METHODS IN ENZYMOLOGY Editors-in-Chief
JOHN N. ABELSON AND MELVIN I. SIMON Division of Biology California Institute of ...
15 downloads
770 Views
30MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
METHODS IN ENZYMOLOGY Editors-in-Chief
JOHN N. ABELSON AND MELVIN I. SIMON Division of Biology California Institute of Technology Pasadena, California Founding Editors
SIDNEY P. COLOWICK AND NATHAN O. KAPLAN
Academic Press is an imprint of Elsevier 525 B Street, Suite 1900, San Diego, CA 92101-4495, USA 30 Corporate Drive, Suite 400, Burlington, MA 01803, USA 32 Jamestown Road, London NW1 7BY, UK First edition 2010 Copyright # 2010, Elsevier Inc. All Rights Reserved. No part of this publication may be reproduced, stored in a retrieval system or transmitted in any form or by any means electronic, mechanical, photocopying, recording or otherwise without the prior written permission of the publisher Permissions may be sought directly from Elsevier’s Science & Technology Rights Department in Oxford, UK: phone (+44) (0) 1865 843830; fax (+44) (0) 1865 853333; email: permissions@ elsevier.com. Alternatively you can submit your request online by visiting the Elsevier web site at http://elsevier.com/locate/permissions, and selecting Obtaining permission to use Elsevier material Notice No responsibility is assumed by the publisher for any injury and/or damage to persons or property as a matter of products liability, negligence or otherwise, or from any use or operation of any methods, products, instructions or ideas contained in the material herein. Because of rapid advances in the medical sciences, in particular, independent verification of diagnoses and drug dosages should be made For information on all Academic Press publications visit our website at elsevierdirect.com ISBN: 978-0-12-380997-1 ISSN: 0076-6879 Printed and bound in United States of America 10 11 12 10 9 8 7 6 5 4 3 2 1
CONTRIBUTORS
Kaoru Akita Department of Molecular Biosciences, Kyoto Sangyo University, Kyoto, Japan Kiyohiko Angata Tumor Microenvironment Program, Cancer Research Center, Sanford-Burnham Medical Research Institute, La Jolla, California, USA Xingfeng Bao Sanford-Burnham Medical Research Institute, La Jolla, California, USA Kumaran Chandrasekharan Center for Gene Therapy, The Research Institute at Nationwide Children’s Hospital, Columbus, Ohio, USA Jesu´s Cruces Departamento de Bioquı´mica, Instituto de Investigaciones Biome´dicas CSIC-UAM, Universidad Auto´noma de Madrid, Madrid, Spain Richard D. Cummings Department of Biochemistry, Emory University School of Medicine, Rollins Research Center, Atlanta, Georgia, USA Mitche dela Rosa The Complex Carbohydrate Research Center and the Department of Biochemistry and Molecular Biology, University of Georgia, Athens, GA Tamao Endo Molecular Glycobiology, Tokyo Metropolitan Institute of Gerontology, Itabashi-Ku, Tokyo, Japan Andreas Faissner Department of Cell Morphology and Molecular Neurobiology, Ruhr-University, Bochum, Germany Minoru Fukuda Glycobiology Unit, Tumor Microenvironment Program, Cancer Research Center, Sanford-Burnham Medical Research Institute, La Jolla, California, USA
xiii
xiv
Contributors
Prabhjit K. Grewal The Department of Molecular, Cellular, and Developmental Biology, University of California Santa Barbara, Santa Barbara, California, USA Jianxin Gu Key Laboratory of Glycoconjuates Research, Ministry of Public Health and Gene Research Center, Shanghai Medical College of Fudan University, Shanghai, People’s Republic of China Pascale Guicheney Ge´ne´tique, Pharmacologie et Physiopathologie des Maladies Cardiovasculaires, Groupe Hospitalier Pitie´-Salpeˆtrie`re, Paris, France Shingo Hatakeyama Department of Urology, Oyokyo Kidney Research Institute, Hirosaki, Japan Jane E. Hewitt Institute of Genetics, School of Biology, Queen’s Medical Centre, University of Nottingham, Nottingham, United Kingdom Jun Hirabayashi Research Center for Medical Glycoscience (RCMG), National Institute of Advanced Industrial Science and Technology (AIST), Central-2 OSL, 1-1-1 Umezono, Tsukuba, Ibaraki, Japan Huaiyu Hu Department of Neuroscience and Physiology, Upstate Medical University, Syracuse, New York, USA Yuzuru Ikehara Research Center for Medical Glycoscience (RCMG), National Institute of Advanced Industrial Science and Technology (AIST), Central-2 OSL, 1-1-1 Umezono, Tsukuba, Ibaraki, Japan Jianhai Jiang Key Laboratory of Glycoconjuates Research, Ministry of Public Health and Gene Research Center, Shanghai Medical College of Fudan University, Shanghai, People’s Republic of China Tongzhong Ju Department of Biochemistry, Emory University School of Medicine, Rollins Research Center, Atlanta, Georgia, USA Hiroto Kawashima Laboratory of Microbiology and Immunology, School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka, and PRESTO, Japan Science and Technology Agency, Kawaguchi, Japan
Contributors
xv
Motohiro Kobayashi Department of Molecular Pathology, Shinshu University Graduate School of Medicine, Matsumoto, Japan Yuko Kozono Research Center for Medical Glycoscience (RCMG), National Institute of Advanced Industrial Science and Technology (AIST), Central-2 OSL, 1-1-1 Umezono, Tsukuba, Ibaraki, Japan Atsushi Kuno Research Center for Medical Glycoscience (RCMG), National Institute of Advanced Industrial Science and Technology (AIST), Central-2 OSL, 1-1-1 Umezono, Tsukuba, Ibaraki, Japan Seung Ho Lee Glycobiology Unit, Tumor Microenvironment Program, Cancer Research Center, Sanford-Burnham Medical Research Institute, La Jolla, California, USA Xiaofeng Li Department of Neurology, Second Affiliated Hospital of Chongqin Medical University, Chongqin, People’s Republic of China Jianmin Liu Vicam, Watertown, Massachusetts, USA Mark Lommel Institut fu¨r Pflanzenwissenschaften (HIP), Ruprecht-Karls-Universita¨t Heidelberg, Heidelberg, Germany Hiroshi Manya Molecular Glycobiology, Tokyo Metropolitan Institute of Gerontology, Itabashi-Ku, Tokyo, Japan Paul T. Martin Center for Gene Therapy, The Research Institute at Nationwide Children’s Hospital, and Department of Pediatrics, Department of Physiology and Cell Biology, The Ohio State University College of Medicine, Columbus, Ohio, USA Junya Mitoma Division of Glyco-Signal Research, Institute of Molecular Biomembrane and Glycobiology, Tohoku Pharmaceutical University, Komatsushima, Aoba, Sendai, Japan Kelley W. Moremen The Complex Carbohydrate Research Center and the Department of Biochemistry and Molecular Biology, University of Georgia, Athens, GA
xvi
Contributors
Alison V. Nairn The Complex Carbohydrate Research Center and the Department of Biochemistry and Molecular Biology, University of Georgia, Athens, GA Mohd Nazri Ismail Division of Molecular Biosciences, Faculty of Natural Sciences, Imperial College London, London, United Kingdom Jun Nakayama Department of Molecular Pathology, Shinshu University Graduate School of Medicine, Matsumoto, Japan Hisashi Narimatsu Research Center for Medical Glycoscience (RCMG), National Institute of Advanced Industrial Science and Technology (AIST), Central-2 OSL, 1-1-1 Umezono, Tsukuba, Ibaraki, Japan Takashi Ohkura Research Center for Medical Glycoscience (RCMG), National Institute of Advanced Industrial Science and Technology (AIST), Central-2 OSL, 1-1-1 Umezono, Tsukuba, Ibaraki, Japan Kazuaki Ohtsubo Department of Disease Glycomics, The Institute of Scientific and Industrial Research, Osaka University, Ibaraki, Osaka, Japan Chikara Ohyama Department of Urology, School of Medicine, Hirosaki Graduate University, Hirosaki, Japan Yue Qi Department of Pathology, Upstate Medical University, New York, USA Robert Sackstein Department of Dermatology and Department of Medicine, Brigham and Women’s Hospital, and Department of Medical Oncology, Dana Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts, USA Takashi Sato Research Center for Medical Glycoscience (RCMG), National Institute of Advanced Industrial Science and Technology (AIST), Central-2 OSL, 1-1-1 Umezono, Tsukuba, Ibaraki, Japan Nathalie Seta Laboratoire de Biochimie Me´tabolique et Cellulaire, AP-HP, Hopital Bichat, Paris, France
Contributors
xvii
Swetlana Sirko Department of Physiological Genomics, Ludwig-Maximilians-University Munich, Germany Erica L. Stone School of Medicine, Department of Cellular and Molecular Medicine, University of California, San Diego, La Jolla, California, USA Sabine Strahl Institut fu¨r Pflanzenwissenschaften (HIP), Ruprecht-Karls-Universita¨t Heidelberg, Heidelberg, Germany Mari Tenno RIKEN Research Center for Allergy and Immunology, Tsurumi-ku, Yokohama City, Kanagawa, Japan Akira Togayachi Research Center for Medical Glycoscience (RCMG), National Institute of Advanced Industrial Science and Technology (AIST), Central-2 OSL, 1-1-1 Umezono, Tsukuba, Ibaraki, Japan Alexander Von Holst Department of Cell Morphology and Molecular Neurobiology, Ruhr-University, Bochum, Germany Tobias Willer Department of Molecular Physiology and Biophysics, University of Iowa College of Medicine, Iowa, USA Lijun Xia Cardiovascular Biology Research Program, Oklahoma Medical Research Foundation, and Department of Biochemistry and Molecular Biology; Oklahoma Center for Medical Glycobiology, University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma, USA Hayato Yamamoto Department of Urology, Oyokyo Kidney Research Institute, Hirosaki, Japan Yuan Yang Department of Neurology, Tongji Medical College, Wuhan, Hubei Province, People’s Republic of China Peng Zhang Department of Neuroscience and Physiology, Upstate Medical University, Syracuse, New York, USA
PREFACE
In 2006, we published three volumes in the Methods in Enzymology dedicated to Glycobiology field as follows: Glycobiology (Volume 415), Glycomics (Volume 416), and Functional Glycomics (Volume 417). We have seen the tremendous progress in the field of glycobiology since then. In particular, the explosive progress was made in immunology, neuroglycobiology, glycomics, signal transduction, and many other disciplines, examining each unique system and employing new technology. The Academic Press kindly gave another opportunity to update the introduction of new methods to a large variety of readers who like to contribute to the advancement of Glycosciences. In the current series of Methods in Enzymology, Glycomics (Volume 478), Functional Glycomics (Volume 479), and Glycobiology (Volume 480), have been dedicated to disseminate information on the methods in determining the biological roles of carbohydrates, thanks to Academic Press Manager, particularly to Ms. Zoe Kruze and Ms. Dels Retchagar. The second volume (Volume 479), Functional Glycomics, covers new development in glycosciences, including functional studies of glycosylation in stem cells, functions revealed by gene knockout mouse, glycan defects in muscular dystrophy, and glycans in tumor formation. In the accompanying Glycomics book (Volume 478), glycomics revealed by mass spectrometric analysis, by carbohydrate-binding proteins, and chemical glycobiology are described. The latter include protein–carbohydrate interaction, synthetic carbohydrate chemistry, and identification of carbohydrate-binding protein by carbohydrate mimicry peptides. The third volume, Glycobiology (Volume 480), covers proteoglycan function, infection, immunity, and carbohydrate-binding proteins, including galectin, and new development, including O-glycosylation in Notch and related signaling. In these books, I tried to bring as new development as possible of these expanding fields, and I believe that we have a collection of outstanding contributors who have expertise in their respective fields. I believe that this book will be useful to a wide variety of readers from graduate students, researchers in academic, and industry, to those who would like to teach glycobiology and glycosciences at various levels. We hope that this book will contribute to further explosive progress in glycosciences and glycobiology. MINORU FUKUDA xix
METHODS IN ENZYMOLOGY
VOLUME I. Preparation and Assay of Enzymes Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME II. Preparation and Assay of Enzymes Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME III. Preparation and Assay of Substrates Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME IV. Special Techniques for the Enzymologist Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME V. Preparation and Assay of Enzymes Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME VI. Preparation and Assay of Enzymes (Continued) Preparation and Assay of Substrates Special Techniques Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME VII. Cumulative Subject Index Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME VIII. Complex Carbohydrates Edited by ELIZABETH F. NEUFELD AND VICTOR GINSBURG VOLUME IX. Carbohydrate Metabolism Edited by WILLIS A. WOOD VOLUME X. Oxidation and Phosphorylation Edited by RONALD W. ESTABROOK AND MAYNARD E. PULLMAN VOLUME XI. Enzyme Structure Edited by C. H. W. HIRS VOLUME XII. Nucleic Acids (Parts A and B) Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE VOLUME XIII. Citric Acid Cycle Edited by J. M. LOWENSTEIN VOLUME XIV. Lipids Edited by J. M. LOWENSTEIN VOLUME XV. Steroids and Terpenoids Edited by RAYMOND B. CLAYTON
xxi
xxii
Methods in Enzymology
VOLUME XVI. Fast Reactions Edited by KENNETH KUSTIN VOLUME XVII. Metabolism of Amino Acids and Amines (Parts A and B) Edited by HERBERT TABOR AND CELIA WHITE TABOR VOLUME XVIII. Vitamins and Coenzymes (Parts A, B, and C) Edited by DONALD B. MCCORMICK AND LEMUEL D. WRIGHT VOLUME XIX. Proteolytic Enzymes Edited by GERTRUDE E. PERLMANN AND LASZLO LORAND VOLUME XX. Nucleic Acids and Protein Synthesis (Part C) Edited by KIVIE MOLDAVE AND LAWRENCE GROSSMAN VOLUME XXI. Nucleic Acids (Part D) Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE VOLUME XXII. Enzyme Purification and Related Techniques Edited by WILLIAM B. JAKOBY VOLUME XXIII. Photosynthesis (Part A) Edited by ANTHONY SAN PIETRO VOLUME XXIV. Photosynthesis and Nitrogen Fixation (Part B) Edited by ANTHONY SAN PIETRO VOLUME XXV. Enzyme Structure (Part B) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME XXVI. Enzyme Structure (Part C) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME XXVII. Enzyme Structure (Part D) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME XXVIII. Complex Carbohydrates (Part B) Edited by VICTOR GINSBURG VOLUME XXIX. Nucleic Acids and Protein Synthesis (Part E) Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE VOLUME XXX. Nucleic Acids and Protein Synthesis (Part F) Edited by KIVIE MOLDAVE AND LAWRENCE GROSSMAN VOLUME XXXI. Biomembranes (Part A) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME XXXII. Biomembranes (Part B) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME XXXIII. Cumulative Subject Index Volumes I-XXX Edited by MARTHA G. DENNIS AND EDWARD A. DENNIS VOLUME XXXIV. Affinity Techniques (Enzyme Purification: Part B) Edited by WILLIAM B. JAKOBY AND MEIR WILCHEK
Methods in Enzymology
VOLUME XXXV. Lipids (Part B) Edited by JOHN M. LOWENSTEIN VOLUME XXXVI. Hormone Action (Part A: Steroid Hormones) Edited by BERT W. O’MALLEY AND JOEL G. HARDMAN VOLUME XXXVII. Hormone Action (Part B: Peptide Hormones) Edited by BERT W. O’MALLEY AND JOEL G. HARDMAN VOLUME XXXVIII. Hormone Action (Part C: Cyclic Nucleotides) Edited by JOEL G. HARDMAN AND BERT W. O’MALLEY VOLUME XXXIX. Hormone Action (Part D: Isolated Cells, Tissues, and Organ Systems) Edited by JOEL G. HARDMAN AND BERT W. O’MALLEY VOLUME XL. Hormone Action (Part E: Nuclear Structure and Function) Edited by BERT W. O’MALLEY AND JOEL G. HARDMAN VOLUME XLI. Carbohydrate Metabolism (Part B) Edited by W. A. WOOD VOLUME XLII. Carbohydrate Metabolism (Part C) Edited by W. A. WOOD VOLUME XLIII. Antibiotics Edited by JOHN H. HASH VOLUME XLIV. Immobilized Enzymes Edited by KLAUS MOSBACH VOLUME XLV. Proteolytic Enzymes (Part B) Edited by LASZLO LORAND VOLUME XLVI. Affinity Labeling Edited by WILLIAM B. JAKOBY AND MEIR WILCHEK VOLUME XLVII. Enzyme Structure (Part E) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME XLVIII. Enzyme Structure (Part F) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME XLIX. Enzyme Structure (Part G) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME L. Complex Carbohydrates (Part C) Edited by VICTOR GINSBURG VOLUME LI. Purine and Pyrimidine Nucleotide Metabolism Edited by PATRICIA A. HOFFEE AND MARY ELLEN JONES VOLUME LII. Biomembranes (Part C: Biological Oxidations) Edited by SIDNEY FLEISCHER AND LESTER PACKER
xxiii
xxiv
Methods in Enzymology
VOLUME LIII. Biomembranes (Part D: Biological Oxidations) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME LIV. Biomembranes (Part E: Biological Oxidations) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME LV. Biomembranes (Part F: Bioenergetics) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME LVI. Biomembranes (Part G: Bioenergetics) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME LVII. Bioluminescence and Chemiluminescence Edited by MARLENE A. DELUCA VOLUME LVIII. Cell Culture Edited by WILLIAM B. JAKOBY AND IRA PASTAN VOLUME LIX. Nucleic Acids and Protein Synthesis (Part G) Edited by KIVIE MOLDAVE AND LAWRENCE GROSSMAN VOLUME LX. Nucleic Acids and Protein Synthesis (Part H) Edited by KIVIE MOLDAVE AND LAWRENCE GROSSMAN VOLUME 61. Enzyme Structure (Part H) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME 62. Vitamins and Coenzymes (Part D) Edited by DONALD B. MCCORMICK AND LEMUEL D. WRIGHT VOLUME 63. Enzyme Kinetics and Mechanism (Part A: Initial Rate and Inhibitor Methods) Edited by DANIEL L. PURICH VOLUME 64. Enzyme Kinetics and Mechanism (Part B: Isotopic Probes and Complex Enzyme Systems) Edited by DANIEL L. PURICH VOLUME 65. Nucleic Acids (Part I) Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE VOLUME 66. Vitamins and Coenzymes (Part E) Edited by DONALD B. MCCORMICK AND LEMUEL D. WRIGHT VOLUME 67. Vitamins and Coenzymes (Part F) Edited by DONALD B. MCCORMICK AND LEMUEL D. WRIGHT VOLUME 68. Recombinant DNA Edited by RAY WU VOLUME 69. Photosynthesis and Nitrogen Fixation (Part C) Edited by ANTHONY SAN PIETRO VOLUME 70. Immunochemical Techniques (Part A) Edited by HELEN VAN VUNAKIS AND JOHN J. LANGONE
Methods in Enzymology
xxv
VOLUME 71. Lipids (Part C) Edited by JOHN M. LOWENSTEIN VOLUME 72. Lipids (Part D) Edited by JOHN M. LOWENSTEIN VOLUME 73. Immunochemical Techniques (Part B) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 74. Immunochemical Techniques (Part C) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 75. Cumulative Subject Index Volumes XXXI, XXXII, XXXIV–LX Edited by EDWARD A. DENNIS AND MARTHA G. DENNIS VOLUME 76. Hemoglobins Edited by ERALDO ANTONINI, LUIGI ROSSI-BERNARDI, AND EMILIA CHIANCONE VOLUME 77. Detoxication and Drug Metabolism Edited by WILLIAM B. JAKOBY VOLUME 78. Interferons (Part A) Edited by SIDNEY PESTKA VOLUME 79. Interferons (Part B) Edited by SIDNEY PESTKA VOLUME 80. Proteolytic Enzymes (Part C) Edited by LASZLO LORAND VOLUME 81. Biomembranes (Part H: Visual Pigments and Purple Membranes, I) Edited by LESTER PACKER VOLUME 82. Structural and Contractile Proteins (Part A: Extracellular Matrix) Edited by LEON W. CUNNINGHAM AND DIXIE W. FREDERIKSEN VOLUME 83. Complex Carbohydrates (Part D) Edited by VICTOR GINSBURG VOLUME 84. Immunochemical Techniques (Part D: Selected Immunoassays) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 85. Structural and Contractile Proteins (Part B: The Contractile Apparatus and the Cytoskeleton) Edited by DIXIE W. FREDERIKSEN AND LEON W. CUNNINGHAM VOLUME 86. Prostaglandins and Arachidonate Metabolites Edited by WILLIAM E. M. LANDS AND WILLIAM L. SMITH VOLUME 87. Enzyme Kinetics and Mechanism (Part C: Intermediates, Stereo-chemistry, and Rate Studies) Edited by DANIEL L. PURICH VOLUME 88. Biomembranes (Part I: Visual Pigments and Purple Membranes, II) Edited by LESTER PACKER
xxvi
Methods in Enzymology
VOLUME 89. Carbohydrate Metabolism (Part D) Edited by WILLIS A. WOOD VOLUME 90. Carbohydrate Metabolism (Part E) Edited by WILLIS A. WOOD VOLUME 91. Enzyme Structure (Part I) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME 92. Immunochemical Techniques (Part E: Monoclonal Antibodies and General Immunoassay Methods) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 93. Immunochemical Techniques (Part F: Conventional Antibodies, Fc Receptors, and Cytotoxicity) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 94. Polyamines Edited by HERBERT TABOR AND CELIA WHITE TABOR VOLUME 95. Cumulative Subject Index Volumes 61–74, 76–80 Edited by EDWARD A. DENNIS AND MARTHA G. DENNIS VOLUME 96. Biomembranes [Part J: Membrane Biogenesis: Assembly and Targeting (General Methods; Eukaryotes)] Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 97. Biomembranes [Part K: Membrane Biogenesis: Assembly and Targeting (Prokaryotes, Mitochondria, and Chloroplasts)] Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 98. Biomembranes (Part L: Membrane Biogenesis: Processing and Recycling) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 99. Hormone Action (Part F: Protein Kinases) Edited by JACKIE D. CORBIN AND JOEL G. HARDMAN VOLUME 100. Recombinant DNA (Part B) Edited by RAY WU, LAWRENCE GROSSMAN, AND KIVIE MOLDAVE VOLUME 101. Recombinant DNA (Part C) Edited by RAY WU, LAWRENCE GROSSMAN, AND KIVIE MOLDAVE VOLUME 102. Hormone Action (Part G: Calmodulin and Calcium-Binding Proteins) Edited by ANTHONY R. MEANS AND BERT W. O’MALLEY VOLUME 103. Hormone Action (Part H: Neuroendocrine Peptides) Edited by P. MICHAEL CONN VOLUME 104. Enzyme Purification and Related Techniques (Part C) Edited by WILLIAM B. JAKOBY
Methods in Enzymology
xxvii
VOLUME 105. Oxygen Radicals in Biological Systems Edited by LESTER PACKER VOLUME 106. Posttranslational Modifications (Part A) Edited by FINN WOLD AND KIVIE MOLDAVE VOLUME 107. Posttranslational Modifications (Part B) Edited by FINN WOLD AND KIVIE MOLDAVE VOLUME 108. Immunochemical Techniques (Part G: Separation and Characterization of Lymphoid Cells) Edited by GIOVANNI DI SABATO, JOHN J. LANGONE, AND HELEN VAN VUNAKIS VOLUME 109. Hormone Action (Part I: Peptide Hormones) Edited by LUTZ BIRNBAUMER AND BERT W. O’MALLEY VOLUME 110. Steroids and Isoprenoids (Part A) Edited by JOHN H. LAW AND HANS C. RILLING VOLUME 111. Steroids and Isoprenoids (Part B) Edited by JOHN H. LAW AND HANS C. RILLING VOLUME 112. Drug and Enzyme Targeting (Part A) Edited by KENNETH J. WIDDER AND RALPH GREEN VOLUME 113. Glutamate, Glutamine, Glutathione, and Related Compounds Edited by ALTON MEISTER VOLUME 114. Diffraction Methods for Biological Macromolecules (Part A) Edited by HAROLD W. WYCKOFF, C. H. W. HIRS, AND SERGE N. TIMASHEFF VOLUME 115. Diffraction Methods for Biological Macromolecules (Part B) Edited by HAROLD W. WYCKOFF, C. H. W. HIRS, AND SERGE N. TIMASHEFF VOLUME 116. Immunochemical Techniques (Part H: Effectors and Mediators of Lymphoid Cell Functions) Edited by GIOVANNI DI SABATO, JOHN J. LANGONE, AND HELEN VAN VUNAKIS VOLUME 117. Enzyme Structure (Part J) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME 118. Plant Molecular Biology Edited by ARTHUR WEISSBACH AND HERBERT WEISSBACH VOLUME 119. Interferons (Part C) Edited by SIDNEY PESTKA VOLUME 120. Cumulative Subject Index Volumes 81–94, 96–101 VOLUME 121. Immunochemical Techniques (Part I: Hybridoma Technology and Monoclonal Antibodies) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 122. Vitamins and Coenzymes (Part G) Edited by FRANK CHYTIL AND DONALD B. MCCORMICK
xxviii
Methods in Enzymology
VOLUME 123. Vitamins and Coenzymes (Part H) Edited by FRANK CHYTIL AND DONALD B. MCCORMICK VOLUME 124. Hormone Action (Part J: Neuroendocrine Peptides) Edited by P. MICHAEL CONN VOLUME 125. Biomembranes (Part M: Transport in Bacteria, Mitochondria, and Chloroplasts: General Approaches and Transport Systems) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 126. Biomembranes (Part N: Transport in Bacteria, Mitochondria, and Chloroplasts: Protonmotive Force) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 127. Biomembranes (Part O: Protons and Water: Structure and Translocation) Edited by LESTER PACKER VOLUME 128. Plasma Lipoproteins (Part A: Preparation, Structure, and Molecular Biology) Edited by JERE P. SEGREST AND JOHN J. ALBERS VOLUME 129. Plasma Lipoproteins (Part B: Characterization, Cell Biology, and Metabolism) Edited by JOHN J. ALBERS AND JERE P. SEGREST VOLUME 130. Enzyme Structure (Part K) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME 131. Enzyme Structure (Part L) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME 132. Immunochemical Techniques (Part J: Phagocytosis and Cell-Mediated Cytotoxicity) Edited by GIOVANNI DI SABATO AND JOHANNES EVERSE VOLUME 133. Bioluminescence and Chemiluminescence (Part B) Edited by MARLENE DELUCA AND WILLIAM D. MCELROY VOLUME 134. Structural and Contractile Proteins (Part C: The Contractile Apparatus and the Cytoskeleton) Edited by RICHARD B. VALLEE VOLUME 135. Immobilized Enzymes and Cells (Part B) Edited by KLAUS MOSBACH VOLUME 136. Immobilized Enzymes and Cells (Part C) Edited by KLAUS MOSBACH VOLUME 137. Immobilized Enzymes and Cells (Part D) Edited by KLAUS MOSBACH VOLUME 138. Complex Carbohydrates (Part E) Edited by VICTOR GINSBURG
Methods in Enzymology
xxix
VOLUME 139. Cellular Regulators (Part A: Calcium- and Calmodulin-Binding Proteins) Edited by ANTHONY R. MEANS AND P. MICHAEL CONN VOLUME 140. Cumulative Subject Index Volumes 102–119, 121–134 VOLUME 141. Cellular Regulators (Part B: Calcium and Lipids) Edited by P. MICHAEL CONN AND ANTHONY R. MEANS VOLUME 142. Metabolism of Aromatic Amino Acids and Amines Edited by SEYMOUR KAUFMAN VOLUME 143. Sulfur and Sulfur Amino Acids Edited by WILLIAM B. JAKOBY AND OWEN GRIFFITH VOLUME 144. Structural and Contractile Proteins (Part D: Extracellular Matrix) Edited by LEON W. CUNNINGHAM VOLUME 145. Structural and Contractile Proteins (Part E: Extracellular Matrix) Edited by LEON W. CUNNINGHAM VOLUME 146. Peptide Growth Factors (Part A) Edited by DAVID BARNES AND DAVID A. SIRBASKU VOLUME 147. Peptide Growth Factors (Part B) Edited by DAVID BARNES AND DAVID A. SIRBASKU VOLUME 148. Plant Cell Membranes Edited by LESTER PACKER AND ROLAND DOUCE VOLUME 149. Drug and Enzyme Targeting (Part B) Edited by RALPH GREEN AND KENNETH J. WIDDER VOLUME 150. Immunochemical Techniques (Part K: In Vitro Models of B and T Cell Functions and Lymphoid Cell Receptors) Edited by GIOVANNI DI SABATO VOLUME 151. Molecular Genetics of Mammalian Cells Edited by MICHAEL M. GOTTESMAN VOLUME 152. Guide to Molecular Cloning Techniques Edited by SHELBY L. BERGER AND ALAN R. KIMMEL VOLUME 153. Recombinant DNA (Part D) Edited by RAY WU AND LAWRENCE GROSSMAN VOLUME 154. Recombinant DNA (Part E) Edited by RAY WU AND LAWRENCE GROSSMAN VOLUME 155. Recombinant DNA (Part F) Edited by RAY WU VOLUME 156. Biomembranes (Part P: ATP-Driven Pumps and Related Transport: The Na, K-Pump) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER
xxx
Methods in Enzymology
VOLUME 157. Biomembranes (Part Q: ATP-Driven Pumps and Related Transport: Calcium, Proton, and Potassium Pumps) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 158. Metalloproteins (Part A) Edited by JAMES F. RIORDAN AND BERT L. VALLEE VOLUME 159. Initiation and Termination of Cyclic Nucleotide Action Edited by JACKIE D. CORBIN AND ROGER A. JOHNSON VOLUME 160. Biomass (Part A: Cellulose and Hemicellulose) Edited by WILLIS A. WOOD AND SCOTT T. KELLOGG VOLUME 161. Biomass (Part B: Lignin, Pectin, and Chitin) Edited by WILLIS A. WOOD AND SCOTT T. KELLOGG VOLUME 162. Immunochemical Techniques (Part L: Chemotaxis and Inflammation) Edited by GIOVANNI DI SABATO VOLUME 163. Immunochemical Techniques (Part M: Chemotaxis and Inflammation) Edited by GIOVANNI DI SABATO VOLUME 164. Ribosomes Edited by HARRY F. NOLLER, JR., AND KIVIE MOLDAVE VOLUME 165. Microbial Toxins: Tools for Enzymology Edited by SIDNEY HARSHMAN VOLUME 166. Branched-Chain Amino Acids Edited by ROBERT HARRIS AND JOHN R. SOKATCH VOLUME 167. Cyanobacteria Edited by LESTER PACKER AND ALEXANDER N. GLAZER VOLUME 168. Hormone Action (Part K: Neuroendocrine Peptides) Edited by P. MICHAEL CONN VOLUME 169. Platelets: Receptors, Adhesion, Secretion (Part A) Edited by JACEK HAWIGER VOLUME 170. Nucleosomes Edited by PAUL M. WASSARMAN AND ROGER D. KORNBERG VOLUME 171. Biomembranes (Part R: Transport Theory: Cells and Model Membranes) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 172. Biomembranes (Part S: Transport: Membrane Isolation and Characterization) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER
Methods in Enzymology
xxxi
VOLUME 173. Biomembranes [Part T: Cellular and Subcellular Transport: Eukaryotic (Nonepithelial) Cells] Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 174. Biomembranes [Part U: Cellular and Subcellular Transport: Eukaryotic (Nonepithelial) Cells] Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 175. Cumulative Subject Index Volumes 135–139, 141–167 VOLUME 176. Nuclear Magnetic Resonance (Part A: Spectral Techniques and Dynamics) Edited by NORMAN J. OPPENHEIMER AND THOMAS L. JAMES VOLUME 177. Nuclear Magnetic Resonance (Part B: Structure and Mechanism) Edited by NORMAN J. OPPENHEIMER AND THOMAS L. JAMES VOLUME 178. Antibodies, Antigens, and Molecular Mimicry Edited by JOHN J. LANGONE VOLUME 179. Complex Carbohydrates (Part F) Edited by VICTOR GINSBURG VOLUME 180. RNA Processing (Part A: General Methods) Edited by JAMES E. DAHLBERG AND JOHN N. ABELSON VOLUME 181. RNA Processing (Part B: Specific Methods) Edited by JAMES E. DAHLBERG AND JOHN N. ABELSON VOLUME 182. Guide to Protein Purification Edited by MURRAY P. DEUTSCHER VOLUME 183. Molecular Evolution: Computer Analysis of Protein and Nucleic Acid Sequences Edited by RUSSELL F. DOOLITTLE VOLUME 184. Avidin-Biotin Technology Edited by MEIR WILCHEK AND EDWARD A. BAYER VOLUME 185. Gene Expression Technology Edited by DAVID V. GOEDDEL VOLUME 186. Oxygen Radicals in Biological Systems (Part B: Oxygen Radicals and Antioxidants) Edited by LESTER PACKER AND ALEXANDER N. GLAZER VOLUME 187. Arachidonate Related Lipid Mediators Edited by ROBERT C. MURPHY AND FRANK A. FITZPATRICK VOLUME 188. Hydrocarbons and Methylotrophy Edited by MARY E. LIDSTROM VOLUME 189. Retinoids (Part A: Molecular and Metabolic Aspects) Edited by LESTER PACKER
xxxii
Methods in Enzymology
VOLUME 190. Retinoids (Part B: Cell Differentiation and Clinical Applications) Edited by LESTER PACKER VOLUME 191. Biomembranes (Part V: Cellular and Subcellular Transport: Epithelial Cells) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 192. Biomembranes (Part W: Cellular and Subcellular Transport: Epithelial Cells) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 193. Mass Spectrometry Edited by JAMES A. MCCLOSKEY VOLUME 194. Guide to Yeast Genetics and Molecular Biology Edited by CHRISTINE GUTHRIE AND GERALD R. FINK VOLUME 195. Adenylyl Cyclase, G Proteins, and Guanylyl Cyclase Edited by ROGER A. JOHNSON AND JACKIE D. CORBIN VOLUME 196. Molecular Motors and the Cytoskeleton Edited by RICHARD B. VALLEE VOLUME 197. Phospholipases Edited by EDWARD A. DENNIS VOLUME 198. Peptide Growth Factors (Part C) Edited by DAVID BARNES, J. P. MATHER, AND GORDON H. SATO VOLUME 199. Cumulative Subject Index Volumes 168–174, 176–194 VOLUME 200. Protein Phosphorylation (Part A: Protein Kinases: Assays, Purification, Antibodies, Functional Analysis, Cloning, and Expression) Edited by TONY HUNTER AND BARTHOLOMEW M. SEFTON VOLUME 201. Protein Phosphorylation (Part B: Analysis of Protein Phosphorylation, Protein Kinase Inhibitors, and Protein Phosphatases) Edited by TONY HUNTER AND BARTHOLOMEW M. SEFTON VOLUME 202. Molecular Design and Modeling: Concepts and Applications (Part A: Proteins, Peptides, and Enzymes) Edited by JOHN J. LANGONE VOLUME 203. Molecular Design and Modeling: Concepts and Applications (Part B: Antibodies and Antigens, Nucleic Acids, Polysaccharides, and Drugs) Edited by JOHN J. LANGONE VOLUME 204. Bacterial Genetic Systems Edited by JEFFREY H. MILLER VOLUME 205. Metallobiochemistry (Part B: Metallothionein and Related Molecules) Edited by JAMES F. RIORDAN AND BERT L. VALLEE
Methods in Enzymology
xxxiii
VOLUME 206. Cytochrome P450 Edited by MICHAEL R. WATERMAN AND ERIC F. JOHNSON VOLUME 207. Ion Channels Edited by BERNARDO RUDY AND LINDA E. IVERSON VOLUME 208. Protein–DNA Interactions Edited by ROBERT T. SAUER VOLUME 209. Phospholipid Biosynthesis Edited by EDWARD A. DENNIS AND DENNIS E. VANCE VOLUME 210. Numerical Computer Methods Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON VOLUME 211. DNA Structures (Part A: Synthesis and Physical Analysis of DNA) Edited by DAVID M. J. LILLEY AND JAMES E. DAHLBERG VOLUME 212. DNA Structures (Part B: Chemical and Electrophoretic Analysis of DNA) Edited by DAVID M. J. LILLEY AND JAMES E. DAHLBERG VOLUME 213. Carotenoids (Part A: Chemistry, Separation, Quantitation, and Antioxidation) Edited by LESTER PACKER VOLUME 214. Carotenoids (Part B: Metabolism, Genetics, and Biosynthesis) Edited by LESTER PACKER VOLUME 215. Platelets: Receptors, Adhesion, Secretion (Part B) Edited by JACEK J. HAWIGER VOLUME 216. Recombinant DNA (Part G) Edited by RAY WU VOLUME 217. Recombinant DNA (Part H) Edited by RAY WU VOLUME 218. Recombinant DNA (Part I) Edited by RAY WU VOLUME 219. Reconstitution of Intracellular Transport Edited by JAMES E. ROTHMAN VOLUME 220. Membrane Fusion Techniques (Part A) Edited by NEJAT DU¨ZGU¨NES VOLUME 221. Membrane Fusion Techniques (Part B) Edited by NEJAT DU¨ZGU¨NES VOLUME 222. Proteolytic Enzymes in Coagulation, Fibrinolysis, and Complement Activation (Part A: Mammalian Blood Coagulation Factors and Inhibitors) Edited by LASZLO LORAND AND KENNETH G. MANN
xxxiv
Methods in Enzymology
VOLUME 223. Proteolytic Enzymes in Coagulation, Fibrinolysis, and Complement Activation (Part B: Complement Activation, Fibrinolysis, and Nonmammalian Blood Coagulation Factors) Edited by LASZLO LORAND AND KENNETH G. MANN VOLUME 224. Molecular Evolution: Producing the Biochemical Data Edited by ELIZABETH ANNE ZIMMER, THOMAS J. WHITE, REBECCA L. CANN, AND ALLAN C. WILSON VOLUME 225. Guide to Techniques in Mouse Development Edited by PAUL M. WASSARMAN AND MELVIN L. DEPAMPHILIS VOLUME 226. Metallobiochemistry (Part C: Spectroscopic and Physical Methods for Probing Metal Ion Environments in Metalloenzymes and Metalloproteins) Edited by JAMES F. RIORDAN AND BERT L. VALLEE VOLUME 227. Metallobiochemistry (Part D: Physical and Spectroscopic Methods for Probing Metal Ion Environments in Metalloproteins) Edited by JAMES F. RIORDAN AND BERT L. VALLEE VOLUME 228. Aqueous Two-Phase Systems Edited by HARRY WALTER AND GO¨TE JOHANSSON VOLUME 229. Cumulative Subject Index Volumes 195–198, 200–227 VOLUME 230. Guide to Techniques in Glycobiology Edited by WILLIAM J. LENNARZ AND GERALD W. HART VOLUME 231. Hemoglobins (Part B: Biochemical and Analytical Methods) Edited by JOHANNES EVERSE, KIM D. VANDEGRIFF, AND ROBERT M. WINSLOW VOLUME 232. Hemoglobins (Part C: Biophysical Methods) Edited by JOHANNES EVERSE, KIM D. VANDEGRIFF, AND ROBERT M. WINSLOW VOLUME 233. Oxygen Radicals in Biological Systems (Part C) Edited by LESTER PACKER VOLUME 234. Oxygen Radicals in Biological Systems (Part D) Edited by LESTER PACKER VOLUME 235. Bacterial Pathogenesis (Part A: Identification and Regulation of Virulence Factors) Edited by VIRGINIA L. CLARK AND PATRIK M. BAVOIL VOLUME 236. Bacterial Pathogenesis (Part B: Integration of Pathogenic Bacteria with Host Cells) Edited by VIRGINIA L. CLARK AND PATRIK M. BAVOIL VOLUME 237. Heterotrimeric G Proteins Edited by RAVI IYENGAR VOLUME 238. Heterotrimeric G-Protein Effectors Edited by RAVI IYENGAR
Methods in Enzymology
xxxv
VOLUME 239. Nuclear Magnetic Resonance (Part C) Edited by THOMAS L. JAMES AND NORMAN J. OPPENHEIMER VOLUME 240. Numerical Computer Methods (Part B) Edited by MICHAEL L. JOHNSON AND LUDWIG BRAND VOLUME 241. Retroviral Proteases Edited by LAWRENCE C. KUO AND JULES A. SHAFER VOLUME 242. Neoglycoconjugates (Part A) Edited by Y. C. LEE AND REIKO T. LEE VOLUME 243. Inorganic Microbial Sulfur Metabolism Edited by HARRY D. PECK, JR., AND JEAN LEGALL VOLUME 244. Proteolytic Enzymes: Serine and Cysteine Peptidases Edited by ALAN J. BARRETT VOLUME 245. Extracellular Matrix Components Edited by E. RUOSLAHTI AND E. ENGVALL VOLUME 246. Biochemical Spectroscopy Edited by KENNETH SAUER VOLUME 247. Neoglycoconjugates (Part B: Biomedical Applications) Edited by Y. C. LEE AND REIKO T. LEE VOLUME 248. Proteolytic Enzymes: Aspartic and Metallo Peptidases Edited by ALAN J. BARRETT VOLUME 249. Enzyme Kinetics and Mechanism (Part D: Developments in Enzyme Dynamics) Edited by DANIEL L. PURICH VOLUME 250. Lipid Modifications of Proteins Edited by PATRICK J. CASEY AND JANICE E. BUSS VOLUME 251. Biothiols (Part A: Monothiols and Dithiols, Protein Thiols, and Thiyl Radicals) Edited by LESTER PACKER VOLUME 252. Biothiols (Part B: Glutathione and Thioredoxin; Thiols in Signal Transduction and Gene Regulation) Edited by LESTER PACKER VOLUME 253. Adhesion of Microbial Pathogens Edited by RON J. DOYLE AND ITZHAK OFEK VOLUME 254. Oncogene Techniques Edited by PETER K. VOGT AND INDER M. VERMA VOLUME 255. Small GTPases and Their Regulators (Part A: Ras Family) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL
xxxvi
Methods in Enzymology
VOLUME 256. Small GTPases and Their Regulators (Part B: Rho Family) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 257. Small GTPases and Their Regulators (Part C: Proteins Involved in Transport) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 258. Redox-Active Amino Acids in Biology Edited by JUDITH P. KLINMAN VOLUME 259. Energetics of Biological Macromolecules Edited by MICHAEL L. JOHNSON AND GARY K. ACKERS VOLUME 260. Mitochondrial Biogenesis and Genetics (Part A) Edited by GIUSEPPE M. ATTARDI AND ANNE CHOMYN VOLUME 261. Nuclear Magnetic Resonance and Nucleic Acids Edited by THOMAS L. JAMES VOLUME 262. DNA Replication Edited by JUDITH L. CAMPBELL VOLUME 263. Plasma Lipoproteins (Part C: Quantitation) Edited by WILLIAM A. BRADLEY, SANDRA H. GIANTURCO, AND JERE P. SEGREST VOLUME 264. Mitochondrial Biogenesis and Genetics (Part B) Edited by GIUSEPPE M. ATTARDI AND ANNE CHOMYN VOLUME 265. Cumulative Subject Index Volumes 228, 230–262 VOLUME 266. Computer Methods for Macromolecular Sequence Analysis Edited by RUSSELL F. DOOLITTLE VOLUME 267. Combinatorial Chemistry Edited by JOHN N. ABELSON VOLUME 268. Nitric Oxide (Part A: Sources and Detection of NO; NO Synthase) Edited by LESTER PACKER VOLUME 269. Nitric Oxide (Part B: Physiological and Pathological Processes) Edited by LESTER PACKER VOLUME 270. High Resolution Separation and Analysis of Biological Macromolecules (Part A: Fundamentals) Edited by BARRY L. KARGER AND WILLIAM S. HANCOCK VOLUME 271. High Resolution Separation and Analysis of Biological Macromolecules (Part B: Applications) Edited by BARRY L. KARGER AND WILLIAM S. HANCOCK VOLUME 272. Cytochrome P450 (Part B) Edited by ERIC F. JOHNSON AND MICHAEL R. WATERMAN VOLUME 273. RNA Polymerase and Associated Factors (Part A) Edited by SANKAR ADHYA
Methods in Enzymology
xxxvii
VOLUME 274. RNA Polymerase and Associated Factors (Part B) Edited by SANKAR ADHYA VOLUME 275. Viral Polymerases and Related Proteins Edited by LAWRENCE C. KUO, DAVID B. OLSEN, AND STEVEN S. CARROLL VOLUME 276. Macromolecular Crystallography (Part A) Edited by CHARLES W. CARTER, JR., AND ROBERT M. SWEET VOLUME 277. Macromolecular Crystallography (Part B) Edited by CHARLES W. CARTER, JR., AND ROBERT M. SWEET VOLUME 278. Fluorescence Spectroscopy Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON VOLUME 279. Vitamins and Coenzymes (Part I) Edited by DONALD B. MCCORMICK, JOHN W. SUTTIE, AND CONRAD WAGNER VOLUME 280. Vitamins and Coenzymes (Part J) Edited by DONALD B. MCCORMICK, JOHN W. SUTTIE, AND CONRAD WAGNER VOLUME 281. Vitamins and Coenzymes (Part K) Edited by DONALD B. MCCORMICK, JOHN W. SUTTIE, AND CONRAD WAGNER VOLUME 282. Vitamins and Coenzymes (Part L) Edited by DONALD B. MCCORMICK, JOHN W. SUTTIE, AND CONRAD WAGNER VOLUME 283. Cell Cycle Control Edited by WILLIAM G. DUNPHY VOLUME 284. Lipases (Part A: Biotechnology) Edited by BYRON RUBIN AND EDWARD A. DENNIS VOLUME 285. Cumulative Subject Index Volumes 263, 264, 266–284, 286–289 VOLUME 286. Lipases (Part B: Enzyme Characterization and Utilization) Edited by BYRON RUBIN AND EDWARD A. DENNIS VOLUME 287. Chemokines Edited by RICHARD HORUK VOLUME 288. Chemokine Receptors Edited by RICHARD HORUK VOLUME 289. Solid Phase Peptide Synthesis Edited by GREGG B. FIELDS VOLUME 290. Molecular Chaperones Edited by GEORGE H. LORIMER AND THOMAS BALDWIN VOLUME 291. Caged Compounds Edited by GERARD MARRIOTT VOLUME 292. ABC Transporters: Biochemical, Cellular, and Molecular Aspects Edited by SURESH V. AMBUDKAR AND MICHAEL M. GOTTESMAN
xxxviii
Methods in Enzymology
VOLUME 293. Ion Channels (Part B) Edited by P. MICHAEL CONN VOLUME 294. Ion Channels (Part C) Edited by P. MICHAEL CONN VOLUME 295. Energetics of Biological Macromolecules (Part B) Edited by GARY K. ACKERS AND MICHAEL L. JOHNSON VOLUME 296. Neurotransmitter Transporters Edited by SUSAN G. AMARA VOLUME 297. Photosynthesis: Molecular Biology of Energy Capture Edited by LEE MCINTOSH VOLUME 298. Molecular Motors and the Cytoskeleton (Part B) Edited by RICHARD B. VALLEE VOLUME 299. Oxidants and Antioxidants (Part A) Edited by LESTER PACKER VOLUME 300. Oxidants and Antioxidants (Part B) Edited by LESTER PACKER VOLUME 301. Nitric Oxide: Biological and Antioxidant Activities (Part C) Edited by LESTER PACKER VOLUME 302. Green Fluorescent Protein Edited by P. MICHAEL CONN VOLUME 303. cDNA Preparation and Display Edited by SHERMAN M. WEISSMAN VOLUME 304. Chromatin Edited by PAUL M. WASSARMAN AND ALAN P. WOLFFE VOLUME 305. Bioluminescence and Chemiluminescence (Part C) Edited by THOMAS O. BALDWIN AND MIRIAM M. ZIEGLER VOLUME 306. Expression of Recombinant Genes in Eukaryotic Systems Edited by JOSEPH C. GLORIOSO AND MARTIN C. SCHMIDT VOLUME 307. Confocal Microscopy Edited by P. MICHAEL CONN VOLUME 308. Enzyme Kinetics and Mechanism (Part E: Energetics of Enzyme Catalysis) Edited by DANIEL L. PURICH AND VERN L. SCHRAMM VOLUME 309. Amyloid, Prions, and Other Protein Aggregates Edited by RONALD WETZEL VOLUME 310. Biofilms Edited by RON J. DOYLE
Methods in Enzymology
xxxix
VOLUME 311. Sphingolipid Metabolism and Cell Signaling (Part A) Edited by ALFRED H. MERRILL, JR., AND YUSUF A. HANNUN VOLUME 312. Sphingolipid Metabolism and Cell Signaling (Part B) Edited by ALFRED H. MERRILL, JR., AND YUSUF A. HANNUN VOLUME 313. Antisense Technology (Part A: General Methods, Methods of Delivery, and RNA Studies) Edited by M. IAN PHILLIPS VOLUME 314. Antisense Technology (Part B: Applications) Edited by M. IAN PHILLIPS VOLUME 315. Vertebrate Phototransduction and the Visual Cycle (Part A) Edited by KRZYSZTOF PALCZEWSKI VOLUME 316. Vertebrate Phototransduction and the Visual Cycle (Part B) Edited by KRZYSZTOF PALCZEWSKI VOLUME 317. RNA–Ligand Interactions (Part A: Structural Biology Methods) Edited by DANIEL W. CELANDER AND JOHN N. ABELSON VOLUME 318. RNA–Ligand Interactions (Part B: Molecular Biology Methods) Edited by DANIEL W. CELANDER AND JOHN N. ABELSON VOLUME 319. Singlet Oxygen, UV-A, and Ozone Edited by LESTER PACKER AND HELMUT SIES VOLUME 320. Cumulative Subject Index Volumes 290–319 VOLUME 321. Numerical Computer Methods (Part C) Edited by MICHAEL L. JOHNSON AND LUDWIG BRAND VOLUME 322. Apoptosis Edited by JOHN C. REED VOLUME 323. Energetics of Biological Macromolecules (Part C) Edited by MICHAEL L. JOHNSON AND GARY K. ACKERS VOLUME 324. Branched-Chain Amino Acids (Part B) Edited by ROBERT A. HARRIS AND JOHN R. SOKATCH VOLUME 325. Regulators and Effectors of Small GTPases (Part D: Rho Family) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 326. Applications of Chimeric Genes and Hybrid Proteins (Part A: Gene Expression and Protein Purification) Edited by JEREMY THORNER, SCOTT D. EMR, AND JOHN N. ABELSON VOLUME 327. Applications of Chimeric Genes and Hybrid Proteins (Part B: Cell Biology and Physiology) Edited by JEREMY THORNER, SCOTT D. EMR, AND JOHN N. ABELSON
xl
Methods in Enzymology
VOLUME 328. Applications of Chimeric Genes and Hybrid Proteins (Part C: Protein–Protein Interactions and Genomics) Edited by JEREMY THORNER, SCOTT D. EMR, AND JOHN N. ABELSON VOLUME 329. Regulators and Effectors of Small GTPases (Part E: GTPases Involved in Vesicular Traffic) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 330. Hyperthermophilic Enzymes (Part A) Edited by MICHAEL W. W. ADAMS AND ROBERT M. KELLY VOLUME 331. Hyperthermophilic Enzymes (Part B) Edited by MICHAEL W. W. ADAMS AND ROBERT M. KELLY VOLUME 332. Regulators and Effectors of Small GTPases (Part F: Ras Family I) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 333. Regulators and Effectors of Small GTPases (Part G: Ras Family II) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 334. Hyperthermophilic Enzymes (Part C) Edited by MICHAEL W. W. ADAMS AND ROBERT M. KELLY VOLUME 335. Flavonoids and Other Polyphenols Edited by LESTER PACKER VOLUME 336. Microbial Growth in Biofilms (Part A: Developmental and Molecular Biological Aspects) Edited by RON J. DOYLE VOLUME 337. Microbial Growth in Biofilms (Part B: Special Environments and Physicochemical Aspects) Edited by RON J. DOYLE VOLUME 338. Nuclear Magnetic Resonance of Biological Macromolecules (Part A) Edited by THOMAS L. JAMES, VOLKER DO¨TSCH, AND ULI SCHMITZ VOLUME 339. Nuclear Magnetic Resonance of Biological Macromolecules (Part B) Edited by THOMAS L. JAMES, VOLKER DO¨TSCH, AND ULI SCHMITZ VOLUME 340. Drug–Nucleic Acid Interactions Edited by JONATHAN B. CHAIRES AND MICHAEL J. WARING VOLUME 341. Ribonucleases (Part A) Edited by ALLEN W. NICHOLSON VOLUME 342. Ribonucleases (Part B) Edited by ALLEN W. NICHOLSON VOLUME 343. G Protein Pathways (Part A: Receptors) Edited by RAVI IYENGAR AND JOHN D. HILDEBRANDT VOLUME 344. G Protein Pathways (Part B: G Proteins and Their Regulators) Edited by RAVI IYENGAR AND JOHN D. HILDEBRANDT
Methods in Enzymology
xli
VOLUME 345. G Protein Pathways (Part C: Effector Mechanisms) Edited by RAVI IYENGAR AND JOHN D. HILDEBRANDT VOLUME 346. Gene Therapy Methods Edited by M. IAN PHILLIPS VOLUME 347. Protein Sensors and Reactive Oxygen Species (Part A: Selenoproteins and Thioredoxin) Edited by HELMUT SIES AND LESTER PACKER VOLUME 348. Protein Sensors and Reactive Oxygen Species (Part B: Thiol Enzymes and Proteins) Edited by HELMUT SIES AND LESTER PACKER VOLUME 349. Superoxide Dismutase Edited by LESTER PACKER VOLUME 350. Guide to Yeast Genetics and Molecular and Cell Biology (Part B) Edited by CHRISTINE GUTHRIE AND GERALD R. FINK VOLUME 351. Guide to Yeast Genetics and Molecular and Cell Biology (Part C) Edited by CHRISTINE GUTHRIE AND GERALD R. FINK VOLUME 352. Redox Cell Biology and Genetics (Part A) Edited by CHANDAN K. SEN AND LESTER PACKER VOLUME 353. Redox Cell Biology and Genetics (Part B) Edited by CHANDAN K. SEN AND LESTER PACKER VOLUME 354. Enzyme Kinetics and Mechanisms (Part F: Detection and Characterization of Enzyme Reaction Intermediates) Edited by DANIEL L. PURICH VOLUME 355. Cumulative Subject Index Volumes 321–354 VOLUME 356. Laser Capture Microscopy and Microdissection Edited by P. MICHAEL CONN VOLUME 357. Cytochrome P450, Part C Edited by ERIC F. JOHNSON AND MICHAEL R. WATERMAN VOLUME 358. Bacterial Pathogenesis (Part C: Identification, Regulation, and Function of Virulence Factors) Edited by VIRGINIA L. CLARK AND PATRIK M. BAVOIL VOLUME 359. Nitric Oxide (Part D) Edited by ENRIQUE CADENAS AND LESTER PACKER VOLUME 360. Biophotonics (Part A) Edited by GERARD MARRIOTT AND IAN PARKER VOLUME 361. Biophotonics (Part B) Edited by GERARD MARRIOTT AND IAN PARKER
xlii
Methods in Enzymology
VOLUME 362. Recognition of Carbohydrates in Biological Systems (Part A) Edited by YUAN C. LEE AND REIKO T. LEE VOLUME 363. Recognition of Carbohydrates in Biological Systems (Part B) Edited by YUAN C. LEE AND REIKO T. LEE VOLUME 364. Nuclear Receptors Edited by DAVID W. RUSSELL AND DAVID J. MANGELSDORF VOLUME 365. Differentiation of Embryonic Stem Cells Edited by PAUL M. WASSAUMAN AND GORDON M. KELLER VOLUME 366. Protein Phosphatases Edited by SUSANNE KLUMPP AND JOSEF KRIEGLSTEIN VOLUME 367. Liposomes (Part A) Edited by NEJAT DU¨ZGU¨NES VOLUME 368. Macromolecular Crystallography (Part C) Edited by CHARLES W. CARTER, JR., AND ROBERT M. SWEET VOLUME 369. Combinational Chemistry (Part B) Edited by GUILLERMO A. MORALES AND BARRY A. BUNIN VOLUME 370. RNA Polymerases and Associated Factors (Part C) Edited by SANKAR L. ADHYA AND SUSAN GARGES VOLUME 371. RNA Polymerases and Associated Factors (Part D) Edited by SANKAR L. ADHYA AND SUSAN GARGES VOLUME 372. Liposomes (Part B) Edited by NEJAT DU¨ZGU¨NES VOLUME 373. Liposomes (Part C) Edited by NEJAT DU¨ZGU¨NES VOLUME 374. Macromolecular Crystallography (Part D) Edited by CHARLES W. CARTER, JR., AND ROBERT W. SWEET VOLUME 375. Chromatin and Chromatin Remodeling Enzymes (Part A) Edited by C. DAVID ALLIS AND CARL WU VOLUME 376. Chromatin and Chromatin Remodeling Enzymes (Part B) Edited by C. DAVID ALLIS AND CARL WU VOLUME 377. Chromatin and Chromatin Remodeling Enzymes (Part C) Edited by C. DAVID ALLIS AND CARL WU VOLUME 378. Quinones and Quinone Enzymes (Part A) Edited by HELMUT SIES AND LESTER PACKER VOLUME 379. Energetics of Biological Macromolecules (Part D) Edited by JO M. HOLT, MICHAEL L. JOHNSON, AND GARY K. ACKERS VOLUME 380. Energetics of Biological Macromolecules (Part E) Edited by JO M. HOLT, MICHAEL L. JOHNSON, AND GARY K. ACKERS
Methods in Enzymology
xliii
VOLUME 381. Oxygen Sensing Edited by CHANDAN K. SEN AND GREGG L. SEMENZA VOLUME 382. Quinones and Quinone Enzymes (Part B) Edited by HELMUT SIES AND LESTER PACKER VOLUME 383. Numerical Computer Methods (Part D) Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON VOLUME 384. Numerical Computer Methods (Part E) Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON VOLUME 385. Imaging in Biological Research (Part A) Edited by P. MICHAEL CONN VOLUME 386. Imaging in Biological Research (Part B) Edited by P. MICHAEL CONN VOLUME 387. Liposomes (Part D) Edited by NEJAT DU¨ZGU¨NES VOLUME 388. Protein Engineering Edited by DAN E. ROBERTSON AND JOSEPH P. NOEL VOLUME 389. Regulators of G-Protein Signaling (Part A) Edited by DAVID P. SIDEROVSKI VOLUME 390. Regulators of G-Protein Signaling (Part B) Edited by DAVID P. SIDEROVSKI VOLUME 391. Liposomes (Part E) Edited by NEJAT DU¨ZGU¨NES VOLUME 392. RNA Interference Edited by ENGELKE ROSSI VOLUME 393. Circadian Rhythms Edited by MICHAEL W. YOUNG VOLUME 394. Nuclear Magnetic Resonance of Biological Macromolecules (Part C) Edited by THOMAS L. JAMES VOLUME 395. Producing the Biochemical Data (Part B) Edited by ELIZABETH A. ZIMMER AND ERIC H. ROALSON VOLUME 396. Nitric Oxide (Part E) Edited by LESTER PACKER AND ENRIQUE CADENAS VOLUME 397. Environmental Microbiology Edited by JARED R. LEADBETTER VOLUME 398. Ubiquitin and Protein Degradation (Part A) Edited by RAYMOND J. DESHAIES VOLUME 399. Ubiquitin and Protein Degradation (Part B) Edited by RAYMOND J. DESHAIES
xliv
Methods in Enzymology
VOLUME 400. Phase II Conjugation Enzymes and Transport Systems Edited by HELMUT SIES AND LESTER PACKER VOLUME 401. Glutathione Transferases and Gamma Glutamyl Transpeptidases Edited by HELMUT SIES AND LESTER PACKER VOLUME 402. Biological Mass Spectrometry Edited by A. L. BURLINGAME VOLUME 403. GTPases Regulating Membrane Targeting and Fusion Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 404. GTPases Regulating Membrane Dynamics Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 405. Mass Spectrometry: Modified Proteins and Glycoconjugates Edited by A. L. BURLINGAME VOLUME 406. Regulators and Effectors of Small GTPases: Rho Family Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 407. Regulators and Effectors of Small GTPases: Ras Family Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 408. DNA Repair (Part A) Edited by JUDITH L. CAMPBELL AND PAUL MODRICH VOLUME 409. DNA Repair (Part B) Edited by JUDITH L. CAMPBELL AND PAUL MODRICH VOLUME 410. DNA Microarrays (Part A: Array Platforms and Web-Bench Protocols) Edited by ALAN KIMMEL AND BRIAN OLIVER VOLUME 411. DNA Microarrays (Part B: Databases and Statistics) Edited by ALAN KIMMEL AND BRIAN OLIVER VOLUME 412. Amyloid, Prions, and Other Protein Aggregates (Part B) Edited by INDU KHETERPAL AND RONALD WETZEL VOLUME 413. Amyloid, Prions, and Other Protein Aggregates (Part C) Edited by INDU KHETERPAL AND RONALD WETZEL VOLUME 414. Measuring Biological Responses with Automated Microscopy Edited by JAMES INGLESE VOLUME 415. Glycobiology Edited by MINORU FUKUDA VOLUME 416. Glycomics Edited by MINORU FUKUDA VOLUME 417. Functional Glycomics Edited by MINORU FUKUDA
Methods in Enzymology
xlv
VOLUME 418. Embryonic Stem Cells Edited by IRINA KLIMANSKAYA AND ROBERT LANZA VOLUME 419. Adult Stem Cells Edited by IRINA KLIMANSKAYA AND ROBERT LANZA VOLUME 420. Stem Cell Tools and Other Experimental Protocols Edited by IRINA KLIMANSKAYA AND ROBERT LANZA VOLUME 421. Advanced Bacterial Genetics: Use of Transposons and Phage for Genomic Engineering Edited by KELLY T. HUGHES VOLUME 422. Two-Component Signaling Systems, Part A Edited by MELVIN I. SIMON, BRIAN R. CRANE, AND ALEXANDRINE CRANE VOLUME 423. Two-Component Signaling Systems, Part B Edited by MELVIN I. SIMON, BRIAN R. CRANE, AND ALEXANDRINE CRANE VOLUME 424. RNA Editing Edited by JONATHA M. GOTT VOLUME 425. RNA Modification Edited by JONATHA M. GOTT VOLUME 426. Integrins Edited by DAVID CHERESH VOLUME 427. MicroRNA Methods Edited by JOHN J. ROSSI VOLUME 428. Osmosensing and Osmosignaling Edited by HELMUT SIES AND DIETER HAUSSINGER VOLUME 429. Translation Initiation: Extract Systems and Molecular Genetics Edited by JON LORSCH VOLUME 430. Translation Initiation: Reconstituted Systems and Biophysical Methods Edited by JON LORSCH VOLUME 431. Translation Initiation: Cell Biology, High-Throughput and Chemical-Based Approaches Edited by JON LORSCH VOLUME 432. Lipidomics and Bioactive Lipids: Mass-Spectrometry–Based Lipid Analysis Edited by H. ALEX BROWN VOLUME 433. Lipidomics and Bioactive Lipids: Specialized Analytical Methods and Lipids in Disease Edited by H. ALEX BROWN
xlvi
Methods in Enzymology
VOLUME 434. Lipidomics and Bioactive Lipids: Lipids and Cell Signaling Edited by H. ALEX BROWN VOLUME 435. Oxygen Biology and Hypoxia Edited by HELMUT SIES AND BERNHARD BRU¨NE VOLUME 436. Globins and Other Nitric Oxide-Reactive Protiens (Part A) Edited by ROBERT K. POOLE VOLUME 437. Globins and Other Nitric Oxide-Reactive Protiens (Part B) Edited by ROBERT K. POOLE VOLUME 438. Small GTPases in Disease (Part A) Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 439. Small GTPases in Disease (Part B) Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 440. Nitric Oxide, Part F Oxidative and Nitrosative Stress in Redox Regulation of Cell Signaling Edited by ENRIQUE CADENAS AND LESTER PACKER VOLUME 441. Nitric Oxide, Part G Oxidative and Nitrosative Stress in Redox Regulation of Cell Signaling Edited by ENRIQUE CADENAS AND LESTER PACKER VOLUME 442. Programmed Cell Death, General Principles for Studying Cell Death (Part A) Edited by ROYA KHOSRAVI-FAR, ZAHRA ZAKERI, RICHARD A. LOCKSHIN, AND MAURO PIACENTINI VOLUME 443. Angiogenesis: In Vitro Systems Edited by DAVID A. CHERESH VOLUME 444. Angiogenesis: In Vivo Systems (Part A) Edited by DAVID A. CHERESH VOLUME 445. Angiogenesis: In Vivo Systems (Part B) Edited by DAVID A. CHERESH VOLUME 446. Programmed Cell Death, The Biology and Therapeutic Implications of Cell Death (Part B) Edited by ROYA KHOSRAVI-FAR, ZAHRA ZAKERI, RICHARD A. LOCKSHIN, AND MAURO PIACENTINI VOLUME 447. RNA Turnover in Bacteria, Archaea and Organelles Edited by LYNNE E. MAQUAT AND CECILIA M. ARRAIANO VOLUME 448. RNA Turnover in Eukaryotes: Nucleases, Pathways and Analysis of mRNA Decay Edited by LYNNE E. MAQUAT AND MEGERDITCH KILEDJIAN
Methods in Enzymology
xlvii
VOLUME 449. RNA Turnover in Eukaryotes: Analysis of Specialized and Quality Control RNA Decay Pathways Edited by LYNNE E. MAQUAT AND MEGERDITCH KILEDJIAN VOLUME 450. Fluorescence Spectroscopy Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON VOLUME 451. Autophagy: Lower Eukaryotes and Non-Mammalian Systems (Part A) Edited by DANIEL J. KLIONSKY VOLUME 452. Autophagy in Mammalian Systems (Part B) Edited by DANIEL J. KLIONSKY VOLUME 453. Autophagy in Disease and Clinical Applications (Part C) Edited by DANIEL J. KLIONSKY VOLUME 454. Computer Methods (Part A) Edited by MICHAEL L. JOHNSON AND LUDWIG BRAND VOLUME 455. Biothermodynamics (Part A) Edited by MICHAEL L. JOHNSON, JO M. HOLT, AND GARY K. ACKERS (RETIRED) VOLUME 456. Mitochondrial Function, Part A: Mitochondrial Electron Transport Complexes and Reactive Oxygen Species Edited by WILLIAM S. ALLISON AND IMMO E. SCHEFFLER VOLUME 457. Mitochondrial Function, Part B: Mitochondrial Protein Kinases, Protein Phosphatases and Mitochondrial Diseases Edited by WILLIAM S. ALLISON AND ANNE N. MURPHY VOLUME 458. Complex Enzymes in Microbial Natural Product Biosynthesis, Part A: Overview Articles and Peptides Edited by DAVID A. HOPWOOD VOLUME 459. Complex Enzymes in Microbial Natural Product Biosynthesis, Part B: Polyketides, Aminocoumarins and Carbohydrates Edited by DAVID A. HOPWOOD VOLUME 460. Chemokines, Part A Edited by TRACY M. HANDEL AND DAMON J. HAMEL VOLUME 461. Chemokines, Part B Edited by TRACY M. HANDEL AND DAMON J. HAMEL VOLUME 462. Non-Natural Amino Acids Edited by TOM W. MUIR AND JOHN N. ABELSON VOLUME 463. Guide to Protein Purification, 2nd Edition Edited by RICHARD R. BURGESS AND MURRAY P. DEUTSCHER VOLUME 464. Liposomes, Part F Edited by NEJAT DU¨ZGU¨NES
xlviii
Methods in Enzymology
VOLUME 465. Liposomes, Part G Edited by NEJAT DU¨ZGU¨NES VOLUME 466. Biothermodynamics, Part B Edited by MICHAEL L. JOHNSON, GARY K. ACKERS, AND JO M. HOLT VOLUME 467. Computer Methods Part B Edited by MICHAEL L. JOHNSON AND LUDWIG BRAND VOLUME 468. Biophysical, Chemical, and Functional Probes of RNA Structure, Interactions and Folding: Part A Edited by DANIEL HERSCHLAG VOLUME 469. Biophysical, Chemical, and Functional Probes of RNA Structure, Interactions and Folding: Part B Edited by DANIEL HERSCHLAG VOLUME 470. Guide to Yeast Genetics: Functional Genomics, Proteomics, and Other Systems Analysis, 2nd Edition Edited by GERALD FINK, JONATHAN WEISSMAN, AND CHRISTINE GUTHRIE VOLUME 471. Two-Component Signaling Systems, Part C Edited by MELVIN I. SIMON, BRIAN R. CRANE, AND ALEXANDRINE CRANE VOLUME 472. Single Molecule Tools, Part A: Fluorescence Based Approaches Edited by NILS WALTER VOLUME 473. Thiol Redox Transitions in Cell Signaling, Part A Chemistry and Biochemistry of Low Molecular Weight and Protein Thiols Edited by ENRIQUE CADENAS AND LESTER PACKER VOLUME 474. Thiol Redox Transitions in Cell Signaling, Part B Cellular Localization and Signaling Edited by ENRIQUE CADENAS AND LESTER PACKER VOLUME 475. Single Molecule Tools, Part B: Super-Resolution, Particle Tracking, Multiparameter, and Force Based Methods Edited by NILS G. WALTER VOLUME 476. Guide to Techniques in Mouse Development, Part A: Mice, Embryos, and Cells, 2nd Edition Edited by PAUL M. WASSARMAN AND PHILIPPE M. SORIANO VOLUME 477. Guide to Techniques in Mouse Development, Part B: Mouse Molecular Genetics, 2nd Edition Edited by PAUL M. WASSARMAN AND PHILIPPE M. SORIANO VOLUME 478. Glycomics, Part A Edited by MINORU FUKUDA VOLUME 479. Functional Glycomics Edited by MINORU FUKUDA
C H A P T E R
O N E
b1,4-Galactosyltransferase V: A Growth Regulator in Glioma Jianhai Jiang and Jianxin Gu Contents 1. Overview 2. Experimental 2.1. Cell culture and transfection 2.2. Lectin blot and lectin staining analysis 2.3. Invasion and migration analysis 2.4. Survival assay 2.5. Implantation of tumor cells in mice 2.6. Reverse transcriptase-polymerase chain reaction (RT-PCR) 2.7. Dual luciferase assay 2.8. Extract of nuclear protein 2.9. Gel shift assay 3. Results 3.1. Elevated expression of b1,4GalT V in glioma 3.2. Function and mechanism of b1,4GalT V in glioma process 3.3. Transcriptional regulation of b1,4GalT V 3.4. Recent research on b1,4GalT V in glioma-initiating cell 4. Conclusion and Future Direction Acknowledgments References
4 5 5 6 6 6 7 7 7 8 8 8 8 10 11 16 18 22 22
Abstract One of the most prominent transformation-associated changes in the sugar chains of glycoproteins is an increase in the large N-glycans of cell surface glycoprotein. b1,4-galactosyltransferase V (b1,4GalT V) could effectively galactosylate the GlcNAcb1!6 branch which is a marker of glioma. The expression of b1,4GalT V is increased in the process of glioma development. b1,4GalT V regulates the invasion, growth in vivo and in vitro of glioma cells. Downregulation of b1,4GalT V expression increases the sensitivity of malignant glioma cells to DNA damage drugs. Furthermore, b1,4GalT V regulates Ras and AKT signaling Key Laboratory of Glycoconjuates Research, Ministry of Public Health & Gene Research Center, Shanghai Medical College of Fudan University, Shanghai, People’s Republic of China Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79001-7
#
2010 Elsevier Inc. All rights reserved.
3
4
Jianhai Jiang and Jianxin Gu
involving in glioma behaviors. Meanwhile, Ras/MAPK and PI3K/AKT signaling pathways are involved in the transcription regulation of b1,4GalT V gene. E1AF transcription factor, a downstream target of Ras/MAPK and PI3K/AKT signaling pathways, regulates the transcription of b1,4GalT V in cooperation with Sp1 transcription factor. The contribution of b1,4GalT V in glioma development is further confirmed in glioma-initiation cells. b1,4GalT V regulates the selfrenewal of glioma-initiation cells. We now present evidence that b1,4GalT V functions as a positive growth regulator in glioma and might represent a novel target in glioma therapy.
1. Overview b1,4-galactosyltransferase (GalT) family are the enzymes responsible for the biosynthesis of N-acetyllactosamine on N-glycans by transferring UDP-galactose to the terminal N-acetylglusamine (N-GlcNAc) residues and this family consist of seven members, from b1,4GalTI to b1,4GalT VII (Guo et al., 2001; Sato et al., 2001). b1,4GalT V, a member of b1,4galactosyltransferase family, could effectively galactosylate the GlcNAcb1!6 branch (Sato et al., 1998). Human b1,4GalT V gene has been isolated by Furukawa et al. from human breast cancer cells in 1998 (Sato et al., 1998). When b1,4GalT V is expressed in Sf9 insect cells with N-linked oligosaccharides terminated predominantly with GlcNAc, the GlcNAc residues are galactosylated by b1,4GalT V as revealed by lectin blot analysis (Sato et al., 2001). The expression change of b1,4GalT V has been investigated using NIH3T3 and the highly malignant transformed cell line MTAg. Northern blot analysis has revealed that the transcript of b1,4GalT V gene increases by two to threefold in the transformed cells (Shirane et al., 1999). Similar results have been obtained in several human cancer cell lines (Sato et al., 2000). Our study has shown that the expression of b1,4GalT V is increased in the process of glioma development, with the highest level in grade IV glioma (Xu et al., 2001). Furthermore, decreasing the expression of b1,4GalT V in glioma cells inhibited the invasion and migration and the ability of growth in vitro and in vivo ( Jiang et al., 2006). To understand this phenomenon, it is necessary to understand the regulation of b1,4GalT V and to determine the functions of the target molecules. In 2004, Frukawa et al. firstly cloned the 50 -flanking region of the human b1,4GalT V gene and contributed to the research on the transcriptional regulation of b1,4GalT V (Sato and Furukawa, 2004). Sp1 transcription factor played an important role in the transcriptional regulation of b1,4GalT V. Sp1 binds to the GC box motif at nucleotide positions 81/69 of the b1,4GalT V promoter and play an essential role in promoter activity in cancer
The Role of b1,4GalTV in Glioma Development
5
cells (Sato and Furukawa, 2004). The Ets family transcription factors, which bind to GGA (A/T) sequences in the promoter and enhancer regions of a number of cellular and viral genes, regulate the expression of genes associated with tumor invasion, angiogenesis, cell adhesion, and organ development (Sharrocks, 2001). Ets-1, a member of Ets family, activates the expression of the b1,4GalT V through upregulating the transcription of Sp1 gene (Sato and Furukawa, 2007). Apart from this, another member of Ets family, E1AF, functions as a positive invasion regulator in glioma in cooperation with Sp1 via upregulation of b1,4GalT V ( Jiang et al., 2007). In addition, the activity of b1,4GalT V promoter could be induced by epidermal growth factor (EGF), dominant active Ras, ERK2, JNK1, and constitutively active AKT ( Jiang et al., 2006), indicating that Ras/MAPK and PI3K/AKT signaling pathways are involved in the transcription regulation of b1,4GalT V gene. Until now, most exact mechanisms and target proteins involved in b1,4GalT V functions in glioma remain unknown. We have found that there is a link between b1,4GalT V and cyclins or other proteins such as integrin, JNK, ERK, and AKT; however, there is no tangible evidence to prove that these proteins are the targets of b1,4GalT V. Taken together, b1,4GalT V functions as a positive growth regulator in glioma and might represent a novel target in glioma therapy.
2. Experimental 2.1. Cell culture and transfection Human glioma cell lines SHG44, U87, and U251 were cultured in RPMI medium 1640 or Dulbecco’s modified eagle medium (DMEM) containing 10% bovine calf serum, 100 units/ml penicillin, and 50 mg/ml streptomycin at 37 C in a humidified CO2 incubator (5% CO2, 95% air). Transformed astrocytes C8-D30 (American Type Culture Collection) were cultured in DMEM containing 10% fetal bovine serum, 1.5 g/l sodium bicarbonate, and 4.5 g/l glucose. Glioma-initiating cells (GICs) were obtained from glioma xenografts digested with collagenase (type Ia, Sigma) in DMEM at 37 C for 90 min and grown under nonadherent conditions in neural stem cell culture medium composed of DMEM and Ham’s F-12 media supplemented with B-27 (Invitrogen), 50 mM Hepes, 2 mg/ml heparin, 20 ng/ml EGF, and 20 ng/ml FGF-2. Cell transient transfection was performed with Lipofectamine (Invitrogen) according to the manufacturer’s instructions. Stable transfection cells were generated by transfection with indicated plasmid, followed by selection in G418. Individual clones were picked and analyzed.
6
Jianhai Jiang and Jianxin Gu
2.2. Lectin blot and lectin staining analysis Cells were harvested, rinsed with phosphate-buffered saline (PBS), and lysed with 1% Triton X-100 in PBS. Cell lysates containing 30 mg of protein were boiled in SDS sample buffer with b-mercaptoethanol, loaded on SDSPAGE, and then transferred onto a PVDF membrane. Then the membrane was treated with 25 mM H2SO4 at 80 C for 60 min to remove sialic acid residues. After being blocked with 5% bovine serum albumin (BSA), the membrane was incubated with HRP-lectin for 2 h at room temperature. The blots were washed and developed with the ECL detection system using X-ray film. Cells coated on the glass coverslips were fixed with 4% paraformaldehyde/PBS for 30 min. To eliminate terminal sialic acid moieties, we treated cells with sialidase (0.03 units/ml) for 5 h at 37 C. Endogenous peroxidase activity was blocked with 0.3% H2O2/methanol for 30 min. To minimize nonspecific binding reactions, we covered specimens for 30 min with 1% BSA in Tris-buffered saline (TBS). Following this, cells were incubated at 37 C for 2 h in the presence of HRP-conjugated lectin. After rinsing the cells thoroughly in PBS, they were stained by treating the coverslips with 3,30 -diaminobenzidinetetra hydrochloride (DAB) solution for 3 min. Finally, the samples were dehydrated, cleared, and mounted.
2.3. Invasion and migration analysis Polycarbonate filters with 8 mm pores were coated with 500 mg/ml of Matrigel (BD Biosciences). The coated filters were washed with serumfree medium and dried immediately. Then cells were added to the upper compartment of the chamber and 800 ml of medium (containing 0.1% BSA) was added into the lower chamber. Cells were incubated and allowed to migrate for 24 h. After removal of nonmigrated cells, cells that had migrated through the filter were counted under a microscope in five fields at a magnification of 400. Wound healing assays were performed as described: Subconfluent cells in 6-well plates were serum-starved overnight. Over 20 wounds were made on the cell monolayer by scratching with a 200-ml sterile tip. After rinsing with PBS three times, the medium was replaced with complete growth media. Cells were photographed at 0 and 24 h after scraping, and the wound-induced migration of cells was measured after 24 h.
2.4. Survival assay Cells were plated onto 6-well dishes. After 24 h, the medium was removed, cells were washed twice with Dulbecco’s phosphate-buffered saline (DPBS), and the serum-free medium was added. Cultures were visually
7
The Role of b1,4GalTV in Glioma Development
inspected everyday. Cell numbers were determined after trypan blue staining of viable cells in parallel plates.
2.5. Implantation of tumor cells in mice At confluence, the cells were harvested, centrifuged and then resuspended in a sterile solution of PBS at a final concentration of about 1.0 107 cells/ml. A 100-ml aliquot of resuspended cells (about 1.0 106 cells) was injected s.c. between the shoulder blade 3 cm from the tail. After 3 weeks, photographs were taken and tumors were harvested and individually weighed after mice anesthetized. Statistical analysis was performed by computer program software using the Student’s t test.
2.6. Reverse transcriptase-polymerase chain reaction (RT-PCR) Total RNA (1 mg) extracted was used as a template for cDNA synthesis, with a TaKaRa RNA PCR Kit and specific primers. Amplification was carried out for 22–27 cycles under saturation, each at 94 C, 45 s; 50–60 C, 45 s; 72 C, 1–5 min in a 50-ml reaction mixture containing 2 ml each cDNA, 0.2 mM each primer, 0.2 mM dNTP, and 2.5 units of Taq DNA polymerase. After amplification, 10 ml of each reaction mixture was analyzed by 1–2% agarose gel electrophoresis, and the bands were then visualized by ethidium bromide staining. b1,4GalT I b1,4GalT II b1,4GalT V b-Actin
Forward primer 50 -ATGAGGCTTCGG GAGCCGCTCCTG-30 0 5 -CGCTGGAGCGCG TCTGCAAGGC-30 0 5 -TGAGAACAATCG GTGCATCAG-30 0 5 -ATGGGTCAGAA GGATTCCTAT-30
Reverse primer 50 -CTAGCTCGGTG TCCCGATGTC-30 0 5 -ACAAGZCCAGG TGGCGAGTCA-30 0 5 -CTCAATCCGCC AAATAACTC-30 0 5 -GCGCTCGGTGA GGATCTTCAT-30
2.7. Dual luciferase assay Cells transiently transfected with pGL3-b1,4GalT V promoter and pRLCMV were washed and lysed in 100 ml of passive lysis buffer (Promega). Firefly luciferase and Renilla luciferase activities were measured with 5 ml of cells lysate using the Dual-Luciferase Reporter assay system (Promega) in a luminometer. ‘‘Relative activity’’ was defined as the ratio of firefly luciferase activity to Renilla luciferase activity and was calculated by dividing
8
Jianhai Jiang and Jianxin Gu
luminescence intensity obtained in the assay for firefly luciferase by that obtained for Renilla luciferase.
2.8. Extract of nuclear protein Cell pellets were resuspended in 400 ml buffer A (10 mM Hepes, pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 0.5 mM PMSF) on ice for 15 min, then 25 ml of 10% NP-40 was added. After centrifugation, the nuclear pellets were resuspended in 50 ml ice-cold buffer C (20 mM Hepes, pH 7.9, 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM PMSF) and the tubes were vortexed at 4 C for 15 min. After centrifugation, the supernatants were collected and protein concentration was determined using Lowry’s method.
2.9. Gel shift assay Gel mobility shift assay was carried out using Gel Shift Assay System (Promega) as follows. The double-stranded oligonucleotides were annealed, end-labeled with 32P using T4 polynucleotide kinase, and purified using Sephadex G-25 quick spin columns (Roche Molecular Biochemicals). Nuclear proteins were preincubated for 10 min with 9 ml of electrophoretic mobility shift assay (EMSA) buffer. Then the 32P-end-labeled duplex oligonucleotide (1 ml, 10 fmol) was added, and the reaction was incubated for 20 min on ice. For competition experiments, unlabeled DNA probes were included at 100-fold molar excess over the 32P-labeled DNA probe. For supershift experiments, 2 mg antibodies were added to the reaction mixtures and incubated for 30 min prior to addition of the 32P-labeled DNA probe. DNA–protein complexes were separated on 5% nondenaturing polyacrylamide gels in 0.5 Tris borate/EDTA (pH 8.4) at 4 C and 35 mA. The gels were dried, and the DNA–protein complexes were visualized by autoradiography.
3. Results 3.1. Elevated expression of b1,4GalT V in glioma Compared to other members of b1,4GalT family, b1,4GalT V has a closer relationship with glioma process. Although the mRNA level of b1,4GalT I, II, and V increased markedly in glioma tissue, further observations revealed that only the expression of b1,4GalT V has statistical discrepancy (p < 0.05) in glioma of grade II, III, and IV (Fig. 1.1A). Another result showed that the transcript of b1,4GalT V increased in proper order to the tissue of normal brain and glioma of grade I–IV (Fig. 1.1B). Because the Ricinus communis agglutinin-I (RCA-I) lectin could preferentially interact with oligosaccharides terminated
9
The Role of b1,4GalTV in Glioma Development
A
D II
III
E RCA-I
IV
GalT I GalT V GAPDH
400
4.75
PHA-L 320
221
4.75
281
111
GalT II
0 0 1 2 3 4 4 1 2 3 10 10 10 10 10 10 10 10 10
GAPDH
Fluorescence intensity SHG44 C
B
PHA-L
RCA-I Control AS-GalT V
Relative cell number
N
200 kDa 150 kDa 100 kDa 80 kDa 50 kDa
25 kDa
GAPDH
Con AS
Con AS
SHG44 CBB
RCA-I 97 kDa
GalT V 66 kDa
b-actin 43 kDa
N
I
II
III
IV
N N II III IV
N N II III IV
Figure 1.1 Elevated expression of b1,4-galactosyltransferase V in glioma (A, B) RTPCR analysis of b1,4-GalT I, II, and V gene expression in normal brain and multiple grade I–IV glioma. (C) RCA-1 lectin blot analysis of human normal brain and glioma glycoprotein. The membrane proteins were prepared from the tissues of normal brain and glioma and the blots were stained with CBB (left) or RCA-1(right). Reduction in the GalT V expression could reduce the expression of N-glycans in glioma cell line SHG44. (D) Both control and antisense-transfected SHG44 cells were incubated with biotinylated RCA-I or PHA-L followed by incubation with FITC-conjugated streptavidin. Analysis was performed using FACScan. The dotted lines represented fluorescence of the secondary antibody alone. The numbers on the left inside of the top panel gave the mean fluorescence intensity of the secondary antibody alone, whereas those in the right inside gave the mean fluorescence intensity of the indicated antibody staining done. (E) The cell extracts were separated by SDS-PAGE and the binding to RCA-I or PHA-L were analyzed by RCA-I-lectin (left panel) or PHA-L-lectin (right panel). The GAPDH Western blot served as a loading control.
with Galb14GlcNAc group, it is widely used to exam the galactosylation of endogenous glycoproteins (Sato and Furukawa, 2007). The total glycoproteins reacted to RCA-I are more extensively in glioma tissue compared with normal brain tissue, using an RCA-I lectin blot (Fig. 1.1C). Reduction of b1,4GalT V by an antisense cDNA decreased the binding with RCA-I and PHA-L on the cell surface (Fig. 1.1D), and a significant decrease of the binding of total glycoprotein with RCA-I or PHA-L was observed in glioma cell line SHG44 (Fig. 1.1E). The data showed that b1,4GalT family membranes, especially b1,4GalT V, should be responsible partly for aberrant galactosylation of proteins in glioma. The substrate proteins involved in these effects and their mechanisms of action remain to be determined.
10
Jianhai Jiang and Jianxin Gu
3.2. Function and mechanism of b1,4GalT V in glioma process Under normal conditions, the glioma cell line SHG44 showed invasive growth with spindle-shaped morphology and grew in an actinomorphic manner (Fig. 1.2A, left panel). When the expression of b1,4GalT V was knockdown by a stably transfection of an antisense cDNA construct, SHG44 cells exhibited a round morphology and grew in a ramble way (Fig. 1.2A, right panel). And, reduction in b1,4GalT V expression resulted in a significant decrease in cell migration in vitro and the ability to migrate, assayed by wound healing and Boyden chamber assays (Fig. 1.2B). Similar results were obtained A
Control
AS-GalT V
1.5
Fold induction (tumor weight/g)
D
Control B
Control
1.0
0.5
0
AS-GalT V
Control AS-GalT V
AS-GalT V C 300
0h Migrated cells
24 h
Leading edge of migration (mm)
75 50 25
0
0h
24 h
SHG44 Control
200
100
0
Control AS-GaIT V
AS-GalT V
Figure 1.2 Effects of reduction in the GalT V expression on glioma cell SHG44 invasiveness and growth. (A) Cell morphology of control or antisense-transfected SHG44 cells. When cells were grown to confluence in RPMI 1640 containing 10% FBS, photographs were taken. (B) Cell migration assay of control or antisense-transfected SHG44 cells. (C) Decreasing the GalT V expression in SHG44 cells inhibited the invasive ability assayed in a modified Boyden chamber ( p < 0.05, n ¼ 3). (D) Nude mice were injected with either control or antisense-transfected SHG44 cells. Three weeks later, photographs were taken (left panel). Tumors were removed and weighted. Results were shown as mean S.D. of tumor weights (right panel).
The Role of b1,4GalTV in Glioma Development
11
in agarose drop explant assay (data not shown). Moreover, reduction in the expression of b1,4GalT V resulted in a total suppression of tumor formation in nude mice, compared with the control (Fig. 1.2D). b1,4GalT V overexpression in glioma cells U87 and U251 and transformed astrocytes C8-D30 resulted in a striking increase of cell migration (Fig. 1.3A), an almost threefold increase in vitro invasiveness through a reconstituted Matrigel basement membrane (Fig. 1.3B), a great increase in colony number (data not shown) and greater numbers of viable cells in serum-free conditions relative to the control cells (Fig. 1.3C). Figure 1.3D showed that b1,4GalT V-transfected cells developed tumors with a markedly large size during the 3 weeks of observation compared with the control cells. Collectively, b1,4GalT V could promote glioma cell invasiveness and survival. The b1,4GalT V protein consists of a short NH2-terminal cytoplasmic domain, a stem region and a catalytic domain which contains two conserved residues (Y268/W294) which are important for the galactosylation activity of b1,4GalT V (Fig. 1.4A). RCA-I lectin blot showed that W294 was involved in the galactosyltransferase activity of b1,4GalT V (Fig. 1.4A). The point mutation (W294G) abolished the ability of GalT V to promote the migration ability and invasive potential of glioma cells (Fig. 1.4B and C), indicating that an intact catalytic domain might be essential for b1,4GalT V tumorigenic function in glioma. Furthermore, the mechanisms of b1,4GalT V involved in glioma process were investigated. Reduction in the expression of b1,4GalT V inhibited cell cycle progression and reduced the endogenous expression of cyclin D1, cyclin D3, and E2F1 (Fig. 1.5A), which are important regulators of cellular proliferation and highly expressed in glioma (Arato-Ohshima and Sawa, 1999; Bacon et al., 2002). Ras/MAPK and PI3K/AKT signaling pathways, which have shown to associate with glioma invasiveness (Fan et al., 2006; Kurose et al., 2001; Shi et al., 2004), have relationship with b1,4GalT V. Reduction in the expression of b1,4GalT V led to a reduction of the levels of phosphor-AKT (Ser473/T308) and phosphor-JNK1/2 (Thr183/ Tyr185) status (Fig. 1.5B). Interestingly, downregulation of b1,4GalT V strengthened the cell adhesion ability to FN by promoting integrin b1 maturation (Fig. 1.5C), subsequently changing the location of integrin b1 in cells and interaction between integrin b1 and a5 subunits (Fig. 1.5D). All the data showed that b1,4GalT V functioned as a positive growth regulator in glioma; however, most of the mechanism involved the process remained unknown and should be explored.
3.3. Transcriptional regulation of b1,4GalT V Sato and Furukawa firstly cloned the 2.3-kb 50 -flanking region of the human b1,4GalT V gene and identified the region 116/18 relative to the transcription start site as that having promoter activity (Sato and
12
Jianhai Jiang and Jianxin Gu
B
A
150
75 Migrated cells
Leading edge of migration (mm)
100
50
50
25
0
0 U87
U251
Control
C8-D30
U87 Control
HA-GalT V
U251
C8-D30
HA-GalT V
D
C 5
2.5
2.0 Tumor weight (g)
Fold induction (survival)
100
2.5
1.5
1.0
0.5
0
0 Control U87
HA-GalT V U251
C8-D30
U87 Control
U251 HA-GalT V
Figure 1.3 Effects of GalT V overexpression on glioma cells and transformed astrocytes invasiveness and survival control or HA-GalT V plasmid was stably transfected into U87, U251, and C8-D30 cells. (A) Cell migration assay of control or HA-GalT Vtransfected cells. (B) HA-GalT V-transfected cells were more invasive than the control cells assayed in a modified Boyden chamber (p < 0.05, n ¼ 3). (C) 100,000 cells were plated into individual wells of 6-well tissue culture plates in sextuplicate in same condition, grown overnight in DMEM with 10% FBS, and serum-starved for 10 days. Fixed and stained with toluidine blue O (0.1%) in 4% paraformaldehyde diluted in PBS, viable cells were counted. (D) The ectopic expression of GalT V promoted glioma growth in vivo. At 3 weeks after injection with the indicated cells, tumors were removed and weighted. Results were shown as mean S.D. of tumor weights.
13
The Role of b1,4GalTV in Glioma Development
A NH2
TM
Catalytic domain COOH
WT G Y268G
Y 268
G
W294G
W 294
200 kDa 100 kDa 80 kDa
RCA-I
50 kDa
4G
G
T
29 W
Y2
68
W
Co
nt
ro
l
25 kDa
U87 B
C 150
Migrated cells
Leading edge of migration (mm)
100
50
100
50
0 U87
U251 Control W294G
C8-D30 WT
0
U87
U251 Control
C8-D30 WT
W294G
Figure 1.4 GalT V acts as a catalytic enzyme in the promotion of its tumorigenic effects on glioma. (A) A schematic diagram of HA-tagged GalT V construct (WT) and its point mutation formats (Y268G/W294G) (upper panel). Proteins from U87 cells transfected with vector or full length of GalT V (WT) or point mutant constructs (Y268G/W294G) were separated by SDS-PAGE and the binding to RCA-I was
14
Jianhai Jiang and Jianxin Gu
Furukawa, 2004). Sp1, a well known DNA-binding nuclear protein, regulate the transcription of b1,4GalT V in lung carcinoma cells and glioma cells through binding to nucleotide positions 81/69 of the promoter region (Sato and Furukawa, 2004). Ets-1 and E1AF, two members of the Ets family of transcription factors characterized by an evolutionarily conserved DNAbinding domain regulate expression of b1,4GalT V in cooperation with Sp1 ( Jiang et al., 2007; Sato and Furukawa, 2007). Ets-1 enhanced expression of the b1,4GalT V gene through activating transcription of the Sp1 gene in cancer cells (Sato and Furukawa, 2007). E1AF might physically interact with Sp1 in a DNA-independent manner in glioma cells and glioma tissue (Fig. 1.6A). E1AF activated the b1,4GalT V promoter in cooperation with Sp1, and mutation of Sp1-binding site but not that of the Ets-binding site abolished the positive effect of E1AF on the activity of the b1,4GalT V promoter (Fig. 1.6B). The EMSA and DNA affinity precipitation assay confirmed that E1AF/Sp1 complex binds to the b1,4GalT V promoter in vitro and in vivo (Fig. 1.6C and D). Furthermore, E1AF overexpression increased the phosphorylation level and DNA-binding activity of Sp1 (Fig. 1.6E). b1,4GalT V, which is sensitive to the extracellular microenviroment, is regulated by many extracellular factors such as chemotherapeutic drugs and EGF. Etoposide (VP16), a common chemotherapy drugs used for the treatment of malignant glioma (Nagane et al., 1999), downregulated the expression level of b1,4GalT V mRNA through reducing the level of transcription factor Sp1 (Fig. 1.7A and D). The treatment of SHG44 cells with etoposide decreased the activity of GalT V promoter (Fig. 1.7B and E), and forced expression of b1,4GalT V could protect cells from apoptosis induced by etoposide (Fig. 1.7C). Arsenic trioxide (As2O3), another chemotherapeutic drug, could decrease the expression of b1,4GalT V protein without changing its mRNA level in SHG44 cells (Fig. 1.7F). However, molecular mechanism involved in this process remained unknown. EGF, a key growth factor regulating cell survival, could activate an extensive network of signal transduction pathways that include activation of the PI3K/AKT, RAS/ERK, and JAK/STAT pathways (Bergstrom et al., 2000; Zheng et al., 2001). In cancer, EGF signaling pathways are often dysfunctional and targeted therapies that block EGF signaling have been successful in treating cancers. The regulation of b1,4GalT V is known to be involved in RAS/ERK and PI3K/AKT signal pathways. Endogenous b1,4GalT V mRNA expression was markedly induced by EGF in SHG44 analyzed by RCA-I-lectin. The GAPDH Western blot served as a loading control (lower panel). (B) Migration assay of control, HA-GalT V- (WT) or W294G-transfected cells. (C) Matrigel invasion assay was performed with the cells stably transfected with control, HA-GalT V (WT) or W294G. Values were shown as mean S.D. of triplicates from two independent experiments.
15
The Role of b1,4GalTV in Glioma Development
A Cell number (%)
100
B Control AS-GalT V
Con AS pERK1 pERK2 ERK1 ERK2 pJNK1 pJNK2 JNK1 JNK2 GAPDH
75 50 25 0 G0-G1 S
G2-M
pAKT(S473) pAKT(T308)
Con AS Cyclin D1
AKT
Cyclin D2
GAPDH
Cyclin D3
p125 Integrin b1 p105
E2F1
GAPDH
GAPDH
Integrin b1
Golgi
Merge
AS
Con
C
E Con AS Integrin b1 Integrin a5
IP: a-integrin a5 pFAK FAK IP: a-FAK
Absorbance at 595 nm
D
0.8
Control GalT V-AS
0.6 0.4 0.2 0
1
3
10
30
FN (mg/ml)
Figure 1.5 The potential mechanisms of GalT V involved in glioma process. (A) Control or antisense-transfected SHG44 cells were harvested, and cell cycle parameters were determined by DNA content (upper panel). Equal amounts of proteins from control or antisense-transfected SHG44 cells were immunoblotted with the antibodies of cyclin D1, cyclin D2, cyclin D3, and E2F1 (lower panel). The GAPDH served as a loading control. (B) Equal amounts of proteins from control or antisense-transfected SHG44 cells were immunoblotted with the antibodies of pERK1, pERK2, ERK1, ERK2, pJNK1, pJNK2, JNK1, JNK2, pAKT, and AKT. The GAPDH served as a loading control. (C) Reduction in the GalT V expression affects the subcellular localization of integrin b1 subunit. After fixed and permeabilized, control (upper panel) or
16
Jianhai Jiang and Jianxin Gu
cells (Fig. 1.8A, upper panel), indicating the contribution of EGF in the transcription regulation of b1,4GalT V gene, and the promoter activity of b1,4GalT V gene was activated by EGF in a dose-dependent manner (Fig. 1.8A, lower panel). When Ras-DN (the dominant negative construct of Ras ) or Ras-DA (the constitutively active expression construct of Ras) was cotransfected with promoter reporter plasmid of b1,4GalT V into SHG44 cells, the Ras-DN decreased the b1,4GalT V promoter activity in a dose-dependent manner, whereas the Ras-DA caused a similarity dependent activation (Fig. 1.8B). Consistent with this, transient overexpression of ERK1 or JNK1 into SHG44 cells led to a significant increase in the b1,4GalT V promoter activity (Fig. 1.8C). The constitutively active AKT (Gag-AKT) construct could also increase the promoter activity of b1,4GalT V gene in a dose-dependent manner (Fig. 1.8D). The data showed that RAS/ERK and PI3K/AKT signal pathways contribute to the regulation of b1,4GalT V. Furthermore, the mutagenesis of Sp1-binding site in the b1,4GalT V promoter could abolish the effects of Ras-DA, Ras-DN, ERK1, JNK1, or Gag-AKT on the b1,4GalT V promoter activity (Fig. 1.8E).
3.4. Recent research on b1,4GalT V in glioma-initiating cell GICs play pivotal roles in glioma initiation, growth, and recurrence, and therefore, their elimination is an essential factor for the development of efficient therapeutic strategies (Chumsri and Burger, 2008; Park et al., 2009). The characterization of GICs has been on the basis of expression of neural stem cell markers like CD133 and Nestin (Das et al., 2008). Recent research revealed that knockdown of b1,4GalT V by RNA interference antisense-transfected SHG44 cells (lower panel) reacted with anti-integrin b1 mouse monoclonal antibody followed by incubation with rhodamine-conjugated goat antimouse IgG and C6-NBD, a special dye labeling Golgi apparatus. Images were captured and analyzed with a Zeiss confocal microscope (magnification 40). Integrin b1 is in red and the Golgi marker is in green. The yellow image is a red/green merge to show colocalization. In antisense-transfected SHG44 cells, the integrin b1 was localized near the cell surface and formed small intracellular clusters (red arrow). (D) Downregulation of GalT V strengthened the interaction between integrin b1 and a5 subunit. Immunoprecipitation was performed with monoclonal anti-integrin a5 antibody. Coimmunoprecipitation protein was probed with indicated antibodies. The tyrosine phosphorylation level of FAK was significantly enhanced in antisense-transfected SHG44 cells. After incubation on FN (15 lg/ml) for 30 min, the cell lysates were immunoprecipitated (IP) by monoclonal anti-FAK antibody. The level of FAK and phosphor-FAK was detected by indicated antibodies. (E) GalT V antisense-transfected SHG44 cells demonstrated more adhesion ability to fibronectin. Antisense-transfected SHG44 cells and control cells (3 104) were applied to 96-well plates coated with polylysine (100 mg/ml), 1% BSA or increasing concentrations (1, 3, 10, and 30 mg/ml) of FN, and incubated at 37 C for 30 min. Adherent cells were crystal violet and absorbance of each well was determined at 595 nm.
17
The Role of b1,4GalTV in Glioma Development
C
A Input IgG
IP
Sp1-concensus: CCTTGGTGGGGGCGGGGCCTAAGCTG Ets-mutation: CTGGCCCCGCCTAACGCGCGTGCGCC
a -Sp1
GalT V (-82/-57): CTGGCCCCGCCTCCCGCGCGTGCGCC Sp1-mutation: CTGGCCAAGCCTCCCGCGCGTGCGCC Sp1 Ets
E1AF Sp1 EtBr
-
IP Input IgG a-Sp1
Cold probe
Nuclear extract GalT V probe GalT V (-82/57) Sp1-mutation Ets-mutation Sp1-concensus
-
+ +
Nuclear extract GalT V probe Normal mouse IgG E1AF-antibody Normal rabbit IgG Sp1-antibody
a b c
N T N TN TN T E1AF
+ + + + + +
a b c
Sp1 EGFR Free probes
GAPDH
Free probes Lane 1 2 3 4 5
Lane 1 2 3 4 5 6 7 8 910
B
-200
Sp1
EBS
Sp1
EBS
LUC
M(Sp1) Sp1
EXS
LUC
M(EBS) 25 20 15
Input WT Sp1-mut
LUC
GalT V-Luc
Control E1AF Sp1 E1AF+Sp1 SHG44
10 5
V -L M uc (S p M 1) (E BS )
0
E1AF Sp1 PARP N T NT NT Input WT Sp1-mut Sp1 E1AF-myc E1AF PARP E1AF-myc - + - + - +
Con E1AF E1AF a -Sp1 p-ser IP p-Thr Sp1 EtBr - - + Con E1AF a-Sp1 IP
32p-Sp1
Sp1
G
al
T
Relative luciferase activity
E
D
Figure 1.6 E1AF and Sp1 regulate the transcription of GalT V in glioma. (A) In vivo association of E1AF with Sp1 determined using cells of the glioma SHG44 cell line and a coimmunoprecipitation assay. Lysates from SHG44 cells were immunoprecipitated (IP) with anti-Sp1 antibody (Ab) or control IgG in the absence or presence of EtBr (50, 200, or 400 mg/ml) and sequentially immunoblotted with anti-E1AF or anti-Sp1 antibody (upper panel). Sp1 IP of glioma tissue (T) and normal brain tissue (N) lysates in the absence or presence of EtBr (50 mg/ml) probed with anti-E1AF, anti-Sp1, anti-EGFR, or anti-GAPDH antibodies (lower panel). (B) PcDNA3.0 and/or E1AF and/or Sp1 expression vectors were transiently cotransfected into SHG44 cells with GalT V-Luc, M(Sp1), or M(EBS). The luciferase activity was determined as described before. (C) Oligonucleotides used in an electrophoretic mobility shift assay (upper). The putative Sp1 and Ets-binding sites are indicated with boxes. The mutated nucleotides are underlined. An electrophoretic mobility shift assay was performed using nuclear proteins of SHG44 cells and a human GalT V promoter sequence ( 82 to 57) double-stranded radiolabeled probe. Competition assays were carried out with a 10- to 20-fold excess of GalT V promoter sequence ( 82 to 57) oligonucleotides with or without the Etsbinding site or Sp1-binding site mutated or Sp1 consensus oligonucleotides. The DNA– protein complexes (arrows a–c) and free DNA are indicated (left panel). E1AF/Sp1 bound to a GC box site within a human GalT V promoter (right). Nuclear extracts from
18
Jianhai Jiang and Jianxin Gu
depleted CD133/Nestin-positive cells in glioma cell xenografts (Fig. 1.9A and C) and inhibited the self-renewal capacity and the tumorigenic potential of GICs isolated from glioma xenografts (Fig. 1.9B). The data provided new insights on the function and mechanism of b1,4GalT V in glioma process.
4. Conclusion and Future Direction Malignant gliomas are the most common primary brain tumor and one of the deadliest. Malignant gliomas exhibit a relentless malignant progression characterized by widespread invasion throughout the brain, resistance to traditional and newer targeted therapeutic approaches, destruction of normal brain tissue, and certain death (Fan et al., 2007; Fine, 2009; Giese and Westphal, 1996; Hambardzumyan et al., 2008; Stiles and Rowitch, 2008). Our results reveal that b1,4GalT V functioned as a positive growth regulator in glioma. Targeting b1,4GalT V expression or activity in glioma may be of clinical value. The characterization of b1,4GalT V as a novel target in glioma therapy is suggested by quantitative evidences. (a) The b1,4GalT V mRNA expression was correlated with glioma grade. (b) Reduction in the b1,4GalT V expression resulted in a decrease in colony number and glioma growth in vivo. (c) The suppression of b1,4GalT V expression inhibited cell cycle progression and reduced the expression of cyclin D1 and E2F1. (d) The impact of b1,4GalT V expression in glioma decreased the relative resistance SHG44 cells were incubated with 32P-labeled double-stranded oligonucleotides spanning the GC box and an Ets-binding site within the GalT V promoter in the presence or absence of control IgG or an antibody specific to Sp1 or E1AF. The unlabeled arrow indicates the DNA–protein antibody complex (right panel). (D) The same amounts of nuclear extracts from glioma tissues or normal brain tissues were incubated with biotinlabeled oligonucleotides as described before. Proteins bound to these nucleotides were isolated with streptavidin-agarose, and E1AF or Sp1 was detected by immunoblotting. PARP expression served as a loading control (upper panel). The same amounts of nuclear extracts from SHG44 cells transiently transfected with control or E1AF-myc plasmids incubated with biotin-labeled oligonucleotides. Proteins bound to these nucleotides were isolated with streptavidin-agarose, and E1AF, Sp1, or myc was detected using immunoblotting (lower panel). (E) (WCL panels) Whole-cell lysates from SHG44 cells transfected with control or E1AF expression vectors in the absence or presence of EtBr (50 mg/ml) were loaded onto an 8% denatured polyacrylamide gel, and E1AF and Sp1 protein levels were determined by Western blotting using anti-E1AF or anti-Sp1 antibody (Sp1-Ab). (IP panels) The results of Sp1 immunoprecipitation of the lysates of SHG44 cells transfected with control or E1AF expression vectors in the absence of EtBr or in the presence of EtBr (50 mg/ml) blotted with the indicated antibodies are shown (upper panel). Whole-cell lysates from SHG44 cells transfected with control or E1AF expression vectors labeled with 32PO4 for 2 h prior to harvesting and the levels of 32P labeling of Sp1 were determined (lower panel).
19
The Role of b1,4GalTV in Glioma Development
b-actin VP16
Relative luciferase activity
B
0.6 SHG44
60 40 20 0
0.4
E
80
Fold induction
C Apoptosis rate (%)
A GalT V
1.2
0.8
0.4
0 VP16 - +
Control HA-GalT V VP16 (200 µM)
WT
- + M(Sp1)
F 0.2
D E2F1 Sp1
0 VP16
GAPDH VP16
GnT V GalT V GAPDH GalT V b-actin As2O3
Figure 1.7 GalT V is regulated by chemotherapeutic drugs in glioma. (A) RT-PCR analysis of endogenous GalT V mRNA expression level in SHG44 cells in the absence or presence of VP16 for 4 h. The concentration of VP16 was 50, 100, or 200 mM. The levels of b-actin mRNA expression were assessed as loading controls. (B) SHG44 cells were transiently transfected with b1,4GalT V promoter construct pGL3 ( 200/þ120). At 24 h after transfection, cells were treated with vehicle or an increasing dose of VP16 for an additional 4 h. The luciferase activity values were standardized to those observed in nontreated samples. (C) Control or HA-GalT V-transfected SHG44 cells were treated with VP16 (200 mM) for 16 h. The apoptotic percentages were assayed by Hoechst 33258 staining. (D) SHG44 cells were treated for 4 h with indicated dose of VP16, and cell extracts were subjected to immunoblot analysis using an anti-Sp1 antibody. The anti-E2F1 antibody was used as a positive control. (E) SHG44 cells were transiently cotransfected with pGL3 ( 200/þ120) construct and control vector or Sp1-expressing vector. At 24 h after transfection, cells were treated with vehicle () or 100 mM VP16 (þ) for 4 h. Normalized luciferase activity was standardized to pGL3 ( 200/þ120) with control vector in untreated cells. (F) SHG44 cells were treated with As2O3 for 24 h and cell extracts were analyzed by Western blot with anti-GnT V, antiGalT V, and anti-GAPDH antibodies (upper panel). GalT V mRNA expression from SHG44 cells treated with the indicated concentrations of As2O3 for 24 h was analyzed by RT-PCR. The mRNA expression of b-actin served as loading controls (bottom panel).
to apoptosis induced by etoposide or X-ray. (e) Reduction in the b1,4GalT V expression decreased the AKT activity which has been inversely correlated with survival in patient glioma specimens. (f) Reduction in the b1,4GalT V expression impaired the self-renewal of GIC. These results indicate that decreasing the b1,4GalT V expression resulted in the changes in the intracellular prosurvival signaling pathways and decreased glioma cell
20
Jianhai Jiang and Jianxin Gu
A
C 5
GalT V
SHG44 pGL3(-200/+120)
EGF(ng/ml)
Fold induction
7.5
0
10
SHG44 pGL3(-200/+120)
5
Fold induction
b-actin
2.5
2.5 0 Control 0 Control
B
Lane
EGF D
5
0
3
JNK1 Gag-AKT 4
5
6
7
Control Ras DA Ras DN ERK1 JNK1 Gag-AKT
2.5
0 Control
2
SHG44
Fold induction
Fold induction
2.5
ERK1
5
Ras DA Ras DN SHG44 pGL3(-200/+120)
1
WT
M(Sp1)
Ras DA/Ras DN
Figure 1.8 The response of GalT V to EGF stimulation. (A) Serum-starved SHG44 cells were stimulated with the EGF (10 ng/ml) for 24 h. Relative GalT V mRNA expression levels were determined by RT-PCR analysis. Levels of b-actin mRNA expression were assessed as loading controls (upper panel). The GalT V promoter construct pGL3 (200/þ120) was transiently transfected into SHG44 cells. After transfection, cells were treated with the indicated concentration of EGF for 24 h. The luciferase activity was determined as described above. The values were presented as fold activation over those observed in 1% FBS-treated or nontreated samples (lower panel). (B) SHG44 cells were transiently cotransfected with pGL3 (200/þ120) and increasing amounts of plasmids expressing the constitutively active form of Ras (RasDA) or dominant negative form of Ras (Ras-DN) and the luciferase activity was determined as described above. (C) SHG44 cells were transiently cotransfected with pGL3 ( 200/þ120) and increasing amounts of ERK1, JNK1, or Gag-AKT constructs, and the luciferase activity was determined as described above. (D) The promoter constructs pGL3(200/þ120) (WT) or M (Sp1) were cotransfected into SHG44 cells with the plasmids expressing the constitutively active Ras (Ras-DA), dominant negative Ras (Ras-DN), ERK1, JNK1, or Gag-AKT. The luciferase activity was determined as described above.
21
The Role of b1,4GalTV in Glioma Development
A
B
Control
Control
GalT V shRNA
GalT V shRNA
CD133 100 CD133+ cell (%)
C
Nestin
0
8.6%
Control
0.21%
GalT V shRNA
Figure 1.9 Recent research on GalT V in glioma-initiating cell. (A) Sections from xenograft tissue formed by control- or GalT V shRNA-infected SHG44 were immunostained with anti-CD133 antibody (left panel) or anti-Nestin antibody (right panel). (B) Representative photographs of neurospheres formed by GICs from xenografts induced by control- or b1,4GalT V shRNA-infected SHG44 cells. (C) GICs from xenografts induced by control- or b1,4GalT V shRNA-infected SHG44 cells were incubated with anti-human CD133 antibody (AC133-1) followed by incubation with FITC-conjugated goat anti-mouse antibody. Analysis was performed using FACScan. The lines represented fluorescence of the secondary antibody alone. The mean fluorescence intensity of the indicated antibody staining done was given. Data are from representative experiments repeated at least three times.
invasion potential, suggesting that manipulating the expression of b1,4GalT V might have therapeutic potential for the treatment of glioma. Our findings also might provide some clinical significance in the killing of malignant glioma cells, as combined treatment with b1,4GalT V inhibitors and DNAdamaging agents will help to achieve more effective therapy with less toxicity by using a lower dose of cytotoxic drugs. In spite of that, the molecular mechanisms for b1,4GalT V-regulating glioma growth remain unknown. Our results indicate that an intact catalytic domain might be essential for b1,4GalT V tumorigenic function in glioma.
22
Jianhai Jiang and Jianxin Gu
The reduction in the expression level of the b1,4GalT V gene in SH-SY5Y cells resulted in the decreased galactosylation of highly branched N-glycans, indicating that b1,4GalT V might be involved in the galactosylation of highly branched N-glycans. However, the specific substrates of b1,4GalT V are not identified. This chapter has shown that b1,4GalT V performed a positive growth regulator in glioma and could represent a novel target in glioma therapy expand our understanding of the proteins involved in gliomagenesis. The molecular mechanism of b1,4GalT V-regulating glioma growth should be explored next.
ACKNOWLEDGMENTS This work was supported by Shanghai Rising-Star Program (08QA14013), Program for New Century Excellent Talents in University (NCET-08-0128), National Natural Scientific Foundation of China (30930025, 30900248, and 30870542), a Grant from the Development of Science and Technology of Shanghai (09ZR140340), Shanghai Educational Development Foundation (2007CG02), and Shanghai Leading Academic Discipline Project (B110).
REFERENCES Arato-Ohshima, T., and Sawa, H. (1999). Over-expression of cyclin D1 induces glioma invasion by increasing matrix metalloproteinase activity and cell motility. Int. J. Cancer 83, 387–392. Bacon, C. L., et al. (2002). Antiproliferative action of valproate is associated with aberrant expression and nuclear translocation of cyclin D3 during the C6 glioma G1 phase. J. Neurochem. 83, 12–19. Bergstrom, J. D., et al. (2000). Epidermal growth factor receptor signaling activates met in human anaplastic thyroid carcinoma cells. Exp. Cell Res. 259, 293–299. Chumsri, S., and Burger, A. M. (2008). Cancer stem cell targeted agents: Therapeutic approaches and consequences. Curr. Opin. Mol. Ther. 10, 323–333. Das, S., et al. (2008). Cancer stem cells and glioma. Nat. Clin. Pract. Neurol. 4, 427–435. Fan, Q. W., et al. (2006). A dual PI3 kinase/mTOR inhibitor reveals emergent efficacy in glioma. Cancer Cell 9, 341–349. Fan, X., et al. (2007). Glioma stem cells: Evidence and limitation. Semin. Cancer Biol. 17, 214–218. Fine, H. A. (2009). Glioma stem cells: Not all created equal. Cancer Cell 15, 247–249. Giese, A., and Westphal, M. (1996). Glioma invasion in the central nervous system. Neurosurgery 39, 235–250. (discussion 250–252). Guo, S., et al. (2001). Galactosylation of N-linked oligosaccharides by human beta-1, 4-galactosyltransferases I, II, III, IV, V, and VI expressed in Sf-9 cells. Glycobiology 11, 813–820. Hambardzumyan, D., et al. (2008). Glioma formation, cancer stem cells, and akt signaling. Stem Cell Rev. 4, 203–210. Jiang, J., et al. (2006). beta1, 4-galactosyltransferase V functions as a positive growth regulator in glioma. J. Biol. Chem. 281, 9482–9489.
The Role of b1,4GalTV in Glioma Development
23
Jiang, J., et al. (2007). Functional interaction of E1AF and Sp1 in glioma invasion. Mol. Cell. Biol. 27, 8770–8782. Kurose, K., et al. (2001). Frequent loss of PTEN expression is linked to elevated phosphorylated Akt levels, but not associated with p27 and cyclin D1 expression, in primary epithelial ovarian carcinomas. Am. J. Pathol. 158, 2097–2106. Nagane, M., et al. (1999). Expression pattern of chemoresistance-related genes in human malignant brain tumors: A working knowledge for proper selection of anticancer drugs. Jpn. J. Clin. Oncol. 29, 527–534. Park, C. Y., et al. (2009). Cancer stem cell-directed therapies: Recent data from the laboratory and clinic. Mol. Ther. 17, 219–230. Sato, T., and Furukawa, K. (2004). Transcriptional regulation of the human beta-1, 4-galactosyltransferase V gene in cancer cells: Essential role of transcription factor Sp1. J. Biol. Chem. 279, 39574–39583. Sato, T., and Furukawa, K. (2007). Sequential action of Ets-1 and Sp1 in the activation of the human beta-1, 4-galactosyltransferase V gene involved in abnormal glycosylation characteristic of cancer cells. J. Biol. Chem. 282, 27702–27712. Sato, T., et al. (1998). Molecular cloning of a human cDNA encoding beta-1, 4-galactosyltransferase with 37% identity to mammalian UDP-Gal:GlcNAc beta-1, 4-galactosyltransferase. Proc. Natl. Acad. Sci. USA 95, 472–477. Sato, T., et al. (2000). Correlated gene expression between beta-1, 4-galactosyltransferase V and N-acetylglucosaminyltransferase V in human cancer cell lines. Biochem. Biophys. Res. Commun. 276, 1019–1023. Sato, T., et al. (2001). Occurrence of poly-N-acetyllactosamine synthesis in Sf-9 cells upon transfection of individual human beta-1, 4-galactosyltransferase I, II, III, IV, V and VI cDNAs. Biochimie 83, 719–725. Sharrocks, A. D. (2001). The ETS-domain transcription factor family. Nat. Rev. Mol. Cell Biol. 2, 827–837. Shi, Q., et al. (2004). Secreted protein acidic, rich in cysteine (SPARC), mediates cellular survival of gliomas through AKT activation. J. Biol. Chem. 279, 52200–52209. Shirane, K., et al. (1999). Involvement of beta-1, 4-galactosyltransferase V in malignant transformation-associated changes in glycosylation. Biochem. Biophys. Res. Commun. 265, 434–438. Stiles, C. D., and Rowitch, D. H. (2008). Glioma stem cells: A midterm exam. Neuron 58, 832–846. Xu, S., et al. (2001). Over-expression of beta-1, 4-galactosyltransferase I, II, and V in human astrocytoma. J. Cancer Res. Clin. Oncol. 127, 502–506. Zheng, X. L., et al. (2001). Epidermal growth factor induction of apolipoprotein A-I is mediated by the Ras-MAP kinase cascade and Sp1. J. Biol. Chem. 276, 13822–13829.
C H A P T E R
T W O
Roles of Polysialic Acid in Migration and Differentiation of Neural Stem Cells Kiyohiko Angata and Minoru Fukuda Contents 26 27 28 28 29 30 33 34 34
1. Overview 1.1. Polysialic acid-deficient mice 1.2. Neurosphere cell culture 1.3. Method for preparation of neurosphere cells 1.4. In vitro migration assay 1.5. In vitro differentiation assay 1.6. Lentivirus generation Acknowledgments References
Abstract Polysialic acid, a homopolymer of a2,8-linked sialic acid, is one of the carbohydrates expressed on neural precursors in the embryonic and adult brain. Polysialic acid, synthesized by two polysialyltransferases (ST8SiaII and ST8SiaIV), mainly modulates functions of the neural cell adhesion molecule (NCAM). Polysialic acid-deficient mice demonstrated that polysialylated NCAM plays crucial roles in various steps of neural development, such as cell survival and cell migration of neural precursors, neuronal guidance, and synapse formation. However, the mechanisms of the diverse phenotypes and molecules affected by polysialic acid remain to be defined. To study the roles of polysialic acid on neural stem cells, analyses of neural stem cells from polysialic acid-deficient and NCAM-deficient mice are useful. Here, we describe how to prepare neural precursor cells from mouse brain and how to analyze migration and differentiation of neurosphere cells in vitro.
Tumor Microenvironment Program, Cancer Research Center, Sanford-Burnham Medical Research Institute, La Jolla, California, USA Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79002-9
#
2010 Elsevier Inc. All rights reserved.
25
26
Kiyohiko Angata and Minoru Fukuda
1. Overview New neurons are extensively generated in the embryonic brain, while they are born in limited areas of adult brains, mainly in the subventricular zone (SVZ) of the lateral ventricle and the subgranular zone (SGZ) in the hippocampus (Merkle and Alvarez-Buylla, 2006; Ming and Song, 2005; Zhao et al., 2008). Many carbohydrates are expressed on the neural stem cell surface and are involved in diverse functions such as cell–cell interaction and modification of cellular signaling (Angata and Fukuda, 2005; Kleene and Schachner, 2004; Matani et al., 2007; Yanagisawa and Yu, 2007). Among functional glycans, polysialic acid, a homopolymer of a2,8-linked sialic acid, is a unique posttranslational modification of the neural cell adhesion molecule (NCAM). Polysialylated NCAM (PSA-NCAM) is highly expressed in the brain during embryonic and neonatal stages, and its expression is significantly reduced in the adult brain (Bonfanti, 2006; Seki and Arai, 1993). In fact, newly generated migrating neurons express polysialic acid in the brain, thus its expression associated with neurogenesis is affected by alcohol, drug, learning, injury, and diseases (Bonfanti, 2006; Brennaman and Maness, 2010; Gascon et al., 2010; Kahn et al., 2005; Zharkovsky et al., 2003). On the other hand, aging results in decreased neuronal proliferation, and the number of polysialic acid-positive cells in dentate gyrus decreases during aging (Kuhn et al., 1996; Seki and Arai, 1995). Lack of polysialic acid in mice causes early postnatal death, which is different from the phenotypes of NCAM-deficient mice (Angata et al., 2007; Weinhold et al., 2005). Polysialic acid-deficient mice exhibited massive apoptotic neural cell death and disturbed radial and tangential neuron migration in vivo (Angata et al., 2007). Recent studies demonstrated that polysialic acid expression induced by virus infection can promote neural cell migration and increase the number of neurons in damaged brain and spinal cord (El Maarouf et al., 2006; Papastefanaki et al., 2007; Rutishauser, 2008; Zhang et al., 2007). Polysialic acid expression on embryonic stem cell-derived glial cells promoted directional migration towards guidance molecules in vitro and in vivo (Glaser et al., 2007). It has also been shown that polysialic acid delays or inhibits glial cell differentiation (Charles et al., 2000; Decker et al., 2002; Fewou et al., 2007; Franceschini et al., 2004). Indeed, loss of polysialic acid promotes glial differentiation in response to platelet-derived growth factor (PDGF; Angata et al., 2007). These results suggest that polysialic acid on the cell surface of neural precursors plays a critical role in the determination of the neural cell fate. To further investigate the function of polysialic acid on neural stem cells, in vitro analysis using neurosphere cells is useful since polysialic acid-deficient mice die in the early postnatal period (Angata et al., 2007). In this chapter, we first describe a method for in vitro culture of neurosphere cells, free-floating spherical clusters generated by neural stem cells. Then, we introduce in vitro migration assay and differentiation assay using neurosphere cells.
27
Polysialic Acid on Neural Stem Cells
A
I
B
C
II-III H
V VI
SVZ DG E
D
F
CC SVZ
LV LV
Figure 2.1 Expression of polysialic acid on neural precursors. (A) Polysialic acid (red) is expressed on neurons in the cortex. Cortical cell layers (I, II, III, V, and VI) are identified by Hoechst staining. (B) Neuroblasts in the neonatal brain highly express polysialic acid (red). (C) In the adult hippocampus, innermost granule cells and axons forming mossy fibers express polysialic acid (red). YFP (green) is expressed under the control of Thy1 promoter, and nuclei are shown by Hoechst staining (blue). (D–F) Neuroblasts in the adult SVZ (D and E) express polysialic acid (red) and move into the RMS (F). Migrating neuroblasts from SVZ to RMS are shown by arrows in (E). CC, corpus callosum; DG, dentate gyrus; H, hilus; LV, lateral ventricle. Scale bars, 0.1 mm. (Partly adapted from Angata et al., 2007)
1.1. Polysialic acid-deficient mice As shown in Fig. 2.1, polysialic acid is found in wide areas, including the striatum and cerebral cortex in early brain development. In adult hippocampus, polysialic acid is expressed on migrating granule cells and axons forming mossy fibers. Polysialic acid is also expressed on neuroblast cells migrating from the SVZ to the olfactory bulb, which is a part of the rostral migratory stream (RMS). Key molecules for polysialic acid expression in the brain are polysialyltransferases, ST8SiaII and ST8SiaIV, and NCAM (Angata and Fukuda, 2003; Hildebrandt et al., 2010). Polysialic acid-deficient mice, but expressing NCAM, are obtained by crossing ST8SiaII-knockout line and ST8SiaIV-knockout line (Angata et al., 2004, 2007; Eckhardt et al., 2000; Weinhold et al., 2005). On the other hand, NCAM-deficient mice also lack a majority of polysialic acid because NCAM is a primary acceptor of polysialic acid (Cremer et al., 1994; Tomasiewicz et al., 1993). NCAMdeficient mice are available from Jackson Laboratory. All animal usage must be in accordance with NIH guidelines and prior institutional approval is required.
28
Kiyohiko Angata and Minoru Fukuda
1.2. Neurosphere cell culture Neural stem cells are the self-renewing and multipotent cells that generate neurons and glial cells in the embryonic and adult brain. To study neural stem cells in vitro, a neurosphere cell culture system is convenient, suitable to compare the nature of neural stem cells obtained from knockout mice, and easy to apply screening for effectors or drugs (Ahmed, 2009; Gage et al., 1995; Geschwind et al., 2001; Reynolds and Weiss, 1992). To obtain neural stem cells, late embryonic to neonatal brains [embryonic day 14 (E14) to postnatal day 0 (P0)] are used because there are enriched neural stem cells with fewer contamination of fully differentiated neurons and glial cells in this developmental period.
1.3. Method for preparation of neurosphere cells 1. Heterozygous male and female mice are set up for timed-mating and mating plugs should be checked in the morning to determine the embryonic day and delivery date. When neurosphere cells are prepared from embryos, the pregnant mouse is deeply anesthetized with CO2 gas and embryos are taken out from the uterus to avoid contamination from the mother mouse. A tail biopsy from each embryo or pup is collected for genotyping by PCR. 2. Brain is removed and placed in cold L15 medium (Invitrogen). Under a dissecting microscope, the left and right semisphere of cerebral cortex is opened at midline to cut out striata (ganglionic eminences). Meninges and visible blood vessels are carefully removed from the section. The striata are mechanically dissociated by a polished Pasteur pipette. 3. The dissociated cells are incubated in a standing tube containing DME: F-12/B27 medium (Invitrogen) for 5 min to precipitate nondissociated cells. The single dissociated cells are cultured in DME:F-12/B27 medium (Invitrogen) supplemented with 20 ng/ml FGF2 and 20 ng/ml EGF (Sigma) as mitogens and antibiotics in a tissue culture flask. When the dissociated cells of each mouse are plated on the tissue culture slides or 24-well plate, cells can be stained with antibodies against polysialic acid to confirm genotypes as described (Angata et al., 2006). 4. The FGF2 and EGF are added into culture medium every other day. At the sixth or seventh day in vitro (DIV), the floating neurosphere cells are precipitated and dissociated by pipetting, as described above. This step is repeated until neurosphere cells are used for in vitro assays. As shown in Fig. 2.2, neurosphere cells grow as floating clusters of cells expressing nestin, an intermediate filament protein and one of the neural stem cell markers. Differentiated cells and other contaminated cells adhere to the bottom of the tissue culture flask so that collecting neurosphere cells is
29
Polysialic Acid on Neural Stem Cells
A
B
C
D
E
F LN
*
+PEI
* 200 400 Migration (mm/2 days)
Figure 2.2 Neurosphere cells prepared from mouse embryonic brain. Dissociated strata cells were cultured in DME:F-12/B27 medium with mitogens. Neurosphere cells present as nonadherent spherical clusters of cells. Neurospheres on the second day (A) and the fifth day (B) after passage are shown. (C) Neurosphere cells adhering on cover glasses coated with polyethylenimine (PEI) and laminin (LN) express a neural stem cell marker, nestin (green). Neurosphere cells were cultured for 2 days in 12-well plates coated with LN alone or plus PEI in Neurobasal/B27 medium without mitogens. After fixing, phase images (D) or Hoechst staining (E) of neurospheres were captured to measure the length of migration. The distance between edge of the clusters and migrated cells are measured as shown by lines in D and E. (F) Neurosphere cells from polysialic acid-deficient mice (black bars) migrated shorter than wild-type cells (white bars). Error bars, SEM; *, p < 0.001. Scale bars, 0.1 mm. (Partly adapted from Angata et al., 2007)
easy for following in vitro assays. Generally, when neurospheres grow too much, they lose neural stem cells and have more differentiated cells after passage. Thus, addition of mitogens and periodical passage are important for continuous neurosphere culture.
1.4. In vitro migration assay Neuroblast cells, which express polysialic acid, migrate from the SVZ to the olfactory bulb and form RMS as shown in Fig. 2.1. Since NCAM-deficient mice develop a smaller olfactory bulb and thicker RMS (Chazal et al., 2000; Cremer et al., 1994; Hu et al., 1996; Tomasiewicz et al., 1993), one of suggested roles of polysialic acid is to promote chain migration of neuronal precursors. To investigate if polysialic acid on neural precursors is important for neural cell migration, in vitro migration assay using neurosphere cells is useful because this system can avoid the effects of the microenvironment surrounding neuronal precursors.
30
Kiyohiko Angata and Minoru Fukuda
1. Twelve-well plates are coated with 0.01% polyethylenimine (PEI; Sigma) in 0.15 M sodium borate, pH 8.4, for 2 h. Wash the wells with DDW twice then once with PBS. The plates are also coated with mouse laminin 5 mg/ ml in PBS for 2 h at 37 C. Wash the wells with PBS four times. 2. Neurospheres on the second or third day after the passage are plated into the well containing 500 ml Neurobasal medium supplemented with B27 (Invitrogen), glutamine, and antibiotics. 3. After 48 h, cells are fixed by 4% paraformaldehyde in 0.1 M phosphate buffer, pH 7.4. The distance between the migrated cell and the edge of aggregated neurosphere cells (500 cells, 25 cells from each of 20 neurospheres) is measured and the significance is analyzed statistically. When cells are stained with Hoechst or DAPI, the distance between nuclei of migrated cells and nuclei of original clusters can be measured (Fig. 2.2). Additional staining with neuronal or glial markers allows to compare cell type-specific migration. We prepared neurosphere cells from embryos of wild-type and polysialic acid-deficient mice for an in vitro migration assay. To reduce the effect of contamination, such as fibroblasts or endothelial cells, from the primary culture, the neurosphere cells after two passages were used for in vitro migration assay. Cells from polysialic acid-deficient mice migrated 8–15% shorter than those from wild-type mice when plated on laminin, demonstrating that polysialic acid itself promotes neural cell migration (Fig. 2.2).
1.5. In vitro differentiation assay One of the most important characteristics of neural stem cells is multipotency to differentiate into neurons or glial cells. Cultured neurosphere cells are able to differentiate into neuronal or glial lineages after removing mitogens such as FGF2 and EGF (Fig. 2.3). In polysialic acid-deficient mice, GFAP-positive astrocyte-like cells are not well spread but are often found as clusters near the SVZ compared to wild-type mice. This result suggested that polysialic acid is required for either migration or differentiation of glial cells. Thus, it is important to assess the role of polysialic acid in differentiation by in vitro differentiation assay using neurosphere cells. 1. Twelve-well plates or cover glasses are coated with 0.01% PEI and 5 mg/ ml laminin as described above. Cover glasses need to be lifted up and washed on both sides by soaking in PBS. 2. Neurospheres are cultured in the well containing Neurobasal/B27 medium without mitogens as described above. BDNF (40 ng/ml, Invitrogen), CNTF (50 ng/ml, Sigma), or PDGF-AA (10 ng/ml, ICN), known as inducer molecules for neurons, astrocytes, or oligodendrocytes, respectively, can be added to the medium to evaluate the effect of cell surface carbohydrates on differentiation.
31
Polysialic Acid on Neural Stem Cells
A
B
C
D
E
F
G
H
I
* * * Figure 2.3 Differentiation of neurosphere cells. Neurosphere cells were plated on cover glasses and cultured in Neurobasal/B27 medium without mitogens to induce differentiation. Neurosphere cells were stained with neural stem cell marker nestin (green) after 1 day (1 DIV, A), 3 days, (3 DIV, B) or 7 days (7 DIV, C). Polysialic acid (red) is expressed during differentiation of neurosphere cells on 1 DIV (D), 3 DIV (E), and 7 DIV (F). Oligodendrocytes (marked with asterisks) expressing CNPase (green) are in 7 DIV culture (G). Neurosphere cells mainly differentiate into neurons and astrocytes. Neurons expressing b-III tubulin (red) and astrocytes expressing GFAP (green) are found in 3 DIV (H) and 7 DIV (I). Nestin expression decreases, and polysialic acid expression also decreases while it remains in neurons. GFAP expression increases during maturation of astrocytes. Scale bar, 0.1 mm.
3. Cells are fixed at various days for in vitro culture and subjected to staining for neural cell markers. Fixed cells are treated with 0.25% Triton-X 100 for 10 min and blocked with 1% normal goat serum. Markers for neural stem cells (nestin), neurons (b-III tubulin), astrocytes (GFAP), and oligodendrocytes (CNPase) are used to judge differentiation (Fig. 2.3). As shown in Fig. 2.4, neurosphere cells highly express nestin when they start differentiation, while nestin expression decreases, and the morphology of nestin-positive cells changes during culture. Polysialic acid also decreases, but remains in neurons. On the other hand, the expression of neuron marker and astrocyte marker increases as neurons and astrocytes mature. Since oligodendrocyte marker-positive cells are fewer than neurons and astrocytes in early differentiation, neurons and astrocytes are used for comparative analysis.
32
Kiyohiko Angata and Minoru Fukuda
A
B
C
D
E
*
GFAP-positive cells (%)
50
**
Control +PDGF Control +PDGF WT
PSA-KO
NCAM-KO
Figure 2.4 Polysialic acid inhibits differentiation of glial cells. Differentiated neurosphere cells were fixed and stained for markers of astrocytes (GFAP, green in A and B) and neurons (b-III tubulin, red in C and D). An example of fewer glial cells from the same neurosphere (A and C), and another example of more glial cells from one neruosphere (B and D) are shown. (E) Neurosphere cells prepared from wild-type, polysialic acid-deficient mice and NCAM-deficient mice were subjected to in vitro differentiation. PDGF was added to culture to assess its effect on the differentiation of neurosphere cells without polysialic acid. The proportion of astrocytes in the total number of differentiated cells is shown (four each neurosphere clone for polysialic acid-deficient mice and two each clone for NCAM-deficient mice). Error bars, S.D.; *p < 0.005; **p < 0.01. Scale bar, 0.1 mm. Partly adapted from Angata et al. (2007).
When neurosphere cells derived from polysialic acid-deficient mice were differentiated, the ratio of GFAP-positive cells to totally differentiated cells was comparable to that of neurosphere cells from wild-type mice (Fig. 2.4). However, loss of polysialic acid significantly increased GFAPexpressing cells over b-III tubulin expressers in the presence of PDGF compared to wild-type neurosphere cells. PDGF-induced glial cell differentiation of neurosphere cells from NCAM-deficient mice, which also lack PSA-NCAM, was also increased in contrast to wild-type control. These results indicate that polysialic acid rather than NCAM inhibits glial cell differentiation.
33
Polysialic Acid on Neural Stem Cells
1.6. Lentivirus generation Expressing exogenous cDNA in neurosphere cells will be a useful technique in studying the functions of carbohydrates, in addition to using of neurosphere cells derived mutant mice as described above. However, transfection of floating neurosphere cells needs to be carried out. In this purpose, virus systems including adenovirus, adeno-associated virus, retrovirus, and lentivirus are used (Franceschini et al., 2004; Waehler et al., 2007). We use lentivirus generated from pGIPz transfer vector (OpenBiosystems; Fig. 2.5). Currently, the second generation and third generation systems, which require a different set of transfer vectors and packaging vectors, are used to generate lentivirus. Lentivirus is generated by cotransfection of vectors and concentrated to increase titer. Aliquots should be kept frozen in 80 C until use. The next day after dissociation, lentivirus is added into
A SIN18.hPGK-GFP LTR
RRE
pPGK
SIN18.hPGKLTR mCherry
RRE
pPGK mCherry WPRE LTR
pGIPz/PG LTR
pCMV
PST•GFP
B
C
D
E
GFP
WPRE LTR
IRES PuroR WPRE LTR
Figure 2.5 Generation of lentivirus to express polysialic acid. (A) Schemes of core structure of transfer vectors (SIN18.hPGK-GFP, SIN18.hPGK-mCherry, and pGIPz/ PG) are shown. GFP and mCherry are expressed under PGK promoter in SIN18 vectors, while cDNA encoding a GFP fusion with human ST8SiaIV (PSTGFP) is expressed under CMV promoter in pGIPz/PG transfer vector. PuroR, Puromycinresistant gene. Pink boxes are sequence elements required for expression by lentivirus. GFP labels whole COS-I cells (B), but PSTGFP is localized in Golgi of COS-I cells (C). Infection with lentivirus-PSTGFP induce polysialic acid expression (red) in (C). GFP is stably expressed in neurosphere cells (D) and differentiated cells of neurospheres (E) after infection with lentivirus-GFP. Scale bar, 0.1 mm.
34
Kiyohiko Angata and Minoru Fukuda
a culture medium overnight, and the medium is changed for further culture. Polybrene at 4 mg/ml (Millipore) can be added for infection into some cells to increase transduction efficiency. Puromycin is added to select stable neurosphere cells, which integrate lentivirus-derived sequences into its genomic DNA and are used for in vitro assays described above. Figure 2.5 shows neurosphere cells efficiently transfected by lentivirus expressing GFP. Neurosphere cells have been useful in vitro models of neural stem cells. Migrating neuroblasts and neurosphere cells express polysialic acid as shown, indicating that neurosphere cells derived from polysialic acid-deficient mice are suitable to study roles of polysialic acid on neural stem cells. In fact, the important roles of polysialic acid on migration and differentiation of neurons and glial cells were recapitulated by in vitro assays. Further studies using neurosphere cells will allow us to study mechanisms of polysialic aciddependent migration and/or differentiation. For instance, analyzing the effects of guidance molecules using in vitro migration assay will identify molecule(s) interacting polysialic acid or NCAM and reveal the molecular mechanism required for neural stem cell migration. Neurosphere cells prepared from glycosyltransferase knockout mice will be good resources to study the roles of carbohydrates on neural stem cells and to screen functional molecules, which affect cell fates of neural stem cells.
ACKNOWLEDGMENTS Authors thank generous supports and technical assistances from Dr. Terskikh’s laboratory, Animal Facility, and Lentiviral Core at Sanford-Burnham Medical Research Institute. This work was supported by NIH grant CA33895.
REFERENCES Ahmed, S. (2009). The culture of neural stem cells. J. Cell. Biochem. 106, 1–6. Angata, K., and Fukuda, M. (2003). Polysialyltransferases: Major players in polysialic acid synthesis on the neural cell adhesion molecule. Biochimie 85, 195–206. Angata, K., and Fukuda, M. (2005). Carbohydrates of neural cell glycoproteins: Structure, biosynthesis and function. In ‘‘Neuroglycobiology,’’ (M. Fukuda, U. Rutishauser, and R. L. Schnaar, eds.), pp. 1–38. Oxford Univ. Press, London. Angata, K., Long, J. M., Bukalo, O., Lee, W., Dityatev, A., Wynshaw-Boris, A., Schachner, M., Fukuda, M., and Marth, J. D. (2004). Sialyltransferase ST8Sia-II assembles a subset of polysialic acid that directs hippocampal axonal targeting and promotes fear behavior. J. Biol. Chem. 279, 32603–32613. Angata, K., Lee, W., Mitoma, J., Marth, J. D., and Fukuda, M. (2006). Cellular and molecular analysis of neural development of glycosyltransferase gene knockout mice. Methods Enzymol. 417, 25–37. Angata, K., Huckaby, V., Ranscht, B., Terskikh, A., Marth, J. D., and Fukuda, M. (2007). Polysialic acid-directed migration and differentiation of neural precursors are essential for mouse brain development. Mol. Cell. Biol. 27, 6659–6668.
Polysialic Acid on Neural Stem Cells
35
Bonfanti, L. (2006). PSA-NCAM in mammalian structural plasticity and neurogenesis. Prog. Neurobiol. 80, 129–164. Brennaman, L. H., and Maness, P. F. (2010). NCAM in neuropsychiatric and neurodegenerative disorders. Adv. Exp. Med. Biol. 663, 299–317. Charles, P., Hernandez, M. P., Stankoff, B., Aigrot, M. S., Colin, C., Rougon, G., Zalc, B., and Lubetzki, C. (2000). Negative regulation of central nervous system myelination by polysialylated-neural cell adhesion molecule. Proc. Natl. Acad. Sci. USA 97, 7585–7590. Chazal, G., Durbec, P., Jankovski, A., Rougon, G., and Cremer, H. (2000). Consequences of neural cell adhesion molecule deficiency on cell migration in the rostral migratory stream of the mouse. J. Neurosci. 20, 1446–1457. Cremer, H., Lange, R., Christoph, A., Plomann, M., Vopper, G., Roes, J., Brown, R., Baldwin, S., Kraemer, P., Scheff, S., Barthels, D., Rajewsky, K., et al. (1994). Inactivation of the N-CAM gene in mice results in size reduction of the olfactory bulb and deficits in spatial learning. Nature 367, 455–459. Decker, L., Durbec, P., Rougon, G., and Evercooren, A. B. (2002). Loss of polysialic residues accelerates CNS neural precursor differentiation in pathological conditions. Mol. Cell. Neurosci. 19, 225–238. Eckhardt, M., Bukalo, O., Chazal, G., Wang, L., Goridis, C., Schachner, M., GerardySchahn, R., Cremer, H., and Dityatev, A. (2000). Mice deficient in the polysialyltransferase ST8SiaIV/PST-1 allow discrimination of the roles of neural cell adhesion molecule protein and polysialic acid in neural development and synaptic plasticity. J. Neurosci. 20, 5234–5244. El Maarouf, A., Petridis, A. K., and Rutishauser, U. (2006). Use of polysialic acid in repair of the central nervous system. Proc. Natl. Acad. Sci. USA 103, 16989–16994. Fewou, S. N., Ramakrishnan, H., Bu¨ssow, H., Gieselmann, V., and Eckhardt, M. (2007). Down-regulation of polysialic acid is required for efficient myelin formation. J. Biol. Chem. 282, 16700–16711. Franceschini, I., Vitry, S., Padilla, F., Casanova, P., Tham, T. N., Fukuda, M., Rougon, G., Durbec, P., and Dubois-Dalcq, M. (2004). Migrating and myelinating potential of neural precursors engineered to overexpress PSA-NCAM. Mol. Cell. Neurosci. 27, 151–162. Gage, F. H., Coates, P. W., Palmer, T. D., Kuhn, H. G., Fisher, L. J., Suhonen, J. O., Peterson, D. A., Suhr, S. T., and Ray, J. (1995). Survival and differentiation of adult neuronal progenitor cells transplanted to the adult brain. Proc. Natl. Acad. Sci. USA 92, 11879–11883. Gascon, E., Vutskits, L., and Kiss, J. Z. (2010). The role of PSA-NCAM in adult neurogenesis. Adv. Exp. Med. Biol. 663, 127–136. Geschwind, D. H., Ou, J., Easterday, M. C., Dougherty, J. D., Jackson, R. L., Chen, Z., Antoine, H., Terskikh, A., Weissman, I. L., Nelson, S. F., and Kornblum, H. I. (2001). A genetic analysis of neural progenitor differentiation. Neuron 29, 325–339. Glaser, T., Brose, C., Franceschini, I., Hamann, K., Smorodchenko, A., Zipp, F., DuboisDalcq, M., and Bru¨stle, O. (2007). Neural cell adhesion molecule polysialylation enhances the sensitivity of embryonic stem cell-derived neural precursors to migration guidance cues. Stem Cells 25, 3016–3025. Hildebrandt, H., Mu¨hlenhoff, M., and Gerardy-Schahn, R. (2010). Polysialylation of NCAM. Adv. Exp. Med. Biol. 663, 95–109. Hu, H., Tomasiewicz, H., Magnuson, T., and Rutishauser, U. (1996). The role of polysialic acid in migration of olfactory bulb interneuron precursors in the subventricular zone. Neuron 16, 735–743. Kahn, L., Alonso, G., Normand, E., and Manzoni, O. J. (2005). Eur. J. Neurosci. 21, 493–500. Kleene, R., and Schachner, M. (2004). Glycans and neural cell interactions. Nat. Rev. Neurosci. 5, 195–208.
36
Kiyohiko Angata and Minoru Fukuda
Kuhn, H. G., Dickinson-Anson, H., and Gage, F. H. (1996). Neurogenesis in the dentate gyrus of the adult rat: Age-related decrease of neuronal progenitor proliferation. J. Neurosci. 16, 2027–2033. Matani, P., Sharrow, M., and Tiemeyer, M. (2007). Ligand, modulatory, and co-receptor functions of neural glycans. Front. Biosci. 12, 3852–3879. Merkle, F. T., and Alvarez-Buylla, A. (2006). Neural stem cells in mammalian development. Curr. Opin. Cell Biol. 18, 704–709. Ming, G. L., and Song, H. (2005). Adult neurogenesis in the mammalian central nervous system. Annu. Rev. Neurosci. 28, 223–250. Papastefanaki, F., Chen, J., Lavdas, A. A., Thomaidou, D., Schachner, M., and Matsas, R. (2007). Grafts of Schwann cells engineered to express PSA-NCAM promote functional recovery after spinal cord injury. Brain 130, 2159–2174. Reynolds, B. A., and Weiss, S. (1992). Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science 255, 1707–1710. Rutishauser, U. (2008). Polysialic acid in the plasticity of the developing and adult vertebrate nervous system. Nat. Rev. Neurosci. 9, 26–35. Seki, T., and Arai, Y. (1993). Distribution and possible roles of the highly polysialylated neural cell adhesion molecule (NCAM-H) in the developing and adult central nervous system. Neurosci. Res. 17, 265–290. Seki, T., and Arai, Y. (1995). Age-related production of new granule cells in the adult dentate gyrus. NeuroReport 6, 2479–2482. Tomasiewicz, H., Ono, K., Yee, D., Thompson, C., Goridis, C., Rutishauser, U., and Magnuson, T. (1993). Genetic deletion of a neural cell adhesion molecule variant (N-CAM-180) produces distinct defects in the central nervous system. Neuron 11, 1163–1174. Waehler, R., Russell, S. J., and Curiel, D. T. (2007). Engineering targeted viral vectors for gene therapy. Nat. Rev. Genet. 8, 573–587. Weinhold, B., Seidenfaden, R., Rockle, I., Muhlenhoff, M., Schertzinge, F., Conzelmann, S., Marth, J. D., Gerardy-Schahn, R., and Hildebrandt, H. (2005). Genetic ablation of polysialic acid causes severe neurodevelopmental defects rescued by deletion of the neural cell adhesion molecule. J. Biol. Chem. 280, 42971–42977. Yanagisawa, M., and Yu, R. K. (2007). The expression and functions of glycoconjugates in neural stem cells. Glycobiology 17, 57R–74R. Zhang, Y., Ghadiri-Sani, M., Zhang, X., Richardson, P. M., Yeh, J., and Bo, X. (2007). Induced expression of polysialic acid in the spinal cord promotes regeneration of sensory axons. Mol. Cell. Neurosci. 35, 109–119. Zhao, C., Deng, W., and Gage, F. H. (2008). Mechanisms and functional implications of adult neurogenesis. Cell 132, 645–660. Zharkovsky, T., Kaasik, A., Jaako, K., and Zharkovsky, A. (2003). Neurodegeneration and production of the new cells in the dentate gyrus of juvenile rat hippocampus after a single administration of ethanol. Brain Res. 978, 115–123.
C H A P T E R
T H R E E
Structural and Functional Analysis of Chondroitin Sulfate Proteoglycans in the Neural Stem Cell Niche Swetlana Sirko,* Kaoru Akita,† Alexander Von Holst,‡ and Andreas Faissner‡ Contents 1. Overview 2. Immunohistochemistry of Embryonic and Postnatal Mouse Brain Sections 3. Method to Stain Embryonic Sections for NSPC Markers 4. Analysis of the Adult Neurogenic Niche and SVZ-Derived Cells by Immunocytochemistry 4.1. Method to cultivate NSPCs from adult neurogenic niches 5. Immunocytochemistry of Acutely Dissociated Cells 5.1. Method for immuncytochemistry performed on neural cell monolayers 6. Isolation of NSPCs by Immunopanning or by Immunoisolation Using Paramagnetic Beads (EasySep) 6.1. Method for immunopanning of NSPCs with MAb 473HD 6.2. Method for preparing 473HD-positive cells applying magnetic beads 7. Neurosphere Cultures and Various Methods for Their Analysis 7.1. Method for cultivating NSPCs as neurospheres 7.2. Method to perform a differentiation assay with neurospheres 7.3. Method for the sectioning of neurospheres and immunohistochemistry 7.4. Method for immunoblot analysis of neurospheres for biochemical analysis 7.5. Method for the partial purification and identification of CSPGs from the conditioned neurosphere culture medium
39 42 43 44 44 46 46 47 48 49 49 50 50 52 52 53
* Department of Physiological Genomics, Ludwig-Maximilians-University Munich, Germany Department of Molecular Biosciences, Kyoto Sangyo University, Kyoto, Japan Department of Cell Morphology and Molecular Neurobiology, Ruhr-University, Bochum, Germany
{ {
Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79003-0
#
2010 Elsevier Inc. All rights reserved.
37
38
Swetlana Sirko et al.
8. Disaccharide Analysis of CS/DS Chains from Embryonic Brain and Conditioned Neurosphere Culture Media and Effect of Sodium Chlorate Treatment on Neurosphere Formation at Clonal Cell Density 8.1. Method for the suppression of sulfation in NSPC cultures 9. Analysis of NSPC-Proliferation In Vitro and In Vivo 9.1. BrdU-pulse labeling of neurospheres in vitro 9.2. Method for the BrdU labeling of NSPCs in vivo 10. Analysis of CSPG Functions in NSPCs Using Chondroitinase ABC Treatment in Culture 10.1. Method for the treatment of neurosphere cultures with ChABC 11. Analysis of Chondroitin Sulfate Functions in the Neural Stem Cell Niche 11.1. Method for intracerebroventricular injections in utero 12. RT-PCR and Semiquantitative Analysis of the Synthetic Machinery for Glycosaminoglycans 12.1. Method for the amplification of distinct sulfotransferases using RT-PCR 13. In Situ Hybridization of Sulfotransferases in Tissue and Neurosphere Sections 13.1. Method for the in situ hybridization of sulfotransferase mRNA 14. Microscopy 15. Conclusion and Outlook Acknowlegments References
55 55 56 56 56 56 57 58 58 59 61 63 63 66 66 66 66
Abstract The stem cell niche plays an important role for the maintenance and differentiation of neural stem/progenitor cells (NSPCs). It is composed of distinct cell types that influence NSCPs by the release of paracrine factors, and a specialized extracellular matrix that structures the NSPC environment. During the past years, several components of the neural stem cell (NSC) niche could be deciphered on the molecular level. One prominent constituent is the tenascin-C (Tnc) glycoprotein and its isoforms that intervene in NSPC proliferation and differentiation. Distinct chondroitin sulfate proteoglycans (CSPGs) associate with Tnc in the niche territory and we could show that these have functional connotations in the stem cell compartment in their own rights. In this chapter, we give an account of the tools and methods we developed to unravel the structures and functions of CSPGs in the NSC niche.
CSPGs in the Neural Stem Cell Niche
39
Abbreviations ACSF BLBP C/D-STs ChABC Cor CNS CS-GAGs CSPGs CS/DS DIG Div ECM EGF ES-cells FGF-2 FACS FCS GE HBSS HSPGs ICVI GAGs NSC NSPCs PAPS RPTP RT SDS-PAGE SGZ SVZ
artificial cerebrospinal fluid brain lipid-binding protein chondroitin/dermatan sulfotransferases chondroitinase ABC cortex central nervous system chondroitin sulfate glycosaminoglycans chondroitin sulfate proteoglycans chondroitin sulfate/dermatan sulfate digoxigenin days in vitro extracellular matrix epidermal growth factor embryonic stem cells fibroblast growth factor 2 (basic FGF) fluorescence activated cell sorting fetal calf serum ganglionic eminence Hank’s basal salt solution heparan sulfate proteoglycans intracerebroventricular injection glycosaminoglycans neural stem cell neural stem/progenitor cells 30 -phosphoadenosine 50 -phosphosulfate receptor protein tyrosinephosphatase room temperature sodium dodecylsulfate polyacrylamide gel electrophoresis subgranular zone (of the hippocampus) subventricular zone (wall of the lateral ventricle)
1. Overview The development of the central nervous system (CNS) evolves in a sequence of defined and carefully orchestrated steps. With regard to the cellular origins, significant progress during the past years has led to a
40
Swetlana Sirko et al.
coherent and unified view of the cellular precursors of the CNS (Kriegstein and Alvarez-Buylla, 2009). During the early phase of forebrain development neuroepithelial (NE) cells expand by cycles of symmetric divisions (Temple, 2001) and can be considered authentic neural stem cells (NSCs) because they can generate the major neural lineages, namely neurons, astrocytes, and oligodendrocytes. Subsequently, these cells give rise to radial glia cells that divide asymmetrically during neurogenesis, producing a postmitotic neuronal precursor cell and a daughter cell that reenters the cell cycle (Temple, 2001; Wodarz and Huttner, 2003). Thereby radial glia cells, beyond their well-known function as substrate and guide for neuronal migration, do give rise to neurons in vitro (Hartfuss et al., 2001; Malatesta et al., 2000) and serve as NSCs, as evidenced by fate mapping studies in vivo (Anthony et al., 2004; Malatesta et al., 2003; Miyata et al., 2001; Noctor et al., 2001, 2002). Around birth, the radial glia cells transform into astrocytes. Remarkably, the specialized subpopulation of subventricular zone (SVZ) astrocytes has been identified as NSC in the adult brain (Doetsch et al., 1999). It has been hypothesized that NE cells, radial glia cells, and SVZ astrocytes constitute the NSC lineage (Alvarez-Buylla et al., 2001; Doetsch, 2003). Because the developmental potential of NSCs becomes progressively restricted, but the intermediate differentiation states cannot be distinguished by distinct sets of markers, we will refer to the complete population as neural stem/progenitors cells (NSPCs) for the purpose of this discussion. As has been pointed out, the transition from the symmetric to the asymmetric division mode is of crucial importance for the diversification of neural cell lineages (Kriegstein and Alvarez-Buylla, 2009). On theoretical grounds, this switch of division mode can either be caused by an asymmetric distribution of specific cellular determinants to only one of the daughters, which has, for example, paradigmatically been proven in the Drosophila nervous system (Gotz and Huttner, 2005; Wodarz and Huttner, 2003); alternatively, it could be caused by dispatching the daughters to distinct microenvironments that might differentially instruct their further fate (Scadden, 2006). During the past years, our laboratory has explored this second possibility further. In situ, NSPCs are located in a niche that consists of a restricted set of cell types and contains a specialized microenvironment composed of soluble factors, membrane bound molecules, and extracellular matrix (ECM) constituents (Alvarez-Buylla and Lim, 2004; Scadden, 2006). The ECM of the CNS is composed of glycoproteins and proteoglycans. With regard to glycoproteins, constituents of the tenascin gene family, in particular tenascin-C (Tnc), are specifically enriched in the environment of NSPCs at embryonic day E12–E13 in the mouse (von Holst et al., 2007). There, Tnc contributes to the maturation of NSPCs (Garcion et al., 2004), the proliferation and maintenance of oligodendrocyte precursors (Czopka
CSPGs in the Neural Stem Cell Niche
41
et al., 2009; Garcion et al., 2001; Garwood et al., 2004), and the regulation of target genes such as Sam68 that are involved in the regulation of NSPC proliferation (Moritz et al., 2008). The proteglycans of the nervous system comprise heparan sulfate proteoglycans (HSPGs) of the glypican and the syndecan type that are mostly membrane associated, and chondroitin sulfate proteoglycans (CSPGs), for example, members of the lectican family, such as brevican, neurocan, and versican, that are mostly released into the extracellular environment (Bandtlow and Zimmermann, 2000). HSPGs play an important role as accessory factors in signaling processes, for example, by exposing growth factors such as fibroblast growth factor 2 (FGF-2) to the FGFR. CSPGs have attracted considerable interest in the field of biomedicine because they are considered a major obstacle to axonal regeneration in the context of CNS lesions (Busch and Silver, 2007; Carulli et al., 2005; Fitch and Silver, 2008). Furthermore, CSPGs have been attributed important roles in the regulation of synaptic plasticity (Bradbury et al., 2002; Pizzorusso et al., 2002). One ECM component present in the postnatal and adult NSC niche is the DSD-1-proteoglycan, a CSPG that is selectively recognized by the monoclonal antibody 473HD (Faissner et al., 1994; Gates et al., 1995). We could subsequently show that DSD-1-PG is the mouse homologue of rat phosphacan (Garwood et al., 1999). The CSPG phosphacan represents a soluble, released splice variant of the receptor protein tyrosinephosphatase (RPTP)-bz gene. The large RPTP-bz receptor is expressed by NSCs and radial glia during development of the CNS and exposes the 473HD-structure (Garwood et al., 2001; von Holst et al., 2006). We could show that this particular GAG-epitope is itself functionally active and promotes neurite outgrowth of several types of CNS neurons (Faissner et al., 1994; Garwood et al., 1999). This motivated a more detailed structural analysis that showed that the 473HD (synonymous to DSD-1-)-epitope depends on sulfation, is enriched in the CS-D-type motif, and by itself sufficient to promote neurite outgrowth (Clement et al., 1998; Faissner et al., 1994; Hikino et al., 2003; Nadanaka et al., 1998). Expanding on the earlier results (Gates et al., 1995), we have recently shown that the unique CS-structure recognized by MAb 473HD is expressed in the germinal layers during mouse forebrain development and represents a novel surface marker of radial glia (von Holst et al., 2006). This observation paralleled a report that CSPGs are released by NSCPs growing as neurospheres (Ida et al., 2006). Neurospheres are a culture model of NSPCs and composed of neural stem and various progenitor cells that grow in suspension. Interestingly, also the neurospheres strongly express the 473HD epitope. Consistent with the expression of the 473HD epitope, various mono- and disulfated disaccharide units have been identified by the compositional analysis of chondroitin sulfate/dermatan sulfate (CS/DS)
42
Swetlana Sirko et al.
chains purified from the embryonic mammalian CNS (Bao et al., 2005; Ida et al., 2006; Properzi et al., 2005; Ueoka et al., 2000; Zou et al., 2003). Furthermore, the expression of some CS/DS-PG core proteins has been detected in the embryonic NSC niche and in neurospheres (Ida et al., 2006; Kabos et al., 2004). The expression of the 473HD epitope in neurogenic regions of the CNS prompted us to explore potential functional implications. Consistent with the hypothesis that chondroitin sulfate glycosaminoglycans (CS-GAGs) play a biological role, the addition of the MAb 473HD or the digestion of CS-GAGs on the surface of 473HD-positive NSPCs using chondroitinase ABC (ChABC) reduced the number of neurospheres and of proliferating NSPCs, as assessed by BrdU-incorporation (von Holst et al., 2006). Furthermore, the differentiation of NSPCs into neurons was reduced while the generation of astrocytes was enhanced, suggesting a role in lineage decisions (Sirko et al., 2007, 2010). Altogether, these data revealed that CS-GAGs are indeed partaking in the pathway of NSPC expansion and differentiation. In view of the importance of sulfation and the distribution of the sulfate groups on the CS-GAGs, we have also studied the biosynthetic machinery that generates distinct CS-GAGs. We could show that the critical enzymes required for the synthesis of CS-D and other CS-variants are expressed in neurogenic regions in the developing and in the adult CNS, and in neurospheres derived therefrom (Akita et al., 2008).
2. Immunohistochemistry of Embryonic and Postnatal Mouse Brain Sections Immunocytochemistry and -histochemistry are classical methods used to localize various components in a tissue and to characterize cell subpopulations with classic markers. For example, the immunocytochemical analysis of radial glia with the marker molecules RC2 (Chanas-Sacre et al., 2000), GLAST (Shibata et al., 1997), and brain lipid-binding protein (BLBP; Feng et al., 1994) has revealed several subpopulations that change dynamically during telencephalic development (Hartfuss et al., 2001). An impressive repertoire of antibodies is available to specifically label subpopulations of neural cells. The following monoclonal antibodies were used in our studies: 473HD that recognizes the DSD-1-epitope, a particular CS-GAG (rat IgM; Faissner et al., 1994); MAb 487 directed to the L5-epitope/LewisX (LeX) (rat IgM; Streit et al., 1996); RC2, a radial glia marker (mouse IgM; Developmental Studies Hybridoma Bank, University of Iowa, IA, USA); anti-E-cadherin, a cell adhesion molecule and polarity marker (mouse IgG, Santa Cruz); O4, a marker of immature oligodendrocytes (mouse IgM; Sommer and Schachner, 1981); PSA-NCAM, a marker of neuroblasts in
CSPGs in the Neural Stem Cell Niche
43
the hippocampus and the rostral migratory stream (Rougon et al., 1986); anti-Nestin, an intermediate filament expressed in NSPCs (mouse IgG, Chemicon); anti-bIII-tubulin, an early marker of CNS neurons (mouse IgG, Sigma); and anti-BrdU antibody that is used in cell proliferation studies (mouse IgG, Roche). Polyclonal antibodies included antibodies (all rabbit): against DSD-1-PG/phosphacan (referred to as pk-antiphosphacan, batch KAF13(4), which recognizes the core proteins of RPTP-b/z; Faissner et al., 1994); against GFAP, an intermediate filament protein expressed by astrocytes (Dako); against NG2, a marker of early oligodendrocytes (Chemicon); against BLBP, a marker of a subtype of neurogenic radial glia (BLBP, gift of Dr Heintz, Rockefeller University, New York; alternatively from Chemicon); against atypical-PKC, a polarity marker of radial glia (aPKC, BD Science); against GLAST, a glutamate transporter that is expressed in radial glia (gift of Dr Pow, University of Queensland, Australia or from the company Chemicon); against phosphohistone-3 (PH3), a marker of the M-phase of the cell cycle, and the ECM basal lamina component laminin-1 (from Chemicon). Secondary antibodies were subclass-specific biotinylated-, CY2-, or CY3-coupled anti-mouse, anti-rat, and anti-rabbit antibodies (all from Dianova). We used streptavidin-Alexa FluorÒ350 (Invitrogen) to reveal biotinylated reagents. In developmental neurobiology, most studies are carried out with embryonic or postnatal tissue that do not require fixation by perfusion.
3. Method to Stain Embryonic Sections for NSPC Markers 1. Pregnant animals are sacrificed by cervical dislocation. The embryos are removed and transferred to phosphate-buffered saline (PBS: 137 mM NaCl, 3 mM KCl, 6.5 mM Na2HPO42H2O, 1.5 mM KH2PO4; pH 7.4). Subsequently, the brains are prepared and immersion fixed overnight with 4% (w/v) paraformaldehyde (PFA) in PBS at 4 C. Thereafter, tissues are cryoprotected overnight with 30% (w/v) sucrose in H2O, embedded in tissue freezing medium (Jung) and frozen on dry ice. 2. Sections (12–14 mm) are cut on a cryostat (Leica). For immunohistochemistry on frontal sections, slides are rehydrated in PBS with 1.7% (w/v) NaCl and 10% (v/v) normal goat serum (Dianova) for 1 h at room temperature (RT) before incubation with the various primary antibodies at convenient dilutions, for example, MAb 473HD (1:500), MAb RC2 (1:500), MAb anti-Nestin (1:500), MAb anti-bIII-tubulin (1:300), antiBLBP (1:1000–2000), anti-NG2 (1:200), and anti-GLAST (1:1500). The sections are incubated with primary antibodies diluted in PBS/
44
Swetlana Sirko et al.
1.7% (w/v) NaCl/10% (v/v) normal goat serum/0.1% Triton-X-100 overnight at 4 C. Subsequently, the sections are washed three times for 5 min in PBS and incubated with adequate secondary antibodies diluted 1:500 in PBS/A (PBS containing 0.1% (w/v) bovine serum albumin (BSA, Sigma)) for 2 h at RT. During incubation with secondary antibodies, cell nuclei are labeled with bisbenzimide (diluted 1:105, Sigma) to aid cell counting. After three further washes in PBS, the sections are mounted in immumount (Thermo Science) and analyzed using fluorescence microscopy (Fig. 3.1A–C).
4. Analysis of the Adult Neurogenic Niche and SVZ-Derived Cells by Immunocytochemistry The SVZ of the lateral ventricle walls of the anterior horn and the subgranular zone (SGZ) of the hippocampus represent the neurogenic niches in the adult CNS. Best preservation of tissues for immunochemistry is achieved by transcardial perfusion of living anesthetized experimental animals with 4% PFA. For immunohistochemical analysis, 12 mm cryosections from adult mouse forebrain as well as from adult NSC-derived neurospheres grown for 7 days in vitro (div) are used. The sections are treated as described for embryonic cryosections.
4.1. Method to cultivate NSPCs from adult neurogenic niches 1. For NSC cultures, the brains of adult mice are removed from the skull, and 300-mm-thick horizontal vibratome sections are prepared for dissection of the SVZ around the lateral ventricle under a high-power stereomicroscope. The SVZ cells are acutely dissociated as described (Hartfuss et al., 2001) and plated onto polyornithine-coated dishes in neurosphere medium containing 1% fetal calf serum (FCS). After 2 h, adherent cells are fixed and immunocytochemically analyzed with the same antibodies as above. This approach yields a picture of the actual frequency of cell types and lineages in the tissue of origin. 2. Instead of being used for frequency counts immediately after dissociation, the cells can also be transferred into suspension culture in neurosphere medium (see 7.1, p.14). The generation of neurospheres from adult NSCs in the presence of 20 ng/ml epidermal growth factor (EGF) or 20 ng/ml FGF-2, or both growth factors combined is determined and quantified after 2 weeks in culture. Alternatively, cell subtypes can be enriched by immunopanning (see 6.1, p.12). The cell biological analysis can be performed as described for embryonic NSPCs.
45
CSPGs in the Neural Stem Cell Niche
A
B 473HD DAPI
C 473HD BrdU
473HD Nestin DAPI
E13
Cor
LV
LV
LV
GE LV D 1. Preincubation with secondary antibody
2. Preincubation with primary antibody
3. Addition of single cell suspension
4. Selective separation of cell fractions
Secondary antibody Primary antibody
E
Immunonegative cell Immunopositive cell
Selectively isolated 473HD + cells
473HD DAPI
Nonselected cortical cells
Figure 3.1 Expression of the 473HD epitope on embryonic forebrain cells in vivo and in vitro. (A) Fluorescence micrograph of frontal cryosection after immunolabeling with MAb 473HD demonstrates expression of the 473HD epitope in the mouse forebrain at embryonic day 13. (B) The radially oriented expression (white arrowheads) of the 473HD epitope is closely associated with BrdU incorporated cells in the telencephalic VZ. (C) Double immunostaining with MAb 473HD and antibodies against Nestin reveals that expression of the 473HD epitope is mainly attributed to Nestin-positive precursor cells in vivo (upper layer). In accordance with the situation in vivo, the surface expression of the 473HD epitope is observed on the Nestin-positive precursor derived from cortical tissue (lower layer). (D) The experimental layout of the immunopanning procedure to enrich for 473HD epitope-expressing cells is schematically represented. The sequential preparation of the immunopanning dishes begins with preincubation of petri dishes with biotin-conjugated secondary antibody (1), followed by the monoclonal primary
46
Swetlana Sirko et al.
5. Immunocytochemistry of Acutely Dissociated Cells The determination of cell numbers is difficult in neural tissues, due to the convoluted arrangement of cell layers in the CNS, the different cell sizes and complex morphologies, and processes of different sizes and lengths. Complex stereological procedures have been designed to optimize cell number counts in the CNS. As an alternative approach, we have favored to prepare acutely dissociated suspension of cells that were subsequently adhered to solid substrates. There, individual cell bodies can be distinguished and investigated with specific lineage markers.
5.1. Method for immuncytochemistry performed on neural cell monolayers 1. For immunocytochemical stainings, the acutely dissociated cells originating from forebrain tissues (Fig. 3.1C and E), from cortical and striatal neurospheres, or obtained by immunopanning using the MAb 473HD (von Holst et al., 2006; Fig. 3.1E) are plated in FCS-containing medium (1% (v/v), Seromed) at a density of 5.000 cells/well in 4-well dishes (Greiner) coated with 10 mg/ml polyornithine (Sigma). The cells are incubated in a humidified atmosphere with 6% (v/v) CO2 at 37 C for 1 h. 2. Embryos at E13 or E18 are removed as described elsewhere. Embryonic brains are dissected and transferred to minimal essential medium (MEM, Sigma). The meninges, hippocampi, and olfactory bulbs are removed and the cerebral cortices (Cor) and the ganglionic eminence (GE) are prepared. Tissues are enzymatically digested with 0.05% trypsin–EDTA in Hank’s basal salt solution (HBSS; Invitrogen) for 10 or 20 min at 37 C to obtain E13 and E18 embryonic cell suspensions, respectively. The enzyme activity is stopped by the addition of 1 ml ovomucoid (1 mg/ml soybean trypsin inhibitor, Sigma; 50 mg/ml BSA, 40 mg/ml DNase I, Worthington, in L-15 medium, Sigma). After centrifugation for 5 min at 1000 rpm (212 g) the cell pellets are resuspended in antibody (2). Afterward, a cell suspension can be transferred to the coated panning dish (3). After incubation for at least 1 h, the nonadherent cells are gently washed away from the panning dish until only adherent cells remains. The latter can be recovered by enzymatic digestion with trypsin–EDTA and collected for further analysis (4). (E) As determined by immunocytochemical analysis at 2 h after the immunopanning procedure, 473HD epitope-expressing cells from embryonic forebrain can be enriched to more than 90% in the immunoselected population. All cell nuclei are counterstained with bisbenzimide and are shown in blue (DAPI: 40 ,6-diamidino-2-phenylindole). Scale bar: 150 mm in (A), 25 mm in (B) and (C), 50 mm in (E).
CSPGs in the Neural Stem Cell Niche
3.
4.
5.
6.
47
neurosphere medium consisting of DMEM/F12 (1:1) that contains 0.2 mg/ml L-glutamine (all Sigma), 2% (v/v) B27, 100 U/ml penicillin, 100 mg/ml streptomycin (all Invitrogen). Four-well dishes (Greiner) are sequentially coated with 10 mg/ml polyornithine (Sigma) in H2O followed by 10 mg/ml laminin-1 (Tebu) in PBS for 1 h at 37 C each. After washing the dishes, the cells are plated at a density of 5.000 cells/well in neurosphere medium containing 1% (v/v) FCS (Seromed) and incubated in a humidified atmosphere with 6% (v/v) CO2 at 37 C. For immunocytochemical stainings, an established protocol is followed, as previously described (von Holst and Rohrer, 1998). All steps are performed at RT. Acutely dissociated cells, adherent after 2 h, are washed twice for 5 min in Krebs–Ringer–Hepes buffer (KRH/A: 125 mM NaCl, 4.8 mM KCl, 1.3 mM CaCl22H2O, 1.2 mM MgSO47H2O, 1.2 mM KH2PO4, 5.6 mM D-glucose, 25 mM Hepes, and 0.1% (w/v) BSA) and then incubated for 20 min with the primary antibodies against cell-surface/extracellular epitopes, for example, MAb 473HD (1:250), a novel radial glia surface marker; MAb O4 (1:25); MAb 487/LeX (1:250); or anti-NG2 (1:200), all diluted in KRH/A. After washing twice for 5 min in KRH/A, the cells are fixed with 4% (w/v) PFA in PBS for 10 min, washed twice with PBT1 (PBS containing 1% (w/v) BSA and 0.1% (w/v) Triton-X-100), and incubated for 30 min with antibodies against the intracellular epitopes RC2 (1:500); Nestin (1:1000); bIII-tubulin (1:300); BLBP (1:1000); GLAST (1:2000) or GFAP (1:250), all diluted in PBT1. After three further washes with PBS/A, the cells are incubated for 30 min with specific fluorochrome-labeled secondary antibodies to detect the various primary antibodies. The last incubation step includes bisbenzimide (1:105) to label cell nuclei. After final washing in PBS, the preparations are mounted in PBS/glycerol (1:1) and viewed under an Axiophot II (Zeiss) using UV-epifluorescence. To assay differentiated cell types in cultures of acutely dissociated or selectively isolated cortical and striatal cells, the same immunostaining protocol is carried out after various time points.
6. Isolation of NSPCs by Immunopanning or by Immunoisolation Using Paramagnetic Beads (EasySep) Several reports have described the isolation of NSPCs from postnatal or adult forebrain (Belachew et al., 2003; Capela and Temple, 2002; Kim and Morshead, 2003; Rietze et al., 2001). These studies reported significant
48
Swetlana Sirko et al.
advances based on fluorescence activated cell sorter (FACS) techniques using a lectin-negative cell-surface marker exclusion protocol (Rietze et al., 2001), antibodies against LeX (Capela and Temple, 2002) or cells selected from the brain of CNP-GFP transgenic mice (Belachew et al., 2003). In vitro, the NSPC fraction was enriched from adult neurospheres using a dye exclusion paradigm or LeX (Capela and Temple, 2002; Kim and Morshead, 2003). Recently, a CD surface antigen code has been proposed that permits the isolation of neural stem from differentiating human ES-cells using FACS (Pruszak et al., 2009). Therefore, it seemed promising to investigate whether the 473HD epitope is present on NSPC surfaces. Indeed, it appeared that the 473HD epitope is expressed in the germinal layers of the telencephalon during development (Fig. 3.1A–C) and in the adult SVZ of the lateral ventricle wall and can be utilized for immunoisolation of 473HD-positive NSCPs (von Holst et al., 2006). The cell biological characterization suggested that the 473HD- (DSD-1)-epitope is a surface marker of a subpopulation of neurogenic radial glia with NSC properties.
6.1. Method for immunopanning of NSPCs with MAb 473HD 1. In order to obtain 473HD epitope expressing cortical and striatal cells an immunopanning protocol was established based on previous experience (von Holst and Rohrer, 1998). Four important steps can be distinguished in a flow diagram (Fig. 3.1D). Two petri dishes ( 100 mm, Falcon) are incubated overnight at 4 C with 10 ml of 50 mM Tris–HCl, pH 9.5, containing 50 mg/ml biotin-SP-conjugated, affinity-purified F(ab0 ) 2 goat anti-rat IgM antibody fragments (m-chain specific; Dianova). Afterward, the dishes are washed three times with PBS and incubated with the MAb 473HD (2.5 mg/ml) in PBS, 0.2% (w/v) BSA for at least 2 h. Then, the panning dishes are washed three further times with PBS. 2. After enzymatic digestion of cortical or GE tissue with 0.05% (w/v) trypsin–EDTA in HBSS, the dissociated cell suspensions are allowed to recover for 1 h at 37 C. Subsequently, 1.6 106 cells from the recovered cell suspensions are incubated per panning dish in 8 ml MEM, 0.2% (w/v) BSA for 1 h at RT. The nonadherent cells are gently washed away by at least five cycles of exposure to 8 ml MEM at RT. The successful removal of nonadherent cells is monitored on an inverted microscope (Leica). 3. Specifically adherent cells are subsequently recovered from the panning dish by incubation with 5 ml trypsin–EDTA in HBSS for 5 min at 37 C. The resulting suspension is transferred to 8 ml MEM, 10% (v/v) FCS, and centrifuged for 5 min at 1000 rpm at RT. The resulting pellet is resuspended in serum-free neurosphere medium (see above).
CSPGs in the Neural Stem Cell Niche
49
In general, between 30% and 50% of the 473HD-positive cells can be recovered, which corresponds to 3.2–5.4 104 cells at E18.
6.2. Method for preparing 473HD-positive cells applying magnetic beads 1. Alternatively, the 473HD-positive cells can be enriched with an immunoisolation procedure using paramagnetic beads (EasySep biotin selection kit), according to the manufacturer’s instructions. For this purpose, E13 forebrain single cell suspensions obtained as described above are incubated in 2 ml MEM/0.2% BSA for 60 min at RT, which is followed by immunolabeling of the cells in suspension. We propose the procedure outlined above for staining of acutely dissociated cells, with the difference that between each step of the protocol, the cell suspension is pelleted by centrifugation for 5 min at 1000 rpm. 2. In short, the cell suspension is washed for 10 min in KRH/A, incubated with the MAb 473HD (1:200 in KRH/A) for 20 min and washed again for 10 min in KRH/A. After incubation with the biotinylated anti-rat IgM (1:300 in KRH/A) for 20 min and a washing step in PBS/A, the cell pellet is resuspended in PBS/A and transferred to a 5-ml FACS tube (Falcon). 3. The EasySep biotin selection cocktail (100 ml/ml) is added for 15 min, followed by the addition of EasySep magnetic nanoparticles (50 ml/ml) for further 10 min of incubation. This suspension is placed into the EasySep magnet for 10 min. The supernatant containing the negative cell population is poured off and 2 ml PBS/A is added twice for gentle washing. Thereafter, the FACS tube is removed from the magnet and the 473HD-positive cell population is recovered by resuspending the cells in neurosphere medium. The purity and the degree of enrichment of the selectively isolated cell population is always determined by immunocytochemistry 2 h after immunoselection (Fig. 3.1E), as described above.
7. Neurosphere Cultures and Various Methods for Their Analysis Neurospheres are composite assemblies that contain various types of progenitors and differentiating cells (Marshall et al., 2007). In order to ascertain the presence of NSPCs, a valuable criterion is to test whether primary neurospheres derived from embryonic E13 cortex can be passaged
50
Swetlana Sirko et al.
over longer periods. The endogenous NSPCs may exhibit neurosphereinitiating capacity for more than nine passages and thus satisfy the key criterion of long-term self-renewal (Louis et al., 2008). A second criterion is to probe the resulting NSPCs for multipotency after several passages in that they generate neurons, astrocytes, and oligodendrocytes in a differentiation assay.
7.1. Method for cultivating NSPCs as neurospheres 1. Dissected tissues from the cerebral cortex and the GEs are acutely dissociated as described above. Embryonic NSCs or NSPCs selectively isolated by immunopanning are cultured at 37 C, 6% CO2 at a cell density of 105 cells/ml in T25 flasks (bulk culture; Fig. 3.2A). The medium is serum-free neurosphere medium (see above) containing EGF and basic FGF-2 at 20 ng/ml each (Preprotech). In general, FGF-2-containing cultures are supplemented with 0.5 U/ml heparin (Sigma). Alternatively, the various single cell suspensions are assayed for neurosphere formation in a clonal density assay as previously described (Garcion et al., 2004). 2. In order to test specific epitopes for functional properties, monoclonal antibodies can be added to the culture system. For this type of antibody perturbation experiments, the MAb 473HD and the IgM-isotype control MAb 487/LeX are added once at a final concentration of 2.5 mg/ml, when the cultures are initiated. The formation of neurospheres is monitored by inspection of the cultures on the stage of an inverted microscope (Leica) and quantified after 7 div by counting the entire dish area (clonal density assays) or 10 randomly selected visual fields (bulk cultures).
7.2. Method to perform a differentiation assay with neurospheres The demonstration of multipotency is important in order to demonstrate the ability of NSPCs to generate the major neural lineages. This is achieved by cultivating individual neurospheres in the absence of growth factors. For differentiation assays, individual neurospheres of 200–250 mm diameter are transferred onto polyornithine/laminin-1-coated wells (coating was done sequentially for 1 h at 37 C at a concentration of 10 mg/ml for both components) and incubated in neurosphere medium (see above) with 1% (v/v) FCS at 37 C, 6% (v/v) CO2 for 5 days. The differentiated cell types are identified by immunocytochemistry using antibody markers described in previous paragraphs (Fig. 3.2C).
A
1d
1h B
Phase
473HD Nestin
1h
bIII GFAP DAPI
3d
O4 Nestin DAPI
C
D
With ChABC
5d
473HD bIIItub
Control
5d
7d
473HD GFAP
473HD Tn-C
With ChABC
bIII tubulin GFAP
Control
E
3d
5d
Figure 3.2 The neurosphere assay as a model for the culture of NSPCs. (A) Starting with a single cell suspension from embryonic cerebral cortex, approximately 3% of total cortical cells are capable to generate multicellular neurospheres after 7 div. Phasecontrast images show examples of individual neurospheres that emerged after 1, 3, 5, and 7 days in growth factor containing medium. (B) Photomicrographs of cryosections of individual cortical-derived neurospheres double labeled with MAb 473HD and antibodies against Nestin revealed that most of the neurosphere cells are Nestinpositive precursors. Only a limited fraction of neurosphere cells differentiates within 7d in serum-free culture condition to the neuronal or astroglial cell lineage, as demonstrated by immunolabeling for bIII-tubulin and GFAP respectively. (C) When individual neurospheres were transferred to a laminin-substrate and allowed to differentiate in serum-containing medium for 3 days, massive cell migration is observed. Within 3d under adherent condition neurosphere cells differentiate to immature bIII-tubulinpositive neurons, to GFAP-positive astrocytes or to O4-positive oligodendrocytes. (D) Removal of CS-GAGs by treatment with ChABC causes a significant reduction of the neurosphere-forming capacity of NSCPs. (E) Continuous presence of ChABC in neurosphere-forming cultures engenders a shift towards astroglial differentiation. All cell nuclei were counterstained with bisbenzimide and are shown in blue (DAPI: 40 ,6diamidino-2-phenylindole). Scale bar: 100 mm in (A), (B), and (E), 150 mm in (C).
52
Swetlana Sirko et al.
7.3. Method for the sectioning of neurospheres and immunohistochemistry Neurospheres can comprise several hundred cells and reach a diameter of up to 300 mm within 7 days of cultivation (Fig. 3.2C). In order to investigate the composition and structural features, individual neurospheres can be sectioned and processed for immunohistochemistry. For cryosectioning, the neurospheres are allowed to settle in 15 ml Falcon tubes for 10 min. Thereafter, the culture medium is gently removed and replaced with 4% (w/v) PFA in PBS for 40 min at RT. After fixation, the neurospheres are cryoprotected with 30% (w/v) sucrose for 4 h at 4 C. Finally, neurospheres are embedded in tissue freezing medium ( Jung), sectioned at 14 mm on a Leica cryostat (Leica) and processed for immunohistochemistry using the same methods as described for embryonic brain sections (Fig. 3.2B).
7.4. Method for immunoblot analysis of neurospheres for biochemical analysis 1. The classical Western blot technique can be used to study protein expression in neurospheres. Neurospheres are homogenized in 150 mM NaCl, 5 mM EDTA, 1 mM phenylmethylsulfonyl fluoride (PMSF), 1% Triton-X-100, 25 mM Tris–HCl, pH 7.5. After centrifugation at 12,000 rpm at 4 C for 10 min, the supernatant is collected and then subjected to sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE; 7% gel) under reducing condition. 2. For immunoprecipitation, 4 ml of polyclonal antiphosphacan (DSD1-PG, batch KAF13, 20 mg) antibodies is added to neurosphere detergent-lysates or conditioned neurosphere culture medium. After incubation at 4 C overnight, 10 ml of protein A-Sepharose is added and incubated at 4 C for 2 h. Thereafter, the beads are collected by centrifugation and washed three times in lysis buffer. 3. Immunoprecipitates are subjected to SDS-PAGE as described above. Separated proteins are transferred to polyvinylidene difluoride (PVDF) membranes using the TransBlot SD cell (Bio-Rad). After blocking with 5% (w/v) milk powder dissolved in 0.15 M NaCl and 25 mM Tris–HCl, pH 7.5 (blocking buffer), the membrane is sequentially incubated first with primary antibodies, for example, MAb 473HD (1:500) or anti-phosphacan antibodies (1:1500) in blocking buffer overnight at 4 C. 4. The next day, the membranes are washed in PBS containing 0.05% (w/v) Tween-20 and thereafter incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies dissolved in blocking buffer for
CSPGs in the Neural Stem Cell Niche
53
1–2 h at RT. We used the following dilutions: anti-rat IgM (1:7500) and anti-rabbit IgG (1:7500). Signals are detected with the chemiluminescence reagent Roti-Lumin (Roth) upon exposure to CL-X PosureTM film (Pierce).
7.5. Method for the partial purification and identification of CSPGs from the conditioned neurosphere culture medium 1. Figure 3.3A shows a scheme for the isolation of CSPGs from the conditioned neurosphere culture medium. NSPCs in E13 mouse forebrain are grown as neurospheres in the presence of FGF-2 and EGF as described above. The conditioned medium is centrifuged at 1500 rpm for 10 min to remove cell debris, and the supernatant is collected. Urea and Tris–HCl (1 M, pH 7.5) are added to the medium to a final concentration of 7 M and 30 mM, respectively. Thereafter, the medium is applied to a column of DEAE-Sepharose (1.5 cm 6 cm; GE Healthcare) equilibrated with 0.15 M NaCl, 7 M urea, 30 mM Tris– HCl, pH 7.5. 2. After washing with 50 ml of equilibration buffer, the bound proteins are eluted in a stepwise manner, with 50 ml of 0.3 M NaCl, 7 M urea, 30 mM Tris–HCl, pH 7.5; followed by 40 ml of 0.7 M NaCl, 7 M urea, 30 mM Tris–HCl, pH 7.5; and finally, 32 ml of 2 M NaCl, 7 M urea, 30 mM Tris–HCl, pH 7.5. Each fraction is monitored for absorbance at 280 nm. The prominent peaks are expected in the 0.3 and 0.7 M NaCl fractions (Fig. 3.3B). 3. Both fractions are individually pooled, and dialyzed against 0.15 M NaCl, 5 mM EDTA, 30 mM Tris–HCl, pH 7.5. Immunoblot analysis can be performed with various antibodies. For example, the MAb 473HD revealed that phosphacan/DSD-1-PG/6B4-PG, a major soluble CSPG in the developing mammalian CNS, is detected in the 0.7 M NaCl, but not in the 0.3 M NaCl fraction (Fig. 3.3C). 4. A total of up to 260 mg of proteins can be recovered in the 0.7 M NaCl fraction from 280 ml of conditioned medium. An aliquot of this fraction (10 mg of protein) is treated with or without ChABC (0.5 U/ml; Sigma) in 2 mM EDTA, 1 mM PMSF, 30 mM Tris–acetate, pH 8.0, for 2 h at 37 C, and analyzed by SDS-PAGE followed by Coomassie Brilliant Blue staining. Several core proteins of CSPGs are detected after ChABC digestion (Fig. 3.3D). MS/MS analyses of these core proteins reveal that neurosphere-forming cells express at least phosphacan/DSD-1PG/6B4-PG, neurocan, versican, brevican, and NG2 proteoglycan (also known as CSPG 4; K. Akita et al., unpublished observations).
A
Conditioned neurosphere culture medium Addition of urea to a final concentration of 7 M Anion exchange chromatography (stepwise elution with 0.3, 0.7, and 2 M NaCl) 0.7 M NaCl fraction (refered as PG fraction) Chondroitinase ABC digestion SDS-PAGE Mass spectrometric analysis
1.0
0
2M
0.5
0.7 M
0.3 M
Absorbance at 280 nm
B
5
10
15
Fraction number
250 150 100 75
0.
0.
kDa
7M
D 3M
C
PG fraction
+
+
−
Ch-ABC
−
+
+
kDa 250 150 100 75
* * * * * * * *
50
Figure 3.3 Partial purification of CSPGs from conditioned neurosphere culture medium. (A) A scheme for enrichment of CSPGs is shown. Totally, 260 mg of proteins were recovered as PG fraction from 280 ml of the conditioned neurosphere culture medium. (B) The conditioned neurosphere culture medium was applied to a DEAESepharose anion exchange column. After washing with 0.15 M NaCl, bound proteins were eluted in a stepwise manner; with 0.3, 0.7 M and then 2 M NaCl. Each fraction was collected and monitored for absorbance at 280 nm. (C) Aliquots of 0.3 and 0.7 M NaCl fractions were analyzed by immunoblotting using 473HD monoclonal antibody. Note that 473HD signals were only detected on 0.7 M NaCl fraction. (D) An aliquot of 0.7 M NaCl fraction was treated with or without chondroitinase ABC, and then subjected to SDS-PAGE, followed by Coomassie Brilliant Blue staining. Several core proteins of CS/DS-PGs were detected in the chondroitinase ABC-treated material (indicated by asterisk). Several molecular species could be discerned.
CSPGs in the Neural Stem Cell Niche
55
8. Disaccharide Analysis of CS/DS Chains from Embryonic Brain and Conditioned Neurosphere Culture Media and Effect of Sodium Chlorate Treatment on Neurosphere Formation at Clonal Cell Density Using the neurosphere culture system, Ida et al. (2006) have recently reported that particular sulfated structures on CS/DS chains such as CS-B, -D, and -E units possess the potential to promote FGF-2-mediated cell proliferation of rat embryonic NSPCs. These findings suggested that the sulfation profile on CS/DS chains is one of the crucial factors that regulate cell proliferation of NSPCs in the CNS. Interestingly, the 473HD epitope that depends on correct sulfation of GAGs also intervenes in NSPC proliferation. These results led to the general concept that a sulfation code may determine functional qualities of CS-GAGs. Following this hypothesis, one would expect distinct and particular CS-GAGs in the NSPC environment. Protocols have been published for disaccharide analysis of CS/DS chains from E13 mouse brain (Ueoka et al., 2000). Using these analytical methods, disaccharide compositions of CS/DS chains from conditioned neurosphere culture media were analyzed (Akita et al., 2008).
8.1. Method for the suppression of sulfation in NSPC cultures 1. Sulfate groups are transferred from 30 -phosphoadenosine 50 -phosphosulfate (PAPS) to the specific acceptor sites. A radical way to suppress any sulfation pattern consists in the competitive inhibition of the formation of PAPS by the addition of chlorate to the culture medium. This can be achieved as described in the following paragraphs (Akita et al., 2008). 2. Primary neurospheres from E13 mouse cerebral cortex are grown in the presence of FGF-2 and EGF as described above. After 5 days of cultivation, these are briefly treated with trypsin–EDTA, mechanically dissociated into single cells, and reseeded under the same culture conditions to generate secondary neurospheres. 3. Dissociated single cells from secondary neurospheres are assayed at clonal density (200 cells/cm2) for the formation of third-passage neurospheres, that is, for the self-renewal capacity of neurosphere-derived NSPCs, as previously described (Garcion et al., 2004). The standard neurosphere culture medium contains EGF, FGF-2 or EGF, and FGF-2. For suppression of sulfation, it is additionally supplemented with 5 or 30 mM sodium chlorate. 4. For rescue experiments, heparin (Sigma) is added at 5 U/ml in the continued presence of 30 mM sodium chlorate. After 5 days of
56
Swetlana Sirko et al.
cultivation, the total number of neurospheres under control and treatment conditions is counted under the phase contrast microscope. Using this approach, sulfation can be efficiently prevented without compromising the health and quality of the cell culture.
9. Analysis of NSPC-Proliferation In Vitro and In Vivo 9.1. BrdU-pulse labeling of neurospheres in vitro In vitro labeling of cycling Nsph cells is performed by addition of 10 mM BrdU (5-bromo-2-deoxyuridine, Sigma) for 15 h prior to enzymatic dissociation. In order to count the number of cells that incorporate BrdU, neurospheres are dissociated, the single cell suspension is plated, and individual cells are immunocytochemically stained 1 h later, essentially following the supplier’s protocol (BrdU Labeling and Detection Kit I; Roche).
9.2. Method for the BrdU labeling of NSPCs in vivo 1. For analysis of cell proliferation in vivo, the label is introduced by intraperitoneal injection of 10 mg BrdU (5-bromo-2-deoxyuridine, Sigma) per 100 g body weight 1 or 2 h prior to removal of the litter. The number of cells that incorporates BrdU is determined by immunocytochemical staining of acutely dissociated cells 2 h after plating, according to the supplier’s protocol (BrdU Labeling and Detection Kit I; Roche). 2. After cryoprotection of embryonic tissues cryosections are cut at 14–18 mm, boiled for 5 min in 0.01 M citrate buffer, pH 6.0, and washed twice in PBS prior to incubation with the anti-BrdU (1:20) at 4 C overnight. Primary antibodies are detected using adequate secondary antibodies. After three further washes in PBS the sections are mounted in immumount (Thermo Science) and analyzed using fluorescence microscope (Fig. 3.1B).
10. Analysis of CSPG Functions in NSPCs Using Chondroitinase ABC Treatment in Culture Recent studies have proposed that CSPGs play important roles in the adult CNS as inhibitors of synaptic plasticity and of axonal regeneration in glial scars. In the light of these findings, treatment strategies based on the application of ChABC, an enzyme that degrades the CS-GAG complement
CSPGs in the Neural Stem Cell Niche
57
of CSPGs, have been developed (Houle et al., 2006; Massey et al., 2008). On the other hand, evidence emerges that neural progenitor cells are recruited to various types of lesion in the adult, which raises the question whether ChABC-application may impact on NSC development in the lesioned tissue (Dobbertin et al., 2003; Sirko et al., 2009). We have, therefore, systematically addressed the question whether ChABC affects NSPC behavior. To this end, we have selectively eliminated CS-GAGs with ChABC both in vivo and in vitro. This treatment reduced NSPC proliferation and impeded the differentiation of radial glia to neurons, while it favored the maturation of the gliogenic subtype of radial glia, and the formation of astrocytes (Sirko et al., 2007; von Holst et al., 2006). These results imply a role of CS-GAGs in the regulation of growth and differentiation factors for NSCs. The methods used for the selective treatment of ECM in the NSPC compartment are quite versatile and applicable to other tools. A convenient approach is described below.
10.1. Method for the treatment of neurosphere cultures with ChABC 1. Embryonic NSPCs are cultured at 37 C, 6% CO2 at a cell density of 105 cells/ml in neurosphere medium in the presence of EGF and FGF-2, both at 20 ng/ml (Preprotech). In general, FGF-2-containing cultures are supplemented with 0.5 U/ml heparin (Sigma), which supports FGFdependent signaling. In parallel experiments, 50 mU/ml ChABC (EC 4.2.2.4; Sigma) or 50 mU/ml keratanase (Calbiochem) are added to neurosphere cultures once at the beginning of the experiment. The concentration of 50 mU/ml has been empirically determined as effective concentration using dose–response assays. However, it has to be kept in mind that ChABC-activity decreases with time in culture. Long-term incubations of more than 3 days therefore requires replenishment of the culture system with the enzyme. 2. The efficiency of the digestion of CS-GAGs is examined by immunocytochemical labeling with MAb 473HD, that detects an epitope sensitive to ChABC treatment (Faissner et al., 1994; von Holst et al., 2006). In parallel experiments, the addition of 50 mU/ml keratanase (Calbiochem) to the culture medium serves as control for the specificity of chondroitin sulfate (CS) deglycanation. Alternatively, the various single cell suspensions are assayed for neurosphere formation in clonal density assays, as described above (Garcion et al., 2004). 3. The formation of neurospheres is monitored by visual inspection with an inverted microscope (Leica) and quantified after 2, 5, and 7 div by counting the entire dish area (clonal density assays) or 10 randomly chosen visual fields (bulk cultures).
58
Swetlana Sirko et al.
Using this strategy, we demonstrated roles of CSPGs for the regulation of proliferation, self-renewal, and cell fate in neural stem and progenitor cells in vitro. Degradation of chondroitin sulfates (CS-GAGs) impaired neurosphere formation, self-renewal, and the generation of neuronal progeny (Fig. 3.2D and E). Analogous effects were observed upon removal of CS-GAGs in the developing cerebral cortex in vivo. Another important aspect that resulted from these studies was the implication of ECM components in cell adhesion processes. For example, CSPGs are considered antiadhesive for neural cell types and involved in inhibition of axon regeneration (Carulli et al., 2005). Neurospheres release large amounts of CSPGs into the culture medium (Akita et al., 2008; Ida et al., 2006) that may contribute to the inhibition of neurosphere attachment to the culture substrate. Thus, the settling and the outgrowth of ChABC-treated neurospheres observed in our studies may reflect a reduction of the antiadhesive properties of the substrate following digestion of CS-GAGs (Bradbury et al., 2002). Enhanced adhesion and outgrowth of neurospheres possibly involves the activation of integrins and downstream signaling that may interact with growth factor-related signal transduction mechanisms (Colognato et al., 2005; Leone et al., 2005). Also, cell adhesion molecules of the Ig-superfamily, for example, transfection with L1-CAM, enhance the survival and regeneration supporting potency of stem cells (Bernreuther et al., 2006; Chen et al., 2005). In conclusion, the impact of ChABC-activity on cell adhesion molecule gene families and downstream signal transduction in NSCPs represents a challenging topic for future studies.
11. Analysis of Chondroitin Sulfate Functions in the Neural Stem Cell Niche In order to replicate the results obtained in vitro in the more complex in vivo situation, CS-GAGs were directly digested in situ. To that end, the injection of ChABC directly into the lateral ventricle of the embryonic CNS proved an efficient approach. The application of ChABC in vivo was well tolerated by the recipient embryos. In particular, no deleterious effects on the cellular level could be observed (Sirko et al., 2007).
11.1. Method for intracerebroventricular injections in utero 1. All experimental procedures in vivo have to be performed in accordance with the Society for Neuroscience and European Union guidelines for animal experiments. We sought approval from the institutional animal care and utilization committees at the ‘‘Helmholtz Zentrum Mu¨nchen
CSPGs in the Neural Stem Cell Niche
59
(German Research Center for Environmental Health, Munich, Germany).’’ Intracerebroventricular injections (ICVI) into telencephalic ventricles of E13 embryos in utero can, for example, be performed with timed-pregnant C57/Bl6 mice. Be aware that the permit for experiments on living animals has to be granted by the regional institutions legally concerned. 2. Animals are anesthetized by intraperitoneal injection of 0.1 ml per 10 g body weight of a narcotic drug mixture (medetomidine 0.5 mg/kg, midazolam 5 mg/ml, Fentanyl Hexal 0.05 mg/kg). Uterine horns are exposed by mideline laparotomy and the ICVI is performed through the uterine wall at the anterior end of the embryonic forebrain using fine-pulled microcapillaries (borosilicate glass capillaries, 1.5 mm 0.86 mm; gc150F-10 Harvard apparatus). ChABC (10 mU/ml) is injected into the lateral ventricles of all embryos in one uterine horn. Keratanase (10 mU/ml) or artificial cerebrospinal fluid (ACSF) controls are injected into the lateral ventricles of the embryos in the second uterine horn. 3. Thereafter, the uterus is reinstated in its physiological site. The incisions of the abdominal muscle and the skin are closed by separate sutures. Finally, the anesthesia is reversed by intraperitoneal application of antisedate (2.5 mg/kg Antisedan, 0.5 mg/kg flumacenil, and 1.2 mg/kg naloxone), and animals are left to recover in a clean cage. 24 h after injection pregnant mice are sacrificed by cervical dislocation.
12. RT-PCR and Semiquantitative Analysis of the Synthetic Machinery for Glycosaminoglycans The hypothesis of the sulfation code posits that spatial patterns of sulfate groups attached to GAG-backbones code for specific protein recognition sites (Ito et al., 2005). Sulfate groups are transferred from PAPS to the specific acceptor sites in CS/DS chains by chondroitin/dermatan sulfotransferases (C/D-STs) that are located in the Golgi apparatus (Habuchi et al., 2000; Kusche-Gullberg and Kjellen, 2003; Silbert and Sugumaran, 2002). As illustrated (Fig. 3.4A), these enzymes can be classified into the following four groups: chondroitin/dermatan 4-O-sulfotransferase (C4ST/D4ST), chondroitin 6-O-sulfotransferase (C6ST), uronosyl 2-Osulfotransferase (UA2OST), and N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase (GalNAc4S-6ST). Three C4ST genes (Hiraoka et al., 2000; Kang et al., 2002; Mikami et al., 2003; Yamauchi et al., 2000), two C6ST genes (Fukuta et al., 1995; Kitagawa et al., 2000), and one D4ST-1 (Evers et al., 2001), UA2OST (Kobayashi et al., 1999), and GalNAc4S-6ST (Ohtake et al., 2001) gene have been identified in mammals. It has been
60
Swetlana Sirko et al.
A
C6ST
~~
D4ST C4ST ~~
O
C4ST
~~
O
C unit UA2OST
GalNAc4S-6ST
~~
O
D unit
~~
O
B unit Sulfate group GlcUA
B
~~
A unit
UA2OST
~~
O
Culture conditions
O
~~
E unit GalNAc IdoUA
H EF FH E
EF
C-cortex
G-eminence
H
FH E
C4ST-1 C4ST-2 C4ST-3 D4ST-1 GalNAc4S-6ST C6ST-1 C6ST-2 UA2OST b-actin
Figure 3.4 RT-PCR analysis of chondroitin/dermatan sulfotransferase expression in neurospheres. (A) Schematic structure of sulfated disaccharides in the CS/DS chains. The repeating CS disaccharide units consisting of glucuronic acid (light grey hexagon, GlcUA) and N-acetylgalactosamine (white hexagon, GalNAc) are depicted. These CSdisaccharide units are modified by four different sulfotransferases: C4ST, C6ST, UA2OST, and GalNAc4S-6ST, as indicated in the scheme. The activity of the C-STs leads to the addition of sulfate groups at defined positions (black circles), which results in the generation of specified CS units as shown in the figure (underlined). In case GlcUA is converted to iduronic acid (dark grey hexagon, IdoUA) by its C-5
CSPGs in the Neural Stem Cell Niche
61
reported that gene expression levels of some enzymes correlate with the amount of sulfated products that corresponded to each enzymatic activity (Kitagawa et al., 1997; Properzi et al., 2005), which holds the promise that studies of gene expression of C/D-STs will yield more detailed insights about the sulfation profiles in mixed CS/DS chains. The expression of the critical enzymes can be detected using the following RT-PCR protocol.
12.1. Method for the amplification of distinct sulfotransferases using RT-PCR 1. Total RNA is prepared from E13 mouse tissues or neurospheres using the RNeasy Mini Kit (Qiagen). First-strand cDNA is synthesized with the help of the First Strand cDNA synthesis Kit (Fermentas). One microgram of total RNA and 1 ml of random hexamer primer (0.2 mg/ml) are mixed and adjusted to a total volume of 11 ml with autoclaved MilliQ water, and then heated to 70 C for 5 min. After cooling on ice, 4 ml of 5X reaction buffer, 1 ml of ribonuclease inhibitor (20 U/ml) and 2 ml of dNTP mixture (10 mM each) are added to the reaction mixture. Subsequent to incubation at 25 C for 5 min, 2 ml of M-MuLV reverse transcriptase (20 U/ml) are added to the reaction mixture and incubated at 25 C for 10 min and, finally, at 37 C for 60 min. The reaction is stopped by heating at 70 C for 10 min. The reaction mixture is cooled on ice, and then diluted with 20 ml of autoclaved MilliQ water. 2. PCR is carried out at 20–38 cycles in a total volume of 20 ml containing 0.8 ml of cDNA, 10 mM Tris–HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.2 mM of each dNTP, 1 U of Taq-polymerase (Eppendorf), and 0.2 pmol of forward and reverse primers. The primer sequences and PCR conditions used for this study are described in detail in Table 3.1. The PCR products are ligated into the pCRII-TOPO vector using the TOPO-TA cloning kit (Invitrogen). After subcloning, the nucleotide sequences of the ligated fragments are confirmed by DNA sequencing using a commercial service (e.g., Macrogen Inc.).
epimerization, the enzyme D4ST preferentially adds a sulfate group at the C4 position of GalNAc, which is adjacent to IdoUA. (B) Neural stem cells in E13 cerebral cortex and ganglionic eminence were grown as neurospheres for 6 days in the presence of EGF, FGF-2, and heparin (EFH); FGF-2 plus heparin (FH); or EGF alone (E). cDNA was synthesized using total RNA purified from neurosphere-forming cells. PCR was performed in the linear range with 29–38 cycles. Detailed information on PCR analysis was shown in Table 3.1. The amplified PCR products are visualized by electrophoresis on a 1.5% agarose gel containing ethidium bromide.
Table 3.1 Primers and PCR conditions for respective genes Gene (Accession number)
Primer sequence (50 –30 )
Annealing temperature ( C)
PCR cycles
Product size (bp)
C4ST-1 (AB030378)
tgctggaagtgatgaggatg ggtggttgatctctgggatg cggctctcatgatccttttg tcatcactcgcttccagttg atgggaagacgctcctgttg gcacgaagagaaaggtcaggtag gctgatgttcgctgtaatcg tgccagaaacaccaagtcac ttgttggtatgaggagttctcg aggcatggatgaagtcttgg aggcagatacgtcttgttcctg agcacatacaggtcgcatagc gggcaagtatgagaactggaag agacatcccccactacgtga cttcttgtcccctctgtactgg gagcagatgaccttgttggtc gatgaagaagaagcagcagcag acctggagaagttgaggaagtg aaccccaggctgttttacatc ccatttttcgtcatcttgctc aggccagtaatagtagccatgag tctgttcttgtgcttgttgtctgg tatgccaacacagtgctgtctggtgg agaagcacttgcggtgcacgatgg
60
29
510a,b
60
32
519a
60
38
505a
60
32
445a,b
60
33
548a
60
31
528a
60
32
505b
60
32
527a,b
65
35
533a
60
34
475b
60
35
422b
60
23
247a
C4ST-2 (AJ289132) C4ST-3 (XM_355798) D4ST-1 (BC085479) GalNAc4S-6ST (AB187269) C6ST-1 (NM_016803) C6ST-1 (NM_016803) C6ST-2 (AB046929) UA2OST (NM_177387) UA2OST (NM_177387) RPTP-b (NM_001081306) b-actin (NM_007393) a b
These primers were used for the semiquantitative PCR analysis. These primers were used for the preparation of the in situ hybridization probes.
CSPGs in the Neural Stem Cell Niche
63
3. For semiquantitative analysis, PCR is carried out at various cycles as appropriate. After electrophoresis on a 1.5% (w/v) agarose gel containing ethidium bromide, the density of the amplified product is measured with the NIH image J program (Version 1.63), and calculated as the ratio versus the b-actin reference band. The mRNA expression of all presently known C/D-STs is detected in the dorsal and ventral telencephalon of the E13 mouse brain with the exception of C4ST-3 (Akita et al., 2008). Furthermore, these enzyme are also expressed in E13 cortical and striatal neurosphere-forming cells that are grown in the presence of EGF, FGF-2, and heparin; FGF-2 plus heparin; and EGF alone (Fig. 3.4B). Notably, the expression levels of some enzymes significantly differ between the tested growth conditions (Akita et al., 2008).
13. In Situ Hybridization of Sulfotransferases in Tissue and Neurosphere Sections In view of the expression of CSPGs and the particular MAb 473HDepitope in the NSC niche, we predicted the presence of specific sulfotransferases that are required to attach sulfate groups at distinct positions of the CS-GAG polymers. In order to prove the expression of the sulfotransferases and localize the expressing cell types, RT-PCR-based approaches proved adequate.
13.1. Method for the in situ hybridization of sulfotransferase mRNA 1. To prepare the hybridization probes for C4ST-1, D4ST, C6ST-1, -2, and UA2OST mRNA, defined fragments for each gene subcloned into pCRII-TOPO (Invitrogen) after RT-PCR as described above can be used. With the same strategy, cDNA corresponding to nucleotide 5160– 5581 including the transmembrane domain of RPTP-b/z (GeneBankÒ accession no. NM_001081306) was also obtained. Digoxigenin (DIG)labeled antisense and sense riboprobes are synthesized by T7 or SP6 RNA polymerase provided with the DIG RNA labeling Kit (Roche), following the manufacturer’s instructions. 2. E13 mouse capita are fixed with 4% (w/v) PFA in 0.1 M phosphate buffer, pH 7.3 (4% PFA/PB) at 4 C overnight, and cryoprotected with 20% (w/v) sucrose in PBS at 4 C for 4–6 h. Tissues are finally embedded in tissue freezing medium (Jung). Adult mouse brains are frozen immediately after dissection.
64
Swetlana Sirko et al.
3. For sectioning, neurospheres are allowed to settle in 15 ml Falcon tubes for 10–20 min, and finally collected in 1.5 ml tubes. Neurospheres are fixed with 4% (w/v) PFA/PB on ice for 2 h, subsequently cryoprotected and embedded as described previously. 4. Cryosections (14 mm) are cut on a cryostat (Leica), thaw-mounted on SuperFrostÒPlus glass slides (Menzel GmbH) and quickly air-dried. Fresh-frozen sections are postfixed with 4% PFA/PBS on ice for 15 min before acetylation. 5. All sections are acetylated with 0.25% (v/v) acetic anhydride in 0.1 M triethanolamine, pH 8.0, for 10 min, treated twice with 50 mM PB for 5 min, and subsequently prehybridized with hybridization buffer (50% (v/v) formamide, 10% (w/v) dextran sulfate, 1 Denhardt’s, 100 mg/ml yeast RNA, 0.2% (w/v) SDS, 2 standard saline citrate (SSC), 50 mM sodium phosphate, pH 7.0) at 50 C for 2 h. 6. Hybridization with riboprobes is carried out overnight at 50 C. After hybridization, sections are sequentially washed at 50 C using the following conditions: 4 SSC for 10 min, 2 SSC containing 50% (v/v) formamide for 20 min twice, 2 SSC for 10 min, 0.2 SSC for 20 min twice, and then treated with Tris–NaCl buffer (0.15 M NaCl, 0.1 M Tris–HCl, pH 7.5) for 10 min twice. 7. After blocking with Tris–NaCl buffer containing 1% (w/v) blocking reagent (Roche) for 30 min, sections are incubated with alkaline phosphatase-conjugated anti-DIG antibody (dilution 1/2000) overnight at 4 C. Sections are washed three times with Tris–NaCl buffer for 10 min, then rinsed with detection buffer (0.1 M NaCl, 50 mM MgCl2, 0.1 M Tris–HCl, pH 9.5), and developed with detection buffer containing 5% (w/v) polyvinyl alcohol, nitroblue tetrazolium (0.34 mg/ml), and 5-bromo-4-chloro-3-indolyl phosphate (0.18 mg/ml). Color development is stopped by the incubation with 1 mM EDTA, 10 mM Tris–HCl, pH 7.5, at various time points, depending on the degree of color development to obtain reasonable signal to noise ratios. A prominent expression of C4ST-1 mRNA is detected in the ventricular zones of E13 mouse dorsal and the ventral telencephalon. As documented (Fig. 3.5A and B), hybridization signals are observed colocalizing with cell bodies that are positioned adjacent to the ventricular surface. C4ST-1 mRNA signals are also observed on the cells residing in the SVZ around the anterior lateral ventricle wall of adult mouse brain (Fig. 3.5C and D). Furthermore, strong C4ST-1 mRNA signals are detected in the circumference of FGF-2-expanded neurospheres, whereas the core region displays lower or nondetectable level (Fig. 3.5E and F). Neurospheres represent a complex mixture of cells that display territorial preference, with actively cycling NSPC populations being localized to the more
65
CSPGs in the Neural Stem Cell Niche
C4ST-1 antisense B
E13 forebrain
A
C4ST-1 sense
CTX
LV C
D
Nsphs FGF-2 + heparin
Adult forebrain
SVZ
LV
E
F
Figure 3.5 In situ hybridization for C4ST-1 in the neural stem cell (NSC) niche. (A–D) Coronal cryosections of E13 (A and B) and adult (C and D) mouse forebrain were hybridized with DIG-labeled antisense (A and C) and sense (B and D) probes for C4ST-1. Note that mRNA signals were detected in the embryonic germinal layer (A) and the adult subventricular zone (C). (E and F) NSCs in E13 mouse cerebral cortex were grown for 6 days as neurospheres in medium supplemented with FGF-2 plus heparin. Cryosections were hybridized with DIG-labeled antisense (E) and sense (F) probes for C4ST-1. Note that mRNA signals were prominently detected in the outer area of neurosphere sections. Scale bars ¼ 50 mm. Abbreviations: CTX, cerebral cortex; LV, lateral ventricle; SVZ, subventricular zone.
superficial areas and the more differentiated, lineage-committed cell populations toward the core of the neurosphere (Sirko et al., 2007). C4ST-1 mRNA is also prominently expressed in cells settling in the outer layer of EGF-expanded neurospheres (Akita et al., 2008).
66
Swetlana Sirko et al.
14. Microscopy All immunofluorescence stainings are analyzed using a fluorescence microscope equipped with UV-epifluorescence (e.g., Axioplan 2 imaging, Zeiss). Images are captured with a digital camera and documented using the Axiovision 3.1 or 4.2 program (AxioCamHRc, Zeiss). In some cases, confocal laser scanning microscopy is applied (LSM510 meta, Zeiss). Standard phase contrast images of living cells are taken using a digital camera (DP10, Olympus) on an inverted CK40 microscope (Olympus).
15. Conclusion and Outlook In conclusion, our work so far suggests a role for CSPGs in stem cell biology. How CSPGs are integrated into the complex interplay of pericellular determinants of differentiation remains to be investigated in detail. However, the identification of functional contributions of CS-GAGs to the regulation of stem cell proliferation and neurogenesis constitutes an important step forward in identifying key factors of the local environment. For example, earlier transplantation experiments have highlighted a role of the local environment as determinant of adult neurogenesis. Thus, glial cells isolated from nonneurogenic regions of the adult CNS give rise to neurons when transplanted into a neurogenic environment (Shihabuddin et al., 2000), while neurogenic precursors isolated from the adult subependymal zone fail to generate neurons outside their niche (Lim et al., 2000). We are convinced that a better understanding of the NSC niche is of utter importance to harness NSCs for repair processes (Scadden, 2006). Our work demonstrated for the first time that complex CS-GAG carbohydrates play a pivotal role in the orchestration of the NSPC microenvironment.
ACKNOWLEGMENTS The work presented in this chapter was supported by the German Research Foundation (DFG), the Federal Ministry of Education and Research (BMBF), The German Academic Exchange Program (DAAD), and the Federal Country Northrhine-Westfalia (NRW, MIWFT).
REFERENCES Akita, K., von Holst, A., Furukawa, Y., Mikami, T., Sugahara, K., and Faissner, A. (2008). Expression of multiple chondroitin/dermatan sulfotransferases in the neurogenic regions of the embryonic and adult central nervous system implies that complex chondroitin sulfates have a role in neural stem cell maintenance. Stem Cells 26, 798–809.
CSPGs in the Neural Stem Cell Niche
67
Alvarez-Buylla, A., and Lim, D. A. (2004). For the long run: Maintaining germinal niches in the adult brain. Neuron 41, 683–686. Alvarez-Buylla, A., Garcia-Verdugo, J. M., and Tramontin, A. D. (2001). A unified hypothesis on the lineage of neural stem cells. Nat. Rev. Neurosci. 2, 287–293. Anthony, T. E., Klein, C., Fishell, G., and Heintz, N. (2004). Radial glia serve as neuronal progenitors in all regions of the central nervous system. Neuron 41, 881–890. Bandtlow, C. E., and Zimmermann, D. R. (2000). Proteoglycans in the developing brain: New conceptual insights for old proteins. Physiol. Rev. 80, 1267–1290. Bao, X., Mikami, T., Yamada, S., Faissner, A., Muramatsu, T., and Sugahara, K. (2005). Heparin-binding growth factor, pleiotrophin, mediates neuritogenic activity of embryonic pig brain-derived chondroitin sulfate/dermatan sulfate hybrid chains. J. Biol. Chem. 280, 9180–9191. Belachew, S., Chittajallu, R., Aguirre, A. A., Yuan, X., Kirby, M., Anderson, S., and Gallo, V. (2003). Postnatal NG2 proteoglycan-expressing progenitor cells are intrinsically multipotent and generate functional neurons. J. Cell Biol. 161, 169–186. Bernreuther, C., Dihne, M., Johann, V., Schiefer, J., Cui, Y., Hargus, G., Schmid, J. S., Xu, J., Kosinski, C. M., and Schachner, M. (2006). Neural cell adhesion molecule L1transfected embryonic stem cells promote functional recovery after excitotoxic lesion of the mouse striatum. J. Neurosci. 26, 11532–11539. Bradbury, E. J., Moon, L. D., Popat, R. J., King, V. R., Bennett, G. S., Patel, P. N., Fawcett, J. W., and McMahon, S. B. (2002). Chondroitinase ABC promotes functional recovery after spinal cord injury. Nature 416, 636–640. Busch, S. A., and Silver, J. (2007). The role of extracellular matrix in CNS regeneration. Curr. Opin. Neurobiol. 17, 120–127. Capela, A., and Temple, S. (2002). LeX/ssea-1 is expressed by adult mouse CNS stem cells, identifying them as nonependymal. Neuron 35, 865–875. Carulli, D., Laabs, T., Geller, H. M., and Fawcett, J. W. (2005). Chondroitin sulfate proteoglycans in neural development and regeneration. Curr. Opin. Neurobiol. 15, 116–120. Chanas-Sacre, G., Thiry, M., Pirard, S., Rogister, B., Moonen, G., Mbebi, C., VerdiereSahuque, M., and Leprince, P. (2000). A 295-kDA intermediate filament-associated protein in radial glia and developing muscle cells in vivo and in vitro. Dev. Dyn. 219, 514–525. Chen, J., Bernreuther, C., Dihne, M., and Schachner, M. (2005). Cell adhesion molecule l1transfected embryonic stem cells with enhanced survival support regrowth of corticospinal tract axons in mice after spinal cord injury. J. Neurotrauma 22, 896–906. Clement, A. M., Nadanaka, S., Masayama, K., Mandl, C., Sugahara, K., and Faissner, A. (1998). The DSD-1 carbohydrate epitope depends on sulfation, correlates with chondroitin sulfate D motifs, and is sufficient to promote neurite outgrowth. J. Biol. Chem. 273, 28444–28453. Colognato, H., ffrench-Constant, C., and Feltri, M. L. (2005). Human diseases reveal novel roles for neural laminins. Trends Neurosci. 28, 480–486. Czopka, T., Von Holst, A., Schmidt, G., Ffrench-Constant, C., and Faissner, A. (2009). Tenascin C and tenascin R similarly prevent the formation of myelin membranes in a RhoA-dependent manner, but antagonistically regulate the expression of myelin basic protein via a separate pathway. Glia 57, 1790–1801. Dobbertin, A., Rhodes, K. E., Garwood, J., Properzi, F., Heck, N., Rogers, J. H., Fawcett, J. W., and Faissner, A. (2003). Regulation of RPTPbeta/phosphacan expression and glycosaminoglycan epitopes in injured brain and cytokine-treated glia. Mol. Cell. Neurosci. 24, 951–971. Doetsch, F. (2003). The glial identity of neural stem cells. Nat. Neurosci. 6, 1127–1134. Doetsch, F., Caille, I., Lim, D. A., Garcia-Verdugo, J. M., and Alvarez-Buylla, A. (1999). Subventricular zone astrocytes are neural stem cells in the adult mammalian brain. Cell 97, 703–716.
68
Swetlana Sirko et al.
Evers, M. R., Xia, G., Kang, H. G., Schachner, M., and Baenziger, J. U. (2001). Molecular cloning and characterization of a dermatan-specific N-acetylgalactosamine 4-O-sulfotransferase. J. Biol. Chem. 276, 36344–36353. Faissner, A., Clement, A., Lochter, A., Streit, A., Mandl, C., and Schachner, M. (1994). Isolation of a neural chondroitin sulfate proteoglycan with neurite outgrowth promoting properties. J. Cell Biol. 126, 783–799. Feng, L., Hatten, M. E., and Heintz, N. (1994). Brain lipid-binding protein (BLBP): A novel signaling system in the developing mammalian CNS. Neuron 12, 895–908. Fitch, M. T., and Silver, J. (2008). CNS injury, glial scars, and inflammation: Inhibitory extracellular matrices and regeneration failure. Exp. Neurol. 209, 294–301. Fukuta, M., Uchimura, K., Nakashima, K., Kato, M., Kimata, K., Shinomura, T., and Habuchi, O. (1995). Molecular cloning and expression of chick chondrocyte chondroitin 6-sulfotransferase. J. Biol. Chem. 270, 18575–18580. Garcion, E., Faissner, A., and ffrench-Constant, C. (2001). Knockout mice reveal a contribution of the extracellular matrix molecule tenascin-C to neural precursor proliferation and migration. Development 128, 2485–2496. Garcion, E., Halilagic, A., Faissner, A., and ffrench-Constant, C. (2004). Generation of an environmental niche for neural stem cell development by the extracellular matrix molecule tenascin C. Development 131, 3423–3432. Garwood, J., Schnadelbach, O., Clement, A., Schutte, K., Bach, A., and Faissner, A. (1999). DSD-1-proteoglycan is the mouse homolog of phosphacan and displays opposing effects on neurite outgrowth dependent on neuronal lineage. J. Neurosci. 19, 3888–3899. Garwood, J., Rigato, F., Heck, N., and Faissner, A. (2001). Tenascin glycoproteins and the complementary ligand DSD-1-PG/ phosphacan–structuring the neural extracellular matrix during development and repair. Restor. Neurol. Neurosci. 19, 51–64. Garwood, J., Garcion, E., Dobbertin, A., Heck, N., Calco, V., ffrench-Constant, C., and Faissner, A. (2004). The extracellular matrix glycoprotein Tenascin-C is expressed by oligodendrocyte precursor cells and required for the regulation of maturation rate, survival and responsiveness to platelet-derived growth factor. Eur. J. Neurosci. 20, 2524–2540. Gates, M. A., Thomas, L. B., Howard, E. M., Laywell, E. D., Sajin, B., Faissner, A., Gotz, B., Silver, J., and Steindler, D. A. (1995). Cell and molecular analysis of the developing and adult mouse subventricular zone of the cerebral hemispheres. J. Comp. Neurol. 361, 249–266. Gotz, M., and Huttner, W. B. (2005). The cell biology of neurogenesis. Nat. Rev. Mol. Cell Biol. 6, 777–788. Habuchi, H., Tanaka, M., Habuchi, O., Yoshida, K., Suzuki, H., Ban, K., and Kimata, K. (2000). The occurrence of three isoforms of heparan sulfate 6-O-sulfotransferase having different specificities for hexuronic acid adjacent to the targeted N-sulfoglucosamine. J. Biol. Chem. 275, 2859–2868. Hartfuss, E., Galli, R., Heins, N., and Gotz, M. (2001). Characterization of CNS precursor subtypes and radial glia. Dev. Biol. 229, 15–30. Hikino, M., Mikami, T., Faissner, A., Vilela-Silva, A. C., Pavao, M. S., and Sugahara, K. (2003). Oversulfated dermatan sulfate exhibits neurite outgrowth-promoting activity toward embryonic mouse hippocampal neurons: Implications of dermatan sulfate in neuritogenesis in the brain. J. Biol. Chem. 278, 43744–43754. Hiraoka, N., Nakagawa, H., Ong, E., Akama, T. O., Fukuda, M. N., and Fukuda, M. (2000). Molecular cloning and expression of two distinct human chondroitin 4-Osulfotransferases that belong to the HNK-1 sulfotransferase gene family. J. Biol. Chem. 275, 20188–20196. Houle, J. D., Tom, V. J., Mayes, D., Wagoner, G., Phillips, N., and Silver, J. (2006). Combining an autologous peripheral nervous system ‘‘bridge’’ and matrix modification
CSPGs in the Neural Stem Cell Niche
69
by chondroitinase allows robust, functional regeneration beyond a hemisection lesion of the adult rat spinal cord. J. Neurosci. 26, 7405–7415. Ida, M., Shuo, T., Hirano, K., Tokita, Y., Nakanishi, K., Matsui, F., Aono, S., Fujita, H., Fujiwara, Y., Kaji, T., and Oohira, A. (2006). Identification and functions of chondroitin sulfate in the milieu of neural stem cells. J. Biol. Chem. 281, 5982–5991. Ito, Y., Hikino, M., Yajima, Y., Mikami, T., Sirko, S., von Holst, A., Faissner, A., Fukui, S., and Sugahara, K. (2005). Structural characterization of the epitopes of the monoclonal antibodies 473HD, CS-56, and MO-225 specific for chondroitin sulfate D-type using the oligosaccharide library. Glycobiology 15, 593–603. Kabos, P., Matundan, H., Zandian, M., Bertolotto, C., Robinson, M. L., Davy, B. E., Yu, J. S., and Krueger, R. C., Jr. (2004). Neural precursors express multiple chondroitin sulfate proteoglycans, including the lectican family. Biochem. Biophys. Res. Commun. 318, 955–963. Kang, H. G., Evers, M. R., Xia, G., Baenziger, J. U., and Schachner, M. (2002). Molecular cloning and characterization of chondroitin-4-O-sulfotransferase-3. A novel member of the HNK-1 family of sulfotransferases. J. Biol. Chem. 277, 34766–34772. Kim, M., and Morshead, C. M. (2003). Distinct populations of forebrain neural stem and progenitor cells can be isolated using side-population analysis. J. Neurosci. 23, 10703–10709. Kitagawa, H., Tsutsumi, K., Tone, Y., and Sugahara, K. (1997). Developmental regulation of the sulfation profile of chondroitin sulfate chains in the chicken embryo brain. J. Biol. Chem. 272, 31377–31381. Kitagawa, H., Fujita, M., Ito, N., and Sugahara, K. (2000). Molecular cloning and expression of a novel chondroitin 6-O-sulfotransferase. J. Biol. Chem. 275, 21075–21080. Kobayashi, M., Sugumaran, G., Liu, J., Shworak, N. W., Silbert, J. E., and Rosenberg, R. D. (1999). Molecular cloning and characterization of a human uronyl 2-sulfotransferase that sulfates iduronyl and glucuronyl residues in dermatan/chondroitin sulfate. J. Biol. Chem. 274, 10474–10480. Kriegstein, A., and Alvarez-Buylla, A. (2009). The glial nature of embryonic and adult neural stem cells. Annu. Rev. Neurosci. 32, 149–184. Kusche-Gullberg, M., and Kjellen, L. (2003). Sulfotransferases in glycosaminoglycan biosynthesis. Curr. Opin. Struct. Biol. 13, 605–611. Leone, D. P., Relvas, J. B., Campos, L. S., Hemmi, S., Brakebusch, C., Fassler, R., ffrenchConstant, C., and Suter, U. (2005). Regulation of neural progenitor proliferation and survival by beta1 integrins. J. Cell Sci. 118, 2589–2599. Lim, D. A., Tramontin, A. D., Trevejo, J. M., Herrera, D. G., Garcia-Verdugo, J. M., and Alvarez-Buylla, A. (2000). Noggin antagonizes BMP signaling to create a niche for adult neurogenesis. Neuron 28, 713–726. Louis, S. A., Rietze, R. L., Deleyrolle, L., Wagey, R. E., Thomas, T. E., Eaves, A. C., and Reynolds, B. A. (2008). Enumeration of neural stem and progenitor cells in the neural colony-forming cell assay. Stem Cells 26, 988–996. Malatesta, P., Hartfuss, E., and Gotz, M. (2000). Isolation of radial glial cells by fluorescentactivated cell sorting reveals a neuronal lineage. Development 127, 5253–5263. Malatesta, P., Hack, M. A., Hartfuss, E., Kettenmann, H., Klinkert, W., Kirchhoff, F., and Gotz, M. (2003). Neuronal or glial progeny: Regional differences in radial glia fate. Neuron 37, 751–764. Marshall, 2nd, G. P., Reynolds, B. A., and Laywell, E. D. (2007). Using the neurosphere assay to quantify neural stem cells in vivo. Curr. Pharm. Biotechnol. 8, 141–145. Massey, J. M., Amps, J., Viapiano, M. S., Matthews, R. T., Wagoner, M. R., Whitaker, C. M., Alilain, W., Yonkof, A. L., Khalyfa, A., Cooper, N. G., Silver, J., and Onifer, S. M. (2008). Increased chondroitin sulfate proteoglycan expression in denervated
70
Swetlana Sirko et al.
brainstem targets following spinal cord injury creates a barrier to axonal regeneration overcome by chondroitinase ABC and neurotrophin-3. Exp. Neurol. 209, 426–445. Mikami, T., Mizumoto, S., Kago, N., Kitagawa, H., and Sugahara, K. (2003). Specificities of three distinct human chondroitin/dermatan N-acetylgalactosamine 4-O-sulfotransferases demonstrated using partially desulfated dermatan sulfate as an acceptor: Implication of differential roles in dermatan sulfate biosynthesis. J. Biol. Chem. 278, 36115–36127. Miyata, T., Kawaguchi, A., Okano, H., and Ogawa, M. (2001). Asymmetric inheritance of radial glial fibers by cortical neurons. Neuron 31, 727–741. Moritz, S., Lehmann, S., Faissner, A., and von Holst, A. (2008). An induction gene trap screen in neural stem cells reveals an instructive function of the niche and identifies the splicing regulator sam68 as a tenascin-C-regulated target gene. Stem Cells 26, 2321–2331. Nadanaka, S., Clement, A., Masayama, K., Faissner, A., and Sugahara, K. (1998). Characteristic hexasaccharide sequences in octasaccharides derived from shark cartilage chondroitin sulfate D with a neurite outgrowth promoting activity. J. Biol. Chem. 273, 3296–3307. Noctor, S. C., Flint, A. C., Weissman, T. A., Dammerman, R. S., and Kriegstein, A. R. (2001). Neurons derived from radial glial cells establish radial units in neocortex. Nature 409, 714–720. Noctor, S. C., Flint, A. C., Weissman, T. A., Wong, W. S., Clinton, B. K., and Kriegstein, A. R. (2002). Dividing precursor cells of the embryonic cortical ventricular zone have morphological and molecular characteristics of radial glia. J. Neurosci. 22, 3161–3173. Ohtake, S., Ito, Y., Fukuta, M., and Habuchi, O. (2001). Human N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase cDNA is related to human B cell recombination activating gene-associated gene. J. Biol. Chem. 276, 43894–43900. Pizzorusso, T., Medini, P., Berardi, N., Chierzi, S., Fawcett, J. W., and Maffei, L. (2002). Reactivation of ocular dominance plasticity in the adult visual cortex. Science 298, 1248–1251. Properzi, F., Carulli, D., Asher, R. A., Muir, E., Camargo, L. M., van Kuppevelt, T. H., ten Dam, G. B., Furukawa, Y., Mikami, T., Sugahara, K., Toida, T., Geller, H. M., et al. (2005). Chondroitin 6-sulphate synthesis is up-regulated in injured CNS, induced by injury-related cytokines and enhanced in axon-growth inhibitory glia. Eur. J. Neurosci. 21, 378–390. Pruszak, J., Ludwig, W., Blak, A., Alavian, K., and Isacson, O. (2009). CD15, CD24, and CD29 define a surface biomarker code for neural lineage differentiation of stem cells. Stem Cells 27, 2928–2940. Rietze, R. L., Valcanis, H., Brooker, G. F., Thomas, T., Voss, A. K., and Bartlett, P. F. (2001). Purification of a pluripotent neural stem cell from the adult mouse brain. Nature 412, 736–739. Rougon, G., Dubois, C., Buckley, N., Magnani, J. L., and Zollinger, W. (1986). A monoclonal antibody against meningococcus group B polysaccharides distinguishes embryonic from adult N-CAM. J. Cell Biol. 103, 2429–2437. Scadden, D. T. (2006). The stem-cell niche as an entity of action. Nature 441, 1075–1079. Shibata, T., Yamada, K., Watanabe, M., Ikenaka, K., Wada, K., Tanaka, K., and Inoue, Y. (1997). Glutamate transporter GLAST is expressed in the radial glia-astrocyte lineage of developing mouse spinal cord. J. Neurosci. 17, 9212–9219. Shihabuddin, L. S., Horner, P. J., Ray, J., and Gage, F. H. (2000). Adult spinal cord stem cells generate neurons after transplantation in the adult dentate gyrus. J. Neurosci. 20, 8727–8735. Silbert, J. E., and Sugumaran, G. (2002). Biosynthesis of chondroitin/dermatan sulfate. IUBMB Life 54, 177–186.
CSPGs in the Neural Stem Cell Niche
71
Sirko, S., von Holst, A., Wizenmann, A., Gotz, M., and Faissner, A. (2007). Chondroitin sulfate glycosaminoglycans control proliferation, radial glia cell differentiation and neurogenesis in neural stem/progenitor cells. Development 134, 2727–2738. Sirko, S., Neitz, A., Mittmann, T., Horvat-Brocker, A., von Holst, A., Eysel, U. T., and Faissner, A. (2009). Focal laser-lesions activate an endogenous population of neural stem/ progenitor cells in the adult visual cortex. Brain 132, 2252–2264. Sirko, S., von Holst, A., Weber, A., Wizenmann, A., Theocharidis, U., Gotz, M., and Faissner, A. (2010). Chondroitin sulfates are required for FGF-2-dependent proliferation and maintenance in neural stem cells and for EGF-dependent migration of their progeny. Stem Cells 28(4), 775–787. Sommer, I., and Schachner, M. (1981). Monoclonal antibodies (O1 to O4) to oligodendrocyte cell surfaces: An immunocytological study in the central nervous system. Dev. Biol. 83, 311–327. Streit, A., Yuen, C. T., Loveless, R. W., Lawson, A. M., Finne, J., Schmitz, B., Feizi, T., and Stern, C. D. (1996). The Le(x) carbohydrate sequence is recognized by antibody to L5, a functional antigen in early neural development. J. Neurochem. 66, 834–844. Temple, S. (2001). The development of neural stem cells. Nature 414, 112–117. Ueoka, C., Kaneda, N., Okazaki, I., Nadanaka, S., Muramatsu, T., and Sugahara, K. (2000). Neuronal cell adhesion, mediated by the heparin-binding neuroregulatory factor midkine, is specifically inhibited by chondroitin sulfate E. Structural ans functional implications of the over-sulfated chondroitin sulfate. J. Biol. Chem. 275, 37407–37413. von Holst, A., and Rohrer, H. (1998). Culture of avian sympathetic neurons. Curr. Top. Dev. Biol. 36, 161–182. von Holst, A., Sirko, S., and Faissner, A. (2006). The unique 473HD-chondroitinsulfate epitope is expressed by radial glia and involved in neural precursor cell proliferation. J. Neurosci. 26, 4082–4094. von Holst, A., Egbers, U., Prochiantz, A., and Faissner, A. (2007). Neural stem/progenitor cells express 20 tenascin C isoforms that are differentially regulated by Pax6. J. Biol. Chem. 282, 9172–9181. Wodarz, A., and Huttner, W. B. (2003). Asymmetric cell division during neurogenesis in Drosophila and vertebrates. Mech. Dev. 120, 1297–1309. Yamauchi, S., Mita, S., Matsubara, T., Fukuta, M., Habuchi, H., Kimata, K., and Habuchi, O. (2000). Molecular cloning and expression of chondroitin 4-sulfotransferase. J. Biol. Chem. 275, 8975–8981. Zou, P., Zou, K., Muramatsu, H., Ichihara-Tanaka, K., Habuchi, O., Ohtake, S., Ikematsu, S., Sakuma, S., and Muramatsu, T. (2003). Glycosaminoglycan structures required for strong binding to midkine, a heparin-binding growth factor. Glycobiology 13, 35–42.
C H A P T E R
F O U R
Transcript Analysis of Stem Cells Alison V. Nairn, Mitche dela Rosa, and Kelley W. Moremen Contents 1. Introduction 2. qRT-PCR as a Tool for Determining Transcript Analysis for Glycan-Related Gene Expression 2.1. Materials and equipment 2.2. Assembly of murine and human glycan-related gene lists 2.3. Primer design 2.4. Primer validation 2.5. RNA isolation 2.6. cDNA synthesis 2.7. Normalization gene selection 2.8. qRT-PCR data analysis 2.9. Statistical analysis 2.10. Display of qRT-PCR data 3. Examples of the Applications of qRT-PCR Transcript Analysis to Investigate Changes in Glycan-Related Gene Expression in Stem Cells 3.1. qRT-PCR analysis of glycosaminoglycan biosynthetic genes in pluripotent and differentiated murine embryonic stem cells 3.2. qRT-PCR analysis of sphingolipid biosynthetic genes in pluripotent and differentiated murine embryonic stem cells 3.3. Transcript analysis of genes involved in N- and O-linked glycan biosynthesis 3.4. Comparison transcript abundance of pluripotency and differentiation marker genes in human ES cells Acknowledgments References
74 75 75 76 76 77 79 80 80 80 81 81
83
84 85 85 86 88 88
The Complex Carbohydrate Research Center and the Department of Biochemistry and Molecular Biology, University of Georgia, Athens, GA Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79004-2
#
2010 Elsevier Inc. All rights reserved.
73
74
Alison V. Nairn et al.
Abstract Quantitative real-time polymerase chain reaction (qRT-PCR) is a flexible and scalable method for analyzing transcript abundance that can be used at a single gene or high-throughput (> 100 genes) level. Information obtained from this technique can be used as an indicator of potential regulation of glycosylation at the transcript level when combined with glycan structural or protein abundance data. This chapter describes detailed methods to design and perform qRT-PCR analyses and provides examples of information that can be obtained from the technique.
1. Introduction The significant and varied roles of carbohydrates in protein bioactivity, folding, localization, and immunogenicity have been investigated over the past several decades (Lowe, 2001; Lowe and Marth, 2003; Ohtsubo and Marth, 2006; Schachter, 2000; Varki, 1993). In addition, several reports have highlighted the roles of glycans in cellular differentiation and development (Cailleau-Thomas et al., 2000; Haltiwanger and Lowe, 2004; Muramatsu and Muramatsu, 2004; Schwarzkopf et al., 2002). Despite the vast body of literature on the genetic and biochemical roles of glycans, little is known about the global regulation of glycan synthesis and degradation. The addition and modification of glycan structures on lipid and protein acceptors is a nontemplate driven, posttranslational process, which makes determining modes of regulation difficult. Factors, such as accessibility to appropriate glycan-modifying enzymes, availability of sugar-nucleotide precursors, the abundance of protein, and lipid acceptor molecules, among others, can impact the efficiency and stability of individual glycan additions onto protein and lipid-linked acceptors. However, there is evidence that regulation of cellular glycosylation at the transcript level provides a considerable amount of global control (Comelli et al., 2006; Nairn et al., 2008). Differentiation of pluripotent stem cells provides a model system for analyzing changes that occur during mammalian embryogenesis and development. The addition of media components, such as cytokines and growth factors, allows researchers to produce defined, differentiated cell populations from pluripotent embryonic stem cells (ESCs; Jaenisch and Young, 2008). Recently, a process known as in vitro reprogramming was established to produce pluripotent stem cells from several adult cell types by ectopic expression of several transcription factors (Maherali et al., 2007; Okita et al., 2007; Takahashi and Yamanaka, 2006; Wernig et al., 2007; Yu et al., 2007). Both embryonic and induced pluripotent stem (iPS) cells have been differentiated into several germ layer-derived cell populations for biochemical and potentially therapeutic purposes. The ability to produce large numbers of homogeneous, defined populations of differentiated cells from pluripotent progenitors is an ideal model system to profile changes in gene expression and
Transcript Analysis of Stem Cells
75
biosynthetic pathway control during development. For studies relating to mammalian glycobiology, the ESC differentiation model system allows numerous avenues to profile the contributions of glycan structures during animal embryogenesis. As an initial step, we have been correlating transcript levels with glycan structural data during ESC differentiation to determine the scope of glycan structural changes and whether these alterations result from changes in expression of the biosynthetic machinery. In order to investigate changes in glycan-related gene expression that accompany stem cell differentiation, we performed a high-throughput transcript analysis of undifferentiated, pluripotent stem cells and several differentiated cell types. Several methods for analyzing gene expression are currently available, including hybridization-based techniques (i.e., microarray), sequence-based techniques (i.e., SAGE), and amplification-based techniques (i.e., RT-PCR), and each has potential advantages and drawbacks (Nairn and Moremen, 2009). Here, we present a quantitative real-time polymerase chain reaction (qRT-PCR) platform that can be used to analyze transcript levels of any number of glycan-related genes in cells and tissues. Several examples of the application of this technique to determine changes in transcript abundance in pluripotent and differentiated stem cells are also presented.
2. qRT-PCR as a Tool for Determining Transcript Analysis for Glycan-Related Gene Expression 2.1. Materials and equipment 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15.
Nuclease-free water Mouse or human genomic DNA (BioLine) iQTM SYBRÒ Green Supermix (Bio-Rad) Gene-specific primer pairs for glycan-related enzymes and proteins (500 nM) Housekeeping gene primer pairs (500 nM) Stem cell marker primer pairs (500 nM) iCycler or myIQ real-time detection system (Bio-Rad) or RealPlex2 MasterCycler (Eppendorf ) Nuclease-free Plasticware (pipet tips, microfuge tubes, etc.) 96-well PCR plates appropriate for cycler used Optical plate sealing film Thermoplate sealer (Eppendorf ) Centrifuge with microtiter plate attachment for swinging bucket rotor Optional: automated pipetting system (epMotion 5075, Eppendorf ) Trizol Reagent (Invitrogen) Phase Lock Gel (Eppendorf )
76
16. 17. 18. 19. 20.
Alison V. Nairn et al.
LiCl (2.5 M) RNeasy Plus Mini RNA isolation Kit (Qiagen) NanoDrop Spectrophotometer (Thermo Scientific) SuperScript III First Strand Synthesis Kit (Invitrogen, Carlsbad, CA) Flash-frozen stem cell pellets
2.2. Assembly of murine and human glycan-related gene lists As previously described for our murine glycan-related gene list (Nairn et al., 2008), several sources were used to assemble a comprehensive human glycanrelated gene list. These include the database of Carbohydrate Active Enzymes (www.cazy.org; Coutinho and Henrissat, 1999), a web-based genomic resource for animal lectins (www.imperial.ac.uk/research/animallectins/; Taylor and Drickamer, 2006) organized by Dr Kurt Drikamer, the Kyoto Encyclopedia of Genes and Genomes (www.genome.jp/kegg/; Kanehisa and Goto, 2000; Kanehisa et al., 2006, 2008), the gene list for the GLYCOv2 and GLYCOv3 gene chips from the Consortium for Functional Genomics (CFG; www.functionalglycomics.org; Bax et al., 2007; Comelli et al., 2006; Smith et al., 2005), the microarray gene list from the Glyco-Chain Expression Laboratory (Naito et al., 2007; Yamamoto et al., 2007), the Transport Classification Database (www.tcdb.org/; Saier et al., 2006), NCBI (www.ncbi.nlm.nih.gov; Wheeler et al., 2007) SOURCE (http://source.stanford.edu; Diehn et al., 2003), contributions from collaborating investigators, and extensive searches of the primary literature. Prevention of duplicate entries and the treatment of genes with high DNA sequence similarity or multifunctional genes (i.e., glycosyltransferase activity and carbohydrate binding domains) were performed as described previously (Nairn et al., 2008). The murine glycan-related gene list can be found as a supplemental file (Nairn et al., 2008) and the human glycanrelated gene list is unpublished, but is available on request. A list of stem cell pluripotency and differentiation markers was assembled and was included as a quality control check of sample status (Nairn et al., 2007).
2.3. Primer design A set of restrictive criteria was selected for all primers, so that one set of amplification conditions could be used for all genes being assayed. Coding region sequences for a specific gene were compared with the corresponding genomic sequence in the NCBI database via the BLAST search algorithm (Altschul et al., 1990) to determine intron/exon boundaries. A single coding exon (usually the largest coding exon) was submitted to the Primer3 webbased primer design program (Rozen and Skaletsky, 2000; frodo.wi.mit. edu/cgi-bin/primer3/primer3_www.cgi) with the following parameters: product size ranges 65–75 bp, primer size 19–21 bp, primer Tm 59–61 C
Transcript Analysis of Stem Cells
77
with a maximum Tm difference between primers for a given gene of 1 C, maximum self-complementarity of six bases, maximum 30 self-complementarity of five bases, and maximum repeat of a single base (poly-X) of five bases. All other settings were the default values. Primer pairs were designed for a number of housekeeping genes and stem cell pluripotency and differentiation markers, as well as the glycan-related genes (Nairn et al., 2007, 2008). Primers were synthesized by Eurofins MWG Operon (Huntsville, AL).
2.4. Primer validation Primer validation, which includes ensuring specificity of primer annealing and determining the efficiency of product amplification, is a critical element for successful transcript analysis. The total volume of amplification reactions was either 20 ml for Bio-Rad real-time PCR machines or 5 ml for Eppendorf machines. Reactions consisted of 25% diluted mouse or human genomic DNA (gDNA) template, 25% primer pair mix (500 nM each primer, 125 nM final concentration; Eurofins MWG Operon), and 50% iQTM SYBRÒ Green Supermix (Bio-Rad, Hercules, CA). For high-throughput applications, an automated pipetting system (i.e., Eppendorf’s epMotion 5075) is helpful for setting up a large number of reactions on multiple plates. Plates containing 5 ml volume reactions were sealed with a heat sealer to protect against evaporation. Plates containing 20 ml volume reactions were sealed with adhesive films. Sealed plates were centrifuged at 2000 rpm for 5 min to collect reaction components at the bottom of the 96-well plate. Amplifications were performed in a 96-well iCycler or myIQ RealTime Detection System (Bio-Rad) or a RealPlex2 MasterCycler (Eppendorf) with the following cycling conditions: 95 C for 3 min; followed by 40 cycles of 95 C for 10 s (denaturing), 65 C for 45 s (annealing), 78 C for 20 s (data collection); followed by a melt curve program (95 C for 1 min, 55 C for 1 min then increasing temperature of 0.5 C per cycle for 80 cycles of 10 s each). To ensure overall consistency of amplification, primer pairs were tested at a single DNA concentration in triplicate and the average of the cycle threshold (Ct) values was compared with that of a housekeeping gene. Primer pairs that yielded an average Ct within 2 units of the average Ct for the control gene were tested for efficiency and those outside the 2 Ct window were redesigned (Fig. 4.1A). A typical amplification curve from a gDNA dilution series is shown in Fig. 4.1B. The efficiency of amplification for each primer pair was determined in duplicate using serial dilutions of mouse gDNA as the template by the method of Liu and Saint (2002). The standard curve method (Livak and Schmittgen, 2001) was applied to the analysis of data from each primer set to generate plots of Ct versus log concentration of template and the slope was used to determine amplification efficiency, where efficiency (E) ¼ 10 1/slope 1 (Fig. 4.1C). For
78
Alison V. Nairn et al.
A 32 30
Average Ct
28 26 24 22
+2Ct
20
-2Ct
18 16 14 St3gal1 St3gal2 St3gal3 St3gal4 St3gal5 St3gal6 St6gahac1 St6gahac2 St6gahac3 St6gahac4 St6gahac5 St6gahac6 St6gal1 St6gal2 St8sia1 St8sia2 (STX) St8sia3 St8sia4 (PST) St8sia5 St8sia6 b3gnt1 b3gnt2 b3gnt3 b3gnt4 b3gnt5 b3gnt6 b3gnt7 b3gnt8 b3gnt8 b3gnt8
12
Gene-specific primer pairs
B
34
620
32
E = 100% E = 90%
540 30
460
Average Ct
Relative flourescence units (RFU)
C 700
380 300 220 NTC
60 -20
2
6
10 14
26 24
Threshold
140
E = 110%
28
18
22
26
30
34
22 20 -3
38 42
-2
D
E
170 150
0
50 40
130 110
d(RFU)/dT
d(RFU)/dT
-1
Log starting template quantity
Cycle number
90 70 50
NTC
30
30 20 NTC 10 0
10 -10 55
60
65
70
75
80
Temperature(°C)
85
-10 90
55
60
65
70
75
80
85
90
Temperature(°C)
Figure 4.1 Primer validation for qRT-PCR. Panel A: Primer pairs were analyzed by qRT-PCR using genomic DNA (gDNA) as template and Ct values were compared to Rpl4 as reference. Primer sets that generated Ct values with 2 Ct units of Rpl4 (shaded area) were considered acceptable for further validation. Primer pairs falling outside the acceptable range are indicated with an asterisk. Panel B: Typical amplification curve generated with gene-specific primers and mouse gDNA as template. The threshold for
Transcript Analysis of Stem Cells
79
validation purposes, we selected an acceptable range of 100 10% efficiency with gDNA as template (shown as dotted lines in Fig. 4.1C). Following the amplification and melt curve analysis, data was set to a common threshold and the efficiency of the primer pair was determined from the slope of the standard curve using software supplied with the qRTPCR instrumentation (Bio-Rad or Eppendorf ). Melt curves were analyzed for the presence of a single peak of d(RFU)/dT at 80–86 C indicating a single amplification product (Fig. 4.1D). An example of a melt curve analysis where a primer pair amplified more than one product is shown in Fig. 4.1E. Primers that failed any of the validation steps were redesigned and reanalyzed until a suitable primer pair was obtained.
2.5. RNA isolation Stem cell pellets were harvested and flash-frozen in liquid nitrogen and stored at 80 C until use. Since all primer sets are designed within a single exon, it is critical that no gDNA remains in the RNA preparation. A screen for gDNA in the isolated RNA is included in the cDNA synthesis protocol. We have used two different methods that produced RNA free of gDNA. Cell pellets were homogenized using a polytron, and RNA was isolated using Trizol Reagent (Invitrogen) and Phase Lock Gel (Eppendorf ) following manufacturer’s instructions. Total RNA was precipitated using LiCl (2.5 M final concentration), resuspended in RNase-free water and treated with RNase-free DNase (Ambion) to remove gDNA. Samples were reextracted with Trizol then reprecipitated with LiCl and resuspended in RNase-free water and used for cDNA synthesis. Alternatively, the RNeasy Plus Mini RNA isolation kit (Qiagen) can be used, which contains a column to remove gDNA. The second option is preferred for its ease of use and faster isolation protocol. Samples were quantitated and checked for purity using a NanoDrop spectrophotometer.
determining Ct values is indicated by the dotted line. The baseline fluorescence trace expected from a ‘‘no template control’’ (NTC) is also indicated on the graph. Panel C: Typical standard curve generated by qRT-PCR of a given primer pair to determine amplification efficiency using a dilution series of mouse gDNA as template. The solid line indicates the linear regression for the data points at each template concentration. The dashed and dotted lines indicate the lower (90%) and upper (110%) efficiency limits, respectively, for primer validation. Panel D: Melt curve analysis of qRT-PCR amplimers generated following the standard curve reactions in shown in Panel C indicating a single sharp peak (single product) formed during the amplification. Panel E: Melt curve analysis of standard curve reactions for primers that failed our quality control validation illustrating the presence of multiple products (peaks) in an amplification reaction. This research was originally published as a supplementary figure in Nairn et al. (2008)#. The American Society of Biochemistry and Molecular Biology.
80
Alison V. Nairn et al.
2.6. cDNA synthesis The SuperScript III First Strand Synthesis kit (Invitrogen) was used to synthesize cDNA from 1 mg total RNA according to the manufacturer’s instructions except that both oligo(dT) and random-primers (1:1) were included in the cDNA synthesis reactions. A control reaction lacking reverse transcriptase (‘‘No-RT’’) was prepared and analyzed to detect the presence of contaminating gDNA. For qRT-PCR reactions, cDNA reaction products (20 ml) were diluted 1:20 in water and used as template in triplicate reactions for each primer pair assayed.
2.7. Normalization gene selection Several housekeeping genes were analyzed to determine which gene had the most stable expression over the range of samples for a given study. qRT-PCR reactions with cDNA templates from stem cell samples were assayed using several housekeeping genes to determine the variability of expression across all cell types. The gene with the lowest variation across all tissues was selected as the normalization gene for all samples. Alternatively, several software programs (i.e., GeNorm and Normfinder; Andersen et al., 2004; Vandesompele et al., 2002) are available for selection of normalization gene(s).
2.8. qRT-PCR data analysis A 96-well plate format was used for qRT-PCR reactions using the same amplification conditions described above for primer validation where gDNA was used as a template. The ‘‘No-RT’’ control cDNA template was tested with several primer pairs to confirm that the sample was free of contaminating gDNA prior to analysis of the reverse transcribed template. Samples from each stem cell stage were analyzed using primer pairs for pluripotency and differentiation markers to ensure the status of the cells prior to glycan-related gene expression analysis. Each primer pair was analyzed in triplicate for each cDNA sample. Following each amplification, the threshold was set to a common value to maintain consistency between runs and data for each primer pair were averaged and the standard deviation was determined. We chose an arbitrary cutoff of 0.5 Ct for the standard deviation (Bustin, 2004). Triplicate values with a standard deviation >0.5 Ct were reassayed. The raw fluorescence data from the PCR machines were also analyzed using LinRegPCR (Ramakers et al., 2003) to determine the amplification efficiency of the individual reactions and a cutoff of < 5% was set as acceptable variability. Averaged Ct data were transformed to linear amplimer abundance values (2 Ct) and normalized to the housekeeping gene.
Transcript Analysis of Stem Cells
81
To determine the relative transcript levels for the glycan-related genes in a given cDNA sample, we utilized the DDCt method (Livak and Schmittgen, 2001). This analysis method requires the assumption that the amplification efficiencies of all reactions are approximately equal. A test for equal efficiencies is to plot DCt (Ctgene Ctcontrol) versus template concentration for a dilutions series and ensure that the slope of the generated line is A homozygous p.Arg442His homozygous p.Gly65Arg þ Trp582Cys heterozygous p.Ala200Pro homozygous
CMD, congenital muscular dystrophy; LGMD, limb-girdle muscular dystrophy; MR, mental retardation.
from the parents. Four patients had already been genetically characterized (patients 1 and 2 for POMGNT1 and patients 3 and 4 for POMT1; Table 19.1). Three other patients (patients 5–7) were genetically uncharacterized. B lymphoblasts were obtained after immortalization by Epstein–Barr virus and cultured in RPMI 1640 (Invitrogen, Carlsbad, CA) according to standard protocols to obtain 100 106 cells. After centrifugation at 800g for 5 min, the pellets were rinsed twice with 50 ml then with 12 ml of PBS buffer. The final pellets were frozen at –80 C. The cells (7.5 106 cells) were homogenized in 10 mM Tris–HCl, pH 7.4, 1 mM EDTA, 250 mM sucrose, 1 mM dithiothreitol, with a protease inhibitor cocktail (3 mg/ml pepstatin A, 1 mg/ml leupeptin, 1 mM benzamidine–HCl, and 1 mM PMSF). After centrifugation at 900g for 10 min, the supernatant was subjected to ultracentrifugation at 100,000g for 1 h. The precipitate was used as the microsomal membrane fraction (enzyme source). Protein concentration was determined by BCA assay (PIERCE, Rockford, IL). About 40 mg proteins of microsomal membranes were obtained from 1 106 cells.
2.2. Assay for glycosyltransferase activity Since GnT1 (UDP-GlcNAc: a-3-D-mannoside b1,2-N-acetylglucosaminyltransferase 1, EC 2.4.1.101) is not involved in O-mannosylglycan biosynthesis, it is not affected in a-dystroglycanopathies and represents a suitable control to normalize samples for baseline microsomal activity.
2.3. GnT1 activity The GnT1 activity was performed in a total volume of 20 ml reaction mixture containing 100 mM MES buffer, 10 mM pyridylaminated Man5GlcNAc2 (M5-PA, Takara Bio, Inc., Otsu, Japan), 2 mM UDP-GlcNAc, 5 mM
Mutations in Muscular Dystrophy
347
AMP, 0.5% Triton X-100, 0.2% BSA, 20 mM MnCl2, and enzyme source (100 mg of microsomal membrane fraction) at 37 C for 2 h. The samples were then analyzed by reversed phase HPLC with a COSMOSIL 5C18AR-II column (4.6 250 mm, Nacalai Tesque, Kyoto, Japan). The solvent used was a 100 mM, pH 6.0, ammonium acetate buffer containing 0.15% 1-butanol, and the substrate and the product were isocratically separated. Fluorescence was detected with a fluorescence detector (RF-10AXL, Shimadzu Corp., Kyoto, Japan) at excitation and emission wavelengths of 320 and 400 nm, respectively. The GnT1 activity mean (standard deviation) of all samples was 0.53 (0.06) nmol/h/mg total proteins with high constancy.
2.4. POMGnT1 activity The POMGnT1 activity was based on the amount of [3H]GlcNAc transferred to a mannosylpeptide (Ac-Ala-Ala-Pro-Thr(Man)-Pro-Val-Ala-AlaPro-NH2) as described in a previous chapter of this series (Endo and Manya, 2006). The mannosylpeptide is not commercially available but it is possible to use Benzyl-Man, which is commercially available, as a substitute as described previously (Endo and Manya, 2006). Therefore, the procedures are described briefly here. The reaction buffer containing 140 mM MES buffer (pH 7.0), 1 mM UDP-[3H]GlcNAc (225,000 dpm/nmol) (PerkinElmer, Inc., Waltham, MA), 1 mM mannosyl nanopeptide, 10 mM MnCl2, 2% Triton X-100, 5 mM AMP, 200 mM GlcNAc, 10% glycerol, and enzyme source (100 mg of microsomal membrane fraction) in 20 ml total volume was incubated at 37 C for 4 h. After boiling for 3 min, the mixture was analyzed by reversed phase HPLC with a Wakopak 5C18-200 column (4.6 250 mm, Wako Pure Chemical Industries, Ltd., Osaka, Japan). Solvent A was 0.1% trifluoroacetic acid in distilled water and solvent B was 0.1% trifluoroacetic acid in acetonitrile. The peptide was eluted at a flow rate of 1 ml/min using a linear gradient of 1–25% solvent B. The peptide separation was monitored continuously at 214 nm, and the radioactivity of each fraction was measured using a liquid scintillation counter. The average POMGnT1 activity measured in lymphoblasts of control patients was 0.163 (0.042) nmol/h/mg total proteins.
2.5. POMT activity The POMT activity was based on the amount of [3H]-mannose transferred to a glutathione-S-transferase fusion a-DG (GST-aDG) as described also in a previous chapter of this series (Endo and Manya, 2006). Therefore, the procedures are described briefly here. The reaction mixture contained 20 mM Tris–HCl (pH 8.0), 100 nM of [3H]-mannosylphosphoryldolichol (Dol-P-Man, 125,000 dpm/pmol) (American Radiolabeled Chemical, Inc., St. Louis, MO), 2 mM 2-mercaptoethanol, 10 mM EDTA, 0.5% noctyl-b-D-thioglucoside (Dojindo Laboratories, Kumamoto, Japan), 10 mg
348
Tamao Endo et al.
GST-a-DG, and enzyme source (80 mg of microsomal membrane fraction) in 20 ml total volume. After 1 h incubation at 22 C, the reaction was stopped by adding 150 ml PBS containing 1% Triton X-100, and the reaction mixture was centrifuged at 10,000g for 10 min. The supernatant was removed, mixed with 400 ml of PBS containing 1% Triton X-100 and 10 ml of Glutathione Sepharose 4B beads (GE Healthcare Bio-Sciences Corp., NJ), rotated at 4 C for 1 h, and washed three times with 20 mM Tris–HCl (pH 7.4) containing 0.5% Triton X-100. The radioactivity adsorbed to the beads was measured using a liquid scintillation counter. The average POMT activity in lymphoblasts of control subjects was 0.041 ( 0.013) pmol/h/mg proteins.
2.6. Mutation analysis Genomic DNA was extracted from lymphoblasts using standard methods. Primer pairs were designed to amplify all coding exons and flanking intronic sequences of POMT1 (9q34.1), POMT2 (14q24), and POMGNT1 (1p34.1). The primer sequences and PCR conditions are available upon request. The generated amplicons were purified and directly sequenced with the BigDye terminator kit (PerkinElmer Applied Biosystems, Wellesley, MA). Sequences were analyzed on an ABI PRISM 31130 capillary sequencer (Applera, CA). For patient 7, to find the second mutation, total RNA extracts from lymphoblasts were reversed transcribed and POMT2 cDNA was amplified by nested PCR as previously reported (Yanagisawa et al., 2009).
3. Procedures for Enzymatic Activity and Mutation Search When we assessed the POMGnT1 activity in lymphoblasts from patients 1 and 2, enzymatic activity in these lymphoblasts was much lower than in the control subjects (Fig. 19.1). Those had previously been genetically confirmed with mutations in the POMGNT1 gene (Table 19.1). Patient 1 carried the mutation c.1539þ1 G>A in the homozygous state, and patient 2 harbored the mutation p.Arg442His, also in homozygous state. When we assessed POMT activity in lymphoblasts from the patients who were been previously genetically confirmed with mutations in the POMT1 gene (Table 19.1). Patient 3 was a compound heterozygous carrier of two missense mutations, p.Gly65Arg and p.Trp582Cys (van Reeuwijk et al., 2006). Patient 4 was homozygous for the missense mutation p.Ala200Pro (Balci et al., 2005). The enzyme activity in these patient lymphoblasts was extremely low.
349
Mutations in Muscular Dystrophy
Patients with a-dystroglycanopathies
0.5
-
0.4 0.3
-
0.2
-
0.1
-
0
-
C 1 2 3 4 5 6 7
Patient 5 (low POMGnT1 activity)
Screening POMGnT1 c. 458C > G, p.Ser153X c. 805_807delTGC, p. Cys269del
POMT/GnT1 (⫻10-3) activity
POMGnT1/GnT1 (⫻10-3) activity
Enzymatic assays 0.08 0.07 0.06 0.05 0.04 0.03 0.02 0.01 0
C 1 2 3 4
5 6 7
Patients 6 and 7 (low POMT activity)
Screening POMT1 Patient 6
Patient 7
c. 2005G > A, p. Ala669Thr c. 2167insG, p. Gly722fs > 730X
No mutations
Screening POMT2 c. 1997A > G, p.Tyr666Cys c. 763del6602insCCTG p. Met112AlafsX16
Figure 19.1 Schematic illustration of procedures for enzymatic activity and mutation search. Enzymatic activities in lymphoblasts from uncharacterized patients with a-dystroglycanopathies were measured. If a patient showed low enzymatic activity, the potential responsible gene was screened. Patient 5 showed low POMGnT1 activity, and POMGNT1 was thus screened. Patients 6 and 7 showed low POMT activity, and thus patients 6 and 7 were screened for POMT1 at first. However, since no mutations were found in the POMT1 gene of patient 7, then the POMT2 gene was further studied.
Among the uncharacterized patients, patient 5 showed low POMGnT1 activity and was thus secondarily screened for POMGNT1. The DNA study of this patient revealed two heterozygous mutations: a nonsense mutation, p.Ser153X (c.458C>G), and a deletion of three nucleotides c.805807delTGC, which is expected to delete one amino acid, cysteine at position 269 (p.Cys269del), localized in the stem domain of the protein (Leu59-Leu300) (Manya et al., 2008).
350
Tamao Endo et al.
When we assessed POMT activity in the uncharacterized patients, we observed a markedly reduced activity in patient 6 and patient 7 (Fig. 19.1). Then patient 6 and patient 7 were secondarily screened for POMT1 at first. We found two heterozygous mutations, in POMT1 for patient 6: p.Ala669Thr (c.2005G>A), associated with c.2167insG which leads to a premature stop codon in amino acid 730 (Manya et al., 2008). However, no mutation was found in the POMT1 gene of patient 7. Then we screened POMT2 for mutations and finally found two heterozygous mutations: a missense mutation, p.Tyr666Cys, and a large deletion 763del6602insCCTG leading to a premature stop codon (Yanagisawa et al., 2009). In conclusion, the lymphoblast-based enzymatic assay is an accurate and extremely useful method to select the patients harboring POMT1, POMT2, and POMGNT1 mutations among those with suspected a-dystroglycanopathies. In other words, the enzymatic assay can be used as a first screening tool for narrowing the responsible gene in a-dystroglycanopathies. Interestingly, the same POMT assay was successfully used in skin fibroblasts from patients (Lommel et al., 2010). The combinatory study of enzyme activity and gene mutation screening will help surveying patients with a-dystroglycanopathies and better understanding the clinical spectrum of theses pathologies.
ACKNOWLEDGMENT This work was supported by Research Grants for Nervous and Mental Disorders (20B-13) and Research on Psychiatric and Neurological Diseases and Mental Health from the Ministry of Health, Labour and Welfare of Japan.
REFERENCES Akasaka-Manya, K., Manya, H., and Endo, T. (2004). Mutations of the POMT1 gene found in patients with Walker–Warburg syndrome lead to a defect of protein O-mannosylation. Biochem. Biophys. Res. Commun. 325, 75–79. Akasaka-Manya, K., Manya, H., Nakajima, A., Kawakita, M., and Endo, T. (2006). Physical and functional association of human protein O-mannosyltransferases 1 and 2. J. Biol. Chem. 281, 19339–19345. Balci, B., Uyanik, G., Dincer, P., Gross, C., Willer, T., Talim, B., Haliloglu, G., Kale, G., Hehr, U., Winkler, J., and Topaloglu, H. (2005). An autosomal recessive limb girdle muscular dystrophy (LGMD2) with mild mental retardation is allelic to Walker–Warburg syndrome (WWS) caused by a mutation in the POMT1 gene. Neuromuscul. Disord. 15, 271–275. Beltran-Valero De Bernabe, D., Currier, S., Steinbrecher, A., Celli, J., Van Beusekom, E., Van Der Zwaag, B., Kayserili, H., Merlini, L., Chitayat, D., Dobyns, W. B., Cormand, B., Lehesjoki, A. E., et al. (2002). Mutations in the O-mannosyltransferase gene POMT1 give rise to the severe neuronal migration disorder Walker–Warburg syndrome. Am. J. Hum. Genet. 71, 1033–1043.
Mutations in Muscular Dystrophy
351
Biancheri, R., Bertini, E., Falace, A., Pedemonte, M., Rossi, A., D’Amico, A., Scapolan, S., Bergamino, L., Petrini, S., Cassandrini, D., Broda, P., Manfredi, M., et al. (2006). POMGnT1 mutations in congenital muscular dystrophy: Genotype–phenotype correlation and expanded clinical spectrum. Arch. Neurol. 63, 1491–1495. Brockington, M., Blake, D. J., Prandini, P., Brown, S. C., Torelli, S., Benson, M. A., Ponting, C. P., Estournet, B., Romero, N. B., Mercuri, E., Voit, T., Sewry, C. A., et al. (2001a). Mutations in the fukutin-related protein gene (FKRP) cause a form of congenital muscular dystrophy with secondary laminin a2 deficiency and abnormal glycosylation of a-dystroglycan. Am. J. Hum. Genet. 69, 1198–1209. Brockington, M., Yuva, Y., Prandini, P., Brown, S. C., Torelli, S., Benson, M. A., Herrmann, R., Anderson, L. V., Bashir, R., Burgunder, J. M., Fallet, S., Romero, N., et al. (2001b). Mutations in the fukutin-related protein gene (FKRP) identify limb girdle muscular dystrophy 2I as a milder allelic variant of congenital muscular dystrophy MDC1C. Hum. Mol. Genet. 10, 2851–2859. Brown, S. C., Torelli, S., Brockington, M., Yuva, Y., Jimenez, C., Feng, L., Anderson, L., Ugo, I., Kroger, S., Bushby, K., Voit, T., Sewry, C., et al. (2004). Abnormalities in adystroglycan expression in MDC1C and LGMD2I muscular dystrophies. Am. J. Pathol. 164, 727–737. D’Amico, A., Tessa, A., Bruno, C., Petrini, S., Biancheri, R., Pane, M., Pedemonte, M., Ricci, E., Falace, A., Rossi, A., Mercuri, E., Santorelli, F. M., et al. (2006). Expanding the clinical spectrum of POMT1 phenotype. Neurology 66, 1564–1567. Endo, T., and Manya, H. (2006). Defect in glycosylation that causes muscular dystrophy. Methods Enzymol. 417, 137–152. Grewal, P. K., Holzfeind, P. J., Bittner, R. E., and Hewitt, J. E. (2001). Mutant glycosyltransferase and altered glycosylation of a-dystroglycan in the myodystrophy mouse. Nat. Genet. 28, 151–154. Kanagawa, M., Nishimoto, A., Chiyonobu, T., Takeda, S., Miyagoe-Suzuki, Y., Wang, F., Fujikake, N., Taniguchi, M., Lu, Z., Tachikawa, M., Nagai, Y., Tashiro, F., et al. (2009). Residual laminin-binding activity and enhanced dystroglycan glycosylation by LARGE in novel model mice to dystroglycanopathy. Hum. Mol. Genet. 18, 621–631. Kobayashi, K., Nakahori, Y., Miyake, M., Matsumura, K., Kondo-Iida, E., Nomura, Y., Segawa, M., Yoshioka, M., Saito, K., Osawa, M., Hamano, K., Sakakihara, Y., et al. (1998). An ancient retrotransposal insertion causes Fukuyama-type congenital muscular dystrophy. Nature 394, 388–392. Liu, J., Ball, S. L., Yang, Y., Mei, P., Zhang, L., Shi, H., Kaminski, H. J., Lemmon, V. P., and Hu, H. (2006). A genetic model for muscle-eye-brain disease in mice lacking protein O-mannose 1,2-N-acetylglucosaminyltransferase (POMGnT1). Mech. Dev. 123, 228–240. Lommel, M., Cirak, S., Willer, T., Hermann, R., Uyanik, G., van Bokhoven, H., Korner, C., Voit, T., Baric, I., Hehr, U., and Strahl, S. (2010). Correlation of enzyme activity and clinical phenotype in POMT1-associated dystroglycanopathies. Neurology 74, 157–164. Longman, C., Brockington, M., Torelli, S., Jimenez-Mallebrera, C., Kennedy, C., Khalil, N., Feng, L., Saran, R. K., Voit, T., Merlini, L., Sewry, C. A., Brown, S. C., et al. (2003). Mutations in the human LARGE gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of a-dystroglycan. Hum. Mol. Genet. 12, 2853–2861. Manya, H., Sakai, K., Kobayashi, K., Taniguchi, K., Kawakita, M., Toda, T., and Endo, T. (2003). Loss-of-function of an N-acetylglucosaminyltransferase, POMGnT1, in muscleeye-brain disease. Biochem. Biophys. Res. Commun. 306, 93–97. Manya, H., Chiba, A., Yoshida, A., Wang, X., Chiba, Y., Jigami, Y., Margolis, R. U., and Endo, T. (2004). Demonstration of mammalian protein O-mannosyltransferase activity:
352
Tamao Endo et al.
Coexpression of POMT1 and POMT2 required for enzymatic activity. Proc. Natl. Acad. Sci. USA 101, 500–505. Manya, H., Bouchet, C., Yanagisawa, A., Vuillaumier-Barrot, S., Quijano-Roy, S., Suzuki, Y., Maugenre, S., Richard, P., Inazu, T., Merlini, L., Romero, N., Leturcq, F., et al. (2008). Protein O-mannosyltransferase activities in lymphoblasts from patients with a-dystroglycanopathies. Neuromuscul. Disord. 18, 45–51. Mercuri, E., Messina, S., Bruno, C., Mora, M., Pegoraro, E., Comi, G. P., D’Amico, A., Aiello, C., Biancheri, R., Berardinelli, A., Boffi, P., Cassandrini, D., et al. (2009). Congenital muscular dystrophies with defective glycosylation of dystroglycan: A population study. Neurology 72, 1802–1809. Michele, D. E., and Campbell, K. P. (2003). Dystrophin-glycoprotein complex: Posttranslational processing and dystroglycan function. J. Biol. Chem. 278, 15457–15460. Miyagoe-Suzuki, Y., Masubuchi, N., Miyamoto, K., Wada, M. R., Yuasa, S., Saito, F., Matsumura, K., Kanesaki, H., Kudo, A., Manya, H., Endo, T., and Takeda, S. (2009). Reduced proliferative activity of primary POMGnT1-null myoblasts in vitro. Mech. Dev. 126, 107–116. Muntoni, F., Torelli, S., and Brockington, M. (2008). Muscular dystrophies due to glycosylation defects. Neurotherapeutics 5, 627–632. Quijano-Roy, S., Galan, L., Ferreiro, A., Cheliout-Heraut, F., Gray, F., Fardeau, M., Barois, A., Guicheney, P., Romero, N. B., and Estournet, B. (2002). Severe progressive form of congenital muscular dystrophy with calf pseudohypertrophy, macroglossia and respiratory insufficiency. Neuromuscul. Disord. 12, 466–475. Vajsar, J., Zhang, W., Dobyns, W. B., Biggar, D., Holden, K. R., Hawkins, C., Ray, P., Olney, A. H., Burson, C. M., Srivastava, A. K., and Schachter, H. (2006). Carriers and patients with muscle-eye-brain disease can be rapidly diagnosed by enzymatic analysis of fibroblasts and lymphoblasts. Neuromuscul. Disord. 16, 132–136. van Reeuwijk, J., Janssen, M., van den Elzen, C., Beltran-Valero de Bernabe, D., Sabatelli, P., Merlini, L., Boon, M., Scheffer, H., Brockington, M., Muntoni, F., Huynen, M. A., Verrips, A., et al. (2005). POMT2 mutations cause a-dystroglycan hypoglycosylation and Walker–Warburg syndrome. J. Med. Genet. 42, 907–912. van Reeuwijk, J., Maugenre, S., van den Elzen, C., Verrips, A., Bertini, E., Muntoni, F., Merlini, L., Scheffer, H., Brunner, H. G., Guicheney, P., and van Bokhoven, H. (2006). The expanding phenotype of POMT1 mutations: From Walker–Warburg syndrome to congenital muscular dystrophy, microcephaly, and mental retardation. Hum. Mutat. 27, 453–459. van Reeuwijk, J., Grewal, P. K., Salih, M. A., Beltran-Valero de Bernabe, D., McLaughlan, J. M., Michielse, C. B., Herrmann, R., Hewitt, J. E., Steinbrecher, A., Seidahmed, M. Z., Shaheed, M. M., Abomelha, A., et al. (2007). Intragenic deletion in the LARGE gene causes Walker–Warburg syndrome. Hum. Genet. 121, 685–690. Yanagisawa, A., Bouchet, C., Quijano-Roy, S., Vuillaumier-Barrot, S., Clarke, N., Odent, S., Rodriguez, D., Romero, N. B., Osawa, M., Endo, T., Taratuto, A. L., Seta, N., et al. (2009). POMT2 intragenic deletions and splicing abnormalities causing congenital muscular dystrophy with mental retardation. Eur. J. Med. Genet. 52, 201–206. Yoshida, A., Kobayashi, K., Manya, H., Taniguchi, K., Kano, H., Mizuno, M., Inazu, T., Mitsuhashi, H., Takahashi, S., Takeuchi, M., Herrmann, R., Straub, V., et al. (2001). Muscular dystrophy and neuronal migration disorder caused by mutations in a glycosyltransferase, POMGnT1. Dev. Cell. 1, 717–724. Zhang, W., Vajsar, J., Cao, P., Breningstall, G., Diesen, C., Dobyns, W., Herrmann, R., Lehesjoki, A. E., Steinbrecher, A., Talim, B., Toda, T., Topaloglu, H., et al. (2003). Enzymatic diagnostic test for muscle-eye-brain type congenital muscular dystrophy using commercially available reagents. Clin. Biochem. 36, 339–344.
C H A P T E R
T W E N T Y
Cellular and Molecular Characterization of Abnormal Brain Development in Protein O-Mannose N-Acetylglucosaminyltransferase 1 Knockout Mice Jianmin Liu,* Yuan Yang,† Xiaofeng Li,‡ Peng Zhang,§ Yue Qi,} and Huaiyu Hu§ Contents 1. Overview 2. Analysis of a-DG Glycosylation and Laminin Binding by Western Blot 3. Histological Analysis of POMGnT1 Knockout Brain 4. Lamination Defects in the Neocortex of POMGnT1 Knockout Mice 5. Analysis of the Pial Basement Membrane by Laminin Immunostaining 6. Analysis of the Pial Basement Membrane by Transmission Electron Microscopy 7. Analysis of the Glia Limitans by GFAP Immunofluorescence Staining Acknowledgments References
354 355 356 357 359 360 362 364 365
Abstract Protein O-mannose N-acetylglucosaminyltransferase 1 (POMGnT1) is an enzyme that catalyzes the transfer of N-acetylglucosamine to O-mannose of glycoproteins. It is involved in posttranslational modification of a-dystroglycan (a-DG). POMGnT1-null mice were generated by gene trapping with a retroviral vector inserted into exon 2 of the POMGnT1 gene. Expression of POMGnT1 was * Vicam, Watertown, Massachusetts, USA Department of Neurology, Tongji Medical College, Wuhan, Hubei Province, PR China Department of Neurology, Second Affiliated Hospital of Chongqin Medical University, Chongqin, PR China } Department of Neuroscience and Physiology, Upstate Medical University, Syracuse, New York, USA } Department of Pathology, Upstate Medical University, New York, USA { {
Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79020-0
#
2010 Elsevier Inc. All rights reserved.
353
354
Jianmin Liu et al.
completely disrupted as evidenced by absence of its mRNA expression. POMGnT1 knockout mice were viable but with reduced fertility and variable lifespan. The functional glycosylated form of a-DG was markedly reduced in POMGnT1 knockout mice along with impaired a-DG-laminin binding activity. Multiple developmental defects in muscle, brain, and eye were observed. In addition, the knockout mice exhibited extensive abnormalities in the neocortex, including changed neuron distribution, presence of ectopic fibroblasts, and GFAP-positive reactive astrocytes. Analysis of POMGnT1 knockout neocortex at several developmental stages revealed that these defects were secondary to disruptions of the pial basement membrane.
1. Overview Mutations in protein O-mannose b-1,2-N-acetylglucosaminyltransferase 1 (POMGnT1) cause congenital muscular dystrophies, including muscle–eye–brain disease (MEB) in human (Yoshida et al., 2001). POMGnT1 is an enzyme that catalyzes the transfer of N-acetylglucosamine to O-mannose of glycoproteins, including dystroglycan (Takahashi et al., 2001). O-Mannosyl glycosylation is essential for proper dystroglycan’s extracellular matrix binding function in brain, nerve, and skeletal muscle (Yoshida et al., 2001). More than 30 different human POMGnT1 mutations have been identified worldwide over the last decade (Biancheri et al., 2006; Oliveira et al., 2008). Mutations discovered so far in MEB patients are distributed along the entire gene. The type and position of the POMGnT1 mutations cannot predict the clinical severity (Hehr et al., 2007). The spectrum of disorders caused by POMGnT1 mutations is broad ranging from mild deficiency to life-threatening (Clement et al., 2008; Taniguchi et al., 2003). Recent studies in POMGnT1 knockout mice reveal multiple developmental defects in muscle, eye, and brain, similar to the phenotypes observed in human MEB disease (Hu et al., 2007; Liu et al., 2006; Miyagoe-Suzuki et al., 2009; Yang et al., 2007). The knockout muscle and brain tissues show aberrant glycosylation of a-dystroglycan (a-DG), and the laminin binding activity of a-DG is greatly reduced in POMGnT1 knockout mouse (Liu et al., 2006; Miyagoe-Suzuki et al., 2009). Reduced fertility, muscle mass, number of muscle fibers, and impaired muscle regeneration are also observed in these POMGnT1 knockouts (Liu et al., 2006; Miyagoe-Suzuki et al., 2009). In vitro study shows that muscle satellite cells derived from POMGnT1 knockout mice proliferated slowly, and transfer of a retrovirus vectormediated POMGnT1 gene into POMGnT1 null myoblasts could completely restore the glycosylation of a-DG (Miyagoe-Suzuki et al., 2009). This result opens up an avenue of gene therapy for severe human POMGnT1 originated muscular dystrophy.
Abnormal Brain Development in POMGnT1 Knockout Mice
355
a-DG is a high-affinity receptor for a variety of extracellular ligands such as laminin, agrin, neurexin, perlecan (Michele and Campbell, 2003; Montanaro and Carbonetto, 2003), and pikachurin (Sato et al., 2008). Correct posttranslational modification of a-DG is essential for the spatial linkage between the extracellular matrix and the cytoskeleton in muscle and nonmuscle tissues (Brancaccio, 2003; Campbell, 1995; Durbeej et al., 1998). POMGnT1 is one of the key enzymes involving in the synthesis of functional a-DG in human and mouse. To dissect the specific role of POMGnT1 in animal development, POMGnT1 knockout mice were generated by gene trapping (Liu et al., 2006). Here, we describe the methods and results from characterization of abnormal brain development in POMGnT1 knockout.
2. Analysis of a-DG Glycosylation and Laminin Binding by Western Blot Two monoclonal antibodies, IIH6C4 and Via4-1, which recognize different epitopes of a-DG have been widely used in previous studies (Ervasti and Campbell, 1993; Grewal et al., 2001) to evaluate glycosylation of a-DG. IIH6C4 reacts with the laminin binding site of a-DG (Ervasti and Campbell, 1993), and the VIA4-1 recognizes an unidentified glycosylated site of a-DG (Longman et al., 2003). Western blot has been used to examine the functional glycosylated a-DG in patients with FCMD, MEB, and WWS, and in mice with Largemyd disease (Michelele et al., 2002). The brain tissues (0.3 g) from wild-type and POMGnT1 knockout mice were homogenized by polytron in 3 ml of Tris-buffered saline (TBS, 50 mM Tris–HCl, 150 mM NaCl, pH 7.4) supplemented with a protease inhibitor cocktail (Roche Diagnostic). Then, Triton X-100 was added to the above homogenate at the final concentration of 1%, and homogenized tissues were incubated with gentle mixing at 4 C for 1 h and centrifuged at 14,000g for 37 min. The supernatant was collected. To enrich glycoproteins, affinity chromatography with wheat germ agglutinin (WGA) gel (EY Laboratories) was performed as previously described with minor changes (Michelele et al., 2002). The supernatant was incubated with 300 ml washed WGA gel at 4 C overnight. The gel was then washed three times with TBS containing 0.1% Triton X-100 and protease inhibitor cocktail, and resuspended in 1 ml TBS þ 0.1% Triton X-100 or 1 SDS-PAGE gel loading buffer, heated in boiling water for 5 min, and stored at –70 C until analysis. For Western blot analysis, 30 ml WGA-enriched glycoproteins were resolved with 4–20% SDS-PAGE and electrophoretically transferred onto polyvinylidene fluoride (PVDF) membrane. The membrane was blocked by 3% bovine serum albumin (BSA) in TBS, incubated with primary antibodies (IIH6C4, Santa Cruz Biotechnologies) for 2 h. After washing
356
Jianmin Liu et al.
with TBS, the membrane was incubated with secondary antibody conjugated with horseradish peroxidase (HRP, goat anti-mouse IgM). After washing with TBS, the results were visualized with an electrochemiluminescence (ECL) detection kit (Pierce). For the laminin overlay assay, the PVDF membrane was incubated with TBS (with 1 mM CaCl2, 1 mM MgCl2) containing 3% BSA for an hour to block nonspecific binding. The membrane was then incubated with 1.25 ng/ml laminin-1 (Invitrogen) in TBS (with 1 mM CaCl2, 1 mM MgCl2) overnight at 4 C. After washing with TBS (with 1 mM CaCl2, 1 mM MgCl2), bound laminin was detected with a rabbit antibody against mouse laminin-1 (Sigma) for 2 h. After washing, the membrane was incubated with goat anti-rabbit IgG conjugated with HRP for 45 min. The signal was then visualized with SuperSignal West Pico chemiluminescent substrate (Thermo Scientific, Rockford, IL). As expected, the monoclonal antibody IIH6C4 detected a 125 kDa signal in wild-type (þ/þ) mouse brain tissue while markedly reduced signals were found in POMGnT1 knockout tissues (Fig. 20.1), suggesting loss of expression of functional glycosylation of a-DG in the POMGnT1 knockout mice. Laminin binding activity was also detected in wild-type mouse brain tissue, but was markedly reduced in POMGnT1 knockout mouse, indicating reduced laminin binding by hypoglycosylated a-DG in the knockout. As a control, wild-type and knockout mice showed similar levels of b-DG.
3. Histological Analysis of POMGnT1 Knockout Brain Classical histological analysis such as H&E or cresyl violet staining is very useful to screen brain malformations in knockout models. The adult brains were embedded into Tissue-Tek OCTÒ (Optimal Cutting Temperature) compound, snap-frozen in 2-methylbutane/dry ice bath, and cryosectioned into 10 mm sections with a cryostat. The sections were mounted onto FisherBrand plus slides and fixed in 4% paraformaldehyde for 15 min. After rinsing with water, the slides were stained with 1% hematoxylin for 2 min and rinsed with running water. The slides were then stained with 2% eosin for 1 min, rinsed with water, dehydrated with an ascending ethanol series, and cover slipped with a xylene-based mounting medium. As shown in Fig. 20.2, the cerebral cortex of wild-type mice showed normal lamination with clear layer I and other discernible cortical layers (I–VI, Fig. 20.2A). By contrast, the POMGnT1 knockout did not show a clear layer I and the other layers could not be identified. In the cerebellum, the knockout often had ectopic granule cell clusters localized between the molecular layers of two folia (asterisks in Fig. 20.2D).
Abnormal Brain Development in POMGnT1 Knockout Mice
−/−
b-DG
Laminin overlay
IIH6C4
+/+
357
Figure 20.1 Western blot analysis of a-dystroglycan glycosylation. WGA-enriched glycoproteins were isolated from the brain and analyzed by Western blot and laminin overlay experiments. Note that the knockout exhibited markedly reduced IIH6C4 immunoreactivity and laminin binding activity. Abbreviations: þ/þ, wild type; /, POMGnT1 knockout.
4. Lamination Defects in the Neocortex of POMGnT1 Knockout Mice Reporter mice that express fluorescent proteins in specific neurons provide excellent tools to show tissue architecture. The transgenic mice, YFPH, express yellow fluorescent protein (YFP) in a subset of neurons in the layer V of the cerebral cortex (Feng et al., 2000). They were used to evaluate neuronal lamination in the cerebral cortex of POMGnT1 knockout mice.
358
Jianmin Liu et al.
-/-
+/+ A
I B II/III IV V VI
D
C ML
GCL
*
*
Figure 20.2 Histology of the cerebral and cerebellar cortex of POMGnT1 knockout mice. Coronal sections of the adult forebrain (A and B) and parasagittal sections of the adult cerebellum (C and D) were stained by H&E. (A and C) Wild type. (B and D) POMGnT1 knockout. Abbreviations: GCL, granule cell layer; ML, molecular layer.
YFPH mice were obtained from Jackson Laboratories. Hemizygous YFPH (þ) mice were crossed with heterozygous POMGnT1 knockout (þ/) mice to obtain POMGnT1 (þ/)/YFPH (þ) animals. These animals were crossed with POMGnT1 (þ/) animals to obtain POMGnT1 (/)/YFPH (þ) animals. Genotyping was carried out with specific primers to confirm identity. For YFPH transgene, the primers were forward AAGTTCATCTGCACCACC and reverse TCCTTGAAGAAGATGGTGCG. Genotyping of POMGnT1 alleles was conducted according to a previous publication (Liu et al., 2006). The adult brains were fixed by transcardial perfusion with 4% paraformaldehyde. The fixed brains were then dissected out and cut into 200 mm coronal sections with a vibratome (Ted Pella, Inc.). The sections were counterstained with propidium iodide or DAPI to visualize the nuclei. Fluorescence was visualized with a Zeiss LSM 510 confocal microscope. As shown in Fig. 20.3, YFP-labeled layer V neurons are located in a unique layer in the cerebral cortex of wild-type animals; the apical dendrites extend dorsally and the axons extend ventrally toward the corpus callosum (Fig. 20.3A). By contrast, YFP-labeled layer V neurons do not form a unique layer in the knockout. Instead, they were widely distributed throughout the neocortex. The orientation of dendrites is disorganized though their axons do extend ventrally into the corpus callosum (Fig. 20.3B). In the cerebellum of wild-type animals, YFP-labeled mossy fibers terminate within the granule cell layer (Fig. 20.3C), while, in the knockout, some
359
Abnormal Brain Development in POMGnT1 Knockout Mice
-/-
+/+ A
I
B
II/III IV
V
VI CC
CC Striatum
Striatum D
C
* ML GCL
GCL
ML *
ML
ML
Figure 20.3 YFPH reporter mice reveal lamination defect of POMGnT1 knockout. YFPH animals that were wild-type and knockout for POMGnT1 locus were perfused with 4% paraformaldehyde. The forebrains were cut into coronal sections (A and B) and the cerebella were cut into parasagittal sections (C and D). Note lamination defects for Layer V neurons in the knockout (B) and extension of mossy fiber beyond the molecular layer into the ectopic granule cell clusters (D).
mossy fibers pass the molecular layer and reach the ectopic granule cell clusters which were often found between the folia and cerebellar surface (Fig. 20.3D).
5. Analysis of the Pial Basement Membrane by Laminin Immunostaining The pial basement membrane serves as a boundary between the neural epithelium and the overlying pia-arachnoid space. Over migration of neurons into the meninges are expected to be caused by breaches in the pial basement membrane. Indeed, breaches in the pial basement membrane were found in patients with Fukuyama congenital muscular dystrophy
360
Jianmin Liu et al.
(Chiyonobu et al., 2005). Thus, the pial basement membrane of POMGnT1 knockout mice was analyzed by immunostaining with antibody against laminin, a major component of all basement membranes. E15.5 fetal heads and adult mouse brains of wild-type and POMGnT1 knockout were embedded in OCT medium and frozen in 2-methylbutane/ dry ice bath. Ten micrometers thick sections were cut in a cryostat and fixed with 4% paraformaldehyde in PBS. After rinsing in PBS, the sections were blocked with PBS containing 1% BSA, and then incubated with antilaminin antibody diluted in 1% BSA in PBS for 2 h. Sections were then rinsed in PBS, and incubated with FITC-conjugated secondary antibody. After 2-h incubation, sections were washed in PBS. Some sections were counterstained with DAPI to show nuclei. The sections were then covered in 1 mg/ml p-phenylenediamine/90% glycerol/0.1 PBS with cover slip and viewed with fluorescence microscopy. Results were shown in Fig. 20.4. In adult wild-type mice, strong laminin staining was observed at the cerebral cortical surface (pial basement membrane staining) and blood vessels. The pial basement membrane staining showed a continuous pattern without disruptions (arrows in Fig. 20.4A). However, in POMGnT1 knockout mice, the laminin staining pattern at the cerebral cortical surface was severely disrupted; showing a punctate pattern (Fig. 20.4B). Some punctate staining could also be observed in the upper half of the knockout neocortex. The blood vessel staining in the knockout appeared normal. Disruptions in the pial basement membrane were detected during development of the cerebral cortex. At E15.5, the pial basement membrane from wild type was continuous without disruptions at the cerebral cortical surface (arrows in Fig. 20.4C). However, the POMGnT1 knockout started to show the disrupted pial basement membrane staining at the cerebral cortical surface (arrowheads in Fig. 20.4D). Furthermore, the pial basement membrane was sandwiched between the diffuse cell zone (over migrated neurons in the pial arachnoid space) and the cortical plate. Similar disruptions of pial basement membrane also existed in the cerebellum of POMGnT1 knockout mice. While there are two pial basement membranes separating the cerebellar folia (arrows in Fig. 20.4E), one of the two pial basement membranes is absent in the example shown in Fig. 20.4F. In some locations, no pial basement membrane could be observed.
6. Analysis of the Pial Basement Membrane by Transmission Electron Microscopy While immunofluorescence staining with antibodies against components of the pial basement membrane strongly suggested disruptions of pial basement membrane in the knockout mice, the gold standard for basement
361
Abnormal Brain Development in POMGnT1 Knockout Mice
-/-
+/+ B
C
D
Adult
A
E15.5
DCZ CP
Cerebellum/P14
E
F
ML
ML ML
ML
Figure 20.4 Laminin immunostaining suggests disrupted pial basement membrane in POMGnT1 knockout. Coronal sections of adult neocortex (A and B), E15.5 neocortex (C and D), and parasagittal sections of P14 cerebella (E and F) were immunostained with anti-laminin. C, D, E, and F were counterstained with DAPI. (A, C, and E) Wild type. (B, D, and F) Knockout. Arrowheads in D indicate broken pial basement membrane. Abbreviations: CP, cortical plate; DCZ, diffuse cell zone; ML, molecular layer.
membrane identification is transmission electron microscopy (EM). Thus, EM analyses of the brain tissues were carried out. Tissue preparation: Newborn and adult brains were fixed by perfusion with 3.7% glutaraldehyde in PBS. After the brains were dissected, the regions of interest were postfixed in the same solution overnight. Fetal brains were fixed by immersion of the fetal heads or dissected brains in 3.7% glutaraldehyde overnight. Tissues were then trimmed to a size of 0.2 0.2 0.3 mm2 and washed three times with 0.1 M phosphate buffer. The tissues were then postfixed in 1% osmium tetroxide in phosphate buffer for 1 h at room temperature and washed three times with phosphate buffer.
362
Jianmin Liu et al.
The tissues were subsequently dehydrated in a series of ethanol (50, 70, 80, and 95% for 5 min each, and followed by absolute ethanol three times for 10 min each time). Afterwards, the tissues were then washed three times with propylene oxide, 10 min each, and then infiltrated with propylene oxide:Araldite 502 at a 1:1 ratio for 1 h in a shaker, followed by 1 h in 100% Araldite 502 in a vacuum before being embedded in a fresh change of Araldite and polymerized in a 60 ºC oven for 16–18 h. One micron thick sections were cut with a glass knife. The area of interest was located from the thick section under microscope. The plastic block was trimmed under an ultramicrotome. Thin sections of 80–100 nm were cut with a diamond knife using a Leica ultramicrotome and picked up on 200 mesh copper grids. The sections were then stained with 2.0% uranyl acetate for 8 min, and Reynold’s lead citrate (Polysciences) for 8 min. The samples were examined and photographed with a Tecnai T12 transmission electron microscope (FEI Company, Salem, MA). EM analysis showed no significant difference in the pial basement membrane at the cerebral cortical surface at earlier stages of development (E11.5) between the wild-type and the POMGnT1 knockout fetuses. However, starting at age of E13.5, the basement membrane in the knockout showed many breaches (Fig. 20.5B). While the pial basement membrane was continuous in the wild type (arrows in Fig. 20.5A), the POMGnT1 knockout showed many disruptions (arrowheads in Fig. 20.5B). As development proceeded, the pial basement membrane became covered by the over migrated neurons and located between the diffuse cell zone and the cortical plate. The broken pial basement membrane could be identified at E15.5 (arrowheads in Fig. 20.5D), E17.5, and newborn animals. However the pial basement membrane eventually disappeared before reaching adulthood as such pial basement membrane no longer existed at the surface of the neocortex in the adult (Fig. 20.5F). Only fragments of pial basement membrane could be observed. By contrast, the pial basement membranes in wild-type animals remained intact through all stages of development (arrows in Fig. 20.5A, C, and D).
7. Analysis of the Glia Limitans by GFAP Immunofluorescence Staining The pial basement membrane closely apposes the glia limitans at the surface of central nervous system. During the developmental period of the cerebral cortex, the glia limitans is composed of endfeet of radial glia. In the adult, the glia limitans is composed of astrocytes with high levels of glial fibrillary acidic protein (GFAP) expression. Thus, glia limitans in the adult mice can be identified by GFAP immunofluorescence staining.
363
Abnormal Brain Development in POMGnT1 Knockout Mice
−/−
E15.5
E13.5
+/+
itans
Adult
Glia lim
Pial fibroblast
500 nm
Figure 20.5 Transmission EM confirms disruptions in the pial basement membrane. Neocortical walls of E13.5 (A and B), 15.5 (C and D), and adult (E and F) were processed for transmission EM. (A, C, and E) Wild type. (B, D, and F) Knockout. Note the knockout pial basement membrane is discontinuous at E13.5 and 15.5 and absent in the adult section shown.
Brains of adult mice were embedded in OCT compound in cryomolds, quick-frozen in 2-methylbutane/dry ice bath, cryostat sectioned in the coronal plane at 10 mm, and mounted on SuperfrostPlus slides. The sections were blocked for 1 h with 1.0% BSA in PBS and then were incubated with rabbit anti-GFAP antibody (Sigma) overnight at 4 C. Sections were washed three times with PBS and incubated with 1:200 FITC-conjugated goat anti-rabbit IgG antibody for 2 h. After washing three times with PBS, the sections were counterstained with 0.10% DAPI (Sigma-Aldrich) for 10 min. Fluorescence staining was visualized and photographed with a Zeiss Axioskop upright fluorescence microscope.
364
Jianmin Liu et al.
-/-
+/+ A
B
C
D
Figure 20.6 GFAP immunostaining reveals defective glia limitans in POMGnT1 knockout. Coronal sections of adult neocortex (A and B) and parasagittal sections of P14 cerebella (C and D) were immunostained with anti-GFAP and counter stained with DAPI. (A and C) Wild type. (B and D) Knockout. Note absence of glia limitans at the neocortex and broken glia limitans in the cerebellum of knockout mice.
As shown in Fig. 20.6, GFAP staining showed a continuous line of bright staining at the cortical surface in the wild-type animals (arrows in Fig. 20.6A). In contrast, the GFAP staining at the cortical surface in knockout mice showed no continuity, indicating the absence of a glia limitans (Fig. 20.6B). Interestingly, the upper half of the POMGnT1 knockout cortex exhibited many GFAP-positive astrocytes, indicating the presence of reactive astrogliosis. Similar disruptions of the glia limitans were also observed in the cerebellum. Glia limitans of the cerebellum is composed of endfeet of Bergman glia. While there were two glia limitans separating the two cerebellar folia in the wild type (arrows in Fig. 20.6C), only one in the example is shown in Fig. 20.6D; the other was broken.
ACKNOWLEDGMENTS This work was supported by NIH grants NS066582 and HD060458 (H. H.), Natural Science Foundation of China grants 30870867(Y. Y.) and 30800346 (X. L.). The authors thank Mr. Noel Gray for reading the manuscript.
Abnormal Brain Development in POMGnT1 Knockout Mice
365
REFERENCES Biancheri, R., Bertini, E., Falace, A., Pedemonte, M., Rossi, A., D’Amico, A., Scapolan, S., Bergamino, L., Petrini, S., Cassandrini, D., Broda, P., Manfredi, M., et al. (2006). POMGnT1 mutations in congenital muscular dystrophy genotype–phenotype correlation and expanded clinical spectrum. Arch. Neurol. 63, 1491–1495. Brancaccio, A. (2003). An adhesion molecule involved in muscular dystrophies: structural and functional analysis of dystroglycan domains. Ital. J. Biochem. 52, 51–54. Campbell, K. P. (1995). Three muscular dystrophies: loss of cytoskeleton-extracellular matrix linkage. Cell 80, 675–679. Chiyonobu, T., Sasaki, J., Nagai, Y., Takeda, S., Funakoshi, H., Nakamura, T., Sugimoto, T., and Toda, T. (2005). Effects of fukutin deficiency in the developing mouse brain. Neuromuscul. Disord. 15, 416–426. Clement, E. M., Godfrey, C., Tan, J., Brockington, M., Torelli, S., Feng, L., Brown, S. C., Jimenez-Mallebrera, C., Sewry, C. A., Longman, C., Mein, R., Abbs, S., et al. (2008). Mild POMGnT1 mutations underlie a novel limb-girdle muscular dystrophy variant. Arch. Neurol. 65, 137–141. Durbeej, M., Henry, M. D., and Campbell, K. P. (1998). Dystroglycan in development and disease. Curr. Opin. Cell Biol. 10, 594–601. Ervasti, J. M., and Campbell, K. P. (1993). A role for the dystrophin-glycoprotein complex as a transmembrane linker between laminin and actin. J. Cell Biol. 122, 809–823. Feng, G., Mellor, R. H., Bernstein, M., Keller-Peck, C., Nguyen, Q. T., Wallace, M., Nerbonne, J. M., Lichtman, J. W., and Sanes, J. R. (2000). Imaging neuronal subsets in transgenic mice expressing multiple spectral variants of GFP. Neuron 28, 41–51. Grewal, P. K., Holzfeind, P. J., Bittner, R. E., and Hewitt, J. E. (2001). Mutant glycosyltransferase and altered glycosylation of alpha-dystroglycan in the myodystrophy mouse. Nat. Genet. 28, 151–154. Hehr, U., Uyanik, G., Gross, C., Walter, M. C., Bohring, A., Cohen, M., OehlJaschkowitz, B., Bird, L. M., Shamdeen, G. M., Bogdahn, U., Schuierer, G., Topaloglu, H., et al. (2007). Novel POMGnT1 mutations define broader phenotypic spectrum of muscle-eye-brain disease. Neurogenetics 8, 279–288. Hu, H., Yang, Y., Eade, A., Xiong, Y., and Qi, Y. (2007). Breaches of the pial basement membrane and disappearance of the glia limitans during development underlie the cortical lamination defect in the mouse model of muscle-eye-brain disease. J. Comp. Neurol. 502, 168–183. Liu, J., Ball, S. L., Yang, Y., Mei, P., Zhang, L., Shi, H., Kaminski, H. J., Lemmon, V. P., and Hu, H. (2006). A genetic model for muscle-eye-brain disease in mice lacking protein O-mannose beta1,2-N-acetylglucosaminyltransferase (POMGnT1). Mech. Dev. 123, 228–240. Longman, C., Brockington, M., Torelli, S., Jimenez-Mallebrera, C., Kennedy, C., Khalil, N., Feng, L., Saran, R. K., Voit, T., Merlini, L., Sewry, C. A., Brown, S. C., and Muntoni, F. (2003). Mutations in the human LARGE gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Hum. Mol. Genet. 12, 2853–2861. Michele, D. E., Barresi, R., Kanagawa, M., Saito, F., Cohn, R. D., Satz, J. S., Dollar, J., Nishino, I., Kelley, R. I., Somer, H., Straub, V., Mathews, K. D., Moore, S. A., and Campbell, K. P. (2002). Post-translational disruption of dystroglycan-ligand interactions in congenital muscular dystrophies. Nature 418, 417–422. Michele, D. E., and Campbell, K. P. (2003). Dystrophin-glycoprotein complex: posttranslational processing and dystroglycan function. J. Biol. Chem. 278, 15457–15460. Miyagoe-Suzuki, Y., Masubuchi, N., Miyamoto, K., Wada, M. R., Yuasa, S., Saito, F., Matsumura, K., Kanesaki, H., Kudo, A., Manya, H., Endo, T., and Takeda, S. (2009).
366
Jianmin Liu et al.
Reduced proliferative activity of primary POMGnT1-null myoblasts in vitro. Mech. Dev. 126, 107–116. Montanaro, F., and Carbonetto, S. (2003). Targeting dystroglycan in the brain. Neuron 37, 193–196. Oliveira, J., Soares-Silva, I., Fokkema, I., Gonc¸alves, A., Cabral, A., Diogo, L., Gala´n, L., Guimara˜es, A., Fineza, I., den Dunnen, J. T., and Santos, R. (2008). Novel synonymous substitution in POMGNT1 promotes exon skipping in a patient with congenital muscular dystrophy. J. Hum. Genet. 53, 565–572. Sato, S., Omori, Y., Katoh, K., Kondo, M., Kanagawa, M., Miyata, K., Funabiki, K., Koyasu, T., Kajimura, N., Miyoshi, T., Sawai, H., Kobayashi, K., et al. (2008). Pikachurin, a dystroglycan ligand, is essential for photoreceptor ribbon synapse formation. Nat. Neurosci. 11, 923–931. Takahashi, S., Sasaki, T., Manya, H., Chiba, Y., Yoshida, A., Mizuno, M., Ishida, H., Ito, F., Inazu, T., Kotani, N., Takasaki, S., Takeuchi, M., et al. (2001). A new beta-1,2N-acetylglucosaminyltransferase that may play a role in the biosynthesis of mammalian O-mannosyl glycans. Glycobiology 11, 37–45. Taniguchi, K., Kobayashi, K., Saito, K., Yamanouchi, H., Ohnuma, A., Hayashi, Y. K., Manya, H., Jin, D. K., Lee, M., Parano, E., Falsaperla, R., Pavone, P., et al. (2003). Worldwide distribution and broader clinical spectrum of muscle-eye-brain disease. Hum. Mol. Genet. 12, 527–534. Yang, Y., Zhang, P., Xiong, Y., Li, X., Qi, Y., and Hu, H. (2007). Ectopia of meningeal fibroblasts and reactive gliosis in the cerebral cortex of the mouse model of muscle-eyebrain disease. J. Comp. Neurol. 505, 459–477. Yoshida, A., Kobayashi, K., Manya, H., Taniguchi, K., Kano, H., Mizuno, M., Inazu, T., Mitsuhashi, H., Takahashi, S., Takeuchi, M., Herrmann, R., Straub, V., et al. (2001). Muscular dystrophy and neuronal migration disorder caused by mutations in a glycosyltransferase, POMGnT1. Dev. Cell. 1, 717–724.
C H A P T E R
T W E N T Y- O N E
Investigating the Functions of LARGE: Lessons from Mutant Mice Jane E. Hewitt Contents 1. Overview 2. Human LARGE and Relevance to Disease 3. Identification of Mice Carrying Mutations in Large 3.1. Veils and enr—two additional mutant alleles of Large 4. Loss of Functional Large Protein Results in Hypoglycosylation of a-Dystroglycan 5. Phenotypes of Mice with Mutations in Large 5.1. Embryonic phenotypes 5.2. Muscle phenotype 5.3. Central nervous system 5.4. Peripheral nervous system 5.5. Ocular defects 6. Expression of LARGE Genes 6.1. Expression of Large in adult CNS by in situ hybridization 7. Does Large Encode a Functional Glycosyltransferase? 8. Largemyd Mice as a Model for Therapeutic Approaches to Dystroglycanopathy Acknowledgments References
368 369 370 372 373 374 374 375 376 377 377 378 378 379 381 381 381
Abstract The Large gene encodes a predicted glycosyltransferase of undefined biological activity. However, one important target of the protein is known, a-dystroglycan. This protein is a key component of the dystrophin-associated glycoprotein in skeletal muscle, which links cytoskeletal actin to the extracellular matrix (ECM), stabilizing the muscle sarcolemmal membrane. a-Dystroglycan binds to extracellular proteins such as laminin through a heavily glycosylated mucin-like domain. Functional Large protein is required for full glycosylation and ligandbinding activity of dystroglycan. The role of Large in this pathway was identified Institute of Genetics, School of Biology, Queen’s Medical Centre, University of Nottingham, Nottingham, United Kingdom Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79021-2
#
2010 Elsevier Inc. All rights reserved.
367
368
Jane E. Hewitt
by positional cloning of the mutation in the myodystrophy mouse, an animal model of muscular dystrophy that also has defects in the central and peripheral nervous system and retinal abnormalities. Mice deficient in Large are models for a group of human disorders that have defective a-dystroglycan glycosylation.
1. Overview Three different strains of mice carrying loss-of-function mutations in the Large gene are animal models for a group of congenital muscular dystrophies termed dystroglycanopathies. Dystroglycan is a core member of the dystrophin-associated glycoprotein complex (DGC), which links the muscle cell cytoskeleton to the extracellular matrix (ECM) via dystrophin and acts as a shock absorber protecting the muscle fiber from mechanical damage (Henry and Campbell, 1999). Essential for normal muscle function, dystroglycan also has important roles in a wide range of tissues, including the central and peripheral nervous systems, and in the assembly and maintenance of basement membrane and epithelial structures (Durbeej et al., 1998). Dystroglycan is synthesized as a precursor molecular that is posttranslationally cleaved into a- and b-subunits (Ibraghimov-Beskrovnaya et al., 1993). Within the DGC, the a-subunit is located outside the muscle membrane and binds ECM proteins such as laminin and agrin. a-Dystroglycan is extensively glycosylated, particularly in a central-mucin-like domain that is highly decorated with O-glycans that include unusual O-mannosyl structures. Correct glycosylation of a-dystroglycan is essential for normal function of the protein, in particular its ligand-binding activity, making this system an important paradigm for studying glycan function. The precise structure of the glycans involved in laminin binding is unclear, although O-mannosyl glycans are known to be required. Dissecting the pathways leading to functional glycosylation of a-dystroglycan is pertinent to understanding many human diseases. Recessive mutations in at least six genes (POMT1, POMT2, POMGnT1, Fukutin, FKRP, and LARGE), several of which are known to play a role in synthesis of O-linked mannose structures, result in the failure of dystroglycan to be properly glycosylated and cause genetic forms of muscular dystrophy (reviewed by Muntoni et al., 2004b). a-Dystroglycan also acts as a cellular receptor for several medically important viruses; intriguingly, both viral and ECM binding require the same glycan structures on the protein (Kunz et al., 2005). Finally, many cancers show loss of a-dystroglycan glycosylation, which may be correlated with tumor progression (Sgambato and Brancaccio, 2005). Here, I focus on mouse models that have null mutations, one of the genes that acts in this dystroglycan glycosylation pathway—LARGE. Mice
Mutant Mice for LARGE
369
lacking a functional Large gene do not glycosylate dystroglycan correctly, particularly in skeletal muscle and neuronal tissues, and many aspects of their phenotypes mimic clinical aspects of human dystroglycanopathies.
2. Human LARGE and Relevance to Disease The mouse Large mutants are animal models for a group of human disorders known collectively as dystroglycanopathies. These clinically important, autosomal recessive conditions are caused by mutations in genes that are required for dystroglycan to be functionally glycosylated (Muntoni et al., 2004b). The dystroglycanopathies show overlapping clinical phenotypes (in particular, muscular dystrophy, CNS abnormalities, and eye defects) that are presumed to be primarily due to this deficiency in dystroglycan glycosylation. Although no patients with mutations in dystroglycan have been reported, a patient with a heterozygous deletion of the gene showed CNS abnormalities similar to those seen in some of the dystroglycanopathies (Frost et al., 2010). Several conditional knockouts of dystroglycan have been generated and these recapitulate many tissuespecific aspects of the disorders (Cohn et al., 2002; Moore et al., 2002; Saito et al., 2003; Satz et al., 2008). Although LARGE is necessary for correct glycosylation of a-dystroglycan, compared to other genes in this pathway very few mutations in LARGE have been identified in human patients. While this may in part reflect the difficulty in screening the gene (it is 650 kb), it is probable that mutations in LARGE are rare. However, understanding the functions of LARGE will be relevant to all disorders within this group; first, the considerable overlap in phenotype points to common molecular pathways, and second, overexpression of LARGE is able to rescue defects in other dystroglycanopathy genes and therefore is a potential therapeutic target (Barresi et al., 2004). There are three well-documented cases of patients with causative mutations in LARGE. An individual with a homozygous intragenic, loss-offunction deletion in LARGE presented with Walker–Warburg syndrome, a severe form of dystroglycanopathy (van Reeuwijk et al., 2007). A less severely affected patient was found to be a compound heterozygote for a missense and a truncating mutation (Longman et al., 2003), the milder phenotype may be due to residual function of mutant protein. A third patient was reported to be homozygous for the missense mutation W495R (Mercuri et al., 2009), an evolutionarily invariant residue within one of the putative catalytic domains. Altered glycosylation of dystroglycan is likely to be relevant to other diseases in humans. a-Dystroglycan is a cellular receptor for several
370
Jane E. Hewitt
arenaviruses, including lymphocytic choriomeningitis virus and Lassa fever virus (Cao et al., 1998). LARGE is relevant here because virus binding and infectivity are dependent on the same LARGE-dependent glycan structures as laminin binding (Kunz et al., 2005). Population genetics studies provide strong evidence for positive selection of LARGE during human evolution and this is likely to be related to its role in viral infectivity (Fumagalli et al., 2010; Sabeti et al., 2007). LARGE has a role in development of the CNS and is one of a set of genes identified as candidates for autism by network analysis (van der Zwaag et al., 2009). Thus, it is likely that LARGE has been subjected to a number of selective pressures during evolution. The high population frequency of mutations in other genes in the a-dystroglycan pathway is suggestive of heterozygote advantage, this might be due to a link between reduced glycosylation and increased susceptibility to viral infection (Emery, 2008). The role of dystroglycan in basement membrane and epithelial assembly and its interaction with the ECM pointed toward a possible involvement in tumor progression (Sgambato and Brancaccio, 2005). A number of cancers of epithelial and neural origin show an association between loss of adystroglycan and tumor progression. Furthermore, initial interest in the human LARGE gene was due to its location within a region of chromosome 22 that is often deleted in meningioma (Dumanski et al., 1987; Peyrard et al., 1999). In some tumor cell lines, a-dystroglycan is expressed at normal levels but is not functionally glycosylated, and thus not able to function as an ECM receptor, due to silencing of LARGE (Beltran-Valero de Bernabe´ et al., 2009). Alternatively, decreased a-dystroglycan may be due to loss of other glycosyltransferases that cooperate with LARGE, such as b-3-N-acetylglucosaminyltransferase-1 (Bao et al., 2009).
3. Identification of Mice Carrying Mutations in Large Unlike the other engineered mouse models of dystroglycanopathy discussed in this issue, a loss-of-function mutation in Large was first described as a spontaneous mutation. The myodystrophy (myd ) mutation arose at the Jackson Laboratory in the mid 1970s (Lane et al., 1976). This mutant was initially reported as a model of human muscular dystrophy, the most apparent aspect of the phenotype being a classical progressive myopathy. Homozygous myd mice are unable to splay their high legs when held aloft by the tail, instead clasping them together, accounting for the alternative locus name of ‘‘froggy.’’ However, this is a common characteristic of mice affected by neuromuscular phenotypes and not specific to this particular mutant.
Mutant Mice for LARGE
371
The myd mutant started to attract interest in the late 1990s, because lowresolution synteny mapping data suggested it may be a naturally occurring mouse model of the neuromuscular disorder facioscapulohumeral muscular dystrophy (FSHD), the mutation for which maps to chromosome 4q35 (Mathews et al., 1995; Mills et al., 1995). However, more detailed mapping indicated that myd and FSHD were not due to mutations in homologous genes (Grewal et al., 1998). The high degree of similarity of genome organization between humans and mice enabled a bioinformatics-assisted approach using the near-completion human genome sequence to produce a detailed gene synteny map of the myd locus. Sequencing of candidate genes then identified a loss-of-function mutation within the gene Large (Grewal et al., 2001). As the human orthologue (LARGE) maps to chromosome 22q (Peyrard et al., 1999), this was also conclusive proof that the myd locus was not homologous to FSHD in humans (Grewal and Hewitt, 2002). LARGE (like-acetylglucosaminyltransferase) was so named by Peyrard et al. because of two properties of the gene, the presence of a predicted glycosyltransferase domain in the encoded protein and the size of LARGE at 650 kb. Indeed, it is the biggest gene on human chromosome 22. There are 16 exons with intron sizes ranging from 2 to over 150 kb (Peyrard et al., 1999), although the coding region is only 2 kb. The mouse Large gene is similar in size and structure to human, although there are only 15 exons (Grewal and Hewitt, 2002; Grewal et al., 2005). The myd deletion spans a region of approximately 100 kb and removes exons 4–6, which are equivalent to exons 5–7 in the human gene (Browning et al., 2005; Grewal et al., 2001). This produces a frameshift in the mutant mRNA and formation of a premature stop codon (Fig. 21.1). This mutation is now designated Largemyd. LARGE is highly conserved, with orthologues in almost all animal genomes, including sponges and cnidarians (Grewal et al., 2005). Drosophila is perhaps the most noteworthy exception, although other insects such as bees and wasps do have a LARGE gene (Grewal et al., 2005). Vertebrates have two paralogues, LARGE and LARGE2, that arose from a gene duplication event (Grewal et al., 2005). In mice, only Large is expressed at significant levels in neuronal and muscle tissues. The myd phenotype shows recessive inheritance and homozygous mutant mice have a much-reduced lifespan and reproductive fitness. Therefore, colonies are maintained by crossing heterozygotes. Due to the size of the causative deletion (100 kb), we developed a multiplex PCR assay for genotyping to facilitate identification of heterozygotes (Browning et al., 2005). This assay uses two pairs of primers: one product spans the deletion breakpoints and hence amplifies a product only from the mutant allele, while the other product is deleted in myd and only amplifies the wild-type allele. A typical genotyping result is shown in Fig. 21.2.
372
Jane E. Hewitt
A Wild-type locus B
1
2
3 4 5
6
7 8 9 10 11 12 13 14
15
myd
vls C
enr 160 kb
Figure 21.1 Genomic organization of mutant alleles of Large. A schematic (not to scale) showing the three different mouse mutations that result in loss of function of Large. The mouse gene has 15 exons (the human gene has 16, due to an additional 50 UTR exon) and spans approximately 550 kb. Coding regions are shaded gray; the exon encoding the coiled-coil domain is hatched. In the myd and the vls mutants, the deletions remove exons 4–6 or 3–5, respectively. In both cases, the remaining exons are spliced correctly but the deletion alters the reading frame and introduces a premature stop codon. In the enr mutation, a transgene insertion of many copies of a 1.3 kb segment of the myelin basic protein promoter approximately 160 kb downstream of the coding region (indicated by arrowheads) causes silencing of Large transcription.
3.1. Veils and enr—two additional mutant alleles of Large After the Largemyd mutation was identified, two additional mutant alleles of this gene were reported. Interestingly, both of these were originally investigated due to ocular or peripheral nervous system (PNS) abnormalities. These two tissues, along with skeletal muscle, mirror the main constellation of affected organs in human dystroglycanopathies (Muntoni et al., 2004b). The veils mutation (Largevls) also arose spontaneously. Genetic mapping of vls showed it to be allelic to myd (Lee et al., 2005). The genetic abnormality in the vls mutant is also a genomic deletion that introduces a premature stop codon into the resulting mRNA; in this case removing exons 3–5 (Fig. 21.1). It is possible that the size and genomic properties of the Large gene may predispose it to deletions, and it is noteworthy that one of the few mutations reported in the human LARGE gene is also an intragenic deletion (van Reeuwijk et al., 2007). In contrast to myd and vls, the enr mutation is engineered, arising from a nontargeted transgenic insertion screen using part of the myelin basic protein (MBP) promoter (Kelly et al., 1994). The enr mutant carries a tandem array of an estimated 120 copies of this 1.3 kb MBP promoter segment. Subsequently, this insertion was shown to be located approximately 160 kb downstream of the Large coding region (Levedakou et al., 2005). Mutant enr mice have a neuromuscular phenotype with impaired
373
Mutant Mice for LARGE
–
+/+
+/m
m/m
+/+
m/m
+/m
+/m
m/m
+/+
+/+ 421 bp 162 bp
Control PCRs
Littermates
Figure 21.2 Genotyping the Large mutation. Representative multiplexed PCR results from a set of controls of known genotypes and 1 l of four pups. Both sets of primers were used in the same PCR reaction using 50 ng DNA and an annealing temperature of 59 C. Products were separated on a 3% agarose gel. Primers GT4F and GT4R amplify a 162 bp product from the wild-type allele only, this region is deleted in the mutant. Primers MydF3 and MydR2 amplify a 421 bp product only from the mutant allele (on the wild-type chromosome these primers are separated by 100 kb). Primer sequences: GT4F 50 GGCCGTGTTCCATAAGTTCAA 30 , GT4R 50 GGCATACGCCTCTGTGAAAAC 30 , MydF3 50 ATCTCAGCTCCAAAGGGTGAAG 30 , MydR2 50 GCCAATGTAAAATGAGGGGAAA 30 . myd
peripheral nerve regeneration (Rath et al., 1995). The transgene appears to disrupt or interfere with essential regulatory regions, as expression of Large mRNA is significantly reduced in the mutant (Fig. 21.1). Of the genes in this region, only expression of Large is altered and the myd and enr mutations fail to complement in genetic crosses. Thus, the enr phenotype appears to be entirely due to this downregulation of Large (Levedakou et al., 2005). The similarity in tissue distribution of the phenotypes between all three mutants suggests that the suppression of Large expression is complete in Largeenr mice.
4. Loss of Functional Large Protein Results in Hypoglycosylation of a-Dystroglycan Large is predicted to encode a bifunctional glycosyltransferase, based on two putative catalytic domains with sequence similarity to separate families of glycosyltransferases (Grewal et al., 2001; Peyrard et al., 1999). The first clue to a biological target for the protein came from immunoblot analysis of the DGC, which links the muscle cell cytoskeleton to the ECM via dystrophin. Mutations in components of the DGC are important contributors to inherited muscular dystrophies (Durbeej and Campbell, 2002). In Largemyd mutants, we observed a loss of immunoreactivity of skeletal muscle with the a-dystroglycan monoclonal antibodies VIA41 and IIH6, while other components of the DGC including the b-subunit of dystroglycan appeared to be normal (Grewal et al., 2001). Both VIA41 and IIH6 recognize epitopes that are present only on the fully glycosylated form of the
374
Jane E. Hewitt
protein, suggesting that loss of Large results in aberrant posttranslational modification of a-dystroglycan (Grewal et al., 2001). This hypothesis was confirmed by the demonstration that a polyclonal antibody (GT-20) raised against a hypoglycosylated form of a-dystroglycan recognizes a reduced molecular weight form of the protein in Largemyd mice (Michele et al., 2002). Hypoglycosylation of dystroglycan is not confined to skeletal muscle of the mutant mice, but also seen in cardiac muscle and in both the central and the peripheral nervous systems (Grewal et al., 2001; Michele et al., 2002), tissues that express high levels of Large mRNA. Hypoglycosylation of adystroglycan is similarly observed in both the Largevls and Largeenr mutants (Lee et al., 2005; Levedakou et al., 2005). Hypoglycosylation of a-dystroglycan is also characteristic of dystroglycanopathy patients and is presumed to underlie many or most of the clinical symptoms (Muntoni et al., 2004b).
5. Phenotypes of Mice with Mutations in Large Although initial analyses focused on skeletal muscle, the myd phenotype has been shown to include abnormalities in other tissues, particularly the central nervous system (CNS). In this section I summarize phenotypic data for all three alleles of Large: Largemyd, Largevls, and Largeenr. As each of these have loss-of-function mutations, it is likely that observations in one strain are applicable to the other mutants. However, the severity and phenotypic expression of the mutations are likely to be modified by the genetic background of the particular allele examined.
5.1. Embryonic phenotypes Mice homozygous for Large null mutations are viable, although with a reduced lifespan. In contrast, null mutants of dystroglycan itself (Williamson et al., 1997) or of many of the other genes required for functional glycosylation show very early embryonic lethality (Takeda et al., 2003; Willer et al., 2004). This phenotype is thought to be due to a requirement of functionally glycosylated dystroglycan for basement membrane formation (Takeda et al., 2003; Willer et al., 2004). One possible reason for the viability of Large mutants is the paralogous gene Large2, which may function to glycosylate dystroglycan during early embryonic development (Grewal et al., 2005). Alternatively, glycosylation of dystroglycan by Large may only be essential after birth. During embryogenesis, in situ hybridization indicates that Large expression is confined to neuronal cell types with very little expression in developing muscle (unpublished data).
Mutant Mice for LARGE
375
Despite the apparent normal development of Largemyd mice, in our breeding colony we obtain significantly fewer homozygous mutants than expected (unpublished data). Observation of newborn litters shows that some mutant mice are notably runted, develop hypoxia, and die soon after birth. A similar perinatal phenotype has been described for Fkrp knockdown mice, although in this model no homozygous mutants survive more than 24 h (Ackroyd et al., 2009). At least one of the two engineered mouse mutants for the gene encoding O-linked mannose b1,2N-acetylglucosaminyltransferase-1 (Pomgnt1) also show perinatal lethality with more than 60% homozygotes reported as dying within 3 weeks of birth (Miyagoe-Suzuki et al., 2009). Thus, early postnatal lethality possibly accounts for the observed reduction in viable homozygous Largemyd mutants, although a more detailed analysis of embryonic phenotypes in this mutant is clearly warranted.
5.2. Muscle phenotype The myodystrophy mutant was initially described as a progressive myopathy affecting skeletal and cardiac muscles (Lane et al., 1976; Meier and MacPike, 1977). Largemyd mice show a progressive myopathy in limb and truck muscles, with abnormalities of muscle structure visible by 3 weeks of age. On histological examination, muscle fibers show necrosis and regeneration, with features typical of myopathy, including variation in fiber size and central nuclei (Mathews et al., 1995). There is no fiber-type specificity (Lee et al., 2005). The myopathy is associated with reduced muscle function as the extensor digitorum longus (EDL) muscle in 3–5-month-old Largemyd mice shows significant reductions in both maximum and specific force (Han et al., 2009). Loss of sarcolemmal membrane integrity was demonstrated in skeletal muscle and diaphragm by accumulation of Evans blue dye, which does not cross the normal skeletal muscle membrane (Holzfeind et al., 2002). Electron microscopy shows the basal lamina of muscle fibers to be thin or absent and generally disorganized and often detached from the underlying plasma membrane (Han et al., 2009; Holzfeind et al., 2002). However, in cardiac tissue, the dystrophic phenotype is milder with limited accumulation of Evans blue dye and few signs of muscle abnormalities before the mice are 2-month-old (Holzfeind et al., 2002). Immunohistochemistry, immunoblotting, and sucrose gradient fractionation assays of Largemyd muscle all show that the DGC is intact within the sarcolemmal membrane (Grewal et al., 2001; Han et al., 2009; Holzfeind et al., 2002). In many muscular dystrophies, mutation of one component often results in loss of the whole complex from the sarcolemmal membrane. However, in Large mutants, the DGC is intact but the hypoglycosylated a-dystroglycan produced in the skeletal muscle lacks laminin-binding
376
Jane E. Hewitt
activity. As a consequence, the anchorage between the basal lamina and the sarcolemma membrane is weak and the muscle is prone to damage. Largemyd and Largeenr mice have aberrant neuromuscular junctions (NMJs), with excessive nerve sprouting and an increase in the size of the endplate zone (Herbst et al., 2009; Levedakou and Popko, 2006; Levedakou et al., 2005), indicating that the interaction between a-dystroglycan and the ECM is also important at the NMJ. Electron microscopy showed fewer synaptic folds and abnormal nerve endings at the junctions in Largemyd (Taniguchi et al., 2006). Previous work has demonstrated a role for dystroglycan in maintenance and stability, rather than in establishment of the NMJ (Coˆte´ et al., 1999). Consistent with this model, NMJ abnormalities in Largemyd mice are minor at birth and become more pronounced with age (Herbst et al., 2009).
5.3. Central nervous system In the cortex and cerebellum, the presence of misplaced neurons in Largemyd mice is indicative of defects in the regulation of neuronal migration (Holzfeind et al., 2002; Michele et al., 2002). The glia limitans shows localized disruption as evidenced by discontinuities in laminin, perlecan, and agrin localizations, although these proteins show normal staining at vascular basement membranes (Michele et al., 2002; Rurak et al., 2007). However, there is a failure of targeting of the potassium channel Kir4.1 and the water permeable channel aquaporin 4 (AQP4) to both the glia limitans and the perivascular astrocyte endfeet within the CNS (Michele et al., 2002; Rurak et al., 2007), probably as a consequence of loss of syntrophins from the DGC (Rurak et al., 2007). The precise molecular mechanisms underlying the aberrant neuronal migration are unclear, but are thought likely to include disruption of the basal lamina and/or failure in neuronal–glia interactions (Michele et al., 2002; Qu and Smith, 2005; Qu et al., 2006). A similar pattern of defective neuronal migration is seen in the cortex and cerebellum of Pomgnt1-deficient mice, which also fail to glycosylate a-dystroglycan normally (Lui et al., 2006). Conditional deletion of dystroglycan in the mouse CNS results in a very similar neuronal migration phenotype to that seen in Large mutant mice, consistent with dystroglycan being the primary target for glycosylation by Large (Moore et al., 2002). Neuronal migration defects in these mutants are not confined to the cortex and cerebellum. In both Largemyd and Largevls mice, the basilar pons (a hindbrain nucleus involved in sensory-motor integration) is absent (Litwack et al., 2006; Qu et al., 2006). Instead, there are clusters of ectopic cells expressing markers typical of the pons, again indicating a failure in neuronal migration (Litwack et al., 2006). As pontine neurons do not
Mutant Mice for LARGE
377
associate with the radial glial scaffold, but undergo tangential migration, this suggests roles for Large in other migrational processes in the CNS.
5.4. Peripheral nervous system Early studies provided the first evidence for a defect in the PNS, with description of irregular and nonmyelinated axons in Largemyd mice (Rayburn and Peterson, 1978). Similar abnormalities are seen in Largeenr mice (Levedakou et al., 2005), along with reduced forelimb grip strength and a reduction in nerve conduction velocity. Nerve regeneration following crush injury is also defective in Largeenr mice (Rath et al., 1995). In both Largemyd and Largeenr, sciatic nerve showed reduced staining for both IIH6 and VIA41 monoclonal antibodies but not for core a-dystroglycan antibody (Levedakou et al., 2005). Glycosylation of a-dystroglycan is important for correct laminin interaction and organization of the myelin sheath (Court et al., 2009). Again, the link between the Large mutation and loss of functional a-dystroglycan is supported by the production of similar phenotypes by conditional depletion of the protein in Schwann cells (Saito et al., 2003). However, one difference is that the aberrant sodium channel distribution in the PNS seen in complete dystroglycan knockouts is not present in the Large mutants (Levedakou et al., 2005; Saito et al., 2003), consistent with the view that the b-subunit of dystroglycan is required for sodium channel localization.
5.5. Ocular defects Initial studies did not observe obvious morphological defects in the Largemyd eye (Holzfeind et al., 2002; Michele et al., 2002), although the mice display abnormalities in dark-adapted electroretinographic (ERG) analysis (Holzfeind et al., 2002). Similar ERG abnormalities were subsequently reported by Lee et al. (2005) in both Largemyd and Largevls mutants. Patients with a severe form of dystroglycanopathy (Muscle Eye Brain disease) also show b-wave attenuation (Santavuori et al., 1989). Formation of the photoribbon synapse depends on the interaction between functionally glycosylated a-dystroglycan and the ligand pikachurin (Sato et al., 2008). In contrast to earlier reports, Lee et al. also reported distinctive retinal morphological abnormalities in both Largemyd and Largevls mutants. Indeed, the vls mutant was named because of the presence of ‘‘veil-like’’ fibrous tissue in the vitreous body (Lee et al., 2005). Leakage of fluorescein was observed from retinal vasculature, although the blood vessel basal lamina appeared normal. Other abnormalities included disorganization of astrocytes and the ganglion cell layer (Lee et al., 2005). Within the retina, dystroglycan and other components of the DGC are known to reside in the vasculature, the inner limiting membrane (ILM), and
378
Jane E. Hewitt
the outer plexiform layer (OPL) (Dalloz et al., 2001; Montanaro et al., 1995), all of which show abnormalities in Largemyd and Largevls mutants (Lee et al., 2005). Within the retina, there appear to be differential requirements for glycosylated a-dystroglycan; in the OPL, as in skeletal muscle, the DGC appears to form correctly, but in the ILM the DGC fails to be assembled (Lee et al., 2005). Unlike in the CNS, targeting of the channel proteins Kir4.1 and AQP4 to perivascular astrocyte endfeet is not disrupted in the retina (Rurak et al., 2007). The use of mouse models can therefore highlight tissue-specific differences in dystroglycan function. In most tissues, there is a general similarity in the defects associated with complete loss of dystroglycan, as generated by conditional gene knockouts, and those seen in Large mutants (Cohn et al., 2002; Moore et al., 2002; Saito et al., 2003; Satz et al., 2008). However, there are some subtle differences. Some of these are probably due the fact that in the Large mutants the bdystroglycan subunit is intact and often appears to be targeted correctly while in the conditional mutants both subunits are usually lost. For example, b-dystroglycan rather than a-dystroglycan probably plays a key role in channel localization (Satz et al., 2009). However, it is possible that Large has additional targets for glycosylation, although none have yet been identified.
6. Expression of LARGE Genes By Northern blotting, LARGE is expressed in a wide range of human tissues, with highest levels in brain, skeletal muscle, and heart (Peyrard et al., 1999). Dot blot analysis on a wider selection of human tissue RNA showed a similar distribution (Grewal et al., 2005). Mice have a similar tissue distribution of Large expression to human. The expression of the paralogous gene Large2 is almost completely absent from neuronal tissues and skeletal muscle, but high in epithelial structures (Fujimura et al., 2005; Grewal et al., 2005; Rurak et al., 2007).
6.1. Expression of Large in adult CNS by in situ hybridization Large expression in the adult mouse cerebellum has previously been demonstrated by in situ hybridization, where it was reported to be present in both Purkinje and Bergmann glial cells (Qu and Smith, 2005). Large is also expressed in neurons in the developing hindbrain (Qu et al., 2006). We have also examined expression of Large and the paralogous gene Large2 by in situ hybridization using frozen or wax sections, as described in Rex and Scotting (1999). Briefly, probe templates were generated by PCR and cloned into pGEM T-EASY vector (Promega). Digoxigenin-labeled
Mutant Mice for LARGE
379
antisense probes were produced using a T7/Sp6 labeling kit (Roche). For Large, the probe corresponded to 125–1716 bp of GenBank Accession no. NM_010687. After hybridization overnight at 70 C, sections were washed and bound probe detected using alkaline-phosphatase anti-DIG Fab fragments (Roche), followed by incubation in NBT/BCIP color detection solution for 24–36 h. Control sense probes to the equivalent region gave no staining (not shown). In adult CNS, there is widespread staining for Large expression (Fig. 21.3), while we saw no evidence for Large2 expression, consistent with published RT-PCR data (Fujimura et al., 2005; Grewal et al., 2005; Rurak et al., 2007). In contrast to Qu and Smith (2005), in adult mouse cerebellum, we saw very strong staining for Large in Purkinje cells but no staining in the Bergmann glia. This distribution of Large mRNA in the CNS reflects the pattern of abnormalities seen in Largemyd mice; aberrant neuronal migration in the cortex, cerebellum, and hindbrain; and defects in the dentate gyrus (Holzfeind et al., 2002; Michele et al., 2002). The strong expression in the olfactory bulb, where dystroglycan is also expressed (Zaccaria et al., 2001), suggests that Largemyd mice may also have defects in the olfactory system.
7. Does Large Encode a Functional Glycosyltransferase? Since the discovery of the relationship between Large and functional glycosylation of a-dystroglycan, the biochemical activity of the encoded has been the subject of much interest. Sequence homology is strongly suggestive of an enzymatic function as overexpression of the protein in a wide range of cultured cells results in addition of the IIH6 epitope to dystroglycan (Barresi et al., 2004; Brockington et al., 2005; Fujimura et al., 2005; Grewal et al., 2005; Kanagawa et al., 2009; Patnaik and Stanley, 2005). Therefore, a direct role for the protein as a glycosyltransferase is highly likely, but not yet proven and no in vitro assay system has yet been developed. By using Chinese hamster ovary (CHO) cells that have mutations in specific glycan pathways, it appears that when overexpressed Large can modify either Olinked or N-linked glycans (Aguilan et al., 2009; Patnaik and Stanley, 2005), although the normal in vivo acceptors are generally believed to be Omannose glycans when overexpressed the enzyme is promiscuous in its choice of acceptor glycan. Coexpression of human LARGE and tagged a-dystroglycan constructs in cultured cells demonstrated that amino acids 313–408 within the mucin domain are also necessary (but not sufficient) for induction of the IIH6positive glycan and that this activity requires an interaction between
380
Jane E. Hewitt
A
B CA
DG
C
D
Figure 21.3 In situ hybridization of Large expression in mouse adult brain. Images of representative in situ experiments: Large expression is denoted by blue staining. Scale bar is 50 mm. (A) In the hippocampus Large transcripts were detected in both the granule cell layer of the dentate gyrus (DG) and the pyramidal cell layers of the cornu ammonis (CA), with staining reproducibly weaker in the CA3 region. Many, but not all cells in the cortex also showed Large expression. (B, C) Large expression was strong the Purkinje cell layer of the cerebellum but no staining was visible in granule or Bergmann glial cells. (D) Large expression was widespread in the olfactory bulb.
LARGE and the N-terminal domain of dystroglycan (Kanagawa et al., 2004). LARGE can also interact or cooperate with other glycosyltransferases such as b-3-N-acetylglucosaminyltransferase-1 (Bao et al., 2009). Recently, Yoshida-Moriguchi et al. (2010) in an elegant study showed that treating partially purified a-dystroglycan from mouse muscle with cold aqueous hydrofluoric acid (which cleaves phosphodiester linkages) resulted in a reduction in mass and loss of both the IIH6 epitope and lamininbinding activity. Significantly, similar treatment of a-dystroglycan from Largemyd mice did not result in a mass reduction. Mass spectroscopy and NMR analyses of purified a-dystroglycan produced using a HEK293 expression system identified a phosphorylated O-mannosyl trisaccharide structure (Yoshida-Moriguchi et al., 2010). In skeletal muscle from Largemyd mice, but not controls, a-dystroglycan could be captured by metal affinity chromatography, using beads that bind to monoester- but not diester-linked
Mutant Mice for LARGE
381
phosphorylated compounds. Taken together, this data indicate that Large acts downstream of the formation of this phosphorylated mannose glycan.
8. Largemyd Mice as a Model for Therapeutic Approaches to Dystroglycanopathy Mutants in Large will be useful in vivo systems for assessing therapeutic strategies for dystroglycanopathy. Overexpression of LARGE in vivo using viral vectors was shown to restore IIH6 immunoreactivity and lamininbinding activity to Largemyd skeletal muscle (Barresi et al., 2004). However, despite the demonstration that Large functions in glycosylation of O-mannosyl glycans in vivo (Yoshida-Moriguchi et al., 2010), overexpression of LARGE can also restore functional glycosylation of dystroglycan in cells that lack other glycosyltransferase components of this pathway such as POMT1 or POMGnT1 (Barresi et al., 2004; Kanagawa et al., 2009). Again, this indicates that the protein can act on alternative glycan targets. These proof of principle experiments indicate that increasing LARGE expression or activity, perhaps by small molecule strategies, might be a therapeutic route that is generally applicable to dystroglycanopathies (Muntoni et al., 2004a). There is still much to discover about this enigmatic and fascinating gene.
ACKNOWLEDGMENTS Thanks to Paul Scotting, Jenny McLaughlan, and Jannine Clapp for help with in situ hybridization analysis. Work in the author’s laboratory on the Largemyd mouse mutant has been supported by The Wellcome Trust, The Biotechnology and Biological Sciences Research Council, UK, and The Muscular Dystrophy Association, USA.
REFERENCES Ackroyd, M. R., Skordis, L., Kaluarachchi, M., Godwin, J., Prior, S., Fidanboylu, M., Piercy, R. J., Muntoni, F., and Brown, S. C. (2009). Reduced expression of fukutin related protein in mice results in a model for fukutin related protein associated muscular dystrophies. Brain 132, 439–451. Aguilan, J. T., Sundaram, S., Nieves, E., and Stanley, P. (2009). Mutational and functional analysis of Large in a novel CHO glycosylation mutant. Glycobiology 19, 971–986. Bao, X. F., Kobayashi, M., Hatakeyama, S., Angata, K., Gullberg, D., Nakayama, J., Fukuda, M. N., and Fukuda, M. (2009). Tumour supressor function of laminin-binding a-dystroglycan requires a distinct 3-N-acetylglucosaminyltransferase. Proc. Natl. Acad. Sci. USA 106, 12109–12114. Barresi, R., Michele, D. E., Kanagawa, M., Harper, H. A., Dovico, S. A., Satz, J. S., Moore, S. A., Zhang, W., Schachter, H., Dumansk, J. P., Cohn, R. D., Nishino, I.,
382
Jane E. Hewitt
et al. (2004). LARGE can functionally bypass a-dystroglycan glycosylation defect in distinct congenital muscular dystrophy. Nat. Med. 10, 696–703. Beltran-Valero de Bernabe´, D., Inamori, K., Yoshida-Moriguchi, T., Weydert, C. J., Harper, H. A., Willer, T., Henry, M. D., and Campbell, K. P. (2009). Loss of adystroglycan laminin binding in epithelium-derived cancers is caused by silencing of LARGE. J. Biol. Chem. 284, 11279–11284. Brockington, M., Torelli, S., Prandini, P., Boito, C., Dolatshad, N. F., Longman, C., Brown, S. C., and Muntoni, F. (2005). Localization and functional analysis of the LARGE family of glycosyltransferases: significance for muscular dystrophy. Hum. Mol. Genet. 15, 657–665. Browning, C. A., Grewal, P. K., Moore, C. J., and Hewitt, J. E. (2005). A rapid PCR method for genotyping the Largemyd mouse, a model of glycosylation-deficient congenital muscular dystrophy. Neuromuscul. Dis. 15, 331–335. Cao, W., Henry, M. D., Borrow, P., Yamada, H., Elder, J. H., Ravkov, E. V., Nichol, S. T., Compans, R. W., Campbell, K. P., and Oldstone, M. B. A. (1998). Identification of a-dystroglycan as a receptor for lymphocytic choriomeningitis viris and Lassa fever virus. Science 282, 2079–2081. Cohn, R. D., Henry, M. D., Michele, D. E., Barresi, R., Saito, F., Moore, S. A., Flanagan, J. D., Skwarchuk, M. W., Robbins, M. E., Mendell, J. R., Williamson, R. A., and Campbell, K. P. (2002). Disruption of Dag1 in differentiated skeletal muscle reveals a role for dystroglycan in muscle regeneration. Cell 110, 639–648. Coˆte´, P. D., Moukhles, H., Lindebaum, M., and Carbonetto, S. (1999). Chimaeric mice deficient in dystroglycans develop muscular dystrophy and have disrupted myoneural synapses. Nat. Genet. 23, 338–342. Court, F. A., Hewitt, J. E., Davies, K., Patton, B. L., Uncini, A., Wrabetz, L., and Feltri, M. L. (2009). A laminin-2, dystroglycan, utrophin axis is required for compartmentalization and elongation of myelin segments. J. Neurosci. 29, 3908–3919. Dalloz, C., Claudepierre, T., Rodius, F., Mornet, D., Sahel, J., and Rendon, A. (2001). Differential distribution of the members of the dystrophin glycoprotein complex in mouse retina: Effect of the mdx(3Cv) mutation. Mol. Cell Neurosci. 17, 908–920. Dumanski, J. P., Carlbom, E., Collins, V. P., and Nordenskjold, M. (1987). Deletion mapping of a locus on human chromosome 22 involved in the oncogenesis of meningioma. Proc. Natl. Acad. Sci. USA 84, 9275–9279. Durbeej, M., and Campbell, K. P. (2002). Muscular dystrophies involving the dystrophinglycoprotein complex: an overview of current mouse models. Curr. Opion. Genet. Dev. 12, 349–361. Durbeej, M., Henry, M. D., and Campbell, K. P. (1998). Dystroglycan in development and disease. Curr. Opion. Cell Biol. 10, 594–601. Emery, A. E. H. (2008). Resistance to infection and the muscular dystrophies–Is there a molecular link? Neuromuscul. Dis. 18, 423–425. Frost, A. R., Bo¨hm, S. V., Sewduth, R. N., Josifova, D., Ogilvie, C. M., Izatt, L., and Robert, R. G. (2010). Heterozygous deletion of 2Mb region inlcuding the dystroglycan gene in a patient with mild myopathy, facial hypotonia, oral-motor dyspraxia and white matter abnormalies. Eur. J. Hum. Genet. 18, 852–855 Fujimura, K., Sawaki, H., Sakai, T., Hiruma, T., Nakanishi, N., Sato, T., Ohkura, T., and Narimatsu, H. (2005). LARGE2 facilitates the maturation of alpha-dystroglycan more effectively than LARGE. Biochem. Biophys. Res. Comm. 329, 1162–1171. Fumagalli, M., Pozzoli, U., Cagliani, R., Comi, G. P., Bresolin, N., Clerici, M., and Sironi, M. (2010). Genome-wide identification of susceptibility alleles for viral infections through a population genetics approach. PLoS Genet. 6, e1000849. Grewal, P. K., Bolland, D. J., Carim Todd, L., and Hewitt, J. E. (1998). High resolution mapping of mouse chromosome 8 identifies an evolutionary chromosomal breakpoint. Mamm. Genome. 9, 603–607.
Mutant Mice for LARGE
383
Grewal, P. K., and Hewitt, J. E. (2002). Mutation of Large, which encodes a putative glycosyltransferase, in an animal model of muscular dystrophy. Biochim. Biophys. Acta 1573, 216–224. Grewal, P. K., Holzfeind, P. J., Bittner, R. E., and Hewitt, J. E. (2001). Mutant glycosyltransferase and altered glycosylation of a-dystroglycan in the myodystrophy mouse. Nat. Genet. 28, 151–154. Grewal, P. K., McLaughlan, J. M., Moore, C. J., Browning, C. A., and Hewitt, J. E. (2005). Characterisation of the LARGE family of putative glycosyltransferases associated with dystroglycanopathies. Glycobiology 15, 912–923. Han, H., Kanagawa, M., Yoshida-Moriguchi, T., Rader, E. P., Ng, R. A., Michele, D. E., Muirhead, D. E., Kunz, S., Moore, S. A., Iannaccone, S. T., Miyake, K., McNeil, P. L., et al. (2009). Basal lamina strengthens cell membrane integrity via the laminin G domainbinding motif of a-dystroglycan. Proc. Natl. Acad. Sci. USA 106, 12573–12579. Henry, M. D., and Campbell, K. P. (1999). Dystroglycan inside and out. Curr. Opin. Cell Biol. 11, 602–607. Herbst, R., Iskratsch, T., Unger, E., and Bittner, R. E. (2009). Aberrant development of neuromuscular junctions in glycosylation-defective Large(myd) mice. Neuromuscul. Dis. 19, 366–378. Holzfeind, P. J., Grewal, P. K., Reitsamer, H. A., Kechvar, J., Lassmann, H., Hoeger, H., Hewitt, J. E., and Bittner, R. E. (2002). Skeletal, cardiac and tongue muscle pathology, defective retinal transmission, and neuronal migration defects in the Largemyd mouse defines a natural model for glycosylation-deficient muscle-eye-brain disorders. Hum. Mol. Genet. 11, 2673–2687. Ibraghimov-Beskrovnaya, O., Milatovich, A., Ozcelik, T., Yang, B., Koepnick, K., Francke, U., and Campbell, K. P. (1993). Human dystroglycan: skeletal muscle cDNA, genomic structure, origin of tissue-specific isoforms and chromosomal localization. Hum. Mol. Genet. 2, 1651–1657. Kanagawa, M., Nishimoto, A., Chiyonobu, T., Takeda, S., Miyagoe-Suzuki, Y., Wang, F., Fujikake, N., Taniguchi, M., Lu, Z. P., Tachikawa, M., Nagai, Y., Tashiro, F., et al. (2009). Residual laminin-binding activity and enhanced dystroglycan glycosylation by LARGE in novel model mice to dystroglycanopathy. Hum. Mol. Genet. 18, 621–631. Kanagawa, M., Saito, F., Kunz, S., Yoshida-Moriguchi, T., Barresi, R., Kobayashi, Y. M., Muschler, J., Dumanski, J. P., Michele, D. E., Oldstone, M. B., and Campbell, K. P. (2004). Molecular recognition by LARGE is essential for expression of functional dystroglycan. Cell 117, 953–964. Kelly, D., Chancellor, K., Milatovich, A., Francke, U., Suzuki, K., and Popko, B. (1994). Autosomal recessive neuromuscular disorder in a transgenic line. J. Neurosci. 14, 198–207. Kunz, S., Rojek, J. M., Kanagawa, M., Spiropoulou, C. F., Barresi, R., Campbell, K. P., and Oldstone, M. B. (2005). Posttranslational modification of a-dystroglycan, the cellular receptor for arenaviruses, by the glycosyltransferase LARGE is critical for virus binding. J. Virol. 79, 14282–14296. Lane, P. W., Beamer, T. C., and Myers, D. D. (1976). Myodystrophy, a new myopathy on chromosome 8 of the mouse. J. Hered. 67, 135–138. Lee, Y., Kameya, S., Cox, G. A., Hsu, J., Hicks, W., Maddatu, T. R., Smith, R. S., Naggert, J. K., Peachey, N. S., and Nishina, P. M. (2005). Ocular abnormalities in Large(myd) and Large(vls) mice, spontaneous models for muscle, eye, and brain diseases. Mol. Cell Neurosci. 30, 160–172. Levedakou, E. N., Chen, X.-J., Soliven, B., and Popko, B. (2005). Disruption of the mouse Large gene in the enr and myd mutants results in nerve, muscle and neuromuscular defects. Mol. Cell Neurosci. 28, 757–769. Levedakou, E. N., and Popko, B. (2006). Rewiring enervated: Thinking LARGEr than myodystrophy. J. Neurosci. Res. 84, 237–243.
384
Jane E. Hewitt
Litwack, E. D., Lee, Y., and Mallott, J. M. (2006). Absence of the basilar pons in mice lacking a functional Large glycosyltransferase gene suggests a defect in pontine meuron migration. Brain Res. 1117, 12–17. Longman, C., Brockington, M., Torelli, S., Jimenez-Mallebrera, C., Kennedy, C., Khalil, N., Feng, L., Saran, R. K., Voit, T., Merlini, L., Sewry, C. A., Brown, S. C., et al. (2003). Mutations in the human LARGE gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Hum. Mol. Genet. 12, 2853–2861. Lui, J., Ball, S. L., Yang, Y., Mei, P. C., Zhang, L., Shi, H., Kaminski, H. J., Lemmon, V. P., and Hu, H. (2006). A genetic model for muscle-eye-brain disease in mice lacking protein O-mannose 1,2-N-acetylglucosaminyltransferase (POMGnT1). Mech. Dev. 123, 228–240. Mathews, K. D., Rapisarda, D., Bailey, H. L., Murray, J. C., Schleper, R. L., and Smith, R. (1995). Phenotypic and pathological evaluation of the myd mouse, a candidate model for facioscapulohumeral dystrophy. J. Neuropath. Exp. Neurol. 54, 601–606. Meier, H., and MacPike, A. D. (1977). Myopathies caused by three mutations of the mouse. J. Hered. 68, 383–385. Mercuri, E., Messina, S., Bruno, C., Mora, M., Pegoraro, E., Comi, G. P., D’Amico, A., Aiello, C., Biancheri, R., Berardinelli, A., Boffi, P., Cassandrini, D., et al. (2009). Congenital muscular dystrophies with defective glycosylation of dystroglycan. A population study. Neurology 72, 1802–1809. Michele, D. E., Barresi, R., Kanagawa, M., Saito, F., Cohn, R. D., Satz, J. S., Dollar, J., Nishino, I., Kelley, R. I., Somer, H., Straub, V., Mathews, K. D., et al. (2002). Posttranslational disruption of dystroglycan–ligand interactions in congenital muscular dystrophies. Nature 418, 417–422. Mills, K. A., Mathews, K. D., Scherpbier-Heddema, T., Schleper, R. L., Schmalzel, R., Bailey, H. L., Nadeau, J. H., Beutow, K. H., and Murray, J. C. (1995). Genetic mapping near the myd locus on mouse chromosome 8. Mamm. Genome 6, 278–280. Miyagoe-Suzuki, Y., Masubuchi, N., Miyamoto, K., Wada, M. R., Yuasa, S., Saito, F., Matsumura, K., Kanesaki, H., Kudo, A., Manya, H., Endo, T., and Takeda, S. (2009). Reduced proliferative activity of primary POMGnT1-null myoblasts in vitro. Mech. Dev. 126, 107–116. Montanaro, F., Carbonetto, S., Campbell, K. P., and Lindenbaum, M. (1995). Dystroglycan expression in the wild type amd mdx mouse neural retina: synaptic colocalisation with dystrophin, dystrophin-related protein but not with laminin. J. Neurosci. Res. 42, 528–538. Moore, S. A., Saito, F., Chen, J., Michele, D. E., Henry, M. D., Messing, A., Cohn, R. D., Ross-Barta, S. E., Westra, S., Williamson, R. A., Hoshi, T., and Campbell, K. P. (2002). Deletion of brain dystroglycan recapitulates aspects of congenital muscular dystrophy. Nature 418, 422–425. Muntoni, F., Brockington, M., and Brown, S. C. (2004a). Glycosylation eases muscular dystrophy. Nat. Med. 10, 676–677. Muntoni, F., Brockington, M., Torelli, S., and Brown, S. C. (2004b). Defective glycosylation in congenital muscular dystrophies. Curr. Opin. Neurol. 17, 205–209. Patnaik, S. K., and Stanley, P. (2005). Mouse Large can modify complex N- and mucin Oglycans on a-dystroglycan to induce laminin binding. J. Biol. Chem. 280, 20851–20859. Peyrard, M., Seroussi, E., Sandberg-Nordqvist, A.-C., Xie, Y.-G., Han, F.-Y., Fransson, I., Collins, J., Dunham, I., Kost-Alimova, M., and Imreh, S. (1999). The human LARGE gene from 22q12.3-q13.1 is a new distinct member of the glycosyltransferase gene family. Proc. Natl. Acad. Sci. USA 96, 598–603. Qu, Q., and Smith, F. I. (2005). Neuronal migration defects in cerebellum of the Largemyd mouse are associated with disruption in Bergmann glia organization and delayed migration of granule neurons. Cerebellum 4, 261–270.
Mutant Mice for LARGE
385
Qu, Q., Crandall, J. E., Luo, T., McCaffery, P. J., and Smith, F. I. (2006). Defects in tangential neuronal migration of pontine nuclei neurons in the Largemyd mouse are sssociated with stalled migration in the ventrolateral hindbrain. Eur. J. Neurosci. 23, 2877–2886. Rath, E. M., Kelly, D., Bouldin, T. W., and Popko, B. (1995). Impaired peripheral nerve regeneration in a mutant strain of mice (enr) with a Schwann cell defect. J. Neurosci. 15, 7226–7237. Rayburn, H. B., and Peterson, A. C. (1978). Naked axons in myodystrophic mice. Brain Res. 146, 380–384. Rex, M., and Scotting, S. J. (1999). In situ hybridisation to sections (non-radioactive). In ‘‘Molecular embryology: Methods and Protocols,’’ (P. T. Sharpe and I. Mason, eds.), pp. 645–654, Humana Press. Rurak, J., Noel, G., Lui, L., Joshi, B., and Moukhles, H. (2007). Distribution of potassium ion and water permeable channels at perivascular glia in brain and retina of the Large (myd) mouse. J. Neurochem. 103, 1940–1953. Sabeti, P. C., Varilly, P., Fry, B., Lohmueller, J., Hostetter, E., Cotsapas, C., Xie, X. H., Byrne, E. H., McCarroll, S. A., Gaudet, R., Schaffner, S. F., and Lander, E. S. (2007). Genome-wide detection and characterization of positive selection in human populations. Nature 913–919. Saito, F., Moore, S. A., Barresi, R., Henry, M. D., Messing, A., Ross-Barta, S. E., Cohn, R. D., Williamson, R. A., Sluka, K. A., Sherman, D. L., Brophy, P. J., Schmelzer, J. D., et al. (2003). Unique role of dystroglycan in peripheral nerve myelination, nodal structure and sodium channel stabilization. Neuron 38, 747–758. Santavuori, P., Somer, H., Sainio, K., Rapola, J., Kruus, S., Nikitin, T., Ketonen, L., and Leisti, J. (1989). Muscle-eye-brain disease (MEB). Brain Dev. 11, 147–153. Sato, S., Omori, Y., Katoh, K., Kondo, M., Kanagawa, M., Miyata, K. K. F., Koyasu, T., Kajimura, N., Miyoshi, T., Sawai, H., Kobayashi, K., Tani, A., et al. (2008). Pikachurin, a dystroglycan ligand, is essential for photoreceptor ribbon synapse formation. Nat. Neurosci 11, 923–931. Satz, J. S., Barresi, R., Durbeej, M., Willer, T., Turner, A., Moore, S. A., and Campbell, K. P. (2008). Brain and eye malformations resembling Walker-Warburg Syndrome are recapitulated in mice by dystroglycan deletion in the epiblast. J. Neurosci. 28, 10567–10575. Satz, J. S., Philp, A. R., Nguyen, H., Kusano, H., Lee, J., Turk, R., Riker, M. J., Herna´ndez, J., Weiss, R. M., Anderson, M. G., Mullins, R. F., Moore, S. A., et al. (2009). Visual impairment in the absence of dystroglycan. J. Neurosci. 29, 13136–13146. Sgambato, A., and Brancaccio, A. (2005). The dystroglycan complex: From biology to cancer. J. Cell Physiol. 205, 163–169. Takeda, S., Kondo, M., Sasaki, J., Kurahasi, H., Kano, H., Arai, K., Misaki, K., Fukui, T., Kobayashi, K., Tachikawa, M., Imamura, M., Nakamura, Y., et al. (2003). Fukutin is required for maintenance of muscle integrity, cortical histiogenesis and normal eye development. Hum. Mol. Genet. 12, 1449–1459. Taniguchi, M., Kurahashi, H., Noguchi, S., Fukudome, T., Okinaga, T., Tsukahara, T., Tajima, Y., Ozono, K., Nishino, I., Nonaka, I., and Toda, T. (2006). Aberrant neuromuscular junctions and delayed terminal muscle fiber maturation in a-dystroglycanopathies. Hum. Mol. Genet. 15, 1279–1289. van der Zwaag, B., Franke, L., Poot, M., Hochstenbach, R., Spierenburg, H. A., Vorstman, J. A. S., Daalen, E., de Jonge, M. V., Verbeek, N. E., Brilstra, E. H., van ’t Slot, R., Ophoff, R. A., et al. (2009). Gene-network analysis identifies susceptibility genes related to glycobiology in autism. PLoS ONE 4, e5324. van Reeuwijk, J., Grewal, P. K., Salih, M. A. M., de Bernabe, D. B. V., McLaughlan, J. M., Michielse, C. B., Herrmann, R., Hewitt, J. E., Steinbrecher, A., Seidahmed, M. Z.,
386
Jane E. Hewitt
Shaheed, M. M., Abomelha, A., et al. (2007). Intragenic deletion in the LARGE gene causes Walker–Warburg syndrome. Hum. Genet. 121, 685–690. Willer, T., Prados, B., Falco´n-Pe´rez, J. M., Renner-Mu¨ller, I., Przemeck, G. K. H., Lommel, M., Coloma, A., Valero, M. C., Hrabe´ de Angelis, M., Tanner, W., Wolf, E., Strahl, S., et al. (2004). Targeted disruption of the Walker–Warburg syndrome gene Pomt1 in mouse results in embryonic lethality. Proc. Natl. Acad. Sci. USA 101, 14126–14131. Williamson, R. A., Henry, M. D., Daniels, K. J., Hrstka, R. F., Lee, C. J., Sunada, Y., Ibraghimov-Beskrovnaya, O., and Campbell, K. P. (1997). Dystroglycan is essential for early embryonic development: disruption of Reichart’s membrane in Dag1-null mice. Hum. Mol. Genet. 6, 831–841. Yoshida-Moriguchi, T., Liping, Y., Stainaker, S. H., Davis, S., Kunz, S., Madson, M., Oldstone, M. B. A., Schachter, H., Wells, L., and Campbell, K. P. (2010). O-mannosyl phosphorylation of alpha-dystroglycan is required for laminin binding. Science 327, 88–92. Zaccaria, M. L., Di Tommaso, F., Brancaccio, A., Paggi, P., and Petrucci, T. C. (2001). Dystroglycan distribution in adult mouse brain: A light and electron microscopy study. Neuroscience 104, 311–324.
C H A P T E R
T W E N T Y- T W O
A Tumor Suppressor Function of Laminin-Binding a-Dystroglycan Xingfeng Bao and Minoru Fukuda Contents 388 389 389 390 392 393 394 395 395
1. Background 2. Methods 2.1. Cell sorting and flow cytometry 2.2. Laminin-binding assay 2.3. Colony formation assay 2.4. Tumor invasion assay 2.5. Orthotopic prostate tumor formation Acknowledgment References
Abstract Interaction of epithelial cells with basement membrane (BM) is mediated by celladhesion molecules, which regulate cell proliferation, motility, and differentiation by integrating signals from extracellular matrix and soluble factors. a-Dystroglycan (a-DG) is one of the most important adhesion molecules in epithelial cell–BM interaction. a-DG serves as the cell surface receptor for several major BM proteins, including laminin, perlecan, and agrin. The laminin G-like domain in all these proteins binds to a unique glycan structure, so-called laminin-binding glycan, attached to a-DG with high affinity. Formation of the laminin-binding glycan is required for the BM assembly, and loss or deficiency of the glycan causes muscular dystrophy. We studied the role of this a-DG-specific glycan modification in tumor development, and identified a tumor suppressor function of the laminin-binding a-DG. In this chapter, we describe methods used to isolate the cell populations from human prostate cancer cell line PC3 and characterize their potentials in tumor formation and metastasis in vitro and in vivo.
Sanford-Burnham Medical Research Institute, La Jolla, California, USA Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79022-4
#
2010 Elsevier Inc. All rights reserved.
387
388
Xingfeng Bao and Minoru Fukuda
1. Background Epithelial cells normally form a monolayer on a unique extracellular matrix called basement membrane (BM). The interaction between epithelial cells and the BM is often abnormal or disrupted in malignant tumor (Bhowmick et al., 2004; Taddei et al., 2008; White et al., 2004). BM is generally thought to form the physical barrier for the tumor development, but the mechanisms underlying this general phenomenon remain unclear. One of the most important epithelial cell–BM interactions is mediated by a-dystroglycan (a-DG), which functions a cell receptor for multiple BM proteins, including laminin, perlecan, and agrin (Barresi and Campbell, 2006). All these extracelluar proteins bind to a-DG through a unique glycan, so-called laminin-binding glycan. The glycan modification specifically modifies a-DG and has been shown to be required for the BM assembly in the early embryonic stage in mice (Willer et al., 2004). a-DG is highly glycosylated and contains both N-linked glycans and mucin type O-glycans. The mucin type O-glycans are clustered in a mucinlike domain at the N-terminal of mature a-DG, which include unique O-mannosyl glycans with or without phosphate modification (Chiba et al., 1997; Yoshida-Moriguchi et al., 2010). Defects in the O-mannosyl glycans have been shown to cause muscular dystrophy (Martin, 2007). Seven glycosyltranferase or glycosyltransferase-like genes, including POMT1, POMT2, POMGnT1, Fukutin, Fukutin-related protein, LARGE, and LAEGE2, have been shown to be involved in the formation or presentation of the laminin-binding glycan on a-DG since mutations of these genes lead to a group of congenital muscular dystrophy called dystroglycanopathy (Martin, 2007; Muntoni et al., 2008), which is characterized by a loss or reduction of the glycan presentation. Recently, we show that a unique b3N-acetylglucosaminyltransferase, b3GnT1, participate in the formation of the laminin-binding glycan through formation of a complex with LARGE or LARGE2, thus regulating the function of LARGE/LARGE2 (Bao et al., 2009). Transcripts of b3GnT1 positively correlates with the expression levels of laminin-binding glycan on a-DG in many human prostate and breast cancer cell lines. Despite a critical function of a-DG glycosylation in the muscular system, not much is known about cancer development. Recent reports have shown that defects of a-DG are associated with breast, colon, oral, and prostate carcinomas (Muschler et al., 2002; Jing et al., 2004; Sgambato et al., 2007). However, the mechanistic link between a-DG defects seen in various carcinomas and tumor progression is not known. By studying the tumor progression properties of two subpopulations of PC3 cells, we identified a tumor suppressor function of the unique laminin-binding a-DG. In this
a-Dystroglycan and Tumorigeneity
389
chapter, we describe methods used to isolate the cell populations from human prostate cancer cell line PC3 and characterize their potentials in tumor formation and metastasis in vitro and in vivo.
2. Methods 2.1. Cell sorting and flow cytometry Many cancer cell lines widely used for cancer research are known to be heterogeneous (Weiss, 2000). Cell sorting that is based on the specific antigen presentation is an efficient way to isolate subclones of the parent cancer cell line. While we were studying the laminin-binding glycan expression on various human prostate and breast cancer cell lines, we noticed that human prostate cancer cell line PC3 contain two populations which express different amounts of a-DG laminin-binding glycan, visualized by monoclonal antibody IIH6 (Upstate) staining. To separate the subpopulations of PC3 cells, cells were harvested using enzyme-free dissociation buffer (Invitrogen), and the monodispersed cells were incubated with mAb IIH6 diluted at 1:100 in PBS containing 1% bovine serum albumin (BSA) on ice for 1 h, followed by Alexa488-conjugated goat anti-mouse IgM m chain specific (Invitrogen) with a dilution of 1:100 in the same buffer. After 30 min incubation with the secondary antibody, the cells were sorted by FACSVantage sort, enhanced (BD) into IIH6 high expressor (PC3-H) and low expressor (PC3-L) as shown in Fig. 22.1. The resultant cells were propagated and subjected for further characterization. To characterize the sorted cells, both near confluent PC3-H and PC3-L cells were harvested as described above and incubated with antibodies that recognize the laminin-binding glycan moiety (VIA4-1 (Upstate) and IIH6 epitopes), the a-DG core protein 6C1 (Calbiochem), and PC3 cell surface markers CD44 (BD PharMingen) and CD16 (BD PharMingen) and a6 and b1 integrins (BD PharMingen), respectively. After 1 h incubation on ice, the cells were washed with PBS containing 0.1% BSA twice and further incubated with the FITC or Alexa488-conjugated secondary antibodies as described above. The stained cells were analyzed by FACSsort (BD) equipped with a Cellquest software (BD). For controls, the primary antibody was omitted. Figure 22.1 shows the FACS analysis results for the parent PC3 cells and the subpopulations (PC3-H and PC3-L). Notably, PC3-L and PC3-H differ specifically in the cell surface expression of laminin-binding glycan as visualized by mAbs VIA4-1 and IIH6. Both populations express equivalent amounts of a-DG core protein and PC3 cell markers CD44 and CD16, and the a6 and b1 integrin receptors. While using cell sorting approach to isolate the subpopulations of a certain cancer cell line, one needs to be cautious. Further careful characterization of
390
Xingfeng Bao and Minoru Fukuda
a-DG glycan IIH6
VIA4-1 PC3-L
PC3 100
IIH6
60
H L
40
PC3-H
Counts
80
20 0 100
101 102 103 104 Fluorescence intensity
Fluorescence intensity a-DG core
PC3 cell marker CD16
CD44
LN-111 receptor a 6-integrin
b1-integrin
PC3-H
PC3-L
6C1
Fluorescence intensity
Figure 22.1 Isolation and characterization of two cell populations with distinct lamininbinding glycan expression from PC3 cells. PC3 cells were sorted into to two fractions (donated as H and L) as indicated according to the IIH6 epitope expression. Flow cytometric analysis shows that the propagated PC3-H express high level of lamininbinding glycan, which is recognized by mAbs IIH6 and VIA4-1, while the PC3-L barely display these glycan epitopes at cell surface. Both PC3-H and PC3-L have equivalent expression for a-dystroglycan core (6C1), PC3 cell markers CD44 and CD16, and a6 and b1-integrins. (Partly adapted from Bao et al., 2009).
the isolated cell populations are required to confirm: (1) the isolated cells are not contaminated cells of the parent cell line and (2) the molecular phenotype does not change after many times passengers during cell culture. Only after these confirmations, the isolated cells will be useful for further study.
2.2. Laminin-binding assay Laminin is a group of proteins that are composed of a distinct composition of three laminin chains, a, b, and g (Larsen et al., 2006). They play critical roles in tissue organization, cell survival, proliferation, and migration during
391
a-Dystroglycan and Tumorigeneity
development. Laminin 111, which consists of each one a, b, and g chain, is a major protein of BM and the most abundant laminin isoform there. Epithelial cells secret laminin 111 that polymerizes at the cell surface and forms a network together with other extracellular proteins such as collagens and proteoglycans. Binding and extensive polymerization of soluble laminin 111 depends on the cell surface receptors, including a-DG (Barresi et al., 2004). Cells were cultured on glass coverslips in 6 cm dish with 10% FBScontaining RPMI-1640 at 37 C till confluency. The conditional medium was removed by aspiration and rinsed with PBS twice. Serum-free OPTIMEM I medium (Invitrogen) with or without mouse laminin 111 at a dose of 10 mg/ml was added to the cell culture. After additional 2-h culture, the medium was removed and the cells were fixed with 2% PFA for 30 min at room temperature. The fixed cells were then sequentially treated with 2% normal goat serum in PBS (blocking buffer) for 30 min, rabbit anti-pan-laminin antibody (Genetics) with a dilution of 1:100 for 60 min, biotinylated goat anti-rabbit IgG (Vector, 1:100) for 60 min, and Rhodamine-conjugated avidin (Vector, 1:100) for 30 min. Antibodies were all diluted in the blocking buffer for the incubation. The fluorescence-stained cells were finally incubated with Holchest (1:1000) for 5 min to stain the nucleus and analyzed with fluorescence microscopy. Figure 22.2 shows the immunofluorescence staining of the cell-bound laminin 111 on PC3-L and PC3-H. Soluble laminin 111 quickly bind to cell surface with a subsequent auto polymerization. This assay was designed to visualize the quick binding of laminin 111 from the culture medium, and a longer incubation time such as 12 h is required if an extensive polymerization is desired. Notably, the staining protocol does not distinguish the endogenous laminin from the exogenous one. Though the exogenously
PC3-L + Laminin 111
PC3-H No laminin 111
+ Laminin 111
Figure 22.2 Laminin-binding assay. Near confluent cells growing on glass coverslips were cultured with serum-free medium with or without 10 mg/ml mouse laminin 111 at 37 C for 2 h. Culture medium was then removed and the cells were fixed with 2% PFA and subjected to staining with rabbit anti-pan-laminin antibody followed by Alexa594-conjugared secondary antibody. Assay with omission of laminin 111 was run and shown here.
392
Xingfeng Bao and Minoru Fukuda
added laminin 111 is usually much more than the endogenous, caution is needed in this assay particularly when the cells of interest express high level of laminin 111.
2.3. Colony formation assay Colony formation assay is a method to evaluate the adhesion-independent cell proliferation of cancer cells. Single tumorigenic cell with a high proliferation rate forms colonies in the soft agar plate in a few weeks. To compare the cell growth of PC3 subpopulations in the adhesion-independent condition, colony formation assay was performed as below: 1. Melt 1% Agar (Difco Laboratories) in serum-free RPMI-1640 medium with microwave and cool to 40 C in a water bath. Warm RPMI-1640 medium containing 20% fetal bovine serum (FBS) to 40 C in the water bath. Allow at least 15 min for temperature to equilibrate. 2. Mix equal volumes of the two solutions to give 0.5% Agar þ 10% FBS in RPMI. 3. Add 1.5 ml of the mixture to 3.5 cm Petri dish and allow to set. The plates can be used immediately or stored at 4 C for up to 1 week. 4. Melt 0.8% Agar in serum-free RPMI-1640 in microwave and cool to 40 C in a water bath. (It is important not to exceed 40 C, otherwise cells may be killed.) Also, warm 20% FBS containing RPMI-1640 to the same temperature. 5. Trypsinze cells and count. Reconstitute cells with RPMI-1640 to make 100,000 cells/ml. 6. Add 100 ml of cell suspension, which contain 10,000 cells, to a 10 ml tube. 7. Add 3 ml of 0.8% Agar solution and 3 ml of 20% FBS containing RPMI-1640 to the tube and mix gently. Add 1.5 ml of the mixture to each replicate plate. Only handle one tube at a time so that agar does not set prematurely. 8. Incubate the plates at 37 C in humidified incubator for 2–3 weeks. It is wise to monitor the colony growth by looking at the plates every other day. 9. Stain plates by adding 0.5 ml of 0.005% of crystal violet (Sigma) at room temperature for over 1 h or 4 C for overnight. 10. The stained colonies were photographed under light microscopy and the pictures were analyzed by Adobe Photoshop (Adobe Systems). Figure 22.3 shows the stained colonies formed by PC3-H and PC3-L. In this protocol, no difference in the number and size was detected for the colonies formed by both cell populations. Since cells differ greatly in their growth, the optimal culture time for each cell line is different and should be determined experimentally. Notably, this assay model can also be used for assay the effectiveness of pharmaceutics in suppression or promotion of cancer cell growth under adhesion-independent manner.
393
a-Dystroglycan and Tumorigeneity
PC3-L
PC3-H
Figure 22.3 Coloney formation assay. Monodispersed cells (n ¼ 5000) were mixed with 0.4% agar in RPMI-1640 medium containing 10% (v/v) FBS and placed on the bottom gel containing 0.5% agar and medium in 35-mm dish. Cells were cultured for 2 weeks at 37 C and then stained with crystal violet overnight; bar, 1.0 mm.
2.4. Tumor invasion assay Cancer cell invasiveness is a characteristic of malignant tumor. The invasive carcinomas are able to break the surrounding BM and therefore further form metastasis to other organs. The in vitro invasion assay is to measure the ability of cancer cells to break the intact BM structure. To compare the invasion potential of PC3 cells and their subpopulations PC3-H and PC3-L cells, a Boyden transwell chamber (Calbiochem) was used. Each chamber includes a bottom well and an insert. The upper surface of the insert was precoated with reconstituted BM extracts, which include extracellular matrix proteins and various growth factors. 1. Bring the transwell plate to the cell culture hood and equilibrate to room temperature. Add 100 ml of serum-free RPMI-1640 medium to the insert. 2. Cells were harvested by enzyme-free cell dissociation buffer (Invitrogen) and reconstituted with serum-free RPMI-1640 to make a cell suspension of 8 105 cells/ml. 3. Remove the medium in the insert by drain on tissue, and add 300 ml of the cell suspension to the upper chamber of the insert. 4. Fill the bottom chamber with 300 ml serum-free RPMI-1640 medium and incubate the plate at 37 C for 24 h. 5. Remove the insert from the bottom well and wipe the upper surface of the insert with a cotton-topped stick. 6. Put the insert into a well containing 0.5% crystal violet in 20% ethanol and stain for 30 min. 7. Dip the stained insert into distilled water several times to wash out the free dyes on the membrane. 8. Dry the insert at room temperature, cut the membrane, and mount it on a glass slide for light microscopy analysis. The results in each well is the
394
Xingfeng Bao and Minoru Fukuda
PC3
PC3-H
PC3-L
Figure 22.4 Cell invasion assay. A suspension of monodispersed cells (n ¼ 2.4 105) in 300 ml of serum-free RPMI-1640 medium was seeded to the insert of a Boyden transwell chamber (Calbiochem). The bottom chamber was filled with serum-free medium too. After a 24 h culture at 37 C, the cells that migrated to bottom surface of the insert were stained with crystal violet and photographed under a light microscopy; bar, 500 mm.
mean cell number of 4–8 randomly selected high magnification fields from duplicate or triplicate experiments. Figure 22.4 shows the stained cells that migrated through the reconstituted BM precoated on a membrane with 8 mm pores. In this assay, PC3-L displayed a higher invasion potential than PC3-H and the parental PC3 cells. Since cells differ substantially in invasion potential, the optimal cell number and incubation time of specific cell lines are different and should be determined experimentally. Notably, cell dissociation by the enzyme-free buffer is preferred particularly in assaying the function of cell surface molecules in invasion against BM.
2.5. Orthotopic prostate tumor formation Orthotopic prostate tumor formation assay is to assess the in vivo activities of growth and metastasis of cancer cells in the prostates of immunocompromised mice. SCID mice were used in this assay because of the severe immunocompromised property. We describe the general procedure here and the detailed surgical protocols are described in Chapter 23. PC3 cells were harvested using enzyme-free cell dissociation buffer (Invitrogen) and suspended in serum-free RPMI-1640 medium. Two million cells at a volume of 20 ml were inoculated into the posterior lobe of the mouse prostate and the wound was closed with surgical clips. Four to seven weeks later, mice were killed, and prostates and prostate surrounding lymph nodes were dissected and weighted. Figure 22.5 shows the prostates (left panels) and their drain lymph nodes (right panels) of SCID mice, which were inoculated with parental PC3 cells and their subpopulations PC3-H and PC3-L. In this assay, PC3 exhibited a
395
a-Dystroglycan and Tumorigeneity
Prostate
Lymph nodes
PC3 PC3-H PC3-L
Figure 22.5 Orthotopic tumor formation assay. Two millions of monodispersed cells in 20 ml serum-free RPMI-1640 medium were inoculated into the posterior lobe of the prostates of immunocompromised SCID mice, and the wound was closed by surgical clips. Seven week later, mice were killed, and the prostate and the prostate drain lymph nodes were dissected and photographed; bar, 1.0 cm.
higher tumor growth and metastasis to lymph nodes. PC3 cells grow aggressively in vivo. Three weeks after cell inoculation, the tumors were already touchable in the lower abdomen, and 6–7 week later, mice are apparently sick because of the heavy tumor burden. Analysis of clones or subpopulations from a parent cell line with distinct expression of glycan structures allows us to evaluate the function of specific glycans in various biological systems. By studying the in vitro and in vivo tumor formation of the two PC3 cell subpopulations, PC3-L and PC3-H, we show here a negative correlation between the a-DG laminin-binding glycan expression and the cell invasion and tumor progression capability. Further analysis using genetic manipulation approach would allow a better define of the role of a-DG in tumor development.
ACKNOWLEDGMENT This work was supported by NIH grants CA48737 (M.F.) and CA71932 (M.F.).
REFERENCES Bao, X., Kobayashi, M., Hatakeyama, S., Angata, K., Gullberg, D., Nakayama, J., Fukuda, M. N., and Fukuda, M. (2009). Tumor suppressor function of laminin-binding a-dystroglycan requires a distinct b3-N-acetylglucosaminyltransferase. Proc. Natl. Acad. Sci. USA 106, 12109–12114. Barresi, R., Michele, D. E., Kanagawa, M., Harper, H. A., Dovico, S. A., Satz, J. S., Moore, S. A., Zhang, W., Schachter, H., Dumanski, J. P., Cohn, R. D., Nishino, I., and Campbell, K. P. (2004). LARGE can functionally bypass alpha-dystroglycan glycosylation defects in distinct congenital muscular dystrophies. Nat. Med. 10, 696–703. Barresi, R., and Campbell, K. P. (2006). Dystroglycan: From biosynthesis to patjogenesis of human disease. J. Cell Sci. 119, 199–207.
396
Xingfeng Bao and Minoru Fukuda
Bhowmick, N. A., Neilson, E. G., and Morse, H. L. (2004). Stromal fibroblasts in cancer initiation and progression. Nature 432, 332–337. Chiba, A., Matsumura, K., Yamada, H., Inazu, T., Shimizu, T., Kusunoki, S., Kanazawa, I., Kobata, A., and Endo, T. (1997). Structures of sialylated O-linked oligosaccharides of bovine peripheral nerve alpha-dystroglycan. The role of a novel O-mannosyl-type oligosaccharide in the binding of alpha-dystroglycan with laminin. J. Biol. Chem. 272, 2156–2162. Jing, J., Lien, C. F., Sharma, S., Rice, J., Brennan, P. A., and Gorecki, D. C. (2004). Aberrant expression, processing and degradation of dystroglycan in squamous cell carcinomas. Eur. J. Cancer 40, 2143–2151. Larsen, M., Artym, V. V., Gree, J. A., and Yamada, K. M. (2006). The matrix reorganized: Extracellular matrix remodeling and integrin signaling. Curr. Opin. Cell Biol. 18, 463–471. Martin, P. T. (2007). Congenital muscular dystrophies involving the O-mannose pathway. Curr. Mol. Med. 7, 417–425. Muntoni, F., Torelli, S., and Brockington, M. (2008). Muscular dystrophies due to glycosylation defects in distinct congenital muscular dystrophies. Nat. Med. 10, 696–703. Muschler, J., Levy, D., Boudreau, R., Henry, M., Campbell, K., and Bissell, M. J. (2002). A role for dystroglycan in epithelial polarization: Loss of function in breast tumor cells. Cancer Res. 62, 7102–7109. Sgambato, A., de Paola, B., Migaldi, M., Di Salvatore, M., Rettino, A., Rossi, G., Faraglia, B., Boninsegna, A., Mariorana, A., and Cittadini, A. (2007). Dystroglycan expression is reduced during prostate tumorigenesis and is regulated by androgens in prostate cancer cells. J. Cell Physiol. 213, 528–539. Taddei, I., Deugnier, M. A., Faraldo, M. A., Petit, V., Bauvard, D., Medina, D., Fassler, R., Thiery, J. P., and Glukhova, M. A. (2008). Beta1 integrin deletion from the basal compartment of the mammary epithelium affects stem cells. Nat. Cell Biol. 10, 716–722. Weiss, L. (2000). Cancer cell heterogeneity. Cancer Metastasis Rev. 19, 345–350. White, D. E., Kurpios, N. A., Zuo, D., Hassell, J. A., Blaess, S., Mueller, U., and Muller, W. J. (2004). Targeted disruption of b1-integrin in a transgenic mouse model of human breast cancer reveals an essential role in mammary tumor induction. Cancer Cells 6, 159–170. Willer, T., Prados, B., Falcon-Perez, J. M., Renner-Muller, I., Przemeck, G. K., Lommel, M., Coloma, A., Valero, M. C., de Angelis, M. H., Tanner, W., Wolf, E., Straul, S., et al. (2004). Targeted disruption of the Walker–Warburg Syndrome gene Pomt1 in mouse results in embryonic lethality. Proc. Natl. Acad. Sci. USA 101, 14126–14131. Yoshida-Moriguchi, T., Yu, L., Stalnaker, S. H., Davis, S., Kunz, S., Madson, M., Oldstone, M. B., Schachter, H., Wells, L., and Campbell, K. P. (2010). O-Mannosyl phosphoryaltion of alpha-dystroglycan is required for laminin-binding. Science 327, 88–92.
C H A P T E R
T W E N T Y- T H R E E
Tumor Formation Assays Shingo Hatakeyama,* Hayato Yamamoto,* and Chikara Ohyama† Contents 398 399 399 399 401 401 403 405 407 408 408 411 411
1. Overview 2. Animal Care and Protocol Approval 3. Disinfection of Mice 4. Analgesia and Anesthesia in Mice 5. IP Injection 6. IV Injection into the Tail Vein 7. IV Tumor Formation Assay Using Immune-Deficiency Mice 8. SC Inoculation 9. FP Inoculation 10. Testicular Inoculation 11. Prostate Inoculation Acknowledgment References
Abstract Animal experiments are necessary to confirm and demonstrate the reliability of the results of in vitro assays and to reveal any unexpected effects in the living body. Tumor invasion and metastasis consist of multistep and complex cascades. Moreover, conflictive interactions between cancer cells and host immune system exist in the living body. Therefore, tumor formation assay is an essential technique in tumor biology. Methods used in tumor formation assay include injection and inoculation, and considerable skill is required to perform these basic techniques. Injections and inoculations are categorized according to the target site: intraperitoneal (IP), intravenous (IV), subcutaneous (SC), footpad (FP), and targeted organ inoculation. Tumor cell injections and inoculations are standard methods for the evaluation of the malignant potential of cancer cells. IP injection is a useful and uncomplicated method for drug administration, SC inoculation is used to evaluate tumor growth and size, FP inoculation to estimate lymph nodule metastasis, and IV injection into the tail vein to evaluate the metastatic potential for lung colonization. Using immune-deficiency mice,
* Department of Urology, Oyokyo Kidney Research Institute, Hirosaki, Japan Department of Urology, School of Medicine, Hirosaki Graduate University, Hirosaki, Japan
{
Methods in Enzymology, Volume 479 ISSN 0076-6879, DOI: 10.1016/S0076-6879(10)79023-6
#
2010 Elsevier Inc. All rights reserved.
397
398
Shingo Hatakeyama et al.
we can address possible roles of carbohydrate antigens against host immune system. In this chapter, we describe details of the materials and methods that can be used for injection (IP and IV) and inoculation (SC, FP, testis, and prostate) in mice.
1. Overview The most important aspects of animal experiments are handling and restraint. Because handling animals can be difficult, repeated practice is essential if reproducible results are to be obtained. The common methods for catching and picking up mice are grasping the animal near the base of tail and grasping the skin at the back of the neck. For additional restraint, the loose skin at the back of the neck is grasped and then the tail is held between the fourth and fifth fingers. If the skin is grasped too far from the head, the mouse will turn and bite the handler. The mouse must be held firmly but gently (Fig. 23.1A). Methods commonly used in studies on mice are injection and inoculation. Injections and inoculations are categorized according to the target site: intraperitoneal (IP), intravenous (IV), subcutaneous (SC), footpad (FP), and targeted organ inoculation.
Figure 23.1 Handling and restraint of mice. (A) Common methods of restraint when handling mice. The loose skin at the back of the neck is grasped and then the tail is held between the fourth and fifth fingers. If this is not done correctly the mouse will bite the handler. (B) Restraint devices suitable for IV tail vein injection and for holding mice for longer periods of time. Left, 28-gauge needle; middle, commercially available restraint device; Right, homemade restraint device for small mice.
Handling and Tumor Formation Assays in Mice
399
Tumor cell injections and inoculations are standard methods for evaluating the malignant potential of cancer cells. IP injection is a useful and uncomplicated method of drug administration (Minagawa et al., 2005), SC inoculation can be used to evaluate tumor growth and size (Lee et al., 2009; Watanabe et al., 2002), FP inoculation to estimate lymph nodule metastasis (Chen et al., 2005), and IV injection into the tail vein to evaluate the metastatic potential for lung colonization (Ohyama et al., 1999, 2002). Orthotopic and heterotopic inoculations into target organ are common methods of evaluating tumor size. Generally, orthotopic inoculation of tumor cells into the same organ as that from which the cells were derived will be acceptable when evaluating their malignant potential, but heterotopic inoculation is also acceptable if there are anatomical limitations of experiments or if there is technical difficulty. We have described orthotopic testicular inoculation (Hatakeyama et al., 2004) and prostate inoculation (Bao et al., 2009; Hagisawa et al., 2005; Inaba et al., 2003) for tumor formation in mice.
2. Animal Care and Protocol Approval Animal care and pain management using anesthesia and analgesia are crucial components in protocols for animal use. All experiments must conform to the Principles of Laboratory Animal Care and the Guide for Care and Use of Laboratory Animals. Animal experiment protocols should be approved by the institutional animal care and use committee.
3. Disinfection of Mice In order to prevent bacterial infection, all invasive procedures should be clean, especially when immunodeficient mice are being used. Before attempting to introduce any instrument or agent into an animal’s body, the injection or inoculation site should be cleaned and disinfected with 70% ethanol or an antiseptic agent.
4. Analgesia and Anesthesia in Mice Standard agents are described in Table 23.1 (Hawk et al., 2005). Injectable analgesics and anesthetics are appropriate for animal experiments. However, careful observation is necessary because there is variation in the depth and duration of the effects of agents among strains and individual animals.
400
Shingo Hatakeyama et al.
Table 23.1 Standard analgesic and anesthetic agents for mice
Anesthetics agent
Dosage of administration
Duration of anesthesia
Pentobarbital Tribromoethanol (Avertin) Metomidate/fentanyl Ketamine/xylazine Analgesics agent Buprenorphine Meloxicam Flunixin meglumine
50–75 mg/kg, IP 250 mg/kg, IP 60 mg/kg þ 0.06 mg/kg, SC 80–100 mg/kg þ 10 mg/kg, IP
20–40 min 15–30 min 20–30 min 20–30 min
0.05–0.1 mg/kg, SC 5–10 mg/kg, SC 2.5 mg/kg, SC
8–12 h 12–24 h 12–24 h
Analgesic agents are used in premedication to block pain and relieve fear and stress, and to reduce the total amount of general anesthetic required for the procedure. Pentobarbital, a barbiturate, is the most popular anesthetic agent for operations on animals. Its duration of action is enough for a 40-min operation, and there is a weaker effect lasting up to about 2–3 h after injection. With pentobarbital, animals do not feel pain in the surgical plane of anesthesia. Once stable anesthesia has been achieved, it will be longlasting than with most other agents. Fifty to 75 mg/kg is the standard dose for mice. Commercially available pentobarbital contains 50 mg/ml of the agent. Tenfold dilution of the original agent and IP injection of 300 ml will provide 75 mg/kg for a mouse weighing 20 g. Barbiturates are also the most commonly injected agents for euthanasia because they induce unconsciousness before respiratory depression and death. The disadvantage of barbiturates is their narrow margin of safety, associated with respiratory depression. The operator should consider the dosage according to the size of the animal and the purpose of the experiment. Tribromoethanol is the standard anesthetic agent used in mice. It produces short-term (15–30 min) surgical anesthesia with good muscle relaxation and moderate respiratory depression. It was once manufactured specifically for use as an anesthetic under the name AvertinÒ. However, this product is no longer commercially available. Investigators who wish to use tribromoethanol as an anesthetic must make their own solution. A stock solution of tribromoethanol is made by mixing equal amounts of tribromyl ethyl alcohol and tertiary amyl alcohol. This must be kept at 4 C in the dark and must not be stored for longer than 1 year. A working solution must be made each time it is needed by dilution of the stock solution to 1.25% in distilled water or saline, because this agent has toxic degradation products. Therefore, the operator should use only a freshly mixed solution or one that has been stored for no more than 1–2 weeks at
Handling and Tumor Formation Assays in Mice
401
4 C in the dark with a pH above 5. The IP injection of mice with 400– 500 ml of 1.25% working solution will provide adequate anesthesia for surgical experiments.
5. IP Injection To inject tumor cells or samples into the peritoneum, the operator must restrain the mouse properly. After grasping the mouse near the base of the tail, the loose skin at the back of neck is grasped and then the tail is held between the fourth and fifth fingers (Fig. 23.1A). Before attempting to enter the IP area, the injection site should be cleaned and disinfected. IP injection requires care in order to prevent penetration of various organs inside the abdominal cavity. The intestine usually reacts by moving away when it is touched with a sharp needle point. However, this is not the case with a full urinary bladder, the liver, and the stomach. For these reasons, IP injections are made in the lower quadrant of the abdomen. The injection site should be chosen to avoid these organs, and the injection should not be deep enough to puncture the kidney or the major vasculature of the abdomen. It is very important to pull back slightly on the plunger of the syringe prior to injection. The appearance of yellow fluid means the needle tip is in the urinary bladder, and green-brown fluid suggests it is in the intestine. IP injection of a-galactosylceramide (a-GalCer) has a strong prophylactic antibacterial effect and a marked antibacterial effect on preestablished urinary tract infections caused by Escherichia coli, Pseudomonas aeruginosa, and methicillin-resistant Staphylococcus aureus (MRSA) in mice. a-GalCer has an important role in host defense against a range of microbial infections because it is a specific ligand for CD1d-restricted variable-a14chain natural killer (NK) T cells. Minagawa et al. (2005) administered a-GalCer (2 mg/ 100 ml in phosphate-buffered saline) on alternate days.
6. IV Injection into the Tail Vein For tail vein injection, mice should be older than 6 weeks of age because at younger ages the vessel is not thick enough for injection. The injection site should be cleaned and disinfected before the operator attempts to enter the vessel. The most important part of the procedure is the method of holding the mouse because injection needs accurate manipulation of the needle. Several restraint devices are available and these are useful for holding mice for longer periods of time (Fig. 23.1B).
402
Shingo Hatakeyama et al.
Three vessels are visible on the back of the mouse’s tail: a central artery with a vein on each side. You can easily distinguish an artery from a vein by the branch vessels. Branch vessels extend from the artery to the veins (Fig. 23.2A, B). Avascularization using a soft tube (Fig. 23.2C) or soaking the tail in warm water will raise the vein and make injection easier. Once the mouse is safely held in the restrainer, the tail is pulled to straighten it. The mouse is monitored during the procedure by observing its respiratory rate and checking whether restraint is causing the animal any distress. The best syringe for tail vein injection is the one for insulin injection with a 28-gauge needle. The needle is bent at an angle of 30– 50 . The total volume recommended for an IV injection is 100 ml. The needle is placed on the surface almost parallel to the vein and inserted carefully (Fig. 23.3A–C). A common reason for misinjection is penetration caused by excessively deep insertion, because the vessel wall is located just beneath the skin surface. Once the needle tip is under the skin, it is very important to pull back the syringe slightly during insertion to confirm the blood will flow back (Fig. 23.3D), and then start the injection without moving the needle tip. The procedure for IV injection into the tail vein requires careful handling of the mouse and needle. Repeated practice is essential for success with this technique. A
B
C
Artery Vein
Branch
FVB/N
BALB/c nude
BALB/c nude
Figure 23.2 Tail vessels of the mouse. (A) Scheme of tail vasculature. Branch vessels extend from the artery to the veins. Red arrows, artery; blue arrows, vein; green arrows, branch vessels. (B) Careful injection is necessary in BALB/c nude (nu/nu) mice because their vessels are thin and leaky. (C) Avascularization (black arrow) or soaking the tail in warm water will make injection easier. Red, blue, and green arrows are arteries, veins, and branch vessels, respectively.
Handling and Tumor Formation Assays in Mice
403
Figure 23.3 Procedure for tail vein injection. (A) Proper handling of the syringe is essential for successful injection. The outer tube is grasped by the first and second fingers. The third finger is placed under the inner cylinder. Place the needle on the surface of the tail in parallel (B) and insert it carefully (C). Once the needle tip is under the skin, pull back the syringe slightly during insertion to confirm that blood will flow back (D, arrow).
In the lung colonization assay, tumor cells (1 105 to 5 106 cells) in 100 ml serum-free medium are injected through the tail vein. The number of cells injected will depend on the malignant potential of the cell line. Numbers of cells commonly used for IV injections are summarized in Table 23.2. Ohyama et al. (1999) injected mouse melanoma B16F1 cells stably transfected with a1,3-fucosyltransferase III (FTIII) to express sialyl Lewis X structures into the tail vein and evaluated lung tumor nodules 2–3 weeks later (Fig. 23.4). When injected to C57BL/6 mice, cells expressing moderate amounts of sialyl Lewis X (B16-FTIII-M) produced a significantly greater number of lung tumor foci than sialyl Lewis X-negative B16 cells (B16-FTIII-N). In contrast, cells expressing large amounts of sialyl Lewis X (B16-FTIII-H) produced few lung tumor foci. These results may seem to be paradoxical, because it has been postulated based on the in vitro experiments that sialyl Lewis X expression correlates with metastatic potential due to its high affinity to E-selectin.
7. IV Tumor Formation Assay Using ImmuneDeficiency Mice Nude mice do not have T cells. Severe combined immune-deficiency (SCID) mice are lack in both T and B cells. Beige mice do not have NK cells. Moreover, NK cells can be depleted by its specific monoclonal
404
Shingo Hatakeyama et al.
Table 23.2 Standard numbers of cells for injection or inoculation in mice Cell line
Methods
Cells/ml
Periods
B16F1 MeWo JKT-1 JKT-1 PC3 LNCaP MBT-2 LNCaP
IV injection IV injection IV injection Testicular inoculation Prostate inoculation Prostate inoculation SC inoculation SC inoculation
2–3 weeks 2–3 weeks 4 weeks 3–4 weeks 4–7 weeks 4 weeks 10 days 12 weeks
MDA-MB231 B16F10 B16F1
MFP inoculation
10 /100 ml 106/100 ml 106/100 ml 106/50–100 ml 106/20 ml 106/20 ml 105/100 ml 106/100 ml (with matrigel) 1 106/100 ml
FP inoculation FP inoculation
2 106/20 ml 4 105/20 ml
10 days 18–21 days
1 5 2 2 2 2 2 5
C57BL/6 mice
5
30–35 days
NK cell depleted
B16-FTIII-N: sLex negative (–)
B16-FTIII-M: sLex moderately (+)
B16-FTIII-H: sLex highly (+)
Figure 23.4 Tumor formation in the lung. Mouse melanoma B16F1 cells were stably transfected with a1,3-fucosyltransferase III (FTIII) to express sialyl Lewis X structures. Transfected B16F1 cells (B16-FTIII cells) were separated by cell sorting into three groups based on the expression level of sialyl Lewis X (sLeX negative, moderately positive, and highly positive). When transfected cells (1 105/100 ml) were injected to C57BL/6 mice, cells expressing moderate amounts of sialyl Lewis X (B16-FTIII-M) produced a significantly greater number of lung tumor foci than sialyl Lewis X-negative B16 cells (B16-FTIII-N). In contrast, cells expressing large amounts of sialyl Lewis X (B16-FTIII-H) produced few lung tumor foci. When injected to C57BL/6 mice that had been depleted of NK cells using anti-asialo-GM1 antibody, B16-FTIII-H cells that were highly positive for sialyl Lewis X produced large numbers of lung tumor nodules.
Handling and Tumor Formation Assays in Mice
405
antibody: NK1.1 or anti-asialoGM1 antibody. Taking advantage of these immune-deficient mice, important roles of cancer-associated carbohydrate antigens against host immune system can be addressed. When B16 cells were injected into mice tail vein, cells expressing large amounts of sialyl Lewis X (B16-FTIII-H) produced few lung tumor foci in C57BL/6 mice but were highly tumorigenic in NK cell depleted mice, which have defective NK cells (Fig. 23.4). These results suggest that B16FTIII-H cells are much more sensitive to NK cell-mediated cytotoxicity than are B16-FTIII-M cells (Ohyama et al., 1999, 2002).
8. SC Inoculation SC inoculation is a simple and basic way to evaluate tumor growth and size. However the technician must be careful to inject to the correct depth because the skin has a layered structure. To prevent unexpected movement of the mouse, it is important to hold the animal’s tail and the back of its neck firmly and with care, or the mouse can be anesthetized by IP injection of tribromoethanol (Avertin, 0.5 ml for a mouse weighing 25 g). Before attempting to inoculate, the injection site should be cleaned and disinfected. Major vessels must be avoided when selecting an inoculation point. Because the SC connective tissue stretches, raising a tent of back skin exposes a large space for injection (Fig. 23.5). The technician must be careful not enter the underlying muscle. If the tumor cells are injected into muscle, tumor growth is much greater than SC inoculation. The number of cells injected depends on the cell line. In general, 2 105 to 2 106 cells in 100 ml are inoculated in serum-free medium. Numbers of cells commonly used for SC inoculation are summarized in Table 23.2.
Tent of skin
Figure 23.5 Subcutaneous injection in mice. To prevent unexpected movement of the mouse, it is important to hold the animal’s tail and the back of its neck. Making a tent of skin will create a space for injection.
406
Shingo Hatakeyama et al.
If the cell line being used does not readily form a solid tumor, mixing the cells with MatrigelÒ will help tumor formation. In a study using core 3 Oglycan, Lee et al. (2009) described a tumor formation assay in which LNCaP prostate cancer cells were inoculated SC with MatrigelÒ. Briefly, mocktransfectant and core 3-O-glycan expressing LNCaP cells (5 106/100 ml) were inoculated subcutaneously together with 50 ml of MatrigelÒ and 50 ml of serum-free RPMI medium (50:50, v/v) into BALB/c nude (nu/nu) mice (6–8-week-old males), and the animals were killed 3 months later. Details are given in Chapter 8. Mammary fat pad (MFP) inoculation of breast cancer cells is a modified method of SC inoculation. The MFP lies directly beneath the skin, above the SC layer. Mice generally have five nipples on each side, three in the pectoral area and another two in the inguinal area (Fig. 23.6A). The second nipple from the top toward the head is a suitable site for MFP inoculation. Slow and careful inoculation will make appropriate swelling of MFP (Fig. 23.6B). Inoculation of 1 106 MDA-MB-231 cells in 100 ml medium into the MFP produced a solid tumor in 6–8-week-old female SCID mice (Sossey-Alaoui et al., 2007). In our trial, inoculation of 2 106 MDA-MD-231 cells in 50 ml with 50 ml of Matrigel (50:50, v/v) into 6–8-week-old female SCID mice made tumor growth easier and faster to evaluate after 4 weeks (Fig. 23.6C).
A
B
C
Pectoral
Inguinal
Figure 23.6 Mammary fat pad (MFP) inoculation in female mice. The mouse should be a female more than 6–8 weeks old. (A) The mouse has five nipples on each side, three in the pectoral area and two in the inguinal area. (B) The MFP lies just beneath the skin, above the subcutaneous layer. (C) Inoculation of 50 ml of MatrigelÒ with 2 106 of MDA-MD-231 cells per 50 ml (50:50 v/v) into 6–8-week-old female SCID mice made tumor growth easier and faster to evaluate after 4 weeks (arrow).
Handling and Tumor Formation Assays in Mice
407
9. FP Inoculation FP inoculation of tumor cells can be used to evaluate the lymph node or lung metastatic potential of cells as well as the tumor growth in the inoculated site. Handling is important for successful FP inoculation. The operator must hold the base of the mouse’s tail between the second and third fingers and then grasp the foot by the first and fourth fingers. The corner of the cage provides a suitable space for holding the mouse. For FP inoculation, place the needle on the surface of the FP and insert carefully. Once the needle is under the skin, pull back the syringe slightly to confirm that the needle tip is not in a vessel (Fig. 23.7). Lymph node or lung metastasis can be evaluated 3 weeks after inoculating 4 105/20 ml of B16F1 cells (Murakami et al., 2002; Wiley et al., 2001). If 2 106/20 ml B16F10 cells are inoculated, the interval before evaluation will be shortened (Chen et al., 2005). Standard numbers of cells for FP inoculation are summarized in Table 23.2.
Figure 23.7 Footpad inoculation of tumor cells. (A) Place the needle on the surface of the footpad and insert carefully. Once the needle is under the skin, pull back the syringe slightly to confirm that the needle tip is not in a vessel. (B) B16F10 cells (2 105/20 ml) were inoculated into the right footpad of C57BL/6 mice and metastasis was evaluated 3 weeks after inoculation. Scale bar ¼ 1 cm.
408
Shingo Hatakeyama et al.
Figure 23.8 Testicular inoculation of tumor cells. (A) After anesthetizing the mouse, hold the testis firmly to prevent leakage of cells into the peritoneal cavity, and slowly inject the testis with a suspension of 2 106 tumor cells in 50–100 ml serum-free medium. Tumor size and distant metastasis can be evaluated 3–4 weeks later. (B) Testis inoculated with JKT-1 tumor cells 3 weeks previously (arrowhead) and normal control (arrow). Scale bar ¼ 1 cm.
10. Testicular Inoculation Testicular orthotopic inoculation of tumor cells can be used to evaluate local tumor formation and the distant metastatic potential of testicular cancer cell lines. For this method, the mouse should be anesthetized by IP injection of tribromoethanol. When the mouse has calmed down, the technician should hold the testis firmly with forceps to prevent leakage of cells into the IP area (Fig. 23.8A). A suspension of 2 106 tumor cells in 50–100 ml is then injected slowly into the testis. Tumor size and distant metastasis can be evaluated 3–4 weeks later (Fig. 23.8B) (Hatakeyama et al., 2004).
11. Prostate Inoculation Like testicular inoculation, this method can be used to evaluate local tumor formation and the distant metastasis potential of prostate cancer cell lines. Sterilization or disinfection of all materials by autoclaving is necessary for this operation in order to prevent bacterial infection (Fig. 23.9). Anatomy of the mouse prostate is described in Fig. 23.10. After anesthetizing the mouse by IP injection of tribromoethanol, disinfect the lower
409
Handling and Tumor Formation Assays in Mice
1
2
3
4
5
6
7
8
Figure 23.9 Implements for inoculation into prostate. Syringe and needles 1 and 2 should be disinfected with an antiseptic agent. Surgical implements 3–8 should be sterilized by autoclaving. (1) 50-ml syringe (Hamilton #80530 705RN 50 ml SYR) þ syringe guide. (2) 30 gauge custom needle (Hamilton #7803-07 RN NDL 6/PK (30/ 0.500 /4)s, angle12 ). (3) Surgical scissors (FineScience #14105-12). (4) 9-mm AutoclipÒ (Clay Adams #7631, Becton Dickinson). (5) Several types of mosquito forceps (6–8).
Urinary bladder
Prostate (posterior)
Prostate (posterior)
SV
SV
SV
Seminal vesicles (SV)
Figure 23.10 Anatomy of mouse prostate. It is easy to find the seminal vesicles (SV), which appear as whitish cords in the lower peritoneal cavity. Withdrawing the seminal vesicles from the peritoneal cavity will reveal the prostate, which is located at the base of the seminal vesicles.
410
A
Shingo Hatakeyama et al.
Peritoneum
B
C Prostate SV
D
E
F
Figure 23.11 Procedure for prostate inoculation. (A) After disinfecting the lower abdomen, cut the skin and peritoneum with scissors. When cutting the peritoneum, raising a tent of peritoneum will create a space that makes it easier to avoid cutting the intestine or other organs. (B) After entering the peritoneal cavity, the two seminal vesicles (whitish convoluted cords) will appear. (C) Withdrawing the seminal vesicles from the peritoneal cavity will reveal the prostate. (D) The syringe must be located in parallel with the prostate to enable the tumor cells to be inoculated precisely in a small area. (E) The skin is closed with a 9-mm AutoclipÒ, together with the peritoneum. (F) Tumors should reach a large size within 4–7 weeks. Scale bar ¼ 1 cm
abdomen of the animal with 70% ethanol or an antiseptic. Cut the skin with scissors to expose the peritoneum (Fig. 23.11A). Raising a tent of peritoneum will create a space that enables avoiding cutting the intestine or other organs. After entering the IP area, the two seminal vesicles (visible as whitish convoluted cords) can be found (Figs. 23.10 and 23.11B). Withdrawing the seminal vesicles from the peritoneum will reveal the location of the prostate gland (Figs. 23.10 and 23.11C). A syringe containing tumor cells (2 106/ 20 ml) should be located in parallel with the prostate so that a small area can be inoculated precisely (Fig. 23.11D). The skin is closed with a 9-mm AutoclipÒ. The peritoneum is closed together with the skin (Fig. 23.11E). The operator has to be careful not to catch the underlying intestine in the clip. If this occurs during wound closure, the mouse will die. Tumors will reach a large size within 4–7 weeks. Tumors can be detected by touching the surface of the lower abdominal area. Prostate cancer cell lines PC3 and LNCaP are standard cell lines for tumor formation in the mouse prostate (Bao et al., 2009; Hagisawa et al., 2005; Inaba et al., 2003).
Handling and Tumor Formation Assays in Mice
411
ACKNOWLEDGMENT This work was supported by the Japan Society for the Promotion of Science, Grant 21791483 and CREST and the Japan Science and Technology Agency, Grant 2310080004.
REFERENCES Bao, X., Kobayashi, M., Hatakeyama, S., Angata, K., Gullberg, D., Nakayama, J., Fukuda, M. N., and Fukuda, M. (2009). Tumor suppressor function of laminin-binding alpha-dystroglycan requires a distinct beta3-N-acetylglucosaminyltransferase. Proc. Natl. Acad. Sci. USA 106, 12109–12114. Chen, S., Kawashima, H., Lowe, J. B., Lanier, L. L., and Fukuda, M. (2005). Suppression of tumor formation in lymph nodes by L-selectin-mediated natural killer cell recruitment. J. Exp. Med. 202, 1679–1689. Hagisawa, S., Ohyama, C., Takahashi, T., Endoh, M., Moriya, T., Nakayama, J., Arai, Y., and Fukuda, M. (2005). Expression of core 2 beta1, 6-N-acetylglucosaminyltransferase facilitates prostate cancer progression. Glycobiology 15, 1016–1024. Hatakeyama, S., Ohyama, C., Minagawa, S., Inoue, T., Kakinuma, H., Kyan, A., Arai, Y., Suga, T., Nakayama, J., Kato, T., Habuchi, T., and Fukuda, M. N. (2004). Functional correlation of trophinin expression with the malignancy of testicular germ cell tumor. Cancer Res. 64, 4257–4262. Hawk, C. T., Leary, S., and Morris, T. (2005). Formulary for Laboratory Animals 3rd edn Blackwell Publishing, Ames, Iowa, USA. Inaba, Y., Ohyama, C., Kato, T., Satoh, M., Saito, H., Hagisawa, S., Takahashi, T., Endoh, M., Fukuda, M. N., Arai, Y., and Fukuda, M. (2003). Gene transfer of alpha1, 3-fucosyltransferase increases tumor growth of the PC-3 human prostate cancer cell line through enhanced adhesion to prostatic stromal cells. Int. J. Cancer 107, 949–957. Lee, S. H., Hatakeyama, S., Yu, S. Y., Bao, X., Ohyama, C., Khoo, K. H., Fukuda, M. N., and Fukuda, M. (2009). Core3 O-glycan synthase suppresses tumor formation and metastasis of prostate carcinoma PC3 and LNCaP cells through down-regulation of alpha2beta1 integrin complex. J. Biol. Chem. 284, 17157–17169. Minagawa, S., Ohyama, C., Hatakeyama, S., Tsuchiya, N., Kato, T., and Habuchi, T. (2005). Activation of natural killer T cells by alpha-galactosylceramide mediates clearance of bacteria in murine urinary tract infection. J. Urol. 173, 2171–2174. Murakami, T., Maki, W., Cardones, A. R., Fang, H., Tun Kyi, A., Nestle, F. O., and Hwang, S. T. (2002). Expression of CXC chemokine receptor-4 enhances the pulmonary metastatic potential of murine B16 melanoma cells. Cancer Res. 62, 7328–7334. Ohyama, C., Tsuboi, S., and Fukuda, M. (1999). Dual roles of sialyl Lewis X oligosaccharides in tumor metastasis and rejection by natural killer cells. EMBO J. 18, 1516–1525. Ohyama, C., Kanto, S., Kato, K., Nakano, O., Arai, Y., Kato, T., Chen, S., Fukuda, M. N., and Fukuda, M. (2002). Natural killer cells attack tumor cells expressing high levels of sialyl Lewis X oligosaccharides. Proc. Natl. Acad. Sci. USA 99, 13789–13794. Sossey-Alaoui, K., Safina, A., Li, X., Vaughan, M. M., Hicks, D. G., Bakin, A. V., and Cowell, J. K. (2007). Down-regulation of WAVE3, a metastasis promoter gene, inhibits invasion and metastasis of breast cancer cells. Am. J. Pathol. 170, 2112–2121. Watanabe, R., Ohyama, C., Aoki, H., Takahashi, T., Satoh, M., Saito, S., Hoshi, S., Ishii, A., Saito, M., and Arai, Y. (2002). Ganglioside G(M3) overexpression induces apoptosis and reduces malignant potential in murine bladder cancer. Cancer Res. 62, 3850–3854. Wiley, H. E., Gonzalez, E. B., Maki, W., Wu, M. T., and Hwang, S. T. (2001). Expression of CC chemokine receptor-7 and regional lymph node metastasis of B16 murine melanoma. J. Natl. Cancer Inst. 93, 1638–1643.
Author Index
A Abbas, S., 96 Abbs, S., 169, 354 Abe, S., 187, 197, 246 Abomelha, A., 345, 369, 372 Abril, E., 228 Ackerl, R., 297 Ackroyd, M. R., 299, 339, 375 Adachi, T., 227 Adriaenssens, E., 109 Aguilan, J. T., 379 Aguirre, A. A., 47, 48 Ahmed, S., 28 Aiello, C., 339, 345, 369 Aigrot, M. S., 26 Akaike, T., 225 Akama, T. O., 59, 244 Akasaka-Manya, K., 344, 345 Akashima, T., 187, 190, 198 Akira, S., 135 Akita, K., 42, 53, 55, 58, 63, 65 Akiyama, S. K., 144–145 Alam, N., 144 Alam, T., 207 Alavian, K., 48 Albers, C., 325 Alford, 3rd, J. A., 260 Alilain, W., 57 Ali, M., 225 Alizadeh, A. A., 76 Aloisi, F., 273 Alon, R., 95 Alonso, G., 26 Altschul, S. F., 76 Alvarez-Buylla, A., 26, 40, 66 Amano, J., 143 Amherdt, M., 207 Amps, J., 57 Amselgruber, W., 324 Anai, M., 207 Andersen, C. L., 80 Anderson, L. V., 345 Anderson, M. G., 378 Anderson, S., 47, 48 Andoh, T., 187 Ando, S., 85 Andra, K., 297
An, G., 108–110, 129, 144, 157, 161, 165, 166, 168, 245 Angata, K., 26–29, 187, 370, 380, 399, 410 Angelini, C., 294 An, H. J., 108 Anstee, D. J., 110, 111 Anthony, T. E., 40 Antoine, H., 28 Antosiewicz-Bourget, J., 74 Aoki, H., 399 Aoki-Kinoshita, K. F., 76, 81 Aono, S., 41, 42, 52, 55, 58 Arai, K., 374 Araishi, K., 298 Arai, Y., 26, 399, 405, 408, 410 Araki, A., 135 Araki, E., 295 Araki, M., 76, 81 Aranda, R., 138 Arato-Ohshima, T., 11 Aravamudan, B., 297 Ariga, T., 85 Arimura, T., 300 Armerding, D., 96 Arnarp, J., 226 Arnold, K., 74 Artym, V. V., 390 Arulanandam, B. P., 165 Aryal, R. P., 110, 111, 119 Asa, D., 96 Asano, T., 207 Ascani, S., 275, 280 Asher, R. A., 42, 61 Ashraf, M., 95 Ashwell, G., 224, 225, 227 Askari, S. W., 259 Assoian, R. K., 144 Atarashi, K., 97 Atkins, R. C., 280 Autuori, F., 227 Azadi, P., 111 B Bach, A., 41 Backstrom, M., 109 Bacon, C. L., 11 Baenziger, J. U., 59, 224–227 Baetens, D., 207
413
414 Bailey, H. L., 371, 375 Bakin, A. V., 406 Balanzino, L., 74 Balci, B., 348 Baldwin, C., 227 Baldwin, S., 27, 29 Ballem, P., 228 Ball, S. L., 339, 345, 354, 358, 376 Banas, J. A., 165 Bandtlow, C. E., 41 Ban, K., 59 Bansal, D., 298 Bao, X. F., 42, 144, 148, 149, 152, 260–262, 265, 268, 370, 380, 387, 399, 406, 410 Barabote, R. D., 76 Barbieri, A. M., 174 Baric, I., 339, 350 Barois, A., 345 Baron, D. A., 248 Barondes, S. H., 218 Barresi, R., 293, 324, 325, 336, 338, 355, 368–370, 374, 376–381, 388, 391 Barrett, K. E., 124 Barrett, T. A., 76, 124 Barthels, D., 27, 29 Bartlett, P. F., 47, 48 Barton, E. R., 301 Bashir, R., 345 Baudhuin, P., 226 Baumheter, S., 258 Baum, L. G., 206 Bauvard, D., 388 Bax, M., 76 Baynes, J., 225 Beamer, T. C., 370, 375 Behrendt, C. L., 162 Behringer, R., 333 Belachew, S., 47, 48 Beltran-Valero De Bernabe´, D., 337, 344, 345, 370 Belyantseva, I. A., 295 Benabdallah, B. F., 301 Benbrook, D. M., 110, 111, 114, 118, 119 Ben-Dor, S., 85 Ben-Hur, H., 95 Bennett, E. P., Bennett, G. S., 41, 58 Benson, D. A., 76 Benson, M. A., 337, 345 Bentzinger, C. F., 302 Berardi, N., 41 Berardinelli, A., 339, 345, 369 Bergamino, L., 344, 354 Berg, E. L., 96, 260, 275 Berger, E. G., 187 Bergstrom, J. D., 14 Berhend, T. L., 186 Berndt, M. C., 96
Author Index
Bernhardt, G., 95 Berninsone, P. M., 108 Bernreuther, C., 58 Bernstein, B. E., 74 Bernstein, M., 357 Bertini, E., 344, 348, 354 Bertolino, P., 228 Bertolotto, C., 42 Betel, D., 161, 169 Bethea, N., 228 Beutow, K. H., 371 Bhatnagar, A. S., 280 Bhattacharyya, R., 206 Bhaumik, M., 206 Bhowmick, N. A., 388 Biancheri, R., 339, 344, 345, 354, 369 Bibiloni, R., 278 Bider, M. D., 224–226 Bieberich, E., 85 Bierhuizen, M. F., Biesecker, G., 311 Biessen, E. A. L., 226 Biggar, D., 345 Bingham, C. O., 169 Binkley, G., 76 Binns, G., 224 Bird, L. M., 354 Birnbaumer, L., 138 Bisgaard, K., 280 Bissell, M. J., 388 Bittner, R. E., 339, 345, 355, 371, 373–377, 379 Blaess, S., 388 Blak, A., 48 Blake, D. J., 294, 324, 337, 345 Blixt, O., 187 Blom, E., 225 Blumenstock, F., 225 Bobowski, M., 109 Boeggeman, E., 99 Boffi, P., 339, 345, 369 Bogdahn, U., 354 Boggi, U., 207 Bo¨hm, S. V., 369 Bohring, A., 354 Boito, C., 379 Bolland, D. J., 371 Bolton, W. K., 274 Bonaldo, P., 298 Bonfanti, L., 26 Boninsegna, A., 388 Bonner-Weir, S., 207 Boon, M., 337, 344 Boorman, G., 228 Borrow, P., 370 Borrow, R., 132 Bosnakovski, D., 300 Bostick, B., 309 Botstein, D., 76
415
Author Index
Bouchet, C., 345, 348–350 Boudreau, R., 388 Bouldin, T. W., 373, 377 Bowen, D., 228 Bo, X., 26 Bradbury, E. J., 41, 58 Bradley, J. D., 169 Braet, F., 228 Braiterman, L. T., 226 Brakebusch, C., 58 Brambrink, T., 74 Brancaccio, A., 355, 368, 370, 379 Braun, J. R., 109, 138, 144, 157, 161, 165, 166, 168, 227, 245 Breedveld, F., 273 Breitfeld, D., 95 Breloy, I., 325 Breningstall, G., 345 Brennaman, L. H., 26 Brennan, P. A., 388 Bresolin, N., 370 Brewer, K., 108, 110, 114 Bridges, L. R., 309 Brilstra, E. H., 370 Briscoe, D. M., 96 Briskin, M. J., 273 Briskomatis, A., 275 Brockhausen, I., 108, 124, 129, 143, 144, 156, 157, 174 Brockington, M., 169, 325, 337, 344, 345, 354, 355, 368, 369, 372, 374, 379, 381, 388 Broda, P., 344, 354 Bronson, R. T., 333 Brooker, G. F., 47, 48 Brophy, P. J., 369, 377, 378 Brose, C., 26 Browning, C. A., 371, 375, 378, 379 Brown, P. O., 76 Brown, R., 27, 29 Brown, S. C., 169, 325, 337, 339, 345, 354, 355, 368, 369, 372, 374, 375, 379, 381 Brunk, D. K., 101 Brunner, H. G., 348 Bruno, C., 339, 344, 345, 369 Bru¨stle, O., 26 Bryan, B. T., 150 Bryant, S. H., 76 Bryson, S., Buckley, N., 43 Bugliani, M., 207 Bukalo, O., 27 Bulfield, G., 295 Buller, H. A., 166, 168, 245 Burchell, J. M., 109, 143 Burger, A. M., 16 Burgunder, J. M., 345 Burkin, D. J., 301, 305 Burns, S. A., 96
Burrows, L., 225 Burson, C. M., 345 Busch, S. A., 41 Bushby, K., 169, 345 Bu¨ssow, H., 26 Bustin, S. A., 80 Butcher, E. C., 96, 260, 272, 275, 283 Butterfield, J. E., 144 Byk, T., 95 Byrd, J. C., 144 Byrne, E. H., 370 C Cabral, A., 354 Cagliani, R., 370 Cailleau-Thomas, A., 74 Caille, I., 40 Cain, D. W., 98 Calco, V., 41 Camargo, L. M., 42, 61 Campbell, G. T., 280 Campbell, K. P., 293, 324, 325, 336, 344, 355, 368–370, 373, 374, 376, 378, 380, 381, 388, 391 Campbell, R. M., 206, 230 Camper, S. A., 284 Camphausen, R. T., 284 Campieri, M., 278 Campos, L. S., 58 Candelier, J. J., 74 Canese, K., 76 Canfield, W. M., 108, 110, 114 Cao, P., 345 Cao, W., 370 Capela, A., 47, 48 Carbonetto, S., 355, 376, 378 Cardones, A. R., 407 Carim Todd, L., 371 Carlbom, E., 370 Carlow, D. A., 156 Carlstedt, I., 249 Carroll, D., 124 Carulli, D., 41, 42, 58, 61 Casanova, P., 26, 33 Casey, C. E., 99, 227 Cassandrini, D., 339, 344, 345, 354, 369 Cazet, A., 109 Ceccarelli, C., 275, 280 Celli, J., 337, 344 Cerqueira, M., 228 Cescato, R., 225, 226 Chakkalakal, J. V., 301, 302 Chamberlain, J. S., 309 Chanas-Sacre, G., 42 Chancellor, K., 372 Chance, S. C., 226 Chandrasekharan, K., 291, 312
416 Chang, X., Charels, K., 228 Charles, P., 26 Chazal, G., 27, 29 Cheliout-Heraut, F., 345 Cheng, G., 259, 260, 284 Cheng, L., 174 Cheng, Z., 95 Chen, I. J., 169 Chen, J., 26, 58, 369, 376, 378 Chen, L., 207 Chen, S., 399, 405, 407 Chen, X.-J., 108, 372–374, 376, 377 Chen, Z., 28 Cheresh, D. A., 147 Cherry, J. M., 76 Chetvernin, V., 76 Cheung, P., 206 Chiba, A., 292, 324, 325, 327, 344, 388 Chiba, Y., 324, 327, 344, 354 Chierzi, S., 41 Chin, C. C. Q., 225 Chintalacharuvu, K., 225 Chirat, F., 225 Chi, S. I., 260 Chitayat, D., 337, 344 Chittajallu, R., 47, 48 Chiyonobu, T., 339, 345, 360, 379, 381 Cho, E.-W., 224 Christoph, A., 27, 29 Chui, D., 157, 207 Chumsri, S., 16 Chung, Y. S., 144 Church, D. M., 76 Chu, V., 309 Cirak, S., 339, 350 Cittadini, A., 388 Clarke, L. L., 124 Clarke, N., 348, 350 Claudepierre, T., 378 Clausen, H., 108, 109, 143, 228 Clayburgh, D. R., 124 Clegg, D. O., 169 Clement, A. M., 41–43, 57 Clement, E. M., 169, 354 Clerici, M., 370 Clinton, B. K., 40 Coalson, J. J., 165 Coates, P. W., 28 Coelho, A. V., 99 Cogger, V., 228 Cohen, M., 354 Cohen, T. V., 299 Cohn, R. D., 297, 305, 309, 325, 336, 338, 355, 369, 374, 376–379, 381, 391 Colgan, S. P., 161 Colin, C., 26 Collins, J., 370, 371, 373, 378
Author Index
Collins, V. P., 370 Colognato, H., 58 Coloma, A., 324, 332–335, 338, 374, 388 Comelli, E. M., 74, 76 Comerford, K., 161 Comi, G. P., 339, 345, 369, 370 Compans, R. W., 370 Condie, B. G., 85 Conzelmann, S., 17, 26 Coombs, P. J., 226 Cooper, D. N., 218 Cooper, H. S., 166 Cooper, N. G., 57 Coral-Vazquez, R., 298 Corbel, S. Y., 156 Corfield, A. P., 124, 144 Corless, C. E., 132 Cormand, B., 337, 344 Corrado, K., 295 Correa, P., 277 Corredor, J., 165, 166 Costa, J., 99 Cotarelo, R. P., 333 Coˆte´, P. D., 297, 376 Cotsapas, C., 370 Coullin, P., 74 Courtand, G., 109 Court, F. A., 377 Coutinho, P. M., 76 Cover, C., 228 Cowell, J. K., 406 Cox, G. A., 301, 302, 372, 374, 375, 377, 378 Coyle, A. J., 281 Craig, R. A., 100 Crandall, J. E., 376, 378 Crawford, C. E., 333 Cremer, H., 27, 29 Crew, V. K., 110, 111 Crocker, P. R., 76 Crosbie, R. H., 303 Cruces, J., 323, 324, 333 Cui, Y., 58 Cummings, R. D., 81, 107–112, 114, 117–119, 128, 129, 144, 157, 161, 165, 166, 168, 187, 217, 245 Curiel, D. T., 33 Currier, S., 337, 344 Cush, J. J., 169 Czopka, T., 40 D Daalen, E., 370 Dagia, N. M., 98 Dalloz, C., 378 Dalton, S., 76, 77, 84, 85, 227 Dalziel, M., 109, 143 Damera, G., 128
417
Author Index
Damiani, S., 275 D’Amico, A., 339, 344, 345, 354, 369 Dammerman, R. S., 40 Dan, B., 324 Daniels, G., 110, 111 Daniels, K. J., 325, 336, 374 Danon, D., 146 D’Antona, G., 300 Daoling, Z., 144 Dar, A., 95 Dasgupta, F., 96 Das, S., 16 Datti, A., Davies, G. J., 98 Davies, J. R., 249 Davies, K., 377 Davis, S., 380, 381, 388 Davy, B. E., 42 Dawson, P. A., 246 Day, J., 225 de Angelis, M. H., 332–335, 338, 388 de Bernabe, D. B. V., 369, 372 De Bruijn, A. C. J. M., 166, 168, 245 Decker, L., 26 Deconinck, A. E., 303, 309 Deconinck, N., 301, 324 DeGuzman, B. J., 96 de Haan-Meulman, M., 273 de Jonge, M. V., 370 Dekker, J., 245 De Koning, B. A. E., 166, 168, 245 Delannoy, P., 109 De la Porte, S., 310 de Leoz, M. L., 108 Deleyrolle, L., 50 Dell, A., 74, 76, 156, 157, 160–163, 165–169, 246 Demetriou, M., 169, 206 den Dunnen, J. T., 354 Deng, W., 26 Dennis, J., 206 Dennis, J. W., 144, 169, 206 De Paepe, A., 80 de Paola, B., 388 De Preter, K., 80 Deprez, R. H., 80 Desgrosellier, J. S., 147 De Simone, C., 278 Deugnier, M. A., 388 Deutsch, V., 95 Deutzmann, R., 324 De Zanger, R., 228 Di Certo, M. G., 301 Dickinson-Anson, H., 26 DiCuccio, M., 76 Diehn, M., 76 Dieleman, L. A., 124 Diesen, C., 345 Di Guglielmo, G. M., 206
Dihne, M., 58 Dimitroff, C. J., 96, 100 Dincer, P., 348 Ding, X., 108, 110, 112, 118 Dini, L., 227 Dinter, A., 187 Diogo, L., 354 Di Salvatore, M., 388 Di Tommaso, F., 379 Ditto, D., 206, 223, 225, 227–230 Dityatev, A., 27 Dixon, M. F., 277 Dobbertin, A., 41, 57 Dobyns, W. B., 337, 344, 345 Doetsch, F., 40 Doe, W. F., 133 Dogan, A., 273 Do, K. Y., 114 Dolatshad, N. F., 379 Dole, K., 144 Dollar, J., 325, 336, 338, 355, 374, 376, 377, 379 Dominov, J. A., 301, 302, 305 Dorfman, D. M., 281 Dougherty, J. D., 28 Dovico, S. A., 369, 379, 381, 391 Doyle, D., 225 Drexhage, H. A., 273 Drickamer, K., 74, 76, 224–226, 283 D’Souza, A., 108, 110, 114 Dubois, C., 43 Dubois-Dalcq, M., 26, 33 Dubose, C. N., 165 Duclos, F., 298 Duenas, J., 156 Duijvestijn, A. M., 275 Du, M., 273 Dumanski, J. P., 369, 379–381, 391 Dunham, I., 370, 371, 373, 378 Durbec, P., 26, 29, 33 Durbeej, M., 298, 355, 368, 369, 373, 378 Dvorak, L. A., 165, 166 E Eade, A., 354 Easterday, M. C., 28 Eaves, A. C., 50 Ebe, Y., 193, 200, 201 Eckhardt, M., 26, 27 Eckmann, L., 162 Edberg, S., 124 Eddy, E. M., 85 Edgar, R., 76 Edwards-Jones, V., 132 Egbers, U., 40 Einarsson, M., 225 Einerhand, A. W. C., 166, 168, 245 Eisenberg, I., 305
418
Author Index
Elder, J. H., 370 Elhammer, A., 174 Ellies, L. G., 156, 157, 161, 207, 223, 225, 227, 230, 244, 272, 275 El Maarouf, A., 26 Elson, C. O., 124 Elvevold, K., 228 Emery, A. E. H., 370 Eminli, S., 74 Endoh, M., 399, 410 Endo, T., 187, 190, 198, 324, 325, 327, 339, 343–345, 347, 348, 350, 354, 375, 388 Endo, Y., 114, 228 Engel, A. G., 311 Ercolessi, C., 275 Ernst, J. F., 161, 169 Ervasti, J. M., 355 Esko, J. D., 74, 76, 81 Eslami-Varzaneh, F., 124 Estournet, B., 337, 345 Evercooren, A. B., 26 Evers, M. R., 59 Eysel, U. T., 57 F Fadden, K., 225 Faid, V., 225 Faissner, A., 40–43, 46, 48, 50, 53, 55, 57–59, 63, 65 Falace, A., 344, 354 Falasca, L., 227 Falco´n-Pe´rez, J. M., 332–335, 338, 374, 388 Fallet, S., 345 Falsaperla, R., 354 Fan, G. C., 95 Fang, H., 407 Fan, Q. W., 11 Fan, X., 18 Faraglia, B., 388 Faraldo, M. A., 388 Fardeau, M., 345 Farrell, D. C., 224 Fassler, R., 58, 388 Fata, J., 206 Faulkner, N. E., 100 Fauss, L., 228 Fawcett, J. W., 41, 57, 58 Federhen, S., 76 Fedorak, R. N., 278 Feinberg, A. P., 326 Feizi, T., 42 Feltri, M. L., 58, 377 Fenderson, B. A., 85 Feng, G., 357 Feng, L., 42, 169, 337, 345, 354, 355, 369 Fennie, C., 260, 283 Fernandez-Valdivia, R., 108
Ferns, M., 226 Ferreiro, A., 345 Fewou, S. N., 26 Ffrench-Constant, C., 40, 41, 50, 55, 57, 58 Fidanboylu, M., 339, 375 Fiete, D., 225, 226 Fine, H. A., 18 Fineza, I., 354 Finger, E. B., 260 Finne, J., 42 Fishell, G., 40 Fisher, L. J., 28 Fitch, M. T., 41 Flanagan, J. D., 369, 378 Flint, A. C., 40 Fokkema, I., 354 Foreman, R., 74 Forlow, S. B., 156 Forster, R., 95 Fox, A. J., 132 Foxall, C., 96 Fox, R. I., 144 Franceschini, I., 26, 33 Francke, U., 368, 372 Frane, J. L., 74 Franke, L., 370 Fransson, I., 370, 371, 373, 378 Fraser, R., 228 Fraternali-Orcioni, G., 280 Freeze, H., 81 Fregien, N., 114 Frey, M. R., 165, 166 Fritz, T. A., 108 Frost, A. R., 369 Fry, B., 370 Fuhlbrigge, R. C., 96, 100 Fu, J., 108, 110 Fujii, S., 209 Fujikake, N., 339, 345, 379, 381 Fujimura, K., 187, 378, 379 Fujinawa, R., 76 Fujita, H., 41, 42, 52, 55, 58 Fujita, M., 59 Fujiwara, Y., 41, 42, 52, 55, 58 Fukuda, M., 26–29, 33, 59, 81, 110, 143–146, 148, 149, 152, 155–157, 160–161, 163, 165–169, 186, 187, 244–246, 253, 257, 259, 263, 272–280, 283, 284, 286, 370, 380, 387, 399, 403, 405–407, 410 Fukuda, M. N., 59, 144, 148, 149, 152, 244, 370, 380, 399, 405, 406, 408, 410 Fukuda, Y., 337 Fukudome, T., 376 Fukui, S., 59 Fukui, T., 374 Fukunaga, K., 99 Fukushima, M., 273, 276, 279, 280 Fukuta, M., 59
419
Author Index
Fumagalli, M., 370 Funabiki, K., 355 Funakoshi, H., 360 Furlan, A., 109 Furukawa, K., 4, 5, 9, 11, 14 Furukawa, Y., 42, 53, 55, 58, 61, 63, 65, 97 Furuta, G. T., 161 Futerman, A. H., 85 G Gabius, H.-J., 224 Gaehtgens, P., 260 Gage, F. H., 26, 28, 66 Gala´n, L., 345, 354 Gallatin, W. M., 283 Galli, R., 40, 42, 44 Gallo, V., 47, 48 Gama, C. I., 84 Gao, G., 169 Garcia-Vallejo, J. J., 76 Garcia-Verdugo, J. M., 40, 66 Garcion, E., 40, 41, 50, 55, 57 Gardiner, B., 246 Garner, O. B., 206 Garrett, W. S., 162, 165 Garwood, J., 41, 57 Gascon, E., 26 Gates, M. A., 41 Gatgens, J., 109 Gaudet, R., 370 Gauguet, J. M., 156, 244, 259–262, 265, 266, 268, 286 Gautam, T., 110, 111, 114, 118, 119 Gazit, D., 95 Gazit, Z., 95 Gebhardt, R., 228 Geer, L. Y., 76 Geller, H. M., 41, 42, 58, 61 Genta, R. M., 277 Geoffroy, J. S., 260, 283 Gerardy-Schahn, R., 17, 26, 27 Gerhardt, H., 110 Gernsheimer, T., 228 Gersten, K. M., 259, 260, 284 Gertsenstein, M., 333 Gertz, A., 206 Geschwind, D. H., 28 Ghadiri-Sani, M., 26 Ghazarian, H., 108 Giancotti, F. G., 144 Giese, A., 18 Gieselmann, V., 26 Gilmartin, T. J., 74, 76, 273 Ginsburg, D., 223, 225, 227, 230 Gionchetti, P., 278 Giorno, R., 280 Gish, W., 76
Glaser, T., 26 Glimcher, L. H., 162, 165 Glukhova, M. A., 388 Godfrey, C., 169, 354 Godwin, J., 339, 375 Goel, H. L., 144 Goetz, D. J., 101 Goldstein, L. J., 150 Gonc¸alves, A., 354 Gonzalez, E. B., 407 Gonzalez, F., 207 Gordon, J. I., 162, 165 Gorecki, D. C., 388 Goridis, C., 27, 29 Gossens, K., 156 Gotoda, T., 227 Gotoh, M., 109, 124, 129, 144, 187, 190, 198 Goto, S., 76, 81 Gotz, B., 41 Gotz, M., 40, 42, 44, 57, 58, 65 Granfors, K., 273 Granovsky, M., 206 Gray, F., 345 Gree, J. A., 390 Green, C., 110, 111 Gregoriadis, G., 224, 225 Grewal, P. K., 169, 223, 227–230, 339, 345, 355, 369, 371–379 Gries, B., 325 Grigorian, A., 169, 206 Grimmond, S., 246 Grogan, J. L., 281 Gross, C., 348, 354 Groux-Degroote, S., 109 Gschmeissner, S., 109, 143 Guerra, S. D., 207 Guglieri, M., 169 Guicheney, P., 343, 345, 348 Guimara˜es, A., 354 Guiver, M., 132 Gu, J., 3, 145, 150, 209 Gullberg, D., 370, 380, 399, 410 Gunetti, M., 95 Gunther, T., 331 Gunton, J. E., 207 Guo, H. B., 144–145, 150 Guo, S., 4 Guo, W., 144 Guthrie, E. P., 114 Gutierrez Gallego, R., 187 Gutierrez-Ramos, J. C., 281 H Habuchi, H., 59 Habuchi, O., 42, 59, 84 Habuchi, T., 399, 401, 408 Hacker, U., 84
420 Hack, M. A., 40 Haeften, T. W., 207 Hagen, F. K., 174 Hagisawa, S., 399, 410 Hagiwara, K., 187, 197 Hakomori, S., 85, 96, 109 Halberg, D. F., 224 Halilagic, A., 40, 50, 55, 57 Haliloglu, G., 348 Hall, E. M., 74, 76, 77, 79, 81 Haltiwanger, R. S., 74, 206 Hamann, K., 26 Hamano, K., 344 Hamasaki, M., 281 Hambardzumyan, D., 18 Hammer, D. A., 101 Hammer, R. E., 227 Hampe, J., 132 Handa, K., 96 Han, F.-Y., 370, 371, 373, 378 Han, H., 375 Hanisch, F. G., 109, 325 Han, R., 324 Han, S., 144 Hansson, G. C., 109 Harada, K., 227 Harada, O., 273, 274, 278, 283, 284, 286 Haraldsson, M., 226 Hara, T., 207, 209 Hardan, I., 95 Hardonk, M., 228 Harduin-Lepers, A., 109 Hardy, M. R., 225, 226 Harford, J., 224, 225 Hargus, G., 58 Harms, G., 228 Harper, H. A., 369, 370, 379, 381, 391 Harris, C. L., 169 Harris, K., 74, 76, 77, 79, 81, 84 Hartfuss, E., 40, 42, 44 Hart, G. W., 81, 157, 207 Hartwig, J. H., 228 Hasebe, O., Hasegawa, A., 96, 260 Hashimoto, Y., 76 Haslam, S. M., 74, 76, 99, 100, 156, 157, 160–163, 165–169, 246, 260, 266, 275 Hassell, J. A., 388 Hasvold, H., 228 Hatakeyama, S., 144, 148, 149, 152, 370, 380, 397, 399, 401, 406, 408, 410 Hatten, M. E., 42 Hattori, E., 227 Hattori, M., 76, 81 Hawk, C. T., 399 Hawkins, C., 345 Hawthorne, W. J., 207 Hayashi, Y. K., 354
Author Index
Haynes, C. A., 85 Hayry, P., 273, 276 Head, S. R., 74, 76, 273 Heck, N., 41, 57 Hehr, U., 339, 348, 350, 354 Heins, N., 40, 42, 44 Heintz, N., 40, 42 He, M., 108, 110, 112, 118 Hemmerich, S., 244, 258, 259, 272 Hemmi, S., 58 Henis, Y. I., 226 Hennet, T., 108, 174, 187 Henrissat, B., 76, 98 Henry, M. D., 325, 336, 355, 368–370, 374, 376–378, 388 Henzel, W., 258 Herbert, D., 228 Herbst, R., 376 Herken, R., 336 Hermann, R., 339, 350 Hermans, K., 110 Hernandez-Boussard, T., 76 Hernandez, G., 76 Herna´ndez, J., 378 Hernandez, M. P., 26 Herrera, D. G., 66 Herrmann, A., 249 Herrmann, R., 161, 169, 337, 344, 345, 354, 369, 372 Hershberg, R. M., 161 Herz, J., 227 Hewitt, J. E., 337, 339, 345, 355, 367, 369, 371–379 Hickman, J., 224, 225 Hicks, D. G., 406 Hicks, W., 372, 374, 375, 377, 378 Higgins, E., 144 Hikino, M., 41, 59 Hildebrandt, H., 17, 26, 27 Hildreth, J.t., 224 Hindemith, A., 227 Hinderlich, S., 74 Hindsgaul, O., 99, 100, 144, 161, 244, 260, 266, 272, 275 Hirabayashi, J., 185, 193, 200, 201 Hiraiwa, N., 260 Hirakawa, J., 245 Hirakawa, M., 76, 81 Hirano, H., 207 Hirano, K., 41, 42, 52, 55, 58 Hiraoka, N., 59, 145, 146, 156, 161, 186, 244, 259, 272, 275 Hirata, T., 97 Hiruma, T., 109, 124, 129, 146, 187, 190, 198, 378, 379 Hochedlinger, K., 74 Hochstenbach, R., 370 Hoeger, H., 375–377, 379
421
Author Index
Hoffmeister, K. M., 228 Holden, K. R., 345 Holland, E. C., 224 Hollingsworth, M. A., Holzfeind, P. J., 339, 345, 355, 371, 373–377, 379 Homa, F. L., 174 Homeister, J. W., 259 Hong, S. J., 76 Hong, W., 225 Honke, K., 81, 145 Hooper, L. V., 162 Hooper, M. M., 169 Horak, I., 74 Horie, M., 338 Horner, P. J., 66 Horst, E., 275 Horstkorte, R., 74 Horvat-Brocker, A., 57 Ho, S. B., 156, 157, 160–163, 165–169, 246 Hoshino, H., 273, 274, 276, 278, 280, 283, 284, 286 Hoshi, S., 399 Hoshi, T., 369, 376, 378 Hostetter, E., 370 Hougaard, D. M., 280 Houle, J. D., 57 Howard, E. M., 41 Hrabe´ de Angelis, M., 374 Hrstka, R. F., 325, 336, 374 Hsieh-Wilson, L. C., 84 Hsu, J., 372, 374, 375, 377, 378 Huang, S. N., 274 Hubbard, A. L., 226 Huber, B. E., 224 Huckaby, V., 26, 27, 29, 244, 259 Hudgin, R. L., 224 Hu, H., 29, 339, 345, 353, 354, 358, 376 Hunter, N., 132 Husband, A. J., 133 Huseby, N.-E., 225 Huttner, W. B., 40 Huxley, S., 246 Huynen, M. A., 337, 344 Hwang, S. T., 407 I Iannaccone, S. T., 324, 375 Ibraghimov-Beskrovnaya, O., 325, 336, 368, 374 Ibrahim, S. A., 166 Ichihara-Tanaka, K., 42 Ichikawa, S., 174 Ichisaka, T., 74 Ida, M., 41, 42, 52, 55, 58 Idoni, B., 108 Iiyama, R., 135 Iizuka, Y., 227 Ikehara, Y., 111, 185
Ikematsu, S., 42 Ikenaga, H., 207, 209 Ikenaka, K., 42 Ilstrup, D. M., 278 Imai, N., 187, 190, 198 Imai, Y., 246, 260, 283 Imamura, M., 374 Imreh, S., 370, 371, 373, 378 Inaba, N., 109, 124, 129, 144, 187, 190, 198 Inaba, Y., 399, 410 Inamori, K., 370 Inazu, T., 161, 169, 325, 337, 344, 345, 349, 350, 354, 388 Inman, L., 207 Inokuchi, J., 187, 190, 198 Inoue, T., 399, 408 Inoue, Y., 42 Inukai, K., 207 Iobst, S. T., 225 Ioffe, E., 206 Irimura, T., 187, 190, 198 Isaacson, P. G., 273 Isacson, O., 48 Isaji, T., 145, 150 Ishibashi, S., 227 Ishida, H., 99, 187, 190, 197, 198, 260, 354 Ishihara, H., 207 Ishii, A., 399 Ishikura, T., 135 Ishizuka, Y., 109, 124, 129, 144, 187 Iskratsch, T., 376 Ismail, A. S., 162 Ismail, M. N., 155–157, 160–163, 165–169, 246 Issakainen, J., 228 Isselbacher, K. J., 124 Isshiki, S., 187 Ito, F., 354 Itohara, S., 76 Itoh, M., 76, 81 Itoh, S., 145 Ito, J., 227 Ito, N., 59 Ito, S., 200 Ito, Y., 59, 228 Ivanciu, L., 108, 110, 129 Iwai, T., 109, 124, 129, 144, 146, 187, 190, 198 Iwamatsu, A., 207 Iwasaki, H., 109, 111, 124, 129, 144, 187, 190, 198 Iyer, S. P. N., 157, 207 Izatt, L., 369 J Jaako, K., 26 Jackson, C. G., 169 Jackson, P. K., 333 Jackson, R. L., 28
422
Author Index
Jacobson, A. C., 165, 166 Jacques, N. A., 132 Jaeken, J., 206, 230 Jaenisch, R., 74 Jaeschke, H., 228 Jafar-Nejad, H., 108 Jalkanen, S., 273 James, P., 96 Jang-Lee, J., 76 Jankovski, A., 29 Janssen, M., 337, 344 Jansson-Sjostrand, L., 95 Jenkins, C. D., 133 Jeno, P., 225, 226 Jensen, J. L., 80 Jiang, J., 3–5, 14 Jia, X., 95 Jigami, Y., 324, 327, 344 Jimenez, C., 345 Jimenez-Mallebrera, C., 169, 337, 345, 354, 355, 369 Jin, D. K., 354 Jing, J., 388 Jin, H., 76 Johann, V., 58 Johnson, J. H., 207 Johnson, K., 228 Jones, D., 281 Jonsdottir, G. A., 74 Josefsson, E., 228 Joshi, B., 376, 378, 379 Josifova, D., 369 Joziasse, D., Julien, S., 109 Jurado, L. A., 324 Ju, T., 107–112, 114, 117–119, 129, 144, 157, 161, 165, 166, 168, 245 K Kaasik, A., 26 Kabashima, K., 124 Kabel, P. J., 273 Kabos, P., 42 Kaczmarski, E. B., 132 Kadomatsu, K., 244, 259 Kageyama, S., 273, 276, 279, 280 Kago, N., 59 Kahn, J., 95 Kahn, L., 26 Kajimura, N., 355, 377 Kaji, T., 41, 42, 52, 55, 58 Kakinuma, H., 399, 408 Kale, G., 348 Kalra, K. L., 274 Kaluarachchi, M., 339, 375 Kamar, M., 144–145 Kamerling, J. P., 187
Kameya, S., 372, 374, 375, 377, 378 Kaminski, H. J., 339, 345, 354, 358, 376 Kammerer, R. A., 224 Kamradt, T., 281 Kanagawa, M., 324, 325, 336, 338, 339, 345, 355, 368–370, 374–377, 379–381, 391 Kanai, T., 135 Kanamori, A., 96 Kanazawa, I., 325, 388 Kaneda, N., 42, 55 Kanehisa, M., 76, 81 Kanesaki, H., 339, 345, 354, 375 Kang, H. G., 59 Kannagi, R., 96, 244, 259, 260, 266, 286 Kano, H., 161, 169, 337, 344, 354, 374 Kansas, G. S., 96, 100 Kanto, S., 399, 405 Kaplan, J., 228 Kapustin, Y., 76 Kariya, Y., 145 Karlsson, H., 109 Karlsson, S., 95 Karube, K., 281 Kassel, K., 227 Kasugai-Sawada, M., 260 Katagiri, H., 207 Katayama, T., 76, 81 Katoh, K., 355, 377 Kato, K., 174, 399, 405 Kato, M., 59 Kato, T., 399, 401, 405, 408, 410 Katsuyama, T., 263, 273, 276, 277 Katzir, Z., 226 Kaufman, S. J., 302, 305–306 Kawaguchi, A., 40 Kawakami-Kimura, N., 260 Kawakita, M., 343, 344 Kawamoto, R., 109, 124, 129, 146, 187 Kawamoto, T., 109, 124, 129, 146, 187 Kawano, T., 99, 100, 260, 266, 275 Kawasaki, C., 281 Kawasaki, N., 145 Kawasaki, T., 200, 224, 225 Kawashima, H., 156, 243–246, 259–262, 265, 268, 272, 399, 407 Kawashima, S., 76, 81 Kayserili, H., 337, 344 Kechvar, J., 375–377, 379 Keck, B., Keller-Peck, C., 357 Kelley, R. I., 325, 336, 338, 355, 374, 376, 377, 379 Kelly, A. M., 324 Kelly, D., 372, 373, 377 Kelly, R. J., 259, 260, 284 Kennedy, C., 337, 345, 355, 369 Ketonen, L., 377 Kettenmann, H., 40
423
Author Index
Key, M. E., 274 Khalil, N., 337, 345, 355, 369 Khalyfa, A., 57 Khan, J., 228 Khokha, R., 206 Khoo, K. H., 144, 148, 149, 152, 260–262, 265, 268, 399, 406 Khuri, F. R., 144 Kieffer, J. D., 96 Kiessling, L. L., 108 Kieviet, E., 226 Kikuchi, M., 281 Kikuchi, N., 187 Kimata, K., 59 Kim, K. S., 76, 224 Kim, M., 47, 48 Kim, Y. S., 144 King, G. L., King, S. L., 96, 100 Kingsley, P. D., 174 King, V. R., 41, 58 Kinoshita, M., 337 Kinoshita-Toyoda, A., 76, 77, 84 Kirby, M., 47, 48 Kirchhoff, F., 40 Kiso, M., 96, 99, 260 Kiss, J. Z., 26 Kitagawa, H., 59, 61 Kitajima, M., 187 Kjellen, L., 59 Kleene, R., 26 Klein, C., 40 Klein, E. A., 144 Klein, M. A., 169 Kleinschmidt, A., 95 Klinkert, W., 40 Kmiec´, Z., 228 Knibbs, R. N., 100 Knobeloch, K. P., 74 Kobata, A., 114, 200, 325, 388 Kobayashi, K., 161, 169, 337, 343, 344, 354, 355, 374, 377 Kobayashi, M., 59, 263, 271, 273, 274, 276–280, 283, 284, 286, 370, 380, 399, 410 Kobayashi, T., 124 Kobayashi, Y. M., 380 Koepnick, K., 368 Koizumi, S., 187, 190, 198 Kojima, N., 96 Kollet, O., 95 Kondo-Iida, E., 337, 344 Kondo, M., 355, 374, 377 Kong, D., 95 Kornblum, H. I., 28 Korner, C., 339, 350 Kornfeld, R., 206 Kornfeld, S., 174, 206
Koseki-Kuno, S., 193, 200, 201 Kosinski, C. M., 58 Kost-Alimova, M., 370, 371, 373, 378 Kotani, N., 354 Koudstaal, J., 228 Koulis, A., 273 Koutsioulis, D., 114 Koya, D., Koyama, S., 76 Koyasu, T., 355, 377 Kozono, Y., 185, 187, 197 Kozutsumi, Y., 74, 76 Kraal, G., 179 Kraemer, P., 27, 29 Kraus, M. D., 281 Kremmer, E., 95 Kriegstein, A. R., 40 Krishnamurthy, K., 85 Kroger, S., 345 Kronenberg, M., 138 Kronewitter, S. R., 108 Krueger, R. C., Jr., 42 Kruus, S., 377 Krzewinski-Recchi, M. A., 109 Kuang, W., 299, 309 Kubik, J., 227 Kubota, T., 109, 124, 129, 146, 187 Kudo, A., 339, 345, 354, 375 Kudo, T., 74, 76, 109, 124, 129, 144, 146, 187, 190, 198 Kudryashova, E., 297 Kuhlenschmidt, T., 225 Kuhn, H. G., 26, 28 Kuhns, W., 124, 129 Kulhavy, R., 225 Kulik, M., 76, 77, 84, 85 Kulkarni, R. N., 207 Ku, M., 74 Kuno, A., 185, 187, 193, 197, 200, 201 Kunz, S., 324, 368, 370, 375, 380, 381, 388 Kupper, T. S., 96, 100 Kurahashi, H., 299, 338, 374, 376 Kurata-Miura, K., 187 Kurose, K., 11 Kurpios, N. A., 388 Kurt Drickamer, K., 206 Kusano, H., 378 Kusche-Gullberg, M., 59 Kusunoki, S., 325, 388 Kwon, Y. D., 187 Kyan, A., 399, 408 L Laabs, T., 41, 58 Lairson, L. L., 98 Lammerding, J., 300 Lander, E. S., 370
424 Landry, D., 114 Lane, N. E., 169 Lane, P. W., 370, 375 Langenbach, R., 124 Lange, R., 27, 29 Lange, S., 296 Languino, L. R., 144 Lan, H. Y., 280 Lanier, L. L., 399, 407 Lanneau, G. S., 110, 111, 114, 118, 119 Lapidot, T., 95 Larsen, M., 390 Larsen, R. D., 186 Larso, G., 228 Larsson, L., 280 Lasky, L. A., 258, 260, 283 Lassmann, H., 375–377, 379 Laszik, Z., 96, 110, 111, 114, 118, 119 Lau, K. S., 206 Lavdas, A. A., 26 Lawson, A. M., 42 Laywell, E. D., 41, 49 Leahy, J. L., 207 Le, A. V., 225 Le Bourhis, X., 109 Lebrilla, C. B., 108 Le Couteur, D., 228 Le, D. T., 223, 225, 227–230 Lee, C. C., 301 Lee, C. J., 374 Lee, H., 273 Lee, I., 144–145, 150 Lee, J. C., 325, 336, 378 Lee, J. Y., 96, 100 Lee, M., 354 Lee, S. H., 143, 144, 148, 149, 152, 155–157, 160–163, 165–169, 246, 399, 406 Lee, S. U., 169 Lee, W., 27, 28 Lee, Y. C., 225, 226, 372, 374–378 Lefeber, D. J., 108 Leffler, H., 76, 258, 259, 272 Lehesjoki, A. E., 337, 344, 345 Lehle, L., 324 Lehmann, S., 41 Lei, K., 300 Leisti, J., 377 Lemmon, V. P., 339, 345, 354, 358, 376 Lengeler, K. B., 161, 169 Lentini, A., 227 Leonardi, J., 108 Leone, D. P., 58 Leone, O., 275 Lepenies, B., 108 Leppanen, A., 187 Leprince, P., 42 Le Roy, C., 206 Leung, J. O., 224
Author Index
Levedakou, E. N., 372–374, 376, 377 Levery, S. B., Levinson, D., 281 Levinson, S. R., 206, 230 Levy, D., 388 Levy, G. G., 223, 225, 227, 230 Lew, A. M., Ley, K., 156, 260 Lichtman, J. W., 357 Lider, O., 95 Lien, C. F., 388 Li, F., 95 Li, J., 108 Lim, D. A., 40, 66 Lin, C. P., 98 Lindebaum, M., 376 Lindell, G., 249 Lindenbaum, M., 378 Lindros, K., 228 Linhardt, R. J., 76, 77, 83, 84 Lin, S., 281 Lin, X., 84 Lipes, M. A., Lipina, T., 206 Liping, Y., 380, 381 Lipman, D. J., 76 Lipp, M., 95 Litwack, E. D., 376 Liu, H., 111 Liu, J., 59, 339, 345, 353, 354, 358 Liu, W., 77 Liu, X., 95, 110 Livak, K. J., 77, 80, 327 Li, X., 299, 353, 354, 406 Li, Y., 95 Li, Z. F., 296, 303 Lochmuller, H., 169 Lochter, A., 41–43, 57 Lodish, H. F., 207, 225, 226 Loeb, J. A., 224, 225 Lohmueller, J., 370 Lohning, M., 281 Lommel, M., 323, 324, 329, 332–335, 338, 339, 350, 374, 388 Long, J. M., 27, 206, 230 Longman, C., 169, 337, 345, 354, 355, 369, 379 Lonngren, J., 226 Lonn, H., 226 Lotan, R., 114, 146 Louis, S. A., 50 Love, D. R., 294 Loveless, R. W., 42 Lowe, J. B., 74, 100, 145, 146, 156, 157, 161, 186, 206, 244, 259, 260, 272, 275, 399, 407 Lubetzki, C., 26 Lucka, L., 74 Ludwig, W., 48 Lui, J., 376
425
Author Index
Lui, L., 376, 378, 379 Luo, T., 376, 378 Lupi, R., 207 Lupu, F., 108, 110, 129 Lupu, R., 144 Luu, Y., 156, 157, 160–163, 165–169, 246 Lu, Z. P., 339, 345, 379, 381 Lyer, P. N., 150 M MacDermott, R., 273 MacDonald, T. T., 124, 165 Macfarlane, G. T., 124 Macfarlane, S., 124 Macher, B. A., 99 Machida, E., 143 Macht, M., 325 MacKinnon, S., 85 Macpherson, A. J., 133 Macpherson, G. G., 133 MacPike, A. D., 375 Maddatu, T. R., 372, 374, 375, 377, 378 Madsen, K. L., 278 Madson, M., 380, 381, 388 Maffei, L., 41 Magid, M., 95 Magnani, J. L., 43, 96, 275 Magnuson, T., 27, 29 Maherali, N., 74 Makita, S., 135 Maki, W., 407 Malarkey, D., 228 Malatesta, P., 40 Malicdan, M. C., 296 Mallott, J. M., 376 Maly, P., 100, 259, 284 Mamon, J. F., 224 Mandl, C., 41–43, 57 Maness, P. F., 26 Manfredi, M., 344, 354 Mansson, O., 96, 275 Many, A., 95 Manya, H., 161, 169, 324, 327, 337, 339, 343–345, 347, 349, 350, 354, 375 Manzoni, O. J., 26 Marek, K. W., 157, 207 Margolis, R. U., 324, 327, 344 Mariorana, A., 388 Markovich, D., 246 Marks, R. M., 186, 259, 284 Maronpot, R., 228 Marselli, L., 207 Marshall, 2nd, G. P., 49 Martensson, S., 249 Marth, J., 81 Marth, J. D., 17, 26–29, 74, 156, 157, 160–163, 165–169, 174, 206–208, 210, 211, 213, 216,
217, 219, 220, 223, 225, 227–230, 244, 246, 259–262, 265, 268, 272, 275 Martin, F. E., 132 Martin, P. T., 169, 291–294, 305, 306, 308, 309, 312, 388 Martin-Rendon, E., 324 Masayama, K., 41 Masini, M., 207 Massey, J. M., 57 Masubuchi, N., 339, 345, 354, 375 Masumoto, J., 273, 276, 279, 280 Matani, P., 26 Matese, J. C., 76 Mathews, K. D., 325, 336, 338, 355, 371, 374–377, 379 Matsas, R., 26 Matsubara, T., 59 Matsui, F., 41, 42, 52, 55, 58 Matsumoto, A., 200 Matsumoto, M., 97 Matsumura, K., 301, 304, 325, 339, 344, 345, 354, 375, 388 Matsuoka, T., 124 Matta, K. L., 144 Matthews, R. T., 57 Mattioli, P., 227 Matundan, H., 42 Maugenre, S., 345, 348–350 Mayer, J. E., Jr., 96 Mayer, L., 124 Mayer, U., 298 Mayes, D., 57 Mbebi, C., 42 McAuley, J. L., 246 McCaffery, P. J., 376, 378 McCarroll, S. A., 370 McCarthy, M. I., 207 McCaughan, G., 228 McCourt, P., 228 McCullagh, K. J., 297 McCuskey, M., 228 McCuskey, R., 228 McDaniel, J. M., 108–110, 129, 144, 157, 161, 165, 166, 168, 245 McEver, R. P., 96, 108, 110, 129 McFarlane, I., 143 McGee, S., 110 McGuckin, M. A., 246 McGuire, E. J., 174 Mckeown-Longo, P., 225 McLaughlan, J. M., 345, 369, 371, 372, 375, 378, 379 McLean, A., 228 McMahon, S. B., 41, 58 McNeil, P. L., 324, 375 McVicker, B., 227 Meddings, J. B., 124 Medina, D., 388
426 Medini, P., 41 Medzhitov, R., 124 Megeney, L. A., 303, 309 Meier, H., 375 Meijer, C. J., 273, 275 Meijerink, J. P. P., 166, 168, 245 Meinen, S., 302 Mein, R., 169, 354 Mei, P. C., 339, 345, 354, 358, 376 Meissner, A., 74 Melcon, G., 299 Mellgren, R. L., 295, 301 Mellor, R. H., 357 Melo, L. G., 95 Mempel, T. R., 272 Mendell, J. R., 369, 378 Mendelsohn, R., 169 Menendez, J. A., 144 Mennesson, B., 74 Meno, C., 338 Mercuri, E., 337, 339, 344, 345, 369 Meredith, S. C., 111 Merkle, F. T., 26 Merkx, G., Merlini, L., 337, 344, 345, 348–350, 355, 369 Merrill, A. H., Jr., 85 Merzaban, J. S., 98, 156 Mesnard, R. M., 274 Messina, S., 339, 345, 369 Messing, A., 369, 376–378 Mestecky, J., 225 Metzler, M., 206 Michalski, J., 225 Michele, D. E., 294, 298, 299, 304, 324, 325, 336, 338, 344, 355, 369, 374–381, 391 Michelson, A. M., 299 Michielse, C. B., 345, 369, 372 Migaldi, M., 388 Mikami, T., 41, 42, 53, 55, 58, 59, 61, 63, 65 Milatovich, A., 368, 372 Miller, G., 297 Miller, W., 76 Mills, K. A., 371 Milner, D. J., 296, 302, 305–306 Minagawa, S., 399, 401, 408 Miner, J. J., 108 Ming, G. L., 26 Minnear, F., 228 Minowa, M. T., 206–211, 213, 216, 217, 219, 220 Mio, H., 187, 190, 198 Miosge, N., 336 Misaki, K., 374 Misawa, K., 227 Mita, S., 59 Mitoma, J., 28, 99, 100, 145, 146, 156, 244, 257, 259–263, 265, 266, 268, 273, 275–277 Mitsuhashi, H., 161, 169, 337, 344, 354
Author Index
Mitsuoka, C., 260 Mittmann, T., 57 Mi, Y., 224 Miyachi, Y., 124 Miyagoe-Suzuki, Y., 299, 339, 345, 354, 375, 379, 381 Miyagoe, Y., 299 Miyake, K., 324, 375 Miyake, M., 344 Miyake, S., 76 Miyamoto, K., 339, 345, 354, 375 Miyasaka, M., 97 Miyata, K. K. F., 355, 377 Miyata, T., 40 Miyazaki, K., 145 Miyazaki, T., 99, 100, 260, 266, 275 Miyoshi, E., 145, 150 Miyoshi, T., 355, 377 Mizumoto, S., 59 Mizuno, M., 161, 169, 337, 344, 354 Mizuochi, T., 200 Mollicone, R., 74 Monroe, R. S., 224 Montanaro, F., 304, 355, 378 Monteleone, G., 124, 165 Moon, D., 228 Moonen, G., 42 Moon, L. D., 41, 58 Moore, C. J., 371, 375, 378, 379 Moore, S. A., 298, 324, 355, 369, 375–379, 381, 391 Moorman, A. F., 80 Moor, R. E., 165, 166 Morais, V. A., 99 Mora, M., 339, 345, 369 Morava, E., 108 Morell, A. G., 224, 225 Morelle, W., 225 Moremen, K. W., 73–77, 79, 81, 84, 85 Morham, S. G., 124 Moritz, S., 41 Moriya, T., 399, 410 Mornet, D., 378 Moroi, R., 84 Morozumi, K., 109, 124, 129, 146, 187 Morris, H. R., 99, 100, 206, 230, 260, 266, 275 Morrison, S., 225 Morris, T., 399 Morse, H. L., 388 Morshead, C. M., 47, 48 Morteau, O., 124 Mortensen, B., 225 Mosca, F., 207 Moukhles, H., 376, 378, 379 Mounkes, L. C., 300 Moza, M., 296 Mrsny, R. J., 124 Mueller, U., 388
427
Author Index
Mu¨hlenhoff, M., 26, 27 Muir, E., 42, 61 Muirhead, D. E., 324, 375 Muller, M., 228 Muller, W. J., 206, 388 Mulligan, R. C., 333 Mullins, R. F., 378 Muntoni, F., 169, 325, 337, 339, 344, 348, 355, 368, 369, 372, 374, 375, 379, 381, 388 Murakami, T., 407 Muramatsu, H., 42, 74 Muramatsu, T., 42, 55, 74, 85, 96, 244, 259, 266, 286 Murata, T., 124 Murata, Y., 228 Murray, B. W., 99 Murray, J. C., 371, 375 Murthy, A. K., 165 Murthy, S. N. S., 166 Muschler, J., 380, 388 Musfeldt, M., 132 Mu, W., 280 Myerscough, N., 124, 144 Myers, D. D., 370, 375 Myers, E. W., 76 N Nabi, I. R., 169, 206 Nachbar, M. S., 187 Nadanaka, S., 41, 42, 55 Nadeau, J. H., 371 Nadkarni, M. A., 132 Nagai, Y., 339, 345, 360, 379, 381 Nagamachi, M., 124 Nagane, M., 14 Naggert, J. K., 372, 374, 375, 377, 378 Nagler, A., 95 Nagy, A., 333 Nagy, P., 228 Nairn, A. V., 73–77, 79, 81, 84, 85 Nair, R. P., 186 Naito, Y., 74, 76 Nakagawa, H., 59 Nakagawa, S., 187, 190, 198 Nakahori, Y., 344 Nakajima, A., 344 Nakajima, T., Nakamura, A., 187 Nakamura, M., 228 Nakamura, N., 263, 273, 276, 277 Nakamura, T., 360 Nakamura, Y., 337, 374 Nakane, P. K., 274 Nakanishi, H., 109, 111, 124, 129, 144, 187 Nakanishi, K., 41, 42, 52, 55, 58 Nakanishi, N., 378, 379 Nakano, O., 399, 405
Nakashima, K., 59 Nakatani, M., 301 Nakayama, J., 143, 156, 161, 244, 259, 263, 271–280, 283, 284, 286, 370, 380, 399, 408, 410 Narimatsu, H., 74, 76, 109, 111, 124, 129, 144, 146, 185, 187, 198, 378, 379 Narimatsu, Y., 111 Narravula, S., 161 Nashed, M., 96 Natsuka, S., 260 Natsuka, Y., 260 Natsume, A., 187, 190, 198 Naundorf, A., 109, 124, 129, 144, 187 Nayeb-Hashemi, S., 228 Neilson, E. G., 388 Neitz, A., 57 Nelson, S. F., 28 Nerbonne, J. M., 357 Nerl, C., 95 Nestle, F. O., 407 Neufeld, E. J., 96 Neville, M. C., 99 Newburger, J. W., 96 Newgard, C. B., 207 Ngamukote, S., 85 Ng, R. A., 324, 375 Nguyen, H. H., 301, 305, 308, 310, 312, 378 Nguyen, Q. T., 357 Nichol, S. T., 370 Nie, J., 74 Nieves, E., 379 Nikitin, T., 377 Nikolic-Paterson, D. J., 280 Nikolova, V., 300 Nishihara, S., 187, 190, 198 Nishikawa, A., 209 Nishikawa, S., 246 Nishimoto, A., 339, 345, 379, 381 Nishina, P. M., 372, 374, 375, 377, 378 Nishino, I., 325, 336, 338, 355, 369, 374, 376, 377, 379, 381, 391 Nishio, Y., Nishi, T., 187 Nishiuchi, R., 145 Nishizono, H., 228 Nitta, Y., 228 Nizet, V., 223, 227–230 Noctor, S. C., 40 Noel, G., 376, 378, 379 Noggle, S., 85 Noguchi, S., 376 Noll, T., 109 Nomoto, M., Nomura, Y., 344 Nonaka, I., 376 Nonomura, C., 111 Nordenskjold, M., 370
428
Author Index
Normand, E., 26 North, S. J., 74, 76 Novak, E. J., 201 Novogrodsky, A., 114 Nudelman, E. D., 96 Ny, A., 110 Nybakken, K., 84 Nye, E., 110 O O’Dell, J. R., 169 Odent, S., 348, 350 O’Donnell, N., 157 Oehl-Jaschkowitz, B., 354 Ogawa, A., 207 Ogawa, M., 40 Ogilvie, C. M., 369 Oguri, S., 207 O’Hara, C., 281 Ohashi, K., 227 Ohira, A., 228 Ohkura, T., 185, 187, 197, 378, 379 Ohlendieck, K., 292 Ohnuma, A., 354 Ohsawa, Y., 297, 302 Ohshima, K., 281 Ohtake, S., 42, 59, 84 Ohtani, H., 273, 274, 276, 278–280, 283, 284, 286 Ohtsubo, K., 74, 169, 174, 205–208, 210, 211, 213, 216, 217, 219, 220, 260–262, 265, 268 Ohyama, C., 144, 148, 149, 152, 397, 399, 401, 403, 405, 406, 408, 410 Oinonen, T., 228 OjConnell, P. J., 207 OjDonnell, N., 207 Okada, T., 109, 124, 129, 146, 187, 207 Okamura, K., 187 Okano, H., 40 Oka, Y., 207 Okazaki, H., 227 Okazaki, I., 42, 55 Okinaga, T., 376 Okita, K., 74 Okubo, R., 187, 190, 198 Okuda, S., 76, 81 Okumoto, K., 227 Okuno, M., 144 Okuno, Y., 74, 76 Oldstone, M. B. A., 368, 370, 380, 381, 388 Oliveira, J., 354 Olney, A. H., 345 Omori, Y., 355, 377 Ong, E., 59, 156, 157 Onifer, S.M., 57 Onodera, Y., 227 Ono, K., 27, 29
Oohira, A., 41, 42, 52, 55, 58 Ookubo, R., 187, 190, 198 Ophoff, R. A., 370 Oppenheimer, S. B., 108 Oppenheim, J. D., 187 Orci, L., 207 Oriol, R., 74 Orntoft, T. F., 80 Osawa, M., 344, 348, 350 Osuga, J.-I., 227 Otani, H., 338 Ottenberg, K., 109 Ottenheijm, C. A., 297 Ott, S. J., 132 Ou, J., 28 Ou, L., 95 Ozcelik, T., 368 Ozono, K., 376 P Paavonen, T., 273, 276 Pacher, P., 308, 309 Packer, N. H., 249 Padilla, F., 26, 33 Paggi, P., 379 Paglino, J., 124 Paietta, E., 224 Palma, A. S., 99 Palmer, T. D., 28 Pals, S. T., 273, 275 Pane, M., 344 Panico, M., 99, 100, 206, 230, 260, 266, 275 Pan, J., 96 Papastefanaki, F., 26 Parano, E., 354 Paraskeva, C., 144 Park, C. Y., 16 Park, E. I., 224, 225, 227 Park, H., 85 Parkhurst, S., 225, 226 Park, J.-H., 224 Parsons, S. A., 302 Parsons, S. F., 110, 111 Partridge, E. A., 206 Pasha, Z., 95 Patel, P. N., 41, 58 Patnaik, S. K., 379 Patton, B. L., 304, 377 Pattyn, F., 80 Paulsen, H., 144 Pavao, M. S., 41 Pavli, P., 133 Pavone, P., 354 Pawling, J., 206 Peachey, N. S., 372, 374, 375, 377, 378 Pearson, P. L., 207 Pedemonte, M., 344, 354
429
Author Index
Pegoraro, E., 339, 345, 369 Peled, A., 95 Pena, A., 333 Pendas, A. M., 300 Peng, J., 297 Perez-Atayde, A. R., 281 Perkins, H. M., 144 Perrimon, N., 84 Peter, A. K., 297, 301 Peterson, A. C., 377 Peterson, D. A., 28 Peterson, R. G., 207 Petit, I., 95 Petit, V., 388 Petridis, A. K., 26 Petrini, S., 344, 354 Petrof, B. J., 324 Petrucci, T. C., 379 Petryniak, B., 145, 146, 156, 157, 161, 244, 259, 260, 260–262, 265, 268, 272, 275, 284 Pewzner-Jung, Y., 85 Peyrard, M., 370, 371, 373, 378 Philip, M., 111 Phillips, J., 225 Phillips, N., 57 Philp, A. R., 378 Piacentini, M., 227 Piacibello, W., 95 Piccaluga, P. P., 275 Piccioli, M., 275, 280 Picker, L. J., 272, 275 Pierce, J. M., 74, 76, 77, 79, 81, 84 Pierce, M., 114, 144–145, 150 Piercy, R. J., 339, 375 Pieri, F., 280 Pileri, S. A., 275, 280 Piller, F., 110, 144 Piller, V., 110, 144 Pirard, S., 42 Piredda, L., 227 Pizzorusso, T., 41 Plath, K., 74 Plomann, M., 27, 29 Podolsky, D. K., 124, 161 Poggi, S., 280 Polk, D. B., 165, 166 Pollera, M., 207 Pollex-Kruger, A., 144 Ponda, P. P., 124 Ponomaryov, T., 95 Ponting, C. P., 337, 345 Poot, M., 370 Popat, R. J., 41, 58 Popko, B., 372–374, 376, 377 Poppe, B., 80 Porter, W. R., 226 Pozzoli, U., 370 Prados, B., 332–335, 338, 374, 388
Prandini, P., 337, 345, 379 Priatel, J. J., 206 Pricer, W. E., Jr., 224 Prior, S., 339, 375 Probert, C. S., 124 Prochiantz, A., 40 Properzi, F., 42, 57, 61 Pruszak, J., 48 Przemeck, G. K. H., 332–335, 338, 374, 388 Puckelwartz, M. J., 300 Pujol-Borrell, R., 273 Puri, K. D., 260 Q Qasba, P. K., 99 Qi, Y., 353, 354 Quackenbush, E. J., 260 Quaggin, S., 206 Quesenberry, M. S., 224 Quijano-Roy, S., 300, 345, 348–350 Quinlan, J. G., 309 Qu, Q., 76, 376, 378, 379 R Rabinovitch, P. S., 201 Rabuka, D., 161, 244, 272, 275 Racevskis, J., 224 Radbruch, A., 281 Rader, E. P., 324, 375 Radke, M. H., 297 Rafael, J. A., 301 Rafii, S., 96, 100 Rajewsky, K., 27, 29 Raju, T. S., 206 Rakoff-Nahoum, S., 124 Ramakers, C., 80 Ramakrishnan, B., 99 Ramakrishnan, H., 26 Raman, R., 84 Ramasamy, V., 99 Ramirez, K., 156, 157, 160–163, 165–169, 246 Ranscht, B., 26, 27, 29 Rao, N., 96 Rapisarda, D., 371, 375 Rapola, J., 377 Rath, E. M., 373, 377 Ravazzola, M., 207 Ravid, A., 114 Ravkov, E. V., 370 Rayburn, H. B., 377 Ray, J., 28, 66 Raymackers, J. M., 303 Ray, P., 345 Razawi, H., 325 Rebres, R., 225 Reck, F.,
430 Reda, D. J., 169 Rees, C. A., 76 Reinhold, V. N., 206 Reitsamer, H. A., 375–377, 379 Relvas, J. B., 58 Rendon, A., 378 Renes, I. B., 245 Renkonen, J., 273, 276 Renkonen, R., 273, 276 Renner-Mu¨ller, I., 332–335, 338, 374, 388 Rensen, P. C. N., 226 Renz, M., 258 Resta-Lenert, S., 124 Rettino, A., 388 Reutter, W., 74 Rex, M., 378 Reynolds, B. A., 28, 49, 50 Rezniczek, G. A., 294 Rhodes, J. M., 124 Rhodes, K. E., 57 Ricci, E., 344 Rice, J., 388 Rice, K. G., 225, 226 Richard, I., 295 Richard, P., 345, 349, 350 Richards, J. C., 108 Richardson, P. M., 26 Ricordi, C., 207 Ridgley, J. A., 301 Rietze, R. L., 47, 48, 50 Rifai, A., 225 Rigato, F., 41 Rigters-Aria, C. A. E., 207 Riker, M. J., 378 Robbins, M. E., 369, 378 Roberson, R. S., 207 Robert, R. G., 369 Robinson, M. K., 96, 260, 275 Robinson, M. L., 42 Rockle, I., 26, 27 Roder, J. C., 206 Rodius, F., 378 Rodriguez, D., 348, 350 Roes, J., 27, 29 Rogers, C. E., 259, 260, 284 Rogers, J. H., 57 Rogister, B., 42 Rogler, C. E., 206 Rohde, E., 74 Rohrer, H., 47, 48 Rojek, J. M., 368, 370 Roman, J., 144 Romero, N. B., 337, 345, 348–350 Roncador, G., 275 Rooney, J. E., 303 Rosa, Mitche dela, 73 Roseman, S., 174 Rosenberg, R. D., 59
Author Index
Rosen, S. D., 156, 244, 258–260, 266, 272, 273, 283, 286 Ross-Barta, S. E., 369, 376–378 Rossi, A., 344, 354 Rossi, F. M. V., 156 Rossi, G., 388 Rotundo, R., 225 Rougon, G., 26, 29, 33, 43 Rouse, B. N., 275 Rouse, B. T., 260, 272, 275 Rowitch, D. H., 18 Royall, J. A., 128 Rozen, S., 76 Ruijter, J. M., 80 Ruiz, N. I., 226 Rumjantseva, V., 228 Ruotti, V., 74 Rurak, J., 376, 378, 379 Russell, S. J., 33 Rutishauser, U., 26, 27, 29 Ryan, L., 228 S Saba, T., 225, 228 Sabatelli, P., 337, 344 Sabattini, E., 275, 280 Sabeti, P. C., 370 Sachdev, G. P., 128 Sackstein, R., 93–96, 98, 100 Safina, A., 406 Saga, Y., 245 Sahel, J., 378 Saier, M. H., Jr., 76 Sainio, K., 377 Saint, D. A., 77 Saito, F., 325, 336, 338, 339, 345, 354, 355, 369, 374–380 Saito, H., 99, 100, 260–262, 265, 266, 268, 275, 399, 410 Saito, K., 344, 354 Saito, M., 399 Saito, S., 399 Sajin, B., 41 Saji, T., 124 Sakai, K., 343 Sakai, T., 187, 190, 198, 378, 379 Sakai, Y., 273, 274, 278, 283, 284, 286 Sakakihara, Y., 344 Sakuma, S., 42 Salamat, M., 336 Salih, M. A. M., 345, 369, 372 Salmi, M., 273 Samira, S., 95 Sandberg-Nordqvist, A.-C., 370, 371, 373, 378 Sandborn, W. J., 124 Sandkuijl, L. A., 207 Sanes, J. R., 357
Author Index
Sanjo, M., 227 Sansoucy, B. G., 144 Santavuori, P., 377 Santini, D., 275 Santorelli, F. M., 344 Santos, R., 354 Saran, R. K., 337, 345, 355, 369 Sarig, R., 295 Sarkar, M., 206 Sartor, R. B., 124, 278 Sasaki, J., 337, 360, 374 Sasaki, K., 187 Sasaki, T., 292, 325, 354 Sasisekharan, R., 84 Sasisekharan, V., 84 Sastry, M. V., 179 Sato, A., 248 Satoh, M., 399, 410 Sato, N., 187, 197 Sato, S., 355, 377 Sato, T., 4, 5, 9, 11, 14, 111, 185, 187, 190, 198, 378, 379 Sato, Y., 150 Satz, J. S., 298, 325, 336, 338, 355, 369, 374, 376–379, 381, 391 Saunders, T. L., 284 Sawa, H., 11 Sawai, H., 355, 377 Sawaki, H., 378, 379 Sawyer, T. K., 144 Saxena, A., 225, 226 Sbrana, S., 207 Scadden, D.T., 40, 66 Scapolan, S., 344, 354 Schachner, M., 26, 27, 41–43, 57–59 Schachter, H., 74, 108, 156, 161, 169, 174, 206, 345, 369, 379–381, 388, 391 Schachter, M., Schaerli, P., 260–262, 265, 268 Schaffer, L., 273 Schaffner, S. F., 370 Scheffer, H., 337, 344, 348 Scheff, S., 27, 29 Scheidegger, E. P., 260 Scheinberg, I. H., 224, 225 Scheper, R., 273 Scherpbier-Heddema, T., 371 Schertzinge, F., 26, 27 Schiefer, J., 58 Schietinger, A., 111 Schleper, R. L., 371, 375 Schmalzel, R., 371 Schmelzer, J. D., 369, 377, 378 Schmid, J. S., 58 Schmidt, G., 40 Schmittgen, T. D., 77, 80, 327 Schmitz, B., 42 Schnaar, R., 226
431 Schnadelbach, O., 41 Schoen, F. J., Schrader, J. W., 206 Schreiber, H., 111 Schreiber, S., 132 Schroeder, K. W., 278 Schubel, A., 95 Schughart, K., 331 Schuierer, G., 354 Schulte, B. A., 248 Schultz, J., 99 Schutte, K., 41 Schwarzkopf, M., 74 Schwientek, T., 143, 325 Scotting, S. J., 378 Sedergran, D. J., 166 Seeberger, P. H., 99, 100, 108, 260, 266, 275 Segawa, M., 344 Segi, E., 124 Seidahmed, M. Z., 345, 369, 372 Seidenfaden, R., 26, 27 Sekiguchi, K., 145 Sekine, S., 187, 190, 198 Seki, T., 26 Seko, A., 187 Sellon, R., 124 Seroussi, E., 370, 371, 373, 378 Seta, N., 343, 348, 350 Setiadi, H., 96 Sewduth, R. N., 369 Sewell, R., 109 Sewry, C., 345 Sewry, C. A., 169, 337, 345, 354, 355, 369 Sgambato, A., 368, 370, 388 Shafi, R., 157, 207 Shaheed, M. M., 345, 369, 372 Shah, R. S., 166 Shahsafaei, A., 281 Shamdeen, G. M., 354 Sharma, S., 388 Sharon, N., 114, 146 Sharrocks, A. D., 5 Sharrow, M., 26 Shavlakadze, T., 301 Shekels, L. L., 165, 166 Sherlock, G., 76 Sherman, D. L., 369, 377, 378 Sher, R. B., 295 Shia, M. A., 226 Shiao, T., 301 Shibata, T., 42 Shibazaki, M., 228 Shigeta, A., 97 Shi, H., 339, 345, 354, 358, 376 Shihabuddin, L. S., 66 Shim, H., 166 Shimizu, T., 325, 388 Shimodaira, K.,
432 Shinoda, K., 99 Shinomura, T., 59 Shinzawa, K., 225 Shiozawa, T., 96 Shi, Q., 4, 11 Shiraishi, N., 187, 190, 198 Shirane, K., 4 Shi, S. R., 274 Shivtiel, S., 95 Shrager, J. B., 324 Shultz, L. D., 95, 299 Shuo, T., 41, 42, 52, 55, 58 Shworak, N. W., 59 Sicinski, P., 295, 304 Siddiki, B. B., 144 Silasi-Mansat, R., 110 Silbert, J. E., 59 Silva, J., 85 Silver, J., 41, 57 Silvescu, C. I., 206 Simon-Santamaria, J., 228 Singer, M. S., 244, 258–260, 266, 286 Singleton, B. K., 110, 111 Sirko, S., 41, 42, 46, 48, 57–59, 65 Sironi, M., 370 Skaletsky, H., 76 Skordis, L., 339, 375 Skutelsky, E., 146 Skwarchuk, M. W., 369, 378 Slichter, S., 228 Sliedregt, L. A. J. M., 226 Sluka, K. A., 369, 377, 378 Slukvin, I. I., 74 Smalheiser, N. R., 292 Smedsrd, B., 225, 228 Smitham, J., 124 Smith, F. I., 76, 376, 378, 379 Smithies, O., 124 Smith, K., 133 Smith, P. L., 100, 259, 260, 284 Smith, R. S., 371, 372, 374, 375, 377, 378 Smithson, G., 259 Smorodchenko, A., 26 Smuga-Otto, K., 74 Soares-Silva, I., 354 Soji, T., 228 So, L., 156 Soleimani, L., 206 Soliven, B., 372–374, 376, 377 Somer, H., 325, 336, 338, 355, 374, 376, 377, 379 Sommer, I., 42 Song, H., 26 Sonnemann, K. J., 295 Srensen, A. L., 228 Srensen, K., 228 Sossey-Alaoui, K., 406 Souchkova, N., 260 Sowa, M., 144
Author Index
Speiss, M., 225, 226 Speleman, F., 80 Spencer, J. A., 98 Spencer, M. J., 295, 301 Sperandio, M., 156 Spicer, S. S., 248 Spierenburg, H. A., 370 Spiess, M., 224, 225 Spiropoulou, C. F., 368, 370 Spiro, R. G., 200 Splain, R. A., 108 Sporle, R., 331 Spricher, K., 138 Springer, T. A., 260 Squire, S., 301 Sridharan, R., 74 Srivastava, A. K., 345 Stadtfeld, M., 74 Stalnaker, S. H., 380, 381, 388 Stamper, H. B. Jr., 260, 283 Stankoff, B., 26 Stanley, P., 206, 379 Stedman, H. H., 310, 324 Steen, M. S., 302 Steere, A. C., 275 Steinbrecher, A., 337, 344, 369, 372 Steindler, D. A., 41 Steirer, L. M., 227 Stern, C. D., 42 Stevceva, L., 133 Stewart, R., 74 Stiles, C. D., 18 Stockert, R. J., 224 Stok, W., 136 Stone, E. L., 155–157, 160–163, 165–169, 246 Stoolman, L. M., 100, 186 Stowell, C. J., 110, 111 Stowell, S. R., 110, 111, 114, 118, 119, 187 Strahl, S., 323, 324, 329, 332–335, 338, 339, 350, 374 Stratton, J., 228 Straub, V., 161, 169, 325, 336–338, 354, 355, 374, 376, 377, 379 Straul, S., 388 Streeter, P. R., 260, 272, 275 Streit, A., 41–43, 57 Strengman, E., 207 Stroehmann, A., 281 Stroud, M. R., 96 Struwe, M., 331 Stults, C. L., 99 Stupka, N., 301, 311 Suda, Y., 246 Suefuji, H., 281 Sugahara, K., 41, 42, 53, 55, 58, 59, 61, 63, 65, 227 Sugai, M., 76 Suga, T., 399, 408
433
Author Index
Sugimoto, T., 360 Sugimoto, Y., 124 Sugumaran, G., 59 Suhonen, J. O., 28 Suhr, S. T., 28 Sullivan, T., 300 Sunada, Y., 297, 299, 325, 336, 337, 374 Sundaram, S., 379 Suter, U., 58 Sutton-Smith, M., 99, 100, 206, 230, 260, 266, 275 Suzawa, K., 273, 274, 276, 278–280, 283, 284, 286 Suzuki, A., 76, 227 Suzuki, H., 59 Suzuki, K., 372 Suzuki, M., 99, 100, 260, 266, 273, 275, 276, 279, 280 Suzuki, N., 187, 197 Suzuki, Y., 345, 349, 350 Suzumiya, J., 281 Swallow, D. M., 249 Sweeney, H. L., 324 T Tabak, L. A., 108 Tachibana, K., 187 Tachikawa, M., 339, 345, 374, 379, 381 Taddei, I., 388 Tagawa, K., 296 Tajima, Y., 376 Takagi, J., 144 Takahara, N., Takahashi, K., 74, 227 Takahashi, M., 145 Takahashi, S., 161, 169, 337, 344, 354 Takahashi, T., 399, 410 Takai, S., 246 Takaishi, S., 273 Takamatsu, S., 206–211, 213, 216, 217, 219, 220 Takasaki, S., 200, 354 Takashima, S., 193, 200, 201 Takata, K., 207 Takayama, S., 99 Takeda, K., 135 Takeda, N., 246 Takeda, S., 299, 338, 339, 345, 354, 360, 374, 375, 379, 381 Takeda, T., 227 Takematsu, H., 76 Takeshita, S., Takeuchi, M., 161, 169, 206–211, 213, 216, 217, 219, 220, 337, 344, 354 Takezawa, R., 225 Talim, B., 345, 348 Tamatani, T., 96 Tamura, Y., 227
Tanahashi, E., 99 Tanaka, K., 42 Tanaka, M., 59, 228 Tang, J., 206 Tang, Y., 124 Tani, A., 377 Taniguchi, K., 161, 169, 337, 343, 344, 354 Taniguchi, M., 338, 339, 345, 376, 379, 381 Taniguchi, N., 81, 145, 150, 206, 209 Taniguchi, Y., 338 Tan, J., 169, 206, 230, 354 Tanner, W., 324, 332–335, 338, 374, 388 Tannock, G. W., 278 Taratuto, A. L., 348, 350 Targan, S. R., 124 Tarp, M. A., 108 Tashiro, F., 339, 345, 379, 381 Taylor, C. T., 161 Taylor, F. B., 96 Taylor, M. E., 76, 206, 226 Taylor-Papadimitriou, J., 109, 143 Tchieu, J., 74 Temple, S., 40, 47, 48 ten Dam, G. B., 42, 61 Ten Hagen, K. G., 108, 174 Tenno, M., 173, 174, 178, 180, 181, 183 Terskikh, A., 26–29 Tessa, A., 344 Thall, A. D., 259, 284 Tham, T. N., 26, 33 Thatte, J., 156 Theocharidis, U., 42 Thiery, J. P., 388 Thiry, M., 42 Thisse, B., 84 Thisse, C., 84 Thomaidou, D., 26 Thomas, J. O., 187 Thomas, L. B., 41 Thomas, T. E., 47, 48, 50 Thomas, V., 225 Thompson, C., 27, 29 Thomson, J. A., 74 Thorens, B., 207 Thorgeirsson, S., 228 Thornburg, R., 225 Thorpe, S., 225 Tian, S., 74 Tian, W., 169 Tidball, J. G., 301 Tielker, D., 161, 169 Tiemeyer, M., 26 Tinsley, J. M., 301 Tobisawa, Y., 245, 246 Toda, K., 260 Toda, T., 337, 338, 343, 345, 360, 376 Togashi, H., 227
434 Togayachi, A., 109, 124, 129, 144, 146, 185, 187, 190, 197, 198 Toida, T., 42, 61, 76, 77, 83, 84 Toki, D., Tokimatsu, T., 76, 81 Tokita, Y., 41, 42, 52, 55, 58 Tokunaga, T., 246 Tomana, M., 225 Tomasiewicz, H., 27, 29 Tome, F. M., 294 Tomonaga, M., 281 Tomooka, Y., 246 Tom, V. J., 57 Tone, Y., 61 Topaloglu, H., 345, 348, 354 Topaz, O., 174 Torelli, S., 169, 325, 337, 344, 345, 354, 355, 368, 369, 372, 374, 379, 388 Tornehave, D., 280 Torri, S., 207 Totsuka, T., 135 Townsend, R. R., 225–227 Toyoda, H., 76, 77, 84 Tozawa, R.-I., 227 Tramontin, A. D., 40, 66 Tran, C. V., 76 Tran, T., 246 Tremaine, W. J., 278 Trevejo, J. M., 66 True, D. D., 260 Tsay, D., 244, 259, 266, 286 Tseng, Y.-H., 207 Tse, R., Tsuboi, K., 124 Tsuboi, S., 156, 157, 399, 403, 405 Tsuchiya, N., 399, 401 Tsuchiya, T., 281 Tsujimoto, G., 74, 76 Tsukada, T., 246 Tsukahara, T., 376 Tsunoda, Y., 187, 197 Tsutsumi, K., 61 Tuma, D., 227 Tun Kyi, A., 407 Turk, R., 378 Turnbull, E. L., 133 Turner, A., 369, 378 Turner, J. R., 124, 161 Turovskaya, O., 138 Tvaroska, I., Tybulewicz, V. L., 333 Tynninen, O., 273, 276 Tyrrell, D., 96 U Uchimura, K., 59, 96, 244, 259, 266, 286 Uchiyama, N., 193, 200, 201
Author Index
Uchiyama, S., 223, 227–230 Ueda, Y., 246 Ueoka, C., 42, 55 Ugo, I., 345 Ujita, M., 187 Ulfman, L. H., 260 Ullmann, U., 132 Umemoto, E., 97 Uncini, A., 377 Ungar, D., 108 Unger, E., 376 Unger, R. H., 207 Unverzagt, C., 224 Uraushihara, K., 135 Utikal, J., 74 Uyanik, G., 339, 348, 350, 354 V Vael, T. Courtoy, P., 226 Vainzof, M., 294 Vaishnava, S., 162 Vajsar, J., 345 Valcanis, H., 47, 48 Valero, M. C., 324, 332–335, 338, 374, 388 van Berkel, T. J. C., 226 Van Beusekom, E., 337, 344 van Bokhoven, H., 339, 348, 350 van den Elzen, C., 337, 344, 348 van den Hamer, C. J. A., 224, 225 Van den Steen, P., 174 Van der Heijden, P. J., 136 Van der Sluis, M., 166, 168, 245 Van Der Smissen, P., 226, 228 Van Der Zwaag, B., 337, 344, 370 Vandesompele, J., 80 van Die, I., 108 van Dinther-Janssen, A. C., 273 Van Eldik, L. J., 124 Van Goudoever, J. B., 166, 168, 245 van Kessel, A. G., van Kooyk, Y., 76 van Kuppevelt, T. H., 42, 61 van Leeuwen, S. H., 226 van Reeuwijk, J., 337, 344, 345, 348, 369, 372 van Rossenberg, S. M. W., 226 Van Roy, N., 80 Van Seuningen, I., 245 Van Someren, H., 207 Van Tilburg, J. H. O., 207 van’t Slot, R., 370 Varilly, P., 370 Varki, A., 74, 81, 108, 223, 225–227, 230, 259 Varki, N. M., 206, 223, 227–230 Vaughan, M. M., 406 Vavasseur, F., 144 Velazquez, P., 138
435
Author Index
Velcich, A., 166, 168, 245 Vellon, L., 144 Verbeek, N. E., 370 Vercoutter-Edouart, A. S., 109 Verdiere-Sahuque, M., 42 Vergnes, L., 300 Verrey, F., 225 Verrips, A., 337, 344, 348 Viapiano, M. S., 57 Vilela-Silva, A. C., 41 Vintersten, K., 333 Vitry, S., 26, 33 Vliegenthart, J. F., 187 Vodyanik, M. A., 74 Vogelstein, B., 326 Voit, T., 337, 339, 345, 350, 355, 369 von Andrian, U. H., 156, 244, 259–262, 265, 266, 268, 272, 286 Von Holst, A., 40–42, 46–48, 53, 55, 57–59, 63, 65 Voorbij, H. A., 273 Vopper, G., 27, 29 Vorstman, J. A. S., 370 Voss, A. K., 47, 48 Vuillaumier-Barrot, S., 345, 348–350 Vutskits, L., 26 W Wada, K., 42 Wada, M. R., 339, 345, 354, 375 Wada, Y., 150 Waehler, R., 33 Wager, R. E., 224 Wagers, A. J., 100 Wagey, R. E., 50 Wagner, K. R., 302, 306 Wagoner, G., 57 Wagoner, M. R., 57 Wahlberg, J. M., 224 Wahrenbrock, M. G., 223, 225–227, 230 Wallace, M., 357 Walter, M. C., 354 Wandall, H. H., 228 Wang, F., 339, 345, 379, 381 Wang, G., 85 Wang, H., 300 Wang, L., 27 Wang, T. C., 273 Wang, W., 108, 110–112, 114, 118, 119 Wang, X., 145, 324, 327, 344 Wang, Y., 95, 108, 110–112, 114, 118, 119, 174, 206, 230 Ward, C. A., 95 Warner, L. E., 301 Warnock, R. A., 96, 260 Warren, A., 228 Warren, C. E.,
Watanabe, M., 42, 135, 187, 273, 274, 278, 283, 284, 286 Watanabe, R., 399 Watanabe, Y., 225 Watson, S. R., 260, 283 Watterson, D. M., 124 Weber, A., 42 Wehling-Henricks, M., 301 Wehling, M., 301 Wei, B., 109, 138, 144, 157, 161, 165, 166, 168, 245 Weigel, J., 228 Weigel, P. H., 225, 226, 228 Weinert, S., 297 Weinhold, B., 26, 27 Weir, G., 207 Weisman, W. H., 169 Weiss, L., 389 Weissman, I. L., 28, 283 Weissman, T. A., 40 Weiss, R. M., 378 Weiss, S., 28 Weisz, O., 226 Wells, D. J., 301 Wells, L., 380, 381, 388 Weninger, W., 260 Wernig, M., 74 Westmuckett, A., 108, 110, 129 Westphal, M., 18 Westra, S., 369, 376, 378 Wevers, R. A., 108 Weydert, C. J., 370 Wheeler, D. L., 76 Whisenant, T., 74, 76 Whitaker, C. M., 57 White, D. E., 388 Whitehouse, C., 143 Wiechens, N., 74 Wiegert, R., 227 Wijmenga, C., 207 Wiley, H. E., 407 Wilkinson, K. D., 150 Willard, M. T., 110, 111, 114, 118, 119 Willer, T., 299, 323, 324, 329, 332–335, 338, 339, 348, 350, 369, 370, 374, 378, 388 Williamson, R. A., 294, 297, 304, 325, 336, 369, 374, 376–378 Willmann, R., 304 Willnow, T. E., 227 Winkler, J., 348 Wisse, E., 228 Withers, S. G., 98 Witsell, D. L., 99 Wizenmann, A., 42, 57, 58, 65 Wodarz, A., 40 Wohlgemuth, R., 98 Wolber, F. M., 100 Wold, F., 225
436
Author Index
Wolf, E., 332–335, 338, 374, 388 Wong, C. H., 99 Wong, N. K., 74, 76 Wong, W. S., 40 Woodmansey, E. J., 124 Woodruff, J. J., 260, 283 Wopereis, S., 108 Wrabetz, L., 377 Wrana, J. L., 206 Wu, G., 295 Wu, L., 281 Wu, M. T., 407 Wynshaw-Boris, A., 27, 206, 230 X Xia, B., 108–112, 114, 118, 119, 128, 144, 157, 161, 165, 166, 168, 245, 305, 312 Xia, G., 59 Xia, J. Y., 110, 111, 114, 118, 119 Xia, L., 96, 108–110, 112, 118, 123, 129, 144, 157, 161, 165, 166, 168, 245 Xie, J., 76, 77, 84 Xie, W., 74 Xie, X. H., 370 Xie, Y.-G., 370, 371, 373, 378 Xiong, Y., 354 Xu, H., 294, 299 Xu, J., 58 Xu, M., 95 Xu, R., 302, 305, 308, 310, 312 Xu, S., 4 Y Yachechko, R., 74 Yagi, T., 246 Yago, T., 108 Yagyu, H., 227 Yahagi, N., 227 Yajima, Y., 59 Yamada, H., 325, 370, 388 Yamada, K. M., 42, 390 Yamada, M., 193, 200, 201 Yamada, S., 42 Yamada, Y., 187, 190, 198 Yamaguchi, T., 281 Yamaji, T., 76 Yamamoto, H., 76, 397 Yamamoto, K., 227 Yamanishi, Y., 76, 81 Yamanouchi, H., 354 Yamashita, K., 187, 200 Yamashita, S., 275 Yamauchi, S., 59 Yanagisawa, A., 345, 348–350 Yanagisawa, M., 26, 85 Yang, B., 368 Yang, J. M., 144
Yang, X., 206 Yang, Y., 225, 339, 345, 353, 354, 358, 376 Yao, L., 96 Yardley, J. H., 277 Yazaki, Y., 207 Yednock, T. A., 260 Yee, D., 27, 29 Yeh, J., 26 Yeh, J. C., 99, 100, 145, 146, 156, 157, 161, 186, 244, 260, 266, 272, 275 Yen, T. Y., Yet, M.-G., 225 Yik, J. H. N., 225, 226 Yi, L., 156 Yim, S. H., 207 Yin, J., 108 Yip, B., Yonkof, A. L., 57 Yoon, J. H., 305, 312 York, W. S., 74, 76, 77, 79, 81 Yoshida, A., 161, 169, 206–211, 213, 216, 217, 219, 220, 324, 327, 337, 344, 354 Yoshida, B. A., 111 Yoshida, K., 59 Yoshida-Moriguchi, T., 292, 324, 370, 375, 380, 381, 388 Yoshima, H., 200 Yoshioka, M., 344 Young, R., 74 Young, W. W., Jr., 174 Yousefi, S., 144 Yrlid, U., 133 Yuan, X., 47, 48 Yuasa, S., 339, 345, 354, 375 Yuen, C. T., 42 Yue, Y., 309 Yu, J. S., 42, 74 Yu, L., 388 Yu, R. K., 26, 85 Yu, S. Y., 144, 148, 149, 152, 260–262, 265, 268, 399, 406 Yuva, Y., 345
Z Zaccaria, M. L., 379 Zalc, B., 26 Zalik, S., 224 Zandian, M., 42 Zarif, M. J., 144 Zhang, D., 95 Zhang, J., 297 Zhang, L., 339, 345, 354, 358, 376 Zhang, P., 353, 354 Zhang, W., 161, 169, 345, 369, 379, 381, 391 Zhang, X., 26, 300 Zhang, Y., 26, 95, 109, 124, 129, 144, 174, 187
437
Author Index
Zhao, C., 26 Zhao, T., 95 Zhao, Y., 145, 150 Zharkovsky, A., 26 Zharkovsky, T., 26 Zheng, M., 296 Zheng, Q., 114 Zheng, X. L., 14 Zhou, B., 228 Zhou, D., 187 Zhou, Q., 296
Zhou, X., 95 Zhu, X., 298 Zhu, Y., 95 Ziltener, H. J., 156 Zimmermann, D. R., 41 Zipp, F., 26 Zollinger, W., 43 Zou, K., 42 Zou, P., 42 Zuna, R. E., 110, 111, 114, 118, 119 Zuo, D., 388
Subject Index
A Activated partial thromboplastin time (APTT), 231 Alpha-2 antiplasmin assay, 233 AMR. See Ashwell–Morell receptor Analgesia and anesthesia, tumor formation assays pentobarbital, 400 tribromoethanol, 400–401 Antibody production assay, ppGalNAcT-1 antigens for, 175–176 evaluation of, 177 process, 176–177 sera collection, 176 Antithrombin activity assay, 231–232 Apoptosis detection, ppGalNAcT-1 caspase 3 active form, using antibody, 179–182 TUNEL system, 182–183 Ashwell–Morell receptor (AMR) asialoglycoprotein receptors (ASGPRs), 225 endogenous ligands of, 227 hematology and coagulation analyses methods activated partial thromboplastin time, 231 alpha-2 antiplasmin assay, 233 antithrombin activity assay, 231–232 factor VII activity assay, 234 factor VIII activity assay, 234 factor X antigen assay, 234–235 fibrinogen activity assay, 233–234 plasminogen activity assay, 233 platelet levels and glycosylation, lectin binding, 230–231 protein C activity assay, 232 protein S antigen assay, 232–233 prothrombin time (PT), 231 Von Willebrand factor antigen assay, 235 hepatic lectin-1 and 2 (HL-1 and 2), 224–226 HL-1/ HL-2-deficient mice, genotyping, 229–230 lectin binding, VWF glycosylation detection, 235–236 molecular clearance mechanisms, hepatocytes in, 228–229 Asialoglycoprotein receptors (ASGPRs), 225 Ò Avertin , 400–401 B Baculovirus, 117–118 Basement membrane (BM), 388 b3GnT2 (B3GNT2) polylactosamine synthase
B3gnt2-/-lymphocytes, phenotype of CD28 and CD19 molecules, 193, 195 cell surface proteins analysis, 193–194 hypersensitive, TCR/CD28, 196 glycogenes for gene trapping vector, genomic localization of, 191 glycan structures, 189 glycosyltransferases, phylogenetic tree of, 188 in vitro assays for, 190 N-glycan polylactosamine reduction, B3gnt2-/-mice LEL, 187 repeating units, decreased numbers of, 192 protocols B3gnt2-/-mice generation of, 197 calcium flux analysis, 201 costimulated T cells, metabolic labeling of, 200 flow cytometric analysis, 200 genotyping of, 197–198 immunoprecipitation and lectin microarray analysis of, 200–201 in vitro assays, 198–199 LEL lectin-blot analysis, 199 lymphocyte isolation and proliferation assays, 201–202 B lymphocyte activation assay, ppGalNAcT-1, 174–175 C CAdC1 cells, treatment with SCFAs, 247 Calcium flux analysis, 201 Carbohydrate antigens, immunohistochemical analysis conventional immunostaining antigen retrieval methods, 274–275 HEV-like vessels quantification, 276–279 materials, 275 methods, 275–276 percentage of MECA-79þ vessels, 280 L-selectin.IgM chimera binding in situ binding assay, 285–287 preparation, 284–285 multiple immunostaining lymphocytes quantification, subsets, 283–284 materials, 280–281 methods, 281–283
439
440 Carbohydrate structural analysis, 250–253 Caspase 3 active form, apoptosis detection, 179–182 CD28 and CD19 molecules, B3gnt2-/-lymphocytes phenotype, 193, 195 Cell culture and transfection, b1,4GalT V, 5 Cell migration assay, attractant method, 147 Cell sorting and flow cytometry, a-dystroglycan, 389–390 Cell surface half-life time, GLUT2, 216–217 Cell-surface protein cross-linking, GnT-IVa galectin-9, 219–220 method for, 219 Cell surface proteins analysis, B3gnt2-/-lymphocytes, 193–194 Central nervous system (CNS) CSPGs and, 39–40 Large gene mutations, 376–377 expression of, in situ hybridization, 378–380 C2GnT2. See Core 2 b1,6-Nacetylglucosaminyltransferase-2 Chondroitin sulfate proteoglycans (CSPGs), in NSC niche CNS development, 39–40 functional analysis, in NSPCs chondroitinase ABC treatment, 57–58 intracerebroventricular injections in utero, 58–59 glycosaminoglycans chondroitin/dermatan sulfotransferases (C/D-STs), 59 primers and PCR conditions, 62 RT-PCR, 61–63 immunocytochemistry acutely dissociated cells, 46–47 adult neurogenic niche and SVZ-derived cells, 44 markers of, 42–43 microscopy, 66 monoclonal antibody 473HD (MAb 473HD), 41–42, 45 neurospheres cell CS/DS chains and sodium chlorate, 55–56 culturing methods, 50 differentiation assay, 50 immunoblot analysis, for biochemical analysis, 52–53 in situ hybridization of sulfotransferases, 63–65 model for, 51 purification and identification, of CSPGs, 53–54 sectioning and immunohistochemistry, 52 Coagulation factor levels, AMR-deficient mice, 229 Colonic-mucins, GlcNAc6STs, 249–252 Colony formation assay, a-dystroglycan, 392–393
Subject Index
Congenital muscular dystrophy (CMD), 344. See also a-Dystroglycanopathy Conventional immunostaining antigen retrieval methods, 274–275 HEV-like vessels quantification, 276–279 materials, 275 methods, 275–276 Core 2 b1,6-N-acetylglucosaminyltransferase-2 (C2GnT2) and core4 enzyme assays, 159–160 KO mice generation, 157 mass spectrometry, 160–161 PCR genotyping, of Gcnt3f/f and Gcnt3r/r mice, 157–158 phenotyping KO mice DSS-induced colitis model, 165–167 immunoglobulin level, naı¨ve mice, 162–165 Muc2 levels, 166–168 mucosal barrier function, 161–162 viability in, 161 UDP-GlcNAc concentration, 169 Core 3-derived O-glycans, intestinal mucins C3GnT-/-mice generation, 125 gene targeting, 126 glycosyltransferase assays, 127 LacZ staining, 127 PCR genotyping, 127–128 results and, 128 transcripts, RT-PCR analysis, 126 DSS-induced colitis immunohistochemistry, 135–136 intracellular cytokine staining, 136 model, 133, 135 results and analysis, 136–139 epithelial cells role, 124 Muc2 expression, C3GnT deficiency bacterial translocation, real-time PCR, 132 immunohistochemical staining for, 131 in vivo intestinal permeability, 132 results and analysis, 133–134 Tn antigen, C3GnT gene disruption anti-Tn immunohistochemical staining, 129 intestinal glycan structure analysis, 128–129 periodic acid-Schiff and Alcian blue staining, 129 results and analysis, 129–131 Core 4 enzyme activity and glycosylation, C2GnT2-deficient mice enzyme assay procedure, 159 reaction mixture purification, 159–160 tissue homogenization, 159 mass spectrometry, 160–161 Core O-glycans, biosynthesis, 259. See also Lymphocyte homing, core O-glycans Core 3 O-glycans, tumor suppressor a2b1 mediated tumorigenesis, 145 cell line generation, 145–146
441
Subject Index
core3 synthase, 144 detection methods of FACS analysis, 146–147 semiquantitative RT-PCR, 146 FAK signaling, 152–153 functional blocking antibodies, for intergrins determination, 147–148 heterodimerization assay, 151–152 lectin blotting, 151 migration assay, attractant role, 147 tumor formation assay orthotopic tumor cell injection, 149–150 subcutaneous injection, 150 western blotting, for a2 and b1 detection, 150–151 Costimulated T cells, b3GnT2 metabolic labeling, 200 CSPGs. See Chondroitin sulfate proteoglycans (CSPGs), in NSC niche Cytokine staining, intracellular, 136 D Dextran sodium sulfate (DSS)-induced colitis, 254–255 C2GnT2, 165–167 immunohistochemistry, 135–136 intracellular cytokine staining, 136 model, 133, 135 results and analysis, 136–139 Dual luciferase assay, b1,4GalTV analysis, 7–8 a-Dystroglycan (a-DG), 292, 368 glycosylation and laminin binding, Western blot, 355–356 hypoglycosylation, 373–374 tumor suppressor function cell sorting and flow cytometry, 389–390 colony formation assay, 392–393 laminin-binding assay, 390–392 orthotopic prostate tumor formation, 394–395 tumor invasion assay, 393–394 a-Dystroglycanopathy enzymatic activity and mutation search, 346, 348–350 microsomal membrane fraction glycosyltransferase activity, assay for, 346 GnT1 activity, 346–347 mutation analysis, 348 patients examined, 346 POMGnT1 activity, 347 POMT activity, 347–348 therapeutic approaches, 381 Dystrophin-associated glycoprotein (DAG) complex, 292–294, 311 Dystrophin-glycoprotein complex (DGC), 324–325
E Embryonic phenotype, in Large mutations, 374–375 Embryonic stem cells (ESCs) pluripotency and differentiation marker genes, 86–88 qRT-PCR analysis glycosaminoglycan biosynthetic genes, 83–84 sphingolipid biosynthetic genes, 85 Endogenous ligands, of AMR, 227 Enzymatic activity and mutation search, 346, 348–350 Enzyme-linked immunosorbent assay (ELISA) immunoglobulin isotypes quantification, 163–164 protein S antigen assay, 232–233 VWF lectin binding, 235–236 Epidermal growth factor (EGF), 14, 20 E-selectin GPS activity test, 101–102 ligand expression detection, 100–101 IgM chimeric proteins, lymph nodes staining frozen sections, preparation and fixation, 264–265 materials and equipment, 263–264 preparation of, 264 staining with, 265–266 F FACS. See Fluorescence activated cell sorter Factor VII activity assay, 234 Factor VIII activity assay, 234 Factor X antigen assay, 234–235 Fibrinogen activity assay, 233–234 Flow cytometry b3GnT2, 200 E-selectin ligand activity test, 101–102 Fluorescence activated cell sorter (FACS) core 3 O-glycan, 146–147 NSCPs isolation, 48 Focal adhesion kinase (FAK) signaling, core 3 O-glycan, 152–153 Footpad (FP) inoculation, 404, 407 Formalin-fixed paraffin-embedded (FFPE), 273 FTVI. See Fucosyltransferase VI a(1,3)-Fucosylation method, of cell surface, 99–100 Fucosyltransferase VI (FTVI), 98–100 Fukutin-related protein (FKRP), 345 Fukuyama-type congenital muscular dystrophy (FCMD), 344–345 Functional blocking antibodies, for intergrins determination, 147–148
442
Subject Index G
b1,4-Galactosyltransferase V (b1,4GalT V), glioma growth regulator catalytic enzyme, 11, 13 characterization, 18–19 chemotherapeutic drugs, 19 EGF stimulation, 21 experimental cell culture and transfection, 5 dual luciferase assay, 7–8 gel shift assay, 8 invasion and migration analysis, 6 lectin blot and staining analysis, 6 nuclear protein, extract of, 8 RT-PCR, 7 survival assay, 6–7 tumor cells implantation, in mice, 7 expression analysis, 4, 8–9 GICs, 16–18, 22 mechanisms, 11 overexpression effects, 11–12 reduction effects, expression, 10–11 Sp1 and Ets transcription factors, 4–5 transcriptional regulation chemotherapy drugs, 14 EGF, 14–16 nuclear protein, 14 Galectin-9, GLUT2 association, 219–220 Gel shift assay, b1,4GalT V analysis, 8 Gene trapping vector, glycogenes, 191 Genotyping b3GnT2, 197–198 HL-1/ HL-2-deficient mice, 229–230 Germinal center (GC) detection of, B lymphocyte apoptosis, 181 in spleen, histological analyses of, 180 GICs. See Glioma-initiating cells GlcNAc6STs. See N-Acetylglucosamine6-O-sulfotransferases Glial cells differentiation inhibition, polysialic acid, 32 Glial fibrillary acidic protein (GFAP) staining, glia limitans analysis, 362–364 Glia limitans analysis, GFAP staining, 362–364 Glioma growth regulator. See b1, 4-Galactosyltransferase V (b1,4GalT V), glioma growth regulator Glioma-initiating cells (GICs), 16–18, 22 Glucose tolerance test, 210–211 Glucose transporter-2 (GLUT2) cell surface half-life time of, 216–217 galectin-9, 219–220 glycan analysis, lectin blot, 217–219 immunohistochemical analysis in situ localization of, 213 method for, 211–212 production and trafficking of, 216
Glutathione-S-transferase (GST), 327–328 Glycan analysis, lectin blot, 217–219 Glycan-related gene expression, qRT-PCR, 75–82 Glycogenes, b3GnT2 (B3GNT2) polylactosamine synthase gene trapping vector, genomic localization of, 191 glycan structures, 189 glycosyltransferases, phylogenetic tree of, 188 in vitro assays for, 190 Glycosaminoglycans biosynthetic genes, qRT-PCR analysis, 83–84 chondroitin/dermatan sulfotransferases (C/D-STs), 59 primers and PCR conditions, 62 RT-PCR and semiquantitative analysis, 59–63 Glycosyltransferase assays, C3GnT -/-mice generation, 125 Large gene, 379–381 phylogenetic tree of, 188 Glycosyltransferase-programmed stereosubstitution (GPS), stem cell trafficking approaches, 94 cell migration, 94–95 E-selectin ligand expression detection, 100–101 testing for, 101–102 a(1,3)-fucosylation, FTVI, 99–100 fucosyltransferase VI (FTVI), 98–99 guiding principles, 97 human mesenchymal stem cells (hMSCs), 97–98 rationale for, 95–97 GnT1 activity, a-dystroglycanopathy, 346–347 GPS. See Glycosyltransferase-programmed stereosubstitution, stem cell trafficking H HCELL. See Hematopoietic cell E-/L-selectin ligand Hematology and coagulation analyses methods, AMR. See also Ashwell-Morell receptor (AMR) antigen levels, 231–235 clotting times, 231 lectin binding platelet levels and glycosylation, 230–231 VWF, 235–236 Hematopoietic cell E-/L-selectin ligand (HCELL), 96–97 Heparan sulfate proteoglycans (HSPGs), 41 Hepatic lectin (HL), 224–226 Hepatocytes, in molecular clearance mechanisms, 228–229
443
Subject Index
Heterodimerization assay, core 3 O-glycan, 151–152 High endothelial venules (HEVs) GlcNAc6ST-2, 244 immunohistochemical analysis, 272–273 lymphocyte subsets, 284 profile, 279 quantification, practical examples, 276–279 in ulcerative colitis, 274, 279 lymphocyte homing, 272 HSPGs. See Heparan sulfate proteoglycans Human mesenchymal stem cells (hMSCs), 97–98 Humoral immunity, ppGalNAcT-1. See Polypeptide GalNAc transferase-1 (ppGalNAcT-1) Hypoglycosylation, dystroglycan, 373–374 I Immunoblot analysis, of neurosphere cells, 52–53 Immunocytochemistry, CSPGs acutely dissociated cells, 46–47 adult neurogenic niche and SVZ-derived cells, 44 markers of, 42–43 Immunoglobulin level, C2GnT2-deficient mice IgA quantification, in fecal samples, 164–165 isotypes quantification, in sera collection, 162–163 ELISAs, 163–164 Immunohistochemical analysis carbohydrate antigens (see Carbohydrate antigens, immunohistochemical analysis) DSS-induced colitis, 135–136 GLUT2 in situ localization of, 213 method for, 211–212 Immunohistochemical staining GlcNAc6STs, 248–249 for intestinal Muc2, 131 ppGalNAcT-1, 177–179 Immunoprecipitation and lectin microarray analysis, b3GnT2, 200–201 Insulin homeostasis, GnT-IVa, 210–211 Intestinal mucus barrier function. See Core 3-derived O-glycans, intestinal mucins Intraperitoneal (IP) injection, 398, 401 Intravenous (IV) injection, tumor formation assays tail vein in lung, 404 procedure for, 403 standard numbers of cells for, 404 tumor formation assays, 403–405 In vitro assays, b3GnT2, 198–199
J Jurkat cells, T-synthase, 110–111 L LacZ staining, C3GnT -/-mice generation, 125 Laminin-binding assay, a-dystroglycan, 390–392 Laminin immunostaining, 359–361 Large gene, dystroglycan glycosylation pathway dystroglycanopathy, therapeutic approaches, 381 expression of, 378–380 glycosyltransferase, 379–381 humans, diseases in, 369 hypoglycosylation of, 373–374 identification of, mutated mice alleles, genomic organization, 371–372 genotyping, Largemyd mutation, 373 myd mutant, 370–371 veils and enr alleles, 372–373 mice phenotypes, mutations in central nervous system (CNS), 376–377 embryonic, 374–375 muscle, 375–376 ocular defects in, 377–378 peripheral nervous system (PNS), 377 Lectin binding platelet levels and glycosylation, 230–231 VWF glycosylation detection, 235–236 Lectin blot analysis core 3 O-glycan, 151 GLUT2 glycan analysis, 217–219 and staining, b1,4GalTV, 6 Lentivirus generation neurosphere cells model, 34 preparation method, 33–34 Leukocyte infiltration, DSS treatment, 254 Liver, in molecular clearance mechanisms, 228–229 L-selectin and E-selectin, lymph nodes staining, 263–265 IgM chimera binding in situ binding assay, 285–287 preparation, 284–285 probing glycoproteins treatment, PVDF membrane, 267–268 materials, 266–267 6-sulfo sLeX, structure of, 258 Lycopersicon esculentum (tomato) agglutinin (LEL), 187 lectin-blot analysis, 199 Lymph nodes staining, L-and E-selectin-IgM chimeric proteins frozen sections, preparation and fixation, 264–265
444
Subject Index
Lymph nodes staining, L-and E-selectin-IgM chimeric proteins (cont.) materials and equipment, 263–264 N-glycosidase F treatment, 266 preparation of, 264 staining with, 265 Lymphocyte homing, core O-glycans assay for fluorescence-labeled lymphocytes preparation, 261–262 inhibition of, lectins, 262–626 intravenous injection, 262–626 materials and equipment for, 261 steps in, 260 biosynthesis of, 259 L-selectin ligands probing glycoproteins treatment, on PVDF membrane, 266–268 materials, 266–267 lymph nodes staining, L-and E-selectin-IgM chimeric proteins frozen sections, preparation and fixation, 264–265 materials and equipment, 263–264 N-glycosidase F treatment, 266 preparation of, 264 staining with, 265–266 Lymphocyte isolation and proliferation assays, b3GnT2, 201–202 M Mammary fat pad (MFP) inoculation, 406 Mass spectrometry, C2GnT2, 160–161 Mgat4a gene, 207–208 Microsomal membrane fraction a-dystroglycanopathy glycosyltransferase activity, assay for, 346 GnT1 activity, 346–347 mutation analysis, 348 patients examined, 346 POMGnT1 activity, 347 POMT activity, 347–348 POMT1 gene, 328 Migration assay, core 3 O-glycan, 147 Molecular chaperone cosmc activity assay baculovirus system, 117–118 expression vector construction, 116–117 in mammalian cell, 118–119 T-synthase activity assay, 113–114 assay procedure and total product calculation, 115–116 cell lines and extracts preparation, 114–115 disruption of, 110 endoplasmic reticulum (ER) model, 111 Jurkat cells, 110–111
materials, 114 mucin type O-glycans biosynthesis, 108–109 vectors preparation and assays for, 112 Muc2 levels, C2GnT2 phenotyping KO mice, 166–168 protein expression, C3GnT deficiency bacterial translocation, real-time PCR, 132 immunohistochemical staining for, 131 in vivo intestinal permeability, 132 results and analysis, 133–134 Mucosal barrier function, C2GnT2 phenotyping KO mice, 161–162 Multiple immunostaining lymphocytes quantification, subsets, 283–284 materials, 280–281 methods, 281–283 Muscle–eye–brain disease (MEB), 344 Muscle phenotype, in Large mutations, 375–376 Muscular dystrophy, genetic defects dystroglycan, 292, 304–305 dystrophin-associated glycoprotein (DAG) complex, 293 Galgt2, 305 genetic modifiers of, 301–303 mouse models for, 294–300 mutation effects, 294 phenotype analysis assessment of, 309–310 central nuclei, 310 DAG proteins expression, 311 force drop, eccentric contractions, 308 immune components, 311 mdx mice, echocardiographic studies, 309 model for, 306–307 therapeutic genes, 305 Myodystrophy (myd ) mutation, 370–371 N N-Acetylglucosamine-6-O-sulfotransferases (GlcNAc6STs) CAdC1 cells, treatment with SCFAs, 247 carbohydrate structural analysis colonic-mucins from WT and KO mice, 253 LC-ESI-MS, 251 LC-ESI-MS/MS, 252 oligosaccharides, colonic-mucins, 250–252 colonic-mucin-enriched fraction, preparation, 249 DSS-induced colitis, 254–255 GlyCAM-1, 244–245 high endothelial venules (HEVs), 244 histology and immunostaining, 248–249 leukocyte infiltration, 254 mouse colon adherent cell line and culture, establishment, 246
445
Subject Index
real-time PCR (RT-PCR), 247–248 N-Acetylglucosaminyltransferase-IVa (GnT-IVa) cell-surface protein cross-linking galectin-9, GLUT2 association, 219–220 method for, 219 enzymology, 209–210 glucose and insulin homeostasis, 210–211 GLUT2 cell surface half-life time of, 216–217 glycan analysis, lectin blot, 217–219 immunohistochemical analysis, 211–214 islet cell preparation and culture, 214 Mgat4a gene and gene targeting strategy, organization of, 207–208 pulse-chase labeling of, 215–216 N- and O-linked glycan biosynthesis, transcript analysis, 85–86 Neocortex, lamination defects, 357–359 Neural stem cells. See Polysialic acid, neural stem cells Neural stem/progenitor cells (NSPCs). See also Chondroitin sulfate proteoglycans (CSPGs), in NSC niche embryonic sections staining method, 43–44 in vitro and in vivo proliferation analysis, 56 isolation of FACS, 48 immunopanning, with MAb 473HD, 48–49 magnetic beads, 49 Neurosphere cells CSPGs biochemical analysis, 52–53 CS/DS chains and sodium chlorate, 55–56 culturing methods, 50 differentiation assay, 50 in situ hybridization of sulfotransferases, 63–65 model for, 51 purification and identification, of CSPGs, 53–54 sectioning and immunohistochemistry, 52 differentiation of, 31 preparation of, 28–29 N-glycan polylactosamine reduction, B3gnt2-/-mice LEL, 187 repeating units, decreased numbers of, 192 Northern blot analysis, POMT1 gene, 325–326 Nuclear protein extraction, b1,4GalT V, 8 O Ocular defects, Large gene mutations, 377–378 O-glycans, 124, 245, 253. See also Core 3-derived O-glycans, intestinal mucins T-synthase and Cosmc, 109 Oligosaccharides, colonic-mucins, 250–252
O-mannosylation, 324. See also Protein O-mannosyltransferase-1 (POMT1) gene OmnibankTM, 197 Orthotopic prostate tumor formation, a-dystroglycan, 394–395 P Pancreatic islet cells preparation and culture of, 214 pulse-chase labeling of, 215–216 Pentobarbital, 400 Peripheral lymph node addressins (PNAd), 272–273 Peripheral nervous system (PNS), Large gene mutations, 377 Phenotype KO mice, C2GnT2 DSS-induced colitis model, 165–167 immunoglobulin level, naı¨ve mice, 162–165 Muc2 levels, 166–168 mucosal barrier function, 161–162 muscular dystrophy, genetic defects assessment of, 309–310 central nuclei, 310 DAG proteins expression, 311 force drop, eccentric contractions, 308 immune components, 311 mdx mice, echocardiographic studies, 309 model for, 307 Pial basement membrane analysis, POMGnT1 laminin immunostaining, 359–361 transmission electron microscopy (TEM), 360–363 Plasminogen activity assay, 233 Platelet levels and glycosylation, lectin binding, 230–231 Polylactosamine synthase. See b3GnT2 (B3GNT2) polylactosamine synthase Polymerasechainreaction(PCR)genotyping,230 of C2GnT2 KO mice, 157–158 C3GnT -/-mice generation, 127–128 Polypeptide GalNAc transferase-1 (ppGalNAcT-1) apoptosis detection caspase 3 active form, using antibody, 179–182 TUNEL system, 182–183 functions, 174 immunohistochemical staining, of frozen sections, 177, 179–180 in vitro B lymphocyte activation assay, 174–175 in vivo antibody production assay antigens for, 175–176 evaluation of, 177 process, 176–177 sera collection, 176 Polysialic acid, neural stem cells deficient mice, 27
446
Subject Index
Polysialic acid, neural stem cells (cont.) expression of, 27 glial cells differentiation inhibition, 32 in vitro assay differentiation, 30–32 migration, 29–30 lack of, 26 lentivirus generation, 33–34 neurons generation, 26 neurosphere cell culture, 28 ppGalNAcT-1. See Polypeptide GalNAc transferase-1 Prostate cancer cell invasion, core3 synthase inhibition Prostate inoculation implements for, 408–409 procedure, 410 Protein C activity assay, 232 Protein O-mannose Nacetylglucosaminyltransferase 1 (POMGnT1) a-dystroglycanopathy, 347 glia limitans analysis, GFAP staining, 362–364 histological analysis of, 356, 358 mutations of, 354 neocortex, lamination defects in, 357–359 pial basement membrane analysis laminin immunostaining, 359–361 transmission electron microscopy (TEM), 360–363 role of, 354 Protein O-mannosyltransferase-1 (POMT1) gene activity determination assay for, 328–330 a-DG-GST fusion protein substrate preparation, 327–328 microsomal membrane fractions preparation, 328 knockout mice, generation and genotyping of progeny, Pomt1þ/-heterozygous intercrosses, 335 targeted disruption, 333–335 murine embryo development, expression in, 329, 331–333 Pomt1-/-embryos, extracellular components characterization, 336–338 transcription level determination Northern blot analysis, 325–326 real-time quantitative PCR (RT-qPCR), 326–327 Protein S antigen assay, 232–233 Prothrombin time (PT), 231 Pulse-chase labeling, pancreatic islet cells, 215–216 Q Quantitative real-time polymerase chain reaction (qRT-PCR), transcript analysis
glycan-related gene expression applications, 83 biosynthetic pathway, 81–82 cDNA synthesis, 79–80 data analysis, 80–81 materials and equipment, 75 murine and human glycan-related gene assembly, 76 normalization gene selection, 80 primer design, 76–77 RNA isolation, 79 statistical analysis, 81 validation, 77–79 glycosaminoglycan biosynthetic genes, 83–84 sphingolipid biosynthetic genes, 85 R Real-time PCR bacterial translocation, colonic mucosa, 132 GlcNAc-6-O-sulfotransferases, 247–248 Real-time quantitative PCR (RT-qPCR), POMT1 gene, 326–327 Reverse transcription PCR (RT-PCR) b1,4GalTV analysis, 7 of C3GnT transcripts, 126 sulfotransferases amplification method, 61–63 S Sandwich ELISA-based assay, VWF lectin binding, 235–236 Sarcoglycan, 294 Selectin. See also E-selectin; L-selectin glycoproteins and glycolipids, 96–97 sialylated Lewis x and Lewis a, 95–96 types, 95 vascular endothelial cells, 96 Semiquantitative RT-PCR, core 3 expression, 146 Sphingolipid biosynthetic genes, qRT-PCR analysis, 85 Stem cells. See Transcript analysis, stem cells Stem cell trafficking. See Glycosyltransferaseprogrammed stereosubstitution (GPS), stem cell trafficking Subcutaneous (SC) inoculation, tumor formation assays, 405–406 Subentricular zone (SVZ), 44 Sulfotransferases amplification method, 61–63 in situ hybridization, 61–63 T Tail vessels, of mice, 402 Testicular inoculation, tumor formation assays, 408 Tn antigen, C3GnT gene disruption anti-Tn immunohistochemical staining, 129
447
Subject Index
intestinal glycan structure analysis, 128–129 periodic acid-Schiff and Alcian blue staining, 129 results and analysis, 129–131 Transcript analysis, stem cells N-and O-linked glycan biosynthesis, 85–86 pluripotency and differentiation marker genes cell lines, 86 MESO lineage, 87 transcript abundance for, 86–88 qRT-PCR glycan-related gene expression, 75–82 glycosaminoglycan biosynthetic genes, 83–84 sphingolipid biosynthetic genes, 85 Transcriptional regulation, b1,4GalT V chemotherapy drugs, 14 EGF, 14–16 nuclear protein, 14 Transmission electron microscopy (TEM), pial basement membrane, 360–363 Tribromoethanol, 400–401 T-synthase activity assay, 113–114 assay procedure and total product calculation, 115–116 cell lines and extracts preparation, 114–115 Cosmc biochemical studies and function, 111–112 endoplasmic reticulum (ER) model, 111 Jurkat cells, 110–111 materials, 114 vectors preparation and assays for, 112 Tumor formation assays analgesia and anesthesia, 399–401 animal care and protocol approval, 399 cell injection and inoculation, 398–399 core 3 O-glycan orthotopic tumor cell injection, 149–150
subcutaneous injection, 150 disinfection of, 399 footpad (FP) inoculation, 404, 407 handling and restraint, 398 intraperitoneal (IP) injection, 398, 401 intravenous (IV) injection, tail vein, 398, 401–404 tumor formation assays, 403–405 for lungs, 404 prostate anatomy of, 408–409 inoculation, implements for, 408–409 procedure, for inoculation, 410 subcutaneous (SC) inoculation, 405–406 testicular inoculation, 408 Tumor invasion assay, a-dystroglycan, 393–394 Tumor suppressor function. See a-Dystroglycan, tumor suppressor function TUNEL system, apoptosis detection, 182–183 U Ulcerative colitis, HEV-like vessels, 274, 279 V Veils and enr, Large gene mutant alleles, 372–373 Von Willebrand factor antigen assay, 235 lectin binding, glycosylation detection, 235–236 W Walker–Warburg syndrome (WWS), 344 Western blot analysis core 3 O-glycan, 150–151 a-dystroglycan, 355–356