Cell Engineering: Apoptosis (Cell Engineering)

Cell Engineering Cell Engineering Volume 4 Editor-in-Chief Professor Mohamed Al-Rubeai School of Chemical Engineering,...

Author: Mohamed Al-Rubeai (Editor) | Martin Fussenegger (Editor)

49 downloads 1891 Views 3MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form

DOWNLOAD PDF

Cell Engineering

Cell Engineering Volume 4 Editor-in-Chief Professor Mohamed Al-Rubeai School of Chemical Engineering, The University of Birmingham, Edgbaston, Birmingham, U.K. Editorial Board Dr Hansjorg Hauser GBF, Braunschweig, Germany Professor Michael Betenbaugh Johns Hopkins University, Baltimore, U.S.A. Professor Martin Fussenegger Swiss Federal Institute of Technology Zurich, Switzerland Dr Nigel Jenkins Bioprocess Research & Development, Lilly Research Laboratories, Indianapolis, U.S.A. Professor Caroline MacDonald University of Paisley, Paisley, U.K. Dr Otto-Wilhelm Merten A.F.M.-Genethon 11, Gene Therapy Program, Evry, France

The titles published in this series are listed at the end of this volume

CELL ENGINEERING Vol. 4: Apoptosis Edited by

Mohammed Al-Rubeai School of Chemical Engineering, The University of Birmingham, Edgbaston, Birmingham, U.K. and

Martin Fussenegger Swiss Federal Institute of Technology, Zurich, Switzerland

KLUWER ACADEMIC PUBLISHERS NEW YORK, BOSTON, DORDRECHT, LONDON, MOSCOW

eBook ISBN: Print ISBN:

1-4020-2217-4 1-4020-2216-6

©2005 Springer Science + Business Media, Inc.

Print ©2004 Kluwer Academic Publishers Dordrecht All rights reserved

No part of this eBook may be reproduced or transmitted in any form or by any means, electronic, mechanical, recording, or otherwise, without written consent from the Publisher

Created in the United States of America

Visit Springer's eBookstore at: and the Springer Global Website Online at:

http://ebooks.kluweronline.com http://www.springeronline.com

CONTENTS

LIST OF CONTRIBUTORS 1. CASPASE REGULATION AT THE MOLECULAR LEVEL H. Kaufmann and M. Fussenegger 2. THE BCL-2 FAMILY A. Petch and M. Al-Rubeai

vii 1

25

3. THE IGF-1 RECEPTOR IN CELLS SURVIVAL: SIGNALLING AND REGULATION 49 P. A. Kiely, D. M. O’Gorman, A. Lyons and R. O’Connor 4. APOPTOSIS IN HEPATOCYTES N.T. Mukwena and M. Al-Rubeai 5. PROGRAMMED CELL DEATH IN PLANTS DURING DEVELOPMENT AND STRESS RESPONSES S. Panter and M. Dickman 6. A SYSTEMS VIEW OF CELL DEATH J. Varner and M. Fusseneger 7. THE ROLE OF CASPASES IN APOPTOSIS AND THEIR INHIBITION IN MAMMALIAN CELL CULTURE T. M. Sauerwald and. M.J. Betenbaugh

93

107

153

181

8. IMPROVEMENT OF INDUSTRIAL CELL CULTURE PROCESSES BY CASPASE- 9 DOMINANT NEGATIVE AND OTHER APOPTOTIC INHIBITORS 211 J. van de Goor 9. THERAPEUTIC SMALL MOLECULE INHIBITORS OF BCL-2 P. Beauparlant and G. C. Shore

223

vi

10. APOPTOSIS CONTOL BASED ON DOWN-REGULATING THE INHIBITOR-OF-APOPTOSIS (IAP) PROTEINS: XIAP ANTISENSE AND OTHER APPROACHES 239 E. LaCasse 11. MONITORING OF APOPTOSIS A. Ishaque and M. Al-Rubeai

281

12. MOLECULAR IMAGING OF PROGRAMMED CELL DEATH; FROM BASIC MECHANISMS TO CLINICAL APPLICATIONS 307 B. L. J. H. Kietselaer, C. P. M. Reutelingsperger and L. Hofstra INDEX

329

LIST OF CONTRIBUTORS Mohamed Al-Rubeai The University of Birmingham Birmingham, UK Pierre Beauparlant Gemin X Biotechnilogies Inc. Montreal, Quebec, Canada Michael Betenbaugh The Johns Hopkins University Baltimore, Maryland, USA Martin Dickman University of Nebraska-Lincoln Lincoln, NE, USA Martin Fusseneger Swiss Federal Institute Zurich, Switzerland Leonard Hofstra University Hospital of Maastricht Maastricht, The Netherlands Adiba Ishaque Bayer Corporation Berkely, California, USA Hitto Kaufmann Walter and Eliza Hall Institute of Medical Research Victoria, Australia Patrick A. Kiely University College Cork Cork, Ireland

vii

viii

Bas L. J. H. Kietselaer University Hospital of Maastricht Maastricht, The Netherlands Eric LaCasse Aegera Onclogy Inc Ottawa, Ontario, Canada Anthony Lyons University College Cork Cork, Ireland Nyaradzo T. Mukwena University of Birmingham Birmingham, UK Rosemary O’Connor University College Cork Cork, Ireland Denise M. O’Gorman University College Cork Cork, Ireland S. Panter University of Nebraska-Lincoln Lincoln, NE, USA Amelia Petch University of Birmingham Birmingham, UK Chris P. M. Reutelingsperger University of Maastricht, Maastricht The Netherlands T. M. Sauerwald Centrocor, Inc. Malvern, PA, USA

ix

Gordon C. Shore Gemin X Biotechnilogies Inc. Montreal, Quebec, Canada Jana van de Goor Genetech Inc. South San Francisco, CA, USA Jeffrey D. Varner Genencor International Inc. Palo Alto, CA, USA

1.

CASPASE REGULATION AT THE MOLECULAR LEVEL

HITTO KAUFMANN1+ AND MARTIN FUSSENEGGER2* Walter and Eliza Hall Institute of Medical Research, 1G Royal Parade, Parkville, Victoria, 3050, Australia 2 Institute of Biotechnology, Swiss Federal Institute of Technology, ETH Hoenggerberg, HPT D74, CH-8093 Zurich, Switzerland. + Present Address: Boehringer Ingelheim Pharma GmbH & Co. KG GFP BP, Birkendorfer Str. 65, D-88397 Biberach

1

*

Corresponding Author: Fax: +41 1 633 12 34 E-mail: [email protected]

1.

Introduction

Apoptosis or programmed cell death is an essential process required for precise embryonic development and tissue homeostasis in adult species. Programmed cell death is controlled by sequential action of a specific set of proteins which are conserved throughout multicellular organisms and convert death-inducing signal(s) into cell-disassembling biochemical processes. Molecular details of the apoptosis machinery first emerged from a genetic screen of the hermaphrodite nematode Caenorhabditis elegans which revealed the four global apoptosis regulators ced-3, ced-4, ced-9 and egl-1 (Metzstein et al., 1998). ced-3 encodes a member of the cystein-containing aspartate-specific proteases family known as “caspases”. ced-3-deficient C. elegans mutants were devoid of programmed cell death during development (Ellis and Horvitz 1986). Ced-4 is an activator of caspase-mediated cell death and nematodes lacking this global proapoptotic regulator exhibit superfluous cells (Ellis and Horvitz 1986). Conversely, Ced-4-mediated apoptosis induction could be blocked by direct interaction with the survival protein Ced-9 (Chen et al., 2000; del Peso et al., 2000; Parrish et al., 2000). The key role of Ced-9 in preventing apoptosis is exemplified by a gain-of-function mutation which constitutively activates Ced-9, resulting in sustained suppression of apoptosis in C. elegans while loss-of-function mutations are lethal at an embryonic stage (Hengartner et al., 1992). Egl-1 is produced in response to death signals and interacts with Ced-9 thus preventing Ced-4-mediated caspase activation (Conradt and Horvitz 1998). This very basic regulatory network of pro- and antiapoptotic response regulators discovered in C. elegans has corresponding homologs in most mammalian cells where they often exist as multigene families. In this chapter we focus on describing 1 M. Al-Rubeai and M. Fussenegger (eds.), Cell Engineering, Vol. 4, 1-23. © 2004 Kluwer Academic Publishers. Printed in the Netherlands.

2

H. KAUFMANN and M. FUSSENEGGER

the function and regulation of the mammalian caspase family of proteases (see Figure 1 for an overview of caspase-modulating proteins).

Figure 1. Caspase regulation network. Activation of initiator caspases such as caspase-8 and 9 involves recruitment to large multiprotein complexes. IAP family members bind and inhibit active caspases and IAP antagonists such as DIABLO/Smac abolish this interaction once released from the mitochondria.

2.

The Caspase Family of Proteins

Caspases are intracellular cysteine proteases that have specific substrate recognition sequences and cleave target proteins after aspartate residues (Thornberry et al., 1997). In healthy cells the majority of caspase molecules are present as monomeric zymogenes called procaspases. Nematodes harbor three caspases, the Drosophila genome encodes seven and 11 cystein proteases are known in humans (Stennicke et al., 2002). Although most caspases have evolved as key regulators of programmed cell death some members of this protease family including caspase-1, caspase-11 and presumably caspases-4 and -5 are involved in the enzymatic maturation of cytokines (Tingsborg et al., 1996; McAlindon et al., 1998; Wang et al., 1998; Furlan et al., 1999) (Table 1). Several extra- and intracellular signals are known to modulate activation of two classes of caspases during apoptosis: initiator and executioner caspases.


3

All caspases are produced as inactive zymogens (procaspases) which undergo proteolytic activation during apoptosis. While initiator caspases-2, -8, -9 and -10 undergo autocatalytic activation following recruitment of the pro-domain into multiprotein-complexes, executioner pro-caspases-3, -6 and -7 are processed by initiator caspases (Table 1). Cleavage of caspase substrates is believed to be the point of no return which commits a cell to apoptosis. While some activated caspases are directly involved in dismantling the cell by cleaving key structural and other proteins, others modulate the extent of caspase activation. Table 1. Mammalian caspases. h, caspase only present in humans; m, caspase only present in mice; b, caspase only present in bovines; CARD, caspase recruitment domain; DED, death effector domain. Caspase Domains Regulators In vivo function Initiator Caspases Caspase-2 CARD RAIDD; RIP; Initiation of apoptosis in germ cells; TRADD neurons and B-cells Caspase-8 DED FADD FLIP Death receptor mediated apoptosis; developmental cell death Caspase-9 CARD APAF-1; IAPs; Neuronal cell death; apoptosis in DIABLO/HtrA2 thymocytes hCaspase-10 DED FADD FLIP Death receptor mediated apoptosis Executioner Caspases Caspase-3 Caspase-6

-

Caspase-7

-

Caspase-14

-

Casp-9; IAPs; DIABLO/HtrA2 Casp-3 ? Casp-9; IAPs; DIABLO/HtrA2 -

Cytokine processing Caspases Caspase-1 CARD ASC; Ipaf Caspase-4

CARD

Caspase-5

CARD

-

mCaspase-11

CARD

-

mCaspase-12 bCaspase-13

-

Casp-8

Casp-8 -

Neuronal cell death; required for apoptosis in thymocytes Chromatin condensation; formation of apoptotic bodies? Not known Not known

Activation of cytokines during inflammation Activation of cytokines during inflammation ? Activation of cytokines during inflammation ? Activation of cytokines during inflammation Not known Not known

Caspase target sites contain at least four specific contiguous amino acids termed P4-P3-P2-P1. Cleavage occurs after the P1 residue that is typically an aparagine (Asp). For all caspases the preferred amino acid at position P3 is glutamine (Glu) whereas amino acids at positions P2 and P4 can vary considerably. Hence, the

4


consensus cleavage specificity of caspases is X-Glu-X-Asp (Thornberry et al., 1997). Various intracellular proteins have been identified as caspase targets, yet the relevance of caspase-mediated cleavage for apoptosis remains elusive in many cases, in particular those which occur at low efficiency and at late stages of programmed cell death. Some caspase substrates are activated by proteolytic processing. The most prominent examples include activation of executioner caspases, p21-activated kinase 2 (PAK2) (Rudel and Bokoch 1997) and protein kinase Cδ (PKCδ) (Emoto et al., 1995; Ghayur et al., 1996). By contrast, caspase-mediated cleavage can inactivate some target proteins such as ICAD/DFF45, the inhibitor of the DNAse CAD, processing of which results in the release of active DNAse involved in DNA fragmentation (Enari et al., 1998; Halenbeck et al., 1998; Liu et al., 1998). The protease domain of caspases consists of a small and a large subunit. Caspase activation is believed to involve two distinct proteolytic steps: Firstly, the smaller Cterminal subunit of the protease domain is released, followed by removal of the prodomain from the large subunit of the protein. Crystallography studies suggest that active caspases are heterotetramers composed of two small and two large subunits (Walker et al., 1994; Wilson et al., 1994; Thornberry and Lazebnik 1998).

3.

In Vivo Function of Caspases – Lessons from Knockout Mice

The central physiological role of caspases in modulating apoptosis and inflammation was revealed by phenotypic analysis of caspase-deficient/negative mouse mutants. Since the phenotypes of caspase-3- and caspase-9-deficient mice are remarkably similar and comparable to knockouts of the ced-4 homologue Apaf-1 which activates caspase-9 suggested that all determinants impinge on the same developmental pathway. In fact, all abnormalities were found to be associated with brain development (Kuida et al., 1996; Hakem et al., 1998; Woo et al., 1998). In caspase-3-/- and even more prominent in caspase-9-/- animals cell death in the proliferative neuroepithelium is drastically reduced which results in distorted anatomical structures (Hakem et al., 1998; Kuida et al., 1998). Some cell types in caspase-9-/- mice exhibited increased resistance to apoptosis when induced by toxic stimuli whereas the sensitivity to programmed cell death remains unchanged when stimulated by the tumor necrosis factor recptor family including Fas/Apo1/CD95 (also referred to as death receptors; see below). Although caspase 2-/- mice develop normally and are fertile, it has been reported that an increased number of germ cells accumulate in female mice, indicating that caspase-2 may be involved in the removal of excess oocytes (Bergeron et al., 1998). All phenotypes (lethality in early development, abnormal hearts, reduced hematopoietic precursor cell number and resistance of fibroblasts to receptormediated apoptosis induction) which are typically associated with caspase-8-/- mice suggest an essential role of the corresponding caspase in the differentiation of the


5

heart muscle and hematopoetic progenitor cells as well as in death receptor signaling in fibroblasts (Varfolomeev et al., 1998). While caspases-2, -3, -8 and -9 appear to play pivotal roles in apoptosis regulatory networks the phenotypes of caspase-1- and caspase-11-deficient mice rather suggest apoptosis-unrelated functions for these proteases in vivo. Caspase-1-/mice lack mature interleukin-1β (IL-1β) and IL-18 (Kuida et al., 1995; Li et al., 1995; Ghayur et al., 1997; Fantuzzi et al., 1998). Furthermore, these mutant mice are unable to produce IL-1α, IL-6, tumor necrosis factor α (TNF-α) and interferon-γ (IF-γ) in response to polysaccharide (LPS) which may result from secondary effects associated with defective IL-1β and IL-18 processing. Caspase-11-/- mice showed a phenotypes comparable to caspase-1-/- mice which correlated with deficient caspase1 activation (Wang et al., 1998).

4.

Caspase Structures

Full or partial structural information has been obtained for caspase-1 (Walker et al., 1994; Wilson et al,. 1994), caspase-3 (Mittl et al., 1997), caspase-7 (Chai, Shiozaki et al., 2001), caspase-8 (Blanchard et al., 1999; Watt et al., 1999) and caspase-9 (Renatus et al., 2001). All of these structural studies support a model by which active caspases are present as homodimers, with each monomer consisting of a large (20 kDa for caspase-1) and a small (10 kDa for caspase-1) subunit. Therefore, the active enzyme is best described as a heterotetramer. Four loops known as L1, L2, L3 and L4 form the active site which is conserved among all caspases. While L1 and L3 represent well-conserved structures, the amino acid composition and length of L2 and L4 vary substantially between different caspases (Shi 2002). The exact position of these four loops within a particular caspase determines its substrate specificity. The substrate recognition residues P1-4 bind to the substrate pockets S1, S2, S3 and S4 respectively, located between the base (L3) and the sides (L1 and L4) of the substrate binding groove (Shi 2002). All caspases except caspase-9 appear to require proteolytic processing for full activation, and the recently resolved crystal structure of caspase-7 provides first insights into the molecular mechanism of caspase activation (Chai et al., 2001; Riedl et al., 2001). The caspase-7 zymogene forms homodimers in which the linker regions connecting the large and the small subunits block the groove of the cavity between the two monomers. This conformation prevents substrate binding and the formation of an active proteolytic center prior to this linker region being cleaved (Riedl et al., 2001). Although the overall structures of procaspase-7 and active caspase-7 are almost identical (less then 0.8 A root-mean-square deviation for all aligned Cα atoms), drastic rearrangements take place within the active site following cleavage. In particular L2, which contains the catalytic residue Cys 186, is rotated by 90° in the active caspase-7 (Chai et al., 2001).

6


Interestingly, proteolytic processing is not required for activation of procaspase9 (Stennicke et al., 2002). Structure-function analysis of caspase-9 and its mutants lacking the caspase recruitment domain (CARD) revealed the classic dimeric caspase conformation consisting of four catalytic domains. However, in contrast to all other caspases, caspase-9 dimers contain only one active catalytic site while the other remain inactive (Renatus et al., 2001). This asymmetry of the caspase-9 dimer suggests a novel activation mechanism for this initiator caspase.

5.

Activation of Caspases

5.1. THE DEATH RECEPTOR PATHWAY - ACTIVATION OF PROCASPASE8 VIA FAS/APO1/CD95 Cytokines of the tumor necrosis factor (TNF) family play an essential role in development, function and homeostasis of the immune system, the bone as well as the mammary gland (Locksley et al., 2001). Binding of TNF family members to their cognate receptors can lead to activation of initiator caspases and subsequent cell death (Baud and Karin 2001). Proteins of the TNF family of proteins contain a conserved C-terminal homologous to the TNF domain which forms homo- and less frequently heterotrimers interacting with cognate receptors of the TNF family (Bodmer et al., 2002). Ligand-mediated oligomerization of TNF recpetors leads to their activation, and depending on the type of receptor, to either induction of pro- or antiapoptotis regulatory pathways (Wallach et al., 1999). TNF-type of receptors that engage cell death pathways include Fas/Apo1/CD95 (specific for the Fas ligand (FasL)), type 1 tumor necrosis factor α (TNFα) receptor (TNFR1) (specific for TNFα), death receptor 3 (DR3; specific for the Apo3 ligand), and DR4 as well as DR5 (both of which bind Apo2/TRAIL). All of these receptors induce cell death by acting as scaffolds for caspase activation. The best-characterized pathway of caspase activation is the processing of procaspase-8 to caspase-8 triggered following binding of FasL to the death receptor Fas/Apo1/CD95 (Figure 1). Fas/Apo1/CD95 exists as a preassociated complex which appears to be required for functional apoptosis signaling following FasL binding (Siegel et al., 2000). When FasL binds to its cognate receptor Fas/Apo1/CD95, the death domain (DD), an intracellular portion of the Fas/Apo1/CD95 receptor of about 90 amino acids, interacts with the death domain of a bipartite adaptor molecule called FADD in a homotypic interaction (Boldin et al., 1995; Chinnaiyan et al., 1995). The rapid recruitment of FADD to form these receptor complexes is associated with the formation of microaggregates (Kischkel et al., 1995; Kamitani et al., 1997). The N-terminal death effector domain (DED) of FADD in turn interacts with the DED of procaspase-8 to form the so-called deathinducing signaling complex (DISC) (Medema et al., 1997). Studies in cultured cells


7

using the actin inhibitor Ltn A suggested that this step requires actin filaments (Algeciras-Schimnich et al., 2002). In a final step, processed caspase-8 is freed from the DISC and starts to process its substrates such as caspase-3 or the proapoptotic Bcl-2 family member Bid (Li et al., 1998; Luo et al., 1998). There is growing evidence that oligomerization of procaspase-8 within the DISC is essential for its proteolytic activation. Transfection of chimeric caspase-8 constructs in which the DED containing prodomain was replaced by a CD8 dimerization domain resulted in cell death induced by caspase-8 autoactivation (Martin et al., 1998). Likewise, in vitro oligomerization of caspase-8 by engineered FK506 binding protein (FKBP) domains was shown to activate procaspase-8 (Yang et al., 1998). Activity of the DISC can be regulated by the FADD-like inhibitor protein FLIP (Cryns and Yuan 1998). FLIP contains two DEDs enabling it to block recruitment of procaspase-8 to activated death receptor complexes by competing with its binding to FADD (Irmler et al., 1997). Procaspase-10 also contains a DED and, like procaspase-8, can be recruited to TRAIL and Fas/Apo1/CD95 death receptor complexes via FADD (Sprick et al., 2002). Although it could be shown that caspase-10 is proteolytically processed during FasL-induced apoptosis, its function appears to differ from that of caspase-8 since it was unable to complement defective apoptosis induction in caspase-8-deficient cells (Sprick et al., 2002). Mice which lack FADD die in an embryonic stage and FasL-induced apoptosis is completely blocked in T-cells derived from FADD-/- embryonic stem cells when transplanted into RAG1-/- hosts (Yeh et al., 1998; Zhang et al., 1998; Kabra et al., 2001). These data indicate that there are no redundant Fas/Apo1/CD95-mediated apoptosis pathways. 5.2. CASPASE-9 ACTIVATION IN THE APOPTOSOME Death stimuli such as UV irradiation lead to distinct changes in the integrity of mitochondria. At early stages of apoptosis transition of mitochondria from an orthodox to a condensed conformation associated with their intracellular redistribution into to perinuclear clusters has been observed (Mancini et al., 1997; De Vos et al., 1998). Furthermore, some apoptosis stimuli result in a reduction of the inner membrane potential, outer membrane discontinuities and release of cytochrome c into the cytoplasm (Desagher and Martinou 2000). Cell-free assays have demonstrated that cytochrome c interacts with apoptotic protease activating factor-1 (Apaf-1) to form a multiprotein complex containing active caspase-9 in the presence of dATP (Figure 1). This complex is also known as the apoptosome (Li et al., 1997). The finding that caspase-9 enzymatic activity increases 1000-fold upon its association with the apoptosome led to the current model whereby the assembly of this scaffolding complex is the key molecular event in the activation of caspase-9 (Rodriguez and Lazebnik 1999). This Apaf-1/caspase-9 holoenzyme has been shown to activate executioner caspases such as caspase-3 (Rodriguez and Lazebnik 1999) (Figure 1).

8


Apaf-1 contains at least three functional domains: (i) an N-terminal CARD that is required for binding caspase-9, (ii) a domain homologous to Ced-4 which mediates Apaf-1 self-organization and (iii) 12 or 13 C-terminal WD-40 repeats thought to be involved in protein-protein interactions (Zou et al., 1997). Highly purified recombinant cytochrome c, Apaf-1 and caspase-9 proteins were demonstrated to form a 1.4 mDa complex as visualized by gel filtration experiments (Saleh et al., 1999; Zou et al., 1999). In agreement with these findings in cell-free assays, Apaf-1 was reported to be present in high molecular weight complexes in cell extracts upon treatment of lysates with dATP and incubation at 37°C (Cain et al., 1999). In these experiments Apaf-1 was found to oligomerize in two distinct complexes, one in the order of 1.4 mDa the other around 700 kDa. The smaller complex appears to form more rapidly and has a higher caspase processing activity. Apoptosis induced in human tumor cells by etoposide or N-tosylphenylalanylchloromethyl ketone (TPCK) resulted in the formation of a 700 kDa complex suggesting a functional relevance in vivo (Cain et al., 1999). Recent studies provided further insights into the molecular mechanisms of caspase-9 activation within the apoptosome. In gel filtration experiments using dATP-activated cell lysates, caspase-3 was detected in apoptosome complexes, the recruitment and processing of which was dependent on the on caspase-9 (Bratton et al., 2001). Interestingly, cleavage-resistant caspase-9 mutants can still recruit and activate caspase-3 leading to the conclusion that processing of caspase-9 is neither sufficient nor required for this process (Bratton et al., 2001). The three-dimensional structure of the apoptosome has been determined at a resolution of 27A using electron cryomicroscopy (Acehan, Jiang et al., 2002). Assembly of purified Apaf-1, cytochrome c and dATP resulted in a wheel-like particle of 7-fold symmetry. Known high-resolution domain structures such as the Apaf-1 CARD or WD40 domains of other proteins enabled the determination of the domain architecture by positioning structural elements within the 3D structure. The spokes of the wheel contain the Ced4 nucleotide-binding domain and cytochrome c between two C-terminal subdomains containing WD40 repeats, while the central hub resembles oligomerised Apaf-1 CARD domains (Acehan et al., 2002). In healthy cells, a mechanistic model for the assembly of the apoptosome has been proposed where the N-terminal CARD domain of Apaf-1 is bound to a Y-shaped structure formed by the C-terminal WD40 domains. Cytochrome c displaces the CARD domain and this change in Apaf-1 conformation enables oligimerization of CARD domains to form the wheel-like structure of the apoptosome.

6.

Activation by Induced Proximity – A Common Theme for Activation of Initiator Caspases?

The aforementioned models for activation of caspase-8 and caspase-9 suggest a similar mechanism for induction of both initiator caspases. Initially, a model of


9

induced proximity was postulated for caspase-8 activation (Muzio et al., 1998). This model was based on the findings that dimerization of chimeric Fpk3Caspase-8 induced their activation and that processing-incompetent caspase-8 mutants retain low but detectable enzymatic activity (Muzio et al., 1998). Pore limit native PAGE experiments have shown that both caspases exist as monomers in their inactive zymogene form (Boatright et al., 2003). Monomers of caspases-8 and -9 purified from bacteria exist in a slow equilibrium with their dimeric form and that enzymatic activity is restricted to the dimers (Renatus et al., 2001; Boatright et al., 2003; Donepudi et al., 2003). The concentration dependency of the dissociation constant of these dimers further supports the induced proximity model (Donepudi et al., 2003). Notably, dimer formation is still observed for non-cleavable mutants of both caspases, albeit with a much higher dissociation constant. As observed for wild-type caspases, cleavage activity is again restricted to dimers (Renatus et al., 2001; Boatright et al., 2003; Donepudi et al., 2003). These findings suggest that the crucial initial step for activation of initiator caspases is the dimerization event and that autoprocessing is not required. Instead, processing of the procaspases may serve to stabilize the dimeric active forms. Does this model, in which the most apical caspases of an apoptotic cascade are activated by an increase in their local concentration through scaffolding to large multiprotein complexes, apply to other known initiator caspases such as caspase-2? Indeed, a recent study suggests that caspase-2 is recruited to high molecular weight complexes upon incubation of cell lysates at 37°C by a mechanism that requires its prodomain (Read et al., 2002). Interestingly, these complexes still form in cell extracts lacking cytochrome c or Apaf-1 (Read et al., 2002).

7.

Caspase Inhibition

Does activation of initiator and effector caspases represent an ultimate commitment to apoptosis? It appears that some proteins can act as a last-line-ofdefense, modulating or preventing apoptosis by binding and inactivating caspases. These proteins include viral caspase inhibitors such as p35 and CrmA and the inhibitor of apoptosis protein (IAP) family. 7.1. THE VIRAL CASPASE INHIBITORS P35 AND CRMA Many viruses have evolved mechanisms to prevent apoptosis of their host cell in order to enable sustained viral replication (O'Brien 1998; Roulston et al., 1999). The p35 gene of the baculovirus Autographa california multiply embedded nuclear polyhedrosis virus (AcMNPV) encodes a potent and broad-acting caspase inhibitor that can inhibit caspase activity and cell death in nematode, insect and mammalian systems (Birnbaum et al., 1994). Infection of SF21 cells derived from the Spodoptera frugiperda (Order Lepidoptera) by a p35-deficient baculovirus causes

10


cell death and prevents viral replication (Clem et al., 1991; Bump et al., 1995). In addition to blocking apoptosis induced by viral infection, p35 can inhibit insect cell death caused by overexpression of activated insect SF-caspase-1 or mammalian caspase-3 (Seshagiri and Miller 1997). Overexpression of p35 can protect mammalian cells from various forms of apoptosis (Rabizadeh et al., 1993; Beidler et al., 1995). Expression of p35 in transgenic nematodes, flies and mice produces phenotypes characterized by excessive developmental cell death (Sugimoto et al., 1994; Hay et al., 1994; Izquierdo et al., 1999). The mechanism by which p35 neutralizes caspase activity involves its proteolytic cleavage (Seshagiri and Miller 1997). Upon binding to caspases, p35 is cleaved at the caspase cleavage sequence DQMD↓G and the cleavage product remains tightly associated with the caspase (Bump et al., 1995). Mutation of the P1 aspartate to a glutamate or an alanine prevents cleavage of p35 and supports the requirement of precise p35 processing for caspase inactivation (Bertin et al., 1996). The inhibited caspase is trapped as a covalent adduct through the binding of the catalytic cysteine by the P1 aspartate, presumably by formation of a thiolester bond (Riedl et al., 2001). Cowpox virus expresses the protein CrmA (cytokine response modifier A) in order to avoid inflammatory and apoptotic responses following host cell infection (Zhou and Salvesen 2000). CrmA targets members of the caspase family of proteases that either initiate apoptosis pathways (caspases-8 and -10) or trigger activation of the pro-inflammatory cytokines interleukin-1 and interleukin-18 (via caspase-1, see above) (Komiyama et al., 1994; Zhou et al., 1997). Similar to p35, CrmA inhibits proteases by acting as a pseudosubstrate (Ray et al., 1992; Stennicke et al., 2002). However, structural analysis showed that CrmA represents a true member of the serpin family of protease inhibitors (Renatus et al., 2000; Simonovic et al., 2000). CrmA can also inhibit the serin protease Granzyme B and therefore represents a cross-class inhibitor of proteases (Stennicke et al., 2002). 7.2. IAPs IAPs are an evolutionarily conserved group of proteins distinguished by the presence of the baculovirus IAP repeat (BIR) motif (Crook et al., 1993) (Figure 2). This BIR domain consists of around 70 amino acids and has been identified in baculoviral protein Op-IAP which harbors a conserved core structure of three cysteines and one histidine containing a zinc ion (Crook et al., 1993; Hinds et al., 1999; Sun et al., 1999). The mammalian proteins XIAP, cIAP-1 and c-IAP2 are direct caspase inhibitors capable of blocking activities of caspases-3, -7 and -9 but not of caspases-1, -6, -8 or -10 (Deveraux et al., 1997; Roy et al., 1997). Amongst these proteins, XIAP is the most potent inhibitor showing an inhibition constant comparable to p35 (Ki of 0.7 nM) (Deveraux et al., 1997). In contrast to XIAP, c-IAP-1 and c-IAP-2 are 50-


11

10’000 less efficient in binding and inhibiting their target caspases (Roy et al., 1997). Cell death induced by a wide variety of stimuli including death receptor activation as well as irradiation can be efficiently blocked in mammalian cells by heterologous expression of IAPs (Figure 1). Unlike some IAPs, many BIR domain-containing proteins (BIRPs) show no apoptosis-inhibiting activities. For example, the yeast genome lacks any caspaseencoding genes but harbors BIRP family members such as the Schizosaccharomyces pombe protein Bir1p. Bir1p regulates cell division during mitosis and was found to be essential for chromosome condensation as well as spindle elongation (Rajagopalan and Balasubramanian 2002). Genetic studies in C. elegans revealed that the nematode BIRP BIR-1 is a complex showing Aurora-like kinase AIR-2 activities involved in regulating mitosis, a characteristic which seems to be conserved in the human proteins survivin and Aurora kinase (Skoufias et al., 2000; Speliotes et al., 2000; Uren et al., 2000) (Figure 2).

Figure 2. Mammalian IAP family members.Mammalian IAPs such as XIAP, cIAP1 and cIAP2 bind an inactivate caspases. Other family members such as survivin appear to function in cell division. BIR, baculovirus IAP repeat; CARD, caspase-recruitment domain.

Genetic studies in Drosophila provide evidence that IAPs may be essential for apoptosis regulation, at least in Drosophila. Homozygous mutants lacking D-IAP1 expression exhibit embryonic lethality, presumably due to excessive cell death during development (Wang et al., 1999) The fact that cell death in these embryos is

12


associated with elevated caspase activity, strongly suggests that the physiological role of IAPs is to prevent undesired cell death by inactivating caspases (Wang et al., 1999). The role of IAPs in vertebrates is less clear. Mice deficient in the most potent mammalian IAP, XIAP, appear to be normal. No difference could be detected following Fas-L-mediated apoptosis induction in thymocytes of wild-type and XIAP-deficient mice (Harlin et al., 2001). Many IAPs encode more than one BIR and recent data suggest different functions for these domains. Biochemical analysis demonstrated that the BIR3 domain of XIAP mediates caspase-9 binding and inhibition whereas it is dispensable for caspase-3 and caspase-7 inhibitory action (Sun et al., 1999). In similar experiments it could be demonstrated that the linker region connecting BIR1 and BIR2 of XIAP contains amino acids essential for the binding of caspases-3 and -7 (Sun et al., 1999). Aspartate residue 148, conserved in c-IAP-1 and c-IAP-2, is critically important as its mutation to alanine leads to complete lack of caspase-3 binding in in vitro experiments (Sun et al., 1999). Crystal structures obtained for XIAP-caspase-3 and XIAP-caspase-7 complexes confirmed the importance of the linker region in the formation of both complexes (Chai et al., 2001; Huang et al., 2001; Riedl et al., 2001). Furthermore, all these structures showed no direct interaction between BIR2 and the caspase molecules which was surprising since in vitro experiments suggested the requirement of BIR2 for caspase-IAP interaction (Sun et al., 1999). The fact that the linker region alone is not sufficient to bind and inactivate caspases-3 and -7 led to the hypothesis that BIR2 serves to align and stabilize the linker, thereby keeping it in a productive caspase binding-competent confirmation (Stennicke et al., 2002). The mechanism by which XIAP inhibits substrate cleavage by caspases-3 and -7 appears to be unique among the mechanisms described for protease inhibition so far. XIAP functions by obstructing access to the substrate groove of the activated caspase. Notably, compared to substrate binding, XIAP interacts with the active center of caspases in the reverse orientation and the critical interactions do not occur within the substrate determining pockets, with the exception of S4 (Chai et al., 2001; Huang et al., 2001; Riedl et al., 2001). Currently, no structural data are available for XIAP-mediated inhibition of the activity of caspase-9. How do these biochemical data reflect the situation in vivo? A screen to identify XIAP mutants that no longer bind and inhibit caspase-3 has been performed in yeast (Silke et al., 2001). In accordance with the in vitro data, most mutants obtained by this screen locate to the N-terminal linker region of BIR2. Furthermore, mutation of the zinc coordinating cysteine 200 to arginine abolished caspase-3 binding presumably by affecting the structure of the BIR2 domain. These data confirm that the linker region between BIR1 and BIR2 and the structure of the BIR2 domain itself facilitate caspase-3 binding. Interestingly, all mutants deficient in caspase-3 binding retained their ability to bind caspase-9 and could still protect cells from UVinduced cell death (Silke et al., 2001). The mechanism by which XIAP complexes


13

with caspase-9 is therefore distinct and appears to be more important for the antiapoptotic function of XIAP. 7.3. ANTAGONISTS OF IAPs A large number of dying cells can be observed during embryogenesis of Drosophila melanogaster (Abrams et al., 1993). A mutant phenotype characterized by the small deletion H99 was found to be devoid of any cell death during fly development (White et al., 1994). Three proteins encoded within this region, Reaper, Hid and Grim have been identified to function as activators of cell death (White et al., 1994; Grether et al., 1995; Chen et al., 1996). These proteins induce apoptosis at least in part by antagonizing IAPs. Binding to IAPs occurs via a conserved 14-amino acid N-terminal motif and prevents interaction with caspases (Vucic et al., 1997; Vucic et al., 1998; Wang et al., 1999). Recently, two mammalian proteins DIABLO/Smac and HtrA2/Omi have been described to function in a similar fashion. Both proteins have been identified based on their physical interaction with XIAP, c-IAP-1 and c-IAP-2 (Figure 1). In healthy cells, DIABLO and HtrA2 reside predominantly in mitochondria but are released into the cytoplasm following death-inducing stimuli such as UV irradiation (Verhagen et al., 2000; Verhagen et al., 2002). The full-length form of both proteins is N-terminally processed in mitochondria so that the N-terminal amino acids of the active proteins (AVPS in Htra2 and AVPI in DIABLO) resemble those of the Nterminal Reaper motif. However, it appears that DIABLO and Htra2 may not be true homologues of Drosophila antagonists. Hid, Reaper and Grim are not sequestered to the mitochondria and are actively inducing apoptosis in vivo whereas DIABLO and HtrA2 can only counteract the antiapoptotic function of IAPs. How does DIABLO or HtrA2 prevent XIAP from acting on their target caspases? Gel filtration studies revealed that binding of DIABLO to XIAP dissociates XIAP from caspase-7 indicating that competitive binding may be the key apoptosis-inducing mechanism (Chai et al., 2001). Competition studies in mammalian cells confirmed that DIABLO functions by disrupting XIAP/caspase interactions in vivo (Ekert et al., 2001). Again, recent structural work provided a better insight into the regulatory mechanism at the molecular level. The crystal structure of DIABLO has been solved, and it appears that it functions as a homodimer (Chai et al., 2000). DIABLO’s elongated arch-shaped form may explain why earlier gel filtration experiments suggested a multimeric structure. In vitro studies using recombinant proteins showed that DIABLO can interact with the BIR2 and BIR3 domains of XIAP and competition assays demonstrated that binding to these domains is mutually exclusive (Chai et al., 2000). Several groups could show that the 5-7 aminoterminal residues of processed DIABLO were essential for interaction with XIAP’s BIRs (Chai et al., 2000; Liu et al., 2000; Wu et al., 2000). Indeed, the mutation of the aminoterminal alanine to methionine completely

14


prevented formation of DIABLO/XIAP complexes (Liu et al., 2000; Wu et al., 2000). Furthermore, monomeric DIABLO mutants (V26D, F33D and L108D) were deficient in binding BIR2 of XIAP, thus supporting a model whereby dimerization of DIABLO is required for its binding capacity (Chai et al., 2000). The solution of DIABLO’s structure as well as a functionally active aminoterminal DIABLO peptide complexed with the XIAP BIR3 showed that the four aminoterminal amino acids AVPI form a network of hydrophobic bonds with the BIR (Wu et al., 2000; Liu et al., 2000). The aminoterminal alanine fits tightly into a hydrophobic pocket defined by leucine 307 and tryptophane 310 (Wu et al., 2000; Liu et al., 2000). This fact explains the strict requirement for an alanine residue at the N-terminus of processed DIABLO. Although XIAP binding sites of DIABLO and caspase-9 overlap, they are not identical. This fact enabled the production of XIAP point mutants that specifically abolish binding to either caspase3, caspase-9 or DIABLO (Silke et al., 2002). Thus, double mutants that bind DIABLO, but not caspases-3 and -9 were generated which interestingly still protected cells from UV- and etoposide-induced cell death. In the same study, complete lack of antiapoptotic function was reported for mutants that lack the ability to bind caspase-3, caspase-9 and DIABLO (Silke et al., 2002). Presumably, transfection of mutants defective in binding caspases-3 and -9 led to sequestration of DIABLO released from the mitochondria, thereby enabling endogenous XIAP to inhibit activated caspases. These results illustrate the requirement of IAP antagonists for UV- and etoposide-induced cell death. The molecular mechanism by which HtrA2 binds IAPs appears to be similar to the DIABLO/IAP interactions. The N-terminus of HtrA2 can bind to BIR2 and BIR3 of XIAP although with different affinity compared to DIABLO (Verhagen et al., 2002). As has been demonstrated for DIABLO, mutation of the N-terminal alanine of processed HtrA2 results in complete ablation of its binding to IAPs (Verhagen et al., 2002). Furthermore, the protease activity of HtrA2 seems to contribute to its ability to promote cell death (Verhagen et al 2002; Suzuki et al., 2001; Hegde et al., 2002).

8.

Understanding Caspase Regulation – Importance for Human Therapy

Every cell of a multicellular organism bears the potential to rapidly commit suicide by initiating a highly conserved cell death program. In order to ensure that apoptosis occurs in a spatially and timely organized fashion tight regulation of the molecular death machinery is necessary. Disturbance of the delicate balance between survival and death signals that determines the fate of a cell is apparent in many forms o human diseases (Thompson 1995). Insufficient apoptosis is major cause of cancer whereas excessive apoptosis is a central feature of many neurodegenerative disorders (Nicholson 2000).


15

Since caspases are enzymes they represent very attractive drug targets. Acute cellular injury such as ischemia/reperefusion injuries can lead to cell death caused by hypoxia in the penumbra (Friedlander 2003). Activation of caspases-1, -3, -8, -9 and -11 have been reported in cerebral tissue affected by ischemia (Kang et al., 2000; Benchoua et al., 2001). Strategies that inhibit caspase activity can block cell death in experimental models of mild ischemia and preserve neurological function. So far, most studies are centered around active-site mimetic peptide ketones such as benzyloxycarbonyl (z)-VAD-flouromethylketone (fmk) or z-YVADfmk/chloromethylketone (cmk) that represent broad spectrum caspase inhibitors (Garcia-Calvo et al., 1998). These group of peptide-based inhibitors where shown to efficiently inhibit apoptosis in various models of ischemia-reperfusion injuries (Cursio et al., 1999; Farber et al., 1999; Endres et al., 1998; Mocanu et al., 2000). Apoptosis by prolonged periods of caspase activation is characteristic of many chronic neurogenerative disorders (Friedlander 2003). Again, caspase inhibition has shown promising efficacy in pre-clinical models of amyotrophic lateral sclerosis (ALS) and Parkinson’s disease (Li et al., 2000; Schierle et al., 1999). It remains to be seen whether the huge preclinical promise of peptide-based caspase inhibitors can produce viable therapeutic strategies. The recent understanding of caspase regulation at the molecular level discussed in this chapter should provide novel drug targets and strategies for regulating apoptosis in tissues where the death/survival balance has been disturbed. The ‘natural’ caspase inhibitors such as the IAPs may represent an interesting group of molecules in this regard. Recent studies have shown the potential of several IAP family members to inhibit neuronal cell death in vivo (Simons et al 1999; Xu et al., 1997; Xu et al., 1999).

9.

Acknowledgements

We would like to thank Monilola Olayioye, Paul Ekhert, Melissa Knight and Cornelia Fux for helpful discussion and comments on the manuscript. The laboratory of M.F. is supported by the Swiss National Science Foundation (grant no. 631-065946).

10.

References

Abrams, J. M., White, K., Fessler, L. I. and Steller, H. (1993) Programmed cell death during Drosophila embryogenesis. Development 117, 29-43. Acehan, D., Jiang, X., Morgan, D. G., Heuser, J. E., Wang, X. and Akey, C. W. (2002) Three-dimensional structure of the apoptosome: implications for assembly, procaspase-9 binding, and activation. Mol. Cell. 9, 423-32.

16


Algeciras-Schimnich, A., Shen, L., Barnhart, B. C., Murmann, A. E., Burkhardt, J. K. and Peter, M. E. (2002) Molecular ordering of the initial signaling events of CD95. Mol. Cell Biol. 22, 207-20. Baud, V. and Karin, M. (2001) Signal transduction by tumor necrosis factor and its relatives. Trends Cell Biol. 11, 372-7. Beidler, D. R., Tewari, M., Friesen, P. D., Poirier, G. and Dixit, V. M. (1995) The baculovirus p35 protein inhibits Fas- and tumor necrosis factor-induced apoptosis. J. Biol. Chem. 270, 16526-8. Benchoua, A., Guegan, C,. Couriaud, C,. Hosseini, H,. Sampaio, N., Morin, D. and Onteniente, B.(2001) Specific caspase pathways are activated in the two stages of cerebral infarction. J. Neurosci. 21, 7127-34. Bergeron, L., Perez, G. I., Macdonald ,G., Shi, L., Sun, Y., Jurisicova, A., Varmuza, K. E., Latham, J. A., Flaws, J. C., Salter, H., Hara, M. A., Moskowitz ,S., Li, E., Greenberg ,A., Tilly ,J. L. and Yuan, J. (1998) Defects in regulation of apoptosis in caspase-2-deficient mice. Genes Dev. 12, 1304-14. Bertin, J., S. Mendrysa, M., LaCount, D. J., Gaur, S., Krebs, J. F., Armstrong, R. C, Tomaselli, K. J. and Friesen ,P. D. (1996) Apoptotic suppression by baculovirus P35 involves cleavage by and inhibition of a virus-induced CED-3/ICE-like protease. J. Virol. 70, 6251-9. Birnbaum, M. J., Clem, R. J. and Miller, L. K. (1994) An apoptosis-inhibiting gene from a nuclear polyhedrosis virus encoding a polypeptide with Cys/His sequence motifs. J. Virol. 68, 2521-8. Blanchard, H., Kodandapani, L., Mittl, P. R., Marco ,S. D., Krebs, J. F., Wu, J. C., Tomaselli, K. J. and Grutter, M. G. (1999) The three-dimensional structure of caspase-8: an initiator enzyme in apoptosis. Structure Fold Des. 7, 1125-33. Boatright, K. M., Renatus, M., Scott, F. L., Sperandio, S., Shin, H., Pedersen, I. M., Ricci, J. E., Edris, W. A., Sutherlin, D. P., Green, D. R. and Salvesen, G. S. (2003) A unified model for apical caspase activation. Mol. Cell. 11, 529-41. Bodmer, J. L., Schneider, P. and Tschopp, J. (2002) The molecular architecture of the TNF superfamily. Trends Biochem. Sci. 27, 19-26. Boldin, M. P., Varfolomeev, E. E., Pancer, Z., Mett, I. L., Camonis, J. H. and Wallach, D. (1995) A novel protein that interacts with the death domain of Fas/APO1 contains a sequence motif related to the death domain. J. Biol. Chem. 270, 7795-8. Bratton, S. B., Walker, G., Srinivasula, S. M., Sun, X. M., Butterworth, M., Alnemri, E. S. and Cohen, G. M. (2001) Recruitment, activation and retention of caspases-9 and -3 by Apaf-1 apoptosome and associated XIAP complexes. Embo. J. 20, 998-1009. Bump, N. J., Hackett, M., Hugunin, M., Seshagiri, S., Brady, K., Chen, P., Ferenz, C., Franklin, S., Ghayur, T., Li, P. and et al. (1995) Inhibition of ICE family proteases by baculovirus antiapoptotic protein p35. Science 269, 1885-8. Cain, K., Brown, D. G., Langlais, C. and Cohen, G. M. (1999) Caspase activation involves the formation of the aposome, a large (approximately 700 kDa) caspase-activating complex. J. Biol. Chem. 274, 22686-92. Chai, J., Du, C., Wu, J. W., Kyin, S., Wang, X. and Shi, Y. (2000) Structural and biochemical basis of apoptotic activation by Smac/DIABLO. Nature 406, 855-62. Chai, J., Shiozaki, E., Srinivasula, S. M., Wu, Q., Datta, P., Alnemri, E. S., Shi, Y. and Dataa, P. (2001) Structural basis of caspase-7 inhibition by XIAP. Cell 104, 769-80. Chen, F., Hersh, B. M., Conradt, B., Zhou, Z., Riemer, D., Gruenbaum, Y. and Horvitz, H. R. (2000) Translocation of C. elegans CED-4 to nuclear membranes during programmed cell death. Science 287, 1485-9.


17

Chen, P., Nordstrom, W., Gish, B. and Abrams, J. M. (1996) grim, a novel cell death gene in Drosophila. Genes Dev. 10, 1773-82. Chinnaiyan, A. M., O'Rourke, K., Tewari, M. and Dixit, V. M. (1995) FADD, a novel death domain-containing protein, interacts with the death domain of Fas and initiates apoptosis. Cell 81, 505-12. Clem, R. J., Fechheimer, M. and Miller, L. K. (1991). Prevention of apoptosis by a baculovirus gene during infection of insect cells. Science 254, 1388-90. Conradt, B. and Horvitz, H. R. (1998) The C. elegans protein EGL-1 is required for programmed cell death and interacts with the Bcl-2-like protein CED-9. Cell 93, 519-29. Cursio, R., Gugenheim, J., Ricci, J. E., Crenesse, D., Rostagno, P., Maulon, L., Saint-Paul, M. C., Ferrua, B., Auberger, A. P. (1999) A caspase inhibitor fully protects rats against lethal normothermic liver ischemia by inhibition of liver apoptosis. Faseb. J. 13, 253-61. Crook, N. E., Clem, R. J. and Miller, L. K. (1993) An apoptosis-inhibiting baculovirus gene with a zinc finger-like motif. J. Virol. 67, 2168-74. Cryns, V. and Yuan, J. (1998) Proteases to die for. Genes Dev. 12, 1551-70. De Vos, K., Goossens, V., Boone, E., Vercammen, D., Vancompernolle, K., Vandenabeele, P., Haegeman, G., Fiers, W. and Grooten, J. (1998) The 55-kDa tumor necrosis factor receptor induces clustering of mitochondria through its membrane-proximal region. J. Biol. Chem. 273, 9673-80. del Peso, L., Gonzalez, V. M., Inohara, N., Ellis, R. E. and Nunez, G. (2000) Disruption of the CED-9.CED-4 complex by EGL-1 is a critical step for programmed cell death in Caenorhabditis elegans. J. Biol. Chem. 275, 27205-11. Desagher, S. and Martinou, J. C. (2000) Mitochondria as the central control point of apoptosis. Trends Cell. Biol. 10, 369-77. Deveraux, Q. L., Takahashi, R., Salvesen, G. S. and Reed, J. C. (1997) X-linked IAP is a direct inhibitor of cell-death proteases. Nature 388, 300-4. Donepudi, M., Sweeney, A. M., Briand, C. and Grutter, M. G. (2003) Insights into the regulatory mechanism for caspase-8 activation. Mol. Cell. 11, 543-9. Ekert, P. G., Silke, J., Hawkins, C. J., Verhagen, A. M. and Vaux, D. L. (2001) DIABLO promotes apoptosis by removing MIHA/XIAP from processed caspase 9. J. Cell. Biol. 152, 483-90. Ellis, H. M. and Horvitz, H. R. (1986) Genetic control of programmed cell death in the nematode C. elegans. Cell 44, 817-29. Emoto, Y., Manome, Y., Meinhardt, G., Kisaki, H., Kharbanda, S., Robertson, M., Ghayur, T., Wong, W. W., Kamen, R., Weichselbaum, R. and et al. (1995) Proteolytic activation of protein kinase C delta by an ICE-like protease in apoptotic cells. Embo. J. 14, 6148-56. Enari, M., Sakahira, H., Yokoyama, H., Okawa, K., Iwamatsu, A. and Nagata, S. (1998) A caspase-activated DNase that degrades DNA during apoptosis, and its inhibitor ICAD. Nature 391, 43-50. Endres, M., Namura, S., Shimizu-Sasamata, M., Waeber, C., Zhang, L., Gomez-Isla, T., Hyman, B. T., Moskowitz, M. A. (1998) Attenuation of delayed neuronal death after mild focal ischemia in mice by inhibition of the caspase family. J. Cereb. Blood Flow. Metab. 18, 238-47. Fantuzzi, G., Puren, A. J., Harding, M. W., Livingston, D. J. and Dinarello, C. A. (1998) Interleukin-18 regulation of interferon gamma production and cell proliferation as shown in interleukin-1beta-converting enzyme (caspase-1)-deficient mice. Blood 91, 2118-25. Farber, A., Connors, J. P., Friedlander, R. M., Wagner, R. J., Powell, R. J., Cronenwett, J. L. (1999) A specific inhibitor of apoptosis decreases tissue injury after intestinal ischemiareperfusion in mice. J. Vasc. Surg. 30, 752-60.

18


Friedlander, R. M. (2003) Apoptosis and caspases in neurodegenerative diseases. N. Engl. J. Med. 348, 1365-75. Furlan, R., Martino, G., Galbiati, F., Poliani, P. L., Smiroldo, S., Bergami, A., Desina, G., Comi, G., Flavell, R., Su, M. S. and Adorini, L. (1999) Caspase-1 regulates the inflammatory process leading to autoimmune demyelination. J. Immunol. 163, 2403-9. Garcia-Calvo, M., Peterson, E. P., Leiting, B., Ruel, R., Nicholson ,D. W. and Thornberry, N. A. (1998) Inhibition of human caspases by peptide-based and macromolecular inhibitors. J. Biol. Chem. 273, 32608-13. Ghayur, T., Banerjee, S., Hugunin, M., Butler, D., Herzog, L., Carter, A., Quintal, L., Sekut, L., Talanian, R., Paskind, M., Wong, W., Kamen, R., Tracey, D. and Allen, H. (1997) Caspase-1 processes IFN-gamma-inducing factor and regulates LPS-induced IFN-gamma production. Nature 386, 619-23. Ghayur, T., Hugunin, M., Talanian, R. V., Ratnofsky, S., Quinlan, C., Emoto, Y., Pandey, P., Datta, R., Huang, Y., Kharbanda, S., Allen, H., Kamen, R., Wong, W. and Kufe, D. (1996) Proteolytic activation of protein kinase C delta by an ICE/CED 3-like protease induces characteristics of apoptosis. J. Exp. Med. 184, 2399-404. Grether, M. E., Abrams, J. M., Agapite, J., White, K. and Steller, H. (1995) The head involution defective gene of Drosophila melanogaster functions in programmed cell death. Genes Dev 9, 1694-708. Hakem, R., Hakem, A., Duncan, G. S., Henderson, J. T., Woo, M., Soengas, M. S., Elia, A., de la Pompa, J. L., Kagi, D., Khoo, W., Potter, J., Yoshida, R., Kaufman, S. A., Lowe, S. W., Penninger, J. M. and Mak, T. W. (1998) Differential requirement for caspase 9 in apoptotic pathways in vivo. Cell 94, 339-52. Halenbeck, R., MacDonald, H., Roulston, A., Chen ,T. T., Conroy, L. and Williams, L. T. (1998) CPAN, a human nuclease regulated by the caspase-sensitive inhibitor DFF45. Curr. Biol. 8, 537-40. Harlin, H., Reffey, S. B, Duckett, C. S., Lindsten, T. and Thompson, C. B. (2001) Characterization of XIAP-deficient mice. Mol. Cell Biol. 21, 3604-8. Hengartner, M. O., Ellis, R. E. and Horvitz, H. R. (1992). Caenorhabditis elegans gene ced-9 protects cells from programmed cell death. Nature 356, 494-9. Hay, B. A., Wolff, T. and Rubin, G. M. (1994) Expression of baculovirus P35 prevents cell death in Drosophila. Development 120, 2121-9. Hegde, R., Srinivasula, S. M., Zhang, Z., Wassell, R., Mukattash, R., Cilenti, L., DuBois, G., Lazebnik ,Y., Zervos, A. S., Fernandes-Alnemri, T., Alnemri, E. S. (2002) Identification of Omi/HtrA2 as a mitochondrial apoptotic serine protease that disrupts inhibitor of apoptosis protein-caspase interaction. J. Biol. Chem. 227, 432-8. Hinds, M. G., Norton, R. S., Vaux, D. L. and Day, C. L. (1999) Solution structure of a baculoviral inhibitor of apoptosis (IAP) repeat. Nat. Struct. Biol. 6, 648-51. Huang, Y., Park, Y. C, Rich, R. L., Segal, D., Myszka D. G. and Wu, H. (2001) Structural basis of caspase inhibition by XIAP: differential roles of the linker versus the BIR domain. Cell 104, 781-90. Irmler, M., Thome, M., Hahne, M., Schneider, P., Hofmann, K., Steiner, V., Bodmer, J. L., Schroter, M., Burns, K., Mattmann, C., Rimoldi, D., French, L. E. and Tschopp, J. (1997) Inhibition of death receptor signals by cellular FLIP. Nature 388, 190-5. Izquierdo, M., Grandien, A., Criado, L. M., Robles, S., Leonardo, E., Albar, J. P., de Buitrago, G. G. and Martinez, A. C. (1999) Blocked negative selection of developing T cells in mice expressing the baculovirus p35 caspase inhibitor. Embo. J. 18, 156-66. Kabra, N. H., Kang, C., Hsing, L. C., Zhang, J. and Winoto, A. (2001) T cell-specific FADDdeficient mice: FADD is required for early T cell development. Proc. Natl. Acad. Sci. U S A 98, 6307-12.


19

Kamitani, T., Nguyen, H. P. and Yeh, E. T. (1997) Activation-induced aggregation and processing of the human Fas antigen. Detection with cytoplasmic domain-specific antibodies. J. Biol. Chem. 272, 22307-14. Kang, P. M. and Izumo, S. (2000) Apoptosis and heart failure: A critical review of the literature. Circ. Res. 86, 1107-13. Kischkel, F. C., Hellbardt, S., Behrmann, I., Germer, M., Pawlita, M., Krammer, P. H. and Peter, M. E. (1995) Cytotoxicity-dependent APO-1 (Fas/CD95)-associated proteins form a death-inducing signaling complex (DISC) with the receptor. Embo. J. 14, 5579-88. Komiyama, T. C., Ray, A., Pickup, D. J., Howard, A. D., Thornberry, N. A., Peterson, E. P. and Salvesen, G. (1994) Inhibition of interleukin-1 beta converting enzyme by the cowpox virus serpin CrmA. An example of cross-class inhibition. J. Biol. Chem. 269, 19331-7. Kuida, K., Haydar, T. F., Kuan, C. Y., Gu, Y., Taya, C., Karasuyama, H., Su, M. S., Rakic, P. and Flavell, R. A. (1998) Reduced apoptosis and cytochrome c-mediated caspase activation in mice lacking caspase 9. Cell 94, 325-37. Kuida, K., Lippke, J. A., Ku, G., Harding, M. W., Livingston, D. J., Su, M. S. and Flavell, R. A. (1995) Altered cytokine export and apoptosis in mice deficient in interleukin-1 beta converting enzyme. Science 267, 2000-3. Kuida, K., Zheng, T. S., Na, S., Kuan, C., Yang, D., Karasuyama, H., Rakic, P. and Flavell, R. A. (1996) Decreased apoptosis in the brain and premature lethality in CPP32-deficient mice. Nature 384, 368-72. Li, H., Zhu, H., Xu, C. J. and Yuan, J. (1998) Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis. Cell 94, 491-501. Li, P., Allen, H., Banerjee, S., Franklin, S., Herzog, L., Johnston, C., McDowell, J., Paskind, M., Rodman, L., Salfeld, J. and et al. (1995) Mice deficient in IL-1 beta-converting enzyme are defective in production of mature IL-1 beta and resistant to endotoxic shock. Cell 80, 401-11. Li, M., Ona, V. O., Guegan, C., Chen, M., Jackson-Lewis, V., Andrews, L. J., Olszewski, A. J., Stieg, P. E., Lee, J. P., Przedborski, S. and Friedlander, R. M. (2000) Functional role of caspase-1 and caspase-3 in an ALS transgenic mouse model. Science 288, 335-9. Liu, X., Li, P., Widlak, P., Zou, H., Luo, X., Garrard, W. T. and Wang, X. (1998) The 40-kDa subunit of DNA fragmentation factor induces DNA fragmentation and chromatin condensation during apoptosis. Proc. Natl. Acad. Sci. U S A 95, 8461-6. Liu, Z., Sun, C., Olejniczak, E. T., Meadows, R. P., Betz, S. F., Oost,T., Herrmann, J., Wu, J. C. and Fesik, S. W. (2000) Structural basis for binding of Smac/DIABLO to the XIAP BIR3 domain. Nature 408, 1004-8. Locksley, R. M., Killeen, N. and Lenardo, M. J. (2001) The TNF and TNF receptor superfamilies: integrating mammalian biology. Cell 104, 487-501. Luo, X., Budihardjo, I., Zou, H., Slaughter, C. and Wang, X. (1998) Bid, a Bcl2 interacting protein, mediates cytochrome c release from mitochondria in response to activation of cell surface death receptors. Cell 94, 481-90. Mancini, M., Anderson, B. O, Caldwell, E., Sedghinasab, M., Paty, P. B. and Hockenbery, D. M. (1997) Mitochondrial proliferation and paradoxical membrane depolarization during terminal differentiation and apoptosis in a human colon carcinoma cell line. J. Cell. Biol. 138, 449-69. Martin, D. A., Siegel, R. M., Zheng, L. and Lenardo, M. J. (1998). Membrane oligomerization and cleavage activates the caspase-8 (FLICE/MACHalpha1) death signal. J. Biol. Chem. 273 4345-9. McAlindon, M. E., Hawkey, C. J. and Mahida, Y. R. (1998) Expression of interleukin 1 beta and interleukin 1 beta converting enzyme by intestinal macrophages in health and inflammatory bowel disease. Gut 42, 214-9.

20


Medema, J. P., Scaffidi, C., Kischkel, F. C., Shevchenko, A., Mann, M., Krammer, P. H. and Peter, M. E. (1997) FLICE is activated by association with the CD95 death-inducing signaling complex (DISC). Embo. J. 16, 2794-804. Metzstein, M. M., Stanfield, G. M. and Horvitz, H. R. (1998) Genetics of programmed cell death in C. elegans: past, present and future. Trends Genet. 14, 410-6. Mittl, P. R., Di, S., Marco, Krebs, J. F., Bai, X., Karanewsky, D. S., Priestle, J. P., Tomaselli, K. J. and Grutter, M. G. (1997) Structure of recombinant human CPP32 in complex with the tetrapeptide acetyl-Asp-Val-Ala-Asp fluoromethyl ketone. J.Biol. Chem. 272, 6539-47. Mocanu, M. M., Baxter, G. F. and Yellon, D. M. (2000) Caspase inhibition and limitation of myocardial infarct size: protection against lethal reperfusion injury. Br. J. Pharmacol. 130, 197-200. Muzio, M., Stockwell, B. R., Stennicke, H. R., Salvesen, G. S. and Dixit, V. M. (1998) An induced proximity model for caspase-8 activation. J. Biol. Chem. 273, 2926-30. Nicholson, D. W. (2000) From bench to clinic with apoptosis-based therapeutic agents. Nature 407, 810-6. O'Brien, V. (1998). Viruses and apoptosis. J. Gen. Virol. 79, 1833-45. Parrish, J., Metters, H., Chen, L. and Xue, D. (2000) Demonstration of the in vivo interaction of key cell death regulators by structure-based design of second-site suppressors. Proc. Natl. Acad. Sci. U S A 97, 11916-21. Rabizadeh, S., LaCount, D. J., Friesen, P. D. and Bredesen, D. E. (1993) Expression of the baculovirus p35 gene inhibits mammalian neural cell death. J. Neurochem. 61, 2318-21. Rajagopalan, S. and Balasubramanian, M. K. (2002) Schizosaccharomyces pombe Bir1p, a nuclear protein that localizes to kinetochores and the spindle midzone, is essential for chromosome condensation and spindle elongation during mitosis. Genetics 160, 445-56. Ray, C. A., Black, R. A., Kronheim, S. R., Greenstreet, T. A., Sleath, P. R., Salvesen, G. S. and Pickup, D. J. (1992) Viral inhibition of inflammation: cowpox virus encodes an inhibitor of the interleukin-1 beta converting enzyme. Cell 69, 597-604. Read, S. H., Baliga, B. C., Ekert, P. G., Vaux, D. L. and Kumar, S. (2002) A novel Apaf-1independent putative caspase-2 activation complex. J. Cell. Biol. 159, 739-45. Renatus, M., Stennicke, H. R., Scott, F. L., Liddington, R. C. and Salvesen, G. S. (2001) Dimer formation drives the activation of the cell death protease caspase 9. Proc. Natl. Acad. Sci. U S A 98, 14250-5. Renatus, M., Zhou, Q., Stennicke, H. R., Snipas, S. J., Turk D., Bankston, L. A., Liddington, R. C. and Salvesen, G. S. (2000) Crystal structure of the apoptotic suppressor CrmA in its cleaved form. Structure Fold Des. 8, 789-97. Riedl, S. J., Fuentes-Prior, P., Renatus, M., Kairies, N., Krapp, S., Huber, R., Salvesen, G. S. and Bode, W. (2001) Structural basis for the activation of human procaspase-7. Proc. Natl. Acad. Sci. U S A 98, 14790-5. Riedl, S. J., Renatus, M., Schwarzenbacher, R., Zhou, Q., Sun, C., Fesik, S. W., Liddington, R. C. and Salvesen, G. S. (2001) Structural basis for the inhibition of caspase-3 by XIAP. Cell 104, 791-800. Rodriguez, J. and Lazebnik, Y. (1999) Caspase-9 and APAF-1 form an active holoenzyme. Genes Dev. 13, 3179-84. Roulston, A., Marcellus, R. C. and Branton, P. E. (1999) Viruses and apoptosis. Annu. Rev. Microbiol. 53, 577-628. Roy, N., Deveraux, Q. L., Takahashi, R., Salvesen, G. S. and Reed, J. C. (1997) The c-IAP-1 and c-IAP-2 proteins are direct inhibitors of specific caspases. Embo. J. 16, 6914-25. Rudel, T. and Bokoch, G. M. (1997) Membrane and morphological changes in apoptotic cells regulated by caspase-mediated activation of PAK2. Science 276, 1571-4.


21

Saleh, A., Srinivasula, S. M, Acharya, S., Fishel, R. and Alnemri, E. S. (1999) Cytochrome c and dATP-mediated oligomerization of Apaf-1 is a prerequisite for procaspase-9 activation. J. Biol. Chem. 274, 17941-5. Schierle, G. S., Hansson, O., Leist, M., Nicotera, P., Widner, H. and Brundin, P. (1999) Caspase inhibition reduces apoptosis and increases survival of nigral transplants. Nat. Med. 5, 97-100. Seshagiri, S. and Miller, L. K. (1997) Baculovirus inhibitors of apoptosis (IAPs) block activation of Sf-caspase-1. Proc. Natl. Acad. Sci. U S A 94, 13606-11. Shi, Y. (2002) Mechanisms of caspase activation and inhibition during apoptosis. Mol. Cell. 9, 459-70. Siegel, R. M., Frederiksen, J. K., Zacharias, D. A., Chan, F. K., Johnson, M., Lynch, D., Tsien, R. Y. and Lenardo, M. J. (2000) Fas preassociation required for apoptosis signaling and dominant inhibition by pathogenic mutations. Science 288, 2354-7. Silke, J., Ekert, P. G., Day, C. L., Hawkins, C. J., Baca, M., Chew, J., Pakusch, M., Verhagen, A. M. and Vaux, D. L. (2001) Direct inhibition of caspase 3 is dispensable for the antiapoptotic activity of XIAP. Embo. J. 20, 3114-23. Silke, J., Hawkins, C. J., Ekert, P. G., Chew, J., Day, C. L., Pakusch, M., Verhagen, A. M. and Vaux, D. L. (2002) The anti-apoptotic activity of XIAP is retained upon mutation of both the caspase 3- and caspase 9-interacting sites. J. Cell Biol. 157, 115-224. Simons, M., Beinroth, S., Gleichmann, M., Liston, P., Korneluk, R. G., MacKenzie, A. E., Bahr, M., Klockgether, T., Robertson, G. S., Weller, M. and Schulz, J. B. (1999) Adenovirus-mediated gene transfer of inhibitors of apoptosis protein delays apoptosis in cerebellar granule neurons. J. Neurochem. 72, 292-301. Simonovic, M., Gettins, P. G. W. and Volz, K. (2000) Crystal structure of viral serpin crmA provides insights into its mechanism of cysteine proteinase inhibition. Protein Sci. 9, 1423-7. Skoufias, D. A., Mollinari, C., Lacroix, F. B. and Margolis, R. L. (2000). Human survivin is a kinetochore-associated passenger protein. J. Cell Biol. 151, 1575-82. Speliotes, E. K., Uren, A., Vaux, D. and Horvitz, H. R. (2000) The survivin-like C. elegans BIR-1 protein acts with the Aurora-like kinase AIR-2 to affect chromosomes and the spindle midzone. Mol. Cell. 6, 211-23. Sprick, M. R., Rieser, E., Stahl, H., Grosse-Wilde, A., Weigand, M. A. and Walczak, H. (2002) Caspase-10 is recruited to and activated at the native TRAIL and CD95 deathinducing signalling complexes in a FADD-dependent manner but can not functionally substitute caspase-8. Embo. J. 21, 4520-30. Stennicke, H. R., Ryan, C. A. and Salvesen, G. S. (2002) Reprieval from execution: the molecular basis of caspase inhibition. Trends Biochem. Sci. 27, 94-101. Sugimoto, A., Friesen, P. D. and Rothman, J. H. (1994) Baculovirus p35 prevents developmentally programmed cell death and rescues a ced-9 mutant in the nematode Caenorhabditis elegans Embo. J. 13, 2023-8. Sun, C., Cai, M., Gunasekera, A. H., Meadows, R. P., Wang, H., Chen, J., Zhang, H., Wu, W., Xu, N., Ng, S. C. and Fesik, S. W. (1999) NMR structure and mutagenesis of the inhibitor-of-apoptosis protein XIAP. Nature 401, 818-22. Suzuki, Y., Imai, Y., Nakayama, H., Takahashi, K., Takio, K. and Takahashi, R. (2001) A serine protease, HtrA2, is released from the mitochondria and interacts with XIAP, inducing cell death. Mol.Cell 8, 613-21. Thornberry, N. A. and Lazebnik, Y. (1998. Caspases: enemies within. Science 281, 1312-6. Thornberry, N. A., Rano, T. A., Peterson, E. P., Rasper, D. M., Timkey, T., Garcia-Calvo, M., Houtzager, V. M., Nordstrom, P. A., Roy, S., Vaillancourt, J. P., Chapman, K. T. and Nicholson, D. W. (1997. A combinatorial approach defines specificities of members of the

22


caspase family and granzyme B. Functional relationships established for key mediators of apoptosis. J. Biol. Chem. 272, 17907-11. Thompson, C. B. (1995)Apoptosis in the pathogenesis and treatment of disease. Science 267, 1456-62. Tingsborg, S., Zetterstrom, M., Alheim, K., Hasanvan, H., Schultzberg, M. and Bartfai, T. (1996) Regionally specific induction of ICE mRNA and enzyme activity in the rat brain and adrenal gland by LPS. Brain Res. 712, 153-8. Uren, A. G., Wong, L., Pakusch, M., Fowler, K. J., Burrows, F. J., Vaux, D. L. and Choo, K. H. (2000) Survivin and the inner centromere protein INCENP show similar cell-cycle localization and gene knockout phenotype. Curr. Biol. 10, 1319-28. Varfolomeev, E. E., Schuchmann, M., Luria, V., Chiannilkulchai, N., Beckmann, J. S., Mett, I. L., Rebrikov, D., Brodianski, V. MKemper, O. C., Kollet, O., Lapidot, T., Soffer, D., Sobe, T., Avraham, K. B., Goncharov, T., Holtmann, H., Lonai, P. and Wallach, D. (1998) Targeted disruption of the mouse Caspase 8 gene ablates cell death induction by the TNF receptors, Fas/Apo1, and DR3 and is lethal prenatally. Immunity 9, 267-76. Verhagen, A. M., Ekert, P. G., Pakusch, M., Silke, J., Connolly, L. M., Reid, G. E., Moritz, R. L, Simpson, R. J. and Vaux, D. L. (2000) Identification of DIABLO, a mammalian protein that promotes apoptosis by binding to and antagonizing IAP proteins. Cell 102, 43-53. Verhagen, A. M., Silke, J., Ekert, P. G., Pakusch, M., Kaufmann, H., Connolly, L. M., Day, C. L., Tikoo, A., Burke, R., Wrobel, C., Moritz, R. L., Simpson, R. J. and Vaux, D. L. (2002) HtrA2 promotes cell death through its serine protease activity and its ability to antagonize inhibitor of apoptosis proteins. J. Biol. Chem. 277, 445-54. Vucic, D., Kaiser, W. J., Harvey, A. J. and Mille, L. K. (1997) Inhibition of reaper-induced apoptosis by interaction with inhibitor of apoptosis proteins (IAPs). Proc. Natl. Acad. Sci. U S A 94, 10183-8. Vucic, D., Kaiser, W. J. and Miller, L. K. (1998) Inhibitor of apoptosis proteins physically interact with and block apoptosis induced by Drosophila proteins HID and GRIM. Mol. Cell Biol. 18, 3300-9. Walker, N. P., Talanian, R. V., Brady, K. D., Dang, L. C., Bump, N. J., Ferenz, C. R., Franklin, S., Ghayur, T., Hackett, M. C., Hammill, L. D. and et al. (1994) Crystal structure of the cysteine protease interleukin-1 beta-converting enzyme: a (p20/p10)2 homodimer. Cell 78, 343-52. Wallach, D., Varfolomeev, E. E., Malinin, N. L., Goltsev, Y. V., Kovalenko, A. V. and Boldin, M. P. (1999) Tumor necrosis factor receptor and Fas signaling mechanisms. Annu. Rev. Immunol. 17, 331-67. Wang, S., Miura, M., Jung, Y. K., Zhu, H., Li, E. and Yuan, J. (1998) Murine caspase-11, an ICE-interacting protease, is essential for the activation of ICE. Cell 92, 501-9. Wang, S. L., Hawkins, C. J., Yoo, S. J., Muller, H. A. and Hay, B. A. (1999) The Drosophila caspase inhibitor DIAP1 is essential for cell survival and is negatively regulated by HID. Cell 98, 453-63. Watt, W., Koeplinger, K. A., Mildner, A. M., Heinrikson, R. L., Tomasselli, A. G. and Watenpaugh, K. D. (1999) The atomic-resolution structure of human caspase-8, a key activator of apoptosis. Structure Fold Des. 7, 1135-43. White, K., Grether, M. E., Abrams, J. M., Young, L., Farrell, K. and Steller, H. (1994) Genetic control of programmed cell death in Drosophila. Science 264, 677-83. Wilson, K. P., Black, J. A., Thomson, J. A., Kim, E. E., Griffith, J. P., Navia, M. A., Murcko, M. A., Chambers, S. P., Aldape, R. A., Raybuck, S. A. and et al. (1994) Structure and mechanism of interleukin-1 beta converting enzyme. Nature 370, 270-5. Woo, M., Hakem, R., Soengas, M. S., Duncan, G. S., Shahinian, A., Kagi, D., Hakem, A., McCurrach, M., Khoo, W., Kaufman, S. A., Senaldi, G., Howard, T., Lowe, S. W. and


23

Mak, T. W. (1998) Essential contribution of caspase 3/CPP32 to apoptosis and its associated nuclear changes. Genes Dev. 12, 806-19. Wu, G., Chai, J., Suber, T. L., Wu, J. W., Du, C., Wang, X. and Shi, Y. (2000) Structural basis of IAP recognition by Smac/DIABLO. Nature 408, 1008-12. Xu, D. G., Crocker, S. J., Doucet, J. P., St-Jean, M., Tamai, K., Hakim, A. M., Ikeda, J. E., Liston, P., Thompson, C. S., Korneluk, R. G., MacKenzie, A. and Robertson, G. S. (1997) Elevation of neuronal expression of NAIP reduces ischemic damage in the rat hippocampus. Nat. Med. 3, 997-1004. Xu, D., Bureau, Y., McIntyre, D. C., Nicholson, D. W., Liston, P., Zhu, Y., Fong, W. G., Crocker, S. J., Korneluk, R. G. and Robertson, G. S. (1999) Attenuation of ischemiainduced cellular and behavioral deficits by X chromosome-linked inhibitor of apoptosis protein overexpression in the rat hippocampus. J. Neurosci. 19, 5026-33. Yang, X., Chang, H. Y and Baltimore, D. (1998). Autoproteolytic activation of pro-caspases by oligomerization."Mol. Cell. 1 319-25. Yeh, W. C., Pompa, J. L, McCurrach, M. E., Shu, H. B., Elia, A. J., Shahinian, A., Ng M., Wakeham, A., Khoo, W., Mitchell, K., El-Deiry, W. S., Lowe, S. W., Goeddel, D. V. and Mak, T. W. (1998) FADD: essential for embryo development and signaling from some, but not all, inducers of apoptosis. Science 279, 1954-8. Zhang, J., Cado, D., Chen, A., Kabra, N. H. and Winoto, A. (1998) Fas-mediated apoptosis and activation-induced T-cell proliferation are defective in mice lacking FADD/Mort1. Nature 392, 296-300. Zhou, Q. and Salvesen, G. S. (2000) Viral caspase inhibitors CrmA and p35. Methods Enzymol. 322, 143-54. Zhou, Q., Snipas, S., Orth, K., Muzio, M., Dixit, V. M. and Salvesen, G. S. (1997) Target protease specificity of the viral serpin CrmA. Analysis of five caspases. J. Biol. Chem. 272, 7797-800. Zou, H., Henzel, W. J., Liu, X., Lutschg, A. and Wang, X. (1997) Apaf-1, a human protein homologous to C. elegans CED-4, participates in cytochrome c-dependent activation of caspase-3. Cell 90, 405-13. Zou, H., Li, Y., Liu, X. and Wang, X. (1999) An APAF-1.cytochrome c multimeric complex is a functional apoptosome that activates procaspase-9. J. Biol. Chem. 274, 11549-56.

2.

THE BCL-2 FAMILY

AMELIA PETCH AND MOHAMED AL-RUBEAI University of Birmingham, Department of Chemical Engineering, Edgbaston, Birmingham B15 2TT, UK E-mail: [email protected]

1.

Introduction

Apoptosis plays a major role in the development and maintenance of homeostasis within all multicellular organisms (Raff, 1992). Therefore as with other processes that have been shown to be vital for survival, the genetic and molecular analysis of apoptosis has shown that it is highly conserved from nematodes to humans (Ellis et al., 1991; Steller, 1995 and Bargmann & Horvitz, 1991). Apoptosis is also involved in a wide range of pathological diseases, generally taking place due to the loss of regulatory pathways that traditionally control the mechanism of apoptosis onset. Considerable progress has been made in identifying the molecules that regulate the apoptotic pathway at each level with findings that often both positive and negative regulators are encoded for within the same family of proteins. These family members also often regulate the same extracellular, cell-surface and intracellular steps (Oltvai & Korsmeyer, 1994). Much has been accomplished in the field of cell death research since apoptosis was defined in 1972 (Kerr et al., 1972) with a major advance in understanding the regulation of cell death, bought about by the discovery of the Bcl-2 proto-oncogene (Bakhshi et al., 1985). It is widely understood that a variety of physiological signals as well as cellular insults can trigger the genetically programmed pathway of apoptosis. The pathway consists of two major routes, those of the caspase pathway and that of organelle disruption, namely mitochondrial dysfunction (for review see Green & Reed, 1998; Thornberry & Lazebnik, 1998). As the Bcl-2 (B cell lymphoma-2) family focus mainly on the mitochondrial membrane they play a pivotal role on the integrity of the mitochondrial membrane and thus are key regulators of deciding whether a cell should live or die (Kroemer et al., 1997). Although there are two pathways involved in the control of apoptosis they are by no means distinct and as such show much cross talk between the molecules involved with each pathway. Indeed, the mitochondria are considered by many to be the central control point of apoptosis through the integration of death signals via the Bcl-2 family and coordination of caspase activation through the release of cytochrome c as a result of the outer mitochondrial membrane becoming permeable. 25 M. Al-Rubeai and M. Fussenegger (eds.), Cell Engineering, Vol. 4, 25-47. © 2004 Kluwer Academic Publishers. Printed in the Netherlands.

26 2.

A. PETCH and M. AL-RUBEAI Members of the Bcl-2 Family

The Bcl-2 family constitutes a critical intracellular checkpoint of apoptosis within a common cell death pathway. Many of the members of the family have been identified as a result of a disease state and thus were first thought to constitute similar properties to oncogenes, in that they would enhance cellular proliferation. The first member of the family to be identified, Bcl-2, was presented at the interchromosomal breakpoint of t (14:18), the molecular hallmark of follicular B cell lymphoma (Bakhshi et. al., 1985;Tsujimoto et al., 1985; Tsujimoto & Croce, 1986; and Cleary et al., 1986). However, it was later discovered that the Bcl-2 functions in preventing cell death rather than promoting cell proliferation (Vaux et al., 1988; and Hockenbery et al., 1990) and subsequently allow the cells to enter Go and exist in a state of quiescence. Thus Bcl-2 is a new class of oncogene that allows neoplastic growth by suppressing cell death. Subsequent to the discovery of Bcl-2 in mammalian cells it was discovered to be a homologue to the protein ced-9 in C. elegans. Since then at least 20 Bcl-2 family members have been identified in mammalian cells with those listed in table 1 being the more prominent members to date. Table 1. Human Bcl-2 family members

Family member Bcl-2 Bcl-xL Bcl-w Bax Bid Bak Bik Bad A1 Mcl-1 Bcl-xS

2.1

Function Anti-apoptotic Anti-apoptotic Anti-apoptotic Pro-apoptotic Pro-apoptotic Pro-apoptotic Pro-apoptotic Pro-apoptotic Anti-apoptotic Anti-apoptotic Pro-apoptotic

Interaction Bax, Bak Bax, Bak Unknown Bcl-2, Bcl-XL Bcl-2, Bcl-XL, Bcl-XS, Bax Bcl-2, Bcl-XL Bcl-2, Bcl-XL Bcl-2, Bcl-XL Bax Unknown Bax, Bak

BAX

Bax, Bcl-2 associated X protein, was the first of the other family members to be discovered by co-immunoprecipitation studies with Bcl-2 (Oltvai et al., 1993) however the tissue distribution of Bax is more wide spread than that of Bcl-2 (Krajewski et al., 1994b). Bax shows a large degree of conservation in its BH1 and BH2 regions with Bcl-2 and can be found in various differential splice forms, with the most common form being Bax-Į (Olsen et al., 1996) however the functional variation of these splice forms remains to be elucidated. The finding that the Bax gene promoter contains four p53 binding sites indicates that it is up-regulated at the

THE BCL-2 FAMILY

27

transcriptional level by p53 (Miyashita & Reed, 1995) and thus that Bax may function as a primary response gene in the p53-mediated pathway of apoptosis initiation (Miyashita et al., 1994; Hussain & Harris, 2000). However, Bax expression can be modulated by other factors as its mRNA levels have been shown to be down-regulated in IL-6 treatments of leukaemia cell lines (Lotem & Sachs, 1995). 2.2

BCL-X

Bcl-x was initially isolated in chicken lymphoid cells using a cDNA Bcl-2 probe and was found to share 44% sequence homology with Bcl-2 (Boise et al., 1993). It was also shown to interact with other family members in a similar manner to that of Bcl-2 (Sato et al., 1994). Bcl-xL exhibits high structural conservation to Bcl-2 in that it contains the essential BH1 and BH2 domains, however the splice variant form, Bcl-xS only contains the BH3 and BH4 domains (Boise et. al., 1993). Both the level and pattern of expression of Bcl-x is different from that of Bcl-2 with expression levels generally higher for Bcl-x in all tissues with the exception of the lymph nodes (Rouayrenc et al., 1995; Krajewski et. al., 1994b), however the subcellular distribution of the two proteins are similar indicating similar functions (Gonzalez-Garcia et al., 1994). Bcl-xL was shown to inhibit apoptosis in growth factor deprivation studies whereby Bcl-xS was shown to counteract the function of Bcl-2 (Boise et. al., 1993). Although Bcl-2 and Bcl-xL initially seemed to show similar functions, differences in tissue distribution and knockout studies indicate that this may not be the case (Choi et al., 1995). 2.3

BAK

Bak (Bcl-2 homologous antagonist / killer) was cloned from human heart and Epstein-Barr transformed human B-cells (Farrow et al., 1995) with three closely related Bak genes found on three different chromosomal locations. Sequence analysis showed that Bak contained the same hydrophobic carboxy-terminal domain found on Bcl-2 and Bcl-xL, indicating that it was also an integral membrane protein (Griffiths et al., 1999), however expression levels and tissue distribution varied (Kiefer et al., 1995). Bak has been shown to promote apoptosis in response to IL-3 withdrawal but inhibits apoptosis in response to serum withdrawal (Chittenden et al., 1995; Kiefer et. al., 1995). Bak is shown to co-immunoprecipitate with Bcl-xL when under non-apoptosis inducing conditions but does not co-immunoprecipitate following apoptotic stimulation. This suggests that upon stimulation of apoptosis, Bak undergoes a conformational change resulting in dissociation of Bak from BclxL leaving Bak free to exert its pro-apoptotic effect (Griffiths et. al., 1999). Further studies suggest that oligomerisation of Bak in the mitochondrial membrane allows release of cytochrome c and thus apoptosis initiation (Wei et al., 2000).

28 2.4

A. PETCH and M. AL-RUBEAI BAD

Bad (Bcl-xL/ Bcl-2 associated death promoter homologue) was shown to heterodimerise with Bcl-2 in vivo but was first discovered by its interaction with Bcl-2 in a yeast two-hybrid system (Yang et al., 1995a). Bad shares limited sequence homology with Bcl-2 but the functional significant sequences within the BH1 and BH2 domains are conserved. Bad plays an important role in the dissociation of Bax from its complex with Bcl-2 or Bcl-xL due to its regulation by phosphorylation. However, this will be detailed further in the section concerning mechanisms of action. 2.5

MCL-1

Mcl-1 (human myeloid differentiation protein), which shares sequence homology with Bcl-2 in the BH1 and BH2 domains and possesses a carboxyterminal transmembrane anchor domain (Yang et al., 1995b) was shown to interact strongly and selectively with Bax but not with any other Bcl-2 family proteins in a yeast two-hybrid system (Sedlak et al., 1995; Sato et. al., 1994). Mcl-1 has also been shown to protect cells against constitutively induced apoptosis by expression of Bax or c-myc, however, its anti-apoptotic effect is not as great as that exhibited by Bcl-2 (Reynolds et al., 1994). The tissue distribution of Mcl-1 compared to that of Bcl-2 is significantly different indicating that maybe Mcl-1 is an alternative to Bcl-2 where tissues cannot express Bcl-2. It is theorised that Mcl-1 blocks apoptosis until Bcl-2 can be up-regulated (Krajewski et al., 1994a). 2.6

A1

A1 is an early response gene whose expression level is decreased immediately following induction of differentiation in predominantly haematopoietic tissues (Lin et al., 1993). Again yeast two-hybrids indicate that A1 interacts specifically with Bax but not with any other Bcl-2 family members. It also shows sequence homology between the BH1 and BH2 domains of Bcl-2 but does not possess a carboxy terminal transmembrane domain (Sedlak et. al., 1995; Sato et. al., 1994). Reports have shown that A1 can protect against TNF-induced apoptosis in the presence of actinomycin D and inhibit ceramide cell death in endothelial cells (Karsan et al., 1996). 2.7

BID

Bid is a BH3 interacting domain death agonist that was initially identified due to its interaction with both Bcl-2 and Bax proteins (Wang et al., 1996). Sequence analysis showed that it only contained homology within the BH3 domain and is

THE BCL-2 FAMILY

29

predominantly localised within the cytoplasm with only a small fraction of the cellular levels located in membranes. Bid interacts with both death agonists and antagonists but does not form homodimers. However it was observed by mutational analysis that the BH3 domain was crucial for interaction with Bax and Bcl-2 (Bruckheimer et al., 1998). 2.8

BIK

Bik (Bcl-2 interacting killer protein) is a Bcl-2 family member detected in a human B-cell line using the yeast two-hybrid system to detect proteins that will interact with Bcl-2 (Boyd et al., 1995). The study also looked at the expression of Bik in rat-1 fibroblasts with the outcome of reduced viability in Bid transfected cells. Upon co-transfection with Bcl-2 and Bcl-xL however the death inducing effects of Bid were abrogated. Bcl-xS was also shown to interact with Bid however, indicating that BH1 and BH2 domains are not essential for Bid interactions. Bik induced apoptosis was inhibited by the addition of the caspase inhibitor, zVAD-fmk, indicating that the induced cell death by Bik involves the activation of proteases (Orth & Dixit, 1997). 2.9

BCL-W

Bcl-w possesses the conserved BH1, BH2 and BH3 domains indicative of the Bcl-2 family and was first cloned using degenerate primers to the BH1 and BH2 domains in a PCR reaction (Gibson et al., 1996). Bcl-w has been shown to protect against apoptosis to a similar extent as that of Bcl-2 and Bcl-xL in haematopoietic cell lines induced by a number of cytotoxic stimuli, including Ȗ-irradiation and IL-3 withdrawal but did not protect B lymphoma cells from CD-95 apoptotic induction while Bcl-2 and Bcl-xL were able to do so. Bcl-w’s role in promoting cell survival was also illustrated by the breeding of Bcl-w-deficient mice, which showed testicular degradation and were sterile (Ross et al., 1998).

3.

What Makes a Family Member

In order to distinguish a member of the growing Bcl-2 family a protein must contain at least one of four homology domains referred to as Bcl-2 homology domains (BH1-BH4). As previously mentioned the family is broadly divided into two main categories those of anti-apoptotic and those that are pro-apoptotic. However the latter category has more recently been divided further into those containing the usually conserved BH1 and BH2 domains and those that contain only the BH3 domain.

30

A. PETCH and M. AL-RUBEAI

The highly conserved homology domains BH1 and BH2 seem to be important for Bcl-2 function and allow it to form heterodimeric complexes with other family members and thus to carry out its anti-apoptotic function (Hanada et al., 1995; Tanaka et al., 1993; Yang et. al., 1995a). In Bcl-2 and Bcl-XL the BH1-BH3 domains form a hydrophobic groove that the BH4 domain then stabilises by inserting hydrophobic residues that would otherwise be exposed (Aritomi et al., 1997; Petros et al., 2001; Huang et al., 2002). Site directed mutagenesis studies have revealed that the BH1 and BH2 domains can prevent the Bcl-2 molecule from forming heterodimers and thus abrogate its anti-apoptotic function (Yin et al., 1994; Borner et al., 1994). Thus this suggests that the hydrophobic groove formed by these regions is essential for the correct functioning of the anti-apoptosis proteins and thus that this groove may constitute the site at which the pro-apoptotic proteins (such as Bax in the case of Bcl-2 and Bak or Bad in the case of Bcl-XL) are likely to compete for binding (Sattler et al., 1997; Spector et al., 1997; del Peso et al., 2000; Petros et al., 2000). Figure 1 shows the main Bcl-2 family members and the conserved regions that they contain. It can be clearly seen that many of the anti-apoptotic members of the family display sequence homology in all four conserved regions however, the proapoptotic members display less sequence homology of the first Į-helical segment, BH4. Deletion and mutagenesis studies show that the BH3 domain is vital as a death domain in the pro-apoptotic members, which is now further supported by the emergence of the BH3-only domain members (Chou et al., 1999; McDonnell et al., 1999). How Bcl-2 family members interact with each other and other molecules within the cell is of major importance in our understanding of how these molecules function in both their normal role and in their neoplastic role. One such approach to determine their function, and that taken by many in the field of apoptosis, is to identify cellular proteins that interact with Bcl-2. The first of the family members following Bcl-2, to be identified was that of Bax (Oltvai et. al., 1993). Functional studies showed that Bax has the ability to suppress Bcl-2 from its anti-apoptosis function via heterodimerising with Bcl-2 thus preventing from interacting with other molecules necessary to allow prevention of apoptosis. Similar scenarios were found whereby the Bcl-xL splice variant, a potent inhibitor of apoptosis, is antagonised by the BCL-xS splice variant by interacting with Bcl-xL product and preventing its function (Boise et. al., 1993).

THE BCL-2 FAMILY

31

Figure 1. Schematic diagram of the protein structure of the Bcl-2 family members. BH1, BH2 BH3 and BH4 are the conserved domains and TM is the transmembrane anchoring domain but is not carried by all members.

Indeed many of the pro-apoptotic proteins such as Bad and Bak can also interact in similar ways to those of Bax and Bcl-xS by interacting with the likes of Bcl-2 and Bcl-XL antagonising their function. It was noted that in these studies the interaction of the pro-apoptotic proteins Bax and Bak only interact via a short stretch of their BH3 domain to allow interaction with the anti-apoptotic molecules to abrogate their activity. Thus it was proposed that other molecules possessing this domain may function similarly to inhibit Bcl-2 and similar members, eventually allowing the emergence of the sub-category of pro-apoptotic members that contain BH3-only domains (for review see White, 1996). However, it is only the BH3-only and Baxlike proteins that have their BH3 domain in an accessible position for binding. Structural studies of Bcl-2 and Bcl-xL show their BH3 to be contained within their hydrophobic groove thus it is not accessible to bind to other apoptotic proteins. This may explain why Bcl-2 and Bcl-xL do not form heterodimers with each other or homodimerise (Conus et al., 2000) although results may vary in vitro (Hanada et. al., 1995).

32 4.

A. PETCH and M. AL-RUBEAI Mechanisms of Action

The Bcl-2 family is a large group of apoptosis regulators, which through the diverse interactions with themselves and other proteins regulates the integrity of the mitochondrial membrane. The mechanism by which Bcl-2 family proteins regulate apoptosis has been subject of intensive research. Currently it remains controversial and several models have been proposed (for reviews see Rao & White, 1997; Wang et al., 1999; Borner, 2003). It is thought however, that several different cellular mechanisms exist to modulate the activity of both the pro- and anti-apoptotic members of the Bcl-2 family and that no one mechanism alone is responsible for the modulation of all of the family members. Members of the family contain both antiapoptotic and pro-apoptotic members and it is proposed that through their interaction together they can “neutralise” each other’s function and thus maintain a delicate balance. However the excess of one or the other can tilt the balance toward cell survival or death. Thus the dimerisation state of the family members plays a key role in the individual activities of family members. For example, Bcl-2 and Bcl-xL have the ability to dimerise with Bax to neutralise its activity. Whilst in this complex, Bax is sequestered, but once free is able to homodimerise and exert its proapoptotic function (Gross et al., 1998; Minn et al., 1998). Thus in this way, the expression levels of the family members is able to regulate the onset of apoptosis. If the levels of Bcl-2 are greater than those of Bax then a cell is protected from apoptosis, however once the levels of Bax are greater than Bcl-2 then a cell is more prone to undergo apoptosis. Secondly the phosphorylation status of the family members plays an important part in the regulation of apoptosis. For example, when Bad is in its unphosphorylated form it can dimerise with Bcl-2 and Bcl-xL and thus neutralise their anti-apoptotic activity allowing Bax to homodimerise (Yang et. al., 1995a). However, in its phosphorylated form it is sequestered by 14-3-3 protein and therefore cannot interact thus allowing apoptosis to be inhibited by Bcl-2 and Bcl-xL (Korsmeyer, 1999). Cleavage pathways can also regulate Bcl-2 family members and thus the interaction and cross talk between the two main apoptosis pathways of mitochondrial and caspase activation are addressed. Upon activation of the death receptors by Fas binding, the caspase pathway is initiated allowing activation of caspase 8 and subsequently caspase 3. Bcl-2 and Bcl-xL have been shown to be cleaved by caspases whereby the cleaved proteins are no longer able to elicit their protective effect upon the cell and in some instances become pro-apoptotic (Fujita et al., 1998; Clem et al., 1998). In other family members cleavage by caspases allows the activation of that member to perform its regulatory function. For instance Bid, in its full-length form, is inactive, but once cleaved by caspase-8 mediated cleavage, Bid induces cytochrome c release from the mitochondria (Gross et al., 1999; Li et al., 1998; Luo et al., 1998).

THE BCL-2 FAMILY

33

Finally, the conformational shape of the Bcl-2 family members can also affect their modulation of apoptosis with the most studied member of the family regulated by this method being that of Bax. In its inactive state Bax exists in a conformation that is resistant to protease cleavage, however once activated it translocates to the mitochondria whereby the N-terminal region of this protein becomes susceptible to protease cleavage. The authors of this study suggest that Bax has therefore undergone a conformational change possibly bought about by changes in pH (Khaled et al., 1999). Although the above theories indicate how Bcl-2 family members interact with each other to initiate the promotion or prevention of apoptosis, they do not fully explain how individual proteins are thought to initiate apoptosis at the molecular level. One such hypothesis is that anti-apoptotic proteins such as Bcl-2 and Bcl-xL and pro-apoptotic proteins such as Bax are capable of forming distinct ion conductive channels in lipid membranes such as the mitochondrial membrane causing changes in ions such as Ca2+, K+ and Cl-. These changes may conform to mitochondrial dysfunction such as mitochondrial swelling, a characteristic of apoptosis. The theories surrounding the molecular levels of Bcl-2 family interactions are reviewed in detail elsewhere (Borner, 2003).

5.

Cell Engineering Approaches of Bcl-2

The use of the Bcl-2 family in cell engineering is a topic of great interest and can manifest in two main approaches. Firstly those approaches aimed at increasing apoptosis either by decreasing the anti-apoptosis members of the family or increasing the pro-apoptotic members of the family. This approach is most likely to be found in the clinic where by neoplastic cells have arisen due to lack of growth control / loss of apoptotic function or in immunological disorders such as immunodeficiency or autoimmunity. Furthermore conditions such as AIDS, neurodegenerative diseases, stroke and renal hypoxia arise due to increased apoptosis thus loss of essential cell types for normal function (for review see Antonsson, 2001). Alternatively an engineering approach could be to decrease the likelihood of apoptosis to allow the cell to survive irrespective of the conditions and signals that it faces. For example in the biotechnology field whereby mammalian cells and viruses are often used to produce potential therapeutic drugs it is advantageous to allow the cell to survive and divide for as long as possible in order to maximise production from that particular cell. It is clear that as the Bcl-2 family plays a central role in the control of cell survival it is a vital target for many therapies and engineering approaches and thus some of the most prominent of these approaches will be discussed here.

34 5.1

A. PETCH and M. AL-RUBEAI BCL-2 FAMILY MEMBERS AS TARGETS FOR IMMUNOTHERAPY

As Bcl-2 family members maintain a central role in life and death decisions they play a pivotal role in the homeostasis of immune cells at every point where such a decision is required. Whether it is the development of B-cells to secret antibody required, the maintenance of memory cells or the activation induced cell death of T and B cells once their function is completed, it is clear that the malfunction of the Bcl-2 family at these critical times can lead to catastrophic problems within the cell. Physiological regulation of cell death in lymphocytes during development is vital to ensure autoreactive lymphocytes are removed and that excess, eventually damaging cells, after the completion of an immune response are removed. Failure to do so can lead to autoimmune diseases or leukemic disease giving rise to chromosomal translocations such as those found with Bcl-2 in B-cell lymphoma. By contrast, mutations and infections that impair survival signals can provoke excessive death of immune cells leading to immunodeficiency. Extrinsic signals act in a limited and tissue specific manner to ensure the correct numbers of lymphocytes are produced at the correct location. Bcl-2 and Bcl-xL are capable of preventing neglect-induced cell death. Bcl-2 and Bcl-xL transgenic mice accumulate vast amounts of lymphocytes depending on cell type targeted (Van Parijs et al., 1998) and the increase in numbers is gene-dose dependant, however the number that are produced and the number that survive exhibit large discrepancies indicating that Bcl-2 and Bcl-xL can not be solely responsible (Rathmell et al., 2000). A1, also an anti-apoptotic member of the Bcl-2 family which shows great homology to Bcl-2 is necessary for haemopoietic cell survival as its deletion leads to accelerating neutrophil apoptosis (Hamasaki et al., 1998). Under infection conditions A1 has been shown to be induced, in order to allow the cells to survive an acute inflammatory response demonstrated by the lack of such a response in A1deficient cells (Orlofsky et al., 2002). The myeloid cell leukemia-1 gene (Mcl-1) was first identified by its increased expression early on in the differentiation of a human myeloid leukemic cell line (Kozopas et al., 1993). In normal peripheral blood B cells treated with agents that either promote survival or enhance cell death the up-regulation of Mcl-1 correlates with cell survival and the down-regulation of Mcl-1 correlates with cell death. In contrast Bcl-2 expression levels remain unchanged under the same conditions indicating that Mcl-1 may function as an alternative to Bcl-2 in cells where Bcl-2 does not function or is not expressed (Lomo et al., 1996). The discovery of how immune cells regulate their function in normal tissue can help us to determine the potential genes to target in immunotherapy treatments. However, the use of genetically modified effector cells in gene-modified adoptive cellular immunotherapy requires the in vivo survival of the cells. Thus the ability to modulate apoptosis in these cells and thus increase survival is vital. Eaton et al.

THE BCL-2 FAMILY

35

(2002) transduced human peripheral blood lymphocytes using a retroviral vector that expresses Bcl-xL in vitro. They showed that over-expression of Bcl-xL promotes the survival of lymphocytes cultured in the absence of interleukin-2 (IL-2) and also in the presence of apoptosis inducing agents. Results did not show any signs of malignancy or autoimmunity in SCID mice injected with the Bcl-xL-transduced lymphocytes thus indicating the usefulness of this approach (Eaton et al., 2002). It is postulated that this approach could improve the clinical outcome of adoptive cellular therapy. Similarly, the role of Bcl-2 in a subset of AIDS patients has enabled us to provide a more effective treatment regime. David et. al. (2002) found that AIDS patients with a low response to CD4 treatment possessed CD4 T-lymphocytes with reduced Bcl-2 expression and thus were more susceptible to spontaneous apoptosis. IL-2 treatment, which is shown to induce Bcl-2 and participate in the control of lymphocyte apoptosis, was shown to be un-reactive in these patients due to the under-expression of the Bcl-2 gene (David et al., 2002). Furthermore identification of aberrant gene expression in tumour cells can lead to the better design of immunotherapy treatments. Cytokine-mediated apoptosis in tumour cells can be achieved through nitrous oxide (NO) either from the cell itself or exogenously from macrophages or endothelial cells. It has been shown that cells that over-express Bcl-2 are capable of protecting themselves from NO-induced apoptosis (Xie et al., 1996). Thus abnormal expression of Bcl-2 may influence the efficacy of tumour immunotherapy. The use of BH-3 mimetics to interfere with autoimmunity or lymphomas has been shown to be a potential future therapy in other cell types. The BH-3 mimetics interfere with anti-apoptotic factors allowing the release of the Bax-like proapoptotic factors allowing apoptosis to be triggered in these otherwise damaging cells (Degterev et al., 2001; Enyedy et al., 2001; Tzung et al.). 5.2 THE ROLE OF BCL-2 FAMILY MEMBERS IN CANCER AND POTENTIAL TARGETS FOR THERAPY When considering the methods by which most malignant cancers arise it is inevitably due to loss of control of growth of an individual or group of cells. Furthermore, it usual to find that these cells would normally have undergone apoptosis to counteract this over stimulation of growth but in fact continue to survive. It is clear therefore that these cells also undergo a loss in apoptotic control predictably due to loss of expression of pro-apoptotic regulators or more commonly over-expression of anti-apoptotic regulators. This was first evident by the discovery of the role of Bcl-2 expression in follicular B-cell lymphoma. The rearrangement of chromosomes found in this malignancy allows the Bcl-2 gene to become juxtaposed to the heavy chain of IgG, whose enhancers are thought to increase expression of the Bcl-2 allowing decreased apoptosis and thus uncontrolled cell growth within these

36


cells (Weiss et al., 1987; and Chen-Levy et al., 1989). High levels of Bcl-2 expression have now been observed in a wide variety of human cancers, including ~70% of breast cancers, 30%-60% of prostate cancers, ~90% of colorectal cancers, ~60% of gastric cancers, 100% of small cell lung carcinomas, ~20% of non-small cell lung carcinomas, ~30% of neuroblastomas, ~80% of B-cell lymphomas and variable percentages in melanomas, renal cell, and thyroid cancers as well as acute and chronic lymophocytic and non-lymphocytic leukaemia’s (Reed et al., 1996; Reed, 1994). The expression level of Bcl-2 also correlates with relative resistance to a spectrum of chemotherapeutic drugs and -irradiation, which thus seem to emerge on the apoptotic pathway at the same point to execute apoptosis (Huang, 2002). Post-translational modifications of Bcl-2, such as phosphorylation and proteolysis can lead to modulation of its protective function. The evidence that drugs targeted to the mitochondria and DNA damaging agents may induce phosphorylation of Bcl-2 (De Cesare et al., 1998; Pratesi et al., 2000), suggests the possibility of exploiting novel targets to improve the therapeutic efficacy of conventional drugs and circumvent the Bcl-2 mediated response to apoptosis. Many of the therapeutic and thus cell engineering approaches to treating Bcl-2 family malfunctions within tumours are reliant on small molecule inhibitors or antisense oligonucleotide targeting of the protein / gene of interest. As previously stated the range of malignancies and therefore the variations in Bcl-2 family expression is vast and increasing at an alarming rate thus this topic is addressed else where within this issue (Therapeutic small molecule inhibitors of Bcl-2), however this approach can only be used to target genes / proteins that are up-regulated and they still have many drawbacks. An increasingly popular approach to targeting tumours is the gene therapy approach with this strategy also a possibility for the Bcl-2 family of genes. Gene therapy is generally used to replace genes that have been lost or whose expression is low resulting in the accumulation of malignancies. In most cancers it is the antiapoptotic genes that are over-expressed however as mentioned previously the balance between the anti- and pro-apoptotic members provides the decision point of whether a cell should enter apoptosis or not. Thus the gene therapy approach relies on the increase of pro-apoptotic molecules within the cell to counterbalance the overexpression of the anti-apoptotic molecules. For instance it has been shown that in prostrate cancer Bcl-2 is widely over-expressed and although this has been targeted with conventional drugs and antisense oligonucleotides (Dorai et al., 1997a, Dorai et al., 1997b) there is still scope for improvement. A future gene therapy goal could be designed to give up-regulation of Bax as a promoter of apoptosis and thus down-regulator of Bcl-2, thus allowing greater chemosensitivity to conventional chemotherapeutic drugs (Shalev et al., 2001).

THE BCL-2 FAMILY

37

5.3 EXPLOITING THE ROLE OF THE BCL-2 FAMILY TO ENHANCE BIOTECHNOLOGY PRODUCTION Therapeutic proteins requiring high dose, chronic administration necessitate the development of highly productive manufacturing processes. Traditional bioreactor processes will continue to provide the fastest and most risk-averse means of making material for early stage clinical studies. Thus maximisation of process productivity has been achieved previously by optimising bioreactor design and media formulation. However, much attention in recent years has been focused on improving cell survival by inhibiting apoptosis in the culture environment. The Bcl-2 gene as previously stated, has been demonstrated to suppress apoptosis in a wide variety of cell lines, especially those that are industrially relevant such as hybridomas, myeloma, Chinese hamster ovary (CHO), baby hamster kidney (BHK) and insect cells. Therefore it was inevitable that it should become the first target for suppression of apoptosis during the bioprocessing of mammalian cells. Indeed the impact of this gene, and some of its family members, on various aspects of cell culture has now been extensively studied. The first report of Bcl-2 suppression of apoptosis in industrial systems was performed using a hybridomas cell line (Itoh et al., 1995). The overexpression of Bcl-2 within these cultures was shown to prolong viable culture period and enhance antibody productivity. Subsequently, Singh, R. et al. (1996) examined the effects of Bcl-2 and over-expression on apoptosis in a Burkitt lymphoma cell line in comparison to a control transfection (Singh et al., 1996). At the stationary phase of the culture it was found that the Bcl-2 containing cell line possessed a reduced rate of total cell death and subsequently a reduction in apoptosis levels. Analysis into the metabolic conditions of the culture showed that the control cell line exhibited cell death following glutamine deprivation but that the Bcl-2 containing line was able to sustain viability until glucose had been completely utilised. It was also shown that not only did the over-expression of Bcl-2 enhance protection of apoptosis but also allowed increased adaptation to suspension culture and serum-free media without prior adaptation. Similar finding were observed with bcl-2 transfected hybridomas cultures (Simpson et al., 1997). Bcl-2 over-expression significantly extended culture viability following hyperoxia, hypoxia, glutamine and glucose deprivation and under serum limited conditions. In CHO cells the removal of insulin and transferrin from the culture media resulted in decreased viabilities due to apotosis but Bcl-2 expression was able to overcome this (Goswami et al., 1999). While the over-expression of Bcl-2 has been shown to increase the culture viability and productivity of some cell lines (Simpson et. al., 1997; Tey et al., 2000a; Tey et al., 2000b) others are not protected by this method (Murray et al., 1996; Fujita et al., 1997). The discovery that these cell lines naturally show increased Bcl-xL expression bought about the idea that over-expression of this gene and maybe other Bcl-2 family genes in mammalian cells would be beneficial in cell

38


engineering approaches. Murine hybridomas cells over-expressing Bcl-xL were found to exhibit increased survival when subjected to stresses such as nutrient limitation in stationary batch cultures (Charbonneau & Gauthier, 2000). A CHO cell line engineered for the production of the common cold therapeutic sICAM and adapted for growth in suspension and serum-free culture was examined for the possible protective effects of Bcl-2 and Bcl-xL on cell survival and productivity. It was observed that no significant effect on apoptosis protection was found with either gene expressed but that Bcl-xL expression, but not Bcl-2, allowed increased productivity. Bcl-2 and Bcl-xL only showed their anti-apoptosis potential following dhfr-based amplification and that Bcl-xL still outperformed Bcl-2 (Meents et al., 2002). Recent studies using inducible expression of Bcl-xL have shown that in hybridoma cultures subjected to cyclohexamide treatment the expression of Bcl-xL during the antibody production phase only allowed increased productivity with no detrimental effects on genetic stability (Jung et al., 2002). The necessity for the development of animal component free medias in the biotechnology industry is becoming ever more important. However, many basal medias that have been developed still contain trace amounts of vitamins, amino acids and ions thought to be essential for cellular growth and biological production and indeed it has been shown that withdrawal of these vitamins individually or as a whole can attribute to apoptosis in cells deprived of these essential nutrients. It has been shown however that in all cases of deprivation, Bcl-2 over-expression in the cell has enabled withdrawal of these nutrients to occur. For instance Bcl-2 suppresses apoptosis induced by removal of any single or a combination of any amino acids from the culture media (Simpson et al., 1998). Similarly the removal of one or all vitamins from the culture media induced apoptosis, which was protected by Bcl-2 expression within the cells (Ishaque & Al Rubeai, 2002). Further studies suggest that Bcl-2 also protects cells from physiochemical parameters such as sub-optimal pH, hyper-osmolality and shear stress (Perani et al., 1998). Furthermore protection by Bcl-2 has been demonstrated in a number of production processes including fixed fed (Fussenegger et al., 2000) and high cell density perfusion cultures (Fassnacht et al., 1999). The induction of apoptosis in response to viral infection is an important natural defence mechanism to prevent the spread of infection. Very high product titres can be obtained using virus expression systems but these often lead to cell death of the cell by apoptosis. The expression of Bcl-2 has been shown to extend the lifespan of baculovirus infected insect cells but unfortunately did not extend the duration of infection (Alnemri et al., 1992). AT3 cells transfected with Bcl-2 however were able to extend the culture viability upon viral infection by seven days compared to the control cell line. Furthermore the production of a model protein was increased and amplified following re-infection with recombinant virus (Mastrangelo et al., 1996). Transfection of BHK and CHO cells with either Bcl-2 or Bcl-xL showed that these

THE BCL-2 FAMILY

39

cell lines with the exception of the CHO-bcl-2 cells exhibited greater protection from apoptosis induced upon viral infection. Furthermore productivity of a model protein expressed by the virus was increased by up to 2-fold with the cells also recovering from viral infection and able to continue exponential cell growth (Mastrangelo et al., 2000a). Other culture insults known to induce apoptosis were also investigated in these cell lines with varying degrees of effectiveness found. BHK cultures expressing Bcl-2 could not protect from glucose deprivation but significantly improved viabilities in the absence of serum. In contrast, Bcl-xL overexpression protected cells from glucose deprivation allowing cells to remain viable for up to three weeks culture time. CHO cells however showed similar protection characteristics from both glucose and serum deprivation with Bcl-xL offering higher protection than Bcl-2 (Mastrangelo et al., 2000b). Many studies have now begun to examine the effects of cell cycle arrest as a means to increase energy drive towards productivity as opposed to cell growth. Thus once cell growth is deemed to have reached its maximum, cell cycle is inhibited. This however has been shown to induce apoptosis thus little or no advantage is gained over productivity (Al-Rubeai & Emery, 1990; Al-Rubeai et al., 1992). One such approach in a CHO cell line was used whereby a mutant p53 gene was transfected into these cells with the outcome of inhibiting cell cycle without the apoptotic function of the gene. This allowed increased expression of the model reported gene without the onset of apoptosis upon cell cycle arrest (Fussenegger et al., 1997). Approaches used to overcome the onset of apoptosis have been to overexpress Bcl-2 in these cells also however the effect of Bcl-2 has not always been as expected (Watanabe et al., 2002). The use of chemicals to enhance production of mammalian cell lines was an approach utilised by many especially as chemicals such as sodium butyrate (NaBu) can increase promoter driven production of foreign proteins (Chang et al., 1999; Cockett et al., 1990; Oster et al., 1993). However despite the positive effect of NaBu its application in large-scale systems is hindered by the finding that it can significantly inhibit cell growth and thus rapidly induce apoptosis (Mandal et al., 1997; Chang et. al., 1999). The use of Bcl-2 to overcome this stress-induced apoptosis was investigated in CHO cells (Kim & Lee, 2000). Although Bcl-2 expressing and control cultures showed similar viabilities and antibody production the Bcl-2 expressing cells showed a decrease in apoptosis by inhibiting caspase-3 activity and extended culture longevity by 2 days. Thus the overall final antibody concentration was two-fold higher than control cells in the presence of NaBu. Besides many reports on apoptosis suppression and increased productivity of mammalian cultures by the overexpression of Bcl-2 and Bcl-xL so far the impact of expression of other Bcl-2 family members have not been investigated. Thus it is felt that maybe some new insights into metabolic engineering in order to improve productivity of industrial cultures are required to further our understanding in this field. So far, anti-apoptosis engineering of industrially important cell lines for

40


production of biopharmaceuticals has been unpredictable and poorly characterised. A finding of an advantage in one cell line has often led to no protection or even a disadvantage in another. Furthermore variables such as culture insults, parameters of growth and cultivation and even history of the cell line seems to only hinder our understanding further by presenting more questions than answers.

6.

Conclusions

A highly regulated network of protein-protein interactions is now known to be the central underlying theme in controlling apoptosis. Understanding the chemical basis of these interactions is a major key to understanding the mechanisms of this diverse pathway, while controlling the outcome of these interactions offers remarkable benefits to the treatment of many pathological diseases. It is now undisputed that the Bcl-2 proteins regulate the mitochondrial apoptotic pathway, however considerable controversy exists as to how they do this at the molecular level. If the desire is to regulate apotosis in various pathological conditions or even exploit the apoptosis pathway to our advantage we need to firstly understand the precise function of all of the pro- and anti-apoptotic proteins. It is vital that we determine which proteins are important in which cell lines and by which pathways they act to carry out their function before we can target them. However, it is clear that the Bcl-2 family still offers a major target for the control of apoptosis as it has been shown to be the central point of control for a variety of cellular damage signals in a multitude of cell types.

7.

References

Al-Rubeai, M. and Emery, A. N. (1990). Mechanisms and kinetics of monoclonal antibody synthesis and secretion synchronous and asynchronous hybridoma cell cultures. J.Biotechnol. 16, 67-85. Al-Rubeai, M., Emery, A. N., Chalder, S., and Jan, D. C. (1992). Specific monoclonal antibody productivity and the cell cycle comparisons of batch, continuous and perfusion cultures. Cytotechnology 9, 85. Alnemri, E. S., Robertson, N. M., Fernandes, T. F., Croce, C. M., and Litwack, G. (1992). Overexpressed full-length human BCL2 extends the survival of baculovirus-infected Sf9 insect cells. Proc.Natl.Acad.Sci.U.S.A 89, 7295-7299. Antonsson, B. (2001). Bax and other pro-apoptotic Bcl-2 family "killer-proteins" and their victim the mitochondrion. Cell Tissue Res. 306, 347-361. Aritomi, M., Kunishima, N., Inohara, N., Ishibashi, Y., Ohta, S., and Morikawa, K. (1997). Crystal structure of rat Bcl-xL. Implications for the function of the Bcl-2 protein family. J.Biol.Chem. 272, 27886-27892. Bakhshi, A., Jensen, J. P., Goldman, P., Wright, J. J., McBride, O. W., Epstein, A. L., and Korsmeyer, S. J. (1985). Cloning the chromosomal breakpoint of t(14;18) human lymphomas: clustering around JH on chromosome 14 and near a transcriptional unit on 18. Cell 41, 899-906.

THE BCL-2 FAMILY

41

Bargmann, C. I. and Horvitz, H. R. (1991). Control of larval development by chemosensory neurons in Caenorhabditis elegans. Science 251, 1243-1246. Boise, L. H., Gonzalez-Garcia, M., Postema, C. E., Ding, L., Lindsten, T., Turka, L. A., Mao, X., Nunez, G., and Thompson, C. B. (1993). bcl-x, a bcl-2-related gene that functions as a dominant regulator of apoptotic cell death. Cell 74, 597-608. Borner, C. (2003). The Bcl-2 protein family: sensors and checkpoints for life-or-death decisions. Mol.Immunol. 39, 615-647. Borner, C., Olivier, R., Martinou, I., Mattmann, C., Tschopp, J., and Martinou, J. C. (1994). Dissection of functional domains in Bcl-2 alpha by site-directed mutagenesis. Biochem.Cell Biol. 463-469. Boyd, J. M., Gallo, G. J., Elangovan, B., Houghton, A. B., Malstrom, S., Avery, B. J., Ebb, R. G., Subramanian, T., Chittenden, T., Lutz, R. J., and . (1995). Bik, a novel death-inducing protein shares a distinct sequence motif with Bcl-2 family proteins and interacts with viral and cellular survival-promoting proteins. Oncogene 11, 1921-1928. Bruckheimer, E. M., Cho, S. H., Sarkiss, M., Herrmann, J., and McDonnell, T. J. (1998). The Bcl-2 gene family and apoptosis. Adv.Biochem.Eng Biotechnol. 62, 75-105. Chang, K. H., Kim, K. S., and Kim, J. H. (1999). N-acetylcysteine increases the biosynthesis of recombinant EPO in apoptotic Chinese hamster ovary cells. Free Radic.Res. 30, 85-91. Charbonneau, J. R. and Gauthier, E. R. (2000). Prolongation of murine hybridoma cell survival in stationary batch culture by Bcl-xL expression. Cytotechnology 34, 131-139. Chen-Levy, Z., Nourse, J., and Cleary, M. L. (1989). The bcl-2 candidate proto-oncogene product is a 24-kilodalton integral- membrane protein highly expressed in lymphoid cell lines and lymphomas carrying the t(14;18) translocation. Mol.Cell Biol. 9, 701-710. Chittenden, T., Harrington, E. A., O'Connor, R., Flemington, C., Lutz, R. J., Evan, G. I., and Guild, B. C. (1995). Induction of apoptosis by the Bcl-2 homologue Bak. Nature 374, 733736. Choi, M. S., Boise, L. H., Gottschalk, A. R., Quintans, J., Thompson, C. B., and Klaus, G. G. (1995). The role of bcl-XL in CD40-mediated rescue from anti-mu-induced apoptosis in WEHI-231 B lymphoma cells. Eur.J.Immunol. 25, 1352-1357. Chou, J. J., Li, H., Salvesen, G. S., Yuan, J., and Wagner, G. (1999). Solution structure of BID, an intracellular amplifier of apoptotic signaling. Cell 96, 615-624. Cleary, M. L., Smith, S. D., and Sklar, J. (1986). Cloning and structural analysis of cDNAs for bcl-2 and a hybrid bcl- 2/immunoglobulin transcript resulting from the t(14;18) translocation. Cell 47, 19-28. Clem, R. J., Cheng, E. H., Karp, C. L., Kirsch, D. G., Ueno, K., Takahashi, A., Kastan, M. B., Griffin, D. E., Earnshaw, W. C., Veliuona, M. A., and Hardwick, J. M. (1998). Modulation of cell death by Bcl-XL through caspase interaction. Proc.Natl.Acad.Sci.U.S.A 95, 554559. Cockett, M. I., Bebbington, C. R., and Yarranton, G. T. (1990). High level expression of tissue inhibitor of metalloproteinases in Chinese hamster ovary cells using glutamine synthetase gene amplification. Biotechnology (N.Y.) 8, 662-667. Conus, S., Kaufmann, T., Fellay, I., Otter, I., Rosse, T., and Borner, C. (2000). Bcl-2 is a monomeric protein: prevention of homodimerization by structural constraints. EMBO J. 19, 1534-1544. David, D., Keller, H., Nait-Ighil, L., Treilhou, M. P., Joussemet, M., Dupont, B., Gachot, B., Maral, J., and Theze, J. (2002). Involvement of Bcl-2 and IL-2R in HIV-positive patients whose CD4 cell counts fail to increase rapidly with highly active antiretroviral therapy. AIDS 16, 1093-1101.

42


De Cesare, M., Pratesi, G., Giusti, A., Polizzi, D., and Zunino, F. (1998). Stimulation of the apoptotic response as a basis for the therapeutic synergism of lonidamine and cisplatin in combination in human tumour xenografts. Br.J.Cancer 77, 434-439. Degterev, A., Lugovskoy, A., Cardone, M., Mulley, B., Wagner, G., Mitchison, T., and Yuan, J. (2001). Identification of small-molecule inhibitors of interaction between the BH3 domain and Bcl-xL. Nat.Cell Biol. 3, 173-182. del Peso, L., Gonzalez, V. M., Inohara, N., Ellis, R. E., and Nunez, G. (2000). Disruption of the CED-9.CED-4 complex by EGL-1 is a critical step for programmed cell death in Caenorhabditis elegans. J.Biol.Chem. 275, 27205-27211. Dorai, T., Goluboff, E. T., Olsson, C. A., and Buttyan, R. (1997a). Development of a hammerhead ribozyme against BCL-2. II. Ribozyme treatment sensitizes hormoneresistant prostate cancer cells to apoptotic agents. Anticancer Res. 17, 3307-3312. Dorai, T., Olsson, C. A., Katz, A. E., and Buttyan, R. (1997b). Development of a hammerhead ribozyme against bcl-2. I. Preliminary evaluation of a potential gene therapeutic agent for hormone-refractory human prostate cancer. Prostate 32, 246-258. Eaton, D., Gilham, D. E., O'Neill, A., and Hawkins, R. E. (2002). Retroviral transduction of human peripheral blood lymphocytes with Bcl- X(L) promotes in vitro lymphocyte survival in pro-apoptotic conditions. Gene Ther. 9, 527-535. Ellis, R. E., Yuan, J. Y., and Horvitz, H. R. (1991). Mechanisms and functions of cell death. Annu.Rev.Cell Biol. 7, 663-698. Enyedy, I. J., Ling, Y., Nacro, K., Tomita, Y., Wu, X., Cao, Y., Guo, R., Li, B., Zhu, X., Huang, Y., Long, Y. Q., Roller, P. P., Yang, D., and Wang, S. (2001). Discovery of smallmolecule inhibitors of Bcl-2 through structure-based computer screening. J.Med.Chem. 44, 4313-4324. Farrow, S. N., White, J. H., Martinou, I., Raven, T., Pun, K. T., Grinham, C. J., Martinou, J. C., and Brown, R. (1995). Cloning of a bcl-2 homologue by interaction with adenovirus E1B 19K. Nature 374, 731-733. Fassnacht, D., Rossing, S., Singh, R. P., Al-Rubeai, M., and Portner, R. (1999). Influence of bcl-2 on antibody productivity in high cell density perfusion cultures of hybridoma. Cytotechnology 30, 95-105. Fujita, N., Nagahashi, A., Nagashima, K., Rokudai, S., and Tsuruo, T. (1998). Acceleration of apoptotic cell death after the cleavage of Bcl-XL protein by caspase-3-like proteases. Oncogene 17, 1295-1304. Fujita, T., Terada, S., Fukuoa, K., Kitayama, A., Ueda, H., and Suzuki, E. (1997). Reinforcing apoptosis-resistance of COS and myeloma cells transfected with bcl-3 gene. Cytotechnology 25, 25-33. Fussenegger, M., Fassnacht, D., Schwartz, R., Zanghi, J. A., Graf, M., Bailey, J. E., and Portner, R. (2000). Regulated overexpression of the survival factor bcl-2 in CHO cells increases viable cell density in batch culture and decreases DNA release in extended fixedbed cultivation. Cytotechnology 32, 45-61. Fussenegger, M., Mazur, X., and Bailey, J. E. (1997). A novel cytostatic process enhances the productivity of chinese hamster ovary cells. Biotech.Bioeng. 55, 927-939. Gibson, L., Holmgreen, S. P., Huang, D. C., Bernard, O., Copeland, N. G., Jenkins, N. A., Sutherland, G. R., Baker, E., Adams, J. M., and Cory, S. (1996). bcl-w, a novel member of the bcl-2 family, promotes cell survival. Oncogene 13, 665-675. Gonzalez-Garcia, M., Perez-Ballestero, R., Ding, L., Duan, L., Boise, L. H., Thompson, C. B., and Nunez, G. (1994). bcl-XL is the major bcl-x mRNA form expressed during murine development and its product localizes to mitochondria. Development 120, 3033-3042.

THE BCL-2 FAMILY

43

Goswami, J., Sinskey, A. J., Steller, H., Stephanopoulos, G. N., and Wang, D. I. (1999). Apoptosis in batch cultures of Chinese hamster ovary cells. Biotechnol.Bioeng. 62, 632640. Green, D. R. and Reed, J. C. (1998). Mitochondria and apoptosis. Science 281, 1309-1312. Griffiths, G. J., Dubrez, L., Morgan, C. P., Jones, N. A., Whitehouse, J., Corfe, B. M., Dive, C., and Hickman, J. A. (1999). Cell damage-induced conformational changes of the proapoptotic protein Bak in vivo precede the onset of apoptosis. J.Cell Biol. 144, 903-914. Gross, A., Jockel, J., Wei, M. C., and Korsmeyer, S. J. (1998). Enforced dimerization of BAX results in its translocation, mitochondrial dysfunction and apoptosis. EMBO J. 17, 38783885. Gross, A., Yin, X. M., Wang, K., Wei, M. C., Jockel, J., Milliman, C., Erdjument-Bromage, H., Tempst, P., and Korsmeyer, S. J. (1999). Caspase cleaved BID targets mitochondria and is required for cytochrome c release, while BCL-XL prevents this release but not tumor necrosis factor-R1/Fas death. J.Biol.Chem. 274, 1156-1163. Hamasaki, A., Sendo, F., Nakayama, K., Ishida, N., Negishi, I., Nakayama, K., and Hatakeyama, S. (1998). Accelerated neutrophil apoptosis in mice lacking A1-a, a subtype of the bcl-2-related A1 gene. J.Exp.Med. 188, 1985-1992. Hanada, M., Aime-Sempe, C., Sato, T., and Reed, J. C. (1995). Structure-function analysis of Bcl-2 protein. Identification of conserved domains important for homodimerization with Bcl-2 and heterodimerization with Bax. J.Biol.Chem. 270, 11962-11969. Hockenbery, D., Nunez, G., Milliman, C., Schreiber, R. D., and Korsmeyer, S. J. (1990). Bcl2 is an inner mitochondrial membrane protein that blocks programmed cell death. Nature 348, 334-336. Huang, Q., Petros, A. M., Virgin, H. W., Fesik, S. W., and Olejniczak, E. T. (2002). Solution structure of a Bcl-2 homolog from Kaposi sarcoma virus. Proc.Natl.Acad.Sci.U.S.A 99, 3428-3433. Huang, Z. (2002). The chemical biology of apoptosis. Exploring protein-protein interactions and the life and death of cells with small molecules. Chem.Biol. 9, 1059-1072. Hussain, S. P. and Harris, C. C. (2000). Molecular epidemiology and carcinogenesis: endogenous and exogenous carcinogens. Mutat.Res. 462, 311-322. Ishaque, A. and Al Rubeai, M. (2002). Role of vitamins in determining apoptosis and extent of suppression by bcl-2 during hybridoma cell culture. Apoptosis. 7, 231-239. Itoh, Y., Ueda, H., and Suzuki, E. (1995). Overexpression of bcl-2, apoptosis suppressing gene:: prolonged viable culture period of hybridoma and enhance antibody production. Biotechnology and Bioengineering 48, 118-122. Jung, D., Cote, S., Drouin, M., Simard, C., and Lemieux, R. (2002). Inducible expression of Bcl-XL restricts apoptosis resistance to the antibody secretion phase in hybridoma cultures. Biotechnol.Bioeng. 79, 180-187. Karsan, A., Yee, E., and Harlan, J. M. (1996). Endothelial cell death induced by tumor necrosis factor-alpha is inhibited by the Bcl-2 family member, A1. J.Biol.Chem. 271, 27201-27204. Kerr, J. F., Wyllie, A. H., and Currie, A. R. (1972). Apoptosis: a basic biological phenomenon with wide-ranging implications in tissue kinetics. Br.J.Cancer 26, 239-257. Khaled, A. R., Kim, K., Hofmeister, R., Muegge, K., and Durum, S. K. (1999). Withdrawal of IL-7 induces Bax translocation from cytosol to mitochondria through a rise in intracellular pH. Proc.Natl.Acad.Sci.U.S.A 96, 14476-14481. Kiefer, M. C., Brauer, M. J., Powers, V. C., Wu, J. J., Umansky, S. R., Tomei, L. D., and Barr, P. J. (1995). Modulation of apoptosis by the widely distributed Bcl-2 homologue Bak. Nature 374, 736-739.

44


Kim, N. S. and Lee, G. M. (2000). Overexpression of bcl-2 inhibits sodium butyrate-induced apoptosis in Chinese hamster ovary cells resulting in enhanced humanized antibody prod. Biotech. Bioeng. 71, 184-193. Korsmeyer, S. J. (1999). BCL-2 gene family and the regulation of programmed cell death. Cancer Res. 59, 1693s-1700s. Kozopas, K. M., Yang, T., Buchan, H. L., Zhou, P., and Craig, R. W. (1993). MCL1, a gene expressed in programmed myeloid cell differentiation, has sequence similarity to BCL2. Proc.Natl.Acad.Sci.U.S.A 90, 3516-3520. Krajewski, S., Bodrug, S., Gascoyne, R., Berean, K., Krajewska, M., and Reed, J. C. (1994a). Immunohistochemical analysis of Mcl-1 and Bcl-2 proteins in normal and neoplastic lymph nodes. Am.J.Pathol. 145, 515-525. Krajewski, S., Krajewska, M., Shabaik, A., Miyashita, T., Wang, H. G., and Reed, J. C. (1994b). Immunohistochemical determination of in vivo distribution of Bax, a dominant inhibitor of Bcl-2. Am.J.Pathol. 145, 1323-1336. Kroemer, G., Zamzami, N., and Susin, S. A. (1997). Mitochondrial control of apoptosis. Immunol.Today 18, 44-51. Li, H., Zhu, H., Xu, C. J., and Yuan, J. (1998). Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis. Cell 94, 491-501. Lin, E. Y., Orlofsky, A., Berger, M. S., and Prystowsky, M. B. (1993). Characterization of A1, a novel hemopoietic-specific early-response gene with sequence similarity to bcl-2. J.Immunol. 151, 1979-1988. Lomo, J., Smeland, E. B., Krajewski, S., Reed, J. C., and Blomhoff, H. K. (1996). Expression of the Bcl-2 homologue Mcl-1 correlates with survival of peripheral blood B lymphocytes. Cancer Res. 56, 40-43. Lotem, J. and Sachs, L. (1995). Regulation of bcl-2, bcl-XL and bax in the control of apoptosis by hematopoietic cytokines and dexamethasone. Cell Growth Differ. 6, 647-653. Luo, X., Budihardjo, I., Zou, H., Slaughter, C., and Wang, X. (1998). Bid, a Bcl2 interacting protein, mediates cytochrome c release from mitochondria in response to activation of cell surface death receptors. Cell 94, 481-490. Mandal, M., Wu, X., and Kumar, R. (1997). Bcl-2 deregulation leads to inhibition of sodium butyrate-induced apoptosis in human colorectal carcinoma cells. Carcinogenesis 18, 229232. Mastrangelo, A. J., Hardwick, J. M., and Betenbaugh, M. J. (1996). Bcl-2 inhibits apoptosis and extends recombinant protein production in cells infected with Sindbis viral vectors. Cytotechnology 22, 169-178. Mastrangelo, A. J., Hardwick, J. M., Bex, F., and Betenbaugh, M. J. (2000a). Part I. Bcl-2 and Bcl-x(L) limit apoptosis upon infection with alphavirus vectors. Biotechnol.Bioeng. 67, 544-554. Mastrangelo, A. J., Hardwick, J. M., Zou, S., and Betenbaugh, M. J. (2000b). Part II. Overexpression of bcl-2 family members enhances survival of mammalian cells in response to various culture insults. Biotechnol.Bioeng. 67, 555-564. McDonnell, J. M., Fushman, D., Milliman, C. L., Korsmeyer, S. J., and Cowburn, D. (1999). Solution structure of the proapoptotic molecule BID: a structural basis for apoptotic agonists and antagonists. Cell 96, 625-634. Meents, H., Enenkel, B., Eppenberger, H. M., Werner, R. G., and Fussenegger, M. (2002). Impact of coexpression and coamplification of sICAM and antiapoptosis determinants bcl2/bcl-x(L) on productivity, cell survival, and mitochondria number in CHO-DG44 grown in suspension and serum-free media. Biotechnol.Bioeng. 80, 706-716. Minn, A. J., Swain, R. E., Ma, A., and Thompson, C. B. (1998). Recent progress on the regulation of apoptosis by Bcl-2 family members. Adv.Immunol. 70, 245-279.

THE BCL-2 FAMILY

45

Miyashita, T., Krajewski, S., Krajewska, M., Wang, H. G., Lin, H. K., Liebermann, D. A., Hoffman, B., and Reed, J. C. (1994). Tumor suppressor p53 is a regulator of bcl-2 and bax gene expression in vitro and in vivo. Oncogene 9, 1799-1805. Miyashita, T. and Reed, J. C. (1995). Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell 80, 293-299. Murray, K., Ang, C. E., Gull, K., Hickman, J. A., and Dickson, A. J. (1996). NSO myeloma cell death: influence of bcl-2 overexpression. Biotech.Bioeng. 51, 298-304. Olsen, C. W., Kehren, J. C., Dybdahl-Sissoko, N. R., and Hinshaw, V. S. (1996). bcl-2 alters influenza virus yield, spread, and hemagglutinin glycosylation. J.Virol. 70, 663-666. Oltvai, Z. N. and Korsmeyer, S. J. (1994). Checkpoints of dueling dimers foil death wishes. Cell 79, 189-192. Oltvai, Z. N., Milliman, C. L., and Korsmeyer, S. J. (1993). Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell 74, 609-619. Orlofsky, A., Weiss, L. M., Kawachi, N., and Prystowsky, M. B. (2002). Deficiency in the anti-apoptotic protein A1-a results in a diminished acute inflammatory response. J.Immunol. 168, 1840-1846. Orth, K. and Dixit, V. M. (1997). Bik and Bak induce apoptosis downstream of CrmA but upstream of inhibitor of apoptosis. J.Biol.Chem. 272, 8841-8844. Oster, T., Thioudellet, C., Chevalot, I., Masson, C., Wellman, M., Marc, A., and Siest, G. (1993). Induction of recombinant human gamma-glutamyl transferase by sodium butyrate in transfected V79 and CHO Chinese hamster cells. Biochem.Biophys.Res.Commun. 193, 406-412. Perani, A., Singh, R. P., Fassnacht, D., Portner, R., and Al-Rubeai, M. (1998). Variable functions of bcl-2 in mediating bioreactor stress-induced apoptosis in hybridoma cultures. Cytotechnology 28, 177-178. Petros, A. M., Medek, A., Nettesheim, D. G., Kim, D. H., Yoon, H. S., Swift, K., Matayoshi, E. D., Oltersdorf, T., and Fesik, S. W. (2001). Solution structure of the antiapoptotic protein bcl-2. Proc.Natl.Acad.Sci.U.S.A 98, 3012-3017. Petros, A. M., Nettesheim, D. G., Wang, Y., Olejniczak, E. T., Meadows, R. P., Mack, J., Swift, K., Matayoshi, E. D., Zhang, H., Thompson, C. B., and Fesik, S. W. (2000). Rationale for Bcl-xL/Bad peptide complex formation from structure, mutagenesis, and biophysical studies. Protein Sci. 9, 2528-2534. Pratesi, G., Polizzi, D., Perego, P., Dal Bo, L., and Zunino, F. (2000). Bcl-2 phosphorylation in a human breast carcinoma xenograft: a common event in response to effective DNAdamaging drugs. Biochem.Pharmacol. 60, 77-82. Raff, M. C. (1992). Social controls on cell survival and cell death. Nature 356, 397-400. Rao, L. and White, E. (1997). Bcl-2 and the ICE family of apoptotic regulators: making a connection. Curr.Opin.Genet.Dev. 7, 52-58. Rathmell, J. C., Vander Heiden, M. G., Harris, M. H., Frauwirth, K. A., and Thompson, C. B. (2000). In the absence of extrinsic signals, nutrient utilization by lymphocytes is insufficient to maintain either cell size or viability. Mol.Cell 6, 683-692. Reed, J. C. (1994). Bcl-2 and the regulation of programmed cell death. J.Cell Biol. 124, 1-6. Reed, J. C., Miyashita, T., Takayama, S., Wang, H. G., Sato, T., Krajewski, S., Aime-Sempe, C., Bodrug, S., Kitada, S., and Hanada, M. (1996). BCL-2 family proteins: regulators of cell death involved in the pathogenesis of cancer and resistance to therapy. J.Cell Biochem. 60, 23-32. Reynolds, J. E., Yang, T., Qian, L., Jenkinson, J. D., Zhou, P., Eastman, A., and Craig, R. W. (1994). Mcl-1, a member of the Bcl-2 family, delays apoptosis induced by c-Myc overexpression in Chinese hamster ovary cells. Cancer Res. 54, 6348-6352.

46


Ross, A. J., Waymire, K. G., Moss, J. E., Parlow, A. F., Skinner, M. K., Russell, L. D., and MacGregor, G. R. (1998). Testicular degeneration in Bclw-deficient mice. Nat.Genet. 18, 251-256. Rouayrenc, J. F., Boise, L. H., Thompson, C. B., Privat, A., and Patey, G. (1995). Presence of the long and the short forms of Bcl-X in several human and murine tissues. C.R.Acad.Sci.III 318, 537-540. Sato, T., Hanada, M., Bodrug, S., Irie, S., Iwama, N., Boise, L. H., Thompson, C. B., Golemis, E., Fong, L., Wang, H. G., and . (1994). Interactions among members of the Bcl2 protein family analyzed with a yeast two-hybrid system. Proc.Natl.Acad.Sci.U.S.A 91, 9238-9242. Sattler, M., Liang, H., Nettesheim, D., Meadows, R. P., Harlan, J. E., Eberstadt, M., Yoon, H. S., Shuker, S. B., Chang, B. S., Minn, A. J., Thompson, C. B., and Fesik, S. W. (1997). Structure of Bcl-xL-Bak peptide complex: recognition between regulators of apoptosis. Science 275, 983-986. Sedlak, T. W., Oltvai, Z. N., Yang, E., Wang, K., Boise, L. H., Thompson, C. B., and Korsmeyer, S. J. (1995). Multiple Bcl-2 family members demonstrate selective dimerizations with Bax. Proc.Natl.Acad.Sci.U.S.A 92, 7834-7838. Shalev, M., Thompson, T. C., Kadmon, D., Ayala, G., Kernen, K., and Miles, B. J. (2001). Gene therapy for prostate cancer. Urology 57, 8-16. Simpson, N. H., Milner, A. E., and Al-Rubeai, M. (1997). Prevention of hybridoma cell death by bcl-2 during sub-optimal culture conditions. Biotech.Bioeng. 54, 1-16. Simpson, N. H., Singh, R. P., Perani, A., Goldenzon, C., and Al-Rubeai, M. (1998). In hybridoma cultures deprvation of any single amino acid leads to apoptotic death, which is suppressed by expression of the bcl-2 gene. Biotech.Bioeng. 59, 90-98. Singh, R. P., Al-Rubeai, M., and Emery, A. N. (1996). Enhancement of survivability of mammalian cells by over-expression of the apotosis suppressor gene Bcl-2. Biotech.Bioeng. 52, 166-175. Spector, M. S., Desnoyers, S., Hoeppner, D. J., and Hengartner, M. O. (1997). Interaction between the C. elegans cell-death regulators CED-9 and CED- 4. Nature 385, 653-656. Steller, H. (1995). Mechanisms and genes of cellular suicide. Science 267, 1445-1449. Tanaka, S., Saito, K., and Reed, J. C. (1993). Structure-function analysis of the Bcl-2 oncoprotein. Addition of a heterologous transmembrane domain to portions of the Bcl-2 beta protein restores function as a regulator of cell survival. J.Biol.Chem. 268, 1092010926. Tey, B. T., Singh, R. P., Piredda, L., Piacentini, M., and Al Rubeai, M. (2000a). Bcl-2 mediated suppression of apoptosis in myeloma NS0 cultures. J.Biotechnol. 79, 147-159. Tey, B. T., Singh, R. P., Piredda, L., Piacentini, M., and Al Rubeai, M. (2000b). Influence of bcl-2 on cell death during the cultivation of a Chinese hamster ovary cell line expressing a chimeric antibody. Biotechnol.Bioeng. 68, 31-43. Thornberry, N. A. and Lazebnik, Y. (1998). Caspases: enemies within. Science 281, 13121316. Tsujimoto, Y. and Croce, C. M. (1986). Analysis of the structure, transcripts, and protein products of bcl-2, the gene involved in human follicular lymphoma. Proc.Natl.Acad.Sci.U.S.A 83, 5214-5218. Tsujimoto, Y., Gorham, J., Cossman, J., Jaffe, E., and Croce, C. M. (1985). The t(14;18) chromosome translocations involved in B-cell neoplasms result from mistakes in VDJ joining. Science 229, 1390-1393. Tzung, S. P., Kim, K. M., Basanez, G., Giedt, C. D., Simon, J., Zimmerberg, J., Zhang, K. Y., and Hockenbery, D. M. Antimycin A mimics a cell-death-inducing Bcl-2 homology domain 3.

THE BCL-2 FAMILY

47

Van Parijs, L., Peterson, D. A., and Abbas, A. K. (1998). The Fas/Fas ligand pathway and Bcl-2 regulate T cell responses to model self and foreign antigens. Immunity. 8, 265-274. Vaux, D. L., Cory, S., and Adams, J. M. (1988). Bcl-2 gene promotes haemopoietic cell survival and cooperates with c- myc to immortalize pre-B cells. Nature 335, 440-442. Wang, E., Marcotte, R., and Petroulakis, E. (1999). Signaling pathway for apoptosis: a racetrack for life or death. J.Cell Biochem. Suppl 32-33, 95-102. Wang, K., Yin, X. M., Chao, D. T., Milliman, C. L., and Korsmeyer, S. J. (1996). BID: a novel BH3 domain-only death agonist. Genes Dev. 10, 2859-2869. Watanabe, S., Shuttleworth, J., and Al Rubeai, M. (2002). Regulation of cell cycle and productivity in NS0 cells by the overexpression of p21CIP1. Biotechnol.Bioeng. 77, 1-7. Wei, M. C., Lindsten, T., Mootha, V. K., Weiler, S., Gross, A., Ashiya, M., Thompson, C. B., and Korsmeyer, S. J. (2000). tBID, a membrane-targeted death ligand, oligomerizes BAK to release cytochrome c. Genes Dev. 14, 2060-2071. Weiss, L. M., Warnke, R. A., Sklar, J., and Cleary, M. L. (1987). Molecular analysis of the t(14;18) chromosomal translocation in malignant lymphomas. N.Engl.J.Med. 317, 11851189. White, E. (1996). Life, death, and the pursuit of apoptosis. Genes Dev. 10, 1-15. Xie, K., Huang, S., Wang, Y., Beltran, P. J., Juang, S. H., Dong, Z., Reed, J. C., McDonnell, T. J., McConkey, D. J., and Fidler, I. J. (1996). Bcl-2 protects cells from cytokine-induced nitric-oxide-dependent apoptosis. Cancer Immunol.Immunother. 43, 109-115. Yang, E., Zha, J., Jockel, J., Boise, L. H., Thompson, C. B., and Korsmeyer, S. J. (1995a). Bad, a heterodimeric partner for Bcl-XL and Bcl-2, displaces Bax and promotes cell death. Cell 80, 285-291. Yang, T., Kozopas, K. M., and Craig, R. W. (1995b). The intracellular distribution and pattern of expression of Mcl-1 overlap with, but are not identical to, those of Bcl-2. J.Cell Biol. 128, 1173-1184. Yin, X. M., Oltvai, Z. N., and Korsmeyer, S. J. (1994). BH1 and BH2 domains of Bcl-2 are required for inhibition of apoptosis and heterodimerization with Bax. Nature 369, 321323.

3.

THE IGF-1 RECEPTOR IN CELL SURVIVAL: SIGNALLING AND REGULATION

PATRICK A. KIELY, DENISE M. O’GORMAN, ANTHONY LYONS AND ROSEMARY O’CONNOR Cell Biology Laboratory, Department of Biochemistry, BioSciences Institute, University College Cork, Cork, Ireland.

1.

Introduction: Growth Factors, Survival Factors and Apoptosis

Survival factors promote cell survival by suppressing the default cell death pathway that is present in our cells and is manifested as apoptosis. Triggering of apoptosis in response to developmental or damage cues is essential to allow normal development to occur and to preserve life in multicellular organisms. This also ensures that certain cells will be removed during tissue patterning and that damaged or mutant cells will be removed before they cause harm or form tumours. In most cell systems survival factors are soluble or membrane bound molecules that act on cell surface receptors and activate signaling pathways that intersect with the core cellular regulators of apoptosis such as the Bcl-2 family or caspases and often lead to transcription of genes that promote cell survival. Cytokines such as stem cell factor (SCF), erythropoietin (EPO), interleukin (IL)-3 and IL-2 promote survival of different populations of hematopoietic cells and allows them to differentiate or carry out their functions in the immune system (Burgess et al., 2003; DiFalco et al., 2003). Neurons are dependent on survival factors such as nerve growth factor (NGF) and other neurotrophins produced by their target tissues to survive and be maintained (Harper and LoGrasso, 2001; Scheepens et al., 2001). Fibroblasts and epithelial cells are dependent on survival factors from surrounding cell contacts as well as soluble growth factors and survival factors. Although several growth factors such as epidermal growth factor (EGF), platlet derived growth factor (PDGF) and the insulin like growth factors (IGFs) can promote cell survival it has been shown than the IGFs are among the most potent growth factors for a broad variety of cells (Evan et al., 1995; Evans et al., 1997; Evans et al., 1987).

2.

The Igf-1 System, Ligands, Receptors, and Binding Proteins

The insulin receptor (IR) family of receptor tyrosine kinases (RTKs) is made up of the IR, the IR-related receptor (IRR) and the type 1 insulin-like growth factor receptor (IGF-1R). The members of this family share extensive homology but have 49 M. Al-Rubeai and M. Fussenegger (eds.), Cell Engineering, Vol. 4, 49-92. © 2004 Kluwer Academic Publishers. Printed in the Netherlands.

50

P. A. KIELY, D. M. O’GORMAN, A. LYONS and R. O’CONNOR

separate gene products and exert diverse biological effects. Insulin acts through the IR and has a primary role in cell survival, growth and regulation of glucose metabolism (Marino-Buslje et al., 1999; Saltiel and Kahn, 2001). IGF-1 and IGF-2 act through the IGF-1R. The IGF-1R plays an essential role in cell proliferation, differentiation, regulation of cellular transformation, tumour cell invasion and metastasis, and inhibition of apoptosis (Baserga et al., 1997a; Baserga et al., 1997b; Baserga et al., 1994; O'Connor, 1998; Sepp-Lorenzino, 1998). Insulin is produced exclusively in the pancreas while the liver is the main organ that synthesizes and releases IGFs into the blood. Low nanomolar (nM) concentrations of free insulin are found in the circulation and circulating IGFs are in the high nM range. Only a fraction of the circulating IGFs are biologically active because at any one time more than 90% of the IGFs are bound to a family of six IGF binding proteins (IGFBPs) designated IGFBP-1 through IGFBP-6 (Figure 1). (Holzenberger et al., 2003; LeRoith et al., 1995; Wex et al., 1998). The IGFBPs have much higher affinities for IGFs (Kd 10-10 M) than the IGF-1R (Kd 10-8-10-9) and thus act as high affinity modulators of IGF availability and activity (Hwa et al., 1999). Similar to IGFs, the IGFBPs characterised to date are well conserved between mammalian and non-mammalian species (James et al., 1993; Upton et al., 1993; Schoen et al., 1995; Kelley et al., 1996; Rajaram et al., 1997). Three of the six IGFBPs, IGFBP-1, IGFBP-3 and IGFBP-5, have been shown to be post-translationally modified by phosphorylation (Coverley and Baxter, 1997). Phosphorylation of human IGFBP-1 enhances the affinity of human IGFBP-1 for IGFs by 5-fold (Jones et al., 1991; Westwood et al., 1997). However, similar phosphorylation of rat IGFBP-1 does not lead to increased affinity for rat IGF (Peterkofsky et al., 1998). The biological significance of phosphorylation remains unclear, as do the precise molecular interactions between IGFBPs and IGFs. Interestingly, IGFBP-3, IGFBP-5 and IGFBP-1 have also been reported to regulate biological activities independent of their ability to bind IGFs (Jones et al., 1993). The IGF-1R is a tetrameric glycoprotein that shares more than 50% overall sequence homology with the IR. These receptors are activated upon ligation with IGF-1, IGF-2 or insulin and they activate a complex network of intracellular signalling pathways. The IR demonstrates high affinity binding to insulin (10-10 M) and lower affinity binding to IGF-1 (10-8 M) whereas the IGF-1R binds IGF-1 with a higher affinity (10-10 M) than it does insulin (10-8 M). The difference in binding affinity is the result of subtle structural differences found in the binding domain of the IR and IGF-1R (Adamo et al., 1992).

THE IGF-1 SYSTEM AND APOPTOSIS

51

Figure 1. The IGF-1R and its binding partners. Circulating IGF’s are in the high nM range but are predominantly bound to a family of IGF-binding proteins (IGFBPs). IGFBP 1-6 are structurally related and bind with high affinity to both IGF-1 and IGF-2 but not insulin. The IGFBPs function as IGF reservoirs and carrier proteins in the circulation but also serve as modulators of IGF action. The inhibitory role of IGFBPs is attributed to sequestering IGF peptides away from the IGF-1R. The enhancer role of IGFBPs is understood to be a result of binding affinity decrease between IGF and the binding protein, increasing the availability of free IGF

3.

The Igf-1 System Is Essential For Development and Is Conserved Throughout Evolution

In the nematode Caenorhabditis elegans, the DAF-2 receptor shares homology to both the IR and the IGF-1R. This gene is equidistant from the IR and IGF-1R in terms of evolution, exhibiting 36% and 35% homology to these receptors respectively (Kimura et al., 1997), and suggests that these receptors diverged during evolution to control distinct functions. DAF-2 regulates development, metabolism

52


and ageing in C. elegans (Kimura et al., 1997; Gil et al., 1999; Mihaylova et al., 1999; Scott et al., 2002), and sends signals through a conserved PI-3 kinase/AKT pathway (Lin et al., 2001; Pierce et al., 2001). In C. elegans, signals from the reproductive system can regulate lifespan by modulating the activities of insulin signal transduction pathways (Leevers, 2001), which suggests the possibility of coevolution of reproduction and ageing. The effects of disruption of the IGF-system has been clearly documented in knockout animals. IGF-1 null mice, if they survive embryogenesis, often die shortly after birth. Those that do survive to adulthood display abnormalities in many organ systems including a delay in ossification and muscle development and infertility. Disruption of the IGF-2 gene, although causing a reduction in growth during embryogenesis, results in viable animals which develop into fertile adults. IGF-1R knockout mice are only 45% of the weight of wildtype animals at birth and die shortly afterwards (Liu et al., 1993). Expression of IR and IGF-IR is known to exist early in embryonic life, as early as the 8 cell stage in mice and the 2 cell stage in humans although the major role of the IR at this early stage is thought to be in mediating IGF-2 rather than insulin action. Expression of the IGF-1R and its ligands IGF-1and IGF-2 follow distinct patterns of tissue distribution during development (LeRoith et al., 1995). Data from mouse mutants demonstrates that the interaction between IGF-1/IGF-1R and IGF2/IGF-1R is of major importance in embryonic growth with a predominant influence of the IGF-2/IGF-1R interaction (Nakae et al., 2001). Both IGF-1 and IGF-2 are required for normal development of the mouse embryo (Allan et al., 2001; Baker et al., 1993; Powell-Braxton et al., 1993). Overexpression of insulin in transgenic mice embryos results in an increased foetal beta-cell proliferation. Mice overexpressing IGF-I/IGF-II and IGFBPs have increased weight due to increased organ size (Devedjian et al., 2000; Modric et al., 1999).

4.

The Igf-1 Receptor - Gene and Expression

Transcription from the IGF-IR gene yields a 11kb mRNA transcript that codes for a precursor protein 1,367 amino acids in length. This primary transcript undergoes a series of co- and post-translational modifications during its maturation (reviewed in (Adams et al., 2000; Baserga et al., 1997a; Baserga et al., 1997b; Marino-Buslje et al., 1999; Sepp-Lorenzino, 1998)). Briefly, exons 1 to 3 contain the 5’ untranslated region and approximately half of the α-subunit, exons 4 to 10 encode the remaining portion of the α-subunit, exon 11 encodes the α-β cleavage site while exons 12 to 21 code for the β-subunit. The first 30 residues constitute the signal peptide that is removed on translocation of the precursor to the endoplasmic reticulum. Further N-linked glycosylation and proteolytic cleavage generates the mature α- and β-subunits. The α and β subunits are then linked by disulfide bonds to form αβ heterodimers which in turn dimerize again and are finally held together by disulfide bonds to form β-α-α-β receptors. The IGF-1R gene promoter, like the


53

IR, EGFR and NGFR lacks TATA and CAAT sequence motifs but contain multiple GC boxes which are highly responsive to Sp1, a ubiquitous member of a family of zinc-finger transcription factors (Beitner-Johnson et al., 1995; Werner et al., 1992)

5.

The Igf-1 Receptor - Protein Structure and Functional Domains

The α subunit of the IGF-1R contains a cysteine rich domain between amino acids 148 and 302 (Figure 2). Surprisingly, there is low overall homology between the IR and the IGF-1R α-subunits (48%), but importantly 24 out of 26 cysteine residues present in the IGF-1R are conserved in the IR (Schumacher et al., 1991; Sepp-Lorenzino, 1998; Zhang and Roth, 1991). Only the cysteine rich domain of the IGF-1R is involved in ligand binding. This is unlike the IR which requires regions surrounding the cysteine rich domain (Hoyne et al., 2000). The β-subunit of the IGF-1R, contains 627 amino acid residues and spans the plasma membrane once. As illustrated in Figure 2, the intracellular section of the β-subunit is subdivided into three regions; the juxtamembrane domain, the tyrosine kinase domain and the Cterminal domain. The juxtamembrane domain of the IGF-1R shares 61% homology with the IR and has been shown to be essential for ligand mediated internalisation of the IGF-1R (Prager et al., 1994). Tyrosine 950 (Y950) in the juxtamembrane region is required for binding the PTP domains of IRS-1 and Shc (Gustafson et al., 1995). The tyrosine kinase domain of the IGF-1R, the catalytic domain, is approximately 84% homologous to that of the IR (Figure 1). This domain in the IGF-1R contains the tyrosine cluster (Y1131, Y1135 and Y1136), the ATP binding motif Gly-X-Gly-X-X -Gly at position 976 to 981 and an ATP binding lysine residue at position 1003, motifs which are present in all protein kinases and critical for biological function of RTKs (Chen, 1995; Hanks et al., 1988; Kato et al., 1993). The tyrosine kinase domain of the IGF-1R has two tyrosines at positions 1162 and 1221 that are unique to the IGF-1R, apart from which, the kinase domains of the IR and IGF-1R are almost identical (Figure 2). The C-terminal domain (residues 12291337) of the IGF-1R is 48% homologous to the corresponding region of the IR. A number of studies on this region have suggested that this domain is critical in the regulation of IGF-1R signalling, but its function is yet to be elucidated. Mutational analysis revealed the importance of this domain in the regulation of the antiapoptotic and transforming activities of the IGF-1R (Brodt et al., 2001; Hongo et al., 1996; Liu et al., 1998; O'Connor et al., 1997). In addition, there are residues in the C-terminus required for signal transduction such as Y1316, which can bind to the SH2 domain of the p85 subunit of PI-3 kinase and Csk (Myers et al., 1996; ArbetEngels et al., 1999).

54


Figure 2. Domain organization of the IGF-1R. The Į and ȕ-chains of the IGF-1R are linked by disulphide bonds to form Įȕ monomers. The native dimeric IGF-1R consists of two Įȕ monomers linked by multiple bonds between opposing Į-chains. The cysteine rich domain in the Į-chain is required for ligand binding. Indicated on the left is % homology shared with the corresponding domains of the closely related IR. On the right is shown important amino acid residues for IGF-1R signalling and function.

THE IGF-1 SYSTEM AND APOPTOSIS 6.

Functions of the Igf-1 Receptor in Suppression of Apoptosis, Proliferation, Differentiation, Motility, and Transformation.

6.1

THE IGF-1 RECEPTOR AND SUPPRESSION OF APOPTOSIS

55

Apoptosis is the most common form of physiological cell death that occurs during embryonic development, tissue remodelling, immune regulation and tumour regression. The rate of cell death (by apoptosis or necrosis) plays a major role in the rate of cell proliferation and the growth rates of human tumours (Romano et al., 1999). The ligand-activated IGF-1R promotes cell survival in response to a multitude of apoptotic stimuli including hypoxia (Klempt et al., 1992), c-myc overexpression (Harrington et al., 1994), TNF-α (Wu et al., 1996), chemotherapeutic agents (Sell et al., 1995), IL-3 withdrawal (O'Connor et al., 1997), p53 (Prisco et al., 1997) and UV radiation (Kulik et al., 1997). The connection between cell survival and tumour progression has led to extensive studies to elucidate the signalling pathways downstream of the IGF-1R. IGF-1 protects from apoptosis by activating many downstream signalling molecules including the Phosphoinositide-3 kinase (PI-3 kinase) pathway, the mitogen activated protein kinase (MAPK) pathway and by the transient activation of the Jun N-terminal kinase (JNK) and p38 stress activated protein kinase (SAPK) pathways (Baserga et al., 1997a; Baserga et al., 1997b; O'Connor et al., 1997; O'Connor, 1998; SeppLorenzino, 1998). Activation of the PI-3 kinase and MAPK pathway results in serine phosphorylation of BAD, a pro-apoptotic member of the BCL-2 family. This prevents BAD heterodimerization with Bcl-2 and Bcl-Xl, which promote mitochondrial integrity thereby preventing cytochrome C release, activation of the caspase cascade and the onset of apoptosis (Gajewski and Thompson, 1996). A variety of methods such as gene deletion, dominant negative, antisense strategies, blocking antibodies and mutated receptor constructs have identified a major role for the IGF-1R in apoptosis and cell survival (Baserga et al., 1997a; Baserga et al., 1997b; Sepp-Lorenzino, 1998; Brodt et al., 2000). A functional IGF1R is required for survival of cells in the haematopoietic lineage such as bone marrow, progenitor cells and activated T lymphocytes (Merchant et al., 1995; Rodriguez-Tarduchy et al., 1992; Walsh and O'Connor, 2000). A minimum level of IGF-1R protein expression is necessary for cellular transformation and maintenance of the transformed phenotype. When the function of the IGF-1R is decreased, tumour cells undergo massive apoptosis (Hongo et al., 1998; Resnicoff et al., 1995a; Resnicoff et al., 1995b; Stiles et al., 1979). Mutational analysis of the IGF-1R has identified domains and residues required for protection from apoptosis (LeRoith et al., 1995; Baserga et al., 1997a; Baserga et al., 1997b; O'Connor et al., 1997; Hongo et al., 1998; Sepp-Lorenzino, 1998). The point mutations Y1250F/Y1251F and H1293F/K1294L in the IGF-1R abolish IGF-1 mediated protection from apoptosis (Resnicoff et al., 1995a).

56


There is a strong link between protection from apoptosis and the ability of RTKs like the IGF-1R to activate Ras (the guanine nucleotide exchange factor) and indeed its downstream effectors Raf and MAPK (Baserga et al., 1997a; Bonni, 1999). Another major survival signalling pathway activated by the IGF-1R in suppression of apoptosis is through the activation of PI-3 kinase and Akt and occurs following receptor activation and subsequent phosphorylation of insulin receptor substrate (IRS)-1 and IRS-2 (Dudek et al., 1997; Kauffmann-Zeh et al., 1997). Transient activation of the JNK and p38 SAPK pathways has also recently been implicated in IGF-1R mediated cell survival (Heron-Milhavet et al., 2001; Krause et al., 2001), suggesting that pathways other than PI-3 kinase and MAPK are involved. 6.2

THE IGF-1 RECEPTOR AND CELL PROLIFERATION

IGF-1 by itself is not sufficient to sustain growth of cells in serum free media. It requires cooperation from many growth factors including PDGF, EGF and fibroblast growth factor (FGF). In fact all growth factors fail to induce proliferative responses by themselves (Scher et al., 1979; Stiles et al., 1979). Sell et al established an embryonic fibroblast cell line from mice which were homozygous for a targeted disruption of the Igf1r gene (Sell et al., 1994). These cells (R- cells) were used in comparison studies with wild type littermate controls (W). W cells grew as normal in serum free media supplemented with growth factors whereas R- cells did not. Importantly, reintroduction of the Igf-1r cDNA into R- cells (R+) restored the ability of these cells to grow with supplementary growth factors. The role of the IGF-1R in cell proliferation has been studied extensively (Reiss et al., 1997; Dupont et al., 2001) and the IGF-1R is needed for optimal progression through the cell cycle. Lack of signals through the IGF-1R lengthens the cell cycle (Leof et al., 1982; Campisi and Pardee, 1984). In R- cells, all phases of the cell cycle are elongated (Sell et al., 1994; Valentinis et al., 1994). The IGF-1R induces the expression of proteins involved in cell cyclin progression such as cyclin dependent kinases (Cdks) and down regulates many Cdk inhibitors (KanterLewensohn et al., 2000). A comprehensive understanding of the precise mechanism for cell cycle control by the IGF-1R will prove essential for investigation of proliferative diseases. The role of the IGF-1R system in cell proliferation is evident in a variety of cell types including fibroblasts, epithelial cells, haematopoietic cells, osteoblasts, smooth muscle cells, and cells of the central nervous system (CNS) (Baserga and Rubin, 1993; Baserga et al., 1994). It is now widely accepted that the IGF-1R plays a critical role in the mitogenic action of other growth factors (Pietrzkowski et al., 1992). It has been shown that the EGF receptor needs a functional IGF-1R to exert its mitogenic potential. In MCF-7 cells (a human breast cancer derived cell line) growth factors acting through the IGF-1R promote cell proliferation (Huff et al., 1986; Karey and Sirbasku, 1988; van der Burg et al., 1988). Withdrawal of serum


57

results in arrest of these cells in the G0/G1 phase of the cell cycle, which can be restored by addition of IGF-1. Activation of the PI-3 kinase and MAPK pathways are thought to be the main effectors of the proliferative responses mediated through the IGF-1R and other growth factor receptors although it must be noted that activation of the PI-3 kinase and MAPK pathways by the IGF-1R can occur independently of each other (Dufourny et al., 1997). This suggests that the proliferative programmes of cells are tightly regulated. 6.3

THE IGF-1 RECEPTOR AND DIFFERENTIATION

Cell proliferation and differentiation are balanced during development and this balance is often controlled by the availability and actions of growth factors including IGF-1. IGF-1 stimulates cell differentiation after initiating short proliferative events in many cells including intestinal, muscle, adipose and bone marrow derived macrophages (Long et al., 1998; Ewton et al., 2002; Ruiz-Hidalgo et al., 2002). Serum withdrawal activates the differentiation of skeletal myoblasts in vitro (Cheng et al., 2001), which suggests that IGF-1 and other growth factors suppress this process. The signaling responses associated with differentiation are tightly regulated. IGF-1 induces NIH-3T3 fibroblast cell proliferation and survival by activating Akt, which in turn inhibits various apoptotic mediators and the forkhead family of transcription factors. However, this Akt signal is short lived, allowing transcriptional upregulation of some Cdk inhibitors resulting in growth arrest and subsequent differentiation by down regulation of the MAPK signalling pathway. The EGF-like membrane protein Dlk, modulates ERK/MAPK signalling in response to IGF-1 and is a signal for differentiation in 3T3-L1 adipocyte cells (Ruiz-Hidalgo et al., 2002). This switch from IGF-1 mediated proliferation to differentiation is also seen in preadipocytes (Boney et al., 2000). 6.4

THE IGF-1 RECEPTOR AND CELL MOTILITY

Growth factor stimulated cell motility is involved in fundamental physiological processes such as embryogenesis, wound healing, tumour invasion and metastasis. Cell movement requires remodelling of the actin cytoskeleton and stabilisation or destabilisation of focal adhesions, a process strongly influenced by growth factors (Chan et al., 1998a). IGF-1 mediated motility has been demonstrated in vitro in fibroblasts (Samani and Brodt, 2001) neuronal cells (Cheng et al., 2000) and breast cancer cells (Guvakova and Surmacz, 1999; Manes et al., 1999). Recently the IGF1R has been shown to play a major role in cell motility and actin cytoskeletal organization in MCF-7 cells. Here activation of the IGF-1R induces the formation of fascin “spikes” found at cell projections (Guvakova et al., 2002). IGF-1R stimulation also causes human neuroblastoma cells to undergo morphological changes leading to extension of lamellipodia and motility. This procedure was

58


dependent on signalling through PI-3 kinase and MAPK pathways. Protein tyrosine phosphatase (PTP)-1B has been shown recently to play a role in IGF-1R mediated motility (Buckley et al., 2002). PTP-1B -/- cells were shown to enhance IGF-1 mediated motility providing evidence that lack of IGF-1R regulation by PTP-1B changes this function of the IGF-1R. Recent work in a mouse model to study the role of IGF-1R function in pancreatic islet tumorigenesis (Lopez and Hanahan, 2002) and in primary prostate cancers (Chan et al., 2002; Lehrer et al., 2002) demonstrates that IGF-1R function contributes to cancer cell metastasis. Metastasis is dependent on cell motility and adhesion, and tumour cell lines known to be more highly invasive have a higher degree of cell motility. 6.5

THE IGF-1R AND TRANSFORMATION

Overexpression and/or constitutive activation of IGF-1R in many cell types results in ligand dependent growth in serum free media and the establishment of the transformed phenotype (the ability to form colonies in soft agar and/or produce tumours in nude mice) (Coppola et al., 1994; Pietrzkowski et al., 1992; Rogler et al., 1994; Sell et al., 1994). Several models suggest that suppression of apoptosis is a major requirement for the establishment of the transformed phenotype and IGF-1R signalling could contribute to this. It had been believed that suppression of apoptosis was the major requirement for the establishment of the transformed phenotype (Hanahan, 1985; Evan et al., 1995). R- cells, which were described earlier, are refractory to transformation by a series of viral and cellular oncogenes that have the ability to transform embryonic fibroblast cell lines that were transfected to re-express the IGF-1R. This list of oncogenes includes SV40 T antigen (Sell et al., 1993), activated Ras or a combination of activated Ras and SV40 T antigen (Sell et al., 1994), human papilloma virus (Steller, 1995) and overexpressed growth factors (Coppola et al., 1994; DeAngelis et al., 1995; Miura et al., 1995a; Miura et al., 1995b). Mutation of Y950 results in a receptor which loses its ability to transform cells (Miura et al., 1995a). As discussed previously Y950 in the IGF-1R is critical for IRS-1/2 and Shc binding. Romano et al (Romano et al., 1999) show that R- cells transfected with this mutant (the Y950F mutant in the IGF-1R) still mediate IGF-1 mediated mitogenesis. There is further evidence to support this result, that the antiapoptotic and mitogenic effects of the IGF-1R are independent of IRS proteins (Sepp-Lorenzino, 1998). IRS proteins may bind to the activated IGF-1R by mechanisms that do not require the NPXY motif (He et al., 1996), or a possible role for Shc in mitogenesis and the anti-apoptotic roles of the IGF-1R. The C-terminal region of the IGF-1R appears to be carry within it domains and amino acid residues that are essential for the transforming activity of IGF-1R (O'Connor, 1998; Krause et al., 2001)


59

Mechanism of Igf-1 Receptor Activation

Ligand binding to the IGF-1R initiates receptor signalling from the cell surface. An activated IGF-1R autophosphorylates itself and this is thought to remove alternate substrate/inhibitory constraints. The phosphorylated residues function as docking sites for the assembly of signalling complexes. In this way cellular adapter proteins and signalling molecules are recruited and able to transmit different signals into the cell. Signalling through the IGF-1R is thought to be similar to other RTKs in that it is regulated (switched off) by down regulation of receptors from the cell surface and by complex negative feedback loops involving PTPs and intracellular kinases. The IGF-1R binds IGF-1 and IGF-2 at the cysteine rich domains of the α subunit (Schumacher et al., 1991; Soos et al., 1992; Schumacher et al., 1993). Ligand binding to this extracellular portion of the IGF-1R leads to transmission of signals through the transmembrane domain to the β-chain which undergoes significant conformational change resulting in activation of the tyrosine kinase activity of the receptor (Sell et al., 1995; Hubbard et al., 1998). The majority of RTKs contain between one and three tyrosines in the kinase activation loop known as the A-loop. Autophosphorylation of the tyrosine cluster (Y1131, Y1135, Y1136) in the kinase domain constitutes the initial phosphorylation event in the IGF-1R (Figure 2). Then, Y943 and Y950 in the juxtamembrane domain and Y1316 in the C-terminal domain are phosphorylated. The major sites for ligand induced phosphorylation are thought to be these six tyrosines (Peterson et al., 1996; Hubbard et al., 1998; SeppLorenzino, 1998). Little is known about the role of the other nine tyrosines in activation of the IGF-1R. A mutant of the IGF-1R with all the tyrosines in the tyrosine cluster mutated to phenylalanine, generated an unresponsive receptor that was not phosphorylated in response to ligand (Jiang et al., 1996; Hubbard, 1999). This indicates that phosphorylation of the triad is critical for stimulation of catalytic activity and biological function of the IGF-1R through activation of intrinsic tyrosine kinase activity towards phosphorylation of other sites in the receptor and in substrate proteins. Autophosphorylation is an intramolecular process and depends on the presence of intact IGF-1R tetramers (Feltz et al., 1988; Magee and Siddle, 1988). The reaction is thought to occur in trans where one β-subunit phosphorylates the other member of the pair (Dufourny et al., 1997; Hellberg et al., 2002). There is some evidence to suggest that IGF-1R and its signalling networks could be activated in the absence of IGF, through the formation of functional receptor heterodimers made up of one insulin αβ dimer and one IGF-1R αβ dimer (Frattali and Pessin, 1993; Takata and Kobayashi, 1994). This could explain some of the overlapping signalling pathways activated by insulin and IGF-1. These heterodimers do exist in vivo and vary widely among cell lines and tissues including adipose tissue, liver and placenta

60


and may account for up to 90% of IGF-1 binding sites in skeletal muscle and heart (Bailyes et al., 1997; Federici et al., 1997). Phosphorylation and subsequent activation of the IGF-1R leads to rapid phosphorylation of IRS proteins, which are the major substrates for IGF-1R and IR (Myers et al., 1994; Kadowaki et al., 1996; Myers and White, 1996). The members of this family contain sequences involved in the interaction with the IR and IGF-1R such as the protein tyrosine binding (PTB) domain (He et al., 1996; Sawka-Verhelle et al., 1996; Sun et al., 1995). This PTB domain recognises the motif NPXY and binds phosphorylated Y950 in the IGF-1R (Y960 in the IR) leading to activation of the IRS protein by the tyrosine kinase receptor (Sun et al., 1995; Xu et al., 1999). GRB 10 and Shc have also been identified as interacting proteins that are phosphorylated upon IGF-1R activation and can recruit other signalling molecules (LeRoith et al., 1995; Werner and LeRoith, 1996). The C-terminal region of the IGF-1R has been hypothesized to have the potential to mediate the major differences in signalling events that exists between the IGF-1R and the IR (Hongo et al., 1996; Miura et al., 1995b; Surmacz et al., 1995) (Figure 2). Y1316 in the C-terminus domain of the IGF-1R interacts with the p85 subunit of PI3 kinase and with SHP2 (Lamothe et al., 1995; Rocchi et al., 1996; Tartare et al., 1994). 14-3-3 and IIP-1 have also been shown to bind to this C-terminal area (Craparo et al., 1997; Ligensa et al., 2001). Recently, RACK1 has been identified as an IGF-1R interacting protein (Hermanto et al., 2002; Kiely et al., 2002) Down regulation of RTKs is thought to be necessary for limiting and ultimately dampening of the previously activated signalling networks. This is accomplished in part by internalisation of the activated receptor after signal transmission (Ullrich and Schlessinger, 1990). Mutation of Y1131 to phenylalanine in the autophosphorylation cluster of the IGF-1R markedly reduces receptor internalisation (Stannard et al., 1995). The juxtamembrane region of the IGF-1R contains critical residues between Glycine at position 940 and Y957 required for efficient internalisation by the endocytic machinery of the cell (Arbet-Engels et al., 1999; Nguyen et al., 2000; Sepp-Lorenzino, 1998; Valverde et al., 1998).

8.

Signalling Pathways That Emanate From An Activated Igf-1 Receptor.

In recent years, we have seen rapid progress made in understanding intracellular signalling pathways. The most well characterized signal transduction pathways activated by the IGF-IR are the MAPK pathway and the PI-3 kinase pathway (reviewed in (Toker and Newton, 2000; Chang and Karin, 2001). More recently JNK and p38 have also been implicated in IGF-1R signalling (LeRoith et al., 1995; Krause et al., 2001). A summary of the known apoptotic signalling pathways are shown in Figure 3.


61

Figure 3. IGF-1 mediated activation of the MAP kinase, PI3-kinase and Jun kinase signalling via IRS and Shc. Both Shc and IRS proteins bind to tyr950 on the activated IGF-1R and become phosphorylated. This creates binding sites for other proteins in the signal transduction cascade. Recruitment of the p85 subunit of PI-3 kinase leads to activation of AKT and cell survival. Formation of the Grb2/SOS complex leads to activation of the MAP kinase pathway and mediates growth and mitogenic effects. Shc is involved in recruitment of substrates that lead to activation of the JNK pathway, which can also promote cell survival.

8.1

THE RAS/MAP KINASE SIGNALLING CASCADE

Activation of the IGF-1R results in stimulation of the exchange of GTP for GDP on the small G protein Ras. This is accomplished through recruitment of Grb-2 to tyrosine phosphorylated IRS proteins or Shc and the subsequent association of the guanine nucleotide exchange factor, Sos with Grb2 via the Sos SH3 domain. (Margolis et al., 1999). Once Sos is at the plasma membrane, it is in close proximity to Ras and can stimulate the exchange of GTP for GDP (Schlessinger and Bar-Sagi, 1994). Alternatively, the Grb2/Sos complex can be recruited to the cell membrane following IGF-1 stimulation, by binding to IRS-1 (Sun, 1993). Once, Ras binds GTP, it can interact with several effector proteins such as Raf and PI-3 kinase, thereby stimulating several intracellular processes. Activated Raf stimulates MAPkinase-kinase (MAPKK, MEK) by phosphorylating a key serine residue in it activation loop. MAPKK then phosphorylates MAPK (ERK) on threonine and tyrosine residues at the activation loop, leading to its activation. Activated MAPK phosphorylates a variety of cytoplasmic and membrane linked substrates such as the

62


EGF receptor and Sos. Also MAPK translocates to the nucleus where it phosphorylates and activates transcription factors (Hunter, 2000). This highly conserved signal transduction cascade plays an important role in cell proliferation, differentiation and motility. 8.2

PHOSPHOINOSITIDE-3KINASE SIGNALLING

PI-3 kinase is activated by ligand stimulated IGF-IR and this response is strongly associated with IGF-1-mediated cell survival (Kauffmann-Zeh et al., 1997; Kennedy et al., 1997). One group of PI-3 kinases are heterodimers composed of a regulatory subunit, p85, which contains two SH2 domains and one SH3 domain and a catalytic subunit, p110. PI-3 kinase can become activated in a number of different ways, by direct binding of the p85 subunit of PI-3 kinase to P-Y1316 on the activated IGF-IR (Tartare-Deckert et al., 1996), by binding with tyrosine phosphorylated IRS-1, or alternatively by p85 interaction with Gab-2 in the Gab-2/Grb2 complex which binds to the activated IGF-IR (Krause et al., 2001). Once PI-3 kinase is activated, it phosphorylates the polyphosphoinositides, PtdIns(4)P and PtdIns(4,5)P2, to generate the second messengers, PtdIns(3,4)P2 and PtdIns(3,4,5)P3. PtdIns(3,4,5)P3 mediates the translocation to the membrane of a number of signalling proteins, the most important of which are the Ser/Thr kinases PDK1 and PKB/Akt and subsequent activation of Akt by PDK1 (Rameh and Cantley, 1999). PDK1 has a PH domain in the C-terminus of the protein through which it binds to PtdIns(3,4,5)P3, leading to membrane translocation (Alessi et al., 1997). Akt is also recruited to the membrane via binding of its N-terminal PH domain binding to PtdIns(3,4,5)P3 (Franke et al., 1995) and is phosphorylated by PDK1 on Thr308 in its activation loop. Phosphorylation of Akt on Ser473 is required for full activation, and it has been reported that phosphorylation of this residue is mediated by transautophosphorylation (Toker and Newton, 2000). PI-3 kinase dependent activation of Akt has been shown to mediate IGF-1 cell survival (Kauffmann-Zeh et al., 1997; Kulik et al., 1997). One mechanism by which Akt promotes survival is through phosphorylation and subsequent inactivation of the pro-apoptotic protein, Bad. This blocks Bad from forming a complex with the antiapoptotic proteins Bcl-2 and Bcl-Xl at the mitochondrial membrane (Datta et al., 1999). Another mechanism for inhibition of apoptosis is via Akt-induced phosphorylation of the transcription factor FKHR1 (Brunet et al., 1999), which in turn suppresses pro-apoptotic gene expression. The importance of Akt in IGF-1-mediated survival signalling is underscored by the actions of the tumour suppressor PTEN, a negative regulator of Akt activation. PTEN is a lipid phosphatase that metabolises the PtdIns(3,4,5)P3 produced by PI-3 kinase preventing downstream PDK1 and Akt activation (Maehama and Dixon, 1998). This is particularly evident in several advanced cancers where PTEN activity is decreased through mutation or loss of heterozygosity (Li et al., 1997; Myers et al.,


63

1997). Loss of PTEN is associated with enhanced tumour cell survival and angiogenesis (Myers et al., 1992; Steck et al., 1997; Wen et al., 2001; Huang and Kontos, 2002; Leslie and Downes, 2002). The PI-3 kinase pathway activated by the IGF-1R and the IR is necessary for metabolic signalling and the promotion of cell survival via maintenance of the metabolic function of mitochondria (Vander Heiden et al., 1999; Vander Heiden and Thompson, 1999). It is likely that Akt exerts a proportion of its survival effect through such mechanisms. Mitochondria play a major role in apoptosis through the release of cytochrome c and other proapoptotic proteins that normally reside in the intermembrane space between the inner and outer mitochondrial membranes (Gross et al., 1999). It has recently been shown that activated Akt inhibits pre-cytochrome c release and preserves mitochondrial function and integrity. This anti-apoptotic effect requires glucose availability and metabolism. Indeed the first step of glycolysis catalysed by hexokinase is sufficient for Akt suppression of apoptosis (Gottlob et al., 2001).

8.3

THE STRESS-ACTIVATED PROTEIN KINASE PATHWAY

SAPKs are a family of protein kinases closely related to the MAPKs, and consist of the JNKs and p38 kinase. The role of SAPKs in cell survival has been controversial (reviewed in Davis, 2000). JNK activity has often been linked with apoptosis, although it is clear that JNK is not required for induction of apoptosis in response to divergent pro-apoptotic stimuli. However, more recent evidence has pointed towards a important function for JNKs in growth factor signal transduction. Many cytokines cause transient JNK activation and this is associated with cell survival. In a biphasic response to TNF alpha there is a correlation with prolonged activation of JNK and induction of apoptosis, whereas there is a correlation with transient activation of JNK and suppression of apoptosis (Roulston et al., 1999). It has also been reported that integrin-mediated survival signalling can be mediated by the JNK pathway (Almeida et al., 2000). We have recently shown that IGF-IR activation leads to a transient increase in JNK phosphorylation in the murine B lymphoblastic cell line FL5.12 (Krause et al., 2001). This JNK activation occurred independently of PI-3 kinase activation, and a specific JNK inhibitor SP600125 led to abrogation of IGF-1 mediated cell survival. A role for JNK in promoting survival of transformed B lymphoblasts has also been proposed from the observation that JNK knockout mouse cells could not be transformed by Bcr-Abl (Hess et al., 2002). Activation of the IGF-1R can lead to activation of several SAPKs and the consequence of this is not known, although it is likely that they may have a role in regulation of IGF-1R signalling as well as in modulating cell survival. Promoter activity of the bcl-2 gene can be increased by IGF-1 stimulation through activation of CREB via a novel signalling pathway mediated by MAPK kinase 6, p38β MAPK, MAPKAP-3, which in turn leads to survival (Pugazhenthi et al., 1999a; Pugazhenthi

64


et al., 1999b). IGF-1 also regulates the MDM2/p53/p21 signalling pathway in a p38 dependent fashion (Heron-Milhavet et al., 2001). It is not yet clear which proximal IGF-1R substrates are necessary for activation of the stress kinase pathways although it is known that JNK activation in response to IGF-1 leads to phosphorylation of several upstream activators of JNK including HPK, MEKK4 and also to phosphorylation of c-Jun (Krause et al., 2001) and our unpublished observation). JNK was originally found to bind the NH2-terminal activation domain of c-Jun (Adler et al., 1992) and to phosphorylate c-Jun on Ser-63 and Ser-73. Phosphorylation of c-Jun on these sites causes increased transcriptional activity. JNK is encoded by three genes (jnk1, jnk2 and jnk3) and are activated by phosphorylation on Thr and Tyr by MKK4 and MKK7, which are in turn activated by upstream MAPKKK (Tournier et al., 2000). Several MAPKKK have been reported to activate the JNK signalling pathway. These include members of the MEKK group, the mixed-lineage kinase group, and the ASK group. Scaffold proteins for the JNK family have been identified. The JNK –interacting proteins (JIP) have been proposed to act as molecular scaffolds that organise the JNK signal transduction pathway in response to specific stimuli (reviewed in Whitmarsh et al., 1998). The assembly of the JNK module by a scaffold protein may lead to the efficient activation of JNK within a restricted region of the cell by a specific stimulus. 8.4

OTHER SIGNALLING PATHWAYS ACTIVATED BY THE IGF-I RECEPTOR

Recent evidence indicates that Stat proteins can be activated by a variety of receptor tyrosine kinases, including the IGF-IR (Zong et al., 2000). It was found that Stat3, but not Stat5, was activated in response to IGF-I. Over-expression of dominant-negative Jak1 or Jak2 (regulators of Stat activation) was sufficient to block the IGF-IR-mediated tyrosine phosphorylation of Stat3. In another report, expression in of a dominant negative mutant of Stat3 in 32D cells that over-express the IGF-1R leads to inhibition of IGF-1 mediated differentiation (Prisco et al., 2001). This caused a dramatic increase in Id2 gene expression. This increase is IGFI dependent and requires Y950 in the IGF-IR. The IGF-IR has also been found to up-regulate Id1 genes in a Stat3 dependent mechanism (Belletti et al., 2002). The cytoplasmic tyrosine kinase Src can phosphorylate and activate the IGF-IR (Peterson et al., 1996). The protein responsible for negative regulation of Src, the Cterminal Src kinase (Csk), can bind via its SH2 domains to P-Y943 and P-Y1316 on the activated IGF-IR (Arbet-Engels et al., 1999). It has been suggested that Y1316 is more effectively phosphorylated by Src rather than by ligand induced autophosphorylation (Peterson et al., 1996), and therefore Csk binding to this residue may be an important control mechanism for attenuation of increased IGF-IR signalling by Src.


65

Another potential alternative signalling pathway activated by the IGF-IR originates from the serines at positions 1280 to 1283. This region has been associated with recruitment of 14-3-3 proteins (Peruzzi et al., 2001). This pathway results in the translocation of Raf-1 to the mitochondria, where it leads to the stabilization of Bad in the phosphorylated and inactive state, thereby promoting cell survival.

9.

Regulation of IGF-1 receptor signalling by phosphatases

Very little is known about the dephosphorylation events that terminate IGF-1R activation and downregulation of its downstream signalling pathways. We have recently identified PTP-1B as a direct negative regulator of IGF-1R function (Buckley et al., 2002) and this has previously been shown for the IR (Goldstein et al., 1998a; Walchli et al., 2000; Zabolotny et al., 2001). Coexpression of PTP-1B with the β-chain of the IGF-1R inhibited IGF-1R kinase activity in the fission yeast Schizosaccharomyces pombe, COS cells and in IGF-1R deficient fibroblasts. Embryonic fibroblasts derived from PTP-1B knockout mice (PTP-1B-/-) demonstrated higher levels of IGF-1R autophosphorylation and kinase activity in response to IGF-1 stimulation. Cell survival and IGF-1R functions associated with the transformed phenotype were also enhanced in these PTP-1B-/- cells. Reintroduction of PTP-1B into embryonic fibroblasts resulted in decreased IGF-1 induced IGF-1R autophosphorylation and kinase activity as well as attenuation of IGF-1R functions such as protection from apoptosis and decreased motility (Buckley et al., 2002). There are other studies that suggest a link between PTP-1B and the IGF-1R. A substrate-trapping mutant of PTP-1B co-immunoprecipitates with the IGF-1R (Kenner et al., 1996) and PTP-1B has been shown to interact with, and inactivate IRS-1 (Bandyopadhyay et al., 1997; Goldstein et al., 1998a; Goldstein et al., 1998b). In the yeast that we used to measure PTB-1B effects on IGF-1R activation we saw that the phosphatase Shp-2 did not inhibit IGF-1R activation. A role for Shp-2 as a positive regulator of IGF-1R signalling has been proposed (Maile and Clemmons, 2002; Maile et al., 2002). Efforts to identify other regulators of the IGF1R and regulators of IGF-1 induced signalling cascades are underway and would increase our understanding of IGF-1R function as well as suggest ways in which to manipulation IGF-1R signalling pathways in normal and transformed cells.

10.

Adaptor and scaffold proteins that modulate IGF-1 receptor functions.

The IGF-IR can recruit a range of adapter proteins including Shc, members of the IRS family, Crk family, and Grb10 and to mediate or modulate activation of signalling pathways in response to IGF-I stimulation. These proteins interact with

66


the IGF-1R via SH2 or PTB. Most SH2 or PTB containing adapter proteins contain additional protein-protein interaction domains, such as SH3 or PDZ domains, which can bind to, and therefore increase the selection of adapter proteins and/or signalling molecules recruited to the activated IGF-IR. In turn, IGF-I dependant tyrosine phosphorylation of these adapter proteins creates additional binding sites for other signalling proteins. 10.1

THE IRS FAMILY AND SHC

The IRS proteins are a family of proteins that are phosphorylated by the activated insulin and IGF-IRs and serve as docking proteins for the activation of down-stream pathways. There are at least four members of this family that have been identified (IRS-1, IRS-2, IRS-3 and IRS-4). A diverse array of SH2 domain containing proteins can then bind to the phosphorylated IRS proteins, such as Grb2, Shc, Nck, SHP2, Fyn and the catalytic subunit of PI-3 kinase, p85 (Sun et al., 1993; Kasus-Jacobi et al., 1997). Knock out (KO) mice have been established for each gene. IRS-1-deficient mice have a phenotype of growth retardation and insulin resistance (Tamemoto et al., 1994), whereas IRS-2 KO mice are overtly diabetic due to reduced ȕ-cell mass and insulin resistance (Withers et al., 1998). In contrast, mice with disruption of IRS-3 do not show any obvious defect in growth or glucose metabolism (Liu et al., 1999), and mice lacking IRS-4 exhibit very mild defects in growth, reproduction and glucose homeostasis (Fantin et al., 2000). Recently it was found that IRS-3 and IRS-4 act as negative regulators of IGF-I signalling pathways by suppressing the function of IRS-1 and IRS-2 in embryonic fibroblasts (Tsuruzoe et al., 2001). Indeed, IRS-1deficiency causes a significant reduction in response to IGF-1 and insulin protection from apoptosis induced by serum withdrawal. It also has recently been reported that expression of a human IGF-1R in an IL-3 dependent haematopoietic cell-line 32D/IRS-1 results in nuclear translocation of IRS-1 and IL3 independence (Prisco et al., 2002). The other major adaptor protein recruited to the IGF-1R upon ligand binding is Shc. Three isoforms of the Shc family are known to exist (p46, p52 and p66 kDa, B, A and C respectively) (Bonfini et al., 1996). The essential nature of Shc in vivo has been demonstrated by the knockout of the shcA gene, which results in embryonic leathality at day 11.5 (Lai and Pawson, 2000). There were defects in angiogenesis and cell-cell contacts in the cardiovascular system. Also, cells from mutant mice showed significant changes in focal contact oganisation and actin stress fibers when plated on fibronectin-coated coverslips, suggesting a role for Shc in cytoskeletal organisation. Activation of the IGF-1R results in recruitment and phosphorylation of Shc on three tyrosine residues (Y239, Y240, and Y317) that then act as docking site for the SH2 domain of Grb2. Via its SH3 domain(s), Grb2 binds Sos, which activates Ras and, consequently, the rest of the MAPK pathway (Seger et al., 1995). More recently


67

a new role for Shc has been identified in mediating activation of the PI-3 kinase/Akt pathway via Dos/Gab family scaffolds (Gu et al., 2000) and the p85 subunit of PI-3 kinase has been found to immunoprecipitate with Shc (Krause et al., 2001). 10.2

GRB10, CRKII AND CRKL

The Grb10, CrkII and CrkL adapter proteins are also involved in IGF-1R signal transduction. Evidence for binding of Grb10 to the IGF-IR has been established using the yeast two-hybrid system (Morrione et al., 1997). Grb10 appears to have a negative effect on IGF-1R signalling, with IGF-1 induced proliferation inhibited by overexpression of Grb10α (Morrione et al., 1997). Crk proteins mediate IGF-1R signalling to the cytoskeleton (Casamassima and Rozengurt, 1998). CrkII is the cellular homologue of the viral oncoprotein, v-Crk, while CrkL was discovered more recently (Matsuda et al., 1992). Both CrkII and CrkL share a similar structure with a single N-terminal SH2 and two C-terminal SH3 domains. IGF-1 stimulation of cultured embryonic kidney and NIH-3T3 cells induces the tyrosine phosphorylation of CrkII (Beitner-Johnson and LeRoith, 1995). In the rat uterus, IGF-1 stimulation has markedly different effects on CrkII and CrkL tyrosine phosphorylation and association with the focal adhesion protein paxillin (Butler et al., 1998). The tyrosine phosphorylation of CrkL is increased following IGF-1 stimulation, whereas CrkII is not affected. Whereas CrkL dissociates from paxillin, CrkII association is stimulated. It has also been recently reported that CrkII and CrkL associate with IRS-4 in an IGF-1 dependent manner (Karas et al., 2001). 10.3

RACK1

The WD repeat scaffold protein (Receptor for Activated C Kinases) RACK1 has recently been identified as a new regulatory adapter protein for the IGF-1R by our group (Kiely et al., 2002) and by Hermanto et al (Hermanto et al., 2002). RACK1 was originally discovered on the basis of its sequence homology with Gsβ, the β subunit of the trimeric G-proteins (Guillemot et al., 1989) and resembles Gsβ in that it also possess repeats of the WD40 motif first identified in the trimeric G proteins (Fong et al., 1987). The WD motif is defined as a protein-protein interaction domain, (reviewed in McCahill et al., 2002). RACK1 is a 36kDa protein with 317 amino acids and has seven WD repeats. RACK1 was subsequently identified as a potential adaptor protein for activated protein kinase C (PKC) (Ron et al., 1994; Mochly-Rosen et al., 1995; Ron et al., 1995; Ron and Mochly-Rosen, 1995). Based on X-ray structural studies of the other WD40 family members, Steele et al (Steele et al., 2001), used mutational analysis to propose a seven blade β propeller structure for RACK1, with each of the seven WD repeats forming a separate β propeller fold. It is now becoming more evident that RACK1 functions as an adaptor for multiple proteins in distinct signalling pathways.

68


Interaction of RACK1 with the IGF-1R did not require tyrosine kinase activity or receptor autophosphorylation, but did require serine 1248 in the IGF-1R C terminus (Figure 4). Over-expression of RACK1 in fibroblasts or MCF-7 cells enhanced proliferation and cellular motility but decreased IGF-1-mediated protection from etoposide induced death. This was accompanied by a reduction in IGF-1-induced phosphorylation of Akt, whereas IGF-1-induced phosphorylation of MAPK and JNK was increased. These data suggest that RACK1 is a positive regulator of IGF-1R-mediated cell motility and proliferation, but is a negative regulator of IGF-1 mediated survival. Interestingly, although the studies by Hermanto did not detect effects of RACK-1 on IGF-1-mediated signalling there studies showed that over-expression of RACK-1 promotes cell spreading, contact with the extracellular matrix and IGF-1-dependent integrin signalling. Altogether these two studies (Hermanto et al., 2002; Kiely et al., 2002) suggest that RACK1 may mediate a point of integration between IGF-1R and integrin signaling. It is likely that RACK1 may have a particular role in IGF-1R and integrin signalling in tumour cells. This is supported by observations from our group and others that RACK1 is inhibitory to the growth of normal fibroblasts and can only be over-expressed in transformed cells or cells that over-express the IGF-1R (Chang et al., 1998; Hermanto et al., 2002; Kiely et al., 2002). There are also a number of reports that indicate that RACK1 is important in cancer progression and that it has increased expression in human carcinomas (Berns et al., 2000; Schechtman and Mochly-Rosen, 2001). RACK1 expression is upregulated during angiogenesis and is also expressed in tumour angiogenesis. RACK1 expression is higher in small cell lung and colon carcinomas than in corresponding normal tissue (Berns et al., 2000) and RACK1 mRNA has higher expression levels in colon cancer than in non-cancerous regions (Berns et al., 2000). We would propose that the results from studies on the functional interaction of RACK1 with the IGF-1R suggest how it might contribute to cancer progression. If more RACK-1 becomes available as is the case in cells that are transfected to overexpress RACK1 this results in increased cellular proliferation, motility, and extracellular matrix connection: all functions which are associated with cancer progression. How might RACK1 integrate and regulate IGF-1R and integrin signalling? Clues may come from the mechanisms associated with known interactions of RACK1 with PKCs, Src and other proteins. The role of RACK1 in PKC signalling is well documented and is thought to be principally to shuttle activated PKCs around the cell, and in particular to the cell membrane (Ron et al., 1995; Korchak and Kilpatrick, 2001; Stebbins and Mochly-Rosen, 2001). PKC isotypes possess a pseudo-RACK binding site in their Ca2+ binding domain. The conformational change in the PKC isozymes induced by co-factors, frees the RACK1 binding site and allows the RACK molecule bind PKC. This binding site for RACK1 on PKC is within the C2 region of the regulatory domain (Ron et al., 1994). However, this


69

adaptor protein does not act as a substrate or indeed an inhibitor of the PKC isozyme. The importance of RACK1 in PKC translocation to the cell surface is supported by the demonstration that changes in brain RACK1 levels during aging may be responsible for age-dependent decreases in PKC translocation to the cell membrane (Battaini et al., 1999; Friedman et al., 1993; Friedman and Wang, 1989; Pascale et al., 1996).

Figure 4. RACK1 binds to the C-terminus of the IGF-1R and modulates receptor signalling. Mutation of S1248 in the C-terminus of the IGF-1R prevents interaction of RACK1 with the IGF-1R. Overexpression of RACK1 in either fibroblasts or MCF-7 cells enhances cell proliferation and motility as well as IGF-1 induced MAP kinase and JNK activation. RACK1 inhibits IGF-1 induced phosphorylation of AKT and cell survival (Kiely et al., 2002). RACK1 also enhances cell spreading and integrin signalling (Hermanto et al, 2002).

A direct interaction between RACK1 and integrin β subunit that is dependent on PKC activation has been reported (Liliental and Chang, 1998). This report suggests that PKC may be involved in integrin function (Rietzler et al., 1998). A role for RACK1 in focal adhesion and integrin mediated signalling could be mediated by its interaction wirh Src, which binds to and phosphorylates RACK1

70


(Chang et al., 2001; Chang et al., 1998; Chang et al., 2002; Chang et al., 2003). Cox et al (Cox et al., 2003), show that RACK1 regulates adhesion, protrusion and chemotactic migration through its interaction with Src. Sequestration of Src has been proposed to account for the growth inhibitory effect of RACK1 in NIH-3T3 cells (Chang et al., 1998) since RACK1 exerts its effects during the G0/G1 phase of the cell cycle inhibiting growth and of these cells and activity of Src tyrosine kinase. Interestingly, we observed that IGF-1 induces release of Src from RACK1 after 30 minutes stimulation and this may regulate Src availability to substrates in focal contacts (Kiely et al., 2002). The protein tyrosine phosphatase PTPµ regulates PTPµ dependent signalling in response to cell-cell adhesions (Mourton et al., 2001). It is also proposed that PTPµ and Src bind RACK1 in a mutually exclusive manner. Since several proteins that interact with RACK1 (reviewed in McCahill et al., 2002) such as Src, PTPµ, PKC, SHP2 and p85 are also known to regulate integrin and IGF-1R signalling it is likely that competition for interaction of these with proteins with RACK1 controls cell survival, adhesion and motility. Thus, RACK1 could serve as a focal point for the integration of IGF-1R and integrin signalling. Other RACK1 interacting proteins may have a role in IGF-1R signalling. Increasing evidence suggests that RACK1 also plays a role in regulation of several cell receptors. RACK1 was found to be constitutively associated with the cytoplasmic domain of IFN-αRβL receptor chain (Croze et al., 2000; Usacheva et al., 2001). RACK1 interaction with the interferon (IFN) receptor is important for STAT1 activation. This interaction also suggests a possible method where PKC activated by other methods may sequester to the IFN receptor. RACK1 has also been demonstrated to interact with another cytokine receptor subunit, the common β chain of the IL-5/IL-3 and GM-CSF receptor (Geijsen et al., 1999). This was also found to be a constitutive association as the authors demonstrated no alteration in the interaction upon cellular stimulation. Recently Yaka et al have identified RACK1 as a scaffolding protein for Fyn kinase and the NR2B subunit of the NMDA receptor (Yaka et al., 2002). Here, RACK1 plays an inhibitory role regulating Fyn and NMDA receptor channels. RACK1 also interacts specifically with PDE4D5 (Steele et al., 2001; Yarwood et al., 1999), phospholipase Cγ, (Disatnik et al., 1994) and viral proteins of influenza A, Epstein-Barr and HIV-1 (Gallina et al., 2001; Smith et al., 2000). Rodriguez et al (Rodriguez et al., 1999), also identified RACK1 as an adaptor protein that binds the pleckstrin homology domains of dynamin-1.

11.

Role of the IGF-1 receptor C terminus as a regulator of receptor function

The C terminus of the IGF-1R shares only 44% homology with the IR and contains within it several unique tyrosines and serines. For this reason it has received a lot of attention as a potential domain within the IGF-1R that could


71

mediate functions or signalling responses that are not shared with the IR. Many studies on C-terminal deletion and point mutant IGF-1Rs indicated that this domain has a particular function in the transforming, anti-apoptotic, and metastasis promoting functions of the IGF-1R (Baserga et al., 1994; LeRoith et al., 1995; Surmacz et al., 1995; Baserga et al., 1997b; O'Connor et al., 1997; Brodt et al., 2001). When an IGF-IR with the C-terminus deleted at residue 1229 (d1229) was introduced into R- cells, these cells lost the ability to form colonies in agarose relative to wild-type (WT) IGF-IR, but retained a full mitogenic response to IGF-I stimulation (Surmacz et al., 1995). Interestingly this receptor also maintained antiapoptotic activity. Two tyrosine residues at positions 1250 and 1251 have been particularly intriguing because mutation on these tyrosines to phenylalanine is sufficient to abrogate the transforming, and anti-apoptotic activity as well as disrupt cytoskeleton architecture and suppress metastasis promotion by the receptor (Blakesley et al., 1998; Brodt et al., 2001). A similar phenotype is observed when the two amino acid residues at H1293/L1294 that are not conserved in the equivalent positions in the insulin receptor are mutated. These IGF-IR point mutations retained the capacity for cell growth, which suggests that different signals are necessary for mitogenesis than form suppression of apoptosis and transformation. Four unique serines S1280-S1283 have been analysed for function by mutating them to alanine, but this did not affect IGF-1R-mediated mitogenicity in mouse embryonic fibroblasts, although this mutant lost the ability to transform cells (Li et al., 1996). Serine 1283 has been found to bind to isoforms of the 14.3.3 protein (Furlanetto et al., 1997) and these serines are required for the mitochondrial translocation of Raf-1. Serine 1272 has also been reported to interact with 14.3.3 proteins (Craparo et al., 1997). Mutation of this serine residue along with serine 1278 was found to completely reverse the inhibitory effect of the four-serine mutation, on the translocation of Raf-1. This mutation also restored the ability to induce IGF-I mediated differentiation in 32D cells (Peruzzi et al., 2001). From these studies it is clear that serine residues as well as tyrosine residues in the C-terminus of the IGF-IR may play a role in mediating IGF-IR function. Many of our studies on the IGF-1R C terminus have raised the question how can an IGF-1R mutant that has the entire C terminus removed mediate anti-apoptotic activity apoptosis and mitogenesis, but point mutations within the C terminus cause abrogation of anti-apoptotic activity? One suggestion is that the C terminus acts as a regulatory domain and is involved in mediating both positive and negative signals. Indeed, we have shown that ectopic expression of the C terminal domain is inhibitory to tumour cell survival and attachment (Liu et al., 1998). Despite these observations the mechanism of action of the C terminus as a regulatory domain has been elusive. There are no known binding partners for the tyrosines at 1250/1251 or for his1293/lys1294, and signalling pathways that these domains might regulate have not been elucidated. However, our recent findings, which show that the negative regulatory adapter protein RACK1 interacts with the IGF-1R and that this

72


interaction is lost when serine 1248 is mutated to alanine, may provide a handle on the C terminus regulatory function. Serine 1248 is adjacent to tyrosine 1250/1251 and may form part of a consensus sequence for a RACK1 binding site that encompasses tyrosines 1250 and 1251. Interestingly, mutation of serine 1252 does not affect RACK interaction with the receptor, which suggests that the requirement for serine 1248 is specific. Does RACK1 regulate the positive and negative signalling effects that are apparently associated with the IGF-1R C terminus? These studies are underway, but it appears that RACK1 is a good candidate for this function because it can modulate IGF-1R mediated anti-apoptotic activity, motility, and integrin signalling. These functions are disrupted in the tyrosine 1250/1251 mutant IGF-1R.

12.

The IGF-1 receptor and cancer

Since the IGF system is intricately linked with cell growth and homeostasis, it is not surprising that aberrations in the IGF-1 system might be involved in cancer development and progression. Elevated serum levels of IGF-1 and IGF-2 with concomitant increased receptor activation identifies individuals at higher risk of developing breast, prostate, lung, bladder and colon cancer and also predicts a poor prognosis for cancer patients (Chan et al., 1998b; Dunn et al., 1998; Hankinson et al., 1998; Mauro et al., 2001; Vorwerk et al., 2002; Wu et al., 2002; Zhao et al., 2003). Along with elevated IGF-1, IGF-2 and IGF-1R levels other components of the IGF system including IRS-1 and IRS-2 are also aberrantly expressed in many tumours and lymphoblastic leukaemias (Lee et al., 1999; Jackson et al., 2001; Lopez and Hanahan, 2002; Vorwerk et al., 2002). Interactions between IGF ligands and receptors are influenced by IGFBPs which act by modulating the availability of unbound IGF-1, inhibiting IGF action in vitro and inducing apoptosis often in an IGF independent manner. In addition to higher levels of IGF-1, lower levels of IGFBP-3 are also associated with an increased risk of cancer development (McGuire et al., 1992; Karas et al., 1997; Yu and Rohan, 2000; Lukanova et al., 2001; Parker et al., 2002; Zhao et al., 2003). Overexpression of the IGF-1R does not result in autonomous receptor signalling in the absense of IGF ligand (Kaleko et al., 1990). Indeed, IGF-1R can induce malignant transformation only in the presence of ligand (Kaleko et al., 1990). Autocrine, paracrine and endocrine IGF-1 production have been documented to enhance tumour growth. Mice with low circulating levels of IGF are unable to support maximal tumour growth (Yang et al., 1996). Injection of IGF-1 in mice increased both cecum tumour growth and liver tumour metastasis, suggesting a clear role for circulating IGF-1 levels in tumour growth and development (Wu et al., 2002). However, in liver specific IGF-1 deficient (LID) mice that demonstrate significantly lowered circulating IGF-1 levels, fewer tumours developed and those tumours that did were significantly smaller than those of control mice (Wu et al.,


73

2002). Many recent studies have implicated enhanced IGF system function with tumour cell invasion and metastasis. IGF-1 has also been reported to regulate tumour invasion. In one report IGF-1 increased synthesis and activation of MMP-2, an extracellular matrix degrading proteinase through a PI-3 kinase dependent signalling pathway (Zhang and Brodt, 2003). In the Rip Tag mouse model for tumour development and progression, SV40 T antigen oncoproteins were expressed in the beta cells of the pancreatic islets under the control of the rat insulin promoter. The resulting overexpression of the IGF-1R caused de novo development of highly invasive and metastatic pancreatic tumours (Lopez and Hanahan, 2002). The IGF1R has also been shown to be upregulated at the protein and mRNA level in primary prostate cancer when compared with benign prostatic epithelium (Hellawell et al., 2002). The IGF-1R is also overexpressed in many other types of cancer including breast, medulloblastomas, pancreatic, colon and renal cell carcinomas (Del Valle et al., 2002; Lopez and Hanahan, 2002; Parker et al., 2002; Weber et al., 2002; Mauro et al., 2003). The IGF-1R promoter is regulated by negative modulators of cellular proliferation known as tumour suppressors, examples include p53, the Wilm’s tumour suppressor (WT1) and BRCA1 (Karnieli et al., 1996; Werner et al., 1996; Ohlsson et al., 1998; Maor et al., 2000). Mutations in tumour suppressor genes like p53 disrupt growth factor receptor levels and contribute to a transformed phenotype. Many oncogenes such as viral products and c-myb have also been shown to exert their effect by stimulating expression of the IGF-1R (Reiss et al., 1991; Kim et al., 1996). Regulation of IGF-pathways by estrogen induces increased expression of IGF-1R, IRS-1 and IRS-2. High IRS-1 expression is an indicator of early disease recurrence in estrogen-positive human primary breast tumours (Lee et al., 1999). Recently significant attention has been given to the development of specific antiIGF therapies for treatment of IGF-sensitive cancers. Antisense oligodeoxynucleotides against IGF-1R have been evaluated as potential anti tumour agents. In clinical trials improvements were noted in patients suffering from malignant astrocytoma, following ex-vivo treatment of glioma cells with antisense nucleotide prior to re-implantation (Andrews et al., 2001). Use of antisense RNA and DNA in rat glioma cells produced similar effects. Injection of gliomablastoma cells into immunocompetent rats induced rapid tumour development but injection of glioma cells in combination with antisense nucleotide proved to be non-tumorigenic (Trojan et al., 1992; Resnicoff et al., 1994b). Furthermore growth of human melanoma cells in nude mice was also strongly inhibited by antisense strategies (Resnicoff et al., 1994a). A dominant negative mutant of IGF-1R has been shown to inhibit cell adhesion and invasion in MDA-MB-435 breast cancer cells and significantly decrease metastasis to the lungs, liver and lymph glands when injected into the mammary fat pad of mice (Dunn et al., 1998). It is possible that the IGFBPs mentioned earlier could be further developed to neutralise IGF action in clinical situations.

74


Recombinant antibodies and a group of synthetic protein tyrosine kinase inhibitors called tyrphostins are also being investigated for potential development in anti-IGF1R therapies (Parrizas et al., 1997; Blum et al., 2000; Sachdev et al., 2003). However, as yet tyrphostins can not discriminately inhibit between the IGF-1R and the insulin receptor which have 60% homology but may be useful lead compounds for design and synthesis of future IGF-1R specific small molecule inhibitors. Finally, methods that exploit a mechanism known as RNA interference may prove useful in switching off genes in a wide range of diseases including IGFresponsive cancers. Short interfering RNA or siRNA is an RNA-mediated sequence specific gene silencing mechanism where the double stranded RNA induces homology dependent degradation of cognate mRNA (Elbashir et al., 2001). With the development of new vectors for efficient siRNA delivery into mammalian cells (Shen et al., 2003), production of dysregulated IGF system proteins may be able to be specifically blocked. siRNA and anti-sense cDNA against IGF have been shown to suppress the malignant phenotype in human leukaemia and breast cancer cell lines (Tuynder et al., 2002). Specific siRNA inhibition of PI-3 kinase, a major mediator of the IGF system, has resulted in inhibition of invasive cell growth in vitro and in a tumour model system (Czauderna et al., 2003). In a paper due to be published shortly, Bohula et al., have demonstrated that the ability of siRNA’s to block IGF1R expression correlates with the accessibility of the target sequence within the secondary structure of the transcript mRNA. This method also shows greatly increased specificity for IGF-1R than previous antisense methods (Bohula et al., 2003). The role survival signals play in inhibiting translation of cytotoxin-induced injury into apoptotic signals is being widely recognised. Indeed, IGF-1 exerts an anti-apoptotic signal which protects many cell types from apoptosis. The IGF-1responsive MCF-7 breast cancer cell line is resistant to the apoptosis inducing chemotherapeutic drugs doxorubicin and paclitaxel. PI-3 kinase is required for this IGF-1 mediated protection from apoptosis (Gooch et al., 1999). Selective IGF or PI3 kinase targeted therapies may in the future be used as anti-cancer therapies alone or in conjunction with traditional chemotherapeutic regimens to render survival factor dependent cancer more susceptible to chemotherapy-induced apoptosis. This approach is already being successfully investigated in other types of cancer. Bcr-Abl chromosomal translocation is the hallmark of chronic myeloid leukaemia. The c-Abl tyrosine kinase inhibitor STI571 (also known as CGP 57148) prevents Bcr-Abl mediated transformation both in vitro and in vivo and is now showing promise in clinical trials (Carroll et al., 1997; le Coutre et al., 1999).


75

Summary

The suppression of apoptosis by the IGF system is critical for normal cell development, proliferation, differentiation and motility. Aberrations in IGF signalling mechanisms contribute to cell transformation, tumour progression and metastasis. Many questions remain to be answered as to how exactly the IGF system mediates its effects both in normal and tumour cells and how the IGF-1R interacting proteins and downstream signalling cascades are regulated. The importance of the IGF system is underscored by the significant interest in the development of anti-IGF therapies for IGF sensitive cancers. Future developments in cancer therapy are likely to focus on methods to target these therapies to diseased but not normal cells.

14.

Acknowledgements

We would like to thank Kurt Tidmore for preparing the illustrations. The Health Research Board of Ireland and Science Foundation Ireland are grateful acknowledged for funding.

15.

References

Adamo M., Roberts C. T., Jr. and LeRoith D. (1992) How distinct are the insulin and insulinlike growth factor I signalling systems? Biofactors 3, 151-7. Adams T. E., Epa V. C., Garrett T. P. and Ward C. W. (2000) Structure and function of the type 1 insulin-like growth factor receptor. Cell Mol Life Sci 57, 1050-93. Adler V., Polotskaya A., Wagner F. and Kraft A. S. (1992) Affinity-purified c-Jun aminoterminal protein kinase requires serine/threonine phosphorylation for activity. J Biol Chem 267, 17001-5. Alessi D. R., James S. R., Downes C. P., Holmes A. B., Gaffney P. R., Reese C. B. and Cohen P. (1997) Characterization of a 3-phosphoinositide-dependent protein kinase which phosphorylates and activates protein kinase Balpha. Curr Biol 7, 261-9. Allan G. J., Flint D. J. and Patel K. (2001) Insulin-like growth factor axis during embryonic development. Reproduction 122, 31-9. Almeida E. A., Ilic D., Han Q., Hauck C. R., Jin F., Kawakatsu H., Schlaepfer D. D. and Damsky C. H. (2000) Matrix survival signaling: from fibronectin via focal adhesion kinase to c-Jun NH(2)-terminal kinase. J Cell Biol 149, 741-54. Andrews D. W., Resnicoff M., Flanders A. E., Kenyon L., Curtis M., Merli G., Baserga R., Iliakis G. and Aiken R. D. (2001) Results of a pilot study involving the use of an antisense oligodeoxynucleotide directed against the insulin-like growth factor type I receptor in malignant astrocytomas. J Clin Oncol 19, 2189-200. Arbet-Engels C., Tartare-Deckert S. and Eckhart W. (1999) C-terminal Src kinase associates with ligand-stimulated insulin-like growth factor-I receptor. J Biol Chem 274, 5422-8. Bailyes E. M., Nave B. T., Soos M. A., Orr S. R., Hayward A. C. and Siddle K. (1997) Insulin receptor/IGF-I receptor hybrids are widely distributed in mammalian tissues: quantification of individual receptor species by selective immunoprecipitation and immunoblotting. Biochem J 327, 209-15.

76


Baker J., Liu J. P., Robertson E. J. and Efstratiadis A. (1993) Role of insulin-like growth factors in embryonic and postnatal growth. Cell 75, 73-82. Bandyopadhyay D., Kusari A., Kenner K. A., Liu F., Chernoff J., Gustafson T. A. and Kusari J. (1997) Protein-tyrosine phosphatase 1B complexes with the insulin receptor in vivo and is tyrosine-phosphorylated in the presence of insulin. J Biol Chem 272, 1639-45. Baserga R., Hongo A., Rubini M., Prisco M. and Valentinis B. (1997a) The IGF-I receptor in cell growth, transformation and apoptosis. Biochim Biophys Acta 1332, F105-26. Baserga R., Resnicoff M., D'Ambrosio C. and Valentinis B. (1997b) The role of the IGF-I receptor in apoptosis. Vitam Horm 53, 65-98. Baserga R. and Rubin R. (1993) Cell cycle and growth control. Crit Rev Eukaryot Gene Expr 3, 47-61. Baserga R., Sell C., Porcu P. and Rubini M. (1994) The role of the IGF-I receptor in the growth and transformation of mammalian cells. Cell Prolif 27, 63-71. Battaini F., Pascale A., Lucchi L., Pasinetti G. M. and Govoni S. (1999) Protein kinase C anchoring deficit in postmortem brains of Alzheimer's disease patients. Exp Neurol 159, 559-64. Beitner-Johnson D. and LeRoith D. (1995) Insulin-like growth factor-I stimulates tyrosine phosphorylation of endogenous c-Crk. J Biol Chem 270, 5187-90. Beitner-Johnson D., Werner H., Roberts C. T., Jr. and LeRoith D. (1995) Regulation of insulin-like growth factor I receptor gene expression by Sp1: physical and functional interactions of Sp1 at GC boxes and at a CT element. Mol Endocrinol 9, 1147-56. Belletti B., Drakas R., Morrione A., Tu X., Prisco M., Yuan T., Casaburi I. and Baserga R. (2002) Regulation of Id1 protein expression in mouse embryo fibroblasts by the type 1 insulin-like growth factor receptor. Exp Cell Res 277, 107-18. Berns H., Humar R., Hengerer B., Kiefer F. N. and Battegay E. J. (2000) RACK1 is upregulated in angiogenesis and human carcinomas. Faseb J 14, 2549-58. Blakesley V. A., Koval A. P., Stannard B. S., Scrimgeour A. and LeRoith D. (1998) Replacement of tyrosine 1251 in the carboxyl terminus of the insulin- like growth factor-I receptor disrupts the actin cytoskeleton and inhibits proliferation and anchorageindependent growth. J Biol Chem 273, 18411-22. Blum G., Gazit A. and Levitzki A. (2000) Substrate competitive inhibitors of IGF-1 receptor kinase. Biochemistry 39, 15705-12. Bohula E. A., Salisbury A. J., Sohail M., Playford M. P., Riedemann J., Southern E. M. and Macaulay V. M. (2003) The efficacy of small interfering RNAs targeted to the type 1 IGF receptor is influenced by secondary structure in the IGF1R transcript. J Biol Chem 24, 24. Boney C. M., Gruppuso P. A., Faris R. A. and Frackelton A. R., Jr. (2000) The critical role of Shc in insulin-like growth factor-I-mediated mitogenesis and differentiation in 3T3-L1 preadipocytes. Mol Endocrinol 14, 805-13. Bonfini L., Migliaccio E., Pelicci G., Lanfrancone L. and Pelicci P. G. (1996) Not all Shc's roads lead to Ras. Trends Biochem Sci 21, 257-61. Bonni A. B., A. West,A.E. Datta,S.R. Takasu,M.A. Greenberg,M.E. (1999) Cell Survival Promoted by the Transcription-Dependant and -Independant Mechanisms. SCIENCE 286, 13581362. Brodt P., Fallavollita L., Khatib A. M., Samani A. A. and Zhang D. (2001) Cooperative regulation of the invasive and metastatic phenotypes by different domains of the type I insulin-like growth factor receptor beta subunit. J Biol Chem 276, 33608-15. Brodt P., Samani A. and Navab R. (2000) Inhibition of the type I insulin-like growth factor receptor expression and signaling: novel strategies for antimetastatic therapy. Biochem Pharmacol 60, 1101-7.


77

Brunet A., Bonni A., Zigmond M. J., Lin M. Z., Juo P., Hu L. S., Anderson M. J., Arden K. C., Blenis J. and Greenberg M. E. (1999) Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell 96, 857-68. Buckley D. A., Cheng A., Kiely P. A., Tremblay M. L. and O'Connor R. (2002) Regulation of insulin-like growth factor type I (IGF-I) receptor kinase activity by protein tyrosine phosphatase 1B (PTP-1B) and enhanced IGF-I- mediated suppression of apoptosis and motility in PTP-1B-deficient fibroblasts. Mol Cell Biol 22, 1998-2010. Burgess W., Jesse K., Tang Q., Broussard S. R., Dantzer R. and Kelley K. W. (2003) Insulinlike growth factor-I and the cytokines IL-3 and IL-4 promote survival of progenitor myeloid cells by different mechanisms. J Neuroimmunol 135, 82-90. Butler A. A., Yakar S., Gewolb I. H., Karas M., Okubo Y. and LeRoith D. (1998) Insulin-like growth factor-I receptor signal transduction: at the interface between physiology and cell biology. Comp Biochem Physiol B Biochem Mol Biol 121, 19-26. Campisi J. and Pardee A. B. (1984) Post-transcriptional control of the onset of DNA synthesis by an insulin-like growth factor. Mol Cell Biol 4, 1807-14. Carroll M., Ohno-Jones S., Tamura S., Buchdunger E., Zimmermann J., Lydon N. B., Gilliland D. G. and Druker B. J. (1997) CGP 57148, a tyrosine kinase inhibitor, inhibits the growth of cells expressing BCR-ABL, TEL-ABL, and TEL-PDGFR fusion proteins. Blood 90, 4947-52. Casamassima A. and Rozengurt E. (1998) Insulin-like growth factor I stimulates tyrosine phosphorylation of p130(Cas), focal adhesion kinase, and paxillin. Role of phosphatidylinositol 3'-kinase and formation of a p130(Cas).Crk complex. J Biol Chem 273, 26149-56. Chan A. Y., Raft S., Bailly M., Wyckoff J. B., Segall J. E. and Condeelis J. S. (1998a) EGF stimulates an increase in actin nucleation and filament number at the leading edge of the lamellipod in mammary adenocarcinoma cells. J Cell Sci 111, 199-211. Chan J. M., Stampfer M. J., Giovannucci E., Gann P. H., Ma J., Wilkinson P., Hennekens C. H. and Pollak M. (1998b) Plasma insulin-like growth factor-I and prostate cancer risk: a prospective study. Science 279, 563-6. Chan J. M., Stampfer M. J., Ma J., Gann P., Gaziano J. M., Pollak M. and Giovannucci E. (2002) Insulin-like growth factor-I (IGF-I) and IGF binding protein-3 as predictors of advanced-stage prostate cancer. J Natl Cancer Inst 94, 1099-106. Chang B. Y., Chiang M. and Cartwright C. A. (2001) The interaction of Src and RACK1 is enhanced by activation of protein kinase C and tyrosine phosphorylation of RACK1. J Biol Chem 276, 20346-56. Chang B. Y., Conroy K. B., Machleder E. M. and Cartwright C. A. (1998) RACK1, a receptor for activated C kinase and a homolog of the beta subunit of G proteins, inhibits activity of src tyrosine kinases and growth of NIH 3T3 cells. Mol Cell Biol 18, 3245-56. Chang B. Y., Harte R. A. and Cartwright C. A. (2002) RACK1: a novel substrate for the Src protein-tyrosine kinase. Oncogene 21, 7619-29. Chang B. Y., Harte R. A. and Cartwright C. A. (2003) RACK1: a novel substrate for the Src protein-tyrosine kinase. Oncogene 22, 1748. Chang L. and Karin M. (2001) Mammalian MAP kinase signalling cascades. Nature 410, 3740. Chen J. L., R. (1995) Interactions between the Gs/ protein kinase A and the Ras/MAP-kinase signalling pathways. Biochemical Society Transactions 23, 129-133. Cheng A., Bal G. S., Kennedy B. P. and Tremblay M. L. (2001) Attenuation of adhesiondependent signaling and cell spreading in transformed fibroblasts lacking protein tyrosine phosphatase-1B. J Biol Chem 276, 25848-55.

78


Cheng H. L., Steinway M. L., Russell J. W. and Feldman E. L. (2000) GTPases and phosphatidylinositol 3-kinase are critical for insulin-like growth factor-I-mediated Schwann cell motility. J Biol Chem 275, 27197-204. Coppola D., Ferber A., Miura M., Sell C., D'Ambrosio C., Rubin R. and Baserga R. (1994) A functional insulin-like growth factor I receptor is required for the mitogenic and transforming activities of the epidermal growth factor receptor. Mol Cell Biol 14, 4588-95. Coverley J. A. and Baxter R. C. (1997) Phosphorylation of insulin-like growth factor binding proteins. Mol Cell Endocrinol 128, 1-5. Cox E. A., Bennin D., Doan A. T., O'Toole T. and Huttenlocher A. (2003) RACK1 Regulates Integrin-mediated Adhesion, Protrusion, and Chemotactic Cell Migration via Its Srcbinding Site. Mol Biol Cell 14, 658-69. Craparo A., Freund R. and Gustafson T. A. (1997) 14-3-3 (epsilon) interacts with the insulinlike growth factor I receptor and insulin receptor substrate I in a phosphoserine-dependent manner. J Biol Chem 272, 11663-9. Croze E., Usacheva A., Asarnow D., Minshall R. D., Perez H. D. and Colamonici O. (2000) Receptor for activated C-kinase (RACK-1), a WD motif-containing protein, specifically associates with the human type I IFN receptor. J Immunol 165, 5127-32. Czauderna F., Fechtner M., Aygun H., Arnold W., Klippel A., Giese K. and Kaufmann J. (2003) Functional studies of the PI(3)-kinase signalling pathway employing synthetic and expressed siRNA. Nucleic Acids Res 31, 670-82. Datta S. R., Brunet A. and Greenberg M. E. (1999) Cellular survival: a play in three Akts. Genes Dev 13, 2905-27. Davis R. J. (2000) Signal transduction by the JNK group of MAP kinases. Cell 103, 239-52. DeAngelis T., Ferber A. and Baserga R. (1995) Insulin-like growth factor I receptor is required for the mitogenic and transforming activities of the platelet-derived growth factor receptor. J Cell Physiol 164, 214-21. Del Valle L., Enam S., Lassak A., Wang J. Y., Croul S., Khalili K. and Reiss K. (2002) Insulin-like growth factor I receptor activity in human medulloblastomas. Clin Cancer Res 8, 1822-30. Devedjian J. C., George M., Casellas A., Pujol A., Visa J., Pelegrin M., Gros L. and Bosch F. (2000) Transgenic mice overexpressing insulin-like growth factor-II in beta cells develop type 2 diabetes. J Clin Invest 105, 731-40. DiFalco M. R., Ali S. and Congote L. F. (2003) The improved survival of hematopoietic cells cultured with a fusion protein of insulin-like growth factor II (IGF-II) and interleukin 3 (IL- 3) is associated with increases in Bcl-xL and phosphatidylinositol-3 kinase activity. J Leukoc Biol 73, 297-305. Disatnik M. H., Hernandez-Sotomayor S. M., Jones G., Carpenter G. and Mochly-Rosen D. (1994) Phospholipase C-gamma 1 binding to intracellular receptors for activated protein kinase C. Proc Natl Acad Sci U S A 91, 559-63. Dudek H., Datta S. R., Franke T. F., Birnbaum M. J., Yao R., Cooper G. M., Segal R. A., Kaplan D. R. and Greenberg M. E. (1997) Regulation of neuronal survival by the serinethreonine protein kinase Akt. Science 275, 661-5. Dufourny B., Alblas J., van Teeffelen H. A., van Schaik F. M., van der Burg B., Steenbergh P. H. and Sussenbach J. S. (1997) Mitogenic signaling of insulin-like growth factor I in MCF-7 human breast cancer cells requires phosphatidylinositol 3-kinase and is independent of mitogen-activated protein kinase. J Biol Chem 272, 31163-71. Dunn S. E., Ehrlich M., Sharp N. J., Reiss K., Solomon G., Hawkins R., Baserga R. and Barrett J. C. (1998) A dominant negative mutant of the insulin-like growth factor-I receptor inhibits the adhesion, invasion, and metastasis of breast cancer. Cancer Res 58, 3353-61.


79

Dupont J., Khan J., Qu B. H., Metzler P., Helman L. and LeRoith D. (2001) Insulin and IGF-1 induce different patterns of gene expression in mouse fibroblast NIH-3T3 cells: identification by cDNA microarray analysis. Endocrinology 142, 4969-75. Elbashir S. M., Harborth J., Lendeckel W., Yalcin A., Weber K. and Tuschl T. (2001) Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411, 494-8. Evan A. P., Henry D. P., Connors B. A., Summerlin P. and Lee W. H. (1995) Analysis of insulin-like growth factors (IGF)-I, and -II, type II IGF receptor and IGF-binding protein-2 mRNA and peptide levels in normal and nephrectomized rat kidney. Kidney Int 48, 151729. Evans J. D., Eggo M. C., Donovan I. A., Bramhall S. R. and Neoptolemos J. P. (1997) Serum levels of insulin-like growth factors (IGF-I and IGF-II) and their binding protein (IGFBP3) are not elevated in pancreatic cancer. Int J Pancreatol 22, 95-100. Evans S. W., Rennick D. and Farrar W. L. (1987) Identification of a signal-transduction pathway shared by haematopoietic growth factors with diverse biological specificity. Biochem J 244, 683-91. Ewton D. Z., Kansra S., Lim S. and Friedman E. (2002) Insulin-like growth factor-I has a biphasic effect on colon carcinoma cells through transient inactivation of forkhead1, initially mitogenic, then mediating growth arrest and differentiation. Int J Cancer 98, 66573. Fantin V. R., Wang Q., Lienhard G. E. and Keller S. R. (2000) Mice lacking insulin receptor substrate 4 exhibit mild defects in growth, reproduction, and glucose homeostasis. Am J Physiol Endocrinol Metab 278, E127-33. Federici M., Porzio O., Zucaro L., Fusco A., Borboni P., Lauro D. and Sesti G. (1997) Distribution of insulin/insulin-like growth factor-I hybrid receptors in human tissues. Mol Cell Endocrinol 129, 121-6. Feltz S. M., Swanson M. L., Wemmie J. A. and Pessin J. E. (1988) Functional properties of an isolated alpha beta heterodimeric human placenta insulin-like growth factor 1 receptor complex. Biochemistry 27, 3234-42. Fong H. K., Amatruda T. T., 3rd, Birren B. W. and Simon M. I. (1987) Distinct forms of the beta subunit of GTP-binding regulatory proteins identified by molecular cloning. Proc Natl Acad Sci U S A 84, 3792-6. Franke T. F., Yang S. I., Chan T. O., Datta K., Kazlauskas A., Morrison D. K., Kaplan D. R. and Tsichlis P. N. (1995) The protein kinase encoded by the Akt proto-oncogene is a target of the PDGF-activated phosphatidylinositol 3-kinase. Cell 81, 727-36. Frattali A. L. and Pessin J. E. (1993) Relationship between alpha subunit ligand occupancy and beta subunit autophosphorylation in insulin/insulin-like growth factor-1 hybrid receptors. J Biol Chem 268, 7393-400. Friedman E., Hoau Yan W., Levinson D., Connell T. A. and Singh H. (1993) Altered platelet protein kinase C activity in bipolar affective disorder, manic episode. Biol Psychiatry 33, 520-5. Friedman E. and Wang H. Y. (1989) Effect of age on brain cortical protein kinase C and its mediation of 5- hydroxytryptamine release. J Neurochem 52, 187-92. Furlanetto R. W., Dey B. R., Lopaczynski W. and Nissley S. P. (1997) 14-3-3 proteins interact with the insulin-like growth factor receptor but not the insulin receptor. Biochem J 327, 765-71. Gajewski T. F. and Thompson C. B. (1996) Apoptosis meets signal transduction: elimination of a BAD influence. Cell 87, 589-92. Gallina A., Rossi F. and Milanesi G. (2001) Rack1 binds HIV-1 Nef and can act as a Nefprotein kinase C adaptor. Virology 283, 7-18.

80


Geijsen N., Spaargaren M., Raaijmakers J. A., Lammers J. W., Koenderman L. and Coffer P. J. (1999) Association of RACK1 and PKCbeta with the common beta-chain of the IL5/IL-3/GM-CSF receptor. Oncogene 18, 5126-30. Gil E. B., Malone Link E., Liu L. X., Johnson C. D. and Lees J. A. (1999) Regulation of the insulin-like developmental pathway of Caenorhabditis elegans by a homolog of the PTEN tumor suppressor gene. Proc Natl Acad Sci U S A 96, 2925-30. Goldstein B. J., Ahmad F., Ding W., Li P. M. and Zhang W. R. (1998a) Regulation of the insulin signalling pathway by cellular protein- tyrosine phosphatases. Mol Cell Biochem 182, 91-9. Goldstein B. J., Li P. M., Ding W., Ahmad F. and Zhang W. R. (1998b) Regulation of insulin action by protein tyrosine phosphatases. Vitam Horm 54, 67-96. Gooch J. L., Van Den Berg C. L. and Yee D. (1999) Insulin-like growth factor (IGF)-I rescues breast cancer cells from chemotherapy-induced cell death--proliferative and antiapoptotic effects. Breast Cancer Res Treat 56, 1-10. Gottlob K., Majewski N., Kennedy S., Kandel E., Robey R. B. and Hay N. (2001) Inhibition of early apoptotic events by Akt/PKB is dependent on the first committed step of glycolysis and mitochondrial hexokinase. Genes Dev 15, 1406-18. Gross A., McDonnell J. M. and Korsmeyer S. J. (1999) BCL-2 family members and the mitochondria in apoptosis. Genes Dev 13, 1899-911. Gu H., Maeda H., Moon J. J., Lord J. D., Yoakim M., Nelson B. H. and Neel B. G. (2000) New role for Shc in activation of the phosphatidylinositol 3-kinase/Akt pathway. Mol Cell Biol 20, 7109-20. Guillemot F., Billault A. and Auffray C. (1989) Physical linkage of a guanine nucleotidebinding protein-related gene to the chicken major histocompatibility complex. Proc Natl Acad Sci U S A 86, 4594-8. Gustafson T. A., He W., Craparo A., Schaub C. D. and O'Neill T. J. (1995) Phosphotyrosinedependent interaction of SHC and insulin receptor substrate 1 with the NPEY motif of the insulin receptor via a novel non- SH2 domain. Mol Cell Biol 15, 2500-8. Guvakova M. A., Boettiger D. and Adams J. C. (2002) Induction of fascin spikes in breast cancer cells by activation of the insulin-like growth factor-I receptor. Int J Biochem Cell Biol 34, 685-98. Guvakova M. A. and Surmacz E. (1999) The activated insulin-like growth factor I receptor induces depolarization in breast epithelial cells characterized by actin filament disassembly and tyrosine dephosphorylation of FAK, Cas, and paxillin. Exp Cell Res 251, 244-55. Hanahan D. (1985) Heritable formation of pancreatic beta-cell tumours in transgenic mice expressing recombinant insulin/simian virus 40 oncogenes. Nature 315, 115-22. Hankinson S. E., Willett W. C., Colditz G. A., Hunter D. J., Michaud D. S., Deroo B., Rosner B., Speizer F. E. and Pollak M. (1998) Circulating concentrations of insulin-like growth factor-I and risk of breast cancer. Lancet 351, 1393-6. Hanks S. K., Quinn A. M. and Hunter T. (1988) The protein kinase family: conserved features and deduced phylogeny of the catalytic domains. Science 241, 42-52. Harper S. J. and LoGrasso P. (2001) Signalling for survival and death in neurones: the role of stress- activated kinases, JNK and p38. Cell Signal 13, 299-310. Harrington E. A., Bennett M. R., Fanidi A. and Evan G. I. (1994) c-Myc-induced apoptosis in fibroblasts is inhibited by specific cytokines. Embo J 13, 3286-95. He W., Craparo A., Zhu Y., O'Neill T. J., Wang L. M., Pierce J. H. and Gustafson T. A. (1996) Interaction of insulin receptor substrate-2 (IRS-2) with the insulin and insulin-like growth factor I receptors. Evidence for two distinct phosphotyrosine-dependent interaction domains within IRS-2. J Biol Chem 271, 11641-5.


81

Hellawell G. O., Turner G. D., Davies D. R., Poulsom R., Brewster S. F. and Macaulay V. M. (2002) Expression of the type 1 insulin-like growth factor receptor is upregulated in primary prostate cancer and commonly persists in metastatic disease. Cancer Res 62, 2942-50. Hellberg C. B., Burden-Gulley S. M., Pietz G. E. and Brady-Kalnay S. M. (2002) Expression of the receptor protein-tyrosine phosphatase, PTPmu, restores E-cadherin-dependent adhesion in human prostate carcinoma cells. J Biol Chem 277, 11165-73. Hermanto U., Zong C. S., Li W. and Wang L. H. (2002) RACK1, an insulin-like growth factor I (IGF-I) receptor-interacting protein, modulates IGF-I-dependent integrin signaling and promotes cell spreading and contact with extracellular matrix. Mol Cell Biol 22, 234565. Heron-Milhavet L., Karas M., Goldsmith C. M., Baum B. J. and LeRoith D. (2001) Insulinlike growth factor-I (IGF-I) receptor activation rescues UV- damaged cells through a p38 signaling pathway. Potential role of the IGF-I receptor in DNA repair. J Biol Chem 276, 18185-92. Hess P., Pihan G., Sawyers C. L., Flavell R. A. and Davis R. J. (2002) Survival signaling mediated by c-Jun NH(2)-terminal kinase in transformed B lymphoblasts. Nat Genet 32, 201-5. Holzenberger M., Dupont J., Ducos B., Leneuve P., Geloen A., Even P. C., Cervera P. and Le Bouc Y. (2003) IGF-1 receptor regulates lifespan and resistance to oxidative stress in mice. Nature 421, 182-7. Hongo A., D'Ambrosio C., Miura M., Morrione A. and Baserga R. (1996) Mutational analysis of the mitogenic and transforming activities of the insulin-like growth factor I receptor. Oncogene 12, 1231-8. Hongo A., Yumet G., Resnicoff M., Romano G., O'Connor R. and Baserga R. (1998) Inhibition of tumorigenesis and induction of apoptosis in human tumor cells by the stable expression of a myristylated COOH terminus of the insulin-like growth factor I receptor. Cancer Res 58, 2477-84. Hoyne P. A., Elleman T. C., Adams T. E., Richards K. M. and Ward C. W. (2000) Properties of an insulin receptor with an IGF-1 receptor loop exchange in the cysteine-rich region. FEBS Lett 469, 57-60. Huang J. and Kontos C. D. (2002) PTEN modulates vascular endothelial growth factormediated signaling and angiogenic effects. J Biol Chem 277, 10760-6. Hubbard S. R. (1999) Structural analysis of receptor tyrosine kinases. Prog Biophys Mol Biol 71, 343-58. Hubbard S. R., Mohammadi M. and Schlessinger J. (1998) Autoregulatory mechanisms in protein-tyrosine kinases. J Biol Chem 273, 11987-90. Huff K. K., Kaufman D., Gabbay K. H., Spencer E. M., Lippman M. E. and Dickson R. B. (1986) Secretion of an insulin-like growth factor-I-related protein by human breast cancer cells. Cancer Res 46, 4613-9. Hunter T. (2000) Signaling--2000 and beyond. Cell 100, 113-27. Hwa V., Oh Y. and Rosenfeld R. G. (1999) The insulin-like growth factor-binding protein (IGFBP) superfamily. Endocr Rev 20, 761-87. Jackson J. G., Zhang X., Yoneda T. and Yee D. (2001) Regulation of breast cancer cell motility by insulin receptor substrate- 2 (IRS-2) in metastatic variants of human breast cancer cell lines. Oncogene 20, 7318-25. James P. L., Jones S. B., Busby W. H., Jr., Clemmons D. R. and Rotwein P. (1993) A highly conserved insulin-like growth factor-binding protein (IGFBP-5) is expressed during myoblast differentiation. J Biol Chem 268, 22305-12.

82


Jiang Y., Chan J. L., Zong C. S. and Wang L. H. (1996) Effect of tyrosine mutations on the kinase activity and transforming potential of an oncogenic human insulin-like growth factor I receptor. J Biol Chem 271, 160-7. Jones J. I., D'Ercole A. J., Camacho-Hubner C. and Clemmons D. R. (1991) Phosphorylation of insulin-like growth factor (IGF)-binding protein 1 in cell culture and in vivo: effects on affinity for IGF-I. Proc Natl Acad Sci U S A 88, 7481-5. Jones J. I., Gockerman A., Busby W. H., Jr., Wright G. and Clemmons D. R. (1993) Insulinlike growth factor binding protein 1 stimulates cell migration and binds to the alpha 5 beta 1 integrin by means of its Arg-Gly-Asp sequence. Proc Natl Acad Sci U S A 90, 10553-7. Kadowaki T., Tobe K., Honda-Yamamoto R., Tamemoto H., Kaburagi Y., Momomura K., Ueki K., Takahashi Y., Yamauchi T., Akanuma Y. and Yazaki Y. (1996) Signal transduction mechanism of insulin and insulin-like growth factor- 1. Endocr J 43 Suppl, S33-41. Kaleko M., Rutter W. J. and Miller A. D. (1990) Overexpression of the human insulinlike growth factor I receptor promotes ligand-dependent neoplastic transformation. Mol Cell Biol 10, 464-73. Kanter-Lewensohn L., Dricu A., Girnita L., Wejde J. and Larsson O. (2000) Expression of insulin-like growth factor-1 receptor (IGF-1R) and p27Kip1 in melanocytic tumors: a potential regulatory role of IGF-1 pathway in distribution of p27Kip1 between different cyclins [In Process Citation]. Growth Factors 17, 193-202. Karas M., Danilenko M., Fishman D., LeRoith D., Levy J. and Sharoni Y. (1997) Membraneassociated insulin-like growth factor-binding protein-3 inhibits insulin-like growth factorI-induced insulin-like growth factor-I receptor signaling in ishikawa endometrial cancer cells. J Biol Chem 272, 16514-20. Karas M., Koval A. P., Zick Y. and LeRoith D. (2001) The insulin-like growth factor I receptor-induced interaction of insulin receptor substrate-4 and Crk-II. Endocrinology 142, 1835-40. Karey K. P. and Sirbasku D. A. (1988) Differential responsiveness of human breast cancer cell lines MCF-7 and T47D to growth factors and 17 beta-estradiol. Cancer Res 48, 408392. Karnieli E., Werner H., Rauscher F. J., 3rd, Benjamin L. E. and LeRoith D. (1996) The IGF-I receptor gene promoter is a molecular target for the Ewing's sarcoma-Wilms' tumor 1 fusion protein. J Biol Chem 271, 19304-9. Kasus-Jacobi A., Perdereau D., Tartare-Deckert S., Van Obberghen E., Girard J. and Burnol A. F. (1997) Evidence for a direct interaction between insulin receptor substrate-1 and Shc. J Biol Chem 272, 17166-70. Kato H., Faria T. N., Stannard B., Roberts C. T., Jr. and LeRoith D. (1993) Role of tyrosine kinase activity in signal transduction by the insulin- like growth factor-I (IGF-I) receptor. Characterization of kinase- deficient IGF-I receptors and the action of an IGF-I-mimetic antibody (alpha IR-3). J Biol Chem 268, 2655-61. Kauffmann-Zeh A., Rodriguez-Viciana P., Ulrich E., Gilbert C., Coffer P., Downward J. and Evan G. (1997) Suppression of c-Myc-induced apoptosis by Ras signalling through PI(3)K and PKB. Nature 385, 544-8. Kelley K. M., Oh Y., Gargosky S. E., Gucev Z., Matsumoto T., Hwa V., Ng L., Simpson D. M. and Rosenfeld R. G. (1996) Insulin-like growth factor-binding proteins (IGFBPs) and their regulatory dynamics. Int J Biochem Cell Biol 28, 619-37. Kennedy S. G., Wagner A. J., Conzen S. D., Jordan J., Bellacosa A., Tsichlis P. N. and Hay N. (1997) The PI 3-kinase/Akt signaling pathway delivers an anti-apoptotic signal. Genes Dev 11, 701-13.


83

Kenner K. A., Anyanwu E., Olefsky J. M. and Kusari J. (1996) Protein-tyrosine phosphatase 1B is a negative regulator of insulin- and insulin-like growth factor-I-stimulated signaling. J Biol Chem 271, 19810-6. Kiely P. A., Sant A. and O'Connor R. (2002) RACK1 is an IGF-1 Receptor interacting protein that can regulate IGF-1- mediated Akt activation and protection from cell death. J Biol Chem 8, 6. Kim S. O., Park J. G. and Lee Y. I. (1996) Increased expression of the insulin-like growth factor I (IGF-I) receptor gene in hepatocellular carcinoma cell lines: implications of IGF-I receptor gene activation by hepatitis B virus X gene product. Cancer Res 56, 3831-6. Kimura K. D., Tissenbaum H. A., Liu Y. and Ruvkun G. (1997) daf-2, an insulin receptor-like gene that regulates longevity and diapause in Caenorhabditis elegans. Science 277, 942-6. Klempt N. D., Klempt M., Gunn A. J., Singh K. and Gluckman P. D. (1992) Expression of insulin-like growth factor-binding protein 2 (IGF-BP 2) following transient hypoxiaischemia in the infant rat brain. Brain Res Mol Brain Res 15, 55-61. Korchak H. M. and Kilpatrick L. E. (2001) Roles for beta II-protein kinase C and RACK1 in positive and negative signaling for superoxide anion generation in differentiated HL60 cells. J Biol Chem 276, 8910-7. Krause D., Lyons A., Fennelly C. and O'Connor R. (2001) Transient activation of Jun Nterminal kinases and protection from apoptosis by the insulin-like growth factor I receptor can be suppressed by dicumarol. J Biol Chem 276, 19244-52. Kulik G., Klippel A. and Weber M. J. (1997) Antiapoptotic signalling by the insulin-like growth factor I receptor, phosphatidylinositol 3-kinase, and Akt. Mol Cell Biol 17, 1595606. Lai K. M. and Pawson T. (2000) The ShcA phosphotyrosine docking protein sensitizes cardiovascular signaling in the mouse embryo. Genes Dev 14, 1132-45. Lamothe B., Bucchini D., Jami J. and Joshi R. L. (1995) Interaction of p85 subunit of PI 3kinase with insulin and IGF-1 receptors analysed by using the two-hybrid system. FEBS Lett 373, 51-5. le Coutre P., Mologni L., Cleris L., Marchesi E., Buchdunger E., Giardini R., Formelli F. and Gambacorti-Passerini C. (1999) In vivo eradication of human BCR/ABL-positive leukemia cells with an ABL kinase inhibitor. J Natl Cancer Inst 91, 163-8. Lee A. V., Jackson J. G., Gooch J. L., Hilsenbeck S. G., Coronado-Heinsohn E., Osborne C. K. and Yee D. (1999) Enhancement of insulin-like growth factor signaling in human breast cancer: estrogen regulation of insulin receptor substrate-1 expression in vitro and in vivo. Mol Endocrinol 13, 787-96. Leevers S. J. (2001) Growth control: invertebrate insulin surprises! Curr Biol 11, R209-12. Lehrer S., Diamond E. J., Droller M. J., Stone N. N. and Stock R. G. (2002) Re: Insulin-like growth factor-I (IGF-I) and IGF binding protein-3 as predictors of advanced-stage prostate cancer. J Natl Cancer Inst 94, 1893; author reply 1893-4. Leof E. B., Wharton W., van Wyk J. J. and Pledger W. J. (1982) Epidermal growth factor (EGF) and somatomedin C regulate G1 progression in competent BALB/c-3T3 cells. Exp Cell Res 141, 107-15. LeRoith D., Werner H., Beitner-Johnson D. and Roberts C. T., Jr. (1995) Molecular and cellular aspects of the insulin-like growth factor I receptor. Endocr Rev 16, 143-63. Leslie N. R. and Downes C. P. (2002) PTEN: The down side of PI 3-kinase signalling. Cell Signal 14, 285-95. Li J., Yen C., Liaw D., Podsypanina K., Bose S., Wang S. I., Puc J., Miliaresis C., Rodgers L., McCombie R., Bigner S. H., Giovanella B. C., Ittmann M., Tycko B., Hibshoosh H., Wigler M. H. and Parsons R. (1997) PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science 275, 1943-7.

84


Li S., Resnicoff M. and Baserga R. (1996) Effect of mutations at serines 1280-1283 on the mitogenic and transforming activities of the insulin-like growth factor I receptor. J Biol Chem 271, 12254-60. Ligensa T., Krauss S., Demuth D., Schumacher R., Camonis J., Jaques G. and Weidner K. M. (2001) A PDZ domain protein interacts with the C-terminal tail of the insulin- like growth factor-1 receptor but not with the insulin receptor. J Biol Chem 276, 33419-27. Liliental J. and Chang D. D. (1998) Rack1, a receptor for activated protein kinase C, interacts with integrin beta subunit. J Biol Chem 273, 2379-83. Lin K., Hsin H., Libina N. and Kenyon C. (2001) Regulation of the Caenorhabditis elegans longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nat Genet 28, 139-45. Liu J. P., Baker J., Perkins A. S., Robertson E. J. and Efstratiadis A. (1993) Mice carrying null mutations of the genes encoding insulin-like growth factor I (Igf-1) and type 1 IGF receptor (Igf1r). Cell 75, 59-72. Liu S. C., Wang Q., Lienhard G. E. and Keller S. R. (1999) Insulin receptor substrate 3 is not essential for growth or glucose homeostasis. J Biol Chem 274, 18093-9. Liu Y., Lehar S., Corvi C., Payne G. and O'Connor R. (1998) Expression of the insulin-like growth factor I receptor C terminus as a myristylated protein leads to induction of apoptosis in tumor cells. Cancer Res 58, 570-6. Long E., Huynh H. T. and Zhao X. (1998) Involvement of insulin-like growth factor-1 and its binding proteins in proliferation and differentiation of murine bone marrow-derived macrophage precursors. Endocrine 9, 185-92. Lopez T. and Hanahan D. (2002) Elevated levels of IGF-1 receptor convey invasive and metastatic capability in a mouse model of pancreatic islet tumorigenesis. Cancer Cell 1, 339-53. Lukanova A., Toniolo P., Akhmedkhanov A., Biessy C., Haley N. J., Shore R. E., Riboli E., Rinaldi S. and Kaaks R. (2001) A prospective study of insulin-like growth factor-I, IGFbinding proteins-1, -2 and -3 and lung cancer risk in women. Int J Cancer 92, 888-92. Maehama T. and Dixon J. E. (1998) The tumor suppressor, PTEN/MMAC1, dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5-trisphosphate. J Biol Chem 273, 13375-8. Magee A. I. and Siddle K. (1988) Insulin and IGF-1 receptors contain covalently bound palmitic acid. J Cell Biochem 37, 347-57. Maile L. A. and Clemmons D. R. (2002) The alphaVbeta3 integrin regulates insulin-like growth factor I (IGF-I) receptor phosphorylation by altering the rate of recruitment of the Src- homology 2-containing phosphotyrosine phosphatase-2 to the activated IGF-I receptor. Endocrinology 143, 4259-64. Maile L. A., Imai Y., Clarke J. B. and Clemmons D. R. (2002) Insulin-like growth factor I increases alpha Vbeta 3 affinity by increasing the amount of integrin-associated protein that is associated with non-raft domains of the cellular membrane. J Biol Chem 277, 18005. Manes S., Mira E., Gomez-Mouton C., Zhao Z. J., Lacalle R. A. and Martinez A. C. (1999) Concerted activity of tyrosine phosphatase SHP-2 and focal adhesion kinase in regulation of cell motility. Mol Cell Biol 19, 3125-35. Maor S. B., Abramovitch S., Erdos M. R., Brody L. C. and Werner H. (2000) BRCA1 suppresses insulin-like growth factor-I receptor promoter activity: potential interaction between BRCA1 and Sp1. Mol Genet Metab 69, 130-6. Margolis B., Borg J. P., Straight S. and Meyer D. (1999) The function of PTB domain proteins. Kidney Int 56, 1230-7. Marino-Buslje C., Martin-Martinez M., Mizuguchi K., Siddle K. and Blundell T. L. (1999) The insulin receptor: from protein sequence to structure. Biochem Soc Trans 27, 715-26.


85

Matsuda M., Tanaka S., Nagata S., Kojima A., Kurata T. and Shibuya M. (1992) Two species of human CRK cDNA encode proteins with distinct biological activities. Mol Cell Biol 12, 3482-9. Mauro L., Bartucci M., Morelli C., Ando S. and Surmacz E. (2001) IGF-I receptor-induced cell-cell adhesion of MCF-7 breast cancer cells requires the expression of junction protein ZO-1. J Biol Chem 276, 39892-7. Mauro L., Salerno M., Morelli C., Boterberg T., Bracke M. E. and Surmacz E. (2003) Role of the IGF-I receptor in the regulation of cell-cell adhesion: implications in cancer development and progression. J Cell Physiol 194, 108-16. McCahill A., Warwicker J., Bolger G. B., Houslay M. D. and Yarwood S. J. (2002) The RACK1 scaffold protein: a dynamic cog in cell response mechanisms. Mol Pharmacol 62, 1261-73. McGuire W. L., Jr., Jackson J. G., Figueroa J. A., Shimasaki S., Powell D. R. and Yee D. (1992) Regulation of insulin-like growth factor-binding protein (IGFBP) expression by breast cancer cells: use of IGFBP-1 as an inhibitor of insulin-like growth factor action. J Natl Cancer Inst 84, 1336-41. Merchant M. S., Garvy B. A. and Riley R. L. (1995) B220- bone marrow progenitor cells from New Zealand black autoimmune mice exhibit an age-associated decline in Pre-B and B-cell generation. Blood 85, 1850-7. Mihaylova V. T., Borland C. Z., Manjarrez L., Stern M. J. and Sun H. (1999) The PTEN tumor suppressor homolog in Caenorhabditis elegans regulates longevity and dauer formation in an insulin receptor-like signaling pathway. Proc Natl Acad Sci U S A 96, 7427-32. Miura M., Li S. and Baserga R. (1995a) Effect of a mutation at tyrosine 950 of the insulinlike growth factor I receptor on the growth and transformation of cells. Cancer Res 55, 663-7. Miura M., Surmacz E., Burgaud J. L. and Baserga R. (1995b) Different effects on mitogenesis and transformation of a mutation at tyrosine 1251 of the insulin-like growth factor I receptor. J Biol Chem 270, 22639-44. Mochly-Rosen D., Smith B. L., Chen C. H., Disatnik M. H. and Ron D. (1995) Interaction of protein kinase C with RACK1, a receptor for activated C- kinase: a role in beta protein kinase C mediated signal transduction. Biochem Soc Trans 23, 596-600. Modric T., Rajkumar K. and Murphy L. J. (1999) Thyroid gland function and growth in IGF binding protein-1 transgenic mice. Eur J Endocrinol 141, 149-59. Morrione A., Valentinis B., Resnicoff M., Xu S. and Baserga R. (1997) The role of mGrb10alpha in insulin-like growth factor I-mediated growth. J Biol Chem 272, 26382-7. Mourton T., Hellberg C. B., Burden-Gulley S. M., Hinman J., Rhee A. and Brady-Kalnay S. M. (2001) The PTPmu protein-tyrosine phosphatase binds and recruits the scaffolding protein RACK1 to cell-cell contacts. J Biol Chem 276, 14896-901. Myers M. G., Jr., Backer J. M., Sun X. J., Shoelson S., Hu P., Schlessinger J., Yoakim M., Schaffhausen B. and White M. F. (1992) IRS-1 activates phosphatidylinositol 3'-kinase by associating with src homology 2 domains of p85. Proc Natl Acad Sci U S A 89, 10350-4. Myers M. G., Jr., Sun X. J. and White M. F. (1994) The IRS-1 signaling system. Trends Biochem Sci 19, 289-93. Myers M. G., Jr. and White M. F. (1996) Insulin signal transduction and the IRS proteins. Annu Rev Pharmacol Toxicol 36, 615-58. Myers M. P., Stolarov J. P., Eng C., Li J., Wang S. I., Wigler M. H., Parsons R. and Tonks N. K. (1997) P-TEN, the tumor suppressor from human chromosome 10q23, is a dualspecificity phosphatase. Proc Natl Acad Sci U S A 94, 9052-7.

86


Nakae J., Kido Y. and Accili D. (2001) Distinct and overlapping functions of insulin and IGFI receptors. Endocr Rev 22, 818-35. Nguyen K. T., Wang W. J., Chan J. L. and Wang L. H. (2000) Differential requirements of the MAP kinase and PI3 kinase signaling pathways in Src- versus insulin and IGF-1 receptors-induced growth and transformation of rat intestinal epithelial cells. Oncogene 19, 5385-97. O'Connor R. (1998) Survival factors and apoptosis. Adv Biochem Eng Biotechnol 62, 137-66. O'Connor R., Kauffmann-Zeh A., Liu Y., Lehar S., Evan G. I., Baserga R. and Blattler W. A. (1997) Identification of domains of the insulin-like growth factor I receptor that are required for protection from apoptosis. Mol Cell Biol 17, 427-35. Ohlsson C., Kley N., Werner H. and LeRoith D. (1998) p53 regulates insulin-like growth factor-I (IGF-I) receptor expression and IGF-I-induced tyrosine phosphorylation in an osteosarcoma cell line: interaction between p53 and Sp1. Endocrinology 139, 1101-7. Parker A. S., Cheville J. C., Janney C. A. and Cerhan J. R. (2002) High expression levels of insulin-like growth factor-I receptor predict poor survival among women with clear-cell renal cell carcinomas. Hum Pathol 33, 801-5. Parrizas M., Gazit A., Levitzki A., Wertheimer E. and LeRoith D. (1997) Specific inhibition of insulin-like growth factor-1 and insulin receptor tyrosine kinase activity and biological function by tyrphostins. Endocrinology 138, 1427-33. Pascale A., Fortino I., Govoni S., Trabucchi M., Wetsel W. C. and Battaini F. (1996) Functional impairment in protein kinase C by RACK1 (receptor for activated C kinase 1) deficiency in aged rat brain cortex. J Neurochem 67, 2471-7. Peruzzi F., Prisco M., Morrione A., Valentinis B. and Baserga R. (2001) Anti-apoptotic signaling of the insulin-like growth factor-I receptor through mitochondrial translocation of c-Raf and Nedd4. J Biol Chem 276, 25990-6. Peterkofsky B., Gosiewska A., Wilson S. and Kim Y. R. (1998) Phosphorylation of rat insulin-like growth factor binding protein-1 does not affect its biological properties. Arch Biochem Biophys 357, 101-10. Peterson J. E., Kulik G., Jelinek T., Reuter C. W., Shannon J. A. and Weber M. J. (1996) Src phosphorylates the insulin-like growth factor type I receptor on the autophosphorylation sites. Requirement for transformation by src. J Biol Chem 271, 31562-71. Pierce S. B., Costa M., Wisotzkey R., Devadhar S., Homburger S. A., Buchman A. R., Ferguson K. C., Heller J., Platt D. M., Pasquinelli A. A., Liu L. X., Doberstein S. K. and Ruvkun G. (2001) Regulation of DAF-2 receptor signaling by human insulin and ins-1, a member of the unusually large and diverse C. elegans insulin gene family. Genes Dev 15, 672-86. Pietrzkowski Z., Sell C., Lammers R., Ullrich A. and Baserga R. (1992) Roles of insulinlike growth factor 1 (IGF-1) and the IGF-1 receptor in epidermal growth factor-stimulated growth of 3T3 cells. Mol Cell Biol 12, 3883-9. Powell-Braxton L., Hollingshead P., Warburton C., Dowd M., Pitts-Meek S., Dalton D., Gillett N. and Stewart T. A. (1993) IGF-I is required for normal embryonic growth in mice. Genes Dev 7, 2609-17. Prager D., Li H. L., Yamasaki H. and Melmed S. (1994) Human insulin-like growth factor I receptor internalization. Role of the juxtamembrane domain. J Biol Chem 269, 11934-7. Prisco M., Peruzzi F., Belletti B. and Baserga R. (2001) Regulation of Id gene expression by type I insulin-like growth factor: roles of Stat3 and the tyrosine 950 residue of the receptor. Mol Cell Biol 21, 5447-58. Prisco M., Santini F., Baffa R., Liu M., Drakas R., Wu A. and Baserga R. (2002) Nuclear translocation of insulin receptor substrate-1 by the simian virus 40 T antigen and the activated type 1 insulin-like growth factor receptor. J Biol Chem 277, 32078-85.


87

Pugazhenthi S., Boras T., O'Connor D., Meintzer M. K., Heidenreich K. A. and Reusch J. E. (1999a) Insulin-like growth factor I-mediated activation of the transcription factor cAMP response element-binding protein in PC12 cells. Involvement of p38 mitogen-activated protein kinase-mediated pathway. J Biol Chem 274, 2829-37. Pugazhenthi S., Miller E., Sable C., Young P., Heidenreich K. A., Boxer L. M. and Reusch J. E. (1999b) Insulin-like growth factor-I induces bcl-2 promoter through the transcription factor cAMP-response element-binding protein. J Biol Chem 274, 27529-35. Rajaram S., Baylink D. J. and Mohan S. (1997) Insulin-like growth factor-binding proteins in serum and other biological fluids: regulation and functions. Endocr Rev 18, 801-31. Rameh L. E. and Cantley L. C. (1999) The role of phosphoinositide 3-kinase lipid products in cell function. J Biol Chem 274, 8347-50. Reiss K., Cheng W., Pierzchalski P., Kodali S., Li B., Wang S., Liu Y. and Anversa P. (1997) Insulin-like growth factor-1 receptor and its ligand regulate the reentry of adult ventricular myocytes into the cell cycle. Exp Cell Res 235, 198-209. Reiss K., Ferber A., Travali S., Porcu P., Phillips P. D. and Baserga R. (1991) The protooncogene c-myb increases the expression of insulin-like growth factor 1 and insulinlike growth factor 1 receptor messenger RNAs by a transcriptional mechanism. Cancer Res 51, 5997-6000. Resnicoff M., Abraham D., Yutanawiboonchai W., Rotman H. L., Kajstura J., Rubin R., Zoltick P. and Baserga R. (1995a) The insulin-like growth factor I receptor protects tumor cells from apoptosis in vivo. Cancer Res 55, 2463-9. Resnicoff M., Burgaud J. L., Rotman H. L., Abraham D. and Baserga R. (1995b) Correlation between apoptosis, tumorigenesis, and levels of insulin- like growth factor I receptors. Cancer Res 55, 3739-41. Resnicoff M., Coppola D., Sell C., Rubin R., Ferrone S. and Baserga R. (1994a) Growth inhibition of human melanoma cells in nude mice by antisense strategies to the type 1 insulin-like growth factor receptor. Cancer Res 54, 4848-50. Resnicoff M., Sell C., Rubini M., Coppola D., Ambrose D., Baserga R. and Rubin R. (1994b) Rat glioblastoma cells expressing an antisense RNA to the insulin-like growth factor-1 (IGF-1) receptor are nontumorigenic and induce regression of wild-type tumors. Cancer Res 54, 2218-22. Rietzler M., Bittner M., Kolanus W., Schuster A. and Holzmann B. (1998) The human WD repeat protein WAIT-1 specifically interacts with the cytoplasmic tails of beta7-integrins. J Biol Chem 273, 27459-66. Rocchi S., Tartare-Deckert S., Sawka-Verhelle D., Gamha A. and van Obberghen E. (1996) Interaction of SH2-containing protein tyrosine phosphatase 2 with the insulin receptor and the insulin-like growth factor-I receptor: studies of the domains involved using the yeast two-hybrid system. Endocrinology 137, 4944-52. Rodriguez M. M., Ron D., Touhara K., Chen C. H. and Mochly-Rosen D. (1999) RACK1, a protein kinase C anchoring protein, coordinates the binding of activated protein kinase C and select pleckstrin homology domains in vitro. Biochemistry 38, 13787-94. Rodriguez-Tarduchy G., Collins M. K., Garcia I. and Lopez-Rivas A. (1992) Insulin-like growth factor-I inhibits apoptosis in IL-3-dependent hemopoietic cells. J Immunol 149, 535-40. Rogler C. E., Yang D., Rossetti L., Donohoe J., Alt E., Chang C. J., Rosenfeld R., Neely K. and Hintz R. (1994) Altered body composition and increased frequency of diverse malignancies in insulin-like growth factor-II transgenic mice. J Biol Chem 269, 13779-84. Romano G., Prisco M., Zanocco-Marani T., Peruzzi F., Valentinis B. and Baserga R. (1999) Dissociation between resistance to apoptosis and the transformed phenotype in IGF-I receptor signaling. J Cell Biochem 72, 294-310.

88


Ron D., Chen C. H., Caldwell J., Jamieson L., Orr E. and Mochly-Rosen D. (1994) Cloning of an intracellular receptor for protein kinase C: a homolog of the beta subunit of G proteins. Proc Natl Acad Sci U S A 91, 839-43. Ron D., Luo J. and Mochly-Rosen D. (1995) C2 region-derived peptides inhibit translocation and function of beta protein kinase C in vivo. J Biol Chem 270, 24180-7. Ron D. and Mochly-Rosen D. (1995) An autoregulatory region in protein kinase C: the pseudoanchoring site. Proc Natl Acad Sci U S A 92, 492-6. Roulston A., Marcellus R. C. and Branton P. E. (1999) Viruses and apoptosis. Annu Rev Microbiol 53, 577-628. Ruiz-Hidalgo M. J., Gubina E., Tull L., Baladron V. and Laborda J. (2002) dlk modulates mitogen-activated protein kinase signaling to allow or prevent differentiation. Exp Cell Res 274, 178-88. Sachdev D., Li S. L., Hartell J. S., Fujita-Yamaguchi Y., Miller J. S. and Yee D. (2003) A chimeric humanized single-chain antibody against the type I insulin- like growth factor (IGF) receptor renders breast cancer cells refractory to the mitogenic effects of IGF-I. Cancer Res 63, 627-35. Saltiel A. R. and Kahn C. R. (2001) Insulin signalling and the regulation of glucose and lipid metabolism. Nature 414, 799-806. Samani A. A. and Brodt P. (2001) The receptor for the type I insulin-like growth factor and its ligands regulate multiple cellular functions that impact on metastasis. Surg Oncol Clin N Am 10, 289-312, viii. Sawka-Verhelle D., Tartare-Deckert S., White M. F. and Van Obberghen E. (1996) Insulin receptor substrate-2 binds to the insulin receptor through its phosphotyrosine-binding domain and through a newly identified domain comprising amino acids 591-786. J Biol Chem 271, 5980-3. Schechtman D. and Mochly-Rosen D. (2001) Adaptor proteins in protein kinase C-mediated signal transduction. Oncogene 20, 6339-47. Scheepens A., Sirimanne E. S., Breier B. H., Clark R. G., Gluckman P. D. and Williams C. E. (2001) Growth hormone as a neuronal rescue factor during recovery from CNS injury. Neuroscience 104, 677-87. Scher C. D., Shepard R. C., Antoniades H. N. and Stiles C. D. (1979) Platelet-derived growth factor and the regulation of the mammalian fibroblast cell cycle. Biochim Biophys Acta 560, 217-41. Schlessinger J. and Bar-Sagi D. (1994) Activation of Ras and other signaling pathways by receptor tyrosine kinases. Cold Spring Harb Symp Quant Biol 59, 173-9. Schoen T. J., Mazuruk K., Waldbillig R. J., Potts J., Beebe D. C., Chader G. J. and Rodriguez I. R. (1995) Cloning and characterization of a chick embryo cDNA and gene for IGFbinding protein-2. J Mol Endocrinol 15, 49-59. Schumacher R., Mosthaf L., Schlessinger J., Brandenburg D. and Ullrich A. (1991) Insulin and insulin-like growth factor-1 binding specificity is determined by distinct regions of their cognate receptors. J Biol Chem 266, 19288-95. Schumacher R., Soos M. A., Schlessinger J., Brandenburg D., Siddle K. and Ullrich A. (1993) Signaling-competent receptor chimeras allow mapping of major insulin receptor binding domain determinants. J Biol Chem 268, 1087-94. Scott B. A., Avidan M. S. and Crowder C. M. (2002) Regulation of hypoxic death in C. elegans by the insulin/IGF receptor homolog DAF-2. Science 296, 2388-91. Seger R., Biener Y., Feinstein R., Hanoch T., Gazit A. and Zick Y. (1995) Differential activation of mitogen-activated protein kinase and S6 kinase signaling pathways by 12-Otetradecanoylphorbol-13-acetate (TPA) and insulin. Evidence for involvement of a TPAstimulated protein- tyrosine kinase. J Biol Chem 270, 28325-30.


89

Sell C., Baserga R. and Rubin R. (1995) Insulin-like growth factor I (IGF-I) and the IGF-I receptor prevent etoposide-induced apoptosis. Cancer Res 55, 303-6. Sell C., Dumenil G., Deveaud C., Miura M., Coppola D., DeAngelis T., Rubin R., Efstratiadis A. and Baserga R. (1994) Effect of a null mutation of the insulin-like growth factor I receptor gene on growth and transformation of mouse embryo fibroblasts. Mol Cell Biol 14, 3604-12. Sell C., Rubini M., Rubin R., Liu J. P., Efstratiadis A. and Baserga R. (1993) Simian virus 40 large tumor antigen is unable to transform mouse embryonic fibroblasts lacking type 1 insulin-like growth factor receptor. Proc Natl Acad Sci U S A 90, 11217-21. Sepp-Lorenzino L. (1998) Structure and function of the insulin-like growth factor I receptor. Breast Cancer Res Treat 47, 235-53. Shen C., Buck A. K., Liu X., Winkler M. and Reske S. N. (2003) Gene silencing by adenovirus-delivered siRNA. FEBS Lett 539, 111-4. Smith P. R., de Jesus O., Turner D., Hollyoake M., Karstegl C. E., Griffin B. E., Karran L., Wang Y., Hayward S. D. and Farrell P. J. (2000) Structure and coding content of CST (BART) family RNAs of Epstein-Barr virus. J Virol 74, 3082-92. Soos M. A., Field C. E., Lammers R., Ullrich A., Zhang B., Roth R. A., Andersen A. S., Kjeldsen T. and Siddle K. (1992) A panel of monoclonal antibodies for the type I insulinlike growth factor receptor. Epitope mapping, effects on ligand binding, and biological activity. J Biol Chem 267, 12955-63. Stannard B., Blakesley V., Kato H., Roberts C. T., Jr. and LeRoith D. (1995) Single tyrosine substitution in the insulin-like growth factor I receptor inhibits ligand-induced receptor autophosphorylation and internalization, but not mitogenesis. Endocrinology 136, 491824. Stebbins E. G. and Mochly-Rosen D. (2001) Binding specificity for RACK1 resides in the V5 region of beta II protein kinase C. J Biol Chem 276, 29644-50. Steck P. A., Pershouse M. A., Jasser S. A., Yung W. K., Lin H., Ligon A. H., Langford L. A., Baumgard M. L., Hattier T., Davis T., Frye C., Hu R., Swedlund B., Teng D. H. and Tavtigian S. V. (1997) Identification of a candidate tumour suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat Genet 15, 356-62. Steele M. R., McCahill A., Thompson D. S., MacKenzie C., Isaacs N. W., Houslay M. D. and Bolger G. B. (2001) Identification of a surface on the beta-propeller protein RACK1 that interacts with the cAMP-specific phosphodiesterase PDE4D5. Cell Signal 13, 507-13. Steller H. (1995) Mechanisms and genes of cellular suicide. Science 267, 1445-9. Stiles C. D., Capone G. T., Scher C. D., Antoniades H. N., Van Wyk J. J. and Pledger W. J. (1979) Dual control of cell growth by somatomedins and platelet-derived growth factor. Proc Natl Acad Sci U S A 76, 1279-83. Sun X. J., Crimmins D. L., Myers M. G., Jr., Miralpeix M. and White M. F. (1993) Pleiotropic insulin signals are engaged by multisite phosphorylation of IRS-1. Mol Cell Biol 13, 7418-28. Sun X. J., Wang L. M., Zhang Y., Yenush L., Myers M. G., Jr., Glasheen E., Lane W. S., Pierce J. H. and White M. F. (1995) Role of IRS-2 in insulin and cytokine signalling. Nature 377, 173-7. Surmacz E., Sell C., Swantek J., Kato H., Roberts C. T., Jr., LeRoith D. and Baserga R. (1995) Dissociation of mitogenesis and transforming activity by C-terminal truncation of the insulin-like growth factor-I receptor. Exp Cell Res 218, 370-80. Takata Y. and Kobayashi M. (1994) Insulin-like growth factor I signalling through heterodimers of insulin and insulin-like growth factor I receptors. Diabete Metab 20, 31-6.

90


Tamemoto H., Kadowaki T., Tobe K., Yagi T., Sakura H., Hayakawa T., Terauchi Y., Ueki K., Kaburagi Y., Satoh S. and et al. (1994) Insulin resistance and growth retardation in mice lacking insulin receptor substrate-1. Nature 372, 182-6. Tartare S., Mothe I., Kowalski-Chauvel A., Breittmayer J. P., Ballotti R. and Van Obberghen E. (1994) Signal transduction by a chimeric insulin-like growth factor-1 (IGF-1) receptor having the carboxyl-terminal domain of the insulin receptor. J Biol Chem 269, 11449-55. Tartare-Deckert S., Murdaca J., Sawka-Verhelle D., Holt K. H., Pessin J. E. and Van Obberghen E. (1996) Interaction of the molecular weight 85K regulatory subunit of the phosphatidylinositol 3-kinase with the insulin receptor and the insulin- like growth factor1 (IGF- I) receptor: comparative study using the yeast two-hybrid system. Endocrinology 137, 1019-24. Toker A. and Newton A. C. (2000) Cellular signaling: pivoting around PDK-1. Cell 103, 1858. Tournier C., Hess P., Yang D. D., Xu J., Turner T. K., Nimnual A., Bar-Sagi D., Jones S. N., Flavell R. A. and Davis R. J. (2000) Requirement of JNK for stress-induced activation of the cytochrome c- mediated death pathway. Science 288, 870-4. Trojan J., Blossey B. K., Johnson T. R., Rudin S. D., Tykocinski M. and Ilan J. (1992) Loss of tumorigenicity of rat glioblastoma directed by episome-based antisense cDNA transcription of insulin-like growth factor I. Proc Natl Acad Sci U S A 89, 4874-8. Tsuruzoe K., Emkey R., Kriauciunas K. M., Ueki K. and Kahn C. R. (2001) Insulin receptor substrate 3 (IRS-3) and IRS-4 impair IRS-1- and IRS-2- mediated signaling. Mol Cell Biol 21, 26-38. Tuynder M., Susini L., Prieur S., Besse S., Fiucci G., Amson R. and Telerman A. (2002) Biological models and genes of tumor reversion: cellular reprogramming through tpt1/TCTP and SIAH-1. Proc Natl Acad Sci U S A 99, 14976-81. Ullrich A. and Schlessinger J. (1990) Signal transduction by receptors with tyrosine kinase activity. Cell 61, 203-12. Upton Z., Chan S. J., Steiner D. F., Wallace J. C. and Ballard F. J. (1993) Evolution of insulin-like growth factor binding proteins. Growth Regul 3, 29-32. Usacheva A., Smith R., Minshall R., Baida G., Seng S., Croze E. and Colamonici O. (2001) The WD motif-containing protein receptor for activated protein kinase C (RACK1) is required for recruitment and activation of signal transducer and activator of transcription 1 through the type I interferon receptor. J Biol Chem 276, 22948-53. Valentinis B., Porcu P. L., Quinn K. and Baserga R. (1994) The role of the insulin-like growth factor I receptor in the transformation by simian virus 40 T antigen. Oncogene 9, 825-31. Valverde A. M., Lorenzo M., Pons S., White M. F. and Benito M. (1998) Insulin receptor substrate (IRS) proteins IRS-1 and IRS-2 differential signaling in the insulin/insulin-like growth factor-I pathways in fetal brown adipocytes. Mol Endocrinol 12, 688-97. van der Burg B., Rutteman G. R., Blankenstein M. A., de Laat S. W. and van Zoelen E. J. (1988) Mitogenic stimulation of human breast cancer cells in a growth factor- defined medium: synergistic action of insulin and estrogen. J Cell Physiol 134, 101-8. Vander Heiden M. G., Chandel N. S., Schumacker P. T. and Thompson C. B. (1999) Bcl-xL prevents cell death following growth factor withdrawal by facilitating mitochondrial ATP/ADP exchange. Mol Cell 3, 159-67. Vander Heiden M. G. and Thompson C. B. (1999) Bcl-2 proteins: regulators of apoptosis or of mitochondrial homeostasis? Nat Cell Biol 1, E209-16. Vorwerk P., Wex H., Hohmann B., Mohnike K., Schmidt U. and Mittler U. (2002) Expression of components of the IGF signalling system in childhood acute lymphoblastic leukaemia. Mol Pathol 55, 40-5.


91

Walchli S., Curchod M. L., Gobert R. P., Arkinstall S. and Hooft van Huijsduijnen R. (2000) Identification of tyrosine phosphatases that dephosphorylate the insulin receptor. A brute force approach based on "substrate-trapping" mutants. J Biol Chem 275, 9792-6. Walsh P. T. and O'Connor R. (2000) The insulin-like growth factor-I receptor is regulated by CD28 and protects activated T cells from apoptosis. Eur J Immunol 30, 1010-8. Weber M. M., Fottner C., Liu S. B., Jung M. C., Engelhardt D. and Baretton G. B. (2002) Overexpression of the insulin-like growth factor I receptor in human colon carcinomas. Cancer 95, 2086-95. Wen S., Stolarov J., Myers M. P., Su J. D., Wigler M. H., Tonks N. K. and Durden D. L. (2001) PTEN controls tumor-induced angiogenesis. Proc Natl Acad Sci U S A 98, 4622-7. Werner H., Bach M. A., Stannard B., Roberts C. T., Jr. and LeRoith D. (1992) Structural and functional analysis of the insulin-like growth factor I receptor gene promoter. Mol Endocrinol 6, 1545-58. Werner H., Karnieli E., Rauscher F. J. and LeRoith D. (1996) Wild-type and mutant p53 differentially regulate transcription of the insulin-like growth factor I receptor gene. Proc Natl Acad Sci U S A 93, 8318-23. Werner H. and LeRoith D. (1996) The role of the insulin-like growth factor system in human cancer. Adv Cancer Res 68, 183-223. Westwood M., Gibson J. M. and White A. (1997) Purification and characterization of the insulin-like growth factor- binding protein-1 phosphoform found in normal plasma. Endocrinology 138, 1130-6. Wex H., Vorwerk P., Mohnike K., Bretschneider D., Kluba U., Aumann V., Blum W. F. and Mittler U. (1998) Elevated serum levels of IGFBP-2 found in children suffering from acute leukaemia is accompanied by the occurrence of IGFBP-2 mRNA in the tumour clone. Br J Cancer 78, 515-20. Whitmarsh A. J., Cavanagh J., Tournier C., Yasuda J. and Davis R. J. (1998) A mammalian scaffold complex that selectively mediates MAP kinase activation. Science 281, 1671-4. Withers D. J., Gutierrez J. S., Towery H., Burks D. J., Ren J. M., Previs S., Zhang Y., Bernal D., Pons S., Shulman G. I., Bonner-Weir S. and White M. F. (1998) Disruption of IRS-2 causes type 2 diabetes in mice. Nature 391, 900-4. Wu Y., Yakar S., Zhao L., Hennighausen L. and LeRoith D. (2002) Circulating insulin-like growth factor-I levels regulate colon cancer growth and metastasis. Cancer Res 62, 10305. Wu Y. L., Jiang X. R., Allen P. D., Jia L., Dronfield D. M., Newland A. C. and Kelsey S. M. (1996) Modulation of surface TNF expression by human leukaemic cells alters their sensitivity to exogenous TNF. Leuk Res 20, 47-55. Xu P., Jacobs A. R. and Taylor S. I. (1999) Interaction of insulin receptor substrate 3 with insulin receptor, insulin receptor-related receptor, insulin-like growth factor-1 receptor, and downstream signaling proteins. J Biol Chem 274, 15262-70. Yaka R., Thornton C., Vagts A. J., Phamluong K., Bonci A. and Ron D. (2002) NMDA receptor function is regulated by the inhibitory scaffolding protein, RACK1. Proc Natl Acad Sci U S A 99, 5710-5. Yang X. F., Beamer W. G., Huynh H. and Pollak M. (1996) Reduced growth of human breast cancer xenografts in hosts homozygous for the lit mutation. Cancer Res 56, 1509-11. Yarwood S. J., Steele M. R., Scotland G., Houslay M. D. and Bolger G. B. (1999) The RACK1 signaling scaffold protein selectively interacts with the cAMP-specific phosphodiesterase PDE4D5 isoform. J Biol Chem 274, 14909-17. Yu H. and Rohan T. (2000) Role of the insulin-like growth factor family in cancer development and progression. J Natl Cancer Inst 92, 1472-89.

92


Zabolotny J. M., Kim Y. B., Peroni O. D., Kim J. K., Pani M. A., Boss O., Klaman L. D., Kamatkar S., Shulman G. I., Kahn B. B. and Neel B. G. (2001) Overexpression of the LAR (leukocyte antigen-related) protein-tyrosine phosphatase in muscle causes insulin resistance. Proc Natl Acad Sci U S A 98, 5187-92. Zhang B. and Roth R. A. (1991) Binding properties of chimeric insulin receptors containing the cysteine-rich domain of either the insulin-like growth factor I receptor or the insulin receptor related receptor. Biochemistry 30, 5113-7. Zhang D. and Brodt P. (2003) Type 1 insulin-like growth factor regulates MT1-MMP synthesis and tumor invasion via PI 3-kinase/Akt signaling. Oncogene 22, 974-82. Zhao H., Grossman H. B., Spitz M. R., Lerner S. P., Zhang K. and Wu X. (2003) Plasma levels of insulin-like growth factor-1 and binding protein-3, and their association with bladder cancer risk. J Urol 169, 714-7. Zong C. S., Chan J., Levy D. E., Horvath C., Sadowski H. B. and Wang L. H. (2000) Mechanism of STAT3 activation by insulin-like growth factor I receptor. J Biol Chem 275, 15099-105.

4.

APOPTOSIS IN HEPATOCYTES

N. T. MUKWENA AND MOHAMED AL-RUBEAI Animal Cell Technology Group, Department of Chemical Engineering, University of Birmingham, Birmingham United Kingdom, B15 2TT E-mail: [email protected]

1.

Introduction

The liver is not only the largest visceral organ in the human body (making up 2.5% of total body mass), but is also the central metabolic organ. Central to liver function are parenchymal cells or hepatocytes, which amount to 80% of cellular mass. Hepatocytes perform a plethora of tasks including, production of blood plasma proteins, synthesis of carrier proteins, detoxification of ingested xenobiotics, conjugation and secretion of hormones, regulation of circulatory lipids and synthesis and metabolism of amino acids. Although by no means exhaustive, this list provides a firm indication of the vital role of the organ. Thus, it is not difficult to appreciate the profound consequences that hepatocyte apoptosis and/or loss of hepatocyte function has on the homeostatic balance of both the organ and organism (Patel and Gore, 1995; Natori et al., 2001, Ziol et al., 2001). If the in vivo functions of hepatocytes are retained in vitro, this could open up a new era of possibilities in the fields of medicine and biotechnology, where their potential uses are manifold. (a) Toxicology: Hepatocyte cultures would provide an alternative to animal testing where animal toxicity data can be extrapolated from in vitro models (Ohno et al., 1998). Such cultures would be used to determine cytotoxicity and genotoxicity of newly developed therapeutics and pesticides (Ilyin et al., 1997). Much investigation has gone into analysing the expression and function of xenobiotic metabolising enzymes in particular the cytochrome P450 family of proteins (Hitchmann et al., 1995). Ohno et al. (1998) present a series of data revealing the hepatotoxicity of a number of commercially available pesticides, using freshly isolated and cultured rat hepatocytes. (b) Production of recombinant proteins: Within the field of biotechnology, the potential uses of hepatocyte cultures extend further than toxicological studies; in addition, hepatocytes could be used as vehicles for production of recombinant proteins. Although used not used extensively in bioprocesses, hepatocytes offer advantages over traditionally used cells lines such as Chinese hamster ovary (CHO) 93 M. Al-Rubeai and M. Fussenegger (eds.), Cell Engineering, Vol. 4, 93-106. © 2004 Kluwer Academic Publishers. Printed in the Netherlands.

94

N. T. MUKWENA and M. AL-RUBEAI

and NSO myeloma. Hepatocytes apart from being able to perform a variety of posttranslational modifications are natural secretors. Use of hepatocytes could allow simplification of culture media formulations as they ectopically express enzymes for synthesis of amino acids, fatty acids and other complex molecules, many of which are constituents of culture media. Furthermore, exploiting the ability of hepatocytes to ‘break down’ ammonia to glutamine and urea would have immense impact in the latter stages of the production process where increased ammonia levels are associated with premature demise of cultures. This may also mean that glutamine concentration in culture medium can be decreased, in turn this would mean reduction of ammonium production. Ultimately utilising hepatocytes (in particular human hepatocytes) in biotechnology could have immense implications in reducing the cost of recombinant protein production by limiting the number of medium additives, and benefiting downstream processing for example, eliminating the need for cell lysis steps for intracellular products. (c) Extracorporeal Liver support devices (ELAD): At present, the only therapy for sufferers of end-stage liver disease or congenital hepatic disorders is orthotopic liver transplantation. Such devices would bridge the gap for patients awaiting liver transplantation or improve the quality of life for those with acute liver disease. Since the 1980s several extracorporeal liver support devices have been developed. These have been classified into artificial and bio-artificial devices. Artificial devices are based on adsorption, haemodialysis and plasmapheresis whilst the bio-artificial are categorised into membrane based, direct perfusion and entrapment based systems (reviewed by Legallais et al., 2001). Although several devices have been developed, none are commercially available primarily because all devices to date have housed porcine hepatocytes, which hold the risk of disease transmission and adverse immune reaction (Miyoshi et al., 1993; Legallais et al., 2001). (d) Hepatocyte transplantation and gene therapy: Further use is in hepatocyte transplantation and gene therapy where a damaged liver is ‘repopulated’ with viable, functional human hepatocytes. At present, hepatocyte transplantation is not seen as a cure but as a bridge to orthotopic liver transplantation or host liver regeneration (Gupta et al., 1999). In gene therapy, this would be extended to transfer of a stable gene via a retroviral vector. Of course, patient safety would heavily influence the way by which hepatocytes are immortalised. Although research in this area had been lagging, successful transplantation of healthy hepatocytes into diseased organs has yet again revived research interest in this mode of therapy. Grossman et al. (1994) reported the successful autologous transplantation of ex vivo-modified hepatocytes by retroviral transfer of the LDL-receptor gene. Unfortunately, the applications of hepatocyte culture are yet to be realised. This is due primarily, to the inherent complexity of liver function, made even more elusive by the low proliferative capacity of primary hepatocytes and further still by their rapid loss of liver specific functions, in vitro (discussed by Leffert et al., 1988; Enosawa et al., 1996). The following sections will however focus on the


95

significance of apoptosis or programmed cell death in hepatic disease and hepatocyte culture.

2.

Hepatic apoptosis

Kerr et al., 1972 coined the term apoptosis to describing a predetermined sequence of events leading to cellular destruction (Kerr et al., 1972). The discovery in Caenorhabditis elegans, that the process was genetically regulated, intensified efforts to elucidate the regulators and pathways of the apoptotic process. Although much has been published about apoptosis it has been centred on in cancer and aging studies and in the context of biotechnology has led emergence of a vehement interest in cell engineering. Cells are metabolically engineered such they are more robust against sub-optimal culture conditions and have enhanced potential for production of commercially valuable proteins and therapeutics. Although hepatocytes are not currently used in bioprocess, a number of texts refer to the occurrence of apoptosis in hepatocytes, although much of the research is centred around the role of apoptosis in liver disease state, particularly the affect both in vitro (primary and immortalised cells) and in vivo (Ni et al., 1994; Maeda et al., 1996; Rouquet et al., 1996; Feldman et al., 1998; Woo et al., 1999). Apoptosis studies in cultured hepatocytes reveal that they, like previously studied cell types, show apoptotic traits such as DNA fragmentation, increased levels of intracellular reactive oxygen species (ROS), decreased intracellular glutathione concentrations, alterations in the mitochondrial permeability transition and activity of intracellular proteases (Sánchez et al., 1996; Maeda et al., 1996; Hatano et al., 2000; Nakatani et al., 2000).

3.

The Fas system

Fas (APO-1/CD95), a member of the tumour necrosis factor (TNF)/nerve growth factor (NGF) receptor superfamily has been widely shown to mediate apoptosis in a wide variety of cell types. Fas is a transmembrane glycoprotein with a molecular weight of 45kDa, its cytoplasmic domain or death domain (DD) constitutes the primary step in transducing the signal for apoptosis. Physiologically Fas has been implicated in immune response where its association with its ligand, FasL aids in maintaining a healthy T-lymphocytes repertoire, by deleting cells expressing incorrect receptors (reviewed by Budd, 2001 and Hildermann et al., 2002). More recently, binding of Fas and FasL has been identified in the pathogenesis of disease states of non-lymphoid organs (Rouquet et al., 1996). Although the intricate signalling pathways that constitute Fas-mediated apoptosis are not fully understood it is generally accepted that trimerisation of Fas occurs upon binding to FasL, initiating a series of interactions between Fas, adaptor

96


molecules (FADD, TRADD and RIP) and procaspases, culminating in cellular destruction (Cleveland and Ihle, 1995; Wallach, 1997; Woo et al., 1999). Evolutionary conserved protein-protein interaction domains including death domain (DDs), death effector domains (DEDs) and caspase recruitment domains (CARDs) enable these highly specific interactions. The ultimate executioners are the interleukin-1ǃ-converting enzyme-like proteases (now termed caspases), which collude to bring about the morphological, biochemical and physiological alterations that characterise the apoptotic process (reviewed by Cain and Freathy, 2001; MacEwan, 2002). Although not the only death receptor expressed on the hepatocyte cell surface, Fas has undoubtedly received the most attention, a fact perhaps explained by its ‘appearance’ in the pathology of may liver afflictions. Rouquet et al. (1996) suggest that the high level of constitutively expressed Fas in normal hepatocytes leaves them more vulnerable to Fas-mediated apoptosis. The investigations of several research groups began to point at the central role of Fas/FasL in hepatitis B and C, where Fas expression was found to be elevated in peri-portal hepatocytes (Mita et al., 1994; Galle et al., 1995; Rouquet et al., 1996). Indeed Fas (and tumour necrosis factor-Į) have since been implicated in alcoholic hepatitis, acute liver failure, reperfusion injury, hepatocellular carcinoma and graft versus host disease (Hatano et al., 2000; Bantel et al., 2001; Cain and Freathy, 2001). The first clear evidence of Fas involvement in hepatic apoptosis was presented by Ogasawara et al. (1993) who demonstrated that administration of anti-Fas antibodies in mice lead to the death of the animal as a consequence of massive apoptotic death of hepatocytes and accumulation of transaminases in serum. Furthermore, Ogasawara and colleagues showed that administration of the same antibody to mutant ipr mice, where Fas is expressed at very low levels, did not result in hepatic lesions associated with Fas and FasL (Ogasawara et al., 1993). These findings were confirmed in vitro where anti-Fas antibodies were shown to induce apoptosis in primary and isolated hepatocyte cultures (Ni et al., 1994; Maeda et al., 1996; Rouquet et al., 1996; Feldman et al., 1998; Woo et al., 1999). However, Hatano et al. (2000) reported although Fas-mediated apoptosis (induced by Fas agonist, Jo2) occurred rapidly in vivo, experiments in cultured hepatocytes yielded contrasting results. In these studies, Jo2 alone was insufficient to yield a cytotoxic response in mouse hepatocytes. Hatano et al. (2000) hypothesised that nuclear factor-ǉB (NF-ǉB), which protects against TNF-α may exert similar protection against Fas-induced apoptosis in primary mouse hepatocytes. Ni et al. (1994) and Rouquet et al. (1996) came to a similar conclusion showing that Fas-mediated apoptosis required the presence of a protein kinase inhibitor (H7), a translation inhibitor (cycloheximide) or an inhibitor of RNA synthesis (actinomycin D) in order to elicit an apoptotic response. A number of in vivo studies have demonstrated the inherent resistance to Fasmediated apoptosis exhibited by hepatoma cells, a trait also observed in the


97

hepatoma cell line, Hep3B (Natoli et al., 1995; Kubo et al., 1998; Lamboley et al., 2000; Lamboley et al., 2002). Lamboley et al. (2002) showed low-level expression of Fas in Hep3B (contrasting studies by Jiang et al., 1999 who found none). Despite expression of procaspase-8, Fas-associating protein with death domain (FADD) and procaspase-3, treatment of Hep3B with Jo2 did not lead to apoptosis; adding further support to the hypothesis that additional stimuli is necessary to yield an apoptotic response in Fas-mediated apoptosis of hepatic cells.

4.

Mitochondria in hepatic apoptosis

For ease of discussion mitochondrial-mediated apoptosis will be considered separately from death receptor-induced apoptosis although it is regarded that these pathways are linked. For example, it is widely accepted that upon activation caspase 8 is able to cleave Bid, a member of the Bcl-2 family of proteins. In its truncated form, tBid enters mitochondria where it is associated with loss of mitochondrial membrane integrity and dysfunction, events that culminate in cellular apoptosis. Although the detailed mechanistic rationales of the associated pathway(s) are yet to be ascertained a wealth of experimental evidence points towards the generation and accumulation of oxidants such as the superoxide anion O2- and its metabolites, referred to as reactive oxygen species (ROS). More broadly speaking, mitochondria are considered to regulate apoptosis via their release of apoptosis–promoting factors such as cytochrome c, apoptosis-inducing factor (AIF) and Diablo-SMAC into the cytosol. Upon its release, cytochrome c, binds to apoptotic protease-activating factor-1 (Aparf-1), initiating recruitment of procapsase-9 to form the apoptosome complex. Activated caspase-9 is released from the apoptosome and proceeds to activate the effector caspases - caspase-3 and caspase- 7 (Cain and Freathy, 2001). 4.1

GENERATION OF REACTIVE OXYGEN SPECIES

Ethanol it has been shown induces a hypermetabolic state in the liver mitochondria which fuels a high demand for re-oxidation of NADH produced during ethanol metabolism by cytosolic alcohol dehydrogenase. The resulting imbalance in NAD+/NADH ratio favours production of superoxides by increasing the electron transport along the respiratory electron transport chain (Adachi and Ishii, 2002). Under normal conditions potentially toxic free radical are quenched and neutralised by endogenous antioxidants, however in the apoptotic model, reactive oxygen species and other free radicals accumulate to levels that deplete intracellular glutathione (GSH) and other thiol-containing proteins (Buttke and Sandstrom, 1994; Ishii et al., 1997). Hepatocytes are particularly vulnerable to injury under hypoxic conditions, as they do not express the hydrogen peroxide metabolising enzyme, catalase. Thus, the mitochondrial glutathione (GSH) system (via GSH peroxidase) is the prime mechanism by which hepatocytes protect against mitochondrial oxidative

98


stress (Adachi and Ishii, 2002). The question of whether GSH depletion is an important determinant of hepatocyte apoptosis has been investigated closely. Sanchez et al. (1997) determined that production of ROS, glutathione depletion and oxidative stress preceded transforming growth factor-ǃ (TGF-ǃ)-induced apoptosis in primary hepatocyte cultures. Results published by Nakatani et al. (2000) also showed that primary rat hepatocytes exposed to the metal ion chelator, TPEN led to apoptosis as a result of Zn2+ and GSH depletion. Additionally, it has been shown that apoptosis could be counteracted by administration of N-acetyl-L-cysteine, a precursor of GSH synthesis (Kurose et al., 1997; Nakatani et al., 2001). In contradiction to these reports, Zhang et al. (2001) found severe depletion of mitochondrial and cytosolic GSH was not sufficient to induce apoptosis, per se. Indeed, no oxidative damage, (lipid peroxidation) was observed. However, it was deemed that exposure to GSH depletory, diethyl maleate (DEM) significantly increased hepatocyte vulnerability to apoptosis-induced by inhibitors of mitochondrial electron transport (Tirmenstein et al., 2000; Zhang et al., 2001). Results on hepatocytes in vivo, show similar reliance on mitochondrial glutathione levels for protection against toxicity of toxicants known to deplete glutathione (Hammond et al., 2002). Chronic ethanol exposure reduces the pool of glutathione within the mitochondrial matrix, as mechanisms for uptake of glutathione from the cytosol become impaired (Takeshi et al., 1992). This reduction in antioxidant concentration leaves hepatic cells vulnerable to oxidative stress and to death receptor mediated apoptosis. Earlier experiments by Kaplowitz et al. (1985) had suggested the need to supply adequate quantities of the sulphur-containing amino acids, methionine and cysteine, in culture medium preparations to promote intracellular glutathione homeostasis. Indeed culture medium supplementation with the cysteine pro-drug N-acetyl-L-cysteine (NAC) was found to protect hepatocyte cultures against the toxicants and glutathione depletors, dichloropropanol and dibromopropanol by stimulating glutathione synthesis (Hammond et al., 2002). The formation of ROS does not cause apoptosis by reducing mitochondrial antioxidant concentration alone, but has been shown to downregulate the expression of the anti-apoptotic protein Bcl-xL in foetal hepatocytes (Herrera et al., 2001). This supported by findings that the presence of free radical scavengers (e.g. ascorbic acids) halted formation of ROS, abolished collapse of the mitochondrial transmembrane potential, Ʃƺm and prevented decrease in Bcl-xL levels. On the other the hand, presence of inhibitors of GSH synthesis promoted the decrease in Bcl-xL levels (Herrera et al., 2001). The regulation of gene expression by oxidants (and ROS) is now thought to extend beyond the bcl-2 family, and has been implicated in regulation of transcription factors nuclear factor kappa β (NF-κβ) and activator protein-1 (Sen et al., 1996; Simon et al., 1998) and association with other survival factors cannot be discounted.

APOPTOSIS IN HEPATOCYTES 4.2

99

MITOCHONDRIAL PERMEABILITY TRANSITION

Coupled to oxidative stress described above, the distribution of protons and other ions either side of the inner mitochondrial membrane becomes unbalanced leading to the formation of an electrochemical gradient across this membrane, the mitochondrial transmembrane potential (Ʃƺm). The formation of this gradient is driven by changes in mitochondrial membrane permeability transition (MPT), both events that are thought to be central in regulating cell viability. The permeability transition pore (PT pore) complex consists of the adenine nucleotide translocator (ANT), voltage-dependent anion channel (VDAC) and cyclophilin D undergo structural changes that result in reversible opening of the PT pore. When open the PT pore allows passage of ions resulting in extensive mitochondrial swelling and loss of potential. Opening of this megachannel is strongly under the influence of Ʃƺm, pH, Ca2+ concentration and mitochondrial antioxidant levels. Opening of the PTP allows rapid influx of ions leading to mitochondrial swelling and subsequent loss of the membrane potential. In a recent publications by Lemasters laboratory, the role of Ʃƺm, in the life or death decision is investigated. They coin the term ‘necrapoptosis’, a phenomenon defining the shared pathway of apoptosis and necrosis, where MPT, initiates events that can culminate in either apoptosis or necrosis. This phenomenon was investigated upon reperfusion of ischemic hepatocytes, where ATP availability was the ultimate decision is determined by the availability of ATP. Where ATP regeneration occurred (via addition of fructose, a substrate for glycolytic ATP formation) apoptosis results, whilst ATP starvation leads to necrotic cell death (Lemarsters, 1999; Kim et al., 2003).

5.

The BCl-2 family

The bcl-2 proto-oncogene, first discovered in B-cell lymphoma/leukaemia has been shown to prolong cell survival by inhibiting apoptosis induced by a variety of stimuli in a number of cell lines, including many commercially viable cell lines. This and other members of the family constitute a biologically important class of apoptosis regulatory genes. Interestingly, immunohistochemical studies reveal the absence of endogenous Bcl-2 in normal hepatocytes, although showed lower levels of expression in portal and interlobular bile ducts (Charlotte et al., 1994). It is reported however that Bcl-2 levels are increased in livers of hepatitis patients and to a greater degree in cirrhotic livers (Frommel et al., 1999). However, a number of authors have reported the expression of the anti-apoptotic Bcl-xL and the proapoptotic protein Bax in normal hepatocytes (Herrera et al., 2001). Bax acts as a dominant inhibitor of Bcl-2 by forming Bax/Bcl-2 heterodimers. Where Bax is present in excess within the heterodimer complex, apoptosis occurs.

100


Pioneering studies by Lacronique et al. (1996) showed that the hepatocytes of transgenic mice overexpressing bcl-2 in their livers were protected from Fasantibody mediated apoptosis. This and other studies hypothesised that the high susceptibility of the liver to Fas-mediated apoptosis correlates with the absence of constitutively expressed bcl-2 and is worsened still by the high levels of expression of pro-apoptotic proteins such as Bax and Bak (Krajewski et al., 1994; Kiefer et al., 1995; Lacronique et al., 1996). In an extensive study, Herrera et al. (2001) show that transforming growth factor-β (TGF-β) induces a decrease in Bcl-xL levels in foetal hepatocytes, with time course analysis revealing a correlation between decrease of Bcl-xL expression and alteration in mitochondrial Ʃƺm. The study also showed neither changes in expression of Bax or translocation of Bax from the cytosol into mitochondria. What in fact was observed was a decrease in the ratio of Bcl-xL/Bax, which would facilitate cytochrome c release. Bax has been implicated in the formation of the permeability transition (PT) pore in mitochondria where it forms oligomers that act as channels encouraging cytochrome c efflux (Brenner et al., 2000; Antonsson et al., 2000). TGF-β also appears to act a molecular level where it modulates bcl-xL mRNA levels in foetal hepatocytes. There exists a degree of speculation as to the role of Bcl-2 family members, BclxL in particular, in formation of the PT pore. Primarily this is centred around the structure of this protein, a structure reminiscent of the pore-forming bacterial toxin, diphtheria. This hypothesis has not been investigated in hepatocytes, although it has been shown that both Bcl-2 and Bcl-xL, directly inhibit caspase-8 (Ogasawara et al., 1993; Kawahara et al., 1998). An area that has now become one of much debate is whether Fas-induced apoptosis is dependent on the involvement of mitochondria, that is to say; does Fas ligation initiate the intrinsic apoptotic pathway? If this is the case, Bcl-2 should inhibit Fas-mediated apoptosis. There is evidence for both sides of the debate in existing publications. Whilst studies by Lacronique et al. (1996) and Rodríguez et al. (1996) show that Bcl-2 and Bcl-xL do inhibit Fas-mediated apoptosis, many dispute these findings. Huang et al. (1999) found that Bcl-2 was unable to protect against hepatotoxicity elicited by FasL both in vitro and in vivo; suggesting that the behaviour of agonistic anti-Fas antibody differs from that of the physiological Fas ligand , FasL (Huang et al.,1999). Similarly, Van Loo et al. (2003) found that Fas/FasL-induced apoptosis was not inhibited by transgenically expressed Bcl-2 in mouse hepatocytes. The mice associated exhibited classic apoptotic morphology and caspase activation to the same extent as wild type mice (Loo et al., 2003). On the other hand, bcl-2 transgenic mice exposed to agonistic anti-Fas antibody were completely protected, with no apoptosis-associated changes in morphology detected nor any caspase activation detected (Van Loo et al., 2003). Clearly, extrapolation of in vitro models to in vivo situations in Fas-mediated apoptosis, must be approached with caution.

APOPTOSIS IN HEPATOCYTES 6.

101

Caspases in liver disease and hepatic apoptosis

Regardless of the pathway that initiates an apoptotic stimuli, it is accepted that the ultimate executioners re the caspases. Despite this, questions remain regarding the physiological and/or pathological role of these proteases. Woo et al. (1999) provide direct evidence of the involvement of caspase-3 in hepatocyte apoptosis (in vivo study) in response to Fas/FasL ligation. Further proof is provided, when caspase-3 deficient mice, show resistance to apoptosis induced by administration of agonistic anti-Fas antibody. The mutant hepatocytes did not show increases Bcl-2 expression nor was there evidence of cytochrome c release. Furthermore, proteolytic cleavage of upstream apoptosis promoter including, caspase-8 and caspase-9 did not occur. Jones et al. (1998) showed that Fas binding to FasL in cultured hepatocytes activated the effector caspases, -3 and –7. Whilst in vivo administration of anti-Fas antibody did not induce hepatic apoptosis or hepatic failure in mouse hepatocytes that had been treated with the caspase-3 inhibitor, Ac-DEVD-cho (Rodriguez et al., 1996). The crucial role of caspases in hepatocyte apoptosis is supported by a wealth of inhibition studies. Pre-treatment of hepatocytes (in vitro and in vivo) with broadspectrum caspase inhibitor, ZVAD-fmk and more specific inhibition of capase-3 (Ac-DEVD-cho or Z-DEVD-fmk), caspase-8 (Z-IETD-fmk) and caspase-9 (ZLEHD-fmk) has provided evidence in the same way as had been reported in previously studied cell types and cell lines (Cain et al., 1996; Rouquet et al., 1996; Jones et al., 1998; Woo et al., 1999; Blom et al., 1999; Albright et al., 2003). 6.1

INHIBITORS OF APOPTOSIS (IAPs)

The inhibitors of apoptosis (IAP) have been identified in numerous types of cells, including human hepatoma cells (Shima et al., 1999) and more recently in hepatocytes (Herrera et al., 2002). IAPs are thought to be caspase antagonists that are endogenously expressed. Herrera et al. (2002) investigated the expression of XIAP, cIAP-1 and cIAP-2 in foetal rat hepatocytes during TGF-ǃ induced apoptosis. cIAP-1 level appeared to decrease whilst levels of the other IAPs remained the same. Decrease in cIAP-1 concentrations bore strong correlation to the appearance of apoptotic morphology (i.e. hypodiploid cells). This finding is thought to indicate the regulation of c-IAP-1 (and not XIAP and cIAP-2) by NF-ǉǃ survival pathway, which is inactivated by TGF-ǃ. Further investigations however, showed cIAP-1 to be a substrate or caspase-3 where cIAP-1 cleavage, yields a pro-apoptotic fragment. Inhibition of caspase-3 (with ZVAD-fmk) prevented reduction in cIAP-1 levels that had been observed in untreated cultures (Herrera et al., 2002). Schoemaker et al., (2002) reported that over-expression of human homologue of rat cIAP2 (hIAP1) in rat hepatocytes prevented caspase-3 activation and hence apoptosis. The study demonstrated the involvement of the NF-ǉǃ survival pathway,

102


and went further to provide evidence of NF-ǉǃ regulated cytokine-induced expression of Bak and Bid in hepatocytes (Schoemaker et al., 2002). Even in its infancy research in IAP, is revealing the complexity of the regulatory mechanisms associated with this family of proteins.

7.

Conclusions

Enhanced knowledge of the significance of apoptosis in hepatic disease has justified much of the research reviewed in this chapter. Our improved knowledge of the process itself will lend itself to the development of new treatment approaches where therapeutic strategies can be aimed at more specific targets. New therapeutic routes are already being considered in hepatocyte culture and in hepatic disease, with some already in early development. Indeed, several small molecule caspase inhibitors have been undergoing trials for treatment of liver disease (Whelan et al., 2002) and no doubt some will be available soon. Of course the possible targets for such therapy are many in a process so complex.

8.

References

Adachi M. and Ishii H. (2002) Role of mitochondria in alcoholic liver injury. Free Radical Biology and Medicine 32(6), 487-491. Albright C. D., Borgman C. and Craciunescu C. N. (2003) Activation of a caspase-dependent oxidative damage response mediates TGF1 apoptosis in rat hepatocytes. Experimental and Molecular Pathology Antonsson B., Montessuit S., Lauper S., Eskes R. and Martinou J. C. (2000) Bax oligomerization is required for channel-forming activity in liposomes and to trigger cytochrome c release from mitochondria. Biochemistry Journal 345, 271-278 Bantel H., Ruck P., Gregor M. and Schulze-Osthoff K. (2001) Detection of elevated caspase activation and early apoptosis in liver disease. European Journal of Cell Biology 80, 230239. Blom W. M., de Bont H. J., Meirjerman I., Mulder G. J. and Nagelkerke J. F. (1999) Prevention of cycloheximide-induced apoptosis in hepatocytes by adenosine and by caspase inhibitor. Biochemical Pharmacology 58, 1891-1898. Brenner C., Cadiou H., Vierra H., Zamzami N., Marzo I., Xie Z., Leber B., Andrews D., Duclohier H., Reed J. C. and Kroemer G. (2000) Bcl-2 and Bax regulate channel activity of the mitochondrial adenine nucleotide translocator. Oncogene 19, 329-336. Budd R. C. (2001). Activation–induced cell death. Current Opinion in Immunology 13, 356362. Buttke T. M. and Sanstrom P. A. (1994) Oxidative stress as a mediator of apoptosis. Immunology Today 15, 7-10. Cain K., Inayat-Hussain S. H., Couet C. and Cohen G. M. (1996) A cleavage-site-directed inhibitor of interleukin-1ǃ-convering enzyme-like proteases inhibits apoptosis in primary cultures of rat hepatocytes. Biochemical Journal 314, 27-32. Cain K. and Freathy C. (2001) Liver toxicity and apoptosis: role of TGF-ß1, cytochrome c and the apoptosome. Toxicological Letters 120, 307-315.


103

Charlotte F., L’Hermine C., Martin N., Geleyn Y., Nollet M., Gaulard P. and Zafrani E.S. (1994) Immunohistochemical detection of bcl-2 protein in normal and pathological human liver. American Journal of Pathology 144, 450-465. Cleveland J. L. and Ihle J. N. (1995) Contenders in Fas/TNF death signalling. Cell 81, 479482. Enosawa S., Suzuki S., Kakefuda T. and Amenmiya H. (1996) Examination of 7ethoxycoumarin deethylation and ammonia removal activities in 31 hepatocyte cell lines. Cell Transplantation 5(5), S39-S40. Feldman G., Lamboley C., Moreau A. and Bringuier A. (1998) Fas-mediated apoptosis of hepatic cells. Biomed and Pharmacother 52, 378-385. Frommel T.O., Yong S. and Zarling E. J. (1999) Immunohistochemical evaluation of Bcl-2 gene family expression in liver of hepatitis C and cirrhotic patients: a novel mechanism to explain the high incidence of hepatocarcinoma in cirrhotics. American Journal of Gastroenterology 94(1), 178-182. Galle P.R., Hoffman W. J. and Walczak H. (1995) Involvement of the CD95 ) APO-1/fas) receptor and ligand in liver damage . Journal of Experimental Medicine 82,1223-1230. Grossman M., Raper S. E., Kozarsky K., Stein E. A, Engelhardt J. F., Muller D., Lupien P. J. and Wilson J. M. (1994) Nature Genetics 6,335-341. Gupta S., Gorla G. R. and Irani A. N. (1999) Hepatocyte transplantation: emerging insights into mechanisms of liver repopulation and their relevance to potential therapies. Journal of Hepatology 30, 162-170. Hammond A. H., Garle M. J., Sooriakumaran P. and Fry J. R. (2002) Modulation of hepatocyte thiol content by medium composition: implications for toxicity studies. Toxicology in Vitro 16, 259-265. Hatano E., Bradham C. A., Stark A., Iimuro Y., Lemarsters J. J. and Brenner D. (2000) The mitochondrial permeability transition augments Fas-induced apoptosis in mouse hepatocytes. The Journal of Biological Chemistry 276(16), 11814-11823. Herrera B., Alvarez A. M., Sanchez A., Fernandez M., Roncero C., Benito M. and Fabergat I. (2001). Reactive oxygen species (ROS) mediates the mitochondrial-dependent apoptosis induced by transforming growth factor ß in fetal hepatocytes. FASEB Journal 15, 741-751 Herrera B., Fernandez M., Benito M. and Fabergat I. (2002).cIAP-1, but not XIAP, is cleaved by caspases during the apoptosis induced TGB-ǃ in fetal rat hepatocytes. FEBS Letters 520, 93-96. Hitchman N., Leaver M. and George S. (1995) Alternatives to whole animal testing: use of cDNA probes for studies of phase I and II enzyme induction in isolated plaice hepatocytes. Marine Environmental Research 39, 289-292. Huang D. C., Hahne M., Schroeter M., Frei K., Fontana A., Villunger A. et la. (1999) Activation of Fas by FasL induces apoptosis by a mechanism that cannot be blocked by Bcl-2 or Bcl-xL. Proceedings of the National Academy of Science USA 96,14871-14876. Ilyin G., Corlu A., Loyer P. and Guguen-Guillouzo C. (1997) Culture systems for hepatocytes for use in toxicology and differentiation studies. In Animal Cell Culture Techniques. (Martin Clynes .ed.). Springer, pp. 371-392. Ishii H., Kurose I and Kati S. (1997) Pathogenesis of alcoholic liver disease with particular emphasis on oxidative stress. Journal of Gastroenterology and Hepatology 12(Suppl.), S272-S282. Jaing S., Song M.J., Shin E. C., Lee M. O., Kim S. J. and Park J. H. (1999) Apoptosis in human hepatoma cell lines by chemotherapeutic drugs via Fas-dependent and Fasindependent pathways. Hepatology 29, 101-110. Kaplowitz N., Aw T. Y. and Ookhtens M. (1985) The regulation of hepatic glutathione. Annual Review of Pharmacology and Toxicology 25, 715-744.

104


Kerr J. F.R., Wyllie A. H. and Currie A. R. (1972) Apoptosis: a basic biological phenomenon with wide ranging implications in tissue kinetics. British Journal of Cancer 26, 239-257. Kiefer M. C. et al. (1995) Modulation of apoptosis by widely distributed Bcl-2 homologue Bak. Nature 374, 736-239. Kim J. S., He L. and Lemasters J. L. (2003) Mitochondrial permeability transition: a common pathway to necrosis and apoptosis. Biochemical and Biophysical Research Communication 304, 463-470. Krajewski S. et al., (1994) Immunohistochemical determination of in vivo distribution of Bax, a dominant inhibitor of Bcl-2. American Journal of Pathology 145, 1323-1336. Kubo K., Matsuzaki Y. M., Okazaki M., Kato A., Kobayashi N. and Okita K. (1998) The Fas system is not significantly involved in apoptosis in human hepatocellular carcinoma. Liver 18, 117-123. Kurose I’, Higuchi H., Kato S., Miura S., Watanabe N., Kamegaya Y., Tomit K., Takaishi M., Horie Y., Fukuda M., Mizukami K. and Ishii H. (1996) Oxidative stress on mitochondria and cell membrane of cultured rat hepatocytes and perfused liver exposed to ethanol. Gastroenterology 112, 131-159. Lacronique V., Mignon A., Fabre M., Viollet B., Rouquet N., Molina T., Porteu A., Henrion A., Bouscary D., Varlet P., Joulin V. and Kahn A. (1996) Bcl-2 protects from lethal hepatic apoptosis induced by an anti-Fas antibody in mice. Nature Medicine 2 (1), 80-86. Lamboley C., Bringuier A.F. and Feldman G. (2000) Apoptotic behaviour of hepatic and extra-hepatic tumour cell lines differs after Fas stimulation. Cell Mol Biology 46, 13-28. Lamboley C., Bringuier A.F., Camus E., Lardeux B., Groyer A. and Feldman G. (2002) Overexpression of the mouse Fas gene in human Hep3B hepatoma cells overcomes their resistance to Fas-mediated apoptosis. Journal of Hepatology 36, 385-394. Legallais C., David B. and Doré E. (2001) Bioartificial livers (BAL): current technological aspects and future developments. Journal of Membrane Science 181, 81-95. Lemarsters J. L. (1999) Necrapoptosis and the mitochondrial permeability transition: shared pathways to necrosis and apoptosis. American Journal of Physiology 276, G1-G6. MacEwan D. J. (2002) TNF receptor subtype signalling: Differences and cellular consequences. Cellular Signalling 14, 477-492. Maeda S., Lin K. H., Inagaki H. and Saito T. (1996) Induction of apoptosis in primary cultures of rat hepatocytes by proteases inhibitors. Biochemistry and Molecular Biology International 39 (3), 447-453. Mita E., Hayashi N., Lio S. (1994) Role of Fas ligand in apoptosis induced by hepatitis C virus infection. Biochemical and Biophysical Research Communications 204, 468-474. Miyoshi H., Yanagi K., Fukuda H., and Ohshima N. (1993) Long-term continuous culture of hepatocytes in a packed-bed reactor utilizing porous resin. Biotechnology and Bioengineering 43, 635-644. Nakatani T., Tawaramoto M., Kennedy D.O., Kojma A. and Matsui-Yuasa I. (2000) Apoptosis induced by chelation of intracellular zinc is associated with depletion of cellular reduced glutathione level in rat hepatocytes. Chemico-Biological Interactions 125, 151163. Natori S., Rust C., Stadheim L. M., Srinivasan A., Burgart L. J. and Gores G. J. (2001) Hepatocyte apoptosis is a pathologic feature of human alcoholic hepatitis. Journal of Hepatology 34, 248-253. Natoli G., Ianni A., Costanzo A., De Petrillo G., Ilari I., Chirillo P et al. (1995) Resistance to Fas-mediated apoptosis in human hepatoma cells. Oncogene 11, 1157-1164. Ni R., Tomita Y., Matsuda K., Ichihar A., Ishimura K., Ogasawar J. and Nagata S. (1994) Fas-mediated apoptosis in primary cultured mouse hepatocytes. Experimental Cell Research 215, 332-337.


105

Ogasawara J., Watanabe-Fukunaga R., Adachi M., Matsuzawa A., Kasugai T., Kitamura Y., Itoh N., Suda T. and Nagata S. (1993) Lethal effect of the anti-Fas antibody in mice. Nature 364, 806-809. Ohno Y., Miyajima A., Sunouchi M. (1998) Alternative methods for mechanistic studies in toxicology. Screening of hepatotoxicity of pesticides using freshly isolated and primary cultured hepatocytes and non-liver-derived cells, SIRC cells. Toxicology Letters 102-103, 569-573. Patel T. and Gores G. J. (1995). Apoptosis and Hepatobiliary Disease. Hepatology 21(6), 1725-1741. Rodriguez I., Matsuua K., Khatib J., Reed J. C.,NagataS. And Vassalli. (1996) A bcl-2 transgene expressed in hepatocytes protects mice from fulminant liver destruction but not from rapid death induced by anti-Fas antibody injection. Journal of Experimental Medicine 183, 1031. Rouquet N., Carlier K., Briand P., Wiels J. and Joulin V. (1996) Multiple pathways of Fasinduced apoptosis in primary culture of hepatocytes. Biochemical and Biophysical Research Communications 229, 27-35. Sánchez A., Álvarez A. M., Benito M., Fabregat I. (1996) Apoptosis induced by transforming growth factor-ǃ in foetal hepatocyte primary culture. The Journal of Biological Chemistry 271(13), 7416-7422. Sánchez A., Álvarez A. M., Benito M., Fabregat I. (1997) Cycloheximide prevents apoptosis, reactive oxygen species production, and glutathione depletion induced by transforming growth factor beta in fetal rat hepatocyte in primary culture. Hepatology 26,935-943. Sen C. K. and Packer L. (1996) Antioxidants and redox regulation of gene transcription. FASEB Journal 10, 709-720. Schoemaker M. H., Ros J. E., Homan M., Trautwein C., Liston P., Poelstra K., van Goor H., Jansen P.L.M. and Moshage H. (2002) Cytokine regulation of pro- and anti-apoptotic genes in rat hepatocytes: NF-ǉB-regulated inhibitor of apoptosis protein 2 (cIAP2) prevents apoptosis. Journal of Hepatolgy 36, 742-750. Shima Y., Nakao K., Nakashima T., Kawakami A., Nakata K., Hamasaki K., Kato Y., Eguchi K. and Ishii N. (1999) Hepatology 30, 1215-1222. Simon A. R., Rai U., Fabburg B. L. and Cochran B. H. (1998) Activation of JAK-STAT pathway by reactive oxygen species. American Journal of Physiology 275, C1640-C1652. Takeshi H., Kaplowitz N., Kammimura T., Tsukamoto H., Fernandez-Checa J. C. (1992) Hepatic mitochondrial GSH depletion and progression of experimental alcoholic liver disease in rats. Hepatology 16, 423-428. Tirmenstein M. A., Nicholls-Grzemski F.A., Zhang J.-G and Fariss M. W. (2000) Glutathione depletion and he production of reactive oxygen species in isolated hepatocyte suspension. Chemico-Biological Interactions 127, 201-217. Van Loo G., Lippens S., Hahne M., Mattijssens F., Declercq W., Saelens X. and Vandenabeele P. (2003) A bcl-2transgene expressed in hepatocytes does not protect mice from fulminant live destruction induced by Fas ligand. Cytokine 22, 62-70. Wallach D. (1997) Placing death under control. Nature 388,123-126. Whelan J. (2002) Caspase inhibitors for liver disease. Drug Discovery Today 7,444-445. Woo M., Hakem A., Elia A. J., Hakem R., Duncan G. S., Patterson B. J. and Mak T. W. (1999) In vivo evidence that caspase-3 is required for Fas-mediated apoptosis of hepatocytes. The Journal of Immunology 163,4911-4916. Zhang J-G, Tirmenstein M. A., Nicholls-Grzemski F. A. and Fariss M. W. (2001) Mitochondrial electron transport inhibitors cause lipid peroxidation-dependent and independent cell death: protective role of antioxidants.

106


Ziol M., Tepper M., Lohez M., Arcangeli G., Ganne N., Christidis C., Trinchet J-C, Beaugrand M., Guillet J-G. and Guettier C. (2001) Clinical and biological relevance of hepatocyte apoptosis in alcoholic hepatitis. Journal of Hepatology 34, 254-260.

5.

PROGRAMMED CELL DEATH IN PLANTS DURING DEVELOPMENT AND STRESS RESPONSES

S. PANTER AND M. DICKMAN* University of Nebraska-Lincoln, Department of Plant Pathology, 406G Plant Sciences, Lincoln, NE 68583-0722, USA *Corresponding Author: E-mail: [email protected]

1.

Introduction

Apoptosis, also known as programmed cell death (PCD), is the fastest growing field of biomedical research today and is becoming an increasingly active research area in plant biology. PCD plays critical roles in a wide variety of normal physiological processes. In humans and other animals, dysregulation of this natural cell death pathway contributes greatly to diseases characterized by either excessive cell accumulation (cancer, restenosis, autoimmunity) or inappropriate cell death (stroke, myocardial infarction, inflammation, AIDS, Alzheimer’s and other neurodegenerative diseases). In addition, most viruses and intracellular bacteria control the cell death pathway in the host cells they infect, thus linking apoptosis to infectious diseases. As in animals, a programmed type of cell death occurs in plants as part of normal growth and development, including reproduction, seed germination, aerenchyma formation, tracheary element differentiation and senescence (Buckner et al., 1998; Nooden et al., 1998; Fath et al., 2000; Fukuda et al., 2000; Wu and Cheung, 2000; Young and Gallie, 2000). Regulation of cell death pathways also occurs in response to abiotic stimuli (Katsuhara, 1997; Koukalova et al., 1997; Danon and Gallois, 1998; Balk et al., 1999; Stein and Hansen, 1999; Chen et al., 2000; Katsuhara and Shibasaka, 2000; Huh et al., 2001; Pan et al., 2001; Vagchippawala, Li and Dickman, in preparation). Moreover, cell suicide programs are activated, at least in some cases, during pathogen attack in both resistant and susceptible interactions (Levine et al., 1996; Ryerson and Heath, 1996; Wang et al., 1996a; Mittler et al., 1997; Navarre and Wolpert, 1999; Dickman et al., 2001; Curtis and Wolpert, 2002). A key issue concerns the extent to which apoptosis, a specialized form of PCD, occurs in plants. The genes that control programmed cell death are conserved across wide evolutionary distances, defining a core set of biochemical reactions that are regulated in diverse ways by inputs from myriad upstream pathways. These genes encode either anti-apoptotic or pro-apoptotic proteins, which do battle with each other in making cell life-death decisions. Ectopic overexpression of certain types of 107 M. Al-Rubeai and M. Fussenegger (eds.), Cell Engineering, Vol. 4, 107-152. © 2004 Kluwer Academic Publishers. Printed in the Netherlands.

108

S. PANTER and M. DICKMAN

anti-apoptotic genes can render animal cells markedly resistant to a wide range of cell death stimuli, including nutrient deprivation, irradiation, cytotoxic chemicals, and hypoxia (Gazitt et al., 1998; Marcelli et al., 2000; Li et al., 2001 and many others). Conceivably, enormous opportunities exist for using animal models of programmed cell death to dissect cell death pathways in plants leading to a mechanistic understanding of the regulation of plant cell death, an area that is not well understood and is of fundamental importance for plant biology. In addition, regulation of cell life/death pathways in plants can be used in an applied manner to enhance protection of crops against common plant pathogens, extending postharvest shelf-life of vegetables, fruits, and flowers, and for generating plants that can better survive adverse climates. However, to date, no endogenous plant genes have been identified that share sequence homology with the apoptosis genes of animal cells or that function in analogous fashion as cytoprotectors or killers. The recent completion of the sequence of the Arabidopsis genome is consistent with this observation. In this chapter we consider plant programmed cell death in the context of animal apoptosis and describe developmental and pathological situations in plants that are modulated by PCD. Finally we descirbe approaches and strategies to identify plant genes that regulate the PCD process in plants 1.1

PROGRAMMED CELL DEATH IN ANIMALS

In mammalian species, at least two major pathways for caspase activation have been defined in detail, sometimes referred to as the “extrinsic” and “intrinsic” pathways by analogy to the coagulation cascade. Though capable of operating independently, the lines of distinction between these pathways can be obscured by cross-talk. The prototypical activators of the extrinsic pathway are members of the Tumor Necrosis Factor (TNF) family of death receptors. Upon activation, a receptor complex is then formed containing pro-caspase 8, which is recruited via specialized adaptor proteins that interact with the large N-terminal prodomain of this caspase. Associations between adaptor proteins, caspases and the TNF-family receptors are characteristically mediated by homotypic interactions among domains known as the death domains (DDs), and death effector domains (DEDs) (Ashkenazi and Dixit, 1998). Multiple endogenous and exogenous suppressors of the extrinsic pathway for caspase activation have been identified in mammals. For example, DED-containing proteins such as FLIP, BAR, and Bap31 compete for binding to the DED-containing caspases (Caspases-8 and 10, in humans). Similarly, the genomes of some animal viruses encode DED-containing suppressors of Fas/TNF-family death receptor signaling (Roulston et al., 1999). Some viruses also produce inhibitors of Caspase8, such as the CrmA protein of poxviruses (Zhou et al., 1997). Recent evidence suggests the existence of a primitive pathway for cell death induction that centers on mitochondria, and which is sometimes referred to as the “intrinsic pathway”. Hints of such a pathway first materialized when cell-free

APOPTOSIS AND PLANT DISEASE

109

systems for reconstituting apoptosis-like destruction of isolated nuclei using extracts from Xenopus eggs revealed a requirement for mitochondria (Newmeyer et al., 1994). Later, it was shown that mitochondria release cytochrome c during apoptosis, with cytosolic cytochrome c activating caspase-family cell death proteases by binding and activating the CED-4 homologue, Apaf-1; apoptotic protease activating factor-1 (Reed, 1997). Mammalian Apaf-1 and C.elegans CED-4 activate procaspases in a similar manner, involving oligomerization of these caspaseactivating proteins via a conserved nucleotide-binding domain. Apaf-1 and CED-4 contain so-called Caspase-Activation Recruitment Domains (CARDs) that interact with corresponding CARDs in the N-terminal prodomains of the caspase with which they associate (Strasser et. al., 2000). Interestingly, a number of plant pathogenresistance genes that function in defenses against bacteria (e.g. RPS2), fungi (e.g. RPP5), and viruses (e.g. N) have sequence similarity to the nucleotide-binding domain of CED-4/Apaf-1 family proteins (Van der Biezen and Jones, 1998). It is tempting therefore to speculate that plant "R" genes may function in a similar manner as Apaf-1 where in animals, Apaf-1 serves as an adaptor molecule recruiting apoptotic factors, forming a high molecular weight oligomer which triggers the apoptotic pathway (via caspase activation). Consistent with this idea are recent reports where, in fact, such higher order R gene complexes have been found (Rivas et al., 2002a, b). However, it remains to be determined whether these complexes in plants participate in protease activation, versus other types of signaling events, such as activation of protein kinases, lipases or other enzymes. The “intrinsic” pathway can be triggered by numerous stimuli, including growth factor withdrawal, oxidative stress, and DNA damage. In mammalian cells, all of these stimuli induce mitochondria to release cytochrome c and other proteins, normally sequestered in the space between the inner and outer membranes of these organelles (reviewed in Hengartner, 2000). When introduced into the cytosol, cytochrome c binding to Apaf-1 results in dATP-dependent fomation of the “apoptosome” comprised of cytochrome C, Apaf-1 and procaspase 9. When this large order oligomeric complex forms, proteolytic processing and activation of caspase 9 occurs. Caspase-9 then activates downstream caspases, ultimately resulting in the execution the cell (Adams and Cory, 2002). While mitochondria have been a mainstream component of cell death research, it has recently been suggested that they may not be primary mediators of the PCD pathway (at least in some cases), but rather serve as an amplifier to enhance the commitment of the cell to die (Marsden et al., 2002) In addition to cytochrome c, several other proteins are released from mitochondria during apoptosis. Some of these enforce caspase-dependent cell death, such as the IAP-antagonists Smac and Omi (HtrA2), which are normally sequestered in mitochondria (Du et al., 2000; Martins, 2002). When released into the cytosol, Smac and Omi bind IAPs, thus taking the breaks off the caspase protease cascade. However, other proteins released from mitochondria kill through caspase-

110


independent mechanisms. For example, AIF (apoptosis inducing factor), which has homology to bacterial oxidereductases, translocates directly to the nucleus where it induces DNA fragmentation (Daugas et al., 2000). Similarly, Endonuclease G, is a mitochondrial nuclease, that like AIF translocates to the nucleus during the induction of apoptosis (Wang et al., 2002). Once released, Endo G cleaves nuclear DNA into nucleosomal fragments in a caspase-independent manner. Also, it should be noted that the loss of cytochrome c from mitochondria has other dire consequences, besides triggering caspase activation through Apaf-1, particularly interrupting electron chain transport. Without cytochrome c to transfer electrons from complex III to complex IV of the respiratory chain, oxidative phosphorylation ceases and ATP supplies may dwindle. Also, interruption of electron chain-transport causes generation of reactive oxygen species (ROS) and other types of free radicals, which can directly damage proteins, lipid membranes, and other macromolecules. Thus, events leading to perturbations in the permeability of mitochondrial membranes can precipitate either caspase-dependent (apoptotic) or caspaseindependent (non-apoptotic) cell death. 1.2

PROGRAMMED DEATH OF PLANT CELLS

Programmed cell death plays a normal physiological role in many plant processes including: (a) deletion of cells with temporary functions such as the aleurone cells in seeds (Fath et al., 2000) and the suspensory cells in embryos (Buckner et al., 1998); (b) removal of unwanted cells, such as the root cap cells found in the tips of elongating plant roots (Wang et al., 1996a), and the stamen primordia cells in unisexual flowers (Dellaporta and Calderon-Urrea, 1993); (c) deletion of cells during sculpting of the plant body and formation of leaf lobes and perforations; (d) death of cells during plant specialization, such as the death of tracheary element (TE) cells (Fukuda, 2000); and (e) leaf senescence (Nooden et al., 1998). Though the biochemical mechanisms responsible for cell suicide in plants are largely unknown, reports indicate similarities to the programmed cell death of animals. Plant PCD is an active, genertically-directed process requiring gene expression. The morphological characteristics of plant cells undergoing PCD also bear striking similarities to apoptosis in animals, though the presence of a cell wall around plant cells imposes certain differences. Akin to animal cells, PCD in plants is associated with internucleosomal DNA fragmentation (DNA ladders) and the activation of proteases (e.g. Ryerson and Heath, 1996; Navarre and Wolpert, 1999; Stein and Hanson, 1999; Solomon et al., 1999). Cell shrinkage, chromatin condensation, DNA fragmentation, internucleosomal DNA cleavage and the formation of structures that resemble apoptotic bodies have been reported in plants during cell death from a number of biotic, abiotic and developmenntal stimuli including chemical treatments (Levine et al., 1996; O'Brien


111

et al., 1998), anther development (Wang et al., 1999), pathogen resistance (Ryerson and Heath, 1996; Wang et al., 1996a; Katsuhara, 1997; Mittler et al., 1997; Orzaez and Granell 1997; Wang et al., 1999; Mlejnek and Prochazka, 2001) and disease development (Wang et al., 1996a; Wang et al., 1999; Dickman et al., 2001). Although the absence of motile scavenging cells in plants mean that phagocytosis is unlikely, structures resembling apoptotic bodies have been observed in plant cells treated with fungal toxins (Wang et al., 1996a; Li and Dickman, in preparation). Pharmacological studies and analyses of transgenic plants expressing caspase inhibitors have also suggested that caspase-like proteins are involved in plant cell death (Del Pozo and Lamb, 1998; De Jong et al., 2000; Mlejnek and Prochazka, 2001; Richael et al., 2001; Elbaz et al., 2002; Lincoln et al., 2002). It should be noted, however, that PCD processes in plants do not always exhibit these hallmark characteristics (Heath, 1998), which is similar to what has been observed in animals. In contrast to apoptosis, necrosis is accidental or passive death of cells caused by a loss of cell integrity and compartmentalization of organelles and is characterised by the cell swelling and disruption of membranes often following a metabolic insult. Table 1 compares and contrasts these two types of cell death. However, the distinction between necrosis and apoptosis is often subtle. In addition, the same treatment or stimulus can trigger either process depending on concentration type or r the innate tolerance of plant cells to a given level of stress. For example, 8 mM hydrogen peroxide (H2O2) induced apoptotic-like PCD in soybean cells, but 100 mM H2O2 caused much more rapid necrotic death, with different ultrastructural changes (Levine et al., 1996). Ozone-sensitive poplar genotypes with defective stress-responsive signaling pathways displayed necrotic cell death at ozone concentrations that induced PCD in the wildtype (Koch et al., 2000). Hence, PCD in plants that exhibit tolerance to abiotic stress, but not necrosis in sensitive plants, might be part of a signaling cascade that activates protective responses, such as the production of antioxidant enzymes. Table 1. A comparison of apoptosis and necrosis

Apoptosis chromatin condensation cell shrinkage preservation of organelles and cell membranes rapid engulfment, no inflammation DNA fragmentation intentional

1.3

Necrosis nuclear swelling cell swelling disruption or organelles and cell membranes inflammatory response DNA degradation accidental

UNIQUE FEATURES OF PCD IN PLANTS

Plant cells differ from animal cells in many ways, including totipotency and the presence of cell walls, chloroplasts and vacuoles. Primary metabolism also differs

112


between animal and plant cells, for example in the chloroplasts, where photosynthetic carbon fixation occurs, and in the vacuoles which contain degradative enzymes that operate at low pH. Plant mitochondria contain a rotenoneresistant NAD(P)H dehydrogenase and a cyanide-resistant alternative oxidase in their respiratory electron transport chain. Developmental changes and stress responses in plants are regulated by small organic molecules; plant hormones, which include: salicylic acid, gibberellic acid, abscisic acid, jasmonic acid, ethylene, cytokinins, auxins, and brassinosteroids (Raven et al., 1976; Vernooij et al., 1994; Salchert et al., 1998; Turner et al., 2002). Many of the unique features of plant growth and development as well as stress responses have been linked to the regulation of PCD. Although generally unknown, plant mediators and/or markers of PCD are of significant interest and are being investigated using a range of approaches including functional screens in heterologous systems, microarrays, proteomics and biochemical methods.

2.

PCD and responses to biotic stress

2.1

PCD AND DISEASE DEVELOPMENT

Necrotrophic pathogens by definition obtain nutrients from dead plant tissue. The distinction between necrotrophs and saprophytes is based on the ability of necrotrophs to kill host tissue to obtain nutrients. Recent studies show that it is simplistic to suggest that these pathogens establish a compatible relationship with host plants by directly killing plant tissue via secreted lytic enzymes or toxins. Indeed, accumulating evidence suggests that necrotrophic pathogens induce PCD in plants, and possibly also suppress disease resistance responses (Wolpert et al., 2002). An emerging paradigm indicates that the pathogen modulates or co-opts plant signalling pathways thereby inducing the plant to actively participate in its own destruction (Dickamn et al., 2001; Wolpert et al., 2002). Pathogenic bacteria in the genera Pseudomonas and Xanthomonas are facultative biotrophs with a necrotrophic stage in their lifestyle that is triggered when bacteria multiply to a threshold population at an infection site, a phenomenon known as 'quorum signaling' (Huguet, 2000). The necrotrophic phase is associated with the induced production of bacterial effector molecules and the formation of watery, necrotic lesions on infected leaves. Bacterial avirulence proteins that trigger an HR in resistant plants are likely to promote, and in some cases have been shown to facilitate pathogenesis and the suppression of plant defenses in susceptible plants (Chang et al., 2000; Abramovitch et al., 2003; Alfano and Dickman, in preperation). The AvrPtoB effector protein of P. syringae pv tomato is conserved among a number of bacterial plant pathogens, and was identified by a yeast two-hybrid screen with Pto as a bait (Guttman et al., 2002; Jackson et al., 2002; Kim et al., 2002d).


113

AvrPtoB elicits a HR in Pto-containing tomato plants (Kim et al., 2002d). However, AvrPto suppresses cell death in wild tobacco (Nicotiana benthamiana) plants caused by the transient expression of Bax or the coexpression of AvrPto and Pto, as well as Avr9 and Cf9. AvrPtoB also inhibits H2O2-induced PCD in yeast cells (Abramovitch et al., 2003). Hence, AvrPtoB represents a novel class of bacterial effector proteins that can suppress PCD in a trans –kingdom manner and PCD associated with disease resistance. There is also evidence that bacterial plant pathogens may induce PCD in plant cells to support the necrotrophic phase of their lifestyle. A range of caspaseinhibiting peptides reduced the severity of chlorotic and necrotic disease symptoms and bacterial proliferation in planta when coinfiltrated with Pseudomonas or Xanthomonas bacteria into the leaves of susceptible host plants (Richael et al., 2001). These results suggest that this class of bacterial plant pathogens triggers PCD in plant cells to exploit their host, possibly through the activation of caspase-like proteases, although the specificity of caspase inhibitors in plants is unknown. Studies of plant hormone mutants also suggest that Pseuomonads and Xanthomonads can manipulate plant signaling to increase damage to host tissue, including PCD (Feys et al., 1994; Lund et al., 1998; Kloek et al, 2001; O'Donnell et al., 2001; O'Donnell et al., 2003). Alternaria alternata f. sp. lycopersici and Fusarium moniliforme are important fungal pathogens that kill plant cells, at least in part, by secreting toxins. These toxins are sphinganine analogues and inhibit ceramide synthase, although whether this inhibition is causal for disease is not clear as these toxins have multiple target site specificities (Jones et al 2001; Brandwagt et al., 2000; Spassieva et al., 2002). Susceptibility or resistance of tomato plants correlates with their response to AAL toxins produced by the pathogen (Siler and Gilchrist, 1983; Clouse and Gilchrist, 1986). F. moniliforme, causes stalk and ear rot in maize, and produces the fumonisins, which are structurally related to AAL toxins. The most potent lipidbased toxins produced by the two fungi, TA and Fumonisin B1 (FB1) have been purified and characterised as compounds inducing apoptotis in plants and animal cells (Wang et al., 1996a, b). FB1 has been demonstrated to induce DNA laddering, TUNEL-positive nuclei and the formation of apoptotic bodies in animal and plant cells (Wang et al., 1996a, b). Changes that resemble apoptosis have also been seen in susceptible tomato cells treated with FB1 or TA (Wang et al., 1996a). Two Arabidopsis mutants insensitive to FB1 were also found to be resistant to a virulent strain of P. syringae (Stone et al., 2000). The genes responsible for this phenotype are likely to encode mutations in a cell death signaling pathway that is triggered by disruption of cellular homeostasis and exploited by some necrotrophic pathogens. FB1 may induce apoptosis-like cell death in plants and apoptosis in animal cells by the same mechanism, even if specific components of the pathway differ.

114


Cochliobolus victoriae is a necrotrophic fungus that causes victoria blight of oats and secretes victorin, a host-selective effector molecule that induces PCD in plants carrying the dominant Vb susceptibility gene (Rines and Luke, 1985; Mayama et al., 1995). Ironically, the Vb allele is genetically inseperable from gene-for-gene resistance to crown rust (Puccinia coronata), a biotroph, suggesting that the same gene may be conditioning susceptibility AND resistance depending on pathogen lifestyle. DNA laddering was seen in susceptible leaves three hours after victorin treatment and cell death was inhibited by zinc ions, which may modulate the activity of survival-promoting zinc-binding regulatory proteins in both animals and plants (Dietrich et al., 1997; Inukai et al., 1999; Navarre and Wolpert, 1999; He and Ting, 2002; Inoue et al., 2002). Like apoptosis, victorin-induced cell death was dependent on the importation of calcium ions by cells (Navarre and Wolpert, 1999) and victorin treatment of oat cells caused the collapse of mitochondrial membrane potential, an indicator of the mitochondrial permeability transition (MPT: Curtis and Wolpert, 2002). Victorin was able to bind to the P subunit of glycine decarboxylase, an enzyme of the mitochondrial matrix, from both susceptible and resistant plants 'in vitro' (Wolpert et al., 1994; Curtis and Wolpert, 2002). However, this target was accessible in only in susceptible plants or in disrupted mitochondria, suggesting that this binding event is downstream of the MPT and its direct involvement in the death of plant cells is questionable (Wolpert et al., 1994; Curtis and Wolpert, 2002). It is possible that an interaction between victorin and the product of the Vb allele causes dysregulation of cell homeostasis causing an MPT and uncontrolled PCD, all to the advantage of C. victoriae. Studies of victorin and other effector molecules from necrotrophic pathogens, such as sphinganine analog mycotoxins, are challenging the concept that toxins simply kill plant cells. Rather, the emerging paradigm is that these molecules subvert the plant cell into triggering its own destruction by altering signaling pathways. Infection of tobacco leaves with Sclerotinia sclerotiorum has been shown to induce genomic DNA laddering and the production of TUNEL-positive nuclei (Dickman et al., 2001). Oxalic acid has emerged as an important pathogenicity factor for S. sclerotiorum (Godoy et al., 1989; Cessna et al., 2000). A nonpathogenic isolate of S. sclerotiorum deficient in oxalic acid production, but not the virulent wildtype, generated an oxidative burst in tobacco, suggesting that oxalate inhibits inducible plant defenses (Cessna et al., 2000). However, oxalic acid is also toxic to plant cells and its acidity may cause the apoptotic-like PCD seen in plant tissues infected by S. sclerotiorum. 2.2

THE HYPERSENSITIVE RESPONSE

Many plants have a type of innate immunity that depends on the presence of a resistance gene in the plant and an avirulence gene in the pathogen, known as the gene-for-gene interaction (Flor, 1971). Recognition of a pathogen is commonly


115

followed by a biphasic production of reactive oxygen species, synthesis of defense molecules and the rapid death of plant cells at sites of infection, termed the hypersensitive response (HR), a type of programmed cell death. The HR is believed to limit pathogen growth in the plant, thus serving as a resistant response in genefor-gene type interactions, although controversy exists over whether it is actually causal for defense or just a consequence of resistance response (Yu et al., 1998). Bacterial avirulence (Avr) gene products include numerous effectors of pathogenicity, which are injected into plant cells by type III bacterial secretion systems (eg: Kearney and Staskawicz, 1990; Ronald et al., 1992; Innes et al., 1993; Ritter and Dangl, 1995). Many resistance (R) gene products have conserved structures, but respond to very different pathogens, leading to the idea that specific recognition of Avr proteins, by R proteins, triggers a common signaling cascade culminating in PCD (Staskawicz et al., 1995). However, recent biochemical studies suggest that this model may be too simplistic (Kooman-Gersmann et al., 1996; Ji et al., 1998; Dixon et al., 2000; Leister and Katagiri, 2000; Luderer et al., 2001; Mackey et al., 2002; Mackey et al., 2003). These studies and others support the “guard hypothesis”, which proposes that Avr proteins target and inactivate regulators of nonspecific disease resistance in susceptible plants in order to facilitate infection (Dangl and Jones, 2001). In resistant plants, R proteins are thought to act as 'guards' by recognising complexes between these regulators and Avr proteins, and rapidly triggering plant defense. As summarised by Greenberg (1997), the HR of plant cells in response to bacteria or bacterial elicitors requires 'de-novo' protein synthesis (as in many forms of animal PCD). These findings suggest that the HR is an active gene-directed process. Other similarities between the HR and apoptosis have been identified. For example, Ryerson and Heath (1996) observed DNA laddering and TUNEL-positive nuclei in leaves of cowpea during the HR in response to fungal infection. Tobacco plants with gene-for-gene resistance to tobacco mosaic virus produced an HR that correlated with the appearance of TUNEL-positive nuclei, cell shrinkage, cleavage of nuclear DNA to 50 kb fragments and sequential disruption of the vacuolar and plasma membranes (Mittler et al., 1997). Nuclear DNA fragmentation was also seen in response to bacteria capable of inducing an HR (Mittler et al., 1997). The inhibition of the HR, in response to bacteria and a virus, by caspase inhibitors is another link between the gene-for-gene disease resistance and apoptosis, although the specificity of caspase inhibitors in plants is uncertain (Del Pozo and Lam, 1998; Del Pozo and Lam, 2003). Hence, there are many similarities between plantpathogen interactions involving and HR and apoptosis.

3.

PCD and abiotic stress

Abiotic stress caused by heat, cold, drought and salinity has been recognised as important limitations for crop growth, worldwide (Boyer, 1982). For example,

116


approximately 1500 million hectares of non-irrigated cropland are affected by increasing soil salinity (FAO, 2003, http://www.iaea.or.at/programmes/nafa/d1/crp/d1_2008.html). Unpredictable variation in rainfall is a particular problem for staple crop productivity in Africa and West Asia) as well as many other parts of the world, as over 100 million people are affected by drought (DePauw, 2003, http://www.earthscape.org/p1/wid03/wid03f.pdf). Hence, the breeding or engineering of plants with increased tolerance to abiotic stress is an important research area. 3.1

COLD AND HEAT SHOCK

Exposure of plant cell cultures and whole plants to cold or heat stress has been shown to induce apoptotic-like cell death. For example, tobacco cell cultures grown at 5oC, resulted in a loss of viability relative to control cells and exhibited DNA laddering (Koukalova et al., 1997). Exposure of a similar culture to temperatures of between 44 oC and 48oC resulted in cell death that also correlated with apoptotic-like changes, including: chromatin condensation, DNA fragmentation, DNA laddering, activation of caspase-like proteases and cleavage of plant homologues of poly ADPRibose Polymerase (PARP) and nuclear lamins (Chen et al., 2000; Tian et al., 2000). Heat-shock treatment of dark-grown cucumber cotyledons (55oC) resulted in the translocation of cytochrome c from the mitochondrion to the cytosol, genomic DNA laddering and cell death (Balk et al., 1999). A similar lethal heat-treatment induced chromatin condensation, TUNEL-positive nuclei and DNA laddering in suspension-cultured tobacco cells, and DNA laddering in tobacco seedlings (Li and Dickman, manuscript in preparation). These data suggest that plant cells can undergo apoptotic-like PCD after lethal heat and cold shock treatments. 3.2

SALT STRESS

Application of a high concentration (500 mM) of sodium chloride (NaCl) to the roots of hydroponically-grown barley plants resulted in an increase in the number of TUNEL-positive nuclei followed by the appearance of genomic DNA laddering (Katsuhara, 1997). When the roots of Bobwhite wheat seedlings were exposed to 350 mM NaCl, which caused death of the shoot, DNA laddering and TUNELpositive nuclei were seen in root sections (Vagchippawala and Dickman, manuscript in preparation). The presence of 200 mM NaCl in Arabidopsis growth media resulted in DNA laddering, the appearance of TUNEL-positive nuclei and the death of the taproot root (Huh et al., 2001). On the basis of these and other observations (Katsuhara and Shibasaka, 2000), it has been suggested that selective PCD within the root system is an adaptative response to salt stress. Low concentrations of an aluminium salt (0.1-1 mM) at low pH (3.5) inhibited root growth in hydroponically-


117

grown barley and induced genomic DNA laddering and loss of viability (Pan et al., 2001). This cell death process was characterised by the generation of ROS, between 3 and 12 hours after the start of the salt stress treatment. The authors suggested that higher concentrations of the aluminium salt (10-50 mM) caused necrosis, characterised by loss of viability in root cells but no oxidative burst, although classic features of necrosis, such as cell swelling and early disruption of organelles, were not discussed (Pan et al., 2001). These findings suggest that as in the cases of heat and cold shock, plant cells respond to salt stress with apoptotic-like PCD. Damage to plants caused by salt stress is thought to result from osmotic stress and the interference of excessive sodium ions with the biochemistry of the cell. Overexpression of a Na+/H+ antiporter in Arabidopsis plants results in the sequestration of sodium ions in the vacuole and appears to be important for salt tolerance, suggesting a potential strategy for engineering salt tolerance into crops (Apse et al., 1999). Alternatively, the inhibition of programmed cell death associated with salt stress by expressing conserved negative regulators of PCD may also be a useful approach, as discussed in section 7.2. 3.3

OTHER STRESS TREATMENTS

Ultraviolet radiation, pharmacological agents that disrupt cellular homeostasis, and culturing of cells at a low density in liquid medium have also induced apoptoticlike death in plant cells. Treatment of Arabidopsis protoplasts with UV-C radiation resulted in the appearance of TUNEL-positive nuclei within 6 hours of treatment, DNA laddering 6-24 hours after treatment, and the appearance of cells with nuclear fragments at the cell periphery (Danon and Gallois, 1998). When maize seedlings were transferred to tissue culture medium containing 40-160 mM D-mannose, root growth was inhibited, and genomic DNA laddering and the leakage of cytochrome c from mitochondria were observed (Stein and Hansen, 1999). Apoptotic death is considered to be the default pathway in animals. In other words if cell death is not actively suppressed, death occurs (Raff, 1992). Cultured plant cells also undergo programmed death by default unless they are kept alive by growth factors dependent on a critical density of plant cells (McCabe et al., 1997). Mechanisms underlying PCD caused by abiotic stress are not understood and it is unclear whether this death is adaptive or is the result of cellular homeostasis being disrupted beyond the threshold of no return. In the case of salt stress, selective death of parts of the root system might limit the rate of salt uptake. Adaptive reasons for PCD in response to heat, cold or ozone stress are less clear, although it could be part of a signaling cascade that leads to the production of cytoprotective molecules; thus sacrificing a few cells for the benefit of the whole

118 4.

S. PANTER and M. DICKMAN PCD during plant development

PCD has been studied at many stages of plant development, including: seed maturation and germination, root growth, formation of the vascular system, floral organ development and leaf senescence (Mittler and Lam, 1995; Wang et al., 1996a; Chen and Foolad, 1997; Fukuda, 1997; Groover et al., 1997; Orzaez and Granell, 1997; Young et al., 1997; Nooden et al., 1998; Groover et al., 1999; Young and Gallie, 1999; Schmid et al., 1999; Fath et al., 2000; Fukuda, 2000; Wu and Cheung, 2000; Dominguez et al., 2001; Gunawardena et al., 2001; Filonova et al., 2002). Some examples of developmentally-controlled PCD in plants are similar to apoptosis but others resemble autolysis or necrotic cell death (Fukuda, 1997). 4.1

PLANT REPRODUCTION

Sexual reproduction of plants involves specialised structures (Figure 1) that mediate the development of sperm and egg cells, their fusion to form the embryo and later, the seed (Raven et al., 1976). Most flowering plants bear male and female structures on the same flower, but in some species (eg: maize), either the male or the female parts of each flower are selectively aborted early in development (Dellaporta and Calderon-Urrea, 1993). Each lobe of an anther, the structure enclosing the male gametes, contains microspore mother cells that eventually differentiate into sterile tapetum cells, stomium cells and pollen grains that encapsulate sperm cells. The two classes of sterile cells undergo PCD in order to nourish, coat and release the pollen grains (Raven et al., 1976; reviewed by Wu and Cheung, 2000). Death of the tapetal cells coats the surface of pollen grains with a compound that allows its survival outside the plant. Stomial cell death allows splitting of the anthers and release of the pollen. In the ovary, female reproductive cells originate from the nucellus, from which an outer layer and a megaspore mother cell differentiate. The remaining cells within the nucellus undergo PCD, presumably to nourish the developing female gametes (Chen and Foolad, 1997). The megaspore mother cell divides meiotically into a tetrad of haploid cells, three of which undergo PCD. The remaining cell undergoes extra mitotic divisions to form the embryo sac containing the egg cell and other cells including polar cells, that do not develop into zygotes but undergo PCD, either during fertilisation or seed development. Successful pollination results in the fusion of sperm cells with polar nuclei and an egg cell, resulting in the formation of endosperm and zygotic tissues, respectively. The zygote then differentiates into embryonic tissue and suspensory cells, which undergo PCD to support the early growth of the embryo. In cereals, the endosperm cells undergo PCD before seed germination and remain as cell corpses that store nutrients (Fath et al., 2000). Seed germination triggers rapid synthesis of lytic enzymes in the adjacent aleurone cells. Programmed death of aleurone cells


119

releases these enzymes into the endosperm (Fath et al., 2000) allowing the availability of stored nutrients to the embryo. In dicotyledonous plants, the cotyledons are believed to replace endosperm in supplying young seedlings with stored nutrients.

Figure 1. Plant reproductive tissues exhibiting programmed cell death. Cross-sections of: an anther showing four locules (A), the zygote and endosperm soon after fertilisation (B) and a cereal grain (C). Cells in the tapetal and stomial tissues, the suspensor, the endosperm and the aleurone undergo developmentally-controlled PCD. Adapted from Raven et al., 1976, Wu and Cheung, 2000 and Fath et al., 2000.

Cotyledon senescence supplies the seedlings with nutrients during early development and in castor bean, PCD in cotyledons is facilitated by the rupture of endoplasmic reticulum-derived lytic vesicles known as ricinosomes (Schmid et al., 1999). Hence, there is a close connection between PCD and nutrient transport during seed germination and during leaf senescence. Analyses of mutant plants, coupled with biochemical and molecular studies, suggest that cell death during plant reproduction and seed germination is genetically programmed and share features with apoptosis. DNA laddering has been correlated with the programmed death of wheat nucellus (Dominguez et al., 2001), maize and wheat endosperm (Young et al., 1997; Young and Gallie, 1999), and barley aleurone (Wang et al., 1996c). DNA fragmentation has been observed by the TUNEL assay in barley aleurone cells (Wang et al., 1996c) and in a gymnosperm, where selection

120


of one dominant embryo and PCD of subordinate embryos precedes seed formation (Filonova et al., 2002). In contrast, programmed death of aleurone cells did not exhibit morphological and molecular markers of apoptosis (Bethke et al., 1999; Fath et al., 2000). Rather, cell death correlated with nuclease activity that did not result in laddering, loss of plasma membrane integrity and autolysis of cells by vacuolisation. These studies suggest that cell death during plant reproduction is programmed, although death is autolytic, rather than apoptosis-like, in the case of aleurone cells. 4.2

ROOT DEVELOPMENT

Plant roots anchor the plant and acquire water and minerals from the soil. The shoot, provides fixed carbon through photosynthesis. The root and shoot apices contain undifferentiated, actively-dividing cells that give rise to specialised plant tissues. Cells at the root apex differentiate into root tissue on the side nearest the shoot and root cap cells on the other side (Raven et al., 1976). Root cap cells are continually regenerated and accumulate a highly hydrated polysaccharide before bursting open and releasing this lubricant that facilitates root progression through the soil. TUNEL microscopy has shown that rupture of cells at the surface of the onion root cap involves genomic DNA fragmentation and the formation of vesicles that resemble apoptotic bodies and contain degraded DNA (Wang et al., 1996a) Plants can adapt to waterlogged soil or flooding by forming aerenchyma, or connected intercellular spaces that facilitate gas diffusion through root tissue (Armstrong, 1979). In some species, including maize and rice, aerenchyma cells are formed by programmed death of a limited number of cells within roots. In maize roots, aerenchyma formation can be induced by anoxia and has some apoptotic-like characteristics: chromatin condensation, DNA fragmentation and the appearance of apoptotic body-like structures (Gunawardena et al., 2001). However, in contrast to apoptosis, transmission electron microscopy showed that plasma membrane invagination, cell shrinkage, and cytoplasmic changes all preceded chromatin condensation (Gunawardena et al., 2001). This suggests that in addition to the continuum between apoptotic-like and necrotic cell death, the chronological sequence of PCD-related events may vary in plants. 4.3

TRACHEARY ELEMENT DIFFERENTIATION

Higher plants have specialised vascular tissues for the transport of water, minerals, carbon compounds and signaling molecules (Raven et al., 1976). Phloem consists of interconnected living cells by which carbon compounds are actively transported from sources, principally mature leaves, to sinks, including meristems and reproductive organs. In contrast, xylem vessels are tubes of interconnected dead cells, called tracheary elements (TEs), that allow the transport of water and mineral salts throughout the plant in a process driven by the evaporation of water from pores


121

of leaves. Cultured Zinnia mesophyll cells have been extensively used as a model system for studying the formation of TEs from mesophyll cells by PCD (Fukuda and Komamine 1980a, Fukuda and Komamine 1980b). Zinnia mesophyll cells can be induced to differentiate in vitro into TEs by manipulating plant hormone concentrations and have been used to define stages in this cell death developmental process (reviewed Fukuda, 1997; Fukuda, 2000). Initially, the synthesis of lytic enzymes, including nucleases and proteases, is induced followed by the thickening of cell walls, which eventually become the walls of TEs (Minami and Fukuda, 1995; Ye and Varner, 1996; Beers and Freeman, 1997). Autophagic vacuoles degrade much of the cytoplasm, apart from the nucleus and chloroplasts, during secondary wall formation. Next, the central vacuole collapses, leading to the rapid degradation of nuclear DNA (Obara et al., 2001) and the lysis of remaining cell material, leaving only the rigid cell walls in place (Groover et al., 1997). Changes in cytosolic calcium ion concentration and extracellular serine protease activity, but not a burst of reactive oxygen species production, have been implicated in vacuole collapse (Groover et al., 1999). Expression of stage-specific genes during TE formation has also been observed in other plants (Runeberg-Roos and Saarma, 1998; Funk et al., 2002) and genomic DNA fragmentation during TE formation has also been seen in pea roots (Mittler and Lam, 1995). The tightly ordered series of events that culminate in Zinnia TE formation indicate that a PCD is involved, although the destruction of much of the cytoplasm before nuclear degradation suggests that the process is more similar to autolysis than to apoptosis. 4.4

SENESCENCE

Senescence is the culmination of development for a number of plant organs, including leaves, flowers and fruit. Cell death during senescence allows the recycling of nutrients from leaves that are no longer needed for carbon fixation via photosynthesis (reviewed in Quirino et al., 2000). Senescence can be induced by leaf age, biotic or abiotic stress, darkness or treatment with plant hormones. Nutrients recovered from senescent leaves, including nitrogen, phosphorus, amino acids and metal ions, can be diverted to other plant tissues, including reproductive organs. The steps in leaf senescence include the induced production of lytic enzymes and transcriptional activation of other 'senescence associated genes', degradation of chloroplasts and photosynthetic proteins, export of nutrients from dying cells and finally, the destruction of nuclei and mitochondria (Nooden et al., 1998). The sequence of events and nutrient-recycling role of leaf senescence indicate that it is programmed, although it is not clear whether this process is apoptotic-like. When pea flowers are emasculated, the female flower parts undergo senescence that is characterised by genomic DNA laddering and the appearance of TUNELpositive nuclei (Orzaez and Granell, 1997). In flower petals, senescence can be triggered by pollination or wounding and in some cases, can be accelerated by

122


treatment with ethylene and abscisic acid (reviewed, Rubenstein, 2000). Generally, flower petal senescence is associated with oxidation of membrane components, generation of reactive oxygen species, changes in production of REDOX-associated proteins and eventually, membrane breakdown and the activation of degradative enzymes. A number of plants have been used to study flower petal senescence, and carnation, daylily, morning glory, petunia, rose and orchid flowers show considerable variation in morphological and biochemical markers of senescence. Generally, there is some evidence that G-protein stimulation, increases in cytosolic calcium levels, inhibition of protein phosphatase activity and stimulation of protein kinase activity are signals that lead to this form of PCD (reviewed Rubenstein, 2000).

5.

Stimuli that induce PCD

5.1

RESISTANCE GENE PRODUCTS

Perception of developmental cues or of changes in cellular homeostasis is likely to be the first step in the initiation of programmed death of plant cells. As mentioned, the HR is mediated by resistance (R) genes during innate immunity. Cell death can also occur spontaneously when some R genes are overexpressed or contain mutations that cause constitutive activation (Rathjen et al., 1999; Hu et al., 1996). R proteins are believed to act as molecular switches that recognise directly or indirectly pathogens or pathogen products (elicitors) and trigger pathways that result in defense responses. R genes have been extensively studied and characterized (Dangl and Jones, 2001). Members of the NBS-LRR class of R proteins are generally predicted to be cytosolic proteins with three domains, although at least one R gene product, RPM1, is attached to the inner leaflet of the plasma membrane (Boyes et al., 1998). R genes have a variable N-terminus with either a coiled-coil structure or homology to the cytosolic portion of the Toll and Interleukin-1 receptors (TIR). Their central Nucleotide-Binding Apaf1-Resistance gene-CED-9 (NB-ARC) domain has homology to the nucleotide-binding domains of Apaf1 and CED-9. The C-terminus is composed of a block of diagnostic leucine-rich repeats (LRRs) (Van der Biezen and Jones, 1998). The NB-ARC domain forms a central ATP-binding and hydrolysis pocket in at least one resistance protein (Tameling et al., 2002). This domain allows the ATP-dependent oligomerisation of Apaf1, leading to the activation of procaspase 9 within the mammalian apoptosome. The role of the NBARC domain in R proteins is not fully understood, although a number of conserved residues associated with nucleotide-binding, are necessary for resistance. The LRR domain is believed to determine resistance specificity by the indirect perception of an avirulence (Avr) protein. Interestingly, human CARD4, an Apaf-1family member, by virtue of its NBS-LRR, is actually more similar to the plant resistance


123

genes “N” in tobaaco (virus) and RPP8 (fungus) in Arabidopsis (Bertin et al., 1999). Like the apoptosome, some R proteins have been found to be part of higher-order oligomeric complexes. For example, Cf-9 and Cf-4 have been found to be subunits of 420 and 400 kDa complexes, respectively (Rivas et al., 2002a; Rivas et al., 2002b) and RPM1 has been immunoprecipitated with RIN4, a protein targeted by bacterial Avr proteins (Mackey et al., 2002, Mackey et al., 2003). Hence, the structural similarity between NBS-LRR R proteins and apoptotic adaptors and the possiblity of functional analogy between the apoptosome and R protein complexes is tantalising. However, signaling partners immediately downstream of R proteins that are involved in the induction of cell death have not yet been identified. 5.2

PERTURBATION OF MITOCHONDRIA AND CHLOROPLASTS

Mitochondria are central to the intrinsic apoptotic pathway, with the release of proapoptotic signaling and effector proteins during apoptosis (Adrain and Martin, 2001; Van Loo et al., 2002). Numerous studies have revealed potential roles for mitochondria and possibly chloroplasts in plant PCD. The mitochondrial electron transport chain and the photosynthetic electron transport chain of chloroplasts are the major sources of reactive oxygen species (ROS) in plant cells, and could be involved in the induction of PCD by oxidative stress. Victorin a host selective toxin of C. victorieae (see section 2.1) is a cyclised pentapeptide that induces a MPT, presumably by an interaction with the product of the Vb susceptibility gene, allowing it to bind to the P subunit of the glycine decarboxylase complex (GDC) of the plant mitochondrial matrix and further disrupt mitochondrial function, resulting in PCD (Wolpert and Macko, 1989; Wolpert et al., 1994; Curtis and Wolpert, 2002; Wolpert et al., 2002). Victorin also induces the cleavage of the large subunit of ribulose biphosphate carboxylase oxygenase (RUBISCO) in chloroplasts (Navarre and Wolpert, 1999). Inhibition of RUBISCO could result in the generation of ROS in chloroplasts. Hence an increased production of ROS in chloroplasts and the accumulation of glycine in mitochondria could contribute to victorin-induced PCD. Alternatively, victorin-induced PCD could involve nitric oxide generation, since a variant of the P subunit is an inducible nitric oxide synthase (Chandok et al., 2003) and combined nitric oxide and hydrogen peroxide production has been linked to cell death during the HR (Delledonne et al., 1998). Plant mitochondria have been found to release cytochrome c (Balk et al., 1999; Saviani et al., 2002; Li, unpublished data) and can undergo a permeability transition (Curtis and Wolpert, 2002) after a range of death-inducing treatments. The correlation of these apoptotic markers with plant PCD may indicate that plant mitochondria, like their animal counterparts, may be involved in pro-death signaling. However, cytochrome c is dispensable in Drosophila, C. elegans and

124


yeast cell death; thus raising questions (and awaited proofs) for functional relevance in plant PCD (Lui et al., 2003). DNA fragmentation has been correlated with potassium cyanide-induced cell death in cowpea leaves (Ryerson and Heath, 1996). Since cyanide inhibits cytochrome C oxidase, the last complex in the mitochondrial electron transport chain, apoptotic-like death might be caused by the generation of reactive oxygen species from a reduced ubiquinone pool. However, plant cells have an alternative oxidase (AOX) coupled to the ubiquinone pool in their mitochondrial electron transfer chain that reduces oxygen to water and could potentially prevent the generation of ROS when cytochrome c oxidase is inhibited (reviewed, Simons and Lambers, 1999). Also, a recent study has suggested that cyanide kills guard cells by a pathway involving protein kinase signaling and cysteine protease activation rather than simply by generating toxic levels of ROS (Samuilov et al., 2002). Hence, the metabolic changes caused in mitochondria by cyanide may induce a PCD pathway that is triggered by loss of homeostasis, although the underlying details remain unclear. The photosynthetic electron transport chain associated with the light-harvesting complexes is a prime source of reactive oxygen species, which could contribute to the induction of PCD. This idea is supported by indirect evidence that chloroplasts are involved in the initiation of PCD. Chloroplast-targeted herbicides,known to induce lethal levels of ROS, including methyl viologen (paraquat), acifluorfen and sulfentrazone were found to induce cell death in tobacco leaves accompanied by DNA fragmentation and TUNEL positive cells suggesting that oxidative damage to chloroplasts can initiate PCD (Chen and Dickman, in preperation). Our laboratory has also found that heat shock induced cell death in tobacco correlates with DNA laddering and is delayed when plants are grown in the dark (Li, unpublished data). Similarly, heat-shock treatment caused light-dependent death of Arabidopsis seedlings (Larkindale and Knight, 2002). Spontaneous cell death caused by some lesion mimic mutations is also light-dependent (Brodersen et al., 2002; Gray et al., 2002). Anecdotally, a number of plant diseases are known to require light. These findings suggest that chloroplasts can contribute to the induction of PCD. After all, chloroplasts are prime sources of reactive oxygen species because of the presence of two electron transport chains associated with photosynthetic light harvesting. Two proteins with chloroplast transit peptide cleavage sites, lls1 and acd1, are modified in lesion mimic mutants of maize and Arabidopsis, respectively (Gray et al., 2002). Both proteins encode aromatic ring hydroxylating dioxygenases and it has been suggested that salicylic acid, an aromatic plant hormone, could be their substrate (Gray et al., 1997). SA is associated with cell death and SA levels are modified in many lesion mimic mutants, so these proteins could be an intriguing link between SA signaling, ROS, chloroplasts and PCD.

APOPTOSIS AND PLANT DISEASE 5.3

125

DISRUPTION OF HOMEOSTASIS

In animals, the mitochondrial apoptotic pathway is triggered after damage is sensed in other parts of the cell, including the nucleus, endoplasmic reticulum and cytoskeleton (Ferri and Kroemer, 2001; Lam et al., 2001). There is also evidence that disruption of cellular homeostasis induces PCD in plant cells. Treatment of sycamore cell cultures with tunicamycin and brefeldin A, which respectively inhibit N-glycosylation in the endoplasmic reticulum and protein trafficking from the Golgi apparatus, resulted in cell death involving DNA laddering (Crosti et al., 2001). As in animals, staurosporine, a general serine/threonine protein kinase inhibitor, induces apoptotic-like cell death (Dickman, unpublished). Some spontaneous cell death mutants have defects in housekeeping proteins involved in chlorophyll metabolism and fatty acid biosynthesis (Hu et al., 1998; Molina et al., 1999; Mou et al., 2000; Mach et al., 2001; Ishikawa et al., 2002). Overexpression of an antagonist of ubiquitin-mediated proteolysis and silencing of proteasome components in tobacco, both caused spontaneous cell death, possibly triggered by the accumulation of aberrant proteins (Bachmair et al., 1990; Kim et al., 2003). Although the programmed nature of cell death was not verified in these plants, cell death caused by the disruption of housekeeping functions supports the idea that disrupted homeostasis can induce PCD in plants.

6.

Early signaling events in the induction of PCD

6.1

PLANT HORMONES

Plant hormones regulate developmentally-controlled and stress-induced PCD, cell division and elongation, fruit development (Raven et al., 1976), resistance to pathogens and insects (Howe et al., 1996; Hunt et al., 1996; Van Wees et al., 1999) and susceptibility to pathogens (Feys et al., 1994; Lund et al., 1998; O'Donnell et al., 2001; O'Donnell et al., 2003), among numerous other phenomena. Plant hormone concentrations are modulated in response to a range of biotic and abiotic stress treatments (Itai, 1999; Moeder et al., 2002) and it is evident from studies of a number of Arabidopsis mutants that proper hormone regulation is necessary for normal growth and development. Plant hormone signaling may link endogenous and exogenous stimuli to the 'core' cell death machinery of plant cells through downstream signaling intermediates. Possible candidates for these intermediates include reactive oxygen species, nitric oxide and MAP kinases. Since the role of plant hormones in cell death has been reviewed recently (Hoeberichts and Woltering, 2003), only key points will be emphasized here. Salicylic acid (SA) accumulation correlates with the induction of plant defense responses and is commonly associated with ROS production and the HR (reviewed

126


Hoeberichts and Woltering, 2003). Inducible SA accumulation is thought to lead to an oxidative burst, which in turn triggers a secondary increase in SA accumulation and the HR. Classically, cell death is necessary for the subsequent activation of broad spectrum resistance throughout the plant, termed systemic acquired resistance (SAR) that protects the plant from secondary infections. The requirement for cell death to trigger SAR, suggests that cell death during the HR is part of a signaling cascade that 'primes' the plant's defenses against further infection as well as allowing the local restriction of a pathogen. The LSD1 transcription factor is thought to be a negative regulator of the positive feedback loop involving SA, since lsd1 mutants of Arabidopsis exhibit spontaneous cell death and also overproduce extracellular superoxide (Jabs et al., 1996). In Arabidopsis leaves infected with an avirulent Pseudomonas syringae strain, the primary oxidative burst and HR was followed by systemic oxidative bursts that resulted in a low frequency of secondary micro-HRs (Alvarez et al., 1998). The requirement for the systemic oxidative bursts and microHRs during the establishment of SAR again suggests that PCD, potentiated by SA, may be part of the defense cascade. However, other studies have shown resistance responses without cell death. The Arabidopsis dnd1 mutant gene does not require an HR gene-for-gene resistance (Yu et al., 1998). Jasmonic acid (JA), which is structurally and possibly functionally analogous to prostaglandins, has been found to inhibit ozone-induced ROS generation and PCD in Arabidopsis and poplar (Orvar et al., 1997; Koch et al., 2000; Overmyer et al., 2000; Rao et al., 2000; Rao et al., 2001). In contrast, JA perception is required for the induction of PCD by fumonisin in Arabidopsis (Asai et al., 2000). Ethylene (the ripening hormone) enhances cell death during the senescence of leaves and floral organs (Orzaez and Granell, 1997; Orzaez et al., 1999; Woo et al., 2001), aerenchyma formation (Drew et al., 1979; Jackson et al., 1985), endosperm development (Young and Gallie, 1999), following treatment of Arabidopsis cells with sphinganine analogue mycotoxins (Asai et al., 2000; Moore et al., 1999) and after infection of plants by Pseudomonas spp. (Lund et al., 1998; O'Donnell et al., 2001; O'Donnell et al., 2003). Hence, ethylene and SA appear to promote PCD in plants, while JA signaling may either promote or inhibit PCD, depending on context. Studies with hormone-defective mutants have shown that a given outcome in the mutant background can vary between plant species. Thus, the phenotype associated with a hormone mutant in one species may not result in the same phenotype as the same same mutation in another. For example, ethylene perception is needed for SA production and therefore, bacterially-induced cell death in tomato plants (O'Donnell et al., 2001). In contrast, ethylene perception is downstream of SA accumulation and surprisingly, suppresses bacterial disease symptoms in Arabidopsis (O'Donnell et al., 2003). These studies demonstrate that caution is needed when making generalisations about hormone signaling based on findings in a single plant species. Although SA, JA and ethylene appear to be the primary hormonal regulators of PCD, it is likely that the balance between these and other plant hormones is crucial


127

for the initiation of PCD. The differentiation of Zinnia tracheary elements in vitro, leaf senescence, and PCD in developing and germinating seeds have been found to be controlled by the balance between at least two plant hormones (El-Antably et al., 1967; Ueda and Kato, 1980; Iwasaki and Shibaoka, 1991; Picton et al., 1993; John et al., 1995; Fukuda, 1997; Yamamoto et al., 1997; Bethke et al., 1999; Young and Gallie, 1999). 6.2

REACTIVE OXYGEN SPECIES, NITRIC OXIDE AND MAP KINASE ACTIVATION

As mentioned, genetically resistant plants produce a biphasic burst of reactive oxygen species, predominantly H2O2, in response to pathogen challenge, whereas susceptible plants produce a single burst (Wojtaszek, 1997). Pharmacological studies and the discovery of plant homologues of genes encoding subunits of the plasma membrane NADPH oxidase suggest that it is primarily this enzyme, as in animals, that mediates ROS production in response to stress (Sagi and Fluhr, 2001). Hydrogen peroxide and ozone have been used to mimic the oxidative burst and induce PCD in plants. Concentrations of H2O2 between 8 and 130 mM induced cell death in suspension-cultured plant cells and such death has been correlated with membrane blebbing, chromatin condensation, and DNA cleavage (Desikan et al., 1998; O'Brien et al., 1998). Ozone decomposes to form ROS that subsequently triggers a secondary burst of H2O2, leading to cell death (Schraudner et al., 1997; Rao and Davis, 1999; Moeder et al., 2002). Exposure of plants to a threshold concentration of ozone, induced a cell death that resembled the HR (Schraudner et al., 1997; Rao and Davis, 1999; Rao and Davis, 2001). Ozone exposure caused PCD with DNA cleavage in genetically-resistant plants and more extensive cell death without these features in susceptible plants (Koch et al., 2000). Hence, both H2O2 and ozone, as sources or inducers of ROS, are capable of triggering apoptoticlike PCD in plants resistant to these stimuli and are likely to be secondary signals in PCD. Thus, ROS-induced PCD in ozone-resistant plants could itself be a signal leading to cellular protection against further damage, by analogy to the HR. Nitric oxide can promote both cell survival and cell death in animals. NO can nitrosylate sulfhydryl groups at the active sites of many enzymes, activate cyclic GMP-mediated signaling and react with ROS to form peroxynitrite. Peroxynitrite, a highly reactive free radical, is produced by mammalian cells to kill transformed cells and bacterial pathogens. In contrast, NO can inhibit PCD by nitrosylating the active sites of caspases (Kim et al., 2002a). Delledonne et al. (1998, 2001) have suggested that the balanced production of both H2O2 and nitric oxide (NO) is necessary for the HR of soybean cells in response to bacterial challenge, and showed that NO accumulation was necessary for gene-for-gene resistance of Arabidopsis plants to bacteria. In contrast to the animal scenario, NO and H2O2 seemed to be acting as secondary messengers rather than as precursors of peroxynitrite (REF). In summary,

128


crosstalk between signaling mediated by ROS and NO appears to promote defenserelated PCD in plants. Mitogen-activated protein kinase (MAPK) are a family of central signaling modules (Lapadat, 2002). In animal cells, the JNK class of MAP kinases are part of a complex signaling network that can promote either apoptosis or cell survival, depending on the cellular context, the duration of the stimulus and the particular JNK isoform (Lin, 2002). MAP kinase signaling is activated in plants (and in animals) in response to a wide range of biotic and abiotic stress stimuli, and the activation of ERK-like MAP kinases has been linked to plant cell death (Ligterink, 2000; Zhang and Klessig, 2001; Jonak et al., 2002). Overexpression of two MEKtype MAPKs in Arabidopsis plants leads to the activation ROS production and cell death (Ren et al., 2002). Over-or underexpression of a SA-induced MAP kinase (SIPK) in tobacco causes prolonged activation of either of two MAP kinases, ROS production and the induction of cell death by ozone concentrations that are nonlethal to wildtype plants (Samuel and Ellis, 2002). Interestingly, prolonged activation of JNK-type MAP kinases in animals promotes apoptosis (Lin, 2002). Hence, the prolonged activation of MAP kinases could potentiate PCD following stress stimuli, although it is unclear from the plant studies whether cell death resembles apoptosis or necrosis. Hoeberichts and Woltering (2003) have proposed a sequence of events leading to cell death that includes: (1) plant hormones and other cell death stimuli, (2) ROS, NO and release of proapoptotic signals from mitochondria (3) MAP kinase signaling and (4) activation of apoptotic effector proteins. However, the roles of NO and cytochrome c release in cell death are unclear. As discussed earlier, there is evidence that NO can promote or inhibit cell death in animals. Microinjection of cytochrome c into the cytosol of animal cells can induce apoptosis (Li et al., 1997; Zhivitovsky et al., 1998). However, the same cause and effect relationship has not been demonstrated in plant cells (or yeast, C.elegans or D. melanogaster, as mentioned (Zimmermann et al., 2002). Furthermore, the overexpression of ARMER, a novel antiapoptotic protein from the mammalian endoplasmic reticulum, inhibits apoptosis but does not prevent the release of cytochrome c from mitochondria (Lui et al., 2003). Hence, as has become a theme for this chapter, more work is needed to determine how plant hormones, MAP kinases, ROS and NO fit into the complex signaling network leading to PCD in plant cells. 6.3

UBIQUITINYLATION

Ubiquitin-mediated proteolysis occurs when specific proteins are tagged with chains of ubiquitin in a number of steps, allowing them to be recognised and degraded by the 26S proteasome (reviewed, DeSalle and Pagano, 2001). E1 ubiquitin-activating enzymes bind to ubiquitin in an ATP-dependent manner and transfer ubiquitin to E2 ubiquitin conjugating enzymes, which with E3 ubiquitin-


129

protein ligases, mediate the binding of ubiquitin to specific proteins that are then targeted for degradation. E3 ubiquitin-protein ligases catalyse the attachment of monomeric ubiquitin to specific proteins, a step preceding elongation of the ubiquitin chain. Skp1, CulA/CDC53 and an F-box protein are the main subunits of the SCF class of E3 ligases that degrade regulatory proteins in yeast to allow cell cycle progression. Complexes formed between different E2 and E3 enzymes, and the interaction of Skp1-CulA with different F-Box proteins within each SCF ubiquitin ligase, generate the specificity needed to target a range of proteins for selective degradation. The role of ubiquitin-mediated proteolysis in mammalian apoptosis is only beginning to be understood (Lee and Peter, 2003). However, there is evidence that in Drosophila, Reaper, a proapoptotic protein analogous to SMAC/Diablo, promotes the ubiquitin-mediated proteolysis of IAPs, derepressing caspase activity and allowing developmentally-controlled apoptosis (Olson et al., 2003). Recent studies suggest that ubiquitin-mediated proteolysis controls PCD during TE differentiation and the HR. Ubiquitin-mediated proteolysis may also be involved in other forms of PCD due to its role in plant hormone perception. Tracheary element formation is delayed by an inhibitor of ubiquitin-mediated proteolysis (Woffenden et al., 1998). The Mla12 resistance protein protects barley from infection by powdery mildew, a biotrophic pathogen. Signaling components downstream of Mla12 are homologous to subunits of SCF ubiquitin ligases (Azevedo et al., 2002). The Required for Mla12 Resistance gene-1 (Rar-1) protein is downstream of the Mla12 resistance protein and needed for the HR (Freialdenhoven et al., 1994). Rar-1 has two zinc-binding CHORD motifs and a C-terminal domain with homology to Sgt1, an additional component of SCF ubiquitin ligases (Kitagawa et al., 1999). Rar-1 occurs in complex with barley homologues of Sgt1, Skp1, Cul1 and two COP1 signalosome components (Shirasu et al., 1999; Azevedo et al., 2002). Arabidopsis Sgt1 homologues also bind to the barley and Arabidopsis Rar1 homologues and complement yeast cells with Sgt1 mutations (Azevedo et al., 2002). AtSgt1b and AtRar1 are also involved in the induction of an HR during resistance to Peronospora parasitica (Austin et al., 2002; Tor et al., 2002) and AtSgt1b is needed for the HR associated with resistance to Pseudomonas syringae (Tornero et al., 2002). The tobacco (N. benthamiana) Sgt1 homologue is required for a number of transgene-and elicitor-induced cell death responses and some forms of nonspecific disease resistance (Peart et al., 2002). SCF ubiquitin-protein ligases are also likely to be involved in plant hormone signaling, since Skp and Cul homologues are needed for auxin perception and F-box proteins are implicated in responses to jasmonic acid, auxin and ethylene (reviewed Azevedo et al., 2001; Woo et al., 2001). Indeed, AtSgt1b has recently been implicated in both disease resistance involving the HR and in the response to auxin (Gray et al., 2003). Hence, it is tempting to speculate that crosstalk between plant hormone signaling pathways controls the ubiquitin-mediated proteolysis of negative regulators of programmed

130


cell death. Indeed, negative regulators of transcription factors have recently been identified as targets of the 26S proteasome during the response of plant cells to auxin (Dharmasiri and Estelle, 2002), but substrates of the 26S proteasome during PCD in plants are not yet known. Hence, ubiquitin-mediated proteolysis may be a key link between nonspecific and gene-for-gene resistance to pathogens, phytohormone signaling and PCD. 6.4

CALCIUM SIGNALING

Changes in intercellular concentrations of calcium ions are a common feature of animal signaling and stress responses in plants. Transient increases in the cytosolic concentration of calcium ions are associated with the HR in response to elicitors and pathogens (Xu and Heath, 1998; Lecourieux et al., 2002). PCD of barley aleurone cells (Kuo et al., 1996), tracheary elements (reviewed Fukuda, 2000) and aerenchyma (He et al., 1996) are also associated with Ca+2 increases. There is also some evidence for calcium signaling in leaf senescence (Huang et al., 1997). MLO, a receptor-like protein of barley is a negative regulator of programmed cell death in stressed plants. Plants with a mlo mutation have enhanced resistance to Blumeria graminis, a biotrophic fungus, enhanced susceptibility to Magnaporthe grisea, a necrotrophic fungus, and spontaneous cell death under certain conditions (reviewed Stein and Somerville, 2002). The cytosolic C-termini of barley and rice homologues of MLO has recently been found to interact with calmodulin in a calcium iondependent manner (Kim et al., 2002b; Kim et al., 2002c). There is also a plantspecific family of calcium-dependent protein kinases, some of which are induced during defense responses, although their physiological roles are largely unknown (reviewed Hoeberichts and Woltering, 2003). Hence, calcium signaling is likely to be an important early event during stress treatments that can induce PCD, although the salient details involving calcium-related signaling events are only beginning to be understood.

7.

Downstream signaling events

Many forms of PCD in plants have been correlated increases in protease and nuclease activities. However, while the core apoptotic machinery is highly conserved, it is evident from plant genomic sequencing efforts, that in general, sequence similar homologs are not present. However, there is evidence that divergence between kingdoms has resulted in functional equivalency but with low sequence similarity. For example, both animals and plants have a pathogeninducible nitric oxide synthase (iNOS). However, the plant and animal enyzmes are different proteins to the extent that data base searches such as BLAST would not identify the plant and animal proteins as having any significant degree of similarity (Chandok et al., 2003). Similarly, apoptotic-like protease and endonuclease


131

activities associated with PCD in plants coupled with the fact that the cell is undergoing a programmed death suggest that plants have at least some functional equivalents of apoptotic proteins. Thus different experimental approaches may be required to identify mediators of plant apoptosis. 7.1

LYTIC ENZYME PRODUCTION

A wide range of proteases and nucleases are activated during cell death in plants. Studies with synthetic substrates and inhibitors have shown that effector caspaselike activities correlate with and are needed for plant cell death induced by a cytokinin, fumonisin, a fungal elicitor, camptothecin and staurosporine (De Jong et al., 2000; Mlejnek and Prochazka, 2001; Elbaz et al., 2002). Studies involving the use of caspase inhibitors in plants have suggested that the activation of caspase-like proteases correlates with cell death in response to avirulent and virulent pathogens (del Pozo and Lam, 1998; Richael et al., 2001) and heat shock (Tian et al., 2000), although the specificity of these inhibitors in plants is uncertain. Cell death induced by necrotrophic pathogens has been inhibited in plants expressing the animal caspase inhibitors, Op-IAP, p35 and Sf-IAP (Dickman et al., 2001; Lincoln et al., 2002; Li, unpublished data). These results are suggestive that caspase-like proteins may participate in plant PCD, although other mechanisms cannot be discounted. The Op-IAP gene from baculovirus, when expressed in tobacco, conferred increased resistance to several necrotrophic fungi including Botrytis cinerea, Sclerotinia sclerotiorum and Cercospora nicotiniae (Dickman et al., 2001). The p35 gene, also from baculovirus, provided transgenic tomato plants with enhanced resistance to two necrotrophic fungi, Alternaria alternata, Colletotrichum coccoides, as well as Pseudomonas syringae pv. tomato (Lincoln et al., 2002). The p35 gene, but not a mutated version encoding a protein incapable of binding caspase 3, also protected transformed hairy root cultures from the toxic effects of AAL (Lincoln et al., 2002). Recently, p35 has also been shown to compromise the HR of tobacco plants mediated by the N resistance protein (Del Pozo and Lam, 2003). The Sf-IAP gene from fall armyworm (Sporodoptera frugipera) provides tomato plants with quantitative resistance to an AAL toxin-free forma speciales of A. alternata, as well as protection from programmed death induced by fumonisin B1 (Li and Dickman, in preparation). Attempts are continuing to purify caspase-like proteases from plants (Elbaz et al., 2002) as well as using computational approaches to predict such enzymes (eg 'metacaspases' see below). In addition to caspase-like protease activity, cysteine-, serine-, aspartic- and metalloprotease activities have been shown to correlate with various forms of PCD and may be functionally equivalent to caspases or at least contribute to autolysis. In contrast to the animal model in which most apoptotic proteases are activated posttranslationally, cysteine proteases are transcriptionally-induced during cell death associated with: the differentiation of tracheary elements (Minami and Fukuda,

132


1995; Funk et al., 2002), senescence of endosperm tissue (Schmid et al., 1995), leaf and floral organ senescence (Xu and Chye, 1999), the response of plant suspension cells to H2O2 (Solomon et al., 1999), anoxia-induced death of root tips (Subbaiah et al., 1999) and seed development (Wan et al. ,2002). Serine protease activity is associated with signal transduction leading to vacuolar collapse during tracheary element differentiation in vitro. This mechanism may be analogous to the release of the serine protease, granzyme B, into target cells by cytotoxic T lymphocytes, and its promotion of PCD by cleavage and activation of pro-apoptotic signaling components (Lord et al., 2003). A barley aspartic protease, phytepsin, has been shown to be transcriptionally activated in early embryogenesis and is active during tracheary element differentiation (Chen and Foolad, 1997; Runeberg-Roos and Saarma., 1998). A putative zinc metalloprotease was found to be induced during senescence in cucumber (Delorme et al., 2000). Despite these findings, the contribution of most of these proteases to plant PCD is, as yet, unclear. Proteases are almost certainly required for the execution phase of plant PCD, although the responsible enzyme may not have the same structural specificity as caspases. 7.2

TRANS-KINGDOM APPROACHES

Studies involving the expression of animal apoptotic regulators in plants, coupled with the similarity in PCD features in certain situations, suggest that animals and plants may have common death-related signaling steps. Amazingly, Bcl-2 family proteins affect cell death in plants, when expressed in plants, modulate PCD (Lacomme and Santa-Cruz, 1999; Mitsuhara et al., 1999; Dickman et al., 2001; Qiao et al., 2002). For example, expression of the proapoptotic Bax protein in tobacco plants resulted in the appearance of necrotic HR-like lesions, which were delayed by the deletion of Bax BH1 or BH2 domains and completely blocked by deletion of the transmembrane domain, suggesting the importance of membrane localization (Lacomme and Santa-Cruz, 1999). The Bax transgene also appeared to be targeted to mitochondria, although the apoptotic-like features of DNA laddering or TUNEL-positive nuclei were not observed. Expression in tobacco of antiapoptotic Bcl-2 proteins including, human Bcl-2, chicken Bcl-xl and CED-9 from C. elegans, enhanced tolerance to biotic and abiotic stresses. For example, expression of Bcl-xl and CED-9 inhibited cell death in response to UV-B irradiation and treatment with paraquat, an herbicide that generates ROS (Mitsuhara et al., 1999). Tobacco seedlings expressing Bcl-xl were cold tolerant and salt tolerant (Qiao et al., 2002). As mentioned, transgenic tobacco plants expressing Bcl-2, Bclxl and CED-9 showed resistance to cell death caused by Sclerotinia sclerotiorum, Botrytis cinerea, Cercospora nicotianae, selected herbicides, heat, cold, salt and drought stresses (Dickman et al., 2001; and unpublished). DNA laddering was induced by S. sclerotiorum during pathogenesis and was inhibited in resistant tobacco plants expressing Bcl-xl. Importantly, these data indicate that the fungus


133

establishes successful colonization and subsequent disease, by triggering plant PCD. These studies show that the Bcl-2 family of apoptotic regulators can modulate stress-induced PCD in plants, consistent with their roles in animals. The underlying mechanisms responsible for these phenotypes are of high priority. 7.3

HOMOLOGUES OF ANIMAL PROTEINS INVOLVED IN APOPTOSIS

Although plant cells can undergo apoptotic-like cell death, plant homologues of apoptotic regulators have in general, not been found. The human Bax Inhibitor (BI1) gene was identified by its ability to prevent cell death in yeast expressing a human Bax transgene. BI-1 is a membrane protein and enhances the cytoprotective activity of Bcl-2 in mammalian cells by a direct protein-protein interaction (Xu and Reed, 1998). BI-1 homologues that function in the yeast assay have been found in rice, Arabidopsis, barley and tomato (Kawai et al., 1999; Sanchez et al., 2000, Chae et al., in review). Overexpression of the rice BI-1 in a rice cell culture inhibited cell death induced by a fungal elicitor and a toxic concentration of salicylic acid (Matsumara et al., 2003). Overexpression of the barley BI-1 homologue compromised basal resistance to Blumeria graminis (Huckelhoven et al., 2003). These findings support an antiapoptotic role for BI-1, since resistance to B. graminis occurs in the mlo barley genotype that displays spontaneous cell death. However, transcripts of BI homologues from Arabidopsis, barley and rice are induced under conditions that would be expected to trigger PCD and cause the down regulation of antiapoptotic genes (Huckelhoven et al., 2001; Swidzinski et al., 2002; Matsumara et al., 2003). Hence, it has been suggested that BI homologues may limit the spread of PCD following biotic stress. Interestingly, the Arabidopsis BI-1 homologue has been shown to induce apoptosis in a human cell line and inhibit it in another, suggesting again that cellular context is crucial (Bolduc et al., 2002; Yu et al., 2002). The metacaspases are caspase-like homologues that have been identified using bioinformatic algorithms in a wide range of organisms, including plants (Uren et al., 2000). Arabidopsis metacaspases, lack an obvious N-terminal protein-protein interaction domain used for the activation of mammalian initiator caspases. The function of any plant metacaspase has not been reported. Overexpression of an Arabidopsis metacaspase was expected to cause precocious cell death but produced no observable phenotype (Vercammen et al., 2003). The function of any plant metacaspase has not been reported. The mammalian Bag-1 protein has numerous roles in as a molecular chaperone promoting cell survival. Bag-2 interacts with Hsp-70 and also enhances the antiapoptotic function of Bcl-2 (Townsend et al., 2003). We have identified eight Bag-1 homologues in Arabidopsis using a bioinformatic approach withthreading algorithms. Preliminary studies using Arabidopsis tplants containing T-DNA insertions in some of these genes show enhanced susceptiblity to abiotic stress

134


(Doukhanina and Dickman, unpublished data). Our data indicates some degree of functional conservation between plant and animal Bag proteins, even though such genes do not come up in BLAST searches. Thus using higher-order bioinformatics approaches may be useful for identifying functional plant homologs of animal PCD genes without reliance on sequence conservation.

8.

Current and future research directions

It is now established that programmed cell death occurs in plants during normal development and stress responses and that some forms of plant cell death resemble apoptosis. There is also limited evidence that the signaling events involved in plant cell death are mediated by conserved plant-specific regulators (Hoeberichts and Woltering, 2003). The following discussion focuses on questions that are currently being asked about PCD in plants and potential approaches that could be used to address them. 8.1

SPONTANEOUS CELL DEATH MUTANTS

Spontaneous cell death has been observed in mutant lines of many plants, including Arabidopsis, tomato, maize and barley. In many cases, the phenotype has striking resemblance to the disease state but with the absence of any pathogen, hence the term, lesion mimic (Johal et al., 1995). This phenotype supports the view that death is the default pathway and that disease symptoms caused by some necrotrophic pathogens results from the manipulation of host signaling to promote PCD (Wang et al., 1996a; Dickman et al., 2001 and others). Indeed, plant pathogenic bacteria can enhance disease symptoms in susceptible plants by manipulating hormonal signaling pathways involving jasmonic acid (Feys et al., 1994), ethylene and salicylic acid (O'Donnell et al., 2001; O'Donnell et al., 2003). Thus, effector molecules of pathogens might co-opt plant cell death pathways by inappropriate regulation of hormone signaling. Mapping of lesion mimic mutations has linked LSD1, a transcription factor that controls superoxide production (Jabs et al., 1996; Dietrich et al., 1997; Kliebenstein et al., 1999), LLS, a putative aromatic ring hydroxylating dioxygenase (Gray et al., 1997), and a number of housekeeping proteins to spontaneous cell death (Molina et al., 1999; Mou et al., 2000; Ishikawa et al. 2001; Mach et al., 2001; Brodersen et al., 2002; Ishikawa et al., 2003). These findings suggest that spontaneous cell death could result from disruption of homeostasis to a threshold where PCD is triggered. LSD1 and LLS1 are likely to be negative regulators of cell death. Other spontaneous death phenotypes correlate with the constitutive activation of plant defenses. Overexpression of the Pto resistance gene in tomato (Rathjen et al., 1999), mutations in the rp1 resistance gene of maize (Hu et al., 1996) and inactivation of mlo, a negative regulator of defense in barley (Buschges et al., 1997)


135

result in spontaneous cell death, presumably due to activation of the HR. Overaccumulation of salicylic acid in many Arabidopsis lesion mimic mutants, or its depletion in the presence of salicylate hydroxylase (Nah G) in tomato also correlate with spontaneous cell death (Dietrich et al., 1994; Greenberg et al., 1994; Bowling et al., 1997; Buschges et al., 1997; Rate et al., 1999; Shah et al., 1999; Devadas et al., 2002; Pilloff et al., 2002). It is not clear in all of these mutants whether an abnormal level of salicylic acid causes programmed cell death or is a consequence of the death process. Lesion mimicry in tomato plants expressing salicylate hydroxylase could be caused by cachetol, the breakdown product of SA and a phytoalexin, rather than lack of SA per se (van Wees and Glazebrook, 2003). However, crosses between Arabidopsis plants showing lesion mimicry and those with other mutations support a role for plant hormones, including SA, in lesion formation (Greenberg et al., 2000; Devadas et al., 2002; Pilloff et al., 2002). In summary, plants exhibiting spontaneous cell death are likely to be a useful tool for studying signals leading to PCD and may lead to the identification of additional suppressors of PCD in plants. The overexpression of animal anti-apoptotic genes in these genetic backgrounds is currently underway in our lab and may facilititate the identification of endogenous plant genes that regulate PCD. 8.2

PLANT-SPECIFIC REGULATORS OF PCD

As mentioned, plant cells contain structures that animal cells lack, including a cell wall, a large vacuole and chloroplasts. The implications of the cell wall and vacuole have already been discussed in terms of tracheary element differentiation. The involvement of chloroplasts in PCD is of growing interest. Further studies of lesion mimic mutants with alterations in chloroplast proteins may help to identify chloroplastic suppressors of PCD (Gray et al., 2002; Ishikawa et al., 2003). Bcl-xl, which inhibits some forms of PCD in plants, is targeted to the chloroplast membrane, among other membranes (Chen and Dickman, in preparation). It will be interesting to determine whether localisation of Bcl-xl to chloroplasts has functional relevance to PCD. The ability of pro-and antiapoptotic proteins to affect PCD in plants suggests that some signaling steps involved in the regulation of PCD are conserved. On the other hand, these animal proteins may have an indirect effect on PCD in plants, such as interference with hormonal signaling. Cellular stress caused by the presence of foreign proteins may induce the production of chaperonins or other protective molecules that inhibit cell death. The relationship between hormonal signaling and phenotypes conferred on plants by antiapoptotic transgenes are being investigated (Li, Panter and Dickman, unpublished). Whatever the mechanism, further efforts to characterise these plants, including the identification of plant proteins interacting with the antiapoptotic proteins, should lead to a better understanding of how PCD is regulated in plants.

136 8.3

S. PANTER and M. DICKMAN GLOBAL APPROACHES

In addition to targeted approaches, there is increasing interest in looking at global changes in gene and protein expression, and post-translational modifications that precede PCD in plants. The development of microarrays has allowed global gene expression to be analysed during the induction of PCD in plant suspension cell cultures by heat-shock, senescence and tracheary element differentiation (Demura et al., 2002; Swidinski et al., 2002). Transcripts expressed in acd11 seedlings, which show spontaneous cell death, and wild type seedlings, have also been compared using a microarray (Brodersen et al., 2002). These studies have shown that cell death often correlates with the activation of stress-related genes, including antioxidant enzymes. However each form of plant PCD is clearly associated with the expression of a distinct subset of genes. Senescence is associated with high-level induction of certain senescence-associated genes, (Swidzinski et al., 2002). Lesion formation in acd11 plants correlates with the down regulation of photosynthetic genes (Brodersen et al., 2002). Genes encoding lytic enzymes are induced during the final stage of tracheary element formation in Zinnia (Demura et al., 2002). The transcriptional activation of some proteases and nucleases may indicate that some effectors of PCD in plants are activated transcriptionally, in contrast to caspases which are activated at the protein level. In fact, PCD in animal systems generally is regulated post-transcriptionally. Hence, transcriptional changes may reflect late events during the death of plant cell cultures and may limit the value of microarrays for characterising early and intermediate signaling events during plant PCD. Proteomics is likely to be an informative approach for the identification of specific proteins during the induction of PCD in plants although the tools are not as well developed as arrays. Subcellular fractionation of plant cells has allowed the subproteomes of individual organelles or their components to be analysed, including mitochondria and chloroplasts (Prime et al., 2000; Peltier et al., 2000; Kruft et al., 2001; Millar et al., 2001). New and established methods for detecting nuclease activity, protease activity and protein kinase activity (Solomon et al., 1999; Subbaiah et al., 1999; Delorme et al., 2000; Kidd et al., 2001; Ito and Fukuda, 2002) should allow directed proteome studies to focus on members of known classes of enzymes activated during PCD in plants. However, proteomics may not detect proteins that are present at very low abundance and has the limitation of not being able to characterise multiprotein complexes, which are central to both the mitochondrial and extrinsic apoptotic pathways and very possibly R gene pathways. The identification of such complexes in plants will necessitate more specialised techniques, such as immunoprecipitation of native or epitope-tagged proteins in complex with their partners. This method has been used successfully to resolve plant signaling complexes (Trotochaud et al., 1999; Rivas et al., 2002a, Rivas et al., 2002b).


137

Hence, proteomics is a good starting point for more focused studies and should allow a relatively unbiased search for death-related proteins in plants. Since the Arabidopsis genome has been sequenced and the number of DNA sequencse from plants is expanding (Somerville and Somerville, 1999), bioinformatic approaches are likely to be important for identifying plant proteins as candidates for regulators of PCD. As mentioned earlier, very few homologues of apoptotic regulators have been identified in plants by sequence comparisons. However, as shown by the discovery of Bag-1 homologues and metacaspases in Arabidopsis, more distant homologues of apoptotic proteins do occur in plants and their effect on developmentally-controlled and stress-induced PCD can potentially be tested. Yeast is recognised for high-throughput screening of candidate apoptotic regulators. Yeast cells undergo a programmed cell death featuring chromatin condensation, DNA fragmentation, and externalisation of phosphatidylserine residues on the plasma membrane can be induced by oxidative stress (Madeo et al., 1999; Jin and Reed, 2002). A recent study from our lab showed that expression of antiapoptotic genes, including CED-9, Bcl-2 and Bcl-xl protected yeast cells against apoptotic-like cell death caused by oxidative stress (Chen et al., 2003). This study demonstrated the potential of the yeast system to screen for plant inhibitors of PCD. In fact we recently isolated a PHGPx from tomato in yeast by inhibtion of human Bax induced cell death that also inhibits PCD in plants (Chen et al. submitted). Thus the use of a heterologous system such as yeast, can translate into similar function in plants.

9.

Conclusions

Compelling evidence indicates that plants possess an intrinsic program for cell suicide. Though enormous progress has been made in understanding the genetic and biochemical basis of programmed cell death in animal cells, very little is known about similar processes in plants. However, there seems to be a continuum between different forms of cell death in plants, with apoptotic-like death at one extreme, necrosis at the other extreme and autolysis in between. Elucidation of the relevant cell death mechanisms is important to understanding plant development, environmental stress responses, as well as plant-pathogen interactions. Knowledge about cell life/death pathways in plants might be exploited for engineering crop resistance against common plant pathogens, extending post-harvest shelf-life of vegetables, fruits, and flowers, and for engineering hardier strains of plants that survive adverse climates. The key now is to identify plant counterparts that function similarly to animal regulators of cell life and death.

138 10.

S. PANTER and M. DICKMAN References

Abramovitch, R. B., Kim, Y. J., Chen, S., Dickman, M. B., and Martin, G. B. (2003) Pseudomonas type III effector AvrPtoB induces plant disease susceptibility by inhibition of host programmed cell death. EMBO J 22, 60-69. Adams, J. M., and Cory, S. (2002). Apoptosomes: engines for caspase activation. Curr Opin Cell Biol. 14, 715-720. Adrain, C. and Martin, S. J. (2001) The mitochondrial apoptosome: a killer unleashed by the cytochrome seas. Trends. Biochem. Sci. 26, 390-397. Alvarez, M. E., Pennell, R. I., Meijer, P. J., Ishikawa, A., Dixon, R. A., Lamb, C. (1998) Reactive oxygen intermediates mediate a systemic signal network in the establishment of plant immunity. Cell 92, 773-784. Apse, M. P., Aharon, G. S., Snedden, W. A., and Blumwald, E. (1999). Salt tolerance conferred by overexpression of a vacuolar Na+/H+ antiport in Arabidopsis. Science 285, 1256-1258. Armstrong, W. (1979) Aeration in higher plants. Adv. Bot. Res. 7, 225-332. Asai, T., Stone, J. M., Heard, J. E., Kovtun, Y., Yorgey, P., Sheen, J., and Ausubel, F. M. (2000) Fumonisin B1-induced cell death in arabidopsis protoplasts requires jasmonate-, ethylene-, and salicylate-dependent signaling pathways. Plant Cell 12, 1823-1836. Ashkenazi, A., and Dixit, V. M. (1998). Death receptors: signaling and modulation. Science 281, 1305-1308. Austin, M. J., Muskett, P., Kahn, K., Feys, B. J., Jones, J. D. G., and Parker, J. E. (2002) Regulatory role of SGT1 in early R gene-mediated plant defences. Science 295, 20772080. Azevedo, C., Santos-Rosa, M. J., and Shirasu, K. (2001) The U-box protein family in plants. Trends Plant Sci. 6, 354-358. Azevedo, C., Sadanandom, A., Kitagawa, K., Freialdenhoven, A., Shirasu, K., and SchulzeLefert, P. (2002) The RAR1 interactor SGT1, an essential component of R gene-triggered disease resistance. Science 295, 2073-2076. Bachmair, A., Becker, F., Masterton, R. V., and Schell, J. (1990) Perturbation of the ubiquitin system causes leaf curling, vascular tissue alterations and necrotic lesions in a higher plant. EMBO J. 9, 4543-4549. Balk, J., Leaver, C. J., and McCabe, P. F. (1999). Translocation of cytochrome c from the mitochondria to the cytosol occurs during heat-induced programmed cell death in cucumber plants. FEBS Lett. 463, 151-154. Beers, E. P., and Freeman, T. B. (1997) Protease activity during tracheary element differentiation in Zinnia mesophyll cells. Plant Physiol. 113, 873-880. Bertin, J., Nir, W. J., Fisher, C. M., Tayber, O. V., Errada, P. R., Grant, J. R., Keilty, J. J., Gosselin, M. L., Robinson, K. E., Wong, G. H., Glucksmann, M. A., and DiStefano, P. S. (1999). Human CARD4 protein is a novel CED-4/Apaf-1 cell death family member that activates NF-kappaB. J. Biol. Chem. 274, 12955-12958. Bethke, P. C., Lonsdale, J. E., Fath, A., and Jones, R. L. (1999) Hormonally regulated programmed cell death in barley aleurone cells. Plant Cell 11, 1033-1045. Bolduc, N., Ouellet, M., Pitre, F., and Brisson, L. F. (2002) Molecular characterization of two plant BI-1 homologues which suppress Bax-induced apoptosis in human 293 cells. Planta 216, 377-386. Bowling, S. A., Clarke, J. D., Liu, Y., Klessig, D. F., and Dong, X. (1997) The cpr5 mutant of Arabidopsis expresses both NPR1-dependent and NPR1-independent resistance. Plant Cell 9, 1573-1584. Boyer, J. S. (1982) Plant productivity and environment. Science 218, 443-448.


139

Boyes, D. C., Nam, J., and Dangl, J. L. (1998) The Arabidopsis thaliana RPM1 disease resistance gene product is a peripheral plasma membrane protein that is degraded coincident with the hypersensitive response. Proc. Natl. Acad. Sci. USA 95, 15849-15854. Brandwagt, B. F., Mesbah, L. A., Takken, F. L., Laurent, P. L., Kneppers, T. J., Hille, J., and Nijkamp, H. J. (2000) A longevity assurance gene homolog of tomato mediates resistance to Alternaria alternata f. sp. lycopersici toxins and fumonisin B1. Proc. Natl. Acad. Sci. U. S. A. 97, 4961-4966. Brodersen, P., Petersen, M., Pike, H. M., Olszak, B., Skov, S., N. Odum, Jorgensen, L. B., Brown, R. E., and Mundy, J. (2002) Knockout of arabidopsis accelerated-cell-death11 encoding a sphingosine transfer protein causes activation of programmed cell death and defense. Genes Dev. 16, 490-502. Buschges, R., Hollricher, K., Panstruga, R., Simons, G., Wolter, M., Frijters, A., Van Daelen, R., Van Der Lee, T., Diergaarde, P., Groenendijk, J., Topsch, S., Vos, P., Salamini, F., and Schulze-Lefert, P. (1997) The barley Mlo gene: a novel control element of plant pathogen resistance. Cell 88, 695-705. Cessna, S. G., Sears, V. E., Dickman, M. B., and Low, P. S. (2000) Oxalic acid, a pathogenicity factor for Sclerotinia sclerotiorum, suppresses the oxidative burst of the host plant. Plant Cell 12, 2191-2200. Chandok, M. R., Ytterberg, A. J., Van Wijk, K. J., Klessig, D. F. (2003) The PathogenInducible Nitric Oxide Synthase (iNOS) in Plants Is a Variant of the P Protein of the Glycine Decarboxylase Complex. Cell 113, 469-482. Chang, J. H., Rathjen, J. P., Bernal, A. J., Staskawicz, B. J., and Michelmore, R. W. (2000) avrPto enhances growth and necrosis caused by Pseudomonas syringae pv.tomato in tomato lines lacking either Pto or Prf. Mol. Plant Microbe Interact. 13, 568-571. Chen, F., and Foolad, M. R. (1997) Molecular organization of a gene in barley which encodes a protein similar to aspartic protease and its specific expression in nucellar cells during degeneration. Plant Mol. Biol. 35, 821-831. Chen, H.-M., Zhou, J., and Dai, Y.-R. (2000) Cleavage of lamin-like proteins in vivo and in vitro apoptosis of tobacco protoplasts induced by heat shock. FEBS Lett. 480, 165-168. Chen, S., Dunigan, D. D., and Dickman, M. B. (2003). Bcl-2 family members inhibit oxidative stress-induced programmed cell death in Saccharomyces cerevisiae. Free Radical Biol. Med. 34, 1315-1325. Clouse, S. D., and Gilchrist, D. G. (1986) Interaction of the as locus in F8 paired lines of tomato with Alternaria alternata f. sp. lycopersici and AAL toxin. Phytopathol. 77, 80-82. Crosti, P., Malerba, M., and Bianchetti, R. (2001) Tunicamycin and Brefeldin A induce in plant cells a programmed cell death showing apoptotic features. Protoplasma 216, 31-38. Curtis, M. J., and Wolpert, T. J. (2002) The oat mitochondrial permeability transition and its implication in victorin binding and induced cell death. Plant J. 29, 295-312. Dangl, J. L., and Jones, J. D. (2001). Plant pathogens and integrated defence responses to infection. Nature 411, 826-833. Danon, A., and Gallois, P. (1998) UV-C radiation induces apoptotic-like changes in Arabidopsis thaliana. FEBS Lett. 437, 131-136. Daugas, E., Nochy, D., Ravagnan, L., Loeffler, M., Susin, S. A., Zamzami, N., and Kroemer, G. (2000). Apoptosis-inducing factor (AIF): a ubiquitous mitochondrial oxidoreductase involved in apoptosis. FEBS Lett. 476, 118-123. De Jong, A. J., Hoeberichts, F. A., Yakimova, E. T., Maximova, E., and Woltering, E. J. (2000) Chemical-induced apoptotic cell death in tomato cells: involvement of caspase-like proteases. Planta 211, 656-662. Dellaporta, S. L., and Calderon-Urrea, A. (1993). Sex determination in flowering plants. Plant Cell 5, 1241-1251.

140


Delledonne, M., Xia, Y., Dixon, R. A., and Lamb, C. (1998) Nitric oxide functions as a signal in plant disease resistance. Nature 394, 585-588. Delledonne, M., Zeier, J., Marocco, A., and Lamb, C. (2001) Signal interactions between nitric oxide and reactive oxygen intermediates in the plant hypersensitive disease resistance response. Proc. Natl. Acad. Sci. U. S. A. 98, 13454-13459. Delorme, V. G. R., McCabe, P. F., Kim, D.-J., and Leaver, C. J. (2000) A matrix metalloproteinase gene is expressed at the boundary of senescence and programmed cell death in cucumber. Plant Physiol. 123, 917-927. Del Pozo, E., and Lam, E. (1998) Caspases and programmed cell death in the hypersensitive response of plants to pathogens. Curr. Biol. 8, 1129-1131. Del Pozo, O., and Lam, E. (2003) Expression of the baculovirus p35 protein in tobacco affects cell death progression and compromises N gene–mediated disease resistance response to tobacco mosaic virus. Mol. Plant-Microbe Interact. 16, 485-494. Demura, T., Tashiro, G., Horiguchi, G., Kishimoto, N., Kubo, M., Matsuoka, N., Minami, A., Nagata-Hiwatashi, M., Nakamura, K., Okamura, Y., Sassa, N., Suzuki, S., Yazaki, J., Kikuchi, S., and Fukuda, H. (2002) Visualization by comprehensive microarray analysis of gene expression programs during transdifferentiation of mesophyll cells into xylem cells. Proc. Natl. Acad. Sci. U. S. A. 99, 15794-15799. DeSalle, L. M., and Pagano, M. (2001) Regulation of the G1 to S transition by the ubiquitin pathway. FEBS Lett. 490, 179-189. Desikan, R., Reynolds, A., Hancock, J. T., and Neill, S. J. (1998) Harpin and hydrogen peroxide both initiate programmed cell death but have differential effects on defence gene expression in Arabidopsis suspension cultures. Biochem. J. 330, 115-120. Devadas, S. K., Enyedi, A., and Raina, R. (2002) The Arabidopsis hrl1 mutation reveals novel overlapping roles for salicylic acid, jasmonic acid and ethylene signalling in cell death and defence against pathogens. Plant J. 30, 467-480. Dharmasiri, S., and Estelle, M. (2002) The role of regulated protein degradation in auxin response. Plant Mol. Biol. 49, 401-409. Dickman, M. B., Park, Y. K., Oltersdorf, T., Li, W., Clemente, T., and French, R. (2001). Abrogation of disease development in plants expressing animal antiapoptotic genes. Proc. Natl. Acad. Sci. USA 98, 6957-6962. Dietrich, R. A., Delaney, T. P., Uknes, S. J., Ward, E. R., Ryals, J. A., and Dangl, J. L. (1994) Arabidopsis mutants simulating disease resistance response. Cell 77, 565-577. Dietrich, R. A., Richberg, M. H., Schmidt, R., Dean, C., and Dangl, J. L. (1997) A novel zinc finger protein is encoded by the arabidopsis LSD1 gene and functions as a negative regulator of plant cell death. Cell 88, 685-694. Dixon, M. S., Golstein, C., Thomas, C. M., Van der Biezen, E. A., and Jones, J. D. (2000) Genetic complexity of pathogen perception by plants: the example of Rcr3, a tomato gene required specifically by Cf-2. Proc. Natl. Acad. Sci. USA 97, 8807-8814. Dominguez, F., Moreno, J., and Cejudo, F. J. (2001) The nucellus degenerates by a process of programmed cell death during the early stages of wheat grain development. Planta 213, 352-360. Drew, M. C., Jackson, M. B., and Giffard, S. (1979) Ethylene promoted adventitious rooting and development of cortical air spaces in Zea mays L. Planta 147, 83-88. Du, C., Fang, M., Li, Y., Li, C. and Wang, X. (2000) Smac, a mitochondrial protein that promotes cytochrome C-dependent caspase activation by eliminating IAP inhibition. Cell 102, 33-42. El-Antably, H. M. M., Wareing, P. F., and Hillman, J. (1967) Some physiological responses to D,L abscisin (dormin). Planta 73, 74-90.


141

Elbaz, M., Avni, A., and Weil, M. (2002) Constitutive caspase-like machinery executes programmed cell death in plant cells. Cell Death Differ. 9, 726-733. Fath, A., Bethke, P., Lonsdale, J., Mez-Romero, R., and Jones, R. (2000) Programmed cell death in barley aleurone. Plant Mol. Biol. 44, 255-266. Ferri, K. F., and Kroemer, G. (2001) Organelle-specific initiation of cell death pathways. Nature Cell Biol. 3, E255-E263 Feys, B., Benedetti, C. E., Penfold, C. N., and Turner, J. G. (1994) Arabidopsis mutants selected for resistance to the phytotoxin coronatine Are male sterile, insensitive to methyl jasmonate, and resistant to a bacterial pathogen. Plant Cell 6, 751-759. Filonova, L. H., Von Arnold, S., Daniel, G., and Bozhkov, P. V. (2002). Programmed cell death eliminates all but one embryo in a polyembryonic plant seed. Cell Death Differ. 9, 1057-1062. Flor, H. H. (1971) Current status of the gene-for-gene concept. Annu. Rev. Phytopathol. 9, 275-296. Fukuda, H. (1997) Programmed cell death during vascular system formation. Cell Death. Differ. 4, 684-688. Fukuda, H. (2000) Programmed cell death of tracheary elements as a paradigm in plants. Plant Mol. Biol. 44, 245-253. Fukuda, H., and Komamine, A. (1980a) Direct evidence for cytodifferentiation to tracheary elements without intervening mitosis in a culture of single cells isolated from the mesophyll cells of Zinnia elegans. Plant Physiol. 65, 61-64. Fukuda, H., and Komamine, A. (1980b) Establishment of an experimental system for the tracheary element differentiation from single cells isolated from the mesophyll of Zinnia elegans. Plant Physiol. 65, 57-60. Funk, V., Kositsup, B., Zhao, C., and Beers, E. P. (2002) The arabidopsis xylem peptidase XCP1 is a tracheary element vacuolar protein that may be a papain ortholog. Plant Physiol. 128, 85-94. Gazitt, Y., Fey, V., Thomas, C., and Alvarez, R. (1998). Bcl-2 overexpression is associated with resistance to dexamethasone, but not melphalan, in multiple myeloma cells. Int. J. Oncol. 13, 397-405. Godoy, G., Steadman, J. R., Dickman, M. B., and Dam, R. (1989) Use of mutants to demonstrate the role of oxalic acid in pathogenicity of Sclerotinia sclerotiorum on Phaseolus vulgaris. Physiol. Mol. Plant Pathol. 37, 179-191. Gray, J., Close, P. S., Briggs, S. P., and Johal, G. S. (1997) A novel suppressor of cell death in plants encoded by the Lls gene of maize. Cell 89, 25-31. Gray, J., Janick-Buckner, D., Buckner, B., Close, P. S., and Johal, G. S. (2002) Lightdependent death of Maize lls1 cells is mediated by mature chloroplasts. Plant Physiol. 130, 1894-1907. Gray, W. M., Muskett, P. R., Chuang, H.-W., Parker, J. E. (2003). Arabidopsis SGT1b is required for SCFTIR1-mediated auxin response. In Plant biology: functions and control of cell death. J. Dangl, P. Schulze-Lefert and J. Glazebrook, eds., Keystone Symposia, Snowbird, Utah, 61. Greenberg, J. T. (1997) Programmed cell death in plant-pathogen interactions. Annu. Rev. Plant Pathol. Plant Mol. Biol. 48, 525-545. Greenberg, J. T., Guo, A., Klessig, D. F., and Ausubel, F. M. (1994) Programmed cell death in plants: a pathogen-triggered response activated coordinately with multiple defence functions. Cell 77, 551-563. Greenberg, J. T., Silverman, F. P., and Liang, H. (2000). Uncoupling salicylic acid-dependent cell death and defence-related responses from disease resistance in the Arabidopsis mutant acd5. Genetics 156, 341-350.

142


Groover, A., DeWitt, N., Heidel, A., and Jones, A. (1997) Programmed cell death of plant tracheary elements differentiating in vitro. Protoplasma 196, 197-211. Groover, A., and Jones, A. M. (1999) Tracheary element differentiation uses a novel mechanism coordinating programmed cell death and secondary cell wall synthesis. Plant Physiol. 119, 375-384. Gunawardena, A. H. L. A. N., Pearce, D. M., Jackson, M. B., Hawes, C. R., and Evans, D. E. (2001). Characterisation of programmed cell death during aerenchyma formation induced by ethylene or hypoxia in roots of maize (Zea mays L.). Planta 212, 205-214. Guttman, D. S., Vinatzer, B. A., Sarkar, S. F., Ranall, M. V., Kettler, G., and Greenberg, J. T. (2002). A functional screen for the type III (Hrp) secretome of the plant pathogen Pseudomonas syringae. Science 295, 1722-1726. He, C. J., Morgan, P. W., and Drew, M. C. (1996) Transduction of an ethylene signal is required for cell death and lysis in the root cortex of maize during aerenchyma formation induced by hypoxia. Plant Physiol. 112, 463-472. Heath, M. (1998) Apoptosis, programmed cell death and the hypersensitive response. Eur. J. Plant Pathol. 104, 117-124. Hengartner, M. O. (2000). The biochemistry of apoptosis. Nature 407, 770-776. Hoeberichts, F. A., and Woltering, E. J. (2002) Multiple mediators of plant programmed cell death: interplay of conserved cell death mechanisms and plant-specific regulators. BioEssays 25, 47-57. Howe G. A., Lightner, J., Browse, J., and Ryan, C. A. (1996) An octadecanoid pathway mutant (JL5) of tomato is compromised in signaling for defense against insect attack. Plant Cell. 8, 2067-2077. Hu, G., Richter, T. E., Hulbert, S. H., and Pryor, T. (1996) Disease lesion mimicry caused by mutations in the rust resistance gene rp1. Plant Cell 8, 1367-1376. Huang, F. Y., Philosoph-Hadas, S., Meir, S., Callaham, D. A., Sabato, R., Zelcer, A., and Hepler, P. K. (1997). Increases in cytosolic Ca2+ in parsley mesophyll cells correlate with leaf senescence. Plant Physiol. 115, 51-60. Huckelhoven, R., Dechert, C., Trujillo, M., and Kogel, K. H. (2001) Differential expression of putative cell death regulator genes in near-isogenic, resistant and susceptible barley lines during interaction with the powdery mildew fungus. Plant Mol. Biol. 47, 739-748. Huckelhoven, R., Dechert, C., and Kogel, K. H. (2003). Overexpression of barley BAX inhibitor 1 induces breakdown of mlo-mediated penetration resistance to Blumeria graminis. Proc. Natl. Acad. Sci. U.S.A. 100, 5555-5560. Huguet, E (2000) Bacterial pathogenicity. In: Annual Plant Reviews Volume 4: Molecular Plant Pathology. M Dickinson and J Beynon eds., Sheffield Academic Press, 26-64 Huh, G.-H., Damsz, B., Matsumoto, T. K., Reddy, M. P., Rus, A. M., Ibeas, J. I., Narasimhan, M. L., Bressan, R. A., and Hasegawa, P. M. (2002) Salt causes ion disequilibrium-induced programmed cell death in yeast and plants. Plant J 29, 649-659. Hunt, M. D., Neuenschwander, U. H., Delaney, T. P., Weymann, K. B., Friedrich, L. B., Lawton, K. A., Steiner, H. Y. and Ryals, J. A. (1996) Recent advances in systemic acquired resistance research--a review. Gene 179, 89-95. Hunt, M. D., Neuenschwander, U. H., Delaney, T. P., Weymann, K. B., Friedrich, L. B., Lawton, K. A., Steiner, H. Y. and Ryals, J. A. (1996) Recent advances in systemic acquired resistance research--a review. Gene 179, 89-95. Innes, R. W., Bent, A. F., Kunkel, B. N., Bisgrove, S. R., and Staskawicz, B. J. (1993) Molecular analysis of avirulence gene avrRpt2 and identification of a putative regulatory sequence common to all known Pseudomonas syringae avirulence genes. J. Bacteriol. 175, 4859-4869.


143

Inukai, T., Inoue, A., Kurosawa, H., Goi, K., Shinjyo, T., Ozawa, K., Mao, M., Inaba, T., and Look, A. T. (1999). SLUG, a ces-1-related zinc finger transcription factor gene with antiapoptotic activity, is a downstream target of the E2A-HLF oncoprotein. Mol. Cell. 4, 343-352. Ishikawa, A., Okamoto, H., Iwasaki, Y., and Asahi, T. (2001) A deficiency of coproporphyrinogen III oxidase causes lesion formation in Arabidopsis. Plant J. 27, 89-99. Ishikawa, A., Tanaka, H., Nakai, M., and Asahi, T. (2003) Deletion of a chaperonin 60beta gene leads to cell death in the arabidopsis lesion initiation 1 mutant. Plant Cell Physiol. 44, 255-261. Itai, C. (1999) Role of phytohormones in plant responses to stresses. In Plant responses to environmental stresses: from phytohormones to genome reorganization. H. R. Lerner, ed., Marcel Dekker Inc., New York, 287-301 Ito, J., and Fukuda, H. (2002) ZEN1 is a key enzyme in the degradation of nuclear DNA during programmed cell death of tracheary elements. Plant Cell 12, 3201-3211 Iwasaki, T., and Shibaoka, H. (1991) Brassinosteroids act as regulators of tracheary-element differentiation in isolated Zinnia mesophyll cells. Plant Cell Physiol. 32, 1007-1014. Jabs, T., Dietrich, R. A., and Dangl, J. L. (1996) Initiation of runaway cell death in an Arabidopsis mutant by extracellular superoxide. Science 273, 1853-1856. Jackson, R. W., Mansfield, J. W., Ammouneh, H., Dutton, L. C., Wharton, B., Ortiz-Barredo, A., Arnold, D. L., Tsiamis, G., Sesma, A., Butcher, D., Boch, J., Kim, Y. J., Martin, G. B., Tegli, S., Murillo, J., and Vivian, A. (2002). Location and activity of members of a family of virPphA homologues in pathovars of Pseudomonas syringae and P. savastanoi. Mol. Plant Pathol. 3, 205-216. Ji, C., Boyd, C., Slaymaker, D., Okinawa, T., Takeuchi, Y., Midland, S. L., Sims, J. J., Herman, E., and Keen, N. (1998) Characterisation of a 34-kDa soybean binding protein for the syringolide elicitors. Proc. Natl. Acad. Sci. USA 95, 3306-3311. Jin, C., and Reed, J. C. (2002). Yeast and apoptosis. Nat. Rev. Mol. Cell Biol. 3, 453-459. Johal, G. S., Hulbert, S. H., and Briggs, S. P. (1995) Disease lesion mimics of maize: a model for cell death in plants. BioEssays 17, 685-692. John, I., Drake, R., Farrell, A., Cooper, W., Lee, P., Horton, P., and Grierson, D. (1995) Delayed leaf senescence in ethylene-deficient ACC oxidase antisense tomato plants: molecular and physiological analysis. Plant J 7, 483-490. Jonak, C., Okresz, L., Bogre, L., and Hirt, H. (2002) Complexity, cross talk and integration of plant MAP kinase signalling. Curr Opin Plant Biol. 5, 415-424. Jones, C., Ciacci-Zanella, J.R., Zhang, Y., Henderson, G., and Dickman, M.B. 2001. Analysis of fumonisin induced apoptosis. Environmental Health Perspectives 109:1-7. Katsuhara M (1997) Apoptosis-like cell death in barley roots under salt stress. Plant Cell Physiol. 38, 1091-1093. Katsuhara, M., and Shibasaka, M. (2000) Cell death and growth recovery of barley after transient salt stress. J. Plant Res. 113, 239-243. Kawai, M., Pan, L., Reed, J. C., and Uchimiya, H. (1999) Evolutionally conserved plant homologue of the Bax inhibitor-1 (BI-1) gene capable of suppressing Bax-induced cell death in yeast. FEBS Lett. 464, 143-147. Kearney, B., and Staskawicz, B. J. (1990) Widespread distribution and fitness contribution of Xanthomonas campestris avirulence gene avrBs2. Nature 346, 385-386. Kidd, D., Liu, Y., and Cravatt, B. F. (2001) Profiling serine hydrolase activities in complex proteomes. Biochemistry 40, 4005-4015. Kim, P. K., Kwon, Y. G., Chung, H. T., and Kim, Y. M. (2002a) Regulation of caspases by nitric oxide. Ann. N. Y. Acad. Sci. 962, 42-52.

144


Kim, M. C., Panstruga, R., Elliott, C., Muller, J., Devoto, A., Yoon, H. W., Park, H. C., Cho, M. J., and Schulze-Lefert, P. (2002b) Calmodulin interacts with MLO protein to regulate defence against mildew in barley. Nature 416, 447-450. Kim, M. C., Lee, S. H., Kim, J. K., Chun, H. J., Choi, M. S., Chung, W. S., Moon, B. C., Kang, C. H., Park, C. Y., Yoo, J. H., Kang, Y. H., Koo, S. C., Koo, Y. D., Kung, J. C., Kim, S. T., Schulze-Lefert, P., Lee, S. Y., and Cho, M. J. (2002c) Mlo, a modulator of plant defense and cell death, is a novel calmodulin-binding protein. Isolation and characterization of a rice Mlo homologue. J. Biol. Chem. 277, 19304-19314. Kim, Y. J., Lin, N. C., and Martin, G. B. (2002d). Two distinct Pseudomonas effector proteins interact with the Pto kinase and activate plant immunity. Cell 109, 589-598. Kim, M., Ahn, J. W., Jin, U. H., Choi, D., Paek, K. H., and Pai, H. S. (2003) Activation of the programmed cell death pathway by inhibition of proteasome function in plants. J. Biol. Chem. 278, 19406-19415. Kitagawa, K., Skowyra, D., Elledge, S. J., Harper, J. W., and Hieter, P. (1999) SGT1 encodes an essential component of the yeast kinetochore assembly pathway and a novel subunit of the SCF ubiquitin ligase complex. Mol. Cell 4, 21-33. Kliebenstein, D. J., Dietrich, R. A., Martin, A. C., Last, R. L., and Dangl, J. L. (1999) LSD1 regulates salicylic acid induction of copper zinc superoxide dismutase in Arabidopsis thaliana. Mol. Plant-Microbe Interact. 12, 1022-1026. Kloek, A. P., Verbsky, M. L., Sharma, S. B., Schoelz, J. E., Vogel, J., Klessig, D. F., and Kunkel, B. N. (2001). Resistance to Pseudomonas syringae conferred by an Arabidopsis thaliana coronatine-insensitive (coi1) mutation occurs through two distinct mechanisms. Plant J. 26, 509-522. Koch, J. R., Creelman, R. A., Eshita, S. M., Seskar, M., Mullet, J. E., and Davis, K. R. (2000) Ozone sensitivity in hybrid poplar correlates with insensitivity to both salicylic acid and jasmonic acid. The role of programmed cell death in lesion formation. Plant Physiol. 123, 487-496. Kooman-Gersmann, M., Honee, G., Bonnema, G., and De Wit, P. G. J. M. (1996). A highaffinity binding site for the AVR9 peptide elicitor of Cladosporium fulvum is present on plasma membranes of tomato and other Solanaceous plants. Plant Cell 8, 929-938. Koukalova, B., Kovarik, A., Fajkus, J., and Siroky, J. (1997) Chromatin fragmentation associated with apoptotic changes in tobacco cells exposed to cold stress. FEBS Lett. 414, 289-292. Kruft, V., Eubel, H., Jansch, L., Werhahn, W., and Braun, H. P. (2001) Proteomic approach to identify novel mitochondrial proteins in Arabidopsis. Plant Physiol. 127, 1694-1710. Kuo, A., Cappelluti, S., Cervantes-Cervantes, M., Rodriguez, M., and Bush, D. S. (1996) Okadaic acid, a protein phosphatase inhibitor, blocks calcium changes, gene expression, and cell death induced by gibberellin in wheat aleurone cells. Plant Cell 8, 259-269. Lacomme, C., and Santa-Cruz, S. (1999) Bax-induced cell death in tobacco is similar to the hypersensitive response. Proc. Natl. Acad. Sci. U.S.A. 96, 7956-7961. Lam, E., Kato, N. and Lawton, M. (2001) Programmed cell death, mitochondria and the plant hypersensitive response. Nature 411, 848-853 Lane, B. G. (2002) Oxalate, germins, and higher-plant pathogens. IUBMB Life 53, 67-75. Larkindale, J., and Knight, M. R. (2002) Protection against heat stress-induced oxidative damage in Arabidopsis involves calcium, abscisic acid, ethylene, and salicylic acid. Plant Physiol. 128, 682-695. Lecourieux, D., Mazars, C., Pauly, N., Ranjeva, R., and Pugin, A. (2002) Analysis and effects of cytosolic free calcium increases in response to elicitors in Nicotiana plumbaginifolia cells. Plant Cell 14, 2627-2641.


145

Lee, J. C., and Peter, M. E. (2002). Regulation of apoptosis by ubiquitinylation. Immunol. Reviews 193, 39-47. Leister, R. T., and Katagiri, F. (2000) A resistance gene product of the nucleotide binding site-leucine-rich repeat class can form a complex with bacterial avirulence proteins in vivo. Plant J. 22, 345-354. Levine A, Pennell RI, Alvarez ME, Palmer R, Lamb C (1996) Calcium-mediated apoptosis in a plant hypersensitive resistance response. Curr. Biol. 6, 427-437. Li, F., Srinivasan, A., Wang, Y., Armstrong, R. C., Tomaselli, K. J., and Fritz, L. C. (1997) Cell-specific induction of apoptosis by microinjection of cytochrome c. Bcl-xL has activity independent of cytochrome c release. J. Biol. Chem. 272, 30299-30305. Li, X., Marani, M., Mannucci, R., Kinsey, B., Andriani, F., Nicoletti, I., Denner, L., and Marcelli, M. (2001). Overexpression of BCL-X(L) underlies the molecular basis for resistance to staurosporine-induced apoptosis in PC-3 cells. Cancer Res. 61, 1699-1706. Ligterink, W. (2000) MAP kinases in plant signal transduction: how many, and what for? Results Probl. Cell Differ. 27, 11-27. Lin, A. (2002). Activation of the JNK signaling pathway: breaking the brake on apoptosis. BioEssays 25, 17-24. Lincoln, J. E., Richael, B., Overduin, B., Smith, K., Bostock, R., and Gilchrist, D. G. (2002) Expression of the antiapoptotic baculovirus p35 gene in tomato blocks programmed cell death and provides broad-spectrum resistance to disease. Proc. Natl. Acad. Sci. U.S.A. 99, 15217-15521. Lord, S. J., Rajotte, R. V., Korbutt, G. S., and Bleackley, R. C. (2003) Granzyme B: a natural born killer. Immunol. Reviews 193, 31-38. Luderer, R., Rivas, S., Nurnberger, T., Mattei, B., Hooven, H. W. V. d., Hoorn, R. A. V. d., Romeis, T., Wehrfritz, J. M., Blume, B., Nennstiel, D., Zuidema, D., Vervoort, J., Lorenzo, G. D., Jones, J. D., Wit, P. J. D., and Joosten, M. H. (2001) No evidence for binding between resistance gene product Cf-9 of tomato and avirulence gene product AVR9 of Cladosporium fulvum. Mol. Plant Microbe Interact. 14, 867-876. Lui, H. M., Chen, J., Wang, L., and Naumovski, L. (2003) ARMER, apoptotic regulator in the membrane of the endoplasmic reticulum, a novel inhibitor of apoptosis. Mol. Cancer Res. 1, 508-518. Lund, S. T., Stall, R. E., and Klee, H. J. (1998) Ethylene regulates the susceptible response to pathogen infection in tomato. Plant Cell 10, 371-382. Mach, J. M., Castillo, A. R., Hoogstraten, R., and Greenberg, J. T. (2001) The Arabidopsisaccelerated cell death gene ACD2 encodes red chlorophyll catabolite reductase and suppresses the spread of disease symptoms. Proc. Natl. Acad. Sci. USA 98, 771-776. Mackey, D., Holt, B. F., Wiig, A., and Dangl, J. L. (2002). RIN4 interacts with Pseudomonas syringae type III effector molecules and is required for RPM1-mediated resistance in Arabidopsis. Cell 108, 743-754. Mackey, D., Belkhadir, Y., Alonso, J. M., Ecker, J. R., and Dangl, J. L. (2003). Arabidopsis RIN4 is a target of the type III virulence effector AvrRpt2 and modulates RPS2-mediated resistance. Cell 112, 379-389. Madeo, F., Frohlich, E., Ligr, M., Grey, M., Sigrist, S. J., Wolf, D. H., and Frohlich, K. U. (1999). Oxygen stress: a regulator of apoptosis in yeast. J. Cell. Biol. 145, 757-767. Marcelli, M., Marani, M., Li, X., Sturgis, L., Haidacher, S. J., Trial, J. A., Mannuci, R., Nicoletti, I., and Denner, L. (2000). Heterogeneous apoptotic responses of prostate cancer cell lines identify an association between sensitivity to staurosporine-induced apoptosis, expression of Bcl-2 family members, and caspase activation. Prostate 42, 260-273. Martins, L. M. (2002). The serine protease Omi/HtrA2: a second mammalian protein with a Reaper-like function. Cell Death Differ. 9, 699-701.

146


Matsumara, H., Nirasawa, S., Kiba, A., Urasaki, N., Saitoh, H., Ito, M., Kawai-Yamada, M., Uchimiya, H., and Terauchi, R. (2003) Overexpression of Bax inhibitor suppresses the fungal elicitor-induced cell death in rice (Oryza sativa L) cells. Plant J. 33, 425-434. Mayama, S., Tani, T., Ueno, T., Midland, S. L., Simms, J. J., and Keen, N. T. (1985) Association of avenalumin accumulation with co-segregation of victorin sensitivity and crown rust resistance in oat lines carrying the Pc-2 gene. Physiol. Mol. Plant Pathol. 46, 263-274. McCabe, P. F., Levine, A., Meijer, P.-J., Tapon, N. A., and Pennell, R. I. (1997) A programmed cell death pathway activated in carrot cells cultured at low cell density. Plant J. 12, 267-280. Millar, A. H., Sweetlove, L. J., Giege, P., and Leaver, C. J. (2001) Analysis of the Arabidopsis mitochondrial proteome. Plant Physiol. 127, 1711-1727. Minami, A., and Fukuda, H. (1995) Transient and specific expression of a cysteine endopeptidase associated with autolysis during differentiation of Zinnia mesophyll cells into tracheary elements. Plant Cell. Physiol. 36, 1599-1606. Mitsuhara, I., Malic, A. M., Miura, M., and Ohashi, Y. (1999) Animal cell death suppressors Bcl-xl and Ced-9 inhibit cell death in tobacco plants. Curr. Biol. 9, 775-778. Mittler, R., and Lam, E. (1995) In situ detection of nDNA fragmentation during the differentiation of tracheary elements in higher plants. Plant Physiol. 108, 489-493. Mittler, R., Simon, L., and Lam, E. (1997) Pathogen-induced programmed cell death in tobacco. J. Cell. Sci. 110, 1333-1344. Mlejnek, P. and Prochazka, S. (2002) Activation of caspase-like proteases and induction of apoptosis by isopentenyladenosine in tobacco BY-2 cells. Planta. 215, 158-66 Moeder, W., Barry, C. S., Tauiainen, A. A., Betz, C., Tuomainen, J., Utriainen, M., Grierson, D., Sandermann, H., Langebartels, C., and Kangasjarvi, J. (2002) Ethylene synthesis regulated by biphasic induction of 1-aminocyclopropane-1-carboxylic acid synthase and 1aminocyclopropane-1-carboxylic acid oxidase genes is required for hydrogen peroxide accumulation and cell death in ozone-exposed tomato. Plant Physiol. 130, 1918-1926. Molina, A., Volrath, S., Guyer, D., Maleck, K., Ryals, J., and Ward, E. (1999) Inhibition of protoporphyrinogen oxidase expression in Arabidopsis causes a lesion-mimic phenotype that induces systemic acquired resistance. Plant J. 17, 667-678. Moore, T., Martineau, B., Bostock, R. M., Lincoln, J. E., and Gilchrist, D. G. (1999) Molecular and genetic characterisation of ethylene involvement in mycotoxin-induced plant cell death. Physiol. Molec. Plant Pathol 42, 359-371. Mothes, K., and Engelbrecht, L. (1961) Kinetin-induced directed transport of substances in excised leaves in the dark. Phytochem. 1, 58-62. Mou, Z., He, Y., Dai, Y., Liu, X., and Li, J. (2000). Deficiency in fatty acid synthase leads to premature cell death and dramatic alterations in plant morphology. Plant Cell 12, 405-417. Navarre, D. A., and Wolpert, T. J. (1999) Victorin induction of an apoptotic/senescence-like response in oats. Plant Cell 11, 237-249. Newmeyer, D. D., Farschon, D. M., and Reed, J. C. (1994). Cell-free apoptosis in Xenopus egg extracts: inhibition by Bcl-2 and requirement for an organelle fraction enriched in mitochondria. Cell 79, 353-364. Nooden, L. D. (1988) The phenomena of senescence and aging. In Senescence and aging in plants. L. D. Nooden and A. C. Leopold, eds. Academic Press. 1-50. Obara, K., Kuriyama, H., and Fukuda, H. (2001) Direct evidence of active and rapid nuclear degradation triggered by vacuole rupture during programmed cell death in Zinnia. Plant Physiol. 125, 615-626. O'Brien, I. E. W., Baguley, B. C., Murray, B. G., Morris, B. A. M., Ferguson, I. B. (1998) Early stages of the apoptotic pathway in plant cells are reversible. Plant J. 13, 803-814.


147

O'Donnell, P. J., Jones, J. B., Antoine, F. R., Ciardi, J. and Klee H. J. (2001) Ethylenedependent salicylic acid regulates an expanded cell death response to a plant pathogen. Plant J. 25, 315-23. O'Donnell, P. J., Schmelz, E. A., Moussatche, P., Lund, S. T., Jones, J. B. and Klee, H. J. (2003) Susceptible to intolerance--a range of hormonal actions in a susceptible Arabidopsis pathogen response. Plant J. 33, 245-57 Olson, M. R., Holley, C. L., Yoo, S. J., Huh, J. R., Hay, B. A., Kornbluth, S. (2003) Reaper is regulated by IAP-mediated ubiquitinylation. J. Biol. Chem. 278, 4028-4034 Orvar, B. L., McPherson, J., and Ellis, B. E. (1997) Pre-activating wounding response in tobacco prior to high-level ozone exposure prevents necrotic injury. Plant J 11, 203-212. Orzaez, D., and Granell, A. (1997) The plant homologue of the defender against apoptotic death gene is down-regulated during senescence of flower petals. FEBS Lett. 404, 275278. Orzaez, D., Blay, R., and Granell, A. (1999) Programme of senescence in petals and carpels of Pisum sativum L. flowers and its control by ethylene. Planta 208, 220-226. Otsuki, Y., Li, Z. and Shibata, M. A. (2003) Apoptotic detection methods--from morphology to gene. Prog Histochem Cytochem. 38, 275-339. Overmyer, K., Tuominen, H., Kettunen, R., Betz, C., Langebartels, C., Sandermann, H., and Kangasjarvi, J. (2000) Ozone-sensitive arabidopsis rcd1 mutant reveals opposite roles for ethylene and jasmonate signaling pathways in regulating superoxide-dependent cell death. Plant Cell 12, 1849-1862. Pan, J.-W., Zhu, M.-Y., and Chen, H. (2001) Aluminium-induced cell death in root-tip cells of barley. Envir. Exper. Bot. 46, 71-79. Peart, J. R., Lu, R., Sadanandom, A., Malcuit, I., Moffett, P., Brice, D. C., Schauser, L., Jaggard, D. A., Xiao, S., Coleman, M. J., Dow, M., Jones, J. D., Shirasu, K., and Baulcombe, D. C. (2002) Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants. Proc. Natl. Acad. Sci. U. S. A. 99, 10865-10869. Peltier, J. B., Friso, G., Kalume, D. E., Roepstorff, P., Nilsson, F., Adamska, I., and Van Wijk, K. J. (2000) Proteomics of the chloroplast: systematic identification and targeting analysis of lumenal and peripheral thylakoid proteins. Plant Cell 12, 319-341. Picton, S., Barton, S. L., Bouzayen, M., Hamilton, A. J., and Grierson, D. (1993) Altered fruit ripening and leaf senescence in tomatoes expressing an antisense ethylene-forming enzyme transgene. Plant J 3, 469-481. Pilloff, R. K., Devadas, S. K., Enyedi, A., and Raina, R. (2002) The Arabidopsis gain-offunction mutant dll1 spontaneously develops lesions mimicking cell death associated with disease. Plant J. 30, 61-70. Prime, T. A., Sherrier, D. J., Mahon, P., Packman, L. C., and Dupree, P. (2001) A proteomic analysis of organelles from Arabidopsis thaliana. Electrophoresis 21, 3488-3499. Qiao, J., Mitsuhara, I., Yazaki, Y., Sakano, K., Gotoh, Y., Miura, M., and Ohashi, Y. (2002) Enhanced resistance to salt, cold and wound stresses by overproduction of animal cell death suppressors Bcl-xL and Ced-9 in tobacco cells - their possible contribution through improved function of organella. Plant Cell Physiol. 43, 992-1005. Quirino, B. F., Noh, Y.-S., Himelblau, E., and Amasino, R. M. (2000) Molecular aspects of leaf senescence. Tr. Plant Sci. 5, 278-282. Raff, M. C. (1992) Social controls on cell survival and cell death. Nature 356, 397-400 Rao, M. V., and Davis, K. R. (2001) The physiology of ozone-induced cell death. Planta 213, 682-690. Rao, M. V., and Davis, K. R. (1999) Ozone-induced cell death occurs via two distinct mechanisms. The role of salicylic acid. Plant J 16, 603-614.

148


Rao, M. V., Lee, H., Creelman, R. A., Mullet, J. E., and Davis, K. R. (2000) Jasmonic acid signaling modulates ozone-induced hypersensitive cell death. Plant Cell 12, 1633-1646. Rao, M. V., Lee, H. I., and Davis, K. R. (2002) Ozone-induced ethylene production is dependent on salicylic acid, and both salicylic acid and ethylene act in concert to regulate ozone-induced cell death. Plant J 32, 447-456. Rathjen, J. P., Chang, J. H., Staskawicz, B. J., and Michelmore, R. W. (1999). Constitutively active Pto induces a Prf-dependent hypersensitive response in the absence of avrPto. EMBO J 18, 3232-3240. Raven, P. R., Evert, R. F., H. Curtis (1976) Biology of plants, second edition. Worth Publishers Inc. 391-497. Reed, J.R. 1997. Cytochrome c: Can’t live with it – can’t live without it. Cell 91, 559-562 Ren, D., Yang, H., and Zhang, S. (2002) Cell death mediated by MAPK is associated with hydrogen peroxide production in Arabidopsis. J Biol Chem. 277, 559-565. Richael, C., Lincoln, J. E., Bostock, R. M., and Gilchrist, D. G. (2001) Caspase inhibitors reduce symptom development and limit bacterial proliferation in susceptible plant tissues. Physiol. Molec. Plant Pathol. 59, 213-221. Rubenstein, B. (2000) Regulation of cell death in flower petals. Plant Mol. Biol. 44, 303-318. Rines, H. W., and Luke, H. H. (1985) Selection and regeneration of toxin-sensitive plants from tissue cultures of oats (Avena sativa) susceptible to Helminthosporum victoriae. Theor. Appl. Genet. 71, 16-21. Ritter, C., and Dangl, J. L. (1995) The avrRpm1 gene of Pseudomonas syringae pv. maculicola is required for virulence on Arabidopsis. Mol. Plant Microbe Interact. 8, 444453. Rivas, S., Romeis, T., and Jones, J. D. (2002a) The Cf-9 disease resistance protein is present in an approximately 420-kilodalton heteromultimeric membrane-associated complex at one molecule per complex. Plant Cell 14, 689-702. Rivas, S., Mucyn, T., Van Den Burg, H. A., Vervoort, J., and Jones, J. D. (2002b) An approximately 400 kDa membrane-associated complex that contains one molecule of the resistance protein Cf-4. Plant J. 29, 783-796. Ronald, P. C., Salmeron, J. M., Carland, F. M., and Staskawicz, B. J. (1992). The cloned avirulence gene avrPto induces disease resistance in tomato cultivars containing the Pto resistance gene. J. Bacteriol. 174, 1604-1611. Roulston, A., Marcellus, R. C., and Branton, P. E. (1999). Viruses and apoptosis. Annu. Rev. Microbiol. 53, 577-628. Runeberg-Roos, P., and Saarma, M. (1998) Phytepsin, a barley vacuolar aspartic proteinase, is highly expressed during autolysis of developing tracheary elements and sieve cells. Plant J. 15, 139-145. Ryerson, D. E., and Heath, M. C. (1996). Cleavage of nuclear DNA into oligonucleosomal fragments during cell death induced by fungal infection or by abiotic treatments. Plant Cell 8, 393-402. Salchert, K., Bhalerao, R., Koncz-Kalman, Z., and Koncz, C. (1998). Control of cell elongation and stress responses by steroid hormones and carbon catabolic repression in plants. Philos. Trans. R. Soc. Lond. B Biol. Sci. 353. Samuel, M. A., and Ellis, B. E. (2002) Double jeopardy: both overexpression and suppression of a redox-activated plant mitogen-activated protein kinase render tobacco plants ozone sensitive. Plant Cell 14, 2059-2069. Samuilov, V. D., Lagunova, E. M., Dzyubinskaya, E. V., Izyumov, D. S., Kiselevsky, D. B., and Makarova, Y. V. (2002) Involvement of chloroplasts in the programmed death of plant cells. Biochemistry (Mosc.) 67, 627-634.


149

Sanchez, P., de Torres Zabala, M., and Grant, M. (2000) AtBI-1, a plant homologue of Bax inhibitor-1, suppresses Bax-induced cell death in yeast and is rapidly upregulated during wounding and pathogen challenge. Plant J. 21, 393-399. Saviani, E. E., Orsi, C. H., Oliveira, J. F., Pinto-Maglio, C. A., and Salgado, I. (2002). Participation of the mitochondrial permeability transition pore in nitric oxide-induced plant cell death. FEBS Lett. 510, 136-140. Schmid, M., Simpson, D., and Gletl, C. (1999) Programmed cell death in castor bean endosperm is associated with the accumulation and release of a cysteine endopeptidase from ricinosomes. Proc. Natl. Acad. Sci. U.S.A. 96, 14159-14164. Schraudner, M., Langebartles, C., and Sandermann, H. (1997). Changes in the biochemical status of plant cells induced by the environmental pollutant ozone. Physiol. Plant. 100, 274-280.. Shah, J., Kachroo, P., and Klessig, D. F. (1999) The arabidopsis ssi1 mutation restores pathogenesis-related gene expression in npr1 plants and renders defensin gene expression salicylic acid dependent. Plant Cell 11, 191-206. Shirasu, K., Lahaye, T., Tan, M.-W., Zhou, F., Azevedo, C., and Schulze-Lefert, P. (1999) A novel class of eukaryotic zinc-binding proteins is required for disease resistance signaling in barley and development in C. elegans. Cell 99, 355-366. Simons, B. H., and Lambers, H. (1999). The alternative oxidase: is it a respiratory pathway allowing a plant to cope with stress? In: Plant responses to environmental stresses: from phytohormones to genome reorganization. H. R. Lerner, ed., Marcel Dekker Inc., New York. 265-286. Solomon, M., Belenghi, B., Delledonne, M., Menachem, D., and Levine, A. (1999) The involvement of cysteine proteases and protease inhibitor genes in the regulation of programmed cell death in plants. Plant Cell 11, 431-443. Somerville, C., and Somerville, S. (1999). Plant functional genomics. Science 285, 380-383. Spassieva, S. D., Markham, J. E., and Hille, J. (2002) The plant disease resistance gene Asc-1 prevents disruption of sphingolipid metabolism during AAL-toxin-induced programmed cell death. Plant J. 32, 561-572. Staskawicz, B. J., Ausubel, F. M., Baker, B. J., Ellis, J. G., and Jones, J. D. (1995) Molecular genetics of plant disease resistance. Science 268, 661-667. Stein, J. C., and Hansen, G. (1999) Mannose induces an endonuclease responsible for DNA laddering in plant cells. Plant Physiol. 121, 71-79. Stein, M., and Somerville, S. C. (2002) MLO, a novel modulator of plant defenses and cell death, binds calmodulin. Trends Plant Sci. 7, 379-380. Stone, J. M., Heard, J. E., Asai, T., and Ausubel, F. M. (2000). Simulation of fungal-mediated cell death by fumonisin B1 and selection of fumonisin B1-resistant (fbr) Arabidopsis mutants. Plant Cell 12, 1811-1822. Strasser, A., O’Conner, L. and Dixit, V.M. (2000) Apoptosis signaling. Ann. Rev. Biochem. 69, 217-245 Subbaiah, C., Kollipara, K. P., and Sachs, M. M. (1999) A Ca2+-dependent cysteine protease is associated with anoxia-induced root tip death in maize. J. Exp. Bot. 51, 721-731. Swidzinski, J. A., Sweetlove, L. J., and Leaver, C. J. (2002) A custom microarray analysis of gene expression during programmed cell death in Arabidopsis thaliana. Plant J. 30, 431446. Tameling, W. I., Elzinga, S. D., Darmin, P. S., Vossen, J. H., Takken, F. L., Haring, M. A., and Cornelissen, B. J. (2002) The tomato R gene products I-2 and MI-1 are functional ATP binding proteins with ATPase activity. Plant Cell 14, 2929-2939.

150


Tian, R.-H., Zhang, G.-Y., Yan, C.-H., and Dai, Y.-R. (2000) Involvement of poly(ADPribose) polymerase and activation of caspase-3-like protease in heat shock-induced apoptosis in tobacco suspension cells. FEBS Lett. 474, 1-15. Tor, M., Gordon, P., Cuzick, A., Eulgem, T., Sinapidou, E., Mert-Turk, F., Can, C., Dangl, J. L., and Holub, E. B. (2002) Arabidopsis SGT1b is required for defense signaling conferred by several powdery mildew resistance genes. Plant Cell 14, 993-1003. Tornero, P., Merritt, P., Sadanandom, A., Shirasu, K., Innes, R. W., and Dangl, J. L. (2002) RAR1 and NDR1 contribute quantitatively to disease resistance in Arabidopsis and their relative contributions are dependent on the R gene assayed. Plant Cell 14, 105-1015. Townsend, P. A., Cutress, R. I., Sharp, A., Brimmell, M., and Packham, G. (2003). BAG-1: a multifunctional regulator of cell growth and survival. Biochim. Biophys. Acta. 1603, 8398. Trotochaud, A. E., Hao, T., Wu, G., Yang, Z., and Clark, S. E. (1999) The CLAVATA1 receptor-like kinase requires CLAVATA3 for its assembly into a signaling complex that includes KAPP and a Rho-related protein. Plant Cell 11, 393-406. Turner, J. G., Ellis, C., and Devoto, A. (2002) The jasmonate signal pathway. Plant Cell 14, S153-S164. Ueda, J., and Kato, J. (1980). Isolation and identification of a senescence-promoting substance from wormwood (Artemisia absintuim L. ). Plant Physiol. 66, 246-249. Van der Biezen, E. A., and Jones, J. D. (1998). The NB-ARC domain: a novel signalling motif shared by plant resistance gene products and regulators of cell death in animals. Curr. Biol. 8, R226-R227. Van Loo, G., Saelens, X., Van Gurp, M., MacFarlane, M., Martin, S. J. and Vandenabeele, P. (2002) The role of mitochondrial factors in apoptosis: a Russian roulette with more than one bullet. Cell Death Differ. 9, 1031-1042 Van Wees, S. C. M., Luijendijk, M., Smoorenburg, I., Van Loon, L. C. and Pieterse, C. M. J. (1999). Rhizobacteria-mediated induced systemic resistance (ISR) in Arabidopsis is not associated with a direct effect on expression of known defense-related genes but stimulates the expression of the jasmonate-inducible gene Atvsp upon challenge. Plant Mol. Biol. 41, 537-549. Van Wees, S. C., and Glazebrook, J. (2003) Loss of non-host resistance of Arabidopsis NahG to Pseudomonas syringae pv. phaseolicola is due to degradation products of salicylic acid. Plant J. 33, 733-742. Vercammen, D., Van de Cotte, B., Vandepoele, K., Declercq, W., Dejaeger, G., Edkhout, D., Inze, D., and Van Breusegem, F. (2003) Cloning and characterisation of the family of Arabidopsis thaliana metacaspases. In Plant biology: functions and control of cell death. J. Dangl, P. Schulze-Lefert and J. Glazebrook, eds., Keystone Symposia, Snowbird, Utah, 60. Vernooij, B., Uknes, S., Ward, E., and Ryals, J. (1994) Salicylic acid as a signal molecule in plant-pathogen interactions. Curr. Opin. Cell Biol. 6, 275-279. Wan, L., Xia, Q., Qiu, X., and Sevaraj, G. (2002) Early stages of seed development in Brassica napus: a seed coat-specific cysteine proteinase associated with programmed cell death of the inner integument. Plant J. 30, 1-10. Wang, H., Li, J., Bostock, R. M., Gilchrist, D. G. (1996a) Apoptosis: a functional paradigm for programmed plant cell death induced by a host-selective phytotoxin and invoked during development. Plant Cell 8, 375-391. Wang, H., Jones, C., Ciacci-Zanella, J., Holt, T., Gilchrist, D. G., Dickman, M. B. (1996b) Fumonisins and Alternaria alternata lycopersici toxins: sphinganine analog mycotoxins induce apoptosis in monkey kidney cells. Proc. Natl. Acad. Sci. U. S. A. 93, 3461-3465.


151

Wang, M., Oppedijk, B. J., Lu, X., Van Duijn, B., and Schilperoort, R. A. (1996c). Apoptosis in barley aleurone during germination and its inhibition by abscisic acid. Plant Mol. Biol. 32, 1125-1134. Wang, M., Hoekstra, S., Van Bergen, S., Lamers, G. E., Oppendijk, B. J., Van der Heijden, M. W., De Priester, W. and Schilperoort, R. A. (1999) Apoptosis in developing anthers and the role of ABA in this process during androgenesis in Hordeum vulgare L. Plant Mol. Biol., 39, 489-501. Wang, X., Yang, C., Chai, J., Shi, Y., and Xue, D. (2002). Mechanisms of AIF-mediated apoptotic DNA degradation in Caenorhabditis elegans. Science 298, 1587-1592. Woffenden, B. J., Freeman, T. B., and Beers, E. P. (1998) Proteasome inhibitors prevent tracheary element differentiation in Zinnia mesophyll cell cultures. Plant Physiol. 118, 419-430. Wojtaszek, P. (1997) Oxidative burst: an early response to pathogen infection. Biochem. J. 322, 681-692 Wolpert, T. J., and Macko, V. (1989) Specific binding of victorin to a 100-kD protein from oats. Proc. Natl. Acad. Sci. U. S. A. 86, 4092-4096. Wolpert, T. J., Macko, V., Acklin, W., Jaun, B., Seibl, J., Meili, J., and Arigoni, D. (1994) Identification of the 100-kD victorin-binding protein from oats. Plant Cell 6, 1145-1155. Wolpert, T. J., Dunkle, L. D., and Ciuffetti, L. M. (2002). Host-selective toxins and avirulence determinants: what's in a name. Annu. Rev. Phytopathol. 40, 251-285. Woo, H. R., Chung, K. M., Park, J. H., Oh, S. A., Ahn, T., Hong, S. H., Jang, S. K., and Nam, H. G. (2001) ORE9, an F-box protein that regulates leaf senescence in Arabidopsis. Plant Cell 13, 1779-1790. Wu, H.-M., and Cheung, A. Y. (2000) Programmed cell death in plant reproduction. Plant Mol. Biol. 44, 267-281. Xu, H., and Heath, M. C. (1998) Role of calcium in signal transduction during the hypersensitive response caused by basidiospore-derived infection of the cowpea rust fungus. Plant Cell 10, 585-598. Xu, Q., and Reed, J. C. (1998) Bax inhibitor-1, a mammalian apoptosis suppressor identified by functional screening in yeast. Mol. Cell 1, 337-346. Xu, F.-X., and Chye, M.-L. (1999) Expression of cysteine proteinase during developmental events associated with programmed cell death in brinjal. Plant J. 17, 321-327. Yamamoto, R., Demura, T., and Fukuda, H. (1997) Brassinosteroids induce entry into the final stage of tracheary element differentiation in cultured Zinnia cells. Plant Cell Physiol. 38, 980-983. Ye, Z.-H., and Varner, J. E. (1996). Induction of cysteine and serine proteases during xylogenesis in Zinnia elegans. Plant Mol. Biol. 30, 1233-1246. Young, T. E., Gallie, D. R., and DeMason, D. A. (1997) Ethylene-mediated programmed cell death during maize endosperm development of Su and sh2 genotypes. Plant Physiol. 115, 737-751. Young, T. E., and Gallie, D. R. (1999) Analysis of programmed cell death in wheat endosperm reveals differenes in endosperm development between cereals. Plant Mol. Biol. 39, 915-926. Yu, I. C., Parker, J. and Bent, A. F. (1998) Gene-for-gene resistance without the hypersensitive response in Arabidopsis dnd1 mutant. Proc. Natl. Acad. Sci. U. S. A. 95, 7819-7824. Yu, L.-H., Kawai-Yamada, M., Naito, M., Watanabe, K., Reed, J. C., and Uchimiya, H. (2002) Induction of mammalian cell death by a plant Bax inhibitor. FEBS Lett. 512, 308312.

152


Zhang, S., and Klessig, D. F. (2001) MAPK cascades in plant defense signaling. Trends Plant Sci. 6, 520-527. Zhivotovsky, B., Orrenius, S., Brustugun, O. T., and Doskeland, S. O. (1998). Injected cytochrome C induces apoptosis. Nature 391, 449-450. Zhou, Q., Snipas, S., Orth, K., Muzio, M., Dixit, V. M., and Salvesen, G. S. (1997). Target protease specificity of the viral serpin CrmA. Analysis of five caspases. J. Biol. Chem. 272, 7797-7800. Zimmermann, K. C., Ricci, J. E., Droin, N. M., and Green, D. R. (2002). The role of ARK in stress-induced apoptosis in Drosophila cells. J. Cell. Biol. 156, 1077-1087

6.

A SYSTEMS VIEW OF CELL DEATH

JEFFREY VARNER AND MARTIN FUSSENEGGER* Institute of Biotechnology - Swiss Federal Institute of Technology, ETH Hönggerberg, HPT D74, CH-8093 Zurich, Switzerland * Corresponding author, Tel.: +41 1 633 3448, Fax: +41 1 633 1051, E-mail: [email protected]

1.

Introduction

Programmed cell death or apoptosis plays a critical role in nature. It is a process by which the cell commits suicide when malfunctions occur, arising from cell stress, cell damage or conflicting cell division signals (Evanand Littlewood, 1998). Cell suicide is also required during normal embryonic development as tissues are sculpted. However, too much or not enough apoptosis can be very harmful. For example, many cancers are difficult to eradicate because they fail to respond to apoptotic signals. Conversely, neurodegenerative disorders such as Parkinson’s, Alzheimer’s and Hungtington’s diseases are characterized by excessive apoptotic activity in certain classes of neurons (Thompson, 1995; Haass, 1999). Autoimmune disorders and central immune system phenomena such as the elimination of selfreactive lymphocytes, the destruction of virus-infected T-cells and the elimination of active immune cells after successful immune response are also strongly linked with cell death activity (Ashkenazi and Dixit, 1998). Central to apoptotic cell death is a family of proteases termed caspases (cysteine-containing aspartate-specific proteases). A more complete picture of the intriguing role these unique enzymes play in apoptosis is beginning to emerge, and has recently been outlined (Adams and Cory, 1998; Ashkenazi and Dixit, 1998). Under normal circumstances caspases are present as inactive proteins termed zymogens or procaspases, which themselves must be activated. However, once activated they seek out and dismantle key protein targets by making selective cuts after aspartate residues. The activation of these powerful enzymes (whose inactive forms are constitutively expressed) is regulated at a number of points. Hence, a cascade of events must occur before a cell is irreversibly committed to apoptotic death. In response to stress, damage, or an order to die intercepted by, for instance, a surface death receptor, a family of caspases termed initiator caspases is activated. Active initiator caspases (caspase-8, 9 among others) then activate a second group of caspases termed executioner or effector caspases 153 M. Al-Rubeai and M. Fussenegger (eds.), Cell Engineering, Vol. 4, 153-179. © 2004 Kluwer Academic Publishers. Printed in the Netherlands.

154

J. VARNER and M. FUSSENEGGER

(caspase-3, 6, 7). Once activated, executioner caspases seek out and cleave their respective protein targets, hence dismantling the cell. The objective of the present work is to compile central elements of caspases activation into a corresponding mathematical description. The spirit of the model, which describes the events required to initiate apoptosis, is that of an exploratory foundation, rather than a finalized quantitative exercise, because the bulk of our current understanding is qualitative. We maintain, however, that formulating such a mathematical model based upon current qualitative understanding is a fruitful exercise: First, modeling offers a rigorous frame-work to store and examine current knowledge. Caspase activation involves a number of important players and has impact on both cancer and neurodegeneration. Thus, a framework that accounts for the various interactions could be of great value in deciphering therapeutic routes that restore the healthy balance between cell survival and cell death. Second, as existing notions are refined, new details emerge, and more quantitative information becomes available the model can be updated. Moreover, the current framework could easily be embedded in larger models of cell growth. Thus, the model represents an exible yet rigorous method to store, visualize and interact with current and newly emerging biological information.

2.

A Mathematical Model of Cell Death

A common challenge to formulate and effectively utilize mathematical descriptions of metabolic and signaling networks is the lack quantitative information. Dynamic mathematical descriptions require kinetics and kinetics require detailed quantitative information to be properly formulated. Different classes of mathematical models require different levels of data input to be effective. Constraints-based models do away with kinetics in favor of a pseudo-steady state picture of how a signal flows through a signaling network or how carbon and energy flow through central metabolism. These models require knowledge of the interaction among species in a signaling network or the stoichiometry of a reaction network to be effective. Constraints-based models have generated genomic-scale physiological snapshots of several organisms and cell types (Schilling et al., 2002; Wiback and Palsson, 2002; Papin et al., 2002; Kauffman et al., 2002; Edwards et al., 2001; Edwards and Palsson, 2000; Schilling and Palsson, 2000) and have grown to include transcriptional regulation (Covert and Palsson, 2003; 2002; Covert et al., 2001). An attractive feature of the constraints-based approach is the relative ease of computation (solving a linear program or determining a generalized matrix inverse) and the ability to directly incorporate qualitative information into the constraints. A limiting factor for the application of constraints-based models to signaling networks has been their restriction to steady-state or pseudo steady-state problems which most signaling problems are not.

A SYSTEMS VIEW ON CELL DEATH

155

Previous mechanistic mathematical descriptions of cell-cycle (Sveiczer et al., 2001; Tyson and Novak, 2001; Sveiczer et al., 2000; Ciliberto and Tyson, 2000; Chen et al., 2000; Tyson, 1999; Novak et al., 1999; Hatzimanikatis et al., 1999; Novak et al., 1998; Borisuk and Tyson, 1998; Novak et al., 1998; Marlovits et al., 1998; Tyson et al., 1995; Novak and Tyson, 1997; Tyson et al., 1996; Novak and Tyson, 1993; Tyson, 1991; Tyson and Hannsgen, 1986), red blood cell dynamics (Jamshidi et al., 2001; Edwards and Palsson, 2000) and cell death (Tyson and Novak, 2001) have relied upon traditional kinetic descriptions. The central difficulty of formulating kinetic models is one of uncertainty; the uncertainty of the functional form of the kinetics, the uncertainty stemming from unknown kinetic and biological parameters and the uncertainty associated with missing or incomplete information about regulation and control. Dynamic models, however, are not restricted to any particular operating regime and they can, potentially, be predictive. 2.1

A NOVEL SOLUTION ALGORITHM

We propose an algorithm for modeling signaling pathways that is a hybrid between a constraints-based perspective and traditional kinetic modeling. The input to the algorithm is information about binding interactions (which species are involved and the reversibility of the interaction); in this way the approach is similar to a constraints-based model. The output of the algorithm is an estimate as a function of time of the flow through the signaling network as well as estimates of the concentration of the signaling species. To estimate signaling dynamics the approach solves a special optimization problem called a State Regulator Problem (SRP) at each simulation time step. A simpler version of the SRP was originally solved by Kalman over 40 years ago and is a standard problem in process control (Kalman, 1960). The SRP determines the minimum signaling network flow that minimizes the concentration of signaling species inside the network. In other words, the SRP will determine the network flow that keeps the accumulation of any individual signaling intermediate small. Note, the SRP does not explicitly forbid transient accumulation, rather, it tries to maximize the net-work output signal by keeping wasteful accumulation of internal intermediate messages small. The mathematical details of the SRP are presented in the computational protocol section. 2.2

CASPASE ACTIVATION MODEL

The model describes, mechanistically, the activation of initiator caspases, such as caspases-8 and 9, by receptor-mediated and stress-induced mechanisms, respectively. These initiator caspases, in turn, activate effector caspases, for example, caspase-3, 6, 7.

156


The model framework is shown in Figure 1 and outlined in Table 1. FAS (also called CD95 or Apo1) is a member of the tumor necrosis factor (TNF) gene superfamily that is defined by similar cysteine-rich extracellular domains (Smith et al., 1994) and a homologous cytoplasmic sequence termed the death domain (DD) (Tartaglia et al., 1993; Nagata, 1997). The cell receives and processes a suicide order via this receptor by binding an extracellular death ligand (L, e.g. FAS Ligand (FASL)), causing the DD of several FAS receptors to cluster (Huang et al., 1996). In the clustered conformation, an adapter protein named FADD (F) (Fas-associated death domain, also called Mort 1) binds to the FAS death domain through a complementary death domain of its own (Chinnaiyan et al., 1995; Boldin et al., 1995). Once FADD is in place, procaspase-8, which is constitutively expressed, can bind to a domain on FADD termed the death effector domain (DED) (Boldin et al., 1995). This brings two molecules of procaspase-8 into close proximity which allows them to activate one another by proteolytic cleavage (Muzio et al., 1998; Salvesen and Dixit, 1999). Once activated, caspase-8 (c8a) activates executioner level caspases, for example caspase-3 or caspase-6, by proteolytic cleavage.

Figure 1. Caspase activation cascade. Eěector caspase, for example caspase-3, 6 or 7, can be activated by external death signals via the FAS receptor and caspase-8 or nutritional signals via Apaf-1andcaspase-9.Reprintedwith permission from Nature Biotechnology 18:768 (2000).


157

Table 1. The caspase network model consists of 66 reactions and 74 species Reaction no. Reaction 1 c8z-geneĺ c8z 2 c9z-geneĺ c9z 3 c3z-geneĺ c3z 4 FLIP-geneĺ FLIP 5 ARC-geneĺ ARC 6 zVAD-fmk-geneĺ zVAD-fmk 7 IAP-geneĺ IAP 8 cyc-c-mito-geneĺ cyc-c-mito 9 FAS-geneĺ FAS 10 apaf-1-geneĺ apaf-1 11 bcl-2-gene-goodĺ bcl-xL 12 bcl-2-gene-evilĺ bax 13 FASL-Xĺ FASL 14 FADD-geneĺ FADD 15 2*c8zĺ c8z-c8z 16 c8z-c8zĺ 2*c8a 17 c8z+c9aĺ c8z-c9a 18 c8z-c9aĺ c8a+c9a 19 FASL+FASĺ FAS-FASL-INACTIVE 20 FAS-FASL-INACTIVEĺ FAS-FASL-A 21 FAS-FASL-A+FADDĺ FAS-FASL-A-FADD 22 FAS-FASL-A-FADD+FADDĺ FAS-FASL-A-2-FADD 23 FAS-FASL-A-2-FADD+c8zĺ FAS-FASL-A-2-FADD-c8z 24 FAS-FASL-A-2-FADD-c8z+c8zĺ FAS-FASL-A-2-FADD-2-c8z 25 FAS-FASL-ACTIVE-2-FADD-2-c8zĺ FAS-FASL-A-226 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45

FADD+2*c8a FAS-FASL-A-2-FADD-2-c8zĺ 2*c8a FAS-FASL-A-2-FADD+FLIP lFAS-FASL-A-2-FADD-FLIP FAS-FASL-A-2-FADD-FLIP+FLIPlFAS-FASL-A-2-FADD-2FLIP FAS-FASL-A-2-FADD-c8z+FLIP l FAS-FASL-A-2-FADD-c8zFLIP 2*c9zĺ c9z-c9z c9z-c9zĺ 2*c9a c8a+c9zĺ c8a-c9z c8a-c9zĺ c8a+c9a apaf-1+bcl-xL l apaf-1-bcl-xL bcl-xL+bax l bax-bcl-xL bcl-xL+cyc-c-mito l bcl-xL-cyc-c-mito cyc-c-mitoĺ cyc-c-free cyc-c-free+apaf-1ĺ cyc-c-free-apaf-1 cyc-c-free-apaf-1+c9zĺ cyc-c-free-apaf-1-c9z cyc-c-free-apaf-1-c9z+c9zĺ cyc-c-free-apaf-1-2-c9z cyc-c-free-apaf-1-2-c9zĺ 2*c9a cyc-c-free-apaf-1+ARCĺ cyc-c-free-apaf-1-ARC cyc-c-free-apaf-1-c9z+ARCĺ cyc-c-free-apaf-1-c9z-ARC c8a+c3zĺ c8a-c3z c8a-c3zĺ c8a+c3a

158


Reaction no. 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67

Reaction

c9a+c3zĺ c9a-c3z c9a-c3zĺ c9a+c3a c8a+zVAD-fmk l zVAD-fmk-c8a c9a+zVAD-fmk l zVAD-fmk-c9a c3a+IAP l IAP-c3a c3a+cyc-c-mitoĺ c3a-cyc-c-mito c3a-cyc-c-mitoĺ c3a+cyc-c-free FASĺ FASD c8zĺ c8zD c9zĺ c9zD c3zĺ c3zD c8aĺ c8aD c9aĺ c9aD c3aĺ c3aD apaf-1ĺ apaf-1D bcl-xLĺ bcl-xLD baxĺ baxD FADDĺ FADDD zVAD-fmkĺ zVAD-fmkD FLIPĺ FLIPD ARCĺ ARCD IAPĺ IAPD

Stress-related factors also induce caspase activation in the absence of an external death signal. Procaspase-9 (expressed constitutively, see (Li et al., 1997)) is activated following the release of mitochondrial cytochrome-c into the cytosol. Cytochrome-c along with Apaf-1 (apoptotic protease activating factor-1) are required for procaspase-9 (c9z) activation. Apaf-1 is thought to bind cytosolic cytochrome-c forming a complex that in turn binds procaspase-9 allowing activation to occur, probably, by a mechanism similar to FAS activation of procaspse-8 (Yang et al., 1997). Once activated, caspase-9 (c9a) can activate executioner caspases, for example caspase-3, by proteolytic cleavage. Several apoptotic agents, such as UV irradiation, staurosporine, ceramide, overexpression of proapoptotic Bcl-2 family members (see below), nutritional stress and amino acid limitation (Kluck et al., 1997; Simpson et al., 1998; Goswami et al., 1999; Sanfeliu and Stephanopoulos, 1999) can cause cytochrome-c to be released leading to procaspase-9 activation. Active initiator caspases in turn activate executioner caspases that in uence the loss of mitochondrial membrane potential (Kluck et al., 1997) and eventually cause the release of cytochrome-c, hence forming a positive activation loop. The activation and activity of initiator and executioner caspases can be inhibited at several points. First, a family of proteins, termed Inhibitors of Apoptosis (IAPs), inhibit executioner caspases directly (Deveraux et al., 1997; Deveraux and Reed, 1999). There is debate, however, if this is their only role because IAPs when overexpressed prevent effector caspases activation (Deveraux et al., 1998; Seshagiri


159

and Miller, 1997). We assume IAPs reversibly convert active executioner caspases to an inactive form. Second, a set of FADD-like proteins termed FLIPs (also called Casper, I-FLICE, FLAME, and CASH) contain a DED similar to FADD and may compete with procaspase-8 for FADD binding sites (Shu et al., 1997; Tschopp et al., 1998; Irmler et al., 1997). Third, a CARD domain- (caspase recruitment domain) containing protein termed ARC (apoptosis repressor with caspases recruitment domain) could inhibit procaspase-9 activation by competing for Apaf-1 binding sites (Koseki et al., 1998). Forth, decoy substrates such as zVAD-fmk covalently bind to initiator caspases thereby preventing the activation of executioner caspases (Amarante-Mendes et al., 1998). The Bcl-2 family of proteins plays a dual role in modulating apoptosis since it contains both antiapoptotic proteins such as Bcl-2 and Bcl-xL and proapoptotic proteins such as Bax, Bad and Bik (Adams and Cory, 1998; Reed, 1997). The antiapoptotic proteins play several key roles restraining the activation of procaspase9. They inhibit the release of cytochrome-c from the mitochondria and may compete with procaspase-9 for Apaf-1 binding sites (Kluck et al., 1997; Yang et al., 1997). Bcl-2 and Bcl-xxL show identical activities with respect to preventing cytochrome-c release and Apaf-1 binding (Adams and Cory, 1998; Newton and Strasser, 1998), however, Bcl-2 is localized to the outer mitochondrial membrane whereas only a fraction of Bcl-xxL is membrane bound (Hsu and Youle, 1997; Hsu et al., 1997). Thus, we assume as a first approximation that the fraction of Bcl-2 that binds Apaf-1 is small compared to Bcl-xxL. Effectiveness of the antiapoptotic Bcl-2 family members may be blunted by proapoptotic proteins such as Bax or Bik. We assume proapoptotic proteins Bax or Bik reversibly bind to antiapoptotic Bcl-2 family members thereby neutralizing their protective abilities. The ratio of anti- versus proapoptotic Bcl-2 family members, for example Bcl-xxL to Bax, is tightly controlled by p53 (a gene heavily involved in cell-cycle regulation). p53 induces Bax and represses Bcl-xxL expression under stress conditions, thereby promoting stress-induced apoptosis (Miyashita and Reed, 1995). Mutations in p53 alter the balance between anti- and proapoptotic Bcl-2 family members. The in uence of p53 is accounted for in the balances around the Bcl-2 family members by adjusting their specific expression rates.

3.

Architecture of the Caspase Cascade

Programmed cell death is central to the survival of a cell, thus it stands to reason that executioner caspase activation would be fault-tolerant or resistant to random mutations. Other biological networks such as metabolic or protein-protein interaction networks, in addition to man-made networks such as the INTERNET, have been shown to possess scale-free or hub-and-spoke architectures (Goh et al., 2002; Featherstone and Broadie, 2002; Wolf et al., 2002; Rzhetsky and Gomez, 2001; Jeong et al., 2000; Albert et al., 2000). In biological scale-free networks, a

160


small fraction of proteins or metabolites have many connections while most others have only a few if any. Structurally, this is a hierarchy with the highly connected species acting as controllers or regulators. Interaction between proteins or metabolites in a scale-free network is characterized by a connection distribution that follows a decaying power-law P(k): P(k) ≈ αk-γ

(1)

where P(k) denotes the probability that any protein in the network will interact with k other proteins. Figure 2 shows the connection probability function for the caspase activation cascade and Figure 3 show the degree of coupling between elements of the cascade. The probability that a protein will be connected to other members of the network decays as a function of the number of connections.

Figure 2. Probability of a connection versus the number of connections for the caspase activation cascade. The circles denote the actual probability values calculated from the network used in this study. The dashed line denotes the best-fit power-law distribution function P(k)§ ĮkíȖ where (Į, Ȗ)=(0.531, 1.58).

Activated initiator caspases-8, 9 with 8 and 9 connections, respectively, are the most highly connected elements of the network. Conversely, the species or process


161

with the lowest number of connections (a single connection) is the expression rate of inactive procaspases. This makes biological sense as the synthesis of the initiator procaspases is not influenced by the network, conversely, active initiator caspase is central to the activation of the executioner caspases. A hub-and-spoke architecture for caspase activation implies that death signals are resistant to random faults in the network. The probability of a random mutation effecting the ability of the activation cascade is small, as the mutation would require that both procaspase-8, 9 be disabled.

Figure 3. Connectivity among the species of the caspase activation cascade. Elements of the reverse diagonal denote the sum of degree (number of connections) of the nodes in the caspase activation cascade. Consistent with a scale-free architecture, the activation cascade has manynodes witha few connections and only a small number of nodes with a large number of connections.

4.

Convex Network Analysis

Convex analysis, sometimes refereed to as extreme pathway or elementary mode analysis, is a technique that has been applied to characterize the steady-state capabilities of several metabolic networks (Price et al., 2003; Papin et al., 2002; Price et al., 2002; Wiback and Palsson, 2002; Papin et al., 2002; Price et al., 2002) .

162


The underlying mathematics have been presented elsewhere (Klamt and Stelling, 2003; Schilling et al., 2000; Pfeiffer et al., 1999). Convex analysis can determine a basis for all thermodynamically permissible paths through a steady-state network. The basis is calculated by solving the steadystate mass balance equations Sν = 0

(2)

subject to constraints on the flux vector ν ν≥0

(3)

The symbol S denotes the network stoichiometry matrix. A signaling cascade or metabolic network in its entirety does not need to be at steady-state to apply this technique. Rather (2) can be written to apply to only a subnetwork excluding those species whose concentration is a strong function of time. We employ a simple criteria to formulate S; if a species has both production and consumption terms in its mass balance, it is retained in S, otherwise, it is excluded. 4.1

ROUTES TO EXECUTIONER CASPASE ACTIVATION

A fully constrained caspase activation cascade (all reactions treated as irreversible with the exception of decoy and inhibitor binding) results in 123 7extreme pathways, 47 or 38% of which terminate in the activation of executioner caspase. Of the 47 activation behaviors, approximately 80% follows from activation by caspase-9 whereas the remaining 20% comes from activated caspase-8. The number of extreme pathways changes as a function of the reversibility of the network. All else being equal, irreversible FLIP binding results in 101 extreme pathways, whereas, irreversible ARC binding yields 128 extreme pathways. The extreme pathways for the constrained network are visualized in Figure 4, where red denotes input into the cascade (for example synthesis of inactive caspase), blue denotes no activity and green denotes positive signal flow. The reaction number is plotted on the x-axis and pathway number is given on the y-axis. There are blocks of reactions that participate in a large number of modes, for example reaction numbers 55 through 60, as well as reactions which show less participation. Pathway groups are also clearly visible, for example pathway number 50 through 70 denote modes of caspase-8 activation.


163

Figure 4. Visualization of Extreme Pathways for constrained network. All reactions are treated as irreversible with the exception of the binding of decoys and inhibitors. The x-axis denotes the reaction number whereas the y-axis denotes the extreme pathway number. Red denotes input to the network (for example synthesis of inactive caspase), blue denotes no participation and green denotes positive signal flow. Under these conditions, 123 extreme pathways are identified of which 47 or 38% terminate in the activation of executioner caspase.

Activation of executioner caspase via initiator caspase-9 has a higher chance of success than the FAS mediated route. There are 21 modes involving binding of the FASL (reaction 19) to the FAS site, 2 result in activation of executioner caspase via caspase-8 and 8 involve activation by caspase-9 through caspase-8. Conversely, there are 29 modes involving activation of the Apaf-1 complex 17 of which result in the activation of executioner caspase (12 by caspase-9 and 5 by caspase-8). The highest yielding routes of executioner caspase activation involve both caspase-8 and caspase-9 albeit in different roles. The routes which lead to the highest yield of active executioner caspase are Apaf-1-mediated routes which cross-activate caspase8. However, activated caspase-8 does not activate executioner caspase, rather, it binds to the zVAD-Link and IAPs decoy and inhibitor molecules thereby allowing caspase-9 to activate executioner caspase. Additional routes exist where caspase-8 is activated by caspase-9 (following Apaf-1 activation) and caspase-9 binds to zVADLink and IAPs, however, the yield in these cases is less.

164


Figure 5. Frequency of reactions in extreme pathways. The larger the number of pathways that a reaction is a member of is indicative of the importance of that reaction step.

5.

Simulation: FAS-Mediated Caspase Activation

Dynamic simulation can be used to explore how a network behaves as a function of time and condition. We explore the activation of procaspase-8 by the FAS death receptor using the State Regulator Problem (SRP) formulation. 5.1

THE ROLE OF FADD DECOYS

Simulation of receptor-mediated activation of initiator caspase-8 in the presence and absence of the decoy protein FLIP is shown in Figures 6 to 10. FASL is introduced at approximately t=19 minutes. Within minutes the activated FAS(FADD)2 complex is formed and inactivated initiator caspase-8 binds to form the FAS-(FADD)2-(C8Z)2 complex (see Figure 6.) Given a fixed FAS site, FADD and inactive procaspase-8 synthesis rate and identical FASL concentrations, the concentration of activated free FAS-(FADD)2 complex available to bind procaspase-8 is predicted to decrease with increasing FLIP synthesis (see Figure 8).


165

Figure 6. Rate of formation of the active FAS-FADD-(C8Z)2 complex versus time in the presence and absence of FLIP synthesis. The red dashed line is the FLIP-free background whereas the blue dashed line is the FLIP synthesis 2 times that of inactive caspase-8 synthesis. FASL was added at approximately 19 min. The addition of FLIP does not significantly alter the acceleration of active FAS-FADD-(C8Z)2 complex formation (the time rate of change of the rate) rather FLIP is predicted to influence the maximum rate of formation.

Figure 7. Rate of FLIP binding to the FAS-(FADD) 2 complex as a function of time and FLIP synthesis rate. Red dashed line denotes no FLIP; blue dashed line denotes FLIP synthesis 5 times the procaspase-8synthesis rate.

166


Figure 8. Free active FAS-FADD complex versus time for a range of FLIP synthesis rates. FASL was introduced into the simulation at approximately 19minutes.The red dashed line denotes a FLIP concentration of zero, whereas as the blue dashed line denotes a FLIP synthesis rate 5times that of inactive caspase-8. Increasing FLIP synthesis reduces the availability of free activated FAS-FADD binding sites.

The specific concentration of inactive caspase-8 is predicted to be influenced by FLIP. Figure 10 shows the concentration of inactive caspase-8 versus time for different FLIP concentrations (all else being equal). Increasing FLIP concentration is predicted to decrease the available activated FAS-(FADD) 2 binding sites resulting in an elevated concentration of inactive initiator caspase. The concentration of procaspase-8 will not increase indefinitely, however, as the frequency of selfactivation increases as the concentration of inactive initiator procaspase increases. The rate of formation and the absolute concentration of executioner caspase is predicted to be negatively impacted by FLIP binding. Figure 9 shows that concentration of activated executioner caspase versus time in the presence (dotted and solid blue lines) and absence (dotted red line) of FLIP synthesis. The model predicts FLIP synthesis will decrease but not stop the activation of executioner caspase. Because FLIP binding is reversible, some procaspase-8 will always be activated.


167

Figure 9. Concentration of activated executioner caspase versus time as a function of the rate of FLIP synthesis. The FASL was added at approximately 19 minutes. The presence of FLIP synthesis decreases the rate of executioner caspase activation as well as decreasing the overall active concentration. Red dashed line denotes FLIP-free background; blue dashed line denotes FLIP synthesis 5 times the procaspase-8 synthesis time.

Figure 10. Procaspase-8 concentration versus time for a range of FLIP synthesis rates. FASL was introduced into the simulation at approximately 19 minutes. The red dashed line denotes a FLIP synthesis rate of zero. The blue dashed line denotes FLIP synthesis 5 times that of inactive caspase-8. The presence of FLIP increases the free inactive initiator caspase-8 concentration.

168 5.2

J. VARNER and M. FUSSENEGGER WHICH SIGNALS CHANGE WHEN FLIP BINDS?

Principle Component Analysis (PCA) can be used to determine which elementary reactions are responsible for the variance resulting from FLIP binding. PCA (also called Singular Value Decomposition or SVD) has been used to study variability in gene expression patterns, to identify gene expression regulatory networks as well examine dominate sets of metabolic pathways (Alter et al., 2000; Wall et al., 2001; Yeung et al., 2002; Price et al., 2003). Figure 11 shows the results of PCA analysis as a function of FLIP synthesis rate. Distance from the origin indicates the contribution a reaction makes to the variability between conditions. Reaction 4 (specific rate of FLIP synthesis) tightly clusters for all FLIP simulated conditions. Other reactions associated with FLIP binding and the activation of procaspase-8 also change in response to FLIP synthesis. The most pronounced are the rate of binding of procaspase-8 to the FAS(FADD)2 complex, the rate of release of activated caspase-8 and the binding of the FLIP decoy to form the single (FAS-(FADD)2-FLIP) and double (FAS-(FADD)2(FLIP)2) inhibited complex.

Figure 11. Principle Component Analysis (PCA) of the deviation away from a FLIP free background. The different symbols represent a PCA analysis for different FLIP synthesis rates, all else being equal. Distance away from the origin indicates that a reaction is responsible for a large fraction of the difference between FLIP+/í states.

A SYSTEMS VIEW ON CELL DEATH 6.

169

Conclusions

A mathematical model of the caspase activation cascade was formulated. The structural properties of the cascade were analyzed first by exploring the underlying connectivity of the network and second by employing convex network analysis to determine the basis of all network behavior. It was shown that caspase activation is a scale-free system with the most connected nodes being activated caspase-8,9. Extreme pathway analysis indicated that there are a larger number of routes leading to executioner caspase activation from caspase-9 when compared to caspase-8. Dynamic simulation of procaspase-8 activation in the presence and absence of FLIP synthesis was conducted using a novel application of the classic state regulator concept found in process control. It was shown that network ow dynamics could be approximated using the SRP approach which is almost exclusively based on qualitative information. The impact of FLIP synthesis upon the activation of executioner caspase was simulated. It was shown that while FLIP synthesis will slow executioner caspase activation, it will not stop it. The model predicts there will always be some activation of procaspase-8 as FLIP binding is reversible. Systems biology and network analysis have a role to play in analyzing cell-death and more generally cell-cycle regulation. The tools and techniques presented are widely available and applicable to problems of much larger size, for example the entire mammalian cell-cycle. The SRP approach presented relies almost exclusively upon qualitative information, and thus, could be of value in the study of signaling systems where molecular interactions may be known but quantitative knowledge is limited.

7.

Acknowledgements

We thank Alessandro Usseglio Viretta for discussions on the manuscript. The laboratory of M. F. is supported by the Swiss National Science Foundation (grant no. 631-065946).

8.

Computational Protocol

8.1

ESTIMATING SIGNALING NETWORK FLOW The species mass balance equations are given by (vector form)

170


The species vector is composed of Ni specific intracellular concentrations (xi,[mmol/gdw]) and Ne extracellular species (xe,[mmol/L]). The term

denotes the dilution of the specific intracellular concentration due to growth. The matrix A(t) is a diagonal matrix with elements given by

and zero everywhere else (i j). The term rˆ g(t) denotes the specific growth rate [hr-1]. Presently, we ignore the dilution due to growth term in the balance equations. The term Bc (t)uc(t) + Bm (t)um(t)c(t) (7) denotes the consumption of metabolites by reaction and transport to and from the environment. The (Ni + Ne) × Fc matrix Bc denotes the stoichiometric matrix governing the network signaling flow. The (Ni + Ne) × Fm matrix Bm denotes the stoichiometry of uptake and secretion. The Fc × 1-dimensional vector uc(t) denotes the specific intracellular reaction rate vector [mmol/gdw-hr] (calculated). The Fm × 1-dimensional vector um(t) denotes the vector of specific uptake/secretion rates [mmol/gdw-hr], where c(t) denotes the cellmass concentration [gdw/L]. Note that biomass is a member of xe. The last term of Equation (4)

ª 0 º «∈ (t ) » ¬ ¼

(8)

is the input to the extracellular mass balances coming from the reactor configuration where the jth element of the Ne ×1-dimensional vector ∈(t) is given by


9.

171

Solution of the State Regulator Problem

The problem of estimating the intracellular specific flux vector, uc(t), can be solved as an optimal state regulator problem. The objective of a state regulator is to minimize the concentration of metabolites (states) without the use of excessive control action (network flow.)

T

The first term in the integrand of Equation (10) ( xr (t)Q(t)xr(t)) represents the cost of metabolite concentration where xr(t) denotes the vector of species the regulator is ‘monitoring’(elements of xr(t) can be both intra as well as extracellular.) T The term u c (t)R(t)uc(t) denotes the cost of regulator action (the cost of operating a network reaction.) The matrices Q(t), R(t) are weight matrices of the appropriate dimension. Typically, the solution of Equation (10) requires the solution of an auxiliary Boundary Value Problem (aBVP) in the form a matrix diěerential equation termed the matrix Riccati equation. Because of non-negativity as well reaction directionality constraints, the solution of the aBVP is diĜcult. To bypass the solution complexity, we approximate the classical solution by employing a methodology similar in spirit to the receding horizon approach of Model Predictive Control (MPC). Instead of evaluating the objective function over the entire interval, we evaluate from tk (now) to Nǻt into the future (tk + Nǻt)

where Ĳ ∈ [tk,tk + Nǻt]. Solution of ( (tk,tk + Nǻt)yields a estimated trajectory uc(Ĳ) of which we keep uc(tk) and move to the next step.

172 10.

J. VARNER and M. FUSSENEGGER Implementation of Receding Horizon Regulator

We approximate the integralofthe performance index (Equation (10)) using the trapezoid rule

The value of the network flow at tk is function of not only the current state (which is known), but the species concentrations N time units (ǻt) into the future. We calculate the future network species concentrations xr(tk + ǻt), xr(tk+2ǻt),...,xr(tk+Nǻt) under the input of potential network flows uc(tk+ǻt),...,uc(tk+Nǻt)using a discrete (zero-order hold)approximation of (4) updated at each tk .

11.

References

Adams, J.M. and S Cory. 1998. The Bcl-2 protein family: arbiters of cell survival, Science 281, 1322–6. Adams, JM. and S. Cory. 2001. Life-or-death decisions bythe Bcl-2 protein family, Trends Biochem Sci. 26, 61–6. Adams, JM. and S. Cory. 2002. Apoptosomes: engines for caspase activation, Curr Opin Cell Biol. 14, 715–20. Adams, JM., DC. Huang, H. Puthalakath, P. Bouillet, G. Vairo, K. Moriishi, G. Hausmann, L. O’Reilly, K. Newton, S. Ogilvy, ML. Bath, CG. Print, AW. Harris, A. Strasser, and S. Cory. 1999. Control of apoptosis in hematopoietic cells by the Bcl-2 family of proteins, Cold Spring Harb Symp Quant Biol., 351–8. . No abstract available. Alter, O., P.O. Brown, and D. Botstein. 2000. Singular value decomposition for genome-wide expression data processing and modeling, Proc Natl Acad Sci U S A, 97, 10101– 6. Amarante-Mendes, GP., DM. Finucane, SJ. Martin, TG. Cotter, GS. Salvesen, and DR. Green. 1998. Anti-apoptotic oncogenes prevent caspase-dependent and independent commitment for cell death, Cell Death Diěer. 5, 298–306. Cory, S. and JM. Adams. 2002. The Bcl2 family: regulators of the cellular life-or-death switch, Nat Rev Cancer. 2, 647–56. Albert, R., H. Jeong, and AL. Barabasi. 2000. Error and attack tolerance of complex networks, Nature. 406, 378–82. Ambrosini, G., C. Adida, and D.C Altieri. 1997. A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma, Nat Med 3, 917–21. Ashkenazi, A. and V.M Dixit.1998. Death receptors: signaling and modulation, Science 281, 1305–8.


173

Ashkenazi, A. and V.M Dixit. 1999. Apoptosis control by death and decoy receptors, Curr Opin Cell Biol 11, 255–60. Boise, L.H., A.R.Gottschalk, J.Quintans, and C.B Thompson.1995. Bcl-2 and Bcl-2-related proteins in apoptosis regulation, Curr Top Microbiol Immunol, 107–21. 15 Boldin, M.P., I.L. Mett, E.E. Varfolomeev, I. Chumakov, Y. Shemer-Avni, J.H. Camonis, and D Wallach. 1995. Self-association of the death domains of the p55 tumor necrosis factor (TNF) receptor and Fas-APO1 prompts signaling for TNF and Fas-APO1 eěects, J Biol Chem 270, 387–91. Boldin, M.P., E.E. Varfolomeev, Z. Pancer, I.L. Mett, J.H. Camonis, and D Wallach. 1995. A novel protein that interacts with the death domain of Fas-APO1 contains a sequence motif related to the death domain, J Biol Chem 270, 7795–8. Borisuk, MT. and JJ. Tyson. 1998. Bifurcation analysis of a model of mitotic control in frog eggs, J Theor Biol. 195, 69–85. Bullani, RR., B. Huard, I. Viard-Leveugle, HR. Byers, M. Irmler, JH. Saurat, J. Tschopp, and LE. French. 2001. Selective expression of FLIP in malignant melanocytic skin lesions, J Invest Dermatol. 117, 360–4. Cahill, M.A., M.E. Peter, F.C. Kischkel, A.M. Chinnaiyan, V.M. Dixit, P.H. Krammer, and A Nordheim. 1996. CD95 (APO-1-Fas)induces activation of SAP kinases downstream of ICE-like proteases, Oncogene 13, 2087–96. Chao, D.T., G.P. Linette, L.H. Boise, L.S. White, C.B. Thompson, and S.J Korsmeyer. 1995. Bcl-XL and Bcl-2 repress a common pathway of cell death, J Exp Med 182, 821– 8. Chen, KC., A. Csikasz-Nagy, B. Gyorěy, J. Val, B. Novak, and JJ. Tyson. 2000. Kinetic analysis of a molecular model of the budding yeast cell cycle, Mol Biol Cell. 11, 369–91. Chinnaiyan, A.M. and V.M Dixit. 1996. The cell-death machine, Curr Biol 6, 555–62. Chinnaiyan, A.M. and V.M Dixit. 1997. Portrait of an executioner: the molecular mechanism of FAS-APO-1-induced apoptosis, Semin Immunol 9, 69–76. Chinnaiyan, A.M., W.L. Hanna, K. Orth, H. Duan, G.G. Poirier, C.J. Froelich, and V.M Dixit. 1996. Cytotoxic T-cell-derived granzyme B activates the apoptotic protease ICELAP3, Curr Biol 6, 897–9. Chinnaiyan, A.M., K. O’Rourke, M. Tewari, and V.M Dixit. 1995. FADD, a novel death domain-containing protein, interacts with the death domain of Fas and initiates apoptosis, Cell, 81, 505–12. Chinnaiyan, A.M., K. Orth, K. O’Rourke, H. Duan, G.G. Poirier, and V.M Dixit. 1996. Molecular ordering of the cell death pathway. Bcl-2 and Bcl-xL function upstream of the CED-3-like apoptotic proteases, J Biol Chem 271, p. 4573–6. Chinnaiyan, A.M., C.G. Tepper, M.F. Seldin, K. O’Rourke, F.C. Kischkel, S. Hellbardt, P.H. Krammer, M.E. Peter, and V.M Dixit. 1996. FADD-MORT1 is a common mediator of CD95 (Fas-APO-1) and tumor necrosis factor receptor-induced apoptosis, J Biol Chem 271, 4961–5. Ciliberto, A. and JJ. Tyson. 2000. Mathematical model for early development of the sea urchin embryo, Bull Math Biol. 62, 37–59. Covert, MW. and BO. Palsson. 2002. Transcriptional regulation in constraints-based metabolic models of Escherichia coli, J Biol Chem. 277, 28058–64. Covert, MW. and BO. Palsson. 2003. Constraints-based models -regulation of gene expression reduces the steady-state solution space, J Theor Biol. 221, 309–25. Covert, MW., CH. Schilling, I. Famili, JS. Edwards, II. Goryanin, E. Selkov, and BO. Palsson. 2001. Metabolic modeling of microbial strains in silico, Trends Biochem Sci. 26, 179–86. Covert, MW., CH. Schilling, and B. Palsson. 2001. Regulation of gene expression in flux balance models of metabolism, J Theor Biol. 213, 73–88.

174


Datta, R., Y. Manome, N. Taneja, L.H. Boise, R. Weichselbaum, C.B. Thompson, C.A. Slapak, and D Kufe.1995. Overexpression of Bcl-XL by cytotoxic drug exposure confers resistance to ionizing radiation-induced internucleosomal DNA fragmentation, Cell Growth Diěer 6, 363–70. Deveraux, Q.L., E.Leo, H.R.Stennicke, K. Welsh, G.S.Salvesen, and J.C Reed.1999. Cleavage of human inhibitor ofapoptosis protein XIAPresults in fragments with distinct specificities for caspases, Embo J 18, 5242–5251. Deveraux, Q.L. and J.C Reed. 1999. IAP family proteins–suppressors of apoptosis, Genes Dev 13, 239–52. Deveraux, Q.L., R. Takahashi, G.S. Salvesen, and J.C Reed. 1997. X-linked IAP is a direct inhibitor of cell-death proteases, Nature 388, 300–4. Deveraux, Q.L., N. Roy, H.R. Stennicke, T. Van Arsdale, Q. Zhou, S.M. Srinivasula, E.S. Alnemri, G.S. Salvesen, and J.C Reed. 1998. IAPs block apoptotic events induced by caspase-8 and cytochrome c by direct inhibition of distinct caspases, Embo J 17, 2215– 23. Dixit, V.M. 1996. Role of ICE-proteases in apoptosis, Adv Exp Med Biol, 113–7. Edwards, JS., RU. Ibarra, and BO. Palsson. 2001. In silico predictions of Escherichia coli metabolic capabilities are consistent with experimental data, Nat Biotechnol. 19, 125–30. Edwards, JS. and BO. Palsson. 2000. Multiple steady states in kinetic models of red cell metabolism, J Theor Biol. 207, 125–7. No abstract available. Edwards, JS. and BO. Palsson. 2000. The Escherichia coli MG1655 in silico metabolic genotype: its definition, characteristics, and capabilities, Proc Natl Acad Sci U S A. 97, 5528–33. Evan, G. and T Littlewood. 1998. A matter of life and cell death, Science 281, 1317–22. Fairbrother, WJ., NC. Gordon, EW. Humke, KM. O’Rourke, MA. Starovasnik, JP. Yin, and VM. Dixit. 2001. The PYRIN domain: a member of the death domain-fold superfamily, Protein Sci. 10, 1911–8. Featherstone, DE. and K. Broadie. 2002. Wrestling with pleiotropy: genomic and topological analysis of the yeast gene expression network, Bioessays. 24, 267–74. Fussenegger, M., JE. Bailey, and J. Varner. 2000. A mathematical model of caspase function in apoptosis, Nat Biotechnol. 18, 768–74. Goh, KI., E. Oh, H. Jeong, B. Kahng, and D. Kim. 2002. Classification of scale-free networks, Proc Natl Acad Sci U S A. 99, 12583–8. Goswami, J., A.J. Sinskey, H. Steller, G.N. Stephanopoulos, and D.I Wang. 1999. Apoptosis in batch cultures of Chinese hamster ovary cells, Biotechnol Bioeng 62, 632–40. Grossman, D., J.M. McNiě, F. Li, and D.C Altieri. 1999. Expression of the apoptosis inhibitor, survivin, in nonmelanoma skin cancer and gene targeting in a keratinocyte cell line, Lab Invest 79, 1121–6. Haass, C. 1999. Apoptosis. Dead end for neurodegeneration?, Nature 399, 204–5. Hannsgen, KB. and JJ. Tyson. 1985. Stability of the steady-state size distribution in a model of cell growth and division, J Math Biol. 22, 293–301. Hatzimanikatis, V., KH. Lee, and JE. Bailey. 1999. A mathematical description of regulation of the G1-S transition of the mammalian cell cycle, Biotechnol Bioeng. 65, 631– 7. Hsu, Y.T., K.G. Wolter, and R.J Youle. 1997. Cytosol-to-membrane redistribution of Bax and Bcl-X(L) during apoptosis, Proc Natl Acad Sci U S A 94, 3668–72. Hsu, Y.T. and R.J Youle. 1997. Nonionic detergents induce dimerization among members of the Bcl-2 family, J Biol Chem 272, 13829–34. Hsu, Y.T. and R.J Youle. 1998. Bax in murine thymus is a soluble monomeric protein that displays diěerential detergent-induced conformations, J Biol Chem 273, 10777–83. Huang, B., M. Eberstadt, E.T. Olejniczak, R.P. Meadows, and S.W Fesik. 1996. NMR structure and mutagenesis of the Fas (APO-1-CD95) death domain, Nature 384, 638– 41.


175

Irmler, M., M. Thome, M. Hahne, P. Schneider, K. Hofmann, V. Steiner, JL. Bodmer, M. Schroter, K. Burns, C. Mattmann, D. Rimoldi, LE. French, and J. Tschopp. 1997. Inhibition of death receptor signals by cellular FLIP, Nature. 388, 190–5. Jaattela, M., M. Benedict, M. Tewari, J.A. Shayman, and V.M Dixit. 1995. Bcl-x and Bcl2 inhibit TNF and Fas-induced apoptosis and activation of phospholipase A2 in breast carcinoma cells, Oncogene 10, 2297–305. Jamshidi, N., JS. Edwards, T. Fahland, GM.Church, and BO. Palsson. 2001. Dynamic simulation of the human red blood cell metabolic network, Bioinformatics. 17, 286–7. Jaroszewski, L., L. Rychlewski, JC. Reed, and A. Godzik. 2000. ATP-activated oligomerization as a mechanism for apoptosis regulation: fold and mechanism prediction for CED-4, Proteins. 39, 197–203. Jeong, H., B. Tombor, R. Albert, ZN.Oltvai, and AL. Barabasi. 2000. The large-scale organization of metabolic networks, Nature. 407, 651–4. Kalman, R.E. 1960. Contributions to the Theory of Optimal Control, Bol. Soc. Mat. Mex., 102–119. Kataoka, T., RC. Budd, N. Holler, M. Thome, F. Martinon, M. Irmler, K. Burns, M. Hahne, N.Kennedy, M.Kovacsovics, and J.Tschopp. 2000. The caspase-8 inhibitor FLIP promotes activation of NF-kappaB and Erk signaling pathways, Curr Biol. 10, 640–8. Kauěman, KJ., JD. Pajerowski, N. Jamshidi, BO. Palsson, and JS. Edwards. 2002. Description and analysis of metabolic connectivity and dynamics in the human red blood cell, Biophys J. 83, 646–62. Klamt, S. and J. Stelling. 2002. Combinatorial complexity of pathway analysis in metabolic networks, Mol Biol Rep. 29, 233–6. Klamt, S. and J. Stelling. 2003. Two approaches for metabolic pathway analysis?, Trends Biotechnol. 21, 64–9. Klamt, S., J. Stelling, M. Ginkel, and ED. Gilles. 2003. FluxAnalyzer: exploring structure, pathways, and flux distributions in metabolic networks on interactive flux maps, Bioinformatics. 19, 261–9. Kluck, R.M., E. Bossy-Wetzel, D.R. Green, and D.D Newmeyer. 1997. The release of cytochrome c from mitochondria:a primarysite for Bcl-2regulation ofapoptosis, Science 275, 1132–6. Kluck, R.M., S.J. Martin, B.M. Hoěman, J.S. Zhou, D.R. Green, and D.D Newmeyer. 1997. Cytochrome c activation of CPP32-like proteolysis plays a criticalrole in a Xenopus cellfree apoptosis system, Embo J 16, 4639–49. Kohn, MC., AS. Tohmaz, KJ. Giroux, GM. Blumenthal, MD. Feezor, and DS. Millington. 2002. Robustness of MetaNet graph models: predicting control of urea production in humans, Biosystems. 65, 61–78. Koseki, T., N. Inohara, S. Chen, and G Nunez. 1998. ARC, an inhibitor of apoptosis expressed in skeletal muscle and heart that interacts selectively with caspases, Proc Natl Acad Sci U S A 95, 5156–60. Krajewski, S., M. Krajewska, L.M. Ellerby, K. Welsh, Z. Xie, Q.L. Deveraux, G.S. Salvesen, D.E. Bredesen, R.E. Rosenthal, G. Fiskum, and J.C Reed. 1999. Release of caspase-9 from mitochondria during neuronal apoptosis and cerebral ischemia, Proc Natl Acad Sci U S A 96, 5752–7. Kuwana, T., J.J. Smith, M. Muzio, V. Dixit, D.D. Newmeyer, and S Kornbluth. 1998. Apoptosis induction by caspase-8 is amplified through the mitochondrial release of cytochrome c, J Biol Chem 273, 16589–94. Li, P., D. Nijhawan, I. Budihardjo, S.M. Srinivasula, M. Ahmad, E.S. Alnemri, and X Wang. 1997. Cytochrome c and dATP-dependent formation of Apaf-1-caspase-9 complex initiates an apoptotic protease cascade, Cell 91, 479–89.

176


Lu, C.D., D.C. Altieri, and N Tanigawa. 1998. Expression of a novel antiapoptosis gene, survivin, correlated with tumor cell apoptosis and p53 accumulation in gastric carcinomas, Cancer Res, 58, 1808–12. Marlovits, G., CJ. Tyson, B. Novak, and JJ. Tyson. 1998. Modeling M-phase control in Xenopus oocyte extracts: the surveillance mechanism for unreplicated DNA, Biophys Chem. 72, 169–84. Miyashita, T. and JC. Reed. 1995. Tumor suppressor p53 is a direct transcriptional activator of the human bax gene, Cell. 80, 293–9. Moriishi, K., DC. Huang, S. Cory, and JM. Adams. 1999. Bcl-2 family members do not inhibit apoptosis by binding the caspase activator Apaf-1, Proc Natl Acad Sci U S A. 96, 9683–8. Muchmore, S.W., M. Sattler, H. Liang, R.P. Meadows, J.E. Harlan, H.S. Yoon, D. Nettesheim, B.S. Chang, C.B. Thompson, S.L. Wong, S.L. Ng, and S.W Fesik. 1996. Xray and NMR structure of human Bcl-xL, an inhibitor of programmed cell death, Nature 381, p. 335–41. Muzio, M., G.S.Salvesen, and V.M Dixit.1997. FLICE induced apoptosis in a cell-free system. Cleavage of caspase zymogens, J Biol Chem, 272, 2952–6. Muzio, M., B.R. Stockwell, H.R. Stennicke, G.S. Salvesen, and V.M Dixit. 1998. An induced proximity model for caspase-8 activation, J Biol Chem 273, 2926–30. Nagata, S. 1997. Apoptosis by death factor, Cell 88, 355–65. Newton, K. and A Strasser. 1998. The Bcl-2 family and cell death regulation, Curr Opin Genet Dev 8, 68–75. Novak, B., A.Csikasz-Nagy, B.Gyorěy, K.Chen, and JJ.Tyson.1998. Mathematical model of the fission yeast cell cycle with checkpoint controls at the G1-S,G2-M and metaphaseanaphase transitions, Biophys Chem. 72, 185–200. Novak, B., A. Csikasz-Nagy, B. Gyorěy, K. Nasmyth, and JJ. Tyson. 1998. Model scenarios for evolution of the eukaryotic cell cycle, Philos Trans R Soc Lond B Biol Sci. 353, 2063– 76. Novak, B., A. Toth, A. Csikasz-Nagy, B. Gyorěy, JJ. Tyson, and K. Nasmyth. 1999. Finishing the cell cycle, J Theor Biol. 199, 223–33. Novak, B. and JJ. Tyson. 1993. Numerical analysis of a comprehensive model of M-phase control in Xenopus oocyte extracts and intact embryos, J Cell Sci. 106, 1153–68. Novak, B. and JJ. Tyson. 1997. Modeling the control of DNA replication in fission yeast, Proc Natl Acad Sci U S A. 94, 9147–52. Ona, V.O., M. Li, J.P. Vonsattel, L.J. Andrews, S.Q. Khan, W.M. Chung, A.S. Frey, A.S. Menon, X.J. Li, P.E. Stieg, J. Yuan, J.B. Penney, A.B. Young, J.H. Cha, and R.M Friedlander. 1999. Inhibition of caspase-1 slows disease progression in a mouse model of Huntington’s disease, Nature 399, 263–7. Pandey, A., R.A. Lindberg, and V.M Dixit. 1995. Cell signalling. Receptor orphans find a family, Curr Biol 5, 986–9. Papin, JA., ND. Price, JS. Edwards, and BO. Palsson. 2002. The genome-scale metabolic extreme pathway structure in Haemophilus influenzae shows significant network redundancy, J Theor Biol. 215, 67–82. Papin, JA., ND. Price, and BO. Palsson. 2002. Extreme pathway lengths and reaction participation in genome-scale metabolic networks, Genome Res. 12, 1889–900. Pfeiěer, T., I. Sanchez-Valdenebro, JC. Nuno, F. Montero, and S. Schuster. 1999. METATOOL: for studying metabolic networks, Bioinformatics. 15, 251–7. Poolman, MG., DA. Fell, and CA. Raines. 2003. Elementary modes analysis of photosynthate metabolism in the chloroplast stroma, Eur J Biochem. 270, 430–9.


177

Price, ND., I. Famili, DA. Beard, and BO. Palsson. 2002. Extreme pathways and Kirchhoě ’s second law, Biophys J. 83, 2879–82. No abstract available. Price, ND., JA. Papin, and BO. Palsson. 2002. Determination of redundancy and systems properties of the metabolic network of Helicobacter pylori using genome-scale extreme pathway analysis, Genome Res. 12, 760–9. Price, ND., JL. Reed, JA. Papin, I. Famili, and BO. Palsson. 2003. Analysis of metabolic capabilities using singular value decomposition of extreme pathway matrices, Biophys J. 84, 794–804. Reed, J.C. 1997. Double identity for proteins of the Bcl-2 family, Nature 387, 773–6. Roy, N., Q.L. Deveraux, R. Takahashi, G.S. Salvesen, and J.C Reed. 1997. The c-IAP-1 and c-IAP-2 proteins are direct inhibitors of specific caspases, Embo J 16, 6914–25. Rzhetsky, A. and SM. Gomez. 2001. Birthofscale-free molecular networks andthe number of distinct DNA and protein domains per genome, Bioinformatics. 17, 988–96. Salvesen, G.S. and V.M Dixit. 1999. Caspase activation: the induced-proximitymodel, Proc Natl Acad Sci U S A 96, 10964–7. Sanfeliu, A. and G Stephanopoulos. 1999. Eěect of glutamine limitation on the death of attached Chinese hamster ovary cells, Biotechnol Bioeng 64, 46–53. Schilling, CH., MW. Covert, I. Famili, GM. Church, JS. Edwards, and BO. Palsson. 2002. Genome-scale metabolic model of Helicobacter pylori 26695, J Bacteriol. 184, 4582–93. Schilling, CH., JS. Edwards, D. Letscher, and BO. Palsson. 2000. Combining pathway analysis with flux balance analysis for the comprehensive study of metabolic systems, Biotechnol Bioeng. 71, 286–306. Schilling, CH., D.Letscher, and BO.Palsson. 2000. Theory for the systemic definition of metabolic pathways and their use in interpreting metabolic function from a pathwayoriented perspective, J Theor Biol. 203, 229–48. Schilling, CH. and BO. Palsson. 2000. Assessment of the metabolic capabilities of Haemophilus influenzae Rd through a genome-scale pathway analysis, J Theor Biol. 203, 249–83. Schilling, CH., S. Schuster, BO. Palsson, and R. Heinrich. 1999. Metabolic pathway analysis: basic concepts and scientific applications in the post-genomic era, Biotechnol Prog. 15, 296–303. Schuster, S., T. Dandekar, and DA. Fell. 1999. Detection of elementary flux modes in biochemical networks: a promising tool for pathway analysis and metabolic engineering, Trends Biotechnol. 17, 53–60. Schuster, S., C. Hilgetag, JH. Woods, and DA. Fell. 2002. Reaction routes in biochemical reaction systems: algebraic properties, validated calculation procedure and example from nucleotide metabolism, J Math Biol. 45, 153–81. Seshagiri, S. and L.K Miller. 1997. Baculovirus inhibitors of apoptosis (IAPs) block activation of Sf-caspase-1, Proc Natl Acad Sci U S A 94, 13606–11. Sha, W., J. Moore, K. Chen, AD. Lassaletta, CS. Yi, JJ. Tyson, and JC. Sible. 2003. Hysteresis drives cell-cycle transitions in Xenopus laevis egg extracts, Proc Natl Acad Sci U S A. 100, 975–80. Shu, H.B., D.R. Halpin, and D.V Goeddel. 1997. Casper is a FADD-and caspase-related inducer of apoptosis, Immunity 6, 751–63. Simpson, N.H., R.P. Singh, A.N. Emery, and M Al-Rubeai. 1999. cl-2 over-expression reduces growth rate and prolongs G1 phase in continuous chemostat cultures of hybridoma cells, Biotechnol Bioeng 64, 174–86. Simpson, N.H., R.P. Singh, A. Perani, C. Goldenzon, and M Al-Rubeai. 1998. In hybridoma cultures, deprivation of any single amino acid leads to apoptotic death, which is suppressed by the expression of the bcl-2 gene, Biotechnol Bioeng 59, 90–8.

178


Smith, C.A., T. Farrah, and R.G Goodwin. 1994. The TNF receptor superfamily of cellular and viral proteins: activation, costimulation, and death, Cell 76, 959–62. Snel, B., P. Bork, and MA. Huynen. 2002. The identification of functional modules from the genomic association of genes, Proc Natl Acad Sci U S A. 99, 5890–5. Song, Q., Y. Kuang, VM. Dixit, and C. Vincenz. 1999. Boo, a novel negative regulator of cell death, interacts with Apaf-1, EMBO J. 18, 167–78. Stelling, J., S. Klamt, K. Bettenbrock, S. Schuster, and ED. Gilles. 2002. Metabolic network structure determines key aspects of functionality and regulation, Nature. 420, 190– 3. Stennicke, H.R., Q.L. Deveraux, E.W. Humke, J.C. Reed, V.M. Dixit, and G.S Salvesen. 1999. Caspase-9 can be activated without proteolytic processing, J Biol Chem 274, 8359– 62. Sveiczer, A., A. Csikasz-Nagy, B. Gyorěy, JJ. Tyson, and B. Novak. 2000. Modeling the fission yeast cell cycle: quantized cycle times in wee1-cdc25Delta mutant cells, Proc Natl Acad Sci U S A. 97, 7865–70. Sveiczer, A., JJ. Tyson, and B. Novak. 2001. A stochastic, molecular model of the fission yeast cell cycle: role of the nucleocytoplasmic ratio in cycle time regulation, Biophys Chem. 92, 1–15. Tartaglia, L.A., T.M. Ayres, G.H. Wong, and D.V Goeddel. 1993. A novel domain within the 55 kd TNF receptor signals cell death, Cell, 74, 845–53. Tschopp, J., M. Irmler, and M. Thome. 1998. Inhibition of fas death signals by FLIPs, Curr Opin Immunol. 10, 552–8. Thompson, C.B. 1995. Apoptosis in the pathogenesis and treatment of disease, Science 267, 1456–62. Tyson, JJ. and KB. Hannsgen. 1986. Cell growthand division: a deterministic-probabilistic model of the cell cycle, J Math Biol. 23, 231–46. Tyson, JJ. 1983. Unstable activator models for size control of the cell cycle, J Theor Biol. 104, 617–31. Tyson, JJ. 1987. Size control of cell division, J Theor Biol. 126, 381–91. Tyson, JJ. 1989. Eěects of asymmetric division on a stochastic model of the cell division cycle, Math Biosci. 96, 165–84. Tyson, JJ. 1991. Modeling the cell division cycle: cdc2 and cyclin interactions, Proc Natl Acad Sci U S A. 88, 7328–32. Tyson, JJ. 1999. Models of cell cycle control in eukaryotes, J Biotechnol. 71, 239–44. Tyson, JJ., A. Csikasz-Nagy, and B. Novak. 2002. The dynamics of cell cycle regulation, Bioessays. 24, 1095–109. Tyson, JJ. and KB. Hannsgen. 1985. The distributions of cell size and generation time in a model of the cell cycle incorporating size control and random transitions, J Theor Biol. 113, 29–62. Tyson, JJ. and B. Novak. 2001. Regulation of the eukaryotic cell cycle: molecular antagonism, hysteresis, and irreversible transitions, J Theor Biol. 210, 249–63. Tyson, JJ., B.Novak, K.Chen, and J. Val. 1995. Checkpoints in the cell cycle from a modeler’s perspective, Prog Cell Cycle Res., 1–8. Tyson, JJ., B. Novak, GM. Odell, K. Chen, and CD. Thron. 1996. Chemical kinetic theory: understanding cell-cycle regulation, Trends Biochem Sci. 21, 89–96. Vucic, D., W.J.Kaiser, A.J.Harvey, and L.K Miller. 1997. Inhibition of reaper-induced apoptosis by interaction with inhibitor of apoptosis proteins (IAPs), Proc Natl Acad Sci U S A 94, 10183–8. Wall, M.E., P.A. Dyck, and T.S.Brettin. 2001. SVDMAN–singular value decomposition analysis of microarray data, Bioinformatics 17, 566–8.


179

Wiback, SJ. and BO. Palsson. 2002. Extreme pathway analysis of human red blood cell metabolism, Biophys J. 83, 808–18. Wolf, YI., G. Karev, and EV. Koonin. 2002. Scale-free networks in biology: new insights into the fundamentals of evolution?, Bioessays. 24, 105–9. Yang, J., X. Liu, K. Bhalla, C.N. Kim, A.M. Ibrado, J. Cai, T.I. Peng, D.P. Jones, and X Wang. 1997. Prevention ofapoptosis by Bcl-2:release ofcytochrome c from mitochondria blocked, Science 275, 1129–32. Yang, E., J. Zha, J. Jockel, L.H. Boise, C.B. Thompson, and S.J Korsmeyer. 1995. Bad, a heterodimeric partner for Bcl-XL and Bcl-2, displaces Bax and promotes cell death, Cell 80, 285–91. Yeh, W.C., J.L. Pompa, M.E. McCurrach, H.B. Shu, A.J. Elia, A. Shahinian, M. Ng, A. Wakeham, W. Khoo, K. Mitchell, W.S. El-Deiry, S.W. Lowe, D.V. Goeddel, and T.W Mak. 1998. FADD: essential for embryo development and signaling from some, but not all, inducers of apoptosis, Science 279, 1954–8. Yeung, M.K., J. Tegner, and J.J. Collins. 2002. Reverse engineering gene networks using singular value decomposition and robust regression, Proc Natl Acad Sci U S A, 99, 6163– 8. Zhang, J., D. Cado, A. Chen, N.H. Kabra, and A Winoto. 1998. Fas-mediated apoptosis and activation-induced T-cell proliferation are defective in mice lacking FADD-Mort1, Nature 392, 296–300.

7.

THE ROLE OF CASPASES IN APOPTOSIS AND THEIR INHIBITION IN MAMMALIAN CELL CULTURE

T.M. SAUERWALD1 AND M.J. BETENBAUGH2* 1 Centocor, Inc, Pharmaceutical Development, 200 Great Valley Parkway,Malvern, PA 19355, U.S.A. 2 The Johns Hopkins University, Department of Chemical Engineering, 3400 North Charles Street, Baltimore, Maryland 21218, U.S.A. *Corresponding Author Tel: 410-516-5461, Fax: 410-516-5510, E-mail: [email protected]

1.

Introduction

The recent advances in recombinant DNA technology, molecular biology techniques, and culture systems have spurred the development of the biological synthesis of medicinal therapeutics. Unlike a few decades ago, scientists now have the ability to genetically engineer living organisms for the production of beneficial biologically-active medicines. As a result, biotechnology-derived products have become increasingly significant in the treatment of disease and, this rise in popularity has led to issues involving their manufacture. Due to the need for proper post-translation modifications, many protein therapeutics need to be produced in mammalian cell culture rather than through other alternatives such as yeast, microbial, and insect cell cultures. There are currently numerous U.S. Food and Drug Administration (FDA)-approved biologics on the market with many more in clinical trials and the majority of these are produced in mammalian systems. These include vaccines such as RabAvertTM for immunization against rabies, recombinant proteins such as ArenespTM for the treatment of anemia, and monoclonal antibodies such as Remicade£ for the treatment of rheumatoid arthritis. The quantity and demand of biotherapeutics coming to market is increasing steadily which is resulting in a critical shortage in manufacturing capacity (Fox, 2001). Therefore, it is necessary for biochemical manufacturers to optimize the culture systems to obtain high cell densities with increased product yields without compromising product quality. One method available for the optimization of cell culture is the inhibition of programmed cell death, commonly called apoptosis. Apoptosis may lead to diminished protein production and inferior product quality due to a decrease in viable cell number and the release of intracellular enzymes from lysed cells, which can modify or degrade a secreted protein product. In addition, debris from lysed 181 M. Al-Rubeai and M. Fussenegger (eds.), Cell Engineering, Vol. 4, 181-210. © 2004 Kluwer Academic Publishers. Printed in the Netherlands.

182

T. M. SAUERWALD and M. J. BETENBAUGH

cells may cause difficulties with downstream purification processes (Kearns, 1990). Apoptosis can be induced in cultures from a multitude of stimuli including intracellular stresses such as inhibited glycosylation and viral infection, as well as extracellular stresses such as nutrient exhaustion, improper oxygenation, elevated osmolality, and pH and temperature fluctuations (deZengotita et al., 2002; Franek, 1995; Hisanaga et al., 1995; Mastrangelo et al., 1996, 2000; Mercille and Massie, 1994a,b; Osman et al., 2001; Rauen et al., 1999; Shimura et al., 1997; Singh et al., 1997; Yoshimi et al., 2000). Irrespective of the stress triggering apoptosis, one class of enzymes is ultimately called into action as the cellular ‘assassin’.

2.

Caspases in Apoptosis

The physical destruction of the cell that occurs during apoptosis is mediated by a class of enzymes called caspases, or cysteine proteases, which are responsible for cleavage of specific protein substrates at an amino acid position immediately following an aspartic acid residue (Asp). To date, 14 members of the caspase family have been discovered Due to the rapidity and simultaneous identification of these caspases, various names have been applied to each, which are shown in parentheses in Table 1. Therefore, nomenclature has been devised for the homologs of the caspase family, designated by the word ‘caspase’ followed by a number indicating the order of discovery (Alnemri et al., 1996). Of these 14, caspases-1 through -10, 13, and -14 are present in humans, whereas caspases-11 and -12 have only been discovered in murine tissues thus far. Caspases are classified liberally dependent upon their involvement in either inflammation or apoptosis. Caspases-1, -4, -5, -11, -12, and -14 have been found to show involvement in the maturation of pro- inflammatory cytokines, whereas caspases-2, -3, -6, -7, -8, -9, and -10 have been implicated in various aspects of apoptosis (Kaufmann and Hengartner, 2001). However, since so little currently is known about caspases-2, -4, -5, -7, -12, and -13, these classifications are not absolute (Creagh and Martin, 2001). The caspases involved in apoptosis can be classified further into two subgroups: signaling/initiator caspases and effector/executioner caspases (Figure 1). The signaling/ initiator caspases (-2, -8, -9, -10) contain one of two protein-protein interaction motifs, either the caspase activation and recruitment domain (CARD) or the death effector domain (DED). Conversely, the effector/executioner caspases (-3, -6, -7) contain small prodomains lacking any interaction motifs. Each caspase is synthesized as a zymogen or pro-caspase containing three distinct functional domains: an N-terminal prodomain which may contain a CARD or DED interaction domain, a catalytic large ~20 kDa (p20) subunit, and a catalytic small ~10 kDa (p10) subunit (Figure 1). Substrate specificity is derived from the small subunit, while the caspase’s ability to cleave its substrates is contained within the large subunit.

CASPASES INHIBITORS

183

Table 1. A classification of members of the caspase family. Caspases are grouped dependent upon their involvement with either apoptosis or inflammation. The role of caspase-13 has yet to be elucidated. *Asterisk denotes hypothesized substrate cleavage site. X refers to any amino acid Caspase Family Members

Caspase Substrate Site Primary Active Site (P4-P1LX) Classification

Reference Cerretti et al., 1992; Thornberry et al., 1992; Van de Craen et al., 1997; Yuan et al., 1993

Caspase-1 (ICE)

QACRG

YEVDLX WEHDLX

Inflammation

Caspase-2 (ICH-1/Nedd2)

QACRG

VDVADLX DEHDLX

Apoptosis

Kumar et al., 1994; Van de Craen et al., 1997; Wang et al., 1994

Caspase-3 (Apopain/CPP32/Yama)

QACRG

DMQDLX DEVDLX

Apoptosis

Fernandes-Alnemri et al., 1994; Nicholson et al., 1995; Tewari et al., 1995; Van de Craen et al., 1997

Caspase-4 (ICErelII/ICH-2/TX)

QACRG

LEVDLX (W/L)EHDLX

Inflammation

Faucheu et al., 1995; Kamens et al., 1995; Munday et al., 1995

Caspase-5 (ICErelIII/TY)

QACRG

(W/L)EHDLX

Inflammation

Faucheu et al., 1996; Munday et al., 1995

Caspase-6 (Mch2)

QACRG

VEIDLN VEHDLX

Apoptosis

Fernandes-Alnemri et al., 1995a; Van de Craen et al., 1997

Caspase-7 (CMH-1/ICE-LAP3/Mch3)

QACRG

DEVDLX

Apoptosis

Duan et al., 1996a; Fernandes-Alnemri et al., 1995b; Lippke et al., 1996; Van de Craen et al., 1997

Caspase-8 (FLICE/MACH/Mch5)

QACQG

IETDLX LETDLX

Apoptosis

Boldin et al., 1996; Fernandes-Alnemri et al., 1996; Muzio et al., 1996; Van de Craen et al., 1998a

Caspase-9 (ICE-LAP6/Mch6)

QACGG

LEHDLX

Apoptosis

Duan et al., 1996b; Srinivasula et al., 1996

Caspase-10 (FLICE2/Mch4)

QACQG

IEADLX

Apoptosis

Fernandes-Alnemri et al., 1996; Vincenz and Dixit, 1997

mCaspase-11 (mICH-3)

QACRG

(I/L/V/P)EHDLX

Inflammation

Kang et al., 2000; Van de Craen et al., 1997; Wang et al., 1996a

mCaspase-12 (mICH-4)

QACRG

WEHDLX*

Inflammation

Van de Craen et al., 1997

Caspase-13 (ERICE)

QACRG

WEHDLX*

?

Caspase-14 (MICE)

QACRG

WEHDLX*

Inflammation

Humke et al., 1998 Ahmad et al., 1998; Eckhart et al., 2000; Hu et al., 1998; Van de Craen et al., 1998b

184


Figure 1. A structural comparison of the caspases involved in apoptosis. The initiator procaspases-2 and -9 contain a CARD domain, whereas the initiator pro-caspases-8 and -10 contain DED domains. Effector caspases possess small prodomains lacking homology domains.

A nucleophilic cysteine embedded within the conserved active site pentapeptide sequence QACXG (where X = R, Q, or G) is responsible for substrate cleavage directly C-terminal to an aspartate residue (Table 1). In normal, healthy cells, caspases exist as inert pro-caspases. However, during activation, cleavage occurs immediately following an Asp residue situated in between the N-terminal prodomain and the large subunit and also in between the two subunits. These two cleavage events allow for the release of the prodomain and heterodimerization of the small and large subunits. Upon binding of two identical heterodimers, a catalytically active heterotetramer is formed consisting of two p10 and two p20 subunits. It is these mature, active caspases that cause the physical destruction of the cell.

3.

Apoptotic Pathways

Following exposure to an apoptotic insult, a signal transduction pathway is initiated leading to a commitment to cellular suicide. Depending upon the insult detected by the cell, the caspase cascade will be triggered through either the intrinsic mitochondrial pathway, the extrinsic death receptor pathway, or a combination of both pathways. In either circumstance, the initiator caspases are activated through the formation of an apoptosome that then causes the stimulation of the effector caspases, mitochondrial damage, and ultimately, degradation of the cell.

CASPASES INHIBITORS 3.1

185

INTRINSIC MITOCHONDRIAL PATHWAY

In the presence of an apoptotic stress such as a chemical toxin, heat shock, radiation, or serum deprivation, cytochrome c is released from the mitochondria (Figure 2). Cytochrome c, which ordinarily resides in the mitochondrial intermembrane space in healthy cells, is released into the cytosol. While the release of cytochrome c sometimes occurs by a caspase-independent mechanism (Liu et al., 1996; Mayer et al., 1995; Sun et al., 1999b), other investigations have revealed that caspase inhibitors can retard the release of cytochrome c (Marsden et al., 2002).

Figure 2. The apoptotic cascade of the intrinsic mitochondrial pathway. An apoptotic stress, such as exposure to a chemical toxin, provokes the release of cytochrome c. Cytochrome c, Apaf-1, and caspase-9 form the apoptosome, which is responsible for the activation of effector caspases.

These studies point to a possible initiator caspase upstream of the release of cytochrome c (Cory and Adams, 2002). Either way, once cytochrome c enters the cytosol, it is available to interact with the apoptotic-protease-activating factor 1 (Apaf-1). In the presence of dATP, cytochrome c binds with Apaf-1 and oligomerizes to form an Apaf-1/cytochrome c octamer (Saleh et al., 1999; Srinivasula et al., 1998). This energy-dependent step serves as an apoptotic control switch thereby only allowing those cells destined for death to activate the caspase cascade, whereas caspase activation is prevented in healthy cells. Simultaneous with Apaf-1 oligomerization, pro-caspase-9 binds Apaf-1 resulting in the autocatalytic activation of the caspase (Li et al., 1997). This activation of caspase-9 is caused by the close proximity and clustering of the caspase-9 molecules due to binding to the

186


oligomerized Apaf-1 (Srinivasula et al., 1998). This ~700-1600 kDa cytochrome c/Apaf-1/caspase-9 complex is referred to as the mitochondrial apoptosome (Cain et al., 2000; Saleh et al., 1999). Upon activation of caspase-9, it can remain in or be released from the Apaf-1 complex to cleave and activate the effector caspases-3 and -7 (Li et al., 1997; Pan et al., 1998; Saleh et al., 1999; Slee et al., 1999). Active caspase-3 then proceeds to activate the remaining effector caspase-6 and is involved in a positive feedback loop to amplify further caspase-9 (Slee et al., 1999). In confirmation of this report, a second group has shown that Smac release can occur in the absence of cytochrome c release (Chauhan et al., 2001). Smac exerts its pro-apoptotic activity by binding to members of the inhibitor of apoptosis (IAP) protein family, thus counteracting the IAPs’ caspase inhibitory functions (Du et al., 2000; Verhagen et al., 2000). Specifically, Smac indirectly promotes activation of the initiator caspase-9 as well as the effector caspases-3 and -7 (Srinivasula et al., 2000). Nevertheless, a recent study examining the effects of a Smac mutant lacking the IAP binding region showed that IAP binding is not essential for Smac’s proapoptotic functions (Roberts et al., 2001). Therefore, the primary targets of Smac in the apoptotic cascade have yet to be elucidated. In addition to the recent discovery of Smac comes the discovery of a novel serine protease called HtrA2/Omi which so happens to be released from that storehouse of pro-apoptotic molecules--the mitochondria (Hedge et al., 2002; Suzuki et al., 2001a). The amino-terminal portion of autoprocessed HtrA2 shares homology with Smac (Martins et al., 2002). HtrA2 also binds IAP family members thus promoting caspase activation; however, HtrA2 can induce an atypical form of death not dependent on caspases (Hedge et al., 2002; Suzuki et al., 2001a; Verhagen et al., 2002). 3.2

EXTRINSIC DEATH RECEPTOR PATHWAY

A second method cells have evolved to initiate apoptosis is through cellular signaling with the aid of death receptors. Death receptors are cell surface receptors that contain an extracellular region responsible for ligand binding and an intracellular region that transmits the death signal within the cell. Numerous members of the TNF-receptor superfamily have been characterized. These include the tumor necrosis factor receptor 1 (TNFR1) which is bound by the TNF-α ligand, Fas/CD95/Apo1 which is bound by the Fas/CD95 ligand (FasL/CD95L), Apo3/DR3/Wsl1 which is bound by the Apo3 ligand (Apo3L, also called TWEAK), and TRAIL-R1/DR4 and TRAIL-R2/DR5 both of which are bound by the Apo2 ligand (Apo2L, also called TRAIL) (reviewed in Ashkenazi and Dixit, 1998). Of these five, the TNFR1 and Fas death receptors are understood best. For example, for the internalization of an extracellular death signal, a Fas ligand will bind a trimeric Fas receptor to evoke a conformational change within the cytoplasmic tail of the receptor. This signals the binding of a cytosolic adapter

CASPASES INHIBITORS

187

protein named FADD/MORT-1 followed by binding of the caspase-8 zymogen (Fig. 3) (Muzio et al., 1996). This cytosolic FADD/caspase-8/receptor complex is a second type of apoptosome called the death-inducing signal complex (DISC) (Kischkel et al., 1995). The formation of the DISC causes clustering of caspase-8 resulting in its subsequent autocatalytic activation, similar to stimulation of caspase9 (Martin et al., 1998; Medema et al., 1997). Mature caspase-8 then activates the downstream effector caspases. The initiator caspase-10 can be activated in a similar manner upon Fas-induced apoptosis (Kischkel et al., 2001; Wang et al., 2001). It has been proposed by Scaffidi et al. (1998) that there exist two Fas signaling pathways, type I and type II (Figure 3). For the type I cascade, the formation of the DISC recruits and activates many caspase-8 molecules which then proceed to activate the effector caspases through proteolytic cleavage in a mitochondrialindependent manner as described above. In the type II pathway, a limited number of caspase-8 molecules are recruited to the DISC for autocatalytic activation. Active caspase-8 then indirectly activates the effector caspases in a mitochondrialdependent manner. This type II signaling pathway is discussed below.

DESTRUCTION

Figure 3. The type I and type II apoptotic cascade of cells in the extrinsic death receptor pathway. Ligand binding to a death receptor provokes the activation of pro-caspase-8. In the type I pathway, caspase-8 directly activates effector caspases. In the type II pathway, caspase8 cleaves Bid, which translocates to the mitochondria triggering the release of cytochrome c. Cytochrome c then triggers apoptosome formation followed by effector caspase activation.

188 3.3

T. M. SAUERWALD and M. J. BETENBAUGH EXTRINSIC AND INTRINSIC PATHWAYS

In addition to activating caspase-3 directly as in the type I extrinsic pathway, caspase-8 also is responsible for the cleavage of a pro-apoptotic protein called Bid, in the Type II pathway (Figure 3) (Gross et al., 1999; Li et al., 1998; Luo et al., 1998). When inactive, full-length Bid is cleaved, its potent pro-apoptotic C-terminal tail translocates from the cytosol to the mitochondrial membrane (Gross et al., 1999). This allows truncated Bid (tBid) to evoke mitochondrial damage allowing the release of cytochrome c and Smac/DIABLO (Li et al., 1998; Madesh et al., 2002). Cytosolic cytochrome c then induces the formation of the apoptosome with dATP, Apaf-1, and pro-caspase-9 which leads to the subsequent activation of caspase-9 and the effector caspases, as described in section 3.1. Although the events occurring downstream in this tBid-induced extrinsic pathway closely parallel those events in the intrinsic mitochondrial pathway, it is believed that cytochrome c release occurs independently of Bid activation in the intrinsic pathway (Sun et al., 1999b). In a similar mechanism to that just described, HtrA2 release is also facilitated through this pathway following induction with TNF and anti-Fas antibodies (van Loo et al., 2002). Regardless of the apoptotic signal received by the cell and apoptotic pathway initiated, both the death receptor and mitochondrial pathways ultimately converge in the activation of the effector caspases. The effector caspases then cleave protein substrates within the cell causing its physical collapse. These substrates are discussed in more detail below.

4.

Caspase Substrates and Cellular Effects

The intent of caspase-mediated cleavage of substrates is to induce the following apoptotic events: (1) interruption of the cell cycle, (2) impairment of cellular repair mechanisms, (3) dismantling of cellular structures, (4) detachment of the cell if adherent, and (5) targeting of the cell for phagocytosis (Stroh and Schulze-Osthoff, 1998). The organized demolition of the apoptotic cell is mediated by the downstream effector caspases. Although caspases-3, -6, and -7 all are considered effector caspases, caspase-3 has been determined to be the primary executioner caspase responsible for much of the cellular degradation that occurs during apoptosis, whereas caspases-6 and -7 are believed to serve either minor or highly specialized roles (Slee et al., 2001). A partial list of caspase substrates is given in Table 2, along with the caspase responsible and the result of the cleavage. Several cell adhesion proteins that are processed by effector caspases are included in Table 2. For example, cytoskeleton-related proteins such as Gas2 and gelsolin are cleaved causing microfilament and actin rearrangements, respectively, leading to cell rounding (Kothakota et al., 1997; Sgorbissa et al., 1999). In addition, cleavage of βcatenin and FAK causes cellular detachment from the culture material in vitro or

CASPASES INHIBITORS

189

Table 2. Caspase-mediated demolition during apoptosis. A partial list of caspase substrates is given along with the effector caspase responsible for their cleavage. Caspase Substrate Actin

Effector Caspase Caspase-3

Substrate Involvement Cytoskeleton

Result/Expected Result of Caspase Cleavage Loss of cell shape

β-Catenin

Caspase-3, -6

Cell adhesion

Cell detachment

γ-Catenin p130Cas Cortactin D4-GDI DFF45/ICAD

Caspase-3 Caspase-3 Caspase-3 Caspase-3 Caspase-3, -7

Cell adhesion Cell adhesion Cytoskeleton Cytoskeleton DNA repair

Cell detachment Cell detachment Loss of cell shape Loss of cell shape Release of active DFF40/CAD to cause chromatin condensation & DNA fragmentation Abolition of DNA repair

DNA-PKCS

Caspase-3

DNA repair

DSEB/RF-C140 FAK

Caspase-3 Caspase-3, -6

DNA replication Impairment of DNA replication Cell adhesion Cell detachment

Fodrin

Caspase-3

Cytoskeleton

Loss of cell shape

Gas2

Caspase-3, -7

Cytoskeleton

Loss of cell shape

Gelsolin

Caspase-3

Cytoskeleton

GRASP65 HIP-55 HS1 Lamin A

Caspase-3 Caspase-3 Caspase-3 Caspase-6

Loss of cell shape

PARP

Golgi apparatus Cytoskeleton Cytoskeleton Nuclear envelope Caspase-3, -6 Nuclear envelope Caspase-3 MAP kinase pathway Caspase-3, -6, -7 DNA repair

PMCA4b

Caspase-3

Creation of fully active Ca

Protein kinase Cδ

Caspase-3

Protein kinase Cθ

Caspase-3

Rb

Caspase-3

ROCK-1 SATB1 STAT1 SREBPs

Caspase-3, -7

Topoisomerase I

Caspase-3

U1-70kD

Caspase-3

Lamin B PAK2

Vimentin

Fragmentation of Golgi Loss of cell shape Loss of cell shape Nuclear shrinkage & budding

Reference Kayalar et al., 1995; Mashima et al., 1997 Brancolini et al., 1997; Van de Craen et al., 1999 Brancolini et al., 1998 Kook et al., 2000 Chen et al., 2001 Na et el., 1996 Enari et al., 1998; Liu et al., 1997; Sakahira et al., 1998; Slee et al., 2001; Wolf et al., 1999 Casciola-Rosen et al., 1996; Song et al., 1996 Ubeda and Habener, 1997 Crouch et al., 1996; Gervais et al., 1998 Cryns, et al., 1996; Martin et al., 1995; Slee et al., 2001 Brancolini et al., 1995; Sgorbissa et al., 1999 Kothakota et al., 1997; Slee et al., 2001 Lane et al., 2002 Chen et al., 2001 Chen et al., 2001 Orth et al., 1996; Rao et al., 1996; Takahashi et al., 1996

Nuclear shrinkage & budding

Buendia et al., 1999; Lazebnik et al., 1995; Slee et al., 2001

Formation of apoptotic bodies

Rudel and Bokoch, 1997; Walter et al., 1998

Disruption of DNA repair

Germain et al., 1999; Lazebnik et al., 1994; Nicholson et al., 1995; Orth et al., 1996; Slee et al., 2001; Tewari et al., 1995 2+

pump Paszty et al., 2002

Plasma 2+ membrane Ca pump Signal transduction Signal transduction Cell cycle

Sub-G1 phase DNA induction & death Sub-G1 phase DNA induction & death Induction of death

Caspase-3

Cytoskeleton

Membrane budding

Caspase-6 Caspase-3

Binds DNA Signal transduction Cholesterol metabolism DNA replication

DNA fragmentation Inability to mediate transduction Deregulation of cholesterol synthesis Impairment of DNA replication

Pre-mRNA Disruption of RNA splicing & splicing protein synthesis Caspase-3, -6, -7 Intermediate Loss of cell shape filament protein

Emoto et al., 1995; Ghayur et al., 1996; Koriyama et al., 1999 Datta et al., 1997b An et al., 1996; Janicke et al., 1996; Slee et al., 2001 Coleman et al., 2001; Sebbagh et al., 2001 Galande et al., 2001 King and Goodbourn, 1998; Slee et al., 2001 Chandler et al., 1998; Wang et al., 1996b Slee et al., 2001; Voelkel-Johnson et al., 1995 Casciola-Rosen et al., 1994, 1996 Byun et al., 2001; Slee et al., 2001

neighboring cells in vivo (Brancolini et al., 1997; Crouch et al., 1996). Organelles also are degraded during the apoptotic process. Caspase-3 processing of a protein localized on the Golgi apparatus, GRASP65, mediates fragmentation of the Golgi ribbon to catalyze its destruction (Lane et al., 2002). Likewise, fragmentation of

190


genetic DNA is ensured with the aid of processed STAT1, which eliminates higherorder chromatin structure, and caspase-3-mediated cleavage of ICAD to CAD, which results in degradation of internucleosomal DNA by CAD (Galande et al., 2001; Sakahira et al., 1998). The list of caspase substrates described in Table 2 is not complete or all encompassing. Other proteins such as the anti-apoptotic molecules Bcl-XL and XIAP, pro-apoptotic molecules like Bid, heat shock proteins, calpain inhibitors, ubiquitin ligases, and pro-caspases, among others are not included here, and elucidation of new caspase substrates is an ongoing process.

5.

Inhibitors of Caspases

The progression of apoptosis can be halted at numerous checkpoints along the apoptotic pathways. Transduction of a death signal can be stalled upstream in the apoptotic cascade immediately following the binding of a ligand to a death receptor or by preventing mitochondrial dysfunction. In addition, the activation of procaspases can be suppressed and the activity of mature processed caspases limited. Regardless of the location or locations along the apoptotic cascade that one chooses to focus, slowing or halting the progression of apoptosis will be a benefit to biochemical manufacturers. Increased viable cell numbers will lead to longer batch times and may cause an increase in recombinant protein production. Apoptosis may be inhibited through the genetic engineering of mammalian cells to overexpress an anti-apoptotic gene or through the addition of chemical inhibitors to the culture medium. Some of the caspase-inhibitory options available to biochemical engineers are outlined below. 5.1

CrmA

Cytokine response modifier A (CrmA) originally was identified in Cowpox virus as a serpin that bound and inhibited the proteolytic activation of caspase-1 normally evoked during the immune response (Komiyama et al., 1994; Miura et al., 1993; Ray et al., 1992). Likewise, CrmA subsequently has been found to bind and inhibit caspase-8, the key mediator of the extrinsic death receptor pathway, but possesses a much weaker affinity for the effector caspase-3 (Muzio et al., 1997; Takahashi et al., 1997; Zhou et al., 1997). In addition, through the aid of kinetic analysis, CrmA has been shown to inhibit caspases-4, -5, -9 and -10 confirming its importance in blocking initiator caspases (Garcia-Calvo et al., 1998). However, the active form of caspase-9 used in the study was not the one that normally exists in vivo. Nevertheless, with the elucidation of CrmA’s potential for inhibiting the serine protease, Granzyme B, came the knowledge that CrmA displays cross-class reactivity by inhibiting both cysteine and serine proteases (Quan et al., 1995).

CASPASES INHIBITORS

191

CrmA is a cytosolic protein that provides inhibition by binding irreversibly to the target caspase following cleavage of itself by the caspase at the amino acid sequence, LVAD (Turner et al., 1999). CrmA primarily functions as an inhibitor of apoptosis in the Type I extrinsic death receptor pathway. Expression of CrmA has been found to prevent apoptosis in numerous mammalian cell lines mediated by death receptors of the TNF receptor superfamily including TNFR1, Fas, DR3, DR4, and DR5 (Chinnaiyan et al., 1996; Enari et al., 1995; Geley et al., 1997; Marsters et al., 1996a, b; Memon et al., 1995; Miura et al., 1995; Nagane et al., 2000; Suliman et al., 2001; Tewari and Dixit, 1995). Likewise, CrmA can protect against apoptosis induced by FADD, the cytosolic adapter protein that binds to the Fas receptor and similarly against apoptosis induced by TRADD, the adapter protein that binds to TNFR1 (Chinnaiyan et al., 1995; Hsu et al., 1995). However, CrmA has been found to possess no effect on tBid-induced death of the Type II pathway (Li et al., 1998). Additionally, CrmA can confer protection against various apoptotic insults including extracellular matrix detachment, ultraviolet irradiation, the toxic metal cadmium, and the chemical reagents etoposide, cisplatin, doxorubicin, and 1-β-Darabinofurasosyl-cytosine. Of significance to biochemical engineers, CrmA inhibits apoptosis induced by hypoxia in primary rat ventricular myocytes, serum deprivation in Rat-1 cells, and Sindbis virus infection in BHK and N18 cells (Antoku et al., 1997; Boudreau et al., 1995; Gurevich et al., 2001; Kim et al., 2000; Nava et al., 1998; Rehemtulla et al., 1997; Wang et al., 1994). Of note, mutation of CrmA’s pseudosubstrate site to that of another caspase inhibitor, P35, enhanced the protein’s ability to inhibit apoptosis induced by caspase-3 as well as spent medium and Sindbis virus infection (Ekert et al., 1999; Sauerwald et al., in press). 5.2

P35

A mutation in a gene encoding a 35 kDa protein in the baculovirus Autographa californica nuclear polyhedrosis virus (AcNPV) led to the discovery of p35’s antiapoptotic potential (Friesen and Miller, 1987; Clem et al., 1991). Currently, no cellular homologs of P35 have been discovered, although other baculoviruses have been found which code for p35 homologs including Spodoptora littoralis NPV, Leucania separata NPV, and Bombyx mori NPV (Du et al., 1999; Kamita et al., 1993; Qi et al., 2001). However, P35 derived from AcNPV has proven to be the superior inhibitor upon comparison to BmNPV P35 (Morishima et al., 1998). P35 is predominantly a cytosolic protein with the ability to homodimerize which may aid in accelerating inhibition or stabilizing the protein (Hershberger et al., 1994; Zoog et al., 1999). Similar to CrmA, inhibition by P35 entails a series of preliminary activation steps. First, slow binding of the inhibitor to the caspase occurs then cleavage of P35 results in a stoichiometric complex between the inhibitor and caspase. The caspase is thus isolated from further cleavage activity (Bertin et al., 1996; Eddins et al., 2002; Xue and Horvitz, 1995; Zhou et al., 1998).

192


P35 has been shown to provide irreversible inhibition of caspases -1, -2, -3, -4, 6, -7, -8, and -10 but not caspase-9, and as a result, possesses broader specificity for caspases than CrmA and a preference for the downstream effector caspases (Bump et al., 1995; Seshagiri and Miller, 1997; Vier et al., 2000; Zhou et al., 1998). Inhibition of apoptosis is afforded in phylogenetically diverse organisms including plants, worms, flies, insects, and mammals. P35 has been proven to repress Agrobacterium-induced apoptosis in maize cells (Hansen, 2000). Upon expression of P35 in the developing nematode, C. elegans, a decrease in the number of cells normally programmed to die was observed (Sugimoto et al., 1994). Similarly, P35 halted apoptosis in the developing eye and during metamorphosis of Drosophila melanogaster as well as apoptosis induced by irradiation (Hay et al., 1994; Jiang et al., 1997). In S. frugiperda insect cells, the survival rate was increased following exposure to the RNA synthesis inhibitors, actinomycin D, α-amanitin, and dichlorobenzimidazole, as well as by a mutant baculovirus lacking the p35 gene and by Heliothis zea 1 virus (Cartier et al., 1994; Clem and Miller, 1994; Crook et al., 1993; Lee and Chao, 1998). In addition, Sf9 cells expressing P35 were found to display an increased resistance to nutrient withdrawal-induced apoptosis and increased protein production in comparison to the parental Sf9 cell line (Lin et al., 2001). Finally, in mammalian cells, apoptosis inhibition can be conferred following insults indicative of the intrinsic mitochondrial pathway. For example, P35 halted apoptosis induced by overexpression of the pro-apoptotic Bcl-2 family members, Bok and Bax (Hsu et al., 1997; Vekrellis et al., 1997). Likewise, P35 expression prevented TNF- and Fas-induced death characteristic of the Type I extrinsic death receptor pathway and partially inhibited tBid-induced death of the Type II pathway (Beidler et al., 1995; Datta et al., 1997a; Hacker et al., 1996; Kojima and Datta, 1996; Li et al., 1998). More pertinent to biochemical engineers, P35 also is able to inhibit apoptosis in culture due to withdrawal of serum, glucose, growth factor, and trophic factor (Haviv et al., 1997; Martinou et al., 1995; Rabizadeh et al., 1993). 5.3

IAP FAMILY

The first iap (inhibitor of apoptosis) gene was discovered in an attempt to search for p35-homologous genes. An AcNPV lacking the p35 coding sequence was transfected into Sf21 insect cells along with coding sequences from the baculovirus Cydia pomonella granulosis virus (CpGV) (Crook et al., 1993). One gene, Cp-iap was able to rescue the wild-type infection allowing the virus to replicate. Since then, structural IAP homologs have been discovered in several other baculoviruses and many diverse eukaryotic species including the worm C. elegans, the insects Drosophila melanogaster and S. frugiperda, and in numerous mammalian organisms including chicken, mice, pigs, and humans; however, not all possess inhibitory properties. IAP proteins are classified based on the existence of a minimum of one BIR (baculovirus iap repeat) domain. BIR domains occur in the amino-terminal

CASPASES INHIBITORS

193

portion of the protein and consist of a series of highly conserved cysteine and histidine residues which are indispensable for the protein’s anti-apoptotic function (Birnbaum et al., 1994; Clem and Miller, 1994; Takahashi et al., 1998). Some IAP family members also contain carboxy-terminal RING fingers which have been discovered to possess E3-ubiquitin ligase activity and may or may not be necessary for the protein’s anti-apoptotic potential (Clem and Miller, 1994; Hay et al., 1995; Huang et al., 2000; Suzuki et al., 2001c; Yang et al., 2000; You et al., 1997). Examples of various forms of IAP proteins are outlined in Figure 4. Some IAPs consist only of BIR motifs like mammalian NAIP/BIRC1, whereas others possess various combinations of BIRs and a RING finger, such as the mammalian proteins XIAP/hILP/MIHA/BIRC4 and KIAP/Livin/ML-IAP/BIRC7, the Drosophila IAPs DIAP1 and DIAP2, the S. frugiperda SfIAP1, and the viral members CpIAP and OpIAP. Moreover, others such as the mammalian proteins cIAP1/hIAP2/MIHB/BIRC2 and cIAP2/hIAP1/ MIHC/BIRC3, contain a CARD motif in addition to BIR and RING motifs (Reviewed in Verhagen et al., 2001). Of these, the human XIAP protein is the most effective inhibitor of caspases and the most studied to date.

Figure 4. A structural comparison of inhibitor of apoptosis (IAP) family members. IAPs are characterized by the presence of one to three baculovirus iap repeat BIR domains and may or may not contain a RING finger. cIAP1 and cIAP2 contain a CARD domain.

XIAP, which is localized to the cytosol, has the ability to inhibit caspases-3, -7, and -9 but possesses no inhibitory function toward caspases-1, -6, -8, and -10

194


(Deveraux et al., 1997, 1998). XIAP-mediated inhibition of the initiator caspase-9 occurs at the level of the apoptosome. XIAP associates with the apoptosome through direct binding of its BIR3 domain to processed caspase-9, thus inhibiting the ability of caspase-9 to activate effector caspases (Srinivasula et al., 2001; Sun et al., 2000). In addition, the pro-apoptotic mitochondrial-released Smac binds to an overlapping region of BIR3 (Liu et al., 2000; Wu et al., 2000). Thus, Smac binds to the BIR3 domain of XIAP facilitating the release of active caspase-9 (Ekert et al., 2001). Released caspase-9 then is available to activate the effector caspases-3 and 7, which also may be inhibited by XIAP through interactions mediated by the BIR2 domain and the amino terminal linker region (Chai et al., 2001; Sun et al., 1999a; Suzuki et al., 2001b; Takahashi et al., 1998). As a result, overexpression of stoichiometric amounts of XIAP in culture should allow for complete inhibition of caspase-9 and the further prevention of effector caspases as well as inhibition of mitochondrial pro-apoptotic molecules Smac and HtrA2/Omi. Indeed, XIAP has been shown to protect mammalian cells signaled to undergo apoptosis following cytochrome c release typical of the intrinsic pathway and treatment with TNF-α and anti-Fas antibody indicative of the extrinsic pathway (Duckett et al., 1998). Moreover, XIAP conferred protection against the TRAILinduced extrinsic death receptor pathway by binding to active caspase-3, thus preventing the degradation of substrates such as PARP and CAD and ultimately cell demise (Zhang et al., 2001). Likewise, XIAP has been proven to inhibit apoptosis mediated by UV radiation, cisplatin and menadione exposure, and potassium withdrawal (Duckett et al., 1998; Liston et al., 1996; Simons et al., 1999). More pertinent to biotechnologists, XIAP also has been shown to increase cell viabilities upon Sindbis virus infection of BHK cells and growth factor withdrawal in human endothelial cells (Duckett et al., 1996; Levkau et al., 2001). Of particular note, a truncation of XIAP which expressed only the BIR domains allowed for enhanced protection against apoptosis mediated by Sindbis virus infection, etoposide, cisplatin, and serum deprivation (Sauerwald et al., 2002). 5.4

DOMINANT NEGATIVE CASPASES

Dominant-negative (DN) caspases are another area being pursued in the quest for caspase inhibition. Expression of a DN caspase serves as a competitive inhibitor of the caspase it represents, thus stalling the processing and activation of that caspase. A naturally occurring genetic dominant-negative inhibitor of caspase-8, FLIP, has been discovered. It is a catalytically-inactive, naturally-occurring inhibitor of DISC formation by binding the adapter protein FADD, thus preventing the transduction of apoptotic signals from death receptors (Irmler et al., 1997). A naturally occurring dominant negative caspase-9 inhibitor also has been discovered. Caspase-9S, cloned from human liver, lacks a large portion of the p20 subunit containing the active site cysteine (Seol and Billiar, 1999). Caspase-9S is able to

CASPASES INHIBITORS

195

bind to Apaf-1 preventing the recruitment of caspase-9 to the apoptosome (Seol and Billiar, 1999). Hence, through the use of a genetically evolved dominant negative inhibitor or through site-directed mutagenesis of a caspase’s active cysteine, overexpression of dominant-negative caspases in mammalian cell culture should allow for attenuation of the apoptotic response leading to higher viabilities and perhaps increased protein production. 5.5

PEPTIDE INHIBITORS

In addition to the overexpression of genetic caspase inhibitors, apoptosis can be inhibited through the treatment of cultures with synthetic compounds containing a tri- or tetrapeptide sequence targeted towards specific caspases. The compounds can be manufactured as aldehydes, ketones, and nitriles, which are reversible inhibitors and acyloxymethyl ketones, diazomethyl ketones, and halomethyl ketones which are irreversible inhibitors. One of the most widely used compounds is the halomethyl ketone benzyloxycarbonyl-Val-Ala-Asp-fluoromethyl ketone (Z-VAD.fmk), a cellpermeable irreversible pan-caspase inhibitor. A study was performed by Garcia-Calvo et al. (1998) to determine the stringency of numerous peptide inhibitors for caspases-1 through -10. They found that Z-VAD.fmk conferred protection against each caspase studied. For inhibition of one specific caspase, a tetrapeptide inhibitor can be used containing the optimal pseudosubstrate site for that caspase. These sequences are outlined in Table 1. Thornberry et al. (1997) also examined the effects of various combinations of 20 amino acids substituted at the P2, P3, and P4 positions N-terminal to the essential P1 aspartate residue. Caspase substrate specificity is defined predominantly by the P4 position with greater variability occurring in the P2 and P3 positions. Consequently, with the knowledge of the numerous recognition sites afforded by each caspase, peptide inhibitors may be designed to combat distinct caspase activities. In the apoptotic pathway, Z-VAD.fmk has been proven to prevent apoptosis in the extrinsic death receptor pathway prior to the commitment of death. The tripeptide inhibitor prevented activation of caspase-8 and subsequent cleavage of Bid, which resulted in a lack of cytochrome c release and effector caspase activation (Sun et al., 1999b). However, Z-VAD.fmk was not as effective in the intrinsic mitochondrial pathway. Inhibition occurred after the commitment to death and cytochrome c release y inhibiting caspase-9 and the resultant activation of downstream effector caspases (Sun et al., 1999b). When used in an industrial application, treatment of cells with Z-VAD.fmk has been shown to increase viabilities and protein production in culture. In fact, in NS0 myeloma batch cultures, treatment of cells with Z-VAD.fmk extended viabilities marginally during conditions of low serum and significantly during conditions of etoposide exposure (McKenna and Cotter, 2000). Likewise, in AT3 cells infected with Sindbis virus, cells exposed to Z-VAD.fmk survived an additional two days compared to the

196


control and produced almost four times the amount of protein (Mastrangelo et al., 1999). In addition, when the tripeptide inhibitor was used during an adenovirus infection of HeLa cells, not only was apoptosis stalled, but virus yield was significantly enhanced (Chiou and White, 1998). 5.6

COMPARISON OF CASPASE INHIBITORS

With the various methods available to inhibit caspases, the ability to extend culture lifetimes is a reality. Through a comparison of caspase inhibitors, biochemical engineers can determine whether to inhibit individual caspases, either upstream or downstream, or a combination thereof (Table 3). Elucidation of the specific caspases being activated in one’s culture may also allow for a more pronounced inhibition of apoptosis (unpublished data). However, the use of chemical inhibitors may prove too costly for large batches or for extended use and may outweigh the benefits derived from increased product yield. Table 3. A comparison of the various types of caspase inhibitors: CrmA, P35, XIAP, dominant-negative (DN) caspases, and synthetic peptide inhibitors.

Apoptosis Caspase Initiator Caspase-2 Caspase-8 Caspase-9 Caspase-10 Effector Caspase-3 Caspase-6 Caspase-7

6.

CrmA

D D? D

P35

XIAP

D D D D D D D

D D

DN

Peptide Inhibitor

D D D D

D D D D

D D D

D D D

Conclusions

The work presented herein provides a general overview of caspase involvement in the apoptotic pathways and methods available for their inhibition. Genetic and chemical approaches may be utilized to lengthen batch times of cultured mammalian cells and in some instances, mutational analyses of genetic inhibitors are an effective means to obtain higher cell viabilities in culture. If these approaches to manipulate caspase activity in cell lines are applied in conjunction with improvements in bioreactor design, culture medium, cell line development, and expression vector design, optimum biopharmaceutical yield will be possible. Such advancements may

CASPASES INHIBITORS

197

lead to a more cost-effective biotechnology operation with recombinant protein yields surpassing those previously obtained.

7.

References

Adrain, C., Creagh, E.M., and Martin, S.J. (2001) Apoptosis-associated release of Smac/DIABLO from mitochondria requires active caspases and is blocked by Bcl-2. EMBO J. 20, 6627-6638. Ahmad, M., Srinivasula, S.M., Hegde, R., Mukattash, R., Fernandes-Alnemri, T., and Alnemri, E.S. (1998) Identification and characterization of murine caspase-14, a new member of the caspase family. Cancer Res. 58, 5201-5205. Alnemri, E.S., Livingston, D.J., Nicholson, D.W., Salvesen, G., Thornberry, N.A., Wong, W.W., and Yuan, J. (1996) Human ICE/CED-3 protease nomenclature. Cell 87, 171. An, B., Jin, J.R., Lin, P., and Dou, Q.P. (1996) Failure to activate interleukin-1β converting enzyme-like proteases and to cleave retinoblastoma protein in drug-resistant cells. FEBS Lett. 399, 158-162. Antoku, K., Liu, Z., and Johnson, D.E. (1997) Inhibition of caspase proteases by CrmA enhances the resistance of human leukemic cells to multiple chemotherapeutic agents. Leukemia 11, 1665-1672. Ashkenazi, A., and Dixit, V.M. (1998) Death receptors: Signaling and modulation. Science 281, 1305-1308. Beidler, D.R., Tewari, M., Friesen, P.D., Poirier, G., and Dixit, V.M. (1995) The baculovirus p35 protein inhibits Fas- and tumor necrosis factor-induced apoptosis. J. Biol. Chem. 270, 16526-16528. Bertin, J., Mendrysa, S.M., LaCount, D.J., Gaur, S., Krebs, J.F., Armstrong, R.C., Tomaselli, K.J., and Friesen, P.D. (1996) Apoptotic suppression by baculovirus P35 involves cleavage by and inhibition of a virus-induced CED-3/ICE-like protease. J. Virol. 70, 62516259. Birnbaum, M.J., Clem, R.J., and Miller, L.K. (1994) An apoptosis-inhibiting gene from a nuclear polyhedrosis virus encoding a polypeptide with Cys/His sequence motifs. J. Virol. 68, 2521-2528. Boldin, M.P., Goncharov, T.M., Goltsev, Y.V., and Wallach, D. (1996) Involvement of MACH, a novel MORT1/FADD-interacting protease, in Fas/APO-1- and TNF receptorinduced cell death. Cell 85, 803-815. Boudreau, N., Sympson, C.J., Werb, Z., and Bissell, M.J. (1995) Suppression of ICE and apoptosis in mammary epithelial cells by extracellular matrix. Science 267, 891-893. Brancolini, C., Benedetti, M., and Schneider, C. (1995) Microfilament reorganization during apoptosis: the role of Gas2, a possible substrate for ICE-like proteases. EMBO J. 14, 51795190. Brancolini, C., Lazarevic, D., Rodriguez, J., and Schneider, C. (1997) Dismantling cell-cell contacts during apoptosis is coupled to a caspase-dependent proteolytic cleavage of betacatenin. J. Cell Biol. 139, 759-771. Brancolini, C., Sgorbissa, A., and Schneider, C. (1998) Proteolytic processing of the adherens junctions components beta-catenin and gamma-catenin/plakoglobin during apoptosis. Cell Death Differ. 5, 1042-1050. Buendia, B., Santa-Maria, A., and Courvalin, J.C. (1999) Caspase-dependent proteolysis of integral and peripheral proteins of nuclear membranes and nuclear pore complex proteins during apoptosis. J. Cell Sci. 112, 1743-1753.

198


Bump, N.J., Hackett, M., Hugunin, M., Seshagiri, S., Brady, K., Chen, P., Ferenz, C., Franklin, S., Ghayur, T., Li, P., Lacari, P., Mankovich, J., Shi, L., Greenburg, A.H., Miller, L.K., and Wong, W.W. (1995) Inhibition of ICE family proteases by baculovirus antiapoptotic protein p35. Science 269, 1885-1888. Byun, Y., Chen, F., Chang, R., Trivedi, M., Green, K.J., and Cryns, V.L. (2001) Caspase cleavage of vimentin disrupts intermediate filaments and promotes apoptosis. Cell Death Differ. 8, 443-450. Cain, K., Bratton, S.B., Langlais, C., Walker, G., Brown, D.G., Sun, X.M., and Cohen, G.M. (2000) Apaf-1 oligomerizes into biologically active approximately 700-kDa and inactive approximately 1.4-Mda apoptosome complexes. J. Biol. Chem. 275, 6067-6070. Cartier, J.L., Hershberger, P.A., and Friesen, P.D. (1994) Suppression of apoptosis in insect cells stably transfected with baculovirus p35: Dominant interference by N-terminal sequences p351-76. J. Virol. 68, 7728-7737. Casciola-Rosen, L., Miller, D.K., Anhalt, G.J., and Rosen, A. (1994) Specific cleavage of the 70-kDa protein component of the U1 small nuclear ribonucleoprotein is a characteristic biochemical feature of apoptotic cell death. J. Biol. Chem. 269, 30757-30760. Casciola-Rosen, L., Nicholson, D.W., Chong, T., Rowan, K.R., Thornberry, N.A., Miller, D.K., and Rosen, A. (1996) Apopain/CPP32 cleaves proteins that are essential for cellular repair: a fundamental principle of apoptotic death. J. Exp. Med. 183, 1957-1964. Cerretti, D.P., Kozlosky, C.J., Mosley, B., Nelson, N., Van Ness, K., Greenstreet, T.A., March, C.J., Kronheim, S.R., Druck, T., Cannizzaro, L.A., Huebner, K., and Black, R.A. (1992) Molecular cloning of the interleukin-1 beta converting enzyme. Science 256, 97100. Chai, J., Shiozaki, E., Srinivasula, S.M., Wu, Q., Dataa, P., Alnemri, E.S., and Shi, Y. (2001) Structural basis of caspase-7 inhibition by XIAP. Cell 104, 769-780. Chandler, J.M., Cohen, G.M., and MacFarlane, M. (1998) Different subcellular distribution of caspase-3 and caspase-7 following Fas-induced apoptosis in mouse liver. J. Biol. Chem. 273, 10815-10818. Chauhan, D., Hideshima, T., Rosen, S., Reed, J.C., Kharbanda, S., and Anderson, K.C. (2001) Apaf-1/cytochrome c-independent and Smac-dependent induction of apoptosis in multiple myeloma (MM) cells. J. Biol. Chem. 276, 24453-24456. Chen, Y.R., Kori, R., John, B., and Tan, T.H. (2001) Caspase-mediated cleavage of actinbinding and SH3-domain-containing proteins cortactin, HS1, and HIP-55 during apoptosis. Biochem. Biophys. Res. Commun. 288, 981-989. Chinnaiyan, A.M., O’Rourke, K., Tewari, M., and Dixit, V.M. (1995) FADD, a novel death domain-containing protein, interacts with the death domain of Fas and initiates apoptosis. Cell 81, 505-512. Chinnaiyan, A.M., O’Rourke, K., Yu, G.L., Lyons, R.H., Garg, M., Duan, D.R., Xing, L., Gentz, R., Ni, J., and Dixit, V.M. (1996) Signal transduction by DR3, a death domaincontaining receptor related to TNFR-1 and CD95. Science 274, 990-992. Chiou, S.-K., and White, E. (1998) Inhibition of ICE-like proteases inhibits apoptosis and increases virus production during adenovirus infection. Virology 244, 108-118. Clem, R.J., Fechheimer, M., and Miller, L.K. (1991) Prevention of apoptosis by a baculovirus gene during infection of insect cells. Science 254, 1388-1390. Clem, R.J., and Miller, L.K. (1994) Control of programmed cell death by the baculovirus genes p35 and iap. Mol. Cell. Biol. 14, 5212-5222. Coleman, M.L., Sahai, E.A., Yeo, M., Bosch, M., Dewar, A., and Olson, M.F. (2001) Membrane blebbing during apoptosis results from caspase-mediated activation of ROCK I. Nat. Cell Biol. 3, 339-345.

CASPASES INHIBITORS

199

Cory, S., and Adams, J.M. (2002) The Bcl2 family: Regulators of the cellular life-or-death switch. Nat. Rev. Cancer 2, 647-656. Creagh, E.M., and Martin, S.J. (2001) Caspases: cellular demolition experts. Biochem. Soc. Tran. 29, 696-702. Crook, N.E., Clem, R.J., and Miller, L.K. (1993) An apoptosis-inhibiting baculovirus gene with a zinc finger-like motif. J. Virol. 67, 2168-2174. Crouch, D.H., Fincham, V.J., and Frame, M.C. (1996) Targeted proteolysis of focal adhesion kinase pp125 FAK during c-MYC-induced apoptosis is suppressed by integrin signaling. Oncogene 12, 2689-2696. Cryns, V.L., Bergeron, L., Zhu, H., Li, H., and Yuan, J. (1996) Specific cleavage of α-fodrin during Fas- and Tumor necrosis factor-induced apoptosis is mediated by an interleukin-1βconverting enzyme/Ced-3 protease distinct from the poly(ADP-ribose) polymerase protease. J. Biol. Chem. 271, 31277-31282. Datta, R., Kojima, H., Banach, D., Bump, N.J., Talanian, R.V., Alnemri, E.S., Weichselbaum, R.R., Wong, W.W., and Kufe, D.W. (1997a) Activation of a CrmA-insensitive, p35sensitive pathway in ionizing radiation-induced apoptosis. J. Biol. Chem. 272, 1965-1969. Datta, R., Kojima, H., Yoshida, K., and Kufe, D. (1997b) Caspase-3-mediated cleavage of protein kinase C θ in induction of apoptosis. J. Biol. Chem. 272, 20317-20320. Deveraux, Q.L., Roy, N., Stennicke, H.R., Van Arsdale, T., Zhou, Q., Srinivasula, S.M., Alnemri, E.S., Salvesen, G.S., and Reed, J.C. (1998) IAPs block apoptotic events induced by caspase-8 and cytochrome c by direct inhibition of distinct caspases. EMBO J. 17, 2215-2223. Deveraux, Q.L., Takahashi, R., Salvesen, G.S., and Reed, J.C. (1997) X-linked IAP is a direct inhibitor of cell-death proteases. Nature 388, 300-304. DeZongotita, V.M., Schmelzer, A.E., and Miller, W.M. (2002) Characterization of hybridoma cell responses to elevated pCO2 and osmolality: Intracellular pH, cell size, apoptosis, and metabolism. Biotechnol. Bioeng. 77, 369-380. Du, C., Fang, M., Li, Y., Li, L., and Wang, X. (2000) Smac, a mitochondrial protein that promotes cytochrome c-dependent caspase activation by eliminating IAP inhibition. Cell 102, 33-42. Du, Q., Lehavi, D., Faktor, O., Qi, Y., and Chejanovsky, N. (1999) Isolation of an apoptosis suppressor gene of the Spodoptera littoralis nucleopolyhedrovirus. J. Virol. 73, 12781285. Duan, H., Chinnaiyan, A.M., Hudson, P.L., Wing, J.P., He, W.-W., and Dixit, V.M. (1996a) ICE-LAP3, a novel mammalian homologue of the Caenorhabditis elegans cell death protein Ced-3 is activated during Fas- and tumor necrosis factor-induced apoptosis. J. Biol. Chem. 271, 1621-1625. Duan, H., Orth, K., Chinnaiyan, A.M., Poirier, G.G., Froelich, C.J., He, W.-W., and Dixit, V.M. (1996b) ICE-LAP6, a novel member of the ICE/Ced-3 gene family, is activated by the cytotoxic T cell protease granzyme B. J. Biol. Chem. 271, 16720-16724. Duckett, C.S., Li, F., Wang, Y., Tomaselli, K.J., Thompson, C.B., and Armstrong, R.C. (1998) Human IAP-like protein regulates programmed cell death downstream of Bcl-XL and cytochrome c. Mol. Cell. Biol. 18, 608-615. Duckett, C.S., Nava, V.E., Gedrich, R.W., Clem, R.J., Van Dongen, J.L., Gilfillan, M.C., Shiels, H., Hardwick, J.M., and Thompson, C.B. (1996) A conserved family of cellular genes related to the baculovirus iap gene and encoding apoptosis inhibitors. EMBO J. 15, 2685-2694. Eckhart, L., Ban, J., Fischer, H., and Tschachler, E. (2000) Caspase-14: analysis of gene structure of mRNA expression during keratinocyte differentiation. Biochem. Biophys. Res. Commun. 277, 655-659.

200


Eddins, M.J., Lemongello, D., Friesen, P.D., and Fisher, A.J. (2002) Crystallization and lowresolution structure of an effector-caspase/P35 complex: similarities and differences to an initiator-caspase/P35 complex. Acta Crystallogr. D Biol. Crystallogr. 58, 299-302. Ekert, P.G., Silke, J., Hawkins, C.J., Verhagen, A.M., and Vaux, D.L. (2001) DIABLO promotes apoptosis by removing MIHA/XIAP from processed caspase 9. J. Cell. Biol. 152, 483-490. Ekert, P.G., Silke, J., and Vaux, D.L. (1999) Inhibition of apoptosis and clonogenic survival of cells expressing crmA variants: optimal caspase substrates are not necessarily optimal inhibitors. EMBO J. 18, 330-338. Emoto, Y., Manome, Y., Meinhardt, G., Kisaki, H., Kharbanda, S., Robertson, M., Ghayur, T., Wong, W.W., Kamen, R., Weichselbaum, R., and Kufe, D. (1995) Proteolytic activation of protein kinase Cδ by an ICE-like protease in apoptotic cells. EMBO J. 14, 6148-6156. Enari, M., Hug, H., and Nagata, S. (1995) Involvement of an ICE-like protease in Fasmediated apoptosis. Nature 375, 78-81. Enari, M., Sakahira, H., Yokoyama, H., Okawa, K., Iwamatsu, A., and Nagata, S. (1998) A caspase-activated DNase that degrades DNA during apoptosis, and its inhibitor ICAD. Nature 391, 43-50. Faucheu, C., Blanchet, A.-M., Collard-Dutilleul, V., Lalanne, J.-L., and Diu-Hercend, A. (1996) Identification of a cysteine protease closely related to interleukin-1β-converting enzyme. Eur. J. Biochem. 236, 207-213. Faucheu, C., Diu, A., Chan, A.W.E., Blanchet, A.-M., Miossec, C., Herve, F., CollardDutilleul, V., Gu, Y., Aldape, R.A., Lippke, J.A., Rocher, C., Su, M.S.-S., Livingston, D.J., Hercend, T., and Lalanne, J.-L. (1995) A novel human protease similar to the interleukin-1β converting enzyme induces apoptosis in transfected cells. EMBO J. 14, 1914-1922. Fernandes-Alnemri, T., Armstrong, R.C., Krebs, J., Srinivasula, S.M., Wang, L., Bullrich, F., Fritz, L.C., Trapani, J.A., Tomaselli, K.J., Litwack, G., and Alnemri, E.S. (1996) In vitro activation of CPP32 and Mch3 by Mch4, a novel human apoptotic cysteine protease containing two FADD-like domains. Proc. Natl. Acad. Sci. USA 93, 7464-7469. Fernandes-Alnemri, T., Litwack, G., and Alnemri, E.S. (1994) CPP32, a novel human apoptotic protein with homology to Caenorhabditis elegans cell death protein Ced-3 and mammalian interleukin-1β-converting enzyme. J. Biol. Chem. 269, 30761-30764. Fernandes-Alnemri, T., Litwack, G., and Alnemri, E.S. (1995a) Mch2, a new member of the apoptotic Ced-3/Ice cysteine protease family. Cancer Res. 55, 2737-2742. Fernandes-Alnemri, T., Takahashi, A., Armstrong, R., Krebs, J., Fritz, L., Tomaselli, K.J., Wang, L., Yu, Z., Croce, C.M., Salvesen, G., Earnshaw, W.C., Litwack, G., and Alnemri, E.S. (1995b) Mch3, a novel human apoptotic cysteine protease highly related to CPP32. Cancer Res. 55, 6045-6052. Fox S. 2001. Capacity crunch in contract manufacturing. Gen. Eng. News 21, 13. Franek, F. (1995) Starvation-induced programmed cell death of hybridoma cells: Prevention by amino acid mixtures. Biotechnol. Bioeng. 45, 86-90. Friesen, P.D., and Miller, L.K. (1987) Divergent transcription of early 35- and 94-kilodalton protein genes encoded by the HindIII K genome fragment of the baculovirus Autographa californica nuclear polyhedrosis virus. J. Virol. 61, 2264-2272. Galande, S., Dickinson, L.A., Mian, I.S., Sikorska, M., and Kohwi-Shigematsu, T. (2001) SATB1 cleavage by caspase 6 disrupts PDZ domain-mediated dimerization, causing detachment from chromatin early in T-cell apoptosis. Mol. Cell. Biol. 21, 5591-5604.

CASPASES INHIBITORS

201

Garcia-Calvo, M., Peterson, E.P., Leiting, B., Ruel, R., Nicholson, D.W., and Thornberry, N.A. (1998) Inhibition of human caspases by peptide-based and macromolecular inhibitors. J. Biol. Chem. 273, 32608-32613. Geley, S., Hartmann, B.L., Kapelari, K., Egle, A., Villunger, A., Heidacher, D., Greil, R., Auer, B., and Kofler, R. (1997) The interleukin 1β-converting enzyme inhibitor CrmA prevents Apo1/Fas- but not glucocorticoid-induced poly(ADP-ribose) polymerase cleavage and apoptosis in lymphoblastic leukemia cells. FEBS Lett. 402, 36-40. Germain, M., Affar, E.B., D'Amours, D., Dixit, V.M., Salvesen, G.S., and Poirier, G.G. (1999) Cleavage of automodified poly(ADP-ribose) polymerase during apoptosis. Evidence for involvement of caspase-7. J. Biol. Chem. 274, 28379-28384. Gervais, F.G., Thornberry, N.A., Ruffolo, S.C., Nicholson, D.W., and Roy, S. (1998) Caspases cleave focal adhesion kinase during apoptosis to generate a FRNK-like polypeptide. J. Biol. Chem. 273, 17102-17108. Ghayur, T., Hugunin, M., Talanian, R.V., Ratnofsky, S., Quinlan, C., Emoto, Y., Pandey, P., Datta, R., Huang, Y., Kharbanda, S., Allen, H., Kamen, R., Wong, W., and Kufe, D. (1996) Proteolytic activation of protein kinase C delta by an ICE/CED 3-like protease induced characteristics of apoptosis. J. Exp. Med. 184, 2399-2404. Gross, A., Yin, X.-M., Wang, K., Wei, M.C., Jockel, J., Milliman, C., Erdjument-Bromage, H., Tempst, P., and Korsmeyer, S.J. (1999) Caspase cleaved BID targets mitochondria and is required for cytochrome c release, while BCL-XL prevents this release but not tumor necrosis factor-R1/Fas death. J. Biol. Chem. 274, 1156-1163. Gurevich, R.M., Regula, K.M., and Kirshenbaum, L.A. (2001) Serpin protein CrmA suppresses hypoxia-mediated apoptosis of ventricular myocytes. Circulation 103, 19841991. Hacker, G., Hawkins, C.J., Smith, K.G.C., and Vaux, D.L. (1996) Effects of viral inhibitors of apoptosis in models of mammalian cell death. Behring Inst. Mitt. 97, 118-126. Hansen, G. (2000) Evidence for Agrobacterium-induced apoptosis in maize cells. Mol. Plant Microbe Interact. 13, 649-657. Hay, B.A., Wassarman, D.A., and Rubin, G.M. (1995) Drosophila homologs of baculovirus inhibitor of apoptosis proteins function to block cell death. Cell 83, 1253-1262. Hay, B.A., Wolff, T., and Rubin, G.M. (1994) Expression of baculovirus P35 prevents cell death in Drosophila. Development 120, 2121-2129. Haviv, R., Lindenboim, L., Li, H., Yuan, J., and Stein, R. (1997) Need for caspases in apoptosis of trophic factor-deprived PC12 cells. J. Neurosci. Res. 50, 69-80. Hegde, R., Srinivasula, S.M., Zhang, Z., Wassell, R., Mukattash, R., Cilent, L., DuBois, G., Lazebnik, Y., Zervos, A.S., Fernandes-Alnemri, T., and Alnemri, E.S. (2002) Identification of Omi/HtrA2 as a mitochondrial apoptotic serine protease that disrupts inhibitor of apoptosis protein-caspase interaction. J. Biol. Chem. 277, 432-438. Hershberger, P.A., LaCount, D.J., and Friesen, P.D. (1994) The apoptotic suppressor P35 is required early during baculovirus replication and is targeted to the cytosol of infected cells. J. Virol. 68, 3467-3477. Hisanaga, K., Kure, S., Bredesen, D.E., Ikeda, Y., Kohsaka, S., and Sharp, F.R. (1995) Apoptotic cell death of a temperature-sensitive central neuronal cell line. Brain Res. 684, 79-86. Hsu, H., Xiong, J., and Goeddel, D.V. (1995) The TNF receptor 1-associated protein TRADD signals cell death and NF-κB activation. Cell 81, 495-504. Hsu, S.Y., Kaipia, A., McGee, E., Lomeli, M., and Hsueh, A.J.W. (1997) Bok is a proapoptotic Bcl-2 protein with restricted expression in reproductive tissues and heterodimerizes with selective anti-apoptotic Bcl-2 family members. Proc. Natl. Acad. Sci. USA 94, 12401-12406.

202


Hu, S., Snipas, S.J., Vincenz, C., Salvesen, G., and Dixit, V.M. (1998) Caspase-14 is a novel developmentally regulated protease. J. Biol. Chem. 273, 29648-29653. Huang, H.k., Joazeiro, C.A.P., Bonfoco, E., Kamada, S., Leverson, J.D., and Hunter, T. (2000) The inhibitor of apoptosis, cIAP2, functions as a ubiquitin-protein ligase and promotes in vitro monoubiquitination of caspases 3 and 7. J. Biol. Chem. 275, 2666126664. Humke, E.W., Ni, J., and Dixit, V.M. (1998) ERICE, a novel FLICE-activatable caspase. J. Biol. Chem. 273, 15702-15707. Irmler, M., Thome, M., Hahne, M., Schneider, P., Hofmann, K., Steiner, V., Bodmer, J.-L., Schroter, M., Burns, K., Mattman, C., Rimoldi, D., French, L.E., and Tschopp, J. (1997) Inhibition of death receptor signals by cellular FLIP. Nature 388, 190-195. Janicke, R.U., Walker, P.A., Lin, X.Y., and Porter, A.G. (1996) Specific cleavage of the retinoblastoma protein by an ICE-like protease in apoptosis. EMBO J. 15, 6969-6978. Jiang, C., Baehreacke, E.H., and Thummel, C.S. (1997) Steroid regulated programmed cell death during Drosophila metamorphosis. Development 124, 4673-4683. Kamens, J., Paskind, M., Hugunin, M., Talanian, R.V., Allen, H., Banach, D., Bump, N., Hackett, M., Johnston, C.G., Li, P., Mankovich, J.A., Terranova, M., and Ghayur, T. (1995) Identification and characterization of ICH-2, a novel member of the interleukin-1βconverting enzyme family of cysteine proteases. J. Biol. Chem. 270, 15250-15256. Kamita, S.G., Majima, K., and Maeda, S. (1993) Identification and characterization of the p35 gene of Bombyx mori nuclear polyhedrosis virus that prevents virus-induced apoptosis. J. Virol. 67, 455-463. Kang, S.-J., Wang, S., Hara, H., Peterson, E.P., Namura, S., Amin-Hanjani, S., Huang, Z., Srinivasan, A., Tomaselli, K.J., Thornberry, N.A., Moskowitz, M.A., and Yuan, J. (2000) Dual role of caspase-11 in mediating activation of caspase-1 and caspase-3 under physiological conditions. J. Cell. Biol. 149, 613-622. Kaufmann, S.H., and Hengartner, M.O. (2001) Programmed cell death: alive and well in the new millennium. Trends Cell. Biol. 11, 526-534. Kayalar, C., Ord, T., Testa, M.P., Zhong, L.T., and Bredesen, D.E. (1995) Cleavage of actin by interleukin 1 beta-converting enzyme to reverse DNase I inhibition. Proc. Natl. Acad. Sci. USA 93, 2234-2238. Kearns, M.J. (1990) Integrated design for mammalian cell culture. Biotechnology 8, 409-413. Kim, M.S., Kim, B.J., Woo, H.N., Kim, K.W., Kim, K.B., Kim, I.K., and Jung, Y.K. (2000) Cadmium induces caspase-mediated cell death: suppression by Bcl-2. Toxicology 145, 2737. King, P., and Goodbourn, S. (1998) STAT1 is inactivated by a caspase. J. Biol. Chem. 271, 8699-8704. Kischkel, F.C., Hellbardt, S., Behrmann, I., Germer, M., Pawlita, M., Krammer, P.H., and Peter, M.E. (1995) Cytotoxicity-dependent APO-1 (Fas/CD95)-associated proteins form a death-inducing signaling complex (DISC) with the receptor. EMBO J. 14, 5579-5588. Kischkel, F.C., Lawrence, D.A., Tinel, A., LeBlanc, H., Virmani, A., Schow, P., Gazdar, A., Blenis, J., Arnott, D., and Ashkenazi, A. (2001) Death receptor recruitment of endogenous caspase-10 and apoptosis initiation in the absence of caspase-8. J. Biol. Chem. 276, 4663946646. Kojima, H., and Datta, R. (1996) Involvement of a CrmA-insensitive ICE/Ced-3-like protease in ceramide-induced apoptosis. Oncol. Res. 8, 497-501. Komiyama, T., Ray, C.A., Pickup, D.J., Howard, A.D., Thornberry, N.A., Peterson, E.P., and Salvesen, G. (1994) Inhibition of interleukin-1β converting enzyme by the cowpox virus serpin CrmA. J. Biol. Chem. 269, 19331-19337.

CASPASES INHIBITORS

203

Kook, S., Shim, S.R., Choi, S.J., Ahnn, J., Kim, J.I., Eom, S.H., Jung, Y.K., Paik, S.G., and Song, W.K. (2000) Caspase-mediated cleavage of p130cas in etoposide-induced apoptotic Rat-1 cells. Mol. Biol. Cell. 11, 929-939. Koriyama, H., Kouchi, Z., Umeda, T., Saido, T.C., Momoi, T., Ishiura, S., and Suzuki, K. (1999) Proteolytic activation of protein kinase C delta and epsilon by caspase-3 in U937 cells during chemotherapeutic agent-induced apoptosis. Cell Signal. 11, 831-838. Kothakota, S., Azuma, T., Reinhard, C., Klippel, A., Tang, J., Chu, K., McGarry, T.J., Kirschner, M.W., Koths, K., Kwiatkowski, D.J., and Williams, L.T. (1997) Caspase-3generated fragment of gelsolin: effector of morphological change in apoptosis. Science 278, 294-298. Kumar, S., Kinoshita, M., Noda, M., Copeland, N.G., and Jenkins, N.A. (1994) Induction of apoptosis by the mouse Nedd2 gene, which encodes a protein similar to the product of the Caenorhabditis elegans cell death gene ced-3 and the mammalian IL-1β-converting enzyme. Genes Dev. 8, 1613-1626. Lane, J.D., Lucocq, J., Pryde, J., Barr, F.A., Woodman, P.G., Allan, V.J., and Lowe, M. (2002) Caspase-mediated cleavage of the stacking protein GRASP65 is required for Golgi fragmentation during apoptosis. J. Cell. Biol. 156, 495-509. Lazebnik, Y.A., Kaufman, S.H., Desnoyers, S., Poirier, G.G., and Earnshaw, W.C. (1994) Cleavage of poly(ADP-ribose) polymerase by a proteins with properties like ICE. Nature 371, 346-347. Lazebnik, Y.A., Takahashi, A., Moir, R.D., Goldman, R.D., Poirier, G.G., Kaufman, S.H., and Earnshaw, W.C. (1995) Studies of the lamin proteinase reveal multiple parallel biochemical pathways during apoptotic execution. Proc. Natl. Acad. Sci. USA 92, 90429046. Lee, J.-C., and Chao, Y.-C. (1998) Apoptosis resulting from superinfection of Heliothis zea virus 1 is inhibited by p35 and is not required for virus interference. J. Gen. Virol. 79, 2293-2300. Levkau, B., Garton, K.J., Ferri, N., Kloke, K., Nofer, J.-R., Baba, H.A., Raines, E.W., and Breithardt, G. (2001) XIAP induces cell-cycle arrest and activates nuclear factor-κB. Circ. Res. 88, 282-290. Li, H., Zhu, H., Xu, C.-j., and Yuan, J. (1998) Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis. Cell 94, 491-501. Li, P., Nijhawan, D., Budihardjo, I., Srinivasula, S.M., Ahmad, M., Alnemri, E.S., and Wang, X. (1997) Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade. Cell 91, 479-489. Lin, G., Li, G., Granados, R.R., and Blissard, G.W. (2001) Stable cell lines expressing baculovirus P35: resistance to apoptosis and nutrient stress, and increased glycoprotein secretion. In Vitro Cell Dev. Biol. Anim. 37, 293-302. Lippke, J.A., Gu, Y., Sarnecki, C., Caron, P.R., and Su, M.S.-S. (1996) Identification and characterization of CPP32/Mch2 homolog 1, a novel cysteine protease similar to CPP32. J. Biol. Chem. 271, 1825-1828. Liston, P., Roy, N., Tamai, K., Lefebvre, C., Baird, S., Cherton-Horvat, G., Farahani, R., McLean, M., Ikeda, J., MacKenzie, A., and Korneluk, R.G. (1996) Suppression of apoptosis in mammalian cells by NAIP and a related family of IAP genes. Nature 379, 349-353. Liu, X., Kim, C.N., Yang, J., Jemmerson, R., and Wang, X. (1996) Induction of apoptotic program in cell-free extracts: Requirement for dATP and cytochrome c. Cell 86, 147-157. Liu, X., Zou, H., Slaughter, C., and Wang, X. (1997) DFF, a heterodimeric protein that functions downstream of caspase-3 to trigger DNA fragmentation during apoptosis. Cell 89, 175-184.

204


Liu, Z., Sun, C., Olejniczak, E.T., Meadows, R.P., Betz, S.F., Oost, T., Herrmann, J., Wu, J.C., and Fesik, S.W. (2000) Structural basis for binding of Smac/DIABLO to the XIAP BIR3 domain. Nature 408, 1004-2008. Luo, X., Budiharjo, H., Zou, H., Slaughter, C., and Wang, X. (1998) Bid, a Bcl2 interacting protein, mediates cytochrome c release from mitochondria in response to activation of cell surface death receptors. Cell 94, 481-490. Madesh, M., Antonsson, B., Srinivasula, S.M., Alnemri, E.S., and Hajnoczky, G. (2002) Rapid kinetics of tBID-induced cytochrome c and Smac/DIABLO release and mitochondrial depolarization. J. Biol. Chem. 277, 5651-5659. Marsden, V.S., O’Connor, L., O’Reilly, L.A., Silke, J., Metcalf, D., Ekert, P.G., Huang, D.C.S., Cecconi, F., Kuida, K., Tomaselli, K.J, Roy, S., Nicholson, D.W., Vaux, D.L., Bouillet, P., Adams, J.M, and Strasser, A. (2002) Apoptosis initiated by Bcl-2-regulated caspase activation independently of the cytochrome c/Apaf-1/caspase-9 apoptosome. Nature 419, 634-637. Marsters, S.A., Pitti, R.M., Donahue, C.J., Ruppert, S., Bauer, K.D., and Ashkenazi, A. (1996a) Activation of apoptosis by Apo-2 ligand is independent of FADD but blocked by CrmA. Curr. Biol. 6, 750-752. Marsters, S.A., Sheridan, J.P., Donahue, C.J., Pitti, R.M., Gray, C.L., Goddard, A.D., Bauer, K.D., and Ashkenazi, A. (1996b) Apo-3, a new member of the tumor necrosis factor receptor family, contains a death domain and activates apoptosis and NF-κB. Curr. Biol. 6, 1669-1676. Martin, D.A., Siegel, R.M., Zheng, L., and Lenardo, M.J. (1998) Membrane oligomerization and cleavage activates the caspase-8 (FLICE/MACHα1) death signal. J. Biol. Chem. 273, 4345-4349. Martin, S.J., O'Brien, G.A., Nishioka, W.K., McGahon, A.J., Mahboubi, A., Saido, T.C., and Green, D.R. (1995) Proteolysis of fodrin (non-erythroid spectrin) during apoptosis. J. Biol. Chem. 270, 6425-6428. Martinou, I., Fernandez, P.-A., Missotten, M., White, E., Allet, B., Sadoul, R., and Martinou, J.-C. 1995. Viral proteins E1B19K and p35 protect sympathetic neurons from cell death induced by NGF deprivation. J. Cell. Biol. 128, 201-208. Martins, L.M., Iaccarino, I., Tenev, T., Gschmeissner, S., Totty, N.F., Lemoine, N.R., Savopoulos, J., Gray, C.W., Creasy, C.L., Dingwall, C., and Downward, J. (2002) The serine protease Omi/HtrA2 regulates apoptosis by binding XIAP through a reaper-like motif. J. Biol. Chem. 277, 439-444. Mashima, T., Naito, M., Noguchi, K., Miller, D.K., Nicholson, D.W., and Tsuruo, T. (1997) Actin cleavage by CPP-32/Apopain during the development of apoptosis. Oncogene 14, 1007-1012. Mastrangelo, A.M, Hardwick, J.M., and Betenbaugh, M.J. (1996) Bcl-2 inhibits apoptosis and extends recombinant protein production in cells infected with Sindbis virus vectors. Cytotechnology 22, 169-178. Mastrangelo, A.J., Hardwick, J.M., Bex, F., and Betenbaugh, M.J. (2000) Part I. Bcl-2 and Bcl-xL limit apoptosis upon infection with alphavirus vectors. Biotechnol. Bioeng. 67, 544-554. Mastrangelo, A.M., Zou, S., Hardwick, J.M., and Betenbaugh, M.J. (1999) Antiapoptosis chemicals prolong productive lifetimes of mammalian cells upon Sindbis virus infection. Biotechnol. Bioeng. 65, 298-305. Mayer, A., Neupert, W., and Lill, R. (1995) Translocation of apocytochrome c across the outer membrane of mitochondria. J. Biol. Chem. 270, 12390-12397. McKenna, S.L., and Cotter, T.G. (2000) Inhibition of caspase activity delays apoptosis in a transfected NS/0 myeloma cell line. Biotechnol. Bioeng. 67, 165-176.

CASPASES INHIBITORS

205

Medema, J.P., Scaffidi, C., Kischkel, F.C., Shevchenko, A., Mann, M., Krammer, P.H., and Peter, M.E. (1997) FLICE is activated by association with the CD95 death-inducing signaling complex (DISC). EMBO J. 16, 2794-2804. Memon, S.A., Moreno, M.B., Petrak, D., and Zacharchuk, C.M. (1995) Bcl-2 blocks glucocorticoid- but not Fas- or activation-induced apoptosis in a T cell hybridoma. J. Immunol. 155, 4644-4652. Mercille, S., and Massie, B. (1994a) Induction of apoptosis in nutrient-deprived cultures of hybridoma and myeloma cells. Biotechnol. Bioeng. 44, 1140-1154. Mercille, S., and Massie, B. (1994b) Induction of apoptosis in oxygen-deprived cultures of hybridoma cells. Cytotechnology 15, 117-128. Miura, M., Friedlander, R.M., and Yuan, J. (1995) Tumor necrosis factor-induced apoptosis is mediated by a CrmA-sensitive cell death pathway. Proc. Natl. Acad. Sci. USA 92, 83188322. Miura, M., Zhu, H., Rotello, R., Hartwieg, E.A., and Yuan, J. (1993) Induction of apoptosis in fibroblasts by IL-1β-converting enzyme, a mammalian homolog of the C. elegans cell death gene ced-3. Cell 75, 653-660. Morishima, N., Okano, K., Shibata, T., and Maeda, S. (1998) Homologous p35 proteins of baculoviruses show distinctive anti-apoptotic activities which correlate with the apoptosisinducing activity of each virus. FEBS Lett. 427, 144-148. Munday, N.A., Vaillancourt, J.P., Ali, A., Casano, F.J., Miller, D.K., Molineaux, S.M., Yamin, T.-T., Yu, V.L., and Nicholson, D.W. (1995) Molecular cloning and pro-apoptotic activity of ICErelII and ICErelIII, members of the ICE/CED-3 family of cysteine proteases. J. Biol. Chem. 270, 15870-15876. Muzio, M., Chinnaiyan, A.M, Kischkel, F.C., O’Rourke, K., Shevchenko, A., Ni, J., Scaffidi, C., Bretz, J.D., Zhang, M., Gentz, R., Mann, M., Krammer, P.H., Peter, M.E., and Dixit, V.M. (1996) FLICE, a novel FADD-homologous ICE/Ced-3-like protease, is recruited to the CD95 (Fas/APO-1) death-inducing signaling complex. Cell 85, 817-827. Muzio, M., Salvesen, G.S., and Dixit, V.M. (1997) FLICE induced apoptosis in a cell-free system. J. Biol. Chem. 272, 2952-2956. Na, S., Chuang, T.H., Cunningham, A., Turi, T.G., Hanke, J.H., Bokoch, G.M., and Danley, D.E. (1996) D4-GDI a substrate of CPP32, is proteolyzed during Fas-induced apoptosis. J. Biol. Chem. 271, 11209-11213. Nagane, M., Pan, G., Weddle, J.J., Dixit, V.M., Cavenee, W.K., and Huang, H.J. (2000) Increased death receptor 5 expression by chemotherapeutic agents in human gliomas causes synergistic cytotoxicity with tumor necrosis factor-related apoptosis-inducing ligand in vitro and in vivo. Cancer Res. 60, 847-853. Nava, V.E., Rosen, A., Veliuona, M.A., Clem, R.J., Levine, B., and Hardwick, J.M. (1998) Sindbis virus induces apoptosis through a caspase-dependent, CrmA-sensitive pathway. J. Virol. 72, 452-459. Nicholson, D.W., Ali, A., Thornberry, N.A., Vaillancourt, J.P., Ding, C.K., Gallant, M., Gareau, Y., Griffin, P.R., Labelle, M., Lazebnik, Y.A., Munday, N.A., Raju, S.M., Smulson, M.E., Yamin, T.-T., Yu, V.L., and Miller, D.K. (1995) Identification and inhibition of the ICE/CED-3 protease necessary for mammalian apoptosis. Nature 376, 3743. Orth, K., Chinnaiyan, A.M., Garg, M., Froelich, C.J., and Dixit, V.M. (1996) The CED3/ICE-like protease Mch2 is activated during apoptosis and cleaves the death substrate lamin A. J. Biol. Chem. 271, 16443-16446. Osman, J.J., Birch, J., and Varley, J. (2001) The response to GS-NS0 myeloma cells to pH shifts and pH perturbations. Biotechnol. Bioeng. 75, 63-73.

206


Pan, G., Humke, E.W., and Dixit, V.M. (1998) Activation of caspases triggered by cytochrome c in vitro. FEBS Lett. 426, 151-154. Paszty, K., Verma, A.K., Padanyi, R., Filoteo, A.G., Penniston, J.T., and Enydei, A. (2002) Plasma membrane Ca2+ATPase isoform 4b is cleaved and activated by caspase-3 during the early phase of apoptosis. J. Biol. Chem. 277, 6822-6829. Qi, Y., Liu, Q., Peng, Y., Li, L., Pei, Z., and Liu, Y. (2001) Identification of apoptosisinhibiting gene in Leucania separata nuclear polyhedrosis virus. Arch. Virol. 146, 21492163. Quan, L.T., Caputo, A., Bleackley, R.C., Pickup, D.J., and Salvesen, G.S. (1995) Granzyme B is inhibited by the cowpox virus serpin cytokine response modifier A. J. Biol. Chem. 270, 10377-10379. Rabizadeh, S., LaCount, D.J., Friesen, P.D., and Breeds, D.E. (1993) Expression of the baculovirus p35 gene inhibits mammalian neural cell death. J. Neurochem. 61, 2318-2321. Rao, L., Perez, D., and White, E. (1996) Lamin proteolysis facilitates nuclear events during apoptosis. J. Cell. Biol. 135, 1441-1455. Rauen, U., Polzar, B., Stephan, H., Mannherz, H.G., and de Groot, H. (1999) Cold-induced apoptosis in cultured hepatocytes and liver endothelial cells: mediation by reactive oxygen species. FASEB J. 13, 155-168. Ray, C.A., Black, R.A., Kronheim, S.R., Greenstreet, T.A., Sleath, P.R., Salvesen, G.S., and Pickup, D.J. (1992) Viral inhibition of inflammation: Cowpox virus encodes an inhibitor of the interleukin-1β converting enzyme. Cell 69, 597-604. Rehemtulla, A., Hamilton, C.A., Chinnaiyan, A.M., and Dixit, V.M. (1997) Ultraviolet radiation-induced apoptosis is mediated by activation of CD-95 (Fas/APO-1). J. Biol. Chem. 272, 25783-25786. Roberts, D.L., Merrison, W., MacFarlane, M., and Cohen, G.M. (2001) The inhibitor of apoptosis protein-binding domain of Smac is not essential for its pro-apoptotic activity. J. Cell. Biol. 153, 221-227. Rudel, T., and Bokoch, G.M. (1997) Membrane and morphological changes in apoptotic cells regulated by caspase-mediated activation of PAK2. Science 276, 1571-1574. Sakahira, H., Enari, M., and Nagata, S. (1998) Cleavage of CAD inhibitor in CAD activation and DNA degradation during apoptosis. Nature 391, 96-99. Saleh, A., Srinivasula, S.M., Acharya, S., Fishel, R., and Alnemri, E.S. (1999) Cytochrome c and dATP-mediated oligomerization of Apaf-1 is a prerequisite for procaspase-9 activation. J. Biol. Chem. 274, 17941-17945. Sauerwald, T.M., Betenbaugh, M.J., and Oyler, G.A. A study of caspase inhibitors for limiting death in mammalian cell culture.” Biotechnol. Bioeng., in press. Sauerwald, T.M., Betenbaugh, M.J., and Oyler, G.A. (2002) Inhibiting apoptosis in mammalian cell culture using the caspase inhibitor XIAP and deletion mutants. Biotechnol. Bioeng. 77, 704-716. Scaffidi, C., Fulda, S., Srinivasan, A., Friesen, C., Li, F., Tomaselli, K.J., Debatin, K.M., Krammer, P.H., and Peter, M.E. (1998) Two CD95 (Apo-1/Fas) signaling pathways. EMBO J. 17, 1675-1687. Sebbagh, M., Renvoize, C., Hamelin, J., Riche, N., Bertoglio, J., and Breard, J. (2001) Caspase-3-mediated cleavage of ROCK I induces MLC phosphorylation and apoptotic membrane blebbing. Nat. Cell. Biol. 3, 346-352. Seshagiri, S., and Miller, L.K. (1997) Baculovirus inhibitors of apoptosis (IAPs) block activation of Sf-caspase-1. Proc. Natl. Acad. Sci. USA 94, 13606-13611. Seol, D.W., and Billiar, T.R. (1999) A caspase-9 variant missing the catalytic site is an endogenous inhibitor of apoptosis. J. Biol. Chem. 274, 2072-2076.

CASPASES INHIBITORS

207

Sgorbissa, A., Benetti, R., Marzinotto, S., Schneider, C., and Brancolini, C. (1999) Caspase-3 and caspase-7 but not caspase-6 cleave Gas2 in vitro: implications for microfilament reorganization during apoptosis. J. Cell. Sci. 112, 4475-4482. Shimura, M., Ishizaka, Y., Yuo, A., Oshima, M., Sasaki, T., and Takaku, F. (1997) Characterization of room temperature induced apoptosis in HL-60. FEBS Lett. 417, 379384. Simons, M., Beinroth, S., Gleichmann, M., Liston, P., Korneluk, R.G., MacKenzie, A.E., Bahr, M., Klockgether, T., Robertson, G.S., Weller, M., and Schulz, J.B. (1999) Adenovirus-mediated gene transfer of inhibitors of apoptosis proteins delays apoptosis in cerebellar granule neurons. J. Neurochem. 72, 292-301. Singh, R.P., Finka, G., Emery, A.N., and Al-Rubeai, M. (1997) Apoptosis and its control in cell culture systems. Cytotechnology 23, 87-93. Slee, E.A., Adrain, C., and Martin, S.J. (2001) Executioner caspase-3, -6, and -7 perform distinct, non-redundant roles during the demolition phase of apoptosis. J. Biol. Chem. 276, 7320-7326. Slee, E.A., Harte, M.T., Kluck, R.M., Wolf, B.B., Casiano, C.A., Newmeyer, D.D., Wang, H.-G., Reed, J.C., Nicholson, D.W., Alnemri, E.S., Green, D.R., and Martin, S.J. (1999) Ordering the cytochrome c-initiated caspase cascade: Hierarchical activation of caspases2,-3,-6,-7,-8, and -10 in a caspase-9-dependent manner. J. Cell. Biol. 144, 281-292. Song, Q., Lees-Miller, S.P., Kumar, S., Zhang, Z., Chan, D.W., Smith, G.C., Jackson, S.P., Alnemri, E.S., Litwack, G., Khanna, K.K., and Lavin, M.F. (1996) DNA-dependent protein kinase catalytic subunit: a target for an ICE-like protease in apoptosis. EMBO J. 15, 3238-3246. Srinivasula, S.M., Ahmad, M., Fernandes-Alnemri, T., and Alnemri, E.S. (1998) Autoactivation of procaspase-9 by Apaf-1 mediated oligomerization. Mol. Cell. 1, 949957. Srinivasula, S.M., Datta, P., Fan, X.-J., Fernandes-Alnemri, T., Huang, Z., and Alnemri, E.S. (2000) Molecular determinants of the caspase-promoting activity of Smac/DIABLO and its role in the death receptor pathway. J. Biol. Chem. 275, 36152-36157. Srinivasula, S.M., Fernandes-Alnemri, T., Zangrilli, J., Robertson, N., Armstrong, R.C., Wang, L., Trapani, J.A., Tomaselli, K.J., Litwack, G., and Alnemri, E.S. (1996) The Ced3/Interleukin 1β converting enzyme-like homolog Mch6 and the lamin-cleaving enzyme Mch2α are substrates for the apoptotic mediator CPP32. J. Biol. Chem. 271, 27099-27106. Srinivasula, S.M., Hegde, R., Saleh, A., Datta, P., Shiozaki, E., Lee, R.-A., Robbins, P.D., Fernandes-Alnemri, T., Shi, Y., and Alnemri, E.S. (2001) A conserved XIAP-interaction motif in caspase-9 and Smac/DIABLO regulates caspase activity and apoptosis. Nature 410, 112-116. Stroh, C., and Schulze-Osthoff, K. (1998) Death by a thousand cuts: an ever increasing list of caspase substrates. Cell Death Differ. 5, 997-1000. Sugimoto, A., Friesen, P.D., and Rothman, J.H. (1994) Baculovirus p35 prevents developmentally programmed cell death and rescues a ced-9 mutant in the nematode Caenorhabditis elegans. EMBO J. 13, 2023-2028. Suliman, A., Lam, A., Datta, R., and Srivastava, R.K. (2001) Intracellular mechanisms of TRAIL: apoptosis through mitochondrial-dependent and -independent pathways. Oncogene 20, 2122-2133. Sun, C., Cai, M., Gunasekera, A.H., Meadows, R.P., Wang, H., Chen, J., Zhang, H., Wu, W., Xu, N., Ng, S.-C., and Fesik, S.W. (1999a) NMR structure and mutagenesis of the inhibitor-of-apoptosis protein XIAP. Nature 401, 818-822.

208


Sun, C., Cai, M., Meadows, R.P., Xu, N., Gunasekera, A.H., Herrman, J., Wu, J.C., and Fesik, S.W. (2000) NMR structure and mutagenesis of the third Bir domain of the inhibitor of apoptosis protein XIAP. J. Biol. Chem. 275, 33777-33781. Sun, X.-M., Macfarlane, M., Zhuang, J., Wolf, B., Green, D., and Cohen, G. (1999b) Distinct caspase cascades are initiated in receptor-mediated and chemical-induced apoptosis. J. Biol. Chem. 274, 5053-5060. Suzuki, Y., Imai, Y., Nakayama, H., Takahashi, K., Takio, K., and Takahashi, R. (2001a) A serine protease, HtrA2, is released from the mitochondria and interacts with XIAP, inducing cell death. Mol. Cell 8, 613-621. Suzuki, Y., Nakabayashi, Y., Nakata, K., Reed, J.C., and Takahashi, R. (2001b) X-linked inhibitor of apoptosis protein (XIAP) inhibits caspases-3 and -7 in distinct modes. J. Biol. Chem. 276, 27058-27063. Suzuki, Y., Nakabayashi, Y., and Takahashi, R. (2001c) Ubiquitin-protein ligase activity of X-linked inhibitor of apoptosis protein promotes proteasomal degradation of caspase-3 and enhances its anti-apoptotic effect in Fas-induced cell death. Proc. Natl. Acad. Sci. USA 98, 8662-8667. Takahashi, A., Alnemri, E.S., Lazebnik, Y.A., Fernandes-Alnemri, T., Litwack, G., Moir, R.D., Goldman, R.D., Poirier, G.G., Kaufmann, S.H., and Earnshaw, W.C. (1996) Cleavage of lamin A by Mch2α but not CPP32: multiple interleukin 1β-converting enzyme-related proteases with distinct substrate recognition properties are active in apoptosis. Proc. Natl. Acad. Sci. USA 93, 8395-8400. Takahashi, A., Hirata, H., Yonehara, S., Imai, Y., Lee, K.-K., Moyer, R.W., Turner, P.C., Mesner, P.W., Okazaki, T., Sawai, H., Kishi, S., Yamamoto, K., Okuma, M., and Sasada, M. (1997) Affinity labeling displays the stepwise activation of ICE-related proteases by Fas, staurosporine, and CrmA-sensitive caspase-8. Oncogene 14, 2741-2752. Takahashi, R., Deveraux, Q., Tamm, I., Welsh, K., Assa-Munt, N., Salvesen, G.S., and Reed, J.C. (1998) A single BIR domain of XIAP sufficient for inhibiting caspases. J. Biol. Chem. 273, 7787-7790. Tewari, M., and Dixit, V.M. (1995) Fas- and tumor necrosis factor-induced apoptosis is inhibited by the poxvirus crmA gene product. J. Biol. Chem. 270, 3255-3260. Tewari, M., Quan, L., O'Rourke, K., Desnoyers, S., Zeng, Z., Beidler, D.R., Poirier, G.G., Salvesen, G.S., and Dixit, V.M. (1995) Yama/CPP32β, a mammalian homolog of CED-3, is a CrmA-inhibitable protease that cleaves the death substrate poly(ADP-ribose) polymerase. Cell 81, 801-809. Thornberry, N.A., Bull, H.G., Calaycay, J.R., Chapman, K.T., Howard, A.D., Kostura, M.J., Miller, D.K., Molineaux, S.M., Weidner, J.R., Aunins, J., Wlliston, K.O., Ayala, J.M., Casano, F.J., Chin, J., Ding, G.J.-F., Egger, L.A., Gaffney, E.P., Limjuco, G., Palyha, O.C., Raju, S.M., Rolando, A.M., Salley, J.P., Yamin, T.-T., Lee, T.D., Shively, J.E., MacCross, M., Mumford, R.A., Schmidt, J.A., and Tocci, M.J. (1992) A novel heterodimeric cysteine protease is required for interleukin-1 beta processing in monocytes. Nature 356, 768-774. Thornberry, N.A., Rano, T.A., Peterson, E.P., Rasper, D.M., Timkey, T., Garcia-Calvo, M., Houtzager, V.M., Nordstrom, P.A., Roy, S., Vaillancourt, J.P., Chapman, K.T., and Nicholson, D.W. (1997) A combinatorial approach defines specificities of members of the caspase family and granzyme B. J. Biol. Chem. 272, 17907-17911. Turner, S., Kenshole, B., and Ruby, J. (1999) Viral modulation of the host response via crmA/SPI-2 expression. Immunol. Cell. Biol. 77, 236-241. Ubeda, M., and Habener, J.F. (1997) The large subunit of the DNA replication complex C (DSEB/RF-C140) cleaved and inactivated by caspase-3 (CPP32/YAMA) during Fasinduced apoptosis. J. Biol. Chem. 272, 19562-19568.

CASPASES INHIBITORS

209

Van de Craen, M., Berx, G., Van den Brande, I., Fiers, W., Declercq, W., and Vandenabeele, P. (1999) Proteolytic cleavage of beta-catenin by caspases: an in vitro analysis. FEBS Lett. 458, 167-170. Van de Craen, M., Vandenabeele, P., Declercq, W., Van den Brande, I., Van Loo, G., Molemans, F., Schotte, P., Van Criekinge, W., Beyaert, R., and Fiers, W. (1997) Characterization of seven murine caspase family members. FEBS Lett. 403, 61-69. Van de Craen, M., Van Loo, G., Declercq, W., Schotte, P., Van den Brande, I., Mandruzzato, S., van der Bruggen, P., Fiers, W., and Vandenabeele, P. (1998a) Molecular cloning and identification of murine caspase-8. J. Mol. Biol. 284, 1017-1026. Van de Craen, M., Van Loo, G., Pype, S., Van Criekinge, W., Van den brande, I., Molemans, F., Fiers, W., Declercq, W., and Vandenabeele, P. (1998b) Identification of a new caspase homologue: caspase-14. Cell Death Differ. 5, 838-846. van Loo, G., van Gurp, M., Depuydt, B., Srinivasula, S.M., Rodriguez, I., Alnemri, E.S., Gevaert, K., Vandekerckhove, J., Declercq, W., and Vandenabeele, P. (2002) The serine protease Omi/HtrA2 is released from mitochondria during apoptosis. Omi interacts with caspase-inhibitor XIAP and induces enhanced caspase activity. Cell Death Differ. 9, 2026. Vekrellis, K., McCarthy, M.J., Watson, A., Whitfield, J., Rubin, L.L., and Ham, J. (1997) Bax promotes neuronal cell death and is downregulated during the development of the nervous system. Development 124, 1239-1249. Verhagen, A.M., Coulson, E.J., and Vaux, D.L. (2001) Inhibitor of apoptosis proteins and their relatives: IAPs and other BIRPs. Genome Biol. 2, 3009.1-3009.10. Verhagen, A.M., Ekert, P.G., Pakusch, M., Silke, J., Connolly, L.M., Reid, G.E., Moritz, R.L., Simpson, R.J., and Vaux, D.L. (2000) Identification of DIABLO, a mammalian protein that promotes apoptosis by binding to and antagonizing IAP proteins. Cell 102, 4353. Verhagen, A.M., Silke, J., Ekert, P.G., Pakusch, M., Kaufman, H., Connolly, L.M., Day, C.L., Tikoo, A., Burke, R., Wrobel, C., Moritz, R.L., Simpson, R.J., and Vaux, D.L. (2002) HtrA2 promotes cell death through its serine protease activity and its ability to antagonize inhibitor of apoptosis proteins. J. Biol. Chem. 277, 445-454. Vier, J., Furmann, C., and Hacker, G. (2000) Baculovirus protein does not inhibit caspase-9 in a cell-free system of apoptosis. Biochem. Biophys. Res. Commun. 276, 855-861. Vincenz, C., and Dixit, V.M. (1997) Fas-associated death domain protein inerleukin-1βconverting enzyme 2 (FLICE2), an ICE/Ced-3 homologue, is proximally involved in CD95- and p55-mediated death signaling. J. Biol. Chem. 272, 6578-6583. Voelkel-Johnson, C., Entingh, A.J., Wold, W.S., Gooding, L.R., and Laster, S.M. (1995) Activation of intracellular proteases is an early event in TNF-induced apoptosis. J. Immunol. 154, 1707-1716. Walter, B.N., Huang, Z., Jakobi, R., Tuazon, P.T., Alnemri, E.S., Litwack, G., Traugh, J.A. (1998) Cleavage and activation of p21-activated protein kinase gamma-PAK by CPP32 (caspase 3). Effects of autophosphorylation on activity. J. Biol. Chem. 273, 28733-29739. Wang, J., Chun, H.J., Wong, W., Spencer, D.M., and Lenardo, M.J. (2001) Caspase-10 is an initiator caspase in death receptor signaling. Proc. Natl. Acad. Sci. USA 98, 13884-13888. Wang, L., Miura, M., Bergeron, L., Zhu, H., and Yuan, J. (1994) Ich-1, an Ice/ced-3-related gene, encodes both positive and negative regulators of programmed cell death. Cell 78, 739-750. Wang, L., Miura, M., Jung, Y.-k., Zhu, H., Gagliardini, V., Shi, L., Grennberg, A.H., and Yuan, J. (1996a) Identification and characterization of Ich-3, a member of the interleukin1β converting enzyme (ICE)/Ced-3 family and an upstream regulator of ICE. J. Biol. Chem. 271, 20580-20587.

210


Wang, X., Zelenski, N.G., Yang, J., Sakai, J., Brown, M.S., and Goldstein, J.L. (1996b) Cleavage of sterol regulatory element binding proteins (SREBPs) by CPP32 during apoptosis. EMBO J. 15, 1012-1020. Wolf, B.B., Schuler, M., Echeverri, F., Green, D.R. (1999) Caspase-3 is the primary activator of apoptotic DNA fragmentation factor-45/inhibitor of caspase-activated Dnase inactivation. J. Biol. Chem. 274, 30651-30656. Wu, G., Chai, J., Suber, T.L., Wu, J.-W., Du, C., Wang, X., and Shi, Y. (2000) Structural basis of IAP recognition by Smac/DIABLO. Nature 408, 1008-1012. Xue, D., and Horvitz, H.R. (1995) Inhibition of the Caenorhabditis elegans cell-death protease CED-3 by a CED-3 cleavage site in baculovirus p35 protein. Nature 377, 248-251. Yang, Y., Fang, S., Jensen, J.P., Weissman, A.M., and Ashwell, J.D. (2000) Ubiquitin protein ligase activity of IAPs and their degradation in proteasomes in response to apoptotic stimuli. Science 288, 874-877. Yoshimi, M., Sekiguchi, T., Hara, N., and Nishimoto, T. (2000) Inhibition of N-linked glycosylation causes apoptosis in hamster BHK21 cells. Biochem. Biophys. Res. Commun. 276, 965-969. You, M., Ku, P.-T., Hrdlickova, R., and Bose Jr, H.R. (1997) ch-IAP1, a member of the inhibitor-of-apoptosis protein family, is a mediator of the antiapoptotic activity of the v-rel oncoprotein. Mol. Cell. Biol. 17, 7328-7341. Yuan, J., Shaham, S., Ledoux, S., Ellis, H.M., and Horvitz, H.R. (1993) The C. elegans cell death gene ced-3 encodes a protein similar to mammalian interleukin-1β-converting enzyme. Cell 75, 641-652. Zhang, X.D., Zhang, X.Y., Gray, C.P., Nguyen, T., and Hersey, P. (2001) Tumor necrosis factor-related apoptosis-inducing ligand-induced apoptosis of human melanoma is regulated by Smac/DIABLO release from mitochondria. Cancer Res. 61, 7339-7348. Zhou, Q., Krebs, J.F., Snipas, S.J., Price, A., Alnemri, E.S., Tomaselli, K.J., and Salvesen, G.S. (1998) Interaction of the baculovirus anti-apoptotic protein p35 with caspases. Specificity, kinetics, and characterization of the caspase/p35 complex. Biochemistry 37, 10757-10765. Zhou, Q., Snipas, S., Orth, K., Muzio, M., Dixit, V.M., and Salvesen, G.S. (1997) Target protease specificity of the viral serpin CrmA. J. Biol. Chem. 272, 7797-7800. Zoog, S.J., Bertin, J., and Friesen, P.D. (1999) Caspase inhibition by baculovirus P35 requires interaction between the reactive site loop and the β-sheet core. J. Cell. Biol. 274, 2599526002.

8.

IMPROVEMENT OF INDUSTRIAL CELL CULTURE PROCESSES BY CASPASE-9 DOMINANT NEGATIVE AND OTHER APOPTOTIC INHIBITORS

JANA VAN DE GOOR Department of Cell Culture & Fermentation R&D, Genentech, Inc, 1 DNA Way, South San Francisco, CA 94080 U.S.A.

1.

Introduction

Apoptosis, also called programmed cell death, has evolved as a highly controlled pathway that is critical in the development and homeostasis of multicellular organisms. Apoptosis is common to most higher eukaryotes, including plants, insects and vertebrates. Upon receiving a death stimulus, this complex pathway leads to an organized destruction of a cell. In general, there are at least two apoptosis pathways: intrinsic and extrinsic. In the intrinsic pathway, also called the mitochondrial mediated pathway, mitochondria are critical for the initiation and execution of cell death and lead to a release of cytochrome c from mitochondria. This triggers a downstream formation of a complex, apoptosome, and activation of an initiator caspase, caspase-9. The extrinsic cell death pathway involves engagement of cell-surface receptor by a ligand and is, therefore, referred to as a receptor-mediated pathway. Engagement of a receptor recruits an endogenous adapter molecule from the cytosol that leads to the activation of an initiator caspase, caspase-8. The intrinsic and extrinsic pathways are interconnected. Activation of caspase-8 via the receptor-mediated pathway can also activate the mitochondrial-mediated pathway via proapoptotic Bid, which triggers cytochrome c release from mitochondria and subsequent activation of caspase-9. After the activation of either initiation caspase (-8 or -9), the pathways converge at the point of activation of an executioner caspase, caspase-3. Active caspase-3 cleaves a range of affector molecules, leading to morphological and biochemical changes in the cell characteristic of apoptosis such as plasma membrane changes, cellular shrinkage, nuclear condensation, DNA cleavage and formation of apoptotic bodies. These hallmarks of apoptosis can be measured and form the basis of apoptosis assays (see chapter 5). A more detailed overview of the molecular mechanism of apoptosis can be found elsewhere in this book. A dramatic increase in basic research directed towards understanding the molecular mechanisms underlying apoptosis resulted in major discoveries that triggered the start of applied research targeted towards generation of industrially 211 M. Al-Rubeai and M. Fussenegger (eds.), Cell Engineering, Vol. 4, 211-221. © 2004 Kluwer Academic Publishers. Printed in the Netherlands.

212

J. VAN DE GOOR

relevant cell lines with increased resistance to cell death. A large percentage of therapeutic proteins produced by the biotechnology industry are generated from mammalian cell cultures in batch or fed-batch cultures. In order to generate high concentration of the biomolecule in the production vessel, it is critical to reach a high cell density and, at the same time, maintain high cell viability. Great efforts have been directed over the past decade towards developing manufacturing processes that reach high cell density and ensure longevity of cells in the environment of a bioreactor. In spite of all these efforts, an early decrease in cell viability due to apoptosis is still the main cause of run termination and limited yields of the therapeutic protein. This review provides a brief overview of apoptotic insults to cells in bioreactors and discusses strategies to minimize apoptosis in cell culture during production of therapeutic proteins.

2.

Apoptotic insults to cells

It is now widely accepted that mammalian cells exposed to the stress of largescale cultivation undergo apoptosis (Moore et al., 1995, Singh et al., 1994 Goswami et al. 1999). Apoptotic pathways are conserved across species and have been shown to occur in essentially every commercially relevant cell type, including Chinese hamster ovary (Figure 1), hybridoma, and baby hamster kidney and insect cells. Cell death in bioreactors may result from a variety of culture conditions such as nutrient limitation, toxic by-product accumulation, cell-cell inhibition, growth factor deprivation and other stress inducers (Zanghi et al., 1999, Al-Rubeai et al., 1998, Mastrangelo et al., 1998). The traditional approaches to manipulation of the cell culture environment have provided improvements in cell culture performance. These approaches include a thorough evaluation of all the media components and their concentrations to allow for the development of robust growth and production media that are able to provide sufficient nutrients to the cell culture and prevent nutrient deprivation (Zang et al., 1995; Mather et al., 1995). The use of low molecular weight digests of biological material such as yeast extracts and plant or animal tissue hydrolysates have resulted in an increase in volumetric productivity during production. These additives are commonly used to improve cell growth characteristics in serum-free media (Bonarius et al., 1996; Keen et al., 1995). Regardless of the source, the major nutrients that hydrolysates provide include free amino acids, peptides, vitamins, minerals and undefined components. It was shown that cells, indeed, take up and utilize some of these components (Nyberg et al., 1999). Besides medium optimization, various process parameters such as temperature, seeding density, pH and feeding strategies are carefully evaluated during process development to reduce apoptotic insults to cells and optimize yields of therapeutic proteins. A commonly applied technique for prevention of early cell death during large-scale production is the use of fed-batch process that involves feeding strategies

CASPASE-9 DOMINANT INHIBITOR IN CHO

213

to supply additional nutrients to the culture in order to prevent nutrient depletion. This approach typically leads to a delay of the onset of apoptosis but still leaves the cells susceptible to apoptosis. Another potent apoptotic trigger is the accumulation of toxic by-products in the cell culture medium, such as ammonium and lactate. These metabolites have been shown to negatively impact cell growth rate (Lao et al., 1997) and cause apoptosis (Singh et al., 1994). Recently, a co-cultivation strategy to remove ammonium by hepatocytes has been reported to improve the productivity of a Chinese hamster ovary cell culture process (Choi et al., 2000) High cell density can cause cell death either by nutrient/growth factor depletion and/or by toxic by-product accumulation. Therefore, strategies to avoid cell overgrowth and keep cell density at acceptable levels are applied by arresting the cell cycle in an optimal production phase. Cells can easily be arrested by temperature reduction in the production vessel. This approach has been shown to positively impact culture viability as well as productivity (Moore et al., 1997). An alternative approach is to use genetic engineering and overexpress proteins involved in cell cycle progression, such as p27 (Fussenegger et al., 1998). Overexpression of p27 was reported to result in cell cycle arrest in the G1 phase and a dramatic increase in specific productivity.

3.

Industrially relevant apoptosis inhibitors

Cell death in the environment of a bioreactor can be triggered by a variety of factors depending on the process conditions. A range of different approaches to inhibit apoptosis was utilized over the past decade from small molecule chemical inhibitors to complex multi-gene genetic engineering of cell death pathways. Suramine, a polysulfated naphtylurea, is speculated to act via inhibition of some of the mechanisms in the apoptotic pathway and was shown to increase cell viability up to 25% with a 40% increase in product yields of recombinant SEAP glycoprotein (Zanghi et al., 2000). Especially attractive is the use of chemical inhibitors that block the activation of caspases. A cell permeable, tripeptide z-Val-Ala-Asp-fluoromethyl ketone (z-VADfmk) irreversibly binds to the active site of a variety of caspases and acts as an inhibitor of apoptosis in several cell types induced by diverse stimuli (Jacobson, M.D. et al., 1996, Perez et al., 1997, Qi, X.M. et al., 1997). Z-VAD-fmk was found to be unable to extend the life of a serum-free batch culture of CHO cells when applied at the start of the culture at 60 uM concentration (Goswami et al., 1999). In contrast to that observation, a dramatic delay of cell death was shown when a repeated dose was given to CHO cell culture at 100 uM concentration every 24 hours (van de Goor et al., 2000), suggesting that the inhibitor may be unstable in the culture and needs to be replenished.

214

J. VAN DE GOOR

A very attractive approach to inhibit apoptosis is the use of genetic engineering. Even in the absence of a complete understanding of the complex apoptotic pathways and their relative importance in a given biological system, it is possible to identify the most likely endogenous molecules as targets for inhibition of apoptosis due to a high degree of conservation of the apoptotic machinery across species. Bcl-2 was first cloned from human follicular lymphoma (Tsujimoto et al., 1984). Its biological function as an anti-apoptotic gene was not discovered until some years later (Vaux et al., 1988). Since then several groups expressed Bcl-2 in industrially relevant systems and showed its positive effect on survival of the cell culture as well as productivity (Mastrangelo et al., 2000; Fussenegger et al., 2000; Kim et al., 2001; Lee et al., 2003). Although Bcl-2 overexpression was found to be effective in several systems, it was unable to prevent apoptotic cell death in all instances (Murray et al., 1996). Clearly, there may be some differences in cell lines in regards to the relative importance and usage of the different apoptotic pathways. Butyrate is often used as an additive to the cell culture during the production phase due to its enhancement of protein expression despite its growth inhibitory effect. This effect was reported by many groups. Ganne et al. (1991) reported a 2fold increase of factor VIII production by CHO cells in the presence of 3 mM butyrate. The t-PA production of CHO cells was increased several fold in the presence of 5 mM butyrate (Palermo et al. 1991). Butyrate induces hyperacetylation of histones, which was shown to play an important role in the regulation of chromatin structure and its transcriptional activity (Turner, B.M. 1993). Butyrate has been shown to trigger apoptosis in cell culture and, therefore, must be carefully titrated for every new process/cell line in order to maximize its positive effect and minimize the negative effect on cell growth. A potent inhibitor of apoptosis can provide resistance of the culture to the apoptotic effect of butyrate and lead to an increase in production yields. Overexpression of Bcl-2 suppressed butyrate induced apoptosis, extended culture longevity and resulted in a two-fold increase in an antibody concentration (Kim and Lee, 2001; Lee and Lee 2003). Since apoptosis is regulated both positively and negatively by a series of gene products, there are a relatively large number of molecules that can potentially be used in genetic engineering approaches. Molecules, such as IAPs, crmA or p35, function as caspase inhibitors and represent alternative targets for overexpression in industrial cell lines. Perhaps the most effective approach to inhibition of apoptosis will be a multigene expression of anti-apoptotic genes to target several apoptotic pathways (intrinsic and extrinsic) simultaneously.

4.

Caspase-9 dominant negative

Caspases (cysteine containing aspartate-specific proteases) are members of a family of intracellular proteins involved in the initiation and execution of apoptosis.


215

Caspase activation is central to the apoptotic pathway (Nicholson 1999, Shi 2002). In recent years the study of the regulation of caspase activation in various cell lines has revealed highly complex mechanisms regulating the fine balance between cell survival and cell death. Caspase-9 is positioned within the intrinsic apoptotic pathway involving mitochondrial changes, downstream of cytochrome c release from mitochondria. Once released, cytochrome c binds Apaf-1, a mammalian homologue of C. elegans Ced-4, inducing a conformational change of Apaf-1 (Li et al., 1997). Apaf-1 associated with cytochrome c and dATP directly activates procaspase-9 (Li et al., 1997) by interacting with the prodomain CARD (caspase recruitment domain), forming an apoptosome (Cain et al., 1999). Upon activation, caspase-9 cleaves and activates an executioner caspase-3 (Li et al., 1997). Caspase-9 was recently shown to activate downstream executioner caspases other than caspase3 (Srinivasula et al., 1998). These results suggest that caspase-9 may be a central regulator of downstream caspase activation in the cytochrome c dependent pathway. A naturally occurring variant of caspase-9, named caspase-9S, was identified and cloned from human liver (Seol et al., 1999). It was shown to inhibit apoptosis induced by caspase-9 and its inhibitory feature was attributed to the absence of most of the large subunit of caspase-9 including the catalytic site. The central role of caspase-9 was underscored by the results from knockout mice where deletion of caspase-9 (Kuida et al., 1998; Hakem et al., 1998) leads to embryonic lethality and more severe defects than caspase-3 knockout (Kuida et al., 1996). Thus, caspase-9 is an attractive target for inhibition of cell death. The loss of catalytic activity of caspase-9 due to a mutation of the catalytic cysteine (Cys286Ala) was reported by Duan et al. (1996). Overexpression of a catalytically inactive caspase-9 (caspase-9 dominant negative or caspase-9DN) was found to effectively inhibit cell death initiated by a wide variety of inducers, such as FADD, TRADD as well as Ced-4, the C. elegans homologue of Apaf-1 (Pan et al. 1998). The mechanism of inhibition of endogenous caspase-9 is thought to be caused by competition with caspase-9 for binding to Apaf-1 and/or directly by a formation of an inactive heterodimer between caspase-9 and caspase-9DN. Human caspase-9DN was overexpressed in Chinese hamster ovary cells to investigate its effect on cell death in bioreactors during production of therapeutic proteins (van de Goor et al., 2000). A stable CHO cell line expressing recombinant antibody was transfected with a plasmid encoding C-terminal FLAG-tagged caspase-9 DN and puromycin as a selectable marker. Clones were selected under 5 ug/ml puromycin and analyzed by Western blot analysis for high expression of caspase-9 DN. The ability of clones overexpressing caspase-9 to inhibit apoptosis was first confirmed by their resistance to staurosporine. Clones were adapted to serum-free suspension growth and subjected to an evaluation in bioreactors using a serum-free DMEM/Ham F-12 based medium containing recombinant human insulin and trace elements (Figure 1 A and B). Cells were grown in batch mode at 37oC with agitation, pH 7.2 and sparged with a mixture of air and oxygen. Clones expressing

216

J. VAN DE GOOR

caspase-9DN were found to dramatically delay the onset of apoptosis in the environment of a bioreactor and resulted in a prolongation of viability by several days (Figure 1A). Delayed onset of cell death was associated with increased viable cell density (Figure 1B). The overexpression of caspase-9DN resulted in generation of a robust cell line that showed long viability in bioreactors as well as spinner vessels during routine passaging, and superior characteristics during thaw/freeze cycle compared to control cells (data not shown).

Figure 1. Inhibition of apoptosis in Chinese hamster ovary cells by overexpression of caspase-9 dominant negative. Human caspase-9 DN was overexpressed in CHO cells and stable clones were analyzed in bioreactors operated in batch mode next to untransfected cells as control. Caspase-9DN dramatically prolonged viability of the cell culture (Fig. 1A) as well as viable cell density (Fig. 1B).

CASPASE-9 DOMINANT INHIBITOR IN CHO 5.

217

Apoptosis Assays

Several assays are routinely used to quantify the percentage of cells in cell culture that undergo apoptosis. Cell death by apoptosis as it occurs over the duration of a production run in a bioreactor is shown in Figure 2. Three assays that measure different hallmarks of apoptosis were used: Annexin V binding assay, DNA fragmentation and caspase-3 activity assay. One of the most convenient assays that provide quick data generation and at the same time allows for analysis of thousands of cells is a flow cytometry based annexinV binding assay. This assay detects the loss of plasma membrane asymmetry, one of the typical symptoms of cells undergoing apoptosis. In these cells the membrane phospholipid phosphatidyl serine (PS) is translocated from the inner to the outer leaflet of the plasma membrane, thereby exposing PS to the external cellular environment. Annexin V is a Ca2+ dependent binding protein that binds to PS with a strong affinity (Raynal et al., 1994). Annexin can be conjugated to fluorochromes such as FITC. In conjunction with a vital dye, propidium iodide, that labels cells with lost membrane integrity, this assay can distinguish cells in early stages of apoptosis (annexin positive, PI negative) from cells in late stage of apoptosis (annexin positive, PI positive). This assay has the potential to be adapted as an on-line assay for continual monitoring of cell death in bioreactors or other industrial production vessels.

Figure 2. Apoptosis in bioreactors. Chinese hamster ovary cells were cultured in bioreactors ran in batch mode under production conditions. Apoptosis was measured by annexin assay, DNA fragmentation assay and caspase-3 activation.

218

J. VAN DE GOOR

DNA fragmentation assay. One of the later stages of apoptosis is the activation of endonucleases (Enari et al., 1998; Sakahira et al., 1998), which translocate into the nucleus and cause DNA fragmentation and internucleosomal cleavage. These nucleases degrade the higher order chromatin structures into fragments of 50-300 kbp and subsequently into smaller DNA pieces of about 200bp in length, forming a characteristic “ladder” of DNA fragments which can be detected by agarose gel electrophoresis (Arends et al., 1990). In order to quantify the percentage of cells in the culture that display such fragmentation pattern, DNA breaks can be labeled at the 3’-hydroxyl termini with, e.g., fluorescent tagged deoxyuridine triphosphate nucleotides (FITC-dUTP) in a reaction catalyzed by deoxynucleotidyl transferase (TdT) and subsequently analyzed by flow cytometry (Li et al., 1995). Caspase-3 activity assay. Caspases are cysteine-containing Asp specific proteases (Steinnicke et al., 1997) that are synthesized as inactive precursors and are processed by proteolytic cleavage during apoptosis. Caspase-3 has been implicated as a key executioner caspase and its activation is often used as a measure of apoptosis either directly by assaying caspase-3 activity or indirectly by detecting its proteolytically cleaved endogenous substrates (such as PARP). The direct measure of caspase-3 activity is based on the utilization of a fluorogenic substrate (AcDEVD-AMC), which is a synthetic tetrapeptide that is recognized by caspase-3 and cleaved between D and AMC, releasing the fluorescent AMC that can be quantified by flow cytometry or spectrofluorometry.

6.

Conclusions

In spite of the progress in apoptosis research, current knowledge of the molecular mechanism of programmed cell death is limited. It is likely that novel pathways and regulators will be elucidated and new targets for intervention will become available. As discussed in this review, work in many laboratories has indicated that manipulating the apoptosis machinery can, indeed, result in suppression of apoptosis and an extension of the productive lifetime of the cell culture, leading to an increase in volumetric productivity. These results indicate that future discoveries that will enable use of improved strategies for cell survival have a great potential for further improvement and optimization of industrial processes.

7.

References

Al-Rubeai, M., and Singh, R.P. (1998) Apoptosis in cell culture. Curr Opin Biotechnol 9, 152-156. Arends, M.J., Morris, R.G and Wyllie, A.H. (1990) Apoptosis: the role of endonucleases. Am. J. Pathol. 136, 593-608.


219

Bonarius, H.P.J., Hatzimanikatis, V., Meesters, K.P.H., de Gooier, C.D., Schmid, G. and Tramper, J. (1996) Metabolic flux analysis of hybridoma cells in different culture media using mass balances. Biotechnol Bioeng 50, 299-318. Caine, K., Brown, D.G., Langlais, C. and Cohen, G.M. (1999) Caspase activation involves the formation of the apoptosome, a large (~700 kDa) caspase-activating complex. J Biol Chem 274, 22686-22692. Choi, Y.S., Lee, D.Y., Kim, I.C., Kang, S., Ahn, K., Kim, H.J., Jeong, Y.H., Chun, G.T., Park, J.K. and Kim, I.H. (2000) Ammonia removal using hepatoma cells in mammalian cell cultures. Biotechnol Prog 16, 760-768. Duan, H., Orth, K., Chinnaiyan, A.M., Poirier, G.G., Froelich, J., He, W.H. and Dixit, V.M. (1996) ICE-LAP6, a novel member of the ICE/Ced-3 gene family, is activated by the cytotoxic T cell protease granzyme B J. Biol Chem 271, 16720-16724. Enari, M., Sakahira, H., Yokoyama, H., Okawa, K., Iwamatsu, A., and Nagata, S. (1998) A caspase-activated DNase that degrades DNA during apoptosis and its inhibitor ICAD. Nature 391, 43-50 Fussenegger, M., Schlatter, S., Datwyler, D., Mazur, X. and Bailey, J.E. (1998) Controlled proliferation by multigene metabolic engineering enhances the productivity of Chinese hamster ovary cells. Nature Biotechnology 16, 468-472. Fussenegger, M., Fassnacht, D., Schwartz, R., Zanghi, J.A., Graf, M., Bailey, J.E, Portner, R. (2000) Regulated overexpression of the survival factor bcl-2 in CHO cells increases viable cell density in batch culture and decreases DNA release in extended fixed-bed cultivation. Cytotechnol 32, 45-61. Ganne, V., Guerin, P., Faure, T., and Mignot, G. (1991) Increased expression of factor VIII by butyrate in Chinese hamster ovary cells. In Spier, R.E., Griffiths, J.B. and Meignier, B. (eds.) Production of biologicals by animal cells in culture (pp.104-106) ButterworthHeinemann, Oxford. Goswami, J., Sinskei, A.J., Steller, H. and Stephanopolous, G.N. and Wang, D.I.C. (1999) Apoptosis in batch cultures of Chinese hamster ovary cells. Biotechnol Bioeng 62, 632640. Hakem, R., Hakem, A., Duncan, G.S., Henderson, J.T., Woo, M., Soemgas, M.S., Elia, A., de la Pompa, J.L., Kagi, D., Khoo, W., Potter, J., Yoshida, R., Kaufman, S.A., Lowe, S.W., Penninger, J.M. and Mak, T.W. (1998) Differential requirement for caspase 9 in apoptotic pathways in vivo. Cell 94, 339-352. Jacobson M.D., Weil, M. and Raff, M.C. (1996) Role of Ced-3/ICE-family proteases in Staurosporine-induced programmed cell death. J. Cell Biol 133, 1041-1051. Keen, M.J. and Rapson, N.T. (1995) Development of a serum-free culture medium for the large-scale production of the recombinant protein from a Chinese hamster ovary cell line. Cytotechnol 17, 153-163. Lao, M.S. and Toth, D. (1997) Effects of ammonium and lactate on growth and metabolism of recombinant Chinese hamster ovary cells. Biotechnol Prog 13, 688-691. Mastrangelo, A.J., Hardwick, J.M., Zou, S. and Betenbaugh, M.U., Part II. (2000) Overexpression of Bcl-2 family members enhances survival of mammalian cells in response to various culture insults. Biotechnol Bioeng 67, 555. Moore, A., Donahue, C.J., Hooley, J., Stocks, D.L., Bauer, K.D. and Mather, J.P. (1995) Apoptosis in cell batch cultures: Examination by flow cytometry. Cytotechnology 17, 111. Moore, A., Mercer, J., Dutina. G., Donahue, C.J., Bauer, K.D., Mather, J.P., Etcheverry, T. and Ryll, T. (1997) Effects of temperature shift on cell cycle, apoptosis and nucleotide pools in CHO cell batch cultures. Cytotechnology 23, 47-54.

220

J. VAN DE GOOR

Murray, K., Ang, C-E., Gull, E., Hickman, J.A. and Dickson, A.J. (1996) NSO myeloma cell death: influence of bcl-2 overexpression. Biotechnol Bioeng 51, 298-304. Nicholson, D.W. (1999) Caspase structure, proteolytic substrates, and function during apoptotic cell death. Cell Death Differ. 6, 1028-1042. Nuberg, G.B., Balcarcel, R.R., Follstad, B.D., Stephanopoulos, G. and Wang, D.I.C. (1999) Metabolism of peptide amino acids by Chinese hamster ovary cells grown in complex medium. Biotechnol Bioeng 62, 324-335. Kim, N.S and Lee, G.M. (2001) Overexpression of bcl-2 inhibits sodium butyrate-induced apoptosis in Chinese hamster ovary cells resulting in enhanced humanized antibody production. Biotechnol Bioeng 71, 184-193. Kuida K., Zheng, T.S., Na, S., Kuan, C., Yang, D., Karasuyama, H., Rakic, P. and Flavell, R.A. (1996) Decreased apoptosis in the brain and premature lethality in CPP32-deficient mice. Nature 384, 368-372. Kuida, K., Haydar, T.F., Kuan, C.Y., Gu, Y., Taya, C., Karasuyama, H., Su, M.S., Rakic, P. and Flavell, R.A. (1998) Reduced apoptosis and cytochrome c-mediated caspase activation in mice lacking caspase 9. Cell 94, 325-337. Lee, S.K. and Lee, G.M. (2003) Development of apoptosis-resistant dihydrofolate reductasedeficient Chinese hamster ovary cell line. Biotechnol Bioeng 82, 872-876. Li, X., Traganos, F., Malamed, M.R. and Darzynkiewitz, Z. (1995) Single-step procedure for labeling DNA strand breaks with fluorescein or BODIPY-conjugated deoxynucleotides. Cytometry 20, 172-180. Li, P., Nijhawan, D., Budihardjo, I., Srinivasula, S.M., Ahmad, M., Alnemri, E.S. and Wang, X. (1997) Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade. Cell 91, 479-489. Mastrangelo, A.J., and Betenbaugh, M.J. (1998) Overcoming apoptosis: New methods for improving protein-expression systems. Trenda Biotechnol 16, 88-95. Mather, J.P, Moore, A. and Shawley, R. Optimization of growth, viability and specific productivity for expression of recombinant proteins in mammalian cells. Methods in molecular biology, vol. 62; recombinant gene expression protocols (R. Tuan ed.) Humana Press Inc., Totowa, NJ, 1995, p.369. Pan, G., O’Rourke, K. and Dixit, V.M. (1998) Caspase-9, Bcl-xl, and Apaf-1 form a ternary complex. J. Biol Chem 273, 5841-5845. Palermo, D.P., DeGraaf, M.E., Marotti, K.R., Rehberg, E. and Post, L.E. (1991) Production of analytical quantities of recombinant proteins in Chinese hamster ovary cells using sodium butyrate to elevate gene expression. J. Biotechnol 19, 35-48. Perez, G.I., Knudson, C.M., Leykin, L., Korsmeyer, S.J. and Tilly, J.L. (1997) Apoptosisassociated signaling pathways are required for chemotherapy-mediated female germ cell destruction. Nature Medicine 3, 1228-1232. Qi, X.M., He, H., Zhong, H. and Diestelhorst, C.W (1997) Baculovirus p35 and z-VAD-fmk inhibit thapsigargin-induced apoptosis of breast cancer cells. Oncogene 15, 1207-1212. Raynal, P. and Pollard, H.B. (1994) Annexins: The problem of assessing the biological role for a gene family of multifunctional calcium and phospholipid binding proteins. Biochemica and Biophysica Acta. 1197: 63-93. Sakahira, H., Enari, M. and Nagata, S. (1998) Cleavage of CAD inhibitor in CAD activation and DNA degradation during apoptosis. Nature 391, 96-99. Shi, Y. (2002) Mechanisms of caspase activation and inhibition during apoptosis. Molecular Cell 9, 459-470. Singh, R.P., Al-Rubai, M., Gregory, C.D., Emery, A.N. (1994) Cell death in bioreactors: a role for apoptosis. Biotechnol Bioeng. 44, 720-726.


221

Srinivasula, S.M., Ahmad, M., Fernandes-Alnemri, T. and Alnemri, E.S. (1998) Autoactivation of procaspase-9 by Apaf-1 mediated oligomerization. Molecular Cell 1, 949-957. Steinnicke, H.R. and Salvesen, G.S. (1997) Biochemical characterization of Caspases-3, -6, -7 and –8. J. Biol. Chem. 272, 25719-25723. Tsujimoto, Y., Finger, L.R., Yunis, J., Nowell, P.C. and Croce, C.M. (1984) Cloning of the chromosome breakpoint of neoplastic B cells with the t(14;18) chromosome translocation. Science 226, 1097-1099. Turner, B.M. (1993) Decoding the nucleosome. Cell 75, 5-8. Van de Goor, J., Boman, K., Zheng, L., Dixit, V., Chisholm, V. and Hamilton, R. (2000) Cell death in bioreactors is suppressed by the expression of caspase-9 dominant negative gene. Proceedings of Programmed Cell Death Regulation: Basic Mechanism and Therapeutic Opportunities. American Association for Cancer Research, Incline Village, USA Vaux, D.L., Cory, S. and Adams, J.M. (1988) Bcl-2 gene promotes haemopoietic cell survival and cooperates with c-myc to immortalize pre-B cells. Nature 335, 440-442. Zang, M., Trautman, H., Gandor, C., Messi, F., Asselbergs, F., Leist, C., Fiechter, A. and Reiser, J. (1991) Production of recombinant proteins in Chinese hamster ovary cells using a protein-free cell culture medium, Biotechnology 9, 1347. Zanghi, J.A., Fussenegger, M. and Bailey, J.E. (1999) Serum protects protein-free competent Chinese hamster ovary cells against apoptosis induced by nutrient deprivation in batch culture. Biotechnol Bioeng 64, 108-119. Zanghi, J.A., Renner, W.A., Bailey, J.E. and Fussenegger, M. (2000) The growth factor inhibitor suramin reduces apoptosis and cell aggregation in the protein free CHO cell batch cultures.Biotehnology Prog 16, 319-325

9.

THERAPEUTIC SMALL MOLECULE INHIBITORS OF BCL-2

PIERRE BEAUPARLANT AND GORDON C. SHORE Gemin X Biotechnologies Inc., 3576 Avenue du Parc, Suite 4310, Montreal, Quebec, H2X 2H7, Canada E-mail: [email protected]

1.

Introduction

In oncology, there is an obvious disaffection by drug discovery researchers for many of the therapies used in the clinic today. These drugs have limited specificity so that when cancer cells become less sensitive to them over the course of the treatment, the lack of specificity results in treatment-limiting side effects. Most current therapies rely on the differential sensitivity of dividing and non-dividing cells to the drug and thus the limitation of these treatments arises from their toxicity to normal dividing cells and their lack of efficacy towards cancer cells that have temporarily exited the cell cycle. Therefore, the Holy Grail would be a compound whose cytotoxicity is independent of the cell cycle and remains specific to one or more types of cancer cells. Furthermore, the activity of the ideal compound should not rely on the function of a gene product that becomes defective in cancer cells. Finally, cancer cells should not be capable of activating a detoxification pathway that would limit the activity of the compound. Certainly, targeting a biochemical pathway that is critical only to the survival of cancer cells will provide more selectivity than drugs that target processes that are common to all dividing cells. Until recently, however, the identification of such biochemical pathways has proven difficult due to the genetic instability and heterogeneity of cancer cells. The realization early in the 90’s that suppression of apoptosis, or programmed cell death, can contribute to tumorigenesis has significantly changed our understanding of cancer etiology and its treatment. The role for apoptosis inhibition in the development of cancer was first suggested by the observations that Myc and or E1A oncogenes are themselves potent inducers of apoptosis but can cause cellular transformation if Bcl-2 is overexpressed (Cory et al., 2002). Several in vivo models have since reproduced this observation. Furthermore, although cellular transformation can be initiated by c-myc and activated Ras oncogene, the transformation efficiency can be dramatically increase if the cells are deficient in critical mediators of the intrinsic apoptotic pathway such as Bax and Bak, Apaf-1 or initiator caspase-9 (Zong et al., 2001, Soegans et al., 1999). C-myc and E1A can also transform cells deficient in p53 or cells expressing dominant negative mutants of p53. Otherwise, these oncogenes lead to up-regulation of p53 in p53 wt cells, 223 M. Al-Rubeai and M. Fussenegger (eds.), Cell Engineering, Vol. 4, 223-237. © 2004 Kluwer Academic Publishers. Printed in the Netherlands.

224

P. BEAUPARLANT and G. C. SHORE

resulting in induction of pro-apoptotic proteins such as Bik and Puma and arrest of the cell cycle via induction of p21waf-1, which on its own could prevent cellular transformation. Supporting the hypothesis that c-myc or E1A require more than apoptosis inhibition to induce transformation, is the observation that E1A alone cannot transform cells deficient in Bax and Bak Degenhardt et al., 2002). Nonetheless, Bax and Bak deficiency confers tumorigenicity to c-myc transformed p53 deficient cells (Degenhardt et al., 2002). Since c-myc and E1A can transform Bcl-2 over expressing cells, Bcl-2 in excess either overcomes a transformation inhibition activity of p53, which does not concern apoptosis induction, or p53mediated apoptosis is not entirely dependent on Bax and Bak. The latter could relate to Bcl-2-regulated initiator procaspase complexes or an involvement of Bcl-2 members in regulating cell cycle progression. A recent report for example illustrates how alleviation of cell cycle arrest by myc potentiates p53-induced apoptosis (Seoane et al., 2002). Dissection of apoptosis pathways has also revealed promising new anti-cancer targets and research teams around the globe are now devoting significant effort to the identification of compounds or biologics that can modulate apoptosis regulation. Such drugs are predicted to trigger apoptosis, characterized by the activation of the endopeptidases, caspases, specifically in cancer cells, leaving normal cells unaffected. Most of the drug discovery efforts in the field of apoptosis were initiated a few years ago, and since then our understanding of apoptosis regulation has significantly improved. We review here new evidence supporting the strategy of inhibiting the Bcl-2 family of anti-apoptotic proteins and recent successes.

2.

Triggering Apoptosis: A Traditional Therapeutic Approach in Cancer

Because apoptosis is regulated, it represents a therapeutic opportunity. Most, if not all conventional chemotherapeutic agents trigger apoptosis preferentially in dividing cells. The specificity of these agents, therefore, relies on the succeptibility of highly dividing cells. For instance, anthracyclines and etoposide act mainly through the inhibition of the topoisomerase II, whose level is low in slowly proliferating cells (Dimanche-Boitrel et al., 1993). Cisplatinum, an alkylating agent, induces apoptosis in cells that are in S or G2-M of the cell cycle (Evans et al., 1994). Moreover, enhanced sensitivity toward cisplatinum correlates with drug-induced deamidation and inactivation of Bcl-Xl, which occurs exclusively in dividing cells (Deverman et al., 2002). In contrast, toxicity of chemotherapeutic drugs in normal vs. cancer dividing cells varies depending on their mode of action. For example, alkylating agents are far less specific and more toxic than tamoxifen, whose efficacy in breast cancer therapy is thought to arise primarily from its ability to compete with estrogens for binding to the estrogen receptor and therefore is harmless to estrogenindependent cells (Mandlekar et al., 2001).

THERAPEUTIC SMALL MOLECULE INHIBITORS

225

Many anticancer agents currently in clinical use are cytotoxic at least in part by activating the tumor suppressor p53, which can induce apoptosis in response to cellular stresses such as DNA damage, hypoxia and oncogene activation. Cisplatinum, the topoisomerase I and II inhibitor doxorubicin, and antimetabolites such as 1-beta-D-arabinofuranosylcytosine depend on p53 to induce apoptosis. Conversely, the microtubule inhibitor paclitaxel induces apoptosis independently of p53 and camptothecin, a topoisomerase I inhibitor, induces apoptosis both in a p53dependent and p53-independent manner (Vasey et al., 1996). p53-dependent apoptosis inducers may still induce cellular necrosis so the resistance of p53 deficient cells to p53-dependent chemotherapy is not absolute: if they are treated with a sufficiently high concentration of tumour-toxic drugs, the resistant cancer cells will eventually be killed but systemic toxicity in the patient may limit the likelihood of achieving this concentration.

3.

Modulating Apoptosis Regulation by Targeted Approaches: Promises and Progress

Once a cancer cell is established, how important is apoptosis inhibition to ensure its survival? Moreover, in normal dividing cells, do pro-apoptotic signals exist that need to be repressed or are such signals absent? These questions are fundamental to validating therapeutic intervention based on apoptosis regulation. One of the first observations suggesting a role for Bcl-2 in human cancer was the discovery that the chromosomal translocation frequently found in non-Hodgkin lymphomas (NHL) resulted in Bcl-2 over expression (Ngan et al., 1988). In NHL, a trend between chemoresistance and high Bcl-2 expression was observed (Wilson et al., 1997), and found to be associated with shorter disease free survival (Hermine et al., 1996). Since the family of anti-apoptotic Bcl-2 proteins comprises several members and because it is the ratio of the pro-apoptotic to anti-apoptotic protein that determines the resistance of a cell to apoptotic signals, a predictive correlation between the expression of an anti-apoptotic protein and cancer outcome may be difficult to assess. Nonetheless, it was reported that Bcl-w and Bcl-Xl are frequently over-expressed in colorectal adenocarcinoma (Beale et al., 2000; Wilson et al., 2000); that Bcl-Xl is frequently up-regulated in squamous cell carcinoma of the head and neck (Pena et al., 1999), in prostate cancer (Friess et al., 1998), and in Kaposi’s sarcoma (Foreman et al., 1996); and that Bcl-2 is frequently expressed at high levels in prostate cancer (Bauer et al. 1996), malignant melanoma (Cerroni et al., 1995), Bcell chronic lymphocytic leukemia (Lazaridou et al. 2000), acute myeloid leukemia (Karakas et al., 1998), gallbladder carcinoma (Mikami et al., 1999), testicular carcinoma (Eid et al., 1998), and gliomas (Rodriguez-Pereira et al., 2001). Several studies support a role for anti-apoptotic Bcl-2 proteins in the maintenance and progression of tumors. Bcl-w expression was shown to be associated with later stage colorectal adenocarcinoma (Beale et al., 2000; Wilson et

226


al., 2000). Bcl-Xl over expression in prostate cancer was associated with shorter survival time after tumor resection and Bcl-2 over expression correlated with gallbladder carcinoma progression, presence of metastases in patients with testicular carcinoma (Eid et al., 1998) and lower complete remission rate and shorter survival in acute myeloid leukemia (Karakas et al., 1998). However, not all studies show such positive association. Strikingly, Bcl-2 has been reported to be a marker of good prognosis and responsiveness to tamoxifen. Bcl-2 expression correlated with the presence of oestrogen receptor and with longer disease-free survival than bcl-2– negative tumours (Elledge et al., 1997). Because estrogens up regulate Bcl-2 expression and, conversely, the anti-oestrogen tamoxifen down-regulates Bcl-2 expression, however, Bcl-2 positive breast cancers may simply represent a group of tumors that are more likely to be oestrogen receptor positive and thus to respond to tamoxifen. Bcl-2 down regulation in response to tamoxifen may even contribute to their responsiveness (Zhang et al., 1999). 3.1

THERAPEUTIC INHIBITION OF BCL-2 SYNTHESIS

Since Bcl-2 appears to be over expressed in several tumours, it was hypothesized that down-regulating Bcl-2 using antisense oligonuclotides (AO) could be therapeutically beneficial. The rational for this approach was reinforced by several observations showing that Bcl-2 protein confers resistance to conventional cytotoxic agents. For example, Bcl-2 over expression protects in a dose dependent manner ovarian carcinoma cells against cisplatinum cytotoxicity (Beale et al., 2000). Furthermore, Bcl-Xl over expression decreases the sensitivity of melanoma cells to cisplatinum (Heere-Rees et al., 2002) and in mouse xenograft tumors models Bcl-Xl over expression negatively influences the sensitivity of ovarian carcinoma to cisplatinum and paclitaxel (Rogers et al., 2002). Studies have shown that Bcl-2 AOs are cytotoxic to a variety of cancer cells including breast cancer cells (Lopes de Menezes et al. 2000), prostate cancer cells (Gleave et al., 1999), NHL (Klasa et al., 2000), melanoma (Jansen et al., 1998) and Merkel cells (Schlagbauer-Wadl et al., 2000). Bcl-2/Bcl-Xl bispecific AOs were also shown to be cytotoxic to several cancers cells, including small cell lung cancer cells (Zangemeister-Wittke et al., 1998), breast, colorectal (Gautschi et al., 2001) and melanoma cells (Strasberg Rieber et al., 2001). As expected, this cytotoxic effect was p53-independent (Strasberg Rieber et al., 2001) and synergies between Bcl-2 AO and cytotoxic agents were observed (Chi et al., 2000, ZangemeisterWittke et al., 1998). Interestingly, in breast cancer cells, the levels of Bcl-2 did not correlate with Bcl-2 AO toxicity suggesting that simply altering the fine balance between the levels of anti-apoptotic and pro apoptotic proteins could be cytotoxic (Chi et al., 2000). Few in vitro studies have characterized the sensitivity of normal cells to Bcl-2 AO. Nonetheless, a certain degree of selectivity towards cancer cells is apparent. Normal fibroblasts, endothelial cells and keratynocytes appear to be only


227

marginally sensitive to Bcl-Xl AO (Cotter et al., 1994, Kumazaki et al., 2002, Ackermann et al. 1999, Taylor et al., 1999). On the other hand, Bcl-Xl AO sensitized normal keratinocytes to cisplatinum and UVB-induced apoptosis (Taylor et al., 1999) and normal human melanocytes, which express very high levels of Bcl2, are as sensitive to Bcl-2 AO as melanoma cells (Olie et al., 2002). The best demonstration of the selectivity of Bcl-2 AO came from mouse xenograft tumor models. Bcl-2 AOs have been tested alone, in a Merkel cell carcinoma (Schlagbauer-Wadl et al., 2000) and a prostate cancer tumour model (Gleave et al., 1999), as well as in combination with doxorubicin, cyclophosphamide, or dacarbazine in a breast (Lopes de Menezes et al., 2000), a NHL (Klasa et al., 2000) and a melanoma (Jansen et al., 1998) tumour model respectively. In all these experiments, Bcl-2 AO was well tolerated and reduction in Bcl-2 levels could be observed in the tumor cells. These encouraging results have prompted several clinical trials for the Bcl-2 AO G3139. Initial results in NHL and melanoma patients have shown that G3139 was well tolerated, induced Bcl-2 downregulation and was associated with some anti-tumour response (Walters et al., 2000). These results validate the anti-cancer strategy of down-regulating Bcl-2. However recent studies suggest that some of the clinical benefit of G3139 may also be related to the immune stimulation affects observed with CpG-containing AO (Agrawal et al., 2001, Jahrsdorfer et al., 2002). 3.2

SMALL MOLECULE INHIBITORS OF ANTI-APOPTOTIC BCL-2 PROTEINS

Small molecule drugs that mimic pro-apoptotic BH3 domains and occupy the BH3 binding cleft of anti-apoptotic Bcl-2 members have the potential to reduce the ratio of functional anti- and pro-apoptotic Bcl-2 proteins in the cell. Since oncogenic stimuli in cancer cells or their treatment with conventional chemotherapy provide a pro-apoptotic stress, these drugs have the potential to overcome the block imposed by upregulation of the anti-apoptotic subfamily. Ideally, a BH3 mimic that sensitizes cancer cells to these stresses would be preferred, as opposed to ones that directly activate Bax and Bak (Letai et al., 2002). A few studies have attempted to validate this approach. First, it was shown that electroporation of Bax or Bak BH3 peptides into prostate cancer cells was cytotoxic and this cytotoxic activity was inhibited by the broad caspase inhibitor zVAD-FMK (Finnegan et al., 2001). Second, treating acute myeloid leukemia (HL60) cells with cell-permeable Bad BH3 peptide induced apoptosis, and this was inhibited by z-VAD. Interestingly, the same peptide was not cytotoxic to mitogen stimulated peripheral blood lymphocytes, suggesting a certain degree of selectivity towards cancer cells. Intraperitoneal administration of the same peptide in SCID mice suppressed HL60 tumor growth (Wang et al., 2000). Finally, over expression of Bik sensitized breast cancer cells to chemotherapy (Radetzki et al., 2002).

228

P. BEAUPARLANT and G. C. SHORE 3.2.1 Identification of small molecule inhibitors using in vitro assays

To date, a number of potential small molecule inhibitors of Bcl-2 have been discovered by screening compound libraries using in vitro assays. One such assay consists of testing compounds for their ability to inhibit fluorescence polarization of a fluorescent BH3 peptide bound to a Bcl-2 protein (Zhang et al., 2002). The basis for this assay is that a fluorescent molecule free in solution, such as a fluorescent peptide, will emit light in all directions when hit by a plane-polarized light because it tumbles rapidly. When bound to a protein, the fluorescent peptide tumbles more slowly and the light it emits is more polarized relative to the excitation light polarization plane. This is measure as an increase in millipolarization units (mP) relative to unbound fluorescent molecule. Zhang and colleagues (Zhang et al., 2002) have developed an assay in which 15 nM of a 21 amino acids peptide corresponding to the BH3 domain of Bad (aa 140-160) is labelled with fluorescein on the glutamine residue 157 and mixed with 30 nM recombinant Bcl-Xl. Recombinant Bcl-Xl is deleted of its c-terminal hydrophobic residues and from the flexible loop region (aa 49-88). The concentration of Bcl-Xl was chosen because it is close to the kD (23 nM) in this assay. This assay was adapted to 96-well plate format for highthroughput screening of small molecule libraries of compounds. The signal to noise ration of bound versus free peptide was 15.37 and the Z factor, which reflects both the assay range and the data variation was 0.73 (an excellent assay as a value between 0.5 and 1). In this assay, unlabelled Bad peptide had an IC50 of 48 nM, whereas Bak peptide had a lower value (1.14 uM), in agreement with their relative affinities for Bcl-Xl. Furthermore, this assay was not affected by concentrations of DMSO up to 8%, a solvent commonly used to solubilized test compounds, and the fluorescence polorization was stable over a 24h indicating the robustness of this assay. One limitation of fluorescence polarization is a possible interference with the natural fluorescence of test compounds. To avoid this possible source of false positive results, other detection systems can be used. One design utilises a protein that is radiolabelled or fused to an enzyme for which a chemiluminescent substrate exists. The binding partner of the first protein is immobilized on a support and compounds are then tested for their ability to compete the binding of the two binding partners. After several washes, the level of radioactivity or chemiluminescence left is inversely proportional to the level of competition exerted by the compound. These assays, because they involve several steps, require more complex robotization and time. BH3I-1 and BH3I-2 (Figure 1) are two small molecules that were identified by screening a chemical library of over 16,000 compounds from ChemBridge


229

HO2C O

S

N

O O

O

S

Br

O

O

NH2

Br

HA14-1

BH3I-1 S

HO2C

Cl

S

N

O O

S Br

OH

S O

H N

O Cl Cl

BH3I-2

BH3I-1sCH3

O

H O

O

2,5,6,9-Tetramethoxy-11,12-dihydrodibenzo[c,g][1,2]diazocine

N H

OMe O

O

Me

O Me

Me

O

Antim ycin A3

O

O O

O

Me

O

H N

OH

Me

O

O

Me

H

N H

O

H N

N N

O

O

Me

O

O

O Me

Me O

HO

O

O

Me OH

2-methoxy antimycin A3

Terphenyl compound no.4

Figure 1. Chemical structures of Bcl-2 Activity small-molecule modulators

230


Corporation using a fluorescence polarization assay in which compounds were tested for their ability to disrupt the binding of fluorescent Bak peptide to recombinant Bcl-Xl (Degterev et al., 2001). The ki for BH3I-1 and BH3I-2 in the fluorescence polarization assay were 2.4 uM and 4.1 uM respectively. By measuring changes in the two-dimensional 15N/1H heteronuclear single-quantum correlation spectrum of 15N-labelled Bcl-Xl, it was possible to determine that BH3Is induced changes in Bcl-Xl structure and that both molecules contacted the hydrophobic pocket of Bcl-Xl formed by the BH1 and BH2 domains as it is the case for the BH3 domain of Bak. Analysis of the residues differentially affected by BH3Is suggested that BH3I-2 probably targets a more upstream part of Bcl-Xl hydrophobic groove than BH3I-1. The ability of BH3Is to displace a Bcl-Xl-bound BH3 peptide derived from Bak was confirmed by competing the binding of Bak BH3 peptides to immobilized recombinant Bcl-Xl (or Bcl-2) to surface-enhanced laser desorption/ionization (SELDI) chips. After several washes, remaining bound peptides were quantified by mass spectroscopy. Similarly, BH3Is could compete the pull down of in vitro translated tBid using Bcl-Xl containing agarose beads. In these assay, BH3I-2 appeared to be a more potent inhibitor than BH3I-1. The specificity of the inhibition was confirmed by testing the ability of BH3Is to inhibit the pull down of U2AF65 with U2AF35 containing beads and to inhibit the interaction between Apaf-1 CARD domain to caspase-9 by SELDI/MS. In Jurkat cells, these compounds induced apoptosis at low micromolar concentrations, with Bcl-Xl and zVAD-FMK providing partial protection. In agreement with in vitro competition assays, BH3I-2 was more potent at inducing cell death than BH3I-1. Using green fluorescent protein (GFP)/Bcl-Xl and GFP/Bax chimeric proteins expressed in HEK-293 cells it was possible to correlate the cyctotoxicity of BH3Is with their ability to dissociate Bax and Bcl-Xl heterodimers as measured by fluorescent resonance energy transfer (FRET) analysis. 3.2.2 Identification of small molecule inhibitors using in silico appraches By NMR, it was possible to determine how BH3I-1 and 2 contact the BH3 groove of Bcl-Xl and to use this information to screen virtual compound libraries using computational methods. A current limitation of in silico screening methods is that proteins can adopt multiple conformations and only some favour ligand binding. BH3I-1 was shown to directly contact residues Y65 and F107 of Bcl-Xls indicated by magnetization transfer between the amide protons of these residues and the benzene-ring protons of BH3I-1. These residues are buried in the structure of free Bcl-Xl but surface exposed in the structure of Bcl-Xl/Bak BH3 complex. It was then hypothesized that BH3Is contact Bcl-Xl in the “open cleft” conformation of the BclXl/Bak complex and this information was used to generate a molecular BclXl/BH3Is complex. The latter was used to generate an algorithm for the screening of the virtual Chemnavigator and Chembridge compound libraries. This approach


231

yielded an additional compound, BH3I-1SCH3 (Figure 1), which is structurally related to BH3I1 and has similar affinity in vitro (Lugovskoy, et al., 2002). Screening of virtual libraries also led to the identification of 7 other compounds that potentially can bind the groove formed by the BH1 BH2, and BH3 domains of Bcl-2 and that inhibited binding of Bak BH3 peptide to Bcl-2 in vitro (Enyedy et al., 2001). The methodology involved modeling the structure of Bcl-2 on the basis of experimental 3D structures of Bcl-Xl, alone and in complex with Bak BH3 peptide (Sattler et al., 1997, Muchmore et al., 1996). This approach was made possible by the high degree of structural homology in the amino acid sequence between Bcl-Xl and Bcl-2. All Bcl-2 residues predicted to be within 8 Å from the Bak peptide in the Bcl-2/Bak complex were selected to define the binding site. The algorithm was then used to screen in silico the National Cancer Institute 3D Database to identify small molecules that could bind the BH3 binding site of Bcl-2. Over 200,000 compounds were screened, 500 were identified as potential Bcl-2 inhibitors and 35 were tested for their ability to inhibit the binding of Bak BH3 peptide to Bcl-2 in vitro. Of the seven in vitro active compounds, 2,5,6,9-Tetramethoxy-11, 12-dihydro-dibenzo [c, g][1, 2] diazocine (TDDD), was shown to be cytotoxic to myeloid leukemia (HL60) cells with an IC50 of about 10 uM (Figure 1). The latter binds the BH3 binding site of Bcl-Xl as shown by NMR spectroscopy and inhibited Bak BH3 peptide binding to Bcl-2 and Bcl-Xl as shown by fluorescence polarization with an IC50 of 10 uM and 7 uM respectively (Enyedy et al., 2001) A very similar in silico strategy involving modeling the Bcl-2/Bak BH3 peptide complex structure using the 3D experimental structure of Bcl-Xl/Bak comlex and screening over 190,000 compounds from the MDL/ACD 3D database was used earlier by Wang and colleagues and lead to the identification HA14-1 (Figure 1) (Wang et al., 2002). By fluorescence polarization, the IC50 of HA14-1 for Bak BH3 peptide binding to Bcl-2 was 9 uM and the compound induced apoptosis in HL60 cells with an apparent IC50 of 20 uM (Wang et al., 2002). Treatment of HL60 cells with HA14-1 was also accompanied by a loss of mitochondria membrane potential. Consistent with its predicted mechanism of action, HA14-1-induced apoptosis is Apaf-1-dependent and zVAD-FMK-inhibited. Recently, another group studied the interaction in the Bak BH3/Bcl-Xl complex in crystal and in solution. Based on three predicted characteristics of the interaction, they designed a series of putative terphenyl BH3 peptido-mimetics. The three characteristics were that (i) one ionic residue and (ii) four hydrophobic residues of the BH3 helix were predicted to be involved in the binding to Bcl-Xl and that (iii) this binding apparently depends on the alpha-helix propensity of the BH3 peptide. One of the designed terphenyl molecules (compound no. 4) interacted with Bcl-Xl as shown by NMR and could displace Bak BH3 peptide from Bcl-Xl in a fluorescent polarization assay with a kD of 0.1 uM (Figure 1). The biological activity of these terphenyl molecules was not tested (Kutzki et al., 2002).

232

P. BEAUPARLANT and G. C. SHORE 3.2.3 Identification of small molecule inhibitors using cellular assays

Tzung and colleagues have hypothesized that compounds that inhibit mitochondrial respiration could induce apoptosis independently of Bcl-Xl expression. They generated isogenic murine hepatotyte cell lines with graded expression of BclXl and unexpectedly found that the cytotoxicity of antimycin A3 (AA), (a complex III inhibitor), and the inactive analogue 2-methoxy-antimycin A3 (MAA), correlated with the expression of Bcl-Xl or Bcl-2 (Figure 1) (Kim et al., 2001, Tzung et al., 2001). Because AA has a comparable effect on oxygen consumption on murine hepatocyte cell lines independently of Bcl-Xl overexpression, and that MAA has no effect on oxygen consumption, AA and MAA appeared to induce cell death by an unsuspected mechanism. Interestingly, pretreating cells with the zVAD-FMK did not protect murine hepatocyte cell overexpressing Bcl-Xl against AA-induced apoptosis and mitochondria from murine hepatocyte cell lines overexpressing Bcl-Xl loss their membrane potential following AA and MAA treatment. The dependence of AA-induced apoptosis on Bcl-Xl cellular levels however, is not observed in all cell types. An independent study showed that Bcl-Xl over expression protected a pro-B lymphoid cell line from AAinduced apoptosis (Van der Heiden et al., 1997). Suggestive that these compounds act through Bcl-Xl or Bcl-2 is that AA binds Bcl-2 with a Kd of 0.82 uM. AA being naturally fluorescent, the association of AA with recombinant Bcl-2 was measured by fluorescent spectroscopy. BSA and lysozyme were used as negative controls. MAA also appeared to interact with Bcl-2 since it competed the binding of AA to Bcl-2 in vitro (MAA is not fluorescent). The binding of AA to Bcl-2 is also inhibited by Bak BH3 peptides with a kD of 2.85 uM. By molecular modeling AA is predicted to contact the BH3 binding site of both Bcl-2 and Bcl-Xl (Kin et al., 2001; Tzung et. al., 2001). The consequence of this interaction however is not fully elucidated. Bcl-Xl was shown to insert into synthetic vesicle and to form an ionconducting channel (Minn et al., 1997). Treatment with AA of Bcl-Xl containing liposomes loaded with calcein lead to a rapid calcein efflux. Similar observations were made with Bak BH3 peptide but not with mutated BH3 peptide. Paradoxically, Degterev et al found that BH3Is and Bak BH3 peptide did not affect the Bcl-Xlmediated release of carboxyfluorescein encapsulated in artificial liposome. Although the results using AA/MAA and BH3Is cannot be readily reconciled, it may suggest that AA and MAA do not simply antagonize the anti-apoptotic activity of Bcl-2 and Bcl-Xl, as expected from a BH3 mimetics, but rather they might convert Bcl-2 and Bcl-Xl into pro-apoptotic factors.

4.

Conclusion

Although several studies suggest that suppression of apoptosis by Bcl-2 proteins is a critical early event in oncogenesis, its role in the maintenance of established


233

tumors has still not been fully characterized. Similarly, the role of apoptosis inhibition by Bcl-2 proteins in normal proliferating cells has been studied only in few cell types. Without this information, it is difficult to predict the selectivity of Bcl-2-modulating therapeutic approaches in cancer treatment. Thus far, the best indication that cancer cells differ from their normal counterparts by their dependence on apoptosis inhibition is the significant up-regulation of anti-apoptotic members in many cancers and the successful treatment of mice bearing tumor xenograft with Bcl-2 AO. Early results from clinical trials for Bcl-2 AO are also providing the first validation for this approach in humans, but will most likely not reveal the full potential for Bcl-2 inhibition given the inherent clinical limitations of AOs (Dvorchik et al., 2002). Therapeutic small molecule inhibitors of Bcl-2 proteins are the preferred mean as they have the potential to be more stable and orally available. Recent successes for these compounds in xenograft animal models promise their clinical testing in the near future. One of the challenges for Bcl-2 inhibitors may be that different tumors may depend on a distinct Bcl-2 family member for their survival. Therefore, agents that act against more than one anti-apoptotic Bcl-2 family protein are desired. This goal has already been achieved with the design of Bcl-2/Bcl-Xl bispecific AOs. To achieve the same Bcl-2 pan-inhibition using small molecules, investigators will need to design inhibitors that contact structures within the BH3 binding site that are conserved among the Bcl-2 family. Results with TDDD, which inhibits both Bcl-2 and Bcl-Xl, as well as results with AA which appear to turn both Bcl-2 and Bcl-Xl into pro-apoptotic proteins, suggest that this could be achieved.

5.

References

Ackermann EJ, Taylor JK, Narayana R, Bennett CF. The role of antiapoptotic Bcl-2 family members in endothelial apoptosis elucidated with antisense oligonucleotides. J Biol Chem 1999; 274: 11245-52 Agrawal S, Kandimalla ER. Antisense and/or immunostimulatory oligonucleotide therapeutics. Curr Cancer Drug Targets 2001; 1: 197-209 Bauer JJ, Sesterhenn IA, Mostofi FK, McLeod DG, Srivastava S, Moul JW. Elevated levels of apoptosis regulator proteins p53 and bcl-2 are independent prognostic biomarkers in surgically treated clinically localized prostate cancer. J Urol 1996; 156: 1511-6 Beale PJ, Rogers P, Boxall F, Sharp SY, Kelland LR. BCL-2 family protein expression and platinum drug resistance in ovarian carcinoma. Br J Cancer 2000; 82: 436-40 Beale PJ, Rogers P, Boxall F, Sharp SY, Kelland LR. BCL-2 family protein expression and platinum drug resistance in ovarian carcinoma. Br J Cancer 2000; 82: 436-40 Cerroni L, Soyer HP, Kerl H. bcl-2 protein expression in cutaneous malignant melanoma and benign melanocytic nevi. Am J Dermatopathol 1995; 17: 7-11 Chi KC, Wallis AE, Lee CH, De Menezes DL, Sartor J, Dragowska WH, Mayer LD. Effects of Bcl-2 modulation with G3139 antisense oligonucleotide on human breast cancer cells are independent of inherent Bcl-2 protein expression. Breast Cancer Res Treat 2000; 63: 199-212

234


Cory S, Adams JM. The Bcl2 family: regulators of the cellular life-or-death switch. Nat Rev Cancer 2002; 2: 647-56 Cotter FE, Johnson P, Hall P, Pocock C, al Mahdi N, Cowell JK, Morgan G. Antisense oligonucleotides suppress B-cell lymphoma growth in a SCID-hu mouse model. Oncogene 1994; 9: 3049-55 Degenhardt K, Chen G, Lindsten T, White E. BAX and BAK mediate p53-independent suppression of tumorigenesis. Cancer Cell 2002 ;2:193-203 Degenhardt K, Sundararajan R, Lindsten T, Thompson C, White E. Bax and Bak independently promote cytochrome C release from mitochondria. J Biol Chem 2002; 277: 14127-34 Degterev A, Lugovskoy A, Cardone M, Mulley B, Wagner G, Mitchison T, Yuan J. Identification of small-molecule inhibitors of interaction between the BH3 domain and Bcl-xL. Nat Cell Biol 2001; 3: 173-82 Deverman BE, Cook BL, Manson SR, Niederhoff RA, Langer EM, Rosova I, Kulans LA, Fu X, Weinberg JS, Heinecke JW, Roth KA, Weintraub SJ. Bcl-xL deamidation is a critical switch in the regulation of the response to DNA damage. Cell 2002; 111: 51-62 Dimanche-Boitrel MT, Garrido C, Chauffert B. Kinetic resistance to anticancer agents. Cytotechnology 1993; 12: 347-56 Dvorchik BH. The disposition (ADME) of antisense oligonucleotides. Curr Opin Mol Ther 2000; 2: 253-7 Eid H, Gulyas M, Geczi L, Bodrogi I, Institoris E, Bak M. Expression of bcl-2 in testicular carcinoma: correlation with tumor progression and MDR1/Pgp. Cancer 1998; 83: 331-6 Elledge RM, Green S, Howes L, Clark GM, Berardo M, Allred DC, Pugh R, Ciocca D, Ravdin P, O'Sullivan J, Rivkin S, Martino S, Osborne CK. bcl-2, p53, and response to tamoxifen in estrogen receptor-positive metastatic breast cancer: a Southwest Oncology Group study. J Clin Oncol 1997; 15: 1916-22 Enyedy IJ, Ling Y, Nacro K, Tomita Y, Wu X, Cao Y, Guo R, Li B, Zhu X, Huang Y, Long YQ, Roller PP, Yang D, Wang S. Discovery of small-molecule inhibitors of Bcl-2 through structure-based computer screening. J Med Chem 2001; 44: 4313-24 Evans DL, Tilby M, Dive C. Differential sensitivity to the induction of apoptosis by cisplatin in proliferating and quiescent immature rat thymocytes is independent of the levels of drug accumulation and DNA adduct formation. Cancer Res 1994; 54: 1596-603 Finnegan NM, Curtin JF, Prevost G, Morgan B, Cotter TG. Induction of apoptosis in prostate carcinoma cells by BH3 peptides which inhibit Bak/Bcl-2 interactions. Br J Cancer 2001; 85: 115-21 Foreman KE, Wrone-Smith T, Boise LH, Thompson CB, Polverini PJ, Simonian PL, Nunez G, Nickoloff BJ. Kaposi's sarcoma tumor cells preferentially express Bcl-xL. Am J Pathol 1996; 149: 795-803 Friess H, Lu Z, Andren-Sandberg A, Berberat P, Zimmermann A, Adler G, Schmid R, Buchler MW. Moderate activation of the apoptosis inhibitor bcl-xL worsens the prognosis in pancreatic cancer. Ann Surg 1998; 228: 780-7 Gautschi O, Tschopp S, Olie RA, Leech SH, Simoes-Wust AP, Ziegler A, Baumann B, Odermatt B, Hall J, Stahel RA, Zangemeister-Wittke U. Activity of a novel bcl-2/bcl-xLbispecific antisense oligonucleotide against tumors of diverse histologic origins. J Natl Cancer Inst 2001; 93: 463-71 Gleave M, Tolcher A, Miyake H, Nelson C, Brown B, Beraldi E, Goldie J. Progression to androgen independence is delayed by adjuvant treatment with antisense Bcl-2 oligodeoxynucleotides after castration in the LNCaP prostate tumor model. Clin Cancer Res 1999; 5: 2891-8


235

Heere-Ress E, Thallinger C, Lucas T, Schlagbauer-Wadl H, Wacheck V, Monia BP, Wolff K, Pehamberger H, Jansen B. Bcl-X(L) is a chemoresistance factor in human melanoma cells that can be inhibited by antisense therapy. Int J Cancer 2002; 99:29-34 Hermine O, Haioun C, Lepage E, d'Agay MF, Briere J, Lavignac C, Fillet G, Salles G, Marolleau JP, Diebold J, Reyas F, Gaulard P. Prognostic significance of bcl-2 protein expression in aggressive non-Hodgkin's lymphoma. Groupe d'Etude des Lymphomes de l'Adulte (GELA). Blood 1996; 87: 265-72 Jahrsdorfer B, Jox R, Muhlenhoff L, Tschoep K, Krug A, Rothenfusser S, Meinhardt G, Emmerich B, Endres S, Hartmann G. Modulation of malignant B cell activation and apoptosis by bcl-2 antisense ODN and immunostimulatory CpG ODN. J Leukoc Biol 2002; 72: 83-92 Jansen B, Schlagbauer-Wadl H, Brown BD, Bryan RN, van Elsas A, Muller M, Wolff K, Eichler HG, Pehamberger H .bcl-2 antisense therapy chemosensitizes human melanoma in SCID mice. Nat Med 1998; 4: 232-4 Karakas T, Maurer U, Weidmann E, Miething CC, Hoelzer D, Bergmann L. High expression of bcl-2 mRNA as a determinant of poor prognosis in acute myeloid leukemia. Ann Oncol 1998; 9: 129-30 Kim KM, Giedt CD, Basanez G, O'Neill JW, Hill JJ, Han YH, Tzung SP, Zimmerberg J, Hockenbery DM, Zhang KY. Biophysical characterization of recombinant human Bcl-2 and its interactions with an inhibitory ligand, antimycin A. Biochemistry 2001;40:4911-22 Klasa RJ, Bally MB, Ng R, Goldie JH, Gascoyne RD, Wong FM. Eradication of human nonHodgkin's lymphoma in SCID mice by BCL-2 antisense oligonucleotides combined with low-dose cyclophosphamide. Clin Cancer Res 2000; 6: 2492-500 Kumazaki T, Sasaki M, Nishiyama M, Teranishi Y, Sumida H, Mitsui Y. Effect of BCL-2 down-regulation on cellular life span. Biogerontology 2002; 3: 291-300 Kutzki O, Park HS, Ernst JT, Orner BP, Yin H, Hamilton AD. Development of a Potent Bclx(L) Antagonist Based on alpha-Helix Mimicry. J Am Chem Soc 2002; 124: 11838-9 Lazaridou A, Miraxtsi C, Korantzis J, Eleftheriadis N, Christakis JI. Simultaneous detection of BCL-2 protein, trisomy 12, retinoblastoma and P53 monoallelic gene deletions in B-cell chronic lymphocytic leukemia by fluorescence in situ hybridization (FISH): relation to disease status. Leuk Lymphoma 2000; 36: 503-12 Letai A, Bassik M, Walensky L, Sorcinelli M, Weiler S, Korsmeyer S. Distinct BH3 domains either sensitize or activate mitochondrial apoptosis, serving as prototype cancer therapeutics. Cancer Cell 2002; 2: 183-92. Lopes de Menezes DE, Hudon N, McIntosh N, Mayer LD. Molecular and pharmacokinetic properties associated with the therapeutics of bcl-2 antisense oligonucleotide G3139 combined with free and liposomal doxorubicin. Clin Cancer Res 2000; 6: 2891-902 Lugovskoy AA, Degterev AI, Fahmy AF, Zhou P, Gross JD, Yuan J, Wagner G. A novel approach for characterizing protein ligand complexes: molecular basis for specificity of small-molecule Bcl-2 inhibitors. J Am Chem Soc 2002; 124: 1234-40 Mandlekar S, Kong AN. Mechanisms of tamoxifen-induced apoptosis. Apoptosis 2001; 6:469-77 Mikami T, Yanagisawa N, Baba H, Koike M, Okayasu I. Association of Bcl-2 protein expression with gallbladder carcinoma differentiation and progression and its relation to apoptosis. Cancer 1999; 85: 318-25 Minn AJ, Velez P, Schendel SL, Liang H, Muchmore SW, Fesik SW, Fill M, Thompson CB. Bcl-x(L) forms an ion channel in synthetic lipid membranes. Nature 1997; 385: 353-7 Muchmore SW, Sattler M, Liang H, Meadows RP, Harlan JE, Yoon HS, Nettesheim D, Chang BS, Thompson CB, Wong SL, Ng SL, Fesik SW. X-ray and NMR structure of human Bcl-xL, an inhibitor of programmed cell death. Nature 1996; 381: 335-41

236


Ngan BY, Chen-Levy Z, Weiss LM, Warnke RA, Cleary ML. Expression in non Hodgkin's lymphoma of the bcl-2 protein associated with the t(14;18) chromosomal translocation. N Engl J Med 1988; 318: 1638-44 Olie RA, Hafner C, Kuttel R, Sigrist B, Willers J, Dummer R, Hall J, Stahel RA, Zangemeister-Wittke U.Bcl-2 and bcl-xL antisense oligonucleotides induce apoptosis in melanoma cells of different clinical stages. J Invest Dermatol 2002; 118: 505-12 Pena JC, Thompson CB, Recant W, Vokes EE, Rudin CM. Bcl-xL and Bcl-2 expression in squamous cell carcinoma of the head and neck. Cancer 1999; 85: 164-70 Radetzki S, Kohne CH, von Haefen C, Gillissen B, Sturm I, Dorken B, Daniel PT. The apoptosis promoting Bcl-2 homologues Bak and Nbk/Bik overcome drug resistance in Mdr-1-negative and Mdr-1-overexpressing breast cancer cell lines. Oncogene 2002; 21: 227-38 Rodriguez-Pereira C, Suarez-Penaranda JM, Barros F, Sobrido MJ, Vazquez-Salvado M, Forteza J. Analysis of 2 antiapoptotic factors in gliomas: bcl-2 overexpression and p53 mutations. Arch Pathol Lab Med 2001; 125: 218-23 Rogers PM, Beale PJ, Al-Moundhri M, Boxall F, Patterson L, Valenti M, Raynaud F, Hobbs S, Johnston S, Kelland LR. Overexpression of BclXL in a human ovarian carcinoma cell line: paradoxic effects on chemosensitivity in vitro versus in vivo. Int J Cancer 2002; 97: 858-63 Sattler M, Liang H, Nettesheim D, Meadows RP, Harlan JE, Eberstadt M, Yoon HS, Shuker SB, Chang BS, Minn AJ, Thompson CB, Fesik SW. Structure of Bcl-xL-Bak peptide complex: recognition between regulators of apoptosis. Science 1997; 275: 983-6 Schlagbauer-Wadl H, Klosner G, Heere-Ress E, Waltering S, Moll I, Wolff K, Pehamberger H, Jansen B. Bcl-2 antisense oligonucleotides (G3139) inhibit Merkel cell carcinoma growth in SCID mice. J Invest Dermatol 2000; 114: 725-30 Seoane J, Le HV, Massague J. Myc suppression of the p21(Cip1) Cdk inhibitor influences the outcome of the p53 response to DNA damage. Nature 2002; 419: 729-34 Soengas MS, Alarcon RM, Yoshida H, Giaccia AJ, Hakem R, Mak TW, Lowe SW. Apaf-1 and caspase-9 in p53-dependent apoptosis and tumor inhibition. Science 1999; 284: 156-9 Strasberg Rieber M, Zangemeister-Wittke U, Rieber M. p53-Independent induction of apoptosis in human melanoma cells by a bcl-2/bcl-xL bispecific antisense oligonucleotide. Clin Cancer Res 2001; 7: 1446-51 Taylor JK, Zhang QQ, Monia BP, Marcusson EG, Dean NM. Inhibition of Bcl-xL expression sensitizes normal human keratinocytes and epithelial cells to apoptotic stimuli. Oncogene 1999; 18: 4495-504 Tzung SP, Kim KM, Basanez G, Giedt CD, Simon J, Zimmerberg J, Zhang KY, Hockenbery DM. Antimycin A mimics a cell-death-inducing Bcl-2 homology domain 3. Nat Cell Biol 2001;3:183-91 Vander Heiden MG, Chandel NS, Williamson EK, Schumacker PT, Thompson CB. Bcl-xL regulates the membrane potential and volume homeostasis of mitochondria. Cell 1997; 91: 559-62 Vasey PA, Jones NA, Jenkins S, Dive C, Brown R. Cisplatin, camptothecin, and taxol sensitivities of cells with p53-associated multidrug resistance. Mol Pharmacol 1996; 50:1536-40 Wang JL, Liu D, Zhang ZJ, Shan S, Han X, Srinivasula SM, Croce CM, Alnemri ES, Huang Z. Structure-based discovery of an organic compound that binds Bcl-2 protein and induces apoptosis of tumor cells. Proc Natl Acad Sci U S A 2000; 97: 7124-9 Wang JL, Zhang ZJ, Choksi S, Shan S, Lu Z, Croce CM, Alnemri ES, Korngold R, Huang Z. Cell permeable Bcl-2 binding peptides: a chemical approach to apoptosis induction in tumor cells. Cancer Res 2000; 60: 1498-502


237

Waters JS, Webb A, Cunningham D, Clarke PA, Raynaud F, di Stefano F, Cotter FE. Phase I clinical and pharmacokinetic study of bcl-2 antisense oligonucleotide therapy in patients with non-Hodgkin's lymphoma. J Clin Oncol 2000; 18: 1812-23 Wilson JW, Nostro MC, Balzi M, Faraoni P, Cianchi F, Becciolini A, Potten CS. Bcl-w expression in colorectal adenocarcinoma. Br J Cancer 2000; 82: 178-85 Wilson WH, Teruya-Feldstein J, Fest T, Harris C, Steinberg SM, Jaffe ES, Raffeld M. Relationship of p53, bcl-2, and tumor proliferation to clinical drug resistance in nonHodgkin's lymphomas. Blood 1997; 89: 601-9 Zangemeister-Wittke U, Schenker T, Luedke GH, Stahel RA. Synergistic cytotoxicity of bcl2 antisense oligodeoxynucleotides and etoposide, doxorubicin and cisplatin on small-cell lung cancer cell lines. Br J Cancer 1998; 78: 1035-42 Zhang GJ, Kimijima I, Onda M, Kanno M, Sato H, Watanabe T, Tsuchiya A, Abe R, Takenoshita S. Tamoxifen-induced apoptosis in breast cancer cells relates to downregulation of bcl-2, but not bax and bcl-X(L), without alteration of p53 protein levels. Clin Cancer Res 1999; 5: 2971-7 Zhang H, Nimmer P, Rosenberg SH, Ng SC, Joseph M. Development of a high-throughput fluorescence polarization assay for Bcl-x(L). Anal Biochem 2002; 307: 70-5 Zong WX, Lindsten T, Ross AJ, MacGregor GR, Thompson CB. BH3-only proteins that bind pro-survival Bcl-2 family members fail to induce apoptosis in the absence of Bax and Bak. Genes Dev 2001; 15: 1481-6

10.

APOPTOSIS CONTROL BASED ON DOWN-REGULATING THE INHIBITOR-OF-APOPTOSIS (IAP) PROTEINS: XIAP ANTISENSE AND OTHER APPROACHES

E. LACASSE Aegera Oncology Inc., Suite 2216, University of Ottawa, 451 Smyth Rd., Ottawa, ON Canada, K1H 8M5 Fax 1-613-562-5604 E-mail: [email protected]

1.

Introduction

Antisense oligonucleotides (ASOs) and RNA interference (RNAi) offer specific means to validate genes involved in biological mechanisms, as well as allowing for the development of potential therapeutic agents based on synthetic nucleobase oligomers (Agrawal and Kandimalla, 2000; Jansen and Zangemeister-Wittke, 2002; McManus and Sharp, 2002; Shuey et al., 2002; Thompson, 2002; Shi, 2003). This Chapter focuses on the strategies used to design and select antisense or RNAi tools, targeting the inhibitor-of-apoptosis (IAP) genes to elucidate their cellular function in apoptosis control. 1.1

THE IAPs, INHIBITORS-OF-APOPTOSIS, AND APOPTOSIS CONTROL

The controlled and ‘normal’ physiological process by which cells die is referred to as apoptosis, or programmed cell death. Apoptosis is distinguished from necrosis, another physiological form of cell death which is considered abnormal, or ‘accidental’, and undesirable because of the secondary tissue damage associated with the inflammatory response provoked in such circumstances. Apoptosis occurs as a normal part of the development and maintenance of healthy tissues. The process occurs in a stochastic fashion and apoptotic cells are rapidly removed, such that it is often difficult to detect the process. Deregulated apoptosis occurs in pathophysiological circumstances such as cancer and neurological disorders (see below), and apoptosis is also the means by which chemotherapy and radiotherapy kills neoplastic cells. The induction of apoptotic pathways leads to the activation of a family of proteases, called caspases (Cysteinyl-active centre proteases or aspartases that cleave proteins at aspartyl residues within defined substrates). These proteases are the main effectors of apoptosis and are responsible for the generation of the majority of morphological and biochemical characteristics associated with apoptosis (Thornberry and Lazebnik, 1998; Earnshaw et al., 1999). The caspases have endogenous inhibitors, referred to as the IAPs, for inhibitors-of-apoptosis 239 M. Al-Rubeai and M. Fussenegger (eds.), Cell Engineering, Vol. 4, 239-280. © 2004 Kluwer Academic Publishers. Printed in the Netherlands.

240

E. LACASSE

(Deveraux et al., 1997; Roy et al., 1997; Stennicke et al., 2002). The IAPs are characterized by the presence of 1 to 3 BIR (Baculovirus IAP Repeat) domains in their N-terminus. BIR motifs are novel zinc-finger folded domains originally described in Baculoviruses as a means to suppress host cell apoptosis (LaCasse et al., 1998; Miller, 1999; Salvesen and Duckett, 2002). Gene knock-out studies have demonstrated the essential role the genes play in yeast, C. elegans and Drosophila (Fraser et al., 1999; Speliotes et al., 2000; Uren et al., 2000), while the increased redundancy and complexity of IAPs in higher organisms has required further understanding of the role each of these genes play in normal physiology and in disease. Table 1 lists the 8 known human IAPs, discovered over the past decade, originating with NAIP, neuronal apoptosis inhibitory protein (Roy et al., 1995). Table 1. List of human IAP genes and loci. Human Gene Alternative names in publications or IAPs symbol patents NAIP birc1 Birc1e/ NAIP5 (mouse), Birc1a/ NAIP1 (mouse) cIAP1 Birc2 HIAP2, MIHB cIAP2 Birc3 HIAP1, API2, MIHC, hITA XIAP Birc4 hILP, hILP1, MIHA (mouse), API3 survivin Birc5 TIAP (mouse), MIHD, API4 apollon Birc6 BRUCE (mouse) livin Birc7 KIAP, ML-IAP, cIAP3, HIAP3 hILP2 Birc8 Ts-IAP, TIAP

Chromosomal locus 5q13.1 11q22 11q22 Xq25 17q25 2 (unspecified) 20q13.3 19q11.3

The apoptosis pathway is now known to play a critical role in embryonic development, viral pathogenesis, cancer, autoimmune disorders, and neurodegenerative diseases, as well as many other events. The failure of an apoptotic response has been implicated in the development of cancer, autoimmune disorders, such as lupus erythematosis and multiple sclerosis, and in viral infections, including those associated with herpes virus, poxvirus, and adenovirus. The role of deregulated apoptosis in cancer has only recently been appreciated to be one of the major hallmarks of cancer (Hanahan and Weinberg, 2000; Igney and Krammer, 2002; Zhivotovsky and Orrenius, 2003), and apoptosis represents a potential therapeutic target for cancer (Evan and Littlewood, 1998; Reed, 2002; Reed, 2003). The identification of growth promoting oncogenes in the late 1970’s gave rise to an almost universal focus on cellular proliferation that dominated research in cancer biology for many years. Long-standing dogma held that anticancer therapies preferentially targeted rapidly dividing cancer cells relative to “normal” cells. This explanation was not entirely satisfactory, since some slow growing tumors are easily treated, while many rapidly dividing tumor types are extremely resistant to anti-cancer therapies. Progress in the cancer field has now led to a new paradigm in cancer biology wherein neoplasia is viewed as a failure to

XIAP ANTISENSE THERAPY FOR CANCER

241

execute normal pathways of programmed cell death. Normal cells receive continuous feedback from their neighbors through various growth factors, and commit “suicide” if removed from this context. Cancer cells somehow ignore these commands and continue inappropriate proliferation. Cancer therapies, including radiation and many chemotherapies, have traditionally been viewed as causing overwhelming cellular injury. New evidence suggests that cancer therapies actually work by triggering apoptosis. Both normal cell types and cancer cell types display a wide range of susceptibility to apoptotic triggers, although the determinants of this resistance are only now under investigation. Many normal cell types undergo temporary growth arrest in response to a sub-lethal dose of radiation or cytotoxic chemicals, while cancer cells in the vicinity undergo apoptosis. This provides the crucial treatment window of appropriate toxicity that allows for successful anti-cancer therapy. It is therefore not surprising that resistance of tumor cells to apoptosis is emerging as a major cause of cancer treatment failure. Compared to the numerous growth-promoting oncogenes identified to date (>100), relatively few cancer associated genes have been isolated that regulate apoptosis. The Bcl-2 gene was first identified as an oncogene associated with the development of follicular lymphomas (Tsujimoto and Croce, 1986). In contrast to all other oncogenes identified to date, Bcl-2 displays no ability to promote cell proliferation, and instead has been demonstrated to suppress apoptosis by a variety of triggers (Vaux et al., 1988). Elevated Bcl-2 expression is associated with a poor prognosis in neuroblastoma, prostate and colon cancers, and can result in a multidrug resistant phenotype in vitro. Although the study of Bcl-2 has helped revolutionize cancer paradigms, the majority of human malignancies do not demonstrate aberrant Bcl-2 expression. In contrast to the findings with Bcl-2, mutation of the p53 tumor suppresser gene has been estimated to occur in up to 50% of human cancers and is the most frequent genetic change associated with cancer to date. The p53 protein plays a crucial role in surveying the genome for DNA damage. The cell type and degree of damage determines whether the cell will undergo growth arrest and repair, or initiate apoptosis. Mutations in p53 interfere with this activity, rendering the cell resistant to apoptosis by a wide range of cellular insults. Some progress has been made in understanding the molecular biology of p53, but many questions remain. p53 is known to function as a transcription factor, with the ability to positively or negatively regulate the expression of a variety of genes involved in cell cycle control, DNA repair, and most importantly, apoptosis control. Lastly, the role of the IAPs in cancer is beginning to emerge (LaCasse et al., 1998; Altieri, 2003). Many investigations have found increased IAP levels in cancer, association of increased IAP expression with poor prognosis, and identified gene amplifications involving cIAP1 and cIAP2 (Imoto et al., 2001; Imoto et al., 2002; Dai et al., 2003), as well as a causal translocation involving cIAP2 in marginal zone

242

E. LACASSE

lymphomas of the MALT (mucosa-associated lymphoid tissue) (Dierlamm et al., 1999; Liu et al., 2001). XIAP, the X-linked IAP (Liston et al., 1996), and the most potent of the IAPs, is also implicated in cancer by several lines of evidence (Tamm et al., 2000; Holcik and Korneluk, 2001; Liston et al., 2001). However, the validity of inhibition of XIAP, and other IAPs, as drug targets in cancer remains to be proven. Antisense and RNAi approaches offer a means to address some of these important questions. 1.2

ANTISENSE AND RNAi NUCLEOBASE OLIGOMER APPROACHES TO GENE DOWN-REGULATION

Antisense oligonucleotides (ASOs) are synthetic nucleobase oligomers that specifically hybridize with a target mRNA transcripts and results in degradation of the transcript by RNAseH recognition of the heteroduplex and degradation of the mRNA. While RNAseH is the principal mechanism of action by which antisense works, inhibition of protein translation and altered intron splicing have also been reported (Agrawal and Kandimalla, 2000). An antisense nucleobase oligomer is a compound that includes a chain of several nucleobases, typically 18-24, joined together by linkage groups. These include natural and non-natural oligonucleotides, both modified and unmodified, in addition to modified backbone linkages such as phosphorothioate (PS) and phosphorodiamidate morpholino (PMO), and as well as oligonucleotide mimetics such as protein nucleic acids (PNA), locked nucleic acids (LNA), and arabinonucleic acids (ANA). The development of PS ASOs allowed for the application of antisense to the clinic by providing the necessary stability against endogenous nucleases. These are often referred to as 1st generation ASOs. Nonetheless, the highly polyanionic nature of PS ODNs has limited their use clinically. One such compound is on the market for a limited ocular use, while a PS ODN targeting bcl-2, Genasense/ G3139, is nearing completion of several phase 3 trials (Pirollo et al., 2003). Newer, 2nd generation ASOs, primarily involving alkoxy substitutions at the 2’ position of an RNA base such as 2’O-methyl (Ome) or 2’O-methoxyethyl (MOE), combined with PS DNA residues in what are termed mixed-backbone oligonucleotides (MBO) or chimeric ASOs, have resulted in improved safety and pharmacokinetic profiles in animal models and humans (Zhou and Agrawal, 1998). The ‘mixture’ of modified RNA and DNA bases is necessitated by the fact that the modified RNA bases do not activate RNAseH once hybridized, while PS DNA does. Thus hybrid molecules with the modified RNA bases flanking a core of PS DNA residues are created to derive all the benefits needed for an effective ASO. These hybrids are referred to as wingmers, or as 2x2 or 4x4 MBOs, with 2 or 4 flanking 2’O-methylRNA bases either side, respectively. Several of these 2nd generation MBO compounds are presently in either phase 1 or 2 trials. The use of minimally-modified ASOs


243

involving 2x2 MBOs as research tools will be described in more detail in the next section on oligonucleotide screening strategies. RNAi oligomers are typically RNA duplexes (doubled-stranded RNA or dsRNA) of synthetic complementary monomers of 21-23 nucleotides (nts), with 2 nucleotide 3’overhangs each. Alternatively, RNAi oligomers are also generated as short hairpin molecules of approximately 50-75 nts with a duplexed region of 21-29 base pairs as part of a stem-loop structure with optional 3’ UU-overhangs produced by RNA polymerase III (see Table 2 and Figures 10 and 11). These molecules are called small interfering RNAs (siRNAs), or short-hairpin RNAs (shRNAs) respectively, and have recently been shown to mediate sequence-specific inhibition of gene expression in mammalian cells via a post-transcriptional gene silencing mechanism termed RNA interference (RNAi) and together are often simply referred to as RNAi (reviewed in Paddison and Hannon, 2002; Dykxhoorn et al., 2003; Shi, 2003). For expression of shRNAs within cells, plasmid or viral vectors contain either the polymerase III H1 or U6 promoter, a cloning site for the stem-looped RNA coding insert, and a 4-5-thymidine transcription termination signal. The Polymerase III promoters generally have well-defined initiation and stop sites and their transcripts lack poly(A) tails. The termination signal for these promoters is defined by the poly-thymidine tract, and the transcript is typically cleaved after the second uridine. Cleavage at this position generates a 3' UU overhang in the expressed shRNA, which is similar to the 3' overhangs of synthetic siRNAs. Table 2 provides examples of structures for some of the ASO and RNAi compounds described above. Table 2. Nucleobase structures of ASO and RNAi compounds described herein. Type of ASO Typical Composition/ structure (using 5’ to 3’ convention) or RNAi Size (nts)

Minimallymodified ASO PS ODN (1st generation ASO) MBO (2nd generation ASO) RNAi duplex (siRNA) RNAi hairpin (shRNA)

18-21

XsXsNoNoNoNoNoNoNoNoNoNoNoNoNoNoXsXs

16-25

NsNsNsNsNsNsNsNsNsNsNsNsNsNsNsNsNsNs

16-25

XsXsXsXsNsNsNsNsNsNsNsNsNsNsXsXsXsXs

21-23

XXXXXXXXXXXXXXXXXXXXXdTdT dTdTXXXXXXXXXXXXXXXXXXXXX 5’-XXXXXXXXXXXXXXXXXXXXXXXXXXX-X] 3’-UUUUXXXXXXXXXXXXXXXXXXXXXXXXXXX-X

21-29

Legend: No, a phosphodiester DNA base consisting of A, G, C, or T; Ns, a phosphorothioate DNA base consisting of A, G, C, or T (IUPAC codes: F, E, O or Z, respectively); Xs, a 2’0-methyl RNA nucleoside with a phosphorothioate linkage consisting of A, G, C or U; X, a natural or synthetic RNA nucleoside consisting of A, G, C or U dT, deoxythymidine-tail base addition (overhang) U, uracil-tail base incorporation (overhang)

244

E. LACASSE

2.

Development of antisense oligonucleotides (ASOs) targeting XIAP

2.1

OVERALL STRATEGY AND APPROACH TO ANTISENSE SEQUENCE SELECTION AND IDENTIFICATION

Multiple approaches exist for selecting ASOs with predicted efficacy (Smith et al., 2000; Sohail and Southern, 2000; Far et al., 2001; Zhang et al., 2003), however the empirical testing of such sequences is the only true means of identifying effective compounds and verifying the predictions or not. Effective ASOs target open areas on the target transcript that are accessible for heteroduplex formation, however the predictability of open structures based on mRNA sequence alone is poor. Our overall strategy, depicted in Figure 1, was to construct a large library of non-overlapping synthetic ASOs that gave good coverage (approximately 60% in our case) of the gene in question, according to its largest sequenced cDNA which included partial 5’ and 3’UTR sequences. In addition, we had knowledge of the intron-exon structure. We also had at our disposal sensitive means, such as Taqman quantitative RT-PCR and ELISA assays, to accurately measure our target knockdown. Therefore, the process of ASO selection is relatively straightforward once conditions had been optimized for ASO transfections and target measurements. Many other ASO selection strategies exist, that are not mutually exclusive to the one proposed here, and the reader is referred to those reviews and reports (Smith et al., 2000; Sohail and Southern, 2000; Far et al., 2001; Zhang et al., 2003). Additional guidance for ASO selection criteria are provided in the following excellent reviews (Agrawal, 1999; Agrawal and Kandimalla, 2000; Stein, 2001), as well as issues related to the specific selection of ASOs to apoptosis suppressor genes (Ziegler et al., 2000).


245

“Gene walk” strategy for selection of potent XIAP antisense sequences Step 1: Synthesis of library (e.g. 40-80 sequences) of chimeric 2x2 MBO 19- mers

Step 2: Screen under high transfection efficiency conditions for XIAP knock-down by Taqman, or ELISA Step 3: Identify ASOs demonstrating XIAP RNA or protein knockdown, as well as ‘hotspots’ on mRNA Step 4 (optional): Re-screen by Taqman, or ELISA, under optimized conditions (time, dose) Step 5: Identify ASOs which consistently knock-down RNA or protein by >50% Step 6: ‘best’ candidates selected and built in PS or 4x4 MBO chemistry for in vitro and in vivo validation and further selection and optimization

Figure 1. "Gen Walk" Strategy for Slection of Potent XIAP antisense sequences

2.2

DESIGN OF ANTISENSE OLIGONUCLEOTIDES

We designed of library of 19-mer ASOs based on their complementary XIAP sequences, figuring in the positive and negative criteria for sequence selection listed in Table 3 for empirical testing and ranking. The selection of specific sequences can also be verified by the use of computer programs designed to select PCR primers, as the rules for ASO specificity are similar, and parameters can be defined within the applications to bias towards ASO selection. (Multiple commercial computer applications exist, for example the computer program OLIGO, previously distributed by National Biosciences Inc.) Additional information on ASO selection criteria can be found in the following reviews (Agrawal and Kandimalla, 2000; Stein, 2001). Additional nucleobase oligomers that only partially fulfilled some of the selection criteria in Table 3 were also chosen as possible candidates if they recognized a predicted open region of the target mRNA. Accessible regions of a target mRNA can be predicted with the help of the RNA secondary structure folding program MFOLD (Zuker et al., 1999; Zuker, 2003). Sub-optimal folds with a free energy value within 5% of the predicted most stable fold of the mRNA are predicted using a window of 200 bases within which a residue can find a complementary base to form base-pair bonds. Open regions that do not form an intramolecular bond were summed together with each sub-optimal fold and areas that consistently were predicted as open were considered more accessible to the binding to nucleobase

246

E. LACASSE

oligomers. Thus relaxing of the selection rules with the added bias for “openness” allowed for several additional sequences to be entered in the library for empirical testing. Table 3. Selection criteria for ASO sequences Inclusion criteria Exclusion criteria

Stretch of 18-20 nts No more than 75% GC content, and no more than 75% AT content

Sequences 30 nts Highly GC-rich, or highly AT-rich sequences GGGG stretch

Self-complementary and palindromic sequences Sequences around translation start and stop sites Sequences spanning exon-intron boundaries Sequences in predicted open, accessable, region of RNA structure CpG

Common sequence to other targets Motifs reported to produce artifacts, such as transcription factor decoy sequences 5’UTR and 3’UTR, as well as coding sequences

Comments Sufficient length for specific hybridization

Possibility of hyperstructure formation. Nonantisense toxic effects reported Ability to form dimers, or hairpin structures, reduces effectiveness Translation start site is a highly favored region of selection Greater chance of success predicted (not proven based solely on predictions) Immuno-stimulatory effects. If this motif is unavoidable and antisense effects are desired, as opposed to immunostimulation, then replace dC and dG bases in motif with 2’O-methyl-C and –G residues respectively. In other words, position CG dinucleotide motifs in flanking region of MBO or wingmer. Specificity is the prime goal

UTRs offer valid targets

XIAP ANTISENSE THERAPY FOR CANCER 2.3

247

INITIAL OPTIMIZATION OF EXPERIMENTAL CONDITIONS

The delivery of highly charged ASOs to the cytoplasm of cells ranges from poor to extremely poor, dependent in part on sequence, hence the degree of cell loading required for ASO selection and future experimentation requires the use of transfection agents. Therefore, as a prelude to embarking on an ASO selection process involving transfection of cells in tissue culture, we first sought to establish transfection conditions in cell lines with predicted high transfection efficiencies (and with measurable target levels), using fluorescently-tagged oligomers. While many methods of cell transfection exist (eg calcium phosphate, DEAE-dextran, electroporation), the development of highly efficient liposomal transfection agents with reduced cytotoxicity lends themselves to ASO screening (eg Lipofectin, LipofectAMINE PLUS, LipofectAMINE 2000). This is especially true when the goal of the final ASO molecule, such as those against XIAP, is to induce apoptosis. The antisense effects must clearly be distinguished from any non-specific cytotoxicity the transfection agents might bring. This is truly a concern. Figure 2 demonstrates some optimization results obtained with a liposomal transfection agent, Lipofectamine 2000, used at two different doses and with two different concentrations of ASO. Clearly, the photomicrographs show that conditions can be discerned which give strong fluorescent-staining for the majority of cells, and in this way multiple conditions and transfection agents can be compared to find the optimal agent and conditions for the cell line in question. More details on this approach can be found in the article by Stein and colleagues (Benimetskaya et al., 2000). In addition to optimizing the transfection conditions, the use of a gold standard, such as a published ASO sequence against of gene of interest measured under similar conditions to the ones proposed in the screening strategy, will allow for optimization of experimental conditions and the identification of some of the technical difficulties associated with the methodology. The knowledge gained from such an exercise can then be applied to the screening process for ASOs against the new target, which is in fact an unknown as to how easily or not ASOs can be identified. Certain unknowns surrounding the chosen target might be the stability of its message or its protein, and how these parameters might influence the ASO selection process.

248

E. LACASSE

A

C

B

D

Figure 2. Optimization of ASO transfection conditions. H460 human non-small-cell lung carcinoma cells were transfected using a 5’ fluorescein labeled 2 x 2 test MBO and LipofectAMINE 2000. A microscopic evaluation of transformation efficiencies was carried out 24 hours later. For optimization purposes either constant amounts (1 ul) of LipofectAMINE 2000 were combined with increasing amounts of 2 x 2 MBO (200 nM – Fig. 2 A, 1.2 uM – Fig. 2 B) or constant amounts (1 uM) of 2 x 2 MBO were combined with increasing amounts of LipofectAMINE 2000 (0.6 ul – Fig. 2 C, 1.0 ul – Fig. 2 D).

2.4

SCREENING STRATEGIES USING MINIMALLY-MODIFIED OLIGONUCLEOTIDES FOR ANTISENSE SELECTION

We devised a screening strategy that involved using minimally-modified ASOs that consisted of only 2 flanking 2’O-methyl RNA residues, instead of the 3 or 4 preferred for greater stability in subsequent in vivo studies. In addition, only the modified RNA bases possessed phosphorothioate linkages, while the core consisted of unmodified phosphodiester DNA residues to minimize the presence of toxic byproducts of the sulfurization step that could affect our screening results. As we had over one hundred sequences to synthesize and test, we chose the simplest, and cheapest, of purification methods, ie Sephadex-G25 desalting, as opposed to the more traditional HPLC purification. The RP-HPLC or IE-HPLC purification methods would have added substantially to the cost of the assay, not only for the


249

purification step but also in the lowering of the final yield of ASO which would require larger scale syntheses to compensate for loss. These minimally-modified ASOs were called 2x2 PS/PO, and the expected major contaminants would be incomplete synthesis yielding N -1 and N -2 products, which we judged to be inconsequential in our screening approach. The concept of using minimallymodified ASOs is not a new one (for example, Peyman et al., 1996; Uhlmann et al., 2000; Samani et al., 2001; Brigui et al., 2003;). However, we have validated the approach here (see results below) to indicate that these 2x2 MBOs are feasible and useful screening tools, and that the associated costs are reasonable for screening purposes. Once an effective ASO sequence had been identified then we would need to re-synthesize the sequence in more stable 4x4 chemistries and re-validate the effectiveness of the hit compound. Invariably, minor modulation of structural features was required for re-optimization, but the minimal approach for screening had identified hot zones for inhibition and focused our efforts. We designed and screened approximately 100 ASOs using this approach against XIAP, to increase our chances of success. These non-overlapping sequences produced an approximate 60% coverage of the 3 kb cDNA sequence. However, screening approaches using only 40 ASOs would most likely suffice in most cases, and possibly 80 ASOs for larger targets. The 2x2 PS/PO ASOs were synthesized by IDT (Integrated DNA Technologies, USA) at a scale of 250 nM, and yielded a minimum of 12 ODs (approximately 1 mg) of nucleobase oligomer, which provided ample material for screening transfections, and larger scale re-validation assays. Other manufacturers of 2’O-methyl RNA containing MBOs now exist. We initially screened the library of ASOs against T24 bladder carcinoma cells because of their high transfection efficiency. Subsequently, we re-screened portions of the library against NCI-H460 lung carcinoma cells once we had optimized conditions. We used TaqMan quantitative RT-PCR (described below) to assay for changes in mRNA levels after oligonucleotide tranfections of cells in 96-well format. Alternatively, we employed ELISA for determining XIAP protein levels during the screening procedure, and Western blotting for validation. Transfection conditions were optimized with LipofectAMINE PLUS or LipofectAMINE 2000 (Invitrogen) on T24 bladder carcinoma cells or H460 non-small cell lung carcinoma cells, using a fluorescein-tagged sense oligonucleotide (5’mGmAGAAGATGACTGGTAAmCmA-3’) from XIAP spanning the start codon as a control. The results were visualized and gauged by epi-fluorescence microscopy. In the case of T24 cells, transfections were further optimized based on the ability of a published oligonucleotide to downregulate survivin expression (Li et al., 1999) (5’-U/TGTGCTATTCTGTGAA U/TU/T-3’). We optimized the transfection conditions based on the TaqMan results of survivin RNA knock-down detected with PCR primers and fluorescent probe, described below. Optimal conditions for oligonucleotide uptake by the cells were found to be 940 nM oligonucleotide and 4 µL PLUS reagent and 0.8 µL Lipofectamine in a total of 70 µL for three hours. We

250

E. LACASSE

then applied these conditions to screen for XIAP mRNA or protein knock-down using the oligo library against T24 cells. RNA was extracted from cells lysed in RLT buffer and purified using QIAGEN RNeasy columns/kits. Real-time quantitative PCR was performed on a Perkin-Elmer ABI 7700 Prism PCR machine. RNA was reverse transcribed and amplified according to the TaqMan Universal PCR Master Mix protocol of PE Biosystems, using primers and probes designed to specifically recognize XIAP, survivin, or GAPDH. For human survivin, the forward primer was 5’-TCTGCT TCAAGGAGCTGGAA-3’, the reverse primer was 5’-GAAAGGAA AGCGCAACCG-3’, and the probe was 5’-(FAM)AGCCAGATGAC GACCCCATAGAGGAACATA(TAMRA)-3’. For human XIAP, the forward primer was 5’-GGTGA TAAAGTAAAGTGCTTTCACTGT-3’, the reverse primer was 5’-TCAGTAGTTCTTACCAGACACTCCTCAA-3’, and the probe was 5’(FAM)CAACATGCTAAATGGTATCCAGGGTGCAAATATC(TAMRA)-3’. For human GAPDH, the forward primer was 5’-GAAGGTGAAGG TCGGAGTC-3’, the reverse primer was 5’-GAAGATGGTGATGG GATTC-3’, and the probe was 5’-(JOE)CAAGCTTCCCGTTCTCA GCC(TAMRA)-3’. FAM and JOE are 5’ reporter dyes, while TAMRA is a 3’ quencher dye. Relative quantification of gene expression was performed as described in the PE Biosystems manual using GAPDH as an internal standard. The comparative Ct (cycle threshold) method was used for relative quantitation of IAP mRNA levels compared to GAPDH mRNA levels. Briefly, real-time fluorescence measurements were taken at each PCR cycle and the threshold cycle (Ct) value for each sample was calculated by determining the point at which fluorescence exceeded a threshold limit of 30 times the baseline standard deviation. The average baseline value and the baseline SD are calculated starting from the third cycle baseline value and stopping at the baseline value three cycles before the signal starts to exponentially rise. The PCR primers and/or probes for the specific IAPs were designed to span at least one exon-intron boundary separated by 1 kb or more of genomic DNA, to reduce the possibility of amplifying and detecting genomic DNA contamination. The specificity of the signal, and possible contamination from DNA, were verified by treating some RNA samples with either DNase or RNase, prior to performing the reverse transcription and PCR reaction steps. Figure 3 is a representative example of library screening results obtained by Taqman RT-PCR, under optimal conditions in H460 cells. Included in this figure are results for mock transfected cells, as well as two control 2x2 PS/PO nucleobase oligomers (G4 sm, and DE4 rev). The figure illustrates that some ASOs have no ability to knock-down XIAP mRNA (eg C8 as) while several do, and some show remarkable activity and cluster in to ‘hotspots’ or islands of activity presumably due to a relaxed, and accessible, RNA structure in that region (eg adjacent sequences D12-G12).

251

1.2

1

0.8

0.6

0.4

hotspot

0.2

H12 as

F12 as

G12 as

E12 as

D12 as

A12 as

F11 as

G11 as

E11 as

B11 as

C11 as

A11 as

F10 as

D10 as

G10 as

C10 as

F9 as

E9 as

A10 as

D9 as

B9 as

A9 as

F8 as

H8 as

G8 as

D8 as

C8 as

F7 as

H7 as

D7 as

G7 as

H6 as

C7 as

G4 sm

DE4 rev

Mock Co.

0 Untransf. Co.

Fold increase XIAP versus endogenous RNA


2 x 2 MBO (1 uM)

1.75

1.5

12 hours

6 hours

20 hours

1.25

1

0.75

0.5

0.25

C5 as

G4 as

F4 as

E4 as

F3 as

Mock co.

C5 as

G4 as

F4 as

E4 as

F3 as

Mock co.

C5 as

G4 as

F4 as

E4 as

F3 as

0

Mock co.


Figure 3. Screening results for a subset of XIAP MBO library consisting of minimallymodified ASOs. H460 human non-small-cell lung carcinoma cells were transfected with 1 uM of 2 x 2 MBOs and LipofectAMINE 2000 (1.0 ul / well). Nine hours after the start of transfection cells were harvested for Taqman analysis. RNA values were normalized to GAPDH and expressed as fold increases of XIAP mRNA relative to total endogenous mRNA.

2 x 2 MBO (940 nM)

Figure 4. Time dependent knock-down of XIAP mRNA by minimally-modified ASOs. T24 human bladder carcinoma cells were transfected with the indicated doses of 2x2 MBOs and LipofectAMINE PLUS for three hours. Then, six, twelve and twenty hours after the start of transfection samples were harvested for analysis by Taqman (RNA). RNA values were normalized to GAPDH and expressed as fold increases of XIAP mRNA relative to total endogenous mRNA.

252

E. LACASSE

A

1.4 1.2 1 0.8 0.6 0.4 0.2

E4 as

2 x 2 MBO

G4 as + C5 as

200 nM

400 nM

600 nM

800 nM

1 uM

C5 scr, 1 uM

200 nM

400 nM

600 nM

800 nM

1 uM

E4 scr, 1 uM

Mock co.

0

untransf. co.


Figure 4 demonstrates the time-dependent knock-down of XIAP mRNA by 2x2 MBO ASOs identified in the primary screen. Time course experiments determined mRNA to be optimally decreased at fairly early time points of 6-9 hours and to return to basal levels by 20-24 hours. This is thought to be reflective of the inherent instability of these minimally-modified ASOs which are applied only once in a bolus transfection. Figure 5 demonstrates the dose-dependent down-regulation of XIAP mRNA, protein and cell viability induced by 2x2 ASO hit compounds. Doses of 800-1000 nM of 2x2 ASOs were required to decrease XIAP mRNA and protein by 50%, while cellular viability was also significantly reduced at those concentrations. Of note, is the high degree of correlation between ASO dose and loss of XIAP mRNA, protein, and loss of cell viability. We believe that the loss of cell viability not only results from XIAP antisense but is also due to the transfection conditions that were utilized to optimize the ASO delivery. However, this effect is antisense specific as two scrambled control 2x2 MBOs (E4 scr, C5 scr) did not negatively affect cell survival compared to a mock transfection (ie transfection with no MBO or DNA). A combination of 2 different ASOs (G4 as + C5 as), targeting different regions of the XIAP message, was found to be an effective combination when each ASO were combined at half-dose compared to either agent used alone at full-dose (data not shown).


253

120

XIAP protein (ng/mg)

100

80

60

40

20

E4 as

200 nM

400 nM

600 nM

800 nM

1 uM

C5 scr, 1 uM

200 nM

400 nM

600 nM

800 nM

1 uM

E4 scr, 1 uM

Mock co.

untransf. co.

0

G4 as + C5 as

2 x 2 MBO

B

3.5

O.D. 450 (Viability)

3 2.5 2 1.5 1 0.5

C

200 nM

400 nM

600 nM

800 nM

1 uM

C5 scr, 1 uM

200 nM

400 nM

600 nM

800 nM

1 uM

E4 scr, 1 uM

Mock co.

untransf. co.

0

G4 as + C5 as

E4 as

2 x 2 MBO

Figure 5 A, B, C. Dose dependent down-regulation of XIAP mRNA, protein, and cell viability by minimally-modified ASOs. T24 human bladder carcinoma cells were transfected with the indicated doses of 2x2 MBOs and LipofectAMINE PLUS for three hours. Eight hours later samples were harvested for analysis by Taqman (RNA, Figure 2 A) and ELISA (protein, Figure 2 B). RNA values were normalized to GAPDH and expressed as fold increases of XIAP mRNA relative to total endogenous mRNA. XIAP protein levels were expressed relative to total cell protein (ng/mg). A third set of samples was analyzed for viability 24 hours post-transfection using a WST-1 assay (Figure 2 C).

254

E. LACASSE

Our strategy of identifying ASO hits from a primary screen in T24 bladdder carcinoma cells, and then optimizing time post-transfection for target measurements, as well as determining optimal dose of ASO for the target in question, allowed us to re-screen the library on other cell lines under optimal conditions to confirm old hits and to identify new ones. This strategy worked effectively and permitted us to identify several new and potent target sequences, which were then moved on to the next step (see below). 2.5

OPTIMIZATION AND VALIDATION OF SEQUENCE SELECTION

The best candidate ASO sequences, identified in the various screens, were synthesized either as fully-phosphorothioated PS ODNs (1st generation ASO) and finally as fully-phosphorothioated 4x4 MBOs (2nd generation ASO) as potential clinical candidates, for re-validation of the optimal sequences in these new chemistries. The PS ODNs were used primarily for in vivo testing in proof-ofprinciple studies involving tumor xenografts in mice, due to the large amounts of materials required for these studies. 4x4 MBOs antisense sequences were further optimized to attain highly potent sequences which were remarkable for their efficacies, even at low (2-8) nanomolar concentrations in some cases. Typically, the IC50 for various assays was around 30-60 nM when a liposomal transfection agent was used for delivery. Figure 6 is an example of the increased potency, and increased duration of effect, seen when a candidate ASO sequence in 4x4 MBO fully-phosphorothioated chemistry is derived from a 2x2 PS/PO chemistry. The 4x4 MBO (FG8 as) is now able to produce a 50% reduction in XIAP mRNA at an ASO concentration of 31 nM which is well within range of our expected target of 50-150 nM IC50 values we sought for optimal activity. The antisense effect is still seen here at 18 hours postbolus transfection, compared to being lost by 20 hours with the 2x2 PS/PO ASOs. No knock-down of XIAP mRNA was seen with a control 4x4 MBO (FG8 rm). Other benefits derived from the use of 4x4 MBOs, include not only the increased duration of effect, due to increased stability, but also the ability for repeated transfections of the same cells when using low doses of MBO and improved transfection agents. Figures 7A and 7B are examples of such repeated transfections which allowed for effective knock-down of XIAP protein by allowing for protein turnover to take place over a period of 3 days while blocking de novo protein synthesis with the ASO. Cells were repeatedly transfected at daily intervals, and harvested after 1, 2 or 3 daily transfections for analysis. Figure 7A demonstrates that the antisense 4x4 MBO (FG8 as) can depress XIAP mRNA to low levels, and maintain those values over several days compared to a control MBO (FG8 rm).

255

1.2

1

0.8

0.6

0.4

0.2

8 nM

16 nM

31 nM

63 nM

125 nM

250 nM

500 nM

8 nM

16 nM

31 nM

63 nM

125 nM

250 nM

500 nM

Mock co.

0

Untransf. Co.



FG8 as

FG8 rm 4 x 4 MBO

Figure 6. Increased potency of 4x4 MBO antisense. Panc-1 human pancreatic epithelioid duct carcinoma cells were transfected with the indicated concentrations of 4 x 4 MBOs and LipofectAMINE 2000 for five hours. 18 hours post-transfection the cells were harvested for Taqman analysis. RNA values were normalized to GAPDH and expressed as fold increases of XIAP mRNA relative to total endogenous mRNA.

Figure 7B demonstrates the continued reduction in XIAP protein levels from days 1 through 3 obtained with repeated low dose transfections with antisense MBO versus control MBO. Results in Figure 7B are shown for two different ASO candidates (FG8 and E12) with their respective controls. These experiments were carried out under transfection conditions that did not increase cell death, and likely explain our ability to see an antisense-specific knock-down of protein target versus a control MBO. Higher concentrations of MBOs or PS ODNs produce some nonspecific killing in the transfection assays which results in the non-specific loss of XIAP protein (data not shown), most likely due to proteosomal mediated degradation of XIAP in a dying cell which is commonly seen. Distinction between antisense-specific and non-specific effects is always the key goal in these experiments in terms of properly validating the target. One other possible solution, employed by Kasof and Gomes in their analysis of livin (Kasof and Gomes, 1999), to address specific protein knock-down when using ASOs against an IAP is to include a chemical caspase inhibitor, such as zVAD-fmk, to maintain cell viability and eliminate or retard non-specific protein degradation.

E. LACASSE 2 1.8 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2

24 hours

FG8 as

FG8 rm

Mock co.

FG8 as

FG8 rm

Mock co.

Mock co.

FG8 rm

FG8 as

0

Untransf. Co.


256

72 hours

48 hours 4 x 4 MBO

rm

rm

as

72 hrs

as

48 hrs

as

24 hrs

rm

UTC

Mock

rm

72 hrs

as

rm

48 hrs

as

as

24 hrs

rm

UTC

Mock

Figure 7 A. Increased potency of 4x4 MBO antisense and reduced non-specific toxicity. Timecourse of XIAP mRNA levels in H460 human non-small-cell lung carcinoma cells after single (24 hours), double (48 hours) and triple (72 hours) transfection with 45 nM 4 x 4 MBOs and LipofectAMINE 2000. Cells were harvested for Taqman analysis at the timepoints indicated. RNA values were normalized to GAPDH and expressed as fold increases of XIAP mRNA relative to total endogenous mRNA.

XIAP 55 KDa GAPDH 36 KDa

4 x 4 FG8 (31 nM)

4 x 4 E12 (31 nM)

Normalized Xiap Protein level (%)

120

100

80

60

43%

62%

40

67%

63%

63% 20

87% 0

UTC Mock rm

as

rm

as

rm

as

4 x 4 FG8 (31 nM) 24 hrs

48 hrs

72 hrs

UTC Mock rm

as

rm

as

rm

as

4 x 4 E12 (31 nM) 24 hrs

48 hrs

72 hrs

Figure 7 B. Increased potency of 4x4 MBO antisense and reduced non-specific toxicity. A time course study of single (24 hours), double (48 hours) and triple (72 hours) transfections with two 4 x 4 MBOs (FG8 and E12) at 31 nM in H460 human non-small-cell lung carcinoma cells. Results are compared to untransfected (UTC) and mock control and normalized for GAPDH loading. Percentage knock-down is indicated against the corresponding control MBO (rm) for the time point indicated.


257

IN VITRO ANALYSIS OF GENE FUNCTION AND APOPTOSIS, AND THE USE OF CONTROLS

Once potent ASOs have been identified through the primary screens, then further testing and validation is possible. These experiments will also allow for some phenotypic analysis resulting from target knock-down. In our case, as we are blocking the production of an IAP, we expect to see apoptosis induction as a result of ASO transfections. However, apoptosis induction may result from many nonspecific phenomena and may not be caused directly by our antisense. Hence, the use of multiple control MBOs becomes very important in ascertaining antisense specific effects, as many artifacts have been noted in the past. The use of a sense oligomer is no longer considered a valid control, as it has a different base composition than the test article. Typical proper controls include a scrambled or non-sense version, reverse polarity and mismatch controls. More than one control is preferred for proper validation of an ASO. Care must be taken when constructing controls that CpG motifs are not introduced if they do not exist in the ASO, as well as any other motif or dimer interface that could affect the validity of the control. Controls should not target the gene in question or any other known genes for that matter. Figure 8 is an example of T24 bladder carcinomas transfected with 1 uM of XIAP 2x2 MBOs. Twenty-four hours post-transfection , the cells were examined for morphological signs of cell death. Only the cells transfected with antisense E4 oligonucleotide showed signs of toxicity, while three separate controls did not (E4 scrambled, reverse polarity or mismatch) compared to mock transfection without an MBO. The determination of cell viability post XIAP antisense treatment is not a trivial matter due to combined non-specific toxicities of the transfection and nucleobase oligomer. Therefore, other more robust assays are sought to identify, or confirm, target-mediated effects on cell viability. Figure 9 is an example of a clonogenic assay performed on cells transfected either with a 2x2 MBO antisense (G4 as) or control (G4 rev), and the resultant reduction of number of colonies and colony-size with XIAP antisense treatment. Other assays are possible, as demonstrated by N. Normanno and colleagues (De Luca et al., 1997; Casamassimi et al., 2000), in which cells are plated and fed high concentrations of MBO in the absence of liposomal carriers to ascertain effects on cell viability with or without the initial use of transfection agents. In this case, we are also relying on passive uptake (through pinocytosis or endocytosis) of the MBOs for cellular entry. This is a very inefficient process and requires high concentrations of MBOs (10-100 uM) for extended times. Variations on this assay are possible, such as the use of brief hyperosmotic exposures for pinocytic loading.

258

E. LACASSE

Untransfected control

E4 scr, 1 uM

Mock control

E4 as, 1 uM

E4 mm, 1 uM

E4 rev, 1 uM

Figure 8. XIAP antisense-mediated loss of cell viability. T24 human bladder cancer cells were transfected with 1 uM E4 sequence ODN as 2x2 MBO and LipofectAMINE PLUS for three hours. Cell morphology was examined 24 hours post-transfection. Specific scrambled (scr), mismatch (mm) and reverse (rev) 2x2 MBOs served as internal controls and demonstrated no apparent toxicity.

Figure 9. Reduced clonogenicity of XIAP antisense transfected cells. H460 human nonsmall-cell lung carcinoma cells were transfected using 2x2 MBOs (1 uM) and LipofectAMINE 2000 for 9 hours. Cells were then trypsinized and 25 cm2 cell culture flasks were inoculated with equal amounts of ~ 750 cells per flask. On day 12 post-transfection the cells were fixed with methanol, stained with 1 % Crystal violet and colonies of 50 cells or more were counted.


259

IN VIVO ANALYSIS OF ANTISENSE EFFECTS ON TUMOR XENOGRAFTS

As our primary goal in validating XIAP with ASOs is to determine the effectivess of blocking XIAP expression on tumor growth and viability, we tested several candidate ASOs in murine xenograft models of human cancer. This has been recently published (Hu et al., 2003), and I will only address the concepts here. Xenograft models in immunodeficient mice (e.g. nude or scid) permit a more realistic venue for testing antisense effects on tumor growth, as the ASOs are applied under conditions similar to clinical use in humans. That is, they are delivered without the use of carriers or transfection agents, and they are given systemically in a chronic manner. In humans, this is done by cycles of continuous IV infusion, either by repeated daily (x 5) short infusions of 2 hours, or continuous infusion for 5-21 days. In mice, the systemic delivery of ASOs is through daily, or less frequent, bolus ip injections. In some cases sub-cutaneous injections are used. Typical dosing ranges from 5-25 mg/kg/day, with the caveat that certain chemistries may exhibit dose-limiting toxicities at the high end, usually manifested by body weight loss. Intra-tumoral injections are also possible, but less preferred than systemic administration. In this way, systemic antisense versus control MBO effects on tumor growth and animal disease-free survival can be measured on a three-dimensional tumor mass a vascular blood supply. Of particular note here is that ASOs bearing immunostimulatory CpG motifs have been shown to induce tumor regression by inducing xenograft rejection through NK cell activity and other immune modulators, and not through a direct antisense effect (see these examples for more information, Kandimalla et al., 2002; Yu et al., 2002; Bhagat et al., 2003). 2.8

THERAPEUTIC APPLICATIONS OF XIAP ANTISENSE

While the principle goal of this chapter is to provide teachings that aid in the development of antisense and RNAi tools for target validation and apoptosis modulation, our ultimate goal is to develop ASO or small molecule compounds with clinical efficacy. To this end, Aegera Therapeutics Inc. (Montreal, QC, Canada) and Hybridon Inc. (Cambridge, MA, USA) entered into a collaboration to develop an optimized, second generation, MBO against XIAP for cancer and lymphoproliferative disorders ([no authors listed] 2002; Reed, 2003). Second generation ASOs offer the additional advantage over 1st generation ASOs besides those already listed, in that they are potentially orally available, and therefore possibly suitable for indications other than cancer, and that may require chronic treatment (Wang et al., 1999; Sussman, 2003). A 1st generation ASO to the bcl2 oncogene, Genasense/ G3139, has been successful in the clinic in phase 2 trials (Jansen et al., 2000) and the industry awaits

260

E. LACASSE

the anticipated announcement of phase 3 results (Pirollo et al., 2003). This will hopefully validate both apoptosis control and antisense technologies as a beneficial therapeutic modality to treat cancer.

3.

Development of RNAi hairpin vectors targeting the IAPs

3.1

OVERALL STRATEGY AND APPROACH TO RNAi SEQUENCE SELECTION AND IDENTIFICATION

Two different methods of RNAi are gaining widespread acceptance and use, and may eventually replace antisense as a validation tool. The first approach involves the use of chemically-synthesized duplexes of RNA (natural, or more preferably modified-bases for increased stability), termed siRNA. Dharmacon Research Inc. (Lafayette, CO) is a leader in this field. These duplexes are then transfected much the same way ASOs are. Therefore, much of the screening optimization process is similar to that for which I have already described for ASOs. For that purpose, I will restrict my discussion on synthetic RNAi to the sequence selection process and some of the differences with the other approaches to target validation. The criteria and rules for siRNA sequence selection differ somewhat from ASO selection criteria (listed in Table 3), although some criteria are the same. The sequence selection process for siRNA also differs a bit from shRNA sequence selection because of base preferences for starting sequences after the polIII promoter or at the 5’end of the synthetic RNA. The current considerations for siRNA design (two 21-23 complementary base oligomers with 2 base overhangs at the 3’ end) is as follows. These criteria derive mostly from information on the Qiagen/ Xeragon web sites, and have not been tried in the author’s laboratory. I will speak in more detail as to the shRNA approach which has been tested in my laboratory, and which I feel offers certain advantages (listed in Table 4) over ASO and siRNA approaches. One caveat, to all these rules and criteria, is that this is still a developing field of study and that many pitfalls of RNAi may still yet be discovered. The RNAi field, at least for the use in mammalian cells, has not yet reached the level of maturity of antisense research and development, and we should be ever mindful of this fact. This being said, the RNAi field is growing in leaps and bounds and positive trends are emerging. While some of the guiding principles that make antisense work, such as an open RNA structure, may equally apply to RNAi (Bohula et al., 2003), there are clearly many differences that may make an RNAi sequence more effective than an ASO sequence and vice versa (Bertrand et al., 2002; Aoki et al., 2003; Grunweller et al., 2003; Holen et al., 2003; Hough et al., 2003; Vickers et al., 2003; Xu et al., 2003). The reason(s) for these differences is not completely understood at this time. The design and selection of effective RNAi sequences is still an empirical process.


261

Highly informative steps for design and selection are given in the following review (Dykxhoorn et al., 2003), and other approaches are available (Yu et al., 2002; Sohail et al., 2003). I have detailed below one such approach to illustrate the process. To design a siRNA, select a 21 or a 23 nt sequence in the coding region of the mRNA with a GC ratio as close to 50% as possible. Ideally, the GC ratio should be between 45% and 55%. An siRNA with 60% GC content has worked in many cases, however when the GC content approaches 70% a sharp decrease in the level of silencing is observed. Also important is to avoid regions within 50-100 nt of the AUG start codon or 50-100 nt of the termination codon. Eliminating sequences with more than three guanosines in a row is advised, as poly G sequences can hyperstack and therefore form agglomerates that potentially interfere in the siRNA silencing mechanism. Preferentially choose target sequences that start with two adenosines. This will make synthesis easier, more economical, and create an siRNA that is potentially more resistant to nucleases. When a sequence that starts with AA is used, siRNA with dTdT overhangs can be produced. If it is not possible to find a sequence that starts with AA and matches the above rules, choose any 23 nt region of the coding sequence with a GC content between 45 and 55% that does not have more than three guanosines in a row. Several corporate web sites include siRNA design tools, for example Qiagen/ Xeragon have the following site: www.python.penguindreams.net/Xeragon_Order_Entry/SearchBySequence.do. In addition, ensure that your target sequence is not homologous to any other genes. It is strongly recommended that a BLAST search of the target sequence be performed to prevent the silencing of unwanted genes with a similar sequence. Labeling, if desired, of the 3'-end of the sense strand gives the best results with respect to not interfering with the gene silencing mechanism of siRNA. The manufacturers report that when these rules are used for siRNA target sequence design, RNAi effectively silences genes in more than 80% of cases. Current data indicate that there are regions of some mRNAs where gene silencing does not work. To help ensure that a given target gene is silenced, it is advised that at least two target sequences as far apart in the defined sequence, as possible, be chosen. It is advisable to use modified RNA residues to increase nuclease resistance, some guidance is given in the following reports (Hamada et al., 2002; Braasch et al., 2003; Czauderna et al., 2003) The second RNAi approach involves the production of shRNA transcripts from a polIII promoter such as H1 (used in the pSUPER vectors for example, Brummelkamp et al., 2002) and U6 (used in the PCR ‘shagging’ approach of Paddison and Hannon, 2002; Paddison et al., 2002a). This molecular biology approach to generating an RNAi duplex molecule has certain advantages that make this an attractive experimental tool. First, the use and introduction of polIII promoter RNAi vectors in to cells while allow for a more sustained production of RNAi transcripts, compared to bolus tranfections of siRNA or ASO nucleobase oligomers. Second, the use of retroviral or adenoviral RNAi vectors, can obviate some of the limitations of poor plasmid transfection efficiency. Third, these polIII RNAi vectors

262

E. LACASSE

allow for the creation of stable cell lines and transgenic animals (Barton and Medzhitov, 2002; Brummelkamp et al., 2002; Carmell et al., 2003; Hemann et al., 2003; Kunath et al., 2003; Paddison et al., 2002b; Rubinson et al., 2003; Stein et al., 2003; Stewart et al., 2003; Tiscornia et al., 2003), that recapitulate the loss-offunction or null phenotype with greater ease than the generation of genetic knockout cell lines or animals. New polIII vectors employing the Tet-repressor allow for antibiotic regulation of RNAi production in cells or animals (van de Wetering et al., 2003; Wang et al., 2003). Many target validation companies are now making use of these molecular biology approaches to carry out phenotypic screens of large libraries of gene specific RNAi. However, RNAi does come with limitations and potential complications that may limit its applicability. Of prime concern here for apoptosis studies in mammalian cells, is the possibility that dsRNA can activate the interferon or PKR, a kinase, pathways which view these molecules as a double-stranded RNA virus. The activation of PKR can shut down protein synthesis, and induce cell death independent of the RNAi effects on the target sequence. The interferon pathway can also lead to cell death. It has been reported that RNAi molecules under 31 nts for the duplexed region do not activate PKR and hence shRNAi vectors have been limited to a duplex of no more than 29 nts (Paddison and Hannon, 2002). However, a recent report indicates that some shRNA vectors can potentially activate these pathways, as seen by the induction of an interferon-inducible gene (Bridge et al., 2003), and therefore may act by non-RNAi mechanisms. Clearly, more work is needed to understand these effects and determine if they pose a problem to the target under study. This potential problem brings to the forefront the important need for controls in determining an RNAi effect. Hence, empty plasmid vectors may not be suitable controls, and vectors producing, validated, shRNA against an irrelevant gene such as firefly luciferase or the jelly fish GFP are likely more appropriate controls for controlling for non-specific effects of RNAi. More suitable controls, such as the creation of mismatch vectors, as well as the use of more than one RNAi targeting the gene of interest, are necessitated to confirm the phenotype observed. In addition, the potency observed with RNAi vectors may also allow the targeting of secondary unpredicted targets, and for this fact, the testing of multiple RNAi constructs is warranted. Full-length RNAi, while useful in C. elegans and Drosophila, is not possible in mammalian cells because of PKR activation. A new approach of generating an in vitro pool of siRNA against a full-length mammalian transcript using the Dicer protein should be approached with caution, as one cannot control for each specific siRNA generated in this system. If only one siRNA targets an unknown gene this may artificially produce an expected or unexpected phenotype.


263

Table 4. Advantages and disadvantages of RNAi compared to antisense and between the various RNAi approaches Advantages of RNAi over antisense Disadvantages of RNAi approaches oligomers Sustained, or longer-term, expression for Possible activation of PKR or interferon vector systems pathways Increased experimental possibilities (eg viral Inexperience with approach leaves many unknown pitfalls. (To confirm phenotype transduction of difficult to transfect cells, observed use at least two different RNAi creation of transgenic animals or stable cell lines for loss-of-function phenotypic studies) sequences against the same target gene. Include as many controls as possible, including mismatches which no longer antagonize the expression of over-expressed target sequences in co-transfection experiments.) Possible increases in potency, or success in Dicer approach to generating multiple RNAi sequence selection (remains to be proven) to full length sequence may hit other unknown secondary targets Large-scale rapid target discovery possible PolIII promoters are not tissue specific with RNAi libraries Antibiotic inducible systems available for Unlikely therapeutic agents at this point due vectors to poor predicted PK

3.2

DESIGN OF RNAi HAIRPIN SEQUENCES (shRNA) AND polIII VECTORS

The approach we used is that developped by Paddison and Hannon at Cold Spring Harbor Laboratories (Paddison and Hannon, 2002; Paddison et al., 2002a), and is referred to as the PCR-Shagging method. Protocol details and sequence selection tools can be found at www.cshl.org/public/SCIENCE/hannon.html. Figure 10 illustrates our PCR and cloning strategy used in the generation of RNAi to the IAPs. The strategy uses the human (mouse is also available) U6 snRNA polIII promoter to produce a short RNA transcript that is designed for RNAi purposes to form a stem-loop structure. The strategy maintains the U6 transcript initiating ‘G’ residue, and hence all RNAi transcripts will start with ‘G’. This will restrict the RNAi sequence selection to those than contain a ‘C’ at the 3’ position of the sense strand. Termination is produced by a run of Ts at the end of the hairpin and incorporated in the construct by the PCR primer.

264

E. LACASSE

Figure 10. Generationof Short-Hairpin RNAi Vectors: A. 93 nucleotide primers are generated according to the PRC-Shagging Method developed by Hnnon and colleagues at the Cold Spring Harbor Laboratory (http://www.cshl.org/public/SCIENCE/hannon.html - go to RNAi tools). The primers contains a complementary region (green) to the 3' end of the U6 promoter, 29 nucleotide sense ans antisense sequences , an 8 nucleotide loop region (blue) to ensure proper folding, and a poly A tail (reverse complement sequence). Additionally, point mutations (*) are introduced into the sense strand to produce G-U base pairing to stabilize the hairpins during propagation in bacteria. B. The human U6 Pol III promoter is used as the template in the PCR reaction to amplify the U6/RNAi sequences with the high fidelity enzyme pfu Turbo® (Stratagene). The PCR products are subsequently incubated with Taq polymerase prior to TOPO TA cloning.

Paddison and Hannon have found that hairpins of 27-29 nt stems are more effective than those with 19-21 nt stems. An additional design feature is the inclusion of a few G-U base pairings in the sense strand of the stem (which are permitted in dsRNA alpha helices) to stabilize hairpins in bacteria during propagation. A PCR-based approach allows the rapid generation of multiple different RNAi sequences by incorporating the sequences in a large PCR primer of approximately 93 nts of which 21 nts are to be used for amplification of the U6 promoter. The final PCR product is then subcloned using the TOPO TA Cloning approach. DNA from the TOPO clone that contains the RNAi cassette with its own promoter, can readily be excised and subcloned into numerous other vectors. The actual hairpin PCR primer is the reverse complement with respect to the intended transcript, onto which is added 21 nt homology to the U6 promoter. HPLC or PAGE purification of the large primer is not necessary as this limits yield and increases


265

cost. In the end, the analytical and functional screens, as well as DNA sequencing will verify integrity of the RNAi vector sequence. A plasmid encoding approximately 300 nts of the U6 promoter is used as a template. PCR conditions may include 4% DMSO to destroy secondary structures induced by the hairpin. Figure 11 illustrates the final shRNA plasmid vector and the predicted hairpin transcript to be generated. Diagnostic restrictions sites are incorporated to aid in clone selection and verification.

Figure 11. Production of Short-Hairpin RNAi Transcripts from U6 Pol III Promoter. The RNAi vectors (directed against IAP coding sequences) produced in the TOPO TA Cloning reaction (Figure 10) are screened initially by EcoRI restrictions digests to identify the correct sized U6/RNAi sequence. The vectors are then used in the transient transfection experiments (24 h) where the effectiveness of each RNAi construct (depicted here in its folded form) in determined initially by monitoring the loss in mRNA by quantitative RT-PCR (taqMAn® analisys – Figure 12). Typically, 4-5 different RNAi are tested against ecahs target to ensure at least one successful RNAi sequence. Protein knowdown (typically in HeLa cells) is measured by Western blot analysis 48 h following ransfections by comparision to U6 control transfected cells (Figure 13).

3.3

SCREENING STRATEGIES FOR RNAi SELECTION

We employed a functional screen to verify shRNA activity by measuring IAP mRNA knock-down post-transfection of plasmid vectors, compared to an empty U6 promoter plasmid. We also employed traditional DNA digest and gel sizing analysis to verify clones and inserts. Figure 12 demonstrates that not all clones of a given PCR reaction, will produce a knock-down of XIAP message. The results also show that those clones that do target XIAP efficiently also show the higher molecular

266

E. LACASSE

weight form on the agarose gel, suggesting that the non-functional clones are likely ‘empty’ U6 promoter constructs for those primers, while other large-insert vectors which show no activity may not be efficient RNAi sequences. Positive clones are DNA sequenced to verify their integrity. Our experience to date, has indicated that by this approach we can obtain positive shRNA clones within a short period of time (typically less than two weeks). Thus making this method relatively fast, efficient, and easy to validate a number of genes in a reasonable time frame.

Figure 12. Screening of RNAi Clones. A. Potential XIAP RNAI pCR®2.1 TOPO® clones are screened by EcoRI restriction digests followed by 2.5% agarose gel electrophoresis (ethidium bromide stained). Different size EcoRI fragments are observed, some representing paretal u6 control vectors. B. The clones in A were transiently transfected into HeLa cells and 24 h posttransfection the XIAP mRNA level was determined by TaqMan® analysis. Clones that significantly knocked down XIAP mRNA are denoted (*) and correspond to the large EcoRI inserts in part A.

3.4

VALIDATION OF SEQUENCE SELECTION

The positive clones identified in Figure 12 were further validated by transfecting cells with the plasmid shRNA vectors, and measuring for specific XIAP protein


267

down-regulation at 48 hours post-transfection. Figure 13 demonstrates the results for 2 clones each for 2 different RNAi sequences identified in Figure 12. All clones demonstrated activity with one pair slightly outperforming the other. The XIAP shRNA results were compared to a shRNA vector for another IAP, HIAP1/cIAP2, and to an ‘empty’ U6 vector.

Figure 13. RNAi-Mediated Protein Knockdown. Transient transfectionof HeLa cells with XIAP RNAi clones in the pCR®2.1-TOPO® plasmid shows substantial loss of XIAP protein by 48 h. A. Western blot two independent transfections in which the amount of DNA and Lipofectamine 2000 was varied in each of the transfections. B. Densitometry (average of the two transfections) was performed to quantify the loss in XIAP protein relative to cells transfected with pCR®2.1-TOPO® plasmid containing the U6 promoter only (U6 CNTRL). For comparison, our HIAP-1 (cIAP-2) RNAi vector was used to demonstrate the specificity of the XIAP RNAi clones. Following sequencing clone 2C was found to contain an error in the antisense region, most likely the result of a heterogeneous batch of primers. Clone 2E had the proper sequence and was used for subsequent subcloning and in the generation of stable XIAP RNAi cell lines (figure 14).

3.5

GENERATION OF ADENOVIRAL OR LENTIVIRAL RNAi VECTORS

To the molecular biologist, strategies to clone shRNA cassettes into other gene vectors, such as adenovirus and retrovirus, is straightforward and apparently limitless. One consideration to keep in mind is that the shRNA cassette carries its own polIII promoter, and therefore sub-cloning strategies must be employed that do not rely on cloning downstream of a polII promoter. Therefore, certain ‘customizations’ of standard shuttle vectors may have to be done. The report by Xia et al. (2002) provides an example of adeno-RNAi.

268 3.6

E. LACASSE IN VITRO ANALYSIS OF GENE FUNCTION IN TRANSIENT OR STABLE TRANSFECTION EXPERIMENTS, OR THROUGH VIRAL TRANSDUCTION

We subcloned a XIAP shRNA cassette into pCDNA3 in which the CMV promoter was deleted. This was done so that the new vector would contain a selectable marker (e.g. neomycin resistance) for creating stable cell lines expressing the RNAi. The breast cancer cell line MDA-MB-231 was transfected with linearized DNA, and after recovery, selected in Geneticin/G418 to obtain clonal populations that were screened for XIAP protein knock-down by Western. Figure 14 demonstrates that for 15 clones tested only 3 produced substantial down-regulation of XIAP protein (40, 80 and 90%).

Figure 14. Screening Potential MDA-MB-231 XIAP RNAi Stable Clones by Western Blot Anlysis. A. The 2E XIAP RNAi sequence was subcloned into pCDNA3 in which the CMV promoter had been previously removed (pCDNA3 CMV-). Linearized DNA was transfected into the MDA-MB-231 breast cancer cell line and potential XIAP RNAi stable clones were amplified and screened by Western Blot Analysis. Three clones, X-H3, X-A4 and X-G4 show visibly reduced XIAP protein levels. B. The relative XIAP protein levels for each clones as a percentage of XIAP found in cells stably transfected with the U6 promoter alone were determined by densitometry and normalized for GAPDh levels. Clones X-H3, X-A4 and X-64 had reductions of XIAP protein by approximately 40%, 80% and 90%, respectively.

Of note, is that the positive clones were actually some of the slower growing colonies. Therefore, it is possible to create stable cell lines and to have continued expression of RNAi molecules in a cell lines that is amenable to further study. This approach is not technically feasible with small ASOs, and must rely on longer


269

antisense transcripts. Interestingly, results obtained against a suppressor of apoptosis, bclXl, as an antisense stable cell lines compared to ASO transfections yielded differing results (Vilenchik et al., 2002). These points to the fact that selective pressures of the cell cloning process, or the insult nature of a bolus ASO transfection can contribute to the phenotype observed and that we have much to learn about the approaches we use to validate a target. The creation of RNAi stable cell lines will hopefully provide another tool to aid in our analysis of apoptosis control.

3.7

IN VIVO ANALYSIS OF RNAi EFFECTS ON TUMOR XENOGRAFTS, OR GENE FUNCTION IN TRANSGENIC ANIMALS

Once a truly validated shRNA construct exists to your gene of interest, then the in vivo testing is possible. For tumor xenograft models, the cells can be transfected or transduced in vitro, and then implanted into an immunodeficient host to analyze tumor growth effects. Alternatively, sub-cutaneous tumors can be injected in situ with adenoviral shRNA vectors. Systemic administration of siRNAs or shRNAs for xenograft studies may be possible based on successes in other systems but this remains to be proven (Lewis et al., 2002; McCaffrey et al., 2002; Song et al., 2003, Sorensen et al., 2003; Zender et al., 2003). Perhaps, one of the biggest advances to come out of RNAi (although still unrealized as to its ultimate potential) is the use of such vectors to create transgenic animals to recapitulate the null phenotype without having to create a gene knock-out (Kunath et al., 2003; as one such example). These are still early days in this process and much remains to be seen as to the promise of this approach. One would expect that an RNAi approach to transgenesis would not lead to complete gene shut-down and thus may allow for some survival of embryos even if the gene is considered ‘essential’. The possible use of Tet-inducible RNAi systems would permit further fine-tuning of the RNAi expression in transgenic animals, to allow analysis of all genes and splice variants in the mouse genome. Although, I have not discussed the subject of targeting specific transcripts, be they wild-type, mutant, or splice variants, or result from chromosomal translocations. Therefore, the possibility exists for targeting specifically one form of transcript versus another. This has been done to some extent with RNAi (Martinez et al., 2002; Wilda et al., 2002; Hemann et al., 2003; Miller et al., 2003), and therefore could provide a powerful tool for gene function analysis in the mouse, or in human cells.

270 4.

E. LACASSE Results and Conclusions

Antisense approaches (e.g. ASO) and RNA interference (e.g. siRNA or shRNA) offer feasible methodologies to validate genes of interest. Each of these approaches has its advantages and disadvantages, and may be more suited for a particular strategy. We are using both of the technologies to validate the IAPs, inhibitors-ofapoptosis, to justify small molecule screening programs for disorders such as cancer and multiple sclerosis. These approaches are also amenable to the development of novel therapeutics that are close to entering the market in a meaningful way, at least for ASOs. To date, many different laboratories have taken multiple approaches aimed at validating the IAPs. These efforts are briefly summarized in Table 5. ASO and RNAi are but two of the approaches taken. Other approaches include adenoviral delivery of full length antisense, stable cell lines expressing full-length antisense, ribozymes, and triplex-forming oligonucleotides (TFOs). Survivin has drawn the most attention because of its high degree of cancer specific expression compared to normal tissues (Ambrosini et al., 1997). However, survivin stands apart from the other IAPs, and this is shown in some of the studies listed below in Table 5. Survivin is a weak inhibitor of apoptosis (Wright et al., 2000) but clearly has a role in chromosome segregation and cytokinesis (Silke and Vaux, 2001). This has been confirmed with some of these validation studies which demonstrate increased polyploidy in the presence of survivin ASOs, full-length AS, or RNAi (Li et al, 1999; Chen et al, 2000; Kallio et al, 2001; Carvalho et al, 2003; Chen et al, 2003; Kawamura et al, 2003; Lens et al, 2003; Shankar et al, 2003; Sommer et al, 2003; Williams et al, 2003). This cellular function of this IAP family member has been conserved in simpler organisms, such as the fly (e.g. deterin), C. elegans (e.g. BIR1), and yeast (e.g. BIR1) which has been confirmed by gene knock-out or RNAi studies (for example, Speliotes et al., 2000; Fraser et al., 1999; Romano et al., 2003). The validation of survivin has been reviewed in more depth in the following reports (Zaffaroni and Daidone, 2002; Altieri, 2003). The survivin knock-out mouse, although unpublished, is supposedly embryonic lethal because of survivin’s essential role in cell division. Hence, some of the specific RNAi approaches described herein may allow further study of the role this IAP plays in apoptosis and cell division. In conclusion, the approaches outlined in this chapter will permit one to develop tools to genes involved in apoptosis control and to test them for functional consequences of blocking gene expression using valid assay systems. Together antisense and RNA interference provide a robust platform to validate gene function in vitro and in vivo, and will greatly aid in our understanding of apoptosis and its role in cancer.


271

Table 5. Summary of published results for antisense, RNAi and other approaches aimed at down-regulating the IAPs. IAP Approach Results References

XIAP

Adenoviral AS

Increased apoptosis

XIAP (h, m)

ASO

Increased apoptosis

HIAP1

ASO

HIAP1 (c) HIAP2

Apollon

Full-length AS Full-length AS Full-length AS ASO

Survivin

ASO

Increased apoptosis Increased apoptosis Increased apoptosis Increased apoptosis Increased apoptosis Increased apoptosis

Surviving

ASO

Surviving

ribozyme

Surviving

RNAi

Surviving

TFO

Surviving (h, m)

Full-length AS

Surviving

Full-length AS

Livin

Increased ploidy/ multinucleation (and apoptosis in some cases) Increased apoptosis Increased ploidy/ multinucleation (and apoptosis in some cases) Increased apoptosis Increased apoptosis Increased ploidy/ multinucleation (and apoptosis in some cases)

Holcik et al., 2000; Sasaki et al., 2000; Zhang et al., 2000; Asselin et al., 2001a; Asselin et al., 2001b; Li et al., 2001; Xiao et al., 2001; Perrelet et al., 2002 Lin et al., 2001; Troy et al., 2001; Bilim et al., 2003; Hu et al., 2003; Miranda et al., 2003 Erl et al., 1999; Gordon et al., 2002 Wiese et al., 1999 Spalding et al., 2002 Kasof and Gomes, 2001 Chen et al., 1999 Olie et al., 2000; Mesri et al., 2001; Xia et al., 2002; Zhou et al., 2002 Li et al., 1999; ; Chen et al., 2000; Kallio et al., 2001; Shankar et al., 2001; Chen et al., 2003; Kawamura et al., 2003 Pennati et al., 2002; Choi et al., 2003; Pennati et al., 2003 Carvalho et al., 2003; Lens et al., 2003; Williams et al., 2003 Shen et al., 2003 Ambrosini et al., 1998; Grossman et al., 1999a; Grossman et al., 1999b; Kanwar et al., 2001; Yamamoto et al., 2002 Li et al, 1999; Sommer et al., 2003*

Legend: All IAPs are human unless otherwise specified. h, human; m, mouse; c, chicken; AS, antisense; TFO, triplex-forming oligonucleotide; *, blocked transformation.

272 5.

E. LACASSE Acknowledgments

Thanks to Gabriele Cherton-Horvat, and Dr. Dan McManus for figure preparation and experimental work. Additional thanks to Dr. Stephen Morris (Aegera Therapeutics Inc.) for cloning of the U6 promoter, Stephen Baird (University of Ottawa) for Mfold analysis and sequence selection, as well as Martine St-Jean, and Charles Lefebvre for technical assistance throughout this project. Special thanks to Drs. Jon Durkin (Aegera Oncology), John Gillard (Aegera Therapeutics) and Bob Korneluk (University of Ottawa) for supporting me in this endeavour. Aegera Oncology Inc. is a wholly-owned subsidiary of Aegera Therapeutics Inc.

6.

References

Agrawal S. (1999) Importance of nucleotide sequence and chemical modifications of antisenseoligonucleotides. Biochim Biophys Acta. 1489, 53-68 Agrawal S, and Kandimalla ER. (2000) Antisense therapeutics: is it as simple as complementary base recognition? Mol Med Today. 6, 72-81. Altieri DC. (2003) Validating survivin as a cancer therapeutic target. Nat Rev Cancer. 3, 4654 Ambrosini G, Adida C, and Altieri DC. (1997) A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma.Nat Med. 3, 917-921. Ambrosini G, Adida C, Sirugo G, and Altieri DC. (1998) Induction of apoptosis and inhibition of cell proliferation by survivin gene targeting. J Biol Chem 273, 11177-11182. Aoki Y, Cioca DP, Oidaira H, and Kiyosawa K (2003) RNA interference may be more potent than antisense RNA in human cancer cell lines. Clin Exp Pharmacol Physiol 30, 96-102 Asselin E, Mills GB, and Tsang BK. (2001a) XIAP regulates Akt activity and caspase-3dependent cleavage during cisplatin-induced apoptosis in human ovarian epithelial cancer cells.Cancer Res. 61, 1862-1868. Asselin E, Wang Y, and Tsang BK. (2001b) X-linked inhibitor of apoptosis protein activates the phosphatidylinositol 3-kinase/Akt pathway in rat granulosa cells during follicular development. Endocrinology. 142, 2451-2457. Barton GM, and Medzhitov R (2002) Retroviral delivery of small interfering RNA into primary cells. Proc Natl Acad Sci USA 99: 14943-14945 Benimetskaya L, Tonkinson J, and Stein CA. (2000) Determination of cellular internalization of fluoresceinated oligonucleotides. Methods Enzymol. 313, 287-297. Bertrand JR, Pottier M, Vekris A, Opolon P, Maksimenko A, and Malvy C. (2002) Comparison of antisense oligonucleotides and siRNAs in cell culture and in vivo. Biochem Biophys Res Commun. 296, 1000-1004. Bhagat L, Zhu FG, Yu D, Tang J, Wang H, Kandimalla ER, Zhang R, and Agrawal S. (2003) CpG penta- and hexadeoxyribonucleotides as potent immunomodulatory agents. Biochem Biophys Res Commun. 300, 853-861. Bilim V, Kasahara T, Hara N, Takahashi K, and Tomita Y. (2003) Role of XIAP in the malignant phenotype of transitional cell cancer (TCC) and therapeutic activity of XIAP antisense oligonucleotides against multidrug-resistant TCC in vitro. Int J Cancer. 103, 2937.


273

Bohula EA, Salisbury AJ, Sohail M, Playford MP, Riedemann J, Southern EM, and Macaulay VM (2003) The efficacy of small interfering RNAs targeted to the type 1 IGF receptor is influenced by secondary structure in the IGF1R transcript. J Biol Chem (missing vol and page info, epub on Feb 24) Braasch DA, Jensen S, Liu Y, Kaur K, Arar K, White MA, and Corey DR. (2003) RNA Interference in Mammalian Cells by Chemically-Modified RNA. Biochemistry. 42, 79677975. Bridge AJ, Pebernard S, Ducraux A, Nicoulaz AL, and Iggo R. (2003) Induction of an interferon response by RNAi vectors in mammalian cells. Nat Genet. 34, 263-264. Brigui I, Djavanbakht-Samani T, Jolles B, Pigaglio S, and Laigle A. (2003) Minimally modified phosphodiester antisense oligodeoxyribonucleotide directed against the multidrug resistance gene mdr1. Biochem Pharmacol. 65, 747-754. Brummelkamp TR, Bernards R, and Agami R. (2002) A system for stable expression of short interfering RNAs in mammalian cells. Science. 296, 550-553. Brummelkamp TR, Bernards R, and Agami R. (2002) Stable suppression of tumorigenicity by virus-mediated RNA interference. Cancer Cell. 2, 243-247. Carmell MA, Zhang L, Conklin DS, Hannon GJ, and Rosenquist TA. (2003) Germline transmission of RNAi in mice. Nat Struct Biol.10, 91-92. Carvalho A, Carmena M, Sambade C, Earnshaw WC, and Wheatley SP. (2003) Survivin is required for stable checkpoint activation in taxol-treated HeLa cells. J Cell Sci. 116, 29872998. Casamassimi A, De Luca A, Agrawal S, Stromberg K, Salomon DS, and Normanno N. (2000)EGF-related antisense oligonucleotides inhibit the proliferation of human ovarian carcinoma cells. Ann Oncol. 11, 319-325. Chen Z, Naito M, Hori S, Mashima T, Yamori T, and Tsuruo T. (1999) A human IAP-family gene, apollon, expressed in human brain cancer cells. Biochem Biophys Res Commun. 264, 847-854. Chen J, Wu W, Tahir SK, Kroeger PE, Rosenberg SH, Cowsert LM, Bennett F, Krajewski S, Krajewska M, Welsh K, Reed JC, and Ng SC. (2000) Down-regulation of survivin by antisense oligonucleotides increases apoptosis, inhibits cytokinesis and anchorageindependent growth. Neoplasia. 2, 235-241. Chen J, Jin S, Tahir SK, Zhang H, Liu X, Sarthy AV, McGonigal TP, Liu Z, Rosenberg SH, and Ng SC. (2003) Survivin enhances Aurora-B kinase activity and localizes Aurora-B in human cells. J Biol Chem. 278, 486-490. Choi KS, Lee TH, and Jung MH. (2003) Ribozyme-mediated cleavage of the human survivin mRNA and inhibition of antiapoptotic function of survivin in MCF-7 cells. Cancer Gene Ther.10, 87-95. Czauderna F, Fechtner M, Dames S, Aygun H, Klippel A, Pronk GJ, Giese K, and Kaufmann J. (2003) Structural variations and stabilising modifications of synthetic siRNAs in mammalian cells. Nucleic Acids Res.31, 2705-2716. Dai Z, Zhu WG, Morrison CD, Brena RM, Smiraglia DJ, Raval A, Wu YZ, Rush LJ, Ross P, Molina JR, Otterson GA, and Plass C. (2003) A comprehensive search for DNA amplification in lung cancer identifies inhibitors of apoptosis cIAP1 and cIAP2 as candidate oncogenes. Hum Mol Genet. 12, 791-801. De Luca A, Selvam MP, Sandomenico C, Pepe S, Bianco AR, Ciardiello F, Salomon DS, Normanno N. (1997) Anti-sense oligonucleotides directed against EGF-related growth factors enhance anti-proliferative effect of conventional anti-tumor drugs in human coloncancer cells. Int J Cancer. 73, 277-282.

274

E. LACASSE

Deveraux QL, Takahashi R, Salvesen GS, and Reed JC. (1997) X-linked IAP is a direct inhibitor of cell-death proteases. Nature. 388, 300-304. Dierlamm J, Baens M, Wlodarska I, Stefanova-Ouzounova M, Hernandez JM, Hossfeld DK, De Wolf-Peeters C, Hagemeijer A, Van den Berghe H, and Marynen P. (1999) The apoptosis inhibitor gene API2 and a novel 18q gene, MLT, are recurrently rearranged in the t(11;18)(q21;q21) associated with mucosa-associated lymphoid tissue lymphomas. Blood. 93, 3601-3609. Dykxhoorn DM, Novina CD, and Sharp PA (2003) Killing the messenger: short RNAs that silence gene expression. Nature Rev Mol Cell Biol 4, 457-467 Earnshaw WC, Martins LM, and Kaufmann SH. (1999) Mammalian caspases: structure, activation, substrates, and functions during apoptosis. Annu Rev Biochem. 68, 383-424. Erl W, Hansson GK, de Martin R, Draude G, Weber KS, and Weber C. (1999) Nuclear factorkappa B regulates induction of apoptosis and inhibitor of apoptosis protein-1 expression in vascular smooth muscle cells. Circ Res. 84, 668-677. Evan G, and Littlewood T. (1998) A matter of life and cell death. Science. 281, 1317-1322. Far RKK, Nedbal W, and Sczakiel G (2001) Concepts to automate the theoretical design of effective antisense oligonucleotides. Bioinformatics 17, 1058-1061 Fraser AG, James C, Evan GI, and Hengartner MO. (1999) Caenorhabditis elegans inhibitor of apoptosis protein (IAP) homologue BIR-1 plays a conserved role in cytokinesis. Curr Biol. 9, 292-301. Gordon GJ, Appasani K, Parcells JP, Mukhopadhyay NK, Jaklitsch MT, Richards WG, Sugarbaker DJ, and Bueno R. (2002) Inhibitor of apoptosis protein-1 promotes tumor cell survival in mesothelioma. Carcinogenesis. 23, 1017-1024. Grossman D, McNiff JM, Li F, and Altieri DC. Expression and targeting of the apoptosis inhibitor, survivin, in human melanoma. J Invest Dermatol. 113, 1076-1081 Grossman D, McNiff JM, Li F, and Altieri DC. (1999) Expression of the apoptosis inhibitor, survivin, in nonmelanoma skin cancer and gene targeting in a keratinocyte cell line. Lab Invest. 79, 1121-1126. Grunweller A, Wyszko E, Bieber B, Jahnel R, Erdmann VA, and Kurreck J. (2003) Comparison of different antisense strategies in mammalian cells using locked nucleic acids, 2'-O-methyl RNA, phosphorothioates and small interfering RNA. Nucleic Acids Res. 31, 3185-3193. Hamada M, Ohtsuka T, Kawaida R, Koizumi M, Morita K, Furukawa H, Imanishi T, Miyagishi M, and Taira K. (2002) Effects on RNA interference in gene expression (RNAi) in cultured mammalian cells of mismatches and the introduction of chemical modifications at the 3'-ends of siRNAs. Antisense Nucleic Acid Drug Dev. 12, 301-309. Hanahan D, and Weinberg RA. (2000) The hallmarks of cancer. Cell.100, 57-70. Hemann MT, Fridman JS, Zilfou JT, Hernando E, Paddison PJ, Cordon-Cardo C, Hannon GJ, and Lowe SW. (2003) An epi-allelic series of p53 hypomorphs created by stable RNAi produces distinct tumor phenotypes in vivo. Nat Genet. 33, 396-400. Holcik M, Yeh C, Korneluk RG, and Chow T. (2000) Translational upregulation of X-linked inhibitor of apoptosis (XIAP) increases resistance to radiation induced cell death. Oncogene. 19, 4174-4177. Holcik M, and Korneluk RG. (2001) XIAP, the guardian angel. Nat Rev Mol Cell Biol. 2, 550-556. Holen T, Amarzguioui M, Babaie E, and Prydz H (2003) Similar behaviour of single-strand and double-strabd si RNAs suggests they act through a common RNAi pathway. Nucleic Acids Res 31, 2401-2407 Hough SR, Wiederholt KA, Burrier AC, Woolf TM, and Taylor MF. (2003) Why RNAi makes sense. Nat Biotechnol. 21, 731-732


275

Hu Y, Cherton-Horvat G, Dragowska V, Baird S, Korneluk RG, Durkin JP, Mayer LD, and LaCasse EC. (2003) Antisense Oligonucleotides Targeting XIAP Induce Apoptosis and Enhance Chemotherapeutic Activity against Human Lung Cancer Cells in Vitro and in Vivo. Clin Cancer Res. 9, 2826-36. Igney FH, and Krammer PH. (2002) Death and anti-death: tumour resistance to apoptosis. Nat Rev Cancer. 2, 277-288. Imoto I, Yang ZQ, Pimkhaokham A, Tsuda H, Shimada Y, Imamura M, Ohki M, and Inazawa J. (2001) Identification of cIAP1 as a candidate target gene within an amplicon at 11q22 in esophageal squamous cell carcinomas. Cancer Res. 61, 6629-6634. Imoto I, Tsuda H, Hirasawa A, Miura M, Sakamoto M, Hirohashi S, and Inazawa J. (2002) Expression of cIAP1, a target for 11q22 amplification, correlates with resistance of cervical cancers to radiotherapy. Cancer Res. 62, 4860-4866. Jansen B, and Zangemeister-Wittke U. (2002) Antisense therapy for cancer--the time of truth. Lancet Oncol. 3, 672-683. Jansen B, Wacheck V, Heere-Ress E, Schlagbauer-Wadl H, Hoeller C, Lucas T, Hoermann M, Hollenstein U, Wolff K, and Pehamberger H. (2000) Chemosensitisation of malignant melanoma by BCL2 antisense therapy. Lancet. 356, 1728-1733. Kallio MJ, Nieminen M, and Eriksson JE. (2001) Human inhibitor of apoptosis protein (IAP) survivin participates in regulation of chromosome segregation and mitotic exit. FASEB J. 15, 2721-2723. Kandimalla ER, Yu D, and Agrawal S (2002) Towards optimal design of second-generation immunostimulatory oligonucleotides. Curr Opin Mol Ther 4, 122-129 Kanwar JR, Shen WP, Kanwar RK, Berg RW, and Krissansen GW. (2001) Effects of survivin antagonists on growth of established tumors and B7-1 immunogene therapy. J Natl Cancer Inst. 93, 1541-1552. Kasof GM, and Gomes BC. (2001) Livin, a novel inhibitor of apoptosis protein family member.J Biol Chem. 276, 3238-3246. Kunath T, Gish G, Lickert H, Jones N, Pawson T, and Rossant J. (2003) Transgenic RNA interference in ES cell-derived embryos recapitulates a genetic null phenotype. Nat Biotechnol. 21, 559-561. LaCasse EC, Baird S, Korneluk RG, and MacKenzie AE. (1998) The inhibitors of apoptosis (IAPs) and their emerging role in cancer. Oncogene. 17, 3247-3259. Lens SM, Wolthuis RM, Klompmaker R, Kauw J, Agami R, Brummelkamp T, Kops G, and Medema RH. (2003) Survivin is required for a sustained spindle checkpoint arrest in response to lack of tension. EMBO J. 22, 2934-2947. Lewis DL, Hagstrom JE, Loomis AG, Wolff JA, and Herweijer H. (2002) Efficient delivery of siRNA for inhibition of gene expression in postnatal mice. Nat Genet. 32, 107-108. Li F, Ackermann EJ, Bennett CF, Rothermel AL, Plescia J, Tognin S, Villa A, Marchisio PC, and Altieri DC. (1999) Pleiotropic cell-division defects and apoptosis induced by interference with survivin function. Nat Cell Biol. 1, 461-466. Li J, Feng Q, Kim JM, Schneiderman D, Liston P, Li M, Vanderhyden B, Faught W, Fung MF, Senterman M, Korneluk RG, and Tsang BK. (2001) Human ovarian cancer and cisplatin resistance: possible role of inhibitor of apoptosis proteins. Endocrinology. 142, 370-380. Lin H, Chen C, and Chen BD. (2001) Resistance of bone marrow-derived macrophages to apoptosis is associated with the expression of X-linked inhibitor of apoptosis protein in primary cultures of bone marrow cells. Biochem J. 353, 299-306.

276

E. LACASSE

Liston P, Roy N, Tamai K, Lefebvre C, Baird S, Cherton-Horvat G, Farahani R, McLean M, Ikeda JE, MacKenzie A, and Korneluk RG. (1996) Suppression of apoptosis in mammalian cells by NAIP and a related family of IAP genes. Nature. 379, 349-353. Liston P, Fong WG, Kelly NL, Toji S, Miyazaki T, Conte D, Tamai K, Craig CG, McBurney MW, and Korneluk RG. (2001) Identification of XAF1 as an antagonist of XIAP antiCaspase activity. Nat Cell Biol. 3, 128-133. Liu H, Ruskon-Fourmestraux A, Lavergne-Slove A, Ye H, Molina T, Bouhnik Y, Hamoudi RA, Diss TC, Dogan A, Megraud F, Rambaud JC, Du MQ, and Isaacson PG. (2001) Resistance of t(11;18) positive gastric mucosa-associated lymphoid tissue lymphoma to Helicobacter pylori eradication therapy. Lancet. 357, 39-40. Martinez LA, Naguibneva I, Lehrmann H, Vervisch A, Tchenio T, Lozano G, and HarelBellan A (2002) Synthetic small inhibiting RNAs: efficient tools to inactivate oncogenic mutations and restore p53 pathways. Proc Natl Acad Sci USA 99: 14849-14854 McCaffrey AP, Meuse L, Pham TT, Conklin DS, Hannon GJ, and Kay MA. (2002) RNA interference in adult mice. Nature. 418, 38-39. McManus MT, and Sharp PA (2002) Gene silencing in mammals by small interfering RNAs. Nature Rev Genet 3, 737-747 Mesri M, Morales-Ruiz M, Ackermann EJ, Bennett CF, Pober JS, Sessa WC, and Altieri DC. (2001) Suppression of vascular endothelial growth factor-mediated endothelial cell protection by survivin targeting. Am J Pathol. 158, 1757-1765. Miller LK. (1999) An exegesis of IAPs: salvation and surprises from BIR motifs. Trends Cell Biol. 9, 323-328. Miller VM, Xia H, Marrs GL, Gouvion CM, Lee G, Davidson BL, and Paulson HL. (2003) Allele-specific silencing of dominant disease genes. Proc Natl Acad Sci U S A. 100, 71957200. Miranda MB, Dyer KF, Grandis JR, and Johnson DE. (2003) Differential activation of apoptosis regulatory pathways during monocytic vs granulocytic differentiation: a requirement for Bcl-X(L)and XIAP in the prolonged survival of monocytic cells. Leukemia. 17, 390-400. [No authors listed] (2002) Hybridon and Aegera collaborate to develop antisense drug. Expert Rev Anticancer Ther. 2, 483-484. Olie RA, Simoes-Wust AP, Baumann B, Leech SH, Fabbro D, Stahel RA, and ZangemeisterWittke U. (2000) A novel antisense oligonucleotide targeting survivin expression induces apoptosis and sensitizes lung cancer cells to chemotherapy. Cancer Res. 60, 2805-2809. Paddison PJ, Caudy AA, Bernstein E, Hannon GJ, and Conklin DS. (2002a) Short hairpin RNAs (shRNAs) induce sequence-specific silencing in mammalian cells. Genes Dev. 16, 948-958. Paddison PJ, Caudy AA, and Hannon GJ. (2002b) Stable suppression of gene expression by RNAi in mammalian cells. Proc Natl Acad Sci U S A. 99, 1443-1448. Paddison PJ, and Hannon GJ. (2002) RNA interference: the new somatic cell genetics? Cancer Cell. 2, 17-23. Pennati M, Colella G, Folini M, Citti L, Daidone MG, and Zaffaroni N. (2002) Ribozymemediated attenuation of survivin expression sensitizes human melanoma cells to cisplatininduced apoptosis. J Clin Invest.109, 285-286. Perrelet D, Ferri A, Liston P, Muzzin P, Korneluk RG, and Kato AC. (2002) IAPs are essential for GDNF-mediated neuroprotective effects in injured motor neurons in vivo. Nat Cell Biol. 4, 175-179. Peyman A, and Uhlmann E. (1996) Minimally modified oligonucleotides - combination of end-capping and pyrimidine-protection. Biol Chem Hoppe Seyler. 377, 67-70.


277

Pirollo KF, Rait A, Sleer LS, and Chang EH (2003) Antisense therapeutics: from theory to clinical practice. Pharmacol Therapeut 99, 55-77 Reed JC. (2002) Apoptosis-based therapies. Nat Rev Drug Discov. 1, 111-121. Reed JC. (2003) Apoptosis-targeted therapies for cancer. Cancer Cell. 3, 17-22. Romano A, Guse A, Krascenicova I, Schnabel H, Schnabel R, and Glotzer M. (2003) CSC-1: a subunit of the Aurora B kinase complex that binds to the survivin-like protein BIR-1 and the incenp-like protein ICP-1. J Cell Biol. 161, 229-236. Roy N, Mahadevan MS, McLean M, Shutler G, Yaraghi Z, Farahani R, et al (1995) The gene for neuronal apoptosis inhibitory protein is partially deleted in individuals with spinal muscular atrophy. Cell 80, 167-178 Roy N, Deveraux QL, Takahashi R, Salvesen GS, and Reed JC. (1997) The c-IAP-1 and cIAP-2 proteins are direct inhibitors of specific caspases. EMBO J. 16, 6914-6925. Rubinson DA, Dillon CP, Kwiatkowski AV, Sievers C, Yang L, Kopinja J, Rooney DL, Ihrig MM, McManus MT, Gertler FB, Scott ML, and Van Parijs L. (2003) A lentivirus-based system to functionally silence genes in primary mammalian cells, stem cells and transgenic mice by RNA interference. Nat Genet. 33, 401-406. Salvesen GS, and Duckett CS. (2002) IAP proteins: blocking the road to death's door. Nat Rev Mol Cell Biol. 3, 401-410. Samani TD, Jolles B, and Laigle A. (2001) Best minimally modified antisense oligonucleotides according to cell nuclease activity. Antisense Nucleic Acid Drug Dev. 11, 129-136. Sasaki H, Sheng Y, Kotsuji F, and Tsang BK. (2000) Down-regulation of X-linked inhibitor of apoptosis protein induces apoptosis in chemoresistant human ovarian cancer cells. Cancer Res. 60, 5659-5666. Shankar SL, Mani S, O'Guin KN, Kandimalla ER, Agrawal S, and Shafit-Zagardo B. (2001) Survivin inhibition induces human neural tumor cell death through caspase-independent and -dependent pathways. J Neurochem. 79, 426-436. Shen C, Buck A, Polat B, Schmid-Kotsas A, Matuschek C, Gross HJ, Bachem M, and Reske SN. (2003) Triplex-forming oligodeoxynucleotides targeting survivin inhibit proliferation and induce apoptosis of human lung carcinoma cells. Cancer Gene Ther. 10, 403-410. Shi Y (2003) Mammalian RNAi for the masses. Trends Genet 19, 9-12 Shuey DJ, McCallus DE, and Giordano T (2002) RNAi: gene-silencing in therapeutic intervention. Drug Discov Today 7, 1040-1046 Silke J, and Vaux DL. (2001) Two kinds of BIR-containing protein - inhibitors of apoptosis, or required for mitosis. J Cell Sci. 114, 1821-1827. Smith L, Andersen KB, Hovgaard L, and Jaroszewski JW. (2000) Rational selection of antisense oligonucleotide sequences. Eur J Pharm Sci. 11, 191-198. Sohail M, and Southern EM. (2000) Selecting optimal antisense reagents. Adv Drug Deliv Rev. 44, 23-34. Sohail M, Doran G, Riedemann J, Macaulay V, and Southern EM. (2003) A simple and costeffective method for producing small interfering RNAs with high efficacy. Nucleic Acids Res. 31, e38. Sommer KW, Schamberger CJ, Schmidt GE, Sasgary S, and Cerni C. (2003) Inhibitor of apoptosis protein (IAP) survivin is upregulated by oncogenic c-H-Ras. Oncogene. 22, 4266-4280. Song E, Lee SK, Wang J, Ince N, Ouyang N, Min J, Chen J, and Shankar P, Lieberman J. (2003) RNA interference targeting Fas protects mice from fulminant hepatitis. Nat Med. 9, 347-351. Sorensen DR, Leirdal M, and Sioud M. (2003) Gene silencing by systemic delivery of synthetic siRNAs in adult mice. J Mol Biol. 327, 761-766.

278

E. LACASSE

Spalding AC, Jotte RM, Scheinman RI, Geraci MW, Clarke P, Tyler KL, and Johnson GL. (2002) TRAIL and inhibitors of apoptosis are opposing determinants for NF-kappaBdependent, genotoxin-induced apoptosis of cancer cells. Oncogene. 21, 260-271. Speliotes EK, Uren A, Vaux D, and Horvitz HR. (2000) The survivin-like C. elegans BIR-1 protein acts with the Aurora-like kinase AIR-2 to affect chromosomes and the spindle midzone Mol Cell. 6, 211-223. Stein CA. (2001) The experimental use of antisense oligonucleotides: a guide for the perplexed.J Clin Invest.108, 641-644. Stein P, Svoboda P, and Schultz RM. (2003) Transgenic RNAi in mouse oocytes: a simple and fast approach to study gene function. Dev Biol. 256, 187-193. Stennicke HR, Ryan CA, and Salvesen GS (2002) Reprieval from execution: the molecular basis of caspase inhibition. Trends Biochem Sci 27, 94-101 Stewart SA, Dykxhoorn DM, Palliser D, Mizuno H, Yu EY, An DS, Sabatini DM, Chen IS, Hahn WC, Sharp PA, Weinberg RA, and Novina CD. (2003) Lentivirus-delivered stable gene silencing by RNAi in primary cells. RNA. 9, 493-501. Sussman HE (2003) Success for oral antisense therapy. Drug Discov Today 8, 516-517 Tamm I, Kornblau SM, Segall H, Krajewski S, Welsh K, Kitada S, Scudiero DA, Tudor G, Qui YH, Monks A, Andreeff M, and Reed JC. (2000) Expression and prognostic significance of IAP-family genes in human cancers and myeloid leukemias. Clin Cancer Res. 6, 1796-1803. Thompson JD (2002) Applications of antisense and siRNAs during preclinical drug development. Drug Discov Today 7, 912-917 Thornberry NA, and Lazebnik Y. (1998) Caspases: enemies within. Science. 281, 1312-1316. Tiscornia G, Singer O, Ikawa M, and Verma IM. (2003) A general method for gene knockdown in mice by using lentiviral vectors expressing small interfering RNA. Proc Natl Acad Sci U S A.100, 1844-1848. Troy CM, Rabacchi SA, Hohl JB, Angelastro JM, Greene LA, and Shelanski ML. (2001) Death in the balance: alternative participation of the caspase-2 and -9 pathways in neuronal death induced by nerve growth factor deprivation. J Neurosci. 21, 5007-5016. Tsujimoto Y, and Croce CM. (1986) Analysis of the structure, transcripts, and protein products of bcl-2, the gene involved in human follicular lymphoma. Proc Natl Acad Sci U S A. 83, 5214-5218. Uhlmann E, Peyman A, Ryte A, Schmidt A, and Buddecke E. (2000) Use of minimally modified antisense oligonucleotides for specific inhibition of gene expression. Methods Enzymol. 13, 268-284. Uren AG, Wong L, Pakusch M, Fowler KJ, Burrows FJ, Vaux DL, and Choo KH. (2000) Survivin and the inner centromere protein INCENP show similar cell-cyclelocalization and gene knockout phenotype. Curr Biol. 10, 1319-1328. van de Wetering M, Oving I, Muncan V, Pon Fong MT, Brantjes H, van Leenen D, Holstege FC, Brummelkamp TR, Agami R, and Clevers H. (2003) Specific inhibition of gene expression using a stably integrated, inducible small-interfering-RNA vector. EMBO Rep. 4, 609-615. Vaux DL, Cory S, and Adams JM. (1988) Bcl-2 gene promotes haemopoietic cell survival and cooperates with c-myc to immortalize pre-B cells. Nature. 335, 440-442. Vickers TA, Koo S, Bennett CF, Crooke ST, Dean NM, and Baker BF. (2003) Efficient reduction of target RNAs by small interfering RNA and RNAse H-dependent antisense agents. A comparative analysis. J Biol Chem. 278, 7108-7118. Vilenchik M, Raffo AJ, Benimetskaya L, Shames D, and Stein CA. (2002) Antisense RNA down-regulation of bcl-xL Expression in prostate cancer cells leads to diminished rates of


279

cellular proliferation and resistance to cytotoxic chemotherapeutic agents. Cancer Res. 62, 2175-2183. Wang H, Cai Q, Zeng X, Yu D, Agrawal S, and Zhang R. (1999) Antitumor activity and pharmacokinetics of a mixed-backbone antisense oligonucleotide targeted to the RIalpha subunit of protein kinase A after oral administration. Proc Natl Acad Sci U S A. 96, 1398913994. Wang J, Tekle E, Oubrahim H, Mieyal JJ, Stadtman ER, and Chock PB. (2003) Stable and controllable RNA interference: Investigating the physiological function of glutathionylated actin. Proc Natl Acad Sci U S A. 100, 5103-5106. Wiese S, Digby MR, Gunnersen JM, Gotz R, Pei G, Holtmann B, Lowenthal J, and Sendtner M. (1999) The anti-apoptotic protein ITA is essential for NGF-mediated survival of embryonic chick neurons. Nat Neurosci. 2, 978-983. Wilda M, Fuchs U, Wossmann W, and Borkhardt A (2002) Killing of leukemic cells with a BCR/ABL fusion gene by RNA interference (RNAi). Oncogene 21, 5716-5724 Williams NS, Gaynor RB, Scoggin S, Verma U, Gokaslan T, Simmang C, Fleming J, Tavana D, Frenkel E, and Becerra C. (2003) Identification and validation of genes involved in the pathogenesis of colorectal cancer using cDNA microarrays and RNA interference. Clin Cancer Res. 9, 931-946. Wright ME, Han DK, and Hockenbery DM. (2000) Caspase-3 and inhibitor of apoptosis protein(s) interactions in Saccharomyces cerevisiae and mammalian cells. FEBS Lett. 481, 13-18. Xia C, Xu Z, Yuan X, Uematsu K, You L, Li K, Li L, McCormick F, and Jablons DM. (2002) Induction of apoptosis in mesothelioma cells by antisurvivin oligonucleotides. Mol Cancer Ther. 1, 687-694. Xia H, Mao Q, Paulson HL, and Davidson BL. (2002) siRNA-mediated gene silencing in vitro and in vivo. Nat Biotechnol. 20, 1006-1010. Xu Y, Zhang HY, Thormeyer D, Larsson O, Du Q, Elmen J, Wahlestedt C, and Liang Z. (2003) Effective small interfering RNAs and phosphorothioate antisense DNAs have different preferences for target sites in the luciferase mRNAs. Biochem Biophys Res Commun. 306, 712-717. Yamamoto T, Manome Y, Nakamura M, and Tanigawa N. (2002) Downregulation of survivin expression by induction of the effector cell protease receptor-1 reduces tumor growth potential and results in an increased sensitivity to anticancer agents in human colon cancer. Eur J Cancer. 38, 2316-2324. Yu D, Zhu F-G, Bhagat L, Wang H, Kandimalla EK, Zhang R, and Agrawal S (2002) Potent CpG oligonucleotides containing phosphodiester linkages: in vitro and in vivo immunostimulatory properties. Biochem Biophys Res Commun 297, 83-90 Yu JY, DeRuiter SL, and Turner DL. (2002) RNA interference by expression of shortinterfering RNAs and hairpin RNAs in mammalian cells. Proc Natl Acad Sci U S A. 99, 6047-6052. Zaffaroni N, and Daidone MG. (2002) Survivin expression and resistance to anticancer treatments: perspectives for new therapeutic interventions. Drug Resist Updat. 5, 65-72. Zender L, Hutker S, Liedtke C, Tillmann HL, Zender S, Mundt B, Waltemathe M, Gosling T, Flemming P, Malek NP, Trautwein C, Manns MP, Kuhnel F, and Kubicka S. (2003) Caspase 8 small interfering RNA prevents acute liver failure in mice. Proc Natl Acad Sci U S A.100, 7797-7802. Zhang HG, Huang N, Liu D, Bilbao L, Zhang X, Yang P, Zhou T, Curiel DT, and Mountz JD. (2000) Gene therapy that inhibits nuclear translocation of nuclear factor kappaB results in tumor necrosis factor alpha-induced apoptosis of human synovial fibroblasts. Arthritis Rheum. 43, 1094-1105.

280

E. LACASSE

Zhang HY, Mao J, Zhou D, Xu Y, Thonberg H, Liang Z, and Wahlestedt C. (2003) mRNA accessible site tagging (MAST): a novel high throughput method for selecting effective antisense oligonucleotides. Nucleic Acids Res. 31, e72. Zhivotovsky B, and Orrenius S. (2003) Defects in the apoptotic machinery of cancer cells: role in drug resistance. Semin Cancer Biol.13, 125-134. Zhou W, and Agrawal S. (1998) Mixed-backbone oligonucleotides as second-generation antisense agents with reduced phosphorothioate-related side effects. Bioorg Med Chem Lett. 8, 3269-3274. Ziegler A, Simoes-Wuest AP, and Zangemeister-Wittke U. (2000) Optimizing efficacy of antisense oligodeoxynucleotides targeting inhibitors of apoptosis. Methods Enzymol. 314, 477-490 Zuker M. (2003) Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31, 3406-3415. Zuker M, Mathews DH, and Turner DH (1999) Algorithms and Thermodynamics for RNA Secondary Structure Prediction: A Practical Guide. In: RNA Biochemistry and Biotechnology, J. Barciszewski & B.F.C. Clark, eds., NATO ASI Series, Kluwer Academic Publishers.

11.

MONITORING OF APOPTOSIS

*ADIBA ISHAQUE AND §MOHAMED AL-RUBEAI *Process and Technology Development, Bayer Corporation, Berkeley California, USA E-mail: [email protected] § School of Chemical Engineering, The University of Birmingham, Birmingham, B15 2TT, UK E-mail: [email protected]

1.

Introduction

Animal cells are the preferred host for the generation of complex recombinant proteins. Recombinant DNA products, such as eryrthropoeitin and coagulation factors (Lubiniecki and Petricciani, 2001) constitute a significant share of current world pharmaceutical sales. Large-scale production of these therapeutics utilize transformed cell lines cultured in bioreactor processes that require rigorous optimization strategies to enhance cellular productivity, ensure product fidelity, and oblige cost-effective implementations in a highly competitive market (Al-Rubeai, 1998). The single most important parameter that can be used to judge cell culture performance is the status of cell culture viability. Previously it was believed that adverse cell culture conditions resulted in a passive or ‘necrotic’ form of cell death. The impact of necrosis is an undesirable phenomenon since cell lysis releases proteases into the culture supernatant, causing product degradation, and/or adsorption of the product, complicating downstream purification procedures. It is now widely acknowledged that many of the mammalian cell lines, which are used for industrial scale recombinant protein productivity, undergo a programmed, genetically regulated form of ‘apoptotic’ cell death in the bioreactor environment. Apoptosis was first distinguished from necrosis by ultrastructural analysis, using electron microscopy, in batch cultures of antibody producing hybridoma cells (AlRubeai et al., 1990; Franek and Dolnikova, 1991). Numerous studies subsequently identified apoptosis in CHO, hybridoma and myleoma cell lines in response to altered bioreactor operations such as nutrient deprivations, metabolic by-product accumulation, hypoxia or variations in hydrodynamic stresses, (Mercille and Massie, 1994; Shimizu et al., 1995; Singh et al., 1994; Simpson et al., 1997; Fussenegger et al., 1999; Mastrangelo and Betenbaugh, 1998; Zanghi et al., 1999). The emergence of apoptotic cells inevitably results in loss of membrane integrity and substantial 281 M. Al-Rubeai and M. Fussenegger (eds.), Cell Engineering, Vol. 4, 281-306. © 2004 Kluwer Academic Publishers. Printed in the Netherlands.

282

A. ISHAQUE and M. AL-RUBEAI

levels of secondary necrotic or late apoptotic cells, since there is no phagocytic disposal of these cells in culture unlike the in vivo milieu. Degradation of these apoptotic cells also damages the cellular derived product due to the release of harmful cellular constituents into the media. The requirement for a high number of viable cells in the bioreactor position apoptosis as a primary optimization target in addition or in conjunction with media optimization and bioreactor operation strategies. Moreover, genetically regulated apoptosis offers a means of manipulation, by the expression of anti-apoptotic genes (Fussenegger and Betenbaugh, 2002), whereas little can be done about the passive, necrotic form of cell death. The identification of cell death regulatory pathways, and the inception by metabolic engineering, should enable more specific strategies for product improvement. An integral component to this route of optimization is a reliable and accurate means of monitoring apoptosis within the culture processes. This chapter begins with a brief overview of the morphological changes that distinguish apoptosis from necrosis and the underlying biochemical and molecular mechanisms. Conventional biochemical and morphological assays are then described, followed by assay procedures utilizing flow cytometry (FC), potentially the most powerful tool for analyzing apoptosis. A particular aim of this chapter is to assess the suitability of these assays in monitoring the earliest possible development of apoptosis. Specific advantages and limitations for each assay are highlighted. Furthermore, the investigator may be confused by the plethora of assays currently available as workable kits by various companies. Notably, some assays may not be suitable for the cell line under investigation, or the results may be difficult to interpret due to ambiguity with the necrotic form of cell death. Therefore, the other aim of this work is to help enable the animal cell technologist to reliably and accurately measure apoptosis by critically assessing these assays in the context of cell culture development.

2.

Apoptosis versus necrosis

2.1

MORPHOLOGY OF APOPTOSIS

Apoptotic cells design and exceute their own demise and body disposal in order to regulate a stable balance of tissue mass (Kerr et., al 1972). As a consequence apoptosis plays a central role in embryoenesis, immune system regulation, and in the response to low levels of toxicological insults. Morphological changes during this form of cell death occur via a stereotypical sequence of events (Wyllie et al., 1980). One of the earliest events is a reduction in cell size as depicted in Figure 1. Cellular shrinkage is attributed to a loss of internal water and as a result intracellular organelles appear closer together in the reduced cell volume. The endoplasmic reticulum is the primary harbour for much of the internal water (Arends et al., 1991).


283

It develops connections to the plasma membrane and channels water out of the cell to give it a pitted appearance. As the apoptotic process proceeds cell membranes begin to form blebs on the intact external cell surface (Figure 1). The formation of blebs is due to the activity of certain actin-binding cytoskeletal proteins. The cell membrane then breaks up and encloses various intact organelles. An important characteristic of apoptotic cells is the rigidity of their membranes, mediated by calcium dependent transglutaminases which prevent leakage of harmful intracellular constituents (Piacentini et al., 1991). The penultimate degenerative phase of apoptosis in in-vitro is termed secondary necrosis (Figure 1). Under in-vivo situations heterophagocytosis occurs to detect and remove apoptotic cells and apoptotic bodies by a multitude of changes occuring at the plasma membrane boundary (Figure 1). One of the most widely recognized changes is the loss in membrane phospholipid asymmetry and the translocation of internal phosphatidylserine (PS) to the intact external membrane surface (Savill et al., 1993). This allows for an early recognition and phagocytosis of apoptotic cells (Koopman et al., 1994).

Figure 1. Morphological changes during cell death. A viable cell loses its architecture in an ordered fashion by apoptosis. Distinct membrane changes and enzymatic destruction of intracellular organelles results in their neat packaging and removal by phagacytosis in vivo or subsequent degeneration during secondray necrosis in vitro. Cell death via primary necrosis is a passive cellular response involving cell swelling and rupture of organelles to herald an inflammatory reaction in vivo or release of intracellular contents into the cell culture media in vitro.

284


At some point during membrane blebbing and membrane phospholipid redistribution significant nuclear chromatin condensation occurs. This becomes very distinctive in the shrunken apoptotic cell (Arends et al., 1990) (Figure 1). Disintegration of the nuclear envelope and degradation of DNA follows, which is catalysed by non-lysosomal ion dependent endouncleases (Arends et al., 1990). DNA is degraded into large or high molecular weight (HMW) fragments of 300 and/or 50 kilo base pairs (kbp) representing loops (50kbp) or rosettes (300 kbp) of chromatin detached from the nuclear matrix. A smaller percentage of these HMW fragments are then degraded into nucleosomes of 180-200 bp. The former HMW reaction is a universal apoptotic phenomenon, whereas further fragmentation is a compulsory event (Oberhammer et al., 1993; Walker et al., 1993). In essence, the large or small DNA fragments represent a failure to completely digest the unwanted DNA, serving to limit release of potentially dangerous genetic material. 2.2

MORPHOLOGY OF NECROSIS

Acute invasive cell injury induced by cytotoxic drug overdose or by severe environmental trauma results in the passive degenerative response of necrosis, which is distinct from apoptosis in every respect (Table 1). Necrosis is not a mechanistic form of cell death; the necrotic changes appear some considerable time after the death stimulus. As a result necrosis describes the sum of post-mortem, cellular morphological changes (Bowen and Lockshin, 1981). Characteristic features of necrosis include direct disturbance to the cell membrane (Figure 1). This initiates an influx of water, causing cell and organelle oedema (Figure 1). Mitochondria and endoplasmic recticulum start to swell prior to a dissolution of the intracellular organelles. Consecutive rupture of internal and external plasma membranes releases cytoplasmic contents and harmful lysosomal constituents into the extracellular compartment (Figure 1). As a result a local inflammatory reaction is induced with subsequent scar formation. In vitro membrane damage during necrosis is usually unaccompanied by cell swelling. Instead cellular shrinkage is likely to occur. Nuclear changes are relatively unremarkable, resulting in patchy areas of condensation and fragmentation.


285

Table 1. Comparison between apoptotic and necrotic cell characteristics Feature Apoptosis Necrosis Pathological in response to Stimuli Physiological response during tissue toxins (high dose), severe homeostasis, cell turnover, and atrophy. hypoxia and ATP depletion. Cell mediated immune killing. Neoplasia. Pathological response during hypoxia (mild) and toxicants (low dose) without ATP depletion. Kinetics of Several hours. Hours to days. morphological change Energy ATP-dependent, active process that does None-passive process that requirement not occur at 4°C. can occur at 4°C. Histology Cellular shrinkage. Cell and organelle swelling. Chromatin condensation. Nuclear disintegration. Initial preservation of mitochondria Mitochondria swelling and morphology. bursting. Death of single isolated cells. Death of patches of tissue. DNA breakdown Large fragments during early stages and Random sized fragments pattern small fragments as internucleosomal multiples of 185 bps during later stages. Plasma Intact, blebbed with membrane Lysed. membrane alterations. Phagocytosis By neighboring cells. By immigrant phagocytes (in vivo) Tissue response No inflammation. Acute inflammation. (in vivo) Rapid involution without collapse of Secondary scarring. overall tissue structure.

2.3

MOLECULAR AND BIOCHEMICAL EVENTS OF APOPTOSIS

The route to the apoptotic structural phenotype is goverened by a complex series of interactions between the caspases, bcl-2 family of proteins, and selective intramitochondrial membrane proteins. A detailed discussion of the mechanisms involved is beyond the scope of this chapter, and the reader is directed to a number of reviews (Green 2003; Strasser et al., 2000). In very general terms the caspases are viewed as the ‘central executioners’ in this complex network. Their activation is initiated by the ligand-receptor mediated (Ashkenazi and Dixit, 1998) and/or mitochondrial pathway (Finkel et al., 2001). Initating events include activation of procaspase-8 and its recruitment to cytosolic death receptor adaptor protein complexes and/or mitochondrial release of cytochrome c (Kroemer and Reed, 2000) or Smac/DIABLO (Du et, a.,l 2000), as illustrated in Figure 2. Convergence of the two stimuli at the mitochondria is governed by the the activation of prop-apoptotic truncated Bid. The net result is processing of downstream capases such as caspase-3,

286


which cleave various apoptotic proteins such as ICAD/DEF-45 (nuclear inhibitor of caspase-activated deoxyribonuclease/DNA fragmentation factor 45) or cytokeratin giving rise to classic apoptotic structural phenotype (Enari et al., 1998; Duan et al., 2003). Prevention of caspase activation can occur at the point of cytochrome c release by anti-apoptotic Bcl-2 and Bcl-xL proteins or by the caspase inhibitor XIAP (Sanna et al., 2002) (Figure 2).

Figure 2. Illustration of a few key pathways involved in apoptosis

3.

Assays of apoptosis that do not utilize flow cytometry

3.1

MORPHOLOGICAL ANALYSIS

Many of the morphological and biochemical events described in section 2 have provided a fresh impetus for the detection of apoptosis at key points during the molecular cascade. One of the most reliable methods is a morphological examination of cells using microscopy based techniques. In particular numerous established apoptotic structural changes can be vividly depicted by electron microscopy. Ultra-structural details, such as chromatin condensation, dilation of the endoplasmic recticulum, and organelle modification are highlighted by transmission electron microscopy. Surface scanning electron microscopy reveals plasma membrane changes such as loss of microvilli and pseudopodia, together with the appearance of characteristic membrane blebs. The major drawback of electron


287

microscopy is its very lengthy methodology in preparing cells for observation using tissue fixation, embedding and sectioning techniques. Its tedious nature reserves its use to a last resort especially in attempting to verify its induction in an atypical model of apoptosis. In order to avoid cumbersome techiques such as electron microscopy, UV light fluorescence microscopy techniques have been developed. These assays are not only easy to perform but they offer a more quantitative assessment of apoptosis. It must be noted that conventional light microscopy techniques based on the extent of plasma membrane integrity by exclusion of vital dyes such as trypan blue will incorporate an early membrane intact apoptotic population and will therefore overestimate the health of the culture. Even though it may be possible to visualize membrane blebbing by light microscopy, it is not a reliable criteria on which to assess apoptosis. Many of the routinely used fluorescence microscopy assays are based on two features: DNA fragmenation/condensation and plasma membrane integrity. These assays utilize various DNA nucleic acid reactive fluorochromes such as acridine orange (AO) or propidium iodide (PI) as outlined in Table 2. Detailed methodology for cells in suspension and their cytocentrifugation for analysis on microscope slides is described elsewhere (Ramachandra and Studzinski, 1995). Table 2. Nucleic acid probes which are best suited to determine apoptosis Nucleic acid probes Membrane Permeable Emission (nm) Propidium iodide (PI) X 637 Ethidium bromide (EtBr) X 620 Acridine orange (AO) ! 530 SYTO 13 and SYTO 16 ! 509/519 Hoechst 33342 or Hoechst 33258 ! 450 4’6-Diamino-2-phenylindole X 461 (DAPI) 7-aminoactinomycin D (7-AAD) X 647

All of the above probes (Table 2) are available from Molecular Probes, Inc. With the exception of DAPI and Hoechst 33342, which are UV excitable, these stains are excited at 488nm. An appropriate method for demonstrating apoptotic chromatin condensation prior to a loss in membrane integrity is by staining live cells with a combination of membrane permeable and impermeable nucleic acid reactive probes. A possible mix includes Hoechst 33342 in combination with either PI or EtBr. Apoptotic nuclei produce a blue fluorescence upon binding with Hoechst 33342. However, this assay reflects only a small fraction of apoptotic cells due to a brief increase in their permeability to Hoechst 33342. Also the assay requires at least 10 minutes incubation with Hoechst 33342. DNA fragmentation and condensation events as determined by Hoechst 33342 staining may appear rather more distinct on cells that have been previously permeabilized and fixed. Simiarily, the use of DAPI

288


on fixed cells is a suitable method for visualizing nuclear events that are characteristic of apoptosis. One of the best assays for a fast reliable and relatively rapid morphological assessment of apoptosis on live cells is the use of AO in combination with PI. Important points in the procedure include: i. Use a small aliquot of cells, approximately 20µL and dilute in phosphate buffered saline if the viable cell density exceeds 1x106 cells/mL. ii. Obtain an optimal concentration of AO and PI dye mix (a good starting range is 1-10µg/mL). iii. Incubate dye mix in a 1:1 ratio with the cell suspension for < 3 minutes. iv. Analysis should be carried out within 10 minutes of sampling. The AO/PI staining procedure allows for the identification of viable, early membrane- intact apoptotic and necrotic cell populations, as demonstrated by Simpson et al., 1997 during the monitoring of industrially relevant hybridoma cell lines (Figure 3). AO develops a protonated positive charge after its passage across an intact cell membrane. This permits its electrostatic intercalation with DNA to produce a green fluorescence. However, if the DNA is denatured, then its binding sites will be exposed, and AO will bind to DNA in dimers to produce a red fluorescence. To ensure that viable green cells with native helical DNA predominate the staining procedure should be carried out in a solution of low pH, and low AO concentration. Otherwise orange-red cells will appear due to the concentration of AO dimers in acidic cytoplasmic structures such as lysosomes. PI interacts with nucleic acids in cells with lysed membranes, highlighting a red fluorescence of necrotic cells (Figure 3). Early membrane intact apoptotic cells, excluding PI, will be distinguished from viable cells by their spherical shaped, condensed chromatin (Figure 3). As these cells persist in culture, they will undergo secondary necrosis and the apoptotic bodies will also take up PI (Figure 3). Ideally at least 50 cells within the microscope field should be counted and repeated with 3 separate aliquots from the same sample. While this assay is reliable there are certain drawbacks to it. Principally, fluorescence microscopy counts are undermined by a subjective nature. This is especially the case when one is attempting to accurately identify the morphology of an apoptotic cell and distinguish it from a viable cell. Therefore, considerable practice and optimization steps are required.


289

Figure 3. Live hybridoma cells stained with a combination of Acridine Orange (AO) and Propidium Iodide (PI). Adapted with permission from Al-Rubeai, 1999.

3.2

BIOCHEMICAL ANALYSIS

As mentioned in section 2.1 apoptotic DNA is fragmentated into 300-50kb and subsequently to 180-200 bp by the action of endonucleases. The latter smaller fragments can be isolated by 1.5 % agraose gel electrophoresis, to reveal a distinctive ‘ladder pattern’ after the DNA is counterstained with EtBr as shown in Figure 4. Assay procedures for this detection method have been greatly simplified in recent years by commercially available DNA fragmentation kits. These kits enable a fast extraction and isolation of DNA in ready-to-use reagents. In all procedures a large cell number is nearly always required in order to reveal this discrete event in apoptosis. Hence it is necessary to sample from approximately 2x106 to 5x106 cells from the culture vessel which may be suitable only with bioreactors operating at high cell density. Analysis of DNA fragmentation by gel electrophoresis is perhaps the most common biochemical assay used to detect apoptosis. This stems from the fact this assay utilizes inexpensive reagents and equipment, thereby representing an easy starting point for the investigator at the bench where resources for more powerful cellular biology tools may not be available. Another advantage of this procedure is that an aliquot of cells can be pelleted (1000 rpm for 5mins) and stored indefinately at–20°C prior to analysis. One of the drawbacks of the technique is that high levels of necrosis may mask lower levels of apoptosis. Also since apoptosis does not always correspond to a progression through to nucleosomal DNA fragmentation (Oberhammer et al., 1993) and instead stops at 300-50kpb degradation (Collins et al., 1992), it may be necessary to identify the bands of these larger fragments. These can be detected by field inversion gel electrophoresis which will require additional

290


optimization. Both approaches are limited because they yield only qualitative data, and the intensity of DNA fragmentation is not representative of the frequency of apoptotic cell death

Figure 4. DNA ladder assayed with Apoptotic DNA ladder kit from Boehringer Mannheim. M=size marker, - =control cells without campothecin, + =cells treated with campothecin, C = positive control available from kit

4.

4.1

Analysis of apoptosis by flow cytometric methods

GENERAL PRINCIPLE OF FLOW CYTOMETRIC PROCEDURES

Conventional microscopy and biochemical analysis of apoptosis described so far yield average population values. Cell-to-cell heterogeneity, variation in cell size, cell cycle stage or chemical composition will go unnoticed. Analysis in industrially relevant, heterogeneous cell culture processes must be on a per cell basis. Also for the animal cell technologist, detection must be rapid, reproducible, and preferably an on-line, method. FC is the only sophisticated means of detecting the structural and biochemical/molecular hallmarks of apoptosis at all stages of process development from the time of inoculation through to product recovery (Al-Rubeai, 1999). An important characteristic is the ability of FC to gain information, over a period seconds to minutes, on tens of thousands of cells, individually. Various subpopulations can therefore be identified, as opposed to yielding average population values. Once the sub-populations have been identified, FC can be extended to flow sorting, which allows an electronic separation of the distinct populations for visual


291

inspection or for further biochemical analysis. The probes that may be utilized are often applicable to fluorescence microscopy. Indeed it is advisable to carry out both methodologies side by side. Virtually any cell associated property or cell organelle for which there is a fluorescence probe can be measured by FC. A few of the apoptotic structural and metabolic associated properties, for which there is a fluorescent probe are highlighted in Table 3, along with their respective excitation and emission wavelenghths. The FC assays highlighted in Table 3 are straightforward to prepare on cells taken from suspension cultures and are suitable for monitoring industrial cell culture processes. Typical sampling procedure for FC analysis of live cells taken directly from the culture is as follows: i. Sample approximately 105-106 cells. ii. Centrifuge @ 1000 rpm for 5mins. iii. Resuspend pellet in 10mLs of phosphate buffered saline. iv. Centrifuge @ 1000 rpm for 5mins. v. Final cell pellet is ready for staining procedure with the desired probe. For intracellular staining, the pellet at this stage should be dislodged by gentle vortex, prior to incubation with fixative and/or permeabilization agent. This enables an equal mixing of the suspension with the fixatives and also prevents cell clumping. Adherent cultures and solid tissues may also be used following delicate procedures to release the cells e.g. by enzymatic digestion using trypsin, collogenase, or mechanical teasing using aspiration or sonication. In monolayer cultures the culture medium should be added back to the cells after their tryspinization as it may contain detached apoptotic or necrotic cells. Table 3. Fluorochromes used to detect apoptosis by flow cytometry Fluorochrome/Assay Excitation/Emission (nm) Apoptotic parameters measured 488/515 Annexin V binds to exposed PS Annexin V-FITC in a Ca2+ dependent manner. Measures phosphatidylerine Ca2+ is normally included in exposure (PS) binding buffers of the commercially available kits. Increase in FITC fluorescence indicates loss of phospholipid membrane asymmetry and exposure of PS Rhodamine 123 515/580 Incorporated into

Monitors mitochondrial transmembrane potential (ψm) DiOC6(3) Monitors ψm

484/501

mitochondria to measure the mitochondrial transmembrane potential (ψm), which is retained during the early stages of apoptosis Reduced uptake into preapoptotic cells with an intact mitochondrial ψm

292


Fluorochrome/Assay

Excitation/Emission (nm)

Apoptotic parameters measured

490/527 590

Dual emission determines mitochondrial activity during apoptosis. Decrease in mitochondrial function (red fluorescence) and increase in mitochondrial mass (green fluorescence) is indicative of apoptosis

FITC-dUTP biotin-dUTP Monitors DNA fragmentation

488/515

Propidium iodide

535/617

Incorporation into DNA strand breaks by DNA polymerase or terminal deoxyribonucleotidyltransferase Intercalates with DNA and higlights reduced DNA content after ethanol permeabilization cells by the development of a sub-diploid population (‘sub-G1 region’) Cells are permealized, fixed and stained using a monoclonal antibody that recognizes human, mouse and rat active caspase-3. Increased FITC or PE fluorescence corresponds with the activation of caspase-3

JC-1 Monitors mitochondrial Activity

Monitors membrane integrity and DNA content-‘Sub-G1’ assay

Caspase-3-PE or FITC conjugate Monitors activation of caspase-3

4.2

488/575

LIGHT SCATTER AND MEMBRANE INTEGRITY

An early event of apoptosis is dehydration, which leads to cell shrinkage. Cellular dehydration is reflected by an alteration in the way cells scatter the light of the FC laser beam. Intensity of light scattered in the forward direction (FS) correlates with cell size. Light scattered at 90 degrees to the direction of the laser beam is referred to as side scatter (SS), and correlates with the ability of intracellular structures to reflect light. Figure 5 illustrates a typical change in light scatter during apoptosis. Apoptotic cells or individual apoptotic bodies are characterized by a low intensity of the FS signal. Apoptotic chromatin condensation may precipitate a transient increase in SS. An increase in SS is not a distinct change, whereas a decrease in FS is a significant indication of apoptosis (Majno and Jors, 1995). With time, as the cells become smaller, the intensity of SS also decreases. Necrotic cells may initially swell resulting in an increase in the FS single. This change is often transient and is proceeded by a rupture of the plasma membrane, which is reflected by a rapid decrease in ability of the cell to scatter light in the forward and right angle direction.


293

Figure 5. Changes in light-scattering properties of cells undergoing apoptosis. A decrease in FS is indicative of an apoptotic (APT) population which is absent in control sample.

There are numerous advantages of light scatter analysis. Principally, it is simple to determine apoptotic cells on the basis of their physical properties. This provides the possibility of combining light scatter analysis with other measurements such as the detection of nuclear DNA, and fluorescein labelled cytoplasmic or surface proteins (Darzynkiewicz et al., 1997) or with PI to identify cells with a ruptured plasma membrane. PI red fluorescence, in combination with light scatter parameters, can be used to distinguish viable (high FS scatter/PI negative) and necrotic (low FS scatter/PI positive) cells. A third apoptotic sub-population may become distinct from the main viable fraction by its reduced FS and ability to transiently exclude PI. The PI exclusion assay for cells in suspension can be regarded as the FC equivalent to a light microscopic determination of cell viability using trypan blue exclusion (Darzynkiewicz et al., 1997). PI staining in combination with light scatter analysis can be used to enumerate viable and dead cell fractions by FC as a suitable alternative to laborious and subjective manual counts (Lloyd et al., 1997). Light scatter changes, however, are specific neither to apoptosis nor necrosis; these parameters could reflect the presence of mechanically broken cells and isolated cell nuclei (Darzynkiewicz et al., 1998). Cell fixation may also alter the light scattering properties of cells in unpredictable ways. Furthermore the distinction between necrotic and apoptotic cells, especially at later stages of apoptosis is not always apparent. Identification of apoptotic cells by light scatter measurements, therefore, requires several controls and should always be accompanied by another more specific assay for apoptosis. 4.3

MITOCONDRIAL TRANSMEMBRANE POTENTIAL MEASUREMENT

Mitochondria remain functional during the initial stages apoptosis. Adequate ATP preserves the mitochondrial transmembrane potential (ψm) very early in the apoptotic process (Kluck et al., 1997). A measurement of a decrease in ψm may provide information about the state of the cell prior to the ‘point of no-return’ along

294


the apoptotic pathway. A decrease in ψm may coincide with the release of apoptogenic species such as cytochrome c. Several membrane-permeable lipophilic cationic fluorochromes have been developed that can accumulate in the mitochondria of viable and early membrane intact apoptotic cells. They diffuse into the mitochondria under the influence of a functional, negative ψm. Mitochondrial probes, of increasing lipophilicity, include rhodamine (Rh) 123, 5,5’,6,6’tetrachloro-1.1’3,3’-tetraethylbenzimidazol-carbocyanine iodide (JC-1) and 3,3’dihexiloxocarbocynaine iodide [DiOC6(3)]. Once inside the cell the lipophilic cations are electrophoreside into the mitochondria. The ability of mitochondria to retain these dyes will therefore dependent upon on the state of an intact ψm.

Figure 6. Stainability of live hybridoma cells with Rhodamine (Rh)-123 and Propidium (PI) during batch culture. Rh123 staining in viable (V) cells is reduced from day 2 (i) to day 3 (ii) and a greater fraction of necrotic (N) cells are PI positive and Rh123 negative by day 3. An intermediate population of apoptotic (A) cells may show a reduction in Rh123 fluorescence while membrane integrity is preserved (ii). Adapted with permission from Al-Rubeai et al., 1991

The fluorescence emission of Rh 123 is in the yellow-green region and so in combination with PI it can be used to discriminate between apoptotic and necrotic cell populations (Lizard et al., 1995). Viable and apoptotic cells stain green with Rh 123 and are negative for PI fluorescence (Figure 6). Necrotic cells on the other hand only stain red with PI (Figure 6). However, as may be apparent from Figure 6 it is difficult to show a distinct separation between the viable and apoptotic fraction using the Rh123 assay. The majority of early apoptotic cells with an intact but lower ψm are most likely incorporated in the viable cell fraction (Figure 6ii). These complications stem from the staining properties of Rh123 itself since it is not always specific to mitochondrial function. It may give measurements of the cytoplasmic


295

membrane potential in addition to the ψm (Shapiro, 1995). Maximal response of fluorescence changes attributed to ψm may be achieved at lower concentrations of Rh 123 with shorter dye incubation times to give a higher ratio of intra- to extramitochondrial dye concentration (Shapiro, 1995). A measurement of the ψm based on the Rh 123 assay may be better suited for a qualitative live and dead cell discrimination only and inadequate for quantifying apoptotic sub-populations and characteristics (Al-Rubeai and Emery, 1991). The use of JC-1 appears to avoid some of the problems encountered with Rh 123. It demonstrates a simple two-colour flow cytometric measurement of the ψm (Piccotti et al., 2002). Uptake of JC-1 by energized and functional mitochondria is reflected by the formation of J-aggregates associated with a red fluorescence emission. As the ψm decreases, the J-aggregates dissipate to monomers, which are detected by a shift in fluorescence emission from red to green as a result of its attachment to the mitochondrial membranes. The green monomer form of JC-1 corresponds to mitochondrial mass, while the red fluorescence indicates total cellular mitochondrial function, and red/green ratio represents the ψm in relation to mitochondrial mass. An increase in mitochondrial mass has been noted in several apoptotic models (Reipert et al., 1995; Mancini et al., 1997). The JC-1 mitochondrial assay is able to perform both a quantitative and qualitative assessment by analysis of sub-populations with differential ψm at the single mitochondrial level. DiOC6(3) produces almost hundred times higher intramitochondrial concentration than Rh 123 (Hirsch et al., 1997; Piccotti et al., 2002) due to its greater lipophilicity. However, this dye can re-distribute to other intracellular membranes such as the endoplasmic reticulum. By virtue of its spectral shift rather than the fluorescence intensity change, JC-1 appears to be the preferred mitochondrial probe for determining ψm, while a cautious approach has to be exercised with the use of DiOC6(3) or Rh 123 (Salvioli et al., 1997). Overall these assays are simple to perform, are low in toxicity and do not require expensive reagents. A decrease in ψm, however, is not a specific marker for apoptosis, and cannot be used as a sole criterion for monitoring its induction. 4.4

DNA CONTENT AND ‘SUB-G1 REGION’

Apoptotic nuclear events such as DNA fragmentation can be identified by the measurement of a reduction in DNA associated fluorescence using various nucleic acid fluorescent probes such as PI in a simple FC assay. Low molecular weight DNA can be extracted from the cells after their fixation and permeabilization in icecold 70% ethanol. The end result is a level of DNA staining which is below that of G0/G1 (Figure 7). Cells, with a fractional DNA content form a ‘sub-G1’ region and not a distinct peak, as often incorrectly described in some publications. Since cell permeabilization or alcohol fixation does not preserve degraded DNA, the DNA is lost purely as a consequence of its extraction following subsequent cell rinsing and

296


staining procedures. Prior to staining with PI it is recommended that the cells are incubated with RNase A (at 37°C for 30 minutes) because PI also binds to RNA.

Figure 7. DNA distribution for cells monitored during batch culture. The development of a ‘sub-G1’ region reflects the induction of apoptotic (Ap) cell death. The intensity of the region increases with time and combines with the cellular debris (d) indicating that a large fraction of apoptoic bodies and small fragments are incorporated into this region towards towards the end of the culture process. Adapted with permission from Al-Rubeai, 1999.

The ‘sub-G1’ assay, commonly utilizing PI (Figure 7), is a very simple FC assay that is applicable to most cell lines used for the therapeutic biologics, such as CHO, hybridomas and BHK cells. It is extremely convenient to perform and provides unrestricted time for analysis of the fixed samples. However, in attempting to reveal the existence of early apoptosis in an industrial cell culture process, the emergence of a ‘sub-G1’ region is only expected at a later time in culture, reflecting a more advanced stage of apoptosis. This also reflects the requirement of significant DNA


297

fragments for the generation of a substantial ‘sub-G1’ region. This can often be retrieved only from a large fraction of late apoptotic or secondary necrotic cells (Darzynkiewicz et al, 1998). Hence this assay may compliment biochemical DNA gel electrophoresis highlighting the later stages of apoptosis. Aside from its inability to determine early apoptosis, the ‘sub-G1’ assay is not an accurate indication of apoptosis. The ‘sub-G1’ population may be comprised of micronuclei, necrotic cells, and individual chromosome aggregates from mitotic cells with lower DNA. This assay represents the number of nuclear fragments, rather than the number of apoptotic cells (Darzynkiewicz et al, 1998). Another major drawback of the ‘sub’G1’ assay is an inability to ascertain from which stage of the cell cycle the apoptotic cells entered ‘sub-G1’. Apoptosis can occur in cells from any stage of the cell cycle. Cells chemically arrested in G2 phase of the cell cycle were found to develop a ‘sub-G2’ region (Klucar and Al-Rubeai, 1997) before migrating to form the ‘sub-G1’ population. In terms of highlighting nuclear apoptotic events, additional tests, such as analysis of DNA laddering, should therefore accompany ‘sub-G1’ analysis by FC. The ‘sub-G1’ region may simply be regarded as an additional confirmation of apoptosis. 4.5

TUNEL ASSAY

DNA fragmentation can also be detected by labeling 3’OH termini of DNA fragments with biotin-conjugated nucleotides. This reaction is catalyzed by exogenous deoxynucleotidyl terminal transferase (TdT) (Gorczyca et al., 1992) or by DNA polymerase I (nick translation) (Gold et al., 1993). Due to these reactions the general method is referred to as TUNEL (TdT-mediated dUTP Nick End Labelling). The net result is identical, in that fluorescein, digoxigen or biotin conjugated nucleotides are incorporated at the DNA breaks. TdT catalyzed reactions are more rapid than the nick translation assays. Fluoresceinated dUTP (Figure 8A) is detected directly, whereas biotin and digoxigenin-dUTP (Figure 8B) are detected using labeled streptavidin and labelled anti-digoxigenin antibodies, respectively. Combining the green fluorescence of FITC-dUTP or biotin-dUTP, for example, with PI simultaneously stains DNA and its fragments. This allows a correlation of apoptosis with the phase of the cell cycle or DNA ploidy (Gorczyca et al., 1993). The TUNEL assay was initially regarded as a very specific assay for apoptosis, especially in the occurrence of a high proportion of DNA strand breaks. Although TUNEL is a quantitative assay applicable to all cell types, there are a number of difficulties in the interpretation of the TUNEL technique. Firstly, the emergence of DNA strand breaks may not be unique to apoptosis. DNA strand breaks may be present in primary necrotic cells (Collins et al., 1992) and in cells that are devoid of internucleosomal cleavage (Chapman et al., 1995). The method itself can be technically quite difficult, and many reaction steps are involved which can account for a loss in the level of apoptotic cells. Primarily, the cells have to be fixed by

298


appropriate concentrations of cross-linking fixatives such as formaldehyde (Gorczyca et al., 1992). Failure of the DNA fragments to cross-link to various intracellular proteins will ultimately result in their leakage from the cells, possibly during the washing procedures. Other detrimental factors may be the assay components themselves due to a possible loss in TdT activity, for example, and degradation of the nucleotides. A number of appropriate negative and positive controls should accompany this assay (Darzynkiewicz et al, 1998).

Figure 8. Comparison of direct (A) and indirect (B) labeling DNA strand breaks in apoptotic cells. Direct labeling produces less nonspecific background with equal sensitivity to the indirect labeling method.

4.6

ANNEXIN V ASSAY

Apoptotic cells expose phosphatidylserine (PS) on their intact membrane surface (Savill et al., 1993). In-vitro, these apoptotic cells fragment further into membrane bound apoptotic bodies to expose the internal PS. PS externalization can be detected by annexin-V (AV) /FITC conjugate. AV preferentially binds to negatively charged phosopholipids such as PS. Koopman et al. (1994) were the first to develop a simple FC assay based on the AV-FITC principle. The staining is done in combination with PI to highlight the DNA of late apoptotic and necrotic cells. By staining cells with FITC-AV and PI it is possible to detect live, viable cells (AV -/PI –ve), early membrane intact (AV +ve/PI –ve) and late apoptotic or necrotic cells (AV and PI +ve) by FC (Figure 9) (Ishaque et al., 1998). Not all the apoptotic cells externalize PS rather only a minority of apoptotic cells actually label with AV before the final lysis of cells at the end of the apoptotic process.

MONITORING OF APOPTOSIS N

N

72 h

PI

PI

0h

299

V

V

A

A FITC-AV

FITC-AV

Figure 9. FITC-AV vs PI staining for hybridoma cells during batch culture. Double staining with FITC-AV and PI highlighted a qualitative and quantitative assessment of cell viability. The transition in biochemical cell state was from viable (V) to necosis (N) via apoptosis (A) by 72 hr in culture. Adapted by permission from Ishaque et al., 1998

An important issue of AV labeling lies in its timing in relation to other apoptotic markers. Initially, PS exposure was shown to occur after chromatin condensation (Darzynkiewicz et al., 1997) but then the same authours decided that this event coincides with DNA fragmentation (Del Bino et al., 1999). Others identified PS exposure irrespective of any chromatin condensation (Oberhammer et al., 1993; Otto et al., 1996) or only after caspase activation since caspase inhibition prevented this membrane alteration (Naito et al., 1997; Andjelic and Liou, 1998). An emerging view, however, is that PS exposure is caspase independent (Van den Eijnde et al., 2001). Whatever the time frame and coordination with other apoptotic events, PS detection is often difficult to pinpoint. Once the death phase has been identified it is crucial to frequentley monitor PS externalization during this period. Although PS exposure is considered as the universal apoptotic parameter (van Engeland et al., 1997; Williamson et al., 2001), it is often not the case in particular clones of industrial cell lines selected for the enhanced production of recombinants. In some clones of CHO cell lines the AV assay faired as a poor indicator of apoptosis. The investigator should not dismiss any lack of apoptosis induction based on this assay alone. The main advantage of the AV assay is that it is very convenient to perform on live cell fractions to yield results within 30mins of sample removal from the culture vessel. 4.7

INTRACELLULAR PH

The FC assays described so far monitor the structural changes associated with classic apoptotic phenotype. As such, the above assays merely confirm the terminal effects of an apoptotic pathway and detect apoptosis only after it is too late to rescue

300


the cell culture process. A more beneficial approach would be to detect an early alteration in cell metabolic status that could indicate imminent execution of apoptotic degradative morphological events. Alterations in cell metabolic status are traditionally concerned with changes in cell respiratory status. Cell respiratory reactions are governed by a strict regulation of intracellular pH (pHi). Numerous cellular enzymes operate at a finely tuned pHi of ≈ 7.2 (reviewed in Madshus, 1988). Sureshkumar et al. (1993) were the first to recognize the suitability of pHi as a valid indicator of cell energy status that could be used to control the optimization of bioreaction processes. A pH sensitive fluoroprobe carboxy-seminaphthorhodfluor-1-acetoxymethylester (carboxySNARF-1-AM) can be used to monitor changes in pHi. Carboxy-SNARF-1-AM is loaded into cells by the direction of its near neutral acetoxymethylester moiety, so that it diffuses across cell membranes. Once inside the cell, the initial nonfluorescent property of the dye, exerted by the acetoxymethylester, is converted into the fluorescent carboxy-SNARF-1 by action of non-specific esterases ubiquitous to all cells. The absorption spectrum of carboxy-SNARF-1 undergoes a significant pHdependent shift from yellow-orange to deep red fluorescence under acidic and basic conditions respectively. This pH dependence produces a ratio of fluorescence intensities at two dye emissions (635/575nm, acidic/basic). To gain absolute values of pHi from acid/base ratios, the probe is calibrated in buffers of known ionic strength. The advantages of using ratiometric measurements include the elimination of extraneous factors such as cell-to-cell variation in dye concentration, probe leakage and cell thickness, since these will be identical at each wavelength. Any alteration in the fluorescence ratio can be attributed to a change in cell viability or biochemical function. Using carboxy-SNARF-1-AM in a simple FC assay, sub-populations of apoptotic cells with reduced fluorescence ratio, and hence pHi can be detected. Figure 10 illustrates the emergence of an acidic fluorescence ratio in response to apoptosis (Ishaque et al., 1998 and 1999). Early membrane intact apoptotic cells are metabolically active due to their ability to retain Carboxy-SNARF-1 (Figure 10). The probe leaks out of necrotic or late apoptotic cells with compromised membranes and is unaffected by the existence of any residual esterase activity. In each instance, the sub-population of acidic cells appears prior to the detection of apoptosis by AVFITC/PI assay, and chromatin condensation as visualized by fluorescence microscopy (Ishaque et al., 1998). Interestingly, a decrease in pHi was a constant and preserved hallmark across the different apoptotic cell systems investigated by Frey et al. 1997 and a better indicator of apoptosis than mitochondrial, nuclear and annexin V flow cytomteric assays.


301

control A. control

ii

i 635 Int

635 nm

campothecin B. campothecin 3 h

i

ii apoptotic

635 Int

APT APT 575 nm

Figure 10. Carboxy-SNARF-1-AM staining to determine a reduction in fluorescence ratio and intracellular pHi. The relative pHi of the individual cells is displayed as a two dimensional dot plot according to their fluorescence intensity at 635 nm vs 575 nm, from which the mean fluorescence ratio (635/575nm) vs cell count highlights an apoptotic (APT) sub-population induced by campothecin. Although not shown here, calibration of the mean fluorescence ratio obtained for cells incubated with campothecin confirmed that the cells had a reduced pHi of 6.8 compared to 7.4 in control cells. Adapted by permission from Ishaque et al., 1998

4.8

CASPASE-3 ACTIVATION

The applications of FC have recently extended to the detection of particular proteins involved in the apoptotic cascade, such as those participating in caspase activation. Caspase-3 activation is the end-point of this cascade and is responsible for cleaving cellular substrates that lead to characteristic apoptotic morphological phenotype. A number of simple FC assay have been developed to monitor caspase-3 activation. For example, an assay utilizing a fluorescent PE or FITC conjugated to a monoclonal rabbit antibody, raised against the active fragment of caspase-3, can be used to assess the biochemical activation of apoptosis.

302 5.

A. ISHAQUE and M. AL-RUBEAI Concluding Remarks

Apoptosis has undoubtedly made a significant impact on biotechnology. Studies of the apoptotic cell phenotype and underlying regulatory mechanisms are fusing traditional engineering practices with cell and molecular biology investigations in order to provide fresh initiatives to enhance recombinant protein productivity and quality. The prevention of apoptosis can only begin to be resolved by a rapid and reliable identification of its emergence. We suggest that fluorescence microscopy is a simple, reliable and reproducible method to the trained eye. However, as mentioned, this technique is subjective, restricts the size of the sample to be analyzed, and is unable to provide information on the intracellular biochemical cell state. To this end, we suggest FC as a more powerful tool since it is objective, unbiased by visual perception and allows analysis of thousands of cells individually. However, it must be emphasized that analysis of cell morphology remains the gold standard for the detection of apoptosis. Morphological changes during apoptosis are specific and should be the deciding factor when ambiguity arises regarding the mechanism of cell death. Since virtually any parameter that can be measured by FC can be measured by alternative cytometric methods it is imperative to recognize apoptosis by using more than a single viability assay. Currently, cytoplasmic pHi appears to be the most feasible FC measurable parameter that can successfully predicate the onset of apoptosis. If adopted, pHi determinations will aid in the utilization of improved, simplified media aimed to enhance protein productivity. The best route to test the effects of media manipulation is to assess their impact on cell viability status by monitoring apoptosis using FC. Animal cell technologists may particularly benefit from this approach since media manipulation is perhaps the easiest strategy for optimizing bioreaction processes, especially compared to a genetic modification of the cell line. Although FC is a powerful technique, current instrumentation is large, expensive (at least $110, 000 and considerably more than this for a cell sorter), requires a trained and dedictated operator who can help trouble-shoot the system. Newer instruments are striving to avoid these issues. For instance the Guava Personnel Cell AnalyzerTM (Hayward, California) is a smaller, more user-friendly bench-top version of the FC. This and similar machines will undoubtedly streamline cell monitoring to enable both routine and advanced cellular assays from upstream cell line development through to large-scale bioreactor operation. Further elucidation of the molecular and biochemical mechanisms of apoptosis will inevitably lead to more assay methods. No doubt issues of specificity and interpretation will continue to fuel the debate on which technique to use. This in turn will inspire the search for more specific assays.

MONITORING OF APOPTOSIS 6.

303

Aknowlegdements

The author would like to thank Dr James A. Zanghi for proof reading this manuscript.

7.

References

Al-Rubeai M, Mills D, Emery AN. 1990. Electron microscopy of hybridoma cells with special regard to monoclonal antibody production. Cytotechnol. 4:13. Al-Rubeai M. and Singh R.P. 1998. Apoptosis in cell culture. Curr Opin Biotechnol 9: 152156 Al-Rubeai M, Emery AN, and Chalder S. 1991. Flow cytometric study of cultured mammalian cells. J.Biotechnol. 19:67-82. Al-Rubeai M., Emery A.N. 1993. Flow cytometry in animal cell culture. Biotechnology 11: 573-579. Al-Rubeai M. and Singh R.P. 1998. Apoptosis in cell culture. Current Biology 9: 152-156. Al-Rubeai M. 1999. Monitoring of growth and productivity of animal cells by flow cytometry. In Animal Cell Biotechnology. Methods in Biotechnology, vol 8. Ed. Jenkins N. p.145-153. Human Press. Andjelic S and Liou HC. 1998. Antigen receptor-induced B lymphocyte apoptosis mediated via a protease of the caspase family. Eur J. Immunol. 28: 570-581. Arends MJ, Morris RG, Wyllie AH. 1990. Apoptosis: The role of the endonuclease. AM. J. Pathol. 136: 593-608. Ashkenazi A, Dixit VM. 1998. Death receptors: Signaling and modulation. Science 281: 1305-1308. Bowen ID and Lockshin RA (eds). 1981. Cell death in biology and pathology. Chapman and Hall, London Chapman RS, Chresta CM, Herberg AA, Beere HM et al. 1995. Further characterisation of the in situ terminal deoxynucleotidyl transferase (TdT) assay for the flow cytometric analysis of apoptosis in drug resistant and drug sensitive leukaemic cells. Cytometry 20:245-56 Cohen GM, Sun XM, Snowden RT,Dinsdale D, Skilleter DN. 1992. Key morphological features of apoptosis may occur in the absence of internucleosomal DNA fragmentation. Biochem J 286: 331-4 Collins RJ, Harmon BV, Gobe GC, Kerr JF. 1992. Internucleosomal DNA cleavage should not be the sole criterion for identifying apoptosis. Int J Radiat Biol 61: 451-3 Cossarizza A, Baccarani-Contri M, Kalashnikove G, Franceshi C. 1993. A new method for the cytofluorimetric analysis of mitochondrial membrane potential using the J-aggregate forming lipophilic cation 5,5’6,6’-tetracholor-1,1,’3,3;tetraethylbenzimidazolcarbocyanaine iodide (JC-1). Biochem. Biophys. Res. Commu. 197:40-45. Darzynkiewicz Z, Juan G, Li X., Gorczyca W, Murakami T, Traganos F. 1997. Cell necrobiology: analysis of apoptosis and accidental cell death (necrosis). Cytometry 27: 120. Darzynkiewicz Z, Traganos F. Measurement of apoptosis. Adv Biochem Eng Biotechnol 1998; 62:33-73.

304


Del Bino G, Darzynkiewicz Z, Degraef C, Mosselmans R, Fokan D, Galand. 1999. Comparison of methods based on annexin-V binding, DNA content or TUNEL for evaluating cell death in HL-60 and adherent MCF-7 cells. Cell Prolif. 32:25-37. Du C, Fang M, Li Y, Li L, Wang X. 2000. Smac, a mitochondrial protein that promotes cytochrome c-dependent caspase activation by eliminating IAP inhibition. Cell 102:33-42 Duan WR, Garner DS, Williams SD, Funckes-Shippy CL, Spath IS, Blomme EA. 2003 Comparison of immunohistochemistry for activated caspase-3 and cleaved cytokeratin 18 with the TUNEL method for quantification of apoptosis in histological sections of PC-3 subcutaneous xenografts. J Pathol 199(2):221-8 Enari M, Sakahira H, Yokoyama H, Okawa K, Iwamatsu A, Nagata S. 1998 . A caspaseactivated DNase that degrades DNA during apoptosis, and its inhibitor ICAD. Nature 391:43-50 Finkel E. The mitochondrion: is it central to apoptosis? 2001. Science 292:624-6 Franek F, Dolnikova J. 1991. Nucleosomes occuring in protein-free hybridoma cell cultures. Evidence for programmed cell death. FEBS Letters 248:285-287. Frey T. 1997. Correlated flow cytometric analysis of terminal events in apoptosis reveals the absence of some changes in some model systems. Cytometry 28: 253-263. Fussenegger M, Bailey JE, Hauser H, Mueller PP. 1999. Genetic optimization of recombinant glycoprotein production by mammalian cells. Trends Biotechnol 17:35-42 Gorczyca W., Bruno, S., Darzynkiewicz Z. 1992. DNA strand breaks occuring during apoptosis: Their early in situ detection by the terminal deoxynucleotidyl transferase and nick translation assays and prevention by serine protease inhibitors. Int. J. Oncol. 1:639 648 Gottlieb RA, 1996. Cell acidification in apoptosis. Apoptosis 1, p. 40. Majno G, Jors I. 1995. Apoptosis, oncosis and necrosis: An overview of cell death. American Journal of Pathol. 153: 313-316. Green DR. 2003. Overview: apoptotic signaling pathways in the immune system. Immunol Rev. 193:5 Hirsch T, Marchetti P, Susin SA, Dallaporta B, Zamzami N, Marzo A, Geuskens M, Kroemer G. 1997. The apoptosis-necrosis paradox. Apoptogenic proteases activated after mitochondrial permeability transition determine the mode of cell death. Oncogene 15: 1573-1581 Ishaque A and Al-Rubeai M .1998. Use of intracellular pH and annexin V flow cytometric assays to monitor apoptosis and its suppression by bcl-2 over-expression in hybridoma cell culture. J. Immunological Methods 221:43-57 Ishaque A and Al-Rubeai M .1999. Role of Ca2+, Mg2+ and K+ ions in determining apoptosis and extent of suppression afforded by bcl-2 during hybridoma cell culture. Journal of Apoptosis 4: 1-21 Kerr JFR, Wyllie AH, Currie AR. 1972. Apoptosis: A basic biological phenomenon with wide ranging implications in tissue kinetics. Br. J. Cancer 26: 239-257. Klucar J, Al-Rubeai M. 1997. G2 cell cycle arrest and apoptosis are induced in Burkitt’s lymphoma cells by the anticancer agent oracin. FEBS letters 400: 127-130. Kluck RM, Bossy-Wetzel E, Green DR, Newmeyer DD. 1997. The release of cytochrome c from the mitochondria: a primary site for bcl-2 regulation of apoptosis. Science 275:113236. Koopman G., Reutlingsperger, C.PM. and Kuijten G.AM., 1994. Annexin V for flow cytometric detection of phosphatidylserine expression on B cells undergoing apoptosis. Blood 84, p. 1415. Kroemer G, Reed JC. 2000. Mitochondrial control of cell death. Nat Med. 6:513-9


305

Lizard G, Fournel S, Genestier L, Dhedin N, Chaput C et al. 1995. Kinetics of plasma membrane and mitochondrial alterations in cells undergoing apoptosis. Cytometry Nov 1 21:3 275-83 Lloyd DR, Welzenbach K, Emery AN, Al-Rubeai M. 1997. A rapid flow cytometric method for the determination of cell number and viability in animal cell technology. Genetic Engineer And Biotechnologist 17:97-9. Lubiniecki AS, Petricciani JC. 2001. Recent trends in cell substrate considerations for continuous cell lines. Curr Opin Biotechnol 12:317-9 Madshus IH. 1988. Regulation of intracellular pH in eukaryotic cells. Biochem. J. 250:1-8. Majno G, Jors I. 1995. Apoptosis, oncosis and necrosis: An overview of cell death. American Journal of Pathol. 153: 313-316. Mancini M, Anderson BO, Sedghinasab M, Paty PB, Caldwell E, Hockenbery D. 1997. Mitochondrial proliferation and paradoxical membrane depolarization during terminal differentiation and apoptosis in a human colon carcinoma cell line. J. Cell Biol. 138: 449469. Mastrangelo AJ, Betenbaugh MJ. 1998. Overcoming apoptosis: new methods for improving protein-expression systems. Trends Biotechnol 16:88-95 Mercille S. and Massie B., 1994. Induction of apoptosis in oxygen deprived cultures of hybridoma cells. Cytotechnology 15. 117-128. Naito M, Nagashima K, Mashima T, Tsuruo T. 1997. Phosphatidylserine externalization is downstream event of interluekin-1-beta converting enzyme family protease activation during apoptosis. Blood 89: 2060-2066. Oberhammer F, Wilson JW, Dive C, et al. 1993. Apoptotic death in epithelial cells: cleavgae of DNA to 300 and/or 50 kb fragments prior to or in the absence of internucleosomal fragmentation. The EMBO Journal 12:3679-3684. Otto A, Paddenberg R, Schubert S et al. 1996. Cell cycle arrest, micronucleus formation and cell death in growth inhibition of MCF-7 breast cancer cells by Tamoxifen and cisplatin. J. Cancer Res. Clin. Oncol. 122: 603. Piacentini M, Fesus L, Farrace MG, Ghibelli L, Piredda L, Melino G. 1991. The expresion of ‘tissue’ transglutaminase in two human cancer cell lines is related with programmed cell death (apoptosis). Eur J Cell Biol. 54: 246-254. Piccotti L, Marchetti C, Migliorati G, Roberti R, Corazzi L. 2002. Exogenous phospholipids specifically affect transmembrane potential of brain mitochondria and cytochrome C release. J Biol Chem. 277:12075-81 Ramachandra S, Studzinski GP. 1995. Morphological and biochemical criteria of apoptosis. In: Studzinski GP (ed) Cell growth and apoptosis. A practical approach. Oxford University Press, Oxford p119 Reipert S, Berry J, Hughes MF, Hickman JA, Allen TD. 1995. Changes of mitochondrial mass in the hemopoietic stem cell line FDCP-mix after treatment with etoposide: a correlative study by multiparameter flow cytometry and confocal and electron microscopy. Exp. Cell Res. 221: 281-288. Salvoli S, Ardizzoni A, Franceschi C, Cossarizza A. 1997. JC-1, but not DiOC6(3) or rhodamine 123, is a reliable fluorescent probe to assess ψ changes in intact cells: implications for studies on mitochondrial functionality during apoptosis. FEBS Lett 411:77-82. Sanna MG, da Silva Correia J, Luo Y, Chuang B, Paulson LM, Nguyen B, Deveraux QL, Ulevitch RJ. 2002. ILPIP, a novel anti-apoptotic protein that enhances XIAP-mediated activation of JNK1 and protection against apoptosis. J Biol Chem 277:30454-62 Savill J, Fadok V, Henson P, Haslett C. 1993. Phagocyte recognition of cells undergoing apoptosis. Immunol 3: 131-6

306


Schotte P, Van Criekinage W, Van de Craen M, Van LooG, Desmedt M., Grooten J, Cornelissen M, De Ridder L, Vandekerckhove J, Fiers W, Vandenabeele P, Beyaert. 1998. Biochem. Biophys. Res. Commun. 251:379-387. Shapiro M. 1995. Practical flow cytometry. Wiley-Liss, Inc., New York. Simpson N.H., Milner A.E. and Al-Rubeai. 1997. Prevention of hybridoma cell death by bcl2 during suboptimal culture conditions. Biotechnol. Bioeng. 54:1-16. Singh RP, Al-Rubeai M, Gregory CD and Emery AN. 1994. Cell death in bioreactors: a role for apoptosis. Biotechnol. Bioeng. 44: 720-726. Strasser A, O'Connor L, Dixit VM. 2000. Apoptosis signaling. Annu Rev Biochem. 69:217245 Sureshkumar GK and Mutharasan R. 1993. Intracellular pH-based controlled cultivation of yeast cells: A cultivation methodology. Biotechnol. Bioeng. 42, p. 295. Van den Eijnde SM, Luitjsterburg AJM, Boshart L, de Zeeuw CI, Reutelingsperger CPM, Vermeij-keers C.1997. In situ detection of apoptosis during embryogenesis with Annexin V: from whole mount to ultrastructure. Cytometry 29:313-320 Van den Eijnde SM, van den Hoff MJ, Reutelingsperger CP, van Heerde WL, Henfling ME, Vermeij-Keers C, Schutte B, Borgers M, Ramaekers FC. 2001. Transient expression of phosphatidylserine at cell-cell contact areas is required for myotube formation. J Cell Sci 114 :3631-42 Yamin T-T, Ayala JM, Miller DK. 1996. Activation of the native 45-kDa precursor form of interleukin-1-βconverting enzyme. J.Biol.Chem. 271:134273-82 Walker PR, Sikorska M. 1997. New aspects of the mechanism of DNA fragmentation in apoptosis. Biochem Cell Biol 75: 287-299. Williamson P, van den Eijnde S, Schlegel RA. 2001. Phosphatidylserine exposure and phagocytosis of apoptotic cells. Mehods Cell Biol 66: 339-364 Wyllie AH. 1980. Gluocorticoid-induced thymocyte apoptosis is associated with endogenous nuclease activation. Nature 284: 555-556. Zhang G, Gurtu V, Kain SR, Yan G. 1997. Early detection of apoptosis using a fluorescent conjugate of Annexin V. Biotechniques 23:525-531. Zanghi JA, Fussenegger M, Bailey JE. 1999. Serum protects protein-free competent Chinese hamster ovary cells against apoptosis induced by nutrient deprivation in batch culture. Biotechnol Bioeng. 64:108-19

12.

MOLECULAR IMAGING OF PROGRAMMED CELL DEATH; FROM BASIC MECHANISMS TO CLINICAL APPLICATIONS

BAS L.J.H. KIETSELAER1, CHRIS P.M. REUTELINGSPERGER2 AND LEONARD HOFSTRA1 1. Department of Cardiology, University Hospital of Maastricht, Maastricht, The Netherlands 2. Department of Biochemistry, University of Maastricht, Maastricht, The Netherlands

1.

Introduction

Programmed cell death, also termed apoptosis, is the physiological process an organism uses to selectively eliminate cells that are no longer needed, have been damaged or are dangerous. Thus cell death is a physiological process that is crucial for tissue homeostasis. Inadequate regulation of cell death is an important underlying pathophysiological mechanism for many diseases, including cardiovascular disease and cancer. Diseases such as myocardial infarction, stroke, transplant rejection and Alzheimer’s disease are characterized by an excess of cell death, leading to loss of function of the affected organ. Novel therapeutic options to treat these diseases are the use of compounds that inhibit apoptosis. In contrast, the development of malignant tumors is characterized by lack of adequate cell death, leading to accumulation of unwanted and dangerous cells. Findings in the nineties have shown that many conventional chemotherapeutic drugs kill cancer cells through apoptosis. In addition, the elucidation of key signaling pathways in apoptosis has provided us with a wealth of potential targets for induction of cell death in tumors. However, to evaluate the efficacy of novel therapeutic compounds affecting apoptosis a way to monitor or visualize apoptosis is essential. To understand timing of events would enable optimization of therapy. We thus require a technique that can monitor programmed cell death relatively quick, can be repeated over time and is preferably non-invasive. One way to achieve this is the use of molecular imaging. Molecular imaging can be defined as the invivo characterization and measurement of biologic processes at the cellular and molecular level. This allows assessment of molecular abnormalities that lie at the basis of a disease, instead of visualizing anatomical abnormalities occurring in an end-stage of disease (Weissleder and Mahmood, 2001). 307 M. Al-Rubeai and M. Fussenegger (eds.), Cell Engineering, Vol. 4, 307-327. © 2004 Kluwer Academic Publishers. Printed in the Netherlands.

308

B.L.J.H. KIETSELAER, C.P.M. REUTELINGSPERGER and L. HOFSTRA

In this chapter we will discuss the various modes of detection of programmed cell death, and how our group and others developed a system that can monitor programmed cell death in a non-invasive manner. Programmed cell death detection can de done in a variety of ways, and more techniques are emerging every day. We will first briefly mention techniques that require invasive action (i.e. harvesting of cells) for the detection of programmed cell death, the in vitro methods. Second, noninvasive imaging of programmed cell death will be discussed, and the use of molecular imaging for this purpose will be explained. Besides not being noninvasive, these imaging techniques have the advantage of being able to monitor the process in a time dependent manner, which are applied in vivo. Finally, we shall discuss future perspectives for these imaging modalities and their role in clinical medicine.

2.

In-Vitro Detection of Programmed Cell Death

Detection of programmed cell death can be done in a variety of ways. The first descriptions of programmed cell death focussed mainly on morphological features of programmed cell death such as chromatin condensation, dissolution of the nuclear membrane, nuclear shrinkage and formation of apoptotic bodies, which are then cleared by adjacent cells and professional phagocytes (Kerr et al., 1972; Wyllie, 1980; Wyllie et al., 1980). All of these events can be distinguished by routine hematoxylin & eosin (H&E) staining. Although this technique is sensitive, quantification is difficult due to inter-observer variability and assessment of larger area’s can be very time-consuming and tedious (Wyllie et al., 1980). A wide variation of techniques for the detection of apoptosis have been described since the reports of Wyllie et al in 1980 (Wyllie et al., 1980). Techniques for detection of apoptosis have focussed on picking up specific parts of the cell death program. In this chapter we will shortly discuss detection of events that occur in late stages of programmed cell death, i.e. after the point where a cell is committed to suicide. A model has been suggested in which there are pro survival signals (such as IAPs XIAPs and Bcl-xl) and signals that drive the cell toward cell death such as ligation of pro-apoptotic messenger such as FAS ligand, oxidative stress and radiation. Thus, the balance between pro-apoptotic and pro-survival signaling determines the fate of the cell. These signaling molecules are therefore difficult to use as marker for programmed cell death. Methods to detect programmed cell death in vitro usually rely on detection of one of the final stages of cell death. One of the hallmarks of the final stages of programmed cell death is the fragmentation of DNA. Wang et al. and Nagata et al showed in an elegant series of experiments that the fragmentation of DNA in apoptosis is caused by caspase-activated-DNAse, CAD, which is present in its inactive form, in normal cells. The inhibitor of CAD, termed ICAD, is cleaved during programmed cell death by caspase 3, resulting in release of CAD (Sakahira et al., 1998). These fragmented pieces of DNA can be detected by different techniques.

MOLECULAR IMAGING OF APOPTOSIS

309

The most well known of these involves staining of tissue sections by the terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick end-labeling (TUNEL), in which the free 3’ –OH termini that occur during DNA fragmentation are labeled and detected (Gavrieli et al., 1992). Additionally, antibodies against single stranded DNA can be used for the detection of fragmented DNA. These techniques have a the disadvantage that they also detect DNA cleavage due to non-apoptotic processes, such as for example DNA damage or DNA repair (Kanoh et al., 1999). Other features of the cell death program can also be detected, for instance the presence of activated caspases. Caspases (cysteïne aspartate-specific proteases) are one of the key components of the cell death machinery. Once activated, they drive important parts of the cell death program. As described above, ICAD is a substrate for activated caspase 3 (Sakahira et al., 1998). Caspase mediated cleavage of substrates is also responsible for the abovementioned morphological features of programmed cell death. For instance, caspase mediated cleavage of PAK2 is responsible for membrane blebbing (Rudel and Bokoch, 1997) and cleavage of nuclear lamins by activated caspases is responsible for nuclear shrinkage (Rao et al., 1996). In caspasemediated cell death caspase 3 is generally seen as the final executioner of the cell death program, as it is activated downstream of all of the other caspases. Detection of activated caspase 3 or caspase cleavage products can be performed on tissue sections as well, and thereby provide clues for detection of apoptosis in addition to morphological features and stainings mentioned above. Activated caspases can also be characterized and quantified by a variety of other techniques, including immunoblotting, cleavage of synthetic substrates, affinity labeling and confocal microscopy (Kohler et al., 2002). Again, discussion occurs when the question is addressed whether a cell having activated its caspase 3 is committed to die. There are reports in the literature that cells can be viable once they have activated caspase 3. This is the case in failing human myocardium, where caspase 3 is activated and cleaves contractile proteins. However, these cells do survive and can regain their function (Narula et al., 1999). The described techniques for cell death detection require samples to be taken from the test subject and processed. Although tissue can be taken from any organism, assessment of programmed cell death will occur ex-vivo. These techniques do provide very accurate information, which can in some cases be quantified. Unfortunately, these techniques are unable to follow the cell death process in time, in the living organism, unless multiple samples are taken. In addition, there is the problem of sampling error. For in-vivo monitoring of programmed cell death, a technique is required that is non-invasive, can be repeated several times in the same organism and is relatively rapid in its assessment. This can be achieved by using molecular imaging.

310 3.


Molecular Imaging of Cell Death; Basic Principles

Molecular imaging is based on the principle that certain molecules can be labeled and imaged in vivo, thereby targeting events in the complex environment of a living organism. To image these molecules, they generally must have a high affinity and reasonable pharmacodynamics and they have to be able to overcome biological barriers such as a vascular wall, the interstitial space and sometimes the cell membrane. The techniques can be aided by use of some sort of amplification, either chemical or biological. The image modality, used for the detection of the labeled molecules have to be sensitive. To have a better idea of timing of events and exact localization, molecular imaging requires a short acquisition time and a high resolution (Weissleder and Mahmood, 2001). The current techniques of molecular imaging of cell death are based on the externalization of phosphatidyl serine (PS), an event that takes place during the early phase of programmed cell death. Phosphatidyl serine is distributed asymmetrically across the cell membrane in normal cells. In normal cells, it is found on the inner membrane of the cell, i.e. facing the cytosol. This is due to the activity of a phospholipid translocase, that actively transports PS to the inner membrane of cells. During programmed cell death translocase is blocked, possibly due to increased calcium and decreased ATP. In addition transmembrane proteins phosphsolipid floppase and scramblase are activated as a consequence of caspase 3 mediated cleavage of protein kinase C-į. This causes externalization of PS (see Figure 1). Consequently the externalized PS can now bind circulating Annexin A5. When Annexin A5 is labeled, detection of the cells undergoing programmed cell death is possible. Depending on the label used, this can be done in tissue sections, cell cultures, but also in the complex environment of a living organism. Externalized phosphatidyl serine provides a target for other imaging molecules. A good example for this is synaptotagmin I, from which the C2 domain binds to anionic phospholipids exposed on the outer membrane of cells. Indeed, it has been shown that this imaging molecule can be used as a MRI probe when labeled with super paramagnetic ion oxide nanoparticles (SPIOs) (Zhao et al., 2001). These techniques and their possible usefulness will be discussed later on.


311

Figure 1. Molecular basis of programmed cell death imaging using labeled Annexin A5: Phosphatidyl Serine (PS) is present only at the inner membrane of the cell in a normal situation, due to translocase activity. When the cell death program is activated (in this scheme by TNF of FAS ligand signaling) translocase is inhibited, and scramblase and floppase are activated. This causes externalization of PS, which is a target for Annexin A5. When Annexin A5 is labeled, it can be detected by a variety of techniques.

4.

Role of Ps Exposure in Programmed Cell Death

PS exposure and is function have been studied widely, and one of the earliest reports in the function of PS exposure is a study of the group of Fadok et al. In their experiments, they used well known model for programmed cell death, a thymocyte model, in which they initiate programmed cell death by stimulation of their Ag receptors. This model is one of the first models in which programmed cell death is reported, as described by Wyllie et al (Wyllie, 1980). Fadok et al describe the loss of membrane PS asymmetry in thymocytes that show DNA fragmentation, a nowadays well known feature of programmed cell death. Then they show ex-vivo and in-vivo that the apoptotic thymocytes are cleared by macrophages, and that this phagocytosis is PS dependent (Fadok et al., 1992). The externalized PS thus serves as a target and signaling molecule for engulfment by macrophages. PS is perhaps the best characterized, but by no means the only way phagocytes recognize an apoptotic cell. Other surface proteins have been identified, such as sites that bind “bridging” molecules such as C1q (Botto et al., 1998). Interestingly, some form of repulsive action in healthy cells also plays a role. In a recent publication, Brown et al show that an intact CD31 receptor is required for macrophages to detach themselves from normal cells, and not to engulf them. In contrast, when CD31 is disrupted by activation of the cell death program, macrophages can attach, engulf and clear apoptotic cells (Brown et al., 2002). All these processes seem highly conserved in several species, from the nematode to

312


human (Henson et al., 2001). This homology in clearance mechanisms is also seen in a candidate gene for the receptor of PS, which was identified by Fadok et al. (Fadok et al., 2000). They show that similar genes can be found in c. elegans, drosophila melanogaster and mouse, providing evidence that these basic processes have been preserved during evolution. The extensive pathways by which this process is regulated and the preservation of these genes indicate that this is an important mechanism. In all forms of programmed cell death, varying from classic, caspase mediated apoptosis, to more necrosis like programmed cell death, or socalled “caspase independent” cell death, expose PS. It is therefore a universal marker for programmed cell death, and a universal site for recognition by for instance macrophages. This recognition of dying cells is important for the removal from their environment, because spilling of cell contents and pro-inflammatory enzymes can be prevented. The removal of these cells thus prevents inflammation. An inflammatory response triggers an immune-reaction, and cause an immune “memory” to form. Lack of adequate removal of dying cells can therefore trigger disease, as can be observed in for instance systemic lupus erythematosus, an autoimmune disease (Herrmann et al., 1998). The adequate removal of dying cells and prevention of inflammatory response in apoptosis is thus vital for the removal of unwanted cells in for instance embryogenesis, where an inflammatory response would be very harmful.

5.

Molecular Imaging of Programmed Cell Death Using Labeled Annexin A5

All imaging modalities for molecular imaging of programmed cell that have been described in the literature so far use the mechanism of PS exposure as a target. Two molecules have been employed as an imaging probe detecting exposed PS. The most studied molecule targeting PS is Annexin A5. Annexin A5 is a family member the annexins. All annexins have structural and functional properties in common and the common functional feature is the binding of Annexins to a phospholipid surface (Reutelingsperger, 2001). Annexin A5 binds to phospholidips in a Ca2+ dependent manner. Some authors propose a model in which Ca2+ causes a change in conformation of the binding site of Annexin A5, which can then bind to the (exposed) phosphatidylserine. In 1995 this mechanism was used to develop assay which was based on the binding of Annexin A5 to apoptotic cells (Koopman et al., 1994). If Annexin A5 is labeled with a of marker, such as biotin, a fluorescent label or a radioligand it can be detected by a variety of different techniques such as lightand laser microscopy or detection of radioactivity via a gamma camera. The affinity assay of Martin et al and van Engelshoven et al (Martin et al., 1995; van Engeland et al., 1996) showed that Annexin A5 could be used for detection of programmed cell death in vitro. In this assay an immortalized cell line, Jurkat cells,


313

were stimulated with a potent trigger for apoptosis, Fas ligand. It was then shown that fluorescently labeled Annexin A5 bound to these cells in all phases of the cell death program (see Figure 2).

Figure 2. Binding of fluorescent Annexin A5 in all stages of the cell death program. In this experiment an immortalized cell line is stimulated by FAS ligand, which activates the cell death program, 2A shows binding of Annexin A5 in early apoptosis, in 2B there is disruption of the cell membrane and in 2C the entire cell has been destroyed and only apoptotic bodies remain. In all stages binding of Annexin A5 can be observed.

Further work was needed to prove that this concept would also work in the complex environment of the living organism. The first model that was used to address this question was a mouse embryo model. In this model the researchers focused on formation of the digits, which takes place at stage E13 in the chick embryo. They did so because formation of the digits at day E13 depends among others on apoptosis of the cells in the interdigital webs. Before sacrifice of the

314


organism, Annexin A5 labeled with biotin was injected. Embryo’s were sacrificed and embedded. Immuno-histochemical analysis showed binding of the labeled Annexin A5 in the interdigital webs, as shown in figure 3 (van den Eijnde et al., 1997). These data provide the first evidence that Annexin A5 can be used for the detection of apoptosis in the complex environment of a living organism.

Figure 3.Annexin A5 aided detection of programmed cell death in vivo. Binding of Annexin A5 (brown stain) to cells in the interdigit space at gestational stage E13. At E13 these cells die to enable paw formation.

The following critical question that needed to be addressed was whether this assay could be used for the detection of apoptosis in pathological situations. Therefore, a mouse model of ischaemia and reperfusion was developed. In this model, the left anterior descending artery of the heart of a mouse was ligated. Prior to ligation of the artery, Annexin A5 with a biotin label was infused. The ligation of the left anterior descending artery initiates cell death distal to the site of ligation. Extensive binding of Annexin A5 was observed by immunohistochemical analysis of tissue slides, as shown in figure 4. This model mimics the situation of an acute myocardial infarction and reperfusion strategies in humans. To confirm that apoptotic cell death was present in the area at risk, DNA electrophoresis was performed on tissue obtained from the area at risk, showing the presence of DNA laddering, one of the previously described hallmark features of programmed cell death. To evaluate if Annexin-A5 could be used as an endpoint to test cell death inhibitors mice undergoing ischemia and reperfusion of the heart in vivo were pretreated with a cell death inhibitor. The use of the Na-H exchange inhibitor eniporide resulted in substantial decrease in the number of Annexin-A5 positive cardiomyocytes in the area at risk. These data indicate that Annexin-A5 may be an


315

attractive endpoint for cell death inhibition studies in experimental disease models of cell loss, such as myocardial ischemia and stroke (Dumont et al., 2000).

Figure 4. Binding of biotin labeled Annexin A5 to cardiomyocytes after ischaemia and reperfusion of a mouse heart. Observe the extensive binding of Annexin A5 to cardiomyocytes in the midmyocardium.

6.

The Use of Fluorescent Labeled Annexin A5 in Molecular Imaging of Programmed Cell Death

The data so far have demonstrated that the concept of detection of cell death is functional in vitro context and in in vivo, using immunohistochemical techniques. However, real time monitoring programmed cell death in an in vivo environment could provide insight in timing of apoptotic events, as continuous monitoring is possible. This in turn could provide clues for timing of therapy, for instance determining the therapeutic interval for cell death blockers in patients with acute myocardial infarction. For this purpose, fluorescent labeled Annexin A5 was used in the cardiac ischaemia and reperfusion model. First, we evaluated whether AnnexinA5 maintained its PS binding properties when labeled with a fluorescent tag. Immunohistochemical analysis of tissue sections after sacrifice of the heart showed that cardiomyocytes in the mid-myocardium had bound Annexin A5 (see Figure 5), as previously shown with the biotin labeled Annexin A5. The midmyocardium is a typical localization for ischaemia reperfusion damage in mice. The next step was to visualize uptake of fluorescently labeled Annexin-A5 in a real-time fashion in the beating heart of the living mouse.

316


Figure 5. Binding of fluorescent Annexin A5 in a murine ischaemia reperfusion model.

Sequential imaging of the heart in vivo during ischemia and reperfusion demonstrated a time dependent uptake of fluorescently labeled Annexin-A5 in the area at risk (Figure 6). In addition, these data showed that the onset of reperfusion coincided with a sudden increase in the uptake of Annexin-A5, suggesting that reperfusion is a strong trigger for activation of the cell death program. In addition, real-time imaging showed that the binding of Annexin-A5 to the area at risk was completed within a time frame of 20 minutes after the onset of reperfusion.

Figure 6. Whole heart in vivo imaging. Observe the limited amount of binding of fluorescent labeled Annexin A5 at ischaemia without reperfusion (panel A) and the marked increase after onset of reperfusion (panel B).

To obtain more detailed information on the binding of fluorescently labeled Annexin-A5, the magnification of the optical imaging platform was increased, up to 160 X. The increase in magnification allowed to observe the binding of AnnexinA5, at the single cell level in the beating murine heart of the living mouse. By taking sequential images, the kinetics of the binding can be observed at the single cell level as shown in figure 7 A through E. Interestingly, the kinetics of the binding of


317

Annexin-A5 to the cardiomyocytes in the area at risk change when a cell death blocker is used, such as caspase activation inhibitors. Pretreatment of the mice with caspase inhibitors resulted in a decrease of the infarct size and a delay in the uptake of Annexin-A5 (see figure 7 F). The delay in the binding may be explained by the fact that the caspase pathway of the cell death are blocked, but that alternative and slower pathways ultimately results in death of some cells in the area at risk. Current investigations are turned towards unraveling these alternate mechanisms. Taken together, the optical imaging model system provides kinetic insight in the role of programmed cell death ischaemia and reperfusion, and it allows us to evaluate the effects of cell death blocking strategies (Dumont et al., 2001).

Figure 7. Time course of binding of Annexin A5 during ischaemia (I) and reperfusion (R) in single cardiomyocytes, in the beating murine heart (panels A through D). E: rapid onset of binding of Annexin A5 after onset of reperfusion, indicating rapid execution of the cell death program . F: Delayed onset of PS exposure when a cell death blocking agent is infused prior to I/R.

7.

The Use of Radiolabeled Annexin A5 for Molecular Imaging of Programmed Cell Death in Cardiovascular Disease

A next step in the development of molecular imaging of apoptosis was to use radiolabeled Annexin-A5 and nuclear imaging to achieve non-invasive assessment of apoptosis in vivo. The group of Blankenberg et al. used three animal models of programmed cell death to evaluate whether radio-labeled Annexin A5 could be used for non invasive imaging of programmed cell death. Annexin A5 was derivatized with

318


hydrazinonicotamine (HYNIC) and labeled with 99mTc. This conjugate was tested in fulminant hepatic necrosis model, where BALB/c mice were injected with anti-Fas antibody, an initiator of the apoptotic cascade. This causes fulminant hepatic failure due to apoptosis of the liver cells, as had been previously described (Ogasawara et al., 1993). After injection with anti-Fas antibody, the labeled Annexin A5 was infused. The anti-Fas treated animals showed marked increase in hepatic uptake of the labeled Annexin A5 when compared to control animals. The second model used was a transplantation model, in which rats were transplanted with heterotopic (noncompatible) cardiac allografts and hearts from syngeneic (compatible) rats. Radiolabeled Annexin A5 was infused and rats were imaged by nuclear imaging. In this model increased uptake of Annexin A5 in the rats that were transplanted with the heterotopic cardiac allografts was shown, compared to controls. The third model that was evaluated was a murine lymphoma. In this model again uptake of the radiolabeled Annexin A5 was observed in the lymphoma. In all 3 models the binding of radiolabeled Annexin-A5 was confirmed by histology. In addition, colocalization with TUNEL staining was shown (Blankenberg et al., 1998). These experimental data showed that non-invasive imaging of programmed cell death with radio-labeled Annexin-A5 was feasible. A next step was to evaluate whether non-invasive imaging of programmed cell death was feasible in patients. Based on the data obtained in the experimental models of cardiac ischemia, showing focal enhanced uptake of Annexin-A5 in the heart following reperfusion, it was decided to evaluate patients with acute myocardial infarction as a first step. Directly after reperfusion was obtained by percutaneous transluminal coronary angioplasty (PTCA), radio-labeled Annexin A5 was infused. Patients were imaged 4 to 8 hours after infusion of the radiolabeled Annexin A5. 3 Days after the PTCA, patients underwent a perfusion scintigraphic study, using either 201Thallium or 99mTc sestaMIBI scan. Reconstruction of the Annexin A5 images in a similar fashion as the perfusion scintigraphic studies, it was shown that the radio-labeled Annexin A5 was taken up in the area of the myocardial infarction (Hofstra et al., 2000). This provided the first data of imaging of programmed cell death in patients. A typical example is shown in figure 8. In addition to the proof of concept of the feasibility of cell death imaging with radiolabeled Annexin-A5, the data suggest that at least a great part of loss of cardiomyocytes after myocardial infarction and reperfusion is due to programmed cell death. Evidence of programmed cell death within a large area of a myocardial infarction probably indicates preventable cell loss, as shown in the mice study of Dumont et al. Arguably “rescued” cardiomyocytes can again regain their function and thereby provide a better outcome after acute myocardial infarction. Whether or not this is true in the human situation and Annexin A5 can be used as an endpoint to measure cell loss is unknown as of yet.


319

Figure 8. Images of a patient presenting with a large anterior wall myocardial infarction. The left panel shows area of perfusion using 99mTc-sestaMIBI prior to opening of the occluded artery. The non-perfused area is the area at risk. The right panel shows binding of Annexin A5 in the area at risk, indicating presence of programmed cell death within the area at risk.

Another application of the non-invasive imaging of cell death using radiolabeled Annexin-A5 may be its use in patients with an intra-cardiac mass. Endocardial tumors have an incidence of 0,02 to 0,3 %, and most endocardial tumors, about 7090%, are benign (Blondeau, 1990; Kietselaer et al., 2002; McAllister HA, 1978; Reynen, 1996). However, they do pose a difficult diagnostic problem for the clinician. “Classic” imaging modalities such as computer tomography (CT), magnetic resonance imaging (MRI) and echocardiography provide excellent data on localization, size, shape, haemodynamic consequences and pericardial ingrowth of the tumor. These techniques are, however, unable to inform the clinician about the nature and biology of the tumor. Taking a biopsy could add to making the diagnosis in these tumors, but this carries a very high risk of causing embolic complications. So although anatomical information about these tumors can be obtained, up to now it has been impossible to obtain information on the biology of the tumor. It is a well known fact that in malignant tumors high proliferation and cell death rates are found, in contrast to benign tumors. Therefore, the hypothesis was tested if molecular imaging of programmed cell death using labeled Annexin A5 in these tumors is feasible, and if so, whether this could be used to differentiate between benign and malignant tumors. For orientation purposes, a dual isotope imaging technique was used. 201Thallium and labeled Annexin A5 were infused, and imaged

320


simultaneously. 201Thallium is a common radiopharmaceutical, depicting the perfusion of the heart, and the properties of 99mTechentium labeled Annexine A5 has already been discussed. Combining the images of both compounds allowed us to localize the possible Annexin A5 uptake within the area of the left ventricle. The first case was a patient presenting with collapse and progressive dyspnea. An echocardiographic image of the tumor is shown in figure 9 A. Using the dual isotope imaging technique showed marked uptake of the labeled Annexin A5 was seen within the area of the tumor. After surgery, the tumor was placed under the gammacamera again, showing 99mTc radiation. Histologic analysis of the tumor revealed an undifferentiated sarcoma, a very malignant tumor. Immunohistochemistry showed binding of Annexin A5 to the membranes of tumor cells, which had activated caspase 3 (Figure 9 B) (Hofstra et al., 2001). This provides evidence of programmed cell death within this tumor, and detection of with radio-labeled Annexin A5. The second case of a patient with an unknown intra-cardiac mass also presented with complaints of near collapse and dyspnea. The echocardiographic image is shown in figure 9 D. Again, a dual isotope imaging technique was used, which showed no uptake of labeled Annexin A5 within the area of the tumor (Figure 9 F). Ex-vivo detection of radiolabeled Annexin-A5 after excision of the tumor revealed no 99MTc activity. Histological examination of the tumor showed a typical picture of myxoma, a benign intracardiac tumor. There was no presence of Annexin A5 or activated caspase 3 detected. Taken together, these preliminary cases indicate that the Annexin A5 imaging protocol could be used to study the biology of tumors that are not suitable for biopsy taking (Kietselaer et al., 2002). A third application of molecular imaging of programmed cell death with radiolabeled Annexin A5 was first described in 2002 by Narula and et al (Narula et al., 2001). This study focussed on cardiac allograft rejection in transplant patients. In cardiac transplantation, rejection of the donor heart poses a difficult clinical problem, and it is a grave complication of this intervention, as rejection of the donor organ results in rapid deterioration of the clinical status of the patient. Sometimes this grave situation can be augmented by adding medication that suppresses the inflammatory response to the donor heart or possibly re-operation. Not uncommonly, these measures fail and the patient will die. On a cellular level, cardiac allograft rejection is characterized by infiltration of monocytes in perivascular and interstitial spaces. This in turn causes myocyte necrosis and apoptosis.


321

Figure 9. A: Echocardiographic picture of a large tumor, originating from the left ventricular wall and moving into the aorta (bottom right). Figures B are histological examinations of this sarcoma. 1 trough 3 shown respectively binding of Annexin A5 to cells, presence of activated caspase 3 (2) and co-localization (3). Figure C shows a dual isotope scan. Left panel shows normal perfusion of the left ventricle. Right panel shows uptake of Annexin A5 within the area of the left ventricle. Figure D shows another intracardiac tumor, but this time no uptake could be detected on dual isotope imaging (F). Histology revealed a myxoma (E) without binding of Annexin A5 to cells or presence of activated caspase 3.

The common way to monitor possible rejection of the transplanted heart is to take myocardial biopsies, and look for these morphological features. Taking a myocardial biopsy, however, involves invasive diagnostic procedure which is not without risks. Since these processes have to be monitored over time, multiple biopsies have to be taken, adding to the risk of complications of these procedures. SPECT imaging of programmed cell death with labeled Annexin A5 could possibly provide a non-invasive method of identifying patients suffering from cardiac allograft rejection. As mentioned previously, Blankenberg et al. had already proven the feasibility of this concept in an animal model of cardiac allograft rejection (Blankenberg et al., 1998). All patients (n=18) underwent an Annexin A5 SPECT study, and biopsies were taken. When assessing the SPECT images, two blinded observers were in perfect agreement about the uptake of radiolabeled Annexin A5 in the myocardium of 5 of these patients, when reconstructing these images in a fashion that allowed a tomographical view of the left ventricle. In 3 cases, focal uptake was observed, and in 2 cases general uptake of labeled Annexin A5 was observed. Tissue sections of the myocardial biopsies were assessed by standard

322


H&E staining, TUNEL staining and staining for activated caspase 3. H&E staining revealed no or only limited abnormalities in the patients that showed no uptake of the radiolabeled Annexin A5. Also, there was no activation of caspase 3 seen. In the cases that showed focal uptake, more severe abnormalities were seen in the H&E staining, when scoring according to the recommendations of the International Society of Heart and Lung Transplantation (ISHLT). Also, scattered cardiomyocytes showed evidence of activation of caspase 3. The 2 patients that showed general uptake of the labeled Annexin A5 were scored as severe transplant rejection reaction according to the ISHLT guidelines, and showed many cardiomyocytes with activated caspase 3. TUNEL staining was positive in all but 2 patients. However, the matter of TUNEL staining for presence of programmed cell death is highly debated, as discussed above (Kanoh et al., 1999; Pulkki and Voipio-Pulkki, 2000), and might be an indication of myocardial repair rather than myocardial cell death. These data, together with the previously reported data on cardiac allograft rejection in animals, provide a proof of concept for detection of programmed cell death in patients with cardiac allograft rejection. This could provide the clinician with an important imaging modality to identify patients at risk, to monitor therapy and to assess efficacy of new treatment modalities such as cell death blockers in graft rejection (Kown et al., 2001; Narula et al., 2001). Taken together, these animal models and human studies provide evidence for the assumption that molecular imaging of programmed cell death using radiolabeled Annexin A5 will provide diagnostic and therapeutic clues in disease states that are characterized by an excess of cell death, such as graft rejection in other transplanted organs and, as previously mentioned, myocardial infarction. In addition, this imaging modality might be useful in the evaluation of cell death blocking drugs, such as caspase inhibitors, for use in the clinical situation. Since this imaging modality functions in both animal and human studies in a similar fashion, it seems reasonable to assume that animal data can be translated to clinical studies rapidly, providing accurate diagnosis and rapid introduction of new treatments in clinical practice.

8.

Annexin A5 Imaging in Oncology

In contrast to most pathological cardiovascular diseases, oncology focuses on the lack of adequate cell loss, and in these diseases cell loss is further initiated using chemotherapeutical agents. Controlling the rate of cell death in both states would mean controlling the disease. It had previously been shown that programmed cell death is susceptible to imaging in an intracardiac tumor (Hofstra et al., 2001). Mochizuki et al recently published an intriguing study in which they introduced hepatoma cells in the calf of rats. Tumor cells were left to grow for 11 days. After 11 days, a single dose of chemotherapy was infused in one group, the controls received normal saline. Here after 99mTc labeled Annexin A5 was administered.


323

Radioisotope imaging showed a significant increase in Annexin A5 uptake at the location of the tumor compared to controls. Histological analysis revealed increased apoptosis, as assessed by standard H&E staining and TUNEL staining (Mochizuki et al., 2003). This finding could point to the fact that Annexin A5 imaging after a single dose of chemotherapy can evaluate effectiveness of the therapy. If so, this would be an very valuable addition to conventional imaging techniques. Conventional techniques can only display differences in tumor size, and occurrence of metastasis, both of which are late, anatomical manifestations of lack of efficacy of chemotherapy. Instead, Annexin A5 imaging can focus on the underlying biology of the tumor, providing the clinician with more time to adjust treatment. This could lead to more accurate, individualized therapy, and better survival. Currently, clinical trials are under way to study this phenomenon in patients, performing single photon emission computed tomography (SPECT) before and after a single dose of chemotherapy.

9.

The Use of Novel Probes for Molecular Imaging of Programmed Cell Death: Magnetic Resonance Imaging (MRI) and Positron Emission Tomography (PET) Probes

Although SPECT and planar nuclear imaging are very sensitive imaging modalities, they suffer from the fact that they have limited spatial resolution. In animals spatial resolutions of 1 to 3 mm have been obtained, due to usage of higher amounts of radiation an a relatively short distance from the organ that has taken up the labeled compound to the camera. However, in patients these high dosages of radiation can not be used, and most intestinal and abdominal organs have a considerable distance to the camera. In addition, the presence of tissue between the camera and the organ attributes to a phenomenon known as scatter, which further decreases spatial resolution. To overcome these technological challenges, different imaging techniques could be used. One imaging technique that has been tried in this respect is magnetic resonance imaging, which has an excellent spatial resolution. Again, the feature of apoptotic cells expressing PS during programmed cell death was exploited. In a 2001 Nature paper the group of Brindle et al. describe the use of labeled synaptotagmin to detect programmed cell death in vivo. The first C2 domain of this protein can bind to externalized PS. In contrast to Annexin A5, which forms a complex of multiple Annexin A5 proteins to one externalized PS protein, synaptotagmin binds to externalized PS in a one to one fashion. This group first showed that synaptotagmin binds specific to apoptotic cells in vitro. They then went on to label this protein with superparamagnetic iron oxide (SPIO) particles. SPIO particles significantly reduces the signal of tissue it is found in when using T2 weighted MRI imaging (Weissleder et al., 1990), and have been used for this

324


purpose in many other models. The SPIO labeled synaptotagmin then proved to be useful in their in vitro setup (Zhao et al., 2001). An other high-resolution technique is that of PET imaging. Because PET imaging utilizes higher energy peaks of 511 KeV and because of the use of coincidence collimators, the problems of scatter can be greatly reduced. Preliminary reports have shown that Annexin A5 can be labeled with a variety of positron emitters, and two of these probes, 124I labeled Annexin A5 and 18F Annexin A5 have been employed in animal models, although no in-vivo imaging data have been reported yet (Keen et al., 2003; Murakami et al., 2003; Smith-Jones et al., 2003). A possibility to increase awareness of localization of uptake is to combine a nuclear imaging technique, either planar nuclear, SPECT or PET with a more anatomical technique, such as CT and MRI. Possibly, this could prove to provide the best of both worlds, i.e. the biological information and thus sensitivity of the nuclear techniques and the anatomical high resolution imaging from either CT or MRI. These dual imaging set-ups have become commercially available in the SPECT/ CT and PET/ CT combination. Although exact co-localization of images of both techniques is still challenging, especially in SPECT/ CT, we feel that this could be a valuable addition, especially in larger animals and humans, where resolution of SPECT imaging alone is poor. These possibilities require further investigation, which will open avenues to more accurate sensitive detection of programmed cell death. This in turn would allow study of programmed cell death in disease where changes occur in relatively small or quantities of cells, for instance programmed cell death in smaller tissue masses such as unstable lesions in coronary arteries or small tumors, or more gradual cell loss as observed in idiopathic dilated cardiomyopathy or alzheimers disease. Molecular imaging will allow accurate and early diagnosis of disease, and monitor early changes in the process ultimately leading to better understanding of disease and better treatment of patients.

10.

References

Blankenberg, F. G., Katsikis, P. D., Tait, J. F., Davis, R. E., Naumovski, L., Ohtsuki, K., Kopiwoda, S., Abrams, M. J., Darkes, M., Robbins, R. C., et al. (1998). In vivo detection and imaging of phosphatidylserine expression during programmed cell death. Proc Natl Acad Sci U S A 95, 6349-6354. Blondeau, P. (1990). Primary cardiac tumors--French studies of 533 cases. Thorac Cardiovasc Surg 38 Suppl 2, 192-195. Botto, M., Dell'Agnola, C., Bygrave, A. E., Thompson, E. M., Cook, H. T., Petry, F., Loos, M., Pandolfi, P. P., and Walport, M. J. (1998). Homozygous C1q deficiency causes glomerulonephritis associated with multiple apoptotic bodies. Nat Genet 19, 56-59. Brown, S., Heinisch, I., Ross, E., Shaw, K., Buckley, C. D., and Savill, J. (2002). Apoptosis disables CD31-mediated cell detachment from phagocytes promoting binding and engulfment. Nature 418, 200-203. Dumont, E. A., Hofstra, L., van Heerde, W. L., van den Eijnde, S., Doevendans, P. A., DeMuinck, E., Daemen, M. A., Smits, J. F., Frederik, P., Wellens, H. J., et al. (2000).


325

Cardiomyocyte death induced by myocardial ischemia and reperfusion: measurement with recombinant human annexin-V in a mouse model. Circulation 102, 1564-1568. Dumont, E. A., Reutelingsperger, C. P., Smits, J. F., Daemen, M. J., Doevendans, P. A., Wellens, H. J., and Hofstra, L. (2001). Real-time imaging of apoptotic cell-membrane changes at the single-cell level in the beating murine heart. Nat Med 7, 1352-1355. Fadok, V. A., Bratton, D. L., Rose, D. M., Pearson, A., Ezekewitz, R. A., and Henson, P. M. (2000). A receptor for phosphatidylserine-specific clearance of apoptotic cells. Nature 405, 85-90. Fadok, V. A., Voelker, D. R., Campbell, P. A., Cohen, J. J., Bratton, D. L., and Henson, P. M. (1992). Exposure of phosphatidylserine on the surface of apoptotic lymphocytes triggers specific recognition and removal by macrophages. J Immunol 148, 2207-2216. Gavrieli, Y., Sherman, Y., and Ben-Sasson, S. A. (1992). Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J Cell Biol 119, 493-501. Henson, P. M., Bratton, D. L., and Fadok, V. A. (2001). The phosphatidylserine receptor: a crucial molecular switch? Nat Rev Mol Cell Biol 2, 627-633. Herrmann, M., Voll, R. E., Zoller, O. M., Hagenhofer, M., Ponner, B. B., and Kalden, J. R. (1998). Impaired phagocytosis of apoptotic cell material by monocyte-derived macrophages from patients with systemic lupus erythematosus. Arthritis Rheum 41, 12411250. Hofstra, L., Dumont, E. A., Thimister, P. W., Heidendal, G. A., DeBruine, A. P., Elenbaas, T. W., Boersma, H. H., van Heerde, W. L., and Reutelingsperger, C. P. (2001). In vivo detection of apoptosis in an intracardiac tumor. Jama 285, 1841-1842. Hofstra, L., Liem, I. H., Dumont, E. A., Boersma, H. H., van Heerde, W. L., Doevendans, P. A., De Muinck, E., Wellens, H. J., Kemerink, G. J., Reutelingsperger, C. P., and Heidendal, G. A. (2000). Visualisation of cell death in vivo in patients with acute myocardial infarction. Lancet 356, 209-212. Kanoh, M., Takemura, G., Misao, J., Hayakawa, Y., Aoyama, T., Nishigaki, K., Noda, T., Fujiwara, T., Fukuda, K., Minatoguchi, S., and Fujiwara, H. (1999). Significance of myocytes with positive DNA in situ nick end-labeling (TUNEL) in hearts with dilated cardiomyopathy: not apoptosis but DNA repair. Circulation 99, 2757-2764. Keen, H., Dekker, B., Disley, L., Lyons, S., Smith, N., J., Z., and Watson, A. (2003). Iodine124 labelled Annexin V for PET imaging of in vivo cell death. Paper presented at: SNM 50th Annual Meeting. Kerr, J. F., Wyllie, A. H., and Currie, A. R. (1972). Apoptosis: a basic biological phenomenon with wide-ranging implications in tissue kinetics. Br J Cancer 26, 239-257. Kietselaer, B. L. J. H., Thimister, P. W., Reutelingsperger, C. P. M., Heidendal, G. A. K., Dumont, E. A. W. J., Boersma, H. H., de Bruine, A. P., and Hofstra, L. (2002). Molecular imaging of cell death in intracardiac tumours. Netherlands Heart Journal 10, 313-317. Kohler, C., Orrenius, S., and Zhivotovsky, B. (2002). Evaluation of caspase activity in apoptotic cells. J Immunol Methods 265, 97-110. Koopman, G., Reutelingsperger, C. P., Kuijten, G. A., Keehnen, R. M., Pals, S. T., and van Oers, M. H. (1994). Annexin V for flow cytometric detection of phosphatidylserine expression on B cells undergoing apoptosis. Blood 84, 1415-1420. Kown, M. H., Strauss, H. W., Blankenberg, F. G., Berry, G. J., Stafford-Cecil, S., Tait, J. F., Goris, M. L., and Robbins, R. C. (2001). In vivo imaging of acute cardiac rejection in human patients using (99m)technetium labeled annexin V. Am J Transplant 1, 270-277. Martin, S. J., Reutelingsperger, C. P., McGahon, A. J., Rader, J. A., van Schie, R. C., LaFace, D. M., and Green, D. R. (1995). Early redistribution of plasma membrane phosphatidylserine is a general feature of apoptosis regardless of the initiating stimulus: inhibition by overexpression of Bcl-2 and Abl. J Exp Med 182, 1545-1556.

326


McAllister HA, F. J. (1978). Tumors of the cardiovascular system. In Atlas of tumor pathology, C. W. Hartmann WH, ed. (Washington DC, Armed Forces Institute of pathology). Mochizuki, T., Kuge, Y., Zhao, S., Tsukamoto, E., Hosokawa, M., Strauss, H. W., Blankenberg, F. G., Tait, J. F., and Tamaki, N. (2003). Detection of apoptotic tumor response in vivo after a single dose of chemotherapy with 99mTc-annexin V. J Nucl Med 44, 92-97. Murakami, Y., Takamatsu, H., Tatsumi, M., Noda, A., Ichise, R., and Nishimura, S. (2003). F-18 Labeled Annexin A5: a PET tracer for apoptosis imaging. Paper presented at: SNM 50th Annual Meeting (New Orleans). Narula, J., Acio, E. R., Narula, N., Samuels, L. E., Fyfe, B., Wood, D., Fitzpatrick, J. M., Raghunath, P. N., Tomaszewski, J. E., Kelly, C., et al. (2001). Annexin-V imaging for noninvasive detection of cardiac allograft rejection. Nat Med 7, 1347-1352. Narula, J., Pandey, P., Arbustini, E., Haider, N., Narula, N., Kolodgie, F. D., Dal Bello, B., Semigran, M. J., Bielsa-Masdeu, A., Dec, G. W., et al. (1999). Apoptosis in heart failure: release of cytochrome c from mitochondria and activation of caspase-3 in human cardiomyopathy. Proc Natl Acad Sci U S A 96, 8144-8149. Ogasawara, J., Watanabe-Fukunaga, R., Adachi, M., Matsuzawa, A., Kasugai, T., Kitamura, Y., Itoh, N., Suda, T., and Nagata, S. (1993). Lethal effect of the anti-Fas antibody in mice. Nature 364, 806-809. Pulkki, A. S., and Voipio-Pulkki, L. M. (2000). Significance of myocytes with positive DNA in situ nick end-labeling (TUNEL) in hearts with dilated cardiomyopathy. Circulation 101, E239. Rao, L., Perez, D., and White, E. (1996). Lamin proteolysis facilitates nuclear events during apoptosis. J Cell Biol 135, 1441-1455. Reutelingsperger, C. P. (2001). Annexins: key regulators of haemostasis, thrombosis, and apoptosis. Thromb Haemost 86, 413-419. Reynen, K. (1996). Frequency of primary tumors of the heart. Am J Cardiol 77, 107. Rudel, T., and Bokoch, G. M. (1997). Membrane and morphological changes in apoptotic cells regulated by caspase-mediated activation of PAK2. Science 276, 1571-1574. Sakahira, H., Enari, M., and Nagata, S. (1998). Cleavage of CAD inhibitor in CAD activation and DNA degradation during apoptosis. Nature 391, 96-99. Smith-Jones, P. M., Afroze, A., Zanzonico, P., Tait, J., Larson, S. M., and Strauss, H. W. (2003). 86Ga Labelling of Annexin-V: Comparison to 99mTc-Annexin-V and 97Ca-Annexin. Paper presented at: SNM 50th annual meeting (New Orleans). van den Eijnde, S. M., Luijsterburg, A. J., Boshart, L., De Zeeuw, C. I., van Dierendonck, J. H., Reutelingsperger, C. P., and Vermeij-Keers, C. (1997). In situ detection of apoptosis during embryogenesis with annexin V: from whole mount to ultrastructure. Cytometry 29, 313-320. van Engeland, M., Ramaekers, F. C., Schutte, B., and Reutelingsperger, C. P. (1996). A novel assay to measure loss of plasma membrane asymmetry during apoptosis of adherent cells in culture. Cytometry 24, 131-139. Weissleder, R., Elizondo, G., Wittenberg, J., Rabito, C. A., Bengele, H. H., and Josephson, L. (1990). Ultrasmall superparamagnetic iron oxide: characterization of a new class of contrast agents for MR imaging. Radiology 175, 489-493. Weissleder, R., and Mahmood, U. (2001). Molecular imaging. Radiology 219, 316-333. Wyllie, A. H. (1980). Glucocorticoid-induced thymocyte apoptosis is associated with endogenous endonuclease activation. Nature 284, 555-556. Wyllie, A. H., Kerr, J. F., and Currie, A. R. (1980). Cell death: the significance of apoptosis. Int Rev Cytol 68, 251-306.


327

Zhao, M., Beauregard, D. A., Loizou, L., Davletov, B., and Brindle, K. M. (2001). Noninvasive detection of apoptosis using magnetic resonance imaging and a targeted contrast agent. Nat Med 7, 1241-1244.

Index A

B

A1 · 26, 28, 34, 43-45 abiotic stress · 111, 115-117, 121, 125, 128, 132, 133 acridine orange · 287 adaptor proteins · 88, 108 annexin · 217, 218, 291, 300, 310-324 Annexin A5 · 310-324 Annexin V-FITC · 291 antiapoptotic · 1, 13, 14, 26, 28-36, 40, 53, 58, 62, 63, 71, 74, 98, 99, 107, 128, 132, 133, 135, 137, 159, 172, 190, 193, 214, 224-227, 232, 233, 282, 286 antisense · 36, 55, 73-75, 226, 233, 234, 239, 242, 244-247, 252, 254-260, 263, 264, 267, 269, 270-272 apoptosis · 1-15, 25-30, 32-40, 49, 50, 55, 56, 58, 62, 63, 65, 66, 71, 72, 74, 75, 93, 95-102, 107-111, 113-115, 118121, 123, 128, 129, 131, 133, 134, 153, 154, 159, 172, 181-184, 186-196, 211-219, 223-225, 227, 230-233, 239241, 244, 247, 257, 259, 260, 262, 269, 270-272, 281-302, 307, 308, 312314, 317, 318, 320, 323, 324, apoptosis inhibition · 192, 223, 225, 233 apoptosome · 7, 8, 15, 97, 102, 109, 122, 184-188, 194, 195, 211, 215, 219 apoptotic agents · 158 apoptotic protease activating factor-1 · 7, 109, 158 apoptotic protease activating factor-1 (Apaf-1) · 4, 7-9, 109, 110, 122, 138, 156, 158, 159, 163, 185, 188, 195, 215, 223, 230, 231

Bad · 26, 28, 30-32, 45, 62, 65, 159, 179, 227, 228 Bak · 26, 27, 30, 31, 100, 102, 223, 227, 228, 230-232 Bax · 26, 28, 30-33, 35, 36, 40, 99, 100, 102, 113, 132, 133, 137, 159, 192, 223, 227, 230 Bcl-2 · 7, 25-40, 49, 55, 62, 97, 99, 100102, 132, 133, 137, 158, 159, 172, 192, 197, 214, 223, 225-233, 241, 286 Bcl-w · 26, 29, 225 Bcl-xL · 26-35, 37-40, 55, 62, 98, 99, 100, 159, 190, 224-226, 228, 230, 231233, 286 Bcl-XS · 26 BH1 · 26-31, 132, 230, 231 BH2 · 26-31, 132, 230, 231 BH3 · 27-31, 227, 228, 230-233 BH4 · 27, 29-31 Bid · 7, 26, 28, 29, 32, 97, 102, 187, 188, 190, 211, 285 Bik · 26, 29, 159, 224, 227 bioprocessing · 37 bioreactors · 212, 215-218, 289 BIR · 10-12, 192-194, 240, butyrate · 39, 214, 219

C cancer · 14, 36, 56-58, 68, 72-75, 95, 107, 154, 172, 223-227, 231, 233, 239, 240, 241, 258-260, 268, 270, 272 cancer cells · 57, 73, 223-227, 233, 240, 241, 258, 272, 307 cardiovascular disease · 307, 322

329

330 caspase(s) · 1-15, 25, 29, 32, 39, 49, 55, 96, 97, 100-102, 108, 109, 111, 113, 115, 116, 127, 129, 131, 133, 136, 153-169, 172, 182-196, 211, 213-219, 223, 224, 227, 230, 239, 255, 272, 285, 292, 299, 301, 308-310, 312, 317, 320, 321, 322 caspase activation · 1, 3-6, 15, 25, 32, 100, 102, 108-110, 154, 156, 158-163, 167, 169, 172, 182, 185-187, 195, 204, 215, 219, 286, 299, 301, 317 caspase inhibitor(s) · 9, 10, 15, 29, 101, 102, 111, 113, 115, 131, 185, 186, 191, 195, 196, 214, 227, 255, 286, 317, 322 Caspase structure · 220 caspase substrate · 3, 4, 188-190, 195 caspase-1 · 2, 3, 5, 7, 10, 183, 187, 190 caspase-3 · 3-5, 7, 8, 10, 12, 14, 39, 42, 97, 101, 154-156, 158, 186, 188, 189, 190, 191, 194, 211, 215, 217, 218, 272, 285, 292, 301 caspase-3 activation · 101, 218, 301 caspase-6 · 3, 156, 186 caspase-8 · 2-8, 32, 100, 101, 108, 153, 156, 162-169, 187, 188, 190, 194, 195, 211 caspase-9 · 3-8, 12, 14, 97, 101, 109, 158, 162, 163, 169, 185-188, 190, 192, 194, 195, 211, 214-217, 223, 230 cell culture · 37, 40, 116, 125, 133, 136, 181, 195, 212-214, 217, 219, 258, 272, 281-283, 290, 291, 296, 300, 310 cell size · 282, 290, 292 chinese hamster ovary cells · 215, 216, 218, 219 cIAP1 · 11, 193, 240, 241 cIAP2 · 11, 101, 193, 240, 241, 267 c-myc · 28, 55, 223 cold shock · 116, 117 Convex analysis · 161, 162 CrmA · 9, 10, 108, 190-192, 196, 197

cytochrome c · 7- 9 , 25, 27, 32, 63, 90, 97, 100-102, 109, 116, 117, 123, 124, 128, 185-188, 194, 195, 211, 215, 285, 294

D death domain (DD)· 6, 30, 95-97, 108, 156 development · 1, 4, 6, 11, 13, 15, 25, 34, 37, 38, 49, 51, 52, 55, 57, 72-75, 102, 107, 111, 112, 118, 119, 121, 125, 126, 132, 134, 136, 137, 153, 181, 196, 211, 212, 220, 223, 239, 240-242, 244, 247, 259, 260, 270, 272, 281, 282, 290, 292, 296, 302, 307, 317 DIABLO · 2, 3, 13, 14, 188, 285 differentiation · 4, 28, 34, 50, 55, 57, 62, 64, 71, 75, 107, 127, 129, 131, 135, 136 DNA fragmentation · 4, 95, 110, 111, 115, 116, 119, 120, 121, 124, 137, 217, 218, 286, 287, 289, 292, 295, 297, 299, 309, 311 dominant negative caspase · 194 down-regulation · 34, 227, 252, 253, 267, 268

E E1A · 223 executioner caspase activation · 159, 163, 167, 169 extrinsic pathway · 108, 188, 194, 211

F FADD · 3, 6, 7, 96, 97, 156-159, 164-168, 187, 191, 194, 215 FAS · 6, 156-158, 163-166, 168, 308, 311, 313

331 FAS Ligand (FASL) · 156 Fas/Apo1/CD95 · 4, 6, 7, 157, 163-167 Fas/FasL · 96, 100, 101 FLIP · 3, 7, 108, 157, 158, 162, 164-169, 194, flow cytometry · 217, 218, 282, 286, 291 fluorescence microscopy · 249, 287, 288, 291, 300, 302 fluorescent probes · 295 follicular B cell lymphoma · 26

G gene therapy · 36, 94 glutathione · 95, 97, 98 GSH · 97, 98, 105

H heat shock · 124, 131, 185, 190 hepatocyte · 93, 94, 96, 98, 101, 102, 232 hepatoma · 96, 101, 322 hydrolysates · 212 hypersensitive response · 115

I immunotherapy · 34, 35 industrial · 37, 39, 195, 214, 217, 219, 281, 291, 296, 299 Inhibitors of Apoptosis (IAPs) · 2, 3, 915, 101, 102, 109, 129, 131, 157, 158, 163, 186, 192-194, 214, 239, 240, 241, 250, 255, 257,260, 263, 265, 267, 270, 271, 308 insulin · 37, 49-52, 56, 59, 66, 71, 73-75, 215 intracellular pH · 43, 300, 301 intrinsic pathway · 108, 188, 194, 211 IRS family · 65, 66

J JNK · 55, 56, 60-64, 68, 69, 128

K kinetic models · 155

L liver regeneration · 94 liver support device · 94 Livin · 193, 240, 255, 271

M magnetic resonance imaging · 319, 323 mammalian cells · 1, 10, 11, 13, 26, 33, 37, 74, 109, 127, 133, 190, 192, 194, 196, 212, 243, 260, 262, 273 MAP-kinase · 61 mathematical model · 154, 169, Mcl-1 · 26, 28, 34 mitochondria · 2, 7, 13, 14, 25, 32, 33, 36, 63, 65, 80, 97, 100, 102, 108, 109, 112, 114, 117, 121, 123, 124, 128, 132, 136, 159, 185-187, 211, 215, 231, 232, 284, 285, 291, 293-295 mitochondrial membrane permeability transition (MPT) · 99, 114, 123 Molecular Imaging · 307, 310, 312, 315, 317, 323 monitoring · 171, 217, 265, 282, 288, 291, 295, 302, 309, 315 morphology · 100, 101, 258, 285, 288, 302 Mort 1 · 156 motility · 55, 57, 58, 62, 65, 68-70, 72 MRI (Magnetic Resonance Imaging) · 310, 319, 323

332 myocardial infarction · 107, 307, 314, 315, 318, 319, 322,

N necrosis · 4-6, 55, 95, 96, 99, 108, 111, 117, 128, 137, 156, 186, 225, 239, 281, 282-285, 288, 289, 293, 312, 318, 320 Non-invasive detection · 327 nucleobase · 239, 242, 243, 245, 249, 250, 257, 261 nutrient limitation · 38, 212

O oligonucleotide · 36, 233, 242, 243, 249, 257, 271 oncogenesis · 232 oncology · 223, 239, 272, 322 oxidative stress · 98, 99, 109, 123, 137, 308

P p35 · 9, 10, 131, 191, 192, 196, 214, 221 peptide inhibitor · 195, 196 permeability transition (PT) pore · 99, 100 PET · 323, 324 phosphatases · 65 phosphatidylserine (PS) · 137, 217, 242, 243, 249, 250, 254, 255, 283, 291,298, 299, 310-312, 315, 317, 323, Phosphoinositide-3kinase · 62 plant apoptosis · 131 plant development · 118, 137 plant resistance · 122, 150 plant-pathogen interactions · 115, 137 Positron Emission Tomography · 323

Principle Component Analysis (PCA) · 168 pro-apoptotic · 1, 7, 26, 27, 29, 30-35, 36, 40, 55, 62, 63, 99, 100, 101, 107, 123, 128, 129, 132, 158, 159, 186, 188, 190, 192, 194, 211, 224, 225, 227, 232, 233, 308 procaspase(s) · 2, 3, 5-9, 15, 96, 97, 109, 122, 153, 156, 158, 159, 161, 164-169, 215, 221, 224, 285 procaspase-7 · 5, 20 procaspase-8 · 6, 7, 97, 156, 159, 161, 164-169, 285 procaspase-9 · 6, 15, 21, 23, 158, 159, 215 programmed cell death · 1, 2, 4, 15, 42, 95, 107, 110, 115, 117, 119, 130, 134, 135, 137, 153, 159, 181, 198, 199, 211, 219, 223, 241, 307-312, 314, 315, 317-323 proliferation · 26, 50, 52, 55-57, 62, 6769, 73, 75, 113, 148, 240, 241, 319 propidium iodide · 217, 287, 292 proteases · 1, 2, 5, 10, 29, 95, 96, 101, 102, 109, 110, 113, 116, 121, 131, 136, 153, 182, 190, 214, 218, 220, 239, 274, 281, 309 PTP-1B · 58, 65

R RACK1 · 60, 67-71 Radioisotope imaging · 323 reactive oxygen species · 95, 97, 110, 115, 121-125, 127, 206 reactive oxygen species (ROS) · 95, 97, 98, 103, 110, 117, 123-128, 132 recombinant protein · 13, 93, 181, 190, 281, 302 Rhodamine 123 · 291 RNA interference · 74, 239, 243, 270, RNAi · 239, 242, 243, 259, 260-271

333

S salt stress · 116, 117, 143 senescence · 107, 110, 118, 119, 121, 126, 127, 130, 132, 136 Shc · 53, 58, 60, 61, 65, 66 shRNA · 243, 260-263, 265-270 signalling · 50, 53-73, 95, 112, 140, 143, 150 single photon emission computed tomography · 323 siRNA · 243, 260-262, 270 Smac · 2, 13, 109, 140, 186, 188, 194, 285 SPECT · 321, 323, 324 State Regulater Problem (SRP) · 155, 164, 169 staurosporine · 125, 131, 158, 215, 220 stress response · 112, 130, 134, 137 survival factors · 49, 86, 98 survivin · 11, 172,, 240, 249, 250, 270, 271, 272

T therapeutics · 36, 37, 93, 95, 181, 221, 224, 233, 270, 272, 281 toxic by-products · 213, 248

`

transformation · 50, 55, 58, 71, 72, 74, 75, 223, 248, 271 transmembrane potential (ǻȌm) · 98, 99, 100, 291, 293 transplantation · 94, 318, 320, 322 Tumor Necrosis Factor (TNF) · 5, 6, 28, 55, 63, 95, 96, 108, 156, 186, 188, 191, 192, 194, 311 TUNEL · 113-117, 119, 120, 121, 124, 132, 297, 309, 318, 322, 323

V validation · 233, 249, 254, 257, 259, 260, 262, 270

X XIAP · 10-14, 101, 103, 190, 193, 194, 196, 198, 239, 240, 242, 244, 245, 247, 249-259, 265-268, 271, 286

Z z-VAD-fmk · 213, 221 zVAD-Link · 163 zymogens · 3, 153

Cell Engineerings 1. M. Al-Rubeai (ed.): Cell Engineering. 1999 ISBN 0-7923-5790-6 2. M. Al-Rubeai (ed.): Cell Engineering. Vol. 2: Transient Expression. 2000 ISBN 0-7923-6596-8 3. M. Al-Rubeai (ed.): Cell Engineering. Vol. 3: Glycosylation. 2002 ISBN 1-4020-0733-7 4. M. Al-Rubeai and M. Fussenegger (eds.): Cell Engineering. Vol. 4: Apoptosis. 2004 ISBN 1-4020-2216-6

Kluwer Academic Publishers – Dordrecht / Boston / London

Cell Engineering: Apoptosis (Cell Engineering)

Cell Engineering

Cell Engineering: Glycosylation

Systems Biology (Cell Engineering)

Cell and Tissue Engineering

Cell Proliferation and Apoptosis

Cell and Tissue Reaction Engineering

Stem Cell and Tissue Engineering

Stem Cell Engineering: Principles and Applications

Artificial Cells, Cell Engineering and Therapy

Artificial Cells, Cell Engineering and Therapy

Apoptosis, Cell Signaling, and Human Diseases

Cell

Cell

Cell

Cell

Cell

Cell

Cell

Cell

Cell

Cell

Cell

Cell

Cell

Cell

Cell

Cell

Cell

Cell

Cell

Cell Engineering: Apoptosis (Cell Engineering)