIB, a TATA binding factor, and the VDR can interact directly (MacDonald et al., 1995; Blanco et al., 1995), and YY1 can function like a TATA-binding protein (Usheva and Shenk, 19941,a plausible mechanism of activity is that YY1-VDRE interactions interfere with the DNA-binding-dependent TFIIB-VDR interaction and consequently abrogates vitamin D enhancement of osteocalcin gene transcription in uiuo. This activity of YY1 at the OC VDRE may involve transient association of YY1 with the nuclear ma-
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
477
trix (see Section V,C). Taken together these relationships may provide an explanation for positive or negative activity of a single regulatory sequence under different biological conditions.
V. CHROMATIN STRUCTURE, NUCLEOSOME ORGANIZATION, AND OSTEOCALCIN GENE-NUCLEAR MATRIX INTERACTIONS SUPPORT INTERRELATIONSHIPS BETWEEN ACTIVITIES AT MULTIPLE
INDEPENDENT PROMOTER ELEMENTS OF NUCLEAR ARCHITECTURE CONTRIBUTE A. PARAMETERS TO TRANSCRIPTIONAL CONTROL
There is a growing awareness of functional interrelationships mediating nuclear structure and function. Historically, there was a perceived dichotomy between regulatory mechanisms supporting gene expression and components of nuclear architecture. However, this parochial view is rapidly changing. The emerging concept is that both transcription and DNA synthesis occur in association with structural parameters of the nucleus. Consequently, it has become increasingly evident that the cellular and molecular mechanisms must be defined that contribute to both the regulated and regulatory relationships of nuclear morphology to the expression and replication of genes. During the past several years, there has been an accrual of insight into the complexities of transcriptional control in eucaryotic cells. Our concept of a promoter has evolved from the initial expectation of a single regulatory sequence that determines transcriptional competency and level of expression. We now appreciate that transcriptional control is mediated by an interdependent series of regulatory sequences that reside 5',3' and within transcribed regions of genes. Rather than focusing on the minimal sequences required for transcriptional control t o support biological activity, efforts are being directed toward defining functional limits. Consequently, contributions of distal flanking sequences to regulation of transcription are being experimentally addressed. This is a necessity for understanding mechanisms by which multiple promoter elements are responsive to a broad spectrum of regulatory signals and the activities of these regulatory sequences are functionally integrated. Crosstalk between a series of regulatory domains must be understood under diverse biological circumstances where expression of genes supports cell and tissue functions. The overlapping binding sites for transcription factors within promoter regulatory elements and protein-protein interactions that influence tran-
478
JANE B. LIAN et a1
scription factor activity provide further components of the requisite diversity to accommodate regulatory options for physiologically responsive gene expression. As the intricacies of gene organization and regulation are elucidated, the implications of a fundamental biological paradox become strikingly evident. How, with a limited representation of gene-specific regulatory elements and low abundance of cognate transactivation factors, can sequence-specific interactions occur to support a threshold for initiation of transcription within nuclei of intact cells? Viewed from a quantitative perspective, the in uiuo regulatory challenge is t o account for formation of functional transcription initiation complexes with a nuclear concentration of regulatory sequences that is approximately 20 nucleotides per 2.5 yards of DNA and a similarly restricted level of DNA binding proteins. There is a growing appreciation that nuclear architecture provides a basis for support of stringently regulated modulation of cell growth and tissue specific transcription that is necessary for the onset and progression of differentiation. Here, multiple lines of evidence point to contributions by three levels of nuclear organization to in uiuo transcriptional control where structural parameters are functionally coupled to regulatory events. The primary level of gene organization establishes a linear ordering of promoter regulatory elements. This representation of regulatory sequences reflects competency for responsiveness t o physiological regulatory signals. However, interspersion of sequences between promoter elements that exhibit coordinated and synergistic activities indicates the requirement of a structural basis for integration of activities at independent regulatory domains. Parameters of chromatin structure and nucleosome organization are a second level of genome architecture that reduces the distance between promoter elements, thereby supporting interactions between the modular components of transcriptional control. Each nucleosome (approximately 140 nucleotide base pairs wound around a core complex of two each of H3, H4, H2, and H2B histone proteins) contracts linear spacing by 7-fold. Higher order chromatin structure further reduces nucleotide distances between regulatory sequences. Folding of nucleosome arrays into solenoid-type structures provides a potential for interactions that support synergism between promoter elements and responsiveness to multiple signaling pathways. A third level of nuclear architecture that contributes to transcriptional control is provided by the nuclear matrix (Bird, 1997; Berezney and Jeon, 1995). The anastomosing network of fibers and filaments that constitute the nuclear matrix supports the structural properties of the nucleus as a
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
479
cellular organelle and accommodates structural modifications associated with proliferation, differentiation, and changes necessary to sustain phenotypic requirements of specialized cells (Dworetzky et al., 1990; Fey et al., 1986; Fey and Penman, 1988; Capco et al., 1982; Getzenberg et al., 1991; Pienta and Coffey, 1991; Zeng et al., 1997). Regulatory functions of the nuclear matrix include but are by no means restricted to DNA replication (Berezney and Coffey, 1975; Vaughn et al., 1990;Jackson and Cook, 19861,gene localization (Robinsonet al., 19821, imposition of physical constraints on chromatin structure that support formation of loop domains (Nelkin et al., 1980;Ciejek et al., 1983; Cockerill and Garrard, 1986;Mirkovitch et al., 1984),concentration and targeting of transcription factors (Merriman et al., 1995; Bidwell et al., 1993; Dworetzky et al., 1992; Zeng et al., 1997; Schaack et al., 1990; Dickinson et al., 1992; van Wijnen et al., 19931, RNA processing and transport of gene transcripts (van Eekelen and van Venrooij, 1981;Xing et al., 1993; Jackson et al., 1981; Herman et al., 1978; Blencowe et al., 1994; Mortillaro et al., 1996; Grande et al., 19961, posttranslational modifications of chromosomal proteins (Hendzel et al., 1994), and imprinting and modifications of chromatin structure (Brown et al., 1992). Taken together these components of nuclear architecture facilitate biological requirements for physiologically responsive modifications in gene expression within the contexts of (1)homeostatic control involving rapid, short-term, and transient responsiveness; (2) developmental control that is progressive stage-specific, and (3) differentiation-related control that is associated with long-term phenotypic commitments to gene expression for support of structural and functional properties of cells and tissues. We are just beginning to comprehend the significance of nuclear domains in the control of gene expression. However, it is already apparent that local nuclear environments that are generated by the multiple aspects of nuclear structure are intimately tied to developmental expression of cell growth and tissue-specific genes. From a broader perspective, reflecting the diversity of regulatory requirements as well as the phenotype-specificand physiologically responsive representation of nuclear structural proteins, there is a reciprocally functional relationship between nuclear structure and gene expression. Nuclear structure is a primary determinant of transcriptional control and the expressed genes modulate the regulatory components of nuclear architecture. Thus, the power of addressing gene expression within the three-dimensional context of nuclear structure would be difficult to overestimate. Membrane-mediated initiation of signaling pathways that ultimately influence transcription have been recognized for some time.
480
JANE B. LIAN et al.
Here, the mechanisms that sense, amplify, dampen, and/or integrate regulatory signals involve structural as well as functional components of cellular membranes. Extending the structure-regulation paradigm t o nuclear architecture expands the cellular context in which cell-structure-gene expression interrelationships are operative. B. DEVELOPMENTAL AND STEROID HORMONE MODIFICATIONS OF OSTEOCALCIN GENECHROMATIN STRUCTURE AND NUCLEOSOME ORGANIZATION Modifications in parameters of chromatin structure and nucleosome organization parallel both competency for transcription and the extent t o which the osteocalcin gene is transcribed. Changes are observed in response to physiological mediators of basal expression and steroid hormone responsiveness. This remodeling of chromatin provides a conceptual and experimental basis for the involvement of nuclear architecture in developmental, homeostatic, and physiologic control of osteocalcin gene expression during establishment and maintenance of bone tissue structure and activity (Fig. 4). In both normal diploid osteoblasts and in osteosarcoma, cells basal expression and enhancement of osteocalcin gene transcription are accompanied by two alterations in structural properties of chromatin. DNase I hypersensitivity of sequences flanking the tissue-specific OC box and the vitamin-D-responsive element enhancer domain are observed (Montecino et al., 1994a,b; Breen et al., 1994). Together with modifications in nucleosome placement (Montecinoet al., 1994a), a basis for accessibility of transactivation factors to basal and steroid-hormone-dependent regulatory sequences can be explained. In the early stage, proliferating, normal diploid osteoblasts when the osteocalcin gene is repressed nucleosomes are placed in the OC box and in VDRE promoter sequences, and nuclease hypersensitive sites are not present in the vicinity of these regulatory elements. In contrast, when osteocalcin gene expression is transcriptionally up-regulated postproliferatively and vitamin-D-mediated enhancement of transcription occurs, the OC box and VDRE become nucleosome free and these regulatory domains are flanked by DNase I hypersensitive sites (Fig. 4). Functional relationships between structural modifications in chromatin and osteocalcin gene transcription are observed in response to 1,25(OH),D, in ROS 17-2.8 osteosarcoma cells, which exhibit vitaminD-responsive transcriptional up-regulation. There are marked changes in nucleosome placement at the VDRE and OC box as well as DNase I hypersensitivity of sequences flanking these basal and enhancer osteo-
Nuclear Matrix
VDRE
prox. prom.
1TF's 1
Nuclear Matrix
1 a prox. prom.
DNasel HS YY-1
DNasel HS
VDR/RXR
IVITAMIN D INDUCED1
Nuclear Matrix
-DNasel HS
DNasel HS
FIG. 4.Schematic representation of the association of the osteocalcin promoter with the nuclear matrix and modifications in chromatin organization during osteoblast differentiation. Postulated interactions of the osteocalcin promoter with the nuclear matrix are illustrated for three states of gene transcription. Top panel: In the inactive state (in nonosseous cells or proliferating osteoprogenitors), nucleosomes throughout the gene block transcription factor binding to regulatory sequences in the absence of gene-nuclear matrix interaction. Middle panel: Induction of gene transcription occurring at basal levels (in postproliferative osteoblasts) is reflected by the repositioning of nucleosomes and the detection of hypersensitive sites (HS)in the VDRE domain and the basal OC box domain. Such changes in chromatin may facilitate interaction of the promoter with the nuclear matrix at the NMP-1 (W1)and the three NMP-2 (CBFA1)sites A, B, and C. CBFu factors are largely associated with the nuclear matrix (Zeng et al., 1997). Under basal conditions, the VDRE half-steroid element that binds the NMP-1 nuclear matrix protein complex is tethered to the nuclear matrix. Lower panel: In the presence of the liganded receptor complex, vitamin-D-enhanced transcription is supported by binding of the VDR-RXR receptor complex to the element. The enhancement of hypersensitivity at the VDRE and in a proximal promoter domain modulates these changes in chromatin structure. These postulated transient associations of osteocalcin promoter domains with the nuclear matrix contribute to regulation of basal and steroid hormone mediated transcription.
482
JANE B. LIAN et al.
calcin gene promoter sequences (Montecinoet al., 1994a,b;Breen et al., 1994).The complete absence of hypersensitivity and the presence of nucleosomes in the VDRE and OC box domains of the osteocalcin gene promoter in ROS 24/1 cells, which lack the vitamin D receptor and are therefore refractory to the steroid hormone additionally corroborate these findings (Montecino et al., 1994a,b; Breen et al., 1994). These steroid hormone-responsive alterations in chromatin structure have been confirmed by restriction enzyme accessibility of promoter sequences within intact nuclei (Montecino et al., 1996) and by ligationmediated PCR (LMPCR) (Montecino et al., 1997) at single nucleotide resolution. We have found that agents that induce histone hyper acetylation (sodium butyrate) promote reorganization of the nucleosomal structure in the distal region of the osteocalcin gene promoter (including the VDRE). This transition results in inhibition of the vitamin-D-induced up-regulation of basal transcription in ROS 17-2.8 cells. Additionally, we have established an absolute requirement for sequences residing in the proximal region of the osteocalcin gene promoter for both formation of the proximal DNase I hypersensitive site and basal transcriptional activity. Our approach was to assay nuclease accessibility (DNase I and restriction endonucleases) in ROS 17-2.8 cell lines stably transfected with promoter deletion constructs driving expression of a CAT reporter gene (Frenkel et al., 1996).
C. CONTRIBUTIONS OF THE NUCLEAR MATRIXTO OSTEOCALCIN GENEEXPRESSION Involvement of the nuclear matrix in control of osteocalcin gene transcription is provided by several lines of evidence. One of the most compelling is association of a bone-specific nuclear matrix protein designated NMPB with sequences flanking the VDRE of the osteocalcin gene promoter (Bidwell et al., 1993).An additional NMPB binding site is a tissue-specific regulatory domain in the osteocalcin gene proximal promoter (Banerjee et al., 1996a; Bidwell et al., 1993; Lindenmuth et d., 1997;van Wijnen et al., 1994).Initial characterization of the NMPB factor has revealed that a component is an AML-l-related transactivation protein (Banerjee et al., 1996a; Lindenmuth et al., 1997; van Wijnen et al., 1994). These results implicate the nuclear matrix in regulating events that mediate structural properties of the VDRE domain and basal tissue-specific gene expression. It is apparent from available findings that the linear organization of gene regulatory sequencesis necessary but insufficient to accommodate
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
483
the requirements for physiological responsiveness to homeostatic, developmental, and tissue-related regulatory signals. It would be presumptive to propose a formal model for a three-dimensional organization of the osteocalcin gene promoter that modulates steroid hormone responsive and developmental transcriptional control. However, the working model presented in (Fig. 5 ) represents postulated interactions between OC gene promoter elements that reflect the potential for integration of activities by nuclear architecture to support transcriptional control within a three-dimensional context of cell structure and regulatory requirements at the cell and tissue levels. A role of the nuclear matrix in steroid-hormone-mediated transcriptional control of the osteocalcin gene is further supported by overlapping binding domains within the VDRE for the VDR and the NMP-1 nuclear matrix protein, which we have shown to be aYY1 transcription factor (Guo et al., 1995).One can speculate that reciprocal interactions of NMP-1 and VDR complexes may contribute to competency of the
basal transcription
I
I
proximal DNase HS
distal DNase HS
1
I
Vit D enhancement
FIG.5. Three-dimensional organization of the rat osteocalcin gene promoter. A model is presented for the spatial organization of the rat osteocalcin gene promoter based on evidence for nucleosome placement and the interaction of DNA-binding sequences with nuclear matrix (hatched bars). These components of chromatin structure and nuclear architecture restrict mobility of the promoter and impose physical constraints that reduce distances between proximal and distal promoter elements. Such postulated modifications would mediate transcription factor binding and facilitate cooperative interactions for crosstalk between elements (e.g., VDRE and TATA domains).
484
JANE B. LIAN et a1
VDRE to support transcriptional enhancement. Binding of NMP-2 at the VDRE flanking sequence may establish permissiveness for VDR interactions by gene-nuclear matrix associations that facilitate conformational modifications in the transcription factor recognition sequences. Taken together, these findings provide a basis for involvement of both the nuclear matrix and chromatin structure in modulating accessibility of promoter sequences to cognate transcription factors and facilitating the integration of activities at multiple regulatory domains. In vzvo studies support functional contributions of nuclear matrix proteins to steroid hormone-mediated transcription. Overexpression of AML transcription factors that flank the osteocalcin gene VDRE up-regulates expression, In contrast, overexpression of W1, which binds to a site overlapping the osteocalcin gene vitamin-D-receptor-binding sequences, abrogates the vitamin D enhancement of transcription and displaces VDR-RXR interactions. Functional data supporting nuclear-structuremediated crosstalk between the osteocalcin gene VDRE and the TATA domain are provided by the demonstration that the transcription factor TFIIB and the VDR cooperatively coactivate ligand-dependent transcription (Blanco et al., 1995) and are partner proteins by the two-hybrid system (MacDonaldet al., 1995;Li et al., 1997a; Oiiate et al., 1995). Functional interrelationships between the VDRE and TATA domains under conditions where YY1 occupancy of the VDRE suppresses enhancer activity are consistent with the demonstration of mutual exclusive binding o f W l or the VDR to the basic domain of TFIIB (Guo et al., 1997). Two fundamental questions are raised with respect to functional interactions of transcription factors with the nuclear matrix. Is there a cause or effect relationship between nuclear matrix association of genes and their cognate transcription factors? What is the mechanism that targets transcription factors to the nuclear matrix? We have addressed how the AML transcription factor becomes nuclear matrix associated by functional biochemical and in situ imunofluorescence analysis of AML deletion and point mutations. Our results indicate that (1)sequences required for targeting AML to the nuclear matrix reside in a 31-amino-acid segment within the C terminal that is physically distinct from the nuclear localization signal (Fig. 6), (2) nuclear matrix association ofAML is independent of DNAbinding activity, (3)the principal active and inactive splice variants of the AML transcription factor are differentially localized within the nucleus, and (4)the nuclear matrix targeting signal of AML functions autonomously. Our findings demonstrate that at least two trafficking signals are required for sub-
-
context-dependent trans-activation
A
runt homology domain
NMTS
I
Nm 1
CBFA2 /AML-1 B
87
1
N
AML-1
tNLS1
I
I
mrn-r-mizzz
Nrnllll IQ
'
I
I
I
A ~
351 381
I 250
I
'A
I
Ikxon7A
432
480
t$g$$j h\qc I
lexons 7 8 s! 8
H C
1 CBFAl /AML-3
'k
[mllll 1
N
I
' DNA binding I Aeterornerization
I
CBFA3lAML-2
204
I I I I 1
I I I
I I I I
I
I/'
VWRPY I I I
I
' 416 C
I
\
I
I
I
I
\
'$13 I C
FIG.6 . Schematic representation of the CBFa-AML class of transcription factors. (A) This class of factors is encoded by three distinct genes designated CBFAl (AML-3), CBFA2 (AML-l), and CBFA3 (AML-2) that each produce multiple protein isoforms. Most isoforms share a n intact and highly conserved runt homology domain (rhd),which functions as a sequence-specific DNA-binding domain and interacts with the heterodimerization partner CBFP. The rhd contains a nuclear localization signal (NLS). ?tyo key splice-variants of the CBFA2 gene are shown on the first two lines: (i)the full-length, nuclear-matrix-associatedAML-1B protein contains a C-terminal domain that spans at least two promoter-context-dependent transactivation domains and the nuclear matrix targeting signal (NMTS) and (ii) the truncated and transcriptionally inactive AML-1 protein, which lacks these regulatory domains. Nuclear-matrix-associated active transcription factors that are homologous to AML-1B are encoded by the CBFA3-AML-2 and CBFA1-AML-3 genes. All three proteins share a n NMTS (blocked filling), the runt homology domain (right diagonal stripes), a n N-terminal region (vertical stripe), and a highly conserved C-terminal VWRPY motif (black filling). The bone-related CBFA1-AML-3 protein contains a unique internal region rich i n glutamine ( Q )and alanines (A). (B)The nuclear matrix targeting signal is a 31-amino-acid domain that is highly conserved among vertebrate species, as well as different subtypes of the CBFA-AML transcription factor family (Zeng et al., 1997). The diagram indicates three groups of conserved amino acids (boxes A, B, and C ) ,which'are flanked by putative turn motifs (gray boxes). (Figure continues on next page.)
0
Nuclear Matrix Targeting Signal
I
1 301
351
7
CBFAZAMLl B
BoxA
ATFTYTP-P ATFTYTP-P
--
GAFTYSP-P GAFTYSPTP
CBFA3/AML2
7
- - - - AT- R Y H-TY L V T - S G IG I GMSAMSS - - - - A-SRYH -TYL - - VT-S G IG IGMSAMSS - - - - -TSRYH -TYL - - VS -SG I G I G M S A M S T - - - - A T - R Y H - T Y L - - VT - S G M S L G M S A - TT - - - - - - - H Y H -TY L
---
GAFTYSPTP GAFTYSP-P
CBFAl lAML3
BoxC
Box B VT-SG I G I GMSAMGS
VT
-S G M S L G M S A
- TT - - - - - - - H Y H -TY L
- S S L - SV A G I ! Y S A T P S G T S I - S S L - SV A G M I
GAMSAAF-P YS ATPS G T S I
ATSRFHHTYl
GAMSAAF-P
ATSRFHHTYl
A
,
+o+
VO.,,PPPOP.
hydrophilic
turn
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
487
nuclear targeting of AML transcription factors; the first supports nuclear import and a second mediates association with the nuclear matrix. In addition, our results suggest that loss of the C-terminal nuclear matrix targeting domain of AML, which occurs frequently in leukemiarelated translocations, is functionally linked to abrogated interrelationships between nuclear structure and gene expression, characteristic of tumor cells. A basis is thus provided for addressing perturbations in the composition and/or organization of nuclear architecture that is observed in cancer. Results from Zeng et al., (1997, 1998)provide insight into the functional consequencesof directing transcription factors to the nuclear matrix. Invoking the rationale that guilt by association is biologically relevant, it has been shown that the 31-amino-acid nuclear matrix targeting sequence of the AML transcription factor targets the regulatory protein to a nuclear domain that supports transcription. Colocalization of AML with transcriptionally active RNA polymerase I1 has been demonstrated as well as the requirements for a functional DNAbinding domain and ongoing transcription (Zeng et aZ., 1998). Functional implications for nuclear matrix association of AML transcription factors is more directly provided by studies that establish that targeting to the nuclear matrix is obligatory for maximal transactivation activity (Zeng et aZ., 1997). Taken together, we are increasing our understanding of mechanisms that mediate the assembly of regulatory components to initiate and sustain transcription within the context of nuclear architecture. VI. CLOSINGREMARKS We have attempted to address how physiologic parameters of gene expression are integrated to support requirements of bone development and functional integrity of the tissue. During osteoblast phenotype development and bone formation, stages of maturation are defined by levels of expression of subsets of osteoblast genes. Effects of a hormone or growth factor on expression of a specific gene is related to the phenotype as well as the stage of cellular maturation because of the different representation of proteins that contribute to gene regulation. The osteocalcin gene is responsive to a broad spectrum of physiologic mediators, which supports expression of the protein in a stringently regulated manner using an in uitro model of osteoblast growth and differentiation that has enabled us to elucidate regulatory mechanisms.Acohort of tissue-specific, developmental, steroid hormone, and growth-factor-relat-
488
JANE B. LIAN et al.
ed transcription factor complexes impinge on osteocalcin gene transcription, providing a complex and integrated series of regulatory signals. Observed modifications in the development of the osteoblast phenotype by steroid hormones and growth factors necessitates making a distinction between primary and secondary effects that contribute to modifications in gene transcription. There is a growing body of evidence for crosstalk between steroid and nonsteroid response elements, mediated through structural rearrangements of the promoter. The osteocalcin gene promoter is a striking example of such an interaction, where steroid hormone responsiveness is exquisitely sensitive to basal levels of expression and activities at other regulatory domains. ACKNOWLEDGMENTS We thank Judy Rask for manuscript preparation. This work was supported by National Institutes of Health grants DE12528, AR39588, and PO1 AR42262-01. The contents are solely the responsibility of the authors and do not necessarily represent the official views of the National Institutes of Health. REFERENCES Andrianarivo, A. G., Robinson, J. A., Mann, K. G., and Tracy, R. P. (1992). Growth on type I collagen promotes expression of the osteoblastic phenotype in human osteosarcoma MG-63 cells. J. Cell. Physiol. 153, 156-165. Arbour, N. C., Prahl, J. M., and DeLuca, H. F. (1993). Stabilization of the vitamin D receptor in rat osteosarcoma cells through the action of 1,25-dihydroxyvitamin D3. Mol. Endocrinol. 7,1307-1312. Aronow, M. A., Gerstenfeld, L. C., Owen, T. A., Tassinari, M. S., Stein, G. S., and Lian, J. B. (1990). Factors that promote progressive development of the osteoblast phenotype in cultures fetal rat calvaria cells. J. Cell. Physiol. 143,213-221. Aronson, B. D., Fisher, A. L., Blechman, K., Caudy, M., and Gergen, J. P. (1997). Groucho-dependent and -independent repression activities of Runt domain proteins. Mol. Cell. Biol. 17, 5581-5587. Aslam, F. (1996). Hormonal control of rat osteocalcin gene: contributions of distal and proximal promoter elements to glucocorticoid regulation of osteocalcin gene transcription. Ph.D. Thesis, University of the Punjab, Lahore, Pakistan, and University of Massachusetts Medical Center, Worcester, Massachusetts. Aslam, F., Shalhoub, V., van Wijnen, A. J., Banerjee, C., Bortell, R., Shakoori, A. R., Litwack, G., Stein, J. L., Stein, G. S., and Lian, J. B. (1995). Contributions of distal and proximal promoter elements to glucocorticoid regulation of osteocalcin gene transcription. Mol. Endocrinol. 9,679-690. Aubin, J. E., and Liu, F. (1996).The osteoblast lineage. In “Principles of Bone Biology” (J.P. Bilezikian, L. G. Raisz, and G. A. Rodan, eds.),pp. 51-68. AcademicPress, San Diego, CA. Bae, S. C., Takahashi, E., Zhang,Y. W., Ogawa, E., Shigesada, K., Namba, Y., Satake, M., and Ito, Y. (1995). Cloning, mapping and expression of PEBP2 alpha C, a third gene encoding the mammalian Runt domain. Gene 159,245-248. Baker, A. R., Hollingshead, P. G., Pitts-Meek, S., Hansen, S., Taylor, R., and Stewart, T. A. (1992). Osteoblast-specific expression of growth hormone stimulates bone growth in transgenic mice. Mol. Cell. Biol. 12, 5541-5547.
REGULATEDEXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
489
Balling, R., Mutter, G., Gruss, P., and Kessel, M. (1989). Craniofacial abnormalities induced by ectopic expression of the homeobox gene Hox-1.1 in transgenic mice. Cell (Cambridge, Mass.) 58,337-347. Banejee, C . , Hiebert, S. W., Stein, J. L., Lian, J. B., and Stein, G. S. (1996a). An AML-1 consensus sequence binds an osteoblast-specific complex and transcriptionally activates the osteocalcin gene. Proc. Natl. Acad. Sci. U.S.A. 93,4968-4973. Banejee, C., Stein, J. L., van Wijnen, A. J., Frenkel, B., Lian, J. B., and Stein, G. S. (1996b). Transforming growth factor-beta 1 responsiveness of the rat osteocalcin gene is mediated by an activator protein-1 binding site. Endocrinology (Baltimore) 137,1991-2000. Banejee, C., McCabe, L. R., Choi, J.-Y., Hiebert, S. W., Stein, J. L., Stein, G. S., and Lian, J. B. (1997). Runt homology domain proteins in osteoblast differentiation: AML3/CBFA1 is a major component of a bone specific complex. J. Cell. Biochem. 66,l-8. Banejee, C., Javed, A., Choi, J., Green, J., van Wijnen, A., Stein, J., Stein, G., and Lian, J. (1998). Representation and activities of multiple Cbfa transcription factors in osteoblasts. J. Bone Miner. Res. (in press) (Abstract). Barille, S., Pellat-Deceunynck, C., Bataille, R., and Amiot, M. (1996). Ectopic secretion of osteocalcin, the major non-collagenous bone protein, by the myeloma cell line NCIH929. J. Bone Miner. Res. 11,466-471. Barone, L. M., Boyd, B., Bettencourt, B., Minkin, C., Stein, G. S., and Lian, J. B. (1991). Osteocalcin (OC), a bone specific protein, mediates differentiation of osteoclasts in two model systems. J. Cell Biol. 115,448A (abstr.). Barone, L. M., Aronow, M. A., Tassinari, M. S., Conlon, D., Canalis, E., Stein, G. S., and Lian, J. B. (1994). Differential effects of warfarin on mRNA levels of developmentally regulated vitamin K dependent proteins, osteocalcin, and matrix GLA protein in vitro. J. Cell. Physiol. 160,255-264. Bellows, C. G., Aubin, J. E., and Heersche, J. N. M. (1987). Physiological concentrations of glucocorticoids stimulate formation of bone nodules from isolated rat calvaria cells in vitro. Endocrinology (Baltimore) 121,1985-1992. Bennett, V. D., Weiss, I. M., and Adams, S. L. (1989). Cartilage-specific 5‘ end of chick alpha 2(I) collagen mRNAs. J. Biol. Chem. 264,8402-8409. Benton, M. E., Price, P. A., and Suttie, J. W. (1995). Multi-site-specificity of the vitamin K-dependent carobxylase: In vitro carboxylation of des-gamma-carboxylated bone Gla protein and Des-gamma-carboxylated pro bone Gla protein. Biochemistry 34, 9541-9551. Beresford, J. N., Bennett, J. H., Devlin, C., Leboy, P. S., and Owen, M. E. (1992). Evidence for an inverse relationship between the differentiation of adipocytic and osteogenic cells in rat marrow stromal cell cultures. J. Cell Sci. 102,341-351. Berezney, R., and Coffey, D. S. (1975). Nuclear protein matrix: Association with newly synthesized DNA. Science 189,291-292. Berezney, R., and Jeon, K. W., eds. (1995). “Structural and Functional Organization of the Nuclear Matrix.” Academic Press, San Diego, CA. Bhargava, U., Bar-Lev, M., Bellows, C. G., and Aubin, J. E. (1988). Ultrastructural analysis of bone nodules formed in vitro by isolated fetal rat calvaria cells. Bone 9, 155-163. Bidwell, J. P., van Wijnen, A. J., Fey, E. G., Dworetzky, S., Penman, S., Stein, J. L., Lian, J . B., and Stein, G. S. (1993). Osteocalcin gene promoter-binding factors are tissuespecific nuclear matrix components. Proc. Natl. Acad. Sci. U.S.A. 90,3162-3166. Bird, R. C. (1997). The cyclin/cyclin-dependent kinase (cdk) complex: regulation of cell cycle progression and nuclear disassembly. In “Nuclear Structure and Gene Expres-
490
JANE B. LIAN et al.
sion” (R.C. Bird, G. S. Stein, J. B. Lian, and J. L. Stein, eds.), pp. 145-174. Academic Press, San Diego, CA. Birnbaum, R. S., and Wiren, D. M. (1994). Changes in insulin-like growth factor-binding protein expression and secretion during the proliferation, differentiation, and mineralization of primary cultures of rat osteoblasts. Endocrinology (Baltimore) 135, 223-230. Blanco, J. C. G., Wang, I.-M., Tsai, S.Y., Tsai, M.-J., O’Malley, B. W., Jurutka, P. W., Haussler, M. R., and Ozato, K. (1995). Transcription factor TFIIB and the vitamin D receptor cooperatively activate ligand-dependent transcription. Proc. Natl. Acad. Sci. U.S.A. 92,1535-1539. Blencowe, B. J., Nickerson, J. A., Issner, R., Penman, S., and Sharp, P. A. (1994). Association of nuclear matrix antigens with exon-containing splicing complexes. J. Cell Biol. 127,593-607. Boivin, G., Morel, G., Lian, J. B., Anthoine-Terrier, C., Dubois, P. M., and Meunier, P. J. (1990). Localization of endogenous osteocalcin in neonatal rat bone and its absence in articular cartilage: Effect of warfarin treatment. VirchoutsArch. A: Pathol. Anat. Histopathol. 417, 505-512. Bortell, R., Owen, T.A., Bidwell, J. P., Gavazzo, P., Breen, E., van Wijnen, A. J.,DeLuca, H. F., Stein, J. L., Lian, J. B., and Stein, G. S. (1992). Vitamin D-responsive proteinDNA interactions at multiple promoter regulatory elements that contribute to the level of rat osteocalcin gene expression. Proc. Natl. Acad. Sci. U.S.A. 89,6119-6123. Bortell, R., Owen, T. A., Shalhoub, V., Heinrichs, A., Aronow, M. A., Rochette-Egly, C., Lutz, Y., Stein, J. L., Lian, J. B., and Stein, G. S. (1993). Constitutive transcription of the osteocalcin gene in osteosarcoma cells is reflected by altered protein-DNA interactions at promoter regulatory elements. Proc. Natl. Acad. Sci. U.S.A. 90, 2300-2304. Boskey, A. L., Wians, F. H. Jr., and Hauschka, P. V. (1985). The effect of osteocalcin on in vitro lipid-induced hydroxyapatite formation and seeded hydroxyapatite growth. Calcif Tissue Znt. 37,57-62. Boskey, A. L., Gadaleta, S., Gundberg, C., Doty, S. B., Ducy, P., and Karsenty, G. (1998). FTIR microspectroscopic analysis of bones of osteocalcin-deficient mice provides insight into the function of osteocalcin. Bone (in press). Boudreaux, J. M., and Towler, D. A. (1996). Synergistic induction of osteocalcin gene expression: Identification of a bipartite element conferring fibroblast growth factor 2 and cyclic AMP responsiveness in the rat osteocalcin promoter. J. Bid. Chern. 271, 7508-7515. Breen, E. C., van Wijnen, A. J., Lian, J. B., Stein, G. S., and Stein, J. L. (1994). In vivo occupancy of the vitamin D responsive element in the osteocalcin gene supports vitamin D-dependent transcriptional upregulation in intact cells. Proc. Natl. Acad. Sci. U.S.A. 91,12902-12906. Brown, C. J., Hendrich, B. D., Rupert, J. L., Lafreniere, R. G., Xing, Y., Lawrence, J., and Willard, H. F. (1992). The humans XIST gene: Analysis of a 17kb inactive X-specific RNA that contains conserved repeats and is highly localized within the nucleus. Cell (Cambridge, Mass.) 71,527-542. Brown, T. A,, and DeLuca, H. F. (1990). Phosphorylation ofthe 1,25-dihydroxyvitamin D3 receptor. A primary event in 1,25-dihydroxyvitamin D3 action. J. Biol. Chem. 265, 10025-10029. Bushmeyer, S., Park, K., and Atchison, M. L. (1995). Characterization of functional domains within the multifunctional transcription factor, YY1. J. Biol. Chem. 270, 30213-30220.
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
49 1
Cairns, J. R., and Price, P. A. (1994).Direct demonstration that the vitamin K-dependent bone Gla protein is incompletely gamma-carboxylated in humans. J. Bone Miner: Res. 9,1989-1997. Calvo, M. S., Eyre, D. R., and Gundberg, C. M. (1996).Molecular basis and clinical application of biological markers of bone turnover. Endocr: Rev. 17,333-368. Cao, X.,Ross, F. P., Zhang, L., MacDonald, P. N., Chappel, J.,and Teitelbaum, S. L. (1993). Cloning of the promoter for the avian integrin beta 3 subunit gene and its regulation by 1,25-dihydroxyvitamin D3. J. Biol. Chem. 268,27371-27380. Capco, D. G., Wan, K. M., and Penman, S. (1982).The nuclear matrix: Three-dimensional architecture and protein composition. Cell (Cambridge, Mass.) 29,847-858. Carlberg, C., Bendik, I., Wyss, A., Meier, E., Sturzenbecker, L. J., Grippo, J. F., and Hunziker, W. (1993).Two nuclear signalling pathways for vitamin D. Nature (London) 361,657-660. Carlson, C. S., Tulli, H. M., Jayo, M. J.,Loeser, R. F., Tracy, R. P., Mann, K. G., and Adams, M. R. (1993).Immunolocalization of noncollagenous bone matrix proteins in lumbar vertebra from intact and surgically menopausal cynomolgus monkeys. J . Bone Miner: Res. 8,71-81. Catron, K. M., Iler, N., and Abate, C. (1993).Nucleotides flanking a conserved TAAT core dictate the DNA binding specificity of three murine homeodomain proteins. Mol, Cell. Biol. 13,2354-2365. Celeste, A. J.,Rosen, V., Buecker, J. L., Kriz, R., Wang, E. A,, and Wozney, J. M. (1986). Isolation of the human gene for bone gla protein utilizing mouse and rat cDNAclones. EMBO J. 5,1885-1890. Centrella, M., McCarthy, T. L., and Canalis, E. (1991).Glucocorticoid regulation of transforming growth factor pl activity and binding in osteoblast-enriched cultures from fetal rat bone. Mol. Cell. Biol. 11,4490-4496. Chen, J.,McKee, M. D., Nanci, A., and Sodek, J. (1994).Bone sialoprotein mRNA expression and ultrastructural localization in fetal porcine calvarial bone: Comparisons with osteopontin. Histochem. J. 26,67-78. Chen, T. L., Bates, R. L., Dudley, A., Hammonds, R. G., Jr., and Amento, E. P. (1991). Bone morphogenetic protein-2b stimulation of growth and osteogenic phenotypes in rat osteoblast-like cells: Comparison with TGF-beta 1. J. Bone Miner: Res. 6, 1387-1393. Cheng, S.-L., Yang, J. W., Rifas, L., Zhang, S.-F., and Avioli, L. V. (1994).Differentiation of human bone marrow osteogenic stromal cells in uitro: Induction of the osteoblast phenotype by dexamethasone. Endocrinology (Baltimore) 134,277-286. Chenu, C., Colucci, S., Grano, M., Zigrino, P., Barattolo, R., Zambonin, G., Baldini, N., Vergnaud, P., Delmas, P. D., and Zallone, A. Z. (1994).Osteocalcin induces chemotaxis, secretion of matrix proteins, and calcium-mediated intracellular signaling in human osteoclast-like cells. J. Cell Biol. 127, 1149-1158. Cheskis, B., and Freedman, L. P. (1994).Ligand modulates the conversion of DNA-bound vitamin D3 receptor (VDR)homodimers into VDR-retinoid X receptor heterodimers. Mol. Cell. Biol. 14,3329-3338. Ciejek, E. M., Tsai, M. J., and O'Malley, B. W. (1983).Actively transcribed genes are associated with the nuclear matrix. Nature (London) 306,607-609. Clemens, T. L., Tang, H., Maeda, S., Kesterson, R. A., DeMayo, F. Pike, J. W., and Gundberg, C. M. (1997).Analysis of osteocalcin expression in transgenic mice reveals a species differences in vitamin D regulation of mouse and human osteocalcin genes. J. Bone Miner: Res. 12,1570-1576. Cockerill, P. N., and Garrard, W. T. (1986).Chromosomal loop anchorage of the kappa im-
492
JANE B. LIAN et al.
munoglobulin gene occurs next to the enhancer in a region containing topoisomerase I1 sites. Cell (Cambridge, Mass.) 44, 273-282. Coelho, C. N. D., Sumoy, L., Rodgers, B. J., Davidson, D. R., Hill, R. E., Upholt, W. B., and Kosher, R. A. (1991). Expression of the chicken homeobox-containing gene GHox-8 during embryonic chick limb development. Mech. Dev. 34,143-154. Danuish, H. M., and DeLuca, H. F. (1992). Identification of a 1,25-dihydroxyvitamin D3response element in the 5’- flanking region of the rat calbindin D-9k gene. Proc. Natl. Acad. Scz. U S A . 89,603-607. Darwish, H. M., Burmester, J. K., Moss, V. E., and DeLuca, H. F. (1993). Phosphorylation is involved in transcriptional activation by the 1,25- dihydroxyvitamin D3 receptor. Biochim. Biophys. Acta 1167, 29-36. Davis, A. P., Witte, D. P., Hsieh-Li, H. M., Potter, S. S., and Capecchi, M. R. (1995). Absence of radius and ulna in mice lacking hoxa- 11and hoxd- 11.Nature (London) 375, 791-795. Defranco, D. J., Glowacki, J., Cox, K. A., and Lian, J. B. (1991). Normal bone particles are preferentially resorbed in the presence of osteocalcin-deficient bone particles in vivo. Calcif. Tissue Int. 49,43-50. Delany, A. M., Dong, Y., and Canalis, E. (1994). Mechanisms of glucocorticoid action in bone cells. J. Cell. Biochem. 56,295-302. Demay, M. B., Gerardi, J. M., DeLuca, H. F., and Kronenberg, H. M. (1990). DNA sequences in the rat osteocalcin gene that bind the 1,25-dihydroxyvitamin D3 receptor and confer responsive to 1,25-dihydroxyvitamin D3. Proc. Natl. Acad. Sci. U.S.A.87, 369-373. Demay, M. B., Kiernan, M. S., DeLuca, H. F., and Kronenberg, H. M. (1992a). Characterization of 1,25-dihydroxyvitamin D3 receptor interactions with target sequences in the rat osteocalcin gene. Mol. Endocrinol. 6,557-562. Demay, M. B., Kiernan, M. S., DeLuca, H. F., and Kronenberg, H. M. (1992b). Sequences in the human parathyroid hormone gene that bind the 1,25- dihydroxyvitamin D3 receptor and mediate transcriptional repression in response to 1,25-dihydroxyvitamin D3. Proc. Natl. Acad. Sci. U.S.A. 89,8097-8101. Denhardt, D. T., and Guo, X. (1993). Osteopontin: A protein with diverse functions. FASEB J. 7,1475-1482. Desai, R. K., van Wijnen, A. J., Stein, J. L., Stein, G. S., and Lian, J. B. (1995). Control of 1,25-dihydroxyvitamin D3 receptor-mediated enhancement of osteocalcin gene transcription: Effects of perturbing phosphorylation pathways by okadaic acid and staurosporine. Endocrinology (Baltimore) 136,5685-5693. Desbois, C., Hogue, D. A., and Karsenty, G. (1994). The mouse osteocalcin gene cluster contains three genes with two separate spatial and temporal patterns of expression. J. Biol. Chem. 269,1183-1190. Desbois, C., Hagihara, K., Pinero, G., Boyce, B., Bonadio, J.,Tseng, K. F., Goulet, R., Goldstein, s. Loyer, E., Bradley, A., and Karsenty, G. (1995). Increased bone formation in osteocalcin deficient mice. J. Bone Minel: Res. 10, S139 (abstr.). Dickinson, L. A., Joh, T., Kohwi, Y., and Kohwi-Shigematsu, T. (1992). A tissue-specific MAR/SAR DNA-binding protein with unusual binding site recognition. Cell (Cambridge, Mass.) 70,631-645. Dodig, M., Kronenberg, M. S., Bedalov, A., Kream, B. E., Gronowicz, G., Clark, S. H., Mack, K., Liu, Y. H., Maxon, R., Pan, Z. Z., Upholt, W. B., Rowe, D. W., and Lichtler, A. C. (1996). Identification of a TAAT-containing motif required for high level expression of the COLlAl promoter in differentiated osteoblasts of transgenic mice. J. Biol. Chem. 271,16422-16429. Doty, S. B., and Schofield, B. H. (1990). Histochemistry and enzymology of bone-forming
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
493
cells. In “The Osteoblast and Osteocyte” (B. K. Hall, ed.), pp. 71-102. Telford Press, London. Ducy, P., and Karsenty, G. (1995).Two distinct osteoblast-specific cis-acting elements control expression of a mouse osteocalcin gene. Mol. Cell. Bid. 16, 1858-1869. Ducy, P., Zhang, R., Geoffroy, V., Ridall, A. L., and Karsenty, G. (1997). Osf2ICbfa 1: A transcriptional activator of osteoblast differentiation. Cell (Cambridge, Mass.) 89, 747-754. Dworetzky, S. I., Fey, E. G., Penman, S., Lian, J. B., Stein, J. L., and Stein, G. S. (1990). Progressive changes in the protein composition of the nuclear matrix during rat osteoblast differentiation. Proc. Natl. Acud. Sci. U.S.A. 87,4605-4609. Dworetzky, S . I., Wright, K. L., Fey, E. G., Penman, S., Lian, J. B., Stein, J. L., and Stein, G. S. (1992). Sequence-specific DNA-binding proteins are components of a nuclear matrix-attachment site. Proc. Nutl. Acud. Sci. U.S.A. 89,4178-4182. Ecarot-Charrier, B., Glorieux, F. H., van der Rest, M., and Pereira, G. (1983).Osteoblasts isolated from mouse calvaria initiate matrix mineralization in culture. J. Cell Biol. 96,639-643. Ferrari, D., Sumoy, L., Gannon, J., Sun, H., Brown, A. M., Upholt, W. B., and Kosher, R. A. (1995).The expression pattern of the Distal-less homeobox-containing gene Dlx5 in the developing chick limb bud suggests its involvement in apical ectodermal ridge activity, pattern formation, and cartilage differentiation. Mech. Den 52, 257-264. Feteih, R., Tassinari, M. S., and Lian, J. B. (1990). Effect of sodium warfarin on vitamin K-dependent proteins and skeletal development in the rat fetus. J. Bone Miner. Res. 5,885-894. Fey, E. G., and Penman, S. (1988). Nuclear matrix proteins reflect cell type of origin in cultured human cells. Proc. Natl. Acad. Sci. U.S.A. 85,121-125. Fey, E. G., Krochmalnic, G., and Penman, S. (1986). The nonchromatin substructures of the nucleus: The ribonucleoprotein RNP-containing and RNP-depleted matrices analyzed by sequential fractionation and resinless section electron microscopy. J. Cell Biol. 102, 1654-1665. Fleet, J. C., and Hock, J. M. (1994). Identification of osteocalcin mRNAin nonosteoid tissue of rats and humans by reverse transcription-polymerase chain reaction. J . Bone Miner Res. 9,1565-1573. Franceschi, R. T., and Iyer, B. S. (1992). Relationship between collagen synthesis and expression of the osteoblast phenotype in MC3T3-El cells. J. Bone Minel: Res. 7, 235-246. Franceschi, R. T., Iyer, B. S., and Cui, Y. (1994). Effects of ascorbic acid on collagen matrix formation and osteoblast differentiation in murine MC3T3-El cells. J . Bone Miner Res. 9,843-854. Freedman, L. P., Arce, V., and Fernandez, R. P. (1994). DNA sequences that act as high affinity targets for the vitamin D, receptor in the absence of the retinoid X receptor. Mol. Endocrinol. 8,265-273. Frenkel, B., Mijnes, J.,Aronow, M. A., Zambetti, G., Banejee, C., Stein, J. L., Lian, J. B., and Stein, G. S. (1993). Position and orientation-selective silencer in protein-coding sequences of the rat osteocalcin gene. Biochemistry 32,13636-13543. Frenkel, B., Montecino, M., Stein, J. L., Lian, J. B., and Stein, G. S. (1994). A composite intragenic silencer domain exhibits negative and positive transcriptional control of the bone-specific osteocalcin gene: Promoter and cell type requirements. Proc. Nutl. Acud. Sci. U.S.A. 91,10923-10927. Frenkel, B., Montecino, M., Green, J.,Aslam, F.,Desai, R., Banejee, C., Stein, J. L., Lain, J. B., and Stein, G. S. (1996). Basal and vitamin D-responsive activity of the rat os-
494
JANE B. LIAN et al.
teocalcin promoter in stably transfected osteosarcoma cells: Requirement of upstream sequences for control by the proximal regulatory domain. Endocrinology (Baltimore) 137, 1080-1088. Frenkel, B., Capparelli, C., vanAuken, M., Bryan J., Stein, J. L., Stein, G. S., and Lian, J. B. (1997). Activity of the osteocalcin promoter in skeletal sites of transgenic mice and during osteoblast differentiation in bone marrow-derived stromal cell cultures: Effects of age and sex. Endocrinology (Baltimore) 138,2109-2116. Gandarillas, A., and Watt, F. M. (1995). Changes in expression of members of the fos and jun families and myc network during terminal differentiation of human keratinocytes. Oncogene 11,1403-1407. Geoffroy, V., Ducy, P., and Karsenty, G. (1995). A PEBP2dAML-1-related factor increases osteocalcin promoter activity through its binding to a n osteoblast-specific cis-acting element. J. Biol. Chem. 270,30973-30979. Geoffroy, V., Corral, D. A., Zhou, L., Lee, B., and Karsenty, G . (1998). Genomic organization, expression of the human CBFAl gene, and evidence for a n alternative splicing event affecting protein function [In Process Citation]. Mamm. Genome 9,54-57. Gerstenfeld, L. C., Chipman, S. D., Glowacki, J., and Lian, J. B. (1987). Expression of differentiated function by mineralizing cultures of chicken osteoblasts. Dev. Biol. 122, 49-60. Gerstenfeld, L. C., Chipman, S. D., Kelly, C. M., Hodgens, K. J., Lee, D. D., and Landis, W. J. (1988). Collagen expression, ultrastructural assembly, and mineralization in cultures of chicken embryo osteoblasts. J. Cell Biol. 106,979-989. Gerstenfeld, L. C., Riva, A., Hodgens, K., Eyre, D. R., and Landis, W. J. (1993). Post-translational control of collagen fibrillogenesis in mineralizing cultures of chick osteoblasts. J. Bone Miner. Res. 8,1031-1043. Getzenberg, R. H., Pienta, K. J., Huang, E. Y., and Coffey, D. S. (1991). Identification of nuclear matrix proteins in the cancerous and normal rat prostrate. Cancer Res. 51, 6514-6520. Gill, R. K., and Christakos, S. (1993). Identification of sequence elements in mouse calbindin-D28k gene that confer 1,25-dihydroxyvitamin D3- and butyrate-inducible responses. Proc. Natl. Acad. Sci. U S A . 90,2984-2988. Glowacki, J., and Lian, J. B. (1987). Impaired recruitment and differentiation of osteoclast progenitors by osteocalcin-deplete bone implants. Cell Differ. 21,247-254. Glowacki, J., Rey, C., Glimcher, M. J., Cox, K. A., and Lian, J. (1991). Arole for osteocalcin in osteoclast differentiation. J. Cell. Biochem. 45,292-302. Godschalk, M., Levy, J. R., and Downs, R. W. Jr. (1992). Glucocorticoids decrease vitamin D receptor number and gene expression in human osteosarcoma cells. J. Bone Miner. Res. 7,21-27. Goldberg, D., Gardiner, E., Morrison, N. A., and Eisman, J. A. (1995). G/C element contributes to the cell line-specific expression of the proximal osteocalcin promoter. J . Cell. Biochem. 58,499-508. Goldberg, D., Polly, P., Eisman, J. A., and Morrison, N. A. (1996). Identification of an osteocalcin gene promoter sequence that binds AP1. J. Cell. Biochem. 60,447-457. Goto, K., Heymont, J. L., Klein-Nulend, J.,Kronenberg, H. M., and Demay, M. B. (1996). Identification of an osteoblastic silencer element in the first intron of the rat osteocalcin gene. Biochemistry 35,11005-11011. Graham, A., Heyman, I., and Lumsden, A. (1993). Even-numbered rhombomeres control the apoptotic elimination of neural crest from odd-numbered rhombomeres in the chick hindbrain. Development (Cambridge, UK)119,233-245. Grande, M. A., van der Kraan, I., van Steensel, B., Schul, W., de-Th6, H., van der Voort, H. T., de Jong, L., and van Driel, R. (1996). PML-containing nuclear bodies: their spa-
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
495
tial distribution in relation to other nuclear components. J. Cell. Biochem. 63, 280-291. Grigoriadis, A. E., Schellander, K., Wang, Z.-Q., and Wagner, E. F. (1993). Osteoblasts are target cells for transformation in c-fos transgenic mice. J. Cell Biol. 122, 685-701. Guo, B., Odgren, P. R., van Wijnen, A. J., Last, T.J., Nickerson, J., Penman, S., Lian, J. B., Stein, J. L., and Stein, G. S. (1995). The nuclear matrix protein NMP-1 is the transcription factor W1. Proc. Natl. Acad. Sci. U.S.A. 92,10526-10530. Guo, B., Aslam, F., van Wijnen, A. J., Roberts, S. G. E., Frenkel, B., Green, M., DeLuca, H., Lian, J. B., Stein, G. S., and Stein, J. L. (1997). YYl regulates MR/RXR mediated transctivation of the vitamin D responsive osteocalcin gene. Proc. Natl. Acad. Sci. U.S.A. 94,121-126. Guo, B., Javed, A., Green, J., Stein, J. L., Lian, J. B., van Wijnen, A. J., and Stein, G. S. (1998). Groucho/TLE proteins associate with the nuclear matrix and repress CbfdAML mediated transactivation on osteocalcin promoter. J. Bone Miner. Res. (in press) (Abstract). Harris, S. E., Sabatini, M., Harris, M. A., Feng, J. Q., Wozney, J., and Mundy, G. R. (1994a). Expression of bone morphogenetic protein messenger RNAin prolonged cultures of fetal rat calvarial cells. J. Bone Miner. Res. 9,389-394. Harris, S . E., Bonewald, L. F., Harris, M. A., Sabatini, M., Dallas, S., Feng, J. Q., GhoshChoudhury, N., Wozney, J., and Mundy, G. R. (199413). Effects of transforming growth factor beta on bone nodule formation and expression of bone morphogenetic protein 2, osteocalcin, osteopontin, alkaline phosphatase, and type I collagen mRNA in longterm cultures of fetal rat calvarial osteoblasts. J. Bone Miner. Res. 9,855-863. Hauschka, P. V., and Wians, F. H., Jr. (1989). Osteocalcin-hydroxyapatite interaction in the extracellular organic matrix of bone. Anat. Rec. 224, 180-188. Hauschka, P. V., Lian, J. B., Cole, D. E. C., and Gundberg, C. M. (1989). Osteocalcin and matrix Gla protein: Vitamin K-dependent proteins in bone. Physiol. Reu. 69,990-1047. Heersche, J. N. M., Reimers, S. M., Wrana, J. L., Waye, M. M. Y., and Gupta, A. K. (1992). Changes in expression of alpha 1type 1collagen and osteocalcin mRNAin osteoblasts and adontoblasts at different stages of maturity as shown by in situ hybridization. Proc. Finn. Dent. SOC.88,173-182. Heinrichs, A. A. J., Banejee, C., Bortell, R., Owen, T. A., Stein, J. L., Stein, G. S., and Lian, J. B. (1993a). Identification and characterization of two proximal elements in the rat osteocalcin gene promoter that may confer species- specific regulation. J . Cell. Biochem. 53,240-250. Heinrichs, A. A. J., Bortell, R., Rahman, S., Stein, J. L., Alnemri, E. S., Litwack, G., Lian, J. B., and Stein, G. S. (1993b). Identification of multiple glucocorticoid receptor binding sites in the rat osteocalcin gene promoter. Biochemistry 32,11436-11444. Heinrichs, A. A. J., Bortell, R., Bourke, M., Lian, J. B., Stein, G. S., and Stein, J. L. (1995). Proximal promoter binding protein contributes to developmental, tissue-restricted expression of the rat osteocalcin gene. J. Cell. Biochem. 57,90-100. Hendzel, M. J., Sun, J. M., Chen, H. Y., Rattner, J . B., and Davie, J. R. (1994). Histone acetyltransferase is associated with the nuclear matrix. J. Biol. Chem. 269, 22894-22901. Herman, R., Weymouth, L., and Penman, S. (1978). Heterogeneous nuclear RNA-protein fibers in chromatin-depleted nuclei. J. Cell Biol. 78,663-674. Hodgkinson, J. E., Davidson, C. L., Beresford, J., and Sharpe, P. T. (1993). Expression of a human homeobox-containing gene is regulated by 1,25(OH),D, in bone cells. Biochim. Biophys. Acta 1174, 11-16. Hoffmann, H. M., Catron, K. M., van Wijnen, A. J., McCabe, L. R., Lian, J . B., Stein, G. S., and Stein, J. L. (1994). Transcriptional control of the tissue-specific, develop-
496
JANE B. LIAN et al.
mentally regulated osteocalcin gene requires a binding motif for the Msx family of homeodomain proteins. Proc. Natl. Acad. Sci. U.S.A.91,12887-12891. Hoffmann, H. M., Beumer, T. L., Rahman, S., McCabe, L. R., Banejee, C., Aslam, F., "iro, J. A., van Wijnen, A. J., Stein, J. L., Stein, G. S., and Lian, J. B. (1996). Bone tissuespecific transcription of the osteocalcin gene: Role of an activator osteoblast-specific complex and suppressor hox proteins that bind the OC box. J . Cell. Biochem. 61, 310-324. Honvitz, K. B., Jackson, T. A., Bain, D. L., Richer, J. K., Takimoto, G. S., and Tung, L. (1996). Nuclear receptor coactivators and corepressors. Mol. Endocrinol. 10, 1167-1177. Hu, Y., Flanagan, J., Brennan, D. P., Zhou, H., Ng, K. W., Eisman, J. A., and Morrison, N. A. (1995). rHox: A horneobox gene expressed in osteoblastic cells. J. Cell. Biochem. 59,486-497. Hughes, F. J., Collyer, J., Stanfield, M., and Goodman, S. A. (1995). The effects of bone morphogenetic protein-2, -4, and -6 on differentiation of rat osteoblast cells in vitro. Endocrinology (Baltimore) 136,2671-2677. Hyder, S. M., Stancel, G. M., and Loose-Mitchell, D. S. (1994). Steroid hormone-induced expression of oncogene encoded nuclear proteins. Grit. Rev. Eukaryotic Gene Expression 4,55-116. Iimura, T., Oida, S., Takeda, K., Maruoka, Y., and Sasaki, S. (1994). Changes in homeobox-containing gene expression during ectopic bone formation induced by bone morphogenetic protein. Biochem. Biophys. Res. Commun. 201,980-987. Ingram, R. T., Park, Y. K., Clarke, B. L., and Fitzpatrick, L. A. (1994). Age- and genderrelated changes in the distribution of osteocalcin in the extracellular matrix of normal male and female bone. Possible involvement of osteocalcin in bone remodeling. J . Clin. Invest. 93,989-997. Jaaskelainen, T., Pirskanen, A., Ryhanen, S., Palvimo, J. J., DeLuca, H. F., and Maenpaa, I?. H. (1994). Functional interference between AP-1and the vitamin D receptor on osteocalcin gene expression in human osteosarcoma cells. Eur. J. Biochem. 224,ll-20. Jabs, E. W., Muller, U., Li, X., Ma, L., Luo, W., Haworth, I. S., Klisak, I., Sparkes, R., Warman, M. L., Mulliken, J. B., Snead, M. L., and Maxson, R. (1993). A mutation in the homeodomain of the human MSX2 gene in a family affected with autosomal dominant craniosynostosis. Cell (Cambridge, Mass.) 75,443-450. Jackson, D. A., and Cook, €? R. (1986).Replication occurs at a nucleoskeleton. EMBO J. 5,1403-1410. Jackson, D. A., McCready, S. J., and Cook, P. R. (1981). RNAis synthesized at the nuclear cage. Nature (London) 292,552-555. Javed, A., Gutierrez, S., van Wijnen, A. J., Stein, G. S., Stein, J. L., and Lian, J. B. (1998). Cbfa binding sites are required for hormonal responsiveness in the osteocalcin promoter. J. Bone Miner. Res. (in press) (Abstract). Ji, C., Casinghino, S., McCarthy, T. L., and Centrella, M. (1997). Multiple and essential Sp 1binding sites in the promoter for transforming growth factor-beta type I receptor. J. Biol. Chem. 272,21260-21267. Johnson, R. L., Riddle, R. D., and Tabin, C. J. (1994). Mechanisms of limb patterning. Cum @in. Genet. Dev. 4,535-542. Johnson, T. L., Sakaguchi, A. Y., Lalley, P. A., and Leach, R. J. (1991). Chromosomal assignment in mouse of matrix Gla protein and bone Gla protein genes. Geonomics 11, 770-772. Jurutka, P. W., Terpening, C. M., and Haussler, M. R. (1993). The 1,25-dihydroxy-vitamin D3 receptor is phosphyorylated in response to 1,25-dihydroxy-vitamin D3 and 22-ox-
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
497
acalcitriol in rat osteoblasts, and by casein kinase 11, in vitro. Biochemistry 32, 8184-8192. Kagoshima, H., Shigesada, K., Satake, M., Ito, Y., Miyoshi, H., Ohki, M., Pepling, M., and Gergen, P. (1993). The runt domain identifies a new family of heteromeric transcriptional regulators. Bends Genet. 9,338-341. Kamalia, N., McCulloch, C. A. G., Tenenbaum, H. C., and Limeback, H. (1992). Dexamethasone recruitment of self-renewing osteoprogenitor cells in chick bone marrow stromal cell cultures. Blood 79,320-326. Kasai, R., Bianco, P., Robey, P. G., and Kahn, A. J. (1994). Production and characterization of an antibody against the human bone GLA protein (BGP/osteocalcin) propeptide and its use in immunocytochemistry of bone cells. Bone Miner. 25,167-182. Kasugai, S., Todescan, R., Nagata, T., Yao, K. L., Butler, W., and Sodek, J. (1991). Expression of bone matrix proteins associated with mineralized tissue formation by adult rat bone marrow cells in vitro: Inductive effects of dexamethasone on the osteoblastic phenotype. J. Cell. Physiol. 147, 111-120. Katagiri, T., Yamaguchi, A., Komaki, M., Abe, E., Takahashi, N., Ikeda, T., Rosen, V., Wozney, J. M., Fujisawa-Sehara, A., and Suda, T. (1994). Bone morphogenetic protein-2 converts the differentiation pathway of C2C 12 myoblasts into the osteoblast lineage. J. Cell Biol. 127, 1755-1766. Kawaguchi, N., DeLuca, H. F., and Noda, M. (1992). Id gene expression and its suppression by 1,25-dihydroxyvitamin D3 in rat osteoblastic osteosarcoma cells. Proc. Natl. Acad. Sci. U.S.A.89,4569-4572. Kerner, S. A., Scott, R. A., and Pike, J. W. (1989). Sequence elements in the human osteocalcin gene confer basal activation and inducible response to hormonal vitamin D,. Proc. Natl. Acad. Sci. U.S.A. 86,4455-4459. Kesterson, R. A,, Stanley, L., DeMayo, F., Finegold, M., and Pike, J. W. (1993). The human osteocalcin promoter directs bone-specific vitamin D-regulatable gene expression in transgenic mice. Mol. Endocrinol. 7,462-467. Kliewer, S . A., Umesono, K., Mangelsdorf, D. J., and Evans, R. M. (1992). Retinoid X receptor interacts with nuclear receptors in retinoic acid, thyroid hormone and vitamin D3 signalling. Nature (London) 355,446-449. Knapen, M. H., Hamulyak, K., and Vermeer, C. (1989). The effect of vitamin K supplementation on circulating osteocalcin (bone Gla protein) and urinary calcium excretion. Ann. Intern. Med. 111,1001-1005. Komori, T., Yagi, H., Nomura, S., Yamaguchi, A., Sasaki, K., Deguchi, K., Shimizu, Y., Bronson, R. T., Gao, Y.-H., Inada, M., Sato, M., Okamoto, R., Kitamura, Y., Yoshiki, S., and Kishimoto, T. (1997). Targeted disruption of Cbfal results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell (Cambridge, Mass.) 89,755-764. Krishnan, A. V., and Feldman, D. (1991). Stimulation of 1,25-dihydroxyvitamin D3 receptor gene expression in cultured cells by serum and growth factors. J. Bone Miner. Res. 6,1099-1107. Landers, J. P., and Spelsberg, T. C. (1992). New concepts in steroid hormone action: Transcription factors, proto-oncogenes, and the cascade model for steroid regulation of gene expression. Crit. Rev. Eukaryotic Gene Expression 2,19-63. Leboy, P. S., Beresford, J. N., Devlin, C., and Owen, M. E. (1991). Dexamethasone induction of osteoblast mRNAs in rat marrow stromal cell cultures. J. Cell. Physiol. 146, 370-378. Lee, B., Thirunavukkarasu, K., Zhou, L., Pastore, L., Baldini, A., Hecht, J., Geoffroy, V., Ducy, P., and Karsenty, G. (1997). Missense mutations abolishing DNA binding of the
498
JANE B. LIAN et al.
osteoblast-specific transcription factor OSF2/CBFAl in cleidocranial dysplasia. Nut. Genet. 16,307-310. Levanon, D., Negreanu, V., Bernstein, Y., Bar-Am, I., Avivi, L., and Groner, Y. (1994). AML1, AML2, and AML3, the human members of the runt domain gene-family: cDNA structure, expression, and chromosomal localization. Genomics 23, 425-432. Levy, R. J., Gundberg, C., and Scheinman, R., (1983). The identification of the vitamin Kdependent bone protein osteocalcin as one of the gamma-carboxyglutamic acid containing proteins present in calcified atherosclerotic plaque and mineralized heart valves. Atherosclerosis (Shannon, Zrel.) 46,49-56. Li, H., Gomes, P. J., and Chen, J. D. (1997a). RAC3, a steroid/nuclear receptor-associated coactivator that is related to SRC-1 and TIF2. Proc. Natl. Acad. Sci. U.S.A. 94, 8479-8484. Li, H., Leo, C., Schroen, D. J., and Chen, J. D. (199713). Characterization of receptor interaction and transcriptional repression by the corepressor SMRT. MoZ. Endocrinol. 11,2025-2037. Li, Y. P., and Stashenko, P. (1993). Characterization of a tumor necrosis factor-responsive element which down-regulates the human osteocalcin gene. Mol. Cell. Biol. 13, 3714-3721. Li,Y. P., Chen, W., and Stashenko, P. (1995). Characterization of a silencer element in the first exon of the human osteocalcin gene. Nucleic Acids Res. 23,5064-5072. Lian, J., Stewart, C., Puchacz, E., Mackowiak, S., Shalhoub, V., Collart, D., Zambetti, G., and Stein, G. (1989). Structure of the r at osteocalcin gene and regulation of vitamin D-dependent expression. Proc. Natl. Acad. Sci. U.S.A. 86,1143-1147. Lian, J. B., and Friedman, P. A. (1978). The vitamin K-dependent synthesis of gammacarboxyglutamic acid by bone microsomes. J. Biol. Chem. 253,6623-6626. Lian, J. B., and Gundberg, C. M.(1988). Osteocalcin. Biochemical considerations and clinical applications. Clin. Orthop. Relat. Res. 267-291. Lian, J . B., and Marks, S. C. J . (1990). Osteopetrosis in the rat: Coexistence of reductions in osteocalcin and bone resorption. Endocrinology (Baltimore) 126,955-962. Lian, J. B., and Stein, G. S. (1992). Transcriptional control of vitamin D-regulated proteins. J. Cell. Biochem. 49,37-45. Lian, J. B., and Stein, G. S. (1993). Vitamin D regulation of osteoblast growth and differentiation. In “Nutrition and Gene Expression” (C. D. Berdanier and J. L. Hargrove, eds.), pp. 391-429. CRC Press, Boca Raton, FL. Lian, J. B., Tassinari, M., and Glowacki, J. (1984). Resorption of implanted bone prepared from normal and warfarin-treated rats. J. Clin. Invest. 73,1223-1226. Lian, J. B., Dunn, K., and Key, L. L. J. (1986). In vitro degradation of bone particles by human monocytes is decreased with the depletion of the vitamin K-dependent bone protein from the matrix. Endocrinology (Baltimore) 118,1636-1642. Lian, J. B., Stein, G. S.,Bortell, R., and Owen, T. A. (1991). Phenotype suppressi0n:Apostulated molecular mechanism for mediating the relationship of proliferation and differentiation by Fos/Jun interactions at AP-1 sites in steroid responsive promoter elements of tissue-specific genes. J. Cell. Biochem. 45,9-14. Lian, J. B., Stein, G. S., Owen, T. A., Bortell, R., Shalhoub, V., Heinrichs, A., van Oordt, W. C., and van Wijnen, A. J. (1992). Hormonal influence on expression of growth (H4 histone) and differentiation (osteocalcin) genes is dependent on developmental stage of the osteoblast: Modification of these regulatory controls in tumor cells. In “Chemistry and Biology of Mineralized Tissues” (H. Salvkin, A. P. Price, eds.), pp. 307-316. Elsevier (Excerpta Media), Amsterdam. Lian, J. B., McKee, M. D., Todd, A. M., and Gerstenfeld, L. C. (1993a). Induction of bonerelated proteins, osteocalcin and osteopontin, and their matrix ultrastructural local-
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
499
ization with development of chrondrocyte hypertrophy in vitro. J. Cell. Biochem. 52, 206-219. Lian, J. B., Stein, G. S., Stein, J. L., Bortell, R., Owen, T. A., Shalhoub, V., Heinrichs, A., vanoordt, C. W., and van Wijnen, A. J. (199313).Implications of abrogated growth control on expression of a cell cycle-regulated histone and osteoblast-specific osteocalcin genes in osteosarcoma cells. In “Frontiers of Osteosarcoma Research: Interdisciplinary Survey of Clinical and Research Advances” (J. F. Novak and J. H. McMaster, eds.), pp. 227-287. Hogrefe & Huber, Seattle, Washington. Lian, J. B., Stein, G. S., Stein, J. L., van Wijnen, A., Montecino, M., Desai, R., Shakoori, A. R., Breen, E., Hoffmann, H., and Pockwinse, S. M. (1994). Vitamin D regulation of osteocalcin gene transcription: A model for defining molecular mechanisms of 1,25(OH),D, control of osteoblast growth and differentiation. In “Vitamin D: A Pluripotent Steroid Hormone: Structural Studies Molecular Endocrinology,and Clinical Applications” (A. W. Norman, R. Bouillon, and M. Thomasset, eds.), pp. 264-272. de Gruyter, Berlin and New York. Lian, J. B., Stein, G. S., Stein, J. L., van Wijnen, A. J.,McCabe, L., Banerjee, C., and Hoffmann, H. (1996). The osteocalcin gene promoter provides a molecular blueprint for regulatory mechanisms controlling bone tissue formation: Role of transcription factors involved in development. Connect. Tissue Res. 35,15-21. Lian, J. B., Shalhoub, V., Asalm, F., Frenkel, B., Green, J., Hamrah, M., Stein, G. S., and Stein, J. L. (1997). Species-specific glucocorticoid and 1,25-dihydroxyvitamin D responsiveness in mouse MC3T3-El osteoblasts: Dexamethasone inhibits osteoblast differentiation and vitamin D downregulates osteocalcin gene expression. Endocrinology (Baltimore) 138,2117-2127. Liggett, W. H. J.,Lian, J. B., Greenberger, J. S., and Glowacki, J. (1994). Osteocalcin promotes differentiation of osteoclast progenitors from murine long-term bone marrow cultures. J. Cell. Biochem. 55,190-199. Lindenmuth, D. M., van Wijnen, A. J., Hiebert, S., Stein, J. L., Lian, J. B., and Stein, G. S. (1997). Subcellular partitioning of transcription factors during osteoblast differentiation: Developmental association of the AML/CBFa/PEBP2a-related transcription factor-NMP-2 with the nuclear matrix. J . Cell. Biochem. 66,123-132. Liska, D. J., Reed, M. J., Sage, E. H., and Bornstein, P. (1994). Cell-specific expression of alpha 1fI)collagen-hGH minigenes in transgenic mice. J. Cell Biol. 125,695-704. Liu, Y. H., Ma, L., Wu, L. Y., Luo, W., Kundu, R., Sangiorgi, F., Snead, M. L., and Maxson, R. (1994). Regulation of the Msx2 homeobox gene during mouse embryogenesis: A transgene with 439 bp of 5’ flanking sequence is expressed exclusively in the apical ectodermal ridge of the developing limb. Mech. Deu. 48, 187-197. Liu, Y. H., Kundu, R., Wu, L., Luo, W., Ignelzi, M. A. J., Snead, M. L., and Maxson, R. E. J. (1995). Premature suture closure and ectopic cranial bone in mice expressing Msx2 transgenes in the developing skull. Proc. Natl. Acad. Sci. U.S.A. 92, 6137-6141. Long, M. W., Williams, J. L., and Mann, K. G. (1990). Expression of bone-related proteins in the hematopoietic microenvironment. J. Clin. Invest. 86,1387-1395. Lufkin, T., Mark, M., Hart, C . F!, Dolle, I?, LeMeur, M., and Chambon, P. (1992). Homeotic transformation of the occipital bones of the skull by ectopic expression of a homeobox gene. Nature (London) 359,835-841. Lynch, M. P., Stein, J. L., Stein, G. S., and Lian, J. B. (1994). Apoptosis during in vitro bone formation. J . Bone Miner. Res. 9, S352 (abstr.). Lynch, M. P., Stein, J. L., Stein, G. S., and Lian, J. B. (1995). The influence of type I collagen on the development and maintenance of the osteoblast phenotype in primary and passaged rat calvarial osteoblasts: modification of expression of genes support-
500
JANE B. LIAN et a1
ing cell growth, adhesion, and extracellular matrix mineralization. Exp. Cell Res. 216,35-45. MacDonald, P. N., Dowd, D. R., Nakajima, S., Galligan, M. A., Reeder, M. C., Haussler, C. A., Ozato, K., and Haussler, M. R. (1993). Retinoid X receptors stimulate and 9-cis retinoic acid inhibits 1,25-dihydroxyvitamin D,-activated expression of the rat osteocalcin gene. Mol. Cell. Biol. 13, 5907-5917. MacDonald, P. N., Sherman, D. R., Dowd, D. R., Jefcoat, S. C., Jr., and DeLisle, R. K. (1995). The vitamin D receptor interacts with general transcription factor IIB. J. Biol. Chem. 270,4748-4752. Machwate, M., Jullienne, A., Moukhtar, M., and Marie, P. J. (1995). Temporal variation of c-fos proto-oncogene expression during osteoblast differentiation and osteogenesis in developing bone. J. Cell. Biochem. 57,62-70. Mackowiak, S . , Gerstenfeld, L., Hauschka, P. V., and Lian, J. B. (1985). Cell-free translation of the vitamin K-dependent bone protein osteocalcin. Biochem. Biophys. Res. Commun. 132,240-244. Mahonen, A., Pirskanen, A., Keinanen, R., and Maenpaa, P. H. (1990). Effect of 1,25(OH),D, on its receptor mRNA levels and osteocalcin synthesis in human osteosarcoma cells. Biochim. Biophys. Actu 1048,30-37. Malaval, L., Modrowski, D., Gupta, A. K., and Aubin, J. E. (1994). Cellular expression of bone-related proteins during in vitro osteogenesis in rat bone marrow stromal cell cultures. J. Cell. Physiol. 158, 555-572. Malone, J. D., Teitelbaum, S. L., Griffin, G. L., Senior, R. M., and Kahn, A. J. (1982). Recruitment of osteoclast precursors by purified bone matrix constituents. J. Cell Biol. 92,227-230. Mark, M. P., Prince, C. W., Gay, S., Austin, R. L., Bhown, M., Finkelman, R. D., and Butler, W. T. (1987). A comparative immunocytochemical study on the subcellular distributions of 44 kDa bone phosphoprotein and bone gamma-carboxyglutamic acid (G1a)-containing protein in osteoblasts. J. Bone Miner. Res. 2,337-346. Markose, E. R., Stein, J. L., Stein, G. S., and Lian, J. B. (1990). Vitamin D-mediated modifications in protein-DNA interactions at two promoter elements of the osteocalcin gene. Proc. Natl. Acad. Sci. U.S.A. 87,1701-1705. Martin, J. F., Bradley, A., and Olson, E. N. (1995). The paired-liks homeo box gene MHox is required for early events of skeletogenesis in multiple lineages. Genes Deu. 9, 1237-1249. Masi, L., Franchi,A., Santucci, M., Danielli, D., Arganini, L., Giannone, V., Formigli, L., Benvenuti, S., Tanini, A., and Beghe, F. (1992). Adhesion, growth, and matrix production by osteoblasts on collagen substrata. Culcif: Tissue Znt. 51,202-212. Masuyama, H., Brownfield, C. M., St.Arnaud, R., and MacDonald, P. N. (1997). Evidence for ligand-dependent intramolecular folding of the AF-2 domain in vitamin D receptor-activated transcription and coactivator interaction. Mol. Endocrinol. 11, 1507-1517. Mayur, N., Lewis, S., Cathenvood, B. D., and Nanes, M. S. (1993). Tumor necrosis factor alpha decreases 1,25-dihydroxyvitamin D3 receptors in osteoblastic ROS 17/22?cells. J. Bone Miner. Res. 8,997-1003. McCabe, L. R., Kockx, M., Lian, J., Stein, J.,and Stein, G. (1995). Selective expression of fos- and jun-related during osteoblast proliferation and differentiation. Exp. Cell Res. 218,255-262. McCabe, L. R., Banerjee, C., Kundu, R., Harrison, R. J., Dobner, P. R., Stein, J. L., Lian, J. B., and Stein, G. S. (1996). Developmental expression and activities of specific fos and jun proteins are funtionally related to osteoblast maturation: Role of fra-2 and jun D during differentiation. Endocrinology (Baltimore) 137,4398-4408.
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
50 1
McKee, M. D., Farach-Carson, M. C., Butler, W. T., Hauschka, F? V., and Nanci, A. (1993). Ultrastructural immunolocalization of noncollagenous (osteopontin and osteocalcin) and plasma (albumin and alpha 2HS-glycoprotein) proteins in rat bone. J. Bone Miner. Res. 8,485-496. Merriman, H. L., van Wijnen, A. J., Hiebert, S., Bidwell, J. P., Fey, E., Lian, J., Stein, J., and Stein, G. S. (1995). The tissue-specific nuclear matrix protein, NMP-2, is a member of the AML/CBF/PEBPa/runt domain transcription factor family: Interactions with the osteocalcin gene promoter. Biochemistry 34,13125-13132. Miner, J. N., and Yamamoto, K. R. (1991). Regulatory crosstalk at composite response elements. Dends Biochem. Sci. 16,423-426. Mirkovitch, J., Mirault, M. E., and Laemmli, U. K. (1984). Organization of the higher-order chromatin loop: specific DNA attachment sites on nuclear scaffold. Cell (Cambridge, Mass.) 39,223-232. Montecino, M., Lian, J., Stein, G., and Stein, J. (1994a). Specific nucleosomal organization supports developmentally regulated expression of the osteocalcin gene. J. Bone Miner. Res. 9, S352 (abstr.). Montecino, M., Pockwinse, S., Lian, J., Stein, G., and Stein, J. (1994b). DNase I hypersensitive sites in promoter elements associated with basal and vitamin D dependent transcription of the bone- specific osteocalcin gene. Biochemistry 33,348-353. Montecino, M., Lian, J., Stein, G., and Stein, J. (1996). Changes in chromatin structure support constitutive and developmentally regulated transcription of the bone-specific osteocalcin gene in osteoblastic cells. Biochemistry 35,5093-5102. Montecino, M., Frenkel, B., van Wijnen, A., Lian, J., Stein, J., and Stein, G. (1997). Chromatin hyperacetylation abrogates vitamin D-mediated transcriptional stimulation of the tissue-specific osteocalcin gene in vivo. (Manuscript submitted.) Morrison, N., and Eisman, J. (1993). Role of the negative glucocorticoid regulatory element in glucocorticoid repression of the human osteocalcin promoter. J. Bone Miner. Res. 8,969-975. Morrison, N. A., Shine, J., Fragonas, J. C., Verkest, V., McMenemy, L., and Eisman, J. A. (1989). 1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene. Science 246,1158-1161. Morrison, N. A., Yeoman, R., Kelly, P. J., and Eisman, J. A. (1992). Contribution of transacting factor alleles to normal physiological variability: Vitamin D receptor gene polymorphism and circulating osteocalcin. Proc. Natl. Acad. Sci. U.S.A. 89, 6665-6669. Mortillaro, M. J., Blencowe, B. J., Wei, X., Nakayasu, H., Du, L., Warren, S. L., Sharp, P. A., and Berezney, R. (1996). A hyperphorylated form of the large subunit of RNA polymerase I1 is associated with splicing complexes and the nuclear matrix. Proc. Natl. Acad. Sci. U.S.A. 93,8253-8257. Mundlos, S., Otto, F., Mundlos, C., Mulliken, J. B., Aylsworth, A. S., Albright, S., Lindhout, D., Cole, W. G., Henn, W., Knoll, J. H. M., Owen, M. J., Mertelsmann, R., Zabel, B. U., and Olsen, B. R. (1997). Mutations involving the transcription factor CBFAl cause cleidocranial dysplasia. Cell (Cambridge, Mass.) 89,773-779. Murray, S. S., Glackin, C. A., Winters, K. A., Gazit, D., Kahn, A. J., and Murray, E. J. (1992). Expression of helix-loop-helix regulatory genes during differentiation of mouse osteoblastic cells. J. Bone Miner. Res. 7,1131-1138. Nakagawa, Y., Renz, C. L., Ahmed, M., and Coe, F. L. (1991). Isolation of nephrocalcin from kidney tissue of nine vertebrate species. Am. J. Physiol. 260, F243-F248. Nakajima, S., Hsieh, J. C., MacDonald, P. N., Galligan, M. A,, Haussler, C. A., Whitfield, G. K., and Haussler, M. R. (1994). The C-terminal region of the vitamin D receptor is essential to form a complex with a receptor auxiliary factor required for high affmity binding to the vitamin D-responsive element. Mol. Endocrinol. 8,159-172.
502
JANE B. LIAN et al.
Nanes, M. S., Kuno, H., Demay, M. B., Kurian, M., Hendy, G. N., DeLuca, H. F., Titus, L., and Rubin, J. (1994). A single up-stream element confers responsiveness to 1,25dihydroxyvitamin D3 and tumor necrosis factor-alpha in the rat osteocalcin gene. Endocrinology (Baltimore) 134, 1113-1120. Nefussi, J. R., Boy-Lefevre, M. L., Boulekbache, H., and Forest, N. (1985). Mineralization in vitro of matrix formed by osteoblasts isolated by collagenase digestion. Differentiation (Berlin) 29, 160-168. Nelkin, B. D., Pardoll, D. M., and Vogelstein, B. (1980). Localization of SV40 genes within supercoiled loop domains. Nucleic Acids Res. 8,5623-5633. Nishikawa, J., Kitaura, M., Matsumoto, M., Imagawa, A., and Nishihara, T. (1994). Difference and similarity of DNA sequences recognized by VDR homodimer and VDR/RXR heterodimer. Nucleic Acids Res. 22,2902-2907. Nishimoto, S . K., and Price, P. A. (1980). Secretion of the vitamin K-dependent protein of bone by rat osteosarcoma cells. Evidence for an intracellular precursor. J. Biol. Chem. 255,6579-6583. Noda, M., Vogel, R. L., Craig, A. M., Prahl, J., DeLuca, H. F., and Denhardt, D. (1990). Identification of a DNA sequence responsible for binding of the 1,25-dihydroxyvitamin D, receptor and 1,25-dihydroxyvitamin D, enhancement of mouse secreted phosphoprotein 1(Spp-1or ostepontin) gene expression. Proc. Natl. Acad. Sci. U.S.A. 87, 9995-9999. Ogata, T., and Noda, M. (1991). Expression of Id, a negative regulator of helix-loop-helix DNA binding proteins, is down-regulated a t confluence and enhanced by dexamethasone in a mouse osteoblastic cell line, MC3T3E1. Biochem. Biophys. Res. Comnun. 180,1194-1199. Ogawa, E., Maruyama, M., Kagoshima, H., Inuzuka, M., Lu, J., Satake, M., Shigesada, K., and Ito, Y. (1993).PEBP2/PEA2 represents a family of transcription factors homologous to the products of the Drosophila runt gene and the human AMLl gene. Proc. Natl. Acad. Sci. U.S.A. 90,6859-6863. Ohyama, Y., Ozono, K., Uchida, M., Shinki, T., Kato, S., Suda, T., Yamamoto, O., Noshiro, M., and Kato, Y. (1994). Identification of a vitamin D-responsive element in the 5'-flanking region of the rat 25-hydroxyvitamin D3 24-hydroxylase gene. J. Biol. Chem. 269,10545-10550. Okuda, T., van Deursen, J.,Hiebert, S. W., Grosveld, G., and Downing, J. R. (1996).AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis. Cell (Cambridge, Mass.) 84,321-330. Oiiate, S . A,, Tsai, S. Y., Tsai, M. J., and O'Malley, B. W. (1995). Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270, 1354- 1357. Otto, F., Thornell, A. P., Crompton, T., Denzel, A., Gilmour, K. C., Rosewell, I. R., Stamp, G. W. H., Beddington, R. S. P., Mundlos, S., Olsen, B. R., Selby, P. B., and Owen, M. J. (1997). Cbfal, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell (Cambridge, Mass.) 89, 765-771. Owen, T. A., Aronow, M., Shalhoub, V., Barone, L. M., Wilming, L., Tassinari, M. S., Kennedy, M. B., Pockwinse, S., Lian, J. B., and Stein, G. S. (1990a). Progressive development of the rat osteoblast phenotype in vitro: Reciprocal relationships in expression of genes associated with osteoblast proliferation and differentiation during formation of the bone extracellular matrix. J. Cell. Physiol. 143,420-430. Owen, T. A,, Bortell, R., Yocum, S. A., Smock, S. L., Zhang, M., Abate, C., Shalhoub, V., Aronin, N., Wright, K. L., van Wijnen, A. J., Stein, J. L., Curran, T., Lian, J. B., and Stein, G. S. (1990b). Coordinate occupancy ofAP-1 sites in the vitamin D responsive
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
503
and CCAAT box elements by Fos-Jun in the osteocalcin gene: Model for phenotype suppression of transcription. Proc. Natl. Acad. Sci. U.S.A. 87,9990-9994. Owen, T. A., Aronow, M. S., Barone, L. M., Bettencourt, B., Stein, G. S., and Lian, J. B. (1991). Pleiotropic effects of vitamin D on osteoblast gene expression are related to the proliferative and differentiated state of the bone cell phenotype: Dependency upon basal levels of gene expression, duration of exposure, and bone matrix competency in normal rat osteoblast cultures. Endocrinology (Baltimore) 128, 1496-1504. Owen, T. A., Bortell, R., Shalhoub, V., Heinrichs, A., Stein, J. L., Stein, G. S., and Lian, J. 3.(1993). Postproliferative transcription of the rat osteocalcin gene is reflected by vitamin D-responsive developmental modifications in protein-DNA interactions at basal and enhancer promoter elements. Proc. Natl. Acad. Sci. U.S.A.90,1503-1507. Ozono, K., Sone, T., and Pike, J. W. (1991). The genomic mechanism of action of 1,25-dihydroxyvitamin D3. J. Bone Miner. Res. 6,1021-1027. Palaparti, A., Baratz, A., and Stifani, S. (1997). The Grouchohansducin-like enhancer of split transcriptional repressors interact with the genetically defined amino-terminal silencing domain of histone H3. J. Biol. Chem. 272,26604-26610. Pan, L. C., and Price, P. A. (1987). Ligand-dependent regulation of 1,25-dihydroxyvitamin D, receptor in rat osteosarcoma cells. J. Biol. Chem. 262,4670-4675. Pastoureau, P., Vergnaud, P., Meunier, P. J., and Delmas, P. D. (1993). Osteopenia and bone-remodeling abnormalities in warfarin-treated lambs. J. Bone Miner. Res. 8, 1417-1426. Pavlin, D., Lichtler, A. C., Bedalov, A., Kream, B. E., Harrison, J. R., Thomas, H. F., Gronowicz, G. A., Clark, S. H., Woody, C. O., and Rowe, D. W. (1992). Differential utilization of regulatory domains within the alpha l(1) collagen promoter in osseous and fibroblastic cells. J. Cell Biol. 116,227-236. Perlmann, T., Rangarajan, P. N., Umesono, K., and Evans, R. M. (1993). Determinants for selective RAR and TR recognition of direct repeat HREs. Genes Deu. 7,1411-1422. Pienta, K. J., and Coffey, D. S. (1991). Correlation of nuclear morphometry with progression of breast cancer. Cancer (Philadelphia) 68, 2012-2016. Pirskanen, A., Jaaskelainen, T., and Maenpaa, P. H. (1994). Effects of transforming growth factor beta 1on the regulation of osteocalcin synthesis in human MG-63 osteosarcoma cells. J. Bone Minel: Res. 9,1635-1642. Pockwinse, S. M., Wilming, L. G., Conlon, D. M., Stein, G. S., and Lian, J. B. (1992). Expression of cell growth and bone specific genes at single cell resolution during development of bone tissue-like organization in primary osteoblast cultures. J. Cell. Biochem. 49,310-323. Pockwinse, S. M., Stein, J. L., Lian, J. B., and Stein, G. S. (1995). Developmental stagespecific cellular responses to vitamin D and glucocorticoids during differentiation of the osteoblast phenotype: Interrelationship of morphology and gene expression by in situ hybridization. Exp. Cell Res. 216, 244-260. Price, P. A. (1988). Role of vitamin-K-dependent proteins in bone metabolism. Annu. Rev. Nutr. 8,565-583. Price, F! A., Williamson, M. K., and Lothringer, J. W.(1981). Origin of the vitamin K-dependent bone protein found in plasma and its clearance by kidney and bone. J. Biol. Chem. 256,12760-12766. Price, P. A., Williamson, M. K., Haba, T., Dell, R. B., and Jee, W. S. (1982). Excessive mineralization with growth plate closure in rats on chronic warfarin treatment. Proc. Natl. Acad. Sci. U S A . 79,7734-7738. Price, P. A., Fraser, J. D., and Metz-Virca, G. (1987). Molecular cloning of matrix Gla protein: Implications for substrate recognition by the vitamin K-dependent gamma-carboxylase. Proc. Natl. Acad. Sci. U.S.A. 84,8335-8339.
504
JANE B. LIAN et al.
Puchacz, E., Lian, J. B., Stein, G. S., Wozney, J., Huebner, K., and Croce, C. (1989). Chromosomal localization of the human osteocalcin gene. Endocrinology (Baltimore) 124, 2648-2650. Quarles, L. D., Yohay, D.A., Lever, L. W., Caton, R., and Wenstrup, R. J. (1992). Distinct proliferative and differentiated stages of murine MC3T3-El cells in culture: An in vitro model of osteoblast development. J. Bone Minezer.Res. 7,683-692. Quarles, L. D., Siddhanti, S. R., and Medda, S. (1997). Developmental regulation of osteocalcin expression in MC3T3-El osteoblasts: Minimal role of the proximal E-box cis-acting promoter elements. J. Cell. Biochem. 65, 11-24. Rafidi, K., Simkina, I., Johnson, E., Moore, M. A., and Gerstenfeld, L. C. (1994). Characterization of the chicken osteopontin-encoding gene. Gene 140,163-169. Rahman, S., Oberdorf, A., Montecino, M., Tanhauser, S. M., Lian, J. B., Stein, G. S., Laipis, P. J., and Stein, J. L. (1993). Multiple copies of the bone-specific osteocalcin gene in mouse and rat. Endocrinology (Baltimore) 133,3050-3053. Rezzonico, R., Loubat, A., Lallemand, D., Ham, C. M., Far, D. F., Proudfoot, A., Rossi, B., and Ponzio, G. (1995). Cyclic AMP stimulates a JunDIFra-2 AP-1 complex and inhibits the proliferation of interleukin-6-dependent cell lines. Oncogene 11, 1069-1078. Rhodes, S. J., Chen, R., DiMattia, G. E., Scully, K. M., Kalla, K. A,, Lin, S. C., Yu, V. C., and Rosenfeld, M. G. (1993).Atissue-specific enhancer confers Pit- 1-dependentmorphogen inducibility and autoregulation on the pit-1 gene. Genes Dev. 7,913-932. Richard, D. J., Sullivan, T. A., Shenker, B. J., Leboy, P. S., and Kazhdan, I. (1994). Induction of rapid osteoblast differentiation in rat bone marrow stromal cell cultures by dexamethasone and BMP-2. Dew. Biol. 161,218-228. Robey, P. G.,and Termine, J. D. (1985). Human bone cells in vitro. Calcif: Zlssues Int. 37, 453-460. Robinson, S. I., Nelkin, B. D., and Vogelstein, B. (1982). The ovalbumin gene is associated with the nuclear matrix of chicken oviduct cells. Cell (Cambridge, Mass.) 28,99-106. Rodan, G. A., and Noda, M. (1990). Gene expression in osteoblastic cells. Crit. Rev. Eukaryotic Gene Expression 1,85-98. Romberg, R. W., Werness, P. G., Riggs, B. L., and Mann, K. G. (1986). Inhibition of hydroxyapatite crystal growth by bone-specific and other calcium-binding proteins. Biochemistry 25,1176-1180. Rosen, H. N., Maitland, L. A,, Suttie, J. W., Manning, W. J., Glynn, R. J., and Greenspan, S. L. (1993). Vitamin K and maintenance of skeletal integrity in adults. Am. J. Med. 94,62-68. Ross, T. K., Moss, V. E., Prahl, J. M., and DeLuca, H. F. (1992). A nuclear protein essential for binding of rat 1,25-dihydorxyvitamin D3 receptor to its response elements. Proc. Natl. Acad. Sci. U.S.A. 89,256-260. Ross, T. K., Danvish, H. M., Moss, V. E., and DeLuca, H. F. (1993). Vitamin D-influenced gene expression via a ligand-independent, receptor- DNA complex intermediate. Proc. Natl. Acad. Sci. U.S.A.90,9257-9260. Rossert, J.A., Chen, S. S., Eberspaecher, H., Smith, C. N., andde Crombrugghe, B. (1996). Identification of a minimal sequence of the mouse pro-al(I) collagen promoter that confers high-level osteoblast expression in transgenic mice and that binds a protein selectively present in osteoblasts. Proc. Natl. Acad. Sci. U.S.A.93, 1027-1031. Ryoo, H.-M., Hoffmann, H. M., Beumer, T. L., Frenkel, B., Towler, D. A., Stein, G. S., Stein, J. L., van Wijnen, A. J.,and Lian, J. B. (1997). Stage-specific expression of Dlx-5 during osteoblast differentiation: involvement in regulation of osteocalcin gene expression. Mol. Endocrinol. 11,1681-1694.
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
505
Saatcioglu, F., Claret, F. X., and Karin, M. (1994). Negative transcriptional regulation by nuclear receptors. Semin. Cancer Biol. 6,347-359. Satokata, I., and Maas, R. (1994). Msxl deficient mice exhibit cleft palate and abnormalities of craniofacial and tooth development. Nut. Genet. 6,348-356. Schaack, J., Ho, W. Y., Freimuth, P., and Shenk, T. (1990). Adenovirus terminal protein mediates both nuclear matrix association and efficient transcription of adenovirus DNA. Genes Dev. 4,1197-1208. Scheper, W., Visser, M., Bettencourt, B., Barone, L., Stein, J., Stein, G., and Lian, J. (1991). Site-directed mutagenesis of the osteocalcin gene and expression in CHO cells provides evidence for the vitamin-K carboxylase enzyme binding site. J . Bone Miner. Res. 6, S157 (abstr.). Schepmoes, G., Breen, E., Owen, T. A., Aronow, M. A., Stein, G. S., and Lian, J. B. (1991). Influence of dexamethasone on the vitamin D-mediated regulation of osteocalcin gene expression. J. Cell. Biochem. 47,184-196. Schrader, M., Bendik, I., Becker-Andre, M., and Carlberg, C. (1993). Interaction between retinoic acid and vitamin D signaling pathways. J. Biol. Chem. 268, 17830-17836. Schroen, D. J., Chen, J. D., Vincenti, M. P., and Brinckerhoff, C. E. (1997). The nuclear receptor corepressor SMRT inhibits interstitial collagenase (MMP-1) transcription through a n HRE-independent mechanism. Biochem. Biophys. Res. Commun. 237, 52-58. Schubart, U. K., Xu, J., Fan, W., Cheng, G., Goldstein, H.,Alpini, G., Shafritz, D. A.,Amat, J. A., Farooq, M., and Norton, W. T. (1992). Widespread differentiation stage-specific expression of the gene encoding phosphoprotein p19 (metablastin) in mammalian cells. Diferentiation (Berlin) 61,21-32. Schiile, R., Umesono, K., Mangelsdorf, D. J., Bolado, J., Pike, J. W., and Evans, R. M. (1990). Jun-Fos and receptors for vitamins A and D recognize a common response element in the human osteocalcin gene. Cell (Cambridge, Mass.) 61,497-504. Shakoori, A. R., Owen, T. A., Shalhoub, V., Stein, J. L., Bustin, M., Stein, G. S., and Lian, J. B. (1993).DiffErential expression of thechromosomal high mobility group proteins 14 and 17 during the onset of differentiation in mammalian osteoblasts and promyelocytic leukemia cells. J. Cell. Biochem. 51,479-487. Shakoori, A. R., van Wijnen, A. J., Bortell, R., Owen, T.A., Stein, J . L., Lian, J. B., and Stein, G. S. (1994). Variations in vitamin D receptor transcription factor complexes associated with the osteocalcin gene vitamin D responsive element in osteoblasts and osteosarcoma cells. J. Cell. Biochem. 65,218-229. Shalhoub, V., Jackson, M. E., Lian, J. B., Stein, G. S., and Marks, S. C. J . (1991). Gene expression during skeletal development in three osteopetrotic rat mutations. Evidence for osteoblast abnormalities. J. Biol. Chem. 266,9847-9856. Shalhoub, V., Conlon, D., Tassinari, M., Quinn, C., Partridge, N., Stein, G. S., and Lian, J. B. (1992). Glucocorticoids promote development of the osteoblast phenotype by selectively modulating expression of cell growth and differentiation associated genes. J. Cell. Biochem. 50,425-440. Shalhoub, V., Bortell, R., Jackson, M. E., Marks, S. C. J., Stein, J. L., Lian, J. B., and Stein, G. S. (1994). Transcriptionally active nuclei isolated from intact bone reflect modified levels of gene expression in skeletal development and pathology. J. Cell. Biochem. 56,182-189. Shalhoub, V., Aslam, F., Breen, E., Bortell, R., Stein, G. S., Stein, J. L., and Lian, J. B. (1998). Multiple levels of steroid hormone-dependent control of osteocalcin during osteoblast differentiation: Glucocorticoid regulation of basal and vitamin D stimulated gene expression. J. Cell. Biochem. 69, 154-168.
506
JANE B.LIAN et al.
Shrivastava, A., and Calame, K. (1994).An analysis of genes regulated by the multi-functional transcriptional regulatory YinYang-1. Nucleic Acids Res. 22, 5151-5155. Siddhanti, S. R., and Quarles, L. D. (1994). Molecular to pharmacologic control of 0steoblast proliferation and differentiation. J. Cell. Biochem. 55,310-320. Sims, N. A., White, C. P., Sunn, K. L., Thomas, G. P., Drummond, M. L., Morrison, N.A., Eisman, J. A., and Gardiner, E. M. (1997). Human and murine osteocalcin gene expression: Conserved tissue restricted expression and divergent responses to 1,25-dihydroxyvitamin D3 in vivo. Mol. Endocrinol. 11,1695-1708. Sneddon, W. B., Bogado, C. E., Kiernan, M.S., and Demay, M. B. (1997). DNA sequences downstream from the vitamin D response element of the rat osteocalcin gene are required for ligand-dependent transactivation. Mol. Endocrinol. 11,210-217. Sone, T., Ozono, K., and Pike, J. W. (1991). A 55-kilodalton accessory factor facilitates vitamin D receptor DNA binding. Mol. Endocrinol. 5, 1578-1586. Speck, N. A., and Stacy, T. (1995). A new transcription factor family associated with human leukemias. Crit. Rev. Eukaryotic Gene Expression 5,337-364. Staal, A., Birkenhager, J. C., Pols, H. A., Buurman, C. J., Vink-van Wijngaarden, T., Kleinekoort, W. M., van der Bemd, G. J., and Van Leeuwen, J. P. (1994). Transforming growth factor beta-induced dissociation between vitamin D receptor level and 1,25-dihydroxyvitamin D3 action in osteoblast-like cells. Bone Miner. 26,27-42. Stein, G. S., and Lian, J. B. (1993). Molecular mechanisms mediating proliferatioddifferentiation interrelationships during progressive development of the osteoblast phenotype. Endocr. Rev. 14,424-442. Stein, G. S., and Lian, J. B. (1995). Molecular mechanisms mediating proliferation-differentiation interrelationships during progressive development of the osteoblast phenotype: Update 1995. Endocr. Rev. 4,290-297. Stein, G. S., Lian, J. B., and Owen, T. A. (1990). Relationship of cell growth to the regulation of tissue- specific gene expression during osteoblast differentiation. FASEB J. 4,3111-3123. Stein, G. S., Lian, J. B., Stein, J. L., van Wijnen, A. J., and Montecino, M. (1996). Transcriptional control of osteoblast growth and differentiation. Physiol. Rev. 76,593-629. Stein, G. S., van Wijnen, A. J., Stein, J. L., Lian, J. B., and Montecino, M. (1997). Interrelationships between nuclear structure and transcriptional control of cell cycle and tissue-specific genes. In “Genome Structure and Function” (Nicolini C, ed.), pp. 57-82. Kluwer Academic Publishers, The Netherlands. Stewart, M., Terry, A., Hu, M., O’Hara, M., Blyth, K., Baxter, E., Cameron, E., Onions, D. E., and Neil, J. C. (1997). Proviral insertions induce the expression of bone-specific isoforms of PEBPZalphaA (CBFA1): Evidence for a new myc collaborating oncogene. Proc. Natl. Acad. Sci. U.S.A. 94,8646-8651. Stifani, S., Blaumueller, C. M., Redhead, N. J., Hill, R. E., and Artavanis-Tsakonas, S. (1992). Human homologs of aDrosophila enhancer of split gene product define a novel family of nuclear proteins. Nat. Genet. 2,119-127. [Published erratum appears in Nat. Genet. 1992,2(4), 343.1 Stromstedt, P. E., Poellinger, L., Gustafsson, J.A., and Cralstedt-Duke, J. (1991). The glucocorticoid receptor binds to a sequence overlapping the TATA box of the human 0steocalcin promoter: a potential mechanism for negative regulation. Mol. Cell. B i d 11,3379-3383. Suttie, J. W., (1993). Synthesis of vitamin K-dependent proteins. FASEB J . 7,445-452. Suwanwalaikorn, S., van Auken, M., Kang, M. I., Alex, S., Braverman, L. E., and Baran, D. T. (1997). Site selectivity of osteoblast gene expression response to thyroid hormone localized by in situ hybridization. Am. J. Physiol. 272, E212-E217.
REGULATED EXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
507
Szabo, E., Preis, L. H., Brown, P. H., and Birrer, M. J. (1991). The role ofjun and fos gene induced hemopoietic diffamily members in 12-0-tetradecanoylphorbol-13-acetate ferentiation. Cell Growth Differ. 2,475-482. Sztajnkrycer, M. D., Kronenberg, M. S., Rowe, D. W., and Pan, L. C. (1994). Regulation of mouse bone Gla protein genes by glucocorticoids and 1,25-dihydroxyvitamin D,. J. Bone Miner. Res. 9, S288 (abstr.). Szulc, P., Arlot, M., Chapuy, M. C., Duboeuf, F., Meunier, P. J., and Delmas, P. D. (1994). Serum undercarboxylated osteocalcin correlates with hip bone mineral density in elderly women. J. Bone Miner. Res. 9, 1591-1595. Tamura, M., and Noda, M. (1994). Identification of a DNA sequence involved in osteoblast-specific gene expression via interaction with helix-loop-helix (HLH)-type transcription factors. J. Cell Biol. 126, 773-782. Terpening, C. M., Haussler, C. A., Jurutka, P. W., Galligan, M. A., Komm, B. S., and Haussler, M. R. (1991). The vitamin D-responsive element in the rat bone Gla protein gene is a n imperfect direct repeat that cooperates with other cis-elements in 1,25-dihydroxyvitamin D3-mediated transcriptional activation. Mol. Endocrinol. 5,373-385. Theofan, G., Haberstroh, L. M., and Price, P.A. (1989). Molecular structure ofthe rat bone Gla protein gene and identification of putative regulatory elements. DNA 8, 213-221. Thiede, M. A., Smock, S. L., Petersen, D. N., Grasser, W. A., Thompson, D. D., and Nishimoto, S. K. (1994). Presence of messenger ribonucleic acid encoding osteocalcin, a marker of bone turnover, in bone marrow megakaryocytes and peripheral blood platelets. Endocrinology (Baltimore) 135,929-937. Thirunavukkarasu, K., Mahajan, M., McLarren, K. W., Stifani, S., and Karsenty, G. (1998). Two domains unique to osteoblast-specific transcription factor Osf2/Cbfal contribute to its transactivation function and its inability to heterodimerize with Cbfp. Mol. Cell Biol. 18,4197-4208. Thrailkill, K. M., Siddhanti, S. R., Fowlkes, J . L., and Quarles, L. D. (1995). Differentiation of MC3T3-El osteoblasts is associated with temporal changes in the expression of IGF-I and IGFBPs. Bone 17,307-313. Tomkinson, A., Reeve, J., Shaw, R. W., and Noble, B. S. (1997). The death of osteocytes via apoptosis accompanies estrogen withdrawal in human bone. J. Clin. Endocrinol. Metab. 82,3128-3135. Towers, T. J., Luisi, B. F., Asianov, A., and Freedman, L. P. (1993). DNA target selectivity by the vitamin D3 receptor: Mechanism of dimer binding to an asymmetric repeat element. Proc. Natl. Acad. Sci. U.S.A. 90,6310-6314. Towler, D. A., and Rodan, G. A. (1995). Identification of a rat osteocalcin promoter 3’,5’cyclic adenosine monophosphate response region containing two PuGGTCA steroid hormone receptor binding motifs. Endocrinology (Baltimore) 136, 1089- 1096. Towler, D. A., Benentt, C. D., and Rodan, G. A. (1994a). Activity of the rat osteocalcin basal promoter in osteoblastic cells is dependent upon homeodomain and CP1 binding motifs. Mol. Endocrinol. 8,614-624. Towler, D. A., Rutledge, S. J., and Rodan, G. A. (1994b). Msx-2/Hox 8.1: A transcriptional regulator of the rat osteocalcin promoter. Mol. Endocrinol. 8,1484-1493. Truss, M., and Beato, M. (1993). Steroid hormone receptors: Interaction with deoxyribonucleic acid and transcription factors. Endocr. Rev. 14,459-479. Tsuji, K., Ito, Y., and Noda, M. (1998). Expression of the PEBPSaA/AMLB/CBFAl gene is regulated by BMP4/7 heterodimer and its overexpression suppresses type I collagen and osteocalcin gene expression in osteoblastic and nonosteoblastic mesenchyma1 cells. Bone 22, 87-92.
508
JANE B. LIAN et al.
Umesono, K., Murakami, K. K., Thompson, C. C., and Evans, R. M. (1991). Direct repeats as selective response elements for the thyroid hormone, retinoic acid, and vitamin D3 receptors. Cell (Cambridge, Mass.) 66,1255-1266. Usheva, A., and Shenk, T. (1994). TATA-binding protein-independent initiation: YY1, TFIIB, and RNA polymerase I1 direct basal transcription on supercoiled template DNA. Cell (Cambridge, Mass.) 76,1115-1121. van den Ent, F. M., van Wijnen, A. J., Last, T. J., Bortell, R., Stein, J. L., Lian, J. B., and Stein, G. S. (1993). Concerted control of multiple histone promoter factors during cell density inhibition of proliferation in osteosarcoma cells: Reciprocal regulation of cell cycle-controlled and bone-related genes. Cancer Res. 53,2399-2409. van Eekelen, C. A., and van Venrooij, W. J. (1981). hnRNA and its attachment to a nuclear protein matrix. J. Cell Biol. 88, 554-563. Van Leeuwen, J. P., Birkenhager, J. C., Buurman, C. J., Schilte, J. P., and Pols, H. A. (1990). Functional involvement of calcium in the homologous up-regulation of the 1,25-dihydroxyvitamin D3 receptor in oseoblast-like cells. FEBS Lett. 270,165-167. van Wijnen, A. J.,Bidwell, J. P., Fey, E. G., Penman, S., Lian, J. B., Stein, J. L., and Stein, G. S. (1993). Nuclear matrix association of multiple sequence-specific DNA binding activities related to SP-1, ATF, CCAAT, C/EBP, OCT-1, and AP-1. Biochemistry 32, 8397-8402. van Wijnen, A. J.,Merriman, H., Guo, B., Bidwell, J. €?, Stein, J. L., Lian, J. B., and Stein, G. S. (1994). Nuclear matrix interactions with the osteocalcin gene promoter: multiple binding sites for the runt-homology related protein NMP-2. J. Bone Miner. Res. 9, S148 (abstr.). Vaughn, J. P., Dijkwel, P.A., Mullenders, L. H., and Hamlin, J. L. (1990). Replication forks are associated with the nuclear matrix. Nucleic Acids Res. 18,1965-1969. Vukicevic, S., Luyten, F. P., Kleinman, H. K., and Reddi, A. H. (1990). Differentiation of canalicular cell processes in bone cells by basement membrane matrix components: Regulation by discrete domains of laminin. Cell (Cambridge, Mass.) 63,437-445. Wang, E. A., Israel, D. I., Kelly, S., and Luxenberg, D. P. (1993). Bone morphogenetic protein-2 causes commitment and differentiation in C3H10T1/2 and 3T3 cells. Growth Factors 9, 57-71, Wang, Z.-Q., Ovitt, C., Grigoriadis, A. E., Mohle-Steinlein, U., Ruther, U., and Wagner, E. F. (1992). Bone and haematopoietic defects in mice lacking c-fos. Nature (London) 360,741-745. Webber, D., Osdoby, P., Hauschka, P., and Krukowski, M. (1990). Correlation of an osteoclast antigen and ruffled border on giant cells formed in response to resorbable substrates. J. Bone Miner. Rex. 5,401-410. Weinreb, M., Shinar, D., and Rodan, G. A. (1990). Different pattern of alkaline phosphatase, osteopontin, and osteocalcin expression in developing rat bone visualized by an in situ hybridization. J. Bone Miner. Res. 5,831-842. Whitson, S. W., Harrison, W., Dunlap, M. K., Bowers, D. E., Jr., Fisher, L. W., Robey, P. G., and Termine, J. D. (1984). Fetal bovine cells synthesize bone-specific matrix proteins. J. Cell Biol. 99,607-614. Wiese, R. J., Uhland-Smith, A., Ross, T. K., Prahl, J. M., and DeLuca, H. F. (1992). Upregulation of the vitamin D receptor in response to 1,25-dihydroxyvitamin D3 results from ligand-induced stabilization. J. Biol. Chem. 267,20082-20086. Wong, M.-M., Rao, L. G., Ly, H., Hamilton, L., Tong, J., Sturtridge, W., McBroom, R., Aubin, J. E., and Murray, T. M. (1990). Long-term effects of physiologic concentrations of dexamethasone on human bone-derived cells. J. Bone Miner. Res. 5.803-813.
REGULATEDEXPRESSION OF BONE-SPECIFIC OSTEOCALCIN GENE
509
Xing, Y.,Johnson, C. V., Dobner, P. R., and Lawrence, J. B. (1993). Higher level organization of individual gene transcription and splicing. Science 259, 1326-1330. Yoon, K., Buenaga, R., and Rodan, G. A. (1987). Tissue specificity and developmental expression of rat osteopontin. Biochem. Biophys. Res. Commun. 148,1129-1136. Yoon, K., Rutledge, S. J. C., Buenaga, R. F., and Rodan, G. A. (1988). Characterization of the rat osteocalcin gene: stimulation of promoter activity by 1,25-dihydroxyvitamin D,. Biochemistry 27,8521-8526. Yu, V. C., Delsert, C., Andersen, B., Holloway, J. M., Devary, 0. V., Naar, A. M., Kim, S. Y., Boutin, J. M., Glass, C. K., and Rosenfeld, M. G. (1991). RXR beta: A coregulator that enhances binding of retinoic acid, thyroid hormone, and vitamin D receptors to their cognate response elements. Cell (Cambridge, Mass.) 67,1251-1266. Yu, X. P., and Chandrasekhar, S. (1997). Parathyroid hormone (PTH1-34) regulation of r a t osteocalcin gene transcription [see comments]. Endocrinology (Baltimore) 138, 3085-3092. Zeng, C., van Wijnen, A. J., Stein, J. L., Meyers, S., Sun, W., Shopland, L., Lawrence, J . B., Penman, S., Lian, J. B., Stein, G. S., and Hiebert, S. W., (1997). Identification of a nuclear matrix targeting signal in the leukemia and bone-related AML/CBFa transcription factors. Proc. Natl. Acad. Sci. U.S.A.94,6746-6751. Zeng, C., McNeil, S., Pockwinse, S., Nickerson, J. A., Shopland, L., Lawrence, J. B., Penman, s.,Hiebert, s. W., Lian, J. B., van Wijnen, A. J., Stein, J. L., and Stein, G. s. (1998). Intranuclear targeting of AML/CBFa regulatory factors to nuclear matrixassociated transcriptional domains. Proc. Natl. Acad. Sci. U.S.A.96, 1585-1589. Zernik, J.,Thiede, M. A., Twarog, K., Stover, M. L., Rodan, G. A., Upholt, W. B., and Rowe, D. W. (1990). Cloning and analysis of the 5‘ region of the rat bone/liver/kidney/placenta alkaline phosphatase gene. A dual-function promoter. Matrix 10,38-47. Zhang, Q., Wrana, J. L., and Sodek, J. (1992). Characterization of the promoter region of the porcine opn (osteopontin, secreted phosphoprotein 1)gene. Identification of positive and negative regulatory elements and a ‘silent’ second promoter. Eur. J. Biochem. 207,649-659. Zhang, R., Ducy, P., and Karsenty, G. (1997). 1,25-dihydroxyvitamin D3 inhibits osteocalcin expression in mouse through an indirect mechanism. J . Biol. Chem. 272, 110-116. Zhou, H., Choong, P., McCarthy, R., Chou, S. T., Martin, T. J., andNg, K. W. (1994). In situ hybridization to show sequential expression of osteoblast gene markers during bone formation in vivo. J. Bone Miner. Res. 9,1489-1499. Zierold, C., Darwish, H. M., and DeLuca, H. F.(1994). Identification of a vitamin D-response element in the rat calcidiol (25-hydroxyvitamin D3) 24-hydroxylase gene. Proc. Natl. Acad. Sci. U.S.A. 91,900-902.
This Page Intentionally Left Blank
Index
A Accessory proteins, modulating nuclear receptor binding to target DNA sequences, 169-178 facilitating steroid receptor-DNA binding, 171-172 HMG-1 and -2,172-176 inhibitors of receptor-DNA interactions, 176-178 retinoid X receptor, 169-171 ACTH, secretion, stress-induced, 426 Adrenal cortex, androgen action, 332-334 Adrenal tissue, steroidogenesis, 403 AF-2 activity, overexpression of coactivators and, 188 function, 181 AF-1 coactivators, 201-202 Age-dependent factor, 321-322 AML, transcription factors, overexpression, 484 Androgens, 2 19-27 4,309 -339 action adrenal cortex and testis, 332-334 mediation by peptide growth factors, 331-332 prostate, 334-337 enzymatic regulation, 326-331 enzymatic pathways, 330-331 inactivation by hydroxysteroid sulfotransferase, 329-330 5a-reductase and hydroxysteroid dehydrogenase, 326-329 apoptosis and, 141-142 dependence, adaptation of prostate tumor cells to independence, 267-270 differential function, 221-223 forms, 310 functions, 309 history, 220
mutation, androgen insensitivity syndrome, 244-246 oxidoreductive modification, 329 withdrawal, apoptosis and, 270-273 Androgen-induced genes, prostate, 259-265 c-myc gene, 263-265 Nkx3.1,265 peptide growth factors, 262-263 prostate-specific antigen, 259 -260 rat C3 gene of a-protein, 261 rat probasin gene, 260-261 spermine-binding protein, 261-262 Androgen insensitivity syndrome, 244-246 Androgen receptor activation, hormonal ligand role, 323-325 amino-terminal domain, 238-239,243, 312,314-315 associated proteins, 241-243 autoregulation, 254-256 binding sites a t target genes, 316 discovery, 220 DNA-binding domain, 312,315 domain interactions during activation, 237-239 encoding, 311- 312 expression adult prostate, 252 mesenchyme-epithelial interactions during prostate development and, 249-252 prostate cancer, 252-253 regulation, 253-256 function modulation by direct interaction with other nuclear receptors and regulatory factors, 318-320 in prostate cancer, 267-273 functional characterization, 227-228 511
512
INDEX
Androgen receptor (cont.) gene expression regulation, 310-313 negative regulation, 322 gene promoter, pur-pyr domain, 321-322 gene structure, 226-227,311-316 hepatic expression, 321-322 hinge region, 315-316 immunolocalization, 333 immunoreactive, cellular localization, 333 interactions between N- and C-terminal ends, 314 ligand-activated, 322 ligand-binding domain, 312 mRNA, 226-227,313 mutation, prostate cancer, 246-249 posttranscriptional effects, 266-267 preferential recognition sequence for, 316-317 promoter structure, 253-254 protein structure, 227-236,311-316 amino-terminal domain, 228-230 DNA-binding domain, 230-232 homopolymeric amino acid repeats, 229-230 phosphorylation, 235-236 steroid-binding domain, 232-235 stimulation of activity by growth factors and modulators of protein phosphorylation, 243-244 transactivation, 314 transformation, 236-237 zinc finger, 313,315 Androgen-receptor-associated protein 70, 187-190 Androgen receptor gene functional domains, 313 Androgen receptor-glucocorticoid receptor heterodimers, 319 Androgen-regulated genes, androgen response elements, 256-259 Androgen-repressed genes, prostate, 265-266 Androgen response elements, 256-259, 316 synergistic cooperation, 317-318 Antiandrogens, 239-241 high-affinity ligands, 325-326
Apoptosis, 452 androgens and, 141-142 androgen withdrawal and, 270-273 nuclear matrix molecular changes during, 149-150 Ap-1 sites, osteocalcin promoter, 469-472
B BAY K 8644,415 Bcl-2, expression, prostate tumors, 272-273 Benign prostatic hyperplasia, 335 Bombyx, prothoracicotropic hormone, 81-83 Bone Ca2+-sensingreceptor in, 29 mineralization, 446 remodeling, 447 resorption, 447-448 Bone marrow cells, Ca2+-sensingreceptor role in local ionic homeostasis, 52-53 Brain cells, Ca2+-sensingreceptor, roles in local ionic homeostasis, 49-51 Breast cell carcinoma nuclear matrix, estrogen and, 142-143 Breast duct cells, Ca2+-sensingreceptor role in local ionic homeostatis, 53-54 Breast tissue, normal and malignant, 17p-hydroxysteroid dehydrogenase enzyme, 373-375 8-Bromo-cyclicadenosine-3',5'-monophosphate, effect on l7p-hydroxysteroid dehydrogenase, 364-365
C CAB1 gene, 427 Calcitonin, secretion regulation by Cap, 23-24 Calcium ion channel, prothoracicotropic hormone and, 84-85 Calcium ions, see Ca2+ Calreticulin, 336 nuclear receptor inhibition, 177 CAMP accumulation, high CaF-evoked inhibition, 18 prothoracicotropic hormone transductory cascade, 84-86
INDEX
CAMPresponse element binding protein, 242 CPB effect, 190-191 Cancer estrogen-dependent, 17P-hydroxysteroid dehydrogenase enzyme applications, 378-380 markers nuclear matrix proteins as, 147-149 Ca2+ fluxes between intra- and extracellular spaces, 44-48 intracellular buffers, 47-48 movements into and out of extracellular reservoirs, 48-49 reabsorption in kidney, 25-26 roles in intra- and extracellular processes, 2 steroidogenic acute regulatory protein expression regulation, 415-416 Ca2 elevated levels, 6,7-8 indirect evidence for sensing by cells, 8-9 microenvironments with varying levels, 42-49 alterations from movement of water without ions, 44 Ca2+fluxes between intra- and extracellular spaces, 44-48 Ca2+movement into and out of extracellular reservoirs, 48-49 changes and epithelial ionic transport, 43-44 environmental Ca2+contributing to CaFvariations, 42-43 other sensors, 14-17 spatial heterogeneity, 42 y-Carboxyglutamic acid residues, vitamin-K-dependent synthesis, 444-448 Ca2+-sensingreceptor, 1-56 in bone, 29 bovine parathyroid, isolation, 9-12 in C cells, 23-24 evidence for, 8-9 gene, 18-19 in intestine, 29-30 intracellular domain residues, 21 in kidney, 24-29
5 13
mutations familial hypocalciuric hypercalcemia, 31-37 forms of hypocalcemia due to activating mutations, 40-42 mou8e models, 39-40 neonatal severe hyperparathyroidism, 37-39 in parathyroid, 21-23 in placenta, 30-31 predicted topological structure, 10-11 regulation of expression, 19-20 renal, Ca2+-sensingreceptor, functional significance, 25-27 roles in local ionic homeostasis, 49-54 bone marrow cells, 52-53 brain cells, 49-51 breast duct cells, 53-54 lens epithelial cells, 51-52 signal transduction pathways, 17-18 structural similarity to other Gprotein-coupled receptors, 12-14 structure-function relationships, 20-21,36 therapeutics based on, 55 in tissues uninvolved in systematic 54-55 Ca:homeostasis, Ca2-sensing receptor, mineral ion homeostasis maintenance, 2-8 CbfaiAML sequences, 467-469 C cells, Ca2+-sensingreceptor in, 23-24 c-fos
antisense inhibition, 454 interaction with androgen receptor, 259 C3 gene, a-protein, 261 Cholesterol cleavage, rate-limiting step in steroidogenesis, 400-401 hydroxylated analogs, 401 transfer, putative model, 427-428 Chromatin remodeling, 145-146 structure and nucleosome organization, 128-129,478-479 hormone modifications, 132-133, 480-482 Chromosome, organization, 136-137 c-jun proteins, interaction with androgen receptor, 259
5 14
INDEX
Clusterin, 336 c-myc gene, 263-265 Coactivator complex, 203 Congenital lipoid adrenal hyperplasia, steroidogenic acute regulatory protein, 421-424 Core-binding factor a-AML, 455-457, 467-469 transcription factor representation, 485-486 Coregulatory proteins, 165-204 future questions, 200-204 mechanism of action, 203 modulation of steroid receptor activity, 204 see also Accessory proteins C-19 steroids, 310 Cyclic AMP response-element-bindingbinding protein, 145 Cyclin-dependent kinases, 336 Cycloheximide, steroidogenesis inhibition, 404 Cytochrome P450 aromatase, 363 expression in human cells of placental origin, 371 Cytochrome P450 side chain cleavage enzyme, 400
DAX-1 protein, 416-417 D17B2,360 Dehydroepiandrosterone, 310 DHR3, 105-107 5ct-Dihydrotestosterone, 220,326 production, 221 testosterone conversion to, 221-222 5P-Dihydrotestosterone, testosterone conversion to, 221-222 1,25-Dihydroxyvitamin D, levels and C a r , 4-6 D1~-5,455 DNA, polymerase chain reaction-amplified tumor, 247 DNA-binding domain, androgen receptor, 230-232 Drosoph ila development, ecdysteroid regulation, 93-95 model insects, 76-79
E75,105-106 Early puff genes, isoforms, tissue diversity, 108-109 Ecdysone effect on polytene chromosomes, 95-97 interactions with other developmental pathways, 112-113 response to, spatial and temporal diversity mechanisms, 107-112 receptor and early puff gene product isoforms, 108-109 Ecdysone receptor, 97-103 effects of mutations on developmental processes, 101-103 molecular biology, 97-101 Ecdysteroid, 75-76 action, 93-114 Drosophila development regulation, 93-95 ecdysone receptor, 97-103 effect on polytene chromosomes, 95-97 interactions with other developmental pathways, 112-113 responsive genes, 103-107 spatial and temporal diversity mechanisms, 107-112 diversity of response, 114 possible roles, 111-112 synthesis, rate-limiting, 90, 92 Ecdysteroid receptor isoforms, tissue diversity, 108-109 titer and response to ecdysone, 110-111 Ecdysteroid-responsive genes, 103-107 molecular characterization, 103- 104 mutations of “early puff genes disrupt ecdysteroid-responsive transcription, 104 puff genes encoding nuclear receptors, 105-107 EcREs, diversity of response, 109-110 Embryogenesis, sexual differentiation, 310-311 Endometrial tissue, 17P-hydroxysteroid dehydrogenase enzyme in, 375-376 Enteric nervous system, Ca2+-sensingreceptor in, 54-55
515
INDEX
Enzymatic pathways, androgen modification, 330-331 Epidermal growth factor, androgens activity and, 243 Epithelial ionic transport, alterations and Caychanges, 43-44 Epithelium, androgen-dependent morphogenesis, 250 ER-associated protein 140, 187-190 17P-Estradio1, testosterone conversion to, 222 Estrogen breast cell carcinoma nuclear matrix and, 142-143 effect on 17P-hydroxysteroid dehydrogenase type 1 enzyme expression regulation, 364 function, 354 regulation of nuclear matrix intermediate filaments, 143-144 role in “gene memory“, 146-147 steroidogenic acute regulatory protein regulation, 415 Estrogen receptor binding of antagonists, 195 chromatin-matrix-associated high-mobility group proteins, 133-134 Estrogen response elements, accessory proteins, 171 Extracellular matrix, 444
F Familial hypocalciuric hypercalcemia, 31-37 gene, 32-33 impact of mutations on Ca2+-sensing receptor, 33-35 mouse models, 39-40 Fat body protein-1 gene promoter, 110 Feminization, 245 Feto-placental unit, 17P-hydroxysteroid dehydrogenase enzyme expression and action, 367-371 Finasteride, 328 as 5a-reductase inhibitor, 225 “Flutamide withdrawal syndrome”, 248-249 Follicle stimulating hormone, effect on
17P-hydroxysteroid dehydrogenase, 364-365 FTZF1.105-107
G Gastric antral gastrin-secreting cells, Ca2+-sensingreceptor in, 54 “Gene memory”, estrogen and nuclear matrix role, 146-147 Gene transcription glucocorticoid receptor action, chromatin-matrix protein role, 134-135 mechanism of steroid action on, 131-132 steroid-mediated, nuclear matrix contribution, 133-136 vitamin D action, matrix protein role, 135-136 Glia, Ca2+-sensingreceptor, roles in local ionic homeostasis, 49-51 Glucocorticoid receptor action on gene transcription, chromatin-matrix protein role, 134-135 steroid-binding domain, 234,238 Glucocorticoid regulatory element, osteocalcin gene, 472-473 G-protein-coupled receptors, structural similarity of Ca2+-sensing receptor, 12-14 Growth factors, stimulation of androgen receptor activity, 243-244
H Heart, Ca$levels, 46 Heat-shock protein 27, levels and breast cell carcinoma, 142 Heat-shock protein 70,89 in luteal cells, 411 Heat-shock protein 90,237 hHSDl?B1,357 gene expression regulation, 381-384 hHSDl7Bl enhancer, structure and function, 382-383 hHSDl7B1 promoter, structure and function, 381-382 hHSDl7Bl silencer, structure and function, 383-384
5 16
INDEX
High-affinity ligands antiandrogenic action, 325-326 Histone, hyper acetylation, 482 Histone acetyltransferase, activity, 197-198,320 HMG-1 and -2,134 as coregulators of steroid class of nuclear receptors, 172-176 Hormonal ligands, role in androgen receptor activation, 323-325 Hormone response elements, binding to, 316 hRPF1,189-190 Human response elements androgen receptor subgroup, 258 nuclear matrix attachment regions, interactions during transgene expression, 146 20-Hydroxyecdysone, 75 prohormone precursor, 75,77 Hydroxysteroid dehydrogenase activation and inactivation of androgenic steroids, 326-329 deficiency, 328 17P-Hydroxysteroid dehydrogenases, 353-385 catalysis of interconversions, 354 enzymatic properties and tissue distributions, 358 estrogen-induced proliferation, 373-3745 expression, 356-357 during pregnancy, 367-373 gene, 357,359-360 mRNA, 357,359-360 physiological role and expression in peripheral tissues, 373-378 endometrial tissue, 375-376 normal and malignant breast tissue, 373-375 other tissues, 376-378 primary structures, 355 substrate and cofactor specificities, 355-356 type 1enzyme, 357,359 applications to prevention and treatment of estrogen-dependent cancers, 378-380 estrogen-specificity, 361 ovarian E2 production and, 360-367
regulation of expression, 363-367 role, 360-363 regulation of expression during follicular development, 361, 363 in ovaries, 363-367 by pituitary gonadotropins, steroid hormones, and growth factors, 366 type 2 enzyme, 359-360 expression pattern, 369-371 Hydroxysteroid sulfotransferase, androgen inactivation, 329-330 Hypercalcemia familial hypocalciuric, 31-37 neonatal severe hyperparathyroidism, 37-40 reduced renal handling of water, 26-29 Hyperparathyroidism, Ca: sensitivity and, 14-15 Hyperthyroidism, neonatal severe, 37-40 Hypocalcemia, due to activating Ca2+sensing receptor mutations, 40-42
I Insect development, mechanisms and models, 73-114 ecdysteroids, 75-77 2O-hydroxyecdysone,75 juvenile hormone, 75 prothoracic gland and, 92-93 model insects for studies, 76-79 polytene chromosomes, ecdysone effect, 95-97 see also Ecdysteroid; Prothoracicotropic hormone molting and metamorphosis, 73-75 Insulin-like growth factor-I androgens activity and, 243 steroidogenesis, 408 Interferon, induction of nuclear matrix proteins, 144-145 Intermediate filament, nuclear matrix, estrogen regulation, 143-144 Intermolt genes, 110 Intestine, Ca2+-sensingreceptor in, 29-30
INDEX
Intracellular cholesterol trafficking, 400-401 J
Juvenile hormone, 75 prothoracic gland and, 92-93
Keratinocyte growth factor, 331 during prostate development, 251 Keratinocytes, Ca2+-sensingreceptor in, 54 Kidney, Ca2+-sensingreceptor in, 24-29 Knockout mouse, steroidogenic acute regulatory protein, 424-425
L Lens epithelial cells, Ca2+roles in local ionic homeostasis, 51-52 y-Linolenic acid, 328 as 5a-reductase inhibitor, 225-226 Liver, 17s-hydroxysteroid dehydrogenase type 2 expression, 376,378
Magnesium ions, reabsorption in kidney, 25-26 Manduca ecdysteroid peaks, 94 model insects, 76-79 Matrix metalloproteinase genes, 318-319 Mesenchyme-epithelial interactions, during prostate development, 249-252 Mineral ions, homeostasis, maintenance and Cay-sensing, 2-8 MLN64, steroidogenic properties, 426-427 mOCX-OG3 gene, 459 Mouse mammary tumor virus, LTR as model target, 324 Mouse mammary tumor virus gene, 199 Mouse mammary tumor virus promoter, 317 Mouse models familial hypocalciuric hypercalcemia, 31-37
517
neonatal severe hyperparathyroidism, 37-40 mRNA androgen receptor, 226-227,255-256, 313 steroidogenic acute regulatory protein, 409-411 analysis, 413 MSX-1 and MSX-2 proteins, 465-466 Msx-1 and Msx-2,453-454
NCOR, 200 Neonatal severe hyperparathyroidism, 37-39 mouse models, 39-40 Nervous system, enteric, Ca2+-sensingreceptor in, 54-55 Neurons, Ca2+-sensingreceptor, roles in local ionic homeostasis, 49-51 Nicotinamide adenine dinucleotide, see 17P-Hydroxysteroid dehydrogenases Nkx3.1 gene, 265 Nuclear architecture, osteocalcin, parameters and transcriptional control, 477-480 Nuclear matrix, 127-150 attachment region, human response elements, interactions during transgene expression, 146 chromatin structure, 128-129 composition, steroid-hormone-induced effects, 131-133 contributions to steroid-mediated gene transcription, 133-136 definition and structure, 129-130 maintenance by steroid hormones, 141-145 androgens and apoptosis, 141-142 estrogen and breast cell carcinoma, 142-143 estrogen regulation of intermediate filaments, 143-144 interferon induction of specific proteins, 144-145 molecular changes during apoptosis, 149-150 osteocalcin gene expression and, 482-487
518
INDEX
Nuclear matrix (cont. ) proteins, 129-131 as cancer markers, 147-149 role in vitamin D action on gene transcription, 135-136 role, 131 in “gene memory”, 146-147 in steroid hormone signaling and nuclear binding, 136-141 laboratory studies, 136-138 novel acceptor sites for progesterone receptor, 139-141 potential role of matrix channels, 136 Nuclear receptor androgen receptor function modulation, 318-320 coactivators association with, DNA effect, 202 corepressor interactions, perturbation by steroid antagonists, 194-197 prediction, 178-179 DNA interaction, inhibitors, 176-178 interaction with nuclear proteins, 319 nonsteroid and orphan, retinoid X receptor as coregulator, 169-171 puff genes encoding, 105-107 steroid class, HMG-1/2 as coregulators, 172-176 transcriptional coactivators, 178-200 mechanism of action, 197-200 ~160,179-187 p300-CBP cointegrators, 190-194 perturbation of receptor coactivatorcorepressor interactions by steroid antagonists, 194-197 Nuclear receptor superfamily, 309-310 classification, 169 domain structure, 166-167 functional significance of segmented domain structure, 313-314 structure and function, 166-169
0 OC box I, 465-467 Osteoblast CaFeffects, 16-17
Ca:-sensing, 48-49 developmental sequence, 449- 450 differentiation Cbfa 1 as determinant, 468 osteocalcin regulated expression, 448-458 gene expression, 449-453 parallels hormonal and growth factor modifications, 457-458 transcription control mediators, 453-457 proliferating, AP-1 activity, 470 Osteocalcin, 443-488 affinity for hydroxyapatite, 446 amino acid sequence, 444-445 bone content, 445 calcium-binding properties, 446 developmental expression, 453-457 nuclear architecture parameters and transcriptional control, 477-480 regulated expression during osteoblast differentiation, 448-458 osteoblast growth and differentiation, 449-453 parallels hormonal and growth factor modifications of osteoblast differentiation, 457-458 transcription control mediators, 454-457 silencer domain, 461 tissue-specific expression, 464-465 Osteocalcin gene, 458-460 activation, 466 chromatin structure and nucleosome organization, hormone modifications, 480-482 expression, nuclear matrix and, 482-487 glucocorticoid regulatory element, 472-473 steroid hormone response elements, 472 transforming growth factor p, 471 vitamin D response elements, 474-476 Osteocalcin promoter AP-1 sites, 469-472 elements contributing to steroid responsiveness, 472-477 elements mediating developmental and tissue-specific regulation, 465-469
INDEX
CbfaIAML sequences, 467-469 OC box I, 465-467 organization, 460-465 regulation of osteocalcin transcription, 464 regulatory elements, 461 three-dimensional organization, 483 Osteoclast, CaF-sensing by, 15-16 Osteoprogenitors, 457 Osteosarcoma cells, 464 Ovarian E2 production, 17p-hydroxysteroid dehydrogenase type 1enzyme role, 360-363 Ovary, 17s-hydroxysteroid dehydrogenase type 1enzyme expression regulation, 363-367
P Parathyroid, Ca2+-sensingreceptor distribution and functions, 21-23 Parathyroid gene, expression and Ca2+sensing receptor, 22-23 Parathyroid hormone, levels and C,a: 4-5 p300 CBP-associated factor, 198 p300-CBP cointegrators, 190-194 functional roles, 193 p160 coactivators, 179-187,201 conserved LXXLL motifs, 184-185 mechanism, 187 multiple nuclear receptor interaction sites, 186 nuclear receptor interaction sites, 184 SRC-1 binding, 181 structural and functional domains, 181-183 transcriptional activation domains, 185-186 Peptide growth factors, 262-263 androgen action mediation, 331-332 Periplasmic binding proteins, bacterial, 13-14 Phorbol 12-myristate 13-acetate, androgens activity and, 243-244 Phosphoprotein, nuclear receptor as, 168 Phosphoprotein p34,86 Phosphorylation androgen receptor, 235-236 modulators, stimulation of androgen receptor activity, 243-244
519
steroidogenic acute regulatory protein, 420-421 Placenta, Ca2+-sensingreceptor in, 30-31 Platelets, peripheral blood, Ca2+-sensing receptor role in local ionic homeostasis, 52-53 Polytene chromosomes, ecdysone effect, 95-97 Posttranscriptional effects, androgen receptor, 266-267 Probasin, 335-336 Probasin gene, 260-261 Progesterone, synthesis, 410 Progesterone receptor binding of antagonists, 195 chromatin-matrix-associated high-mobility group proteins, 133-134 high-affinity binding, HMG-1 as accessory factor, 173-175 novel nuclear matrix acceptor sites, 139-141 Promyelocytic leukemia protein-nuclear bodies, 145 Prostate androgen action, 334-337 androgen-induced genes, 259-265 androgen receptor expression, 252 androgen-repressed genes, 265-266 development, androgen receptor expression and mesenchyme-epithelial interactions, 249-252 hyperplasia, 335 nuclear matrix, 141-142 Prostate cancer, androgen receptor expression, 252-253 function, 267-273 adaptation from androgen dependence to independence, 267-270 androgen withdrawal and apoptosis, 270-273 mutation, 246-249 Prostate-specific antigen, 259-260 induction by androgen in androgen-independent cells, 269 Protein androgen receptor-associated, 241-243 high-mobility group, 172 role in estrogen and progesterone receptor action, 133-134
INDEX
Protein (cont.1 nuclear matrix, 129-131 as cancer markers, 147-149 interferon induction, 144-145 role in vitamin D action on gene transcription, 135-136 synthesis, P'Il'H-stimulated, 88-92 see also Coregulatory proteins a-Protein, C3 gene, 261 Protein B23, 142 Protein kinase A androgens activity and, 243-244 prothoracicotropic hormone transductory cascade, 84-86 Protein kinase C androgens activity and, 243-244 effects on Ca2+-sensingreceptor, 20-21 Protein kinase CK2, 142 Protein PC-1, 148 Prothoracic glands, prothoracicotropic hormone stimulated, 85-87 Prothoracicotropic hormone, 75,79-92 amino acid sequence, 80 Bombyx, 81-83 characteristics and comparisons, 80, 82-83 protein synthesis stimulation, 88-92 purification, 79 structure, 79-84 transductory cascade, 84-88 CAMPand protein kinase A,84-86 ribosomal protein S6,86-88 Proximal tubule, Ca2+-sensingreceptor localization, 25 Pseudohermaphroditism, 328 Puff genes, early and late, 103 Puffs, intermolt, repression, 104 Puromycin, effect on corticoid synthesis, 403
Rat C3 gene of a-protein, 261 probasin gene, 260-261 Receptor-binding factor, 137-141 Receptor-interacting protein 140, 187-190 5a-Reductase
activation and inactivation of androgenic steroids, 326-329 deficiency, mutations in type 2 gene, 224 isoforms, 327 structure, expression, and function, 223-224 tissue expression, 338 5a-Reductase inhibitors, 224-226,328 Regulatory factors, androgen receptor function modulation, 318-320 Retinoic acid, in human cells of placental origin, 372-373 Retinoic acid receptor-vitamin D receptor heterodimer, 474-475 Retinoid X receptor as coregulator of nonsteroid and orphan nuclear receptors, 169-171 in human cells of placental origin, 372 Ribosomal protein S6,prothoracicotropic hormone transductory cascade, 84-86 Runt homology domain protein-binding sites, 467-469
S SDR protein family, 379 Serine residue, effect on 17P-hydroxysteroid dehydrogenase enzyme, 379-380 Sertoli cells, regulation of androgen action, 334 SF-1, steroidogenic acute regulatory protein regulation, 414 Signaling pathways, convergence, osteocalcin promoter, 469-472 Signal signaling, nuclear matrix channel role, 136 Signal transduction pathways, Ca2+-sensing receptor, 17-18 Small intestine, 17P-hydroxysteroid dehydrogenase type 2 expression, 376-377 SMRT, 200 Spermine-binding protein, 261-262 SRC-1 as coactivator, 180 coexpression, 179-180 C terminus, 181
52 1
INDEX
interactions, 319-320 Steroid antagonists mixed, 195-196 perturbation of receptor coactivator-corepressor, 194-197 Steroid-binding domain, androgen receptor, 232-235 Steroid hormone receptors, common structural feature, 312 Steroid hormones common characteristics, 400 function, 165 Steroidogenesis acute regulation, 402-404 in adrenal tissue, 403 cycloheximide-sensitive step, 403-404 rate-limiting step, 400-401 Steroidogenic acute regulatory protein, 399-430 amino acid sequences, 417-418 characteristics, 417-420 congenital lipoid adrenal hyperplasia, 42 1- 424 consensus PKA sites, 421 correlations with steroid biosynthesis, 408-412 steroidogenesis, 404, 406-408 steroidogenic acute regulatory protein, 404,406-408 expression, 410-413 regulation, 414-416 gene, 413-414 negative regulation, 416-417 regulation, 409 import, cholesterol transport and, 426-428 knockout mouse, 424-425 mRNA, 409-411 analysis, 413 phosphorylation, 420-421 putative mechanism of action, 425-429 putative Spl consensus sequences, 414 steroidogenically active form, 419 Steroidogenic cells, effect of tropic hormone stimulation, 404-405 Steroid receptor activity, modulation by coregulatory proteins, 204
binding to nuclear matrix, laboratory studies, 136-138 Steroid receptor coactivator 1(SRC-11,242 Steroid receptor-DNA binding, nuclear proteins that facilitate, 171-172 Steroid receptor supergene family, effects on chromatin structure and matrix composition, 131 Steroid responsiveness, osteocalcin promoter elements contributing to, 472-477 Steroids biosynthesis, correlations with, steroidogenic acute regulatory protein, 408-412 hormonally inert, functional androgen synthesis from, 330-331 Stromal-epithelial interactions, 25 1-252 Synaptic cleft, Ca2+influx, 45-46
T TATA domain, crosstalk with vitamin D response element, 484 Testis, androgen action, 332-334 Testosterone, 310 conversion, 221-222 Testosterone glucuronide, formation, 330 Tetrapods, C a y constancy, 2-3 Therapeutics, Ca2+-sensingreceptorbased, 55 Thyroid hormone receptor associated proteins, 319 Thyroid-receptor-interacting protein 1, 187-190 Tobacco hornworm, as model insect, 77-78 Transcription, ecdysteroid-responsive, early puff gene mutations and, 104 Transcriptional intermediary factor 1, 187-190 Transcription factors, cis-elements, 317 Transductory cascade, 84-88 CAMPand protein kinase A, 84-86 ribosomal protein S6, 86-88 Transformation, androgen receptor, 236-237 Transforming growth factor p, 332 effect on 17P-hydroxysteroid dehydrogenase, 365 temporal pattern, 451
522
INDEX
Transgene expression, potential human response elements-matrix attachment region interactions, 146 Trichostatin A, 199 Tubular reabsorption, direct effect of Cap, 6 p Tubulin, 89 Tyrosine residue, role in catalysis of SDR family, 379
Vitamin D receptor, osteocalcin, 474-476 Vitamin D response element crosstalk with TATA domain, 484 osteocalcin gene, 474-476 osteocalcin promoter, 469-470 Vitamin K, y-carboxyglutamic acid residue synthesis, dependence on, 444-448 Vitellogenins, 146- 147
U
W
Urinary tract, 17s-hydroxysteroid dehydrogenase type 2 expression, 377-378 Urogenital sinus mesenchyme, 250 usp genes, 100-101 mutant, 102-103
V Vitamin D, gene transcription action on gene transcription, matrix protein role, 135-136
Water, movement without ions, C a y alterations, 44
X Xenopus laevis oocytes, expression cloning, Ca2+-sensingreceptor, 9-12
“Zinc finger,” 230-231
This Page Intentionally Left Blank
I S B N 0-12-707855-0