Developmental Biology Protocols

Methods in Molecular Biology TM TM VOLUME 137 Developmental Biology Protocols Volume III Edited by Rocky S. Tuan Cec...

Author: Rocky S. Tuan | Cecilia W. Lo

33 downloads 1066 Views 3MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form

DOWNLOAD PDF

Methods in Molecular Biology

TM TM

VOLUME 137

Developmental Biology Protocols Volume III Edited by

Rocky S. Tuan Cecilia W. Lo

HUMANA PRESS

Overview

3

1 Developmental Biology Protocols Overview III Rocky S. Tuan and Cecilia W. Lo 1. Introduction The marriage of cell and molecular biology with embryology has produced remarkable advances for the field of developmental biology. In this third volume of Developmental Biology Protocols, contemporary, practical methods are first presented for the analysis and manipulation of developmental gene expression. To illustrate how such techniques, as well as procedures of experimental embryology including those described in the first two volumes of the series, may be applied in the study of development, a panoramic collection of experimental models of morphogenesis, development, and cellular differentiation are detailed. Both in vivo and in vitro systems are included. The volume concludes with various examples of developmental models of diseases and their molecular basis. 2. Manipulation of Developmental Gene Expression and Function Drosophila has been and remains one of the most versatile model systems for the manipulation of developmental gene expression. Chapter 2 focuses on a description of the experimental approaches currently used in ectopic gene expression in Drosophila to examine the function of a given gene in the desired tissue. Chapter 3 deals with the utilization of the highly efficient FLP/FRT yeast site-specific recombination system to generate somatic and germline clones in Drosophila for phenotypic analysis and screening. Chapters 3 and 4 address the methods used to alter gene expression as well as gene function in another experimentally highly accessible system, the developing chick embryo. Chapter 3 describes the application of antisense oligonucleotides to “knock down” gene expression in somitic stage chick embryos, whereas Chapter 4 discusses how functional neutralizing monoclonal antibodies may be used to block the activity of a specific gene product, N-cadherin, in the developing chick embryonic limb bud. 3. Analysis of Gene Expression The first step in analyzing the molecular basis of any developmental event is to characterize and compare gene expression profiles, both spatial and temporal, as a function From: Methods in Molecular Biology, Vol. 137: Developmental Biology Protocols, Vol. III Edited by: R. S. Tuan and C. W. Lo © Humana Press Inc., Totowa, NJ

3

4

Tuan and Lo

of development. A comprehensive list is provided in this section. Classic methods such as Northern blotting is not presented here, because relevant protocols are readily available in many technical manuals of molecular biology. Quantitative methods include ribonuclease protection assay (Chapter 6), and polymerase chain reaction (PCR) based methods (Chapters 7 and 8). In situ hybridization (Chapters 9–15) has gained wide application in visualizing the spatial aspects of gene expression in the developing embryo, particularly in mapping the dynamics of tissue morphogenesis. In particular, the ability to carry out multiple in situ hybridizations (Chapter 14), or sequential in situ hybridization and immunohistochemistry (Chapters 12 and 15), on a given specimen should be invaluable for analyzing the potential roles of genes and gene products in development. The potential of the green fluorescent protein (GFP) of the jellyfish, Aequoria victoria, as a vital recombinant tag for genes of interest has produced a great deal of excitement in developmental biology; Chapter 16 provides a thorough discussion of the principles and techniques in the application of the GFP. Finally, the basic strategy in the application of monoclonal antibodies, one of the most powerful technical advances in modern biomedical research that has enjoyed a distinguished history, in the study of embryonic development is presented (Chapter 17). 4. Models of Morphogenesis and Development This section presents a number of developmental model systems under active investigation to illustrate the multitude of experimental questions currently being addressed in the field of developmental biology. The inductive events of embryogenesis and means for their analyses are described in Chapters 18 and 19. Techniques for whole or partial embryo explant cultures for the somitic stage embryos for the analysis of mesodermal and neural crest studies are covered in Chapters 20 and 21. Other models of morphogenesis include those for angiogenesis (Chapter 22), vasculogenesis (Chapter 23), and epithelial–mesenchyme interactions (Chapter 24). Specific organogenesis models are also included—limb bud (Chapter 25) and palate (Chapter 26). 5. In Vitro Models and Analysis of Differentiation and Development Regulation of cell differentiation is one of most active research areas of developmental biology. With the advent of cell and molecular biology, and the identification of differentiation-associated genes, cell differentiation is often interpreted in terms of regulation of gene expression. Both cis and trans modes of gene expression regulation have been found to operate during cell differentiation, leading to active investigation on structure/function of gene promoters and transcription factors. This section is a collection of many in vitro cell differentiation systems currently under active investigation. Early events in development include fertilization (Chapter 27) and trophoblastic differentiation (Chapter 28). Bone marrow-derived mesechymal progenitor cells have received a great deal of recent attention as candidate cells for cellbased tissue engineering. It is generally believed that the differentiation potentials of these cells represent a partial recapitulation of the characteristics of embryonic mesodermal cells. Techniques for their isolation, culture, and characterization are described in Chapter 29. Another cell type important for studying cell differentiation are germ cells; methods for their isolation and culture are included in Chapter 30. Prostate cell

Overview

5

differentiation is discussed in Chapter 30. Cell differentiation in connective tissues is presented in the following chapters: striated muscle differentiation (Chapter 31), somitic myogenesis (Chapter 32), mesenchymal chondrogenesis (Chapters 33–35), and bone cell differentiation (Chapter 36). In addition to specific examples and systems of cellular differentiation, methods for three crucial aspects of cellular activities are also presented. Cell–cell interaction is illustrated in Chapter 39, which deals with cadherin-mediated events. Cell–matrix interactions as mediated by hyaluronan binding are discussed in Chapter 40. The dynamic regulation of cytoskeletal architecture, visualized and analyzed by the microinjection of fluorescently-labeled α-actinin into living cells, is presented in Chapter 41. 6. Developmental Models of Diseases The experimental paradigms gained from developmental biology lend readily to the mechanistic analysis of diseases. Several examples are included here. Pax 3, a member of the vertebrate Pax gene family containing a DNA-binding domain known as the paired domain, is important for proper formation of the nervous, cardiovascular, and muscular systems. The molecular analysis of Pax 3 mutations and how the pathways affected lead to the pathogenesis of specific dysmorphogenic consequences is the subject of Chapter 42. Finally, one of the most powerful contributions of molecular developmental biology to the study of diseases is the application of transgenic methodologies to create animal models of human diseases. The three examples included here all deal with various aspects of skeletal defects, including both trunk as well as craniofacial malformations. The methods involve studies utilizing a structural gene (collagen type X, Chapter 43), cell specific promoter (α1(II) procollagen gene, Chapter 44), as well as transcription factors (Msx2, Chapter 44).

Ectopic Expression in Drosophila

9

2 Ectopic Expression in Drosophila Elizabeth L. Wilder 1. Introduction Ectopic expression in Drosophila has been used extensively to examine the capabilities of a given gene in virtually any tissue. Three general approaches are described here, and the choice of which to use is determined by the needs of the particular experiment. Certain aspects of each approach can also be combined, providing powerful tools for the examination of gene function. Because ectopic expression does not involve a protocol, but rather generation of certain types of transgenic strains, this chapter focuses on a description of the approaches and in what circumstances each is likely to be useful. 2. Materials For each of the methods of ectopic expression described here, the production of transgenic strains is required. The vectors that are widely used in these experiments are available (1–3). 3. Methods 3.1. Expression Through Defined Promoters The simplest means of ectopic expression is through the construction of a promotercDNA fusion in which a gene of interest is driven by a defined promoter or enhancer. Transgenic strains carrying this construct then ectopically express the gene of interest in the defined pattern. One of the most commonly used promoters for this purpose is the heat shock protein 70 (hsp70) promoter (1). This promoter allows ubiquitous expression to be induced in any tissue of the fly through a simple heat shock at 37°C. The inducible nature of this approach is a great advantage. However, basal levels of expression can be problematic, and heat shock itself can induce developmental defects. In addition, short bursts of ectopic expression ubiquitously is often not ideal. Therefore, sustained expression in defined domains may be preferred. To achieve ectopic expression within a defined domain, transcriptional regulatory regions from characterized genes have been linked to genes of interest (4,5). The advantage of this approach is its simplicity. Its primary limitation is that lethality can result from the ectopic expression. This makes it impossible to establish stable transgenic From: Methods in Molecular Biology, Vol. 137: Developmental Biology Protocols, Vol. III Edited by: R. S. Tuan and C. W. Lo © Humana Press Inc., Totowa, NJ

9

10

Wilder

Fig. 1. The GAL4 system of ectopic expression (modified from ref. 2). This system allows the ectopic expression of any gene of interest (Gene X) in a pattern determined by the expression of the transcriptional activator, GAL4. Hundreds of lines in which GAL4 is expressed in a variety of patterns have been generated through enhancer trapping or by linking the GAL4 coding sequence to defined regulatory elements. These are crossed to flies carrying the gene of interest under the transcriptional control of the GAL4 Upstream Activating Sequence (UAS). The progeny of this cross express the gene of interest in the pattern of choice.

lines. Enhancers that drive expression during late stages of development or in tissues that are nonessential have been particularly useful, because lethality owing to ectopic expression is avoided. The lethality associated with sustained expression of transgenes during development, the effort required to generate transgenic strains in which the transgene is expressed in multiple patterns, and the lack of defined enhancers driving expression in certain tissues prompted the development of alternative strategies for ectopic expression.

3.2. The GAL4 System The identification of the yeast transcriptional activator, GAL4, as a highly active, specific transcription factor that can activate transcription in Drosophila (6) led to the development of a system of ectopic expression referred to as the GAL4 system (2). This two-part system is shown in Fig. 1 and involves a cross between a fly expressing GAL4 in particular cells and a fly carrying a gene of interest under the transcriptional control of the GAL4 upstream activating sequence, or UAS. In the progeny of such a cross, the gene of interest will be expressed in cells where GAL4 is synthesized. Targeted ectopic expression of the gene of interest can therefore be achieved by choosing among many strains that express GAL4 in defined patterns. Three vectors are generally useful for investigators using this system (2). pGaTB/N provides either a BamHI site or a NotI site upstream of GAL4, allowing a defined promoter to drive GAL4 expression. The second, pGawB, is an enhancer-trapping vector that directs GAL4 expression from genomic enhancers. Finally, pUAST includes multiple cloning sites behind five copies of an ideal GAL4 binding sequence. Genes of interest are easily cloned into this vector for GAL4-mediated expression.


11

Hundreds of GAL4 strains have been generated through the process of enhancer trapping. These strains have been characterized by crossing newly generated lines to a UAS-LacZ strain and characterizing the expression pattern. Many of these strains are now available through the Drosophila Stock Center at Bloomington, IN. The expression patterns that have been detected through these enhancers vary from very broad expression to highly specific patterns. They, thus, offer the possibility of driving ectopic expression in virtually any tissue. In addition to the strains generated through enhancer trapping, many lines have been generated by fusing the GAL4 coding sequence to defined promoters, such as the hsp70 promoter. The latter offers the advantage mentioned above of inducible expression. The construction of strains expressing GAL4 in defined domains allows any UAS transgene to be examined within the particular region of interest. The GAL4 system has contributed to the utility of the FLP-FRT system of inducing mutant clones (see Chapter 3) (7). In this system, mitotic recombination is induced via flip recombinase (FLP), which is under the control of a heat shock promoter. The resulting mutant clones are then generated in all mitotically active cell populations. However, if FLP is placed under the control of GAL4-UAS, mutant clones are only generated within the GAL4 expression domain. This allows the investigator to determine whether a particular gene has an endogenous function within cells defined by GAL4 expression. The GAL4 system addresses many of the problems associated with simple transgenes. First, since the UAS transgenic lines are produced in the absence of GAL4 activity, ectopic expression of the transgene does not occur. Therefore, lethality associated with ectopic expression is avoided until the transgenic flies are crossed to a GAL4 expressing strain. Second, defined enhancers are not required for expression in a particular set of cells. Sites of expression are only limited by the number of enhancer trapped strains available, the number of which is continually growing. Finally, the GAL4 system allows ectopic expression in any number of patterns and conditions with the construction of only a single UAS transgene. This system of ectopic expression is extremely powerful for these reasons, but it does have limitations. First, for undefined reasons, GAL4 does not seem to function in the germline (A. Brand, personal communication). For experiments where germline expression is needed, other methods must be used. A more universal limitation of the GAL4 system is the fact that it is not inducible. Many enhancers drive expression during early phases of development, so that GAL4-mediated ectopic expression of certain UAS transgenes results in embryonic lethality. For investigators interested in later aspects of development, this has been a serious limitation of the GAL4 system. This problem can be partially addressed through modulation of temperature. The optimal temperature for GAL4 activity appears to be the ambient temperature for yeast, which is 30°C. By rearing flies at lower temperature, GAL4 activity is reduced (8,9), and in some instances, early lethality associated with higher levels of ectopic expression from the UAS transgene is avoided. The flies can be shifted at later stages of development to increase GAL4-mediated expression. In at least one instance, an inductive ability has been added to the GAL4 system through the construction of a UAS transgene carrying a cDNA encoding a temperature sensitive protein (9). Thus, progeny of the GAL4-UAS cross are maintained at the

12

Wilder

Fig. 2. The Flip-out system of ectopic expression (see ref. 3). Flip recombinase (FLP) target sites (FRTs) are arranged as direct repeats flanking a visible marker. The expression of this marker is under the control of the promoter element. However, in the presence of FLP, recombination between the FRTs is induced, resulting in deletion of the marker gene. The gene of interest is now juxtaposed to the promoter element, resulting in ectopic expression of the gene of interest. This is an efficient but stochastic process, resulting in clones of cells that express the gene. The area over which the clones are induced is defined by the region in which the promoter is active.

restrictive temperature during embryogenesis and shifted to the permissive temperature at the relevant stages. This permits ectopic activity to begin at the desired stage. However, since temperature sensitive lesions have not been defined for most genes, the inability to control expression temporally remains a problem with the GAL4 system in analysis of postembryonic development.

3.3. Ectopic Expression in Clones The temporal control of ectopic expression has been critical for the analysis of gene activity during imaginal development. An ingenious method of ectopically expressing genes in any region of the imaginal discs was developed by Struhl and Basler (3) (Fig. 2) and has come to be called the flip-out system. This method involves the generation of random clones in which the coding region of a gene of interest comes to lie adjacent to a ubiquitous promoter. In these clones, the gene is ectopically expressed, whereas in the surrounding tissue, a gene encoding a visible marker is adjacent to the ubiquitous promoter, separating it from the gene of interest. This is accomplished through the use of flip recombinase target (FRT) sites flanking the marker gene. In the presence of the recombinase, the marker is removed, bringing the promoter and the gene of interest together. The resulting clone of cells is marked by the absence of the marker, which is ubiquitously present elsewhere in the fly. This technique requires the generation of a construct in which the gene of interest is placed within the context of the promoter-FRT-marker-FRT construct (3,10,11). Two vectors are available that utilize either the Actin-5C promoter or the β-Tubulin pro-


13

moter. Both of these produce ubiquitous expression, so clones can be generated in any tissue. Levels of expression produced by the Actin-5C promoter are generally higher than those produced by the β-Tubulin promoter. A third vector uses the Ultrabithorax (Ubx) promoter, which produces clones in a more restricted pattern. Transgenic lines carrying the flip-out construct as well as a FLP transgene under the control of the hsp70 promoter (hs-FLP) must be generated. This is done through standard genetic manipulations using any of a number of hsFLP insertions on various chromosomes. A variation on this method of ectopic expression involves a combination of the GAL4 system and the flip-out system (12). The promoter-driving expression of the FRT cassette, in this instance, is the GAL4 UAS. Clones induced via hs-FLP, therefore, fall only within the domain of GAL4 expression. The advantage of this combination lies in the strength of GAL4 as a transcriptional activator. Clones induced in this way express very high levels of the gene of interest. The strengths of the flip-out technique are as follows. 1. The clones are efficiently generated randomly throughout the animal. By analyzing a number of animals, it is very likely that clones will be found in a region of interest. 2. Ectopic expression is completely inducible. Lethality because of early expression is avoided. 3. The clones are marked molecularly by the ectopic expression of the gene of interest, and they are marked in the adult cuticle by the absence of the visible marker.

As with any form of clonal analysis, this technique is limited to mitotically active cells, because cell division is required to generate a clone. A second limitation is that randomly generated clones are not reproducible; therefore, clones analyzed in the imaginal discs cannot be analyzed later in the adult cuticle. This contrasts with GAL4driven expression that generates reproducible phenotypes. In this instance, one can precisely correlate imaginal disc phenotypes with the later phenotypes produced in the adult. Although these limitations need to be considered, the strengths of the flip-out system make it a very useful way to analyze gene activity during imaginal development. 4. Notes The foregoing approaches provide enormous temporal and spatial control over ectopic expression in Drosophila, allowing investigators to analyze gene activity in virtually any cell at any stage of development. However, in addition to the caveats mentioned for each of these methods, a few general concerns should be noted. 1. Positional effects can alter the levels of ectopic expression produced from any transgene. Thus, a transgene under the control of a given regulatory element may not express at the same level as a different transgene under the control of the same element. Therefore, multiple transgenic strains should be generated for any experiment to control for positional effects. 2. Variability in phenotypes produced by ectopic expression is common. The reason for this is apparent with the flip-out system, because clones are randomly generated. Variation can be controlled, however, by inducing the clones within a narrow window of development. By collecting embryos over a short period before aging them and inducing the clones, clone size is kept more constant, as is the timing of ectopic expression relative to other developmental events. Variation in phenotypes using the GAL4 system is less pronounced, but can still be a problem. This can be minimized by rearing flies at a consistent temperature and by maintaining cultures in uncrowded conditions.

14

Wilder

References 1. Struhl, G. (1985) Near-reciprocal phenotypes caused by inactivation or indiscriminate expression of the Drosophila segmentation gene ftz. Nature 318, 677–680. 2. Brand, A. and Perrimon, N. (1992) Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118, 401–415. 3. Struhl, G. and Basler, K. (1993) Organizing activity of wingless protein in Drosophila. Cell 72, 527–540. 4. Zuker, C. S., Mismer, D., Hardy, R., and Rubin, G. M. (1988) Ectopic expression of a minor Drosophila opsin in the major photoreceptor cell class: distinguishing the role of primary receptor and cellular context. Cell 53, 475–482. 5. Parkhurst, S. M. and Ish-Horowicz, D. (1991) Mis-regulating segmentation gene expression in Drosophila. Development 111, 1121–1135. 6. Fischer, J. A., Giniger, E., Maniatis, T., and Ptashne, M. (1988) GAL4 activates transcription in Drosophila. Nature 332, 853–856. 7. Duffy, J. B., Harrison, D. A., and Perrimon, N. (1998) Identifying loci required for follicular patterning using directed mosaics. Development 125, 2263–2271. 8. Staehling-Hampton, K., Jackson, P. D., Clark, M. J., Brand, A. H., and Hoffmann, F. M. (1994) Specificity of bone morphogenesis protein (BMP) related factors: cell fate and gene expression changes in Drosophila embryos induced by decapentaplegic but not 60A. Cell Growth Diff. 5, 585–593. 9. Wilder, E. L. and Perrimon, N. (1995) Dual functions of wingless in the Drosophila leg imaginal disc. Development 121, 477–488. 10. Diaz-Benjumea, F. J. and Cohen, S. M. (1995) Serrate signals through Notch to establish a Wingless-dependent organizer at the dorsal/ventral compartment boundary of the Drosophila wing. Development 121, 4215–4225. 11. Zecca, M., Basler, K., and Struhl, G. (1995) Sequential organizing activities of engrailed, hedgehog, and decapentaplegic in the Drosophila wing. Development 121, 2265–2278. 12. Nellen, D., Burke, R., Struhl, G., and Basler, K. (1996) Direct and Long Range action of a Dpp morphogen Gradient. Cell 85, 357–368.

Gene Function in Drosophila

15

3 Clonal Analysis in the Examination of Gene Function in Drosophila Jenny E. Rooke, Nicole A. Theodosiou, and Tian Xu 1. Introduction Clonal analysis in Drosophila has been successfully used to address numerous biological questions of fundamental importance, including issues of cell lineage, fate determination, autonomy of gene action and pattern formation (1,2). Clonal analysis has been particularly useful for the study of genes that would be lethal in a homozygous mutant state; this approach also makes it possible to recover essential genes in mosaic screens (3). Among the methods traditionally used by researchers to generate clones in Drosophila, the most frequent technique has been the induction of mitotic recombination through ionizing radiation such as X-rays (4–6). X-ray irradiation causes chromosomal breaks that can lead to the exchange of homologous chromosome arms; at mitosis, daughter cells may inherit a homozygous region distal to the point of recombination (see Fig. 1). Mitotic recombination events induced by X-rays take place at low frequencies, a factor that cripples the efficiency of most clonal analyses using this technique. Use of the FLP–FRT yeast site-specific recombination system provides an efficient method for generating clones at high frequencies for phenotypic analysis and screening (see Fig. 2; [7–9]). Strains have been constructed such that expression of the site-specific FLP recombinase can be driven by a heat-inducible promoter (see Table 1). Clones for almost any gene of the Drosophila genome can be produced once the gene of interest has been recombined onto specially engineered FRT-carrying chromosome arms (see Tables 2 and 3). And a sizable array of markers is available, facilitating the choice of a genetic marker appropriate for the tissue and developmental stage being studied (see Tables 4–6). Protocols for using the FLP/FRT system to generate both somatic and germline clones are given below. Because some genes are not amenable to FLP/FRT clonal analysis, equivalent protocols for X-ray-induced clone production are also provided. Successful clone production for both protocols critically depends upon the timing of clone induction, as mitotic recombination can be induced only in cells that are actively dividing. For this reason, a timeline of cell divisions in specific tissues of the developing From: Methods in Molecular Biology, Vol. 137: Developmental Biology Protocols, Vol. III Edited by: R. S. Tuan and C. W. Lo © Humana Press Inc., Totowa, NJ

15

16

Rooke, Theodosiou, and Xu

Fig. 1. (A) Use of the FLP–FRT system or X-rays to induce mitotic recombination and clone formation. Mutant clones are identifiable by concomitant loss of a marker gene. (B) Because X-rays induce recombination at random points along the chromosome, the marker gene must be located more proximal to the centromere than the mutation under study in X-ray induced clonal analysis. If the marker is more distal, some random X-ray events will generate marked wild-type clones (false positives). Because the action of FLP-ase is site-specific, proximity of the marker relative to the mutation is not important in FLP-FRT analysis.

fruit fly (see Fig. 3) is included to aid the researcher in designing successful clonal analyses. 2. Materials Information for Drosophila strains is provided in Tables 1–6. 3. Methods

3.1. Induction of Somatic Clones by (a) FLP/FRT or (b) X-rays (see Note 1) 1. Set up crosses of the appropriate genotypes at 25°C (Fig. 2; see Notes 2–4). 2. Collect eggs for 12 h at 25°C. 3. Age eggs for 24 h (large adult clones) to 48 h (smaller, more frequent adult clones) at 25°C (see Note 5). 4a. Heat shock vials for 60 min in a 38°C water bath (see Notes 6 and 7). 4b. Place vials containing larvae close to X-ray source and expose to 1000R dose (see Note 6). 5. Return vials to 25°C for recovery.


17

Fig. 2. An example scheme of crosses for recombining an allele of lats onto an FRT chromosome for FLP–FRT analysis. Table 1 FLP Chromosomes Chromosomes X

2

3

Strains

Footnotes

y w hsFLP1; Adv/CyO y w hsFLP1; TM3, Sb/TM6B, Hu y hsFLP1; Bc; kar2 ry506 y w hsFLP122 y w hsFLP122; TM3, ryRK Sb/TM6B, Hu y w hsFLP12; Sco/CyO y w hsFLP22; CxD/TM3, Sb w; UAS-FLP yw; Ey-FLP y; hsFLP38 Bc/CyO; Ki kar2 ry506 Tb pr pwn hsFLP38/CyO; Ki kar2 ry506 w; UAS-FLP yw; Ey-FLP hsFLP3, MKRS/TM6B w; UAS-FLP

a–c

aGolic and Lindquist, 1989; bXu and Rubin, 1993; cXu, T., et al., unpublished; dStruhl

a–c a,g d d,e a,f a,f c i a,g a,g c i a,b,h c

and Basler, 1993; eIto, N., et al., unpublished; fChou and Perrimon, 1996; gHeitzler, P., unpublished; hJan, Y. N., et al., unpublished; iDickson, B., unpublished.

18


Table 2 FRT Elements Chromosomes X

2L

2R

3L

3R

Frequencies of recombination

Insertions

Code

Footnotes

P[mini w+; FRT]14A-B P[ry+, hs-neo; FRT]11A P[mini w+; FRT]18E-F P[ry+, hs-neo; FRT]18A P[ry+, hs-neo; FRT]19A P[ry+, hs-neo; FRT]19F

FRT101 FRT11A FRT9-2 FRT18A FRT19A FRT19F

High ND High High High Low

a,c

P[ry+, hs-neo; FRT]29D P[ry+, hs-neo; FRT]34B P[ry+, hs-neo; FRT]40A

FRT29D FRT34B FRT40A

ND ND High

b

P[mini w+; FRT]42B P[ry+, hs-neo; FRT]42B P[ry+, hs-neo; FRT]42C P[ry+, hs-neo; FRT]42D P[ry+, hs-neo; FRT]43D P[ry+, hs-neo; FRT]50B

FRT2R-G13 FRT42B FRT42C FRT42D FRT43D FRT50B

High Low Low Medium High ND

a,c

P[ry+, hs-neo; FRT]69A P[ry+, hs-neo; FRT]72D P[mini w+; FRT]79D-F P[ry+, hs-neo; FRT]80B

FRT69A FRT72D FRT3L-2A FRT80B

ND High High Medium

b

P[ry+, hs-neo; FRT]82B P[ry+, hs-neo; FRT]89B P[ry+, hs-neo; FRT]93D

FRT82B FRT89B FRT93D

High ND ND

b a,c b b b

b b

b b b b b

b a,c b b b b

ND = Not determined. aGolic and Lindquist, 1989; bXu and Rubin, 1993; cChou and Perrimon, 1993 and 1996.

Table 3 Strains for Recombining Mutation onto FRT Arms Chromosomes

Strains P[mini-w+

X

w hsπF]17B FRT18A y w P[mini-w+ hsπM]5A, 10D FRT19A f36a FRT19A; mwh kar2 ry506 w; P[mini-w+ hsπM]36F FRT40A y; P[y+ ry+]25F ckCH52 FRT40A/CyO; kar2 ry506

2L

w; FRT42D P[mini-w+, hsπM]45F y; FRT42D pwn P[y+, ry+]44B/CyO; kar2 ry506 w; FRT43D P[mini-w+, hsπM]45F

2R

y w; P[mini-w+ hsπM]75C FRT80B yy; mwh (FRT73D?) FRT80B kar2 ry506

3L

w; FRT82B P[mini-w+ hsπM] 87E

3R aXu

and Rubin, 1993; bHeitzler, P., unpublished.

Footnotes a a a,b a a,b a a,b a a a,b a


19

Table 4 Strains for Adult Cuticular Clones Chromosomes X

2L 2R

3L

3R

Strains FRT18A; hsFLP3, MKRS/TM6B FRT19A; hsFLP3, MKRS/TM6B y w FRT19A w sn3 FRT19A f36a FRT19A; mwh kar2 ry506 Dp(3;Y;1)M2 y FRT19A/FM7; emcFX119 mwh kar2 ry506 Dp(3;Y;1)M2 y M(1)oSp FRT19A/FM7; kar2 ry506 y w hsFLP1; P[y+ ry+]25F P[w+ ry+]30C FRT40A y; P[y+ ry+]25F ckCH52 FRT40A/CyO; kar2 ry506 y w hsFLP1; FRT42D P[y+, ry+]44B P[w+, ry+]47A/CyO y; FRT 42D pwn P[y+, ry+]44B/CyO; kar2 ry506 y w; FRT42D P[mini-w+, hsπM]45F M(2)S7/CyO; kar2 ry506 y w hsFLP1; FRT43D P[w+, ry+]47A y w hsFLP1; FRT43D P[y+, ry+]44B w hsFLP122; P[w+]70C FRT80B y w hsFLP122; P[ry+ y+]66E P[w+]70C FRT80B y; mwh (FRT73D?) FRT80B kar2 ry506 y; trc FRT80B kar2 ry506/TM6C ryCB Sb Tb y w; jv P[ry+ y+]66E P[mini-w+ hsπM]75C FRT80B kar2 ry506/TM3 ryRK Sb y w; M(3)i55 P[mini-w+ hsπM]75C FRT80B kar2 ry506/TM3 ryRK Sb y w hsFLP1; FRT82B P[w+; ry+]90E P[y+ ry+]96E y w hsFLP1; FRT82B P[mini-w+ hsπM]87E Sb63b P[y+ ry+]96E FRT82B kar2 ry506 pr pwn; FRT82B kar2 ry506 bx34e Dp(2;3)P32/FRT82B kar2 ry506

Footnotes a a,b a,b a,b a,d a,d a,d a,b a,d a,b a,d a,d a,b a,b a,c a,c a,d a,d a,d

a,d

a,b a a,d a,d

aXu and Rubin, 1993; bXu, T., et al., unpublished; cIto, N., et al., unpublished; dHeitzler, P., unpublished.

Note that most eye clones marked with w– will appear as dark or black patches against the background of a wild-type red eye. Only very large clones or clones located at the edge of the eye will appear white.

3.2. Induction of Germline Clones by FLP/FRT or X-rays 1. Set up crosses at 25°C such that progeny will be trans-heterozygous for a dominant female-sterile mutation (such as OvoD1) and the mutant gene or marker of interest (see Notes 2, 3, and 8). 2. Collect eggs for 24 h at 25°C. 3a. Heat-shock vials for 60 min in a 38°C water bath twice over a period of several days while progeny are in first and second larval instar stages. Adult virgin females collected from these crosses may be heat-shocked again before mating to initiate mitotic recombination in ovariole germline cells. 3b. X-ray twice, once during first and once during second larval instar stage. Place vials containing progeny close to X-ray source and expose to 1000R dose. Adult virgin females collected from these crosses may be X-rayed again before mating to initiate mitotic recombination in ovariole germline cells. 4. Allow females to recover at 25°C for a day before mating.

20


Table 5 Strains for Clones in Developing and Internal Tissues Chromosomes X

Strains w P[mini-w+ hsπM]5A, 10D FRT18A; hsFLP3, MKRS/TM6B w P[mini-w+ hsNM]8A FRT18A w P[mini-w+ hsπF]17B FRT18A y w P[mini-w+ hsπM]5A, 10D FRT19A y w P[mini-w+ hsπM]5A, 10D M(1)oSp FRT19A/FM7 w hsFLP1; P[mini-w+ hsπM]21C, 36F FRT40A w hsFLP1; P[mini-w+ hsNM]31E FRT40A w hsFLP1; FRT42D P[mini-w+, hsπM]45F/CyO y w; FRT42D P[mini-w+, hsπM]45F M(2)S7/CyO; kar2 ry506 y w hsFLP1; FRT42D P[mini-w+, hsNM]46F w hsFLP1; FRT43D P[mini-w+, hsπM]45F,47F y w hsFLP1; FRT43D P[mini-w+, hsNM]46F y w hs FLP122; P[mini-w+ hsπM]75C FRT80B y w hsFLP1; P[mini-w+ hsNM]67B (FRT73D?) FRT80B y w; jv P[ry+ y+]66E P[mini-w+ hsπM]75C FRT80B kar2 ry506/TM3 ryRK Sb y w; M(3)i55 P[mini-w+ hsπM]75C FRT80B kar2 ry506/TM3 ryRK Sb w hsFLP1; FRT82B P[mini-w+ hsπM]87E,97E y w hsFLP1; FRT82B P[mini-w+ hsNM]88C

2L 2R

3L

3R

Footnotes a a a a a,c a a a a,c a a a a,b a a,c

a,c a a

aXu

and Rubin, 1993; bIto, N., et al., unpublished; cHeitzler, P., unpublished. Detailed protocols for dissection of imaginal disc tissues and staining of the π-myc and N-myc markers can be found in refs. 3 and 13.

Table 6 Strains for Generating Germline Clones Chromosomes ovoD1

X

v24

Strains

Footnotes

FRT101/Y;

a,b

C(1)DX, y f/w hsFLP38 C(1)DX, y f/ovoD2 v24 FRT9-2/Y; hsFLP38 P[mini w+; ovoD1]2L-13X13 FRT40 A/S Sp Ms(2)M bwD/CyO FRT2R-G13 P[mini w+; ovoD1]2R-32X9/S Sp Ms(2)M bwD/CyO w; P[mini w+; ovoD1]3L-2X48 FRT3L-2A/ru h st βTub85DD ss eS/TM3, Sb w; FRT82B P[mini w+; ovoD1]3R-C13a31 n9/ru h st βTub85DD ss eS/TM3, Sb

2L 2R 3L 3R aChou

a,b a,c a,b a,b

a,c

and Perrimon, 1993; 1996; bGolic and Lindquist, 1989; cXu and Rubin, 1993.

4. Notes 1. The heat shock promoter is apparently not active in early embryo divisions. Workers wishing to produce clones in the embryo may need to use X-ray induction. 2. All crosses and egg collections should be carried out on well-yeasted rich medium such as the standard molasses-agar substrate. 3. It is important to culture flies at 25°C as heat shocking often kills larvae grown at 18°C.


21

Fig. 3. Timeline of cell divisions in different tissues during Drosophila development. Times are given as hours after egg deposition (AED), except where noted. All times are for 25°C. Adapted from text and tables in 14–16. AP, after pupariation.

4. Crowded vials will produce divergent development rates among the progeny and thereby decrease the efficiency with which clones are produced at the precise desired developmental stage. If an experiment calls for large numbers of progeny, set up additional crosses in individual vials rather than crowd more females into a vial. 5. The production of clones using mitotic recombination is restricted to cells which are dividing at the time of heat shock (or X-ray). Thus, it is essential to induce FLP expression/ expose to X-rays when cells in the tissues of interest are actively dividing. Know the

22


developmental profile of the tissue(s) you wish to study (see Fig. 3). For Ey-FLP or GAL4/ UAS-FLP, FLP is expressed and will get large clones. 6. When heat-shocking or X-raying older larvae or adult flies, push the cotton stopper down into the vial to restrict the animals’ movement to as small a space as possible. Then ensure that this space is fully submerged (in the case of heat-shock) or placed very near the X-ray source; this will increase the frequency of clone production. 7. The temperature of the water bath for heat-shocking must be at 38°C. One degree less will dramatically decrease the clone frequency. On the other hand, temperatures higher than 40°C will kill the animals. 8. Remember that only a fraction of females collected from a germline clone experiment involving a dominant sterile mutation such as OvoD1 will be fertile. It is useful to set up more than enough crosses to produce an excess of the required virgins, and to then be fastidious about maintaining a daily heat-shock (or X-ray) regimen and frequent collection of virgins.

References 1. Postlethwait, J. H. (1976) Clonal analysis of Drosophila cuticular patterns, in The Genetics and Biology of Drosophila, vol. 2c (Ashburner, M. and Wright, T. R. F., eds.), Academic, New York, pp. 359–441. 2. Ashburner, M. (1989) Drosophila: A Laboratory Handbook. Cold Spring Harbor, New York. 3. Xu, T. and Harrison, S. D. (1994) Mosaic analysis using FLP recombinase. Methods Cell Biol. 44, 655–681. 4. Patterson, J. T. (1929) The production of mutations in somatic cells of Drosophila melanogaster by means of X-rays. J. Exp. Zool. 53, 327–372. 5. Friesen, H. (1936) Spermatogoniales crossing-over bei Drosophila. Z. Indukt. Abstammungs. Vererbungsl. 71, 501–526. 6. Lawrence, P. A., Johnston, P., and Morata, G. (1986) Methods of marking cells, in Drosophila: A Practical Approach (Roberts, D. B., ed.), IRL, Oxford, UK, pp. 229–242. 7. Golic, K. G. and Lindquist, S. (1989) The FLP recombinase of yeast catalyzes site-specific recombination in the Drosophila genome. Cell 59, 499–509. 8. Golic, K. G. (1991) Site-specific recombination between homologous chromosomes in Drosophila. Science 252, 958–961. 9. Xu, T. and Rubin, G. M. (1993) Analysis of genetic mosaics in developing and adult Drosophila tissues. Development 117, 1223–1237. 10. Struhl, G. and Basler, K. (1993) Organizing activity of wingless protein in Drosophila. Cell 72, 527–540. 11. Chou, T. B. and Perrimon, N. (1992) Use of a yeast site-specific recombinase to produce female germline chimeras in Drosophila. Genetics 131, 643–653. 12. Chou, T. B. and Perrimon, N. (1996) The autosomal FLP-DFS technique for generating germline mosaics in Drosophila melanogaster. Genetics 144, 1673–1679. 13. Theodosiou, N. A. and Xu, T. (1998) Use of the FLP-FRT system to study Drosophila development. Methods, in press. 14. Roberts, D. B. (1986) Basic Drosophila care and techniques, in Drosophila: A Practical Approach (Roberts, D. B., ed.), IRL, Oxford, UK, pp. 1–38. 15. Foe, V. E., Odell, G. M., and Edgar, B. A. (1993) Mitosis and morphogenesis in the Drosophila embryo: Point and counterpoint, in The Development of Drosophila melanogaster (Bate, M. and Martinez-Arias, A., eds.), Cold Spring Harbor, New York, pp. 149–300. 16. Cohen, S. M. (1993) Imaginal disc development, in The Development of Drosophila melanogaster (Bate, M. and Martinez-Arias, A., eds.), Cold Spring Harbor, New York, pp. 747–842.

Antisense ODNs in Developing Chick Embryos

23

4 Application of Antisense Oligodeoxynucleotides in Developing Chick Embryos Peter G. Alexander, George L. Barnes, and Rocky S. Tuan 1. Introduction Perturbing the expression level of a specific gene in vivo provides a powerful approach towards explaining its function during embryonic development. One technique used for perturbing the level of expression of a specific gene is the application of gene-specific antisense oligodeoxyribonucleotides (ODNs). ODNs are a quick, affordable, and effective means to “knock down” the expression of a gene in order to learn more of its function in vivo. It is a particularly useful tool to study the function of a gene in a specific target tissue, as it acts in a spatially (i.e., site of injection) and temporally (i.e., time of treatment) restricted manner. Antisense ODNs are short DNA sequences designed to be complementary to unique regions of target mRNAs (1). Upon entering individual cells, ODNs disrupt the expression of the target gene product by at least three different mechanisms (2–5). The first, and probably most prevalent, is by binding the antisense ODN to the complementary mRNA sequences, forming a DNA/RNA hybrid duplex that is degraded by endogenous RNase H activity within the cytoplasm. The second postulated mechanism involves the entry of the ODN into the nucleus of the cell where it binds to the complementary genomic sequence, thus disrupting gene transcription. The third pathway is for the ODN to bind and physically perturb the mRNA in the translation process. The specific degradation of gene specific mRNAs is generally considered to be the most probable mechanism of action for antisense ODN perturbation of gene expression events. The primary limitation in the use of ODNs in a given developmental system is the degree of its use is the accessibility of the system to the investigator. For this reason, antisense ODN studies are frequently performed on embryonic systems maintained in vitro or using oviparous animal models such as Xenopus, zebrafish and chicken. In this chapter, we describe protocols we have developed for the application of antisense ODNs to developing chick embryos by two routes of administration—topical treatment and microinjection—for the study of somite development.

From: Methods in Molecular Biology, Vol. 137: Developmental Biology Protocols, Vol. III Edited by: R. S. Tuan and C. W. Lo © Humana Press Inc., Totowa, NJ

23

24

Alexander, Barnes, and Tuan

2. Materials 1. Fertilized white leghorn chicken eggs from a commercial source (e.g., Truslow Farms Inc., Chestertowne, MD or SPAFAS Inc., Preston, CT). 2. Forced-draft commercial egg incubator (e.g., Model 1202, G.Q.F. Manufacturing Co., Savannah, GA or Favorite Incubator Leahy Manufacturing Co. Inc., Higginsville, MO). 3. Warm humidified incubator maintained at 38°C for ex ovo embryo culture (see Note 1). 4. Laminar flow hood or otherwise sterile area for manipulating eggs and embryo cultures and for performing microinjections. 5. Dissection stereo microscope. 6. Pure cellulose chromatography paper for embryo explant rings (Fisher Scientific, Pittsburgh, PA, cat. no. 05-714-40). 7. Two- or three-hole paper hole punch (see Note 2). 8. Glass Petri dishes (Fisher cat. no. 08-747C). 9. Autoclaved Spratt Ringers solution (6). A 1X solution contains 120 mM NaCl, 56 mM KCl, and 2 mM CaCl2 in ddH2O. We prepare 20X stock solutions. 10. Large weigh boats (Fisher cat. no. 02-202D). 11. Parafilm (Fisher cat. no. 13-347-10). 12. 35 mm Petri dishes (Fisher cat. no. 08-757-11YZ). 13. 100 mm Petri dishes (Fisher cat. no. 08-757-12). 14. 150 mm Petri dishes (Fisher cat. no. 08-757-14). 15. Low-melt agarose (Fisher cat. no. BP1360-100). 16. Sterilized Erlenmeyer flasks. 17. Sterilized 30 mL capped polystyrene centrifuge tubes (Fisher cat. no. 3138-0030). 18. Phenol red (Sigma cat. no. P-2417). 19. Metal insert of a heat block. 20. Sterilized thermometer. 21. 50°C Water bath. 22. Rubbermaid storage container (16 in. × 6 in. × 12 in., optional). 23. Microinjector system such as the Drummond Nanoject Variable automatic injector (cat. no. 3-000-203-XV, see Note 3) (Drummond, Broomall, PA or via the IVD Suppliers Directory Inc. on the Internet at www.devicelink.com. Similar products are also provided by World Precision Instruments, Sarasota FL, or [email protected]). 24. A micromanipulator such as the Marzhauser MM33 micromanipulator available through Drummond (cat. no. 3-000-025, see Note 4). 25. Straight or angled micromanipulator base such as those offered by Drummond (cat. no. 3-000-025-SB, see Note 5). 26. Micropipet puller from suppliers such as Narishige (cat. no. PN-30). Narishige (Tokyo, Japan) can be contacted at www.narishige.co.jp. 27. 7 in. Glass capillaries (Drummond cat. no. 3-00-203-G/XL). 28. Microsurgical scissors (e.g., ROBOZ Surgical Instruments Co. Inc., Rockville MD, cat. no. RS-5914SC or World Precision Instruments). 29. Microsurgical tweezers (e.g., ROBOZ, cat. no. RS-5045 or similar instrument from World Precision Instruments). 30. Nile Blue, vital dye (Sigma, St. Louis, MO, cat. no. N 5383).

3. Methods 3.1. Designing ODNs The design and quality of ODN synthesis are crucial considerations in the design of an antisense ODN experiment. In designing our ODNs, we begin with the following


25

parameters: an ODN length between 15 and 20 nucleotides (nt) (preferably 18), a cytosine/guanine (GC) content between 45 and 55% and a Tm between 50 and 60°C. Adhering to these parameters will maximize the ODNs’ penetration into target cells and hybridization to target mRNAs while minimizing their cytotoxicity. There are several good reviews addressing basic ODN design in the literature (7–10). The first and foremost consideration in ODN design is targeting the ODN to a unique portion of the target mRNA (11,12). This decreases the possibility of nonspecific ODN cross hybridization and undesirable results (see Note 6). In order to address the issue of cross hybridization with other mRNA species, we routinely perform BLAST searches with candidate ODN sequences against the GeneBank prior to synthesis (see Note 7). We have had the best success with ODNs targeted to sequences within the 5' untranslated regions of target genes, specifically those that lie adjacent to or overlap the ATG translational start site (see Notes 8 and 9). A second consideration is how best to modify the ODN in order to maximize its effective half-life within the cell while minimizing its toxic side effects (11,13,14). Although there are several options, we routinely use phosphorothioate modified ODNs to minimize spontaneous and enzymatic degradation (15–17). Because the phosphorothioates themselves can be toxic (see Note 10), we only have the terminal 2–3 bases on both ends of the antisense ODN phosphorothioated. Choosing a reliable facility for synthesis is very important because apart from proper ODN synthesis and modification, the ODNs must be properly purified and free from unbound modifiers, organics, and salts. We routinely use the services provided by either IDT (Coralville, IA, www.idtna.com) or Oligos Etc. Inc. (Wilsonville, OR, www.Oligosetc.com; see Note 10). Once choices have been made in terms of the variables discussed above, the proper controls must also be designed (7,9,10). We routinely use at least two types of basic controls. The first is a sense strand ODN of the complementary sequence to the antisense. This ODN is designed to provide a control for DNA-based effects of ODNs, particularly on entry into the nucleus and binding of genomic sequences. The second control is a base-matched random sequence ODN that controls primarily for nonspecific ODN effects. A third important control involves the use of fluorescently labeled ODNs that provide proof of ODN localization with respect to the phenotype produced by the treatment. Although other detection methods are possible, such as the use of radiolabeled probes, we use fluorescein isothiocyanate (FITC)-conjugated ODNs followed by viewing under at 10X under appropriate fluorescence optics (18, Fig. 1). All control ODNs are phosphorothioated like the antisense ODN in order to control for the nonspecific effects of applying modified ODNs to a developing embryo.

3.2. Preparing ODN Stock Solutions We treat lyophilized ODN stocks from the manufacturer as sterile and make concentrated stocks in sterile water at 50 mg/mL. ODNs are aliquoted in small volumes and stored at –20°C to maintain stability (up to a year). This concentration constitutes a 100X solution for topical applications and 10X solutions for injection applications. Immediately prior to use, the stock is diluted to a working concentration in sterile Spratt Ringers solution.

26


Fig. 1. Assessment of the distribution of ODN administered to chick embryos. To assess the distribution of fluorescently labeled ODN after several hours in culture, embryos were either injected with 50 nL of ODN or treated with a direct topical application of 1 µL of the labeled ODN. The embryos were allowed to develop under normal culture conditions and were observed immediately after injection (A and B) and after another 6 h (C and D). Arrows indicate the site of ODN injection. Embryos in (A) and (C) are viewed in Nomarski differential interference optics and embryos in (B) and (D) are viewed with appropriate fluorescence optics. Immediately after injection, the fluorescent signal was evident in discrete areas of the somite (B). After 6 h, embryos that had been injected were found to have a localized area of very bright fluorescence at the injection site, as well as a diffuse fluorescence over a wider area of the embryo (D). NT, neural tube; S, somite. Adapted from ref. 18.

3.3. Preparing the Embryo Explant Rings Make embryo explant rings by cutting 3MM Whatman filter paper (Whatman, Clifton, NJ) into approximately 3/4 in. squares with a central opening large enough to surround the chick embryos of desired developmental stage for experimental manipulation. We create the opening by using a two-hole hole punch and punching two partially overlapping holes. Explant rings are sterilized by autoclaving (10 min dry cycle) in a covered glass Petri dish with cover.

3.4. Preparing Albumen-Agar Embryo Culture Plates 1. Ringer-albumen component: Separate the yolk from the albumen of one fresh, unincubated egg (12). Add the albumen to 50 mL of sterilized Spratt Ringers solution in sterilized Erlenmeyer flask. Add 0.5 mg of phenol red (see Note 13). Seal the flask with Parafilm and shake the contents vigorously for 1 min. Centrifuge the mixture in 30 mL capped


27

polystyrene centrifuge tubes at 10,000g for 10 min at 4°C. Pour the supernatant into another sterilized Erlenmeyer flask and place in a preheated 50°C water bath. 2. Ringer-agar component: Autoclave-sterilize (15 min moist cycle) 120 mL of 2% low-melt agarose dissolved in 1X Spratt Ringers solution. After autoclaving, place the Ringer-agar mixture in a preheated 50°C water bath. Place a sterilized thermometer into the Ringer-agar. 3. Albumen-agar medium: Once the temperatures of both Ringer-agar and Ringer-albumen components are equilibrated at 50°C, mix the two together at a ratio of 2 parts Ringeralbumen to 3 parts Ringer-agar mixtures. Gently mix the two components while maintaining the 50°C temperature in the 50°C water bath. Place 2–3 mL of medium in each 35 mm Petri dish and allow the mixture to gel at room temperature (see Note 14). Plates can be stored for up to 1 wk at 4°C in a humidified storage container.

3.5. Pulling the Glass Capillary Microinjection Needles For the purpose of injecting antisense ODNs into the segmental plate and somites, we pull needles with tip diameters of approximately 20 µm, the minimal tip diameter for our model injector system. The strength of the magnet and the intensity of the heating element of the pipet puller should be adjusted such that the tapered portion is about 2–3 cm long with the final 0.2–0.5 cm being of almost uniform, minimal diameter (see Note 15). The closed tips of the pulled needles are not cut off until just before use. Pulled injection needles are kept in a 150-mm Petri dish held in place with plasticine keeping the tips suspended above the surface. Just before use, a pulled tip is dipped in 70% ethanol for sterilization. The ethanol will evaporate by the time the injection needle is mounted on the plunger. Drummond (Broomall, PA) provides an excellent description of the mounting procedure with their product, which includes a troubleshooting guide.

3.6. Microinjector Setup Before the injection procedure is begun, a mock plate is placed on the stage, and the plane of focus is set upon the surface of the plate. Adjust the height of the manipulator such that when the infection tip is advanced to three-fourths of its maximal extension the tip of the injection needle is in the center of the plane of focus just above the embryo culture albumen-agar plate surface. We set the angle of the injection needle to approximately 45–60°. Remember to retract the injection needle completely before removing the plate.

3.7. Harvesting Embryos Preheat a 500-mL bottle of 1X Spratt Ringer’s solution to 37°C. Incubate fresh fertilized chicken eggs and harvest appropriately aged chick embryos are harvested by cracking the egg open and dropping the contents into a sterile 100 mm Petri dish. We stage embryos according to Hamburger and Hamilton (19) (see Note 16). An excellent morphological description is given by Bellairs and Osmond (20). Before the eggs are cracked, rinse and wipe them clean with 70% ethanol to remove contaminants. We break the eggs by gently cracking the egg about 180° around its center (see Note 17). Drop the contents of the egg into an open, sterile 100 mm Petri dish so that the embryo is on top (exposed) surface of the yolk (see Note 18). Lift the embryo from the yolk by placing an explant ring onto the surface of the yolk sac with the embryo located in the center of the ring opening. Trim the extra-embryonic mem-

28


branes along the outer edge of explant ring and lift the embryo from the underlying yolk. Embryos are rinsed twice by slowly passing them through prewarmed, 38°C Spratt Ringers solution (see Note 19). The washed embryos are placed onto prewarmed, 38°C albumen-agar plates and quickly transferred to the embryo incubator (see Note 20). For these procedures, embryos are cultured in an inverted orientation so that the ventral side of the embryo is exposed (facing up, see Note 21).

3.8. Delivery of ODN by Topical Application and Injection (see Note 22) Prepare and prewarm ODN working solutions. We prepare 5 µg/µL dilutions of ODN in Spratt Ringer’s solution (see Note 23). Remove harvested embryos from the embryo incubator in small numbers and examine for condition and health. Discard abnormal or damaged embryos (see Note 24).

3.8.1. Topical Application The ODNs are administered with a pipet in a 10-µL drop containing 5 µg/µL of ODNs suspended in sterile Spratt Ringers solution (see Note 25). After making the appropriate observations of the pretreated embryo, choose the area to which the ODN will be applied and position it in the center of the visual field. Under the dissection scope, bring the pipet tip as close to the embryo as possible. While slowly administering the drop of ODN, lay the drop on the embryo at close proximity but without touching to the desired location (see Note 26). Immediately place the treated embryo back in the incubator for 16–24 h (see Note 27).

3.8.2. Application by Injection (see Note 28) Place selected embryos onto the stage of the dissecting microscope with the microinjector set up, observed and positioned as described earlier. Advance the tip of the injection needle slowly until it begins to come into the plane of focus. Again advance the tip of the injection needle so that it enters the field of view and comes into focus. Continue to slowly advance the tip towards the embryo using the fine advancement control so that it gently comes in contact with the endoderm of the embryo just to the side of the desired point of injection (see Note 29). To inject into the segmental plate, use a swift but controlled 10° turn of the fine adjustment control to penetrate the endoderm. Slowly retract the needle several degrees (see Note 30). See that the endoderm is slightly pulled. Upon injection, you should see a slight movement of the loose segmental plate mesenchymal cells. Several microliters of a saturated Nile Blue (a vital dye) may be added to aid in visualizing the injected material. Retract the needle smoothly and gently out of the embryo (Fig. 2; see Note 31). In the case of somitocoel injection, continue to advance the injection needle tip until it makes contact with the outside of the chosen desired somite. With the fine advancement control, test this contact by nudging the somite gently and seeing that the somite moves. As described earlier, use a swift but controlled 10° turn of the fine adjustment control to penetrate the somite and retract. Upon injection, the somite should be seen to swell (see Note 32). Retract the needle smoothly and gently out of the embryo. Minimal leaking should be seen (Fig. 3).


29

Fig. 2. Sequential views of segmental plate injection. Embryos were injected with 50 ng Paraxis antisense ODNs in 10 nL Ringers solution plus 2% Nile Blue sulfate into a stage 13 chick embryo segmental plate (A–C). In (A) the microinjection needle is positioned inside the segmental plate ready for injection. After injection and retraction of the needle, the dark, injected ODN solution remains confined in the segmental plate (B). If the ectoderm on the underside of the inverted, explanted embryo had been punctured, the dark solution would bleed into a wider area and would be visible under the neural tube as well as lateral to the segmental plate (C).

Fig. 3. Sequential views of somite injection. Embryos were injected with 50 ng Paraxis antisense ODNs in 10 nL Ringers solution plus 2% Nile Blue sulfate into stage 13 chick embryo somites (A–C). In (A) the microinjection needle is positioned inside the somitocoel of the third epithelialized somite (the 6th somite caudal-rostrally) ready for injection. Part (B) shows the same somite after injection and retraction of the microinjection needle. The dark ODN suspension remains contained within the somite. In (C) a different embryo has been injected, this time into a damaged somite. Evidence of the excessive damage was only apparent after the dark ODN suspension began to leak from the somite.

3.9. Analysis Remove treated and control embryos from the incubator and examine under the dissecting microscope to determine the condition of the embryo. Only embryos that have remained in good health are gently lifted from the albumen-agar plates, rinsed twice in Spratt Ringers solution, and prepared for subsequent analysis. There are several ways to control the effectiveness of the ODN. Although Northern blots or reverse transcriptase-polymerase chain reaction (RT-PCR) could be used to assay for the reduction of a specific message after ODN treatment, we prefer using whole-mount in situ hybridization (WISH) (Figs. 4 and 5). This procedure provides

30


Fig. 4. Somite fusion resulting from the injection of Pax-1 paired-box antisense ODN. (A) A stage 13 embryo exhibiting a fused somite. Abnormalities occurred in somites that developed just caudal to the injection site. (B) Whole-mount in situ hybridization of Pax-1 expression in a fused somite resulting from injection of Pax-1 paired-box antisense. Note that expression of Pax-1 in this fused somite is less than in the normal contra-lateral somites. (C) A hematoxylin-eosin stained horizontal section of a chick embryo displaying a Pax-1 antisense ODN-induced somite fusion. The arrow in each of the figures indicates the fused somite. This fused somite is situated directly across from two somites of normal size. Note the fused somite retains the normal histology displayed by the smaller normally segmented somites. Adapted from ref. 18.

Fig. 5. Effect of topical application of Paraxis antisense ODN on somite development and Paraxis expression. (A) A normal Hamburger and Hamilton stage 14 embryo (54 h) stained for Paraxis by whole-mount in situ hybridization. (B and C) Two different stage 13 chick embryos topically treated with 50 µg Paraxis antisense ODN in 50 µL of Ringer’s solution. The brackets in both (B) and (C) indicate regions in which somite formation is disrupted. Paraxis expression is either absent (B) or very reduced (C). The arrow in (B) indicates a region in the segmental plate in which Paraxis expression is reappearing (adapted from ref. 24).


31

both temporal and spatial information regarding the production of the target mRNA that can be directly compared to any “induced” phenotype (see Note 33). One could also complement the WISH with immunoanalysis, preferably in situ immunohistochemistry, to confirm a reduction in protein level. For WISH, fix the embryos in 4% paraformaldehyde in phosphate-buffered saline (PBS) for 2–4 h at room temperature or overnight at 4°C. If the embryos are to be processed for in situ immunohistochemistry, the embryos may need to be fixed with either ethanol or Histochoice (Amresco Inc., Solon, OH, cat. no. H120). Wash the embryos twice in PBS for 15 min and pass them through a graded methanol dehydration process. We trim the embryos and perform our morphological analyses of the embryos while they are in the 100% methanol. Embryos can be stored in 100% methanol inside a closed container wrapped in Parafilm for up to 1 mo. Otherwise the embryos are rehydrated in a graded fashion for subsequent processing. 4. Notes 1. Humidity is generated by passing air through a pan of sterile water in the incubator. We use a fish tank air pump available at pet supply stores to bubble air through the water. 2. We use a two-hole paper hole punch, as it does not have page guards on either side. This allows 3/4 in. strips of the thick chromatography paper to slide freely along the track of hole punch and facilitates offset hole punching. 3. The injector chosen should operate with positive displacement to avoid backfilling, a significant problem when injecting volumes in the nanoliter range. 4. The micromanipulator chosen should have mobility in all three planes and a fine adjustment knob for advancement. Note that they come in right- and left-handed configurations. 5. Stands with magnetic clamps that are more stable are also available through other vendors (e.g., World Precision Instruments). 6. We now work exclusively with digital sequences obtained from our sequencing facility or from “ENTREZ” nucleotide sequence searches on GeneBank accessed via the Internet at www.ncbi.nlm.nih.gov. The design of ODNs can be facilitated by programs such as MacVector (Oxford Molecular Biology Group, Inc., Campell, CA, at www.oxmol.com) or Oligo (from NBI/Genovus, Plymouth, MN). These programs allow direct comparison of sequences to avoid cross-reactivity, and screen for ODNs within desired stretches of the target mRNA. 7. To effectively search in GeneBank with short sequences, it is important to use the “Advanced BLAST Search” option while changing the default “expect value” parameter to 1000. 8. On occasion, we have had to design several ODNs before arriving at an effective sequence. ODNs against other positions along the target mRNA have also been used successfully. It may also be advantageous to apply two different ODNs versus the same message to more effectively block expression (21). 9. It has been reported that antisense ODNs containing the sequence TCCC anywhere within the ODN enhances the effectiveness of the ODN (22). 10. Unbound modifiers (sulfur groups in the case of phosphorothioated ODNs) are one of the primary causes of nonspecific toxic effects (16). 11. These ODN stock solutions can be kept for up to 12 mo at –20°C. Repeated freeze thawing of ODN solutions should be kept to a minimum. 12. We allow the albumen to pour into a large weigh boat and use the flexibility of the weigh boat to create a spout to pour the albumen into the Erlenmeyer flask.

32


13. Add just enough phenol red so that when the embryo culture plates are made, they have a medium pink color. The phenol red is added to monitor the acidity of the plate during culturing and to create contrast to visualize the embryo better. 14. Be consistent with the amount of albumen agar mixture added to each plate in order to better “standardize” the height of the explanted embryos. This will facilitate injection later in the procedure, as the embryos will be in a more consistent focal plane. 15. To achieve this, we favor magnetic strength slightly over heat intensity (3:2 ratio). Under 40X magnification, we cut the tip of the pulled needle with microsurgical scissors just behind the point at which the interior walls of the pulled needle fuse. The resulting width of the injection tip should be between 20 and 30 mm. 16. Whether studying somite formation or maturation, it is advantageous to administer the ODN to a stage 12 or 13 embryo. At this time the embryo has between 16–20 somites, which together represent a full complement of all the elements of the early stages of somitogenesis: paraxial mesoderm, segmental plate, condensed somites, epithelial somites, and somites undergoing primary somite differentiation (sclerotomal migration). More importantly, the circulatory system and the dorsal aortae have not yet formed and are not transporting large amounts of fluid. There is little threat that the topically applied ODN will be washed away prior to reaching its target. After injection, the punctured endoderm of the future dorsal aorta will have time to heal, minimizing hemorrhage that can either kill an embryo or induce malformations. In addition, the escaping circulatory fluid will not wash away the injected ODN and will not be diluted or washed away by the circulation. 17. We do this by tapping it along a sharp metal edge such as that provided by an inverted heat block insert. 18. In order to facilitate the proper orientation of the embryo for explantation, eggs are placed on their sides for 45–60 min at 38°C prior to cracking. This allows the embryo to orient itself on the top side of the yolk so that when the egg contents are dropped into the dish the embryo is easily accessible. 19. It is preferable to remove as much residual yolk as possible from the embryo. However, it is equally important to be gentle during the washes to impose minimal physical stresses on the embryo, which themselves can cause developmental axial anomalies. 20. Keeping the embryos at physiological temperature (38°C) increases the viability and overall condition of the embryo cultures. 21. The inverted orientation of the embryo is advantageous to both topical and injected applications. Penetrance of topically applied ODNs to target tissues may be facilitated by the absence of the vitelline membrane. In addition, only the endoderm needs to be traversed by the microinjection needle to access the target tissue. Control experiments indicate that embryos survive longer in this orientation under these culture conditions. 22. We use injection for spatially controlled reduction of gene expression, i.e., injection of 50 ng antisense ODN affects only one or two somites. This was shown by observing the distribution of fluorescently labeled ODNs in the embryo as a control during the treatment protocol (18). We use topical ODN applications to reduce gene expression in a broader area. 23. The dose of ODN applied must be titrated to minimize any toxic effects of the ODN while reliably disturbing gene expression. In the case of topical ODN application, we begin with 5 µg ODN in 10 µL of vehicle (Spratt Ringer’s solution): for injections into the somitocoel or segmental plate, 50 ng in a 10-nL vol. 24. The stringency of embryo selection prior to treatment is a critical component of these experiments. Only those embryos that are clearly robust and completely normal it terms of morphology should be used. Careful observation and staging of individual embryos both before and after treatment will facilitate the interpretation of experimental results.


33

25. The mechanism of delivery is an important consideration. In our system, we have found that naked ODNs are quite effective in entering target tissue and blocking specific gene expression (18,23–25). Several other options exist including delivery with cationic lipids and conjugation to fusigenic proteins (14,26–28). The use of lipid delivery systems introduces new variables into the treatment protocol that must be properly controlled for. 26. If the drop is allowed to fall too far, It will damage the embryo. Damaged embryos should be discarded. In general, the site at which the ODNs penetrate the embryonic tissue is quite well restricted to the point of administration (18). 27. Embryos between 36 and 48 h old may be cultured on the plates to a maximum age of 72 h without producing significant developmental anomalies. In some cases turning the head to the right relative to the trunk may be prevented; however, axial and vascular development remains normal. Development on these plates beyond 72 h is delayed, inconsistent, and essentially unachievable due to the limitations in vascular development imposed by the filter ring. Thus, for embryos to be cultured to 72 h or slightly beyond, larger explant rings can be used to provide greater surface area and slightly longer normal development on these plates. 28. ODNs delivered by injection appear to act in a more immediate fashion than those applied topically. Injected anti-Pax-1 ODN appears to take effect within 90–120 min (18,23). Topically applied anti-Paraxis ODN appears to take effect within 6–8 h (24). This may be a function of penetrance of the ODN to the target tissue. Topically applied ODN must pass through the endoderm before reaching the target, i.e., segmental plate. The consequence of this is that the observed phenotype will be observed 3–4 somites caudal to the last formed somite observed pretreatment in the case of topically applied ODNs. 29. The endoderm is a delicate structure at the level of the segmental plate and somites. A 20-µm injection needle tip should be sharp enough to pass through this germ layer easily. 30. We have found that injection of ODNs works better if the microinjector needle is slightly retracted just before injection. Injected volumes should be kept as small as possible in order to minimize mechanical disruption of the tissue surrounding the injection site. 31. In an ideal setting, the same injection needle may be used for all injections of the same ODN. The needle must be changed between injecting different ODNs. Therefore, it is a good idea to sort the embryos into the various experimental and control groups before the injections are begun. However, occasionally the injection needle can become clogged and needs to be changed. 32. The somite will return to its original size shortly (Fig. 5). Control experiments have shown that the somite will return to its original size and heal itself in a timely manner so that injection of controls produces no observable defect 18 h later (after considerable somite differentiation). 33. The effectiveness of a chosen ODN in knocking down the expression of a gene of interest varies not only between ODNs of different design, but also as a function of slight or imperceptible differences in ODN delivery and penetrance combined with variability in the genetic background between chick embryos treated (see Figs. 5 and 6). 34. The ODNs appear to exert their effect over a 12–16 h period as indicated by the recovery of target gene expression, e.g., Paraxis, in the segmental plate representing a distance equivalent to 8–10 somites caudal to the first observed mRNA reduction and coincident somitic defect (Fig. 3). 35. In vivo, one new somite pair forms every 90–100 min. In our culture system, new somite pairs form at a slightly slower rate of one new somite pair per 100–110 min. For example, a stage 13 embryo that has been cultured for 16 h has formed 10 somite pairs instead of the expected 12.

34


Fig. 6. Somite histology of embryos treated with topically applied Paraxis antisense ODN. Horizontal sections of control (A), and embryos treated with topically applied ODN (B and C) were stained with hematoxylin-eosin. Somitogenesis is absent in the somitic region of the embryo depicted in (B), consistent with absent epithelialization. Note that in this embryo there remain alternating bands of less and more cell condensation, consistent with anterior-posterior patterning of more mature sclerotome indicating that segmentation may be retained. Although somite structures are apparent in (C), their size and shape are irregular, consistent with poor condensation and/or epithelialization during their formation. (Note that the embryo in [C] is not sectioned along a true frontal plane.) Notice the varying phenotypes in different individuals resulting from apparently identical treatments of Paraxis antisense ODN. Figures adapted from ref. 24.

Acknowledgment Supported in part by National Institutes of Health (NIH) grants ES07005, DE11327, AR44501, and DE12864. AMD was supported by NIH training grant T32-ES07282. References 1. Toulme, J. J. and Helene, C. (1988) Antimessenger oligodeoxynucleotides: an alternative to antisense RNA for artificial regulation of gene expression—a review. Gene 72, 51–58. 2. Dagle, J. M., Weeks, D. L., and Walder, J. A. (1991) Pathways of degradation and mechanism of action of antisense oligonucleotides in Xenopus laevis embryos. Antisense Res. Dev. 1, 11–20. 3. Eckstein, F. (1985) Investigations of enzyme mechanisms with nucleoside phosphorothioates. Ann. Rev. Biochem. 54, 367–402. 4. Loke, J. W., Stein, C., Zhang, X., Mori, K., and Nakanishi, C. (1989) Proc. Natl. Acad. Sci. USA 86, 3474–3478.


35

5. Lorenz, P., Baker, B. F., Bennett, C. F., and Spector, D. L. (1998) Phosphorothioate antisense oligonucleotides induce the formation of nuclear bodies. Mol. Biol. Cell 9, 1007–1023. 6. Spratt, N. (1947) A simple method for explanting and cultivating early chick embryos in vitro. Science 106, 452. 7. Augustine, K. (1997) Antisense approaches for investigating mechanisms of abnormal, development. Mutat. Res. 396, 175–193. 8. Brysch, W. and Schlingensiepen, K. H. (1994). Design and application of antisense oligonucleotides in cell, culture, in vivo, and as therapeutic agents. Cell Mol. Neurobiol. 14, 557–568. 9. Sczakiel, G. (1997) The design of antisense RNA. Antisense Nucleic Acid Drug Dev. 7, 439–444. 10. Stein, C. A. (1998) How to design an antisense oligodeoxynucleotide experiment: a consensus approach. Antisense Nucleic Acid Drug Dev. 8(2), 129–132. 11. Altmann, K. H., Fabbro, D., Dean, N. M., Geiger, T., Monia, B. P., Muller, M., and Nicklin, P. (1996) Second-generation antisense oligonucleotides: structure-activity, relationships and the design of improved signal-transduction inhibitors. Biochem. Soc. Trans. 24, 630–637. 12. Toulme, J. J., Tinevez, R. L., and Brossalina, E. (1996) Targeting RNA structures by antisense oligonucleotides. Biochimie 78, 663–673. 13. De Mesmaeker, A., Altmann, K. H., Waldner, A., and Wendeborn, S. (1995) Backbone modifications in oligonucleotides and peptide nucleic acid, systems. Curr. Opin. Struct. Biol. 5, 343–355. 14. Gewirtz, A. M., Stein, C. A., and Glazer, P. M. (1996) Facilitating oligonucleotide delivery: helping antisense deliver on its promise. Proc. Natl. Acad. Sci. USA 93, 3161–3163. 15. Eckstein, F. (1979) Phosphorothioate analogs of nucleotides. Acc. Chem. Res. 12, 204–210. 16. Stein, C., Subasininghe, C., Shinozuka, K., and Cohen, J. (1988) Physiochemical properties of phosphorothioated oligodeoxynucleotides. Nucleic Acids Res. 16, 3209–3221. 17. Zon, G. (1995) Antisense phosphorothioate oligodeoxynucleotides: introductory concepts and possible molecular mechanisms of toxicity. Toxicol. Lett. 82–83, 419–424. 18. Smith, C. A. and Tuan, R. S. (1995) Functional involvement of Pax-1 in somite development: somite dysmorphogenesis in chick embryos treated with Pax-1 paired-box antisense oligodeoxynucleotide. Teratology 52, 333–345. 19. Hamburger, V. and Hamilton, L. (1951) A series of normal stages in the development of the chick embryo. J. Morphol. 88, 49–52. 20. Bellairs, R. and Osmond, M. (1998) The Atlas of Chick Development, Academic, New York. 21. Kandimalla, E. R., Manning, A., Lathan, C., Byrn, R. A., and Agrawal, S. (1995) Design, biochemical, biophysical and biological properties of cooperative antisense oligonucleotides. Nucleic Acids Res. 23, 3578–3584. 22. Tu, G. C., Cao, Q. N., Zhou, F., and Isreal, Y. (1998) Tetranucleotide GGGA motif in primary RNA transcripts—novel target site for antisense design. J. Biol. Chem. 273, 25,125–25,131. 23. Barnes, G. L., Jr., Mariani, B. D., and Tuan, R. S. (1996) Valproic acid-induced somite teratogenesis in the chick embryo: relationship with Pax-1 gene expression. Teratology 54, 93–102. 24. Barnes, G. L., Alexander, P. G., Hsu, C. W., Mariani, B. D., and Tuan, R. S. (1997) Cloning and characterization of chicken Paraxis: a regulator of paraxial mesoderm development and somite formation. Dev. Biol. 189, 95–111.

36


25. Love, J. M. and Tuan, R. S. (1993) Pair-rule gene expression in the somitic stage chick embryo: association with somite segmentation and border formation. Differentiation 54, 73–83. 26. Miller, K. J. and Das, S. K. (1998) Antisense oligonucleotides: strategies for delivery. Pharmaceut. Sci . Tech. Today 1, 377–386. 27. Monkkonen, J. and Urt, A. (1998) Lipid fusion in oligonucleotide and gene delivery with cationic lipids. Adv. Drug Delivery Rev. 34, 37–49. 28. Spiller, D. G., Giles, R. V., Grzybowski, J., and Clark, R. E. (1998) Improving the intracellular delivery and molecular efficacy of antisense oligonucleotides in chronic myeloid leukemia cells: a comparison of streptolysin-O permeabilization, electroporation, and lipophilic conjugation. Blood 91, 4738–4746.

Functional Blocking Antibodies

37

5 Application of Functional Blocking Antibodies N-Cadherin and Chick Embryonic Limb Development Steven A. Oberlender and Rocky S. Tuan 1. Introduction The current trend in developmental biology research is to identify candidate functional genes and then manipulate their expression or activity by either gain or loss of function to elucidate the specific roles of their protein products. One such procedure is the introduction of antigen-specific antibodies that are capable of precisely interfering with the function of a particular protein in a specific anatomical structure of the developing embryo. This technique, when performed correctly, proves to be a very powerful tool when investigating the presumed function of a specific protein. Monoclonal antibodies have the unique characteristic of interacting with a single epitope of a given antigen such as a protein. The ability to produce such monoclonal antibody has proven to be one of the most important modern scientific advances (1). Here we describe the procedure we have developed in administering a specific monoclonal antibody to the cell adhesion protein, N-cadherin (2), to the developing chicken embryonic limb bud to investigate the functional importance of N-cadherin (3). A key method required for this technique is the establishment of shell-less chick embryo cultures (4). Although this chapter covers a specific protocol for N-cadherin in the developing chick limb, the procedure may be modified appropriately for application to investigate other developmental systems. 2. Materials 1. Ethanol: 95% for washing down cell culture hoods, rubber bands, and glass stirring rod; 70% for cleaning off eggs. 2. Phosphate buffered saline (PBS), pH 7.4: composition per liter, 8 g NaCl, 0.2 g KCL, 1.15 g Na2HPO4 and 0.2 g KH2PO4. 3. PBS-buffered 10% formalin: Pure formaldehyde is ~38% w/v, which is equivalent to 100% formalin. Therefore, one part pure formaldehyde (Sigma Chemical Co., St. Louis, MO) added to nine parts PBS will yield 10% formalin buffered with PBS. Formaldehyde should be used within 3 mo of purchase. 4. Vital dye Nile Blue sulfate; add to antibody solution just prior to use.

From: Methods in Molecular Biology, Vol. 137: Developmental Biology Protocols, Vol. III Edited by: R. S. Tuan and C. W. Lo © Humana Press Inc., Totowa, NJ

37

38

Oberlender and Tuan

5. Mineral oil; keep isolated and as clean as possible. Only pour out of the jar; do not dip tubes into the jar. 6. Acid-alcohol Alcian Blue. 7. 2% KOH: 2 g KOH per 100 mL distilled, filtered water. 8. Glycerin 50% (1:1 with distilled water) and 100%. 9. 10 µL micropipets (Drummond, Broomall, PA). 10. For shell-less chick embryo culture (see Methods): culture stand, plastic wrap, and rubber bands. 11. Microinjector (e.g., Drummond). 12. Micropipet puller (e.g., Narashige, Tokyo, Japan). 13. Dissection tools: precision-curved forceps, blunt forceps.

3. Methods 3.1. Shell-less Chick Embryo Cultures 1. Fertilized White Leghorn chicken eggs (see Note 1) are incubated in a humidified egg incubator at 99°F for 3 d. The eggs are then removed and placed on their sides in an egg crate, previously sterilized by autoclaving, for ~10–15 min. This allows the embryos to float to the top of the egg (3). 2. The entire procedure is then carried out in a sterile culture hood. Because the eggs are set on their sides, the culture apparatus is prepared. Three inch diameter PVC (polyvinyl chloride) conduit tubes are obtained and previously cut in cross section to obtain ~3 in sections when stood on end (see Note 2). The tube sections are then autoclaved and allowed to cool prior to using them. A piece of plastic food wrap (i.e., polyethylene kitchen wrap; see Note 3) is then placed over the top or up end of the tube with at least 2 in of overhang around the tube. A slight depression is made in the center of the wrap with a blunt end, sterile glass rod. This will form a concave surface in which the embryo will sit. Be careful not to create any small tears in the food wrap. A rubber band which has been soaked in ethanol is then placed around the outside of the top of the tube, making sure the overhanging food wrap is underneath the rubberband. This will serve to secure the food wrap in place with the pouch preserved in the center of the tube. 3. The eggs are then sprayed with ethanol to decrease the likelihood of contamination. The first egg is then carefully cracked along a sharp edge, similar to the way in which one would crack an egg when making breakfast, making sure to keep the egg in the same orientation as it has been in for the last several minutes (see Note 4). The egg shell is then slowly separated just above the tube, and the contents are allowed to gently slide onto the food wrap. If done correctly, the embryo, with its attached vasculature and yolk, should be floating on top. A 100-mm Petri dish lid is then placed on top of the tube (it should sit on top of the tube without sliding off, but it does not have to be a perfect fit). The entire culture apparatus is then placed in a humidified incubator at 37.5°C with constant air flow and allowed to continue to develop.

3.2. Injection of Antibodies into Chick Limb Buds 1. When the chick embryos have reached Hamburger–Hamilton (H–H) stage 22–24 (see Note 5), the time period in which the limb mesenchyme condenses and differentiates into chondrocytes, the shell-less chick cultures are removed from the incubator and placed into a sterile culture hood (1). 2. Two antibody preparations were used in our study. For the control antibody, rat IgG antibodies were obtained commercially from Sigma and diluted to a concentration of 10 mg/mL in PBS at physiological pH. NCD-2, a rat-derived monoclonal antibody directed against


3. 4.

5.

6.

7.

8. 9.

39

the extracellular binding region of N-cadherin and capable of blocking N-cadherin-mediated homophilic interaction, was purified from an NCD-2 rat hybridoma cell line (2) using a standard procedure involving ammonium sulfate precipitation and DEAE ion-exchange chromatography (1), and stored as a lyophilized preparation at –20°C (4). The antibody was reconstituted prior to its use in PBS at physiologic pH to a working concentration of 10 mg/mL. In order to visualize the efficacy of each injection, a small quantity of the vital dye Nile Blue sulfate was added to each of the antibody preparations (see Note 6). Prior to the procedure, you must prepare the injection apparatus, especially the injection micropipets. For this procedure, 10 µL micropipets are used for impalement and injection into the limb bud. These injection pipets may be prepared by handpulling the micropipets in a Bunsen flame (see later). However, a commercially available micropipet puller is preferred for more controlled and reproducible production. Occasionally, the end of the injector is sealed, but this can be cut open using a fine pair of sharpened surgical scissors (see Note 7). If the automated pipet puller is not readily available, similar microinjectors may be produced by holding a capillary tube in the thumb and index fingers of both hands and slowly rolling it with its center over a Bunsen flame. Gently apply even tension in opposite directions with your hands. As the middle section of glass melts and softens, move it away from the flame and the capillary tube will pull apart, creating fine tapered ends. These may also need to be cut open with fine scissors (see Note 8). A microsyringe must be used to inject the limb buds. You may use either a mechanical or electronically operated syringe that allows you to reproducibly inject quantities in 1–2 µL increments. For our experiments, we used two types of microsyringes. One type was a hand-engineered mechanical burette plunger connected to a syringe. The burette scale needs to be calibrated to correspond to exact quantities of solution (see Note 9). The automated device we used was an electronically operated microsyringe manufactured by Drummond equipped with an operating pad with options for injection quantities and plungers that fit into 10 µL capillary tubes. The microsyringe is mounted onto a micromanipulator with the capability of precision micromovements in all three planes (see Note 10). A pulled capillary microinjector pipet is then removed from its holding case and the tip is dipped into an ethanol-filled beaker. The blunt, back end of the capillary is then placed into a thin layer of mineral oil and the oil is allowed to back-fill by capillary diffusion to a height of ~0.5–1.0 cm (see Note 11). The microinjection needle is then placed onto the microsyringe. At this time, the plunger is passed into the needle and the excess ethanol is purged from the tip. The tip is then lowered into a microcentrifuge tube containing the suspended antibody preparation and the plunger is pulled back, thus filling the needle (see Note 12). Retrieve a shell-less cultured chick embryo from the incubator. After removing the Petri dish lid under the culture hood, it will become readily evident that the embryo is lying on one side, almost always exposing its right side, i.e., only one forelimb and one hindlimb. Physically turning the embryo over to inject the other limb should be avoided, as such a harsh manipulation inevitably results in the death of the embryo. Place the entire shell-less culture apparatus on the stage of a stereoscopic dissecting microscope with good optics and fiber optics illumination. To maintain a clean and sterile technique, the base and stage of the microscope should be wiped down with ethanol prior to its use and introduction into the hood. Overlying the embryo are the clear embryonic membranes. Using fine forceps, gently tease away the membranes so as to gain access to both exposed limbs (see Note 13). Carefully position the microsyringe and injection pipet at an angle of about 45–60° to the limb bud, and using the micromanipulator, bring the tip of the pipet in close proximity to

40

Oberlender and Tuan

the limb bud. The syringe is then advanced until contact of the tip of the needle is made with the limb bud. The point of injection should be as close to the center of the limb bud as possible. If the tip of the injection pipet is very sharp (which is preferable), then it will easily pass into the tissue. At this point, you only want to advance it a few microns past the outer, epithelial layer. Because you will be looking head-on at the tissue in its long axis, it is not possible to visually gage how far into the tissue the tip has penetrated. However, after performing several passes, it will be possible to get the feel of where to place the pipet tip. If the tip is not extra sharp, the tissue may begin to depress inward at the point of contact. Advancing slightly further will usually create enough pressure so that the tissue gives and the pipet tip penetrates the outer surface. 10. When you feel that your positioning is correct, start to inject the antibody solution into the limb bud. You should then visualize active filling of the antibody solution into the limb bud as you are injecting (see Note 14). If done correctly, a “blue ball” should be situated within the central region of the limb bud. The total volume injected should range from 0.5–1.0 µL per limb bud. 11. Because it is not advisable to turn the embryo to gain access to the contralateral limb buds, and because forelimbs should not be compared to hindlimbs, modifications have to be made as far as experimental controls are concerned. In our study, for all experiments, either the right forelimb or right hindlimb was injected with NCD-2, and the other right limb was injected with the same volume of control rat IgG. All comparisons are made between the injected limb and the contralateral, uninjected limb. In addition, the rat IgG injected limbs serve as both a control for possible effects due to the injection buffer or the presence of rat IgG, as compared to the contralateral, uninjected limb. Provided enough injections are done, differences may be considered significant. 12. After both injections are made (see Note 15), there is no need to try and replace the membranes that have been teased away. Simply replace the Petri dish lid, place the culture vessel back in the incubator, and leave undisturbed.

3.3. Whole-Mount Alcian Blue Staining of Chick Limb Buds 1. Two days after the limb buds are injected, remove the shell-less cultures from the incubator (the rest of the protocol does not necessitate the use of a culture hood). The Petri dish lids are removed and the embryo is gently separated from the extra embryonic membranes and placed into a Petri dish by grasping the embryo gently, but firmly on the torso with a pair of fine forceps. Any attached blood vessels and membranes are gently teased away from the embryo. 2. The entire embryo is then placed in a 7-mL glass or polypropylene vial and then filled with PBS-buffered 10% formalin for fixation. The embryo may be stored in this manner until whole-mount staining is performed (see Note 16). 3. The fixative is carefully decanted and then acid-alcohol Alcian blue is poured in and left to stand for 17 h (5). 4. The Alcian blue is poured off and 2% KOH is added in order to clear and macerate the soft tissue (see Note 17). 5. After the desired result is obtained, the KOH is decanted and a 50% solution of glycerin is added for several hours. This is then replaced with 100% glycerin, which allows the specimen to be stored until analysis can be performed. 6. For observation, the embryos are poured from the vials into a Petri dish and the limbs are carefully separated from the torso by using fine surgical microscissors and fine forceps. This should be done using the stereo dissecting microscope with a fiber-optic light source. The torso is then discarded. Again, it is critical to keep the correct orientation of the limbs.


41

7. Each set of limbs, the injected (NCD-2 or rat IgG) and contralateral control, is then analyzed by observation using a stereo microscope. A good specimen should be cleared of soft tissues, allowing the cartilaginous structures to be clearly visualized. Specimens may be photographed using black and white or color photography.

4. Notes 1. The farm where you obtain the eggs should have a good record of reliability. Over 95% of the eggs should be fertilized and delivered to the lab refrigerated and unincubated. In this manner, you can refrigerate the eggs (at 45–50°F) up to several days and then begin the incubation at a convenient time point. 2. The PVC tubes that we used are obtained in the form of drainage pipes from a plumbing supplier and then cut with a circular saw. Cut edges are smoothed by sanding. 3. In our experience, generic plastic wraps (i.e., store-brand) obtained at the food market yield better than brand name products. 4. One must crack the egg very gently. We use a rectangular block of stainless steel and crack the eggs on a sharp edge, creating a precise split in the eggshell. 5. Each egg incubator will vary slightly in temperature and humidity, and one must calibrate the length of time that corresponds to specific Hamburger–Hamilton stages. 6. There is no exact amount of dye that needs to be added. Simply add a few microliters of a saturated solution so that the color is visible and keep this amount constant throughout all of your experiments. 7. The capillary microinjectors, once prepared, should be carefully stored in a large Petri dish until they are used. We added a piece of clay to the bottom of the dish and placed the microinjectors lengthwise into the clay, making sure the ends were suspended just above the bottom of the dish. In this manner, the microinjectors remain relatively secure until their use. 8. If performing a manual capillary tube pull, do not stop applying tension when the tube begins to separate. Pull the ends evenly and fully apart. 9. The buret may be calibrated by weighing quantities of water delivered according to specific calibration marks on an analytical balance. The volume is calculated based on the density of water (1 µg = 1 µL). 10. Before attempting any experiments, become completely familiar with the correct operation of the micromanipulator. Failure to do so will likely result in damage to the embryo when performing the experiment. 11. The mineral oil creates a tight seal so that the plunger operates correctly. Without the oil, the plunger will move and not deliver the correct amount of solution because of air pockets. 12. Be very careful not to damage or contaminate the tip of the microinjection pipet. 13. The embryonic membranes must be penetrated prior to injection. This can be done by fine manipulation with precision-curved forceps. Sometimes, using two pairs of forceps and creating small tears in the membranes, while avoiding blood vessels and embryonic movement, will allow you to gain access as well. 14. If the pipet accidentally passes through the entire limb bud, the blue dye will be seen dispersing under the embryo. If this happens, stop injecting, back up the pipet slightly into the limb bud, and begin injecting again. Another possible outcome is that the pipet contacts a blood vessel. If this happens, the blue dye will be seen to circulate up the limb bud and into the embryonic vasculature. Once again, repositioning the syringe should resolve this problem. Because of these potential situations, only inject a very small quantity of antibody once the pipet tip is thought to be in the correct position. Once verified, you may finish the injection. It is important to note that any repositioning of the syringe should be

42

Oberlender and Tuan

done in an “in and out” manner and not in a “side to side” fashion, to minimize trauma to the embryo. 15. The same injection pipet may be used for about five injections before replacement because of dulling of the tip. One must never use the same pipet for different antibody solutions. Therefore, we generally filled a pipet with a particular antibody solution and then used it to inject five embryos (forelimbs) that were placed in the hood at the same time. We then switched pipets and injected the other limbs (hindlimbs) of the same five embryos, and then placed all of them back into the incubator. 16. In order to maximize efficiency, a large number of embryos should be stored and processed for whole-mount staining. The crucial point here is to keep the orientation of the embryos correct. Remember, only one side of the embryos is injected, and because it is usually the right side, it may also be the left side at times. A good labeling system is a key feature to proper interpretation of the results. 17. Unfortunately, there is no exact time to use for this step. Therefore, the embryos have to be periodically examined to assess the amount of clearing that is taking place. When a sufficient amount of clearing is obtained, the next step is performed. If the embryos are left in too long, they will “dissolve,” rendering the experiment uninterpretable. Generally, several hours are needed, but the time fluctuates from experiment to experiment. However, leaving them unattended overnight is strongly discouraged.

Acknowledgment This work is supported in part by grants from the NIH (HD15822, HD29937, and DE11327). References 1. Harlow, E. and Lane, D. (1988) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. 2. Hatta, K. and Takeichi, M. (1986) Expression of N-cadherin adhesion molecules associated with early morphogenetic events in chick development. Nature 320, 447–449. 3. Oberlender, S. A. and Tuan, R. S. (1994) Expression and functional involvement of N-cadherin in embryonic limb chondrogenesis. Development 120, 177–187. 4. Tuan, R. (1980) Calcium transport and related functions in the chorioallantoic membrane of cultured shell-less chick embryos. Dev. Biol. 74, 196–204. 5. Kimmel, C. A. and Trammell, C. (1981) A rapid procedure for routine double staining of cartilage and bone in fetal and adult animals. Stain Technol. 56, 271–273.

RNase Protection Assay

45

6 Gene Expression Analyzed by Ribonuclease Protection Assay Vickie D. Bennett 1. Introduction The ribonuclease (RNase) protection assay provides a highly sensitive method for the detection and quantitation of specific RNAs from tissues and cells as well as for the analysis of mRNA and gene structure (1). This solution hybridization approach is at least 10-fold more sensitive than Northern blot analysis, and thus is useful for the evaluation of low-abundance mRNAs. Furthermore, the greater stability of the RNA duplex structure over RNA–DNA hybrids used in S1 nuclease protection assays provides the greatest sensitivity among the solution hybridization approaches. Structurally, these assays also provide a useful means of determining the size of specific exons (2,3) in a gene and for the quantitative analysis of specific alternative splicing events occurring in homogeneous tissues (see Note 1), as well as the mapping of transcription start site (4,5). 2. Materials 1. Hybridization mix: 80% (v/v) deionized formamide in 40 mM PIPES, pH 6.4, 0.4 M NaCl, 1 mM EDTA. Prepare 40 mM PIPES from the disodium salt of PIPES (piperazine-N,N-bis [2-ethanesulfonic acid]), add salts, adjust the pH with 1 N HCl, and filter sterilize the solution prior to formamide addition. Store completed hybridization mix at –20°C. 2. RNase digestion buffer: 50 mM Tris-HCl, pH 7.5, 0.5 M NaCl containing 40 mg/mL RNase A (Sigma Chemical Co., St. Louis, MO, boiled, 10 mg/mL stock) and 2 mg/mL RNase T1 (Life Technologies, Bethesda, MD). Prepare fresh prior to use from stock RNasefree solutions. 3. 10% SDS: 10% (w/v) sodium dodecyl sulfate. Filter sterilize and store at room temperature. 4. Proteinase K solution: 10 mg/mL Proteinase K (Boehringer Mannheim, Mannheim, Germany). Prepare fresh prior to use. 5. Formamide loading buffer: 80% (v/v) formamide, 10 mM EDTA, pH 8.0 containing 1 mg/mL xylene cyanol FF and 1 mg/mL bromophenol blue. Store at –20°C. 6. Phenol equilibrated with diethylpyrocarbonate-treated water. 7. General RNase-free stock solutions: a. 2.5 M ammonium acetate. b. 3 M sodium acetate. From: Methods in Molecular Biology, Vol. 137: Developmental Biology Protocols, Vol. III Edited by: R. S. Tuan and C. W. Lo © Humana Press Inc., Totowa, NJ

45

46

Bennett

c. 100 mM EDTA, pH 8.0. d. TE: 10 mM Tris-HCl, pH 8.0 10 mM EDTA. e. Absolute ethanol. 8. Ethanol/dry-ice bath. 9. 8% denaturing polyacrylamide gel. 10. TBE (Tris-borate/EDTA) electrophoresis buffer: Prepare 10X stock solution with 108 g Tris base, 27.5 g boric acid, and 20 mL 0.5 M EDTA, pH 8.0 in 1 L. Use at 1X (1:10 dilution) working strength for polyacrylamide gel electrophoresis. A precipitate often forms in concentrated solutions of TBE over time; filter sterilize the 10X stock solution and store in a clean glass bottle at room temperature to avoid precipitate formation for as long as possible. Discard if precipitate develops before use.

3. Methods

3.1. Preparation of Probe RNase protection assays require the use of a uniformly labeled RNA probe that is completely complementary to the RNA to be analyzed. Generally, this probe, because of the sensitivity of the RNase digestion, should be species-specific (see Note 2). 1. Subclone a cDNA fragment containing the sequence of interest into the multiple cloning site of a plasmid vector containing the cloned copies of two different bacteriophage DNAdependent RNA polymerase promoters (derived from bacteriophage SP6, T7, or T3) arranged in opposite orientations and separated by the multiple cloning site (see Note 3). This subcloning can be done directionally or the orientation can be determined subsequent to subcloning. 2. Linearize the plasmid with a restriction enzyme that will result in a 100- to 500-base runoff transcript that is complementary to the sequence of interest (antisense RNA) when the plasmid is transcribed with the appropriate bacteriophage polymerase. The linearized plasmid should be phenol/chloroform extracted to minimize RNase contamination. Complete digestion of the plasmid is essential to prevent generation of very long transcripts containing substantial vector-derived sequences that incorporate significant amounts of the radiolabeled ribonucleotide during in vitro transcription. Thus, a portion of the linearized product should be run on an agarose gel to check for complete digestion of the plasmid prior to in vitro transcription. 3. Synthesize a uniformly labeled, antisense RNA probe by in vitro transcription of the linearized template with the appropriate bacteriophage DNA-dependent RNA polymerase. We currently use a commercially available in vitro transcription kit (Promega, Madison, WI) in a 20-mL reaction volume containing 0.3–0.4 pmole linear template DNA and 50 mCi [α- 32P] CTP (Amersham, specific activity of 800 Ci/mmole; 20 mCi/mL) according to the directions supplied by the manufacturer. 4. Add 10 U RNase-free DNase (Promega, 1000 U/mL) and incubate at 37°C for 15 min to digest the template DNA in the transcription reaction. Stop the reaction by adding 10 mL 0.2 M EDTA, pH 8.0. 5. Add 100 mL RNase-free water and 5 mg carrier RNA (nuclease-free, yeast tRNA; Life Technologies) and phenol/chloroform extract to remove enzymes. 6. Precipitate the labeled RNA with 0.25 M ammonium acetate and 2.5 vol RNase-free 100% ethanol in an ethanol/dry-ice bath for 45 min. Centrifuge in a microcentrifuge for 15 min, remove the supernatant, dry the pellet under vacuum for 5 min, and then resuspend the labeled RNA in 100 µL hybridization mix (see Note 4). The probe should be used within a few days, preferably immediately, to avoid radiochemical damage to the RNA.


47

3.2. Preparation of RNA Samples 1. Aliquot a known amount of total cellular or poly(A)+ RNA from each sample RNA that you wish to analyze into individual microcentrifuge tubes. The amount of unlabeled sample RNA depends upon the concentration of the mRNAs of interest. For most applications in our experience, 1–10 µg of RNA provides a strong hybridization signal in an overnight exposure of the completed gel to X-ray film with intensifying screens. However, up to 150 µg in a 30 µL hybridization reaction can be utilized for detection of very low copy RNAs. A preliminary experiment designed to determine an acceptable range of RNA concentrations for the particular RNA of interest is often a good idea. An equal amount of each sample RNA should be used if the purpose for the experiment is to quantify the relative abundance of a particular RNA in various samples (see Note 5). 2. Add carrier yeast tRNA to each sample in order to maintain a constant amount of RNA (generally 30 mg) in each reaction. 3. Include a “no RNA” sample, containing only carrier RNA, to monitor for complete RNase digestion of the RNA probe and background hybridization later in the experiment. The sample should result in the absence of any protected probe following RNase digestion. 4. Dry down the RNA mixtures in each microcentrifuge tube under vacuum until they are “just dry.” 5. Redissolve each RNA pellet in 30 mL hybridization mix. Either pipet up and down vigorously or heat the samples to 60°C if dissolving the RNA presents a problem.

3.3. Hybridization of Probe to RNA 1. Add 5 µL (containing 1–5 × 10 5 cpm) of radiolabeled RNA probe to each sample (see Note 6). 2. Vortex to mix thoroughly. Centrifuge in microcentrifuge for 5 s to bring all of the sample to the bottom of the tube. 3. Incubate samples at 85°C for 5–10 min to denature the RNAs. 4. Immediately transfer samples to a water bath preset to the appropriate annealing temperature. A good beginning temperature to try is 45–50°C, but the optimal temperature for hybridization may range from 30 to 65°C depending upon the probe. 5. Incubate the hybridization mixtures at the annealing temperature for 8–16 h (overnight is generally a convenient incubation time).

3.4. RNase Digestion 1. Microcentrifuge each sample for 5–10 s to bring the condensate in each tube to the bottom. 2. Add 250 µL of RNase digestion buffer containing RNases A and T1. 3. Mix each sample gently by tapping the side of the microcentrifuge tube or by pipetting. Do not vortex. 4. Microcentrifuge each sample for 5 s. 5. Incubate the samples at 27–30°C for 30 min. 6. Microcentrifuge each sample for 5 s. 7. Add 20 µL of 10% SDS and 10 µL of 10 mg/mL Proteinase K to each sample. 8. Mix each sample gently by tapping the side of the microcentrifuge tube. Do not vortex. 9. Incubate the samples at 37°C for 30 min. 10. Add 200 µL phenol. Vortex. 11. Microcentrifuge at room temperature for 5 min to separate phases. 12. Carefully transfer the aqueous phase from each sample into a new microcentrifuge tube. 13. Add 30 µL 3 M sodium acetate and 700 µL ethanol to each sample. tRNA may also be added in sodium acetate as carrier.

48

Bennett

Fig. 1. RNase protection assay for determination of fibronectin mRNA in various chick embryonic tissues. Poly(A)+ RNA, isolated from each of the embryonic tissue, was analyzed as described in the text.

14. Incubate in ethanol/dry-ice bath for 30 min. 15. Microcentrifuge at 4–6°C for 15 min to precipitate the RNA. 16. Remove the supernatant from each sample. Dry the resulting pellet under a vacuum until “just dry” (usually 5–10 min in a Speed-Vac).

3.5. Separation of Products by Gel Electrophoresis 1. Redissolve each pellet in 10 µL TE. 2. Add 10 µL Formamide Dyes to 5 µL of each sample in a new microcentrifuge. Prepare a “Probe Alone” sample that contains undigested probe only (1 µL of a 1:10 dilution of the probe mixed with 4 µL TE and 10 µL formamide dyes generally gives a good signal). As molecular weight markers, use end-labeled fragments of DNA (for general size determinations) or end-labeled RNA markers (for exact size determinations) of known size. 3. Boil all samples for 3 min or heat at 95°C for 5 min and then transfer all tubes immediately to an ice bath. 4. Load each sample into a single lane of an 8% denaturing polyacrylamide gel (or agarose gel of the appropriate percentage for larger probes). Immediately prior to loading each sample, carefully clear the lane of urea leaching from the gel using excess electrophoresis buffer (1X TBE) in a syringe; the sample should then fall to the bottom of the lane to allow for the crisp, even separation of the labeled strands across the gel. 5. Perform electrophoresis at 30 mAmp/gel constant current for 2–4 h, depending on expected sizes of the protected fragments. 6. Dry the gel completely under vacuum on a gel dryer and then subject the dried gel to autoradiography (see Note 7).

3.6. Analysis of Results 1. Determine the relative band intensities using a densitometer or PhosphoImager. As an example, we have performed RNase protection assays designed to determine the relative abundance of fibronectin mRNAs in various chick embryonic tissues (see Fig. 1). The


49

plasmid pchFN01 is a 397-base Pst I fragment of chick fibronectin cDNA, derived from clone 58 (6) and then subcloned into pGEM2. For preparation of a uniformly labeled antisense RNA probe, pchFN01 was linearized with Hind III and then transcribed with SP6 polymerase as described in Subheading 3.1. Equal amounts of total cellular RNA (10 µg) from each tissue were then subjected to the RNase protection assay procedure described earlier. The resulting autoradiogram was scanned on a densitometer (various manufacturers) to determine the relative intensity of each band.

4. Notes 1. In most cases, the use of homogeneous tissues for the isolation of the sample RNA is advisable, especially for the determination of tissue-specific alternative splicing events, because the percent recovery of RNA from a specific subset of a heterogeneous tissue can vary to a large degree. 2. In general, an appropriate concentration of RNases A and T1 will tolerate single-base mismatches. However, two or more mismatches in a row are generally perceived by the enzymes as single-stranded RNA and are thus cleaved. To minimize such effects, a species-specific probe is advisable. Polymorphisms between the probe and the particular cellular RNA sample may result in cleavage at the mismatch to produce smaller than expected protected fragments even with a species-specific probe, especially if higher than necessary RNase A and T1 concentrations are utilized during the digestion step. 3. Ideally, the cloned sequence should include a short vector-derived sequence so that the resulting transcript, as the undigested probe, is clearly larger than the protected region. 4. Gel purification of the full-length probe prior to hybridization is not generally necessary. However, gel purification of the probe often eliminates background (excessive signal in the no RNA control sample) resulting from incomplete RNA transcripts or contaminating template DNA present within the probe mixture. A protocol for gel purification has been described (7). 5. This semiquantitative method only provides comparative information on the relative amounts of a particular mRNA in various tissues or resulting from various treatments. However, the use of internal controls such as multiple probe hybridizations in a single sample can provide more accurate information regarding the specific amounts of a particular mRNA per the amount of total RNA in the sample (8). 6. The amount of probe used for hybridization should always be in excess of the amount of RNA so that you achieve a linear increase in signal with the amount of input RNA. Background increases with the amount of probe present in the hybridization reaction. Therefore, only the least amount of probe necessary to achieve probe-excess should be included in the hybridization mixture. Probe excess can be determined empirically by completing RNase digestions on a series of hybridization mixtures containing different ratios of probe RNA to target RNA. Multiple probes can be added to a single sample. Each should be in probe-excess and background will increase with each additional probe. 7. The protocol as written takes about 1.5 days of hands-on experimental time. The first half day includes the labeling of the RNA probe and preparation of the RNA samples for hybridization. The hybridization then proceeds overnight. The second full day includes the RNase digestion, template DNA digestion, Proteinase K digestion, and phenol extraction of all of the samples. The samples are then subjected to electrophoresis on a denaturing polyacrylamide gel for 2–4 h, depending upon the expected sizes of the protected fragments. Protocols are available from commercial sources (Ambion, Inc., Austin, TX) that allow for a shorter hybridization time.

50

Bennett

Acknowledgments The author gratefully acknowledged Drs. Pamela Norton (Thomas Jefferson University) and Richard Hynes (Massachusetts Institute of Technology) for the gift of the recombinant plasmid, pchFN01; Denise White, Amy Gehris, and Tatyana Uporova for the preparation of RNAs from various chicken embryonic tissues and cells; and Drs. Pamela Norton, Howard Hershey, and Rocky Tuan for constructive criticism of the manuscript. This work was supported in part by grants from the National and Eastern Pennsylvania Chapters of the Arthritis Foundation, and the National Institutes of Health (AR40184 and AR42887). Manuscript completed by Rocky S. Tuan and dedicated to the memory of the late Dr. Vickie D. Bennett. References 1. Zinn, K., DiMaio, D., and Maniatis, T. (1983) Identification of two distinct regulatory regions adjacent to the human b-interferon gene. Cell 34, 865–879. 2. Melton, D. A., Krieg, P. A., Rebagliati, M. R., Maniatis, T., Zinn, K., and Green, M. R. (1984) Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter. Nucl. Acids Res. 12, 7035–7056. 3. Lau, E. T., Kong, R. Y. C., and Cheah, K. S. E. (1993) A critical assessment of the RNase protection assay as a means of determining exon sizes. Anal. Biochem. 209, 360–366. 4. Bennett, V. D., Pallante, K. M., and Adams, S. L. (1991) The splicing pattern of fibronectin mRNA changes during chondrogenesis resulting in an unusual form of the mRNA in cartilage. J. Biol. Chem. 266, 5918–5924. 5. Gehris, A. L., Brandli, D. W., Lewis, S. D., and Bennett, V. D. (1996) The exon encoding the fibronectin type III-9 repeat is constitutively included in the mRNA from chick limb mesenchyme and cartilage. Biochim. Biophys. Acta 1311, 5–12. 6. Norton, P. A. and Hynes, R. O. (1987) Alternative splicing of chicken fibronectin in embryos and in normal and transformed cells. Mol. Cell. Biol. 7, 4297–4307. 7. Gilman, M. (1993) Gel purification of RNA probes, in Current Protocols in Molecular Biology, Wiley, New York, pp. 4.7.3–4.7.4. 8. Davis, M. J. J., Bailey, C. S., and Smith, C. K. (1997) Use of internal controls to increase quantitative capabilities of the ribonuclease protection assay. Biotechniques 23, 280–285.

Relative RT-PCR

51

7 Relative Reverse Transcription-Polymerase Chain Reaction Troy A. Giambernardi and Robert J. Klebe 1. Introduction A number of methods are available for assessing messenger ribonucleic acid (mRNA) levels, namely, reverse-transcription polymerase chain reaction (RT-PCR), Northern blot analysis, primer extension, and RNA protection assays (1). Because of the PCR amplification step, RT-PCR has the important advantage that little RNA is required. In addition, RT-PCR is a relatively simple procedure that does not have an absolute requirement for the use of radioisotopes. Northern blot analysis requires at least ten times as much sample, radioisotopes, and the results obtained are, at best, semiquantitative. Northern blot analysis also is technically more difficult since electrophoresis of mRNA, a blotting step, and autoradiography are required. Nuclease S1 mapping, ribonuclease protection, and primer extension methods differ fundamentally from RT-PCR in that they are solution hybridization-based procedures that allow information to be obtained about the amount and structure of the test transcript, however, each method has potential pitfalls. For example, the S1 nuclease protection method is simple, but is rarely used because of a lack of sensitivity. In addition, the nuclease reaction is somewhat difficult to control due to digestion of doublestranded regions of deoxyribonucleic acid (DNA) in areas that are AT-rich (10,14). A potential disadvantage of the RNase protection procedure is the need to generate specific subclones (12). The main limitation of primer extension is that it is extremely insensitive and prone to considerable background problems. Furthermore, the 5' ends of mRNAs are often highly structured, with the result that reverse transcriptase does not copy these sequences (2). RT-PCR can avoid these potential problems and is considered a more sensitive assay. Because of the sensitivity of RT-PCR, it is the method of choice for detection of rare transcripts and cloning of difficult regions such as the extreme 5' ends of transcripts. In addition, semiquantitation of transcripts can be easily and efficiently carried out. Two major variants of RT-PCR exist. The semiquantitative (or relative) RT-PCR method described in this chapter permits one to determine relative differences in mRNA levels between samples while the quantitative (or absolute) RT-PCR procedure allows one to determine the absolute amount of a given species of mRNA in a sample (see [13]). The relative RT-PCR method involves determination of the levels of both the target From: Methods in Molecular Biology, Vol. 137: Developmental Biology Protocols, Vol. III Edited by: R. S. Tuan and C. W. Lo © Humana Press Inc., Totowa, NJ

51

52

Giambernardi and Klebe

mRNA and an internal control mRNA (generally, a housekeeping enzyme). Comparison of housekeeping mRNA levels in different samples is used to standardize samples such that the each sample contains the same amount of the housekeeping enzyme mRNA. Based on the assumption that the level of housekeeping enzyme is constant, the relative levels of target mRNA in each sample can be determined. The major technical difference between the relative and absolute RT-PCR methods involves the use of a second control in the absolute method, namely, an external control, which is identical to the target mRNA, except for the addition (or deletion) of a small amount of sequence. Different amounts of the external control are added to the sample and the RT-PCR procedure is carried out. Because the relative RT-PCR procedure can be performed with one reading (performed in triplicate), the absolute RT-PCR method requires at least eight readings (one reading for each of eight different amounts of external standard). The amount of external control that gives an identical amount of PCR product as the unknown sample is taken to be the amount of mRNA in the sample. Hence, by knowing the absolute amount of external standard employed, one can deduce the absolute amount of target mRNA/sample. Both the relative and absolute RT-PCR methods require the use of an internal control to account for pipetting errors and problems involved in the precise determination of RNA in each sample. Thus, both RT-PCR methods have similar advantages as well as disadvantages. Both methods are extremely sensitive because of the PCR amplification step; however, both methods suffer from potential PCR-related problems (false priming leading to spurious PCR product bands, primer dimer formation, differences in PCR reaction efficiencies, etc.). Basically, the major difference between the relative and absolute RT-PCR methods is the use of the additional external control. When the determination of the absolute mass of mRNA is required, the absolute RT-PCR method is required. If the relative amounts of mRNA in two samples are desired, either method can be used and careful quantitative studies have shown that the relative and absolute RT-PCR methods yield comparable results (3). That the relative and absolute methods yield comparable results is expected since both methods are identical other than the incorporation of an external control in the absolute method. The relative RT-PCR method has the advantage of requiring only one reading in contrast to the eight readings needed for the absolute method. In this chapter, we will present details of the relative RT-PCR assay. The RT-PCR assay can be performed with the use of only six reagents; namely, a. the total RNA sample, b. an A-mix containing reagents for the reverse transcription step c. sense primer, d. antisense primer, e. a T-mix that contains all reagents needed for the PCR step, and f. water. We have found that the use of reagents aliquoted in unit of use quantities increases the ease and reliability of the assay (5). We will also present an alternative method for extracting total RNA (11). 2. Materials 1. Solution D: To make 53 mL stock (stable 3 mo). 25 g guanidine thiocynate, 29.3 mL DEPCH 2 O (see Subheading 2.4.), 1.76 mL 0.75 M sodium citrate, pH 7.0, 2.64 mL of 10% Sarcosyl (L-Lauryl Sarcosine). 2. RNA sample dissolved in DEPC-treated water (about 0.5 µg/assay). 3. Antisense primer dissolved in DEPC-treated water (200 ng/assay; stock solution = 200 ng/µL).

Relative RT-PCR

53

Table 1 Aliquoted Reverse Transcription Reagents (A-mix) Solution a. 10× RT buffer (Cetus PCR buffer) b. 1 M Tris-HCl (pH 8.3) c. 5 mg/mL BSA (BRL) d. 0.5 M dithiothreitol (DTT) e. 0.1 M MgCl2 (or as required by primer set) f. 40 U/µL Rnasin (Promega) g. dNTPs (25 mM each) (Pharmacia, Uppsala, Sweden) h. 20 U/µL AMV (Life Sciences, St. Petersburg, FL)

Conc./assay

200 assays (µL)

1 assay (µL)

0.8× 50.0 mM 5.0 µg 12.5 mM 8.0 mM 20.0 U 2.0 mM

160 84 100 50 136 50 40

0.800 0.420 0.500 0.250 0.680 0.250 0.200

5

0.025

625

3.125

1.0 U Final volume

Store AMV stock solution frozen at –70°C in tubes containing 12.5 assays/tube (40 µL A-mix/tube) and use 3.2 µL A-mix/assay. The RT reaction is carried out in a final volume of 10 µL. To ensure reproducibility, do not reuse unused A-mix.

4. Diethylpyrocarbonate (DEPC)-treated water. 5. Aliquoted reverse transcription reagents (A-mix) (see Subheading 3.): A premixed, aliquoted and frozen solution that contains all reagents for the RT step, except primers. 6. The 10× RT buffer is Cetus 10× PCR buffer which consists of 500 mM KCl, 100 mM TrisHCl (pH 8.3), 15 mM MgCl2, and 0.1% gelatin (wt/vol). 7. Sense primer (either 200 ng of cold primer/assay or 100 ng of cold primer/assay + 100 ng 32P-labeled primer/assay; working solution = 100 ng/µL). 8. PCR-reagents (T-mix) (see Subheading 3.): A premixed, aliquoted and frozen solution that contains all reagents for the PCR step, except primers. 9. The 10× Taq DNA polymerase buffer used in preparing T-mix is Promega (Madison, WI) 10× PCR buffer which consists of 500 mM KCl, 100 mM Tris-HCl (pH 9.0), 15 mM MgCl2, 0.1% gelatin (wt/vol), and 1% Triton X-100. 10. Solutions for RT-PCR using frozen-thawed cells (alternative RNA extraction approach). a. Freezing solution: 0.15 M NaCl + 10 mM Tris-HCl, pH 8.0. b. 2× RNase inhibitor stock: Add 2 µL of RNase inhibitor (40 U/µL) (Promega) to 18 µL of 0.15 M NaCl + 10 mM Tris-HCl (pH 8.0) + 5 mM DTT (store at –20°C in 10 µL aliquots) Note that we have developed a facile method for purification of bovine liver RNase inhibitor, the most expensive RT-PCR reagent (7).

3. Methods 3.1. Preparation of Aliquoted Reagents Presented below are the solutions needed for RT-PCR, their source, the final concentration of each reagent in the RT-PCR assay, the volume of each stock solution used to prepare 200 assays, and the volume of the assay mix sufficient for 12 assays. We have found that the concentrations for MgCl2, dNTPs, primers, Taq, and AMV given in Tables 1 and 2 can be used successfully for many mRNA species; nevertheless, if problems occur, one should optimize MgCl2 and buffer conditions for the primer set employed. Other considerations about RT-PCR stock solutions are discussed later (see Note 1).

54


Table 2 PCR-Reagents (T-mix) Solution a. Water b. 10× Taq DNA polymerase buffer (Promega) c. 25 mM dNTPs (Pharmacia) d. 5 U/µL Taq DNA polymerase (Promega)

Conc./assay

200 assays (µL)

1 assay (µL)

0.8× 0.8 mM 2.5 U Final volume

6870 800 80 50 7800

34.35 4.00 0.40 0.25 39.00

Store Taq stock solution frozen at –70°C in tubes containing 12.5 assays/tube (487.5 µL T-mix/tube) and use 39 µL T-mix/assay + 1 µL sense primer/assay + 10 µL RT = 50 µL/assay. The PCR final volume is 10 µL RT + 40 µL PCR reagents (see above) = 50 µL final volume.

3.2. RNA Isolation Total RNA was isolated from cultured cells by adding a guanidine thiocyanate solution (solution D) directly into the culture vessel followed by extraction with phenol and chloroform (9). In Subheading 6., an alternative method for RNA extraction (11), which employs freeze/thaw treatment of cells, is described.

3.3. Reverse Transcription Step The RT step can be performed in 0.2 mL tubes under optimized conditions that employ standardized unit-of-use stock reaction solutions as previously described (5). Briefly, a 10-µL reverse transcription reaction is carried out at 42°C for 60 min using 0.5 µg total RNA, 5.3 µL DEPC-treated H2O, 0.5 µL 200 ng/µL antisense primer, and 3.2 µL A-mix (see Note 2).

3.4. PCR Step PCR is performed in a final volume of 50 µL: 39 µL T-mix and 1 µL 100 ng/µL sense primer are added to the previous 10 µL RT reaction (see Subheading 3.3.). The standard cycling conditions used are as follows: initial denaturation at 94°C for 30 s, annealing at X°C (optimized Tm) for 60 s, elongation at 72°C for 110 s, and 94°C for 20 s (see Note 2).

3.5. Analysis of Data 3.5.1. Adjustment of the Amount of Total RNA Amount Employed by Standardization with an Aldolase Internal Control In order to compare mRNA levels in different cell lines or tissues, results can be standardized with respect to the housekeeping gene, aldolase, as previously described (5). Briefly, the amount of total RNA used in each assay is adjusted such that each RNA sample has an identical amount of aldolase mRNA. Standardization is carried out by performing RT-PCR with 32P-end-labeled aldolase primers. All samples are amplified to PCR cycle 16, which is in the exponential range of amplification for aldolase. Following separation on 5% polyacrylamide gels (PAGE), PCR product bands are visualized by ethidium bromide staining, the bands are excised with a razor blade, and the radioactivity in each band is determined by scintillation counting. If the amount of

Relative RT-PCR

55

radioactivity in aldolase PCR products in different cell lines is not comparable, the amount of total RNA employed is increased (or decreased) such that the amount of total RNA employed yields equal amounts of radioactivity in all aldolase PCR products. Hence, in comparison of samples, the amount of total RNA employed yielded comparable levels of aldolase mRNA.

3.5.2. Semiquantitative Analysis of mRNA Levels in Different Samples Initially, total RNA from all cell lines or tissues of interest is amplified for 45 PCR cycles with primer sets specific for a given target sequence. If no PCR product is observed at PCR cycle 45 after two repetitions, the cells are considered to be negative for the transcript in question. Those cell lines (or tissues) positive for a given transcript at PCR cycle 45 are amplified again and 15 µL aliquots are withdrawn at PCR cycles 25, 30, 35, and 40. The cycle at which a PCR product can first be detected is determined (see Note 3). Results are presented as follows: PCR product observed at cycle 20-25 = 5+ (highest level of expression); cycle 26-30 = 4+; cycle 31-35 = 3+; cycle 36-40 = 2+; cycle 41-45 = 1+ (lowest level of expression); 0 = no expression noted after 45 cycles. This procedure allows one to compare samples in a facile fashion (8) (see Note 4).

3.5.3. Procedure to Compare Relative Amount of Transcripts Between Treatments Data are analyzed by use of the following equation that states that the ratio of treated/ untreated mRNA levels = (target mRNAexp/aldolaseexp)/(target mRNAcon/aldolasecon), where exp is the experimental condition (treated) and con is the control (untreated). Because of potential differences in the efficiencies of different primer sets, the equation should be applied to one transcript of interest at a time, i.e., experimental and control levels of a given integrin subunit mRNA can be compared with one another, however, levels of different subunits should not be compared to one another. The constitutively expressed mRNA (i.e., aldolase) levels, which appear in the denominator of the equation, are assumed to be constant under experimental and control conditions and are used as a correction factor to account for possible errors in RNA quantitation and/or pipetting. Again, since the same primer set is used for this comparison, the efficiencies of the primers employed are identical.

3.6. Alternative Approach for RT-PCR Without RNA Extraction The time required for extraction of total RNA often exceeds the time involved in the RT-PCR procedure itself (6). Described below is a simple alternative method for performing RT-PCR that involves 1. lysis of cells by a rapid freeze-thaw cycle in the presence of RNase inhibitor plus 5 mM DTT and 2. the use of extracts of 250 or fewer cells directly in the RT-PCR assay. The method described (11) entirely avoids RNA extraction and thereby, eliminates the most time consuming and error prone step in RT-PCR. The method bases comparisons on cell number, which can be determined quite accurately with an electronic cell counter. RT-PCR results are usually reported as the amount of PCR product generated per microgram of total RNA (4). The procedure described here enables one to use cell number, rather than RNA mass, to standardize results.

56


The procedure for a 50-µL RT-PCR reaction using freeze-thawed cells (11) is as follows: a. trypsinize and count cells; b. add 105 cells to a culture tube and spin at approx 400g for 4 min to gently pellet cells; c. resuspend cells in 0.5 mL Freezing Solution to adjust cell concentration to 2 × 105 cells/mL; d. place 10 µL of resuspended cells in a 0.2-mL microfuge tube and add 10 µL of 2× RNase Inhibitor stock (note: final cell concentration is now 105 cells/mL); e. freeze immediately in a pipet tip box containing 95% ethanol at –70°C. An empty 10 µL pipet tip box will allow a 0.2-mL tube to be about 50% submerged in ethanol; f. to a new 0.2 mL PCR tube add 3.2 µL A-mix + 0.5 µL antisense primer (200 ng/µL) (maintain at 4°C until cells are added); g. thaw cells rapidly in a room temperature water bath, vortex for 10 s, spin tubes for a few seconds to collect all liquid in the bottom of tubes; h. add desired number of cells to tubes (note that 2.5 µL of 105 cells/mL = 250 cells, etc.); i. bring volume to 10 µL with DEPC-treated water; j. place tubes at 42°C; incubate for 1 h to complete the reverse transcription step; k. add 39 µL of T-mix and 1 µL of sense primer (100 ng/µL) to perform the PCR step at a 50 µL final volume; l. Analyze PCR products on a 5% PAGE gel. As we have shown, it is possible to obtain semiquantitative information about specific mRNA levels using RT-PCR. The ability to obtain accurate measurements of gene expression in small amounts of tissue or in mixed cell populations will considerably expand future applications of PCR, both in research laboratories as well as in clinical settings. 4. Notes 1. use of aliquoted A- and T-mix: (To ensure reproducibility, do not reuse unused A-mix.). a. The Tris-HCl in the 10× RT buffer plus the 1 M Tris-HCl supplement yields a final concentration of 50 mM Tris-HCl. b. The MgCl2 in the 10× RT buffer plus the 0.1 M MgCl2 supplement yields a final concentration of 8 mM MgCl2 (6 mM free MgCl2 plus 2 mM dNTP bound MgCl2). c. Recommend using 1 U of AMV reverse transcriptase per assay for low to moderate abundance mRNAs and 10 U per assay for high-abundance mRNAs. d. 0.8 mM dNTPs in 100 µL final volume (note that the final volume will also contain unreacted dNTPs from the RT step). 2. Following RT-PCR using 32P-end-labeled primers, bands visualized by ethidium bromide staining are excised from 5% polyacrylamide electrophoresis gels and radioactivity in each band determined by scintillation counting. The use of PCR-incorporated labeled nucleotides can be problematic. High levels of unincorporated, labeled nucleotides in PCR products can lead to high background levels of radioactivity throughout a lane of a PAGE gel. Even a relatively small amount of “trailing” can make it difficult to measure small amounts of incorporated label. For this reason, it is advisable to end-label PCR primers rather than use labeled nucleotides during the PCR reaction. 3. Data should be obtained at a PCR cycle number that is in the exponential range of amplification for each mRNA species analyzed. Experimentally, the amount of product generated during PCR deviates from the theoretical or ideal. The amount of PCR product produced initially increases exponentially; however, a plateau phase occurs beyond a certain PCR cycle. One must determine which PCR cycles are in the exponential range when employing semiquantitative RT-PCR. Use this PCR cycle to obtain data from all samples studied.

Relative RT-PCR

57

4. The method described above uses two separate PCR reactions to determine the levels of constitutive transcripts. However, an endogenous standard sequence can be coamplified along with the transcript of interest in the same reaction tube. The efficiency of amplification between the two transcripts must not differ significantly or one may risk one reaction reaching plateau whereas the other has not been amplified sufficiently. Therefore, we strongly advise not using a one-tube reaction in doing comparisons of different samples. Notwithstanding the advantages to this approach, several complications may arise when amplification of endogenous mRNAs is used for semiquantitative analysis. For this method to be reliable, the level of expression of the reference standard must be the same in each sample to be compared and must not change as a result of the experimental treatment. Unfortunately few, if any, genes are expressed in a strictly constitutive manner. Therefore, the level of the mRNA used as the endogenous standard must be examined very carefully to ensure its level remains constant during all of the experimental conditions studied.

Acknowledgment This study was supported in part by the National Institutes of Health, under Grant DE08144. References 1. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (1996) Current Protocols in Molecular Biology, 6th Ed., WileyInterscience, New York. 2. Bailey, J. M. and Davidson, N. (1976) Methylmercury as a reversible denaturing agent for agarose gel electrophoresis. Anal. Biochem. 70, 75–85. 3. Bouaboula, M., Legoux, P., Pessegue, B., Delpech, B., Dumont, X., Piechaczyk, M., Casellas, P., and Shire, D. (1992) Standardization of mRNA titration using a polymerase chain reaction method involving co-amplification with a multispecific internal control. J. Biol. Chem. 267, 21,830–21,838. 4. Chen, D., Magnuson, V. L., Steffensen, B., and Klebe, R. J. (1993) Use of stock solutions to simplify mRNA quantitation by reverse transcription-polymerase chain reaction (RT-PCR) assays. PCR Methods Appl. 2, 351–353. 5. Chen, D. and Klebe, R. J. (1993) Controls for validation of relative reverse transcriptionpolymerase chain reaction (RT-PCR) assays. PCR Methods Appl. 3, 127–129. 6. Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinum thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. 7. Garcia, M. A. and Klebe, R. J. (1997) Affinity chromatography of RNase inhibitor. Molecular Biol. Rep. 24, 231–233. 8. Giambernardi, T. A., Grant, G. M., Maher, V. M., McCormick, J. J., Taylor, G. P., and Klebe, R. J. (1998) Overview of matrix metalloproteinase expression in transformed cells. Matrix Biol. 16, 483–496. 9. Grant, G. M., Cobb, J. K., Castillo, B., and Klebe, R. J. (1996) Regulation of matrix metalloproteinases following cellular transformation. J. Cellular Physiol. 167, 177–183. 10. Johnson, P. H. and Laskowski, M. (1970) Mung bean nuclease I. Resistance of double stranded deoxyribonucleic acid and susceptibility of regions rich in adenosine and thymidine to enzymatic hydrolysis. J. Biol. Chem. 245, 891–898. 11. Klebe, R. J., Grant, G. M., Grant, A. M., Garcia, M. A., Giambernardi, T. A., and Taylor, G. P. (1996) RT-PCR without RNA Isolation. BioTechniques 21, 1094–1100.

58


12. Skennan, K. I., Taylor, N. A., Jermany, J. L., Matthews, G., and Docherty, K. (1995) Differences in pH optima and calcium requirements for maturation of the prohormone convertases PC2 and PC3 indicates different intracellular locations for these events. J. Biol. Chem. 270, 1402–1407. 13. Souaze, F., Ntodou-Thome, A., Tran, C. Y., Rostene, W., and Forgez, P. (1996) Quantitative RT-PCR: Limits and Accuracy. BioTechniques, 21, 280–285. 14. Zinn, K., Dimaio, D., and Maniatis, T. (1983) Identification of two distinct regulatory regions adjacent to the human b-interferon gene. Cell 34, 865–879.

Gene Expression Analysis Using RT-PCR

59

8 Gene Expression Analysis Using Quantitative Reverse Transcription-Polymerase Chain Reaction and a Multispecific Internal Control David Shire and Pascale Legoux 1. Introduction Quantitation of very small amounts of specific messenger ribonucleic acids (mRNAs) extracted from tissues or cell cultures is a difficult and time-consuming task that necessitates the use of carefully controlled amplification procedures. Reverse transcription (RT) of the mRNA to cDNA followed by amplification using the polymerization chain reaction (RT-PCR) is widely used for simple detection purposes, but the procedure can be employed for accurate quantitation provided an appropriate internal control is present throughout the process. The choice of an internal control depends on the number of mRNAs that are to be quantitated, but it is essential that it incorporates exactly the same PCR priming sites as those chosen in the target mRNA. The amplification efficiency of the PCR is rarely 100% and often far lower and it is the primer pair that contributes the most towards PCR efficiency. In addition, because the RT step is also well under 100% efficient, it is highly desirable that the control be in the form of an RNA and that it be added to the total RNA before RT. Two main categories of control have been developed in recent years. The simplest control is one that is identical to the cellular target, except for a small internal deletion or insertion, so that one has one control for each target. The second category is made up of multispecific internal controls in which the priming sites for several targets are lined up head-to-tail so that a single control can be used to measure all the targets simultaneously (1). For each category the final control and target amplification products have to be distinguished in some way, in the first category by the presence or absence of a restriction site, for example, and in the multispecific control by a size difference between the target and the control. In each category, quantitation is achieved by varying the initial quantities of either total RNA or control RNA and correlating these quantities with the quantities of the amplicons obtained, as will be described later. In this chapter, we will detail the use of multispecific internal controls we (2–4) (see Note 1 and Tables 1–4) and others (1,5–12) have developed for the quantitation of certain cytokine and neurotrophic factor mRNAs (see Note 2). The controls also contain priming sites for housekeeping genes (see Note 3). Several standards have From: Methods in Molecular Biology, Vol. 137: Developmental Biology Protocols, Vol. III Edited by: R. S. Tuan and C. W. Lo © Humana Press Inc., Totowa, NJ

59

60

Table 1 Oligonucleotide Primers for pQA-1 (Human)

60 are two IL-2 antisense primers in pQA-1 to IL-2(2) gives a standard amplicon of 352 bp, all the others being of 370 bp. is the peripheral benzodiazepine receptor. 3The TNFα intron (300 bp) is extremely useful for determining whether the sample is contaminated or not with genomic DNA. 4? Introns from homologies with mouse (IL-3 and IL-6) or rat (PBR). 5From GenEMBL sequences, as are those in Tables 2–4. 6The F factor is defined in Subheading 3. 2PBR

Shire and Legoux

1There

61

61

1c-jun and jun-D primers are in pQB-1, 2IL-10, IL-12p40, and IL-13 primers are in pQB-3. 3The Groα primers are not specific and will amplify both Groα and Groβ. Both Groβ priming regions are mutated (small characters) and are nonspecific. 4The MCP-1 sense priming site contains a dG to dC mutation at position 16. 5The Groα(2) and Groβ(2) antisense primers are not in the construction, but can be used with the sense primers for diagnostic purposes. The standard amplicons are 370 bp and 410 bp in length for pQB-1 and pQB-3, respectively.


Table 2 Oligonucleotide Primers for pQB-1/3 (Human)

62

Table 3 Oligonucleotides Primers for pMus-3

62 is the peripheral benzodiazepine receptor. Introns unknown or, where given, are based on homology with identified human or rat (PBR) introns. 3The IL-13 intron (310 bp) is extremely useful for determining whether or not the sample is contaminated with genomic DNA. The length of the standard amplicon is 440 bp. 2?

Shire and Legoux

1PBR

63


Table 4 Oligonucleotide Primers1 for pRat-6

1Special

care must be taken with this plasmid, as it was constructed not knowing the positions of introns. The length of the standard amplicon is 480 bp.

63

64

Shire and Legoux

Fig. 1. Quantitative RT-PCR method using an internal multispecific control.

been constructed and their structure is shown schematically in Fig. 1. All have the same basic design. The boxes represent priming sites for the targets shown inside the boxes and listed in Tables 1–4. The top series of boxes represent sense primers, the lower series, antisense primers. The primers are highly standardized in that nearly all are 20 nt in length and of 50% dC/dG content. Because the primers have similar Tm values a single set of amplification conditions can be used. Wherever possible, the primers were selected from different exons of the cellular targets. Each pair of primers is separated by the same distance in each construction, e.g., 410 bp in pQB-3. Exactly the same priming sites are found in the respective mRNAs, but the distance between them differs from that in the standard. This size difference allows good chromatographic or electrophoretic separation of the amplicons after PCR. The priming sites are inserted in the polylinker region of a pTZ19 plasmid, between a T7 promoter and a polydA stretch ending in a unique EcoRI site. The constructions contain other unique


65

Fig. 2. Log–log plot of the cellular amplicon/control amplicon (cell-amplicon/st-amplicon) ratio against the quantity of total cellular RNA (cell-RNA) for determining the quantity of IL-13 mRNA in peripheral blood mononuclear cells. From the graph it can be seen that the quantity in unstimulated cells is too low to be measured (see Note 12). After stimulation with PMA, PMA + PHA-P + CsA, PMA + PHA-P or PMA + anti-CD28, 20 fg of IL-13 mRNA are found in 10, 6, 3, and 1 ng, respectively, of total RNA.

restriction sites, facilitating modifications (see Note 2). The 21 bp linker regions in all of the constructions are identical and a “universal” probe can be used to identify standard amplicons. The EcoRI site allows linearization of the plasmid before transcription by T7 RNA polymerase to produce standard RNA (st-RNA). The principle of the method is shown in Fig. 1. A known quantity of st-RNA is added to a known quantity of total cellular or tissular RNA (cell-RNA). Co-reverse transcription gives a mixture of standard cDNA, denoted as st-cDNA, and cellular cDNA, denoted as such. The primer pair is added and PCR co-amplifies st-cDNA and cDNA. The two amplicons that result (st-amplicon and cell-amplicon) are separated electrophoretically and the bands are quantitated. By separating the st-DNA/cDNA mixture into several aliquots different primer pairs can be used in parallel PCRs and separated on the same gel. By using different known quantities of cell-RNA and keeping st-RNA at a known constant amount, one or more mRNAs can be quantitated simultaneously, as shown in Fig. 2. Provided the RT and PCR steps are equally efficient for both standard and cellular RNAs, the intensity of the bands is directly related to the quantity of the original mRNAs. The objective of the method is to find the point of equivalence, where the two bands are of equal intensity, showing that the st-RNA added at the outset matches the quantity of the mRNA contained in the extracted RNA. In order to achieve this, further rounds of RT-PCR may be necessary, keeping st-RNA constant and using different quantities of cell-RNA. Finally, a log–log plot of [cell-amplicon]/[st-amplicon] against [cell-RNA] should give a straight line of slope 1 (2,13) as shown in Fig. 2. The amount of cell-RNA containing the quantity of mRNA equivalent to st-RNA is obtained from

66

Shire and Legoux

the graph from the point where [cell-amplicon]/[st-amplicon] = 1 on the log–log scale. A good theoretical treatment of competitive quantitative PCR has been published (14). Although the method is simple in principle, in practice, certain precautions have to be taken to ensure success and these will be discussed throughout the following protocols. 2. Materials 1. EcoRI buffer: Mix 50 mM NaCl, 0.1 M Tris-HCl, pH 7.9, 10 mM MgCl2, 0.025% Triton X100. 2. 20× RNA buffer: Prepare a buffer containing 40 mL 1 M MOPS, pH 7.4, 4 mL 0.5 M EDTA and 156 mL water, filter and store at –20°C. 3. 10× Tris-borate buffer: 121.1 g Tris, 61.84 g boric acid, 7.46 g ethylene diamine tetraacetic acid (EDTA) in 1 L water, adjusted to pH 8.3, and autoclaved for 20 min at 120°C. 4. TE buffer: Mix 10 mM Tris pH 8 and 1 mM EDTA. 5. Blue RNA dye buffer: Prepare formamide (674 µL, deionized biotechnology grade, e.g., Fisher), formaldehyde (216 µL), 5% ethidium bromide solution (8 mg/L), 1 M MOPS pH 7.4 (30 µL), 0.5 M EDTA (3 µL), 10% sodium dodecyl sulfate (10 µL), e.g., Ultrapure grade, Gibco-BRL, 1% bromophenol blue solution (10 µL), and glycerol (57 µL). 6. Blue DNA dye buffer: 0.25% xylene cyanol, 0.25% bromophenol blue, 5% ethidium bromide solution (8 mg/L), 30% glycerol and 65% water. 7. Ampliscribe T7 High Yield Transcription Kit: Contains T7 enzyme solution with RNase inhibitor, 10× buffer solution, 100 mM ATP, CTP, GTP, and UTP solutions, 100 mM dithiothreitol and RNase-free DNase I (Epicentre Technologies, Madison, WI). 8. DNA polymerization mixture: 20 mM/dNTP (LKB-Pharmacia, Uppsala, Sweden). 9. Superscript II RNase H– reverse transcriptase kit: Contains 5× buffer solution, 100 mM dithiothreitol and enzyme (200 U/µL) (Gibco BRL, Gaithersburg, MD). 10. AmpliTaq thermostable DNA polymerase kit: Contains 10× PCR buffer, 10 mM each dNTP, 25 mM MgCl2 solution and enzyme (5 U/µL) (Perkin-Elmer, Norwalk, CT). 11. 1% and 2% nondenaturing agarose gels: Dissolve 1 g or 2.0 g of agarose in 1× Tris-borate buffer (100 mL). 12. 1% denaturing agarose gel: Dissolve 0.5 g of agarose in 2.5 mL 20× RNA buffer and 43.5 mL autoclaved Millipore-purified water in a microwave oven. Cool to about 40°C and, under a fume hood, add formaldehyde (4 mL) 13. Biogel P10 gel fine 45–90 µm (wet) (Bio-Rad Laboratories, Richmond, CA). 14. Brosilicate glass beads of 100–200 µm diameter (OSI, France) (ref. A10585.10). 15. Phenol saturated with TE, pH 7.9 (Amresco, Solon, OH). 16. Phenol saturated with chloroform 5:1 at pH 4.7 (Amresco). 17. RNase inhibitor (40 U/µL) (Promega, Madison, WI). 18. [α-32P]dCTP (Amersham, Arlington Heights, IL), 3000 Ci/mmol (10 µCi/µL). 19. Diethylpyrocarbonate (Sigma Chemical Co., St. Louis, MO). 20. 10% polyacrylamide gel: Miniprotean II Ready gel (Bio-Rad).

3. Methods 1. Plasmid linearization: Dissolve the plasmid (4 µg; see Note 4) in EcoRI buffer (30 µL) and incubate with 2 µL EcoRI (40 U) for 1 h at 37°C. Add a further 10 µL of the above buffer and 2 µL of EcoRI and leave the mixture for a further 1 h at 37°C (see Note 5). Extract with 1 vol phenol saturated with TE, then with 1 vol chloroform (see Note 6), precipitate with 2 vol ethanol at –20°C and dry the pellet in a Speedvac. Dissolve in 40 µL water and electrophorese 1 µL mixed with blue DNA dye (1 µL) on a 1% nondenaturing agarose gel


67

Fig. 3. The setup used to purify cRNA.

using 1× Tris-borat buffer, together with 100 ng of the original plasmid to ensure complete linearization and to assess the quantity of recovered plasmid. The linearized plasmid is stored lyophilized or in aqueous solution at –20°C. 2. Transcription of st-DNA to cRNA: Mix linearized plasmid (1 µg in 8 µL water), 10× T7 reaction buffer (2 µL), NTP mixture (6 µL, final concentration of each NTP is 7.5 mM), 100 mM, dithiothreitol (2 µL, 10 mM final), and Ampliscribe T7 RNA polymerase (2 µL), (all contained in the Epicentre Technologies kit [see Note 7]). After incubation for 2 h at 37°C add the RNase-free DNase I (1 µL) and continue the incubation for 15 min at 37°C. Cool the solution in ice and extract with the phenol saturated with chloroform. 3. cRNA purification (see Note 8): Swell Biogel P10 (2 g) in 100 mL TE buffer, decant the supernatant and add 100 mL TE. The suspension of 2/3 gel, 1/3 buffer in two 50 mL Falcon tubes is heated for 5 min in a pressure cooker (do not autoclave), then stored at 4°C. In a 50 mL tube wash borosilicate glass beads (10 mL) successively with 1 M HCl, 1 M NaOH, and 1 M Tris pH 8, decanting floating glass debris at each washing. The beads are treated with diethylpyrocarbonate (10 µL/100 mL water) overnight at room temperature before autoclaving for 20 min at 120°C. For the setup used for the cRNA purification see Fig. 3. Pierce the bottom of a 0.7 mL microtube with a hot sterile needle. Cut off the tip of a sterile plastic cone and use it to pipette 10 µL of the borosilicate glass beads into the tube, with a minimum of liquid. Completely fill the tube with P10 resin, place the microtube on a truncated Eppendorf tube inserted into a conventional centrifuge tube and centrifuge for 5 min at 3000g on a swinging rotor. Make sure that the resin remains moist. Place the microtube on a sterile 1.5 mL Eppendorf tube posed on the centrifuge tube. Pipet 20–30 µL of cRNA solution onto the resin and centrifuge the tube for 5 min at 3000g on a swinging rotor. Lyophilize the eluant. 4. cRNA quantification and quality control: Dissolve the pellet in 100 µL autoclaved, Millipore-treated water. Pipet 2 µL into 98 µL water and take a UV spectrum in a 50-µL quartz cuvette. The 260 nm/280 nm ratio should be near 1.8. The quantity of cRNA = OD260nm/1000 × 50/2 × 40 µg/µL (assuming one OD260nm/mL = 40 µg). In several preparations from different plasmids we have obtained yields of between 50 and 90 µg of pure cRNA from 1 µg of plasmid. Pipet a volume of cRNA solution containing 1–2 µg into the blue RNA dye buffer (15 µL). Denature the mixture for 5 min at 65°C and cool quickly in ice. The totality of the cRNA and a size ladder are separated on a 1% agarose gel for 30 min at 50 V. A single band of pure cRNA that should be obtained. The purified cRNA is stored at –20°C (see Note 9). It is used at 20 fg/PCR in all experiments, the number of molecules being calculated from an extinction of 35,900 at 260 nm (pH 7), the molecular mass of the cRNA and Avogadro’s number.

68

Shire and Legoux

5. Total RNA preparation: a. Homogenization. i. Tissues (for precautions see Note 10): Large amounts (>10 mg) of fresh tissue must be immediately cooled in liquid nitrogen or dry ice. Cool a metal box in dry ice, add the tissue, and crush it with a pestel to obtain a coarse powder. Transfer the powder to a Corning tube and store it at –80°C. The extraction of total RNA from both the tissues and cells (next paragraph) follows the TRIZOL Reagent procedure reproduced here (Gibco BRL), based on the Chomczynski and Sacchi method (15). Homogenize the powdered tissue in 1 mL of TRIZOL (see Note 11) per 50–100 mg of tissue using a glass-Teflon or power homogenizer (Polytron or equivalent). Small amounts ( 1 reduce the quantity of total RNA. The objective is to obtain R as near 1 as possible. Treatment of the results: Draw a graph of R against total RNA (ng) on a log–log scale as shown in Fig. 2. A straight line of slope near unity should be obtained. From the point of equivalence, where R = 1, a vertical line to the abscissa gives the quantity of total RNA that contains 20 fg of the mRNA targeted. Quantification of the mRNA from a housekeeping gene, of unvariable quantity under ideal conditions (but see Note 3), allows one to correlate mRNA quantities from different tissues or cell cultures.

4. Notes 1. The plasmids pQA-1, pQB-3, pMus3, and pRat6, together with full sequence details, are available from the authors. The constructs been thoroughly tested and used with success in a large number of laboratories worldwide. The primers give single bands with cellular RNAs, all of which have been authenticated by Southern blot analysis or sequencing. 2. The cytokine network constitutes a vast number of interesting mRNA targets not present in the present controls. The controls can readily be adapted for the incorporation of new targets, especially using overlap extension PCR (16). Such modifications are not within the scope of the present protocol, but advice on how to achieve them can be obtained from the authors. 3. To correlate the mRNA quantities present in the total RNA extracted from different tissues or cell lines, it is normal practice to use a housekeeping gene, supposedly present in an unvarying quantity throughout the material being investigated, as an internal control.

70

4. 5. 6. 7.

8.

9.

10.

11.

12.

Shire and Legoux The choice of such a gene has long been the subject of debate and controversy and it would seem that the solution is that it depends on the material being examined. (For a discussion see ref. (17) and also consult an internet newsgroup: bionet.molbio.mthdsreagnts mail newsgroup archives.) The plasmids furnished by the authors are in amounts of 5 µg, of which 1 µg should be kept in reserve for control purposes and for possibly growing up a fresh supply. The enzymatic digestion is repeated since it is essential that the plasmid is fully linearized in order to avoid run-through and to have a homogeneous st-RNA of correct length. To be carried out under a fume hood because of solvent toxicity. Several years ago, we found that the Epicentre Ampliscribe T7 transcription kit was by far the best of several that were commercially available, but others may now be comparable. It is highly desirable to obtain a high quantity of st-RNA in order to quantitate it accurately by optical density measurements. The purification step is essential to avoid contamination with nonincorporated NTPs, which would seriously affect the st-RNA quantification. We favor P10 chromatography for the purification, rather than an oligodT affinity method, because recoveries are much higher. A stock solution of 200 fg/µL in autoclaved Millipore-treated water (1 µL for 10 simultaneous PCRs) has been used for several years without cRNA deterioration despite repeated freezing and defreezing, normal care being taken, however, to avoid contamination. Tissue homogenization must be carried out in a cold room. To avoid RNA degradation the tissues must be kept very cold . The operator should wear two pairs of gloves, an overall, hat, and a mask. After the homogenization procedure the working surface and the metal tin and pestel should be washed successively with disinfectant, hot water, ethanol, and demineralized water. When working with TRIZOL Reagent use gloves and eye protection (shield, safety goggles). Avoid contact with skin or clothing. Use in a chemical fume hood and avoid breathing vapor. Before undertaking the quantification as such, it is highly advisable to ascertain the presence of the targeted RNA in the mixture to be analyzed, together with its approximate quantity. The objective is to obtain an easily visible ethidium bromide-stained band on a gel after 30 amplification cycles. We generally fix the quantity of total RNA for this preliminary test at 50 ng (or about 0.5 ng polyA+ RNA) per target. This allows one to distinguish between poorly and well-expressed mRNAs. If the resulting band is very intense or weak, further preliminary tests with 5 or 500 ng, respectively, are advisable. If more than 500 ng appears to be necessary, then it must be concluded that the RNA is too rare to be quantifiable and the results will be meaningless. For cytokine messengers in stimulated cells, the preliminary test can be carried out on 5 ng of total RNA. In each case, the total RNA sample may be spiked with 20 fg cRNA. The total RNA can be tested for the presence of many mRNAs by multiplying the initial quantities by the number of mRNAs to be assessed and dividing up the resulting cDNA mixture in consequence before adding the appropriate primers. Grouping together mRNAs of similar abundance can be timesaving during quantification experiments. The usual control reaction of PCR without RT can be carried out here to verify the absence of contaminating genomic DNA in the RNA preparations. Contamination may also be evident during amplicon separations, because most of the primers are situated in different exons of the cellular targets. Some of the introns are very large, but the TNFα intron of 300 bp, for example, gives rise to a supplementary band on a gel that is easily seen in DNA contaminated samples.


71

13. There are several possibilities for the choice of primer for the reverse transcription, dT12–18, random hexamer priming, specific priming with the antisense primer, or a combination of primers. We have adopted dT12–18 priming. The use of this primer assumes the presence of a polyA stretch in the mRNA to be assayed (it is present in the internal standard cRNA), which is generally the case in functional mRNAs. An objection may be raised that mRNAs may be incompletely reverse-transcribed because of long 3'-UTR or because of pauses caused by secondary structures. The distances between the polyA region and the sense primers we have chosen range from 400 to 1600 nt, with the great majority being less than 900 nt. (The exceptions are c-jun (2100 nt), Krox20 (2600 nt) and CSF-1 (3600 nt).) The maximum distance in the controls is 600 nt. As to the second point, our experience with preparing cDNA libraries has shown us that Superscript II reverse transcriptase is highly efficient at producing full-length transcripts from mRNA up to at least 7 kb in length. A 1 h reaction time should be more than adequate. If random priming with hexamers is chosen for the reverse transcription, it must be remembered that the whole RNA population will be transcribed, not just the 1–2% polyA+ RNA, possibly resulting in increased nonspecific amplification. However, satisfactory results can apparently be obtained if hexamer concentrations are kept low (approx 1 ng/2.5 µg cellular RNA). 14. The PCR conditions may have to be modified according to the apparatus used. 15. In our experience the st-DNA/cDNA mixture has to be freshly prepared in order to obtain reproducible results. 16. The present protocol only describes amplicon assays using radioactivity. Many other assays have been described in the literature, for example, gel-based assays using Southern blot analysis (18) and fluorescence intensity measurements after ethidium bromide staining (19), (for the latter we have found that weak bands give unsatisfactory results), capture strategies using paramagnetic beads and chemiluminescence assays (20,21), microplate assays after sandwich-base amplicon quantification (22,23), capillary gel electrophoresis (24) and HPLC (25). 17. Separation of amplicons can be accomplished on agarose. This is quite acceptable once it is certain that both st-cDNA and cell-cDNA amplify with equal efficiency. A plot of slope 1, obtained on polyacrylamide gel separation, will probably not be observed, as we have previously demonstrated (2). However, the point of equivalence, where st-amplicon = cell-amplicon, has been shown to be identical (2).

References 1. Wang, A. M., Doyle, M. V., and Mark, D. F. (1989) Quantitation of mRNA by the polymerase chain reaction. Proc. Natl. Acad. Sci. USA 86, 9717–9721. 2. Bouaboula, M., Legoux, P., Pességué, B., Delpech, B., Dumont, X., Piechaczyk, M., Casellas, P., and Shire, D. (1992) Standardization of mRNA titration using a polymerase chain reaction method involving co-amplification with a multispecific internal control. J. Biol. Chem. 267, 21,830–21,838. 3. Shire, D., et al. (1993) An invitation to an open exchange of reagents and information useful for the measurement of cytokine mRNA levels by PCR. Eur. Cytokine Net. 4, 161–162. 4. Pousset, F., Fournier, J., Legoux, P., Keane, P., Shire, D., and Bloch, B. (1996) The effect of serotonin on the expression of cytokines by rat hippocampal astrocytes. Mol. Brain Res. 38, 54–62. 5. Platzer, C., Richter, G., Überla, K., Müller, W., Blöcker, H., Diamantstein, T., and Blankenstein, T. (1992) Analysis of cytokine mRNA levels in interleukin-4-transgenic mice by quantitative polymerase chain reaction. Eur. J. Immunol. 22, 1179–1184.

72

Shire and Legoux

6. Feldman, A. M., Ray, P. E., Silan, C. M., Mercer, J. A., Minobe, W., and Bristow, M. R. (1991) Selective gene expression in failing human heart. Quantification of steady-state levels of messenger RNA in endomyocardial biopsies using the polymerase chain reaction. Circulation 83, 1866–1872. 7. Platzer, C., Ode-Hakim, S., Reinke, P., Döcke, W.-D., Ewert, R., and Volk, H.-D. (1994) Quantitative PCR analysis of cytokine transcription patterns in peripheral mononuclear cells after anti-CD3 rejection therapy using two novel multispecific competitor fragments. Transplantation 58, 264–268. 8. Jia, G. Q. and Gutierrez-Ramos, J. C. (1995) Quantitative measurement of mouse cytokine mRNA by polymerase chain reaction. Eur. Cytokine Net. 6, 253–255. 9. Siegling, A., Lehmann, M., Platzer, C., Emmrich, F., and Volk, H.-D. (1994) A novel multispecific competitor fragment for quantitative PCR analysis of cytokine gene expression in rats. J. Immunol. Methods 177, 23–28. 10. Farrar, J. D. and Street, N. E. (1995) A synthetic standard DNA construct for use in quantification of murine cytokine mRNA molecules. Mol. Immunol. 32, 991–1000. 11. Tarnuzzer, R. W., Macauley, S. P., Farmerie, W. G., Caballero, S., Ghassemifar, M. R., Anderson, J. T., Robinson, C. P., Graut, M. B., Humphreys-Beher, M. G., Franzen, L., Peck, A. B., and Schultz, G. S. (1996) Competitive RNA templates for detection and quantitation of growth factors, cytokines, extracellular matrix components and matrix metalloproteinases by RT-PCR. BioTechniques 20, 670–674. 12. Pitossi, F. J. and Besedovsky, H. O. (1996) A multispecific internal control (pRat6) for the analysis of rat cytokine mRNA levels by quantitative RT-PCR. Eur. Cytokine Net. 7, 377–379. 13. Legoux, P., Minty, C., Delpech, B., Minty, A. J., and Shire, D. (1992) Simultaneous quantitation of cytokine mRNAs in interleukin-1β stimulated U373 human astrocytoma cells by a polymerisation chain reaction method involving co-amplification with an internal multi-specific control. Eur. Cytokine Net. 3, 553–563. 14. Raeymaekers, L. (1993) Quantitative PCR: Theoretical considerations with practical implications. Anal. Biochem. 214, 582–585. 15. Chomczynski, P. and Saachi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. 16. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., and Pease, L. R. (1989) Engineering hybrid genes without the use of restriction enzymes: Gene splicing by overlap extension. Gene 77, 61–68. 17. Kidd, V. and Lion, T. (1997) Appropriate controls for RT-PCR. Leukemia 11, 871–881. 18. Bickel, M., Nothen, S. M., Freiburghaus, K., and Shire, D. (1996) Chemokine expression in human oral keratinocyte cell lines and keratinized mucosa. J. Dental Res. 75, 1827–1834. 19. Kopf, M., Brombacher, F., Kohler, G., Kienzle, G., Widmann, K. H., Lefrang, K., Humborg, C., Ledermann, B., and Solbach, W. (1996) Il-4-deficient balb/c mice resist infection with leishmania major. J. Exp. Med. 184, 1127–1136. 20. Vandevyver, C. and Raus, J. (1995) Quantitative analysis of lymphokine mRNA expression by an automated, non-radioactive method. Cell. Mol. Biol. 41, 683–694. 21. Motmans, K., Raus, J., and Vandevyver, C. (1996) Quantification of cytokine messenger RNA in transfected human T cells by RT-PCR and an automated electrochemiluminescence-based post-PCR detection system. J. Immunol. Methods 190, 107–116. 22. Hockett, R. D., Jr., Janowski, K. M., and Bucy, R. P. (1995) Simultaneous quantitation of multiple cytokine mRNAs by RT-PCR utilizing plate based EIA methodology. J. Immunol. Methods 187, 273–285.


73

23. Zou, W. P., Durand-Gasselin, I., Dulioust, A., Maillot, M. C., Galanaud, P., and Emilie, D. (1995) Quantification of cytokine gene expression by competitive PCR using a colorimetric assay. Eur. Cytokine Net. 6, 257–264. 24. Williams, S. J., Schwer, C., Krishnarao, A. S. M., Heid, C., Karger, B. L., and Williams, P. M. (1996) Quantitative competitive polymerase chain reaction: analysis of amplified products of the HIV-1 gag gene by capillary electrophoresis with laser-induced fluorescence detection. Anal. Biochem. 236, 146–152. 25. Hayward-Lester, A., Oefner, P. J., and Doris, P. A. (1996) Rapid quantification of gene expression by competitive RT-PCR and ion-pair reversed-phase hplc. BioTechniques 20, 250–257.

In Situ PCR Detection of HIV Expression

75

9 In Situ PCR Detection of HIV Expression in the Human Placenta Asad U. Sheikh, Bruno M. Polliotti, and Richard K. Miller 1. Introduction Control of vertical transmission of HIV-1 has progressed remarkably despite a lack of understanding of precise mechanisms by which infection may occur (1). The latter situation partially resulted from inadequate tools for in vitro analysis. However, in utero data suggest that placental infection coincides with vertical transmission. In many cases of fetal infection, placental infection is also present; detection of fetal infection without placental infection is relatively rare. An interesting observation is that not all placentae of HIV-1-infected women are infected (2–5). This raises the possibility that understanding how the placenta becomes infected will give insight into mechanisms of vertical transmission and may lead to therapies to prevent infection. Use of an organ culture system, placental explants, provides a model, which maintains many in vivo characteristics and is useful to study infection (6–9). The key to evaluation of infection in this system is accurate detection and localization of infection. A group of techniques collectively known as in situ polymerase chain reaction (IS-PCR) have been developed to amplify DNA within intact cells (10–13). IS-PCR provides an extremely useful approach to detect very low amounts of targets of interest. Thus, this assay is particularly well suited for detection of virus within tissues, the concentration of which is frequently low (13). IS-PCR continues to evolve as no single methodology is useful for all tissues or targets. IS-PCR appears to be more robust for analysis of cell preparations, but we and others have demonstrated its utility in detection of targets within paraffin embedded tissue sections (14–16). Success in using this assay depends upon optimization of conditions, use of appropriate controls and the ability to troubleshoot when the technique is not working. In the following pages, we will describe our development of an approach to IS-PCR for detecting HIV-1 in the placental explant, an approach we have also used for identification of placental tissues infected in utero. 2. Material 2.1. Explant Culture 1. Six-well and 24-well culture plates and Transwell™ inserts (Corning Costar, Cambridge, MA). 2. RPMI 1640 and Hams F-12 (Mediatech, Herndon, VA). From: Methods in Molecular Biology, Vol. 137: Developmental Biology Protocols, Vol. III Edited by: R. S. Tuan and C. W. Lo © Humana Press Inc., Totowa, NJ

75

76 3. 4. 5. 6. 7. 8.

Sheikh, Polliotti, and Miller Fetal calf serum (Mediatech). Matrigel (Collaborative Biologics, Bedford, MA). Penicillin (Mediatech). Streptomycin (Mediatech). L-Glutamine (Gibco-BRL, Gaithersburg, MD). Pyruvate (Cellgro, through Fisher Scientific, Fair Lawn, NJ).

2.2. Tissue Preparation 1. 10% buffered formaldehyde (Sigma, St. Louis, MO). 2. 10% paraformaldehyde (Sigma)—100 g paraformaldehyde in 900 mL of PBS, heated to 60°C for 1 h while stirring. Solution is cooled to room temperature and pH adjusted to 7.4 with NaOH. Volume is adjusted to 1000 mL with PBS and filtered through 315 grade fluted filter paper (VWR, Rochester, NY) (see Note 2). The stock solution is diluted to the desired concentration in PBS. 3. Silane coated slides (Polysciences, Warrington, PA). 4. Xylene (Fisher Scientific, Fair Lawn, NJ). 5. Graded Ethanol baths (100%, 95%, 80%, 70%). 6. PBS: Phosphate buffered saline: 8 g NaCl, 0.2 g KCl, 1.15 g NasHPO4, 0.2 g KH2PO4, 800 mL distilled deionized (dd) H2O. Stir until dissolved and adjust pH to 7.4 with HCl. Bring final volume to 1000 mL with ddH2O. 7. 3% H2O2: 10 mL 30% H2O2 (Fisher Scientific reagent grade, Fair Lawn, NJ) stored in refrigerator, 90 mL methanol (Fisher Scientific Baker grade, Fair Lawn, NJ), prepared immediately prior to use.

2.3. Amplification 1. Proteinase K: (Gibco-BRL, Gaithersburg, MD) final concentrations of 6–24 µg/mL in PBS, freshly prepared and prewarmed to 37°C. 2. Self-seal (MJ Research, Watertown, MA). 3. Glass coverslips—#1.5 and #2 (Corning, Corning, NY). 4. Frame Seal (MJ Research, Watertown, MA). 5. Nail polish—Wet and Wild Clear Nail Protector (Pavilion Ltd., Nyack on the Hudson, NY). 6. Nucleotides—100 mM stock dATP, dCTP, dGTP, dTTP (Gibco-BRL, Gaithersburg, MD). 7. Tissue amplification mixture: 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 3–4 mM MgCl2, 0.2 mM dATP, 0.2 mM dTTP, 0.2 mM dGTP, 0.2 mM dCTP, 0.5–1.25 mM of each primer, 0.05U/µL Taq polymerase (Boehringer Mannheim, Indianapolis, IN), 0.1% bovine serum albumin (Boehringer Mannheim, Indianapolis, IN). 8. Final concentrations of primers: 0.25 µM β-globin1, 0.25 µM β-globin2; 1.25 µM of each gag primer (SK 38, SK39); 1.25 µM of each pol primer (HPOL1 Outer, HPOL2 Outer); 1.25 µM of each LTR primer (LTR1 Outer, LTR2 Outer [see Table 1]). 9. Dedicated slide thermal cycler: PTC-100™ MS-16 (MJ Research, Watertown, MA), Omnislide Cycler (Hybaid, Franklin, MA). 10. Chloroform (Amresco, Solon, OH).

2.4. Detection 1. 20XSSC: 175.3 g NaCl, 88.2 g sodium citrate, 900 mL ddH2O. Adjust pH to 7.0 with NaOH and bring the final volume to 1000 mL with ddH2O. This stock solution is diluted to the desired concentration in ddH2O. 2. Hybridization buffer: 50% deionized formamide (Boehringer Mannheim, Indianapolis, IN), 0.1% sodium dodecylsulfate, 2X Denhardt’s solution (Amresco, Solon, OH), 1 mg/mL sheared salmon sperm DNA (Gibco-BRL, Gaithersburg, MD).

In Situ PCR Detection of HIV Expression

77

Table 1 Primer Sequences Used for Amplification In Situ Primer β-globin1 β-globin2 SK38 SK39 LTR1 Outer LTR2 Outer HPOL1 Outer HPOL2 Outer

Sequence

Size of expected product

CAACTTCATCCACGTTCACC GAAGAGCCAAGGACAGGTAC ATAATCCACCTATCCCAGTAGGAGAAA TTTGGTCCTTGTCTTATGTCCAGAATGC CTAACCAGAGAGACCCAGTACAGGC AGACAAGATATCCTTGATCTGTGG CCCTACAATCCCCAAAGTCAAGG TACTGCCCCTTCACCTTTCCA

268 115 441 324

Table 2 Oligonucleotides and Primers Used for Generation of Labeled Probes for In Situ Hybridization Probe β-globin SK19 LTR1 Inner LTR2 Inner HPOL1 Inner HPOL2 Inner

Sequence

Size of expected product

ACACAACTGTGTTCACTAGC ATCCTGGGATTAAATAAAATAGTAAGAAT GTATAGCCCTAC CCACACACAAGGCTACTTCCCTGA GTCCCCAGCGGAAAGTCCCTTGT TAAGACAGCAGTACAAATGGCAG GCTGTCCCTGTAATAAACCCG

312 175

3. Probe cocktails: a. Alu: 1–2 ng/µL biotin Alu probe (Alu1/Alu2 probe, Research Genetics, Huntsville, AL) in hybridization buffer. b. β-globin: the oligonucleotide probe (see Table 2) is 3' end labeled with biotin 16-dUTP or digoxigenin 1-dUTP (Boehringer Mannheim, Indianapolis, IN) is added to the hybridization mixture. Dig Oligonucleotide 3'-end Labeling kit (Boehringer Mannheim, Indianapolis, IN). c. HIV-1 probes: in the hybridization buffer, 2 ng/mL of digoxigenin or biotin labeled genomic probe and 5 pmol/100 µL of 3' tailed oligonucleotide probe is added. Primer (see Table 2); HPOL1 Inner, HPOL2 Inner; LTR1 Inner, LTR2 Inner. Oligonucleotide SK19 (see Table 2). Plasmid pNL4-3 (AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH: pNL4-3 from Dr. Malcom Martin) (17). 4. Gel extraction: QIAquick Gel Extraction Kit (Qiagen, Valencia, CA). 5. Signal detection: Vectastain ABC Elite kits for alkaline phosphatase and horseradish peroxidase systems (Vector laboratories, Burlingame, CA), DAB Substrate kit (Vector Laboratories, Burlingame, CA), AEC Substrate kit (Vector Laboratories, Burlingame, CA), NBT/BCIP Substrate kit (Vector Laboratories, Burlingame, CA). 6. Counterstain: methyl green (Chroma-Gesellschaff, Germany), eosin (Sigma), Nuclear Fast Red (Vector Laboratories, Burlingame, CA), Mayers hematoxylin (Sigma). 7. n-Butanol: (Fisher Scientific, Fair Lawn, NJ) 8. Mounting media: Permount for insoluble stains (Fisher Scientific, Fair Lawn, NJ); Glycergel for soluble stains (Dako, Carpinteria, CA). 9. Pap hydrophobic markers: 4 mm and 1 mm (Kiyota, Japan).

78

Sheikh, Polliotti, and Miller

3. Methods 3.1. Explant Culture 1. Small pieces (

Developmental Biology Protocols

Developmental Biology Protocols

Developmental Biology Protocols